U.S. patent number 9,585,971 [Application Number 14/485,024] was granted by the patent office on 2017-03-07 for recombinant aav capsid protein.
This patent grant is currently assigned to CALIFORNIA INSTITUTE OF TECHNOLOGY. The grantee listed for this patent is California Institute of Technology. Invention is credited to Benjamin E. Deverman, Viviana Gradinaru, Paul H. Patterson.
United States Patent |
9,585,971 |
Deverman , et al. |
March 7, 2017 |
Recombinant AAV capsid protein
Abstract
Provided herein are methods of selective screening. In addition,
various targeting proteins and sequences, as well as methods of
their use, are also provided.
Inventors: |
Deverman; Benjamin E.
(Pasadena, CA), Patterson; Paul H. (Altadena, CA),
Gradinaru; Viviana (La Canada --Flintridge, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
California Institute of Technology |
Pasadena |
CA |
US |
|
|
Assignee: |
CALIFORNIA INSTITUTE OF
TECHNOLOGY (Pasadena, CA)
|
Family
ID: |
52666345 |
Appl.
No.: |
14/485,024 |
Filed: |
September 12, 2014 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20150079038 A1 |
Mar 19, 2015 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
61877506 |
Sep 13, 2013 |
|
|
|
|
61983624 |
Apr 24, 2014 |
|
|
|
|
62020658 |
Jul 3, 2014 |
|
|
|
|
62034060 |
Aug 6, 2014 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K
7/06 (20130101); A61K 39/3955 (20130101); C12N
15/1068 (20130101); C07K 14/005 (20130101); A61K
38/2093 (20130101); A61K 48/005 (20130101); A61K
38/50 (20130101); A61K 38/47 (20130101); A61K
38/1709 (20130101); A61K 38/4813 (20130101); C12N
15/86 (20130101); A61K 48/0058 (20130101); C12N
7/00 (20130101); C07K 2319/33 (20130101); A61K
38/00 (20130101); C12N 2750/14143 (20130101); C12N
2810/6027 (20130101); C12Y 304/14009 (20130101); C12N
2750/14145 (20130101); C12N 2750/14122 (20130101); C12Y
305/01015 (20130101) |
Current International
Class: |
C07K
7/06 (20060101); A61K 38/50 (20060101); A61K
38/47 (20060101); A61K 38/00 (20060101); C12N
7/00 (20060101); C12N 15/85 (20060101); A61K
38/20 (20060101); A61K 38/48 (20060101); A61K
38/17 (20060101); A61K 48/00 (20060101); C12N
15/86 (20060101); A61K 39/395 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 2005/017101 |
|
Feb 2005 |
|
WO |
|
Other References
Wu et al., Mutational Analysis of the Adeno-Associated Virus Type 2
(AAV2) Capsid Gene and Construction of AAV2 Vectors with Altered
Tropism, 2000, Journal of Virology, vol. 74, No. 18, pp. 8635-8647.
cited by examiner .
Albert, H., Dale, E. C., Lee, E., & Ow, D. W. (1995).
Site-specific integration of DNA into wild-type and mutant lox
sites placed in the plant genome. The Plant journal : for cell and
molecular biology, 7(4), 649-659. cited by applicant .
Araki, K., Araki, M., and Yamamura, K. (1997). Targeted integration
of DNA using mutant lox sites in embryonic stem cells. Nucleic
Acids Res 25, 868-872. cited by applicant .
Aschauer, D.F., Kreuz, S., and Rumpel, S. (2013). Analysis of
transduction efficiency, tropism and axonal transport of AAV
serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain. PLoS One 8,
e76310. cited by applicant .
Asokan, A. (2010). Reengineered AAV vectors: old dog, new tricks.
Discovery medicine 9, 399-403. cited by applicant .
Asokan, A., Schaffer, D.V., and Samulski, R.J. (2012). The AAV
Vector Toolkit: Poised at the Clinical Crossroads. Molecular
therapy : the journal of the American Society of Gene Therapy.
cited by applicant .
Ayuso, E., Mingozzi, F., Montane, J., Leon, X., Anguela, X. M.,
Haurigot, V., et al. (2010). High AAV vector purity results in
serotype- and tissue-independent enhancement of transduction
efficiency. Gene Therapy, 17(4), 503-510. doi:10.1038/gt.2009.157.
cited by applicant .
Balazs, A.B., Bloom, J.D., Hong, C.M., Rao, D.S., and Baltimore, D.
(2013). Broad protection against influenza infection by vectored
immunoprophylaxis in mice. Nature biotechnology. cited by applicant
.
Balazs, A.B., Chen, J., Hong, C.M., Rao, D.S., Yang, L., and
Baltimore, D. (2011). Antibody-based protection against HIV
infection by vectored immunoprophylaxis. Nature 481, 81-84. cited
by applicant .
Bartel, M., Schaffer, D.V., and Buning, H. (2011). Enhancing the
Clinical Potential of AAV Vectors by Capsid Engineering to Evade
Pre-Existing Immunity. Frontiers in microbiology 2, 204. cited by
applicant .
Callaway, E.M. (2008). Transneuronal circuit tracing with
neurotropic viruses. Curr Opin Neurobiol 18, 617-623. cited by
applicant .
Castle, M.J., Gershenson, Z.T., Giles, A.R., Holzbaur, E.L., and
Wolfe, J.H. (2014a). Adeno-Associated Virus Serotypes 1, 8, and 9
Share Conserved Mechanisms for Anterograde and Retrograde Axonal
Transport. Hum Gene Ther. cited by applicant .
Cearley, C.N., and Wolfe, J.H. (2007). A single injection of an
adeno-associated virus vector into nuclei with divergent
connections results in widespread vector distribution in the brain
and global correction of a neurogenetic disease. The Journal of
neuroscience : the official journal of the Society for Neuroscience
27, 9928-9940. cited by applicant .
Chung, K., and Deisseroth, K. (2013). Clarity for mapping the
nervous system. Nat Methods 10, 508-513. cited by applicant .
Dalkara, D., Byrne, L.C., Klimczak, R.R., Visel, M., Yin, L.,
Merigan, W.H., Flannery, J.G., and Schaffer, D.V. (2013). In
vivo-directed evolution of a new adeno-associated virus for
therapeutic outer retinal gene delivery from the vitreous. Science
translational medicine 5, 189ra176. cited by applicant .
Duque, S., Joussemet, B., Riviere, C., Marais, T., Dubreil, L.,
Douar, A.-M., Fyfe, J., Moullier, P., Colle, M.-A., and Barkats, M.
(2009). Intravenous Administration of Self-complementary AAV9
Enables Transgene Delivery to Adult Motor Neurons. Molecular
therapy : the journal of the American Society of Gene Therapy 17,
1187-1196. cited by applicant .
Excoffon, K.J.D.A., Koerber, J.T., Dickey, D.D., Murtha, M.,
Keshavjee, S., Kaspar, B.K., Zabner, J., and Schaffer, D.V. (2009).
Directed evolution of adeno-associated virus to an infectious
respiratory virus. Proceedings of the National Academy of Sciences
of the United States of America 106, 3865-3870. cited by applicant
.
Fenno, L., Yizhar, O., and Deisseroth, K. (2011). The development
and application of optogenetics. Annual review of neuroscience 34,
389-412. cited by applicant .
Fenno, L.E., Mattis, J., Ramakrishnan, C., Hyun, M., Lee, S.Y., He,
M., Tucciarone, J., Selimbeyoglu, A., Berndt, A., Grosenick, L., et
al. (2014). Targeting cells with single vectors using
multiple-feature Boolean logic. Nat Methods 11, 763-772. cited by
applicant .
Foust, K.D., Nurre, E., Montgomery, C.L., Hernandez, A., Chan,
C.M., and Kaspar, B.K. (2009). Intravascular AAV9 preferentially
targets neonatal neurons and adult astrocytes. Nature biotechnology
27, 59-65. cited by applicant .
Foust, K.D., Salazar, D.L., Likhite, S., Ferraiuolo, L., Ditsworth,
D., Ilieva, H., Meyer, K., Schmelzer, L., Braun, L., Cleveland,
D.W., et al. (2013). Therapeutic AAV9-mediated Suppression of
Mutant SOD1 Slows Disease Progression and Extends Survival in
Models of Inherited ALS. Molecular therapy : the journal of the
American Society of Gene Therapy. cited by applicant .
Foust, K.D., Wang, X., McGovern, V.L., Braun, L., Bevan, A.K.,
Haidet, A.M., Le, T.T., Morales, P.R., Rich, M.M., Burghes, A.H.,
et al. (2010). Rescue of the spinal muscular atrophy phenotype in a
mouse model by early postnatal delivery of SMN. Nat Biotechnol 28,
271-274. cited by applicant .
Garcia, A.D.R., Doan, N.B., Imura, T., Bush, T.G., and Sofroniew,
M.V. (2004). GFAP-expressing progenitors are the principal source
of constitutive neurogenesis in adult mouse forebrain. Nature
neuroscience 7, 1233-1241. cited by applicant .
Garg, S.K., Lioy, D.T., Cheval, H., McGann, J.C., Bissonnette,
J.M., Murtha, M.J., Foust, K.D., Kaspar, B.K., Bird, A., and
Mandel, G. (2013). Systemic Delivery of MeCP2 Rescues Behavioral
and Cellular Deficits in Female Mouse Models of Rett Syndrome. The
Journal of neuroscience : the official journal of the Society for
Neuroscience 33, 13612-13620. cited by applicant .
Gaudet, D., de Wal, J., Tremblay, K., Dery, S., van Deventer, S.,
Freidig, A., Brisson, D., and Methot, J. (2010). Review of the
clinical development of alipogene tiparvovec gene therapy for
lipoprotein lipase deficiency. Atherosclerosis Supplements 11,
55-60. cited by applicant .
Gray, S.J., Blake, B.L., Criswell, H.E., Nicolson, S.C., Samulski,
R.J., and McCown, T.J. (2009). Directed Evolution of a Novel
Adeno-associated Virus (AAV) Vector That Crosses the
Seizure-compromised Blood-Brain Barrier (BBB). Molecular therapy :
the journal of the American Society of Gene Therapy 18, 570-578.
cited by applicant .
Gray, S.J., Matagne, V., Bachaboina, L., Yadav, S., Ojeda, S.R.,
and Samulski, R.J. (2011). Preclinical Differences of Intravascular
AAV9 Delivery to Neurons and Glia: A Comparative Study of Adult
Mice and Nonhuman Primates. Molecular therapy : the journal of the
American Society of Gene Therapy 19, 1058-1069. cited by applicant
.
Gray, S. J., Choi, V. W., Asokan, A., Haberman, R. A., McCown, T.
J., & Samulski, R. J. (2011). Production of recombinant
adeno-associated viral vectors and use in in vitro and in vivo
administration. Current Protocols in Neuroscience / Editorial
Board, Jacqueline N. Crawley . . . [Et Al.], Chapter 4, Unit 4.17.
doi:10.1002/0471142301.ns0417s57. cited by applicant .
Grimm, D., Lee, J.S., Wang, L., Desai, T., Akache, B., Storm, T.A.,
and Kay, M.A. (2008). In vitro and in vivo gene therapy vector
evolution via multispecies interbreeding and retargeting of
adeno-associated viruses. Journal of virology 82, 5887-5911. cited
by applicant .
Grieger, J. C., Choi, V. W., & Samulski, R. J. (2006).
Production and characterization of adeno-associated viral vectors.
Nature Protocols, 1(3), 1412-1428. doi:10.1038/nprot.2006.207.
cited by applicant .
National Institute of Health. Advisory Committee to the Director
(2013). Interim Report: Brain Research Through Advancing Innovation
Neurotechnologies (BRAIN) Working Group. Sep. 16, 1-58. cited by
applicant .
Hirt, B. (1967). Selective extraction of polyoma DNA from infected
mouse cell cultures. Journal of Molecular Biology, 26(2), 365-369.
cited by applicant .
Hutson, T.H., Verhaagen, J., Yanez-Munoz, R.J., and Moon, L.D.F.
(2012). Corticospinal tract transduction: a comparison of seven
adeno-associated viral vector serotypes and a non-integrating
lentiviral vector. Gene therapy 19, 49-60. cited by applicant .
Inagaki, K., Piao, C., Kotchey, N.M., Wu, X., and Nakai, H. (2008).
Frequency and spectrum of genomic integration of recombinant
adeno-associated virus serotype 8 vector in neonatal mouse liver. J
Virol 82, 9513-9524. cited by applicant .
Kaeppel, C., Beattie, S.G., Fronza, R., van Logtenstein, R.,
Salmon, F., Schmidt, S., Wolf, S., Nowrouzi, A., Glimm, H., von
Kalle, C., et al. (2013). A largely random AAV integration profile
after LPLD gene therapy. Nat Med 19, 889-891. cited by applicant
.
Kaplitt, M.G., Feigin, A., Tang, C., Fitzsimons, H.L., Mattis, P.,
Lawlor, P.A., Bland, R.J., Young, D., Strybing, K., Eidelberg, D.,
et al. (2007). Safety and tolerability of gene therapy with an
adeno-associated associated virus (AAV) borne GAD gene for
Parkinson's disease: an open label, phase I trial. Lancet 369,
2097-2105. cited by applicant .
Knipe, D., and Howley, P. (2007). Fields of virology. edition
(2006), Section 57, vol. II (Lippincott Williams & Wilkins).
cited by applicant .
Koerber, J.T., Maheshri, N., Kaspar, B.K., and Schaffer, D.V.
(2006). Construction of diverse adeno-associated viral libraries
for directed evolution of enhanced gene delivery vehicles. Nature
protocols 1, 701-706. cited by applicant .
Levitt, N., Briggs, D., Gil, A., and Proudfoot, N.J. (1989).
Definition of an efficient synthetic poly(A) site. Genes and
Development 3, 1019-1025. cited by applicant .
Limberis, M.P., Adam, V.S., Wong, G., Gren, J., Kobasa, D., Ross,
T.M., Kobinger, G.P., Tretiakova, A., and Wilson, J.M. (2013).
Intranasal antibody gene transfer in mice and ferrets elicits broad
protection against pandemic influenza. Sci Transl Med 5, 187ra172.
cited by applicant .
Lisowski, L., Dane, A.P., Chu, K., Zhang, Y., Cunningham, S.C.,
Wilson, E.M., Nygaard, S., Grompe, M., Alexander, I.E., and Kay,
M.A. (2014). Selection and evaluation of clinically relevant AAV
variants in a xenograft liver model. Nature 506, 382-386. cited by
applicant .
Low, K., Aebischer, P., and Schneider, B.L. (2013). Direct and
retrograde transduction of nigral neurons with AAV6, 8, and 9 and
intraneuronal persistence of viral particles. Human gene therapy
24, 613-629. cited by applicant .
Luo, L., Callaway, E.M., and Svoboda, K. (2008). Genetic dissection
of neural circuits. Neuron 57, 634-660. cited by applicant .
Maguire, A.M., Simonelli, F., Pierce, E.A., Pugh, E.N., Jr.,
Mingozzi, F., Bennicelli, J., Banfi, S., Marshall, K.A., Testa, F.,
Surace, E.M., et al. (2008). Safety and efficacy of gene transfer
for Leber's congenital amaurosis. N Engl J Med 358, 2240-2248.
cited by applicant .
Maguire, C. A., Gianni, D., Meijer, D. H., Shaket, L. A., Wakimoto,
H., Rabkin, S. D., et al. (2010). Directed evolution of
adeno-associated virus for glioma cell transduction. Journal of
neuro-oncology, 96(3), 337-347. doi:10.1007/s11060-009-9972-7.
cited by applicant .
Maheshri, N., Koerber, J.T., Kaspar, B.K., and Schaffer, D.V.
(2006). Directed evolution of adeno-associated virus yields
enhanced gene delivery vectors. Nature biotechnology 24, 198-204.
cited by applicant .
Marshel, J.H., Mori, T., Nielsen, K.J., and Callaway, E.M. (2010).
Targeting single neuronal networks for gene expression and cell
labeling in vivo. Neuron 67, 562-574. cited by applicant .
Martino, A.T., Suzuki, M., Markusic, D.M., Zolotukhin, I., Ryals,
R.C., Moghimi, B., Ertl, H.C., Muruve, D.A., Lee, B., and Herzog,
R.W. (2011). The genome of self-complementary adeno-associated
viral vectors increases Toll-like receptor 9-dependent innate
immune responses in the liver. Blood 117, 6459-6468. cited by
applicant .
McBride, J.L., Pitzer, M.R., Boudreau, R.L., Dufour, B., Hobbs, T.,
Ojeda, S.R., and Davidson, B.L. (2011). Preclinical safety of
RNAi-mediated HTT suppression in the rhesus macaque as a potential
therapy for Huntington's disease. Molecular therapy : the journal
of the American Society of Gene Therapy 19, 2152-2162. cited by
applicant .
McCarty, D.M. (2008). Self-complementary AAV vectors; advances and
applications. Molecular therapy : the journal of the American
Society of Gene Therapy 16, 1648-1656. cited by applicant .
MGI Mouse Genome Informatics Web Site. Available at
htto://www.informatics.jax.org in some form no later than Aug. 6,
2014. While no copy of the website as it existed on Aug. 6, 2014 is
in Applicant's possession, Applicant has provided a copy of the
website that was printed on Jan. 22, 2015. cited by applicant .
Mittermeyer, G., Christine, C.W., Rosenbluth, K.H., Baker, S.L.,
Starr, P., Larson, P., Kaplan, P.L., Forsayeth, J., Aminoff, M.J.,
and Bankiewicz, K.S. (2012). Long-term evaluation of a phase 1
study of AADC gene therapy for Parkinson's disease. Hum Gene Ther
23, 377-381. cited by applicant .
Nathwani, A. C., Tuddenham, E. G. D., Rangarajan, S., Rosales, C.,
McIntosh, J., Linch, D. C., et al. (2011). Adenovirus-associated
virus vector-mediated gene transfer in hemophilia B. The New
England Journal of Medicine, 365(25), 2357-2365.
doi:10.1056/NEJMoa1108046. cited by applicant .
Nathwani, A.C., Rosales, C., McIntosh, J., Rastegarlari, G.,
Nathwani, D., Raj, D., Nawathe, S., Waddington, S.N., Bronson, R.,
Jackson, S., et al. (2011). Long-term safety and efficacy following
systemic administration of a self-complementary AAV vector encoding
human FIX pseudotyped with serotype 5 and 8 capsid proteins.
Molecular therapy : the journal of the American Society of Gene
Therapy 19, 876-885. cited by applicant .
Nowrouzi, A., Penaud-Budloo, M., Kaeppel, C., Appelt, U., Le
Guiner, C., Moullier, P., von Kalle, C., Snyder, R.O., and Schmidt,
M. (2012). Integration frequency and intermolecular recombination
of rAAV vectors in non-human primate skeletal muscle and liver. Mol
Ther 20, 1177-1186. cited by applicant .
Osakada, F., Mori, T., Cetin, A.H., Marshel, J.H., Virgen, B., and
Callaway, E.M. (2011). New rabies virus variants for monitoring and
manipulating activity and gene expression in defined neural
circuits. Neuron 71, 617-631. cited by applicant .
Pulicherla, N., Shen, S., Yadav, S., Debbink, K., Govindasamy, L.,
Agbandje-Mckenna, M., and Asokan, A. (2011). Engineering
Liver-detargeted AAV9 Vectors for Cardiac and Musculoskeletal Gene
Transfer. Molecular therapy : the journal of the American Society
of Gene Therapy 19, 1070-1078. cited by applicant .
Salegio, E.A., Samaranch, L., Kells, A.P., Mittermeyer, G., San
Sebastian, W., Zhou, S., Beyer, J., Forsayeth, J., and Bankiewicz,
K.S. (2013). Axonal transport of adeno-associated viral vectors is
serotype-dependent. Gene Ther 20, 348-352. cited by applicant .
Samaranch, L., Salegio, E.A., San Sebastian, W., Kells, A.P.,
Foust, K.D., Bringas, J.R., Lamarre, C., Forsayeth, J., Kaspar,
B.K., and Bankiewicz, K.S. (2012). Adeno-associated virus serotype
9 transduction in the central nervous system of nonhuman primates.
Hum Gene Ther 23, 382-389. cited by applicant .
Schaffer, D.V., Koerber, J.T., and Lim, K.-i. (2008). Molecular
Engineering of Viral Gene Delivery Vehicles. Annual Review of
Biomedical Engineering 10, 169-194. cited by applicant .
Simonelli, F., Maguire, A. M., Testa, F., Pierce, E. A., Mingozzi,
F., Bennicelli, J. L., et al. (2009). Gene Therapy for Leber's
Congenital Amaurosis is Safe and Effective Through 1.5 Years After
Vector Administration. Molecular Therapy : the Journal of the
American Society of Gene Therapy, 18(3), 643-650.
doi:10.1038/mt.2009.277. cited by applicant .
Smith, A.D., and Bolam, J.P. (1990). The neural network of the
basal ganglia as revealed by the study of synaptic connections of
identified neurones. Trends Neurosci 13, 259-265. cited by
applicant .
Sonntag, F., Schmidt, K., and Kleinschmidt, J.A. (2010). A viral
assembly factor promotes AAV2 capsid formation in the nucleolus.
Proceedings of the National Academy of Sciences of the United
States of America 107, 10220-10225. cited by applicant .
Southwell, A.L., Ko, J., and Patterson, P.H. (2009). Intrabody gene
therapy ameliorates motor, cognitive, and neuropathological
symptoms in multiple mouse models of Huntington's disease. The
Journal of neuroscience : the official journal of the Society for
Neuroscience 29, 13589-13602. cited by applicant .
Tang et al., "Role of ornithine decarboxylase antizyme inhibitor in
vivo", Genes to Cells, Dec. 10, 2008, vol. 14, No. 1, pp. 79-87.
cited by applicant .
Tomer, R., Ye, L., Hsueh, B., and Deisseroth, K. (2014). Advanced
Clarity for rapid and high-resolution imaging of intact tissues.
Nat Protoc 9, 1682-1697. cited by applicant .
Valori, C.F., Ning, K., Wyles, M., Mead, R.J., Grierson, A.J.,
Shaw, P.J., and Azzouz, M. (2010). Systemic delivery of scAAV9
expressing SMN prolongs survival in a model of spinal muscular
atrophy. Sci Transl Med 2, 35ra42. cited by applicant .
Vandendriessche, T., Thorrez, L., Acosta-Sanchez, A., Petrus, I.,
Wang, L., Ma, L., DE Waele, L., Iwasaki, Y., Gillijns, V., Wilson,
J.M., et al. (2007). Efficacy and safety of adeno-associated viral
vectors based on serotype 8 and 9 vs. lentiviral vectors for
hemophilia B gene therapy. Journal of thrombosis and haemostasis :
JTH 5, 16-24. cited by applicant .
Wall, N.R., De La Parra, M., Callaway, E.M., and Kreitzer, A.C.
(2013). Differential innervation of direct- and indirect-pathway
striatal projection neurons. Neuron 79, 347-360. cited by applicant
.
Wang, J., Xie, J., Lu, H., Chen, L., Hauck, B., Samulski, R. J.,
& Xiao, W. (2007). Existence of transient functional
double-stranded DNA intermediates during recombinant AAV
transduction. Proceedings of the National Academy of Sciences of
the United States of America, 104(32), 13104-13109.
doi:10.1073/pnas.0702778104. cited by applicant .
Wu, T., Topfer, K., Lin, S.W., Li, H., Bian, A., Zhou, X.Y., High,
K.A., and Ertl, H.C. (2012). Self-complementary AAVs induce more
potent transgene product-specific immune responses compared to a
single-stranded genome. Mol Ther 20, 572-579. cited by applicant
.
Yang, B., Li, S., Wang, H., Guo, Y., Gessler, D.J., Cao, C., Su,
Q., Kramer, J., Zhong, L., Ahmed, S.S., et al. (2014a). Global CNS
Transduction of Adult Mice by Intravenously Delivered rAAVrh.8 and
rAAVrh.10 and Nonhuman Primates by rAAVrh.10. Molecular Therapy 22,
1299-1309. cited by applicant .
Yang, B., Treweek, J.B., Kulkarni, R.P., Deverman, B.E., Chen,
C.K., Lubeck, E., Shah, S., Cai, L., and Gradinaru, V. (2014b).
Single-Cell Phenotyping within Transparent Intact Tissue through
Whole-Body Clearing. Cell. cited by applicant .
Yang, L., Jiang, J., Drouin, L.M., Agbandje-McKenna, M., Chen, C.,
Qiao, C., Pu, D., Hu, X., Wang, D.Z., Li, J., et al. (2009). A
myocardium tropic adeno-associated virus (AAV) evolved by DNA
shuffling and in vivo selection. Proceedings of the National
Academy of Sciences of the United States of America 106, 3946-3951.
cited by applicant .
Zariwala et al., "A Cre-dependent GCaMP3 reporter mouse for
neuronal imaging in vivo", J. Neurosci., Feb. 29, 2012, Vo. 32, No.
9, pp. 3131-3141. cited by applicant .
Albert et al., "Site-specific integration of DNA into wild-type and
mutant lox sites placed in the plant genome," The Plant Journal:
for cell and molecular biology, vol. 7(4), pp. 649-659, 1995. cited
by applicant .
Castle et al., "Long-distance axonal transport of AAV9 is driven by
dynein and kinesin-2 and is trafficked in a highly motile
Rab7-positive compartment," Molecular Therapy, vol. 22, pp.
554-566, 2014. cited by applicant .
Farris et al., "Improved splicing of adeno-associated viral (AAV)
capsid protein-supplying pre-mRNAs leads to increased recombinant
AAV vector production," Human Gene Therapy, vol. 19: p. 1421-1427.
2008. cited by applicant .
Flotte et al., "Adeno-associated virus vectors for gene therapy of
cystic fibrosis," Methods Enzymol, vol. 292, pp. 717-732, 1998.
cited by applicant .
Gibson et al., "Enzymatic assembly of DNA molecules up to several
hundred kilobases," Nature Methods, vol. 6(5), pp. 343-345, 2009.
cited by applicant .
Kaplitt et al., "Long-term gene expression and phenotypic
correction using adeno-associated virus vectors in the mammalian
brain," Nature, vol. 8, pp. 148-154, 1994. cited by applicant .
Kessler et al., "Gene delivery to skeletal muscle results in
sustained expression and systemic delivery of a therapeutic
protein," Proceedings of the National Academy of Sciences USA, vol.
93, pp. 14082-14087, 1996. cited by applicant .
Qiu et al., "Characterization of the Transcription Profile of
Adeno-Associated Virus Type 5 Reveals a Number of Unique Features
Compared to Previously Characterized Adeno-Associated Viruses,"
Journal of Virology., vol. 76, pp. 12435-12447, 2002. cited by
applicant .
Samaranch et al, "AAV9 Transduction in the Central Nervous System
of Non-Human Primates," Human gene therapy, vol. 22, pp. 329-337,
2011. cited by applicant .
Sambrook et el., Molecular Cloning: A Laboratory Manual, 2nd Ed.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989. cited by applicant .
Savitt et al., "Bcl-x Is Required for Proper Development of the
Mouse Substantia Nigra," The Journal of Neuroscience, vol. 25, pp.
6721-6728, 2005. cited by applicant .
Wagner et al., "Efficient and persistent gene transfer of AAV-CFTR
in maxillary sinus," Lancet, vol. 351, Issue 9117, pp. 1702-1703,
1998. cited by applicant .
Zolotukhin et al., "Recombinant adeno-associated virus purification
using novel methods improves infectious titer and yield," Gene
Therapy, vol. 6, pp. 973-985, 1999. cited by applicant .
International Preliminary Report on Patentability of Mar. 15, 2016
for International Patent Application No. PCT/US2014/055490 filed
Sep. 12, 2014, 10 pages. cited by applicant .
Internation Search Report and Written Opinion of Dec. 24, 2014 for
International Patent Application No. PCT/US2014/055490 filed Sep.
12, 2014, 18 pages. cited by applicant.
|
Primary Examiner: Blumel; Benjamin P
Attorney, Agent or Firm: Knobbe, Martens, Olson & Bear
LLP
Government Interests
STATEMENT REGARDING FEDERALLY SPONSORED R&D
This invention was made with government support under Grant No.
MH100556, Grant No. MH086383, Grant No. AG047664 and Grant No.
0D017782 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
What is claimed is:
1. An AAV vector comprising an amino acid sequence that comprises
at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID
NO: 1) or KFPVALT (SEQ ID NO: 3).
2. The AAV vector of claim 1, wherein the amino acid sequence is
part of a capsid protein of the AAV vector.
3. The AAV vector of claim 1, wherein the sequence TLAVPFK (SEQ ID
NO: 1) is inserted between AA588-589 of SEQ ID NO: 2 of the
vector.
4. The AAV vector of claim 1, wherein the sequence TLAVPFK (SEQ ID
NO: 1) is inserted between AA586-592 of SEQ ID NO: 2 of the
vector.
5. The AAV vector of claim 1, wherein the sequence TLAVPFK (SEQ ID
NO: 1) further comprises at least two of amino acids selected from
the group consisting of: 587, 588, 589, or 590 of SEQ ID NO: 2.
6. An AAV capsid protein comprising SEQ ID NO: 1.
7. The AAV capsid protein of claim 6, further conjugated to a
nanoparticle or second molecule.
8. The AAV capsid protein of claim 6, wherein the AAV capsid
protein is part of an AAV.
9. The AAV capsid protein of claim 8, wherein the AAV is an
AAV9.
10. An AAV capsid protein comprising an amino acid sequence that
comprises at least 4 contiguous amino acids from the sequence
TLAVPFK (SEQ ID NO: 1) or KFPVALT (SEQ ID NO: 3).
Description
RELATED APPLICATIONS
This application is a nonprovisional application of U.S.
Provisional Application Ser. No. 61/877,506, filed Sep. 13, 2013;
Ser. No. 61/983,624, filed Apr. 24, 2014; Ser. No. 62/020,658,
filed Jul. 3, 2014; and Ser. No. 62/034,060, filed Aug. 6, 2014,
each of which is hereby incorporated by reference in their
entireties.
SEQUENCE LISTING IN ELECTRONIC FORMAT
The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CALTE103A_SUBSTITUTE_SEQUENCELISTING.txt, created on
Oct. 21, 2014, last modified on Nov. 12, 2014, which is 98,622
bytes in size. The information in the electronic format of the
Sequence Listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
The present invention relates to methods of selective recovery and
targeting proteins and/or methods.
BACKGROUND
Recombinant adeno-associated viruses (rAAV) are vectors for in vivo
gene transfer applications. Several rAAV-based gene therapies are
proving to be efficacious, most notably for the treatment of
Leber's congenital amaurosis, hemophilia associated with factor IX
deficiency and lipoprotein lipase deficiency (Simonelli et al 2010;
Nathwani et al 2011; Gaudet et al. 2010). Recently, the first
rAAV-based gene therapy, Glybera, was approved by the European
Medicines Agency for the treatment of lipoprotein lipase
deficiency. rAAVs have also shown success in preclinical models of
a large variety of diseases, including Rett syndrome, congenital
ALS, Parkinson's, Huntington's disease, Spinal Muscular Atrophy,
among others and for the prophylactic delivery of broad
neutralizing antibodies against infectious diseases such as HIV and
influenza (Garg et al 2013; Valori et al. 2010; Foust et al. 2010;
Foust et al 2013; Southwell et al 2009; Balazs et al 2011; and
Balazs et al 2013). In addition, rAAVs are also popular vectors for
in vivo delivery of transgenes for non-therapeutic scientific
studies, such as optogenics.
SUMMARY OF THE INVENTION
In some embodiments, an AAV vector is provided that comprises an
amino acid sequence that comprises at least 4 contiguous amino
acids from the sequence TLAVPFK (SEQ ID NO: 1) or KFPVALT (SEQ ID
NO: 3).
In some embodiments, a central nervous system targeting peptide is
provided that comprises an amino acid sequence of SEQ ID NO: 1 (or
any of the amino acid sequences in FIG. 31).
In some embodiments, a nucleic acid sequence encoding any four
contiguous amino acids in TLAVPFK (SEQ ID NO: 1) or in KFPVALT (SEQ
ID NO: 3) is provided (or for any of the sequences from FIG.
31).
In some embodiments, a method of delivering a nucleic acid sequence
to a nervous system is provided. The method can comprise providing
a protein comprising TLAVPFK (SEQ ID NO: 1) (or any of the other
targeting sequences provided herein, for example, in FIG. 31),
wherein the protein is part of a capsid of an AAV, and wherein the
AAV comprises a nucleic acid sequence to be delivered to a nervous
system; and administering the AAV to the subject.
In some embodiments, an rAAV genome is provided that comprises at
least one inverted terminal repeat configured to allow packaging
into a vector and a cap gene.
In some embodiments a plasmid system is provided that comprises a
first plasmid comprising a modified AAV2/9 rep-cap helper plasmid
configured such that it eliminates at least one of VP1, VP2, or VP3
expression and a second plasmid comprising a rAAV-cap-in-cis
plasmid.
In some embodiments, a method of developing a capsid with a desired
characteristic is provided. The method can comprise providing a
population of rAAV genomes (of any provided herein), selecting the
population by a specific set of criteria, and selecting the rAAV
genome that meets the screening criteria.
In some embodiments, a capsid protein is provided that comprises an
amino acid sequence that comprises at least 4 contiguous amino
acids from the sequence TLAVPFK (SEQ ID NO: 1) or KFPVALT (SEQ ID
NO: 3) (or from any of the sequences in FIG. 31).
In some embodiments, a library of nucleic acid sequences is
provided. The library can comprise a selectable element and one or
more recombinase recognition sequences.
In some embodiments, a method of developing a capsid with a desired
characteristic is provided. The method comprises providing a
library of plasmids that comprise a capsid gene, and at least one
recombinase recognition sequence, configured such that it allows a
recombinase-dependent change in a sequence of a plasmid of the
library that comprises the capsid gene that is a detectable change.
The method can further comprise selecting the population by a
specific set of criteria and selecting the rAAV genome that meets
the screening criteria.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1A depicts various embodiments for aspects of various
targeting proteins (in this case, examples of AAV capsid proteins),
including G2B-13, G2B-26, TH1.1-32 and TH1.1-35.
FIG. 1B depicts some embodiments of selective recovery of capsid
proteins.
FIG. 2A depicts some embodiments of AAV genome manipulation.
FIG. 2B depicts some embodiments of capsid gene manipulation.
FIG. 2C depicts a flow chart for some embodiments of selective
recovery embodiments.
FIG. 2D depicts a schematic of AAV genes and their known products.
The AAV rep gene makes four protein products shown in black. The
cap gene makes three structural capsid proteins (VP1-3) from one
reading frame by a combination of alternative splicing and
alternative initiator codons. In addition, the capsid gene also
encodes an additional protein, assembly-activating protein (AAP),
which is expressed from an alternative reading frame.
FIG. 2E is a schematic for the design of constructs used for some
embodiments of the rAAV-based capsid library selection method. A
capsid gene is inserted within a recombinant AAV genome flanked by
ITRs. The expression and splicing of the AAV capsid gene products
is controlled by the AAV5 p41 promoter upstream of the AAV2 rep
sequences that contain the splice donor and intron sequences for
the capsid gene products. By eliminating most of the rep gene,
space (represented by the dotted lines) is available within the
rAAV cap-in-cis genome for the insertion of additional
elements.
FIG. 2F is a schematic showing the AAV components of the rep-AAP
helper plasmid. Five stop codons were inserted within the capsid VP
reading frame to ensure that VP1, VP2 and VP3 expression is
eliminated from the rep-AAP helper.
FIGS. 3A and 3B. A strategy for recombinase-dependent recovery of
sequences from transduced target cells. (FIG. 3A) The schematic
shows the cap-in-cis rAAV genome. A ubiquitin C promoter fragment
can be used to drive expression of an mCherry reporter followed by
a synthetic polyA sequence. An AAV capsid gene, controlled by rep
regulatory sequences, is followed by a lox71- and lox66-flanked
SV40 late polyA signal. The lox66 site is inverted relative to
lox71. In this configuration, Cre mediates the inversion (FIG. 3B)
of the sequence flanked by the mutant lox sites. After the
inversion, incompatible, double mutant lox72 and a loxP site are
generated, reducing the efficiency of inversion back to the
original state. Using PCR primers represented by the arrows in the
schematic, cap sequences can be recovered selectively from genomes
that have undergone a Cre-dependent inversion.
FIGS. 4A-4D. Alternative lox strategies for recombinase dependent
recovery. (FIG. 4A) Single inverted loxP or lox71 and lox66 sites
can be replaced by double loxP (white triangle) and lox2272 (black
triangle) for irreversible recombination. (FIG. 4B) loxP sites or
similar sites (lox2272 or other variants) inserted in the same
orientation to mediate a deletion also allow selective
recombination-dependent amplification. Recombination specific
recovery can be achieved by performing the PCR-based recovery with
three primers: one 5' of the randomized sequence (black arrow), one
reverse primer downstream of the 3' loxP sequence (dark gray arrow)
and a second forward primer that binds specifically within the
deleted sequence (light gray arrow). This primer out competes the
5' (black) forward primer during amplification, reducing
amplification of cap sequences from non-recombined sequences.
Recovery of non-recombined sequences can also be reduced by
digestion with an enzyme that recognizes a site within the sequence
deleted by the recombinase. Alternatively, Cre-dependent and
-independent products can be separated by size by gel
electrophoresis. (FIGS. 4C & 4D) Inverted loxP, lox71 and lox66
(shown), or DIO, FLEX sites can be placed in alternative
configurations. (FIG. 4C) shows lox sites in an inverted
orientation surrounding the rep and cap sequences, which can be
inverted in the presence of Cre. (FIG. 4D) Schematic shows the
option of flanking the reporter with lox sites. In this embodiment,
the reporter is inverted and can be expressed after
recombination.
FIGS. 5A-5C. A split Rep/AAP helper and rAAV-Cap-lox vector
produces high titer virus. (FIG. 5A) DNase-resistant AAV genome
copies (GCs) produced with the split AAV2/9 rep-AAP and AAV9
cap-in-cis genome (left), the AAV2/9 rep-AAP and a mCherry
expressing rAAV genome (no cap--middle) or a control AAV2/9 rep/cap
helper with the same AAV2:mCherry genome (right). (FIG. 5B)
DNase-resistant viral GCs obtained from larger scale (7-10 150 mm
plate) preps of libraries with randomized 7-mer sequences replacing
AAV9 capsid amino acids 452-8 (left) or inserted after amino acid
588 (right) (n=4/per library.+-.SEM). (FIG. 5C) The PCR fragments
containing the capsid sequence variation (black, 452-8 or light
gray, 588) libraries are generated and cloned into a
rAAV9R-delta-X/Acap-in-cis vector that has been modified to insert
unique restriction sites XbaI (X) and AgeI (A) flanking the region
to be modified.
FIGS. 6A-6C. Cre-dependent sequence recovery after selection in Cre
transgenics or Cre+ cells. (FIG. 6A) The schematic shows an
overview of the selection process. In example 3, GFAP-Cre+ mice
were injected with AAV virus containing AAV9-cap-in-cis, or the cap
libraries with random 7mers at amino acids 452-8 or 588, and PCR
products were recovered using primers that selectively amplify
sequences from cap-in-cis genomes that have undergone Cre-mediated
inversion of the sequence 3' to the cap gene. (FIG. 6B) The image
shows an ethidium bromide-stained agarose gel of the PCR products
recovered after the second PCR step using primers 1331 and 1312.
(FIG. 6C) Recovered PCR products are then cloned into the
rAAV9R-delta-X/A-cap-in-cis vector as a first step to generate the
next round of capsid virus libraries.
FIG. 7. The novel AAV variants generate virus with efficiencies
similar to AAV9. The graph shows the DNase-resistant viral GCs
generated per 150 mm dish of near confluent 293 producer cells for
AAV9 and the four novel AAV serotypes.
FIGS. 8A-8C. G2B13 and G2B26 variants mediate enhanced transduction
of the brain and spinal cord after IV administration as compared to
AAV9. An AAV-CAG-eGFP-2A-ffLUC-WPRE-SV40 pA vector was packaged
into AAV9 (left) or the novel variants G2B13 (middle) or G2B26
(right). 1e12 GC of each virus was injected IV into individual
5-week old female wt C57Bl/6 mice and the brains of the mice were
assessed for GFP expression 6 days later. (FIG. 8A) Panels show
native eGFP fluorescence in whole brain. (FIG. 8B) Immunostaining
for eGFP expression in the sectioned brains of mice injected with
the indicated virus show efficient transduction of multiple cell
types including neurons (n) and astrocytes (a). (FIG. 8C) Panels
show native eGFP fluorescence in the livers of mice injected with
the indicated virus.
FIGS. 9A-9I. G2B13 and G2B26 variants mediate enhanced transduction
of CNS neurons and glia after IV administration as compared to
AAV9. A rAAV-CAG-eGFP-2A-ffLUC-WPRE-SV40-pA vector was packaged
into G2B13 (FIG. 9A-9C) or G2B26 (FIG. 9D-9I) and 1e12 GC of the
indicated virus was injected IV into individual 5-week old female
wt C57Bl/6 mice. (FIG. 9A-9B, FIG. 9D-9I) Panels show
immunostaining for eGFP in the sectioned brains of mice 6 days
after they were injected IV with G2B13:CAG-GFP2A-Luc (FIG. 9A-9B)
or G2B26:CAG-GFP2A-Luc (FIG. 9D, FIG. 9E, FIG. 9G-9I). Both vectors
show transduction of several cell types including neurons (n) and
astrocytes (a). (FIG. 9A-9B, FIG. 9D-9E, FIG. 9G-9H) Panels show
eGFP immunostaining (upper panels) and NeuN immunostaining (lower
panels) from paired image fields. (FIG. 9C and FIG. 9F) Panels show
native eGFP fluorescence in the spinal cords of mice injected with
G2B13 (FIG. 9C) or G2B26 (FIG. 9F). (FIG. 9I) Panel shows eGFP
immunostaining in (upper panels) co-localized (arrows) with the
glial marker Sox2 (lower panels) from the same image field.
FIG. 10. Strategy for generating further diversity by combining
sequences recovered at multiple sites. Following one or more rounds
of selection for novel cap variants at two different sites, the
pools of selected variants can be mixed to generate libraries that
combine the randomized sequences at two or more sites by
overlapping PCR. Using the same strategy, individual clones with
novel sequences at 2 more sites can also be combined to generate
clones with multiple modifications.
FIGS. 11A-11E. Cre-dependent sequence recovery after in vivo
selection. (FIG. 11A) The Brain Explorer 2 (Allen Brain Atlas)
schematic shows an overview of the selection process. Capsid virus
libraries were injected bilaterally into the straita of TH-Cre+
mice (asterisks show approximate injection sites), and capsid
sequences were recovered from the substantia nigra (highlighted
with a white square). (FIG. 11B) The image shows native mCherry
fluorescence from 1 mm slices through the forebrain containing the
striatal injection sites. (FIG. 11C) mCherry+ fibers from striatal
neurons can be seen in slices from the SNr. The SNr and SNc located
dorsal to the SNr were collected for capsid sequence recovery.
(FIG. 11D) Panels show ethidium bromide stained PCR products
recovered from TH-Cre+ cells of mice injected with AAV virus
containing the libraries with random 7mers at amino acids 452-8 or
588 (round 1). (FIG. 11E) Cap-in-cis genomes were recovered by a
Cre-independent PCR strategy from Cre+ and Cre- mice demonstrating
the presence of virus in all samples.
FIGS. 12A-12H. TH1.1-32 and -35 variants exhibit rapid and
efficient retrograde transduction of TH+ SNc neurons as well as
neurons in additional regions known to project to the striatum.
AAV-TH1.1-32:CAG-GFP or AAVTH1.1-35:CAG-GFP were injected into the
striatum of adult mice and mice were killed 7 days later for GFP
expression analysis. Panels show immunostaining for eGFP (FIG.
12A-B, FIG. 12D and FIG. 12F-H) or TH (FIG. 12C and FIG. 12E).
(FIG. 12A) GFP expression within the striatum surrounding the
injection site of the TH1.1-35 variant. (FIG. 12B-E) Panels show
GFP immunostaining (FIG. 12B and FIG. 12D) and TH immunostaining
(FIG. 12C and FIG. 12E) within the same image field within the SN.
Co-localization of GFP and TH+ immunostaining within the same cell
is noted with arrows. GFP expression is evident in the SNr and a
subpopulation of TH+ neurons in the SNc of a mouse injected with
TH1.1-35 (FIG. 12B-C) or TH1.1-32 (FIG. 12D-E). (FIG. 12F) GFP
immunostaining in the frontal cortex of a mouse injected with the
TH1.1-35 variant. GFP immunostaining in the thalamus (FIG. 12G) and
amygdala (FIG. 12H) of a mouse injected with the TH1.1-32
variant.
FIG. 13 depicts a sequence alignment of AAVs and related
parvoviruses showing diversity at 7mer insertion/replacement sites.
The figure is split into three parts, with the first sheet
representing the left-hand side of the figure, the second sheet
representing the middle part of the figure, and the third sheet of
FIG. 13 representing the right-hand side of the sheet. That is, the
names for each of the rows in the first sheet are intended to carry
across to the other two sheets (in each row).
FIG. 14 depicts a structural model of some embodiments of a capsid
protein showing the loop regions where targeting sequences can be
added or substituted in.
FIG. 15 depicts some embodiments of the rAAV9R-delta-X/A-cap-in-cis
vector.
FIG. 16 depicts some embodiments of an AAV rep/cap helper plasmid
that was modified by inserting a total of 5 stop codons within the
cap gene within the VP1, 2 and 3 reading frame (1 stop codon
disrupts VP3, 3 disrupt VP2 and all 5 disrupt VP1--FIG. 2F, SEQ ID
NO: 5).
FIG. 17 depicts some embodiments of a template DNA (pCRII-9R-X/A EK
plasmid, SEQ ID NO: 6.)
FIG. 18 depicts AAV9R-delta-X/A-cap-in-cis, SEQ ID NO: 7, in which
the coding region between the XbaI and AgeI sites was eliminated to
prevent "wt" AAV9R X/A capsid protein production from any
undigested vector during library virus production.
FIG. 19 depicts some embodiments of a sequence of an AAV-PHP.B
(AAV-G2B26) capsid VP1 protein.
FIG. 20 depicts some embodiments of a nucleic acid sequence for an
AAV-PHP.B (AAV-G2B26) capsid gene coding sequence.
FIG. 21 depicts some embodiments in which a nucleic acid sequence
for a targeting protein is cloned into an AAV Rep-Cap helper
plasmid.
FIGS. 22A-22F. Recombinase-dependent recovery of AAV capsid
sequences from transduced target cells. FIG. 22A is a schematic
showing the rAAV-cap-in-cis rAAV genome used for capsid library
generation. Cre mediates the inversion of the sequence flanked by
the mutant lox sites and PCR primers, represented by half arrows in
the schematic, are used to selectively amplify the recombined
sequences. (FIG. 22B) The schematic shows the AAV components of the
Rep-AAP helper plasmid. Stop codons inserted in the VP reading
frame eliminate VP1, VP2 and VP3. (FIG. 22C) DNase-resistant AAV
genome copies (GCs) produced with the split AAV2/9 rep-AAP and AAV9
cap-in-cis genome (left) as compared to a control AAV2/9 rep/cap
helper with a control AAV-UBC-mCherry genome (middle) or the AAV2/9
rep-AAP and control AAV-UBC-mCherry genome (no cap--right). (FIG.
22D) Representative PCR products showing Cre dependent (top) and
Cre independent (bottom) amplification of recovered capsid library
sequences from TH-Cre positive or Cre negative mice. (FIG. 22E) The
capsid sequence variation libraries at AA452-8 or after AA588 of
AAV9 (vertical gradient) are generated by PCR and cloned into a
rAAV-.DELTA.cap-in-cis vector that has been modified to insert
unique restriction sites XbaI (x) and AgeI (a) flanking the
variable region(s). (FIG. 22F) The schematic shows an overview of
some embodiments of the selection process.
FIGS. 23A-23H. AAV-PHP.R2 mediates rapid and efficient retrograde
transduction. (FIG. 23A) Capsid libraries were injected into the
striatum (left) and tissue from the substantia nigra was collected
for capsid sequence recovery 10 days later. (FIG. 23A) Images show
native mCherry fluorescence expressed from the cap-in-cis library
genomes surrounding the injection sites (left) and mCherry positive
axons from striatal neurons in the SNr (right). (FIG. 23B-FIG. 23H)
The recovered AAV variant PHP.R2 was used to package ssAAV-CAG-GFP
and 7.times.10.sup.9 VG was injected into the striatum. Seven days
later, the mice were assessed for GFP expression by immunostaining.
The images show GFP positive cells at the striatal injection site
(FIG. 23B) or at the indicated brain regions that contain GFP+ cell
bodies (FIG. 23C, FIG. 23E-I). (FIG. 23D) shows immunostaining for
TH in the SNc. (FIG. 23E) shows GFP immunostaining from the same
field shown in FIG. 23D. Co-localization of GFP and TH
immunostaining within the same cell is noted with arrows. Scale
bars are 100 um in C, E-H and 20 um in 23D.
FIGS. 24A-24I. AAV-PHP.B mediates robust transduction of the entire
CNS after IV administration. Representative images from mice
transduced with 1.times.10.sup.2 VG of ssAAV-CAG-GFP-2A-Luc
packaged in AAV9 or AAV-PHP.B. GFP expression was assessed 3 weeks
later by immunostaining (FIG. 24A and FIG. 24C) or native GFP
fluorescence (FIG. 24B, FIG. 24D-24G). (FIG. 24A) Images show GFP
immunostaining in sagittal brain sections from mice given AAV9
(left), an equivalent dose of AAV-PHP.B (middle) or
1.times.10.sup.11 VG of AAV-PHP.B (right). (FIG. 24B)
Representative cortical (left) or striatal (right) 50 um maximum
confocal projection images of native eGFP fluorescence from the
brains of mice treated as in 24A. (FIG. 24C) Nearly all
Calbindin.sup.+ Purkinje cells (bottom) are GFP.sup.+ (top) 3 weeks
after IV injection of 1.times.10.sup.12 VG of AAV-PHP.B (FIG. 24D)
Representative image of native GFP fluorescence from the lumbar
spinal cord. The inset shows an enlargement of the boxed ventral
spinal cord area. (FIG. 24E) Confocal maximum projection image of
GFP fluorescence from a whole mount retina. (FIG. 24F) Cross
section of the retina. (FIG. 24G) CLARITY images of GFP
fluorescence from the cortex (left), striatum (right) and ventral
spinal cord of a mouse transduced with 1.times.10.sup.12 VG of
AAV-PHP.B. AAV biodistribution in the brain (FIG. 24H) and
peripheral organs (FIG. 24I) 25 days after injection of
1.times.10.sup.11 VG IV into adult mice. N=3 for AAV-PHP.B and N=4
for AAV9; error bars show standard deviation (s.d.); *p<0.05,
***p<0.001, one-way ANOVA and Bonferroni's multiple comparison
test. Scale bars are 1 mm in FIG. 24A and FIG. 24D, 50 um in 24B,
and 200 .mu.m in FIG. 24C. Major tick marks in FIG. 24G are 100
um.
FIGS. 25A-25J. AAV-PHP.b transduces many CNS neuronal and glial
cell types. Representative images show immunostaining for GFP (FIG.
25A-25D, FIG. 25G-25I) or native GFP fluorescence (FIG. 25E, FIG.
25F, and FIG. 25J). Images are of the brain regions indicated in
the panel or striatum (FIG. 25E) or hippocampus (FIG. 25H). For
FIGS. 25A-25F, the left image shows the antigen immunostaining,
while the right image in each pair shows GFP expression. For FIGS.
25G-25J, the top image shows the indicated antigen immunostaining,
the middle images show GFP expression and the lower paired images
show a higher magnification views of the indicated boxed areas.
Mice received 1.times.10.sup.11 VG (FIG. 25A) or 1.times.10.sup.12
VG (FIG. 25B-25J) at 5-6 weeks of age and were assessed for eGFP
expression 3 weeks later. Scale bars are 50 .mu.m in FIG. 25A, and
20 .mu.m in FIG. 25B-25J. In all panels, arrows indicate
colocalization and asterisks indicate cells that are positive for
the indicated antigen but negative for GFP.
FIG. 26. Systemic, low-dose AAV-PHP.B reporter vector labeling can
be used together with CLARITY for single cell morphological
phenotyping. (FIG. 26A) A tiled image of the cortex shows sparse
labeling of cells with GFP after IV administration of
1.times.10.sup.10 VG of rAAV-PHP.B:CAG-GFP. The region highlighted
by the box is shown magnified in 3 different orientations (FIG.
26B). Two astrocytes can be seen making contact with a blood vessel
containing an endothelial cell with a GFP+ nucleus. The astrocyte
endfeet can be seen spiraling around the blood vessel. In some
embodiments, this can be used to label individual cells, assess the
morphology of the cells and see the material's impact on the cells.
(FIG. 26C) An image of the striatum shows sparse labeling of cells
with GFP after IV administration of 1.times.10.sup.10 VG of
rAAV-PHP.B:CAG-GFP. (FIG. 26D) An individual medium spiny neuron is
highlighted using an semi-automated filament tracing method
(Imaris, Bitplane software). (FIG. 26E) The same medium spiny
neuron highlighted in FIG. 26D is shown isolated along with several
closely associated neural processes. In some embodiments, this can
be used to sparsely label cells and assess the association of the
labeled cells.
FIGS. 27A-27C Primers used for generating capsid library fragments
and Cre-dependent capsid sequence recovery. (FIG. 27A) Schematic
shows PCR products as the right hand shaded section with 7AA of
randomized sequence (represented by vertical multishaded bars)
inserted after amino acid 588 (588i library) or replacing AA452-8
(452-8r library). The primers used to generate these libraries are
indicted by name and half arrow. For the generation of the second
library, the template was modified to eliminate a naturally
occurring EarI restriction site within the capsid gene fragment
(xE). In this way, any contamination from amplified wt AAV capsid
sequence could be eliminated by digesting the recovered libraries
with EarI. (FIG. 27B) Schematic shows the rAAV-Cap-in-cis vector
and the primers used to quantify vector genomes (left) and recover
sequences that have transduced Cre expressing cells (left). (FIG.
27C) The figure provides the sequences for the primers shown in
FIG. 27A and FIG. 27B. Table 0.1 also provides a listing of the
sequences:
TABLE-US-00001 TABLE 0.1 Primer Purpose Sequence 9CapF Step 1:
CAGGTCTTCACGGACTCAGACTATCAG SEQ ID forward NO: 16 CDF Step 1:
CAAGTAAAACCTCTACAAATGTGGTAA SEQ ID reversed AATCG NO: 17 by Cre XF
Step 2 ACTCATCGACCAATACTTGTACTATCT SEQ ID forward CTCTAGAAC NO: 18
AR Step 2 GGAAGTATTCCTTGGTTTTGAACCCA SEQ ID reverse NO: 19 TF qPCR
GGTCGCGGTTCTTGTTTGTGGAT SEQ ID forward NO: 20 TR qPCR
GCACCTTGAAGCGCATGAACTCCT SEQ ID reverse NO: 21 7xNNK 452-8r
CATCGACCAATACTTGTACTATCTCTCT SEQ ID library
AGAACTATTNNKNNKNNKNNKNNKNNKN NO: 22 gener-
NKCAAACGCTAAAATTCAGTGTGGCC ation GGA 7xMNN 588i
GTATTCCTTGGTTTTGAACCCAACCGGT SEQ ID library
CTGCGCCTGTGCMNNMNNMNNMNNMNNM NO: 23 gener-
NNMNNTTGGGCACTCTGGTGGTTTGTG ation
FIG. 27D The schematic shows an overview of some embodiments of a
process used to introduce 2-site randomization after the first
round of selection (combinatorial libraries). This process was used
to develop AAV-PHP.R2. Both libraries (452-8r and 588i) were
generated by PCR, cloned into the rAAV-Cap-in-cis vector and capsid
selection was performed in TH-Cre mice. Sequences from both
libraries were recovered and were combined using an overlapping PCR
strategy to generate a new library that should contain all possible
combinations of the 7mer sequences recovered from the 452-8r
library with all of the 7mer sequences recovered at the 588i in one
library. This library was subjected to a second round of selection
in TH-Cre mice and recovered variants that showed signs of
enrichment were characterized individually.
FIG. 27E DNase-resistant vector genomes (VGs) obtained from preps
of individual variants recovered from GFAP-Cre and TH-Cre
selections. Yields are given as vector genome copies per 150 mm
dish of producer cells. Error bars show s.d. N=3 for AAV9, PHP.A
and PHP.B. N=1 for PHP.r. One way analysis of variance (ANOVA).
FIG. 28A-28E AAV-PHP.A more efficiently and selectively transduces
CNS astrocytes. (FIG. 28A) Representative images of GFP
immunostaining of brain sections from mice injected as adults with
3.times.10.sup.11 VG of a ssAAV-CAG-eGFP expressing vector packaged
into AAV9 or PHP.A as indicated. (FIG. 28B) Panels show GFP
immunostaining (left) and cell nuclei (right) in the cortex of mice
that received AAV9 or PHP.A as indicated. AAV biodistribution in
the brain (FIG. 28C) and peripheral organs (FIG. 28D) 25 days after
injection of 1.times.10.sup.11 VG IV into adult mice. N=4; error
bars show standard deviation (s.d.); *p<0.05, **p<0.01,
***p<0.001, one-way ANOVA and Bonferroni's multiple comparison
test. (FIG. 28E) Representative images of GFP immunostaining of
liver sections from mice injected as adults with 3.times.10.sup.11
VG of a ssAAV-CAG-eGFP expressing vector packaged into AAV9 or
PHP.A as indicated. Scale bar is 50 .mu.m in 28B.
FIG. 29. Rapid cellular level tropism characterization with whole
animal tissue clearing. Images show native GFP fluorescence in the
indicated organs of mice 3 weeks after IV injection of
1.times.10.sup.12 AAV9 or AAV-PHP.B as indicated. The indicated
organs were rendered optically transparent using the PARS-based
CLARITY (a whole body tissue clearing method--Yang et al. 2014).
Confocal Z-stack images were reconstructed into three-dimensional
images using Imaris software (Bitplane).
FIG. 30 depicts a set of embodiments for amino acid and nucleic
acid of AAV9.
FIG. 31 Depicts a set of embodiments for additional targeting
proteins. Any of the targeting protein embodiments provided in FIG.
31 can be swapped out for any of the embodiments involving any
other particular targeting protein embodiment described herein.
Similarly, any of the nucleic acids provided in FIG. 31 can
similarly be swapped out for any of the particular nucleic acids
provided herein. The figure depicts the most highly enriched
sequences recovered from the second round of selection for AAV
variants that transduce GFAP-Cre+ astrocytes following intravenous
administration.
DETAILED DESCRIPTION OF EMBODIMENTS
rAAVs have reinvigorated the field of gene therapy and facilitate
the gene transfer critical for a wide variety of basic science
studies. Several characteristics make rAAVs attractive as gene
delivery vehicles: (i) they provide long-term transgene expression,
(ii) they are not associated with any known human disease, (iii)
they elicit relatively weak immune responses, (iv) they are capable
of transducing a variety of dividing and non-dividing cell types
and (v) the rAAV genome can be packaged into a variety of capsids,
or protein coat of the virus, which have different transduction
characteristics and tissue tropisms. Despite these advantages, the
use of AAV for many applications is limited by the lack of capsid
serotypes that can efficiently transduce certain difficult cell
types and by the lack of serotypes that can efficiently and
selectively target a desired cell type/organ after systemic
delivery.
Using Directed Evolution to Improve AAV Capsid Characteristics.
One approach that has been used to develop rAAVs with improved
tissue/cell type targeting is to perform directed evolution on the
AAV capsid gene. Typically this is done by making a library of
replication competent AAVs that are modified to introduce random
mutations into the AAV cap gene, which codes for the capsid
proteins that determines the tissue tropism. The AAV capsid virus
library is then injected in an animal or delivered to cells in
culture. After a certain time, capsid sequences that are present in
the cells/tissue of interest are recovered. These recovered
sequences are then used to generate a new pool of viruses and then
the process is repeated. Through repeated rounds of
selection/sequence recovery, sequences that generate capsids that
function better (i.e., those repeatedly pass the selection process)
will be enriched. The capsids that exhibit an improved ability to
transduce the target can then be recovered and assessed as
individual clones or mutated further and subjected to additional
rounds of selection.
Directed evolution has been used to generate AAVs that evade
neutralizing antibodies (Maheshri et al 2006) and better target
glioma cells (McGuire et al. 2010), airway epithelium (Excoffon et
al. 2009) and photoreceptors in the retina after intravitreal
injection (Dalkara et al 2013). In addition, using a human/mouse
chimeric liver model, Lisowski et al. developed a rAAV that
specifically and efficiently targeted the human hepatocytes
(2013).
Some of the embodiments herein described provide methods for the
enrichment and selective recovery of sequences with desirable
traits from libraries of sequence variants using a
recombination-dependent recovery strategy. This method is widely
applicable for the selective enrichment of sequences from
randomized libraries that mediate an increased contact between the
nucleic acid containing the randomized sequence and a recombinase
that recognizes a specific sequence or sequences present on the
same nucleic acid as the randomized sequence. The recombinase can
be expressed in response to desired stimuli, in a desired
subcellular compartment or expressed in a specific target
population of cells in vitro or in vivo.
As an example of the use of some embodiments, an option for
selectively recovering adenoassociated virus (AAV) capsid sequences
that encode capsid proteins that more efficiently and/or
selectively transduce specific Cre recombinase (Cre) expressing
target cell populations has been provided herein. Cre recognition
sites (loxP or variants of loxP sites) can be inserted into an rAAV
genome adjacent or flanking to the capsid gene. In this way, when
the capsid gene enters the nucleus of a Cre expressing cell and is
converted to dsDNA, Cre can induce a recombination event between
the lox sites within the rAAV genome resulting on an inversion or
deletion (depending on their relative orientations) of the sequence
flanked by the lox sites. Using a recovery strategy that is
dependent on the recombination event, capsid sequences that encode
capsids that direct the rAAV genome to the nucleus of Cre+ cells
can be enriched through one or more rounds of selection. Capsid
gene directed evolution is only one example application of this
technology. In some embodiments, the method can be adapted for the
selection of any other coding or non-coding sequences with
desirable traits within an AAV genome or any sequences within other
viruses or non-viral nucleic acids that alter the interaction with
the recombinase.
The following sections provide a brief set of definitions for the
various terms and then various embodiments that have been produced
through these screening methods. Following this, detailed variants
and embodiments of the screening method are provided, as well as
examples thereof.
DEFINITIONS
It is to be understood that both the foregoing general description
and the following detailed description are exemplary and
explanatory only and are not restrictive of the invention as
claimed. In this application, the use of the singular includes the
plural unless specifically stated otherwise. In this application,
the use of "or" means "and/or" unless stated otherwise.
Furthermore, the use of the term "including", as well as other
forms, such as "includes" and "included", is not limiting. Also,
terms such as "element" or "component" encompass both elements and
components comprising one unit and elements and components that
comprise more than one subunit unless specifically stated
otherwise. Also, the use of the term "portion" can include part of
a moiety or the entire moiety.
The section headings used herein are for organizational purposes
only and are not to be construed as limiting the subject matter
described. All documents, or portions of documents, cited in this
application, including but not limited to patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose. As
utilized in accordance with the present disclosure, the following
terms, unless otherwise indicated, shall be understood to have the
following meanings:
A "plasmid" is as a nucleic acid that can be used to replicate
recombinant DNA sequences within a host organism. The sequence can
be preferably double stranded DNA.
The term "recombinase recognition sequence" or "recombinase
recognition site" refers to a sequence of nucleic acid that is
recognizable by a recombinase and can serve as the substrate for a
recombination event catalyzed by said recombinase. The sequence can
be double stranded DNA.
The term "virus genome" refers to a nucleic acid sequence that is
flanked by cis acting nucleic acid sequences that mediate the
packaging of the nucleic acid into a viral capsid. For AAVs and
parvoviruses, for example it is known that the "inverted terminal
repeats" (ITRs) that are located at the 5' and 3' end of the viral
genome have this function and that the ITRs can mediate the
packaging of heterologous, for example, non-wt virus genomes, into
a viral capsid.
The term "element" refers to a separate or distinct part of
something, for example, a nucleic acid sequence with a separate
function within a longer nucleic acid sequence.
The term "rAAV" refers to a "recombinant AAV". Recombinant AAV
refers to an AAV genome in which part or all of the rep and cap
genes have been replaced with heterologous sequences.
The term "AAV" or "adeno-associated virus" refers to a
Dependoparvovirus within the Parvoviridae genus of viruses. Herein,
AAV can refer to an AAV derived from a naturally occurring
"wild-type" virus, an AAV derived from a rAAV genome packaged into
a capsid derived from capsid proteins encoded by a naturally
occurring cap gene and/or a rAAV genome packaged into a capsid
derived from capsid proteins encoded by a non-natural capsid cap
gene, for example, AAV-PHP.B.
The term "rep-cap helper plasmid" refers to a plasmid that provides
the viral rep and cap gene functions. This plasmid can be useful
for the production of AAVs from rAAV genomes lacking functional rep
and/or the capsid gene sequences.
The term "vector" is defined as a vehicle for carrying or
transferring a nucleic acid. Examples of vectors include plasmids
and viruses.
The term "cap gene" refers to the nucleic acid sequences that
encode capsid proteins that form, or contribute to the formation
of, the capsid, or protein shell, of the virus. In the case of AAV,
the capsid protein may be VP1, VP2, or VP3. For other parvoviruses,
the names and numbers of the capsid proteins can differ.
The term "rep gene" refers to the nucleic acid sequences that
encode the non-structural proteins (rep78, rep68, rep52 and rep40)
required for the replication and production of virus.
A "library" may be in the form of a multiplicity of linear nucleic
acids, plasmids, viral particles or viral vectors. A library will
include at least two linear nucleic acids.
When the inserted nucleic acid sequences are randomly generated,
N=A, C, G or T; K=G or T; M=A or C.
Unless specified otherwise, the left-hand end of any
single-stranded polynucleotide sequence discussed herein is the 5'
end; the left-hand direction of double-stranded polynucleotide
sequences is referred to as the 5' direction.
As used herein, "operably linked" means that the components to
which the term is applied are in a relationship that allows them to
carry out their inherent functions under suitable conditions. For
example, a control sequence in a vector that is "operably linked"
to a protein coding sequence is ligated thereto so that expression
of the protein coding sequence is achieved under conditions
compatible with the transcriptional activity of the control
sequences.
The term "host cell" means a cell that has been transformed, or is
capable of being transformed, with a nucleic acid sequence and
thereby expresses a gene of interest. The term includes the progeny
of the parent cell, whether or not the progeny is identical in
morphology or in genetic make-up to the original parent cell, so
long as the gene of interest is present.
The term "naturally occurring" as used herein refers to materials
which are found in nature or a form of the materials that is found
in nature.
The term "treat" and "treatment" includes therapeutic treatments,
prophylactic treatments, and applications in which one reduces the
risk that a subject will develop a disorder or other risk factor.
Treatment does not require the complete curing of a disorder and
encompasses embodiments in which one reduces symptoms or underlying
risk factors.
The term "prevent" does not require the 100% elimination of the
possibility of an event. Rather, it denotes that the likelihood of
the occurrence of the event has been reduced in the presence of the
compound or method.
Standard techniques can be used for recombinant DNA,
oligonucleotide synthesis, and tissue culture and transformation
(e.g., electroporation, lipofection). Enzymatic reactions and
purification techniques can be performed according to
manufacturer's specifications or as commonly accomplished in the
art or as described herein. The foregoing techniques and procedures
can be generally performed according to conventional methods well
known in the art and as described in various general and more
specific references that are cited and discussed throughout the
present specification. See, e.g., Sambrook et al., Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. (1989)), which is incorporated
herein by reference for any purpose. Unless specific definitions
are provided, the nomenclatures utilized in connection with, and
the laboratory procedures and techniques of, analytical chemistry,
synthetic organic chemistry, and medicinal and pharmaceutical
chemistry described herein are those well known and commonly used
in the art. Standard techniques can be used for chemical syntheses,
chemical analyses, pharmaceutical preparation, formulation, and
delivery, and treatment of patients
As described herein, SEQ ID NO:4--rAAV-cap-in-cis plasmid may also
be referred to as: AAV-cap-in-cis, rAAV-Cap-in-cis vector,
rAAV-CAP-in-cis genome, rAAV-Cap-in-cis construct,
rAAV9-cap-in-cis, rAAV9R-X/A-cap-in-cis, or cap-in-cis, rAAV
mCherry-cap-lox71/66 genome, rAAV-CAP-in-cis-lox, AAV9 cap-in-cis
genome, rAAV-cap-in-cis rAAV genome, or the cap-in-cis rAAV
genome.
As described herein, SEQ ID NO:7 (for
example)-rAAV-delta-cap-in-cis may also be referred to as:
rAAV9R-delta-X/A-cap-in-cis, rAAV9R-delta-X/A-cap-in-cis vector,
rAAV-.DELTA.cap-in-cis vector, rAAV-cap-in-cis acceptor vector,
cap-in-cis acceptor construct, rAAV9R-delta-X/A-cap-in-cis acceptor
construct, rAAV-cap-in-cis library acceptor, or
AAV9R-delta-X/A-cap-in-cis.
As described herein, SEQ ID NO:5 (for example)--AAV Rep-AAP helper
may also be referred to as the Rep-AAP, rep-AAP helper and REP-AAP
helper, AAV REP-AAP helper, AAV2/9 rep-AAP, or AAV2/9 REP-AAP
helper plasmid.
As described herein, SEQ ID NO:6 (for example)-pCRII-9R-X/A EK
plasmid or pCRII-9Cap-xE are interchangeable terms.
As described herein, AAV-PHP.B denotes the same thing as AAV-PHP.b,
which denotes the same things as AAV-G2B26.
As described herein, AAV-PHP.A denotes the same things as
AAV-PHP.a.
As described herein, AAV-PHP.R2 denotes the same thing as
AAV-PHP.r, which denotes the same thing as AAV-TH1.1-35.
As described herein, 1253 is also referred to as 9CapF; 1316 is
also referred to as CDF; 1331 is also referred to as XF; 1312 is
also referred to as AR; 1287 is also referred to as 7.times.NNK;
and 1286 is also referred to as 7.times.MNN.
The term "central nervous system" or "CNS" as used herein refers to
the art recognized use of the term. The CNS includes the brain,
optic nerves, cranial nerves, and spinal cord. The CNS also
includes the cerebrospinal fluid, which fills the ventricles of the
brain and the central canal of the spinal cord.
Systemic administration of vectors including a capsid protein that
includes a targeting protein of SEQ ID NO:1 of the are particularly
suitable for delivering exogenous DNA sequences encoding
polypeptides, proteins, or non-coding DNA, RNA, or oligonucleotides
to, for example, cells of the CNS of subjects afflicted by a CNS
disease.
Targeting Sequence:
In some embodiments, a central nervous system targeting peptide is
provided. In some embodiments, the peptide comprises an amino acid
sequence of SEQ ID NO: 1. In some embodiments, the peptide is
further conjugated to a nanoparticle, a second molecule, a viral
capsid protein, or inserted between amino acids 588 and 589 of AAV9
(SEQ ID NO: 2, FIG. 30).
In some embodiments, the central nervous system targeting peptide
includes 4 or more amino acids of residues that overlap with
residues 585 to 595 within SEQ ID NO: 8.
In some embodiments, the central nervous system targeting peptide
includes 4 or more contiguous amino acids of SEQ ID NO: 1 (or any
of the sequences in FIG. 31). In some embodiments, the central
nervous system targeting peptide comprises 4-7 amino acids of SEQ
ID NO: 1 (or any of the sequences in FIG. 31). In some embodiments,
the central nervous system targeting peptide comprises 4-6 amino
acids of SEQ ID NO: 1 (or any of the sequences in FIG. 31). In some
embodiments, the central nervous system targeting peptide includes
one or more of the following options: TLAVPFK (SEQ ID NO: 1);
LAVPFK (SEQ ID NO: 31); AVPFK (SEQ ID NO: 32); VPFK (SEQ ID NO:
33); TLAVPF (SEQ ID NO: 34); TLAVP (SEQ ID NO: 35); or TLAV (SEQ ID
NO: 36). In some embodiments, the targeting peptide can consist of,
consist essentially of, or comprise one or more of the sequences in
FIG. 31. In some embodiments, 2 or fewer amino acids can be altered
within TLAVPFK (or for any of the sequences within FIG. 31). In
some embodiments, one amino acid can be altered within TLAVPFK (or
for any of the sequences within FIG. 31). In some embodiments, the
alteration is a conservative alteration (within any of the
targeting peptides provided herein). In some embodiments, the
alteration is a deletion or insertion of one or two amino acids
(within any of the targeting peptides provided herein).
In some embodiments, the amino acid can include a non-natural amino
acid. In some embodiments, the central nervous system targeting
peptide sequence can be one or more of: SQTLA, QTLAV, TLAVP, LAVPK,
AVPKA, VPKAQ. In some embodiments, the targeting peptide can be at
least 75% identical to one or more of the above sequences, for
example, at least 80% identical.
In some embodiments, the central nervous system targeting peptide
sequence can be inverted, such as in KFPVALT (SEQ ID NO: 3)
(similarly, any of the sequences in FIG. 31 can also be inverted).
In such embodiments, 4 or more contiguous amino acids can be
employed. For example, the sequence can comprise and/or consist of
KFPV, FPVA, PVAL, VALT, etc. In some embodiments, the targeting
peptide can be at least 75% identical to one or more of the above
sequences, for example, at least 80%.
In some embodiments, the central nervous system targeting peptide
comprises an amino acid sequence that comprises at least 4
contiguous amino acids from the sequence TLAVPFK (SEQ ID NO: 1) or
KFPVALT (SEQ ID NO: 3) or any of the sequences in FIG. 31. In some
embodiments, the amino acid sequence results in an increase in CNS
cell transduction by the AAV. In some embodiments, the amino acid
sequence is part of a capsid protein of the AAV vector. In some
embodiments, the sequence TLAVPFK (SEQ ID NO: 1; (or any of the
sequences in FIG. 31)) is inserted between AA588-589 of an AAV
sequence of the vector (SEQ ID NO: 2). In some embodiments, the
sequence TLAVPFK (SEQ ID NO: 1; or any of the sequences in FIG. 31)
is inserted between AA586-592 of an AAV sequence of the vector (SEQ
ID NO: 2). In some embodiments, the sequence TLAVPFK (SEQ ID NO: 1;
or any of the sequences in FIG. 31) further comprises at least two
of amino acids 587, 588, 589, or 590 of SEQ ID NO: 2. In some
embodiments, the targeting peptide can be at least 75% identical to
one or more of the above sequences.
In some embodiments, the central nervous system targeting peptide
comprises, consists, or consists essentially of any one or more of
the above sequences. In some embodiments, the central nervous
system targeting peptide is inserted into a longer peptide, as
described herein.
In some embodiments, the targeting peptide is part of an AAV, as
described herein. In some embodiments, the targeting peptide is
part of an AAV9. In some embodiments, the targeting peptide can be
linked to any molecule that should be targeted as desired. In some
embodiments, the targeting peptide can be linked, without
limitation, to a recombinant protein, antibody, a cell, a
diagnostic, a therapeutic, a nanomolecule, etc.
In some embodiments, the targeting sequence is an amino acid
sequence. In some embodiments, the targeting sequence is a nucleic
acid sequence. In some embodiments, the targeting sequence is a
capsid protein comprising an amino acid sequence that comprises at
least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID
NO: 1) and/or KFPVALT (SEQ ID NO: 3) and/or any of the sequences in
FIG. 31.
Some embodiments of options of targeting sequences, as outlined in
the examples below, are provided in FIG. 1A, which includes G2B-13,
G2B-26, TH1.1-32, and TH1.1-35, by way of example.
In some embodiments, the targeting protein can be inserted into any
desired section of a protein. In some embodiments, the targeting
protein can be inserted into a capsid protein. In some embodiments,
the targeting protein is inserted on a surface of the desired
protein. In some embodiments, the targeting protein is inserted
into the primary sequence of the protein. In some embodiments, the
targeting protein is linked to the protein. In some embodiments,
the targeting protein is covalently linked to the protein. In some
embodiments, the targeting protein is inserted into an unstructured
loop of the desired protein. In some embodiments, the unstructured
loop can be one identified via a structural model of the
protein.
In some embodiments, the unstructured loop can be one identified by
sequence comparisons, such as shown in FIG. 13. FIG. 13 shows an
alignment of VP1 capsid amino sequence from AAV and related
parvoviruses aligned to AAV9. Sequence identity is shown as a dot.
The AAs that differ from AAV9 are indicated. The numbering is based
on AAV9 VP1. Only AA 418-624 are shown, although such an alignment
can be done by one of skill in the art for any desired section of
protein. Shaded vertical bars of different length represent the
relative conservation at each AA. Longer bars indicate greater
conservation. Horizontal shaded bars indicate sites of the
unstructured loops into which the targeting protein can be
inserted.
In some embodiments, the location of insertion of the targeting
protein into the desired protein can be achieved by a structural
model. An example of such a structural model is shown in FIG. 14.
FIG. 14 depicts a structural model highlighting surface loops
randomized by targeted sequence insertion. The insert (which is a
blow up) depicts a ribbon diagram of AAV9 surface model constructed
in PyMol from the AAV9 Protein Data Bank file 3ux1.pdb. The capsid
surface is shown in gray and the loop regions chosen for sequence
insertion are highlighted by shading (AA586-592) and (AA452-458).
Other regions of sequence insertion or replacement can be
identified from within regions that are not highly conserved.
Additional examples include the regions of AAV9 between AA262-269,
AA464-473, AA491-495, AA546-557 and AA659-668 or the homologous
regions of other the capsid proteins from other AAVs or
parvoviruses.
In some embodiments, the capsid protein can comprise or consist of
the sequence shown in FIG. 19, SEQ ID NO: 8. The underlined amino
acid is a K to R mutation that was made to provide a unique XbaI
restriction site, this can be optional. For references, SEQ ID NO:
1 (TLAVPFK) is in bold text. Any of the other targeting peptides
provided herein (for example, in FIG. 31) can also be inserted in
place of SEQ ID NO: 1. FIG. 20 depicts some embodiments of a
nucleic acid sequence for an AAV-PHP.B (AAV-G2B26) capsid gene
coding sequence). The recovered nucleic acid sequence encoding SEQ
ID NO: 1 (TLAVPFK) is in bold and underlined text. The mutations
introduced to insert or remove restriction sites are highlighted
with double underlined italicized text.
Vectors
In some embodiments, a viral vector can include one or more of the
noted targeting sequences (for example, any of the central nervous
system targeting peptides noted herein or any peptide provided by
the screening methods provided herein). In some embodiments, an AAV
vector can be provided that comprises a sequence TLAVPFK (SEQ ID
NO: 1) (or any of the other targeting proteins provided herein,
including those in FIG. 31).
In some embodiments, one or more targeting sequences can be
employed in a single system. For example one can employ one or more
targeting sequences and also modify other sites to reduce the
recognition of the AAVs by the pre-existing antibodies present in
the host, such as a human. In some embodiments, the AAV vector can
include a capsid, which influences the tropism/targeting, speed of
expression and possible immune response. The vector can also
include the rAAV, which genome carries the transgene/therapeutic
aspects (e.g., sequences) along with regulatory sequences. In some
embodiments, the vector can include the targeting sequence
within/on a substrate that is or transports the desired molecule
(therapeutic molecule, diagnostic molecule, etc.).
In some embodiments, any one or more of the targeting sequences
provided herein can be incorporated into a vector.
In some embodiments, the sequence TLAVPFK (SEQ ID NO: 1) (or any of
the other targeting proteins provided herein, including those in
FIG. 31) results in an increase in CNS cell transduction from a
virus containing the vector. In some embodiments, the increase is
at least 2, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100
fold more than transduction without the targeting sequence. In some
embodiments, there is a 40-90 fold increase in transduction of the
CNS, as compared with AAV9 transduction.
In some embodiments, the sequence TLAVPFK (SEQ ID NO: 1) (or any of
the other targeting proteins provided herein, including those in
FIG. 31) is part of a capsid protein of the AAV vector. In some
embodiments, the sequence TLAVPFK (SEQ ID NO: 1) (or any of the
other targeting proteins provided herein, including those in FIG.
31) is inserted between AA588-589 of an AAV sequence of the vector
(SEQ ID NO: 2). In some embodiments, the sequence TLAVPFK (SEQ ID
NO:1) (or any of the other targeting proteins provided herein,
including those in FIG. 31) is inserted within AA452-458 of an AAV
sequence of the vector (SEQ ID NO: 2). In some embodiments, the
sequence TLAVPFK (SEQ ID NO:1) (or any of the other targeting
proteins provided herein, including those in FIG. 31) is inserted
within AA491-495 of an AAV sequence of the vector (SEQ ID NO: 2).
In some embodiments, the sequence TLAVPFK (SEQ ID NO:1) (or any of
the other targeting proteins provided herein, including those in
FIG. 31) is inserted within AA546-557 of an AAV sequence of the
vector (SEQ ID NO: 2). In some embodiments, any of the targeting
sequences (or combination thereof) in FIG. 31 can be used and/or
substituted for any of the embodiments provided herein regarding
SEQ ID NO: 1. Thus, for example, one or more of the sequences
within FIG. 31 can be inserted between AA588-589 of an AAV sequence
of the vector (SEQ ID NO: 2). In some embodiments, the targeting
sequence can be one or more of: SVSKPFL (SEQ ID NO: 28); FTLTTPK
(SEQ ID NO: 29); or MNATKNV (SEQ ID NO: 30). FIG. 31 depicts some
of the most highly enriched sequences recovered from the second
round of selection for AAV variants that transduce GFAP-Cre+
astrocytes following intravenous administration.
In some embodiments, the targeting sequence that is part of the
vector can comprise any four contiguous AAs within AAV9 VP1
AA585-598 of SEQ ID NO: 8.
While the numbering is not identical between serotypes, the exact
insertion site is not critical. In some embodiments, the targeting
sequence is inserted within the unstructured (see FIG. 14) and
poorly conserved (see alignment, FIG. 13) surface exposed loops. In
some embodiments, the insertion of the targeting sequence can be
achieved within other AAV capsids by inserting the targeting
sequence within the homologous unstructured loops of other AAV
sequences.
In some embodiments, an rAAV genome is provided. The genome can
comprise at least one inverted terminal repeat configured to allow
packaging into a vector and a cap gene. In some embodiments, it can
further include a sequence within a rep gene required for
expression and splicing of the cap gene. In some embodiments, the
genome can further include a sequence capable of expressing
VP3.
In some embodiments, the only protein that is expressed is VP3 (the
smallest of the capsid structural proteins that makes up most of
the assembled capsid--the assembled capsid is composed of 60 units
of VP proteins, .about.50 of which are VP3). In some embodiments,
VP3 expression alone is adequate to allow the method of screening
to be adequate.
In some embodiments, the system for screening involves placing the
selectable element, (which in some embodiments can be the AAV cap
gene into the AAV genome) together with one or more recombinase
recognition sites (loxP or mutant loxP sites are preferred, but
others could be used). In some embodiments, the AAV genome can be
defined by a nucleic acid comprising at least one inverted terminal
repeat.
In some embodiments, the rAAV genome further comprises a mCherry
reporter cassette comprising a ubiquitin C gene, a mCherry cDNA,
and a minimal synthetic polyA sequence.
In some embodiments, the genome further comprises cre-dependent
switch comprising: a polyA sequence and a pair of inverted loxP
sites flanking the polyA sequence. In some embodiments, the polyA
sequence is downstream of the cap gene. In some embodiments, the
pair of inverted loxP sites comprises lox71 and lox66. In some
embodiments, the genome contains only those sequences within the
rep gene required for expression and splicing of the cap gene
product.
In some embodiments, AAV-PHP.B delivers genes efficiently to one or
more organs including, but not limited to the central nervous
system, liver, muscle, heart, lungs, stomach, adrenal gland,
adipose and intestine.
In some embodiments, a capsid library is provided that comprises
AAV genomes that contain both the full rep and cap sequence that
have been modified so as to not prevent the replication of the
virus under conditions in which it could normally replicate
(co-infection of a mammalian cell along with a helper virus such as
adenovirus). A pseudo wt genome can be one that has an engineered
cap gene within a "wt" AAV genome.
In some embodiments, the capsid library is made within a
"pseudo-wild type" AAV genome containing the viral replication gene
(rep) and capsid gene (cap) flanked by inverted terminal repeats
(ITRs). In some embodiments, the capsid library is not made within
a "pseudo-wild type" AAV genome containing the viral replication
gene (rep) and capsid gene (cap) flanked by inverted terminal
repeats (ITRs).
In some embodiments, the rAAV genome contains the cap gene and only
those sequences within the rep gene required for the expression and
splicing of the cap gene products (FIG. 22B).
In some embodiments, a capsid gene recombinase recognition sequence
is provided with inverted terminal repeats flanking these
sequences.
In some embodiments, the system could be used to develop capsids
that exhibit enhanced targeting of specific cells/organs, select
for capsids that evade immunity, select for genomes that are more
at homologous recombination, select for genome elements that
increase the efficiency of conversion of the single stranded AAV
genome to a double stranded DNA genome within a cell and/or select
for genome elements that increase the conversion of AAV genome to a
persistent, circularized form within the cell.
Nucleic Acid Sequences
In some embodiments, a nucleic acid sequence encoding any of the
targeting sequences provided herein is provided. In some
embodiments, the nucleic acid sequence is AAGTTTCCTGTGGCGTTGACT FOR
SEQ ID NO 3). ACT TTG GCG GTG CCT TTT AAG (SEQ ID NO:49) for a
sequence encoding the AA sequence of SEQ ID NO: 1. In some
embodiments, the nucleic acid sequence is one that will hybridize
to this sequence under stringent conditions. In some embodiments,
the nucleic acid sequence includes a nucleic acid sequence that
encodes for SEQ ID NOS: 1 and/or 3 and the sequence is part of a
larger nucleic acid sequence. In some embodiments, any one or more
of the sequences from FIG. 31 can provide the noted nucleic acid
sequence (that is, any nucleic acid sequence that encodes for any
of these sequences can be provided). In some embodiments, the
nucleic acid sequence is one that will hybridize to any of the
sequences within FIG. 31 (or the sequences that encode the amino
acid sequences) under stringent conditions. In some embodiments,
the nucleic acid sequence includes a nucleic acid sequence that
encodes for any of the sequences within FIG. 31 and the sequence is
part of a larger nucleic acid sequence. In some embodiments, the
nucleic acid sequence is one or more of:
TABLE-US-00002 (SEQ ID NO: 24) AGTGTGAGTAAGCCTTTTTTG; (SEQ ID NO:
26) TTTACGTTGACGACGCCTAAG; or (SEQ ID NO: 27)
ATGAATGCTACGAAGAATGTG.
In some embodiments, the nucleic acid sequence that encodes for SEQ
ID NO: 1 is inserted between a sequence encoding for amino acids
588 and 589 of AAV9 (SEQ ID NO: 2).
In some embodiments, a nucleic acid sequence encoding any four
contiguous amino acids in TLAVPFK (SEQ ID NO: 1) or in KFPVALT (SEQ
ID NO: 3) is provided. In some embodiments, a nucleic acid sequence
encoding any five contiguous amino acids in TLAVPFK (SEQ ID NO: 1)
or in KFPVALT (SEQ ID NO: 3) is provided. In some embodiments, a
nucleic acid sequence encoding any six contiguous amino acids in
TLAVPFK (SEQ ID NO: 1) or in KFPVALT (SEQ ID NO: 3) (or any of the
other targeting proteins provided herein, including those in FIG.
31) is provided.
In some embodiments, the nucleic acid sequence is inserted between
a sequence encoding for amino acids 588 and 589 of AAV9 (SEQ ID NO:
2).
In some embodiments, a plasmid system is provided. The plasmid can
include a first plasmid comprising a modified AAV2/9 rep-cap helper
plasmid comprising at least one in frame stop codon within its VP1,
VP2 and VP3 reading frame. The stop codon is positioned to disrupt
VP expression without altering the amino acid sequence of the
assembly activating protein. The plasmid system can further include
a second plasmid comprising a rAAV-cap-in-cis plasmid.
In some embodiments, the method does not involve expressing single
VP proteins from heterologous plasmids to generate "mosaic" capsids
made from VP proteins encoded by different plasmids.
In some embodiments, a library of nucleic acid sequences is
provided. The library can comprise a selectable element and one or
more recombinase recognition sequences. In some embodiments, the
nucleic acid sequences and one or more recombinase recognition
sequences are incorporated within a virus genome. In some
embodiments, the viral genome is an AAV genome. In some
embodiments, the selectable element encodes an AAV capsid. In some
embodiments, the selectable element is a genetic element that
increases conversion to dsDNA. In some embodiments, the selectable
element increases the efficiency of homologous recombination
between the element and the endogenous genome. In some embodiments,
the recombinase recognition sequences are comprised of one or more
loxP sites. In some embodiments, the loxP site is a lox71 site and
an inverted lox66 site.
In some embodiments, the gene encoding the targeting protein and/or
the capsid can be cloned into an AAV Rep-Cap helper plasmid in
place of the existing capsid gene. When introduced together into
producer cells, this plasmid can be used to package an rAAV genome
into the targeting protein and/or capsid. Producer cells can be any
cell type possessing the genes necessary to promote AAV genome
replication, capsid assembly and packaging. Preferred producer
cells are 293 cells, or derivatives, HELA cells or insect cells
together with helper virus or a second plasmid encoding the helper
virus genes known to promote rAAV genome replication. In some
embodiments, an AAV rep-cap helper sequence can be modified to
introduce a tetracycline-inducible expression system in between the
rep and the cap gene to increase capsid expression and virus
production. In some embodiments, a tetracycline transactivator
cDNA, poly adenylation sequence, tetracycline responsive element
and AAV5 p41 promoter and AAV2 splicing regulatory elements
contained within the AAV2 rep gene are inserted between the rep
gene and the gene encoding the capsid or targeting protein. Use of
this inducible rep-cap plasmid when making rAAV provides 1.5-2-fold
more virus than the AAV2/9 rep-cap plasmid. Some embodiments of
such a nucleic acid cloned into a plasmid are depicted in FIG. 21,
SEQ ID NO: 10. The cap gene sequence is underlined in FIG. 21.
Uppercase letters indicate sites where the capsid sequence differs
from AAV9.
Methods of Use
In some embodiments, a method of delivering a nucleic acid sequence
to a nervous system (or other desired system) is provided. The
method can include providing a protein comprising any one or more
of the targeting sequences provided herein. The protein can be part
of a capsid of an AAV. The AAV can comprise a nucleic acid sequence
to be delivered to a nervous system. One can then administer the
AAV to the subject.
In some embodiments, the nucleic acid sequence to be delivered to a
nervous system comprises one or more sequences that would be of
some use or benefit to the nervous system and/or the local of
delivery or surrounding tissue or environment. In some embodiments,
it can be a nucleic acid that encodes a trophic factor, a growth
factor, or other soluble factors that might be released from the
transduced cells and affect the survival or function of that cell
and/or surrounding cells. In some embodiments, it can be a cDNA
that restores protein function to humans or animals harboring a
genetic mutation(s) in that gene. In some embodiments, it can be a
cDNA that encodes a protein that can be used to control or alter
the activity or state of a cell. In some embodiments, it can be a
cDNA that encodes a protein or a nucleic acid used for assessing
the state of a cell. In some embodiments, it can be a cDNA and/or
associated RNA for performing genomic engineering. In some
embodiments, it can be a sequence for genome editing via homologous
recombination. In some embodiments, it can be a DNA sequence
encoding a therapeutic RNA. In some embodiments, it can be a shRNA
or an artificial miRNA delivery system. In some embodiments, it can
be a DNA sequence that influences the splicing of an endogenous
gene.
In some embodiments, the resulting targeting molecules can be
employed in methods and/or therapies relating to in vivo gene
transfer applications to long-lived cell populations. In some
embodiments, these can be applied to any rAAV-based gene therapy,
including, for example: spinal muscular atrophy (SMA), amyotrophic
lateral sclerosis (ALS), Parkinson's disease, Pompe disease,
Huntington's disease, Alzheimer's disease, Battens disease,
lysosomal storage disorders, glioblastoma multiforme, Rett
syndrome, Leber's congenital amaurosis, chronic pain, stroke,
spinal cord injury, traumatic brain injury and lysosomal storage
disorders. In addition, rAAVs can also be employed for in vivo
delivery of transgenes for non-therapeutic scientific studies such
as optogenetics, gene overexpression, gene knock-down with shRNA or
miRNAs, modulation of endogenous miRNAs using miRNA sponges or
decoys, recombinase delivery for conditional gene deletion,
conditional (recombinase-dependent) expression, or gene editing
with CRISPRs, TALENs, and zinc finger nucleases.
Provided herein are methods for treating and/or preventing
Huntington's disease using the methods and compositions described
herein. The method of treating and/or preventing Huntington's
disease can include identifying the subject(s), providing a vector
for delivery of a polynucleotide to the nervous system of the
subject as provided herein, administering the vector in an
effective dose to the subject thereby treating and/or preventing
Huntington's disease in the subject. In some embodiments, the
methods for treating a subject with Huntington's disease involve
compositions where the vector delivers the polynucleotide
composition comprising a Zinc finger protein (ZFP) engineered to
represses the transcription of the Huntingtin (HTT) gene. In some
embodiments, the ZFP selectively represses the transcription of the
HTT gene allele responsible for causing the Huntington's disease in
the subject by binding to the CAG repeat region of the HTT gene in
a CAG repeat length-dependent manner. In some embodiments, the
ZNFTR selectively represses transcription of both alleles of the
HTT gene.
In some embodiments, the therapeutic item to be administered to the
subject comprises a short hairpin RNA (shRNA) or microRNA (miRNA)
that knocks down Huntingtin expression by inducing the selective
degradation of, or inhibiting translation from, RNA molecules
transcribed from the disease causing HTT allele by binding to the
CAG repeat. In some embodiments, the therapeutic item to be
administered to the subject comprises a short hairpin RNA (shRNA)
or microRNA (miRNA) that knocks down Huntingtin expression by
inducing the degradation of, or inhibiting translation from, RNA
molecules transcribed from one or both alleles of the HTT gene. In
some embodiments, the therapeutic item to be administered to the
subject comprises a short hairpin RNA (shRNA) or microRNA (miRNA)
that knocks down Huntingtin expression by inducing the selective
degradation of, or inhibiting translation from, RNA molecules
transcribed from the disease causing HTT allele through the
selective recognition of one or more nucleotide polymorphisms
present within the disease causing allele. The nucleotide
polymorphisms can be used by one skilled in the art to
differentiate between the normal and disease causing allele.
In some embodiments, the therapeutic item to be administered to the
subject comprises a polynucleotide that encodes an RNA or protein
that alters the splicing or production of the HTT RNA. In some
embodiments, the therapeutic item to be administered to the subject
comprises a polynucleotide that encodes one or more polypeptides
and/or RNAs for genome editing using a Transcription activator-like
effector nuclease (TALEN), zinc finger nuclease or clustered
regularly interspaced short palindromic repeats--cas9 gene
(CRISPR/Cap9) system engineered by one skilled in the art to induce
a DNA nick or double-stranded DNA break within or adjacent to the
HTT gene to cause an alteration in the HTT gene sequence. In some
embodiments, the therapeutic item to be administered to the subject
comprises a polynucleotide encoding a polypeptide that binds to a
polypeptide from the HTT gene, alters the conformation of a
polypeptide from the HTT gene or alters the assembly of a
polypeptide from the HTT gene into aggregates or alters the
half-life of a polypeptide from the HTT gene. In some embodiments,
the therapeutic item to be administered to the subject comprises a
polynucleotide that encodes a RNA or polypeptide that causes or
prevents a post-transcriptional modification of a polypeptide from
the HTT gene. In some embodiments, the therapeutic item to be
administered to the subject comprises a polynucleotide that encodes
a polypeptide from a chaperone protein known to those skilled in
the art to influence the conformation and/or stability of a
polypeptide from the HTT gene.
In some embodiments, the therapeutic item to be administered to the
subject comprises regulatory elements known to one skilled in the
art to influence the expression of the RNA and/or protein products
encoded by the polynucleotide within desired cells of the
subject.
In some embodiments, the therapeutic item to be administered to the
subject comprises a therapeutic item applicable for any disease or
disorder of choice. In some embodiments, this can include
compositions for treating and/or preventing Alzheimers disease
using the methods and compositions described herein, for example,
ApoE2 or ApoE3 for Alzheimer's disease; SMN for the treatment of
SMA; frataxin delivery for the treatment of Friedreich's ataxia;
and/or shRNA or miRNA for the treatment of ALS.
In some embodiments, the therapeutic item for delivery is a protein
(encodes a protein) or RNA based strategy for reducing synuclein
aggregation for the treatment of Parkinson's. For example
delivering a polynucleotide that encodes a synuclein variant that
is resistant to aggregation and thus disrupts the aggregation of
the endogenous synuclein.
In some embodiments, a transgene encoding a trophic factor for the
treatment of AD, PD, ALS, SMA, HD can be the therapeutic item
involved. In some embodiments, a trophic factor can be employed and
can include, for example, BDNF, GDNF, NGF, LIF, and/or CNTF.
Dosages of a viral vector can depend primarily on factors such as
the condition being treated, the age, weight and health of the
patient, and may thus vary among patients. For example, a
therapeutically effective human dosage of the viral vector is
generally in the range of from about 0.1 ml to about 100 ml of
solution containing concentrations of from about 1.times.10.sup.9
to 1.times.10.sup.16 genomes virus vector. A preferred human dosage
can be about 1.times.10.sup.13 to 1.times.10.sup.16 AAV genomes.
The dosage will be adjusted to balance the therapeutic benefit
against any side effects and such dosages may vary depending upon
the therapeutic application for which the recombinant vector is
employed. The levels of expression of the transgene can be
monitored to determine the frequency of dosage resulting from the
vector of the invention.
In some embodiments, the polynucleotides vector also includes
regulatory control elements known to one skilled in the art to
influence the expression of the RNA and/or protein products encoded
by the polynucleotide within desired cells of the subject.
In some embodiments, functionally, expression of the polynucleotide
is at least in part controllable by the operably linked regulatory
elements such that the element(s) modulates transcription of the
polynucleotide, transport, processing and stability of the RNA
encoded by the polynucleotide and, as appropriate, translation of
the transcript. A specific example of an expression control element
is a promoter, which is usually located 5' of the transcribed
sequence. Another example of an expression control element is an
enhancer, which can be located 5' or 3' of the transcribed
sequence, or within the transcribed sequence. Another example of a
regulatory element is a recognition sequence for a microRNA.
Another example of a regulatory element is an intron and the splice
donor and splice acceptor sequences that regulate the splicing of
said intron. Another example of a regulatory element is a
transcription termination signal and/or a polyadenylation
sequences.
Expression control elements and promoters include those active in a
particular tissue or cell type, referred to herein as a
"tissue-specific expression control elements/promoters."
Tissue-specific expression control elements are typically active in
specific cell or tissue (for example in the liver, brain, central
nervous system, spinal cord, eye, retina or lung). Expression
control elements are typically active in these cells, tissues or
organs because they are recognized by transcriptional activator
proteins, or other regulators of transcription, that are unique to
a specific cell, tissue or organ type.
Expression control elements also include ubiquitous or promiscuous
promoters/enhancers which are capable of driving expression of a
polynucleotide in many different cell types. Such elements include,
but are not limited to the cytomegalovirus (CMV) immediate early
promoter/enhancer sequences, the Rous sarcoma virus (RSV)
promoter/enhancer sequences and the other viral promoters/enhancers
active in a variety of mammalian cell types; promoter/enhancer
sequences from ubiquitously or promiscuously expressed mammalian
genes including, but not limited to, beta actin, ubiquitin or
EF1alpha; or synthetic elements that are not present in nature.
Expression control elements also can confer expression in a manner
that is regulatable, that is, a signal or stimuli increases or
decreases expression of the operably linked polynucleotide. A
regulatable element that increases expression of the operably
linked polynucleotide in response to a signal or stimuli is also
referred to as an "inducible element" (that is, it is induced by a
signal). Particular examples include, but are not limited to, a
hormone (for example, steroid) inducible promoter. A regulatable
element that decreases expression of the operably linked
polynucleotide in response to a signal or stimuli is referred to as
a "repressible element" (that is, the signal decreases expression
such that when the signal, is removed or absent, expression is
increased). Typically, the amount of increase or decrease conferred
by such elements is proportional to the amount of signal or stimuli
present; the greater the amount of signal or stimuli, the greater
the increase or decrease in expression.
Any one or more of the above aspects can be included within any of
the vectors provided herein, in combination with any targeting
protein.
Method of Selection
Current directed evolution protocols used to enhance AAV capsids
have several shortcomings. The first is that it is difficult to
design an in vivo screen that specifically recovers sequences from
the target cell of interest when that target cell is one of many
cell types in a complex organ. Typically, after the virus is
administered in vivo, the tissue of interest is collected, and
virus DNA is recovered from the DNA of the entire tissue, or region
of tissue. Recently, Dalkara et al. reported the use of FACS
sorting the target cells (photoreceptors) as a means to selectively
recover capsid sequences present in those cells. But this method is
labor intensive and costly, especially for sorting from large
volumes of dissociated tissues. In addition, this additional
sorting effort does not overcome the other major limitation of
selecting for AAV capsid sequences: all capsid sequences present
within the cell/tissue are recovered regardless of whether or not
these viruses functionally transduced any cells. In other words,
sequences from viruses stuck on the cell surface or viruses that
entered the cell bound to a receptor that trafficked to an
intracellular compartment not compatible with AAV unpackaging and
transduction are recovered by these screens along with sequences
that encoded capsids that successfully induced transgene expression
in the target cell population. Therefore, non-functional capsids
are also enriched by typical selection methods. Finally, most
current methods also require the use of libraries made from
replication competent AAV, which is a potential biosafety concern,
especially if the virus will be introduced in animal facilities
where there are primates since these viruses could replicate in
animals carrying helper viruses. Herein is described an AAV capsid
library screening platform that overcomes one or more of each of
these limitations.
Successful production of an AAV capsid variant library depends upon
each variant cap gene being packaged by the particular capsid
proteins it encodes. Therefore, it is useful that the cap gene is
present in cis (within the AAV genome). However, it is not
essential that the non-structural rep genes be present in cis.
Herein is disclosed a replication incompetent rAAV genome
expressing the cap gene and in place of much of the rep sequence,
several recombinant elements have been added that provide a way to
selectively recover only those capsid sequences that have
functionally transduced the target cell population of interest
without the need for target cell isolation.
Selective Recovery of AAV Capsid Sequences from Specific Cre+ Cell
Populations
In some embodiments, the approach incorporates a Cre
recombinase-dependent switch that uses PCR (polymerase chain
reaction) to selectively recover capsid sequences that have
transduced Cre+ target cells. This can be accomplished by inserting
mutant Cre recognition sites (lox66 and lox71 in a head-to-head
orientation) into the rAAV genome around a sequence adjacent to the
cap gene (FIG. 1B). Cre recombination results in an inversion of
the sequence flanked by the lox66 and lox71 sites, and one can then
use a PCR recovery strategy that only amplifies the cap gene
sequence from rAAV genomes after Cre-mediated inversion of the cap
gene adjacent sequence (one PCR primer binds the invertible
sequence and one binds the cap gene). Mutant loxP sites (lox66 and
lox71) can be chosen so that the inversion would be less reversible
(Alberts et al. 1995). FIG. 1B shows an embodiments of a rAAV
plasmid that has been developed.
In some embodiments, the method takes advantage of the large number
of Cre transgenic mice that have been (and can be) developed. These
lines express Cre under the control of cell specific promoters such
that Cre is present only in a subpopulation of cells within a given
organ. Hundreds of Cre transgenic lines are available from
commercial vendors and academic sources, and custom lines can be
generated.
In some embodiments, one can apply this for developing capsids that
more efficiently transduce astrocytes in the central nervous system
after IV virus administration. Transgenic mGFAP-Cre mice are
available that express Cre specifically within astrocytes and
neural stem cells (NSCs) in the adult brain and spinal cord. Using
the Cre-dependent sequence recovery strategy, one can deliver rAAV
capsid libraries in vivo, collect DNA from the entire brain and
spinal cord and recover rAAV capsid sequences specifically from
astrocytes and NSCs.
Another advantage of some embodiments of this approach is that this
Cre dependent strategy only recovers those sequences that have
transduced the target cell. AAV is a single stranded DNA virus, and
its genome must enter the nucleus and be converted to double
stranded DNA (dsDNA) for functional transduction. Since Cre only
recombines dsDNA, only those capsid sequences that have trafficked
properly to the cell nucleus and have been converted to dsDNA will
be recovered.
Inclusion of a Reporter Gene Cassette to Facilitate Cell
Sorting
For cases where Cre+ transgenics are not available, one can also
incorporate a reporter cassette driven by a ubiquitous
promoter/enhancer to facilitate sorting of transduced/transgene
expressing cells from within a mixed population. This second option
is more labor intensive than the Cre-based strategy as it requires
generating single cell suspensions and FACS or magnetic
bead/antibody-based sorting. But the reporter method is also
powerful in that it can be combined with sorting for specific
target cell populations using antibodies to known surface markers
or with GFP transgenics to limit recovery to a particular
population. And like the Cre strategy above, it will only lead to
the recovery of sequences that are present in transduced cells. The
reporter also facilitates following the transduction
characteristics of the pooled library during screening (useful for
both the Cre- and reporter-dependent methods).
The technology described herein can be used in conjunction with any
transgenic line expressing Cre in the target cell type of interest
to develop AAV capsids that more efficiently transduce that target
cell population. Applications include, but are not limited to,
developing capsids that are more efficient at transducing specific
cell types in any organ after IV AAV administration, targeting
specific populations of neurons, improving interneuronal transport,
targeting tumor cells, hematopoetic stem cells, insulin producing
beta cells, lung epithelium, etc. The method is not limited to any
one virus delivery method. The vector may be delivered via any
route including, but not limited to, oral, intravenous,
intraarticular, intracardiac, intramuscular, intradermal, topical,
intranasal, intraparitoneal, rectal, sublingual, subcutaneous,
epidural, intracerebral, intracerebroventricular, intrathecal,
intravitreal or subretinal administrations. The system can also be
used to develop viruses that better cross specific barriers (blood
brain barrier, gut epithelium, placenta, etc.). The method can also
be used in vitro to develop capsids that are better at achieving
nuclear entry and second strand synthesis (conversion to
dsDNA).
In addition, this system is not limited to AAV9. Any starting AAV
capsid (naturally occurring or modified variants) can be
incorporated into this rAAV-cap vector, mutagenized by standard
methods to create the capsid library and then screened with this
Cre-dependent recovery strategy. Preferred AAV capsids include
AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10,
human isolates (for example, hu.31 and hu.32), rhesus isolates (for
example, rh.8 and rh.10), AAVs or related parvoviruses from other
primates, mammals and non-mammalian species. Furthermore, this
method is not limited to any one commonly used capsid mutagenesis
strategy. Any method can be used to generate the library diversity,
including but not limited to capsid domain shuffling, random
sequence insertion and random mutagenesis by error prone PCR.
Finally, the vector has been designed to be modular making it
simple to replace various elements such as the reporter cassette or
capsid sequence to further customize the screening options.
To make this system possible, an option for incorporating the AAV
capsid gene within the rAAV genome while providing the other
non-structural AAV gene products in trans from a helper plasmid was
developed. This was not necessarily straightforward since the cap
gene codes for 4 proteins (the capsid proteins VP1, VP2, VP3 and
the assembly activating protein (AAP)) using a combination of
alternative splicing, alternative start codons and alternative
reading frames. Maintaining proper regulation of the expression of
these proteins is relevant for efficient virus production. It was
found that the capsid proteins could be expressed from a rAAV
genome when a fragment of the 3' end of the rep gene, which
contains critical promoter/enhancer and splicing signals, is
included (FIG. 2A). Retaining only the 3' end of the rep gene
together with the capsid gene left enough space within the rAAV
genome to incorporate the Cre invertible polyA sequence downstream
of the cap gene as well as an mCherry (red fluorescent protein)
reporter cassette.
To insure that the capsid is made entirely from the capsid gene
encoded within the rAAA capsid library genome, an AAV helper
plasmid that would provide the AAV non-structural proteins but not
any capsid protein expression (typically rAAV are produced by
supplying both rep and cap genes in trans from the AAV helper
plasmid) was developed. Using a AAV2/9 RepCap plasmid vector core
as a starting point, 5 stop codons were inserted within the cap
gene near the translation initiation sites for the three capsid
proteins VP1, VP2 and VP3 (FIG. 2B). This effectively eliminated
rAAV production unless the VP1-3 capsid proteins are provided
elsewhere (such as in cis on the AAV genome cap library construct
described above).
In some embodiments, a method of developing a capsid with a desired
characteristic is provided. The method can comprise providing a
population of rAAV genomes provided herein. The method can further
involve screening the population by a specific set of criteria. The
method can further involve selecting the rAVV genome that meets the
screening criteria.
In some embodiments, some of the methods of screening provided
herein provide at least one of the following advantages. First, in
some embodiments, the method makes use of the growing library of
Cre-transgenics to provide selective pressure for capsids that more
efficiently transduce genetically defined cell populations (for
example, see cre.jax, gensat, creportal, connectivity.brain-map
(MGI) (all ".org"). Second, in some embodiments, since Cre only
recombines double stranded DNA (dsDNA) and the AAV genome is single
stranded, only those capsid sequences that mediate the proper
intracellular trafficking and conversion of the packaged genome to
a persistent dsDNA form will be recovered. Therefore, such an
approach can provide additional selective pressure for functional
capsids.
As depicted in FIG. 2C, additional sequence variants can be
selected based on their ability to mediated an increased
association of the nucleic acid carrying the sequence library and
recombinase site with the recombinase for similar or different
desired applications. In some embodiments, the process can start by
generating a library of DNA sequence variants (1A). In some
embodiments, this can include 10^2 if not more sequences (for
example 10^6 or more). Within the same nucleic acid, one can also
incorporate one or more recombinase recognition sequences (1B). A
strategy is then designed for recombination-dependent sequence
recovery/amplification of the sequence variants. (1B). This can
involve one or more recombinase recognition sites. One can then
combine the library and recombination sites to transfer library DNA
fragments into a vector with recombinase recognition sites (2). One
can then deliver the library (for example, in vivo and/or in
vitro). The recombinase (REC+) expression is restricted to one or
more target cell populations or compartments (3). One can then
apply a selected selective pressure to the system such that one can
recover/amplify sequences based on the presence or absence of the
recombinase-mediated recombination events on the nucleic acids
comprising the library variants (4). This process can be repeated
if necessary, transferring the recovered or amplified selected
variants back into the library acceptor vector (5B) for 1 to 5, or
more rounds of selection. One can then obtain and characterize the
variant sequences (5A) by various methods, such as Sanger
sequencing or next generation sequencing. Finally, one can then
characterize the function of any or all of the individual
variants.
A Method for Selectively Recovering Capsid Sequences that have
Transduced Specific Target Cell Populations within Complex Tissue
Samples.
The AAV genome has two genes-rep, which encodes 4 nonstructural
proteins relevant for replication (rep78, rep68, rep52 and rep40)
and cap, which encodes three proteins (VP1, VP2, and VP3) that form
the shell, or capsid, of the virus (FIG. 2D). In addition, the cap
gene also encodes an accessory protein Assembly-activating protein
(AAP) that is required for capsid assembly. Capsid directed
evolution methods make use of replication competent AAV so that the
capsid gene is present in cis (that is, within the viral genome).
However, successful production of an AAV capsid variant library
depends only upon each variant cap gene being packaged by the
particular capsid proteins it encodes. Therefore, while it is
useful that the cap gene is present in cis, it is not essential
that the nonstructural replication (rep) genes be present in cis.
With this in mind, a replication-incompetent, rAAV genome
expressing the cap gene and only those regions of the rep gene
necessary for expression and splicing of the capsid gene (FIG. 2D)
has been developed. In place of the remaining rep sequences,
several recombinant elements that provide a means to selectively
recover only those capsid sequences that have functionally
transduced the target cell population of interest without the need
for target cell isolation have been incorporated (FIG. 3A). To
ensure that the proteins encoded by the cap are properly expressed,
the splicing donor and acceptor sequences (and all intervening
sequences) present within the AAV2 rep gene upstream of the AAV cap
gene within the recombinant genome (FIG. 2E) were incorporated. A
p41 promoter fragment from AAV5 was used to drive translation from
the capsid gene (SEQ ID NO: 4, FIG. 15, depicting the entire
plasmid: the plasmid backbone, AAV ITRs, UBC-mCherry-syn-pA, AAV5
p41 promoter-AAV2 rep splicing seq, AAV9 cap, lox71-SV40
polyA-lox66-ITR). To provide rep and AAP helper function, an AAV
rep/cap helper plasmid was modified by inserting a total of 5 stop
codons within the cap gene within the VP1, 2 and 3 reading frame (1
stop codon disrupts VP3, 3 disrupt VP2 and all 5 disrupt VP1--FIG.
2F, SEQ ID NO: 5, FIG. 16). These stop codons were designed such
that they did not disrupt the coding sequence of the AAP protein,
which is encoded within an alternative reading frame.
Selective Recovery of AAV Capsid Sequences from Specific Cre+ Cell
Populations.
To facilitate selective recovery of only those capsid sequences
that encode the capsid protein that mediate transduction of a
specific target cell population, a system was designed to take
advantage of the large number of Cre transgenic mice, rats or other
Cre transgenic organisms that have been (and can be) developed.
These lines express Cre under the control of cell-specific
promoters such that Cre is present only in a subpopulation of cells
within a given organ. This approach incorporates a Cre
recombinase-dependent "switch" that provides a means to selectively
recover capsid sequences that have transduced Cre+ target cells.
Cre recombination results in an inversion or deletion (depending on
the configuration the lox sites used--see FIGS. 3 and 4) of a
sequence within the AAV genome, and a PCR-based recovery strategy
was used that only amplifies the cap gene sequence from rAAV
genomes that have undergone a Cre-mediated inversion event. This
strategy can also be adapted to select for AAV capsids that target
cells that had previously been made to express Cre through non
transgenic means (e.g., prior transduction with a Cre expressing
virus), which could be useful for selection in larger species where
Cre transgenes are not available.
An advantage of some of these embodiments is that this
recombinase-dependent strategy only recovers those sequences that
have transduced the target cell. AAV is a single stranded DNA
virus, and its genome must be converted to double-stranded DNA
(dsDNA) for functional transduction. Since Cre only recombines
dsDNA, only those capsid sequences that have trafficked properly
and have been converted to dsDNA will be recovered. This increases
the selective pressure applied, which we anticipate will reduce the
number of selection rounds that are necessary to develop viruses
with improved properties.
This application is not limited to using Cre-lox as a
recombinase/target site system. Other embodiments can include
recombinases/integrases including, for example, Flp, phiC31 or
Bxb1. The method can also be adapted for use with
recombination-dependent, non-PCR-based recovery strategies.
Furthermore, a recombinant AAV genome lacking most of the rep
sequences was used to provide space for the lox switch and a
reporter cassette, a cre-dependent switch could alternatively be
inserted within a "replication competent" AAV genome in such a
manner that it did not disrupt virus gene expression and
packaging.
Recent efforts to use rAAV as a vehicle for gene therapy hold
promise for its applicability as a treatment for human diseases
based on genetic defects. rAAV vectors provide long-term expression
of introduced genes from an episomal genome, although integration
of the rAAV genome into the host chromosomes has been noted
(Kaeppel 2013). An additional advantage of rAAV is its ability to
perform this function in both dividing and non-dividing cell types
including hepatocytes, neurons and skeletal myocytes. rAAV has been
used successfully as a gene therapy vehicle to enable expression of
erythropoietin in skeletal muscle of mice (Kessler et al., 1996),
tyrosine hydroxylase and aromatic amino acid decarboxylase in the
CNS in monkey models of Parkinson disease (Kaplitt et al., 1994)
and Factor IX in skeletal muscle and liver in animal models of
hemophilia. At the clinical level, the rAAV vector has been used in
human clinical trials to deliver the cftr gene to cystic fibrosis
patients, the Factor IX gene to hemophilia patients (Flotte, et
al., 1998, Wagner et al, 1998).
Recombinant AAV is produced in vitro by introduction of gene
constructs into cells known as producer cells. Some systems for
production of rAAV employ three fundamental elements: 1) a gene
cassette containing the gene of interest, 2) a gene cassette
containing AAV rep and cap genes and 3) a source of "helper" virus
genes.
The first gene cassette is constructed with the gene of interest
flanked by inverted terminal repeats (ITRs) from AAV. ITRs function
to direct the packaging of the gene of interest into the AAV
virion. The second gene cassette contains rep and cap, AAV genes
encoding proteins needed for replication and packaging of rAAV. The
rep gene encodes four proteins (Rep 78, 68, 52 and 40) required for
DNA replication. The cap genes encode three structural proteins
(VP1, VP2, and VP3) that make up the virus capsid.
The third element is relevant because AAV-2 does not replicate on
its own. Helper functions are protein products from helper DNA
viruses that create a cellular environment conducive to efficient
replication and packaging of rAAV. Adenovirus (Ad) has been used
almost exclusively to provide helper functions for rAAV. The gene
products provided by Ad are encoded by the genes E1a, E1b, E2a,
E4orf6, and Va.
Production of rAAV vectors for gene therapy can be carried out in
vitro, using suitable producer cell lines such as 293 and HeLa. One
strategy for delivering all of the required elements for rAAV
production utilizes two plasmids and a helper virus. This method
relies on transfection of the producer cells with plasmids
containing gene cassettes encoding the necessary gene products, as
well as infection of the cells with Ad to provide the helper
functions. This system employs plasmids with two different gene
cassettes. The first is a proviral plasmid encoding the recombinant
DNA to be packaged as rAAV. The second is a plasmid encoding the
rep and cap genes. To introduce these various elements into the
cells, the cells are infected with Ad as well as transfected with
the two plasmids. Alternatively, in more recent protocols, the Ad
infection step can be replaced by transfection with an adenovirus
"helper plasmid" containing the VA, E2A and E4 genes. As provided
herein, the rep and cap arrangements can be in trans for the
screening aspects.
While Ad has been used conventionally as the helper virus for rAAV
production, it is known that other DNA viruses, such as Herpes
simplex virus type 1 (HSV-1) can be used as well. The minimal set
of HSV-1 genes required for AAV-2 replication and packaging has
been identified, and includes the early genes UL5, UL8, UL52 and
UL29. These genes encode components of the HSV-1 core replication
machinery, i.e., the helicase, primase, primase accessory proteins,
and the single-stranded DNA binding protein. This rAAV helper
property of HSV-1 has been utilized in the design and construction
of a recombinant Herpes virus vector capable of providing helper
virus gene products needed for rAAV production.
The following examples are presented as exemplary embodiments only,
and are not intended to be limiting on the scope of the claims. In
addition, there are further sections of various embodiments
provided between some of the various examples below, as
appropriate, and as indicated by the text and spacing of the
document.
Example 1
The Split Rep-AAP and rAAV-Cap-in-Cis Constructs Generate High
Titer rAAV
To test whether the split rep-AAP helper and rAAV-cap-in-cis system
generates rAAV virus, a triple transfection of 293T (ATCC) cells
was performed with the rep-AAP helper, rAAV mCherry-cap-lox71/66
genome and the adenoviral helper construct pHelper. Plasmids were
transfected at a ratio of 2:1:4 (0.263 ug total DNA/cm2 of plated
cell surface area), respectively using linear polyethylenimine
(PEI) as the transfection reagent with a N:P ratio of 25. With
these constructs, one was able to generate recombinant virus with
an efficiency that was equivalent to that observed with the
standard AAV2/9 rep/cap helper, a rAAV2 genome expressing mCherry
only and pHelper (FIG. 5A). In contrast, when the rep-AAP helper
and pHelper were used together with an rAAV genome encoding
mCherry, but not an AAV cap, little to no virus was generated. This
confirms that capsid expression in cis was required for rAAV
production.
Generating the Capsid Libraries: Introducing Short Randomized
Sequences into Surface Loops of AAV9.
Several strategies can be used to introduce sequence diversity into
the cap gene. Examples include, but are not limited to (i) error
prone PCR, which introduces mutations at a controllable rate
throughout a region of the cap gene amplified by PCR, (ii) capsid
domain shuffling, where libraries are generated through
recombination events between fragmented capsid sequences generated
from a panel of different capsid serotypes and (iii) targeted
sequence modification at specific sites using primers with mixed
bases, which generates stretches of randomized sequences at
specific sites within the capsid. Each of these methods has
advantages and disadvantages. In some embodiments, one can use
targeted sequence modification strategy to replace or insert random
sequences of seven amino acids (21 nucleotides) into two different
surface loops.
Example 2
To generate libraries of AAV capsid variants, seven amino acids of
randomized sequence was introduced into the AAV9 capsid. In one
library, (452-8r) AA452-8, (VP1 counting) was replaced by
randomized sequence. In a second library, (588i) seven AA of
randomized sequence was inserted after AA588 in the AAV9 capsid.
Using this targeted randomization strategy the sites can be
randomized together in the same library or randomized sequentially
after selection at an individual site.
The library fragments were generated by PCR. AA452-458 of AAV9 were
replaced with 7 random amino acids through the use of a primer
containing a stretch of 21 hand-mixed bases (7.times.NNK, Primer
1287). Primer 1312 was used as a reverse primer. For the 588i
library, a stretch of 7AA was inserted after AA588 using a primer
containing a stretch of 21 hand-mixed bases (7.times.MNN, primer
1286). Primer 1331 was used as a forward primer. The PCR conditions
reactions were performed using 200 nM of each primer, 0.1-0.5 ng of
template DNA (pCRII-9R-X/A EK plasmid, SEQ ID NO: 6, FIG. 17), 200
um dNTPs, 0.5 ul Q5 Hot Start, High-Fidelity DNA Polymerase (NEB),
10 ul 5.times. buffer and 10 ul GC enhancer provided by the
manufacturer. The template plasmid contained a fragment of the AAV9
capsid gene that has been modified to have two unique restriction
sites (XbaI and AgeI) flanking the region that was varied (this
region creates an overlap with the rAAV9R-X/A-cap-in-cis acceptor
plasmid cut with the same enzymes, see FIG. 5C). In addition, the
PCR template fragment was further modified to eliminate a naturally
occurring EarI restriction site within the capsid gene fragment and
insert a KpnI site. The modification to remove the EarI restriction
site provides a way to eliminate any "wild-type" AAV capsid vector
sequence contamination from the libraries that might arise during
cloning by digesting the libraries with the EarI enzyme. The EarI
digestion step may not be necessary if care is taken to eliminate
the possibility of wt AAV capsid sequence carry over/amplification.
The insertion of the XbaI site caused a K449R mutation, but the
other mutations introduced into the AAV9 sequence are silent.
To facilitate cloning of the PCR fragments comprising the capsid
library sequences into a recombinant AAV genome, the
rAAV-cap-in-cis plasmid was modified to introduce the same two
unique restriction sites, XbaI and AgeI, within the capsid sequence
flanking the region that will be replaced by the PCR-based
libraries (FIG. 5C). In addition, the coding region between the
XbaI and AgeI sites was eliminated to prevent "wt" AAV9R X/A capsid
protein production from any undigested vector during library virus
production (AAV9R-delta-X/A-cap-in-cis, SEQ ID NO: 7, FIG. 18).
To assemble the PCR library products into the acceptor vector, the
PCR products can be digested with XbaI and AgeI restriction enzymes
and then ligated into the cap-in-cis acceptor construct cut with
the same enzymes. Alternatively, the PCR products and the
rAAV-cap-in-cis acceptor vector can be assembled using the Gibson
Assembly method (Gibson et al., 2009). Enzymatic assembly of DNA
molecules up to several hundred kilobases. Nature Methods, 6(5),
343-345. doi:10.1038/nmeth.1318). In the examples presented here,
the Gibson Assembly method was used to consistently assemble over
100 ng of Plasmid Safe DNase-resistant circular DNA from an
assembly reaction made from 400 ng of XbaI and AgeI digested,
alkaline phosphatase treated AAV9R-delta-X/A-cap-in-cis vector and
67 ng of library PCR product with 30 ul of 2.times. Gibson Assembly
Master Mix (NEB) in a total volume of 60 ul. The reactions were run
at 50 C for 120 minutes.
Following Gibson assembly, reaction products were digested with a
Plasmid Safe (PS) DNase as directed (Epicenter), which digests
linearized but not circularized DNA molecules. The assembly
reactions were incubated with 1 ul (10 U) of PS DNase in a reaction
containing 2 ul ATP and 7 ul of the reaction buffer supplied by the
manufacturer (Epicentre) at 37 C for 20 minutes followed by a heat
inactivation step at 70 C for 30 minutes. This reaction typically
yielded over 100 ng of assembled plasmid (as defined by the
measured amount of product remaining after the PS DNase reaction
(measured by Qubit dsDNA Broad Range kit from Invitrogen). 100 ng
is sufficient to transfect 10 150 mm dishes at 10 ng/dish. It was
useful to transfect this amount of the rAAV-cap-in-cis library
plasmid to minimize number of packaging cells that were transfected
with multiple copies of the rAAV-cap-in-cis plasmid, which could
cause the generation of mosaic capsids. Mosaic capsids (those
having a capsid shell composed of more than one capsid protein
variant) would only carry one capsid variant genome. Therefore, not
all of the amino acids within the capsids would be encoded by the
capsid gene within the packaged genome By directly transfecting the
assembled DNA, rather than first transforming it into competent
cells and amplifying it in bacteria, it was possible to transfect
the packaging cells with a maximally diverse library (theoretically
>1e10 unique sequences).
Transfection of 293 Cells for Capsid Library Virus Production.
7-10 150 mm dishes of near confluent 293T cells that had been
seeded 16-30 hour prior to transfection were typically transfected.
In addition to the 10 ng of rAAV-cap-in-cis library vector, 5.7 ug
of puc18, 11.4 ug of Rep-AAP helper and 22.82 ug of pHelper (per
dish) were co-transfected using PEI at a N:P ratio of 25 (see
Grieger et al 2006). The transfection mix was made in phosphate
buffered saline (PBS) and was incubated at room temperature for 10
minutes and then added drop wise into the media. 12-18 hours after
transfection, the media on the transfected cells was exchanged for
fresh DMEM supplemented with 5% FBS, 1.times. Pen/Strep and
1.times. non-essential amino acid mix (Invitrogen). This media was
then collected 48 hours after transfection, and replaced with fresh
media. At 60 hours post transfection the media and cells were
collected. Virus present in the media was concentrated by
precipitation by adding poly(ethylene glycol) and sodium chloride
to 8% and 0.5M, respectively. The cell pellets were resuspended in
10 mM Tris, 2 mM MgCl.sub.2 and the viruses were released from the
cells by 3 freeze-thaw cycles (alternating between a bath made from
100% ethanol and dry ice and a 37 C water bath. After the final
thaw at 37 C, the lysates were treated with 50 U of Benzonase for 1
hour at 37 C. The virus precipitated from the media was then
collected by centrifugation at 4000.times.g for 30 minutes at 4 C.
The pelleted virus from the media was resuspended in the same
Tris-MgCl.sub.2 buffer as above and then combined with the cell
lysate viral stock. At this time, deoxycholine (DOC) was added to
0.5% and the virus stock was incubated at 37 C for an additional 30
minutes. The virus stock was then adjusted to 500 mM NaCl and
incubated for a further 30 minutes before the lysate was cleared by
spinning at 4000.times.g for 15 minutes at 25 C. After spinning,
the cleared viral stock lysates were purified over iodixanol
(Optiprep, Sigma) step gradients (15%, 25%, 40% and 60% as
described by Ayuso et al 2010). Viruses were then sterile filtered
and dialyzed with Amicon Ultra 100K Centrifugal filters as directed
(Invitrogen) and concentrated in PBS. Virus titers were determined
by measuring the number of DNaseI-resistant genome copies (GCs)
using qPCR and a linearized plasmid as a control (Gray et al
2011).
The virus production was halted at 60 hours post-transfection to
reduce the likelihood of secondary transduction of the producer
cells by the rAAV-cap-in-cis virus that is released into the
medium.
Secondary transduction of cells that were successfully transfected
with all of the plasmids necessary for virus production may lead to
the generation of viruses from more than one capsid sequence (i.e.,
mosaics). Effort can be taken to minimize mosaic virus production
to ensure that each capsid gene is packaged only into the physical
capsid variant that it encodes.
Discussion of Additional Embodiments and Further Examples
Based on the results from the initial examples presented below, it
is expected that this system can be used in conjunction with any
transgenic line expressing a recombinase in the target cell type of
interest to develop AAV capsids that more efficiently transduce
that target cell population. Applications include, but are not
limited to, developing capsids that are more efficient at
transducing specific cell types in any organ after IV AAV
administration, targeting specific populations of neurons after
intraparenchymal brain injections, improving neuronal transport
(anterograde or retrograde), targeting tumor cells, hematopoetic
stem cells, insulin producing beta cells, lung epithelium, skeletal
or cardiac muscle. Thus, the selection methods provided herein can
be applied for one or more these aspects.
In addition, the approach can be used to select for viruses that
target human cells in human/mouse chimeric animals (the human cells
would be made to express Cre prior to in vivo delivery). This last
example can be useful in the successful development of efficient
vectors for gene therapy applications as there is evidence that the
AAV serotypes that function best in animal models may not always
function with the same efficiencies in humans (Lisowski et al
2013). Therefore, it can be advantageous to select for viruses that
most efficiently transduce the target human cell population in the
in vivo context of an animal model.
In addition, the method can be used in conjunction with any virus
delivery method (e.g., intravenously, SC, IP, intramuscular,
intranasal, i.c.v, intrathecal, oral or
intracranial/intraparenchymal brain injection). In some
embodiments, the vector can be delivered via any route including,
but not limited to: oral, intravenous, intraarticular,
intracardiac, intramuscular, intradermal, topical, intranasal,
intraparitoneal, rectal, sublingual, subcutaneous, epidural,
intracerebral, intracerebroventricular, intrathecal, intravitreal
or subretinal administrations.
Although the examples herein have used AAV9 as a starting point,
any naturally occurring or previously engineered AAV capsid could
also be used as a starting point for selection using this approach.
Furthermore, this method could also be useful for identifying other
coding or non-coding sequences within an AAV or other viral genome
that influenced transduction of recombinase expressing cells.
Preferred examples include selecting for sequences within the AAV
genome that increase conversion of the viral genome to dsDNA,
increase the persistence of viral genomes by facilitating
recombination or circularization, increase the efficiency of
integration of the viral genome into a favored site(s) in the
cellular genome or sequences that influence gene expression in the
target cell population.
In some embodiments, provided herein is the use of CREATE (Cre
Recombinase-based AAV Targeted Evolution), a novel platform for the
selective recovery of capsid sequences that transduce Cre.sup.+
target cell populations. Using CREATE, it was possible to develop
several new AAV capsid variants with useful properties, including
one, AAV-PHP.R2, that mediates efficient retrograde transduction
within the brain as early as seven days post administration, and a
second variant, AAV-PHP.B that crosses the adult mouse blood brain
barrier (BBB) and transduces a variety of CNS neural cell types
with an efficiency that is at least 40-fold greater than AAV9, the
current standard for systemic delivery. In addition, whole animal
tissue clearing using PARS-based CLARITY (Yang et al., 2014b) as a
more rapid method for assessing serotype tropism at the cellular
level and as a method to study individual cell morphology in the
brain when combined with low-dose systemic AAV-PHP.B delivery is
provided. Used together, transduction mapping in intact tissues and
the Cre-based capsid selection method presented provide a novel
platform that should facilitate further custom virus
development.
Example 3
In Vivo Selection Using GFAP-Cre Transgenic Animals
AAV capsids were developed that more efficiently transduce cells
within the CNS of adult mice after IV injection. For this purpose,
transgenic mGFAP-Cre mice were used that express Cre specifically
within astrocytes and neural stem cells (NSCs) in the adult brain
and spinal cord. The capsid libraries (1.2e11 GC) were delivered
intravenously (IV) to mice through the retro-orbital sinus. 7-8
days later, the DNA was collected from the entire brain and spinal
cord and recovered rAAV capsid sequences from GFAP-Cre+ cells (FIG.
6). Vector DNA was recovered from one hemisphere of the brain and
half of the spinal cord using 4 ml of Trizol (Invitrogen). The
manufacture's protocol was followed, and the aqueous,
RNA-containing fraction was precipitated with isopropanol and
subjected to three washes in 70% ethanol made with water (all water
used for PCR recovery of capsid sequences in this protocol is
treated with UV using a UV light box for 10-15 minutes prior to
use). The precipitated material was then resuspended in 10 mM Tris
pH8.0. In addition to RNA, this fraction also contains a
significant fraction of the viral genome as well as some
mitochondrial DNA. To eliminate the RNA, which reduced the
efficiency of the PCR-based recovery of capsid sequences, the
samples were treated with 1 ul of RNase (Qiagen) overnight.
Alternative strategies for selective recovery of viral genomes away
from the animal's genomic DNA could also be used, e.g., the HIRT
extraction protocol (Hirt 1967), sized-based gel-purification,
sequences specific capture/hybridization methods or selective
digestion of the mouse genomic DNA by PS DNase following digestion
with a restriction enzyme that does not cut the rAAV-cap-in-cis
genome.
Capsid sequence recovery was performed in a Cre-dependent manner
using primers 1253+1316. PCR conditions were 20-28 cycles with 95 C
20 sec/60 C for 20 sec/72 C for 30 sec using Q5 Hot Start
High-fidelity DNA Polymerase. The PCR product was then diluted 1:10
and then used as a template for a second, PCR reaction that
generated the X to A fragment (using primers 1331+1312) that was
cloned back into the rAAV9R-deltaX/A-cap-in-cis acceptor construct
to generate the next round of library virus using the same methods
describe above. 1 ul of the Gibson Assembly reactions was then
diluted 1:10 and transformed into Sure2 competent cells (Agilent)
as directed by the manufacturer. At least 10 colonies/library were
picked 12-16 hours later, DNA was isolated by miniprep kit (Qiagen)
and the clones were sequenced. Alternatively, DNA from the clones
can be amplified by PCR using primers 1253 and 1312 and sequenced
directly, eliminating the need to perform mini plasmid DNA
preps.
After the first round of selection all of the clones sequenced for
both libraries were unique. Therefore, a second selection round was
performed to further enrich for the most potent sequences. The
assembled rAAV-cap-in-cis library regenerated after the first round
of selection was used to generate a second round of virus which was
then injected into a second batch of GFAP-Cre+ mice as described
above. After the second round, two sequences, G2B13 and G2B26
showed evidence of enrichment (Table 2).
TABLE-US-00003 TABLE 2 Enriched Sequences from GFAP- Cre in vivo
selection 7mer 7mer % Selec- DNA AA of Vari- Mouse Deliv- tion se-
se- total ant line ery rounds site quence(s) quence(s) clones G2B-
GFAP- IV 2 452- CAGTCGTCGCA QSSQTPR 18% 13 Cre 8 GACGCCTAGG (SEQ ID
(SEQ ID NO: 54) NO: 48) G2B- GFAP- IV 2 588 ACTTTGGCGGT TLAVPFK 27%
26 Cre GCCTTTTAAG (SEQ ID (SEQ ID NO: 1) NO: 49) TH1.1- TH- intra-
1 + 1 452- ATTCTGGGGAC ILGTGTS 18% 32 Cre crain- 8+ TGGTACTTCG
(452-8) ial 588 (SEQ ID (SEQ ID (striatum) NO: 50) NO: 55)
ACGCGGACTAA TRTNPEA 9% TCCTGAGGCT (588) (SEQ ID (SEQ ID NO: 51) NO:
56) TH1.1- TH- intra- 1 + 1 452- ATTCTGGGGAC ILGTGTS 18% 35 Cre
crain- 8+ TGGTACTTCG (452-8) ial 588 (SEQ ID (SEQ ID (striatum) NO:
52) NO: 57) AATGGGGGGAC NGGTSSS 36% TAGTAGTTCT (588) (SEQ ID (SEQ
ID NO: 53) NO: 58)
To test the variants recovered, the sequences were cut with BsiWI
and AgeI and ligated into an AAV2/9R-X/A rep/cap helper (AAV2/9
rep/cap helper modified with the AAV9R-X/A capsid sequence from
rAAV-cap-in-cis plasmid) also cut with BsiWI and AgeI and
transformed into DHSalpha competent cells (NEB). Plasmid DNA was
purified using an Endofree Plasmid Maxi Kit (Qiagen). The resulting
rep/cap plasmids carrying the novel variant sequences, or AAV2/9
rep/cap as a control, were then used to package a rAAV genome
containing a dual eGFP-2A-luciferase reporter cassette driven by a
ubiquitous CAG promoter (rAAV-CAG-eGFP-2A-Luc-WPRE-SV40 pA). The
novel capsids packaged the genome with efficiencies comparable with
AAV9 (FIG. 7). 1e12 GC of each vector was injected IV into
individual adult female C57Bl/6 mice. Six days later, the mice were
perfused with 4% paraformaldehyde in 100 mM phosphate buffer and
the brains were examined for eGFP fluorescence.
Remarkably, transduction by the G2B26 variant was efficient enough
that the native eGFP fluorescence throughout the intact brain could
be seen with a 1.times. objective on an epifluorescence microscope
(FIG. 8A). At this same exposure setting, little to no eGFP
fluorescence is evident in the brain from the mouse injected with
AAV9. In sections prepared from a brain from a mouse injected with
G2B26, transduction of neurons and glia in all regions examined in
the brain and spinal cord were seen (FIGS. 8 and 9). In certain
thalamic nuclei, over 90% of the NeuN+ cell bodies expressed GFP
(FIG. 9G). Transduction of motor neurons in the ventral spinal cord
was also robust (FIG. 9F). Numerous Sox2+ glia expressed GFP (FIG.
9I). The G2B13 variant also transduced astrocytes and neurons more
efficiently than AAV9, but the effect was not as dramatic as
compared to the transduction by G2B26 (FIGS. 8 and 9A-C). The G2B13
variant showed strong transduction of fiber tracts in the dorsal
brain stem (FIG. 9B) and spinal cord (FIG. 9C) as well as robust
liver transduction (FIG. 8C). It also appears that the G2B26
variant provides more rapid onset of expression in the CNS than
AAV9. Transduction by AAV9 transduction at six days post-injection
was weak. Stronger expression was observed per cell and more eGFP
expressing cells with the same dose of AAV9 at 21 days post
injection.
Since rapid unpackaging has been proposed to be an important
component of transduction efficiency and viral genome persistence
(Wang et al. 2007), recovering capsid sequences soon after
injection (in this case 7-8 days) may be an important component of
a successful selection.
In the example above, the number of cycles can be determined
empirically with the optimal number of cycles being within a range
that yields more product from samples taken from Cre+ cells/animals
than from samples lacking Cre+ cells. If the PCR reaction is
allowed to continue past this optimal range by performing too many
cycles, products may be recovered even from Cre negative samples.
It can be desirable to avoid doing too many cycles.
Example 4
In Vivo Selection for Improved Retrograde Transduction Using TH-Cre
Animals
In a second test of the Cre-dependent selection platform, it was
asked whether one could generate novel AAV serotypes that lead to
more efficient transduction of TH+ neurons in the substantia nigra
(SN) compact part after virus injection into the striatum, a
structure that receives axons from TH neurons. This selection
scheme is designed to develop AAVs that are capable of rapid
retrograde transport and transduction of TH+ and non-TH+ cells.
The same libraries were used as initially generated for the Example
3 selection and injected 0.6 ul of the virus bilaterally into the
striata of adult TH-Cre+ male mice using the stereotaxic
coordinates 0.7 mm rostral, 2.0 mm lateral and 3.0 mm ventral from
Bregma. 10 days later, the region containing the SN was collected
and isolated virus DNA from the tissue as described above. For
these dissections, the mCherry reporter expressed from the
rAAV-cap-in-cis genome aided in the identification of the SN (FIG.
10C) and the confirmation that the virus libraries injections had
targeted the desired areas (FIG. 10B). Virus DNA was obtained from
the SN-containing tissue sample using Trizol (Invitrogen) as
described above and the same Cre-dependent PCR strategy was used to
selectively recover those capsid sequences that led to the
transduction of TH+ neurons (FIG. 10D). Using primers that amplify
capsid sequences from all genomes regardless of recombination
status (1253+1267) demonstrate that the viral sequences were also
present in the Cre- controls (FIG. 10D, lower panel). Sequences
recovered through the Cre-recombination dependent strategy were
cloned back into the rAAV-cap-in-cis library acceptor as described
above in Example 3.
Colonies were picked for sequencing. After the first round of
selection, all of the tested sequences were unique, so a second
round of selection was performed as described above. In addition to
continuing with the libraries modified at the two individual sites,
combinatorial libraries were also made by mixing all of the
sequences recovered at the 452-8 replacement site with the
sequences recovered at the 588 insertion site using the PCR
strategy outlined in FIG. 10. Capsid virus libraries from the
recovered sequences were prepared, selected again in TH-Cre mice
and recovered as described above.
After the second selection round in the combinatorial library,
several sequences at both randomization sites showed evidence of
enrichment. Several novel capsid sequences were selected to test as
individual variants. The sequences were cloned into an AAV2/9R-X/A
rep/cap helper using unique BsiWI and AgeI sites present in both
vectors. The resulting rep/cap plasmids carrying the novel variant
sequences, or AAV2/9 rep/cap as a control, were then used to
package a single stranded (ss) rAAV-CAG-GFP-W-pA genome. The novel
capsids packaged the genome with efficiencies comparable with AAV9
(FIG. 7). 7e9 VGs (in 0.5 ul) of each virus was injected
individually, and bilaterally, into adult C57Bl/6 mice using the
same stereotaxic coordinates described above. 7 days later, mice
were given an overdose of Euthasol and killed by cardiac perfusion
with 4% PFA as described above. At this time, there were few if any
GFP+/TH+ neurons in the SNc of mice that received an injection of
the control virus, AAV9:CAG-GFP-W-SV40 pA. In contrast, there were
numerous GFP+/TH+ neurons present in the mice given injections of
the same rAAV genome packaged into the novel clones TH1.1-32 (FIG.
12D) or TH1.1-35 (FIG. 23D)
A listing of the primers used in examples 3 and 4 is provided in
Table 1 below:
TABLE-US-00004 TABLE 1 Primer Purpose Sequence 1253 Cre-dependent
CAGGTCTTCACGGACTCAGACT amplification, ATCAG (SEQ ID NO: 16) forward
1254 9R-X/A delta, CAACCGGTAATAGTTCTAGAGA reverse
GATAGTACAAGTATTGGTCGAT GAGTG (SEQ ID NO: 37) 1255 9R-X/A delta,
CTCTCTAGAACTATTACCGGTT forward GGGTTCAAAACCAAGGAATACT TC (SEQ ID
NO: 38) 1267 Library GTCCAAACTCATCAATGTATCT recovery, non-
TATCATGTCTG recombined, (SEQ ID NO: 39) reverse 1280 VP1 stop,
GAGTCAATCTGGAAGTTAACCA reverse TCGGCA (SEQ ID NO: 40) 1281 VP1
stop, GATGGTTAACTTCCAGATTGAC forward TCG (SEQ ID NO: 41) 1283 VP2
stop, GACTACTCTACAGGCCTCTTCT reverse ATCCAG (SEQ ID NO: 42) 1284
VP2 stop, GATAGAAGAGGCCTGTAGAGTA forward GTCTCC (SEQ ID NO: 43)
1285 VP3 stop, CATCGGCACCTTAGTTATTGTC reverse TG (SEQ ID NO: 44)
1286 VP3 stop, GACAATAACTAAGGTGCCGATG forward GAGTGG (SEQ ID NO:
45) 1286 Site 588 GTATTCCTTGGTTTTGAACCCA random-
ACCGGTCTGCGCCTGTGCMNNM ization NNMNNMNNMNNMNNMNNTTGG reverse
GCACTCTGGTGGTTTGTG (SEQ ID NO: 23) 1287 Site 452-8
CATCGACCAATACTTGTACTAT random- CTCTCTAGAACTATTNNKNNK ization
NNKNNKNNKNNKNNKCAAACG CTAAAATTCAGTGTGGCCGGA (SEQ ID NO: 22) 1312
Site 452-8, GGAAGTATTCCTTGGTTTTGA reverse and ACCCA X/A fragment
(SEQ ID NO: 19) generation, reverse 1316 Library
CAAGTAAAACCTCTACAAATG recovery, Cre- TGGTAAAATCG dependent, (SEQ ID
NO: 17) forward (reversed by recombination) 1331 Site 588,
ACTCATCGACCAATACTTGTA forward and CTATCTCTCTAGAAC X/A fragment (SEQ
ID NO: 18) generation, forward 1352 Combinatorial
GTCTCTGCCGGTACCTTGTTT library GCCAAAAATTAAAGATCCA generation, (SEQ
ID NO: 46) Earl to Kpnl mutation insertion, Rev 1353 Combinatorial
GCAAACAAGGTACCGGCAGAG library AGACAACGTGGATGCGGACA generation, (SEQ
ID NO: 47) Earl to Kpnl mutation insertion, For
By using the platform for selection provided herein, it was
possible to developed several capsids that provide enhanced,
widespread gene expression in the CNS.
Notably, one capsid (AAV-PHP.R2) was capable of rapid, retrograde
transport within CNS neurons after intracerebral injection, while
another capsid (AAV-PHP.B) transduced cells throughout central
nervous systems with 40-90-fold greater efficiency than AAV9 when
delivered systemically. AAV-PHP.B transduces both neurons and glia
and is therefore well suited for gene transfer to global CNS neural
cell types including neurons, astrocytes and oligodendrocytes.
Given the large collection of cell type-specific Cre transgenic
lines, the present capsid-selection platform is a valuable resource
for customizing gene delivery vectors for biomedical
applications.
Example 5
Within the rAAV cap-in-cis recombinant genome, two elements were
introduced to facilitate the selection. The first is an mCherry
reporter cassette, having a 398 base pair promoter fragment from
the ubiquitin C gene (UBC), the 711 bp mCherry cDNA, and a 118 bp
3' untranslated region containing a 51 bp synthetic poly
adenylation (polyA) sequence (Levitt et al., 1989). The second, and
more relevant element is a Cre-dependent "switch", having a pair of
inverted, modified loxP sites (lox71 and lox66) (Araki et al.,
1997) flanking a SV40 polyA sequence downstream of the cap gene.
This floxed element created a Cre-invertible sequence that allows
for the selective PCR amplification and recovery of only those cap
sequences contained within the AAV genomes that have transduced
Cre.sup.+ cells (FIG. 22A).
To provide rep, but not cap, gene function in trans, an AAV2/9
REP-CAP helper plasmid was modified by inserting five in frame stop
codons within the reading frame for the capsid proteins, VP1, VP2
and VP3. These stop codons were designed to disrupt capsid protein
expression, but not alter the amino acid sequence of the assembly
activating protein (AAP), which is expressed from an alternative
reading frame within the cap gene (FIG. 22B) (Sonntag et al.,
2010). In this way, the modified REP-AAP helper plasmid continues
to provide all of the AAV gene products in trans, save for capsid
protein expression. To test whether this split rAAV-CAP-in-cis-lox
and REP-AAP helper system efficiently generates rAAV, a triple
transfection of HEK 293T cells was performed with the
rAAV-CAP-in-cis genome, the REP-AAP helper, and the adenoviral
helper plasmid, pHelper. Importantly, with these plasmids, it was
possible to generate recombinant virus with an efficiency that was
equivalent, if not greater than, that observed when an AAV2/9
REP-CAP helper was used to package a rAAV genome encoding mCherry
(AAV-UBC-mCherry) (FIG. 22C).
In contrast, when the AAV REP-AAP helper was used to package
AAV-UBC-mCherry, lacking the cap gene in cis, little to no virus
was generated, confirming that capsid protein expression from the
rAAV-CAP-in-cis-lox vector was required for rAAV production. Used
together, the rAAV-CAP-in-cis-lox and AAV REP-AAP helper provided a
novel platform, which is here below termed CREATE, for selective
capsid sequence recovery from genetically defined populations of
cells within complex tissue samples.
Example 6
Two AAV9-based capsid libraries were generated by PCR using a mixed
base randomization strategy. One library was made by inserting 7
amino acids of randomized sequence between AA588-9 (VP1 position)
of the AAV9 capsid and another with 7 amino acids of randomized
sequence replacing AA452-8 of AAV9. The cloning strategy was
designed such that the recoverable PCR product would contain only
the stretch of amino acids spanning the variable regions (sequences
between AA450 and AA592), which encompasses a significant portion
of the surface exposed amino acids, while the rest of the capsid
sequence within the backbone vector remains unmodified. Library
fragments were then cloned into the rAAV-delta-cap-in-cis vector
and assembled products were directly transfected into packaging
cells to produce virus, bypassing the primary bottleneck of library
diversification, bacterial transformation. With this approach, the
library diversity is limited by the number of transfected cells,
rather than the number of bacterial transformants resulting in an
estimated diversity of 1.times.10.sup.7-1.times.10.sup.8 unique
sequences. Using this approach, it was possible to achieve yields
of 5-10.times.10.sup.11 VGs.
Vectors that mediate efficient retrograde transduction of neurons,
i.e., the uptake of vector by axons and transport back to the
nucleus, are desired for neuronal circuit tracing and
intersectional approaches for circuit-specific gene expression, and
may also have uses for clinical gene delivery. While viruses such
as recombinant rabies and herpes simplex virus (HSV), exhibit
highly efficient retrograde transduction and are useful for
short-term circuit tracing studies, their long-term toxicity
precludes their use for longitudinal experiments or experiments
where their impact on cellular health would cofound (e.g.
optogenetics, aging, neurodegeneration studies). For long-lasting
gene expression, AAVs capable of efficient retrograde transduction
would be highly valuable as they would allow the extensive tool-set
available in the rAAV genome format to be applied to applications
requiring retrograde transduction (NIH Brain Initiative Working
Group, 2013).
Example 7
In Vivo Selection for AAV Variants with Enhanced Retrograde
Transduction in the Rodent CNS
Several AAV serotypes have been shown to mediate retrograde
transduction of neurons in the CNS with varying efficiencies
(Aschauer et al., 2013; Castle et al., 2014a; Castle et al., 2014b;
Cearley and Wolfe, 2007; Hutson et al., 2012; Low et al., 2013;
Salegio et al., 2013; Samaranch et al., 2012). To develop AAV
capsids with improved retrograde transduction, an in vivo selection
for capsids that transduced TH.sup.+ dopaminergic neurons in the
substantia nigra via retrograde transport from their axons within
striatum (Smith and Bolam, 1990) was set up. The AAV-CAP-in-cis-lox
452-8r and 588i libraries were separately injected into the striata
of adult TH-Cre.sup.+ mice. 10 days later the tissue surrounding
the substantia nigra (SN) (FIG. 23A) was dissected and isolated
viral DNA. For these dissections, the mCherry reporter expressed
from the AAV-cap-in-cis library vectors aided in the identification
of the SN as the SN pars reticulata (SNr) was easily identified
from the mCherry.sup.+ axons that project to the SNr from the
striatum. mCherry expression in the striatum confirmed that the
virus library injections had been properly targeted (FIG. 23A).
After the first round of selection, 10 clones from each library
were sequenced and it was found that all of the tested sequences
were unique, so a second round of selection was performed. To
further diversify the libraries after the initial round of
enrichment, combinatorial libraries were made by mixing all of the
sequences recovered from the 452-8r library with all of the
sequences recovered from the 588i library by PCR (see FIG. 27D).
Viral capsid libraries from the combinatorial library were prepared
and selected again in TH-Cre mice as described above. After the
second selection round, several sequences at both randomization
sites showed evidence of enrichment.
The most highly enriched variant, PHP.R2, was further characterized
by testing it individually (see Table 3 for sequence information
and enrichment data).
TABLE-US-00005 TABLE 3 7mer Var- Selec- Site DNA AA iant tion Route
Rounds (s) sequence seq. % PHP. TH i.c. 1 + 1 452- ATTCTGGGGAC
ILGTGTS 18% R2 8r TGGTACTTCG (SEQ ID 588i (SEQ ID NO: 55) NO: 50)
NGGTSSS 36% AATGGGGGG (SEQ ID ACTAGTA NO: 58) GTTCT (SEQ ID NO: 53)
PHP. GFAP i.v. 2 588i TATACTTTGTC YTLSQGW 40% A GCAGGGTTGG (SEQ ID
(SEQ ID NO: 60) NO: 59) PHP. GFAP i.v. 2 588i ACTTTGGCGGT TLAVPFK
27% B GCCTTTTAAG (SEQ ID (SEQ ID NO: 1) NO: 49)
Table 3 lists the AAV-PHP variants, the Cre transgenic line used to
perform the library selection, the route of administration and the
number of selection rounds used to enrich for the improved
variants. 1+1 refers to one round of selection of the two separate
libraries and then an additional round of selection of the
combinatorial library. The site within AAV9 that was modified in
each recovered variant is listed as is the 7mer DNA sequence(s) and
amino acid sequence(s) (AA seq.) that are modified in each capsid
variant. The number of occurrences of the enriched sequence as a
percentage of the total number of clones sequenced is also
given.
AAV-PHP.R2 was used to package a single stranded (ss) AAV-CAG-GFP
genome and injected it into the striatum of adult mice. Notably,
after only 7 days, robust GFP expression was observed at the
striatal injection site (FIG. 23B) as well as at sites distant to
the injection that are known to send projections to the striatum
including the SNc (FIGS. 23C and 23D), the cortex (FIGS. 23E and
23F), the thalamus (FIG. 23G) and the amygdala (FIG. 23H). These
results demonstrate that AAV-PHP.R2 can provide rapid retrograde
transduction of several distributed neuronal populations.
Example 8
In Vivo Selection for AAV Variants Capable of Widespread CNS
Transduction Following Systemic Administration
The present example examines the development of AAV capsids that
more efficiently transduce cells throughout the CNS. Several AAVs,
most notably AAV9, rh.10 and rh.8, transduce CNS neurons and glia
after neonatal or adult systemic, intravenous delivery (Duque et
al., 2009; Foust et al., 2009; Gray et al., 2011; Samaranch et al.,
2011; Yang et al., 2014a). While systemic rAAV administration with
these serotypes is capable of widespread CNS delivery, the
transduction efficiency is significantly reduced compared to that
achievable in other organs such as liver, heart or skeletal muscle
(Pulicherla et al., 2011). The present example demonstrates the use
of the CREATE platform to develop capsids that more efficiently
transduce the CNS globally. This was done given the important roles
astrocytes play in the pathogenesis of neurodegenerative disease,
together with the baseline tropism of AAV9 for astrocytes.
The AA452-8r and AA588i capsid libraries described above were
delivered into transgenic mGFAP-Cre mice that express Cre from the
mouse GFAP promoter, which is expressed within astrocytes and
neural stem cells (NSCs) in the adult brain and spinal cord (Garcia
et al., 2004). 1.times.10.sup.11 VG of each capsid library were
injected into separate adult GFAP-Cre positive mice and GFAP-Cre
negative mice as controls. Seven days later, virus DNA from the
brains and spinal cords and recovered capsid sequences from viral
genomes that had undergone Cre-mediated recombination by PCR were
isolated. The recovered fragments were cloned back into the
rAAV-CAP-in-cis-lox acceptor vector, and clones from each library
were picked at random for sequencing. As observed in the first
round of the TH-Cre selection, all of the tested sequences
recovered from both libraries after the first round were unique.
After the second round, a single sequence, designate as AAV-PHP.B,
was identified from the 588i library and showed signs of
enrichment.
To assess the AAV-PHP.B variant individually, this capsid or AAV9
was used to package a dual-GFP and firefly Luciferase reporter
vector, ssAAV-CAG-GFP-2A-Luc. AAV-PHP.B packaged the recombinant
genome with an efficiency similar to AAV9 (FIGS. 27A-27E). Next,
1.times.10.sup.12 VG of ssAAV-CAG-GFP-2A-Luc packaged into
AAV-PHP.B or AAV9 was delivered into adult mice by IV injection and
assessed transduction by GFP expression three weeks later.
Remarkably, this variant transduced the entire CNS with high
efficiency as indicated by immunostaining for GFP (FIGS. 24A and
24C) and analysis of native eGFP fluorescence in several brain
regions (FIGS. 24B, 24D, and 24G), the spinal cord (FIGS. 24D and
24G) and retina (FIG. 24E-24F). Native GFP fluorescence remained
dramatically increased over AAV9 even when 10-fold less AAV-PHP.B
was delivered (FIG. 25A-right and 25D). In stark contrast with
AAV9, which sparsely labels neurons and glia, individual transduced
astrocytes were difficult to discern in mice that received
1.times.10.sup.12 VG AAV-PHP.B, but could be seen in animals that
received 10-fold less virus (FIGS. 24A-24B and FIG. 25A). AAV-PHP.B
also transduced cerebellar Purkinje cells with strikingly high
efficiency as demonstrated by co-localization of GFP and Calbindin
immunostaining (FIG. 24C). Taking advantage of recent advances in
CLARITY-based tissue clearing (Yang et al., 2014b), the native eGFP
fluorescence was imaged through several hundred micron thick
sections of tissue from the cortex, striatum and ventral spinal
cord. These 3D renderings further demonstrate the efficiency of
transduction by the AAV-PHP.B variant and confirm tissue clearing
(Chung and Deisseroth, 2013; Tomer et al., 2014; Yang et al.,
2014b) as a means of assessing the three-dimensional distribution
of transduced cells within the brain (FIG. 24G).
To quantify CNS transduction by this variant as compared to AAV9,
the number of viral genomes present in several brain regions 25
days post injection were measured. Brain and spinal cord
transduction by AAV-PHP.B was between 40 and 92-fold more efficient
than AAV9, depending on the region examined (FIG. 24H), while
outside of the CNS, the AAV-PHP.B vector transduced several
peripheral organs less efficiently than AAV9 (FIG. 24I).
Remarkably, in all regions other than the cerebellum, the number of
viral genomes detected in the CNS in mice treated with AAV-PHP.B
was similar that observed in the liver and greater than that seen
in the other peripheral organs examined. In stark contrast, after
AAV9 transduction, the number of AAV genomes detected within any of
the CNS regions examined was at least 120-fold less than the number
found in the liver. Therefore, while the tropism of AAV-PHP.B was
not CNS specific, the enhanced transduction exhibited by this
vector was CNS specific. In an initial selection using CREATE in
GFAP-Cre mice an AAV9-based variant, AAV-PHP.A, was identified that
exhibited both more efficient astrocyte transduction as well as
reduced tropism for several peripheral organs (FIG. 28A-28E). Based
on these results, AAV-PHP.B appears applicable for non-invasive,
CNS-wide gene transfer in the adult.
AAV9 preferentially transduces astrocytes when delivered
systemically to adult animals, but it also transduces neurons in
several regions (FIG. 24A and FIG. 25A, Foust et al 2009, and Yang
et al 2014). To examine the cell types transduced by AAV-PHP.B, the
colocalization of GFP expression with proteins expressed in
specific cell populations was analyzed. AAV-PHP.B transduced
GFAP.sup.+ astrocytes (FIG. 25A), CC1.sup.+ oligodendrocytes (FIG.
25B), NeuN.sup.+ neurons (FIG. 25C and FIG. 25D) but not IBA1.sup.+
microglia (FIG. 25E).
Several cell types of clinical importance are also targeted with
high efficiency including TH.sup.+ dopaminergic neurons in the SNc
(FIG. 25F), spinal motor neurons (FIG. 34D and FIG. 24H) and
striatal medium spiny neurons (FIG. 25D). In addition, several
interneuron populations were also transduced (FIG. 25G-25J),
although strong eGFP fluorescence was rarely found to colocalize
with cells with Calretinin staining (FIG. 25J).
In sum, adult IV administration of AAV-PHP.B can be used to target,
with high efficiency, numerous CNS cell types of scientific and
clinical interest.
Tissue Clearing for Serotype Tropism Characterization and 3D Cell
Phenotyping
Because CLARITY allows for the 3D imaging of cells in thick
sections or intact tissue (Chung et al 2013; Yang et al. 2014) and
AAV-PHP.B transduces numerous glial and neuronal cell types in the
brain, whether CLARITY could be used together with a low dose of
AAV-PHP.B to provide random, Golgi-like labeling of neural cells in
the CNS was examined. To evaluate this approach, 1.times.10.sup.10
VG of AAV-PHP.B expressing GFP was delivered into adult mice by IV
injection. These mice were perfusion cleared and native GFP
fluorescence in the brains of the mice was imaged. Individual
neurons, astrocytes and endothelial cells were visible and could be
imaged through at least 400 um of cleared tissue (FIG. 26D).
This approach can be useful for studying the morphology of
individual cells in normal and diseased states. This approach can
be used to co-express a reporter along with any of the following
examples of genetic elements to investigate the effects of said
genetic element on cell morphology or connectivity in vivo: a gene
encoding a protein of interest; Cre, or another recombinase, for
conditional gene modification in transgenic animals harboring a
floxed target allele(s); conditional, floxed, alleles to transgenic
animals made to express Cre in a defined target cell population; a
gene knockdown cassettes containing a suitable promoter and shRNA
or miRNA, or an endogenous miRNA sponge or decoy. Given the ease of
adjusting the labeling/gene modification frequency by modulating
the amount of virus administered, this vector could also be used to
address questions related to cell autonomy by generating genetic
mosaics.
Whole animal tissue clearing using PARS-based CLARITY may also be
useful for the assessment of AAV tropism at a cellular level. This
is typically a labor-intensive process that requires processing,
mounting and imaging individual thin (1-100 micron) sections of
tissue from each organ. The potential whole animal tissue clearing
to reduce this burden was explored. 1.times.10.sup.12 VG of
ssAAV-CAG-GFP-2A-Luc packaged into AAV-PHP.B or AAV9 was delivered
into adult mice by IV injection. Three weeks later, all of the
tissue in the mice was cleared using the PARS-based CLARITY method
described in Yang et al. (2014) and used confocal imaging and 3D
image reconstruction (Imaris software, Bitplane) to assess native
GFP expression as a reporter of vector transduction. In several
organs, including skeletal muscle, lung, pancreas, and the liver,
the mice that received AAV-PHP.B showed a reduction in the
expression of GFP as compared to the mice that received an
equivalent dose of AAV9 (FIG. 29). The reduced GFP expression in
several peripheral organs observed with AAV-PHP.B as compared with
AAV9 appears consistent with the number of VGs detected for each
vector in these same peripheral organs (FIG. 24I). Note the GFP
positive nerve fibers present in the muscle and pancreas of mice
injected with AAV9 and AAV-PHP.B.
rAAV labeling combined with CLARITY will be a useful approach for
studying the 3D morphologies of peripheral nerves.
The following aspects apply to the experiments outlined in Examples
7 and 8 above:
Mice
5-week-old female C57Bl/6 mice were purchased from the Jackson Labs
(Maine). GFAP-Cre mice expressing Cre under the control of the
mouse GFAP promoter (Garcia et al., 2004) and TH-Cre mice (Savitt
et al., 2005) were from the Jackson Labs. In vivo selection was
performed in adult mice of either sex.
Plasmids
The rAAV-cap-in-cis-lox plasmid contains the following elements
cloned into a vector containing AAV2 ITRs (Balazs et al. 2011). An
mCherry expression cassette (398 bp fragment of the human UBC gene
upstream of the mCherry reporter followed by a 48 bp synthetic
polyA sequence--(Levitt et al., 1989) followed by the AAV9 capsid
cassette.
Expression of the AAV9 capsid gene was placed under the control of
the p41 promoter sequence from AAV5 (1680-1974 of GenBank
AF085716.1; Qiu, Nayak Pintel 2002 and Farris and Pintel 2008) and
splicing sequences taken from the rep gene from the AAV9 packaging
plasmid (U. Penn). A SV40 polyA sequence flanked by inverted lox71
and lox66 sites was placed downstream of the AAV9 capsid. The
rAAV-cap-in-cis-lox plasmid was modified to introduce two unique
restriction sites, XbaI and AgeI, within the capsid sequence
flanking the region that was replaced by the PCR fragment. The
insertion of the XbaI site caused a K449R mutation and the
mutations required to insert the AgeI site were silent.
In the second iteration of the library construction (used in the
second GFAP-Cre capsid selection that yielded PHP.B), two
modifications were made to reduce contamination of the libraries by
AAV9 or the starting AAV9R X/A capsid. First, the coding region
between the XbaI and AgeI sites was eliminated in the plasmid used
for the capsid library cloning (rAAV-.DELTA.cap-in-cis acceptor) to
eliminate any potential carryover of undigested plasmid. Second,
the PCR fragment covering the capsid library variable region
between the XbaI and AgeI sites was modified to remove a unique
EarI restriction site (xE) within this region of AAV9 and insert a
unique KpnI site. The modified xE fragment was TA cloned into pCRII
to generate pCRII-9Cap-xE, which served as the template for our
later library PCR fragments. Eliminating the EarI site provided a
secondary precaution allowing for the digestion of any
contaminating AAV9 sequences recovered by PCR. It was not necessary
to use this digestion step as taking standard PCR precautions
including UV treating reagents and pipettors and using the
rAAV-.DELTA.Cap-in-cis acceptor for cloning the libraries was
sufficient to prevent contamination from AAV9 or AAV9R X/A.
The AAV2/9 REP-AAP helper plasmid was constructed by introducing 5
stop codons into the coding sequence of the VP reading frame of the
AAV9 gene at AAs 6, 10, 142, 148, 216 (VP1 numbering). The stop
codon at AA216 was designed such that it did not disrupt the coding
sequence of the AAP protein, which is encoded within an alternative
reading frame.
Library Generation
The 452-8r and 588i library fragments were generated by PCR using
Q5 Hot Start, High-Fidelity DNA Polymerase (NEB). A schematic
showing the approximate primer binding sites and the primer
sequences are given in FIGS. 27A and 27C, respectively. To
facilitate cloning of the PCR fragments comprising the capsid
library sequences into a rAAV genome, the rAAV-cap-in-cis plasmid
was modified to introduce two unique restriction sites, XbaI and
AgeI, within the capsid sequence flanking the region that was
replaced by the PCR fragment. The insertion of the XbaI site caused
a K449R mutation and the mutations required to insert the AgeI site
were silent. To prevent contamination of the libraries by "wild
type" AAV9R X/A capsid, the coding region between the XbaI and AgeI
sites was eliminated from the rAAV-cap-in-cis plasmid to create
rAAV-Cap-in-cis.
To generate the rAAV based library, the PCR products containing the
library and the XbaI and AgeI digested cap-in-cis acceptor vector
were assembled using Gibson Assembly. The reaction products were
then treated with PS DNase (Epicentre) to eliminate any unassembled
fragments. This reaction typically yielded over 100 ng of assembled
plasmid (as defined by the amount of DNA remaining after a PS DNase
digestion step). 100 ng is sufficient to transfect 10 150 mm dishes
at 10 ng/dish.
Virus Production and Purification
Recombinant AAVs were generated by triple transfection of 293T
cells using PEI. Viral particles were harvested from the media at
72 h post transfection and from the cells and media at 120 h. Virus
present in the media was concentrated by precipitation with 8%
poly(ethylene glycol) and 500 mM sodium chloride (Ayuso et al 2010)
and then the precipitated virus was added to the lysates prepared
from the collected cells. The viruses were purified over iodixanol
(Optiprep, Sigma) step gradients (15%, 25%, 40% and 60% as
described by Zolotukhin et al 1999). Viruses were concentrated and
formulated in PBS. Virus titers were determined by measuring the
number of DNaseI-resistant vector genome copies (VGs) using qPCR
and the linearized genome plasmid as a control (Gray et al
2011).
For capsid library virus generation, two modifications were made to
the virus production protocol to reduce the production of mosaic
capsids that could arise from the presence of multiple capsid
sequences in the same cell. First, only 10 ng per dish of
AAV-Cap9-in-cis library vector per dish was transfected to insure
that the vast majority of transfected cells only received one
capsid variant sequence. Second, the virus was collected earlier
(48 h and 60 hours, instead of 72 h and 120 h as above) to minimize
the secondary transduction of the producer cells with the rAAV
library virus released into the medium.
In Vivo Selection
For the selections in GFAP-Cre mice, 1.times.10.sup.11 vg of the
capsid libraries were injected IV (retro-orbital route) into adult
Cre+ mice. Seven or eight days post-injection, mice were euthanized
and the brain and spinal cord were collected. Vector DNA was
recovered from one hemisphere of the brain and half of the spinal
cord using 4-5 ml of Trizol (Invitrogen). For the selections in
TH-Cre mice, 8.times.10.sup.9 vg of each capsid was injected by
intracranially using the stereotaxic coordinates 0.7 mm rostral,
2.0 mm lateral and 3.0 mm ventral from bregma. 10 days later, the
region containing the substantia nigra was collected and the tissue
was homogenized in 1 ml of Trizol. For virus DNA isolation, the
manufacture's RNA extraction protocol was followed (the upper
aqueous, RNA-containing fraction collected). In addition to RNA, it
was found that this fraction also contains a significant portion of
the viral genome as well as some mitochondrial DNA. RNA was
eliminated by treating the samples with 1 ul of RNase (Qiagen) at
37 C overnight. The Cre recombination-dependent PCR strategy
involved a two-step amplification strategy (FIG. 27A-27E). Sequence
recovery was first performed in a Cre-dependent manner using the
primers 9CAPF and CDF (FIG. 27A-27E). PCR was performed for 20-26
cycles of 95 C for 20 sec, 60 C for 20 sec and 72 C for 30 sec
using Q5 Hot Start High-fidelity DNA Polymerase. The PCR product
was then diluted 1:10-1:100 and then used as a template for a
second, PCR reaction using primer XF and AR that generated a
shorter fragment that was cloned back into the
rAAV-delta-cap-in-cis acceptor construct as described above. 1 ul
of the Gibson Assembly reactions was then diluted 1:10 and
transformed into Sure2 competent cells (Agilent) as directed by the
manufacturer to generate individual clones for sequencing.
Clones that showed evidence of enrichment were cut with BsiWI and
AgeI and ligated into a custom 2/9R-X/A rep/cap helper also cut
with BsiWI and AgeI and then transformed into DHSalpha competent
cells (NEB). The resulting rep/cap plasmids carrying the novel
variant sequences, or AAV2/9 rep/cap as a control, were then used
to package a rAAV genome containing a dual eGFP-2A-luciferase
reporter cassette driven by a ubiquitous CAG promoter
(rAAV-CAG-eGFP-2A-Luc-WPRE-SV40 pA) for the IV injected variants
(AAV-PHP.A and AAV-PHP.B) or a similar vector lacking the Luc gene
(rAAV-CAG-eGFP-WPRE-SV40 pA) for the intracranial injections
(AAV-PHP.R2).
Tissue Preparation and Immunostaining
Mice were anesthetized with Nembutal and transcardially perfused
first with 0.1 M phosphate buffer (PB), pH 7.4 and then with
freshly prepared 4% paraformaldehyde in PB. Brains were postfixed
overnight and then sectioned by vibratome or cryoprotected and
sectioned by cryostat. Immunostaining was performed on the floating
sections by diluting primary and secondary antibodies in PBS
containing 10% goat or donkey serum 0.5% Triton X-100 or no
detergent (GAD67 staining). Primary antibodies used were rabbit
anti-GFP (1:1000; Invitrogen), chicken anti-GFP (1:1000; Abcam),
mouse anti-CC1 (1:200; Calbiochem), rabbit anti-GFAP (1:1000;
Dako), mouse anti-NeuN (1:500; Millipore), rabbit anti IbaI (1:500;
Biocare Medical), mouse anti-Calbindin (1:200; Sigma), rabbit
anti-Calretinin (1:1000; Chemicon), mouse anti-GAD67 (1:1000;
Millipore), mouse anti-Parvalbumin (1:1000). Primary antibodies
incubations were performed for 16-24 hours at room temperature. The
sections washed and incubated with secondary antibodies conjugated
to Alexa 568 (1:1000; Invitrogen) for 2-16 hours.
Tissue Clearing
Mice were perfused via peristaltic pump through the left ventricle
with phosphate buffer (PB) followed by an initial perfusion with
60-80 mL of 4% PFA in PB at a flow rate of 14 mL per minute. The
flow rate was then reduced to 2-3 mL per minute and continued for 2
hours at room temperature. The mice were then placed in individual
custom-built perfusion chambers and perfused with 200 mL of
recycling 4% acrylamide in PB at the same flow rate at room
temperature overnight followed by a 2-hour perfusion flush with PB
to remove residual polymers/monomers in the vasculature. The
polymerization process was initiated placing the chambers in a
42.degree. C. water bath and delivering, by perfusion at the same
flow rate, 200 mL of recycling, degassed 0.25% VA-044 initiator in
PB. After polymerization was complete, the mice were perfused with
a clearing solution of 8% SDS in 0.1M PB, pH 7.5 for 7 days. The
SDS containing solution was changed two times and then flushed by
the perfusion of roughly 2 L of nonrecirculating PB overnight.
Tissue samples cleared of lipids were incubated in RIMS solution
(Yang et al. 2014) until imaging (at least one week for optimal
transparency of unsectioned mouse brain tissue). The samples were
then mounted in RIMS and enclosed with a coverglass on a slide
using an appropriate thickness spacer (iSpacer, SunJin Lab Co.).
Images were taken with a Zeiss LSM 780 single-photon microscope. 3
dimensional image reconstructions were performed using Imaris
imaging software (Bitplane).
Vector Biodistribution
Mice were injected IV with 1.times.10.sup.11 VG of a
rAAV-CAG-GFP2A-Luc-WPRE-SV40-pA vector packaged into the indicated
capsids. 25 days later, the mice were euthanized and tissues and
indicated brain regions were collected and frozen at -80 C. DNA was
isolated using Qiagen DNeasy Blood and Tissue kit. Vector genomes
were detected using PCR primers that bind to the WPRE element and
were normalized to mouse genomes using primers specific to the
mouse glucagon gene. Absolute quantification was performed by
comparing unknown samples to serial dilutions of standards of known
concentration.
Example 9
Method of Treatment Employing Targeting Proteins
A subject having a disorder that can be treated by the application
of a nucleic acid to be expressed within a subject is identified.
The subject is then administered a first amount of a vector that
includes the polynucleotide to be expressed. The polynucleotide
encodes for a therapeutic protein. The vector will include a capsid
protein that includes a targeting protein section that is SEQ ID
NO: 1, so as to allow proper targeting of the protein to be
expressed to the appropriate system within the subject. If needed,
the subject is administered a second or third dose of the vector,
until a therapeutically effective amount of the protein to be
expressed is expressed within the subject in the appropriate
system.
Example 10
Method of Treatment of Huntington's Disease
A subject having Huntington's disease is identified. The subject is
then administered a first amount of a vector that includes the
polynucleotide to be expressed. The polynucleotide encodes for a
therapeutic protein. The vector will include a capsid protein that
includes a targeting protein section that is SEQ ID NO: 1, so as to
allow proper targeting of the protein to be expressed to the
nervous system within the subject. If needed, the subject is
administered a second or third dose of the vector, until a
therapeutically effective amount of the protein to be expressed is
expressed within the subject in the nervous system.
Example 11
Method of Treatment of Huntington's Disease
A subject having Huntington's disease is identified. The subject is
then administered a first amount of a vector that includes a
polynucleotide that encodes for a small non-coding RNA (small
hairpin RNA (shRNA) or microRNA (miRNA)) configured to reduce
expression of the Huntingtin protein by its sequence). The vector
will include a capsid protein that includes a targeting protein of
SEQ ID NO: 1, so as to allow proper targeting of the said
polynucleotide to the nervous system. If needed, the subject is
administered a second or third dose of the vector, until a
therapeutically effective amount of the small non-coding RNA is
expressed the subject in the nervous system.
Example 12
Method of Treatment
A subject having Huntington's disease is identified. The subject is
then systemically administered a first amount of a vector that
includes a polynucleotide that encodes for a Zinc finger protein
(ZFP) engineered to represses the transcription of the Huntingtin
(HTT) gene. The vector will include a capsid protein that includes
a targeting protein of SEQ ID NO: 1 or any of the targeting
proteins in FIG. 31, so as to allow proper targeting of the ZFP to
the nervous system, among other organs. If needed, the subject is
administered a second or third dose of the vector, until a
therapeutically effective amount of the ZFP is expressed the
subject in the nervous system.
Example 13
Method of Treatment
A subject having Huntington's disease is identified. The subject is
then systemically administered a first amount of a vector that
includes a polynucleotide that encodes for a small non-coding RNA
(small hairpin RNA (shRNA) or microRNA (miRNA)) designed by one
skilled in the art to reduce expression of the Huntingtin protein.
The vector will include a capsid protein that includes a targeting
protein of SEQ ID NO: 1 or any of the targeting proteins in FIG.
31, so as to allow proper targeting of the polynucleotide to the
nervous system, among other organs. If needed, the subject is
administered a second or third dose of the vector, until a
therapeutically effective amount of the small non-coding RNA is
expressed the subject in the nervous system.
Example 14
Method of Treatment
A subject having Alzheimer's disease is identified. The subject is
then administered a first amount of a vector that includes a
polynucleotide that encodes for an anti-Abeta antibodies or
antibody fragments. The vector will include a capsid protein that
includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the antibody or antibody fragment to be expressed to the nervous
system. If needed, the subject is administered a second or third
dose of the vector, until a therapeutically effective amount of the
antibody or antibody fragment is expressed the subject in the
nervous system.
Example 15
Method of Treatment
A subject having Alzheimer's disease is identified. The subject is
then administered a first amount of a vector that includes a
polynucleotide that encodes for an apolipoprotein E (ApoE) protein,
preferably the human apoE polypeptide apoE2 or modified variant of
apoE2. The vector will include a capsid protein that includes a
targeting protein of SEQ ID NO: 1 or any of the targeting proteins
in FIG. 31, so as to allow proper targeting of the antibody or
antibody fragment to be expressed to the nervous system. If needed,
the subject is administered a second or third dose of the vector,
until a therapeutically effective amount of the ApoE protein is
expressed the subject in the nervous system.
Example 16
Method of Treatment
A subject having spinal muscular atrophy (SMA) is identified. The
subject is then administered a first amount of a vector that
includes a polynucleotide that encodes for a survival motor neuron
1 (SMN1) polypeptide. The vector will include a capsid protein that
includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the SMN protein to be expressed to the nervous system. If needed,
the subject is administered a second or third dose of the vector,
until a therapeutically effective amount of the SMN protein is
expressed the subject in the nervous system.
Example 17
Method of Treatment
A subject having Friedreich's ataxia is identified. The subject is
then systemically administered a first amount of a vector that
includes a polynucleotide that encodes for a frataxin protein. The
vector will include a capsid protein that includes a targeting
protein of SEQ ID NO: 1 or any of the targeting proteins in FIG.
31, so as to allow proper targeting of the frataxin protein to be
expressed to the nervous system and heart, among other organs. If
needed, the subject is administered a second or third dose of the
vector, until a therapeutically effective amount of the frataxin
protein is expressed the subject in the nervous system and
heart.
Example 18
Method of Treatment
A subject having Pompe disease is identified. The subject is then
systemically administered a first amount of a vector that includes
a polynucleotide that encodes for an acid alpha-glucosidase (GAA)
protein. The vector will include a capsid protein that includes a
targeting protein of SEQ ID NO: 1 or any of the targeting proteins
in FIG. 31, so as to allow proper targeting of the GAA protein to
be expressed to the nervous system and heart, among other organs.
If needed, the subject is administered a second or third dose of
the vector, until a therapeutically effective amount of the GAA
protein is expressed the subject in the nervous system and
heart.
Example 19
Method of Treatment
A subject having Late Infantile neuronal ceroid lipofuscinosis
(LINCL) is identified. The subject is then systemically
administered a first amount of a vector that includes a CLN2
polynucleotide that encodes for the tripeptidyl peptidase 1
protein. The vector will include a capsid protein that includes a
targeting protein of SEQ ID NO: 1 or any of the targeting proteins
in FIG. 31, so as to allow proper targeting of the tripeptidyl
peptidase 1 protein to be expressed to the nervous system. If
needed, the subject is administered a second or third dose of the
vector, until a therapeutically effective amount of the tripeptidyl
peptidase 1 protein is expressed the subject in the nervous
system.
Example 20
Method of Treatment
A subject having the Juvenile NCL form of Batten disease is
identified. The subject is then systemically administered a first
amount of a vector that includes a CLN3 polynucleotide that encodes
for the battenin protein. The vector will include a capsid protein
that includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the battenin protein to be expressed to the nervous system. If
needed, the subject is administered a second or third dose of the
vector, until a therapeutically effective amount of the battenin
protein is expressed the subject in the nervous system.
Example 21
Method of Treatment
A subject having Canavan disease is identified. The subject is then
systemically administered a first amount of a vector that includes
an ASPA polynucleotide that encodes for the aspartoacylase protein.
The vector will include a capsid protein that includes a targeting
protein of SEQ ID NO: 1 or any of the targeting proteins in FIG.
31, so as to allow proper targeting of the aspartoacylase protein
to be expressed to the nervous system. If needed, the subject is
administered a second or third dose of the vector, until a
therapeutically effective amount of the aspartoacylase protein is
expressed the subject in the nervous system.
Example 22
Method of Treatment
A subject having Parkinson's disease is identified. The subject is
then systemically administered a first amount of one or more
vectors that each includes one or more polynucleotide(s) that
encode an enzyme(s) necessary for the increased production of
dopamine from non-dopaminergic cells. The vector will include a
capsid protein that includes a targeting protein of SEQ ID NO: 1 or
any of the targeting proteins in FIG. 31, so as to allow proper
targeting of said enzyme(s) to be expressed to the nervous system.
If needed, the subject is administered a second or third dose of
the vector, until a therapeutically effective amount of the
enzyme(s) is expressed the subject in the nervous system.
Example 23
Method of Treatment
A subject having Parkinson's disease is identified. The subject is
then systemically administered a first amount of a vector that
includes a polynucleotide that encode a modified,
aggregation-resistant form of alpha-synuclein protein that reduces
the aggregation of endogenous alpha-synuclein. The vector will
include a capsid protein that includes a targeting protein of SEQ
ID NO: 1 or any of the targeting proteins in FIG. 31, so as to
allow proper targeting of the aggregation-resistant alpha-synuclein
protein to be expressed to the nervous system. If needed, the
subject is administered a second or third dose of the vector, until
a therapeutically effective amount of the protein is expressed the
subject in the nervous system.
Example 24
Method of Treatment
A subject having amyotrophic lateral sclerosis or frontal dementia
caused by a mutation in C90RF72 is identified. The subject is then
administered a first amount of a vector that includes a
polynucleotide that encodes a non-coding RNA(s) that reduce nuclear
RNA foci caused by the hexanucleotide expansion (GGGGCC) in the
subjects cells. The vector will include a capsid protein that
includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the RNA(s) to be expressed to the nervous system. If needed, the
subject is administered a second or third dose of the vector, until
a therapeutically effective amount of the RNA(s) is expressed the
subject in the nervous system.
Example 25
Method of Treatment
A subject having multiple sclerosis is identified. The subject is
then systemically administered a first amount of a vector that
includes a polynucleotide that encode a trophic or immunomodulatory
factor, for example leukemia inhibitory factor (LIF) or ciliary
eurotrophic factor (CNTF). The vector will include a capsid protein
that includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the said factor to be expressed to the nervous system. If needed,
the subject is administered a second or third dose of the vector,
until a therapeutically effective amount of the factor is expressed
the subject in the nervous system.
Example 26
Method of Treatment
A subject having amyotrophic lateral sclerosis caused by SOD1
mutation is identified. The subject is then administered a first
amount of a vector that includes a polynucleotide that encodes for
a small non-coding RNA (small hairpin RNA (shRNA) or microRNA
(miRNA)) designed by one skilled in the art to reduce expression of
mutant SOD1 protein. The vector will include a capsid protein that
includes a targeting protein of SEQ ID NO: 1 or any of the
targeting proteins in FIG. 31, so as to allow proper targeting of
the small non-coding RNA to be expressed to the nervous system. If
needed, the subject is administered a second or third dose of the
vector, until a therapeutically effective amount of the small
non-coding RNA is expressed the subject in the nervous system.
Additional Embodiments
In some embodiments, provided herein is a CREATE--Cre
Recombinase-based AAV Targeted Evolution platform.
In some embodiments, provided herein is an AAV-PHP.B, which allows
Broad gene delivery to CNS neurons and glia via the
vasculature.
In some embodiments, provided herein is an AAV-PHP.R2, which allows
Rapid Retrograde transduction in the CNS.
INCORPORATION BY REFERENCE
All references cited herein, including patents, patent
applications, papers, text books, and the like, and the references
cited therein, to the extent that they are not already, are hereby
incorporated herein by reference in their entirety. To the extent
that any of the definitions or terms provided in the references
incorporated by reference differ from the terms and discussion
provided herein, the present terms and definitions control.
EQUIVALENTS
The foregoing written specification is considered to be sufficient
to enable one skilled in the art to practice the invention. The
foregoing description and examples detail certain preferred
embodiments of the invention and describe the best mode
contemplated by the inventors. It will be appreciated, however,
that no matter how detailed the foregoing may appear in text, the
invention may be practiced in many ways and the invention should be
construed in accordance with the appended claims and any
equivalents thereof.
SEQUENCE LISTINGS
1
6017PRTArtificial SequenceAdeno-associated virus capsid protein
1Thr Leu Ala Val Pro Phe Lys 1 52736PRTAdeno-associated
dependoparvovirusAdeno-associated virus AAV9 capsid sequence 2Met
Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10
15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro
20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val
Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp
Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu
His Asp Lys Ala Tyr Asp65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn
Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu
Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg
Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125 Leu Gly
Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140
Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145
150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly
Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile
Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr
Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Val Ala Asp Asn Asn Glu
Gly Ala Asp Gly Val Gly Ser Ser 210 215 220 Ser Gly Asn Trp His Cys
Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235 240 Thr Thr Ser
Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr
Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265
270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile
Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys
Leu Phe Asn Ile305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn
Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln
Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly
Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val
Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380 Gly
Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390
395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr
Glu 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser
Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr
Leu Tyr Tyr Leu Ser 435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn
Gln Gln Thr Leu Lys Phe Ser 450 455 460 Val Ala Gly Pro Ser Asn Met
Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480 Gly Pro Ser Tyr
Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495 Asn Asn
Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510
Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515
520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe
Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys
Val Met Ile545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn
Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val Ala Thr Asn His
Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590 Thr Gly Trp Val Gln Asn
Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val
Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp
Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met625 630 635
640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala
645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe
Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu
Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu
Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu
Phe Ala Val Asn Thr Glu Gly Val705 710 715 720 Tyr Ser Glu Pro Arg
Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735
37PRTArtificial SequenceAdeno-associated viruS capsid protein 3Lys
Phe Pro Val Ala Leu Thr1 546672DNAArtificial SequencePlasmid
4ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc
60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg
120gccaactcca tcactagggg ttcctactag tggcctccgc gccgggtttt
ggcgcctccc 180gcgggcgccc ccctcctcac ggcgagcgct gccacgtcag
acgaagggcg cagcgagcgt 240cctgatcctt ccgcccggac gctcaggaca
gcggcccgct gctcataaga ctcggcctta 300gaaccccagt atcagcagaa
ggacatttta ggacgggact tgggtgactc tagggcactg 360gttttctttc
cagagagcgg aacaggcgag gaaaagtagt cccttctcgg cgattctgcg
420gagggatctc cgtggggcgg tgaacgccga tgattatata aggacgcgcc
gggtgtggca 480cagctagttc cgtcgcagcc gggatttggg tcgcggttct
tgtttgtgga tcgctgtgat 540cgtcacttgg cggccgccat ggtcagcaag
ggcgaggagg ataacatggc catcatcaag 600gagttcatgc gcttcaaggt
gcacatggag ggctccgtga acggccacga gttcgagatc 660gagggcgagg
gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc
720aagggtggcc ccctgccctt cgcctgggac atcctgtccc ctcaattcat
gtatggctcc 780aaggcctacg tgaagcaccc cgccgacatc cccgactact
tgaagctgtc cttccccgag 840ggcttcaagt gggagcgcgt gatgaacttc
gaggacggcg gcgtggtgac cgtgacccag 900gactcctcct tacaagacgg
cgagttcatc tacaaagtga agctgcgcgg caccaacttc 960ccctccgacg
gccccgtaat gcagaagaag accatgggct gggaggcctc ctccgagcgg
1020atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa
gctgaaggac 1080ggcggccact acgacgctga ggtcaagacc acctacaagg
ccaagaagcc cgtgcagctg 1140cccggcgcct acaacgtcaa catcaagttg
gacatcacct cccacaacga ggactacacc 1200atcgtggaac agtacgaacg
cgccgagggc cgccactcca ccggcggcat ggacgagctg 1260tacaagtaaa
ggatcccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact
1320gtcctttcct cctcctagga ataaaatatc tttattttca ttacatctgt
gtgttggttt 1380tttgtgtaga tctgttcaaa tttgaactga ctaagcggct
cccgccagat tttggcaaga 1440ttactaagca ggaagtcaag gacttttttg
cttgggcaaa ggtcaatcag gtgccggtga 1500ctcacgagtt taaagttccc
agggaattgg cgggaactaa aggggcggag aaatctctaa 1560aacgcccact
gggtgacgtc accaatacta gctataaaag tctggagaag cgggccaggc
1620tctcatttgt tcccgagacg cctcgcagtt cagacgtgac tgttgatccc
gctcctctgc 1680gaccgctagc ttcgatcaac tacgcggaca ggtaccaaaa
caaatgttct cgtcacgtgg 1740gcatgaatct gatgctgttt ccctgcagac
aatgcgagag actgaatcag aattcaaata 1800tctgcttcac tcacggtgtc
aaagactgtt tagagtgctt tcccgtgtca gaatctcaac 1860ccgtttctgt
cgtcaaaaag gcgtatcaga aactgtgcta cattcatcac atcatgggaa
1920aggtgccaga cgcttgcact gcttgcgacc tggtcaatgt ggacttggat
gactgtgttt 1980ctgaacaata aatgacttaa accaggtatg gctgccgatg
gttatcttcc agattggctc 2040gaggacaacc ttagtgaagg aattcgcgag
tggtgggctt tgaaacctgg agcccctcaa 2100cccaaggcaa atcaacaaca
tcaagacaac gctcgaggtc ttgtgcttcc gggttacaaa 2160taccttggac
ccggcaacgg actcgacaag ggggagccgg tcaacgcagc agacgcggcg
2220gccctcgagc acgacaaggc ctacgaccag cagctcaagg ccggagacaa
cccgtacctc 2280aagtacaacc acgccgacgc cgagttccag gagcggctca
aagaagatac gtcttttggg 2340ggcaacctcg ggcgagcagt cttccaggcc
aaaaagaggc ttcttgaacc tcttggtctg 2400gttgaggaag cggctaagac
ggctcctgga aagaagaggc ctgtagagca gtctcctcag 2460gaaccggact
cctccgcggg tattggcaaa tcgggtgcac agcccgctaa aaagagactc
2520aatttcggtc agactggcga cacagagtca gtcccagacc ctcaaccaat
cggagaacct 2580cccgcagccc cctcaggtgt gggatctctt acaatggctt
caggtggtgg cgcaccagtg 2640gcagacaata acgaaggtgc cgatggagtg
ggtagttcct cgggaaattg gcattgcgat 2700tcccaatggc tgggggacag
agtcatcacc accagcaccc gaacctgggc cctgcccacc 2760tacaacaatc
acctctacaa gcaaatctcc aacagcacat ctggaggatc ttcaaatgac
2820aacgcctact tcggctacag caccccctgg gggtattttg acttcaacag
attccactgc 2880cacttctcac cacgtgactg gcagcgactc atcaacaaca
actggggatt ccggcctaag 2940cgactcaact tcaagctctt caacattcag
gtcaaagagg ttacggacaa caatggagtc 3000aagaccatcg ccaataacct
taccagcacg gtccaggtct tcacggactc agactatcag 3060ctcccgtacg
tgctcgggtc ggctcacgag ggctgcctcc cgccgttccc agcggacgtt
3120ttcatgattc ctcagtacgg gtatctgacg cttaatgatg gaagccaggc
cgtgggtcgt 3180tcgtcctttt actgcctgga atatttcccg tcgcaaatgc
taagaacggg taacaacttc 3240cagttcagct acgagtttga gaacgtacct
ttccatagca gctacgctca cagccaaagc 3300ctggaccgac taatgaatcc
actcatcgac caatacttgt actatctctc tagaactatt 3360aacggttctg
gacagaatca acaaacgcta aaattcagtg tggccggacc cagcaacatg
3420gctgtccagg gaagaaacta catacctgga cccagctacc gacaacaacg
tgtctcaacc 3480actgtgactc aaaacaacaa cagcgaattt gcttggcctg
gagcttcttc ttgggctctc 3540aatggacgta atagcttgat gaatcctgga
cctgctatgg ccagccacaa agaaggagag 3600gaccgtttct ttcctttgtc
tggatcttta atttttggca aacaaggaac tggaagagac 3660aacgtggatg
cggacaaagt catgataacc aacgaagaag aaattaaaac tactaacccg
3720gtagcaacgg agtcctatgg acaagtggcc acaaaccacc agagtgccca
agcacaggcg 3780cagaccggtt gggttcaaaa ccaaggaata cttccgggta
tggtttggca ggacagagat 3840gtgtacctgc aaggacccat ttgggccaaa
attcctcaca cggacggcaa ctttcaccct 3900tctccgctga tgggagggtt
tggaatgaag cacccgcctc ctcagatcct catcaaaaac 3960acacctgtac
ctgcggatcc tccaacggcc ttcaacaagg acaagctgaa ctctttcatc
4020acccagtatt ctactggcca agtcagcgtg gagatcgagt gggagctgca
gaaggaaaac 4080agcaagcgct ggaacccgga gatccagtac acttccaact
attacaagtc taataatgtt 4140gaatttgctg ttaatactga aggtgtatat
agtgaacccc gccccattgg caccagatac 4200ctgactcgta atctgtaagt
cgactaccgt tcgtatagca tacattatac gaagttatca 4260tatgttcgag
cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg
4320cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt
tgtaaccatt 4380ataagctgca ataaacaagt taacaacaac aattgcattc
attttatgtt tcaggttcag 4440ggggagatgt gggaggtttt ttaaagcaag
taaaacctct acaaatgtgg taaaatcgag 4500ctctaccgtt cgtataatgt
atgctatacg aagttatgat atcaagctta ggaaccccta 4560gtgatggagt
tggccactcc ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca
4620aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag tgagcgagcg
agcgcgcaga 4680gagggagtgg ccaagctagc gggcgattaa ggaaagggct
agatcattct tgaagacgaa 4740agggcctcgt gatacgccta tttttatagg
ttaatgtcat gataataatg gtttcttaga 4800cgtcaggtgg cacttttcgg
ggaaatgtgc gcggaacccc tatttgttta tttttctaaa 4860tacattcaaa
tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt
4920gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc
ttttttgcgg 4980cattttgcct tcctgttttt gctcacccag aaacgctggt
gaaagtaaaa gatgctgaag 5040atcagttggg tgcacgagtg ggttacatcg
aactggatct caacagcggt aagatccttg 5100agagttttcg ccccgaagaa
cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg 5160gcgcggtatt
atcccgtgtt gacgccgggc aagagcaact cggtcgccgc atacactatt
5220ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg
gatggcatga 5280cagtaagaga attatgcagt gctgccataa ccatgagtga
taacactgcg gccaacttac 5340ttctgacaac gatcggagga ccgaaggagc
taaccgcttt tttgcacaac atgggggatc 5400atgtaactcg ccttgatcgt
tgggaaccgg agctgaatga agccatacca aacgacgagc 5460gtgacaccac
gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac
5520tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat
aaagttgcag 5580gaccacttct gcgctcggcc cttccggctg gctggtttat
tgctgataaa tctggagccg 5640gtgagcgtgg gtctcgcggt atcattgcag
cactggggcc agatggtaag ccctcccgta 5700tcgtagttat ctacacgacg
gggagtcagg caactatgga tgaacgaaat agacagatcg 5760ctgagatagg
tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata
5820tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg
aagatccttt 5880ttgataatct catgaccaaa atcccttaac gtgagttttc
gttccactga gcgtcagacc 5940ccgtagaaaa gatcaaagga tcttcttgag
atcctttttt tctgcgcgta atctgctgct 6000tgcaaacaaa aaaaccaccg
ctaccagcgg tggtttgttt gccggatcaa gagctaccaa 6060ctctttttcc
gaaggtaact ggcttcagca gagcgcagat accaaatact gttcttctag
6120tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca
tacctcgctc 6180tgctaatcct gttaccagtg gctgctgcca gtggcgataa
gtcgtgtctt accgggttgg 6240actcaagacg atagttaccg gataaggcgc
agcggtcggg ctgaacgggg ggttcgtgca 6300cacagcccag cttggagcga
acgacctaca ccgaactgag atacctacag cgtgagctat 6360gagaaagcgc
cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg
6420tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat
ctttatagtc 6480ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt
gtgatgctcg tcaggggggc 6540ggagcctatg gaaaaacgcc agcaacgcgg
cctttttacg gttcctggcc ttttgctggc 6600cttttgctca catgtaataa
acacacacac accaacaacc gtggttggtt gttgtgttgg 6660tttattctcg ag
667257330DNAArtificial SequencePlasmid 5gtcgacggta tcgggggagc
tcgcagggtc tccattttga agcgggaggt ttgaacgcgc 60agccgccatg ccggggtttt
acgagattgt gattaaggtc cccagcgacc ttgacgagca 120tctgcccggc
atttctgaca gctttgtgaa ctgggtggcc gagaaggaat gggagttgcc
180gccagattct gacatggatc tgaatctgat tgagcaggca cccctgaccg
tggccgagaa 240gctgcagcgc gactttctga cggaatggcg ccgtgtgagt
aaggccccgg aggctctttt 300ctttgtgcaa tttgagaagg gagagagcta
cttccacatg cacgtgctcg tggaaaccac 360cggggtgaaa tccatggttt
tgggacgttt cctgagtcag attcgcgaaa aactgattca 420gagaatttac
cgcgggatcg agccgacttt gccaaactgg ttcgcggtca caaagaccag
480aaatggcgcc ggaggcggga acaaggtggt ggatgagtgc tacatcccca
attacttgct 540ccccaaaacc cagcctgagc tccagtgggc gtggactaat
atggaacagt atttaagcgc 600ctgtttgaat ctcacggagc gtaaacggtt
ggtggcgcag catctgacgc acgtgtcgca 660gacgcaggag cagaacaaag
agaatcagaa tcccaattct gatgcgccgg tgatcagatc 720aaaaacttca
gccaggtaca tggagctggt cgggtggctc gtggacaagg ggattacctc
780ggagaagcag tggatccagg aggaccaggc ctcatacatc tccttcaatg
cggcctccaa 840ctcgcggtcc caaatcaagg ctgccttgga caatgcggga
aagattatga gcctgactaa 900aaccgccccc gactacctgg tgggccagca
gcccgtggag gacatttcca gcaatcggat 960ttataaaatt ttggaactaa
acgggtacga tccccaatat gcggcttccg tctttctggg 1020atgggccacg
aaaaagttcg gcaagaggaa caccatctgg ctgtttgggc ctgcaactac
1080cgggaagacc aacatcgcgg aggccatagc ccacactgtg cccttctacg
ggtgcgtaaa 1140ctggaccaat gagaactttc ccttcaacga ctgtgtcgac
aagatggtga tctggtggga 1200ggaggggaag atgaccgcca aggtcgtgga
gtcggccaaa gccattctcg gaggaagcaa 1260ggtgcgcgtg gaccagaaat
gcaagtcctc ggcccagata gacccgactc ccgtgatcgt 1320cacctccaac
accaacatgt gcgccgtgat tgacgggaac tcaacgacct tcgaacacca
1380gcagccgttg caagaccgga tgttcaaatt tgaactcacc cgccgtctgg
atcatgactt 1440tgggaaggtc accaagcagg aagtcaaaga ctttttccgg
tgggcaaagg atcacgtggt 1500tgaggtggag catgaattct acgtcaaaaa
gggtggagcc aagaaaagac ccgcccccag 1560tgacgcagat ataagtgagc
ccaaacgggt gcgcgagtca gttgcgcagc catcgacgtc 1620agacgcggaa
gcttcgatca actacgcgga caggtaccaa aacaaatgtt ctcgtcacgt
1680gggcatgaat ctgatgctgt ttccctgcag acaatgcgag agactgaatc
agaattcaaa 1740tatctgcttc actcacggtg tcaaagactg tttagagtgc
tttcccgtgt cagaatctca 1800acccgtttct gtcgtcaaaa aggcgtatca
gaaactgtgc tacattcatc acatcatggg 1860aaaggtgcca gacgcttgca
ctgcttgcga cctggtcaat gtggacttgg atgactgtgt 1920ttctgaacaa
taaatgactt aaaccaggta tggctgccga tggttaactt ccagattgac
1980tcgaggacaa ccttagtgaa ggaattcgcg agtggtgggc tttgaaacct
ggagcccctc 2040aacccaaggc aaatcaacaa catcaagaca acgctcgagg
tcttgtgctt ccgggttaca 2100aataccttgg acccggcaac ggactcgaca
agggggagcc ggtcaacgca gcagacgcgg 2160cggccctcga gcacgacaag
gcctacgacc agcagctcaa ggccggagac aacccgtacc 2220tcaagtacaa
ccacgccgac gccgagttcc aggagcggct caaagaagat acgtcttttg
2280ggggcaacct cgggcgagca gtcttccagg ccaaaaagag gcttcttgaa
cctcttggtc 2340tggttgagga agcggctaag acggctcctg gatagaagag
gcctgtagag tagtctcctc 2400aggaaccgga ctcctccgcg ggtattggca
aatcgggtgc acagcccgct aaaaagagac 2460tcaatttcgg tcagactggc
gacacagagt cagtcccaga ccctcaacca atcggagaac 2520ctcccgcagc
cccctcaggt gtgggatctc ttacaatggc ttcaggtggt ggcgcaccag
2580tggcagacaa taactaaggt gccgatggag tgggtagttc ctcgggaaat
tggcattgcg 2640attcccaatg gctgggggac agagtcatca ccaccagcac
ccgaacctgg gccctgccca 2700cctacaacaa tcacctctac aagcaaatct
ccaacagcac atctggagga tcttcaaatg 2760acaacgccta cttcggctac
agcaccccct gggggtattt tgacttcaac agattccact 2820gccacttctc
accacgtgac tggcagcgac tcatcaacaa caactgggga ttccggccta
2880agcgactcaa cttcaagctc ttcaacattc aggtcaaaga ggttacggac
aacaatggag 2940tcaagaccat cgccaataac cttaccagca cggtccaggt
cttcacggac tcagactatc 3000agctcccgta cgtgctcggg tcggctcacg
agggctgcct cccgccgttc ccagcggacg 3060ttttcatgat tcctcagtac
gggtatctga cgcttaatga tggaagccag gccgtgggtc 3120gttcgtcctt
ttactgcctg gaatatttcc cgtcgcaaat gctaagaacg ggtaacaact
3180tccagttcag ctacgagttt
gagaacgtac ctttccatag cagctacgct cacagccaaa 3240gcctggaccg
actaatgaat ccactcatcg accaatactt gtactatctc tcaaagacta
3300ttaacggttc tggacagaat caacaaacgc taaaattcag tgtggccgga
cccagcaaca 3360tggctgtcca gggaagaaac tacatacctg gacccagcta
ccgacaacaa cgtgtctcaa 3420ccactgtgac tcaaaacaac aacagcgaat
ttgcttggcc tggagcttct tcttgggctc 3480tcaatggacg taatagcttg
atgaatcctg gacctgctat ggccagccac aaagaaggag 3540aggaccgttt
ctttcctttg tctggatctt taatttttgg caaacaagga actggaagag
3600acaacgtgga tgcggacaaa gtcatgataa ccaacgaaga agaaattaaa
actactaacc 3660cggtagcaac ggagtcctat ggacaagtgg ccacaaacca
ccagagtgcc caagcacagg 3720cgcagaccgg ctgggttcaa aaccaaggaa
tacttccggg tatggtttgg caggacagag 3780atgtgtacct gcaaggaccc
atttgggcca aaattcctca cacggacggc aactttcacc 3840cttctccgct
gatgggaggg tttggaatga agcacccgcc tcctcagatc ctcatcaaaa
3900acacacctgt acctgcggat cctccaacgg ccttcaacaa ggacaagctg
aactctttca 3960tcacccagta ttctactggc caagtcagcg tggagatcga
gtgggagctg cagaaggaaa 4020acagcaagcg ctggaacccg gagatccagt
acacttccaa ctattacaag tctaataatg 4080ttgaatttgc tgttaatact
gaaggtgtat atagtgaacc ccgccccatt ggcaccagat 4140acctgactcg
taatctgtaa ttgcttgtta atcaataaac cgtttaattc gtttcagttg
4200aactttggtc tctgcgaagg gcgaattcgt ttaaacctgc aggactagag
gtcctgtatt 4260agaggtcacg tgagtgtttt gcgacatttt gcgacaccat
gtggtcacgc tgggtattta 4320agcccgagtg agcacgcagg gtctccattt
tgaagcggga ggtttgaacg cgcagccgcc 4380aagccgaatt ctgcagatat
ccatcacact ggcggccgct cgactagagc ggccgccacc 4440gcggtggagc
tccagctttt gttcccttta gtgagggtta attgcgcgct tggcgtaatc
4500atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac
acaacatacg 4560agccggaagc ataaagtgta aagcctgggg tgcctaatga
gtgagctaac tcacattaat 4620tgcgttgcgc tcactgcccg ctttccagtc
gggaaacctg tcgtgccagc tgcattaatg 4680aatcggccaa cgcgcgggga
gaggcggttt gcgtattggg cgctcttccg cttcctcgct 4740cactgactcg
ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc
4800ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt
gagcaaaagg 4860ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg
gcgtttttcc ataggctccg 4920cccccctgac gagcatcaca aaaatcgacg
ctcaagtcag aggtggcgaa acccgacagg 4980actataaaga taccaggcgt
ttccccctgg aagctccctc gtgcgctctc ctgttccgac 5040cctgccgctt
accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca
5100tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc
tgggctgtgt 5160gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc
ggtaactatc gtcttgagtc 5220caacccggta agacacgact tatcgccact
ggcagcagcc actggtaaca ggattagcag 5280agcgaggtat gtaggcggtg
ctacagagtt cttgaagtgg tggcctaact acggctacac 5340tagaagaaca
gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt
5400tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt
ttgtttgcaa 5460gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
cctttgatct tttctacggg 5520gtctgacgct cagtggaacg aaaactcacg
ttaagggatt ttggtcatga gattatcaaa 5580aaggatcttc acctagatcc
ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 5640atatgagtaa
acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc
5700gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga
taactacgat 5760acgggagggc ttaccatctg gccccagtgc tgcaatgata
ccgcgagacc cacgctcacc 5820ggctccagat ttatcagcaa taaaccagcc
agccggaagg gccgagcgca gaagtggtcc 5880tgcaacttta tccgcctcca
tccagtctat taattgttgc cgggaagcta gagtaagtag 5940ttcgccagtt
aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg
6000ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc
gagttacatg 6060atcccccatg ttgtgcaaaa aagcggttag ctccttcggt
cctccgatcg ttgtcagaag 6120taagttggcc gcagtgttat cactcatggt
tatggcagca ctgcataatt ctcttactgt 6180catgccatcc gtaagatgct
tttctgtgac tggtgagtac tcaaccaagt cattctgaga 6240atagtgtatg
cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc
6300acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc
gaaaactctc 6360aaggatctta ccgctgttga gatccagttc gatgtaaccc
actcgtgcac ccaactgatc 6420ttcagcatct tttactttca ccagcgtttc
tgggtgagca aaaacaggaa ggcaaaatgc 6480cgcaaaaaag ggaataaggg
cgacacggaa atgttgaata ctcatactct tcctttttca 6540atattattga
agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat
6600ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc
cacctaaatt 6660gtaagcgtta atattttgtt aaaattcgcg ttaaattttt
gttaaatcag ctcatttttt 6720aaccaatagg ccgaaatcgg caaaatccct
tataaatcaa aagaatagac cgagataggg 6780ttgagtgttg ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc 6840aaagggcgaa
aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca
6900agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg
gagcccccga 6960tttagagctt gacggggaaa gccggcgaac gtggcgagaa
aggaagggaa gaaagcgaaa 7020ggagcgggcg ctagggcgct ggcaagtgta
gcggtcacgc tgcgcgtaac caccacaccc 7080gccgcgctta atgcgccgct
acagggcgcg tcccattcgc cattcaggct gcgcaactgt 7140tgggaagggc
gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt
7200gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg
ttgtaaaacg 7260acggccagtg agcgcgcgta atacgactca ctatagggcg
aattgggtac cgggcccccc 7320ctcgatcgag 733064468DNAArtificial
SequencePlasmid 6agcgcccaat acgcaaaccg cctctccccg cgcgttggcc
gattcattaa tgcagctggc 60acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa
cgcaattaat gtgagttagc 120tcactcatta ggcaccccag gctttacact
ttatgcttcc ggctcgtatg ttgtgtggaa 180ttgtgagcgg ataacaattt
cacacaggaa acagctatga ccatgattac gccaagctat 240ttaggtgaca
ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca
300ctagtaacgg ccgccagtgt gctggaattc gcccttactc atcgaccaat
acttgtacta 360tctctctaga actattaacg gttctggaca gaatcaacaa
acgctaaaat tcagtgtggc 420cggacccagc aacatggctg tccagggaag
aaactacata cctggaccca gctaccgaca 480acaacgtgtc tcaaccactg
tgactcaaaa caacaacagc gaatttgctt ggcctggagc 540ttcttcttgg
gctctcaatg gacgtaatag cttgatgaat cctggacctg ctatggccag
600ccacaaagaa ggagaggacc gtttctttcc tttgtctgga tctttaattt
ttggcaaaca 660aggtaccggc agagacaacg tggatgcgga caaagtcatg
ataaccaacg aagaagaaat 720taaaactact aacccggtag caacggagtc
ctatggacaa gtggccacaa accaccagag 780tgcccaagca caggcgcaga
ccggttgggt tcaaaaccaa ggaatacttc caagggcgaa 840ttctgcagat
atccatcaca ctggcggccg ctcgagcatg catctagagg gcccaattcg
900ccctatagtg agtcgtatta caattcactg gccgtcgttt tacaacgtcg
tgactgggaa 960aaccctggcg ttacccaact taatcgcctt gcagcacatc
cccctttcgc cagctggcgt 1020aatagcgaag aggcccgcac cgatcgccct
tcccaacagt tgcgcagcct gaatggcgaa 1080tggacgcgcc ctgtagcggc
gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga 1140ccgctacact
tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg
1200ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta
gggttccgat 1260ttagtgcttt acggcacctc gaccccaaaa aacttgatta
gggtgatggt tcacgtagtg 1320ggccatcgcc ctgatagacg gtttttcgcc
ctttgacgtt ggagtccacg ttctttaata 1380gtggactctt gttccaaact
ggaacaacac tcaaccctat ctcggtctat tcttttgatt 1440tataagggat
tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat
1500ttaacgcgaa ttttaacaaa attcagggcg caagggctgc taaaggaagc
ggaacacgta 1560gaaagccagt ccgcagaaac ggtgctgacc ccggatgaat
gtcagctact gggctatctg 1620gacaagggaa aacgcaagcg caaagagaaa
gcaggtagct tgcagtgggc ttacatggcg 1680atagctagac tgggcggttt
tatggacagc aagcgaaccg gaattgccag ctggggcgcc 1740ctctggtaag
gttgggaagc cctgcaaagt aaactggatg gctttcttgc cgccaaggat
1800ctgatggcgc aggggatcaa gatctgatca agagacagga tgaggatcgt
ttcgcatgat 1860tgaacaagat ggattgcacg caggttctcc ggccgcttgg
gtggagaggc tattcggcta 1920tgactgggca caacagacaa tcggctgctc
tgatgccgcc gtgttccggc tgtcagcgca 1980ggggcgcccg gttctttttg
tcaagaccga cctgtccggt gccctgaatg aactgcagga 2040cgaggcagcg
cggctatcgt ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga
2100cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg
ggcaggatct 2160cctgtcatcc caccttgctc ctgccgagaa agtatccatc
atggctgatg caatgcggcg 2220gctgcatacg cttgatccgg ctacctgccc
attcgaccac caagcgaaac atcgcatcga 2280gcgagcacgt actcggatgg
aagccggtct tgtcgatcag gatgatctgg acgaagagca 2340tcaggggctc
gcgccagccg aactgttcgc caggctcaag gcgcgcatgc ccgacggcga
2400ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg
aaaatggccg 2460cttttctgga ttcatcgact gtggccggct gggtgtggcg
gaccgctatc aggacatagc 2520gttggctacc cgtgatattg ctgaagagct
tggcggcgaa tgggctgacc gcttcctcgt 2580gctttacggt atcgccgctc
ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 2640gttcttctga
attgaaaaag gaagagtatg agtattcaac atttccgtgt cgcccttatt
2700cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct
ggtgaaagta 2760aaagatgctg aagatcagtt gggtgcacga gtgggttaca
tcgaactgga tctcaacagc 2820ggtaagatcc ttgagagttt tcgccccgaa
gaacgttttc caatgatgag cacttttaaa 2880gttctgctat gtggcgcggt
attatcccgt attgacgccg ggcaagagca actcggtcgc 2940cgcatacact
attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt
3000acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag
tgataacact 3060gcggccaact tacttctgac aacgatcgga ggaccgaagg
agctaaccgc ttttttgcac 3120aacatggggg atcatgtaac tcgccttgat
cgttgggaac cggagctgaa tgaagccata 3180ccaaacgacg agcgtgacac
cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta 3240ttaactggcg
aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg
3300gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt
tattgctgat 3360aaatctggag ccggtgagcg tgggtctcgc ggtatcattg
cagcactggg gccagatggt 3420aagccctccc gtatcgtagt tatctacacg
acggggagtc aggcaactat ggatgaacga 3480aatagacaga tcgctgagat
aggtgcctca ctgattaagc attggtaact gtcagaccaa 3540gtttactcat
atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag
3600gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt
ttcgttccac 3660tgagcgtcag accccgtaga aaagatcaaa ggatcttctt
gagatccttt ttttctgcgc 3720gtaatctgct gcttgcaaac aaaaaaacca
ccgctaccag cggtggtttg tttgccggat 3780caagagctac caactctttt
tccgaaggta actggcttca gcagagcgca gataccaaat 3840actgttcttc
tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct
3900acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga
taagtcgtgt 3960cttaccgggt tggactcaag acgatagtta ccggataagg
cgcagcggtc gggctgaacg 4020gggggttcgt gcacacagcc cagcttggag
cgaacgacct acaccgaact gagataccta 4080cagcgtgagc tatgagaaag
cgccacgctt cccgaaggga gaaaggcgga caggtatccg 4140gtaagcggca
gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg
4200tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt
tttgtgatgc 4260tcgtcagggg ggcggagcct atggaaaaac gccagcaacg
cggccttttt acggttcctg 4320gccttttgct ggccttttgc tcacatgttc
tttcctgcgt tatcccctga ttctgtggat 4380aaccgtatta ccgcctttga
gtgagctgat accgctcgcc gcagccgaac gaccgagcgc 4440agcgagtcag
tgagcgagga agcggaag 446876249DNAArtificial SequencePlasmid
7ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc
60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg
120gccaactcca tcactagggg ttcctactag tggcctccgc gccgggtttt
ggcgcctccc 180gcgggcgccc ccctcctcac ggcgagcgct gccacgtcag
acgaagggcg cagcgagcgt 240cctgatcctt ccgcccggac gctcaggaca
gcggcccgct gctcataaga ctcggcctta 300gaaccccagt atcagcagaa
ggacatttta ggacgggact tgggtgactc tagggcactg 360gttttctttc
cagagagcgg aacaggcgag gaaaagtagt cccttctcgg cgattctgcg
420gagggatctc cgtggggcgg tgaacgccga tgattatata aggacgcgcc
gggtgtggca 480cagctagttc cgtcgcagcc gggatttggg tcgcggttct
tgtttgtgga tcgctgtgat 540cgtcacttgg cggccgccat ggtcagcaag
ggcgaggagg ataacatggc catcatcaag 600gagttcatgc gcttcaaggt
gcacatggag ggctccgtga acggccacga gttcgagatc 660gagggcgagg
gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc
720aagggtggcc ccctgccctt cgcctgggac atcctgtccc ctcaattcat
gtatggctcc 780aaggcctacg tgaagcaccc cgccgacatc cccgactact
tgaagctgtc cttccccgag 840ggcttcaagt gggagcgcgt gatgaacttc
gaggacggcg gcgtggtgac cgtgacccag 900gactcctcct tacaagacgg
cgagttcatc tacaaagtga agctgcgcgg caccaacttc 960ccctccgacg
gccccgtaat gcagaagaag accatgggct gggaggcctc ctccgagcgg
1020atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa
gctgaaggac 1080ggcggccact acgacgctga ggtcaagacc acctacaagg
ccaagaagcc cgtgcagctg 1140cccggcgcct acaacgtcaa catcaagttg
gacatcacct cccacaacga ggactacacc 1200atcgtggaac agtacgaacg
cgccgagggc cgccactcca ccggcggcat ggacgagctg 1260tacaagtaaa
ggatcccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact
1320gtcctttcct cctcctagga ataaaatatc tttattttca ttacatctgt
gtgttggttt 1380tttgtgtaga tctgttcaaa tttgaactga ctaagcggct
cccgccagat tttggcaaga 1440ttactaagca ggaagtcaag gacttttttg
cttgggcaaa ggtcaatcag gtgccggtga 1500ctcacgagtt taaagttccc
agggaattgg cgggaactaa aggggcggag aaatctctaa 1560aacgcccact
gggtgacgtc accaatacta gctataaaag tctggagaag cgggccaggc
1620tctcatttgt tcccgagacg cctcgcagtt cagacgtgac tgttgatccc
gctcctctgc 1680gaccgctagc ttcgatcaac tacgcggaca ggtaccaaaa
caaatgttct cgtcacgtgg 1740gcatgaatct gatgctgttt ccctgcagac
aatgcgagag actgaatcag aattcaaata 1800tctgcttcac tcacggtgtc
aaagactgtt tagagtgctt tcccgtgtca gaatctcaac 1860ccgtttctgt
cgtcaaaaag gcgtatcaga aactgtgcta cattcatcac atcatgggaa
1920aggtgccaga cgcttgcact gcttgcgacc tggtcaatgt ggacttggat
gactgtgttt 1980ctgaacaata aatgacttaa accaggtatg gctgccgatg
gttatcttcc agattggctc 2040gaggacaacc ttagtgaagg aattcgcgag
tggtgggctt tgaaacctgg agcccctcaa 2100cccaaggcaa atcaacaaca
tcaagacaac gctcgaggtc ttgtgcttcc gggttacaaa 2160taccttggac
ccggcaacgg actcgacaag ggggagccgg tcaacgcagc agacgcggcg
2220gccctcgagc acgacaaggc ctacgaccag cagctcaagg ccggagacaa
cccgtacctc 2280aagtacaacc acgccgacgc cgagttccag gagcggctca
aagaagatac gtcttttggg 2340ggcaacctcg ggcgagcagt cttccaggcc
aaaaagaggc ttcttgaacc tcttggtctg 2400gttgaggaag cggctaagac
ggctcctgga aagaagaggc ctgtagagca gtctcctcag 2460gaaccggact
cctccgcggg tattggcaaa tcgggtgcac agcccgctaa aaagagactc
2520aatttcggtc agactggcga cacagagtca gtcccagacc ctcaaccaat
cggagaacct 2580cccgcagccc cctcaggtgt gggatctctt acaatggctt
caggtggtgg cgcaccagtg 2640gcagacaata acgaaggtgc cgatggagtg
ggtagttcct cgggaaattg gcattgcgat 2700tcccaatggc tgggggacag
agtcatcacc accagcaccc gaacctgggc cctgcccacc 2760tacaacaatc
acctctacaa gcaaatctcc aacagcacat ctggaggatc ttcaaatgac
2820aacgcctact tcggctacag caccccctgg gggtattttg acttcaacag
attccactgc 2880cacttctcac cacgtgactg gcagcgactc atcaacaaca
actggggatt ccggcctaag 2940cgactcaact tcaagctctt caacattcag
gtcaaagagg ttacggacaa caatggagtc 3000aagaccatcg ccaataacct
taccagcacg gtccaggtct tcacggactc agactatcag 3060ctcccgtacg
tgctcgggtc ggctcacgag ggctgcctcc cgccgttccc agcggacgtt
3120ttcatgattc ctcagtacgg gtatctgacg cttaatgatg gaagccaggc
cgtgggtcgt 3180tcgtcctttt actgcctgga atatttcccg tcgcaaatgc
taagaacggg taacaacttc 3240cagttcagct acgagtttga gaacgtacct
ttccatagca gctacgctca cagccaaagc 3300ctggaccgac taatgaatcc
actcatcgac caatacttgt actatctctc tagaactatt 3360accggttggg
ttcaaaacca aggaatactt ccgggtatgg tttggcagga cagagatgtg
3420tacctgcaag gacccatttg ggccaaaatt cctcacacgg acggcaactt
tcacccttct 3480ccgctgatgg gagggtttgg aatgaagcac ccgcctcctc
agatcctcat caaaaacaca 3540cctgtacctg cggatcctcc aacggccttc
aacaaggaca agctgaactc tttcatcacc 3600cagtattcta ctggccaagt
cagcgtggag atcgagtggg agctgcagaa ggaaaacagc 3660aagcgctgga
acccggagat ccagtacact tccaactatt acaagtctaa taatgttgaa
3720tttgctgtta atactgaagg tgtatatagt gaaccccgcc ccattggcac
cagatacctg 3780actcgtaatc tgtaagtcga ctaccgttcg tatagcatac
attatacgaa gttatcatat 3840gttcgagcag acatgataag atacattgat
gagtttggac aaaccacaac tagaatgcag 3900tgaaaaaaat gctttatttg
tgaaatttgt gatgctattg ctttatttgt aaccattata 3960agctgcaata
aacaagttaa caacaacaat tgcattcatt ttatgtttca ggttcagggg
4020gagatgtggg aggtttttta aagcaagtaa aacctctaca aatgtggtaa
aatcgagctc 4080taccgttcgt ataatgtatg ctatacgaag ttatgatatc
aagcttagga acccctagtg 4140atggagttgg ccactccctc tctgcgcgct
cgctcgctca ctgaggccgg gcgaccaaag 4200gtcgcccgac gcccgggctt
tgcccgggcg gcctcagtga gcgagcgagc gcgcagagag 4260ggagtggcca
agctagcggg cgattaagga aagggctaga tcattcttga agacgaaagg
4320gcctcgtgat acgcctattt ttataggtta atgtcatgat aataatggtt
tcttagacgt 4380caggtggcac ttttcgggga aatgtgcgcg gaacccctat
ttgtttattt ttctaaatac 4440attcaaatat gtatccgctc atgagacaat
aaccctgata aatgcttcaa taatattgaa 4500aaaggaagag tatgagtatt
caacatttcc gtgtcgccct tattcccttt tttgcggcat 4560tttgccttcc
tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
4620agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag
atccttgaga 4680gttttcgccc cgaagaacgt tttccaatga tgagcacttt
taaagttctg ctatgtggcg 4740cggtattatc ccgtgttgac gccgggcaag
agcaactcgg tcgccgcata cactattctc 4800agaatgactt ggttgagtac
tcaccagtca cagaaaagca tcttacggat ggcatgacag 4860taagagaatt
atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
4920tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg
ggggatcatg 4980taactcgcct tgatcgttgg gaaccggagc tgaatgaagc
cataccaaac gacgagcgtg 5040acaccacgat gcctgtagca atggcaacaa
cgttgcgcaa actattaact ggcgaactac 5100ttactctagc ttcccggcaa
caattaatag actggatgga ggcggataaa gttgcaggac 5160cacttctgcg
ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
5220agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc
tcccgtatcg 5280tagttatcta cacgacgggg agtcaggcaa ctatggatga
acgaaataga cagatcgctg 5340agataggtgc ctcactgatt aagcattggt
aactgtcaga ccaagtttac tcatatatac 5400tttagattga tttaaaactt
catttttaat ttaaaaggat ctaggtgaag atcctttttg 5460ataatctcat
gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
5520tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc
tgctgcttgc 5580aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc
ggatcaagag ctaccaactc 5640tttttccgaa ggtaactggc ttcagcagag
cgcagatacc aaatactgtt cttctagtgt 5700agccgtagtt aggccaccac
ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 5760taatcctgtt
accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
5820caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt
tcgtgcacac 5880agcccagctt ggagcgaacg acctacaccg aactgagata
cctacagcgt gagctatgag 5940aaagcgccac gcttcccgaa gggagaaagg
cggacaggta tccggtaagc ggcagggtcg 6000gaacaggaga gcgcacgagg
gagcttccag ggggaaacgc ctggtatctt tatagtcctg 6060tcgggtttcg
ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
6120gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt
tgctggcctt 6180ttgctcacat gtaataaaca cacacacacc aacaaccgtg
gttggttgtt gtgttggttt 6240attctcgag 62498743PRTArtificial
SequenceAdeno-associated virus capsid VP1 protein 8Met Ala Ala Asp
Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly
Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30
Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35
40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu
Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys
Ala Tyr Asp65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu
Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys
Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe
Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu
Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu
Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly145 150 155 160
Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165
170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro
Pro 180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser
Gly Gly Gly 195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp
Gly Val Gly Ser Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln
Trp Leu Gly Asp Arg Val Ile225 230 235 240 Thr Thr Ser Thr Arg Thr
Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile
Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr
Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290
295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn
Ile305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys
Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr
Asp Ser Asp Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His
Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile
Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala
Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400 Pro
Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410
415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr
Leu Ser 435 440 445 Arg Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr
Leu Lys Phe Ser 450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln
Gly Arg Asn Tyr Ile Pro465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln
Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe
Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn
Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu
Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535
540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met
Ile545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val
Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser
Ala Gln Thr Leu Ala Val 580 585 590 Pro Phe Lys Ala Gln Ala Gln Thr
Gly Trp Val Gln Asn Gln Gly Ile 595 600 605 Leu Pro Gly Met Val Trp
Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro 610 615 620 Ile Trp Ala Lys
Ile Pro His Thr Asp Gly Asn Phe His Pro Ser Pro625 630 635 640 Leu
Met Gly Gly Phe Gly Met Lys His Pro Pro Pro Gln Ile Leu Ile 645 650
655 Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp
660 665 670 Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val
Ser Val 675 680 685 Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys
Arg Trp Asn Pro 690 695 700 Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys
Ser Asn Asn Val Glu Phe705 710 715 720 Ala Val Asn Thr Glu Gly Val
Tyr Ser Glu Pro Arg Pro Ile Gly Thr 725 730 735 Arg Tyr Leu Thr Arg
Asn Leu 740 92232DNAArtificial SequenceAdeno-associated virus
capsid gene 9atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga
aggaattcgc 60gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca
acatcaagac 120aacgctcgag gtcttgtgct tccgggttac aaataccttg
gacccggcaa cggactcgac 180aagggggagc cggtcaacgc agcagacgcg
gcggccctcg agcacgacaa ggcctacgac 240cagcagctca aggccggaga
caacccgtac ctcaagtaca accacgccga cgccgagttc 300caggagcggc
tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag
360gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa
gacggctcct 420ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg
actcctccgc gggtattggc 480aaatcgggtg cacagcccgc taaaaagaga
ctcaatttcg gtcagactgg cgacacagag 540tcagtcccag accctcaacc
aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600cttacaatgg
cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga
660gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga
cagagtcatc 720accaccagca cccgaacctg ggccctgccc acctacaaca
atcacctcta caagcaaatc 780tccaacagca catctggagg atcttcaaat
gacaacgcct acttcggcta cagcaccccc 840tgggggtatt ttgacttcaa
cagattccac tgccacttct caccacgtga ctggcagcga 900ctcatcaaca
acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt
960caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa
ccttaccagc 1020acggtccagg tcttcacgga ctcagactat cagctcccgt
acgtgctcgg gtcggctcac 1080gagggctgcc tcccgccgtt cccagcggac
gttttcatga ttcctcagta cgggtatctg 1140acgcttaatg atggaagcca
ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200ccgtcgcaaa
tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta
1260cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa
tccactcatc 1320gaccaatact tgtactatct ctctagaact attaacggtt
ctggacagaa tcaacaaacg 1380ctaaaattca gtgtggccgg acccagcaac
atggctgtcc agggaagaaa ctacatacct 1440ggacccagct accgacaaca
acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500tttgcttggc
ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct
1560ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt
gtctggatct 1620ttaatttttg gcaaacaagg taccggcaga gacaacgtgg
atgcggacaa agtcatgata 1680accaacgaag aagaaattaa aactactaac
ccggtagcaa cggagtccta tggacaagtg 1740gccacaaacc accagagtgc
ccaaactttg gcggtgcctt ttaaggcaca ggcgcagacc 1800ggttgggttc
aaaaccaagg aatacttccg ggtatggttt ggcaggacag agatgtgtac
1860ctgcaaggac ccatttgggc caaaattcct cacacggacg gcaactttca
cccttctccg 1920ctgatgggag ggtttggaat gaagcacccg cctcctcaga
tcctcatcaa aaacacacct 1980gtacctgcgg atcctccaac ggccttcaac
aaggacaagc tgaactcttt catcacccag 2040tattctactg gccaagtcag
cgtggagatc gagtgggagc tgcagaagga aaacagcaag 2100cgctggaacc
cggagatcca gtacacttcc aactattaca agtctaataa tgttgaattt
2160gctgttaata ctgaaggtgt atatagtgaa ccccgcccca ttggcaccag
atacctgact 2220cgtaatctgt aa 2232109378DNAArtificial
SequencePlasmid 10gtcgacggta tcgggggagc tcgcagggtc tccattttga
agcgggaggt ttgaacgcgc 60agccgccatg ccggggtttt acgagattgt gattaaggtc
cccagcgacc ttgacgagca 120tctgcccggc atttctgaca gctttgtgaa
ctgggtggcc gagaaggaat gggagttgcc 180gccagattct gacatggatc
tgaatctgat tgagcaggca cccctgaccg tggccgagaa 240gctgcagcgc
gactttctga cggaatggcg ccgtgtgagt aaggccccgg aggctctttt
300ctttgtgcaa tttgagaagg gagagagcta cttccacatg cacgtgctcg
tggaaaccac 360cggggtgaaa tccatggttt tgggacgttt cctgagtcag
attcgcgaaa aactgattca 420gagaatttac cgcgggatcg agccgacttt
gccaaactgg ttcgcggtca caaagaccag 480aaatggcgcc ggaggcggga
acaaggtggt ggatgagtgc tacatcccca attacttgct 540ccccaaaacc
cagcctgagc tccagtgggc gtggactaat atggaacagt atttaagcgc
600ctgtttgaat ctcacggagc gtaaacggtt ggtggcgcag catctgacgc
acgtgtcgca 660gacgcaggag cagaacaaag agaatcagaa tcccaattct
gatgcgccgg tgatcagatc 720aaaaacttca gccaggtaca tggagctggt
cgggtggctc gtggacaagg ggattacctc 780ggagaagcag tggatccagg
aggaccaggc ctcatacatc tccttcaatg cggcctccaa 840ctcgcggtcc
caaatcaagg ctgccttgga caatgcggga aagattatga gcctgactaa
900aaccgccccc gactacctgg tgggccagca gcccgtggag gacatttcca
gcaatcggat 960ttataaaatt ttggaactaa acgggtacga tccccaatat
gcggcttccg tctttctggg 1020atgggccacg aaaaagttcg gcaagaggaa
caccatctgg ctgtttgggc ctgcaactac 1080cgggaagacc aacatcgcgg
aggccatagc ccacactgtg cccttctacg ggtgcgtaaa 1140ctggaccaat
gagaactttc ccttcaacga ctgtgtcgac aagatggtga tctggtggga
1200ggaggggaag atgaccgcca aggtcgtgga gtcggccaaa gccattctcg
gaggaagcaa 1260ggtgcgcgtg gaccagaaat gcaagtcctc ggcccagata
gacccgactc ccgtgatcgt 1320cacctccaac accaacatgt gcgccgtgat
tgacgggaac tcaacgacct tcgaacacca 1380gcagccgttg caagaccgga
tgttcaaatt tgaactcacc cgccgtctgg atcatgactt 1440tgggaaggtc
accaagcagg aagtcaaaga ctttttccgg tgggcaaagg atcacgtggt
1500tgaggtggag catgaattct acgtcaaaaa gggtggagcc aagaaaagac
ccgcccccag 1560tgacgcagat ataagtgagc ccaaacgggt gcgcgagtca
gttgcgcagc catcgacgtc 1620agacgcggaa gcttcgatca actacgcgga
caggtaccaa aacaaatgtt ctcgtcacgt 1680gggcatgaat ctgatgctgt
ttccctgcag acaatgcgag agactgaatc agaattcaaa 1740tatctgcttc
actcacggtg tcaaagactg tttagagtgc tttcccgtgt cagaatctca
1800acccgtttct gtcgtcaaaa aggcgtatca gaaactgtgc tacattcatc
acatcatggg 1860aaaggtgcca gacgcttgca ctgcttgcga cctggtcaat
gtggacttgg atgactgtgt 1920ttctgaacaa taaatgactt aaaccaggta
tgagtcggct ggataaatct aaagtcataa 1980acggcgctct ggaattactc
aatgaagtcg gtatcgaagg cctgacgaca aggaaactcg 2040ctcaaaagct
gggagttgag cagcctaccc tgtactggca cgtgaagaac aagcgggccc
2100tgctcgatgc cctggccatc gagatgctgg acaggcatca tacccacttc
tgccccctgg 2160aaggcgagtc atggcaagac tttctgcgga acaacgccaa
gtcattccgc tgtgctctcc 2220tctcacatcg cgacggggct aaagtgcatc
tcggcacccg cccaacagag aaacagtacg 2280aaaccctgga aaatcagctc
gcgttcctgt gtcagcaagg cttctccctg gagaacgcac 2340tgtacgctct
gtccgccgtg ggccacttta cactgggctg cgtattggag gaacaggagc
2400atcaagtagc aaaagaggaa agagagacac ctaccaccga ttctatgccc
ccacttctga 2460gacaagcaat tgagctgttc gaccggcagg gagccgaacc
tgccttcctt ttcggcctgg 2520aactaatcat atgtggcctg gagaaacagc
taaagtgcga aagcggcggg ccggccgacg 2580cccttgacga ttttgactta
gacatgctcc cagccgatgc ccttgacgac tttgaccttg 2640atatgctgcc
tgctgacgct cttgacgatt ttgaccttga catgctcccc gggtaaatgc
2700atgaattcga tctagagggc cctattctat agtgtcacct aaatgctaga
gctcgctgat 2760cagcctcgac tgtgccttct agttgccagc catctgttgt
ttgcccctcc cccgtgcctt 2820ccttgaccct ggaaggtgcc actcccactg
tcctttccta ataaaatgag gaaattgcat 2880cgcattgtct gagtaggtgt
cattctattc tggggggtgg ggtggggcag gacagcaagg 2940gggaggattg
ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggcttctg
3000aggcggaaag aaccagctgg ggctcgaatc aagctatcaa gtgccacctg
acgtctccct 3060atcagtgata gagaagtcga cacgtctcga gctccctatc
agtgatagag aaggtacgtc 3120tagaacgtct ccctatcagt gatagagaag
tcgacacgtc tcgagctccc tatcagtgat 3180agagaaggta cgtctagaac
gtctccctat cagtgataga gaagtcgaca cgtctcgagc 3240tccctatcag
tgatagagaa ggtacgtcta gaacgtctcc ctatcagtga tagagaagtc
3300gacacgtctc gagctcccta tcagtgatag agaaggtacc ccctatataa
gcagagagat 3360ctgttcaaat ttgaactgac taagcggctc ccgccagatt
ttggcaagat tactaagcag 3420gaagtcaagg acttttttgc ttgggcaaag
gtcaatcagg tgccggtgac tcacgagttt 3480aaagttccca gggaattggc
gggaactaaa ggggcggaga aatctctaaa acgcccactg 3540ggtgacgtca
ccaatactag ctataaaagt ctggagaagc gggccaggct ctcatttgtt
3600cccgagacgc ctcgcagttc agacgtgact gttgatcccg ctcctctgcg
accgctagct 3660tcgatcaact acgcggacag gtaccaaaac aaatgttctc
gtcacgtggg catgaatctg 3720atgctgtttc cctgcagaca atgcgagaga
ctgaatcaga attcaaatat ctgcttcact 3780cacggtgtca aagactgttt
agagtgcttt cccgtgtcag aatctcaacc cgtttctgtc 3840gtcaaaaagg
cgtatcagaa actgtgctac attcatcaca tcatgggaaa ggtgccagac
3900gcttgcactg cttgcgacct ggtcaatgtg gacttggatg actgtgtttc
tgaacaataa 3960atgacttaaa ccaggtatgg ctgccgatgg ttatcttcca
gattggctcg aggacaacct 4020tagtgaagga attcgcgagt ggtgggcttt
gaaacctgga gcccctcaac ccaaggcaaa 4080tcaacaacat caagacaacg
ctcgaggtct tgtgcttccg ggttacaaat accttggacc 4140cggcaacgga
ctcgacaagg gggagccggt caacgcagca gacgcggcgg ccctcgagca
4200cgacaaggcc tacgaccagc agctcaaggc cggagacaac ccgtacctca
agtacaacca 4260cgccgacgcc gagttccagg agcggctcaa agaagatacg
tcttttgggg gcaacctcgg 4320gcgagcagtc ttccaggcca aaaagaggct
tcttgaacct cttggtctgg ttgaggaagc 4380ggctaagacg gctcctggaa
agaagaggcc tgtagagcag tctcctcagg aaccggactc 4440ctccgcgggt
attggcaaat cgggtgcaca gcccgctaaa aagagactca atttcggtca
4500gactggcgac acagagtcag tcccagaccc tcaaccaatc ggagaacctc
ccgcagcccc 4560ctcaggtgtg ggatctctta caatggcttc aggtggtggc
gcaccagtgg cagacaataa 4620cgaaggtgcc gatggagtgg gtagttcctc
gggaaattgg cattgcgatt cccaatggct 4680gggggacaga gtcatcacca
ccagcacccg aacctgggcc ctgcccacct acaacaatca 4740cctctacaag
caaatctcca acagcacatc tggaggatct tcaaatgaca acgcctactt
4800cggctacagc accccctggg ggtattttga cttcaacaga ttccactgcc
acttctcacc 4860acgtgactgg cagcgactca tcaacaacaa ctggggattc
cggcctaagc gactcaactt 4920caagctcttc aacattcagg tcaaagaggt
tacggacaac aatggagtca agaccatcgc 4980caataacctt accagcacgg
tccaggtctt cacggactca gactatcagc tcccgtacgt 5040gctcgggtcg
gctcacgagg gctgcctccc gccgttccca gcggacgttt tcatgattcc
5100tcagtacggg tatctgacgc ttaatgatgg aagccaggcc gtgggtcgtt
cgtcctttta 5160ctgcctggaa tatttcccgt cgcaaatgct aagaacgggt
aacaacttcc agttcagcta 5220cgagtttgag aacgtacctt tccatagcag
ctacgctcac agccaaagcc tggaccgact 5280aatgaatcca ctcatcgacc
aatacttgta ctatctctct agaactatta acggttctgg 5340acagaatcaa
caaacgctaa aattcagtgt ggccggaccc agcaacatgg ctgtccaggg
5400aagaaactac atacctggac ccagctaccg acaacaacgt gtctcaacca
ctgtgactca 5460aaacaacaac agcgaatttg cttggcctgg agcttcttct
tgggctctca atggacgtaa 5520tagcttgatg aatcctggac ctgctatggc
cagccacaaa gaaggagagg accgtttctt 5580tcctttgtct ggatctttaa
tttttggcaa acaaggtacc ggcagagaca acgtggatgc 5640ggacaaagtc
atgataacca acgaagaaga aattaaaact actaacccgg tagcaacgga
5700gtcctatgga caagtggcca caaaccacca gagtgcccaa actttggcgg
tgccttttaa 5760ggcacaggcg cagaccggtt gggttcaaaa ccaaggaata
cttccgggta tggtttggca 5820ggacagagat gtgtacctgc aaggacccat
ttgggccaaa attcctcaca cggacggcaa 5880ctttcaccct tctccgctga
tgggagggtt tggaatgaag cacccgcctc ctcagatcct 5940catcaaaaac
acacctgtac ctgcggatcc tccaacggcc ttcaacaagg acaagctgaa
6000ctctttcatc acccagtatt ctactggcca agtcagcgtg gagatcgagt
gggagctgca 6060gaaggaaaac agcaagcgct ggaacccgga gatccagtac
acttccaact attacaagtc 6120taataatgtt gaatttgctg ttaatactga
aggtgtatat agtgaacccc gccccattgg 6180caccagatac ctgactcgta
atctgtaatt gcttgttaat caataaaccg tttaattcgt 6240ttcagttgaa
ctttggtctc tgcgaagggc gaattcgttt aaacctgcag gactagaggt
6300cctgtattag aggtcacgtg agtgttttgc gacattttgc gacaccatgt
ggtcacgctg 6360ggtatttaag cccgagtgag cacgcagggt ctccattttg
aagcgggagg tttgaacgcg 6420cagccgccaa gccgaattct gcagatatcc
atcacactgg cggccgctcg actagagcgg 6480ccgccaccgc ggtggagctc
cagcttttgt tccctttagt gagggttaat tgcgcgcttg 6540gcgtaatcat
ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac
6600aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
gagctaactc 6660acattaattg cgttgcgctc actgcccgct ttccagtcgg
gaaacctgtc gtgccagctg 6720cattaatgaa tcggccaacg cgcggggaga
ggcggtttgc gtattgggcg ctcttccgct 6780tcctcgctca ctgactcgct
gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 6840tcaaaggcgg
taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga
6900gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
gtttttccat 6960aggctccgcc cccctgacga gcatcacaaa aatcgacgct
caagtcagag gtggcgaaac 7020ccgacaggac tataaagata ccaggcgttt
ccccctggaa gctccctcgt gcgctctcct 7080gttccgaccc tgccgcttac
cggatacctg tccgcctttc tcccttcggg aagcgtggcg 7140ctttctcata
gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg
7200ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
taactatcgt 7260cttgagtcca acccggtaag acacgactta tcgccactgg
cagcagccac tggtaacagg 7320attagcagag cgaggtatgt aggcggtgct
acagagttct tgaagtggtg gcctaactac 7380ggctacacta gaagaacagt
atttggtatc tgcgctctgc tgaagccagt taccttcgga 7440aaaagagttg
gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt
7500gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc
tttgatcttt 7560tctacggggt ctgacgctca gtggaacgaa aactcacgtt
aagggatttt ggtcatgaga 7620ttatcaaaaa ggatcttcac ctagatcctt
ttaaattaaa aatgaagttt taaatcaatc 7680taaagtatat atgagtaaac
ttggtctgac agttaccaat gcttaatcag tgaggcacct 7740atctcagcga
tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata
7800actacgatac
gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca
7860cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc
cgagcgcaga 7920agtggtcctg caactttatc cgcctccatc cagtctatta
attgttgccg ggaagctaga 7980gtaagtagtt cgccagttaa tagtttgcgc
aacgttgttg ccattgctac aggcatcgtg 8040gtgtcacgct cgtcgtttgg
tatggcttca ttcagctccg gttcccaacg atcaaggcga 8100gttacatgat
cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt
8160gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact
gcataattct 8220cttactgtca tgccatccgt aagatgcttt tctgtgactg
gtgagtactc aaccaagtca 8280ttctgagaat agtgtatgcg gcgaccgagt
tgctcttgcc cggcgtcaat acgggataat 8340accgcgccac atagcagaac
tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 8400aaactctcaa
ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc
8460aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa
aacaggaagg 8520caaaatgccg caaaaaaggg aataagggcg acacggaaat
gttgaatact catactcttc 8580ctttttcaat attattgaag catttatcag
ggttattgtc tcatgagcgg atacatattt 8640gaatgtattt agaaaaataa
acaaataggg gttccgcgca catttccccg aaaagtgcca 8700cctaaattgt
aagcgttaat attttgttaa aattcgcgtt aaatttttgt taaatcagct
8760cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa
gaatagaccg 8820agatagggtt gagtgttgtt ccagtttgga acaagagtcc
actattaaag aacgtggact 8880ccaacgtcaa agggcgaaaa accgtctatc
agggcgatgg cccactacgt gaaccatcac 8940cctaatcaag ttttttgggg
tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga 9000gcccccgatt
tagagcttga cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga
9060aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg
cgcgtaacca 9120ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc
ccattcgcca ttcaggctgc 9180gcaactgttg ggaagggcga tcggtgcggg
cctcttcgct attacgccag ctggcgaaag 9240ggggatgtgc tgcaaggcga
ttaagttggg taacgccagg gttttcccag tcacgacgtt 9300gtaaaacgac
ggccagtgag cgcgcgtaat acgactcact atagggcgaa ttgggtaccg
9360ggccccccct cgatcgag 9378112211DNAAdeno-associated
dependoparvovirusAdeno-associated virus capsid VP1 gene
11atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc
60gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac
120aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa
cggactcgac 180aagggggagc cggtcaacgc agcagacgcg gcggccctcg
agcacgacaa ggcctacgac 240cagcagctca aggccggaga caacccgtac
ctcaagtaca accacgccga cgccgagttc 300caggagcggc tcaaagaaga
tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360gccaaaaaga
ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct
420ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc
gggtattggc 480aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg
gtcagactgg cgacacagag 540tcagtcccag accctcaacc aatcggagaa
cctcccgcag ccccctcagg tgtgggatct 600cttacaatgg cttcaggtgg
tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660gtgggtagtt
cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc
720accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta
caagcaaatc 780tccaacagca catctggagg atcttcaaat gacaacgcct
acttcggcta cagcaccccc 840tgggggtatt ttgacttcaa cagattccac
tgccacttct caccacgtga ctggcagcga 900ctcatcaaca acaactgggg
attccggcct aagcgactca acttcaagct cttcaacatt 960caggtcaaag
aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc
1020acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg
gtcggctcac 1080gagggctgcc tcccgccgtt cccagcggac gttttcatga
ttcctcagta cgggtatctg 1140acgcttaatg atggaagcca ggccgtgggt
cgttcgtcct tttactgcct ggaatatttc 1200ccgtcgcaaa tgctaagaac
gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260cctttccata
gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc
1320gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa
tcaacaaacg 1380ctaaaattca gtgtggccgg acccagcaac atggctgtcc
agggaagaaa ctacatacct 1440ggacccagct accgacaaca acgtgtctca
accactgtga ctcaaaacaa caacagcgaa 1500tttgcttggc ctggagcttc
ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560ggacctgcta
tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct
1620ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa
agtcatgata 1680accaacgaag aagaaattaa aactactaac ccggtagcaa
cggagtccta tggacaagtg 1740gccacaaacc accagagtgc ccaagcacag
gcgcagaccg gctgggttca aaaccaagga 1800atacttccgg gtatggtttg
gcaggacaga gatgtgtacc tgcaaggacc catttgggcc 1860aaaattcctc
acacggacgg caactttcac ccttctccgc tgatgggagg gtttggaatg
1920aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga
tcctccaacg 1980gccttcaaca aggacaagct gaactctttc atcacccagt
attctactgg ccaagtcagc 2040gtggagatcg agtgggagct gcagaaggaa
aacagcaagc gctggaaccc ggagatccag 2100tacacttcca actattacaa
gtctaataat gttgaatttg ctgttaatac tgaaggtgta 2160tatagtgaac
cccgccccat tggcaccaga tacctgactc gtaatctgta a
221112736PRTArtificial SequenceAdeno-associated virus capsid
protein G2B-13 12Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu
Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys
Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp
Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly
Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala
Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80 Gln Gln
Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100
105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu
Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly
Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser
Ser Ala Gly Ile Gly145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys
Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val
Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser
Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro
Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225
230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn
His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser
Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly
Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg
Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro
Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320 Gln Val Lys
Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn
Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345
350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu
Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys
Leu Glu Tyr Phe385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn
Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His
Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn
Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Arg Thr Ile
Gln Ser Ser Gln Thr Pro Arg Gln Thr Leu Lys Phe Ser 450 455 460 Val
Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470
475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln
Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp
Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala
Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu
Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp
Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560 Thr Asn Glu Glu
Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly
Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590
Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595
600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro
His 610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly
Phe Gly Met625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys
Asn Thr Pro Val Pro Ala 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys
Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln
Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser
Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr
Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val705 710 715
720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu
725 730 735 13743PRTArtificial SequenceAdeno-associated virus
capsid protein G2B-26 13Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu
Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu
Lys Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln
Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu
Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala
Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80 Gln
Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90
95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly
100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu
Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro
Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp
Ser Ser Ala Gly Ile Gly145 150 155 160 Lys Ser Gly Ala Gln Pro Ala
Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser
Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro
Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala
Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215
220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val
Ile225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr
Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly
Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro
Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser
Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe
Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320 Gln
Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330
335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu
340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro
Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu
Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe
Tyr Cys Leu Glu Tyr Phe385 390 395 400 Pro Ser Gln Met Leu Arg Thr
Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro
Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu
Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Arg
Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455
460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile
Pro465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr
Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala
Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro
Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe
Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr
Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560 Thr
Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570
575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Thr Leu Ala Val
580 585 590 Pro Phe Lys Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln
Gly Ile 595 600 605 Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr
Leu Gln Gly Pro 610 615 620 Ile Trp Ala Lys Ile Pro His Thr Asp Gly
Asn Phe His Pro Ser Pro625 630 635 640 Leu Met Gly Gly Phe Gly Met
Lys His Pro Pro Pro Gln Ile Leu Ile 645 650 655 Lys Asn Thr Pro Val
Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp 660 665 670 Lys Leu Asn
Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val 675 680 685 Glu
Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro 690 695
700 Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu
Phe705 710 715 720 Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg
Pro Ile Gly Thr 725 730 735 Arg Tyr Leu Thr Arg Asn Leu 740
14743PRTArtificial SequenceAdeno-associated virus capsid protein
TH1.1-32 14Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn
Leu Ser1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly
Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala
Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly
Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala
Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80 Gln Gln Leu Lys
Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala
Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115
120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys
Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala
Gly Ile Gly145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg
Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp
Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val
Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200
205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser
210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg
Val Ile225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr
Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser
Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr
Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe
Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly
Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320
Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325
330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln
Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro
Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr
Leu Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser
Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400 Pro Ser Gln Met Leu Arg
Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val
Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg
Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445
Arg Thr Ile Ile Leu Gly Thr Gly Thr Ser Gln Thr Leu Lys Phe Ser 450
455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile
Pro465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr
Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala
Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro
Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe
Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr
Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile545 550 555 560 Thr
Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570
575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Thr Arg Thr Asn
580 585 590 Pro Glu Ala Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln
Gly Ile 595 600 605 Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr
Leu Gln Gly Pro 610 615 620 Ile Trp Ala Lys Ile Pro His Thr Asp Gly
Asn Phe His Pro Ser Pro625 630 635 640 Leu Met Gly Gly Phe Gly Met
Lys His Pro Pro Pro Gln Ile Leu Ile 645 650 655 Lys Asn Thr Pro Val
Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp 660 665 670 Lys Leu Asn
Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val 675 680 685 Glu
Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro 690 695
700 Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu
Phe705 710 715 720 Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg
Pro Ile Gly Thr 725 730 735 Arg Tyr Leu Thr Arg Asn Leu 740
15743PRTArtificial SequenceAdeno-associated virus capsid protein
TH1.1-35 15Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn
Leu Ser1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly
Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala
Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly
Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala
Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65 70 75 80 Gln Gln Leu Lys
Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala
Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115
120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys
Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala
Gly Ile Gly145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg
Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp
Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val
Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Val Ala
Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220 Ser Gly
Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile225 230 235
240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn
Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe
Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp
Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg
Leu Asn Phe Lys Leu Phe Asn Ile305 310 315 320 Gln Val Lys Glu Val
Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr
Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350 Pro
Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360
365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp
370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu
Tyr Phe385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe
Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser
Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu
Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Arg Thr Ile Ile Leu
Gly Thr Gly Thr Ser Gln Thr Leu Lys Phe Ser 450 455 460 Val Ala Gly
Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro465 470 475 480
Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485
490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu
Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala
Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly
Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val
Asp Ala Asp Lys Val Met Ile545 550 555 560 Thr Asn Glu Glu Glu Ile
Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val
Ala Thr Asn His Gln Ser Ala Gln Asn Gly Gly Thr 580 585 590 Ser Ser
Ser Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln Gly Ile 595 600 605
Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro 610
615 620 Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser
Pro625 630 635 640 Leu Met Gly Gly Phe Gly Met Lys His Pro Pro Pro
Gln Ile Leu Ile 645 650 655 Lys Asn Thr Pro Val Pro Ala Asp Pro Pro
Thr Ala Phe Asn Lys Asp 660 665 670 Lys Leu Asn Ser Phe Ile Thr Gln
Tyr Ser Thr Gly Gln Val Ser Val 675 680 685 Glu Ile Glu Trp Glu Leu
Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro 690 695 700 Glu Ile Gln Tyr
Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu Phe705 710 715 720 Ala
Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr 725 730
735 Arg Tyr Leu Thr Arg Asn Leu 740 1627DNAArtificial Sequence9CapF
primer 16caggtcttca cggactcaga ctatcag 271732DNAArtificial
SequenceCDF Primer 17caagtaaaac ctctacaaat gtggtaaaat cg
321836DNAArtificial SequenceXF primer 18actcatcgac caatacttgt
actatctctc tagaac 361926DNAArtificial SequenceAR Primer
19ggaagtattc cttggttttg aaccca 262023DNAArtificial SequenceTF
Primer 20ggtcgcggtt cttgtttgtg gat 232124DNAArtificial SequenceTR
Primer 21gcaccttgaa gcgcatgaac tcct 242285DNAArtificial
Sequence7xNNK Primer 22catcgaccaa tacttgtact atctctctag aactattnnk
nnknnknnkn nknnknnkca 60aacgctaaaa ttcagtgtgg ccgga
852383DNAArtificial Sequence7xMNN Primer 23gtattccttg gttttgaacc
caaccggtct gcgcctgtgc mnnmnnmnnm nnmnnmnnmn 60nttgggcact ctggtggttt
gtg 832421DNAArtificial SequenceAAV varient 24actttggcgg tgccttttaa
g 212521DNAArtificial SequenceAAV varient 25agtgtgagta agcctttttt g
212621DNAArtificial SequenceAAV varient 26tttacgttga cgacgcctaa g
212721DNAArtificial SequenceAAV varient 27atgaatgcta cgaagaatgt g
21287PRTArtificial SequenceAAV varient 28Ser Val Ser Lys Pro Phe
Leu1 5 297PRTArtificial SequenceAAV varient 29Phe Thr Leu Thr Thr
Pro Lys1 5 307PRTArtificial SequenceAAV varient 30Met Asn Ala Thr
Lys Asn Val1 5 316PRTArtificial SequenceTarget peptide 31Leu Ala
Val Pro Phe Lys1 5 325PRTArtificial SequenceTarget peptide 32Ala
Val Pro Phe Lys 1 5 334PRTArtificial SequenceTarget peptide 33Val
Pro Phe Lys1 346PRTArtificial SequenceTarget peptide 34Thr Leu Ala
Val Pro Phe1 5 355PRTArtificial SequenceTarget peptide 35Thr Leu
Ala Val Pro1 5 364PRTArtificial SequenceTarget peptide 36Thr Leu
Ala Val1 3749DNAArtificial SequencePrimer 37caaccggtaa tagttctaga
gagatagtac aagtattggt cgatgagtg 493846DNAArtificial SequencePrimer
38ctctctagaa ctattaccgg ttgggttcaa aaccaaggaa tacttc
463933DNAArtificial SequencePrimer 39gtccaaactc atcaatgtat
cttatcatgt ctg 334028DNAArtificial SequencePrimer 40gagtcaatct
ggaagttaac catcggca 284125DNAArtificial SequencePrimer 41gatggttaac
ttccagattg actcg 254228DNAArtificial SequencePrimer 42gactactcta
caggcctctt ctatccag 284328DNAArtificial SequencePrimer 43gatagaagag
gcctgtagag tagtctcc 284424DNAArtificial SequencePrimer 44catcggcacc
ttagttattg tctg 244528DNAArtificial SequencePrimer 45gacaataact
aaggtgccga tggagtgg 284640DNAArtificial SequencePrimer 46gtctctgccg
gtaccttgtt tgccaaaaat taaagatcca 404739DNAArtificial SequencePrimer
47gcaaacaagg taccggcaga gacaacgtgg atgcggaca 394821DNAArtificial
SequenceVarient G2B-13 48cagtcgtcgc agacgcctag g
214921DNAArtificial SequenceVarient G2B-26 49actttggcgg tgccttttaa
g 215021DNAArtificial SequenceVarient TH 1-32 50attctgggga
ctggtacttc g 215121DNAArtificial SequenceVarient TH 1-32
51acgcggacta atcctgaggc t 215221DNAArtificial SequenceVarient TH
1-35 52attctgggga ctggtacttc g 215321DNAArtificial SequenceVarient
TH 1-35 53aatgggggga ctagtagttc t 21547PRTArtificial
SequenceVarient G2B-13 54Gln Ser Ser Gln Thr Pro Arg1 5
557PRTArtificial SequenceVarient TH 1-32 55Ile Leu Gly Thr Gly Thr
Ser1 5 567PRTArtificial SequenceVarient TH 1-32 56Thr Arg Thr Asn
Pro Glu Ala1 5 577PRTArtificial SequenceVarient TH 1-35 57Ile Leu
Gly Thr Gly Thr Ser1 5 587PRTArtificial SequenceVarient TH 1-35
58Asn Gly Gly Thr Ser Ser Ser1 5 5921DNAArtificial SequenceVarient
PHP-A 59tatactttgt cgcagggttg g 21607PRTArtificial SequenceVarient
PHP-A 60Tyr Thr Leu Ser Gln Gly Trp1 5
* * * * *