U.S. patent number 9,725,732 [Application Number 14/884,448] was granted by the patent office on 2017-08-08 for plant cytochrome p450.
This patent grant is currently assigned to Sun Pharmaceutical Industries (Australia) Pty Ltd. The grantee listed for this patent is Sun Pharmaceutical Industries (Australia) Pty Ltd. Invention is credited to Ian Alexander Graham, Tracy Carol Walker, Thilo Winzer.
United States Patent |
9,725,732 |
Winzer , et al. |
August 8, 2017 |
Plant cytochrome P450
Abstract
This disclosure relates to the isolation and sequencing of
nucleic acid molecules that encode cytochrome P450 polypeptides
from a Papaver somniferum cultivar; uses in the production of
noscapine and identification of poppy cultivars that include genes
that comprise said nucleic acid molecules.
Inventors: |
Winzer; Thilo (York,
GB), Walker; Tracy Carol (Latrobe, AU),
Graham; Ian Alexander (York, GB) |
Applicant: |
Name |
City |
State |
Country |
Type |
Sun Pharmaceutical Industries (Australia) Pty Ltd |
Notting Hill |
N/A |
AU |
|
|
Assignee: |
Sun Pharmaceutical Industries
(Australia) Pty Ltd (Notting Hill, AU)
|
Family
ID: |
45497211 |
Appl.
No.: |
14/884,448 |
Filed: |
October 15, 2015 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20160032305 A1 |
Feb 4, 2016 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
13806608 |
|
9200261 |
|
|
|
PCT/GB2011/051340 |
Jul 18, 2011 |
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Jul 22, 2010 [GB] |
|
|
1012262.0 |
Dec 22, 2010 [GB] |
|
|
1021707.3 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01H
3/04 (20130101); C12N 9/0071 (20130101); C12N
15/8243 (20130101); C12Y 114/00 (20130101); C12N
15/8218 (20130101); C12N 7/00 (20130101); C12N
15/8251 (20130101); C12P 17/188 (20130101); C12N
9/0077 (20130101); C07K 14/415 (20130101); C12Q
1/6876 (20130101); C12N 15/67 (20130101); C12Q
2600/158 (20130101); C12Q 2600/156 (20130101) |
Current International
Class: |
C12N
9/02 (20060101); C12N 15/82 (20060101); C12N
9/00 (20060101); C07K 14/415 (20060101); C12P
17/18 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
1 270 727 |
|
Jan 2003 |
|
EP |
|
1 512 748 |
|
Mar 2005 |
|
EP |
|
1 632 565 |
|
Mar 2006 |
|
EP |
|
1 837 396 |
|
Sep 2007 |
|
EP |
|
WO 99/14351 |
|
Mar 1999 |
|
WO |
|
WO 02/101052 |
|
Dec 2002 |
|
WO |
|
WO 2006/081029 |
|
Aug 2006 |
|
WO |
|
WO 2006/138012 |
|
Dec 2006 |
|
WO |
|
WO 2008/069878 |
|
Jun 2008 |
|
WO |
|
WO 2009/005647 |
|
Jan 2009 |
|
WO |
|
WO 2009/064771 |
|
May 2009 |
|
WO |
|
WO 2011/161431 |
|
Dec 2011 |
|
WO |
|
WO 2012/010872 |
|
Jan 2012 |
|
WO |
|
WO 2013/136057 |
|
Sep 2013 |
|
WO |
|
Other References
Accession No. JQ659006 & JQ659012 & JQ659010, Jul. 17,
2012. cited by applicant .
Accession No. JQ659007 & JQ659012 & JQ659010, Jul. 17,
2012. cited by applicant .
Accession No. JQ659008 & JQ659011 & JQ659012 &
JQ659005, Jul. 17, 2012. cited by applicant .
Sequence alignment: Amino acid sequence alignment between GenBank
Accession No. AK320249.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 8 in U.S. Appl. No. 13/806,310 (obtained Oct. 10, 2014).
cited by applicant .
Sequence alignment: Amino acid sequence alignment between GenBank
Accession No. BT096188.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 8 in U.S. Appl. No. 13/806,310 (obtained Oct. 10, 2014).
cited by applicant .
Sequence alignment: Amino acid sequence alignment between GenBank
Accession No. EU882980.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 8 in U.S. Appl. No. 13/806,310 (obtained Oct. 10, 2014).
cited by applicant .
Sequence alignment: Nucleic acid sequence alignment between GenBank
Accession No. AK320249.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 2 in U.S. Appl. No. 13/806,310, Provided by New Zealand
Intellectual Property Office on Sep. 15, 2014. cited by applicant
.
Sequence alignment: Nucleic acid sequence alignment between GenBank
Accession No. BT096188.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 2 in U.S. Appl. No. 13/806,310, Provided by New Zealand
Intellectual Property Office on Sep. 15, 2014. cited by applicant
.
Sequence alignment: Nucleic acid sequence alignment between GenBank
Accession No. EU882980.1 and methyltransferase PSMT2 sequence of
SEQ ID No: 2 in U.S. Appl. No. 13/806,310, Provided by New Zealand
Intellectual Property Office on Sep. 15, 2014. cited by applicant
.
Accession No. AB126256, May 10, 2005. cited by applicant .
Accession No. AB126257, May 10, 2005. cited by applicant .
Accession No. AB374409, Jan. 10, 2008. cited by applicant .
Accession No. A9ZT62, Feb. 26, 2008. cited by applicant .
Accession No. D3JXF8, Mar. 23, 2010. cited by applicant .
Accession No. GU325750, Jan. 28, 2010. cited by applicant .
Allen et al., "Metabolic Engineering of Morphinan Alkaloids by
Over-Expression and RNAi Suppression of Salutaridinol
7-O-acetyltransferase in Opium Poppy," Plant Biotech J. 6:22-30,
2008. cited by applicant .
Amino acid sequence alignment between GenBank Accession No.
AK320249.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 8). cited by applicant .
Amino acid sequence alignment between GenBank Accession No.
BT096188.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 8). cited by applicant .
Amino acid sequence alignment between GenBank Accession No.
EU882980.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 8). cited by applicant .
Chan et al., "Draft Genome Sequence of the Oilseed Species Ricinus
communis," Nat Biotechnol. 28:951-959, 2010. cited by applicant
.
Chavez et al., "Characterization of Two Methylenedioxy
Bridge-Forming Cytochrome P450-Dependent Enzymes of Alkaloid
Formation in the Mexican Prickly Poppy Argemone mexica," Arch.
Biochem. Biophys. 507:186-193, 2011. cited by applicant .
Chu et al., "From Hormones to Secondary Metabolism: The Emergence
of Metabolic Gene Clusters in Plants," Plant J. 66:66-79, 2011.
cited by applicant .
Database UniProt [Online] Accession No. Q0ZPV6, Aug. 22, 2006.
cited by applicant .
Database UniProt [Online] Accession No. B9SK36, Mar. 24, 2009.
cited by applicant .
Decker et al., "Characterization of Proteins in Latex of the Opium
Poppy (Papaver somniferum) Using Two-Dimensional Gel
Electrophoresis and Microsequencing," Electrophoresis 21:3500-3516,
2000. cited by applicant .
Desgagne-Penix et al., "Integration of Deep Transcriptome and
Proteome Analyses Reveals the Components of Alkaloid Metabolism in
Opium Poppy Cell Cultures," BMC Plant Biol. 10:252, 2010. cited by
applicant .
Evertsz et al., "Research Report Hybridization Cross-Reactivity
within Homologous Gene Families on Glass cDNA Microarrays,"
Biotechniques 31:1182-1192, 2001. cited by applicant .
Facchini et al., "Developmental and Inducible Accumulation of Gene
Transcripts Involved in Alkaloid Biosynthesis in Opium Poppy,"
Phytochemistry 64:177-186. cited by applicant .
Facchini et al., "Opium Poppy: Blueprint for an Alkaloid Factory,"
Phytochem Rev. 6:97-124, 2007. cited by applicant .
Facchini and De Luca, "Opium Poppy and Madagascar Periwinkle: Model
Non-Model Systems to Investigate Alkaloid Biosynthesis in Plants,"
Plant J. 54:763-784, 2008. cited by applicant .
Field et al., "Formation of Plant Metabolic Gene Clusters Within
Dynamic Chromosomal Regions," Proc Natl Acad Sci. 108:16116-16121,
2011. cited by applicant .
Frick et al., "Metabolic Engineering with a Morphine Biosynthetic
P450 in Opium Poppy Surpasses Breeding," Metab. Eng. 9:169-176,
2007. cited by applicant .
GenBank Accession No. AK320249.1, published May 1, 2010. cited by
applicant .
GenBank Accession No. BT096188.1, published Aug. 6, 2009. cited by
applicant .
GenBank Accession No. CAG34222.1, Jun. 14, 2004. cited by applicant
.
GenBank Accession No. EU882980.1, published Nov. 13, 2009. cited by
applicant .
Gesell et al., "CYP719B1 is Salutaridine Synthase, the C-C
Phenol-Coupling Enzyme of Morphine Biosynthesis in Opium Poppy," J.
Biol. Chem. 284:24432-24442, 2009. cited by applicant .
Great Britain Search Report dated Oct. 15, 2010 for Great Britain
Application No. GB1010471.9. cited by applicant .
Great Britain Search Report dated Nov. 23, 2010 for Great Britain
Application No. GB1012262.0. cited by applicant .
Great Britain Search Report dated Jul. 2, 2012 for Great Britain
Application No. GB1204407.9 (PSMT1). cited by applicant .
Great Britain Search Report dated Oct. 1, 2012 for Great Britain
Application No. GB1204407.9 (CYP82Y1). cited by applicant .
Great Britain Search Report dated Oct. 1, 2012 for Great Britain
Application No. GB1204407.9 (PSSDR1). cited by applicant .
Great Britain Search Report dated Oct. 31, 2012 for Great Britain
Application No. GB1204407.9 (PSATI). cited by applicant .
Great Britain Search Report dated Oct. 31, 2012 for Great Britain
Application No. GB1204407.9 (PSCXE1). cited by applicant .
et al., "Evaluation of Selected Poppy (Papaver somniferum L.) Lines
by Their Morphine and Other Alkaloids Contents," Eur Food Res
Technol. 226:1213-1220, 2008. cited by applicant .
Hagel et al., "Quantitative .sup.1H Nuclear Magnetic Resonance
Metabolite Profiling as a Functional Genomics Platform to
Investigate Alkaloid Biosynthesis in Opium Poppy," Plant Physiol.
147:1805-1821, 2008. cited by applicant .
Hileman et al., "Virus-Induced Gene Silencing is an Effective Tool
for Assaying Gene Function in the Basal Eudicot Species Papaver
somniferum (Opium Poppy),"Plant J. 44:334-341, 2005. cited by
applicant .
Ikezawa et al., "Molecular Cloning and Characterization of
Methylenedioxy Bridge-Forming Enzymes Involved in Stylopine
Biosynthesis in Eschscholzia californica,"FEBS J. 274:1019-1035,
2007. cited by applicant .
International Search Report and Written Opinion of the
International Searching Authority for corresponding PCT Application
No. PCT/GB2011/051340, dated Feb. 8, 2012. cited by applicant .
Kleber da Rocha et al., "Effect of Different Culture Medium
Components on Production of Alkaloid in Callus Tissues of Cereus
peruvianus (Cactaceae)," Acta Scientiarum Biol. Sci. 27:37-41,
2005. cited by applicant .
Liscombe and Facchini, "Molecular Cloning and Characterization of
Tetrahydroprotoberberine cis-N-Methyltransferase, an Enzyme
Involved in Alkaloid Biosynthesis in Opium Poppy," J. Biol. Chem.
282:14741-14751, 2007. cited by applicant .
Morishige et al., "Molecular Characterization of the
S-adenosyl-L-methionine:3'-Hydroxy-N-methylcoclaurine
4'-O-Methyltransferase Involved in Isoquinoline Alkaloid
Biosynthesis in Coptis japonica," J. Biol. Chem. 275:23398-23405,
2000. cited by applicant .
NCBI accession number: XP.sub.--002284806 dated Mar. 20, 2009.
cited by applicant .
NCBI accession number: XP.sub.--002284810.2 dated Mar. 20, 2009.
cited by applicant .
NCBI accession number: XP.sub.--002284031.1 dated Mar. 20, 2009.
cited by applicant .
New Zealand Patent Office, Further Examination Report, dated Sep.
15, 2014 (2 pages). cited by applicant .
New Zealand Intellectual Property Office, Further Examination
Report for NZ Application 604057, dated Oct. 17, 2014 (2 pages).
cited by applicant .
Nucleic acid sequence alignment between GenBank Accession No.
AK320249.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 2). cited by applicant .
Nucleic acid sequence alignment between GenBank Accession No.
BT096188.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 2). cited by applicant .
Nucleic acid sequence alignment between GenBank Accession No.
EU882980.1 and methyltransferase PSMT2 sequence of the current
application (SEQ ID No: 2). cited by applicant .
Okada, "The Biosynthesis of Isoprenoids and the Mechanisms
Regulating it in Plants," Biosci Biotechol Biochem. 75:1219-1225,
2011. cited by applicant .
Omura and Sato, "The Carbon Monoxide-binding Pigment of Liver
Microsomes" J. Biol. Chem. 239:2370-2378, 1964. cited by applicant
.
Ounaroon et al., "(R,S)-Reticuline 7-O-methyltransferase and
(R,S)-norcoclaurine 6-O-methyltransferase of Papaver
somniferum--cDNA Cloning and Characterization of Methyl Transfer
Enzymes of Alkaloid Biosynthesis in Opium Poppy," Plant J.
36:808-819, 2003. cited by applicant .
Pienkny et al., "Functional characterization of a novel
benzylisoquinoline O-methyltransferase suggests its involvement in
papaverine biosynthesis in opium poppy (Papaver somniferum L)" The
Plant Journal 60:56-67, 2009. cited by applicant .
Sato et al., "S-Adenosyl-L-Methionine:
Scoulerine-9-O-Methyltransferase from Cultured Coptis japonica
Cells" Phytochem. 32:659-664, 1993. cited by applicant .
Schuler and Werck-Reichart, "Functional Genomics of P450s"Annu.
Rev. Plant Biol. 54:629-667, 2003. cited by applicant .
Sequence alignment showing alignment of SEQ ID No: 10 (Fig. 4C,
PSCYP3) of the present application with NCBI accession number:
XP.sub.--002284806, NCBI accession number: XP.sub.--002284810.2,
and NCBI accession number: XP.sub.--002284031.1. cited by applicant
.
Takos et al., "Genomic Clustering of Cyanogenic Glucoside
Biosynthetic Genes Aids Their Identification in Lotus japonicus and
Suggests the Repeated Evolution of this Chemical Defence Pathway,"
Plant J. 68:273-286, 2011. cited by applicant .
Till et al., "Mismatch Cleavage by Single-Strand Specific
Nucleases," Nucleic Acids Res. 32:2632-2641, 2004. cited by
applicant .
Wesley et al., "Construct Design for Efficient, Effective and
High-Throughput Gene Silencing in Plants," Plant J. 27:581-590,
2001. cited by applicant .
Wijekoon and Facchini, "Systematic Knockdown of Morphine Pathway
Enzymes in Opium Poppy Using Virus-Induced Genen Silencing," Plant
J. 69:1052-1063, 2012. cited by applicant .
Winzer et al., "A Papaver somniferum 10-Gene Cluster for Synthesis
of the Anticancer Alkaloid Noscapine," Science 336:1704-1708, 2012.
cited by applicant .
Ziegler et al., "Comparative Macroarray Analysis of Morphine
Containing Papaver somniferum and Eight Morphine Free Papaver
Species Identifies an O-methyltransferase Involved in
Benzylisoquinoline Biosynthesis," Planta 222:458-471, 2005. cited
by applicant .
Ziegler et al., "Comparative Transcript and Alkaloid Profiling in
Papaver Species Identifies a Short Chain Dehydrogenase/Reductase
Involved in Morphine Biosynthesis," Plant J. 48:177-192, 2006.
cited by applicant .
Ziegler et al., "Evolution of Morphine Biosynthesis in Opium
Poppy," Phytochem. 70:1696-1707, 2009. cited by applicant .
Ziegler et al., "Comparative transcript and alkaloid profiling in
Papaver species identifies a short chain dehydrogenase/reductase
involved in morphine biosynthesis" The Plant Journal 48:177-192,
2006. cited by applicant.
|
Primary Examiner: Abraham; Amjad
Assistant Examiner: Stankovic; Bratislav
Attorney, Agent or Firm: Klarquist Sparkman, LLP
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This is a divisional of U.S. patent application Ser. No. 13/806,608
filed Dec. 21, 2012, which is the U.S. National Stage of
International Application No. PCT/GB2011/051340, filed Jul. 18,
2011, which was published in English under PCT Article 21(2), which
in turn claims the benefit of Great Britain Application No.
1012262.0, filed Jul. 22, 2010 and Great Britain Application No.
1021707.3, filed Dec. 22, 2010.
Claims
The invention claimed is:
1. An isolated nucleic acid molecule that encodes a cytochrome P450
polypeptide wherein said nucleic acid molecule comprises or
consists of a nucleotide sequence selected from the group
consisting of: i) the cDNA nucleotide sequence of SEQ ID NO:1; ii)
a cDNA nucleotide sequence that is degenerate as a result of the
genetic code to the cDNA nucleotide sequence defined in (i); iii) a
nucleic acid sequence comprising at least 90% sequence identity
with the cDNA nucleotide sequence of SEQ ID NO:1; iv) a nucleotide
sequence that encodes the polypeptide sequence of SEQ ID NO:8; and
v) a nucleotide sequence that encodes a polypeptide comprising at
least 95% sequence identity to the protein sequence of SEQ ID
NO:8.
2. The isolated nucleic acid molecule according to claim 1, wherein
said nucleic acid molecule comprises or consists of the nucleotide
sequence of SEQ ID NO:1.
3. A vector comprising the nucleic acid molecule encoding the
cytochrome P450 polypeptide according to claim 1, wherein said
nucleic acid molecule is operably linked to a nucleic acid molecule
comprising a promoter sequence.
4. The vector according to claim 3, wherein said nucleic acid
sequence comprising a promoter confers constitutive expression on
said cytochrome P450 polypeptide.
5. A transgenic cell transformed or transfected with the nucleic
acid molecule of claim 1.
6. The transgenic cell according to claim 5, wherein said cell is a
plant cell.
7. The transgenic cell according to claim 6, wherein said plant
cell is from the family Papaveraceae.
8. The transgenic cell according to claim 7, wherein said plant
cell is a Papaver somniferum cell.
9. A plant comprising the plant cell of claim 6.
10. The plant according to claim 9, wherein said plant is from the
family Papaveraceae.
11. The plant according to claim 10, wherein said plant is Papaver
somniferum.
12. The transgenic cell according to claim 5, wherein said cell is
a microbial cell.
13. The transgenic cell of claim 5, wherein said cell is adapted
such that the nucleic acid molecule encoding the cytochrome P450 is
over-expressed when compared to a non-transgenic cell or plant of
the same species.
14. A nucleic acid molecule comprising a transcription cassette,
wherein said cassette comprises the nucleotide sequence of SEQ ID
NO:1 or SEQ ID NO:5 and is adapted for expression by provision of
at least one promoter operably linked to said nucleotide sequence
such that both sense and antisense molecules are transcribed from
said cassette.
15. The nucleic acid molecule according to claim 14, wherein said
cassette is adapted such that both sense and antisense ribonucleic
acid molecules are transcribed from said cassette wherein said
sense and antisense nucleic acid molecules are adapted to anneal
over at least part or all of their length to form a siRNA or
shRNA.
16. The nucleic acid molecule according to claim 15, wherein said
cassette is provided with at least two promoters adapted to
transcribe both sense and antisense strands of said ribonucleic
acid molecule.
17. The nucleic acid molecule according to claim 14, wherein said
cassette comprises a nucleic acid molecule wherein said molecule
comprises a first part linked to a second part wherein said first
and second parts are complementary over at least part of their
sequence and further wherein transcription of said nucleic acid
molecule produces a ribonucleic acid molecule which forms a double
stranded region by complementary base pairing of said first and
second parts thereby forming an shRNA.
18. The nucleic acid molecule according to claim 14, wherein said
nucleic acid molecule is part of a vector adapted for expression in
a plant cell.
19. A plant cell transfected with the nucleic acid molecule claim
14, wherein said cell has reduced expression of said cytochrome
P450 polypeptide.
20. A process for the modification of an opiate alkaloid
comprising: i) providing the transgenic plant cell according to
claim 19; ii) cultivating said plant cell to produce a transgenic
plant; and optionally iii) harvesting said transgenic plant, or
part thereof.
21. The process according to claim 20, wherein said harvested plant
part is dried straw and said opiate alkaloid is extracted.
22. A process for the modification of an opiate alkaloid
comprising: i) providing the transgenic microbial cell according to
claim 12 that expresses a cytochrome P450 in culture with at least
one opiate alkaloid; ii) cultivating the microbial cell under
conditions that modify one or more opiate alkaloids; and optionally
iii) isolating said modified alkaloid from the microbial cell or
cell culture.
23. The process according to claim 22, wherein said microbial cell
is a bacterial cell or fungal/yeast cell.
24. A plant comprising a viral vector that includes the nucleic
acid molecule according to claim 1.
25. The plant according to claim 24, wherein said gene is encoded
by a nucleic acid molecule comprising a nucleic acid sequence
selected from the group consisting of: i) the nucleic acid molecule
comprising or consisting of SEQ ID NO:1 or SEQ ID NO:5; ii) a
nucleic acid molecule comprising a nucleotide sequence that
hybridizes under stringent hybridization conditions to a nucleic
acid molecule in (i) and which encodes a cytochrome p450
polypeptide; and iii) a nucleic acid molecule that encodes a
variant polypeptide that varies from a polypeptide comprising the
amino acid sequence as represented in SEQ ID NO:8.
26. A viral vector comprising the nucleic acid molecule of claim
1.
27. A method of gene silencing in a plant, comprising: introducing
the viral vector of claim 26 into the plant, thereby inducing gene
silencing.
28. The method of claim 27, wherein the plant is from the family
Papaveraceae.
29. The isolated nucleic acid molecule of claim 1, wherein the
isolated nucleic acid molecule encodes a cytochrome P450
polypeptide having at least 95% sequence identity to the protein
sequence in SEQ ID NO:8, wherein said nucleic acid molecule
comprises or consists of a nucleotide sequence selected from the
group consisting of: i) the cDNA nucleotide sequence shown in SEQ
ID NO:1; ii) a cDNA nucleotide sequence that is degenerate as a
result of the genetic code to the nucleotide sequence defined in
(i); and iii) a nucleotide sequence comprising at least 90%
sequence identity with the cDNA nucleotide sequence in SEQ ID NO:1.
Description
INTRODUCTION
This disclosure relates to the isolation and sequencing of nucleic
acid molecules that encode novel cytochrome P450s from a Papaver
somniferum cultivar, [poppy plant]; transgenic cells transformed
with said nucleic acid molecules, sequence variants of the gene;
the use of said genes/proteins in the production of noscapine and
the use of the genes as a marker of poppy plants that synthesize
noscapine.
BACKGROUND
Plant cytochrome P450s are a very large family of enzymes
responsible for the oxidation, peroxidation and reduction of a vast
number of plant intermediate metabolites such as alkaloids,
terpenoids, lipids, glycosides and glucosinolates. P450s are known
to be involved in the metabolism and detoxification of pesticides
as well as the biosynthesis of primary and secondary
metabolites.
Plant cytochrome P450s are known in the art and have been
successfully cloned, expressed and characterized. For example,
WO2009/064771 and WO2008/070274, each disclose cytochrome P450
genes and their use in the alteration of alkaloid content in
Nicotiana tabacum. These patent applications describe how the
inhibition of specific P450s reduces the amount of N'
nitrosonornicotine, a known carcinogen, in planta. WO2008/150473
discloses the over expression of cytochrome P450s to confer
resistance or tolerance to herbicides, in particular,
benzothiadiazones and sulfonylureas. In WO2008/088161 is disclosed
transgenic plants that over express a cytochrome P450 which results
in increased seed size or the storage protein content of seeds. The
over expression also confers increased water stress resistance.
What is apparent is that plant cytochrome P450s have diverse
functions in regulating the biochemical activities in plant cells
and are known in the art.
The opium poppy P. somniferum is the plant from which opium is
extracted. The opium poppy is the only commercially exploited poppy
of the family Papaveraceae and is the principal source of natural
opiates. The opium is extracted from latex harvested from the green
seed pods. A further source of opiate alkaloids is the poppy straw
which is the dried mature plant. P. somniferum is a source of
clinically useful opiate alkaloids such as morphine, codeine,
thebaine, noscapine [also known as narcotine] and papaverine. The
clinical application of these opiate alkaloids and their derivates
is broad having use as analgesics, cough suppressants and
anti-spasmodics. Although not used as a pharmacological agent in
its own right, thebaine is a particularly useful opiate which can
be converted into a range of compounds such as hydrocodone,
oxycodone, oxymorphone, nalbuphine naltrexone, buprenorphine and
etorphine. These intermediates also have broad pharmaceutical
applications. For example, oxycodone, oxymorphone and etorphine are
widely used as an analgesic for moderate to severe pain and are
often combined with other analgesics such as ibuprofen.
Buprenorphine is used in the treatment of heroin addiction and
chronic pain. Naltrexone is used in the treatment of alcohol and
opiate addiction.
This disclosure relates to the identification and characterization
of cytochrome P450s isolated from a Papaver somniferum cultivar we
call PSCYP1, PSCYP2 and PSCYP3. The predicted protein encoded by
PSCYP1 exhibits highest sequence identity to a cytochrome P450 from
Coptis japonica (GenBank accession no. BAF98472.1, 46% identity).
The closest homologue with an assignment to a cytochrome P450
subfamily is CYP82C4 from Arabidopsis lyrata (NCBI reference seq
no. XP_002869304.1, 44% identity). The Arabidopsis thaliana CYP82C4
protein has been shown to add a hydroxyl group to the 5 position of
8-methoxypsoralen, a furocoumarin, creating
5-hydroxy-8-methoxypsoralen (Kruse et al. (2008) Chemistry &
Biology 15: 149-156). The closest homologues of the predicted
protein encoded by PSCYP2 are annotated as stylopine synthases from
Argemone mexicana (GenBank accession no. ABR14721, 77% identity),
Papaver somniferum (GenBank accession no ADB89214, 76% identity)
and Eschscholzia californica (GenBank accession no. BAD98250, 72%
identity). They belong to the CYP719A subfamily of cytochrome P450s
which have only been found in isoquinoline alkaloid-producing plant
species where they catalyse the formation of methylenedioxy-bridges
(Ikezawa et al. (2009) Plant Cell Rep. 28:123-133). The closest
homologue of the predicted protein encoded by PSCYP3 is annotated
as protopine 6-hydroxylase from Eschscholzia californica (GenBank
accession no. BAK20464, 44% identity). The closest homologue with
an assignment to a cytochrome P450 subfamily is CYP82C4 from
Arabidopsis lyrata mentioned above (42% identity). Surprisingly
PSCYP1, PSCYP2 and PSCYP3 are unique to Papaver somniferum
cultivars that produce noscapine. Those cultivars that do not
produce noscapine do not include this gene.
STATEMENTS OF INVENTION
According to an aspect of the invention there is provided an
isolated nucleic acid molecule that encodes a cytochrome P450
polypeptide wherein said nucleic acid molecule comprises or
consists of a nucleotide sequence selected from the group
consisting of: i) a nucleotide sequence as represented by the
sequence in FIG. 1a, 1b, 1c, 1d, 3a, 3b or 3c; ii) a nucleotide
sequence wherein said sequence is degenerate as a result of the
genetic code to the nucleotide sequence defined in (i); iii) a
nucleic acid molecule the complementary strand of which hybridizes
under stringent hybridization conditions to the sequence in FIG.
1a, 1b, 1c, 1d, 3a, 3b or 3c wherein said nucleic acid molecule
encodes a cytochrome P450 polypeptide; iv) a nucleotide sequence
that encodes a polypeptide comprising an amino acid sequence as
represented in FIG. 4a, 4b, 4c or 4d; v) a nucleotide sequence that
encodes a polypeptide comprising an amino acid sequence wherein
said amino acid sequence is modified by addition deletion or
substitution of at least one amino acid residue as represented in
iv) above and which has retained or enhanced cytochrome P450
activity.
Hybridization of a nucleic acid molecule occurs when two
complementary nucleic acid molecules undergo an amount of hydrogen
bonding to each other. The stringency of hybridization can vary
according to the environmental conditions surrounding the nucleic
acids, the nature of the hybridization method, and the composition
and length of the nucleic acid molecules used. Calculations
regarding hybridization conditions required for attaining
particular degrees of stringency are discussed in Sambrook et al.,
Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001); and Tijssen,
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2
(Elsevier, New York, 1993). The T.sub.m is the temperature at which
50% of a given strand of a nucleic acid molecule is hybridized to
its complementary strand. The following is an exemplary set of
hybridization conditions and is not limiting:
Very High Stringency (Allows Sequences that Share at Least 90%
Identity to Hybridize)
Hybridization: 5.times.SSC at 65.degree. C. for 16 hours
Wash twice: 2.times.SSC at room temperature (RT) for 15 minutes
each
Wash twice: 0.5.times.SSC at 65.degree. C. for 20 minutes each
High Stringency (Allows Sequences that Share at Least 80% Identity
to Hybridize)
Hybridization: 5.times.-6.times.SSC at 65.degree. C.-70.degree. C.
for 16-20 hours
Wash twice: 2.times.SSC at RT for 5-20 minutes each
Wash twice: 1.times.SSC at 55.degree. C.-70.degree. C. for 30
minutes each
Low Stringency (Allows Sequences that Share at Least 50% Identity
to Hybridize)
Hybridization: 6.times.SSC at RT to 55.degree. C. for 16-20
hours
Wash at least twice: 2.times.-3.times.SSC at RT to 55.degree. C.
for 20-30 minutes each.
In a preferred embodiment of the invention said nucleic acid
molecule comprises or consists of a nucleotide sequence as
represented in FIG. 1a, 1b, 1c or 1d.
According to a further aspect of the invention there is provided an
isolated polypeptide selected from the group consisting of: i) a
polypeptide comprising or consisting of an amino acid sequence as
represented in FIG. 4a, 4b, 4c or 4d; or ii) a modified polypeptide
comprising or consisting of a modified amino acid sequence wherein
said polypeptide is modified by addition deletion or substitution
of at least one amino acid residue of the sequence presented in
FIG. 4a, 4b, 4c or 4d and which has retained or enhanced cytochrome
P450 activity.
A modified polypeptide as herein disclosed may differ in amino acid
sequence by one or more substitutions, additions, deletions,
truncations that may be present in any combination. Among preferred
variants are those that vary from a reference polypeptide by
conservative amino acid substitutions. Such substitutions are those
that substitute a given amino acid by another amino acid of like
characteristics. The following non-limiting list of amino acids are
considered conservative replacements (similar): a) alanine, serine,
and threonine; b) glutamic acid and aspartic acid; c) asparagine
and glutamine d) arginine and lysine; e) isoleucine, leucine,
methionine and valine and f) phenylalanine, tyrosine and
tryptophan. Most highly preferred are variants that retain or
enhance the same biological function and activity as the reference
polypeptide from which it varies.
In one embodiment, the variant polypeptides have at least 43%, 45%,
or 47% identity, more preferably at least 50% identity, still more
preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%
identity, and at least 99% identity with the full length amino acid
sequence illustrated herein.
According to a further aspect of the invention there is provided a
vector comprising a nucleic acid molecule encoding a cytochrome
P450 polypeptide according to the invention wherein said nucleic
acid molecule is operably linked to a nucleic acid molecule
comprising a promoter sequence.
In a preferred embodiment of the invention said nucleic acid
sequence comprising a promoter confers constitutive expression on
said cytochrome P450 polypeptide.
In an alternative preferred embodiment of the invention said
nucleic acid molecule comprising a promoter confers regulated
expression on said cytochrome P450 polypeptide.
In a preferred embodiment of the invention said regulated
expression is tissue or developmentally regulated expression.
In a further alternative embodiment of the invention said regulated
expression is inducible expression.
In an alternative embodiment of the invention a vector including a
nucleic acid molecule according to the invention need not include a
promoter or other regulatory sequence, particularly if the vector
is to be used to introduce the nucleic acid molecule into cells for
recombination into the gene.
Preferably the nucleic acid molecule in the vector is under the
control of, and operably linked to, an appropriate promoter or
other regulatory elements for transcription in a host cell such as
a microbial, (e.g. bacterial, yeast), or plant cell. The vector may
be a bi-functional expression vector which functions in multiple
hosts. In the case of cytochrome P450 genomic DNA this may contain
its own promoter or other regulatory elements and in the case of
cDNA this may be under the control of an appropriate promoter or
other regulatory elements for expression in the host cell.
By "promoter" is meant a nucleotide sequence upstream from the
transcriptional initiation site and which contains all the
regulatory regions required for transcription. Suitable promoters
include constitutive, tissue-specific, inducible, developmental or
other promoters for expression in plant cells comprised in plants
depending on design. Such promoters include viral, fungal,
bacterial, animal and plant-derived promoters capable of
functioning in plant cells.
Constitutive promoters include, for example CaMV 35S promoter
(Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et
al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al.
(1989) Plant Mol. Biol. 18: (675-689); pEMU (Last et al. (1991)
Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J.
3. 2723-2730); ALS promoter (U.S. application Ser. No. 08/409,297),
and the like. Other constitutive promoters include those in U.S.
Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785;
5,399,680, 5,268,463; and 5,608,142, each of which is incorporated
by reference.
Chemical-regulated promoters can be used to modulate the expression
of a gene in a plant through the application of an exogenous
chemical regulator. Depending upon the objective, the promoter may
be a chemical-inducible promoter, where application of the chemical
induced gene expression, or a chemical-repressible promoter, where
application of the chemical represses gene expression.
Chemical-inducible promoters are known in the art and include, but
are not limited to, the maize In2-2 promoter, which is activated by
benzenesulfonamide herbicide safeners, the maize GST promoter,
which is activated by hydrophobic electrophilic compounds that are
used as pre-emergent herbicides, and the tobacco PR-1a promoter,
which is activated by salicylic acid. Other chemical-regulated
promoters of interest include steroid-responsive promoters (see,
for example, the glucocorticoid-inducible promoter in Schena et al.
(1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et
al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and
tetracycline-repressible promoters (see, for example, Gatz et al.
(1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618
and 5,789,156, herein incorporated by reference.
Where enhanced expression in particular tissues is desired,
tissue-specific promoters can be utilised. Tissue-specific
promoters include those described by Yamamoto et al. (1997) Plant
J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol.
38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3):
337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168;
Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp
et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al.
(1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant
Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell
Differ. 20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6):
1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90
(20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3):
495-50.
"Operably linked" means joined as part of the same nucleic acid
molecule, suitably positioned and oriented for transcription to be
initiated from the promoter. DNA operably linked to a promoter is
"under transcriptional initiation regulation" of the promoter. In a
preferred aspect, the promoter is a tissue specific promoter, an
inducible promoter or a developmentally regulated promoter.
Particular of interest in the present context are nucleic acid
constructs which operate as plant vectors. Specific procedures and
vectors previously used with wide success in plants are described
by Guerineau and Mullineaux (1993) (Plant transformation and
expression vectors. In: Plant Molecular Biology Labfax (Croy RRD
ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable
vectors may include plant viral-derived vectors (see e.g.
EP194809).
If desired, selectable genetic markers may be included in the
construct, such as those that confer selectable phenotypes such as
resistance to herbicides (e.g. kanamycin, hygromycin,
phosphinotricin, chlorsulfuron, methotrexate, gentamycin,
spectinomycin, imidazolinones and glyphosate).
According to a further aspect of the invention there is provided a
transgenic cell transformed or transfected with a nucleic acid
molecule or vector according to the invention.
In a preferred embodiment of the invention said cell is a plant
cell.
In a preferred embodiment of the invention said plant cell is from
the family Papaveraceae.
In a preferred embodiment of the invention said plant cell is a
Papaver somniferum cell.
According to a further aspect of the invention there is provided a
plant comprising a plant cell according to the invention.
In a preferred embodiment of the invention said plant is from the
family Papaveraceae; preferably Papaver somniferum.
In an alternative preferred embodiment of the invention said cell
is a microbial cell; preferably a bacterial or fungal cell [e.g.
yeast, Saccharomyces cerevisiae].
In a preferred embodiment of the invention said cell is adapted
such that the nucleic acid molecule encoding the cytochrome P450 is
over-expressed when compared to a non-transgenic cell of the same
species.
According to a further aspect of the invention there is provided a
nucleic acid molecule comprising a transcription cassette wherein
said cassette includes a nucleotide sequence designed with
reference to FIG. 1a, 1b, 1c or 1d and is adapted for expression by
provision of at least one promoter operably linked to said
nucleotide sequence such that both sense and antisense molecules
are transcribed from said cassette.
In a preferred embodiment of the invention said cassette is adapted
such that both sense and antisense ribonucleic acid molecules are
transcribed from said cassette wherein said sense and antisense
nucleic acid molecules are adapted to anneal over at least part or
all of their length to form a small interfering RNA [siRNA] or
short hairpin RNA [shRNA].
In a preferred embodiment of the invention said cassette is
provided with at least two promoters adapted to transcribe both
sense and antisense strands of said ribonucleic acid molecule.
In an alternative preferred embodiment of the invention said
cassette comprises a nucleic acid molecule wherein said molecule
comprises a first part linked to a second part wherein said first
and second parts are complementary over at least part of their
sequence and further wherein transcription of said nucleic acid
molecule produces an ribonucleic acid molecule which forms a double
stranded region by complementary base pairing of said first and
second parts thereby forming an shRNA.
A technique to specifically ablate gene function is through the
introduction of double stranded RNA, also referred to as small
inhibitory/interfering RNA (siRNA) or short hairpin RNA [shRNA],
into a cell which results in the destruction of mRNA complementary
to the sequence included in the siRNA/shRNA molecule. The siRNA
molecule comprises two complementary strands of RNA (a sense strand
and an antisense strand) annealed to each other to form a double
stranded RNA molecule. The siRNA molecule is typically derived from
exons of the gene which is to be ablated. The mechanism of RNA
interference is being elucidated. Many organisms respond to the
presence of double stranded RNA by activating a cascade that leads
to the formation of siRNA. The presence of double stranded RNA
activates a protein complex comprising RNase III which processes
the double stranded RNA into smaller fragments (siRNAs,
approximately 21-29 nucleotides in length) which become part of a
ribonucleoprotein complex. The siRNA acts as a guide for the RNase
complex to cleave mRNA complementary to the antisense strand of the
siRNA thereby resulting in destruction of the mRNA.
In a preferred embodiment of the invention said nucleic acid
molecule is part of a vector adapted for expression in a plant
cell.
According to a further aspect of the invention there is provided a
plant cell transfected with a nucleic acid molecule or vector
according to the invention wherein said cell has reduced expression
of said cytochrome P450 polypeptide.
According to an aspect of the invention there is provided a process
for the modification of an opiate alkaloid comprising: i) providing
a transgenic plant cell according to the invention; ii) cultivating
said plant cell to produce a transgenic plant; and optionally i)
harvesting said transgenic plant, or part thereof.
In a preferred method of the invention said harvested plant
material is dried straw and said opiate alkaloid is extracted.
According to an alternative aspect of the invention there is
provided a process for the modification of an opiate alkaloid
comprising: i) providing a transgenic microbial cell according to
the invention that expresses a cytochrome P450 according to the
invention in culture with at least one opiate alkaloid; ii)
cultivating the microbial cell under conditions that modify one or
more opiate alkaloids; and optionally iii) isolating said modified
alkaloid from the microbial cell or cell culture.
In a preferred method of the invention said microbial cell is a
bacterial cell or fungal/yeast cell.
If microbial cells are used as organisms in the process according
to the invention they are grown or cultured in the manner with
which the skilled worker is familiar, depending on the host
organism. As a rule, microorganisms are grown in a liquid medium
comprising a carbon source, usually in the form of sugars, a
nitrogen source, usually in the form of organic nitrogen sources
such as yeast extract or salts such as ammonium sulfate, trace
elements such as salts of iron, manganese and magnesium and, if
appropriate, vitamins, at temperatures of between 0.degree. C. and
100.degree. C., preferably between 10.degree. C. and 60.degree. C.,
while gassing in oxygen.
The pH of the liquid medium can either be kept constant, that is to
say regulated during the culturing period, or not. The cultures can
be grown batchwise, semi-batchwise or continuously. Nutrients can
be provided at the beginning of the fermentation or fed in
semi-continuously or continuously. The methylated opiate alkaloids
produced can be isolated from the organisms as described above by
processes known to the skilled worker, for example by extraction,
distillation, crystallization, if appropriate precipitation with
salt, and/or chromatography. To this end, the organisms can
advantageously be disrupted beforehand. In this process, the pH
value is advantageously kept between pH 4 and 12, preferably
between pH 6 and 9, especially preferably between pH 7 and 8.
The culture medium to be used must suitably meet the requirements
of the strains in question. Descriptions of culture media for
various microorganisms can be found in the textbook "Manual of
Methods for General Bacteriology" of the American Society for
Bacteriology (Washington D.C., USA, 1981).
As described above, these media which can be employed in accordance
with the invention usually comprise one or more carbon sources,
nitrogen sources, inorganic salts, vitamins and/or trace
elements.
Preferred carbon sources are sugars, such as mono-, di- or
polysaccharides. Examples of carbon sources are glucose, fructose,
mannose, galactose, ribose, sorbose, ribulose, lactose, maltose,
sucrose, raffinose, starch or cellulose. Sugars can also be added
to the media via complex compounds such as molasses or other
by-products from sugar refining. The addition of mixtures of a
variety of carbon sources may also be advantageous. Other possible
carbon sources are oils and fats such as, for example, soya oil,
sunflower oil, peanut oil and/or coconut fat, fatty acids such as,
for example, palmitic acid, stearic acid and/or linoleic acid,
alcohols and/or polyalcohols such as, for example, glycerol,
methanol and/or ethanol, and/or organic acids such as, for example,
acetic acid and/or lactic acid.
Nitrogen sources are usually organic or inorganic nitrogen
compounds or materials comprising these compounds. Examples of
nitrogen sources comprise ammonia in liquid or gaseous form or
ammonium salts such as ammonium sulfate, ammonium chloride,
ammonium phosphate, ammonium carbonate or ammonium nitrate,
nitrates, urea, amino acids or complex nitrogen sources such as
cornsteep liquor, soya meal, soya protein, yeast extract, meat
extract and others. The nitrogen sources can be used individually
or as a mixture.
Inorganic salt compounds which may be present in the media comprise
the chloride, phosphorus and sulfate salts of calcium, magnesium,
sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and
iron.
Inorganic sulfur-containing compounds such as, for example,
sulfates, sulfites, dithionites, tetrathionates, thiosulfates,
sulfides, or else organic sulfur compounds such as mercaptans and
thiols may be used as sources of sulfur for the production of
sulfur-containing fine chemicals, in particular of methionine.
Phosphoric acid, potassium dihydrogenphosphate or dipotassium
hydrogenphosphate or the corresponding sodium-containing salts may
be used as sources of phosphorus.
Chelating agents may be added to the medium in order to keep the
metal ions in solution. Particularly suitable chelating agents
comprise dihydroxyphenols such as catechol or protocatechuate and
organic acids such as citric acid.
The fermentation media used according to the invention for
culturing microorganisms usually also comprise other growth factors
such as vitamins or growth promoters, which include, for example,
biotin, riboflavin, thiamine, folic acid, nicotinic acid,
panthothenate and pyridoxine. Growth factors and salts are
frequently derived from complex media components such as yeast
extract, molasses, cornsteep liquor and the like. It is moreover
possible to add suitable precursors to the culture medium. The
exact composition of the media compounds heavily depends on the
particular experiment and is decided upon individually for each
specific case. Information on the optimization of media can be
found in the textbook "Applied Microbiol. Physiology, A Practical
Approach" (Editors P. M. Rhodes, P. F. Stanbury, IRL Press (1997)
pp. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained
from commercial suppliers, for example Standard 1 (Merck) or BHI
(brain heart infusion, DIEGO) and the like.
All media components are sterilized, either by heat (20 min at 1.5
bar and 121.degree. C.) or by filter sterilization. The components
may be sterilized either together or, if required, separately. All
media components may be present at the start of the cultivation or
added continuously or batchwise, as desired.
The culture temperature is normally between 15.degree. C. and
45.degree. C., preferably at from 25.degree. C. to 40.degree. C.,
and may be kept constant or may be altered during the experiment.
The pH of the medium should be in the range from 5 to 8.5,
preferably around 7.0. The pH for cultivation can be controlled
during cultivation by adding basic compounds such as sodium
hydroxide, potassium hydroxide, ammonia and aqueous ammonia or
acidic compounds such as phosphoric acid or sulfuric acid. Foaming
can be controlled by employing antifoams such as, for example,
fatty acid polyglycol esters. To maintain the stability of plasmids
it is possible to add to the medium suitable substances having a
selective effect, for example antibiotics. Aerobic conditions are
maintained by introducing oxygen or oxygen-containing gas mixtures
such as, for example, ambient air into the culture. The temperature
of the culture is normally 20.degree. C. to 45.degree. C. and
preferably 25.degree. C. to 40.degree. C. The culture is continued
until formation of the desired product is at a maximum. This aim is
normally achieved within 10 to 160 hours.
The fermentation broth can then be processed further. The biomass
may, according to requirement, be removed completely or partially
from the fermentation broth by separation methods such as, for
example, centrifugation, filtration, decanting or a combination of
these methods or be left completely in said broth. It is
advantageous to process the biomass after its separation.
However, the fermentation broth can also be thickened or
concentrated without separating the cells, using known methods such
as, for example, with the aid of a rotary evaporator, thin-film
evaporator, falling-film evaporator, by reverse osmosis or by
nanofiltration. Finally, this concentrated fermentation broth can
be processed to obtain the opiate alkaloids present therein.
According to a further aspect of the invention there is provided
the use of a gene encoded by a nucleic acid molecule as represented
by the nucleic acid sequence in FIG. 3a, 3b or 3c, or a nucleic
acid molecule that hybridizes under stringent hybridization
conditions to the nucleotide sequence in FIG. 3a, 3b or 3c and
encodes a polypeptide with cytochrome P450 activity as a means to
identify the presence or absence of a gene that encodes said
cytochrome P450 in a Papaveraceae plant.
According to a further aspect of the invention there is provided a
method to determine the presence or absence of a gene according to
the invention in a Papaveraceae variety comprising: i) obtaining a
sample from a Papaveraceae plant; ii) extracting genomic DNA from
the plant; and iii) analyzing the genomic DNA for the presence of a
gene comprising or consisting of a nucleotide sequence as
represented in FIG. 3a, 3b or 3c.
Methods to analyze genomic DNA are well known in the art. For
example, polymerase chain reaction methods using sequence specific
oligonucleotide primers to amplify specific regions of the gene
according to the invention. The extraction, isolation and
restriction analysis using sequence specific restriction
endonucleases followed by separation and Southern blotting to
analyze genomic structure have been established for over thirty
years. The analysis may be directed to intron or exon structure or
upstream or downstream regions of the gene; e.g. promoter
regions.
According to a further aspect of the invention there is provided
the use of a gene encoded by a nucleic acid molecule as represented
by the nucleic acid sequence in FIG. 3a, 3b or 3c, or a nucleic
acid molecule that hybridizes under stringent hybridization
conditions to the nucleotide sequence in FIG. 3a, 3b or 3c and
encodes a polypeptide with cytochrome P450 activity as a means to
identify a locus wherein said locus is associated with altered
expression or activity of said cytochrome P450.
Mutagenesis as a means to induce phenotypic changes in organisms is
well known in the art and includes but is not limited to the use of
mutagenic agents such as chemical mutagens [e.g. base analogues,
deaminating agents, DNA intercalating agents, alkylating agents,
transposons, bromine, sodium azide] and physical mutagens [e.g.
ionizing radiation, psoralen exposure combined with UV
irradiation].
According to a further aspect of the invention there is provided a
method to produce a Papaveraceae plant variety that has altered
expression of a cytochrome P450 polypeptide according to the
invention comprising the steps of: i) mutagenesis of wild-type seed
from a plant that does express said cytochrome P450 polypeptide;
ii) cultivation of the seed in i) to produce first and subsequent
generations of plants; iii) obtaining seed from the first
generation plant and subsequent generations of plants; iv)
determining if the seed from said first and subsequent generations
of plants has altered nucleotide sequence and/or altered expression
of said cytochrome P450 polypeptide; v) obtaining a sample and
analysing the nucleic acid sequence of a nucleic acid molecule
selected from the group consisting of: a) a nucleic acid molecule
comprising a nucleotide sequence as represented in FIG. 3a, 3b or
3c; b) a nucleic acid molecule that hybridises to the nucleic acid
molecule in a) under stringent hybridisation conditions and that
encodes a polypeptide with cytochrome P450 polypeptide activity;
and optionally vi) comparing the nucleotide sequence of the nucleic
acid molecule in said sample to a nucleotide sequence of a nucleic
acid molecule of the original wild-type plant.
In a preferred method of the invention said nucleic acid molecule
is analysed by a method comprising the steps of: i) extracting
nucleic acid from said mutated plants; ii) amplification of a part
of said nucleic acid molecule by a polymerase chain reaction; iii)
forming a preparation comprising the amplified nucleic acid and
nucleic acid extracted from wild-type seed to form heteroduplex
nucleic acid; iv) incubating said preparation with a single
stranded nuclease that cuts at a region of heteroduplex nucleic
acid to identify the mismatch in said heteroduplex; and v)
determining the site of the mismatch in said nucleic acid
heteroduplex.
In a preferred method of the invention said Papaveraceae plant
variety has enhanced cytochrome P450 polypeptide expression and/or
activity.
According to a further aspect of the invention there is provided a
plant obtained by the method according to the invention.
According to an aspect of the invention there is provided a plant
wherein said plant comprises a viral vector that includes all or
part of a gene comprising a nucleic acid molecule according to the
invention.
In a preferred embodiment of the invention said gene is encoded by
a nucleic acid molecule comprising a nucleic acid sequence selected
from the group consisting of: i) a nucleic acid molecule comprising
a nucleotide sequence as represented in FIG. 1a, 1b, 1c or 1d; ii)
a nucleic acid molecule comprising a nucleotide sequence that
hybridises under stringent hybridisation conditions to a nucleic
acid molecule in (i) and which encodes a cytochrome p450
polypeptide; iii) a nucleic acid molecule that encodes a variant
polypeptide that varies from a polypeptide comprising the amino
acid sequence as represented in FIG. 4a, 4b, 4c, or 4d.
In a preferred embodiment of the invention said nucleic acid
molecule comprises or consists of a nucleotide sequence as
represented in FIG. 1a.
In a preferred embodiment of the invention said nucleic acid
molecule comprises or consists of a nucleotide sequence as
represented in FIG. 1b.
In a preferred embodiment of the invention said nucleic acid
molecule comprises or consists of a nucleotide sequence as
represented in FIG. 1c
In a preferred embodiment of the invention said nucleic acid
molecule comprises or consists of a nucleotide sequence as
represented in FIG. 1d.
In a preferred embodiment of the invention said nucleic acid
molecule consists of a nucleotide sequence as represented in FIG.
12.
In an alternative preferred embodiment of the invention said
nucleic acid molecule consists of a nucleotide sequence as
represented in FIG. 13.
According to a further aspect of the invention there is provided a
viral vector comprising all or part of a nucleic acid molecule
according to the invention.
According to an aspect of the invention there is provided the use
of a viral vector according to the invention in viral induced gene
silencing in a plant.
In a preferred embodiment of the invention said plant is from the
family Papaveraceae.
Virus induced gene silencing [VIGS] is known in the art and
exploits a RNA mediated antiviral defence mechanism. Plants that
are infected with an unmodified virus induce a mechanism that
specifically targets the viral genome. However, viral vectors which
are engineered to include nucleic acid molecules derived from host
plant genes also induce specific inhibition of viral vector
expression and additionally target host mRNA. This allows gene
specific gene silencing without genetic modification of the plant
genome and is essentially a non-transgenic modification.
Throughout the description and claims of this specification, the
words "comprise" and "contain" and variations of the words, for
example "comprising" and "comprises", means "including but not
limited to", and is not intended to (and does not) exclude other
moieties, additives, components, integers or steps.
Throughout the description and claims of this specification, the
singular encompasses the plural unless the context otherwise
requires. In particular, where the indefinite article is used, the
specification is to be understood as contemplating plurality as
well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties
or groups described in conjunction with a particular aspect,
embodiment or example of the invention are to be understood to be
applicable to any other aspect, embodiment or example described
herein unless incompatible therewith.
An embodiment of the invention will now be described by example
only and with reference to the following figures:
FIG. 1a (SEQ ID NO: 1) is nucleotide sequence of a cDNA that
encodes PSCYP1, FIG. 1b (SEQ ID NO: 2) is nucleotide sequence of a
cDNA that encodes PSCYP2, FIG. 1c (SEQ ID NO: 3) is nucleotide
sequence of a cDNA that encodes PSCYP3; FIG. 1d (SEQ ID NO: 4) is
nucleotide sequence of another embodiment of a cDNA that encodes
PSCYP3;
FIG. 2a illustrates the frequency of ESTs of the PSCYP1 gene in EST
libraries derived from 454 sequencing of stem and capsule tissues
from cultivars GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK NOSCAPINE
CVS1 and GSK THEBAINE CVS1. The 16 EST libraries were generated by
pyrosequencing using cDNA libraries prepared from stems (S) and
capsules (C) at two developmental stages `early harvest` (EH, 1-3
days after petals had fallen off) and `late-harvest` (LH, 4-6 days
after petals had fallen off) from each of the four P. somniferum
cultivars; FIG. 2b illustrates the frequency of ESTs of the PSCYP2
gene; FIG. 2c illustrates the frequency of ESTs of the PSCYP3
gene;
FIG. 3a (SEQ ID NO: 5) is the nucleotide sequence of the gene
encoding PSCYP1; FIG. 3b (SEQ ID NO: 6) is the nucleotide sequence
of the gene encoding PSCYP2, FIG. 3c (SEQ ID NO: 7) is the
nucleotide sequence of the gene encoding PSCYP3;
FIG. 4a (SEQ ID NO: 8) is the deduced amino acid sequence of
PSCYP1; FIG. 4b (SEQ ID NO: 9) is the deduced amino acid sequence
of PSCYP2; FIG. 4c (SEQ ID NO: 10) is the deduced amino acid
sequence of PSCYP3; FIG. 4d (SEQ ID NO: 11) is the deduced amino
acid sequence of PSCYP3;
FIG. 5 illustrates that the PSCYP1 gene sequence is only present in
cultivar GSK NOSCAPINE CVS1 and is absent from cultivars GSK
MORPHINE CVS1, GSK MORPHINE CVS2 and GSK THEBAINE CVS1;
FIG. 6 illustrates that the PSCYP2 gene sequence is only present in
cultivar GSK NOSCAPINE CVS1 and is absent from cultivars GSK
MORPHINE CVS1, GSK MORPHINE CVS2 and GSK THEBAINE CVS1;
FIG. 7 illustrates that the PSCYP3 gene sequence is only present in
cultivar GSK NOSCAPINE CVS1 and is absent from cultivars GSK
MORPHINE CVS1, GSK MORPHINE CVS2 and GSK THEBAINE CVS1;
FIG. 8a is a tabular representation of the segregation of the
PSCYP1 gene in an F2 mapping population derived from a parental
cross of cultivars GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 along
with the co-segregation of PSCYP1 and noscapine accumulation in
individual F2 plants, FIG. 8b is the equivalent representation of
the segregation of the PSCYP2 gene, FIG. 8c is the equivalent
representation of the segregation of the PSCYP3 gene, the PSCYP3
genotyping assay failed on 16 samples (as indicated by the failure
to amplify the internal positive control), these samples were
excluded from the PSCYP3 co-segregation analysis;
FIG. 9 illustrates a typical UPLC chromatogram for standard
solution;
FIG. 10 illustrates a typical UPLC chromatogram for a noscapine
containing poppy variety;
FIG. 11 (SEQ ID NO: 12) is the 622 bases long part of the phytoene
desaturase gene sequence amplified from cDNA of GSK NOSCAPINE CVS1.
The sequence stretch of 129 bases used to silence the phytoene
desaturase gene is underlined;
FIG. 12 (SEQ ID NO: 13) is the part of the cDNA sequence used to
silence PSCYP2;
FIG. 13 (SEQ ID NO: 14) is the part of the cDNA sequence used to
silence PSCYP3;
FIG. 14 shows the normalised peak area of putative
tetrahydrocolumbamine in the UPLC chromatograms obtained from latex
and mature capsules of plants that displayed the photo-bleaching
phenotype after infection with the silencing constructs
pTRV2-PDS-PSCYP2, pTRV2-PDS-PSCYP3 or pTRV2-PDS, respectively. The
putative tetrahydrocolumbamine peak area obtained from uninfected
plants is shown as well;
FIG. 15 shows the normalised peak area of a putative secoberbine
alkaloid (in the UPLC chromatograms obtained from latex and mature
capsules of plants that displayed the photo-bleaching phenotype
after infection with the silencing constructs pTRV2-PDS-PSCYP2,
pTRV2-PDS-PSCYP3 or pTRV2-PDS, respectively. The putative
secoberbine peak area obtained from uninfected plants is shown as
well. The mass, molecular formula and fragmentation pattern of the
compound is consistent with demethoxyhydroxymacrantaldehyde or
demethoxymacrantoridine; and
FIG. 16 shows the normalised peak area of another putative
secoberbine alkaloid in the UPLC chromatograms obtained from latex
and mature capsules of plants that displayed the photo-bleaching
phenotype after infection with the silencing constructs
pTRV2-PDS-PSCYP2, pTRV2-PDS-PSCYP3 or pTRV2-PDS, respectively. The
putative secoberbine peak area obtained from uninfected plants is
shown as well. The mass, molecular formula and fragmentation
pattern of the compound is consistent with either
demethoxynarcotinediol or narctololinol.
MATERIALS AND METHODS
Generation of EST Libraries
a) RNA Isolation and cDNA Synthesis
Material was harvested from stems and capsules at two developmental
stages from four poppy cultivars. RNA was prepared individually
from five plants per cultivar, developmental stage and organ. The
harvested material was ground in liquid nitrogen using a mortar and
pestle. RNA was isolated from the ground stem or capsule
preparations using a CTAB (hexadecyltrimethylammonium bromide)
based method as described in Chang et al. (1993) Plant Molecular
Rep. 11: 113-116 with slight modifications (three extractions with
chloroform:isoamylalcohol, RNA precipitation with Lithium chloride
at -20.degree. C. over night). RNA was quantified
spectrophotometrically before pooling equal amounts of RNA from
five plants per cultivar, stage and organ. The pooled samples
underwent a final purification step using an RNeasy Plus MicroKit
(Qiagen, Crawley, UK) to remove any remaining genomic DNA from the
preparations. RNA was typically eluted in 30-100 .mu.l water. cDNA
was prepared using a SMART cDNA Library Construction Kit (Clontech,
Saint-Germainen-Laye, France) according to the manufacturer's
instructions but using SuperScript II Reverse Transcriptase
(Invitrogen, Paisley, UK) for first strand synthesis. The CDSIII
PCR primer was modified to: 5' ATT CTA GAT CCR ACA TGT TTT TTT TTT
TTT TTT TTT TVN 3' (SEQ ID NO: 56) where R=A or G, V=A, C or G;
N=NT or C/G. cDNA was digested with MmeI (New England Biolabs Inc.,
Hitchin, UK) followed by a final purification using a QIAquick PCR
Purification kit (Qiagen, Crawley, UK).
b) cDNA Pyrosequencing
The Roche 454 GS-FLX sequencing platform (Branford, Conn., USA) was
used to perform pyrosequencing on cDNA samples prepared from the
following materials for each of the four P. somniferum
cultivars--GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK NOSCAPINE CVS1
and GSK THEBAINE CVS1.
1. Stem, 1-3 days after petal fall (early harvest)
2. Stem, 4-6 days after petal fall (late harvest)
3. Capsule, 1-3 days after petal fall (early harvest)
4. Capsule, 4-6 days after petal fall (late harvest)
c) Raw Sequence Analysis, Contiguous Sequence Assembly and
Annotation
The raw sequence datasets were derived from parallel tagged
sequencing on the 454 sequencing platform (Meyer et al. (2008)
Nature Protocols 3: 267-278). Primer and tag sequences were first
removed from all individual sequence reads. Contiguous sequence
assembly was only performed on sequences longer than 40 nucleotides
and containing less than 3% unknown (N) residues. These high
quality EST sequences were assembled into unique contiguous
sequences with the CAP3 Sequence Assembly Program (Huang and Madan
(1999) Genome Research 9: 868-877), and the resulting contigs were
annotated locally using the BLAST2 program (Altschul et al.(1997)
Nucleic Acids Res. 25: 3389-3402) against the non-redundant peptide
database downloaded from the NCBI.
d) Expression Profiling of the Cytochrome P450 Genes
The number of ESTs associated with the respective cytochrome P450
gene consensus sequences were counted in each of the 16 EST
libraries. The values obtained were normalised on the basis of the
total number of ESTs obtained per library.
Amplification and Sequencing of the Cytochrome P450 Genes from GSK
NOSCAPINE CVS1 Genomic DNA.
a) Genomic DNA Preparation
DNA preparation: Leaf samples (30-50 mg) for DNA extraction were
harvested from plants of GSK MORPHINE CVS1, GSK MORPHINE CVS2 GSK
NOSCAPINE CVS1, GSK THEBAINE CVS1 grown in the glasshouse. DNA was
extracted using Qiagen BioSprint 96. Extracted DNA was quantified
using Hoescht 33258 and normalized to 10 ng/ul.
b) Amplification and sequencing of the cytochrome P450 genes from
DNA of GSK NOSCAPINE CVS1 Primers and primer combinations used for
amplification of the respective cytochrome P450 genes from the
extracted genomic DNA are shown in Table
TABLE-US-00001 TABLE 1 Sequences of forward and reverse primers
used to amplify the cytochrome P450 genes from genomic or cDNA
cytochrome Primer Oligonucleotide sequences P450 gene name (5'- to
3'-) (SEQ ID NO:) PSCYP1 PSCYP1_F1 CTTGAGTCATGCCTTGAT ATGC (15)
PSCYP1_F2 TTGATGAACGACAAGGAA CCG (16) PSCYP1_F3 GCTACGAAAGATAATGGT
GCAGC (17) PSCYP1_F4 TCGACAGCGCTTACGAAC G (18) PSCYP1_F8
GAACCATTAAACACTTGA GTCATGC (19) PSCYP1_LA_R1 GCATTTGGTGCTTTCTTC
CTCTTCTTTTTCTTATCA GTA (20) PSCYP1_R1 AGCAAACCATTCGTCCAT CC (21)
PSCYP1_R3 TGCAATTGAATTTAGCTC ATCT (22) PSCYP1_R5 ATTCATGATTGTGACCTT
TGTAATCC (23) PSCYP1_R7 TACGACAGGTTGCTAGCT TGG (24) PSCYP2
PSCYP2_F1 CAAAGAGTCAATCTGACT CAAGCTAGC (25) PSCYP2_F2
TGAAATGCCTGAGATCAC TAAAATCG (26) PSCYP2_F3 TCAAACCCTGCTACTAAC
ACTTACTTGC (27) PSCYP2_F4 TGTAAAGACACTTCATTG ATGGGC (28) PSCYP2_R1
GAGATGATCAAGTGGTTT AACCATTCC (29) PSCYP2_R2 CGAGTGCCCATGCAGTGG (30)
PSCYP2_R3 CACTCCATCAGACACACA AGACC (31) PSCYP2_R4
GTAAACATTAATGATATT TGGAAGTTTAGATC (32) PSCYP2_R5 TTCGATTTGTGTAAACAT
TAATGATATTTGG (33) PSCYP3 PSCYP3_F1 GTTATCTTTGTCAAATGA ATCCGTTGG
(34) PSCYP3_F2 AATAATGGATCAGTCACG GCTTCC (35) PSCYP3_F3
ATGTGGAAAACGGTAAGC AAGTGG (36) PSCYP3_F4 AATCCATCAGATTTTCAA
CCAGAGAGG (37) PSCYP3_R1 ACGATTCTGTCATCATCA TTTTCGC (38) PSCYP3_R2
AGTCGTGTATCGTTCGCT TAATGC (39) PSCYP3_LA_F2 GGCTTCCCGGAGATGACC
CAGATTTTAT (40) PSCYP3_LA_F3 TTGTTATTTTCATGACTA TTACCACCAGCTTCCTCT
TA (41) PSCYP3_LA_F4 AGTGGAGGAGGCACAAAA GTTAGGATGGAC (42)
PSCYP3_LA_F5 CCATGTCTGATAAATACG GGTCGGTGTTC (43) PSCYP3_LA_F6
TTGTTGATAAGGACGACT AAGAATAAGCAGAAGATA (44) PSCYP3_LA_R1
CATGCCTATCTATTTCCT CCCTTGCCCTC (45) PSCYP3_LA_R2 TGTCAGCCAACCATTCGT
CCATCCTAAC (46) PSCYP3_LA_R3 TGTTCGATCACGTTGTCT CTTTTTGCCATAA (47)
PSCYP3_LA_R4 TAACAATAAAAGTACTGA TAATGGTGGTCGAAGGAG AA (48)
PSCYP3_LA_R5 ATAATGGTGGTCGAAGGA GAATCAGTAATC(49)
Primers were designed based on the respective cytochrome P450
contigs assembled from ESTs unique to cultivar GSK NOSCAPINE CVS1.
The PSCYP1 and PSCY P2 contigs contained the complete open reading
frame of as well as 5' and 3' untranslated regions. PSCYP3 was
represented by two contigs covering the 5'- and 3'-ends of the open
reading frame with 200 bases from the centre of the open reading
frame missing. This missing stretch of coding sequence was
amplified and confirmed by amplification and sequencing from cDNA
(prepared as described above) in addition to genomic DNA to
determine the precise position and of intron 1 (FIG. 3c).
Amplification were performed on pools of DNA comprising the DNA of
at least four individuals and the primer combinations shown in
Table 2.
TABLE-US-00002 TABLE 2 Primer combinations used to amplify and
Sanger-sequence the cytochrome P450 genes from genomic DNA
Annealing Extension Sequencing primers used cytochrome Primer
temperature time for Sanger sequencing of P450 gene combination
[.degree. C.] [s] purified PCR product PSCYP1 PSCYP1_F8/R3 68.5 60
PSCYP1_F3, PSCYP1_F8, PSCYP1_R3 PSCYP1_F2/R5 69.3 60 PSCYP1_F2,
PSCYP1_F4, PSCYP1_F5, PSCYP1_R2, PSCYP1_R4, PSCYP1_R5 PSCYP1_F4/R7
69.8 60 PSCYP1_F4, PSCYP1_F6, PSCYP1_R4, PSCYP1_R7 PSCYP2
PSCYP2_F1/R5 61.7 60 PSCYP2_F1, PSCYP2_F2, PSCYP2_F3, PSCYP2_F4,
PSCYP2_R1, PSCYP2_R2, PSCYP2_R5 PSCYP3 PSCYP3_F2/R1 66 60
PSCYP3_F2, PSCYP3_F4, PSCYP3_R1, PSCYP3_R2 PSCYP1_LA_R1/ See Long
See Long PSCYP3_LA_F2, PSCYP_LA_R1 Amp PCR Amp PCR PSCYP3_ LA_F3,
PSCYP3_ LA_F4, PSCYP3_ LA_F5, PSCYP3_ LA_F6, PSCYP3_LA_R1, PSCYP3_
LA_R2, PSCYP3_ LA_R3, PSCYP3_ LA_R4, PSCYP3_ LA_R5
The PCR conditions were as follows:
Reaction Mixture:
TABLE-US-00003 5 .times. HF buffer (Finnzymes) 5 .mu.l dNTPs (20 mM
each) 0.25 .mu.l Fwd primer (10 .mu.M) 2.5 .mu.l Rev primer (10
.mu.M) 2.5 .mu.l DNA (10 ng/.mu.l) 5 .mu.l Phusion Hot Start
(Finnzymes) 0.25 .mu.l dH.sub.2O 9.5 .mu.l Reaction volume: 25
.mu.l
Phusion Hot Start from Finnzymes was purchased through New England
Biolabs, (Bishops Stortford, UK).
PCR Program:
TABLE-US-00004 initial denaturation 98.degree. C. 1 min 30 cycles
of: denaturation 98.degree. C. 30 sec annealing temperature Table
2&3 30 sec extension 72.degree. C. 40 sec final extension
72.degree. C. 10 min incubation 4.degree. C. storage
The 5'-end and part of the promoter region of PSCYP3 was amplified
from genomic DNA via a long range PCR set up using primers
PSCYP1_LA_R1 and PSCYP3_LA_R1:
Long Range PCR Reaction Mixture:
TABLE-US-00005 5 .times. LongAmp buffer (New England Biolabs) 10
.mu.l dNTPs (10 mM each) 1.5 .mu.l Fwd primer (10 .mu.M) 2 .mu.l
Rev primer (10 .mu.M) 2 .mu.l gDNA (100 ng/.mu.l) 2 .mu.l LongAmp
Taq (New England Biolabs) 2 .mu.l dH.sub.2O 30.5 .mu.l Reaction
volume: 50 .mu.l
Long Range PCR Program:
TABLE-US-00006 initial denaturation 94.degree. C. 30 sec 30 cycles
of: denaturation 94.degree. C. 30 sec annealing & extension
65.degree. C. 13.5 min final extension 65.degree. C. 10 min
incubation 4.degree. C. storage
The products resulting from the various PCRs were purified using
the Agencourt AMPure purification kit (Beckman Coulter LTD,
Bromley, UK). 30-50 ng of the respective purified PCR products were
subjected to Sanger-sequencing using the primers shown in Table 2
as sequencing primers. Since primer combination PSCYP1_F4/R7
resulted in amplification of a smaller, unspecific product in
addition to the expected amplicon (see also FIG. 4d), the latter
was excised and purified from the gel using QIAEX II Gel Extraction
Kit (Qiagen, Hilden, Germany) prior to sequencing.
The amino acid sequences of the respective cytochrome P450s,
predicted from the Sanger-sequence confirmed open reading frame
sequences, were compared to protein sequences deposited in the
non-redundant protein database using the Standard Protein BLAST
program (blastp).
c) Analysis of genomic DNA from GSK MORPHINE CVS1, GSK MORPHINE
CVS2, GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 for the presence of
cytochrome P450 genes
To investigate if the cytochrome P450 genes were present in all
four cultivars, amplification from genomic DNA (pools of four
individuals per cultivar) of GSK MORPHINE CVS1, GSK MORPHINE CVS2,
GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 was performed in a series
of overlapping fragments using primer combinations shown in Table
3. Exactly the same PCR conditions as described above to obtain the
full length genomic sequences from GSK NOSCAPINE CVS1 were used.
=0.5 .mu.l of each PCR reaction was resolved on 1% agarose
alongside an appropriate size standards.
TABLE-US-00007 TABLE 3 Primer combinations used to amplify the
cytochrome P450 genes from genomic DNA Annealing Extension Expected
cytochrome Primer temperature time fragment size P450 gene
combination [.degree. C.] [s] [bp] IG. PSCYP1 PSCYP1_F1/R3 66 40
1051 FIG. 5a PSCYP1_F8/R3 68.5 60 1064 FIG. 5b PSCYP1_F2/R5 69.3 60
1400 FIG. 5c PSCYP1_F4/R7 69.8 60 ~1200 FIG. 5d PSCYP2 PSCYP2_F1/R1
61 60 596 FIG. 6a PSCYP2_F2/R2 61 60 596 FIG. 6b PSCYP2_F3/R3 61 60
603 FIG. 6c PSCYP2_F4/R4 61 60 475 FIG. 6d PSCYP3 PSCYP3_F1/R1 66
60 994 FIG. 7a PSCYP3_F2/R2 66 60 418 FIG. 7b PSCYP3_F3/R2 66 60
122 FIG. 7c PSCYP3_F3/R1 66 60 638 FIG. 7d
Generation of a Mapping Population, Extraction and Analysis of
Genomic DNA from Leaf Material Plus Extraction and Analysis of
Alkaloids from Poppy Straw a) DNA Extraction from F2 Plants
40-50 mg of leaf tissue was harvested, in duplicate, from all poppy
plants within the GSK NOSCAPINE CVS1.times.GSK THEBAINE CVS1 F2
mapping population and parental plants) at the `small rosette`
growth stage (.about.10 leaves present on each plant).
Leaf tissue (40-50 mg wet weight) was collected into 1.2 ml sample
tubes in 8.times.12 format (Part Number 1760-00, Scientific
Specialties Inc, 130 Thurman St, Lodi, Calif. 95240 USA), closed
with strip caps (Part Number 1702-00, Scientific Specialties Inc)
and shipped to the AGRF (Australian Genome Research Facility)
Adelaide on Techni-Ice dry Ice packs by overnight courier.
On receipt, strip caps were removed and a 3 mm tungsten carbide
bead was added to each tube (Part Number 69997, Qiagen GmbH,
Hilden, Germany). Samples were placed at -80.degree. C. (Freezer
model; Sanyo MDF-U73V) for a minimum of two hours prior to
freeze-drying for 18 hr (Christ Model Alpha 2-4 LSC).
Following freeze drying, tubes were sealed with fresh strip caps
(as above), and samples were powdered by bead-milling (Model
"Tissue Lyser", Part Number 85300; Qiagen) at 3,000 RPM for
2.times.60 sec cycles separated by plate inversion. DNA extraction
was performed using the "Nucleospin Plant II" system
(Macherey-Nagel, GmbH & Co. KG Neumann-Neander-Stra.beta.e 6-8,
52355 Duren, Germany).
Cell lysis was performed using the supplied Buffer Set PL2/3. The
manufacturer's protocol for centrifugal extraction was followed
(Centrifuge model 4-K 15; Sigma Laborzentrifugen GmbH, 37520
Osterode am Harz, Germany).
The recovered DNA (12/96 samples, one sample per plate column) was
checked for quality and quantity by ultra violet spectroscopy
(Model Nanodrop-8000; NanoDrop products, 3411 Silverside Rd,
Bancroft Building; Wilmington, Del. 19810, USA) at 230, 260 and 280
nM.
b) Genotyping of F2 DNA Samples for the Presence of Absence of the
Cytochrome P450 Genes
DNA samples from a total of 275 F2 plants were genotyped for the
presence or absence of PSCYP1, PSCYP2 and PSCYP3, respectively, by
amplifying a short fragment of each of the genes. In order to
fluorescently label the resulting PCR fragments, the forward
primers carried a VIC-label (Applied Biosystems, UK) at their
5'-prime ends. Fragment analyses were carried out on the
96-capillary electrophoresis 3730xl DNA Analyzer (Applied
Biosystems, UK) according to the manufacturer's instructions. In
addition to the respective cytochrome P450 fragments, an internal
positive control was amplified in each PCR assay in order to
distinguish lack of amplification due to absence of the cytochrome
P450 genes in the DNA samples from lack of amplification caused by
PCR assay failures. Samples were the PCR assay had failed were
excluded from the co-segragation analyses of the genes with the
noscapine trait.
The following primers were used (primer sequences are shown in
Table 1; forward primers were 5'-end-labeled with VIC):
PSCYP1: VIC-PSCYP1_F3/PSCYP1_R2; amplified fragment size: 166
bp
PSCYP2: VIC-PSCYP2_F2/PSCYP2_R1; amplified fragment size: 226
bp
PSCYP3: VIC-PSCYP3_F3/PSCYP3_R1; amplified fragment size: 638
bp
The PSCYP1-fragment was amplified with the following PCR
conditions:
Reaction Mixture:
TABLE-US-00008 5 .times. GoTaq Buffer (Promega) 2 .mu.l dNTPs (2.5
mM mix) 0.5 .mu.l MgCl.sub.2 (25 mM) 0.6 .mu.l Forward primer (10
.mu.M) 0.5 .mu.l Reverse primer (10 .mu.M) 0.5 .mu.l gDNA (5
ng/.mu.l) 2 .mu.l GoTaq (Promega) 0.2 .mu.l dH.sub.2O 3.7 .mu.l
Reaction volume: 10 .mu.l
PCR Program:
TABLE-US-00009 initial denaturation 94.degree. C. 1 min 30 cycles
of: denaturation 94.degree. C. 30 sec annealing temperature
62.degree. C. 30 sec extension 72.degree. C. 20-30 sec final
extension 72.degree. C. 5 min incubation 4.degree. C. storage
The PSCYP2- and PSCYP3-fragments were amplified with the following
PCR conditions:
Reaction Mixture:
TABLE-US-00010 5 .times. Type-it multiplex PCR mix (Qiagen) 5 .mu.l
Forward primer (10 .mu.M) 0.5 .mu.l Reverse primer (10 .mu.M) 0.5
.mu.l gDNA (5 ng/.mu.l) 2 .mu.l dH.sub.2O 2 .mu.l Reaction volume:
10 .mu.l
PCR Program:
TABLE-US-00011 initial denaturation 95.degree. C. 15 min 30 cycles
of: denaturation 95.degree. C. 15 sec annealing temperature
60.degree. C. 30 sec extension 72.degree. C. 30 sec final extension
72.degree. C. 5 min incubation 4.degree. C. storage
c) Poppy Straw Analysis
Poppy capsules were harvested by hand from the mapping population
once capsules had dried to approximately 10% moisture on the plant.
The seed was manually separated from the capsule, and capsule straw
material (Poppy Straw) was then shipped to the GSK extraction
facility in Port Fairy, Australia.
The poppy straw samples were then ground in a Retsch Model MM04
ball mill into a fine powder. Two gram samples of ground poppy
straw were then weighed accurately (2.+-.0.003 g) and extracted in
50 mL of a 10% acetic acid solution. The extraction suspension was
shaken on an orbital shaker at 200 rpm for a minimum of 10 minutes
then filtered to provide a clear filtrate. The final filtrate was
passed through a 0.22 .mu.m filter prior to analysis.
The solutions were analysed using a Waters Acquity UPLC system
fitted with a Waters Acquity BEH C18 column, 2.1 mm.times.100 mm
with 1.7 micron packing. The mobile phase used a gradient profile
with eluent A consisting of 0.1% Trifluoroacetic acid in deionised
water and eluent B consisting of 100% Acetonitrile. The mobile
phase gradient conditions used are as listed in Table 2, the
gradient curve number as determined using a Waters Empower
chromatography software package. The flow rate was 0.6 mL per
minute and the column maintained at 45 C. The injection volume was
1 .mu.L injection volume and the alkaloids were detected using a UV
detector at 285 nm.
The loss on drying (LOD) of the straw was determined by drying in
an oven at 105 degrees centrigrade for 3 hours.
Gradient Flow Program
TABLE-US-00012 TIME Flow (minutes) % Eluent A % Eluent B (mL/min)
Curve No 0.00 95.0 5.0 0.60 INITIAL 0.80 90.0 10.0 0.60 6 3.40 75.0
25.0 0.60 3 3.60 95.0 5.0 0.60 6 4.00 95.0 5.0 0.60 11
Alkaloid concentrations for morphine, codeine, thebaine, oripavine
and noscapine were determined by comparison with standard solutions
and the results calculated on a dry weight basis.
Typical retention times are as follows:
TABLE-US-00013 Compound Retention Time (minutes) Morphine 1.14
Pseudo morphine 1.26 Codeine 1.69 Oripavine 1.80 10-Hydroxythebaine
2.32 Thebaine 2.53 Noscapine 3.16
Virus Induced Gene Silencing (VIGS) of PSCYP3 and PSCYP3 a)
Generation of Silencing Constructs
A tobacco rattle virus (TRV) based virus induced gene silencing
system developed and described by Liu et al. (2002) Plant J. 30(4):
415-429 was used to investigate the gene function of PSCYP2 and
PSCYP3. DNA fragments selected for silencing of PSCYP2 and PSCYP3,
respectively, were amplified by PCR and cloned into the silencing
vector pTRV2 (GenBank accession no. AF406991; Liu et al. (2002)
Plant J. 30(4): 415-429). They were linked to a 129 bp-long
fragment of the P. somniferum phytoene desaturase gene (PsPDS) in
order to silence the respective cytochrome P450 genes and PsPDS
simultaneously. Plants displaying the photo-bleaching phenotype
that resulted from silencing of PsPDS (Hileman et al. (2005) Plant
J. 44(2): 334-341) were identified as plants successfully infected
with the respective silencing constructs and selected for
analysis.
Generation of the pTRV2-PDS construct: A 622 bp fragment (FIG. 11)
of PsPDS was amplified from cDNA prepared from GSK NOSCAPINE CVS1
as described above using primers ps_pds_F and ps_pds_R4 (Table
4).
TABLE-US-00014 TABLE 4 Primers used to amplify sequences selected
for virus induced gene silencing Oligonucleotide sequences (5'- to
3'-) (SEQ ID NO:) (in capitals: gene- Target specific sequence; in
gene lower case: added to be Primer sequence; underlined: silenced
name restriction sites) PS PHYTOENE ps_pds_F GAGGTGTTCATTGCCATGTCAA
DESATURASE (50) ps_pds_R4 GTTTCGCAAGCTCCTGCATAGT (51) PSCYP2
VIGS_PSCYP2_F aaactcgagaagcttATGATCA TGAGTAACTTATGGA (52)
VIGS_PSCYP2_R aaaggtaccCCAACAGGCCATT CCGTTG (53) PSCYP3
VIGS_PSCYP3_F aaactcgagaagcttTAGGAGG GTATGTCCGGC (54) VIGS_PSCYP3_R
aaaggtaccTTAACTCCGCCTC GGCTCC(55)
The sequence of the forward primer was based on a 412 bp long
contig derived from the EST-libraries which shared 99% identity at
its 3' end with the partial coding sequence of the P. somniferum
phytoene desaturase (GenBank accession no. DQ116056). The sequence
of the reverse primer was designed based on the DQ116056 sequence.
The PCR conditions were identical to those described above for the
amplification of the cytochrome P450 genes from genomic sequence
except that the annealing step was carried out at 70.degree. C. and
the extension time was increased to 60 seconds.
Sau3AI digestion of the PCR-fragment yielded among others two
fragments (280 bp and 129 bp in length) that carried
BamHI-compatible sticky ends at both, their 5' and 3' ends. The 129
bp long fragment (underlined stretch in FIG. 11) was cloned into
the BamHI site of the pTRV2 vector. Because Sau3AI was used to
produce BamHI-compatible sticky ends, the BamHI site at the 5-end
of the PDS-insert was abolished in the pYL156-PDS construct.
However, the BamHI recognition site at its 3'-end was kept intact
due to the nature of the PDS-insert sequence.
A sequence-confirmed pTRV2-PDS construct, with the 129 bp fragment
in sense orientation, was subsequently used as a vector for
generating the PSCYP2 and PSCYP3 silencing constructs, and served
as a control in the VIGS experiments.
Generation of silencing constructs for PSCYP2 and PSCYP3
(pTRV2-PDS-PSCYP2 and pTRV2-PDS-PSCYP3): The DNA fragments selected
for silencing PSCYP2 and PSCYP3 were amplified from cDNA of GSK
NOSCAPINE CVS1 prepared as described above with the use of the
primer sequences shown in Table 4. Additional restriction sites
(forward primers: XhoI and HindIII for forward primers; KpnI site
for reverse primers) were added to the gene-specific primers in
order to facilitate cloning. The amplification conditions were as
described above for amplifying the PDS-fragment except that the
annealing temperatures were 60.9.degree. C. for PSCYP2 and
66.degree. C. for PSCYP3 and the extension time was 30 seconds.
The sequence selected to silence PSCYP2 (FIG. 12) and PSCYP3 (FIG.
12), respectively, were cloned into pTV00 (Ratcliff et al. (2001)
Plant J. 25(2): 237-245) using HindIII and KpnI and subcloned into
pTRV2-PDS using BamHI and KpnI. Sequence-confirmed pTRV2-PDS-PSCYP2
and pTRV2-PDS-PSCYP3 constructs were used in the VIGS
experiments.
b) Transformation of Constructs into Agrobacterium Tumefaciens
The propagation of the silencing constructs was carried out with
the E. coli strain DH5a and, subsequently, the respective silencing
constructs, as well as pTRV1 (GenBank accession no. AF406990; Liu
et al. (2002) Plant J. 30(4): 415-429) were independently
transformed into electrocompetent Agrobacterium tumefaciens (strain
GV3101).
c) Infiltration of Plants
Overnight liquid cultures of A. tumefaciens containing each
silencing construct were used to inoculate Luria-Bertani (LB)
medium containing 10 mM MES, 20 .mu.M acetosyringone and 50
.mu.g/ml kanamycin. Cultures were maintained at 28.degree. C. for
24 hours, harvested by centrifugation at 3000 g for 20 min, and
resuspended in infiltration solution (10 mM MES, 200 .mu.M
acetosyringone, 10 mM MgCl2) to an OD600 of 2.5. A. tumefaciens
harbouring the respective constructs (pTRV2-PDS-PSCYP2,
pTRV2-PDS-PSCYP3 or, as a control, pTRV2-PDS) were each mixed 1:1
(v/v) with A. tumefaciens containing pTRV1, and incubated for two
hours at 22.degree. C. prior to infiltration. Two weeks old
seedlings of GSK NOSCAPINE CVS1 grown under standard greenhouse
conditions (22.degree. C., 16 h photoperiod), with emerging first
leaves, were infiltrated as described by Hagel and Facchini (2010)
Nat. Chem. Biol. 6: 273-275.
d) Latex and Capsule Analysis of Silenced Plants
Leaf latex of infiltrated opium poppy plants displaying
photo-bleaching as a visual marker for successful infection and
silencing was analysed when the first flower buds emerged (.about.7
week old plants). Plants showing a similar degree of
photo-bleaching of leaves were selected for analysis.
Latex was collected from cut petioles, with a single drop dispersed
into 500 .mu.L 10% acetic acid. This was diluted 10.times. in 1%
acetic acid to give an alkaloid solution in 2% acetic acid for
further analysis. Capsules were harvested by hand from
glasshouse-grown from the same plants used for latex analysis and
single capsules were ground in a Retsch Model MM04 ball mill into a
fine powder. Ten mg samples of ground poppy straw were then weighed
accurately (10.+-.0.1 mg) and extracted in 0.5 mL of a 10% acetic
acid solution with gentle shaking for 1 h at room temperature.
Samples were then clarified by centrifugation and a 50 .mu.L
subsample diluted 10.times. in 1% acetic acid to give an alkaloid
solution in 2% acetic acid for further analysis.
All solutions were analysed using a Waters Acquity UPLC system
fitted with a Waters Acquity BEH C18 column, 2.1 mm.times.100 mm
with 1.7 micron packing. The mobile phase used a gradient profile
with eluent A consisting of 10 mM ammonium bicarbonate pH 10.2 and
eluent B methanol. The mobile phase gradient conditions used are as
listed in Table 1, with a linear gradient. The flow rate was 0.5 mL
per minute and the column maintained at 60.degree. C. The injection
volume was 2 .mu.L and eluted peaks were ionised in positive APCI
mode and detected within .about.3 ppm mass accuracy using a Thermo
LTQ-Orbitrap. The runs were controlled by Thermo Xcalibur
software.
--Gradient Flow Program:
TABLE-US-00015 TIME Flow (minutes) % Eluent A % Eluent B (mL/min)
0.0 98.0 2.0 0.50 0.2 98.0 2.0 0.50 0.5 60.0 40 0.50 4.0 20.0 80.0
0.50 4.5 20.0 0.0 0.50
All data analysis was carried out in R. Putative alkaloid peaks
were quantified by their pseudomolecular ion areas using custom
scripts. Peak lists were compiled and any peak-wise significant
differences between samples were identified using 1-way ANOVA with
p-values adjusted using the Bonferroni correction for the number of
unique peaks in the data set. For any peak-wise comparisons with
adjusted p-values<0.05, Tukey's HSD test was used to identify
peaks that were significantly different between any given sample
and the control. Alkaloids were identified by comparing exact mass
and retention time values to those of standards. Where standards
were not available, neutral exact masses were used to generate
molecular formulae hits within elemental constraints of C=1:100,
H=1:200, O=0:200, N=0:3 and mass accuracy<20 ppm. The hit with
the lowest ppm error within these constraints was used to assign a
putative formula.
Example 1
Assembly of Full Length PSCYP1 cDNA Sequence from ESTs and
Confirmation by Sequencing from Genomic DNA.
The full length open reading frame of PSCYP1 (FIG. 1a) was
assembled from ESTs derived from the 454 sequencing platform using
the CAP3 sequence assembly programme. The full length cDNA sequence
was confirmed by direct amplification of the full length cDNA from
GSK NOSCAPINE CVS1 genomic DNA.
Example 2
PSCYP1 is Exclusively Expressed in the Noscapine Producing Papaver
somniferum Cultivar GSK Noscapine CVS1.
FIG. 2a shows the normalized distribution of ESTs associated with
the PSCYP1 consensus sequence across each of the 16 EST libraries
prepared from two organs (capsules and stems) at two developmental
stages (early and late harvest) from each of the four poppy
cultivars, GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK NOSCAPINE CVS1
and GSK THEBAINE CVS1. ESTs corresponding to PSCYP1 were
exclusively found in libraries derived from the noscapine producing
cultivar GSK NOSCAPINE CVS1 (FIG. 2a). PSCYP1 expression was
strongest in stem tissue shortly after flowering.
Example 3
PCR-Amplification of PSCYP1 from Genomic DNA of the Four Papaver
somniferum Cultivars GSK Morphine CVS1, GSK Morphine CVS2, GSK
Noscapine CVS1 and GSK Thebaine CVS1.
PCR-amplifications of PSCYP1 fragments were performed on genomic
DNA from the four poppy cultivars GSK MORPHINE CVS1, GSK MORPHINE
CVS2, GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 using the primer
combinations shown in Table 2 and 3.
FIG. 5 shows the PCR-amplification of PSCYP1 from genomic DNA of
the four Papaver somniferum cultivars GSK MORPHINE CVS1, GSK
MORPHINE CVS2, GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1;
The amplification from genomic DNA yielded the gene sequence shown
in FIG. 3a.
Example 4
The Putative Protein Encoded by PSCYP1 Shows Highest Sequence
Similarity to a Cytochrome P450 from Coptis japonica and Thalictrum
flavum.
The closest homologues to the putative protein encoded by the
PSCYP1 open reading frame (FIG. 4a) are a cytochrome P450 from
Coptis japonica (GenBank accession no. BAF98472.1, 46% identical at
amino acid level). The closest homologue with an assignment to a
cytochrome P450 subfamily is CYP82C4 from Arabidopsis lyrata
(GenBank accession no. XP_002869304.1, 44% identical at amino acid
level).
Example 5
PSCYP1 is Only Present in the Genome of the Noscapine Producing P.
Somniferum Cultivar GSK NOSCAPINE CVS1.
The transcribed region covered by the ESTs contained the complete
coding sequence of PSCYP1 (including 5' and 3' untranslated
regions), which was used for primer design (Table 1) to amplify the
PSCYP1 gene from genomic DNA in a series of overlapping fragments
for sequencing. Upon testing a subset of the primer combinations
(Table 3) on genomic DNA samples from all four cultivars it was
discovered that the PSCYP1 fragments could only be amplified from
genomic DNA of the noscapine producing cultivar GSK NOSCAPINE CVS1
but not from genomic DNA of the predominantly morphine (GSK
MORPHINE CVS1, GSK MORPHINE) or thebaine (GSK THEBAINE CVS1)
producing cultivars (FIG. 5). The PCR amplifications were performed
on pools of genomic DNA comprising DNA from four individuals per
cultivar. This discovery explains why the PSCYP1 is only expressed
in the GSK NOSCAPINE CVS1 cultivar and is absent from the
transcriptome of the other three cultivars.
Example 6
Assembly of Full Length PSCYP2 cDNA Sequence from ESTs and
Confirmation by Sequencing from Genomic DNA.
The full length open reading frame of PSCYP2 (FIG. 1b) was
assembled from ESTs derived from the 454 sequencing platform using
the CAP3 sequence assembly programme. The full length cDNA sequence
was confirmed by direct amplification of the full length cDNA from
GSK NOSCAPINE CVS1 genomic DNA.
Example 7
PSCYP2 is Exclusively Expressed in the Noscapine Producing Papaver
somniferum Cultivar GSK NOSCAPINE CVS1.
FIG. 2b shows the normalized distribution of ESTs associated with
the PSCYP2 consensus sequence across each of the 16 EST libraries
prepared from two organs (capsules and stems) at two developmental
stages (early and late harvest) from each of the four poppy
cultivars, GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK NOSCAPINE CVS1
and GSK THEBAINE CVS1. ESTs corresponding to PSCYP2 were
exclusively found in libraries derived from the noscapine producing
cultivar GSK NOSCAPINE CVS1 (FIG. 2b). PSCYP2 expression was
strongest in stem tissue shortly after flowering.
Example 8
PCR-Amplification of PSCYP2 from Genomic DNA of the Four Papaver
somniferum Cultivars GSK Morphine CVS1, GSK Morphine CVS2, GSK
Noscapine CVS1 and GSK Thebaine CVS1.
PCR-amplifications of PSCYP2 fragments were performed on genomic
DNA from the four poppy cultivars GSK MORPHINE CVS1, GSK MORPHINE
CVS2, GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 using the primer
combinations shown in Table 2 and 3. FIG. 6 shows the
PCR-amplification of PsCYP2 from genomic DNA of the four Papaver
somniferum cultivars GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK
NOSCAPINE CVS1 and GSK THEBAINE CVS1;
The amplification from genomic DNA yielded the gene sequence shown
in FIG. 3b.
Example 9
The Putative Protein Encoded by PSCYP2 Shows Highest Sequence
Similarity to a Cytochrome P450 from Coptis japonica and Thalictrum
flavum.
The closest homologues to the putative protein encoded by the
PSCYP2 open reading frame (FIG. 4b) are cytochrome P450s annotated
as stylopine synthase from Argemone mexicana (GenBank accession no.
ABR14721, identities: 366/475 (78%)) and from Papaver somniferum
(GenBank accession no. ADB89214, identities=373/491 (76%)). The
sequence comparisons were carried out using NCBI's `blastp`
algorithm (method: compositional matrix adjust).
Example 10
PSCYP2 is Only Present in the Genome of the Noscapine Producing P.
Somniferum Cultivar GSK Noscapine CVS1.
The transcribed region covered by the ESTs contained the complete
coding sequence of PSCYP2 (including 5' and 3' untranslated
regions), which was used for primer design (Table 1) to amplify the
PSCYP2 gene from genomic DNA in a series of overlapping fragments
for sequencing. Upon testing a subset of the primer combinations
(Table 3) on genomic DNA samples from all four cultivars it was
discovered that the PSCYP2 fragments could only be amplified from
genomic DNA of the noscapine producing cultivar GSK NOSCAPINE CVS1
but not from genomic DNA of the predominantly morphine (GSK
MORPHINE CVS1, GSK MORPHINE) or thebaine (GSK THEBAINE CVS1)
producing cultivars (FIG. 6). The PCR amplifications were performed
on pools of genomic DNA comprising DNA from four individuals per
cultivar. This discovery explains why the PSCYP2 is only expressed
in the GSK NOSCAPINE CVS1 cultivar and is absent from the
transcriptome of the other three cultivars.
Example 11
Assembly of the Full Length PSCYP3 cDNA Sequence from ESTs and by
Sequencing from cDNA and Genomic DNA.
Two possible full length open reading frames of PSCYP3 (FIGS. 1c
and 1d) were partially assembled from ESTs derived from the 454
sequencing platform using the CAP3 sequence assembly programme. The
ESTs covered the 5' and 3' area of the sequence with a stretch of
200 bases missing. The missing stretch of bases was obtained by
direct amplification and sequencing from cDNA of the GSK NOSCAPINE
CVS1. The full length sequences were further confirmed by direct
amplification and sequencing of PSCYP3 from genomic DNA of the GSK
NOSCAPINE CVS1. Two possible ATG start codons were identified.
Since they were in frame and adjacent to each other the resulting
full length open reading frame sequences shown in FIGS. 1c and 1d,
respectively, differ only by one ATG codon at the 5'-terminus.
Example 12
PSCYP3 is Exclusively Expressed in the Noscapine Producing Papaver
Somniferum Cultivar GSK NOSCAPINE CVS1.
FIG. 2c shows the normalized distribution of ESTs associated with
the PSCYP3 consensus sequence across each of the 16 EST libraries
prepared from two organs (capsules and stems) at two developmental
stages (early and late harvest) from each of the four poppy
cultivars, GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK NOSCAPINE CVS1
and GSK THEBAINE CVS1. ESTs corresponding to PSCYP3 were
exclusively found in libraries derived from the noscapine producing
cultivar GSK NOSCAPINE CVS1 (FIG. 2c). PSCYP3 expression was
strongest in stem tissue shortly after flowering.
Example 13
PCR-Amplification of PSCYP3 from Genomic DNA of the Four Papaver
Somniferum Cultivars GSK Morphine CVS1, GSK Morphine CVS2, GSK
Noscapine CVS1 and GSK Thebaine CVS1.
PCR-amplifications of PSCYP3 fragments were performed on genomic
DNA from the four poppy cultivars GSK MORPHINE CVS1, GSK MORPHINE
CVS2, GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 using the primer
combinations shown in Table 2 and 3. FIG. 7 shows the
PCR-amplification of PSCYP3 from genomic DNA of the four Papaver
somniferum cultivars GSK MORPHINE CVS1, GSK MORPHINE CVS2, GSK
NOSCAPINE CVS1 and GSK THEBAINE CVS1;
The amplification from genomic DNA yielded the gene sequence shown
in FIG. 3c.
Example 14
The Putative Protein Encoded by PSCYP3 Shows Highest Sequence
Similarity to Protopine 6-Hydroxylase from Eschscholzia
californica.
The closest homologue to the putative proteins encoded by the two
possible PSCYP3 open reading frames (FIGS. 1c and 1d) is a
cytochrome P450s annotated as protopine 6-hydroxylase from
Eschscholzia californica (GenBank accession no. BAK20464,
identities: 228/522 (44%)) and a cytochrome P450 from Coptis
japonica (GenBank accession no. BAF98472, identities=230/539
(43%)). The sequence comparisons were carried out using NCBI's
`blastp` algorithm (method: compositional matrix adjust).
Example 15
PSCYP3 is Only Present in the Genome of the Noscapine Producing P.
Somniferum Cultivar GSK Noscapine CVS1.
The transcribed region covered by the ESTs contained the partial
coding sequence of PSCYP3 (including 5' and 3' untranslated
regions), which was used for primer design (Table 1) to amplify the
PSCYP3 gene from genomic DNA in a series of overlapping fragments
for sequencing. Upon testing a subset of the primer combinations on
genomic DNA samples from all four cultivars it was discovered that
the PsCYP3 fragments could only be amplified from genomic DNA of
the noscapine producing cultivar GSK NOSCAPINE CVS1 but not from
genomic DNA of the predominantly morphine (GSK MORPHINE CVS1, GSK
MORPHINE) or thebaine (GSK THEBAINE CVS1) producing cultivars (FIG.
7). The PCR amplifications were performed on pools of genomic DNA
comprising DNA from four individuals per cultivar using the primer
combinations shown in Table 3. This discovery explains why the
PSCYP3 is only expressed in the GSK NOSCAPINE CVS1 cultivar and is
absent from the transcriptome of the other three cultivars.
Example 16
Segregation Analysis of PSCYP1 and Noscapine Production in an F2
Mapping Population Derived from a Cross between GSK Noscapine CVS1
and GSK Thebaine CVS1.
Cultivar GSK NOSCAPINE CVS1, which produces noscapine, was cross
pollinated with cultivar GSK THEBAINE CVS1 which produces
negligible amounts of noscapine. Resulting F1 plants were grown to
maturity and F2 seed collected. Two hundred and seventy five F2
individuals from the GSK NOSCAPINE CVS1 and GSK THEBAINE CVS1 10
cross were grown to maturity in the field. Leaf material was
collected from each individual and used for DNA extraction and
analysis. Mature capsules were collected from each individual for
alkaloid extraction and analysis.
FIGS. 8a-c present the results of the F2 mapping population
analysis. The PSCYP1, PSCYP2 and PSCYP3 genes are linked and
segregate with noscapine production in the F2 mapping population.
The data demonstrate that in the mapping population GSK NOSCAPINE
CVS1 levels are present in 61 out of 275 individual F2 plants. The
PSCYP1, PSCYP2 and PSCYP3 gene were detected in all of the
noscapine containing plants thus confirming that the PSCYP1, PSCYP2
and PSCYP3 genes and noscapine production are linked. Furthermore,
all plants in which the PSCYP1, PSCYP2 and PSCYP3 genes were not
detected lacked noscapine (The genotyping assay for PSCYP3 failed
on 16 samples as indicated by the failure of the internal positive
control included in the assay; since these samples were excluded
from the segregation analysis of PSCYP3 with the noscapine trait).
These data are highly statistically relevant and confirm that the
PSCYP1, PSCYP2 and PSCYP3 genes are required for production of GSK
NOSCAPINE CVS1 levels of noscapine.
Example 17
Putative Tetrahydrocolumbamine Accumulates in PSCYP2-Silenced
Plants
Virus induced gene silencing led to the accumulation of putative
tetrahydrocolumbamine in both latex and mature capsules of
PSCYP2-silenced plants but not of PSCYP3-silenced plants,
PDS-silenced control plants or uninfected plants of GSK NOSCAPINE
CVS1 (FIG. 14). The data suggest that PSCYP2 encodes a
methylenedioxy-bridge forming enzyme which converts
tetrahydrocolumbamine to canadine thus leading to the formation of
the methylenedioxybridge present at C-3a'/C-9a' of the isoquinoline
moiety of noscapine.
Example 18
Putative Secoberbines Accumulates in PSCYP3-Silenced Plants
Virus induced gene silencing led to the accumulation of putative
secoberbine alkaloids in both latex and mature capsules of
PSCYP3-silenced plants but not of PSCYP2-silenced plants,
PDS-silenced control plants or uninfected plants of GSK NOSCAPINE
CVS1 (FIGS. 15 and 16). The mass, assigned molecular formula
(C21H23NO6) and fragmentation pattern of the putative secoberbine
shown to accumulate in FIG. 15 is consistent with either
demethoxyhydroxymacrantaldehyde or demethoxymacrantoridine. Both of
these secoberbines lack a methoxy-group at the carbon of the
isoquinoline moiety which is equivalent to the C-4' of noscapine.
The mass, assigned molecular formula (C21H25NO6) and fragmentation
pattern of the second compound found to accumulate in
PSCYP3-silenced plants (FIG. 16) is consistent with two
secoberbines, demethoxynarcotinediol and narcotolinol,
respectively. The former compound lacks the methoxy-group at the
carbon equivalent to C-4' of noscapine. Together the data suggest
that the protein encoded by PSCYP3 hydroxylates the isoquinoline
moiety of secoberbines at a position equivalent to C-4' of
noscapine thus enabling the formation of the methoxy-group present
in noscapine at this position by subsequent 0-methylation. The
respective methoxylated derivatives (methoxylated at the carbon
equivalent to C-4' of noscapaine) of the putative secoberbines
accumulating in PSCYP3-silenced plants have been found in various
Papaver species producing noscapine (Sariyar and Phillipson (1977)
Phytochem. 16: 2009-2013; Sariyar and Shamma (1986) Phytochem. 25:
2403-2406, Sariyar (2002) Pure Appl. Chem. 74: 557-574). They have
been implicated, on structural grounds, in the biosynthetic
conversion of protoberberines into phthalideisoquinolines such as
noscapine (Sariyar and Shamma (1986) Phytochem. 25: 2403-2406,
Sariyar and Phillipson (1977) Phytochem. 16: 2009-2013).
SEQUENCE LISTINGS
1
5611623DNAPapaver somniferum 1atggagttat tcataaagtt accatttatc
caaccaattc ctttcagtat tattcttgtt 60actacagttt cgattgttct attatacagt
gtcttcttct gggttactga taagaaaaag 120aagaggaaga aagcaccaaa
tgctgcaggg gcatggccgt taataggtca tctccgtcta 180ttgatgaacg
acaaggaacc gttgtataga gcactaggga gcatggctga taagtacgga
240cctgcattca acatccgatt aggtaaccaa gaagttcttg ttgtgagtaa
ctgggagatg 300gtaaaacagt gttttggtaa tcaaaatgat aagctatttt
cgaatcgtca aactacatta 360gctgcaaaat acatgcttaa tcaaacaact
tctagcggat tcgcaccata tggaccatat 420tggagagagc tacgaaagat
aatggtgcag caattactct ctaaacaatc tttagaatcg 480tggaaacatc
tgaaaatcaa agagatggat gcttcattta gtaaacttaa cgagttatgc
540aacaacaacg gtactggaac agctacccta attaggatgg acgaatggtt
tgctgagttg 600acgttcaacg tgatcgcaag aaatgtcttt ggctaccaaa
gtggcggaag gtcgacagcg 660cttacgaacg gagatacgga atcaaagggc
gagaggtaca agaaaacatt ggaagaagca 720cttcatctta tgtcaatttt
tgcagtttca gacatatttc caagtctaga gtgggtagat 780cggttaagag
gccttataag gaatatgaaa cgctttggag atgagctaaa ttcaattgca
840gggtgtctta ttgaagagca ccgccaaaag agattacaat ccgtatctaa
aagtgataaa 900ggagttggtg atgaacaaga cttcgttgat gttctcttat
cggttgctga aaaatcgcaa 960cttcctggag atgaccctga tttggtcatc
aagtctatga ttctggaaat cgtatcaggt 1020gggagtgaga ccacatcgtc
aaccttaact tgggccctct gtctgttact gaaccatccg 1080catgtgttaa
agaaggcaaa agaggaatta gatacgcacg taggaaaaga taggcatgta
1140gaagagtcag atacccctaa gctcgtgtac attaatgcaa ttatcaaaga
atcaatgcga 1200ttgtatccaa acggggcaat gcttgatcgg ttggcgttag
aagagtgcga agttggtgga 1260tttcatgtac cggccggggg acgcttattt
gtcaatgttt ggaagattca gagagatccg 1320agtgtttggg agaatcctct
ggagtttaaa ccagagaggt ggtttttgag taatggtgaa 1380aagatggatg
tggattacaa aggtcacaat catgaattca taccatttgg gataggtcgg
1440aggatgtgcg ctggtatgct ttgggcatcg gaggtgattc atttggtgct
gccccgtctt 1500attcatgggt ttgatatgaa agcagcaagt gccaatggga
aagtagatat ggcagaaatg 1560gcaggcatgg tgatttgttt taagaagaca
cctcttgaag ttatggtcaa tcctcgagag 1620tag 162321439DNAPapaver
somniferum 2atgatcatga gtaacttatg gattcttacg ctcatttcta ccatattagc
agtctttgct 60gctgtgttaa tcattttcag gagaagaata tcagcatcca caacggaatg
gcctgttggc 120ccaaaaatta ccaatcatag gtaacttgca cattcttgga
ggcactgctc tccatgtcgt 180cttacataaa cttgctgaag tttacggcag
tgtaatgacg atatggattg gtagttggaa 240acctgttatt attttccgac
tttgatcgag cctgggaagt tcttgttaac aaatcgtcag 300attattcagc
tcgtgaaatg cctgagatca ctaaaatcgg cactgcaaat tggagaacaa
360tttcaagttc tgattctggc cttttgggcc actcttcgaa aaggtcttca
gagtgtagca 420ttatcgcctc agcatttagc atcgcaaact gcacaccaag
agagagatat aataaagttg 480atcaaaaatt tgaaagacga agcagttcgg
aatggttaaa ccacttgatc atctcaagaa 540agcaactgta agattaatca
gtcggttaat ctatggtcag gattttgatg acgataagta 600tgttgaagat
atgcatgacg tgatcgagtt ttgatcgtat tagtggttat gctcaacttg
660ctgaggtatt ctattatgct aaatatctac caggtcataa gagagctgta
actggcgccg 720aagaagcaaa aagaagagta atagctctgg tgcgtccttt
ctcagtcaaa ccctgctact 780aacacttact tgcattttct caaatcgcaa
ctgtatcctg aagaggttat catattcgct 840atattcgaag cttatctttt
aggtgttgat agcacttctt caacactgct gggcactcgc 900attcttaata
cgcgaaccat ctgttcaaga gaaactttat caagagctta agaatttcac
960agccaataac aatcgcacaa tgctgaaagt cgaagacgtc aacaaattac
atatttcaag 1020ctgttgttaa agaaacaatg aggatgaaac caattgcacc
actggcgatt cctcataaag 1080cttgtaaaga cacttcattg atgggcaaga
aagttgataa gggaactaaa gttatgttaa 1140catcatgctt tacatcatac
tgaaaaggtt tggaaagaac cttacaaatt cataccagag 1200aggtttctgc
agaagcacga taaggcgatg gaacaatcac tattaccatt tagtgcaggt
1260agagaatttg gcaggaatgg aattaggaaa acttcagttt agtttttctc
ttgctaatct 1320tgttaatgct tttaaatggt cttgtgtgtc tgatggagtg
cttcctgata tgagtgattt 1380actggggttg ttctgttatg aaaaccccac
tcgaagcacg tatagttcct cgtttgtag 143931653DNAPapaver somniferum
3atgatgaaca agttattatt tctccaacgg attactgatt ctccttcgac caccattatc
60agtactttta ttgttacaat aatatccatt gtttttctct acactgtctt gttgataagg
120acgactaaga ataagcagaa gatagcagca ccaaaagcat cgggggcgtg
gccgttcata 180ggtcatctca aactattcat gaaacaagat actcagtttt
acagaactct aggaaccatg 240tctgataaat acgggtcggt gttcacactt
cgattaggaa accaagcaat cctagttgtg 300agcaactggg agatggtaaa
agaatgtttc acaacaaacg acaagtcatt ctcgaatcgt 360ccaagtacgt
taagcactaa atacatgctg aatgacacta attctgtcgt gttttcacct
420tacggaacgt attggagaga aatgcggaag atattggtgc aaaaactact
gatctctaac 480caaagatcag aggcattgaa aaatctgaaa acgaaagaaa
tcgacaactc gtttgtaaag 540cttaatgatt tatgcaacaa cgatgtcagt
ggaggaggca caaaagttag gatggacgaa 600tggttggctg acatgatgtt
caacattatt gctaggatta catttggtta ccaaagcgga 660ggaggcgatg
cacctggcgc ttctacaaca tccaagaatg tcgagagata caagaaaacg
720ttggacgaga tgtttgttgt tttagcgacg aggtttgcag tttcagatat
atttccatct 780ctggagttta tagaccgatt gagaggtctt gtaaaggata
tgaaaatctt gggagacgaa 840ttaaactcca ttgctggatg ttttattgaa
gaacatcgtc aaaagagacg agaatcatta 900tcctcattgt tatctttgtc
aaatgaatcc gttggtgatg aacaagattt cattgatgtt 960ctcttgtcaa
taatggatca gtcacggctt cccggagatg acccagattt tattatcaaa
1020attatgatcc tggaagcttt tgcaggtggg acggacagtt taagtgcaac
cttaacttgg 1080gtcctctctc tactgctgaa ccacccaaac gtgttaaaga
gggcaaggga ggaaatagat 1140aggcatgtgg aaaacggtaa gcaagtggaa
gtgtctgata ttccgaagct cggatacatt 1200gatgcaataa tcaaagagac
gatgagattg tatccagtcg gagcattaag cgaacgatac 1260acgactgaag
aatgcgaggt tggtcggttt aacgtacccg ctggcacacg cttactggtg
1320aatatatgga agatccacag agacccaagt gtgtgggaga atccatcaga
ttttcaacca 1380gagaggtttt tgtgcagcga taaggtgggt gtggatttat
atggccagaa ttatgagctg 1440ataccatttg gggccggtag gagggtatgt
ccggctatag tttcatcact gcagacgatg 1500cattatgcgt tggcgcgtct
tattcaagga tatgaaatga aatcagccag cctcgatggg 1560aaggtgaata
tggaagaaat gatagccatg tcgtgccaca agatgagccc tcttgaagtt
1620attatcagtc ctcgggagcc gaggcggagt taa 165341650DNAPapaver
somniferum 4atgaacaagt tattatttct ccaacggatt actgattctc cttcgaccac
cattatcagt 60acttttattg ttacaataat atccattgtt tttctctaca ctgtcttgtt
gataaggacg 120actaagaata agcagaagat agcagcacca aaagcatcgg
gggcgtggcc gttcataggt 180catctcaaac tattcatgaa acaagatact
cagttttaca gaactctagg aaccatgtct 240gataaatacg ggtcggtgtt
cacacttcga ttaggaaacc aagcaatcct agttgtgagc 300aactgggaga
tggtaaaaga atgtttcaca acaaacgaca agtcattctc gaatcgtcca
360agtacgttaa gcactaaata catgctgaat gacactaatt ctgtcgtgtt
ttcaccttac 420ggaacgtatt ggagagaaat gcggaagata ttggtgcaaa
aactactgat ctctaaccaa 480agatcagagg cattgaaaaa tctgaaaacg
aaagaaatcg acaactcgtt tgtaaagctt 540aatgatttat gcaacaacga
tgtcagtgga ggaggcacaa aagttaggat ggacgaatgg 600ttggctgaca
tgatgttcaa cattattgct aggattacat ttggttacca aagcggagga
660ggcgatgcac ctggcgcttc tacaacatcc aagaatgtcg agagatacaa
gaaaacgttg 720gacgagatgt ttgttgtttt agcgacgagg tttgcagttt
cagatatatt tccatctctg 780gagtttatag accgattgag aggtcttgta
aaggatatga aaatcttggg agacgaatta 840aactccattg ctggatgttt
tattgaagaa catcgtcaaa agagacgaga atcattatcc 900tcattgttat
ctttgtcaaa tgaatccgtt ggtgatgaac aagatttcat tgatgttctc
960ttgtcaataa tggatcagtc acggcttccc ggagatgacc cagattttat
tatcaaaatt 1020atgatcctgg aagcttttgc aggtgggacg gacagtttaa
gtgcaacctt aacttgggtc 1080ctctctctac tgctgaacca cccaaacgtg
ttaaagaggg caagggagga aatagatagg 1140catgtggaaa acggtaagca
agtggaagtg tctgatattc cgaagctcgg atacattgat 1200gcaataatca
aagagacgat gagattgtat ccagtcggag cattaagcga acgatacacg
1260actgaagaat gcgaggttgg tcggtttaac gtacccgctg gcacacgctt
actggtgaat 1320atatggaaga tccacagaga cccaagtgtg tgggagaatc
catcagattt tcaaccagag 1380aggtttttgt gcagcgataa ggtgggtgtg
gatttatatg gccagaatta tgagctgata 1440ccatttgggg ccggtaggag
ggtatgtccg gctatagttt catcactgca gacgatgcat 1500tatgcgttgg
cgcgtcttat tcaaggatat gaaatgaaat cagccagcct cgatgggaag
1560gtgaatatgg aagaaatgat agccatgtcg tgccacaaga tgagccctct
tgaagttatt 1620atcagtcctc gggagccgag gcggagttaa 165051921DNAPapaver
somniferum 5cttgagtcat gccttgatat gctcatattt tagtttgtca tattcactat
aactataaat 60ttcaatacaa tttctaaaac tcatcatcat tcaagagaga tacaaatacc
ttgatatcct 120tttatcatca atggagttat tcataaagtt accatttatc
caaccaattc ctttcagtat 180tattcttgtt actacagttt cgattgttct
attatacagt gtcttcttct gggttactga 240taagaaaaag aagaggaaga
aagcaccaaa tgctgcaggg gcatggccgt taataggtca 300tctccgtcta
ttgatgaacg acaaggaacc gttgtataga gcactaggga gcatggctga
360taagtacgga cctgcattca acatccgatt aggtaaccaa gaagttcttg
ttgtgagtaa 420ctgggagatg gtaaaacagt gttttggtaa tcaaaatgat
aagctatttt cgaatcgtca 480aactacatta gctgcaaaat acatgcttaa
tcaaacaact tctagcggat tcgcaccata 540tggaccatat tggagagagc
tacgaaagat aatggtgcag caattactct ctaaacaatc 600tttagaatcg
tggaaacatc tgaaaatcaa agagatggat gcttcattta gtaaacttaa
660cgagttatgc aacaacaacg gtactggaac agctacccta attaggatgg
acgaatggtt 720tgctgagttg acgttcaacg tgatcgcaag aaatgtcttt
ggctaccaaa gtggcggaag 780gtcgacagcg cttacgaacg gtaatatgat
catactccct caatctgtat caatttaagg 840aaatcatttt ggtcttgtta
ttaacttgaa ttttctatta ggagatacgg aatcaaaggg 900cgagaggtac
aagaaaacat tggaagaagc acttcatctt atgtcaattt ttgcagtttc
960agacatattt ccaagtctag agtgggtaga tcggttaaga ggccttataa
ggaatatgaa 1020acgctttgga gatgagctaa attcaattgc agggtgtctt
attgaagagc accgccaaaa 1080gagattacaa tccgtatcta aaagtgataa
aggagttggt gatgaacaag acttcgttga 1140tgttctctta tcggttgctg
aaaaatcgca acttcctgga gatgaccctg atttggtcat 1200caagtctatg
attctggtta ggctattgat accaagtcta ttgcaatttt ggtttatgtg
1260cttgttctaa ctttcgttta ctgcatatgg atgtgcagga aatcgtatca
ggtgggagtg 1320agaccacatc gtcaacctta acttgggccc tctgtctgtt
actgaaccat ccgcatgtgt 1380taaagaaggc aaaagaggaa ttagatacgc
acgtaggaaa agataggcat gtagaagagt 1440cagatacccc taagctcgtg
tacattaatg caattatcaa agaatcaatg cgattgtatc 1500caaacggggc
aatgcttgat cggttggcgt tagaagagtg cgaagttggt ggatttcatg
1560taccggccgg gggacgctta tttgtcaatg tttggaagat tcagagagat
ccgagtgttt 1620gggagaatcc tctggagttt aaaccagaga ggtggttttt
gagtaatggt gaaaagatgg 1680atgtggatta caaaggtcac aatcatgaat
tcataccatt tgggataggt cggaggatgt 1740gcgctggtat gctttgggca
tcggaggtga ttcatttggt gctgccccgt cttattcatg 1800ggtttgatat
gaaagcagca agtgccaatg ggaaagtaga tatggcagaa atggcaggca
1860tggtgatttg ttttaagaag acacctcttg aagttatggt caatcctcga
gagtagatgt 1920t 192161688DNAPapaver somniferum 6gatgaaattc
tttatgcaaa gagtcaatct gactcaagct agctagaata tataccaatc 60ataaaagaaa
tgatcatgag taacttatgg attcttacgc tcatttctac catattagca
120gtctttgctg ctgtgttaat cattttcagg agaagaatat cagcatccac
aacggaatgg 180cctgttggcc caaaaacatt accaatcata ggtaacttgc
acattcttgg aggcactgct 240ctccatgtcg tcttacataa acttgctgaa
gtttacggca gtgtaatgac gatatggatt 300ggtagttgga aacctgttat
tattgtttcc gactttgatc gagcctggga agttcttgtt 360aacaaatcgt
cagattattc agctcgtgaa atgcctgaga tcactaaaat cggcactgca
420aattggagaa caatttcaag ttctgattct ggtccgtttt gggccactct
tcgaaaaggt 480cttcagagtg tagcattatc gcctcagcat ttagcatcgc
aaactgcaca ccaagagaga 540gatataataa agttgatcaa aaatttgaaa
gacgaagcag cttctggaat ggttaaacca 600cttgatcatc tcaagaaagc
aactgtaaga ttaatcagtc ggttaatcta tggtcaggat 660tttgatgacg
ataagtatgt tgaagatatg catgacgtga tcgagttttt gattcgtatt
720agtggttatg ctcaacttgc tgaggtattc tattatgcta aatatctacc
aggtcataag 780agagctgtaa ctggcgccga agaagcaaaa agaagagtaa
tagctctggt gcgtcctttt 840cttcagtcaa accctgctac taacacttac
ttgcattttc tcaaatcgca actgtatcct 900gaagaggtta tcatattcgc
tatattcgaa gcttatcttt taggtgttga tagcacttct 960tcaaccactg
catgggcact cgcattctta atacgcgaac catctgttca agagaaactt
1020tatcaagagc ttaagaattt cacagccaat aacaatcgca caatgctgaa
agtcgaagac 1080gtcaacaaat taccatattt acaagctgtt gttaaagaaa
caatgaggat gaaaccaatt 1140gcaccactgg cgattcctca taaagcttgt
aaagacactt cattgatggg caagaaagtt 1200gataagggaa ctaaagttat
ggttaacatt catgctttac atcatactga aaaggtttgg 1260aaagaacctt
acaaattcat accagagagg tttctgcaga agcacgataa ggcgatggaa
1320caatcactat taccatttag tgcaggtatg agaatttgtg caggaatgga
attaggaaaa 1380cttcagttta gtttttctct tgctaatctt gttaatgctt
ttaaatggtc ttgtgtgtct 1440gatggagtgc ttcctgatat gagtgattta
ctggggtttg ttctgttcat gaaaacccca 1500ctcgaagcac gtatagttcc
tcgtttgtag tgatggaaat ttcatctcat gttgttgttt 1560ctcttcatgt
ttactatttc gtactcgttt ggttttggtg taaaaaataa gatctaaact
1620tccaaatatc attaatgttt acacaaatcg aaatcaatca actatgttat
gaaaattagt 1680gttttcgc 168872918DNAPapaver somniferum 7aagtgtgcca
ctaatctact gctagtgcta ctgctcactg acacttacac atatgattga 60tttatggcta
aacaggatga ccactaaatt tattttggaa agcggagtga attaattaag
120tggcacattt tccatgagaa ttattgatgg catgcattta gatgaacaag
atacaccaaa 180tgtagtgact gaacaagatg ctcgatccta accccacctg
caactttagc taaactttaa 240taattacatg tcttatcttt ttattgaatc
attttatcta tcaatggatg ctgatcaata 300atatcatata tctttgcttt
ttcttcaatc atttagatga acaaaaaaca caataagtgt 360agtggttgtt
cataacccca ccttcaactc attcttccct ttaataacaa atatctttgc
420tttttctcca atcatttact tgaacaacca acactagtaa gtgtagtggt
ttctcataac 480cccacctgca atttttgctt acctttaata acatatatct
ttgattttct tcgatcattt 540tagctaccaa tggatgctga tccaaaaagt
tatggcaaaa agagacaacg tgatcgaaca 600cgagcctctc gtgcaccaca
gcatcaaggt ttgtggaaat taaccgcttg taaaaaatgg 660agtgcgtgat
cataatgagg tattgctaag atatagtatc aactttagtg aactgggcca
720acaaaactca cgagttgttg aaaattggag attatattta taagataaaa
gggtcactcc 780ctacacaacg acttgcactg caagtgaaaa agaaaaaaaa
caaacaacct caatctagct 840agagtcgtga aaaagttttg tgcgactgtt
atttagttaa ttataaaatt tcaatgaagt 900cgttaatgat gaacaagtta
ttatttctcc aacggattac tgattctcct tcgaccacca 960ttatcagtac
ttttattgtt acaataatat ccattgtttt tctctacact gtcttgttga
1020taaggacgac taagaataag cagaagatag cagcaccaaa agcatcgggg
gcgtggccgt 1080tcataggtca tctcaaacta ttcatgaaac aagatactca
gttttacaga actctaggaa 1140ccatgtctga taaatacggg tcggtgttca
cacttcgatt aggaaaccaa gcaatcctag 1200ttgtgagcaa ctgggagatg
gtaaaagaat gtttcacaac aaacgacaag tcattctcga 1260atcgtccaag
tacgttaagc actaaataca tgctgaatga cactaattct gtcgtgtttt
1320caccttacgg aacgtattgg agagaaatgc ggaagatatt ggtgcaaaaa
ctactgatct 1380ctaaccaaag atcagaggca ttgaaaaatc tgaaaacgaa
agaaatcgac aactcgtttg 1440taaagcttaa tgatttatgc aacaacgatg
tcagtggagg aggcacaaaa gttaggatgg 1500acgaatggtt ggctgacatg
atgttcaaca ttattgctag gattacattt ggttaccaaa 1560gcggaggagg
cgatgcacct ggtatgtgat catcaaattt tcgttaaaac caaattaact
1620tgtactatat cttatgttta catgttatat tgatcacttt gacacgttct
gatcattttc 1680acaaatcgaa ttaggcgctt ctacaacatc caagaatgtc
gagagataca agaaaacgtt 1740ggacgagatg tttgttgttt tagcgacgag
gtttgcagtt tcagatatat ttccatctct 1800ggagtttata gaccgattga
gaggtcttgt aaaggatatg aaaatcttgg gagacgaatt 1860aaactccatt
gctggatgtt ttattgaaga acatcgtcaa aagagacgag aatcattatc
1920ctcattgtta tctttgtcaa atgaatccgt tggtgatgaa caagatttca
ttgatgttct 1980cttgtcaata atggatcagt cacggcttcc cggagatgac
ccagatttta ttatcaaaat 2040tatgatcctg gtaacatata ttacaacagt
atttctttaa gttatggatt aatggatgtc 2100gtaaccatga atatttttct
gatctggata aatgtaatcc ggaactaata tatgaatatt 2160gttgacgcag
gaagcttttg caggtgggac ggacagttta agtgcaacct taacttgggt
2220cctctctcta ctgctgaacc acccaaacgt gttaaagagg gcaagggagg
aaatagatag 2280gcatgtggaa aacggtaagc aagtggaagt gtctgatatt
ccgaagctcg gatacattga 2340tgcaataatc aaagagacga tgagattgta
tccagtcgga gcattaagcg aacgatacac 2400gactgaagaa tgcgaggttg
gtcggtttaa cgtacccgct ggcacacgct tactggtgaa 2460tatatggaag
atccacagag acccaagtgt gtgggagaat ccatcagatt ttcaaccaga
2520gaggtttttg tgcagcgata aggtgggtgt ggatttatat ggccagaatt
atgagctgat 2580accatttggg gccggtagga gggtatgtcc ggctatagtt
tcatcactgc agacgatgca 2640ttatgcgttg gcgcgtctta ttcaaggata
tgaaatgaaa tcagccagcc tcgatgggaa 2700ggtgaatatg gaagaaatga
tagccatgtc gtgccacaag atgagccctc ttgaagttat 2760tatcagtcct
cgggagccga ggcggagtta aatcttatgt tccaatttta cattagcatc
2820tttgattatg aaatgtattg ctcttaagtt tcttttttgt tttttatatt
tttaagcttg 2880tatgtgatca tcagcgaaaa tgatgatgac agaatcgt
29188540PRTPapaver somniferum 8Met Glu Leu Phe Ile Lys Leu Pro Phe
Ile Gln Pro Ile Pro Phe Ser 1 5 10 15 Ile Ile Leu Val Thr Thr Val
Ser Ile Val Leu Leu Tyr Ser Val Phe 20 25 30 Phe Trp Val Thr Asp
Lys Lys Lys Lys Arg Lys Lys Ala Pro Asn Ala 35 40 45 Ala Gly Ala
Trp Pro Leu Ile Gly His Leu Arg Leu Leu Met Asn Asp 50 55 60 Lys
Glu Pro Leu Tyr Arg Ala Leu Gly Ser Met Ala Asp Lys Tyr Gly 65 70
75 80 Pro Ala Phe Asn Ile Arg Leu Gly Asn Gln Glu Val Leu Val Val
Ser 85 90 95 Asn Trp Glu Met Val Lys Gln Cys Phe Gly Asn Gln Asn
Asp Lys Leu 100 105 110 Phe Ser Asn Arg Gln Thr Thr Leu Ala Ala Lys
Tyr Met Leu Asn Gln 115 120 125 Thr Thr Ser Ser Gly Phe Ala Pro Tyr
Gly Pro Tyr Trp Arg Glu Leu 130 135 140 Arg Lys Ile Met Val Gln Gln
Leu Leu Ser Lys Gln Ser Leu Glu Ser 145 150 155 160 Trp Lys His Leu
Lys Ile Lys Glu Met Asp Ala Ser Phe Ser Lys Leu 165 170 175 Asn Glu
Leu Cys Asn Asn Asn Gly Thr Gly Thr Ala Thr Leu Ile Arg 180 185 190
Met Asp Glu Trp Phe Ala Glu Leu Thr Phe Asn Val Ile Ala Arg Asn 195
200 205 Val Phe Gly Tyr Gln Ser Gly Gly Arg Ser Thr Ala Leu Thr Asn
Gly 210 215 220 Asp Thr Glu Ser Lys Gly Glu Arg Tyr Lys Lys Thr Leu
Glu Glu Ala 225 230 235 240 Leu His Leu Met Ser Ile Phe Ala Val Ser
Asp Ile Phe Pro Ser Leu 245 250 255 Glu Trp Val
Asp Arg Leu Arg Gly Leu Ile Arg Asn Met Lys Arg Phe 260 265 270 Gly
Asp Glu Leu Asn Ser Ile Ala Gly Cys Leu Ile Glu Glu His Arg 275 280
285 Gln Lys Arg Leu Gln Ser Val Ser Lys Ser Asp Lys Gly Val Gly Asp
290 295 300 Glu Gln Asp Phe Val Asp Val Leu Leu Ser Val Ala Glu Lys
Ser Gln 305 310 315 320 Leu Pro Gly Asp Asp Pro Asp Leu Val Ile Lys
Ser Met Ile Leu Glu 325 330 335 Ile Val Ser Gly Gly Ser Glu Thr Thr
Ser Ser Thr Leu Thr Trp Ala 340 345 350 Leu Cys Leu Leu Leu Asn His
Pro His Val Leu Lys Lys Ala Lys Glu 355 360 365 Glu Leu Asp Thr His
Val Gly Lys Asp Arg His Val Glu Glu Ser Asp 370 375 380 Thr Pro Lys
Leu Val Tyr Ile Asn Ala Ile Ile Lys Glu Ser Met Arg 385 390 395 400
Leu Tyr Pro Asn Gly Ala Met Leu Asp Arg Leu Ala Leu Glu Glu Cys 405
410 415 Glu Val Gly Gly Phe His Val Pro Ala Gly Gly Arg Leu Phe Val
Asn 420 425 430 Val Trp Lys Ile Gln Arg Asp Pro Ser Val Trp Glu Asn
Pro Leu Glu 435 440 445 Phe Lys Pro Glu Arg Trp Phe Leu Ser Asn Gly
Glu Lys Met Asp Val 450 455 460 Asp Tyr Lys Gly His Asn His Glu Phe
Ile Pro Phe Gly Ile Gly Arg 465 470 475 480 Arg Met Cys Ala Gly Met
Leu Trp Ala Ser Glu Val Ile His Leu Val 485 490 495 Leu Pro Arg Leu
Ile His Gly Phe Asp Met Lys Ala Ala Ser Ala Asn 500 505 510 Gly Lys
Val Asp Met Ala Glu Met Ala Gly Met Val Ile Cys Phe Lys 515 520 525
Lys Thr Pro Leu Glu Val Met Val Asn Pro Arg Glu 530 535 540
9486PRTPapaver somniferum 9Met Ile Met Ser Asn Leu Trp Ile Leu Thr
Leu Ile Ser Thr Ile Leu 1 5 10 15 Ala Val Phe Ala Ala Val Leu Ile
Ile Phe Arg Arg Arg Ile Ser Ala 20 25 30 Ser Thr Thr Glu Trp Pro
Val Gly Pro Lys Thr Leu Pro Ile Ile Gly 35 40 45 Asn Leu His Ile
Leu Gly Gly Thr Ala Leu His Val Val Leu His Lys 50 55 60 Leu Ala
Glu Val Tyr Gly Ser Val Met Thr Ile Trp Ile Gly Ser Trp 65 70 75 80
Lys Pro Val Ile Ile Val Ser Asp Phe Asp Arg Ala Trp Glu Val Leu 85
90 95 Val Asn Lys Ser Ser Asp Tyr Ser Ala Arg Glu Met Pro Glu Ile
Thr 100 105 110 Lys Ile Gly Thr Ala Asn Trp Arg Thr Ile Ser Ser Ser
Asp Ser Gly 115 120 125 Pro Phe Trp Ala Thr Leu Arg Lys Gly Leu Gln
Ser Val Ala Leu Ser 130 135 140 Pro Gln His Leu Ala Ser Gln Thr Ala
His Gln Glu Arg Asp Ile Ile 145 150 155 160 Lys Leu Ile Lys Asn Leu
Lys Asp Glu Ala Ala Ser Gly Met Val Lys 165 170 175 Pro Leu Asp His
Leu Lys Lys Ala Thr Val Arg Leu Ile Ser Arg Leu 180 185 190 Ile Tyr
Gly Gln Asp Phe Asp Asp Asp Lys Tyr Val Glu Asp Met His 195 200 205
Asp Val Ile Glu Phe Leu Ile Arg Ile Ser Gly Tyr Ala Gln Leu Ala 210
215 220 Glu Val Phe Tyr Tyr Ala Lys Tyr Leu Pro Gly His Lys Arg Ala
Val 225 230 235 240 Thr Gly Ala Glu Glu Ala Lys Arg Arg Val Ile Ala
Leu Val Arg Pro 245 250 255 Phe Leu Gln Ser Asn Pro Ala Thr Asn Thr
Tyr Leu His Phe Leu Lys 260 265 270 Ser Gln Leu Tyr Pro Glu Glu Val
Ile Ile Phe Ala Ile Phe Glu Ala 275 280 285 Tyr Leu Leu Gly Val Asp
Ser Thr Ser Ser Thr Thr Ala Trp Ala Leu 290 295 300 Ala Phe Leu Ile
Arg Glu Pro Ser Val Gln Glu Lys Leu Tyr Gln Glu 305 310 315 320 Leu
Lys Asn Phe Thr Ala Asn Asn Asn Arg Thr Met Leu Lys Val Glu 325 330
335 Asp Val Asn Lys Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr Met
340 345 350 Arg Met Lys Pro Ile Ala Pro Leu Ala Ile Pro His Lys Ala
Cys Lys 355 360 365 Asp Thr Ser Leu Met Gly Lys Lys Val Asp Lys Gly
Thr Lys Val Met 370 375 380 Val Asn Ile His Ala Leu His His Thr Glu
Lys Val Trp Lys Glu Pro 385 390 395 400 Tyr Lys Phe Ile Pro Glu Arg
Phe Leu Gln Lys His Asp Lys Ala Met 405 410 415 Glu Gln Ser Leu Leu
Pro Phe Ser Ala Gly Met Arg Ile Cys Ala Gly 420 425 430 Met Glu Leu
Gly Lys Leu Gln Phe Ser Phe Ser Leu Ala Asn Leu Val 435 440 445 Asn
Ala Phe Lys Trp Ser Cys Val Ser Asp Gly Val Leu Pro Asp Met 450 455
460 Ser Asp Leu Leu Gly Phe Val Leu Phe Met Lys Thr Pro Leu Glu Ala
465 470 475 480 Arg Ile Val Pro Arg Leu 485 10550PRTPapaver
somniferum 10Met Met Asn Lys Leu Leu Phe Leu Gln Arg Ile Thr Asp
Ser Pro Ser 1 5 10 15 Thr Thr Ile Ile Ser Thr Phe Ile Val Thr Ile
Ile Ser Ile Val Phe 20 25 30 Leu Tyr Thr Val Leu Leu Ile Arg Thr
Thr Lys Asn Lys Gln Lys Ile 35 40 45 Ala Ala Pro Lys Ala Ser Gly
Ala Trp Pro Phe Ile Gly His Leu Lys 50 55 60 Leu Phe Met Lys Gln
Asp Thr Gln Phe Tyr Arg Thr Leu Gly Thr Met 65 70 75 80 Ser Asp Lys
Tyr Gly Ser Val Phe Thr Leu Arg Leu Gly Asn Gln Ala 85 90 95 Ile
Leu Val Val Ser Asn Trp Glu Met Val Lys Glu Cys Phe Thr Thr 100 105
110 Asn Asp Lys Ser Phe Ser Asn Arg Pro Ser Thr Leu Ser Thr Lys Tyr
115 120 125 Met Leu Asn Asp Thr Asn Ser Val Val Phe Ser Pro Tyr Gly
Thr Tyr 130 135 140 Trp Arg Glu Met Arg Lys Ile Leu Val Gln Lys Leu
Leu Ile Ser Asn 145 150 155 160 Gln Arg Ser Glu Ala Leu Lys Asn Leu
Lys Thr Lys Glu Ile Asp Asn 165 170 175 Ser Phe Val Lys Leu Asn Asp
Leu Cys Asn Asn Asp Val Ser Gly Gly 180 185 190 Gly Thr Lys Val Arg
Met Asp Glu Trp Leu Ala Asp Met Met Phe Asn 195 200 205 Ile Ile Ala
Arg Ile Thr Phe Gly Tyr Gln Ser Gly Gly Gly Asp Ala 210 215 220 Pro
Gly Ala Ser Thr Thr Ser Lys Asn Val Glu Arg Tyr Lys Lys Thr 225 230
235 240 Leu Asp Glu Met Phe Val Val Leu Ala Thr Arg Phe Ala Val Ser
Asp 245 250 255 Ile Phe Pro Ser Leu Glu Phe Ile Asp Arg Leu Arg Gly
Leu Val Lys 260 265 270 Asp Met Lys Ile Leu Gly Asp Glu Leu Asn Ser
Ile Ala Gly Cys Phe 275 280 285 Ile Glu Glu His Arg Gln Lys Arg Arg
Glu Ser Leu Ser Ser Leu Leu 290 295 300 Ser Leu Ser Asn Glu Ser Val
Gly Asp Glu Gln Asp Phe Ile Asp Val 305 310 315 320 Leu Leu Ser Ile
Met Asp Gln Ser Arg Leu Pro Gly Asp Asp Pro Asp 325 330 335 Phe Ile
Ile Lys Ile Met Ile Leu Glu Ala Phe Ala Gly Gly Thr Asp 340 345 350
Ser Leu Ser Ala Thr Leu Thr Trp Val Leu Ser Leu Leu Leu Asn His 355
360 365 Pro Asn Val Leu Lys Arg Ala Arg Glu Glu Ile Asp Arg His Val
Glu 370 375 380 Asn Gly Lys Gln Val Glu Val Ser Asp Ile Pro Lys Leu
Gly Tyr Ile 385 390 395 400 Asp Ala Ile Ile Lys Glu Thr Met Arg Leu
Tyr Pro Val Gly Ala Leu 405 410 415 Ser Glu Arg Tyr Thr Thr Glu Glu
Cys Glu Val Gly Arg Phe Asn Val 420 425 430 Pro Ala Gly Thr Arg Leu
Leu Val Asn Ile Trp Lys Ile His Arg Asp 435 440 445 Pro Ser Val Trp
Glu Asn Pro Ser Asp Phe Gln Pro Glu Arg Phe Leu 450 455 460 Cys Ser
Asp Lys Val Gly Val Asp Leu Tyr Gly Gln Asn Tyr Glu Leu 465 470 475
480 Ile Pro Phe Gly Ala Gly Arg Arg Val Cys Pro Ala Ile Val Ser Ser
485 490 495 Leu Gln Thr Met His Tyr Ala Leu Ala Arg Leu Ile Gln Gly
Tyr Glu 500 505 510 Met Lys Ser Ala Ser Leu Asp Gly Lys Val Asn Met
Glu Glu Met Ile 515 520 525 Ala Met Ser Cys His Lys Met Ser Pro Leu
Glu Val Ile Ile Ser Pro 530 535 540 Arg Glu Pro Arg Arg Ser 545 550
11549PRTPapaver somniferum 11Met Asn Lys Leu Leu Phe Leu Gln Arg
Ile Thr Asp Ser Pro Ser Thr 1 5 10 15 Thr Ile Ile Ser Thr Phe Ile
Val Thr Ile Ile Ser Ile Val Phe Leu 20 25 30 Tyr Thr Val Leu Leu
Ile Arg Thr Thr Lys Asn Lys Gln Lys Ile Ala 35 40 45 Ala Pro Lys
Ala Ser Gly Ala Trp Pro Phe Ile Gly His Leu Lys Leu 50 55 60 Phe
Met Lys Gln Asp Thr Gln Phe Tyr Arg Thr Leu Gly Thr Met Ser 65 70
75 80 Asp Lys Tyr Gly Ser Val Phe Thr Leu Arg Leu Gly Asn Gln Ala
Ile 85 90 95 Leu Val Val Ser Asn Trp Glu Met Val Lys Glu Cys Phe
Thr Thr Asn 100 105 110 Asp Lys Ser Phe Ser Asn Arg Pro Ser Thr Leu
Ser Thr Lys Tyr Met 115 120 125 Leu Asn Asp Thr Asn Ser Val Val Phe
Ser Pro Tyr Gly Thr Tyr Trp 130 135 140 Arg Glu Met Arg Lys Ile Leu
Val Gln Lys Leu Leu Ile Ser Asn Gln 145 150 155 160 Arg Ser Glu Ala
Leu Lys Asn Leu Lys Thr Lys Glu Ile Asp Asn Ser 165 170 175 Phe Val
Lys Leu Asn Asp Leu Cys Asn Asn Asp Val Ser Gly Gly Gly 180 185 190
Thr Lys Val Arg Met Asp Glu Trp Leu Ala Asp Met Met Phe Asn Ile 195
200 205 Ile Ala Arg Ile Thr Phe Gly Tyr Gln Ser Gly Gly Gly Asp Ala
Pro 210 215 220 Gly Ala Ser Thr Thr Ser Lys Asn Val Glu Arg Tyr Lys
Lys Thr Leu 225 230 235 240 Asp Glu Met Phe Val Val Leu Ala Thr Arg
Phe Ala Val Ser Asp Ile 245 250 255 Phe Pro Ser Leu Glu Phe Ile Asp
Arg Leu Arg Gly Leu Val Lys Asp 260 265 270 Met Lys Ile Leu Gly Asp
Glu Leu Asn Ser Ile Ala Gly Cys Phe Ile 275 280 285 Glu Glu His Arg
Gln Lys Arg Arg Glu Ser Leu Ser Ser Leu Leu Ser 290 295 300 Leu Ser
Asn Glu Ser Val Gly Asp Glu Gln Asp Phe Ile Asp Val Leu 305 310 315
320 Leu Ser Ile Met Asp Gln Ser Arg Leu Pro Gly Asp Asp Pro Asp Phe
325 330 335 Ile Ile Lys Ile Met Ile Leu Glu Ala Phe Ala Gly Gly Thr
Asp Ser 340 345 350 Leu Ser Ala Thr Leu Thr Trp Val Leu Ser Leu Leu
Leu Asn His Pro 355 360 365 Asn Val Leu Lys Arg Ala Arg Glu Glu Ile
Asp Arg His Val Glu Asn 370 375 380 Gly Lys Gln Val Glu Val Ser Asp
Ile Pro Lys Leu Gly Tyr Ile Asp 385 390 395 400 Ala Ile Ile Lys Glu
Thr Met Arg Leu Tyr Pro Val Gly Ala Leu Ser 405 410 415 Glu Arg Tyr
Thr Thr Glu Glu Cys Glu Val Gly Arg Phe Asn Val Pro 420 425 430 Ala
Gly Thr Arg Leu Leu Val Asn Ile Trp Lys Ile His Arg Asp Pro 435 440
445 Ser Val Trp Glu Asn Pro Ser Asp Phe Gln Pro Glu Arg Phe Leu Cys
450 455 460 Ser Asp Lys Val Gly Val Asp Leu Tyr Gly Gln Asn Tyr Glu
Leu Ile 465 470 475 480 Pro Phe Gly Ala Gly Arg Arg Val Cys Pro Ala
Ile Val Ser Ser Leu 485 490 495 Gln Thr Met His Tyr Ala Leu Ala Arg
Leu Ile Gln Gly Tyr Glu Met 500 505 510 Lys Ser Ala Ser Leu Asp Gly
Lys Val Asn Met Glu Glu Met Ile Ala 515 520 525 Met Ser Cys His Lys
Met Ser Pro Leu Glu Val Ile Ile Ser Pro Arg 530 535 540 Glu Pro Arg
Arg Ser 545 12622DNAPapaver somniferum 12gaggtgttca ttgccatgtc
aaaggcatta aacttcataa acccagatga gctttcgatg 60cagtgcattt tgatagcttt
gaaccgtttc cttcaggaaa agcatggttc caagatggcc 120tttttagatg
gtaatcctcc cgagagactt tgcaagccgg tcgtggatca tatagagtca
180cttggcggtg aagtccgtct caattccagg attaaaaaga ttgagcttaa
aaaagatggt 240actgtgaaac gtctaatgct caccaacggt gatgcaatag
aaggagatgc ttatgtcatt 300gcaaccccag tggacatcct aaagctgctt
atacccgagg agtggaaaga agttgggtac 360tttaaaagat tggataaatt
agttggagtt cctgtgatta acgtccatat atggtttgac 420aggaaattga
aaaatacata tgatcatctt ctcttcagca gaagtcccct cttaagcgta
480tacgctgaca tgtcagtgac atgcaaggaa tattatgacc caaacaaatc
catgcttgag 540ttggtatttg cacccgctga ggaatggatc tcgcgcagtg
actctgaaat tattgaagct 600actatgcagg agcttgcgaa ac
62213119DNAPapaver somniferum 13atgatcatga gtaacttatg gattcttacg
ctcatttcta ccatattagc agtctttgct 60gctgtgttaa tcattttcag gagaagaata
tcagcatcca caacggaatg gcctgttgg 11914196DNAPapaver somniferum
14taggagggta tgtccggcta tagtttcatc actgcagacg atgcattatg cgttggcgcg
60tcttattcaa ggatatgaaa tgaaatcagc cagcctcgat gggaaggtga atatggaaga
120aatgatagcc atgtcgtgcc acaagatgag ccctcttgaa gttattatca
gtcctcggga 180gccgaggcgg agttaa 1961522DNAPapaver somniferum
15cttgagtcat gccttgatat gc 221621DNAPapaver somniferum 16ttgatgaacg
acaaggaacc g 211723DNAPapaver somniferum 17gctacgaaag ataatggtgc
agc 231819DNAPapaver somniferum 18tcgacagcgc ttacgaacg
191925DNAPapaver somniferum 19gaaccattaa acacttgagt catgc
252039DNAPapaver somniferum 20gcatttggtg ctttcttcct cttctttttc
ttatcagta 392120DNAPapaver somniferum 21agcaaaccat tcgtccatcc
202222DNAPapaver somniferum 22tgcaattgaa tttagctcat ct
222326DNAPapaver somniferum 23attcatgatt gtgacctttg taatcc
262421DNAPapaver somniferum 24tacgacaggt tgctagcttg g
212527DNAPapaver somniferum 25caaagagtca atctgactca agctagc
272626DNAPapaver somniferum 26tgaaatgcct gagatcacta aaatcg
262728DNAPapaver somniferum 27tcaaaccctg ctactaacac ttacttgc
282824DNAPapaver somniferum 28tgtaaagaca cttcattgat gggc
242927DNAPapaver somniferum 29gagatgatca agtggtttaa ccattcc
273018DNAPapaver somniferum 30cgagtgccca tgcagtgg 183123DNAPapaver
somniferum 31cactccatca gacacacaag acc 233232DNAPapaver somniferum
32gtaaacatta atgatatttg gaagtttaga tc 323331DNAPapaver somniferum
33ttcgatttgt gtaaacatta atgatatttg g
313427DNAPapaver somniferum 34gttatctttg tcaaatgaat ccgttgg
273524DNAPapaver somniferum 35aataatggat cagtcacggc ttcc
243624DNAPapaver somniferum 36atgtggaaaa cggtaagcaa gtgg
243727DNAPapaver somniferum 37aatccatcag attttcaacc agagagg
273825DNAPapaver somniferum 38acgattctgt catcatcatt ttcgc
253924DNAPapaver somniferum 39agtcgtgtat cgttcgctta atgc
244028DNAPapaver somniferum 40ggcttcccgg agatgaccca gattttat
284138DNAPapaver somniferum 41ttgttatttt catgactatt accaccagct
tcctctta 384230DNAPapaver somniferum 42agtggaggag gcacaaaagt
taggatggac 304329DNAPapaver somniferum 43ccatgtctga taaatacggg
tcggtgttc 294436DNAPapaver somniferum 44ttgttgataa ggacgactaa
gaataagcag aagata 364529DNAPapaver somniferum 45catgcctatc
tatttcctcc cttgccctc 294628DNAPapaver somniferum 46tgtcagccaa
ccattcgtcc atcctaac 284731DNAPapaver somniferum 47tgttcgatca
cgttgtctct ttttgccata a 314838DNAPapaver somniferum 48taacaataaa
agtactgata atggtggtcg aaggagaa 384930DNAPapaver somniferum
49ataatggtgg tcgaaggaga atcagtaatc 305022DNAPapaver somniferum
50gaggtgttca ttgccatgtc aa 225122DNAPapaver somniferum 51gtttcgcaag
ctcctgcata gt 225237DNAPapaver somniferum 52aaactcgaga agcttatgat
catgagtaac ttatgga 375328DNAPapaver somniferum 53aaaggtaccc
caacaggcca ttccgttg 285433DNAPapaver somniferum 54aaactcgaga
agctttagga gggtatgtcc ggc 335528DNAPapaver somniferum 55aaaggtacct
taactccgcc tcggctcc 285636DNAArtificialoligo T primer for cDNA
synthesis 56attctagatc cracatgttt tttttttttt tttttt 36
* * * * *