Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis

Abstract

The invention in principle pertains to the field of recombinant manufacture of fatty acids. It provides novel nucleic acid molecules comprising nucleic acid sequences encoding fatty acid desaturases, elongases, acyltransferases, terminator sequences and high expressing seed-specific promoters operatively linked to the said nucleic acid sequences wherein nucleic acid expression enhancing nucleic acids (NEENAs) are functionally linked to said promoters.

Parent Case Text

RELATED APPLICATIONS

This application is a national stage application (under 35 U.S.C. .sctn.371) of PCT/EP2010/062561, filed Aug. 27, 2010 which claims benefit of U.S. Provisional Application No. 61/238,254, filed Aug. 31, 2009 and European Application No. 09169079.2, filed Aug. 31, 2009.

Description

SUBMISSION OF SEQUENCE LISTING

The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is Revised_Sequence_List_13987_00173_US. The size of the text file is 318 KB and the text file was created on Mar. 23, 2012.

The invention in principle pertains to the field of recombinant manufacture of fatty acids. It provides novel nucleic acid molecules comprising nucleic acid sequences encoding fatty acid desaturases, elongases, acyltransferases, terminator sequences and high expressing seed-specific promoters operatively linked to the said nucleic acid sequences wherein nucleic acid expression enhancing nucleic acids (NEENAs) are functionally linked to said promoters.

The invention also provides recombinant expression vectors containing the nucleic acid molecules, host cells or host cell cultures into which the expression vectors have been introduced, and methods for large-scale production of long chain polyunsaturated fatty acids (LCPUFAs), e.g. arachidonic acid (ARA), eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA).

DESCRIPTION OF THE INVENTION

Expression of transgenes in plants is strongly affected by various external and internal factors resulting in a variable and unpredictable level of transgene expression. Often a high number of transformants have to be produced and analyzed in order to identify lines with desirable expression strength. As transformation and screening for lines with desirable expression strength is costly and labor intensive there is a need for high expression of one or more transgenes in a plant. This problem is especially pronounced, when several genes have to be coordinately expressed in a transgenic plant in order to achieve a specific effect as a plant has to be identified in which each and every gene is strongly expressed.

For example, expression of a transgene can vary significantly, depending on construct design and positional effects of the T-DNA insertion locus in individual transformation events. Strong promoters can partially overcome these challenges. However, availability of suitable promoters showing strong expression with the desired specificity is often limited. In order to ensure availability of sufficient promoters with desired expression specificity, the identification and characterization of additional promoters can help to close this gap. However, natural availability of promoters of the respective specificity and strength and the time consuming characterization of promoter candidates impedes the identification of suitable new promoters.

In order to overcome these challenges, diverse genetic elements and/or motifs have been shown to positively affect gene expression. Among these, some introns have been recognized as genetic elements with a strong potential for improving gene expression. Although the mechanism is largely unknown, it has been shown that some introns positively affect the steady state amount of mature mRNA, possibly by enhanced transcriptional activity, improved mRNA maturation, enhanced nuclear mRNA export and/or improved translation initiation (e.g. Huang and Gorman, 1990; Le Hir et al., 2003; Nott et al., 2004). Since only selected introns were shown to increase expression, splicing as such is likely not accountable for the observed effects.

The increase of gene expression observed upon functionally linking introns to promoters is called intron mediated enhancement (IME) of gene expression and has been shown in various monocotyledonous (e.g. Callis et al., 1987; Vasil et al., 1989; Bruce et al., 1990; Lu et al., 2008) and dicotyledonous plants (e.g. Chung et al., 2006; Kim et al., 2006; Rose et al., 2008). In this respect, the position of the intron in relation to the translational start site (ATG) was shown to be crucial for intron mediated enhancement of gene expression (Rose et al., 2004).

Next to their potential for enhancing gene expression, few introns were shown to also affect the tissue specificity in their native nucleotide environment in plants. Reporter gene expression was found to be dependent on the presence of genomic regions containing up to two introns (Sieburth et al., 1997; Wang et al., 2004). 5' UTR introns have also been reported to be of importance for proper functionality of promoter elements, likely due to tissue specific gene control elements residing in the introns (Fu et al., 1995a; Fu et al., 1995b; Vitale et al., 2003; Kim et al., 2006). However, these studies also show that combination of introns with heterologous promoters can have strong negative impacts on strength and/or specificity of gene expression (Vitale et al., 2003; Kim et al., 2006, WO2006/003186, WO2007/098042). For example the strong constitutive Cauliflower Mosaic Virus CaMV35S promoter is negatively affected through combination with the sesame SeFAD2 5' UTR intron (Kim et al., 2006). In contrast to these observations, some documents show enhanced expression of a nucleic acid by IME without affecting the tissue specificity of the respective promoter (Schunemann et al., 2004). Introns or NEENAs that enhance seed-specific expression when functionally linked to a heterologous promoter have not been shown in the art.

In the present application further nucleic acid molecules are described that enhance the expression of said promoters without affecting their specificity upon functionally linkage to seed-specific promoters. These nucleic acid molecules are in the present application described as "nucleic acid expression enhancing nucleic acids" (NEENA). Introns have the intrinsic feature to be spliced out of the respective pre-mRNA. In contrast to that the nucleic acids presented in the application at hand, do not necessarily have to be included in the mRNA or, if present in the mRNA, have not necessarily to be spliced out of the mRNA in order to enhance the expression derived from the promoter the NEENAs are functionally linked to.

DETAILED DESCRIPTION OF THE INVENTION

A first embodiment of the invention pertains to a polynucleotide that promotes enhancing of polyunsaturated fatty acid synthesis, therefore it pertains in generally in the recombinant manufacture of polyunsaturated fatty acids.

Fatty acids are carboxylic acids with long-chain hydrocarbon side groups that play a fundamental role in many biological processes. Fatty acids are rarely found free in nature but, rather, occur in esterified form as the major component of lipids. As such, lipids/fatty acids are sources of energy (e.g., b-oxidation). In addition, lipids/fatty acids are an integral part of cell membranes and, therefore, are indispensable for processing biological or biochemical information.

Fatty acids can be divided into two groups: saturated fatty acids formed of single carbon bonds and the unsaturated fatty acids which contain one or more carbon double bonds in cis-configuration. Unsaturated fatty acids are produced by terminal desaturases that belong to the class of nonheme-iron enzymes. Each of these enzymes are part of an electron-transport system that involves one or two other proteins, namely cytochrome b.sub.5 and NADH-cytochrome b.sub.5 reductase. The cytochrome b5 functionality can also be n-terminally fused to the desaturase moiety of one single protein. Specifically, such enzymes catalyze the formation of double bonds between the carbon atoms of a fatty acid molecule, for example, by catalyzing the oxygen-dependent dehydrogenation of fatty acids (Sperling et al., 2003). Human and other mammals have a limited spectrum of desaturases that are required for the formation of particular double bonds in unsaturated fatty acids and thus, have a limited capacity for synthesizing essential fatty acids, e.g., long chain polyunsaturated fatty acids (LCPUFAs). Thus, humans have to take up some fatty acids through their diet. Such essential fatty acids include, for example, linoleic acid (C18:2), linolenic acid (C18:3). In contrast, insects, microorganisms and plants are able to synthesize a much larger variety of unsaturated fatty acids and their derivatives. Indeed, the biosynthesis of fatty acids is a major activity of plants and microorganisms.

Long chain polyunsaturated fatty acids (LCPUFAs) such as docosahexaenoic acid (DHA, 22:6(4,7,10,13,16,19)) are essential components of cell membranes of various tissues and organelles in mammals (nerve, retina, brain and immune cells). For example, over 30% of fatty acids in brain phospholipid are 22:6 (n-3) and 20:4 (n-6) (Crawford, M. A., et al., (1997) Am. J. Clin. Nutr. 66:1032 S-1041S). In retina, DHA accounts for more than 60% of the total fatty acids in the rod outer segment, the photosensitive part of the photoreceptor cell (Giusto, N. M., et al. (2000) Prog. Lipid Res. 39:315-391). Clinical studies have shown that DHA is essential for the growth and development of the brain in infants, and for maintenance of normal brain function in adults (Martinetz, M. (1992) J. Pediatr. 120:S129-S138). DHA also has significant effects on photoreceptor function involved in the signal transduction process, rhodopsin activation, and rod and cone development (Giusto, N. M., et al. (2000) Prog. Lipid Res. 39:315-391). In addition, some positive effects of DHA were also found on diseases such as hypertension, arthritis, atherosclerosis, depression, thrombosis and cancers (Horrocks, L. A. and Yeo, Y. K. (1999) Pharmacol. Res. 40:211-215). Therefore, appropriate dietary supply of the fatty acid is important for human health. Because such fatty acids cannot be efficiently synthesized by infants, young children and senior citizens, it is particularly important for these individuals to adequately intake these fatty acids from the diet (Spector, A. A. (1999) Lipids 34:S1-S3).

Currently the major sources of DHA are oils from fish and algae. Fish oil is a major and traditional source for this fatty acid, however, it is usually oxidized by the time it is sold. In addition, the supply of fish oil is highly variable, particularly in view of the shrinking fish populations. Moreover, the algal source of oil is expensive due to low yield and the high costs of extraction.

EPA and ARA are both .DELTA.5 essential fatty acids. They form a unique class of food and feed constituents for humans and animals. EPA belongs to the n-3 series with five double bonds in the acyl chain. EPA is found in marine food and is abundant in oily fish from North Atlantic. ARA belongs to the n-6 series with four double bonds. The lack of a double bond in the .omega.-3 position confers on ARA different properties than those found in EPA. The eicosanoids produced from ARA have strong inflammatory and platelet aggregating properties, whereas those derived from EPA have anti-inflammatory and anti-platelet aggregating properties. ARA can be obtained from some foods such as meat, fish and eggs, but the concentration is low.

Gamma-linolenic acid (GLA) is another essential fatty acid found in mammals. GLA is the metabolic intermediate for very long chain n-6 fatty acids and for various active molecules. In mammals, formation of long chain polyunsaturated fatty acids is rate-limited by .DELTA.6 desaturation. Many physiological and pathological conditions such as aging, stress, diabetes, eczema, and some infections have been shown to depress the .DELTA.6 desaturation step. In addition, GLA is readily catabolized by the oxidation and rapid cell division associated with certain disorders, e.g., cancer or inflammation. Therefore, dietary supplementation with GLA can reduce the risks of these disorders. Clinical studies have shown that dietary supplementation with GLA is effective in treating some pathological conditions such as atopic eczema, premenstrual syndrome, diabetes, hypercholesterolemia, and inflammatory and cardiovascular disorders.

A large number of beneficial health effects have been shown for DHA or mixtures of EPA/DHA. DHA is a n-3 very long chain fatty acid with six double bonds.

Although biotechnology offers an attractive route for the production of specialty fatty acids, current techniques fail to provide an efficient means for the large scale production of unsaturated fatty acids. Accordingly, there exists a need for an improved and efficient method of producing unsaturated fatty acids, such as DHA, EPA and ARA.

Thus, the present invention relates to a polynucleotide comprising: a) at least one nucleic acid sequence encoding a polypeptide having desaturase or elongase activity; b) at least one seed-specific and/or a seed-preferential plant promoter operatively linked to the said nucleic acid sequence; c) at least one terminator sequence operatively linked to the said nucleic acid sequence and d) one or more nucleic acid expression enhancing nucleic acid (NEENA) molecule functionally linked to said promoter and which is/are heterologous to said promoter and to said polypeptide defined in a).

In one embodiment the term "polynucleotide" as used in accordance with the present invention relates to a polynucleotide comprising a nucleic acid sequence which encodes a polypeptide having desaturase or elongase activity. Preferably, the polypeptide encoded by the polynucleotide of the present invention having desaturase, or elongase activity upon expression in a plant shall be capable of increasing the amount of PUFA and, in particular, LCPUFA in, e.g., seed oils or the entire plant or parts thereof. Such an increase is, preferably, statistically significant when compared to a LCPUFA producing transgenic control plant which expresses the present state of the art set of desaturases and elongases required for LCPUFA synthesis but does not express the polynucleotide of the present invention. Whether an increase is significant can be determined by statistical tests well known in the art including, e.g., Student's t-test. More preferably, the increase is an increase of the amount of triglycerides containing LCPUFA of at least 5%, at least 10%, at least 15%, at least 20% or at least 30% compared to the said control. Preferably, the LCPUFA referred to before is a polyunsaturated fatty acid having a C-20 or C-22 fatty acid body, more preferably, ARA, EPA or DHA. Suitable assays for measuring the activities mentioned before are described in the accompanying Examples.

The term "desaturase" or "elongase" as used herein refers to the activity of a desaturase, introducing a double bond into the carbon chain of a fatty acid, preferably into fatty acids with 18, 20 or 22 carbon molecules, or an elongase, introducing two carbon molecules into the carbon chain of a fatty acid, preferably into fatty acids with 18, 20 or 22 carbon molecules

Preferred polynucleotides are those having a nucleic acid sequence as shown in SEQ ID NOs: 95, 96, 97, 98, 99, 100 or 101 encoding for polypeptides exhibit desaturase or elongase activity (see table 3)

Other preferred polynucleotides are those having a nucleic acid sequence are shown in SEQ ID NOs: 102 or 103 encoding a polypeptide having desaturase or elongase activity (see table 4, also), that are especially used in addition to the polynucleotides listed in table 3 for synthesis of 22:6n-3 (DHA), i.e. in rapeseed.

A preferred seed-specific promoter as meant herein is selected from the group consisting of Napin, USP, Conlinin, SBP, Fae, Arc and LuPXR. Other most preferred seed-specific promoter as meant herein are encoded by a nucleic acid sequence as shown in SEQ ID NOs: 25, 26, 27, 28, 29 or 30. A person skilled in the art is aware of methods for rendering a unidirectional to a bidirectional promoter and of methods to use the complement or reverse complement of a promoter sequence for creating a promoter having the same promoter specificity as the original sequence. Such methods are for example described for constitutive as well as inducible promoters by Xie et al. (2001) "Bidirectionalization of polar promoters in plants" (Nature Biotechnology 19, pages 677-679). The authors describe that it is sufficient to add a minimal promoter to the 5' prime end of any given promoter to receive a promoter controlling expression in both directions with same promoter specificity.

The term "NEENA" as described below is used for the expression "nucleic acid expression enhancing nucleic acid" referring to a sequence and/or a nucleic acid molecule of a specific sequence having the intrinsic property to enhance expression of a nucleic acid under the control of a promoter to which the NEENA is functionally linked. Hence a high expression promoter functionally linked to a NEENA as claimed is functional in complement or reverse complement and therefore the NEENA is functional in complement or reverse complement too.

In principal the NEENA may be functionally linked to any promoter such as tissue specific, inducible, developmental specific or constitutive promoters. The respective NEENA will lead to an enhanced seed-specific expression of the heterologous nucleic acid under the control of the respective promoter to which the one or more NEENA is functionally linked to. The enhancement of expression of promoters other than seed-specific promoters, for example constitutive promoters or promoters with differing tissue specificity, will influence the specificity of these promoters. Expression of the nucleic acid under control of the respective promoter will be significantly increased in seeds, where the transcript of said nucleic acid may have not or only weakly been detected without the NEENA functionally linked to its promoter. Hence, tissue- or developmental specific or any other promoter may be rendered to seed-specific promoters by functionally linking one or more of the NEENA molecules as described above to said promoter. Preferred NEENAs as for the present invention are encoded by the sequences shown in SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23 or 24. More preferred NEENAs as for the present invention are encoded by the sequences shown in SEQ ID NOs: 6, 7, 8, 9 or 10. Also (i) nucleic acid molecule having a sequence with an identity of 80% or more to any of the sequences as defined by SEQ ID NO: 6 to 24, preferably, the identity is 85% or more, more preferably the identity is 90% or more, even more preferably, the identity is 95% or more, 96% or more, 97% or more, 98% or more or 99% or more, in the most preferred embodiment, the identity is 100% to any of the sequences as defined by SEQ ID NO: 6 to 24 or (ii) a fragment of 100 bases or more consecutive bases, preferably 150 or more consecutive bases, more preferably 200 consecutive bases or more even more preferably 250 or more consecutive bases of a nucleic acid molecule of i) or ii) which has an expressing enhancing activity, for example 65% or more, preferably 70% or more, more preferably 75% or more, even more preferably 80% or more, 85% or more or 90% or more, in a most preferred embodiment it has 95% or more of the expression enhancing activity as the corresponding nucleic acid molecule having the sequence of any of the sequences as defined by SEQ ID NO: 6 to 24, or iii) a nucleic acid molecule which is the complement or reverse complement of any of the previously mentioned nucleic acid molecules under i) to ii) or iv) a nucleic acid molecule which is obtainable by PCR using oligonucleotide primers as shown in Table 6 or v) a nucleic acid molecule of 100 nucleotides or more, 150 nucleotides or more, 200 nucleotides or more or 250 nucleotides or more, hybridizing under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50.degree. C. with washing in 2.times.SSC, 0.1% SDS at 50.degree. C. or 65.degree. C., preferably 65.degree. C. to a nucleic acid molecule comprising at least 50, preferably at least 100, more preferably at least 150, even more preferably at least 200, most preferably at least 250 consecutive nucleotides of a transcription enhancing nucleotide sequence described by SEQ ID NO: 6 to 24 or the complement thereof are encompassed by the present invention. Preferably, said nucleic acid molecule is hybridizing under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50.degree. C. with washing in 1.times.SSC, 0.1% SDS at 50.degree. C. or 65.degree. C., preferably 65.degree. C. to a nucleic acid molecule comprising at least 50, preferably at least 100, more preferably at least 150, even more preferably at least 200, most preferably at least 250 consecutive nucleotides of a transcription enhancing nucleotide sequence described by SEQ ID NO: 6 to 24 or the complement thereof, more preferably, said nucleic acid molecule is hybridizing under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50.degree. C. with washing in 0.1.times.SSC, 0.1% SDS at 50.degree. C. or 65.degree. C., preferably 65.degree. C. to a nucleic acid molecule comprising at least 50, preferably at least 100, more preferably at least 150, even more preferably at least 200, most preferably at least 250 consecutive nucleotides of a transcription enhancing nucleotide sequence described by any of the sequences as defined by SEQ ID NO:1 to 15 or the complement thereof.

As described above under iv) the nucleic acid molecule obtainable by PCR using oligonucleotides shown in table 6 is obtainable for example from genomic DNA from Arabidopsis plants such as A. thaliana using the conditions as described in Example 3.2 below.

Preferably, the one or more NEENA is functionally linked to seed-specific promoters and will enhance expression of the nucleic acid molecule under control of said promoter. Seed-specific promoters to be used in any method of the invention may be derived from plants, for example monocotyledonous or dicotyledonous plants, from bacteria and/or viruses or may be synthetic promoters. Seed specific promoters to be used functionally linked to a NEENA are in a preferred embodiment the seed-specific promoter linked to NEENAs shown in SEQ ID NOs: 1, 2, 3, 4 or 5, table 5.

The high expression seed-specific promoters functionally linked to a NEENA may be employed in any plant comprising for example moss, fern, gymnosperm or angiosperm, for example monocotyledonous or dicotyledonous plant. In a preferred embodiment said promoter of the invention functionally linked to a NEENA may be employed in monocotyledonous or dicotyledonous plants, preferably crop plant such as corn, soy, canola, cotton, potato, sugar beet, rice, wheat, sorghum, barley, musa, sugarcane, miscanthus and the like. In a preferred embodiment of the invention, said promoter which is functionally linked to a NEENA may be employed in monocotyledonous crop plants such as corn, rice, wheat, sorghum, barley, musa, miscanthus or sugarcane. In an especially preferred embodiment the promoter functionally linked to a NEENA may be employed in dicotyledonous crop plants such as soy, canola, cotton or potato.

A high expressing seed-specific promoter as used in the application means for example a promoter which is functionally linked to a NEENA causing enhanced seed-specific expression of the promoter in a plant seed or part thereof wherein the accumulation of RNA or rate of synthesis of RNA in seeds derived from the nucleic acid molecule under the control of the respective promoter functionally linked to a NEENA is higher, preferably significantly higher than the expression in seeds caused by the same promoter lacking a NEENA of the invention. Preferably the amount of RNA of the respective nucleic acid and/or the rate of RNA synthesis and/or the RNA stability in a plant is increased 50% or more, for example 100% or more, preferably 200% or more, more preferably 5 fold or more, even more preferably 10 fold or more, most preferably 20 fold or more for example 50 fold compared to a control plant of same age grown under the same conditions comprising the same seed-specific promoter the latter not being functionally linked to a NEENA of the invention.

When used herein, significantly higher refers to statistical significance the skilled person is aware how to determine, for example by applying statistical tests such as the t-test to the respective data sets.

Methods for detecting expression conferred by a promoter are known in the art. For example, the promoter may be functionally linked to a marker gene such as GUS, GFP or luciferase and the activity of the respective protein encoded by the respective marker gene may be determined in the plant or part thereof. As a representative example, the method for detecting luciferase is described in detail below. Other methods are for example measuring the steady state level or synthesis rate of RNA of the nucleic acid molecule controlled by the promoter by methods known in the art, for example Northern blot analysis, qPCR, run-on assays or other methods described in the art, or detecting the encoded protein using specific antibodies by methods known in the art, e.g. Western Blot and/or enzyme-linked immunosorbent assay (ELISA).

A skilled person is aware of various methods for functionally linking two or more nucleic acid molecules. Such methods may encompass restriction/ligation, ligase independent cloning, recombineering, recombination or synthesis. Other methods may be employed to functionally link two or more nucleic acid molecules.

The term "heterologous" with respect to a nucleic acid molecule or DNA refers to a nucleic acid molecule which is operably linked to, or is manipulated to become operably linked to, a second nucleic acid molecule to which it is not operably linked in nature, or to which it is operably linked at a different location in nature. For example, a NEENA of the invention is in its natural environment functionally linked to its native promoter, whereas in the present invention it is linked to another promoter which might be derived from the same organism, a different organism or might be a synthetic promoter. It may also mean that the NEENA of the present invention is linked to its native promoter but the nucleic acid molecule under control of said promoter is heterologous to the promoter comprising its native NEENA. It is in addition to be understood that the promoter and/or the nucleic acid molecule under the control of said promoter functionally linked to a NEENA of the invention are heterologous to said NEENA as their sequence has been manipulated by for example mutation such as insertions, deletions and the forth so that the natural sequence of the promoter and/or the nucleic acid molecule under control of said promoter is modified and therefore have become heterologous to a NEENA of the invention. It may also be understood that the NEENA is heterologous to the nucleic acid to which it is functionally linked when the NEENA is functionally linked to its native promoter wherein the position of the NEENA in relation to said promoter is changed so that the promoter shows higher expression after such manipulation.

A plant exhibiting enhanced seed-specific expression of a nucleic acid molecule as meant herein means a plant having a higher, preferably statistically significant higher seed-specific expression of a nucleic acid molecule compared to a control plant grown under the same conditions without the respective NEENA functionally linked to the respective nucleic acid molecule. Such control plant may be a wild-type plant or a transgenic plant comprising the same promoter controlling the same gene as in the plant of the invention wherein the promoter is not linked to a NEENA of the invention.

In generally the NEENA may be heterologous to the nucleic acid molecule which is under the control of said promoter to which the NEENA is functionally linked or it may be heterologous to both the promoter and the nucleic acid molecule under the control of said promoter.

The term "elongase activity" as meant by the present invention refers to the activity of the entire elongation complex as defined in the passage below and it is also be understood as the activity of the first component of the elongation complex with beta-ketoacyl-CoA synthase activity, which determines the substrate specificity of the entire elongation complex. By understanding the elongase activity as synthase activity only, the polypeptide of the of the present invention needs also comprising: e) at least one nucleic acid sequence encoding a polypeptide having beta-ketoacyl reductase activity; f) at least one nucleic acid sequence encoding a polypeptide having dehydratase activity or g) at least one nucleic acid sequence encoding a polypeptide having enoyl-CoA reductase activity, wherein the nucleic acid sequences defined in e) to g) are heterologous to said polypeptide having desaturase or elongase activity.

Preferably, the polynucleotide of the present invention comprises nucleic acid sequence encoding fatty acid dehydratase-/enoyl-CoA reductase (nECR) protein having an activity of catalyzing the dehydration and reduction of fatty acid elongated intermediates.

Fatty acid elongation is catalyzed in four steps, represented by four enzymes: KCR (.beta.-keto-acyl-CoA-synthase), KCR (.beta.-keto-acyl-CoA reductase), DH (dehydratase) and ECR (enoyl-CoA-reductase) forming the entire elongation complex. In the first step a fatty acid-CoA ester is condensed with malonyl-CoA producing a .beta.-keto-acyl-CoA intermediate, which is elongated by to carbon atoms, and CO.sub.2. The keto-group of the intermediate is then reduced by the KCR to a hydroxyl-group. In the next step the DH cleaves of the hydroxyl-group (H.sub.2O is produced), forming a 2-acylen-CoA ester. In the final step the double bound at position 2, 3 is reduced by the ECR forming the elongated acyl-CoA ester (Buchanan, Gruissem, Jones (2000) Biochemistry & Molecular biology of plants, American Society of Plant Physiologists). DH and ECR activity might also be confered by one single protein being a natural or artificial fusion of a DH-moiety and a ECR moiety, referred to as novel enoyl-CoA-reductase (nECR) in the present invention. In the current invention either all nucleic acid sequences defined in e) to f) could be comprised in the polynucleotide or only at least one of these nucleic acid sequences defined in e) to f) could be comprised in the polynucleotide in any combination occurred from different organisms.

A polynucleotide comprising a fragment of any of the aforementioned nucleic acid sequences is also encompassed as a nucleic acid molecule of the present invention. The fragment shall encode a polypeptide which still has nECR activity as specified above. Accordingly, the polypeptide may comprise or consist of the domains of the polypeptide of the present invention conferring the said biological activity. A fragment as meant herein, preferably, comprises at least 15, at least 20, at least 50, at least 100, at least 250 or at least 500 consecutive nucleotides of any one of the aforementioned nucleic acid sequences or encodes an amino acid sequence comprising at least 5, at least 10, at least 20, at least 30, at least 50, at least 80, at least 100 or at least 150 consecutive amino acids of any one of the aforementioned amino acid sequences.

The variant nucleic acid molecule or fragments referred to above, preferably, encode polypeptides retaining at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the nECR activity exhibited by the polypeptide encoded by the nucleotide sequences.

The term "polynucleotide" as used in accordance with the present invention also relates to a polynucleotide comprising a nucleic acid sequence which encodes a polypeptide having acyltransferase activity. Preferably, the polypeptide encoded by the polynucleotide of the present invention having acyltransferase activity upon expression in a plant shall be capable of increasing the amount of PUFA and, in particular, LCPUFA esterified to triglycerides in, e.g., seed oils or the entire plant or parts thereof. Such an increase is, preferably, statistically significant when compared to a LCPUFA producing transgenic control plant which expresses the minimal set of desaturases and elongases required for LCPUFA synthesis but does not express the polynucleotide of the present invention. Such a transgenic plant may, preferably, express desaturases and elongases comprised by the vector LJB765 listed in table 11 of example 5 in WO2009/016202 or a similar set of desaturases and elongases required for DHA synthesis. Whether an increase is significant can be determined by statistical tests well known in the art including, e.g., Student's t-test. More preferably, the increase is an increase of the amount of triglycerides containing LCPUFA of at least 5%, at least 10%, at least 15%, at least 20% or at least 30% compared to the said control. Preferably, the LCPUFA referred to before is a polyunsaturated fatty acid having a C-20, C-22 or C24 fatty acid body, more preferably, EPA or DHA, most preferably, DHA. Suitable assays for measuring the activities mentioned before are described in the accompanying Examples. Variant nucleic acid molecules as referred above may be obtained by various natural as well as artificial sources. For example, nucleic acid molecules may be obtained by in vitro and in vivo mutagenesis approaches using the above mentioned specific nucleic acid molecules as a basis. Moreover, nucleic acid molecules being homologs or orthologs may be obtained from various animal, plant or fungus species. Preferably, they are obtained from plants such as algae, for example Isochrysis, Mantoniella, Ostreococcus or Crypthecodinium, algae/diatoms such as Phaeodactylum, Thalassiosira or Thraustochytrium, mosses such as Physcomitrella or Ceratodon, or higher plants such as the Primulaceae such as Aleuritia, Calendula stellate, Osteospermum spinescens or Osteospermum hyoseroides, microorganisms such as fungi, such as Aspergillus, Phytophthora, Entomophthora, Mucor or Mortierella, bacteria such as Shewanella, yeasts or animals. Preferred animals are nematodes such as Caenorhabditis, insects or vertebrates. Among the vertebrates, the nucleic acid molecules may, preferably, be derived from Euteleostomi, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus, more preferably, from the order of the Salmoniformes, most preferably, the family of the Salmonidae, such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario. Moreover, the nucleic acid molecules may be obtained from the diatoms such as the genera Thallasiosira or Phaeodactylum.

Thus the present invention also relates to a polynucleotide comprising at least one nucleic acid sequence encoding a polypeptide having acyltransferase activity additionally to the abovementioned polypeptides exhibit desaturase, elongase orbeta-ketoacyl reductase, dehydratase or enoyl-CoA reductase activity. Therefore the polynucleotide of the present invention also comprising at least one nucleic acid sequence encoding a polypeptide having acyltransferase activity, wherein the nucleic acid sequence is heterologous to said polypeptide having desaturase, elongase, beta-ketoacyl reductase, dehydratase or enoyl-CoA reductase activity and wherein at least one seed-specific plant promoter and at least one terminator sequence are operatively linked to the said nucleic acid sequence and wherein one or more nucleic acid expression enhancing nucleic acid (NEENA) molecule is/are functionally linked to said promoter and which is/are heterologous to said promoter.

The term "acyltransferase activity" or "acyltransferase" as used herein encompasses all enymatic activities and enzymes which are capable of transferring or are involved in the transfer of PUFA and, in particular; LCPUFA from the acly-CoA pool or the membrane phospholipids to the triglycerides, from the acyl-CoA pool to membrane lipids and from membrane lipids to the acyl-CoA pool by a transesterification process. It will be understood that this acyltransferase activity will result in an increase of the LCPUFA esterified to triglycerides in, e.g., seed oils. In particular, it is envisaged that these acyltransferases are capable of producing triglycerides having esterified EPA or even DHA, or that these acyltransferases are capable of enhancing synthesis of desired PUFA by increasing the flux for specific intermediates of the desired PUFA between the acyl-CoA pool (the site of elongation) and membrane lipids (the predominant site of desaturation). Specifically, acyltransferase activity as used herein pertains to lysophospholipid acyltransferase (LPLAT) activity, preferably, lysophosphatidylcholine acyltransferase (LPCAT) or Lysophosphophatidylethanolamine acyltransferase (LPEAT) activity, lysophosphosphatidic acid acyltransferase (LPAAT) activity, phospholipid:diacylglycerol acyltransferase (PDAT) activity, glycerol-3-phosphate acyltransferase (GPAT) activity or diacylglycerol acyltransferase (DGAT), and, more preferably, to PLAT, LPAAT, DGAT, PDAT or GPAT activity.

A polynucleotide encoding a polypeptide having a acyltransferase activity as specified above could be obtained for example from Phythophthora infestance. Polynucleotides encoding a polypeptide having desaturase or elongase activity as specified above could be obtained in accordance with the present invention from Thraustochytrium ssp. for example. Preferred acyltransferases which shall be present in the host cell are at least one enzyme selected from the group consisting of: LPLATs, LPAATs, DGATs, PDATs and GPATs. Especially preferred are the LPLATs LPLAT(Ce) from Caenorhabditis elegans (WO2004076617), LPCAT(Ms) from Mantoniella squamata (WO2006069936) and LPCAT(Ot) from Ostreococcus tauri (WO2006069936), pLPLAT_01332(Pi) (SEQ-ID No.:104 encoding the polypeptide SEQ-ID No.:125) pLPLAT_01330(Pi) (SEQ-ID No.:105 encoding the polypeptide SEQ-ID No.:126), pLPLAT_07077(Pi) (SEQ-ID No.:106 encoding the polypeptide SEQ-ID No.:127), LPLAT_18374(Pi) (SEQ-ID No.:107 encoding the polypeptide SEQ-ID No.:128), pLPLAT_14816(Pi) (SEQ-ID No.:108 encoding the polypeptide SEQ-ID No.:129), LPCAT_02075(Pi) (SEQ-ID No.:111 encoding the polypeptide SEQ-ID No.:132), pLPAAT_06638(Pi) (SEQ-ID No.:112 encoding the polypeptide SEQ-ID No.:133) form Phytophthora infestance, the LPAATs LPAAT(Ma)1.1 from Mortierella alpina (WO2004087902), LPAAT(Ma)1.2 from Mortierella alpina (WO2004087902), the LPAAT_13842(Pi) (SEQ-ID No.:109 encoding the polypeptide SEQ-ID No.:130), pLPAAT_10763(Pi) (SEQ-ID No.:110 encoding the polypeptide SEQ-ID No.:131) from Phytophthora infestance, the DGATs DGAT2(Cc) from Crypthecodinium cohnii (WO2004087902), pDGAT1_12278(Pi) (SEQ-ID No.:113 encoding the polypeptide SEQ-ID No.:134), DGAT2_03074(Pi) (SEQ-ID No.:114 encoding the polypeptide SEQ-ID No.:135), pDGAT2_08467(Pi) (SEQ-ID No.:115 encoding the polypeptide SEQ-ID No.:136), DGAT2_08470(Pi) (SEQ-ID No.:116 encoding the polypeptide SEQ-ID No.:137), pDGAT2_03835-mod(Pi) (SEQ-ID No.:117 encoding the polypeptide SEQ-ID No.:138), DGAT2_11677-mod(Pi) (SEQ-ID No.:118 encoding the polypeptide SEQ-ID No.:139), DGAT2_08432-mod(Pi) (SEQ-ID No.:119 encoding the polypeptide SEQ-ID No.:140), pDGAT2_08431(Pi) (SEQ-ID No.:120 encoding the polypeptide SEQ-ID No.:141), DGAT_13152-mod(Pi) (SEQ-ID No.:121 encoding the polypeptide SEQ-ID No.:142), the PDAT pPDAT_11965-mod(Pi) (SEQ-ID No.:122 encoding the polypeptide SEQ-ID No.:143) and the GPATs pGPAT-PITG_18707 (SEQ-ID No.:123 encoding the polypeptide SEQ-ID No.:144) and pGPAT-PITG_03371 (SEQ-ID No.:124 encoding the polypeptide SEQ-ID No.:145).

However, orthologs, paralogs or other homologs may be identified from other species. Preferably, they are obtained from plants such as algae, for example Isochrysis, Mantoniella, Ostreococcus or Crypthecodinium, algae/diatoms such as Phaeodactylum or Thalassiosira or Thraustochytrium, mosses such as Physcomitrella or Ceratodon, or higher plants such as the Primulaceae such as Aleuritia, Calendula stellata, Osteospermum spinescens or Osteospermum hyoseroides, microorganisms such as fungi, such as Aspergillus, Phytophthora, Entomophthora, Mucor or Mortierella, bacteria such as Shewanella, yeasts or animals. Preferred animals are nematodes such as Caenorhabditis, insects or vertebrates. Among the vertebrates, the nucleic acid molecules may, preferably, be derived from Euteleostomi, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus, more preferably, from the order of the Salmoniformes, most preferably, the family of the Salmonidae, such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario. Moreover, the nucleic acid molecules may be obtained from the diatoms such as the genera Thallasiosira or Phaeodactylum.

Thus, the term "polynucleotide" as used in accordance with the present invention further encompasses variants of the aforementioned specific polynucleotides representing orthologs, paralogs or other homologs of the polynucleotide of the present invention. Moreover, variants of the polynucleotide of the present invention also include artificially generated muteins. Said muteins include, e.g., enzymes which are generated by mutagenesis techniques and which exhibit improved or altered substrate specificity, or codon optimized polynucleotides. The polynucleotide variants, preferably, comprise a nucleic acid sequence characterized in that the sequence can be derived from the aforementioned specific nucleic acid sequences shown in any one of SEQ ID NOs: 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 or 124 by a polynucleotide encoding a polypeptide having an amino acid sequence (i.e. as shown in any one of SEQ ID NOs: 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144 or 145 as for acyltransferases) by at least one nucleotide substitution, addition and/or deletion, whereby the variant nucleic acid sequence shall still encode a polypeptide having a desaturase or elongase activity as specified above. Variants also encompass polynucleotides comprising a nucleic acid sequence which is capable of hybridizing to the aforementioned specific nucleic acid sequences, preferably, under stringent hybridization conditions. These stringent conditions are known to the skilled worker and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1-6.3.6. A preferred example for stringent hybridization conditions are hybridization conditions in 6.times. sodium chloride/sodium citrate (=SSC) at approximately 45.degree. C., followed by one or more wash steps in 0.2.times.SSC, 0.1% SDS at 50 to 65.degree. C. The skilled worker knows that these hybridization conditions differ depending on the type of nucleic acid and, for example when organic solvents are present, with regard to the temperature and concentration of the buffer. For example, under "standard hybridization conditions" the temperature differs depending on the type of nucleic acid between 42.degree. C. and 58.degree. C. in aqueous buffer with a concentration of 0.1 to 5.times.SSC (pH 7.2). If organic solvent is present in the abovementioned buffer, for example 50% formamide, the temperature under standard conditions is approximately 42.degree. C. The hybridization conditions for DNA: DNA hybrids are, preferably, 0.1.times.SSC and 20.degree. C. to 45.degree. C., preferably between 30.degree. C. and 45.degree. C. The hybridization conditions for DNA:RNA hybrids are, preferably, 0.1.times.SSC and 30.degree. C. to 55.degree. C., preferably between 45.degree. C. and 55.degree. C. The abovementioned hybridization temperatures are determined for example for a nucleic acid with approximately 100 bp (=base pairs) in length and a G+C content of 50% in the absence of formamide. The skilled worker knows how to determine the hybridization conditions required by referring to textbooks such as the textbook mentioned above, or the following textbooks: Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach", IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach", IRL Press at Oxford University Press, Oxford. Alternatively, polynucleotide variants are obtainable by PCR-based techniques such as mixed oligonucleotide primer-based amplification of DNA, i.e. using degenerated primers against conserved domains of the polypeptides of the present invention. Conserved domains of the polypeptide of the present invention may be identified by a sequence comparison of the nucleic acid sequences of the polynucleotides or the amino acid sequences of the polypeptides of the present invention. Oligonucleotides suitable as PCR primers as well as suitable PCR conditions are described in the accompanying Examples. As a template, DNA or cDNA from bacteria, fungi, plants or animals may be used. Further, variants include polynucleotides comprising nucleic acid sequences which are at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequences shown in any one of SEQ ID NOs: 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 or 124 preferably, encoding polypeptides retaining a desaturase, elongase, or acyltransferase activity as specified above. Moreover, also encompassed are polynucleotides which comprise nucleic acid sequences encoding a polypeptide having an amino acid sequences which are at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequences encoded by the nucleic acid sequences shown in any one of SEQ ID NOs: 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 or 124 (i.e. as shown in any one of SEQ ID NOs: 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144 or 145 as for acyltransferases), wherein the polypeptide, preferably, retains desaturase, elongase or acyltransferase activity as specified above. The percent identity values are, preferably, calculated over the entire amino acid or nucleic acid sequence region. A series of programs based on a variety of algorithms is available to the skilled worker for comparing different sequences. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (Needleman 1970, J. Mol. Biol. (48):444-453) which has been incorporated into the needle program in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice, P., Longden, I., and Bleasby, A, Trends in Genetics 16(6), 276-277, 2000), using either a BLOSUM 45 or PAM250 scoring matrix for distantly related proteins, or either a BLOSUM 62 or PAM160 scoring matrix for closer related proteins, and a gap opening penalty of 16, 14, 12, 10, 8, 6, or 4 and a gap entension pentalty of 0.5, 1, 2, 3, 4, 5, or 6. Guides for local installation of the EMBOSS package as well as links to WEB-Services can be found at emboss.sourceforge.net. A preferred, non-limiting example of parameters to be used for aligning two amino acid sequences using the needle program are the default parameters, including the EBLOSUM62 scoring matrix, a gap opening penalty of 10 and a gap extension penalty of 0.5. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the needle program in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice, P., Longden, I., and Bleasby, A, Trends in Genetics 16(6), 276-277, 2000), using the EDNAFULL scoring matrix and a gap opening penalty of 16, 14, 12, 10, 8, 6, or 4 and a gap extension penalty of 0.5, 1, 2, 3, 4, 5, or 6. A preferred, non-limiting example of parameters to be used in conjunction for aligning two amino acid sequences using the needle program are the default parameters, including the EDNAFULL scoring matrix, a gap opening penalty of 10 and a gap extension penalty of 0.5. The nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the BLAST series of programs (version 2.2) of Altschul et al. (Altschul 1990, J. Mol. Biol. 215:403-10). BLAST using nucleic acid sequences of the invention as query sequence can be performed with the BLASTn, BLASTx or the tBLASTx program using default parameters to obtain either nucleotide sequences (BLASTn, tBLASTx) or amino acid sequences (BLASTx) homologous to sequences encoded by the nucleic acid sequences of the invention. BLAST using protein sequences encoded by the nucleic acid sequences of the invention as query sequence can be performed with the BLASTp or the tBLASTn program using default parameters to obtain either amino acid sequences (BLASTp) or nucleic acid sequences (tBLASTn) homologous to sequences of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST using default parameters can be utilized as described in Altschul et al. (Altschul 1997, Nucleic Acids Res. 25(17):3389-3402).

The following block diagram shows the relation of sequence types of querry and hit sequences for various BLASt programs

TABLE-US-00001 Input query Converted Converted Actual sequence Query Algorithm Hit Database DNA BLASTn DNA PRT BLASTp PRT DNA PRT BLASTx PRT PRT tBLASTn PRT DNA DNA PRT tBLASTx PRT DNA

A polynucleotide comprising a fragment of any of the aforementioned nucleic acid sequences is also encompassed as a polynucleotide of the present invention. The fragment shall encode a polypeptide which still has desaturase and elongase activity as specified above. Accordingly, the polypeptide may comprise or consist of the domains of the polypeptide of the present invention conferring the said biological activity. A fragment as meant herein, preferably, comprises at least 50, at least 100, at least 250 or at least 500 consecutive nucleotides of any one of the aforementioned nucleic acid sequences or encodes an amino acid sequence comprising at least 20, at least 30, at least 50, at least 80, at least 100 or at least 150 consecutive amino acids of any one of the aforementioned amino acid sequences.

The variant polynucleotides or fragments referred to above, preferably, encode polypeptides retaining desaturase or elongase activity to a significant extent, preferably, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the desaturase and elongase activity exhibited by any of the polypeptide encoded by the nucleic acid sequences shown in any one of SEQ ID NOs: 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 or 124 (i.e. as shown in any one of SEQ ID NOs: 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144 or 145 as for acyltransferases). The activity may be tested as described in the accompanying Examples.

The polynucleotides of the present invention either essentially consist of the aforementioned nucleic acid sequences or comprise the aforementioned nucleic acid sequences. Thus, they may contain further nucleic acid sequences as well. Preferably, the polynucleotide of the present invention may comprise in addition to an open reading frame further untranslated sequence at the 3' and at the 5' terminus of the coding gene region: at least 500, preferably 200, more preferably 100 nucleotides of the sequence upstream of the 5' terminus of the coding region and at least 100, preferably 50, more preferably 20 nucleotides of the sequence downstream of the 3' terminus of the coding gene region. Furthermore, the polynucleotides of the present invention may encode fusion proteins wherein one partner of the fusion protein is a polypeptide being encoded by a nucleic acid sequence recited above. Such fusion proteins may comprise as additional part other enzymes of the fatty acid or PUFA biosynthesis pathways, polypeptides for monitoring expression (e.g., green, yellow, blue or red fluorescent proteins, alkaline phosphatase and the like) or so called "tags" which may serve as a detectable marker or as an auxiliary measure for purification purposes. Tags for the different purposes are well known in the art and comprise FLAG-tags, 6-histidine-tags, MYC-tags and the like.

The polynucleotide of the present invention shall be provided, preferably, either as an isolated polynucleotide (i.e. purified or at least isolated from its natural context such as its natural gene locus) or in genetically modified or exogenously (i.e. artificially) manipulated form. An isolated polynucleotide can, for example, comprise less than approximately 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived. The polynucleotide, preferably, is provided in the form of double or single stranded molecule. It will be understood that the present invention by referring to any of the aforementioned polynucleotides of the invention also refers to complementary or reverse complementary strands of the specific sequences or variants thereof referred to before. The polynucleotide encompasses DNA, including cDNA and genomic DNA, or RNA polynucleotides.

However, the present invention also pertains to polynucleotide variants which are derived from the polynucleotides of the present invention and are capable of interfering with the transcription or translation of the polynucleotides of the present invention. Such variant polynucleotides include anti-sense nucleic acids, ribozymes, siRNA molecules, morpholino nucleic acids (phosphorodiamidate morpholino oligos), triple-helix forming oligonucleotides, inhibitory oligonucleotides, or micro RNA molecules all of which shall specifically recognize the polynucleotide of the invention due to the presence of complementary or substantially complementary sequences. These techniques are well known to the skilled artisan. Suitable variant polynucleotides of the aforementioned kind can be readily designed based on the structure of the polynucleotides of this invention.

Moreover, comprised are also chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificial modified ones such as biotinylated polynucleotides.

In a preferred embodiment of the polynucleotide of the present invention, said polynucleotide further comprises an expression control sequence operatively linked to the said nucleic acid sequence.

The term "expression control sequence" as used herein refers to a nucleic acid sequence which is capable of governing, i.e. initiating and controlling, transcription of a nucleic acid sequence of interest, in the present case the nucleic sequences recited above. Such a sequence usually comprises or consists of a promoter or a combination of a promoter and enhancer sequences. Expression of a polynucleotide comprises transcription of the nucleic acid molecule, preferably, into a translatable mRNA. Additional regulatory elements may include transcriptional as well as translational enhancers. The following promoters and expression control sequences may be, preferably, used in an expression vector according to the present invention. The cos, tac, trp, tet, trp-tet, Ipp, lac, Ipp-lac, lacIq, T7, T5, T3, gal, trc, ara, SP6, .lamda.-PR or .lamda.-PL promoters are, preferably, used in Gram-negative bacteria. For Gram-positive bacteria, promoters amy and SPO2 may be used. From yeast or fungal promoters ADC1, AOX1r, GAL1, MF.alpha., AC, P-60, CYC1, GAPDH, TEF, rp28, ADH are, preferably, used. For animal cell or organism expression, the promoters CMV-, SV40-, RSV-promoter (Rous sarcoma virus), CMV-enhancer, SV40-enhancer are preferably used. From plants the promoters CaMV/35S (Franck 1980, Cell 21: 285-294], PRP1 (Ward 1993, Plant. Mol. Biol. 22), SSU, OCS, lib4, usp, STLS1, B33, nos or the ubiquitin or phaseolin promoter. Also preferred in this context are inducible promoters, such as the promoters described in EP 0 388 186 A1 (i.e. a benzylsulfonamide-inducible promoter), Gatz 1992, Plant J. 2:397-404 (i.e. a tetracyclin-inducible promoter), EP 0 335 528 A1 (i.e. a abscisic-acid-inducible promoter) or WO 93/21334 (i.e. a ethanol- or cyclohexenol-inducible promoter). Further suitable plant promoters are the promoter of cytosolic FBPase or the ST-LSI promoter from potato (Stockhaus 1989, EMBO J. 8, 2445), the phosphoribosyl-pyrophosphate amidotransferase promoter from Glycine max (Genbank accession No. U87999) or the node-specific promoter described in EP 0 249 676 A1. Particularly preferred are promoters which enable the expression in tissues which are involved in the biosynthesis of fatty acids. Also particularly preferred are seed-specific promoters such as the USP promoter in accordance with the practice, but also other promoters such as the LeB4, DC3, phaseolin or napin promoters. Further especially preferred promoters are seed-specific promoters which can be used for monocotyledonous or dicotyledonous plants and which are described in U.S. Pat. No. 5,608,152 (napin promoter from oilseed rape), WO 98/45461 (oleosin promoter from Arobidopsis, U.S. Pat. No. 5,504,200 (phaseolin promoter from Phaseolus vulgaris), WO 91/13980 (Bce4 promoter from Brassica), by Baeumlein et al., Plant J., 2, 2, 1992:233-239 (LeB4 promoter from a legume), these promoters being suitable for dicots. The following promoters are suitable for monocots: Ipt-2 or Ipt-1 promoter from barley (WO 95/15389 and WO 95/23230), hordein promoter from barley and other promoters which are suitable and which are described in WO 99/16890. In principle, it is possible to use all natural promoters together with their regulatory sequences, such as those mentioned above, for the novel process. Likewise, it is possible and advantageous to use synthetic promoters, either additionally or alone, especially when they mediate a seed-specific expression, such as, for example, as described in WO 99/16890. In a particular embodiment, seed-specific promoters are utilized to enhance the production of the desired PUFA or LCPUFA. In a preferred embodiment of the present invention promoters encoded by the nucleic acid sequences shown in any one of SEQ ID NOs: 25, 26, 27, 28, 29 or 30 are used.

The term "operatively linked" as used herein means that the expression control sequence and the nucleic acid of interest are linked so that the expression of the said nucleic acid of interest can be governed by the said expression control sequence, i.e. the expression control sequence shall be functionally linked to the said nucleic acid sequence to be expressed. Accordingly, the expression control sequence and, the nucleic acid sequence to be expressed may be physically linked to each other, e.g., by inserting the expression control sequence at the 5''end of the nucleic acid sequence to be expressed. Alternatively, the expression control sequence and the nucleic acid to be expressed may be merely in physical proximity so that the expression control sequence is capable of governing the expression of at least one nucleic acid sequence of interest. The expression control sequence and the nucleic acid to be expressed are, preferably, separated by not more than 500 bp, 300 bp, 100 bp, 80 bp, 60 bp, 40 bp, 20 bp, 10 bp or 5 bp.

In a further preferred embodiment of the polynucleotide of the present invention, said polynucleotide further comprises a terminator sequence operatively linked to the nucleic acid sequence. Preferably used terminators are encoded by the nucleotide sequences shown in SEQ ID NOs: 36 or 37. More preferably used terminators are encoded by the nucleotide sequences shown in SEQ ID NOs: 31, 32, 33, 34 or 35

The term "terminator" as used herein refers to a nucleic acid sequence which is capable of terminating transcription. These sequences will cause dissociation of the transcription machinery from the nucleic acid sequence to be transcribed. Preferably, the terminator shall be active in plants and, in particular, in plant seeds. Suitable terminators are known in the art and, preferably, include polyadenylation signals such as the SV40-poly-A site or the tk-poly-A site or one of the plant specific signals indicated in Loke et al. (Loke 2005, Plant Physiol 138, pp. 1457-1468), downstream of the nucleic acid sequence to be expressed.

The present invention also relates to a vector comprising the polynucleotide of the present invention.

The term "vector", preferably, encompasses phage, plasmid, viral vectors as well as artificial chromosomes, such as bacterial or yeast artificial chromosomes. Moreover, the term also relates to targeting constructs which allow for random or site-directed integration of the targeting construct into genomic DNA. Such target constructs, preferably, comprise DNA of sufficient length for either homolgous or heterologous recombination as described in detail below. The vector encompassing the polynucleotide of the present invention, preferably, further comprises selectable markers for propagation and/or selection in a host. The vector may be incorporated into a host cell by various techniques well known in the art. If introduced into a host cell, the vector may reside in the cytoplasm or may be incorporated into the genome. In the latter case, it is to be understood that the vector may further comprise nucleic acid sequences which allow for homologous recombination or heterologous insertion. Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. The terms "transformation" and "transfection", conjugation and transduction, as used in the present context, are intended to comprise a multiplicity of prior-art processes for introducing foreign nucleic acid (for example DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, carbon-based clusters, chemically mediated transfer, electroporation or particle bombardment. Suitable methods for the transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, Ed.: Gartland and Davey, Humana Press, Totowa, N.J. Alternatively, a plasmid vector may be introduced by heat shock or electroporation techniques. Should the vector be a virus, it may be packaged in vitro using an appropriate packaging cell line prior to application to host cells.

Preferably, the vector referred to herein (VC-LJBXXX) is suitable as a cloning vector, i.e. replicable in microbial systems. Such vectors ensure efficient cloning in bacteria and, preferably, yeasts or fungi and make possible the stable transformation of plants. Those which must be mentioned are, in particular, various binary and co-integrated vector systems which are suitable for the T-DNA-mediated transformation. Such vector systems are, as a rule, characterized in that they contain at least the vir genes, which are required for the Agrobacterium-mediated transformation, and the sequences which delimit the T-DNA (T-DNA border). These vector systems, preferably, also comprise further cis-regulatory regions such as promoters and terminators and/or selection markers with which suitable transformed host cells or organisms can be identified. While co-integrated vector systems have vir genes and T-DNA sequences arranged on the same vector, binary systems are based on at least two vectors, one of which bears vir genes, but no T-DNA, while a second one bears T-DNA, but no vir gene. As a consequence, the last-mentioned vectors are relatively small, easy to manipulate and can be replicated both in E. coli and in Agrobacterium. These binary vectors include vectors from the pBIB-HYG, pPZP, pBecks, pGreen series. Preferably used in accordance with the invention are Bin19, pBI101, pBinAR, pGPTV and pCAMBIA. An overview of binary vectors and their use can be found in Hellens et al, Trends in Plant Science (2000) 5, 446-451. Furthermore, by using appropriate cloning vectors, the polynucleotides can be introduced into host cells or organisms such as plants or animals and, thus, be used in the transformation of plants, such as those which are published, and cited, in: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Fla.), chapter 6/7, pp. 71-119 (1993); F. F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus 1991, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42, 205-225.

More preferably, the vector of the present invention is an expression vector. In such an expression vector, i.e. a vector which comprises the polynucleotide of the invention having the nucleic acid sequence operatively linked to an expression control sequence (also called "expression cassette") allowing expression in prokaryotic or eukaryotic cells or isolated fractions thereof. Suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL). Further examples of typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.), where glutathione S-transferase (GST), maltose E-binding protein and protein A, respectively, are fused with the recombinant target protein. Examples of suitable inducible nonfusion E. coli expression vectors are, inter alia, pTrc (Amann 1988, Gene 69:301-315) and pET 11d (Studier 1990, Methods in Enzymology 185, 60-89). The target gene expression of the pTrc vector is based on the transcription from a hybrid trp-lac fusion promoter by host RNA polymerase. The target gene expression from the pET 11d vector is based on the transcription of a T7-gn10-lac fusion promoter, which is mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from a resident 2-prophage which harbors a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter. The skilled worker is familiar with other vectors which are suitable in prokaryotic organisms; these vectors are, for example, in E. coli, pLG338, pACYC184, the pBR series such as pBR322, the pUC series such as pUC18 or pUC19, the M113 mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, .lamda.gt11 or pBdCI, in Streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667. Examples of vectors for expression in the yeast S. cerevisiae comprise pYep Sec1 (Baldari 1987, Embo J. 6:229-234), pMFa (Kurjan 1982, Cell 30:933-943), pJRY88 (Schultz 1987, Gene 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, Calif.). Vectors and processes for the construction of vectors which are suitable for use in other fungi, such as the filamentous fungi, comprise those which are described in detail in: van den Hondel, C.A.M.J.J., & Punt, P. J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of fungi, J. F. Peberdy et al., Ed., pp. 1-28, Cambridge University Press: Cambridge, or in: More Gene Manipulations in Fungi (J. W. Bennett & L. L. Lasure, Ed., pp. 396-428: Academic Press: San Diego). Further suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23. As an alternative, the polynucleotides of the present invention can be also expressed in insect cells using baculovirus expression vectors. Baculovirus vectors which are available for the expression of proteins in cultured insect cells (for example Sf9 cells) comprise the pAc series (Smith 1983, Mol. Cell. Biol. 3:2156-2165) and the pVL series (Lucklow 1989, Virology 170:31-39).

The abovementioned vectors are only a small overview of vectors to be used in accordance with the present invention. Further vectors are known to the skilled worker and are described, for example, in: Cloning Vectors (Ed., Pouwels, P. H., et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). For further suitable expression systems for prokaryotic and eukaryotic cells see the chapters 16 and 17 of Sambrook, loc cit.

It follows from the above that, preferably, said vector is an expression vector. More preferably, the said polynucleotide of the present invention is under the control of a seed-specific promoter in the vector of the present invention. A preferred seed-specific promoter as meant herein is selected from the group consisting of Conlinin 1, Conlinin 2, napin, LuFad3, USP, LeB4, Arc, Fae, ACP, LuPXR, and SBP. For details, see, e.g., US 2003-0159174.

The polynucleotide of the present invention can be expressed in single-cell plant cells (such as algae), see Falciatore 1999, Marine Biotechnology 1 (3):239-251 and the references cited therein, and plant cells from higher plants (for example Spermatophytes, such as arable crops) by using plant expression vectors. Examples of plant expression vectors comprise those which are described in detail in: Becker 1992, Plant Mol. Biol. 20:1195-1197; Bevan 1984, Nucl. Acids Res. 12:8711-8721; Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, p. 15-38. A plant expression cassette, preferably, comprises regulatory sequences which are capable of controlling the gene expression in plant cells and which are functionally linked so that each sequence can fulfill its function, such as transcriptional termination, for example polyadenylation signals. Preferred polyadenylation signals are those which are derived from Agrobacterium tumefaciens T-DNA, such as the gene 3 of the Ti plasmid pTiACH5, which is known as octopine synthase (Gielen 1984, EMBO J. 3, 835) or functional equivalents of these, but all other terminators which are functionally active in plants are also suitable. Since plant gene expression is very often not limited to transcriptional levels, a plant expression cassette preferably comprises other functionally linked sequences such as translation enhancers, for example the overdrive sequence, which comprises the 5'-untranslated tobacco mosaic virus leader sequence, which increases the protein/RNA ratio (Gallie 1987, Nucl. Acids Research 15:8693-8711). As described above, plant gene expression must be functionally linked to a suitable promoter which performs the expression of the gene in a timely, cell-specific or tissue-specific manner. Promoters which can be used are constitutive promoters (Benfey 1989, EMBO J. 8:2195-2202) such as those which are derived from plant viruses such as 35S CAMV (Franck 1980, Cell 21:285-294), 19S CaMV (see U.S. Pat. No. 5,352,605 and WO 84/02913) or plant promoters such as the promoter of the Rubisco small subunit, which is described in U.S. Pat. No. 4,962,028. Other preferred sequences for the use in functional linkage in plant gene expression cassettes are targeting sequences which are required for targeting the gene product into its relevant cell compartment (for a review, see Kermode 1996, Crit. Rev. Plant Sci. 15, 4: 285-423 and references cited therein), for example into the vacuole, the nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, the extracellular space, the mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant cells. As described above, plant gene expression can also be facilitated via a chemically inducible promoter (for a review, see Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically inducible promoters are particularly suitable if it is desired that genes are expressed in a time-specific manner. Examples of such promoters are a salicylic-acid-inducible promoter (WO 95/19443), a tetracyclin-inducible promoter (Gatz 1992, Plant J. 2, 397-404) and an ethanol-inducible promoter. Promoters which respond to biotic or abiotic stress conditions are also suitable promoters, for example the pathogen-induced PRP1-gene promoter (Ward 1993, Plant Mol. Biol. 22:361-366), the heat-inducible hsp80 promoter from tomato (U.S. Pat. No. 5,187,267), the cold-inducible alpha-amylase promoter from potato (WO 96/12814) or the wound-inducible pinII promoter (EP 0 375 091 A). The promoters which are especially preferred are those which bring about the expression of genes in tissues and organs in which fatty acid, lipid and oil biosynthesis takes place, in seed cells such as the cells of endosperm and of the developing embryo. Suitable promoters are the napin gene promoter from oilseed rape (U.S. Pat. No. 5,608,152), the USP promoter from Vicia faba (Baeumlein 1991, Mol. Gen. Genet. 225 (3):459-67), the oleosin promoter from Arabidopsis (WO 98/45461), the phaseolin promoter from Phaseolus vulgaris (U.S. Pat. No. 5,504,200), the Bce4 promoter from Brassica (WO 91/13980) or the legumin B4 promoter (LeB4; Baeumlein 1992, Plant Journal, 2 (2):233-9), and promoters which bring about the seed-specific expression in monocotyledonous plants such as maize, barley, wheat, rye, rice and the like. Suitable promoters to be taken into consideration are the Ipt2 or Ipt1 gene promoter from barley (WO 95/15389 and WO 95/23230) or those which are described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene). Likewise, especially suitable are promoters which bring about the plastid-specific expression since plastids are the compartment in which the precursors and some end products of lipid biosynthesis are synthesized. Suitable promoters such as the viral RNA-polymerase promoter, are described in WO 95/16783 and WO 97/06250, and the clpP promoter from Arabidopsis, described in WO 99/46394.

Moreover, the present invention relates to a host cell comprising the polynucleotide or the vector of the present invention. The term "host cell" is also meant as "host cell culture".

Preferably, said host cell is a plant cell or plant cell culture and, more preferably, a plant cell obtained from an oilseed crop. More preferably, said oilseed crop is selected from the group consisting of flax (Linum sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower (Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive (Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa), peanut (Arachis sp.), hemp, camelina, crambe, oil palm, coconuts, groundnuts, sesame seed, castor bean, lesquerella, tallow tree, sheanuts, tungnuts, kapok fruit, poppy seed, jojoba seeds and perilla.

Also preferably, said host cell is a microorganism. More preferably, said microorganism is a bacterium, a fungus or algae. More preferably, it is selected from the group consisting of Candida, Cryptococcus, Lipomyces, Rhodosporidium, Yarrowia and Schizochytrium.

Moreover, a host cell host cell culture according to the present invention may also be an animal cell. Preferably, said animal host cell is a host cell of a fish or a cell line obtained therefrom. More preferably, the fish host cell is from herring, salmon, sardine, redfish, eel, carp, trout, halibut, mackerel, zander or tuna.

Generally, the controlling steps in the production of LCPUFAs, i.e., the long chain unsaturated fatty acid biosynthetic pathway, are catalyzed by membrane-associated fatty acid desaturases and elongases. Plants and most other eukaryotic organisms have specialized desaturase and elongase systems for the introduction of double bonds and the extension of fatty acids beyond C18 atoms. The elongase reactions have several important features in common with the fatty acid synthase complex (FAS). However, the elongase complex is different from the FAS complex as the complex is localized in the cytosol and membrane bound, ACP is not involved and the elongase 3-keto-acyl-CoA-synthase catalyzes the condensation of malonyl-CoA with an acyl primer. The elongase complex consists of four components with different catalytic functions, the keto-acyl-synthase (condensation reaction of malonyl-CoA to acyl-CoA, creation of a 2 C atom longer keto-acyl-CoA fatty acid), the keto-acyl-reductase (reduction of the 3-keto group to a 3-hydroxy-group), the dehydratase (dehydration results in a 3-enoyl-acyl-CoA fatty acid) and the enoly-CoA-reductase (reduction of the double bond at position 3, release from the complex). For the production of LCPUFAs including ARA, EPA and/or DHA the elongation reactions, beside the desaturation reactions, are essential. Higher plants do not have the necessary enzyme set to produce LCPUFAs (4 or more double bonds, 20 or more C atoms). Therefore the catalytic activities have to be conferred to the plants or plant cells. The polynucleotides of the present invention catalyze the desaturation and elongation activities necessary for the formation of ARA, EPA and/or DHA. By delivering the novel desaturases and elongases increased levels of PUFAs and LCPUFAs are produced.

However, person skilled in the art knows that dependent on the host cell, further, enzymatic activities may be conferred to the host cells, e.g., by recombinant technologies. Accordingly, the present invention, preferably, envisages a host cell which in addition to the polynucleotide of the present invention comprises polynucleotides encoding such desaturases and/or elongases as required depending on the selected host cell. Preferred desaturases and/or elongases which shall be present in the host cell are at least one enzyme selected from the group consisting of: .DELTA.-4-desaturase, .DELTA.-5-desaturase, .DELTA.-5-elongase, .DELTA.-6-desaturase, .DELTA.12-desaturase, 415-desaturase, .omega.3-desaturase and .DELTA.-6-elongase. Especially preferred are the bifunctional d12d15-Desaturases d12d15Des(Ac) from Acanthamoeba castellanii (WO2007042510), d12d15Des(Cp) from Claviceps purpurea (WO2008006202) and d12d15Des(Lg)1 from Lottia gigantea (WO2009016202), the d12-Desaturases d12Des(Co) from Calendula officinalis (WO200185968), d12Des(Lb) from Laccaria bicolor (WO2009016202), d12Des(Mb) from Monosiga brevicollis (WO2009016202), d12Des(Mg) from Mycosphaerella graminicola (WO2009016202), d12Des(Nh) from Nectria haematococca (WO2009016202), d12Des(Ol) from Ostreococcus lucimarinus (WO2008040787), d12Des(Pb) from Phycomyces blakesleeanus (WO2009016202), d12Des(Ps) from Phytophthora sojae (WO2006100241) and d12Des(Tp) from Thalassiosira pseudonana (WO2006069710), the d15-Desaturases d15Des(Hr) from Helobdella robusta (WO2009016202), d15Des(Mc) from Microcoleus chthonoplastes (WO2009016202), d15Des(Mf) from Mycosphaerella fijiensis (WO2009016202), d15Des(Mg) from Mycosphaerella graminicola (WO2009016202) and d15Des(Nh)2 from Nectria haematococca (WO2009016202), the d4-Desaturases d4Des(Eg) from Euglena gracilis (WO2004090123), d4Des(Tc) from Thraustochytrium sp. (WO2002026946) and d4Des(Tp) from Thalassiosira pseudonana (WO2006069710), the d5-Desaturases d5Des(Ol)2 from Ostreococcus lucimarinus (WO2008040787), d5Des(Pp) from Physcomitrella patens (WO2004057001), d5Des(Pt) from Phaeodactylum tricornutum (WO2002057465), d5Des(Tc) from Thraustochytrium sp. (WO2002026946), d5Des(Tp) from Thalassiosira pseudonana (WO2006069710) and the d6-Desaturases d6Des(Cp) from Ceratodon purpureus (WO2000075341), d6Des(Ol) from Ostreococcus lucimarinus (WO2008040787), d6Des(Ot) from Ostreococcus tauri (WO2006069710), d6Des(Pf) from Primula farinosa (WO2003072784), d6Des(Pir)_BO from Pythium irregulare (WO2002026946), d6Des(Pir) from Pythium irregulare (WO2002026946), d6Des(Plu) from Primula luteola (WO2003072784), d6Des(Pp) from Physcomitrella patens (WO200102591), d6Des(Pt) from Phaeodactylum tricornutum (WO2002057465), d6Des(Pv) from Primula vialii (WO2003072784) and d6Des(Tp) from Thalassiosira pseudonana (WO2006069710), the d8-Desaturases d8Des(Ac) from Acanthamoeba castellanii (EP1790731), d8Des(Eg) from Euglena gracilis (WO200034439) and d8Des(Pm) from Perkinsus marinus (WO2007093776), the o3-Desaturases o3Des(Pi) from Phytophthora infestans (WO2005083053), o3Des(Pir) from Pythium irregulare (WO2008022963), o3Des(Pir)2 from Pythium irregulare (WO2008022963) and o3Des(Ps) from Phytophthora sojae (WO2006100241), the bifunctional d5d6-elongases d5d6Elo(Om)2 from Oncorhynchus mykiss (WO2005012316), d5d6Elo(Ta) from Thraustochytrium aureum (WO2005012316) and d5d6Elo(Tc) from Thraustochytrium sp. (WO2005012316), the d5-elongases d5Elo(At) from Arabidopsis thaliana (WO2005012316), d5Elo(At)2 from Arabidopsis thaliana (WO2005012316), d5Elo(Ci) from Ciona intestinalis (WO2005012316), d5Elo(Ol) from Ostreococcus lucimarinus (WO2008040787), d5Elo(Ot) from Ostreococcus tauri (WO2005012316), d5Elo(Tp) from Thalassiosira pseudonana (WO2005012316) and d5Elo(Xl) from Xenopus laevis (WO2005012316), the d6-elongases d6Elo(Ol) from Ostreococcus lucimarinus (WO2008040787), d6Elo(Ot) from Ostreococcus tauri (WO2005012316), d6Elo(Pi) from Phytophthora infestans (WO2003064638), d6Elo(Pir) from Pythium irregulare (WO2009016208), d6Elo(Pp) from Physcomitrella patens (WO2001059128), d6Elo(Ps) from Phytophthora sojae (WO2006100241), d6Elo(Ps)2 from Phytophthora sojae (WO2006100241), d6Elo(Ps)3 from Phytophthora sojae (WO2006100241), d6Elo(Pt) from Phaeodactylum tricornutum (WO2005012316), d6Elo(Tc) from Thraustochytrium sp. (WO2005012316) and d6Elo(Tp) from Thalassiosira pseudonana (WO2005012316), the d9-elongases d9Elo(Ig) from Isochrysis galbana (WO2002077213), d9Elo(Pm) from Perkinsus marinus (WO2007093776) and d9Elo(Ro) from Rhizopus oryzae (WO2009016208). Particularly, if the manufacture of ARA is envisaged in higher plants, the enzymes recited in Table 3, below (i.e. additionally a d6-desaturase, d6-elongase, d5-elongase, d5-desaturase, d12-desaturase, and d6-elongase) or enzymes having essentially the same activity may be combined in a host cell. If the manufacture of EPA is envisaged in higher plants, the enzymes having additionally a d6-desaturase, d6-elongase, d5-desaturase, d12-desaturase, d6-elongase, omega 3-desaturase and d15-desaturase, or enzymes having essentially the same activity may be combined in a host cell. If the manufacture of DHA is envisaged in higher plants, the enzymes having additionally a d6-desaturase, d6-elongase, d5-desaturase, d12-desaturase, d6-elongase, omega 3-desaturase, d15-desaturase, d5-elongase, and d4-desaturase activity, or enzymes having essentially the same activity may be combined in a host cell.

The present invention also relates to a cell, preferably a host cell as specified above or a cell of a non-human organism specified elsewhere herein, said cell comprising a polynucleotide which is obtained from the polynucleotide of the present invention by a point mutation, a truncation, an inversion, a deletion, an addition, a substitution and homologous recombination. How to carry out such modifications to a polynucleotide is well known to the skilled artisan and has been described elsewhere in this specification in detail.

The present invention furthermore pertains to a method for the manufacture of a polypeptide encoded by a polynucleotide of any the present invention comprising a) cultivating the host cell of the invention under conditions which allow for the production of the said polypeptide; and b) obtaining the polypeptide from the host cell of step a).

Suitable conditions which allow for expression of the polynucleotide of the invention comprised by the host cell depend on the host cell as well as the expression control sequence used for governing expression of the said polynucleotide. These conditions and how to select them are very well known to those skilled in the art. The expressed polypeptide may be obtained, for example, by all conventional purification techniques including affinity chromatography, size exclusion chromatography, high pressure liquid chromatography (HPLC) and precipitation techniques including antibody precipitation. It is to be understood that the method may--although preferred--not necessarily yield an essentially pure preparation of the polypeptide. It is to be understood that depending on the host cell which is used for the aforementioned method, the polypeptides produced thereby may become posttranslationally modified or processed otherwise.

The present invention also encompasses a polypeptide encoded by the polynucleotide of the present invention or which is obtainable by the aforementioned method.

The term "polypeptide" as used herein encompasses essentially purified polypeptides or polypeptide preparations comprising other proteins in addition. Further, the term also relates to the fusion proteins or polypeptide fragments being at least partially encoded by the polynucleotide of the present invention referred to above. Moreover, it includes chemically modified polypeptides. Such modifications may be artificial modifications or naturally occurring modifications such as phosphorylation, glycosylation, myristylation and the like (Review in Mann 2003, Nat. Biotechnol. 21, 255-261, review with focus on plants in Huber 2004, Curr. Opin. Plant Biol. 7, 318-322). Currently, more than 300 posttranslational modifications are known (see full ABFRC Delta mass list at abrforg/index.cfm/dm.home). The polypeptides of the present invention shall exhibit the desaturase or elongase activitiy referred to above.

Moreover, the present invention contemplates a non-human transgenic organism comprising the polynucleotide or the vector of the present invention.

Preferably, the non-human transgenic organism is a plant or a plant part. Preferred plants to be used for introducing the polynucleotide or the vector of the invention are plants which are capable of synthesizing fatty acids, such as all dicotyledonous or monocotyledonous plants, algae or mosses. It is to be understood that host cells derived from a plant may also be used for producing a plant according to the present invention. Preferred plant parts are seeds from the plants. Preferred plants are selected from the group of the plant families Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminosae, Linaceae, Prasinophyceae or vegetable plants or ornamentals such as Tagetes. Examples which may be mentioned are the following plants selected from the group consisting of: Adelotheciaceae such as the genera Physcomitrella, such as the genus and species Physcomitrella patens, Anacardiaceae such as the genera Pistacia, Mangifera, Anacardium, for example the genus and species Pistacia vera [pistachio], Mangifer indica [mango] or Anacardium occidentale [cashew], Asteraceae, such as the genera Calendula, Carthamus, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta, Tagetes, Valeriana, for example the genus and species Calendula officinalis [common marigold], Carthamus tinctorius [safflower], Centaurea cyanus [cornflower], Cichorium intybus [chicory], Cynara scolymus [artichoke], Helianthus annus [sunflower], Lactuca sativa, Lactuca crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa, Lactuca scariola L. var. integrate, Lactuca scariola L. var. integrifolia, Lactuca sativa subsp. romana, Locusta communis, Valeriana locusta [salad vegetables], Tagetes lucida, Tagetes erecta or Tagetes tenuifolia [african or french marigold], Apiaceae, such as the genus Daucus, for example the genus and species Daucus carota [carrot], Betulaceae, such as the genus Corylus, for example the genera and species Corylus avellana or Corylus colurna [hazelnut], Boraginaceae, such as the genus Borago, for example the genus and species Borago officinalis [borage], Brassicaceae, such as the genera Brassica, Melanosinapis, Sinapis, Arabadopsis, for example the genera and species Brassica napus, Brassica rapa ssp. [oilseed rape], Sinapis arvensis Brassica juncea, Brassica juncea var. juncea, Brassica juncea var. crispifolia, Brassica juncea var. foliosa, Brassica nigra, Brassica sinapioides, Melanosinapis communis [mustard], Brassica oleracea [fodder beet] or Arabidopsis thaliana, Bromeliaceae, such as the genera Anana, Bromelia (pineapple), for example the genera and species Anana comosus, Ananas ananas or Bromelia comosa [pineapple], Caricaceae, such as the genus Carica, such as the genus and species Carica papaya [pawpaw], Cannabaceae, such as the genus Cannabis, such as the genus and species Cannabis sativa [hemp], Convolvulaceae, such as the genera Ipomea, Convolvulus, for example the genera and species Ipomoea batatus, Ipomoea pandurata, Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, Ipomoea triloba or Convolvulus panduratus [sweet potato, batate], Chenopodiaceae, such as the genus Beta, such as the genera and species Beta vulgaris, Beta vulgaris var. altissima, Beta vulgaris var. Vulgaris, Beta maritima, Beta vulgaris var. perennis, Beta vulgaris var. conditiva or Beta vulgaris var. esculenta [sugarbeet], Crypthecodiniaceae, such as the genus Crypthecodinium, for example the genus and species Cryptecodinium cohnii, Cucurbitaceae, such as the genus Cucurbita, for example the genera and species Cucurbita maxima, Cucurbita mixta, Cucurbita pepo or Cucurbita moschata [pumpkin/squash], Cymbellaceae such as the genera Amphora, Cymbella, Okedenia, Phaeodactylum, Reimeria, for example the genus and species Phaeodactylum tricornutum, Ditrichaceae such as the genera Ditrichaceae, Astomiopsis, Ceratodon, Chrysoblastella, Ditrichum, Distichium, Eccremidium, Lophidion, Philibertiella, Pleuridium, Saelania, Trichodon, Skottsbergia, for example the genera and species Ceratodon antarcticus, Ceratodon columbiae, Ceratodon heterophyllus, Ceratodon purpureus, Ceratodon purpureus, Ceratodon purpureus ssp. convolutus, Ceratodon, purpureus spp. stenocarpus, Ceratodon purpureus var. rotundifolius, Ceratodon ratodon, Ceratodon stenocarpus, Chrysoblastella chilensis, Ditrichum ambiguum, Ditrichum brevisetum, Ditrichum crispatissimum, Ditrichum difficile, Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum giganteum, Ditrichum heteromallum, Ditrichum lineare, Ditrichum lineare, Ditrichum montanum, Ditrichum montanum, Ditrichum pallidum, Ditrichum punctulatum, Ditrichum pusillum, Ditrichum pusillum var. tortile, Ditrichum rhynchostegium, Ditrichum schimperi, Ditrichum tortile, Distichium capillaceum, Distichium hagenii, Distichium inclinatum, Distichium macounii, Eccremidium floridanum, Eccremidium whiteleggei, Lophidion strictus, Pleuridium acuminatum, Pleuridium alternifolium, Pleuridium holdridgei, Pleuridium mexicanum, Pleuridium ravenelii, Pleuridium subulatum, Saelania glaucescens, Trichodon borealis, Trichodon cylindricus or Trichodon cylindricus var. oblongus, Elaeagnaceae such as the genus Elaeagnus, for example the genus and species Olea europaea [olive], Ericaceae such as the genus Kalmia, for example the genera and species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla, Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or Kalmia lucida [mountain laurel], Euphorbiaceae such as the genera Manihot, Janipha, Jatropha, Ricinus, for example the genera and species Manihot utilissima, Janipha manihot, Jatropha manihot, Manihot aipil, Manihot dulcis, Manihot manihot, Manihot melanobasis, Manihot esculenta [manihot] or Ricinus communis [castor-oil plant], Fabaceae such as the genera Pisum, Albizia, Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa, Medicajo, Glycine, Dolichos, Phaseolus, Soja, for example the genera and species Pisum sativum, Pisum arvense, Pisum humile [pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, Acacia lebbeck, Acacia macrophylla, Albizia lebbek, Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa [silk tree], Medicago sativa, Medicago falcata, Medicago varia [alfalfa], Glycine max Dolichos soja, Glycine gracilis, Glycine hispida, Phaseolus max, Soja hispida or Soja max [soybean], Funariaceae such as the genera Aphanorrhegma, Entosthodon, Funaria, Physcomitrella, Physcomitrium, for example the genera and species Aphanorrhegma serratum, Entosthodon attenuatus, Entosthodon bolanderi, Entosthodon bonplandii, Entosthodon californicus, Entosthodon drummondii, Entosthodon jamesonii, Entosthodon leibergii, Entosthodon neoscoticus, Entosthodon rubrisetus, Entosthodon spathulifolius, Entosthodon tucsoni, Funaria americana, Funaria bolanderi, Funaria calcarea, Funaria californica, Funaria calvescens, Funaria convoluta, Funaria flavicans, Funaria groutiana, Funaria hygrometrica, Funaria hygrometrica var. arctica, Funaria hygrometrica var. calvescens, Funaria hygrometrica var. convoluta, Funaria hygrometrica var. muralis, Funaria hygrometrica var. utahensis, Funaria microstoma, Funaria microstoma var. obtusifolia, Funaria muhlenbergii, Funaria orcuttii, Funaria plano-convexa, Funaria polaris, Funaria ravenelii, Funaria rubriseta, Funaria serrata, Funaria sonorae, Funaria sublimbatus, Funaria tucsoni, Physcomitrella californica, Physcomitrella patens, Physcomitrella readeri, Physcomitrium australe, Physcomitrium californicum, Physcomitrium collenchymatum, Physcomitrium coloradense, Physcomitrium cupuliferum, Physcomitrium drummondii, Physcomitrium eurystomum, Physcomitrium flexifolium, Physcomitrium hookeri, Physcomitrium hookeri var. serratum, Physcomitrium immersum, Physcomitrium kellermanii, Physcomitrium megalocarpum, Physcomitrium pyriforme, Physcomitrium pyriforme var. serratum, Physcomitrium rufipes, Physcomitrium sandbergii, Physcomitrium subsphaericum, Physcomitrium washingtoniense, Geraniaceae, such as the genera Pelargonium, Cocos, Oleum, for example the genera and species Cocos nucifera, Pelargonium grossularioides or Oleum cocois [coconut], Gramineae, such as the genus Saccharum, for example the genus and species Saccharum officinarum, Juglandaceae, such as the genera Juglans, Wallia, for example the genera and species Juglans regia, Juglans ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia cinerea, Juglans bixbyi, Juglans californica, Juglans hindsii, Juglans intermedia, Juglans jamaicensis, Juglans major, Juglans microcarpa, Juglans nigra or Wallia nigra [walnut], Lauraceae, such as the genera Persea, Laurus, for example the genera and species Laurus nobilis [bay], Persea americana, Persea gratissima or Persea persea [avocado], Leguminosae, such as the genus Arachis, for example the genus and species Arachis hypogaea [peanut], Linaceae, such as the genera Linum, Adenolinum, for example the genera and species Linum usitatissimum, Linum humile, Linum austriacum, Linum bienne, Linum angustifolium, Linum catharticum, Linum flavum, Linum grandiflorum, Adenolinum grandiflorum, Linum lewisii, Linum narbonense, Linum perenne, Linum perenne var. lewisii, Linum pratense or Linum trigynum [linseed], Lythrarieae, such as the genus Punica, for example the genus and species Punica granatum [pomegranate], Malvaceae, such as the genus Gossypium, for example the genera and species Gossypium hirsutum, Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum or Gossypium thurberi [cotton], Marchantiaceae, such as the genus Marchantia, for example the genera and species Marchantia berteroana, Marchantia foliacea, Marchantia macropora, Musaceae, such as the genus Musa, for example the genera and species Musa nana, Musa acuminata, Musa paradisiaca, Musa spp. [banana], Onagraceae, such as the genera Camissonia, Oenothera, for example the genera and species Oenothera biennis or Camissonia brevipes [evening primrose], Palmae, such as the genus Elacis, for example the genus and species Elaeis guineensis [oil palm], Papaveraceae, such as the genus Papaver, for example the genera and species Papaver orientale, Papaver rhoeas, Papaver dubium [poppy], Pedaliaceae, such as the genus Sesamum, for example the genus and species Sesamum indicum [sesame], Piperaceae, such as the genera Piper, Artanthe, Peperomia, Steffensia, for example the genera and species Piper aduncum, Piper amalago, Piper angustifolium, Piper auritum, Piper betel, Piper cubeba, Piper longum, Piper nigrum, Piper retrofractum, Artanthe adunca, Artanthe elongata, Peperomia elongata, Piper elongatum, Steffensia elongata [cayenne pepper], Poaceae, such as the genera Hordeum, Secale, Avena, Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea (maize), Triticum, for example the genera and species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon, Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregulare, Hordeum sativum, Hordeum secalinum [barley], Secale cereale [rye], Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida [oats], Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum miliaceum, Panicum militaceum [millet], Oryza sativa, Oryza latifolia [rice], Zea mays [maize], Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare [wheat], Porphyridiaceae, such as the genera Chroothece, Flintiella, Petrovanella, Porphyridium, Rhodella, Rhodosorus, Vanhoeffenia, for example the genus and species Porphyridium cruentum, Proteaceae, such as the genus Macadamia, for example the genus and species Macadamia intergrifolia [macadamia], Prasinophyceae such as the genera Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, for example the genera and species Nephroselmis olivacea, Prasinococcus capsulatus, Scherffelia dubia, Tetraselmis chui, Tetraselmis suecica, Mantoniella squamata, Ostreococcus tauri, Rubiaceae such as the genus Cofea, for example the genera and species Cofea spp., Coffea arabica, Coffea canephora or Coffea liberica [coffee], Scrophulariaceae such as the genus Verbascum, for example the genera and species Verbascum blattaria, Verbascum chaixii, Verbascum densiflorum, Verbascum lagurus, Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum, Verbascum olympicum, Verbascum phlomoides, Verbascum phoenicum, Verbascum pulverulentum or Verbascum thapsus [mullein], Solanaceae such as the genera Capsicum, Nicotiana, Solanum, Lycopersicon, for example the genera and species Capsicum annuum, Capsicum annuum var. glabriusculum, Capsicum frutescens [pepper], Capsicum annuum [paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana attenuata, Nicotiana glauca, Nicotiana langsdorffii, Nicotiana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana rustica, Nicotiana sylvestris [tobacco], Solanum tuberosum [potato], Solanum melongena [eggplant], Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme, Solanum integrifolium or Solanum lycopersicum [tomato], Sterculiaceae, such as the genus Theobroma, for example the genus and species Theobroma cacao [cacao] or Theaceae, such as the genus Camellia, for example the genus and species Camellia sinensis [tea]. In particular preferred plants to be used as transgenic plants in accordance with the present invention are oil fruit crops which comprise large amounts of lipid compounds, such as peanut, oilseed rape, canola, sunflower, safflower, poppy, mustard, hemp, castor-oil plant, olive, sesame, Calendula, Punica, evening primrose, mullein, thistle, wild roses, hazelnut, almond, macadamia, avocado, bay, pumpkin/squash, linseed, soybean, pistachios, borage, trees (oil palm, coconut, walnut) or crops such as maize, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa or bushy plants (coffee, cacao, tea), Salix species, and perennial grasses and fodder crops. Preferred plants according to the invention are oil crop plants such as peanut, oilseed rape, canola, sunflower, safflower, poppy, mustard, hemp, castor-oil plant, olive, Calendula, Punica, evening primrose, pumpkin/squash, linseed, soybean, borage, trees (oil palm, coconut). Especially preferred are sunflower, safflower, tobacco, mullein, sesame, cotton, pumpkin/squash, poppy, evening primrose, walnut, linseed, hemp, thistle or safflower. Very especially preferred plants are plants such as safflower, sunflower, poppy, evening primrose, walnut, linseed, or hemp.

Preferred mosses are Physcomitrella or Ceratodon. Preferred algae are Isochrysis, Mantoniella, Ostreococcus or Crypthecodinium, and algae/diatoms such as Phaeodactylum or Thraustochytrium. More preferably, said algae or mosses are selected from the group consisting of: Emiliana, Shewanella, Physcomitrella, Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Isochrysis, Aleurita, Muscarioides, Mortierella, Phaeodactylum, Cryphthecodinium, specifically from the genera and species Thallasiosira pseudonona, Euglena gracilis, Physcomitrella patens, Phytophtora infestans, Fusarium graminaeum, Cryptocodinium cohnii, Ceratodon purpureus, Isochrysis galbana, Aleurita farinosa, Thraustochytrium sp., Muscarioides viallii, Mortierella alpina, Phaeodactylum tricornutum or Caenorhabditis elegans or especially advantageously Phytophtora infestans, Thallasiosira pseudonona and Cryptocodinium cohnii.

Transgenic plants may be obtained by transformation techniques as elsewhere in this specification. Preferably, transgenic plants can be obtained by T-DNA-mediated transformation. Such vector systems are, as a rule, characterized in that they contain at least the vir genes, which are required for the Agrobacterium-mediated transformation, and the sequences which delimit the T-DNA (T-DNA border). Suitable vectors are described elsewhere in the specification in detail.

Also encompassed are transgenic non-human animals comprising the vector or polynucleotide of the present invention. Preferred non-human transgenic animals envisaged by the present invention are fish, such as herring, salmon, sardine, redfish, eel, carp, trout, halibut, mackerel, zander or tuna.

However, it will be understood that dependent on the non-human transgenic organism specified above, further, enzymatic activities may be conferred to the said organism, e.g., by recombinant technologies. Accordingly, the present invention, preferably, envisages a non-human transgenic organism specified above which in addition to the polynucleotide of the present invention comprises polynucleotides encoding such desaturases and/or elongases as required depending on the selected host cell. Preferred desaturases and/or elongases which shall be present in the organism are at least one enzyme selected from the group of desaturases and/or elongases or the combinations specifically recited elsewhere in this specification (see above and Tables 3, 4 and 5).

Furthermore, the present invention encompasses a method for the manufacture of polyunsaturated fatty acids comprising: a) cultivating the host cell of the invention under conditions which allow for the production of polyunsaturated fatty acids in said host cell; b) obtaining said polyunsaturated fatty acids from the said host cell.

The term "polyunsaturated fatty acids (PUFA)" as used herein refers to fatty acids comprising at least two, preferably, three, four, five or six, double bonds. Moreover, it is to be understood that such fatty acids comprise, preferably from 18 to 24 carbon atoms in the fatty acid chain. More preferably, the term relates to long chain PUFA (LCPUFA) having from 20 to 24 carbon atoms in the fatty acid chain. Preferred unsaturated fatty acids in the sense of the present invention are selected from the group consisting of DGLA 20:3 (8,11,14), ARA 20:4 (5,8,11,14), iARA 20:4(8,11,14,17), EPA 20:5 (5,8,11,14,17), DPA 22:5 (4,7,10,13,16), DHA 22:6 (4,7,10,13,16,19), 20:4 (8,11,14,17), more preferably, arachidonic acid (ARA) 20:4 (5,8,11,14), eicosapentaenoic acid (EPA) 20:5 (5,8,11,14,17), and docosahexaenoic acid (DHA) 22:6 (4,7,10,13,16,19). Thus, it will be understood that most preferably, the methods provided by the present invention pertaining to the manufacture of ARA, EPA or DHA. Moreover, also encompassed are the intermediates of LCPUFA which occur during synthesis. Such intermediates are, preferably, formed from substrates by the desaturase or elongase activity of the polypeptides of the present invention. Preferably, substrates encompass LA 18:2 (9,12), ALA 18:3(9,12,15), Eicosadienoic acid 20:2 (11,14), Eicosatrienoic acid 20:3 (11,14,17)), DGLA 20:3 (8,11,14), ARA 20:4 (5,8,11,14), eicosatetraenoic acid 20:4 (8,11,14,17), Eicosapentaenoic acid 20:5 (5,8,11,14,17), Docosahexapentanoic acid 22:5 (7,10,13,16,19).

The term "cultivating" as used herein refers maintaining and growing the host cells under culture conditions which allow the cells to produce the said polyunsaturated fatty acid, i.e. the PUFA and/or LCPUFA referred to above. This implies that the polynucleotide of the present invention is expressed in the host cell so that the desaturase and/or elongase activity is present. Suitable culture conditions for cultivating the host cell are described in more detail below.

The term "obtaining" as used herein encompasses the provision of the cell culture including the host cells and the culture medium as well as the provision of purified or partially purified preparations thereof comprising the polyunsaturated fatty acids, preferably, ARA, EPA, DHA, in free or in -CoA bound form, as membrane phospholipids or as triacylglyceride estres. More preferably, the PUFA and LCPUFA are to be obtained as triglyceride esters, e.g., in form of an oil. More details on purification techniques can be found elsewhere herein below.

The host cells to be used in the method of the invention are grown or cultured in the manner with which the skilled worker is familiar, depending on the host organism. Usually, host cells are grown in a liquid medium comprising a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as salts of iron, manganese and magnesium and, if appropriate, vitamins, at temperatures of between 0.degree. C. and 100.degree. C., preferably between 10.degree. C. and 60.degree. C. under oxygen or anaerobic atmosphere dependent on the type of organism. The pH of the liquid medium can either be kept constant, that is to say regulated during the culturing period, or not. The cultures can be grown batchwise, semibatchwise or continuously. Nutrients can be provided at the beginning of the fermentation or administered semicontinuously or continuously: The produced PUFA or LCPUFA can be isolated from the host cells as described above by processes known to the skilled worker, e.g., by extraction, distillation, crystallization, if appropriate precipitation with salt, and/or chromatography. It might be required to disrupt the host cells prior to purification. To this end, the host cells can be disrupted beforehand. The culture medium to be used must suitably meet the requirements of the host cells in question. Descriptions of culture media for various microorganisms which can be used as host cells according to the present invention can be found in the textbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981). Culture media can also be obtained from various commercial suppliers. All media components are sterilized, either by heat or by filter sterilization. All media components may be present at the start of the cultivation or added continuously or batchwise, as desired. If the polynucleotide or vector of the invention which has been introduced in the host cell further comprises an expressible selection marker, such as an antibiotic resistance gene, it might be necessary to add a selection agent to the culture, such as a antibiotic in order to maintain the stability of the introduced polynucleotide. The culture is continued until formation of the desired product is at a maximum. This is normally achieved within 10 to 160 hours. The fermentation broths can be used directly or can be processed further. The biomass may, according to requirement, be removed completely or partially from the fermentation broth by separation methods such as, for example, centrifugation, filtration, decanting or a combination of these methods or be left completely in said broth. The fatty acid preparations obtained by the method of the invention, e.g., oils, comprising the desired PUFA or LCPUFA as triglyceride esters are also suitable as starting material for the chemical synthesis of further products of interest. For example, they can be used in combination with one another or alone for the preparation of pharmaceutical or cosmetic compositions, foodstuffs, or animal feeds. Chemically pure triglycerides comprising the desired PUFA or LCPUFA can also be manufactured by the methods described above. To this end, the fatty acid preparations are further purified by extraction, distillation, crystallization, chromatography or combinations of these methods. In order to release the fatty acid moieties from the triglycerides, hydrolysis may be also required. The said chemically pure triglycerides or free fatty acids are, in particular, suitable for applications in the food industry or for cosmetic and pharmacological compositions.

Moreover, the present invention relates to a method for the manufacture of poly-unsaturated fatty acids comprising: a) cultivating the non-human transgenic organism of the invention under conditions which allow for the production of poly-unsaturated fatty acids in said non-human transgenic organism; and b) obtaining said poly-unsaturated fatty acids from the said non-human transgenic organism.

Further, it follows from the above that a method for the manufacture of an oil, lipid or fatty acid composition is also envisaged by the present invention comprising the steps of any one of the aforementioned methods and the further step of formulating PUFA or LCPUFA as oil, lipid or fatty acid composition. Preferably, said oil, lipid or fatty acid composition is to be used for feed, foodstuffs, cosmetics or medicaments. Accordingly, the formulation of the PUFA or LCPUFA shall be carried out according to the GMP standards for the individual envisaged products. For example, an oil may be obtained from plant seeds by an oil mill. However, for product safety reasons, sterilization may be required under the applicable GMP standard. Similar standards will apply for lipid or fatty acid compositions to be applied in cosmetic or pharmaceutical compositions. All these measures for formulating oil, lipid or fatty acid compositions as products are comprised by the aforementioned manufacture.

The term "oil" refers to a fatty acid mixture comprising unsaturated and/or saturated fatty acids which are esterified to triglycerides. Preferably, the triglycerides in the oil of the invention comprise PUFA or LCPUFA as referred to above. The amount of esterified PUFA and/or LCPUFA is, preferably, approximately 30%, a content of 50% is more preferred, a content of 60%, 70%, 80% or more is even more preferred. The oil may further comprise free fatty acids, preferably, the PUFA and LCPUFA referred to above. For the analysis, the fatty acid content can be, e.g., determined by GC analysis after converting the fatty acids into the methyl esters by transesterification. The content of the various fatty acids in the oil or fat can vary, in particular depending on the source. The oil, however, shall have a non-naturally occurring composition with respect to the PUFA and/or LCPUFA composition and content. It will be understood that such a unique oil composition and the unique esterification pattern of PUFA and LCPUFA in the triglycerides of the oil shall only be obtainable by applying the methods of the present invention specified above. Moreover, the oil of the invention may comprise other molecular species as well. Specifically, it may comprise minor impurities of the polynucleotide or vector of the invention. Such impurities, however, can be detected only by highly sensitive techniques such as PCR.

Another embodiment is the use of the polynucleotide comprising NEENA or the recombinant vector comprising the polynucleotide with NEENA as defined above for enhancing expression of at least one enzyme of the polyunsaturated fatty acid biosynthetic pathway as defined in plants or parts thereof, in a more preferably embodiment the polynucleotide comprising NEENA or the recombinant vector comprising the polynucleotide with NEENA as defined above for enhancing expression of at least one enzyme of the polyunsaturated fatty acid biosynthetic pathway is used in plant seeds.

Another preferred embodiment is the use of a host cell or a host cell culture or of a non-human transgenic organism, transgenic plant, plant parts or plant seeds derived from the transgenic non-human organism or plant as described above for the production of foodstuffs, animal feeds, seeds, pharmaceuticals or fine chemicals.

DEFINITIONS

Abbreviations: NEENA--nucleic acid expression enhancing nucleic acid, GFP--green fluorescence protein, GUS--beta-Glucuronidase, BAP--6-benzylaminopurine; MS--Murashige and Skoog medium; Kan: Kanamycin sulfate; GA3--Gibberellic acid; microl: Microliter.

It is to be understood that this invention is not limited to the particular methodology or protocols. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a," "and," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a vector" is a reference to one or more vectors and includes equivalents thereof known to those skilled in the art, and so forth. The term "about" is used herein to mean approximately, roughly, around, or in the region of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20 percent, preferably 10 percent up or down (higher or lower). As used herein, the word "or" means any one member of a particular list and also includes any combination of members of that list. The words "comprise," "comprising," "include," "including," and "includes" when used in this specification and in the following claims are intended to specify the presence of one or more stated features, integers, components, or steps, but they do not preclude the presence or addition of one or more other features, integers, components, steps, or groups thereof. For clarity, certain terms used in the specification are defined and used as follows:

Antiparallel: "Antiparallel" refers herein to two nucleotide sequences paired through hydrogen bonds between complementary base residues with phosphodiester bonds running in the 5'-3' direction in one nucleotide sequence and in the 3'-5' direction in the other nucleotide sequence. Antisense: The term "antisense" refers to a nucleotide sequence that is inverted relative to its normal orientation for transcription or function and so expresses an RNA transcript that is complementary to a target gene mRNA molecule expressed within the host cell (e.g., it can hybridize to the target gene mRNA molecule or single stranded genomic DNA through Watson-Crick base pairing) or that is complementary to a target DNA molecule such as, for example genomic DNA present in the host cell. Coding region: As used herein the term "coding region" when used in reference to a structural gene refers to the nucleotide sequences which encode the amino acids found in the nascent polypeptide as a result of translation of a mRNA molecule. The coding region is bounded, in eukaryotes, on the 5'-side by the nucleotide triplet "ATG" which encodes the initiator methionine and on the 3'-side by one of the three triplets which specify stop codons (i.e., TAA, TAG, TGA). In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5'- and 3'-end of the sequences which are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the non-translated sequences present on the mRNA transcript). The 5'-flanking region may contain regulatory sequences such as promoters and enhancers which control or influence the transcription of the gene. The 3'-flanking region may contain sequences which direct the termination of transcription, post-transcriptional cleavage and polyadenylation. Complementary: "Complementary" or "complementarity" refers to two nucleotide sequences which comprise antiparallel nucleotide sequences capable of pairing with one another (by the base-pairing rules) upon formation of hydrogen bonds between the complementary base residues in the antiparallel nucleotide sequences. For example, the sequence 5'-AGT-3' is complementary to the sequence 5'-ACT-3'. Complementarity can be "partial" or "total." "Partial" complementarity is where one or more nucleic acid bases are not matched according to the base pairing rules. "Total" or "complete" complementarity between nucleic acid molecules is where each and every nucleic acid base is matched with another base under the base pairing rules. The degree of complementarity between nucleic acid molecule strands has significant effects on the efficiency and strength of hybridization between nucleic acid molecule strands. A "complement" of a nucleic acid sequence as used herein refers to a nucleotide sequence whose nucleic acid molecules show total complementarity to the nucleic acid molecules of the nucleic acid sequence. Double-stranded RNA: A "double-stranded RNA" molecule or "dsRNA" molecule comprises a sense RNA fragment of a nucleotide sequence and an antisense RNA fragment of the nucleotide sequence, which both comprise nucleotide sequences complementary to one another, thereby allowing the sense and antisense RNA fragments to pair and form a double-stranded RNA molecule. Endogenous: An "endogenous" nucleotide sequence refers to a nucleotide sequence, which is present in the genome of the untransformed plant cell. Enhanced expression: "enhance" or "increase" the expression of a nucleic acid molecule in a plant cell are used equivalently herein and mean that the level of expression of the nucleic acid molecule in a plant, part of a plant or plant cell after applying a method of the present invention is higher than its expression in the plant, part of the plant or plant cell before applying the method, or compared to a reference plant lacking a recombinant nucleic acid molecule of the invention. For example, the reference plant is comprising the same construct which is only lacking the respective NEENA. The term "enhanced" or "increased" as used herein are synonymous and means herein higher, preferably significantly higher expression of the nucleic acid molecule to be expressed. As used herein, an "enhancement" or "increase" of the level of an agent such as a protein, mRNA or RNA means that the level is increased relative to a substantially identical plant, part of a plant or plant cell grown under substantially identical conditions, lacking a recombinant nucleic acid molecule of the invention, for example lacking the NEENA molecule, the recombinant construct or recombinant vector of the invention. As used herein, "enhancement" or "increase" of the level of an agent, such as for example a preRNA, mRNA, rRNA, tRNA, snoRNA, snRNA expressed by the target gene and/or of the protein product encoded by it, means that the level is increased 50% or more, for example 100% or more, preferably 200% or more, more preferably 5 fold or more, even more preferably 10 fold or more, most preferably 20 fold or more for example 50 fold relative to a cell or organism lacking a recombinant nucleic acid molecule of the invention. The enhancement or increase can be determined by methods with which the skilled worker is familiar. Thus, the enhancement or increase of the nucleic acid or protein quantity can be determined for example by an immunological detection of the protein. Moreover, techniques such as protein assay, fluorescence, Northern hybridization, nuclease protection assay, reverse transcription (quantitative RT-PCR), ELISA (enzyme-linked immunosorbent assay), Western blotting, radioimmunoassay (RIA) or other immunoassays and fluorescence-activated cell analysis (FACS) can be employed to measure a specific protein or RNA in a plant or plant cell. Depending on the type of the induced protein product, its activity or the effect on the phenotype of the organism or the cell may also be determined. Methods for determining the protein quantity are known to the skilled worker. Examples, which may be mentioned, are: the micro-Biuret method (Goa J (1953) Scand J Clin Lab Invest 5:218-222), the Folin-Ciocalteau method (Lowry O H et al. (1951) J Biol Chem 193:265-275) or measuring the absorption of CBB G-250 (Bradford M M (1976) Analyt Biochem 72:248-254). As one example for quantifying the activity of a protein, the detection of luciferase activity is described in the Examples below. Expression: "Expression" refers to the biosynthesis of a gene product, preferably to the transcription and/or translation of a nucleotide sequence, for example an endogenous gene or a heterologous gene, in a cell. For example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and--optionally--the subsequent translation of mRNA into one or more polypeptides. In other cases, expression may refer only to the transcription of the DNA harboring an RNA molecule. Expression construct: "Expression construct" as used herein mean a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate part of a plant or plant cell, comprising a promoter functional in said part of a plant or plant cell into which it will be introduced, operatively linked to the nucleotide sequence of interest which is--optionally--operatively linked to termination signals. If translation is required, it also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region may code for a protein of interest but may also code for a functional RNA of interest, for example RNAa, siRNA, snoRNA, snRNA, microRNA, ta-siRNA or any other noncoding regulatory RNA, in the sense or antisense direction. The expression construct comprising the nucleotide sequence of interest may be chimeric, meaning that one or more of its components is heterologous with respect to one or more of its other components. The expression construct may also be one, which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Typically, however, the expression construct is heterologous with respect to the host, i.e., the particular DNA sequence of the expression construct does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event. The expression of the nucleotide sequence in the expression construct may be under the control of a seed-specific promoter or of an inducible promoter, which initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a plant, the promoter can also be specific to a particular tissue or organ or stage of development. Foreign: The term "foreign" refers to any nucleic acid molecule (e.g., gene sequence) which is introduced into the genome of a cell by experimental manipulations and may include sequences found in that cell so long as the introduced sequence contains some modification (e.g., a point mutation, the presence of a selectable marker gene, etc.) and is therefore distinct relative to the naturally-occurring sequence. Functional linkage: The term "functional linkage" or "functionally linked" is to be understood as meaning, for example, the sequential arrangement of a regulatory element (e.g. a promoter) with a nucleic acid sequence to be expressed and, if appropriate, further regulatory elements (such as e.g., a terminator or a NEENA) in such a way that each of the regulatory elements can fulfill its intended function to allow, modify, facilitate or otherwise influence expression of said nucleic acid sequence. As a synonym the wording "operable linkage" or "operably linked" may be used. The expression may result depending on the arrangement of the nucleic acid sequences in relation to sense or antisense RNA. To this end, direct linkage in the chemical sense is not necessarily required. Genetic control sequences such as, for example, enhancer sequences, can also exert their function on the target sequence from positions which are further away, or indeed from other DNA molecules. Preferred arrangements are those in which the nucleic acid sequence to be expressed recombinantly is positioned behind the sequence acting as promoter, so that the two sequences are linked covalently to each other. The distance between the promoter sequence and the nucleic acid sequence to be expressed recombinantly is preferably less than 200 base pairs, especially preferably less than 100 base pairs, very especially preferably less than 50 base pairs. In a preferred embodiment, the nucleic acid sequence to be transcribed is located behind the promoter in such a way that the transcription start is identical with the desired beginning of the chimeric RNA of the invention. Functional linkage, and an expression construct, can be generated by means of customary recombination and cloning techniques as described (e.g., in Maniatis T, Fritsch E F and Sambrook J (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor (NY); Silhavy et al. (1984) Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY); Ausubel et al. (1987) Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience; Gelvin et al. (Eds) (1990) Plant Molecular Biology Manual; Kluwer Academic Publisher, Dordrecht, The Netherlands). However, further sequences, which, for example, act as a linker with specific cleavage sites for restriction enzymes, or as a signal peptide, may also be positioned between the two sequences. The insertion of sequences may also lead to the expression of fusion proteins. Preferably, the expression construct, consisting of a linkage of a regulatory region for example a promoter and nucleic acid sequence to be expressed, can exist in a vector-integrated form and be inserted into a plant genome, for example by transformation. Gene: The term "gene" refers to a region operably joined to appropriate regulatory sequences capable of regulating the expression of the gene product (e.g., a polypeptide or a functional RNA) in some manner. A gene includes untranslated regulatory regions of DNA (e.g., promoters, enhancers, repressors, etc.) preceding (up-stream) and following (downstream) the coding region (open reading frame, ORF) as well as, where applicable, intervening sequences (i.e., introns) between individual coding regions (i.e., exons). The term "structural gene" as used herein is intended to mean a DNA sequence that is transcribed into mRNA which is then translated into a sequence of amino acids characteristic of a specific polypeptide. Genome and genomic DNA: The terms "genome" or "genomic DNA" is referring to the heritable genetic information of a host organism. Said genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA) but also the DNA of the plastids (e.g., chloroplasts) and other cellular organelles (e.g., mitochondria). Preferably the terms genome or genomic DNA is referring to the chromosomal DNA of the nucleus. Heterologous: The term "heterologous" with respect to a nucleic acid molecule or DNA refers to a nucleic acid molecule which is operably linked to, or is manipulated to become operably linked to, a second nucleic acid molecule to which it is not operably linked in nature, or to which it is operably linked at a different location in nature. A heterologous expression construct comprising a nucleic acid molecule and one or more regulatory nucleic acid molecule (such as a promoter or a transcription termination signal) linked thereto for example is a constructs originating by experimental manipulations in which either a) said nucleic acid molecule, or b) said regulatory nucleic acid molecule or c) both (i.e. (a) and (b)) is not located in its natural (native) genetic environment or has been modified by experimental manipulations, an example of a modification being a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. Natural genetic environment refers to the natural chromosomal locus in the organism of origin, or to the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the sequence of the nucleic acid molecule is preferably retained, at least in part. The environment flanks the nucleic acid sequence at least at one side and has a sequence of at least 50 bp, preferably at least 500 bp, especially preferably at least 1,000 bp, very especially preferably at least 5,000 bp, in length. A naturally occurring expression construct--for example the naturally occurring combination of a promoter with the corresponding gene--becomes a transgenic expression construct when it is modified by non-natural, synthetic "artificial" methods such as, for example, mutagenization. Such methods have been described (U.S. Pat. No. 5,565,350; WO 00/15815). For example a protein encoding nucleic acid molecule operably linked to a promoter, which is not the native promoter of this molecule, is considered to be heterologous with respect to the promoter. Preferably, heterologous DNA is not endogenous to or not naturally associated with the cell into which it is introduced, but has been obtained from another cell or has been synthesized. Heterologous DNA also includes an endogenous DNA sequence, which contains some modification, non-naturally occurring, multiple copies of an endogenous DNA sequence, or a DNA sequence which is not naturally associated with another DNA sequence physically linked thereto. Generally, although not necessarily, heterologous DNA encodes RNA or proteins that are not normally produced by the cell into which it is expressed. High expression seed-specific promoter: A "high expression seed-specific promoter" as used herein means a promoter causing seed-specific or seed-preferential expression in a plant or part thereof wherein the accumulation or rate of synthesis of RNA or stability of RNA derived from the nucleic acid molecule under the control of the respective promoter is higher, preferably significantly higher than the expression caused by the promoter lacking the NEENA of the invention. Preferably the amount of RNA and/or the rate of RNA synthesis and/or stability of RNA is increased 50% or more, for example 100% or more, preferably 200% or more, more preferably 5 fold or more, even more preferably 10 fold or more, most preferably 20 fold or more for example 50 fold relative to a seed-specific or a seed-preferential promoter lacking a NEENA of the invention. Hybridization: The term "hybridization" as used herein includes "any process by which a strand of nucleic acid molecule joins with a complementary strand through base pairing." (J. Coombs (1994) Dictionary of Biotechnology, Stockton Press, New York). Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acid molecules) is impacted by such factors as the degree of complementarity between the nucleic acid molecules, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acid molecules. As used herein, the term "Tm" is used in reference to the "melting temperature." The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. The equation for calculating the Tm of nucleic acid

molecules is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41(% G+C), when a nucleic acid molecule is in aqueous solution at 1 M NaCl [see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985)]. Other references include more sophisticated computations, which take structural as well as sequence characteristics into account for the calculation of Tm. Stringent conditions, are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. "Identity": "Identity" when used in respect to the comparison of two or more nucleic acid or amino acid molecules means that the sequences of said molecules share a certain degree of sequence similarity, the sequences being partially identical.

To determine the percentage identity (homology is herein used interchangeably) of two amino acid sequences or of two nucleic acid molecules, the sequences are written one underneath the other for an optimal comparison (for example gaps may be inserted into the sequence of a protein or of a nucleic acid in order to generate an optimal alignment with the other protein or the other nucleic acid).

The amino acid residues or nucleic acid molecules at the corresponding amino acid positions or nucleotide positions are then compared. If a position in one sequence is occupied by the same amino acid residue or the same nucleic acid molecule as the corresponding position in the other sequence, the molecules are homologous at this position (i.e. amino acid or nucleic acid "homology" as used in the present context corresponds to amino acid or nucleic acid "identity". The percentage homology between the two sequences is a function of the number of identical positions shared by the sequences (i.e. % homology=number of identical positions/total number of positions.times.100). The terms "homology" and "identity" are thus to be considered as synonyms.

For the determination of the percentage identity of two or more amino acids or of two or more nucleotide sequences several computer software programs have been developed. The identity of two or more sequences can be calculated with for example the software fasta, which presently has been used in the version fasta 3 (W. R. Pearson and D. J. Lipman, PNAS 85, 2444 (1988); W. R. Pearson, Methods in Enzymology 183, 63 (1990); W. R. Pearson and D. J. Lipman, PNAS 85, 2444 (1988); W. R. Pearson, Enzymology 183, 63 (1990)). Another useful program for the calculation of identities of different sequences is the standard blast program, which is included in the Biomax pedant software (Biomax, Munich, Federal Republic of Germany). This leads unfortunately sometimes to suboptimal results since blast does not always include complete sequences of the subject and the query. Nevertheless as this program is very efficient it can be used for the comparison of a huge number of sequences. The following settings are typically used for such a comparisons of sequences:

Intron: refers to sections of DNA (intervening sequences) within a gene that do not encode part of the protein that the gene produces, and that is spliced out of the mRNA that is transcribed from the gene before it is exported from the cell nucleus. Intron sequence refers to the nucleic acid sequence of an intron. Thus, introns are those regions of DNA sequences that are transcribed along with the coding sequence (exons) but are removed during the formation of mature mRNA. Introns can be positioned within the actual coding region or in either the 5' or 3' untranslated leaders of the pre-mRNA (unspliced mRNA). Introns in the primary transcript are excised and the coding sequences are simultaneously and precisely ligated to form the mature mRNA. The junctions of introns and exons form the splice site. The sequence of an intron begins with GU and ends with AG. Furthermore, in plants, two examples of AU-AC introns have been described: the fourteenth intron of the RecA-like protein gene and the seventh intron of the G5 gene from Arabidopsis thaliana are AT-AC introns. Pre-mRNAs containing introns have three short sequences that are--beside other sequences--essential for the intron to be accurately spliced. These sequences are the 5' splice-site, the 3' splice-site, and the branchpoint. mRNA splicing is the removal of intervening sequences (introns) present in primary mRNA transcripts and joining or ligation of exon sequences. This is also known as cis-splicing which joins two exons on the same RNA with the removal of the intervening sequence (intron). The functional elements of an intron is comprising sequences that are recognized and bound by the specific protein components of the spliceosome (e.g. splicing consensus sequences at the ends of introns). The interaction of the functional elements with the spliceosome results in the removal of the intron sequence from the premature mRNA and the rejoining of the exon sequences. Introns have three short sequences that are essential--although not sufficient--for the intron to be accurately spliced. These sequences are the 5' splice site, the 3' splice site and the branch point. The branchpoint sequence is important in splicing and splice-site selection in plants. The branchpoint sequence is usually located 10-60 nucleotides upstream of the 3' splice site. Isolated: The term "isolated" as used herein means that a material has been removed by the hand of man and exists apart from its original, native environment and is therefore not a product of nature. An isolated material or molecule (such as a DNA molecule or enzyme) may exist in a purified form or may exist in a non-native environment such as, for example, in a transgenic host cell. For example, a naturally occurring polynucleotide or polypeptide present in a living plant is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides can be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and would be isolated in that such a vector or composition is not part of its original environment. Preferably, the term "isolated" when used in relation to a nucleic acid molecule, as in "an isolated nucleic acid sequence" refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in its natural source. Isolated nucleic acid molecule is nucleic acid molecule present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acid molecules are nucleic acid molecules such as DNA and RNA, which are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs, which encode a multitude of proteins. However, an isolated nucleic acid sequence comprising for example SEQ ID NO: 1 includes, by way of example, such nucleic acid sequences in cells which ordinarily contain SEQ ID NO:1 where the nucleic acid sequence is in a chromosomal or extrachromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid sequence may be present in single-stranded or double-stranded form. When an isolated nucleic acid sequence is to be utilized to express a protein, the nucleic acid sequence will contain at a minimum at least a portion of the sense or coding strand (i.e., the nucleic acid sequence may be single-stranded). Alternatively, it may contain both the sense and anti-sense strands (i.e., the nucleic acid sequence may be double-stranded). Minimal Promoter: promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. NEENA: see "Nucleic acid expression enhancing nucleic acid". Nucleic acid expression enhancing nucleic acid (NEENA): The term "nucleic acid expression enhancing nucleic acid" refers to a sequence and/or a nucleic acid molecule of a specific sequence having the intrinsic property to enhance expression of a nucleic acid under the control of a promoter to which the NEENA is functionally linked. Unlike promoter sequences, the NEENA as such is not able to drive expression. In order to fulfill the function of enhancing expression of a nucleic acid molecule functionally linked to the NEENA, the NEENA itself has to be functionally linked to a promoter. In distinction to enhancer sequences known in the art, the NEENA is acting in cis but not in trans and has to be located close to the transcription start site of the nucleic acid to be expressed. Nucleic acids and nucleotides: The terms "Nucleic Acids" and "Nucleotides" refer to naturally occurring or synthetic or artificial nucleic acid or nucleotides. The terms "nucleic acids" and "nucleotides" comprise deoxyribonucleotides or ribonucleotides or any nucleotide analogue and polymers or hybrids thereof in either single- or double-stranded, sense or antisense form. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. The term "nucleic acid" is used inter-changeably herein with "gene", "cDNA, "mRNA", "oligonucleotide," and "polynucleotide". Nucleotide analogues include nucleotides having modifications in the chemical structure of the base, sugar and/or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, substitution of 5-bromo-uracil, and the like; and 2'-position sugar modifications, including but not limited to, sugar-modified ribonucleotides in which the 2'-OH is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN. Short hairpin RNAs (shRNAs) also can comprise non-natural elements such as non-natural bases, e.g., ionosin and xanthine, non-natural sugars, e.g., 2'-methoxy ribose, or non-natural phosphodiester linkages, e.g., methylphosphonates, phosphorothioates and peptides. Nucleic acid sequence: The phrase "nucleic acid sequence" refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5'- to the 3'-end. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role. "Nucleic acid sequence" also refers to a consecutive list of abbreviations, letters, characters or words, which represent nucleotides. In one embodiment, a nucleic acid can be a "probe" which is a relatively short nucleic acid, usually less than 100 nucleotides in length. Often a nucleic acid probe is from about 50 nucleotides in length to about 10 nucleotides in length. A "target region" of a nucleic acid is a portion of a nucleic acid that is identified to be of interest. Oligonucleotide: The term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof, as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. An oligonucleotide preferably includes two or more nucleomonomers covalently coupled to each other by linkages (e.g., phosphodiesters) or substitute linkages. Plant: is generally understood as meaning any eukaryotic single- or multi-celled organism or a cell, tissue, organ, part or propagation material (such as seeds or fruit) of same which is capable of photosynthesis. Included for the purpose of the invention are all genera and species of higher and lower plants of the Plant Kingdom. Annual, perennial, monocotyledonous and dicotyledonous plants are preferred. The term includes the mature plants, seed, shoots and seedlings and their derived parts, propagation material (such as seeds or microspores), plant organs, tissue, protoplasts, callus and other cultures, for example cell cultures, and any other type of plant cell grouping to give functional or structural units. Mature plants refer to plants at any desired developmental stage beyond that of the seedling. Seedling refers to a young immature plant at an early developmental stage. Annual, biennial, monocotyledonous and dicotyledonous plants are preferred host organisms for the generation of transgenic plants. The expression of genes is furthermore advantageous in all ornamental plants, useful or ornamental trees, flowers, cut flowers, shrubs or lawns. Plants which may be mentioned by way of example but not by limitation are angiosperms, bryophytes such as, for example, Hepaticae (liverworts) and Musci (mosses); Pteridophytes such as ferns, horsetail and club mosses; gymnosperms such as conifers, cycads, ginkgo and Gnetatae; algae such as Chlorophyceae, Phaeophpyceae, Rhodophyceae, Myxophyceae, Xanthophyceae, Bacillariophyceae (diatoms), and Euglenophyceae. Preferred are plants which are used for food or feed purpose such as the families of the Leguminosae such as pea, alfalfa and soya; Gramineae such as rice, maize, wheat, barley, sorghum, millet, rye, triticale, or oats; the family of the Umbelliferae, especially the genus Daucus, very especially the species carota (carrot) and Apium, very especially the species Graveolens dulce (celery) and many others; the family of the Solanaceae, especially the genus Lycopersicon, very especially the species esculentum (tomato) and the genus Solanum, very especially the species tuberosum (potato) and melongena (egg plant), and many others (such as tobacco); and the genus Capsicum, very especially the species annuum (peppers) and many others; the family of the Leguminosae, especially the genus Glycine, very especially the species max (soybean), alfalfa, pea, lucerne, beans or peanut and many others; and the family of the Cruciferae (Brassicacae), especially the genus Brassica, very especially the species napus (oil seed rape), campestris (beet), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv Emperor (broccoli); and of the genus Arabidopsis, very especially the species thaliana and many others; the family of the Compositae, especially the genus Lactuca, very especially the species sativa (lettuce) and many others; the family of the Asteraceae such as sunflower, Tagetes, lettuce or Calendula and many other; the family of the Cucurbitaceae such as melon, pumpkin/squash or zucchini, and linseed. Further preferred are cotton, sugar cane, hemp, flax, chilies, and the various tree, nut and wine species. Polypeptide: The terms "polypeptide", "peptide", "oligopeptide", "polypeptide", "gene product", "expression product" and "protein" are used interchangeably herein to refer to a polymer or oligomer of consecutive amino acid residues. Primary transcript: The term "primary transcript" as used herein refers to a premature RNA transcript of a gene. A "primary transcript" for example still comprises introns and/or is not yet comprising a polyA tail or a cap structure and/or is missing other modifications necessary for its correct function as transcript such as for example trimming or editing.

Promoter: The terms "promoter", or "promoter sequence" are equivalents and as used herein, refer to a DNA sequence which when ligated to a nucleotide sequence of interest is capable of controlling the transcription of the nucleotide sequence of interest into RNA. Such promoters can for example be found in the following public databases grassius.org/grasspromdb.html, mendel.cs.rhul.ac.uk/mendel.php?topic=plantprom, ppdb.gene.nagoya-u.ac.jp/cgi-bin/index.cgi. Promoters listed there may be addressed with the methods of the invention and are herewith included by reference. A promoter is located 5' (i.e., upstream), proximal to the transcriptional start site of a nucleotide sequence of interest whose transcription into mRNA it controls, and provides a site for specific binding by RNA polymerase and other transcription factors for initiation of transcription. Said promoter comprises for example the at least 10 kb, for example 5 kb or 2 kb proximal to the transcription start site. It may also comprise the at least 1500 bp proximal to the transcriptional start site, preferably the at least 1000 bp, more preferably the at least 500 bp, even more preferably the at least 400 bp, the at least 300 bp, the at least 200 bp or the at least 100 bp. In a further preferred embodiment, the promoter comprises the at least 50 bp proximal to the transcription start site, for example, at least 25 bp. The promoter does not comprise exon and/or intron regions or 5' untranslated regions. The promoter may for example be heterologous or homologous to the respective plant. A polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is not naturally associated with the promoter (e.g. a genetically engineered coding sequence or an allele from a different ecotype or variety). Suitable promoters can be derived from genes of the host cells where expression should occur or from pathogens for this host cells (e.g., plants or plant pathogens like plant viruses). A plant specific promoter is a promoter suitable for regulating expression in a plant. It may be derived from a plant but also from plant pathogens or it might be a synthetic promoter designed by man. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. Also, the promoter may be regulated in a tissue-specific or tissue preferred manner such that it is only or predominantly active in transcribing the associated coding region in a specific tissue type(s) such as leaves, roots or meristem. The term "tissue specific" as it applies to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., petals) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (e.g., roots). Tissue specificity of a promoter may be evaluated by, for example, operably linking a reporter gene to the promoter sequence to generate a reporter construct, introducing the reporter construct into the genome of a plant such that the reporter construct is integrated into every tissue of the resulting transgenic plant, and detecting the expression of the reporter gene (e.g., detecting mRNA, protein, or the activity of a protein encoded by the reporter gene) in different tissues of the transgenic plant. The detection of a greater level of expression of the reporter gene in one or more tissues relative to the level of expression of the reporter gene in other tissues shows that the promoter is specific for the tissues in which greater levels of expression are detected. The term "cell type specific" as applied to a promoter refers to a promoter, which is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term "cell type specific" when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g., GUS activity staining, GFP protein or immunohistochemical staining. The term "constitutive" when made in reference to a promoter or the expression derived from a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid molecule in the absence of a stimulus (e.g., heat shock, chemicals, light, etc.) in the majority of plant tissues and cells throughout substantially the entire lifespan of a plant or part of a plant. Typically, constitutive promoters are capable of directing expression of a transgene in substantially any cell and any tissue.

Promoter specificity: The term "specificity" when referring to a promoter means the pattern of expression conferred by the respective promoter. The specificity describes the tissues and/or developmental status of a plant or part thereof, in which the promoter is conferring expression of the nucleic acid molecule under the control of the respective promoter. Specificity of a promoter may also comprise the environmental conditions, under which the promoter may be activated or down-regulated such as induction or repression by biological or environmental stresses such as cold, drought, wounding or infection. Purified: As used herein, the term "purified" refers to molecules, either nucleic or amino acid sequences that are removed from their natural environment, isolated or separated. "Substantially purified" molecules are at least 60% free, preferably at least 75% free, and more preferably at least 90% free from other components with which they are naturally associated. A purified nucleic acid sequence may be an isolated nucleic acid sequence. Recombinant: The term "recombinant" with respect to nucleic acid molecules refers to nucleic acid molecules produced by recombinant DNA techniques. Recombinant nucleic acid molecules may also comprise molecules, which as such does not exist in nature but are modified, changed, mutated or otherwise manipulated by man. Preferably, a "recombinant nucleic acid molecule" is a non-naturally occurring nucleic acid molecule that differs in sequence from a naturally occurring nucleic acid molecule by at least one nucleic acid. A "recombinant nucleic acid molecule" may also comprise a "recombinant construct" which comprises, preferably operably linked, a sequence of nucleic acid molecules not naturally occurring in that order. Preferred methods for producing said recombinant nucleic acid molecule may comprise cloning techniques, directed or non-directed mutagenesis, synthesis or recombination techniques. "Seed-specific promoter" in the context of this invention means a promoter which is regulating transcription of a nucleic acid molecule under control of the respective promoter in seeds wherein the transcription in any tissue or cell of the seeds contribute to more than 90%, preferably more than 95%, more preferably more than 99% of the entire quantity of the RNA transcribed from said nucleic acid sequence in the entire plant during any of its developmental stage. The term "seed-specific expression" and "seed-specific NEENA" are to be understood accordingly. Hence a "seed-specific NEENA" enhances the transcription of a seed-specific or seed-preferential promoter in a way, that the transcription in seeds derived from said promoter functionally linked to a respective NEENA contribute to more than 90%, preferably more than 95%, more preferably more than 99% of the entire quantity of the RNA transcribed from the respective promoter functionally linked to a NEENA in the entire plant during any of its developmental stage. "Seed-preferential promoter" in the context of this invention means a promoter which is regulating transcription of a nucleic acid molecule under control of the respective promoter in seeds wherein the transcription in any tissue or cell of the seeds contribute to more than 50%, preferably more than 70%, more preferably more than 80% of the entire quantity of the RNA transcribed from said nucleic acid sequence in the entire plant during any of its developmental stage. The term "seed-preferential expression" and "seed-preferential NEENA" are to be understood accordingly. Hence a "seed-preferential NEENA" enhances the transcription of a seed-specific or seed-preferential promoter in a way, that the transcription in seeds derived from said promoter functionally linked to a respective NEENA contribute to more than 50%, preferably more than 70%, more preferably more than 80% of the entire quantity of the RNA transcribed from the respective promoter functionally linked to a NEENA in the entire plant during any of its developmental stage. Sense: The term "sense" is understood to mean a nucleic acid molecule having a sequence which is complementary or identical to a target sequence, for example a sequence which binds to a protein transcription factor and which is involved in the expression of a given gene. According to a preferred embodiment, the nucleic acid molecule comprises a gene of interest and elements allowing the expression of the said gene of interest. Significant increase or decrease: An increase or decrease, for example in enzymatic activity or in gene expression, that is larger than the margin of error inherent in the measurement technique, preferably an increase or decrease by about 2-fold or greater of the activity of the control enzyme or expression in the control cell, more preferably an increase or decrease by about 5-fold or greater, and most preferably an increase or decrease by about 10-fold or greater. Substantially complementary: In its broadest sense, the term "substantially complementary", when used herein with respect to a nucleotide sequence in relation to a reference or target nucleotide sequence, means a nucleotide sequence having a percentage of identity between the substantially complementary nucleotide sequence and the exact complementary sequence of said reference or target nucleotide sequence of at least 60%, more desirably at least 70%, more desirably at least 80% or 85%, preferably at least 90%, more preferably at least 93%, still more preferably at least 95% or 96%, yet still more preferably at least 97% or 98%, yet still more preferably at least 99% or most preferably 100% (the later being equivalent to the term "identical" in this context). Preferably identity is assessed over a length of at least 19 nucleotides, preferably at least 50 nucleotides, more preferably the entire length of the nucleic acid sequence to said reference sequence (if not specified otherwise below). Sequence comparisons are carried out using default GAP analysis with the University of Wisconsin GCG, SEQWEB application of GAP, based on the algorithm of Needleman and Wunsch (Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453; as defined above). A nucleotide sequence "substantially complementary" to a reference nucleotide sequence hybridizes to the reference nucleotide sequence under low stringency conditions, preferably medium stringency conditions, most preferably high stringency conditions (as defined above). Transgene: The term "transgene" as used herein refers to any nucleic acid sequence, which is introduced into the genome of a cell by experimental manipulations. A transgene may be an "endogenous DNA sequence," or a "heterologous DNA sequence" (i.e., "foreign DNA"). The term "endogenous DNA sequence" refers to a nucleotide sequence, which is naturally found in the cell into which it is introduced so long as it does not contain some modification (e.g., a point mutation, the presence of a selectable marker gene, etc.) relative to the naturally-occurring sequence. Transgenic: The term transgenic when referring to an organism means transformed, preferably stably transformed, with a recombinant DNA molecule that preferably comprises a suitable promoter operatively linked to a DNA sequence of interest. Vector: As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked. One type of vector is a genomic integrated vector, or "integrated vector", which can become integrated into the chromosomal DNA of the host cell. Another type of vector is an episomal vector, i.e., a nucleic acid molecule capable of extra-chromosomal replication. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In the present specification, "plasmid" and "vector" are used interchangeably unless otherwise clear from the context. Expression vectors designed to produce RNAs as described herein in vitro or in vivo may contain sequences recognized by any RNA polymerase, including mitochondrial RNA polymerase, RNA pol I, RNA pol II, and RNA pol III. These vectors can be used to transcribe the desired RNA molecule in the cell according to this invention. A plant transformation vector is to be understood as a vector suitable in the process of plant transformation. Wild-type: The term "wild-type", "natural" or "natural origin" means with respect to an organism, polypeptide, or nucleic acid sequence, that said organism is naturally occurring or available in at least one naturally occurring organism which is not changed, mutated, or otherwise manipulated by man.

The contents of all references cited throughout this application are herewith incorporated by reference in general and with respect to their specific disclosure content referred to above.

FIGURES

FIG. 1: Schematical figure of the different enzymatic activities leading to the production of ARA, EPA and DHA.

FIG. 2 Strategy employed for stepwise buildup of plant expression plasmids of the invention. A detailed description is given in example 4. Abbreviations: Nco I, Pac I, Kas I, Sfo I, Fse I, Sbf I, Xma I, Not I indicate restriction endonucleases used for cloning; attLx and attRx--where x are numbers from 1 to 4--designate attachment sites for site specific recombination of the Multisite Gateway.TM. System (Invitrogen); pENTR_A, pENTR_B, pENTR_C are Multisite Gateway.TM. System-Entry-vectors; Kan (Kanaycin) and Strep (Streptinomycin) designate antibiotic selection markers used for cloning; on-origin of replication.

FIG. 3 Orientation and combination of the functional elements (promoter, NEENA, gene, terminator) of the plant expression vecotrs VC-LJB913-1qcz (SEQ-ID 38), VC-LJB1327-1qcz (SEQ-ID 39), VC-LJB2003-1qcz (SEQ-ID 40) and VC-LJB2197-1qcz (SEQ-ID 146).

EXAMPLES

Example 1

General Cloning Methods

Cloning methods as e.g. use of restriction endonucleases to cut double stranded DNA at specific sites, agarose gel electrophoreses, purification of DNA fragments, transfer of nucleic acids onto nitrocellulose and nylon membranes, joining of DNA-fragments, transformation of E. coli cells and culture of bacteria where performed as described in Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87965-309-6). Polymerase chain reaction was performed using Phusion.TM. High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) according to the manufactures instructions. In general, primers used in PCR were designed such, that at least 20 nucleotides of the 3' end of the primer anneal perfectly with the template to amplify. Restriction site were added by attaching the corresponding nucleotides of the recognition sites to the 5' end of the primer. Fusion PCR, for example described by K. Heckman and L. R. Pease, Nature Protocols (2207) 2, 924-932 was used as an alternative method to join two fragments of interest, e.g. a promoter to a gene or a gene to a terminator.

Example 2

Sequence Analysis of Recombinant DNA

Sequencing of recombinant DNA-molecules was performed using a laser-fluorescence DNA sequencer (Applied Biosystems Inc, USA) employing the sanger method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467). Expression constructs harboring fragments obtained by polymerase chain reactions (PCR) were subjected to sequencing to confirm the correctness of expression cassettes consisting of promoter, nucleic acid molecule to be expressed and terminator to avoid mutations that might result from handling of the DNA during cloning, e.g. due to incorrect primers, mutations from exposure to UV-light or errors of polymerases.

Example 3

Identification of Nucleic Acid Expression Enhancing Nucleic Acids (NEENA) from Genes with Seed Preferred Expression

3.1 Identification of NEENA Molecules from A. thaliana Genes

Using publicly available genomic DNA sequences (e.g. ncbi.nlm.nih.gov/genomes/PLANTS/PlantList.html) and transcript expression data (e.g. weigelworld.org/resources/microarray/AtGenExpress/), a set of 19 NEENA candidates deriving from Arabidopsis thaliana transcripts with seed preferred expression was selected for detailed analyses. The candidates were named as follows:

TABLE-US-00002 TABLE 1 seed specific NEENA candidates (NEENAss). NEENA SEQ ID name Locus Annotation No NEENAss1 At1g62290 aspartyl protease family protein 6 NEENAss2 At1g65090 expressed protein 7 NEENAss15 At2g27040 PAZ domain-containing protein 9 NEENAss18 At1g01170 ozone-responsive stress-related protein, 10 putative NEENAss14 At5g63190 MA3 domain-containing protein 8 NEENAss4 At5g07830 glycosyl hydrolase family 79 N-terminal 11 domain-containing protein similar to beta- glucuronidase AtGUS2 NEENAss13 At2g04520 eukaryotic translation initiation factor 1A, 12 putative/eIF-1A NEENAss3 At5g60760 2-phosphoglycerate kinase-related 13 NEENAss5 At1g11170 expressed protein contains Pfam profile 14 PF05212 NEENAss11 At4g37050 PLA V/PLP4 (Patatin-like protein 4) 15 NEENAss8 At1g56170 HAP5B (Heme activator protein (yeast) 16 homolog 5B) NEENAss16 At1g54100 aldehyde dehydrogenase, putative/ 17 antiquitin NEENAss9 At3g12670 CTP synthase, putative/UTP--ammonia 18 ligase, putative NEENAss20 At4g04460 aspartyl protease family protein 19 NEENAss10 At1g04120 ATMRP5 (Arabidopsis thaliana multidrug 20 resistance-associated protein 5) NEENAss6 At2g41070 basic leucine zipper transcription factor 21 (BZIP12) NEENAss12 At1g05450 protease inhibitor/seed storage/lipid transfer 22 protein (LTP)-related NEENAss7 At4g03050 2-oxoglutarate-dependent dioxygenase, 23 putative (AOP3) NEENAss17 At3g12490 cysteine protease inhibitor, putative/cystatin 24

3.2 Isolation of the NEENA Candidates

Genomic DNA was extracted from A. thaliana green tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Genomic DNA fragments containing NEENA molecules were isolated by conventional polymerase chain reaction (PCR). Primers were designed on the basis of the A. thaliana genome sequence with a multitude of NEENA candidates. The reaction comprised 19 sets of primers (Table 2) and followed the protocol outlined by Phusion High Fidelity DNA Polymerase (Cat No F-540L, New England Biolabs, Ipswich, Mass., USA). The isolated DNA was used as template DNA in a PCR amplification using the following primers:

TABLE-US-00003 TABLE 2 Primer sequences for isolation of NEENAs PCR yielding Primer name Sequence SEQ ID No SEQ ID No NEENAss1_for tggtgcttaaacactctggtgagt 42 6 NEENAss1_rev tttgacctacaaaatcaaagcagtca 43 NEENAss2_for agttctttgctttcgaagttgc 44 7 NEENAss2_rev tactacgtactgttttcaattct 45 NEENAss3_for atttccacacgctttctatcatttc 46 13 NEENAss3_rev ttatctctctctaaaaaataaaaacgaatc 47 NEENAss4_for gtccagaattttctccattga 48 11 NEENAss4_rev tcttcactatccaaagctctca 49 NEENAss5_for gtctactttcattacagtgactctg 50 14 NEENAss5_rev ttatattttacctgcaacacaattcaa 51 NEENAss6_for cactcgaatactgcatgcaa 52 21 NEENAss6_rev ttatgtagcctttacacagaaaacaa 53 NEENAss7_for aacaactatggcctgagggt 54 23 NEENAss7_rev ttatcttactgtttttaaccaaaaaataaaat 55 NEENAss8_for atcttagggtttcgcgagatctca 56 16 NEENAss8_rev tgctaagctatctctgttaatataaaattg 57 NEENAss9_for atttttgttggtgaaaggtaga 58 18 NEENAss9_rev ttacgtttttgtctctgcttcttct 59 NEENAss10_for tctgggaaatatcgattttgatct 60 20 NEENAss10_rev tctcaccacatcccaaagctc 61 NEENAss11_for gcacaatcttagcttaccttgaa 62 15 NEENAssll_rev ttatttaatccacaagccttgcctc 63 NEENAss12_for tgtcggagaagtgggcg 64 22 NEENAss12-rev agaagtgggcggacg 65 NEENAss13_for tagcttaatctcagattcgaatcgt 66 12 NEENAss13_rev tagtatctacataccaatcatacaaatg 67 NEENAss14_for tttcacgatttggaatttga 68 8 NEENAss14_rev tctacaacattaaaacgaccatta 69 NEENAss15_for agggtttcgtttttgtttca 70 9 NEENAss15_rev ttatctcctgctcaaagaaacca 71 NEENAss16_for agaagctcatttcttcgatac 72 17 NEENAss16_rev tctctgcgcaaaaattcacc 73 NEENAss17_for tctaaaaatacagggcacc 74 24 NEENAss17_rev ttactcttcgttgcagaagccta 75 NEENAss18_for actgtttaagcttcactgtct 76 10 NEENAss18_rev tttcttctaaagctgaaagt 77 NEENAss20_for ttaagcttttaagaatctctactcaca 78 19 NEENAss20_rev ttaaattttacctgtcatcaaaaacaaca 79

Amplification during the PCR was carried out with the following composition (50 microl):

3.00 microl A. thaliana genomic DNA

10.00 microl 5.times. Phusion HF Buffer

4.00 microl dNTP (2.5 mM)

2.50 microl for Primer (10 microM)

2.50 microl rev Primer (10 microM)

0.50 microl Phusion HF DNA Polymerase (2 U/microl)

A touch-down approach was employed for the PCR with the following parameters: 98.0.degree. C. for 30 sec (1 cycle), 98.0.degree. C. for 30 sec, 56.0.degree. C. for 30 sec and 72.0.degree. C. for 60 sec (4 cycles), 4 additional cycles each for 54.0.degree. C., 51.0.degree. C. and 49.0.degree. C. annealing temperature, followed by 20 cycles with 98.0.degree. C. for 30 sec, 46.0.degree. C. for 30 sec and 72.0.degree. C. for 60 sec (4 cycles) and 72.0.degree. C. for 5 min. The amplification products was loaded on a 2% (w/v) agarose gel and separated at 80V. The PCR products were excised from the gel and purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified PCR products were cloned into the pCR2.1 TOPO (Invitrogen) vector according to the manufacturer's manual and subsequently sequenced. These plasmids served as source for further cloning steps or as template for further PCR, e.g. fusion PCR for fusion with promoters as described in example 4.

Example 4

Assembly of Genes Required for PUFA Synthesis within a T-Plasmid

For synthesis of LC-PUFA in Brassica napus seeds, the set of genes encoding the proteins of the metabolic LC-PUFA pathway (table 3) was combined with expression elements (promoter, terminators, NEENAs, table 5) and transferred into binary t-plasmids that were used for agrobacteria mediated transformation of plants as described in example 5. To this end, the general cloning strategy depicted in FIG. 2 was employed: Genes listed in table 3 were PCR-amplified using Phusion.TM. High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) according to the manufactures instructions from cDNA using primer introducing a Nco I and/or Asc I restriction site at the 5' terminus, and a Pac I restriction site at the 3' terminus (FIG. 2A). Promoter-terminator modules or promoter-NEENA-terminator modules were created by joining the corresponding expression elements listed in table 2 using fusion PCR as described in example 1 and cloning the PCR-product into the TOPO-vector pCR2.1 (Invitrogen) according to the manufactures instructions (FIG. 2B). As a non limiting example, primer combinations are listed in table 6 were used to create fusions of promoter-NEENAs harbored by the plasmid VC-LJB2003-1qcz (SEQ-ID 40) and VC-LJB2197-1qcz (SEQ-ID 146) containing the required set of pathway genes to synthesize arachidonic acid in seeds of rapeseed. While joining terminator sequences to promoter sequences or promoter-NEENA sequences using fusion PCR, primers were designed such, that recognition sequences for the restriction endonucleases depicted in FIG. 2 were added to either side of the modules, and the recognition sites for the restriction endonucleases Nco I, Asc I and Pac I were introduced between promoter and terminator or between NEENA and terminator (see FIG. 2B). To obtain the final expression modules, PCR-amplified genes were cloned between promoter and terminator or NEENA and terminator via Nco I and/or Pac I restriction sites (FIG. 2C). Employing the custom multiple cloning site (MCS) SEQ-ID 41, up to three of those expression modules were combined as desired to expression cassettes harbored by either one of pENTR/A, pENTR/B or pENTR/C (FIG. 2D). Deviating from the strategy depicted in FIG. 2, some elements or joined elements were synthesized by a service provider or cloned using blunt-end ligation. Finally, the Multisite Gateway.TM. System (Invitrogen) was used to combine three expression cassette harbored by pENTR/A, pENTR/B and pENTR/C (FIG. 2E) to obtain the final binary pSUN T-plasmids VC-LJB913-1qcz (SEQ-ID 38), VC-LJB1327-1qcz (SEQ-ID 39) and VC-LJB2003-1qcz (SEQ-ID 40) and VC-LJB2197-1qcz (SEQ-ID 146). The orientation and combination of the functional elements (promoter, NEENA, gene, terminator) is depicted in FIGS. 3A, 3B, 3C and 3D. An overview of binary vectors and their usage is given by Hellens et al, Trends in Plant Science (2000) 5: 446-451.

TABLE-US-00004 TABLE 3 Genes used for synthesis of 20:4n - 6 (ARA) in rapeseed. Gene Source Organism Activity SEQ-ID d12Des(Ps_GA) Phytophtora sojae .DELTA. 12-Desaturase 95 d6Des(Ot_febit) Ostreococcus tauri .DELTA. 6-Desaturase 96 d6Des(Ot_GA2) Ostreococcus tauri .DELTA. 6-Desaturase 97 d6Des(Pir_GAI) Pythium irregulare .DELTA. 6-Desaturase 98 d6Elo(Pp_GA2) Physcomitrella patens .DELTA. 6-Elongase 99 d6Elo(Tp_GA2) Thalassiosira .DELTA. 6-Elongase 100 pseudonana d5Des(Tc_GA2) Thraustochytrium ssp. .DELTA. 5-Desaturase 101

TABLE-US-00005 TABLE 4 Genes used in addition to genes listed in table 1 for synthesis of 22:6n - 3 (DHA) in rapeseed. Gene Source Organism Activity SEQ-ID d5Elo(Ot_GA3) Ostreococcus tauri .DELTA. 5-Elongase 102 d4Des(Tc_GA3) Traustochytrium ssp. .DELTA. 4-Desaturase 103

TABLE-US-00006 TABLE 5 Expression elements used for synthesis of 20:4n - 6 (ARA) or 22:6n - 3 (DHA) in rapeseed Element Source Organism Function SEQ-ID p-VfSBP- Vicia faba; Promotor + NEENA 1 NEENAss1 Arabidopsis p-BnNapin- Brassica napus; Promotor + NEENA 2 NEENAss2 Arabidopsis p-LuCnl- Linum usitatissimum; Promotor + NEENA 3 NEENAss14 Arabidopsis p-LuPxr- Linum usitatissimum; Promotor + NEENA 4 NEENAss15 Arabidopsis p-VfUSP- Vicia faba; Promotor + NEENA 5 NEENAss18 Arabidopsis p-VfSBP- Vicia faba, Promoter + NEENA 147 NEENAss2 Arabidopsis p-LuPxr- Linum usitatissimum, Promoter + NEENA 148 NEENAss1 Arabidopsis p-BnNapin- Brassica napus, Promoter + NEENA 149 NEENAss14 Arabidopsis NEENAss1 Arabidopsis NEENA from locus At1g62290 6 (aspartyl protease family protein) NEENAss2 Arabidopsis NEENA from locus At1g65090 7 (expressed protein) NEENAss14 Arabidopsis NEENA from locus At5g63190 8 (MA3 domain-containing protein) NEENAss15 Arabidopsis NEENA from locus At2g27040 9 (PAZ domain-containing protein) NEENAss18 Arabidopsis NEENA from locus At1g01170 10 (ozone-responsive stress-related protein, putative) NEENAss4 Arabidopsis NEENA from locus At5g07830 11 (glycosyl hydrolase family 79 N- terminal domain-containing protein similar to beta- glucuronidase AtGUS2) NEENAss13 Arabidopsis NEENA from locus At2g04520 12 (eukaryotic translation initiation factor 1A, putative/eIF-1A) NEENAss3 Arabidopsis NEENA from locus At5g60760 (2- 13 phosphoglycerate kinase-related) NEENAss5 Arabidopsis NEENA from locus At1g11170 14 (expressed protein contains Pfam profile PF05212) NEENAss11 Arabidopsis NEENA from locus At4g37050 15 (PLA V/PLP4 (Patatin-like protein 4)) NEENAss8 Arabidopsis NEENA from locus At1g56170 16 (HAP5B (Heme activator protein (yeast) homolog 5B)) NEENAss16 Arabidopsis NEENA from locus At1g54100 17 (aldehyde dehydrogenase, putative/antiquitin) NEENAss9 Arabidopsis NEENA from locus At3g12670 18 (CTP synthase, putative/UTP-- ammonia ligase, putative) NEENAss20 Arabidopsis NEENA from locus At4g04460 19 (aspartyl protease family protein) NEENAss10 Arabidopsis NEENA from locus At1g04120 20 (ATMRP5 (Arabidopsis thaliana multidrug resistance-associated protein 5)) NEENAss6 Arabidopsis NEENA from locus At2g41070 21 (basic leucine zipper transcription factor (BZIP12)) NEENAss12 Arabidopsis NEENA from locus At1g05450 22 (protease inhibitor/seed storage/lipid transfer protein (LTP)-related) NEENAss7 Arabidopsis NEENA from locus At4g03050 (2- 23 oxoglutarate-dependent dioxygenase, putative (AOP3)) NEENAss17 Arabidopsis NEENA from locus At3g12490 24 (cysteine protease inhibitor, putative/cystatin) p-BnNapin Brassica napus Promotor 25 p-LuCnl Linum usitatissimum Promotor 26 p-LuPXR Linum usitatissimum Promotor 27 p-VfSBP Vicia faba Promotor 28 p-VfUSP Vicia faba Promotor 29 p-VfLeB4 Vicia faba Promotor 30 t-AtPXR Arabidopsis Terminator 31 t-CaMV35S CaMV Terminator 32 t-E9 Pisum sativum Terminator 33 t-AgrOCS Agrobacterium tumefaciens Terminator 34 t-PvArc Phaseolus vulgaris Terminator 35 t-StCat Solanum tuberosum Terminator 36 t-VfLeB3 Vicia faba Terminator 37

TABLE-US-00007 TABLE 6 Primers used for creation of fusions between promotor and NEENA elements using fusion PCR as described in example 1. Promoter/NEENA Primer pair 1. PCR Primer pair 1. PCR Primer pair 2. PCR cassette Promoter NEENA Promotor-NEENA p-VfSBP- Forw: Forw: Forw: NEENAss1 tcgacggcccggactgta attaatagagcgatcaag tcgacggcccggactgta tccaac ctgaactggtgcttaaaca tccaac (SEQ-ID No: 80) ctctggtgagt (SEQ-ID No: 80) Rev: (SEQ-ID No: 82) Rev: actcaccagagtgtttaag Rev: tttgacctacaaaatcaaa caccagttcagcttgatcg tttgacctacaaaatcaaa gcagtca ctctattaat gcagtca (SEQ-ID No: 43) (SEQ-ID No: 81) (SEQ-ID No: 43) p-BnNapin- Forw: Forw: Forw: NEENAss2 taaggatgacctacccatt tcaatacaaacaagatta taaggatgacctacccatt cttga aaaacaagttctttgctttc cttga (SEQ-ID No: 83) gaagttgc (SEQ-ID No: 83) Rev: (SEQ-ID No: 85) Rev: gcaacttcgaaagcaaa Rev: tactacgtactgttttcaatt gaacttgtttttaatcttgtttg tactacgtactgttttcaatt ct tattga ct (SEQ-ID No: 45) (SEQ-ID No: 84) (SEQ-ID No: 45) p-LuCnl- Forw: Forw: Forw: NEENAss14 ttagcagatatttggtgtcta aaagaaccaatcaccac ttagcagatatttggtgtcta aat caaaaaatttcacgatttg aat (SEQ-ID No: 86) gaatttga (SEQ-ID No: 86) Rev: (SEQ-ID No: 88) Rev: tcaaattccaaatcgtgaa Rev: tctacaacattaaaacga attttttggtggtgattggttc tctacaacattaaaacga ccatta ttt ccatta (SEQ-ID No: 69) (SEQ-ID No: 87) (SEQ-ID No: 69) p-LuPxr- Forw: Forw: Forw: NEENAss15 cacgggcaggacatagg aaaccgacatttttatcata cacgggcaggacatagg gactact aatcagggtttcgtttttgttt gactact (SEQ-ID No: 89) ca (SEQ-ID No: 89) Rev: (SEQ-ID No: 91) Rev: tgaaacaaaaacgaaac Rev: ttatctcctgctcaaagaa c ttatctcctgctcaaagaa acca ctgatttatgataaaaatgt acca (SEQ-ID No: 71) cggttt (SEQ-ID No: 71) (SEQ-ID No: 90) p-VfUSP- Forw: Forw: Forw: NEENAss18 ctgcagcaaatttacacat gattataatttcttcatagcc ctgcagcaaatttacacat tgcca agtactgtttaagcttcact tgcca (SEQ-ID No: 92) gtct (SEQ-ID No: 92) Rev: (SEQ-ID No: 94) Rev: agacagtgaagcttaaac Rev: tttcttctaaagctgaaagt agtactggctatgaagaa tttcttctaaagctgaaagt (SEQ-ID No: 77) attataatc (SEQ-ID No: 77) (SEQ-ID No: 93) p-VfSBP- Forw: Forw: Forw: NEENAss2 Tcgacggcccggactgt Attaatagagcgatcaag Tcgacggcccggactgt atccaac ctgaacagttctttgctttcg atccaac (SEQ-ID No: 80) aagttgc (SEQ-ID No: 80) Rev: (SEQ-ID No: 151) Rev: Gcaacttcgaaagcaaa Rev: Tactacgtactgttttcaatt gaactgttcagcttgatcg Tactacgtactgttttcaatt ct ctctattaat ct (SEQ-ID No: 45) (SEQ_ID No: 150) (SEQ-ID No: 45) p-LuPxr- Forw: Forw: Forw: NEENAss1 Cacgggcaggacatag aaaccgacatttttatcata Cacgggcaggacatag ggactact aatctggtgcttaaacact ggactact (SEQ-ID No: 89) ctggtgagt (SEQ-ID No: 89) Rev: (SEQ-ID No: 153) Rev: Actcaccagagtgtttaag Rev: tggtgcttaaacactctggt caccagatttatgataaaa tggtgcttaaacactctggt gagt atgtcggttt gagt (SEQ-ID No: 42) (SEQ_ID No: 152) (SEQ-ID No: 42) p-BnNapin- Forw: Forw: Forw: NEENAss14 taaggatgacctacccatt tcaatacaaacaagatta taaggatgacctacccatt cttga aaaacatttcacgatttgg cttga (SEQ-ID No: 83) aatttga (SEQ-ID No: 83) Rev: (SEQ-ID No: 155) Rev: tcaaattccaaatcgtgaa Rev: tctacaacattaaaacga atgtttttaatcttgtttgtatt tctacaacattaaaacga ccatta ga ccatta (SEQ_ID No: 69) (SEQ_ID No: 154) (SEQ_ID No: 69)

Binary T-plasmids harboring functional expression modules for synthesis of docosahexaenoic acid (DHA) in rapeseed can be obtained in a similar manner. To this end, in addition to the functional modules (promoter-gene-terminator and/or promoter-NEENA-gene-terminator) described for synthesis ARA, constructs also contain functional modules required for the expression of the genes listed in table 4. Promoters used in those expression modules can be SEQ-ID No. 25, 26, 27, 28, 29 and/or 30, NEENAs can be any or none of SEQ-ID No. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and (or 24, and terminators can be SEQ-ID No. 31, 32, 33, 34, 35, 36 and 37.

Example 5

Production of Transgenic Plants

a) Generation of Transgenic Rape Seed Plants (Amended Protocol According to Moloney et al. 1992, Plant Cell Reports, 8:238-242)

For the generation of transgenic rapeseed plants, the binary vectors described in example 3 were transformed into Agrobacterium tumefaciens C58C1:pGV2260 (Deblaere et al. 1984, Nucl. Acids. Res. 13: 4777-4788). For the transformation of rapeseed plants (cv. Kumily,) a 1:50 dilution of an overnight culture of positive transformed acrobacteria colonies grown in Murashige-Skoog Medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) supplemented by 3% saccharose (3MS-Medium) was used. Petiols or Hypocotyledones of sterial rapeseed plants were incubated in a petri dish with a 1:50 acrobacterial dilusion for 5-10 minutes. This was followed by a tree day co-incubation in darkness at 25.degree. C. on 3MS-Medium with 0.8% bacto-Agar. After three days the culture was put on to 16 hours light/8 hours darkness weekly on MS-medium containing 500 mg/l Claforan (Cefotaxime-Natrium), 100 nM Imazetapyr, 20 mikroM Benzylaminopurin (BAP) and 1.6 g/l Glucose. Growing sprouts were transferred to MS-Medium containing 2% saccharose, 250 mg/l Claforan and 0.8% Bacto-Agar. Even after three weeks no root formation was observed, a growth hormone 2-Indolbutyl acid was added to the medium for enhancing root formation.

Regenerated sprouts have been obtained on 2MS-Medium with Imazetapyr and Claforan and were transferred to the green house for sprouting. After flowering, the mature seeds were harvested and analysed for expression of the Desaturase gene via lipid analysis as described in Qui et al. 2001, J. Biol. Chem. 276, 31561-31566.

b) Production of Transgenic Flax Plants

The production of transgenic flax plants can be carried out according to the method of Bell et al., 1999, In Vitro Cell. Dev. Biol. Plant 35(6):456-465 using particle bombardment. Acrobacterial transformation could be carried out according to Mlynarova et al. (1994), Plant Cell Report 13: 282-285.

Example 6

Lipid Extraction and Lipid Analysis of Plant Oils

The results of genetic modifications in plants or on the production of a desired molecule, e.g. a certain fatty acid, can be determined by growing the plant under suitable conditions, e.g. as described below, and analysing the growth media and/or the cellular components for enhanced production of the desired molecule, e.g. lipids or a certain fatty acid. Lipids can be extracted as described in the standard literature including Ullman, Encyclopedia of Industrial Chemistry, Bd. A2, S. 89-90 und S. 443-613, VCH: Weinheim (1985); Fallon, A., et al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, Bd. 17; Rehm et al. (1993) Biotechnology, Bd. 3, Kapitel III: "Product recovery and purification", S. 469-714, VCH: Weinheim; Belter, P. A., et al. (1988) Bioseparations: downstream processing for Biotechnology, John Wiley and Sons; Kennedy, J. F., und Cabral, J. M. S. (1992) Recovery processes for biological Materials, John Wiley and Sons; Shaeiwitz, J. A., und Henry, J. D. (1988) Biochemical Separations, in: Ullmann's Encyclopedia of Industrial Chemistry, Bd. B3; Kapitel 11, S. 1-27, VCH: Weinheim; und Dechow, F. J. (1989) Separation and purification techniques in biotechnology, Noyes Publications.

Alternatively, extraction will be carried out as described in Cahoon et al. (1999) Proc. Natl. Acad. Sci. USA 96 (22):12935-12940, und Browse et al. (1986) Analytic Biochemistry 152:141-145. Quantitative and qualitative analysis of lipids or fatty acids are described in Christie, William W., Advances in Lipid Methodology, Ayr/Scotland: Oily Press (Oily Press Lipid Library; 2); Christie, William W., Gas Chromatography and Lipids. A Practical Guide--Ayr, Scotland: Oily Press, 1989, Repr. 1992, IX, 307 S. (Oily Press Lipid Library; 1); "Progress in Lipid Research, Oxford: Pergamon Press, 1 (1952)-16 (1977) u.d.T.: Progress in the Chemistry of Fats and Other Lipids CODEN.

The binary T-plasmids described in example 4 were transformed into rapeseed (Brassica napus) as described in example 5. After selection of transgenic plants using PCR, plats were grown until development of mature seeds (Day/night cycle: 16 h at 200 mE and 21.degree. C., 8 h at darkness and 19.degree. C.). Fatty acids from harvested seeds were extracted and analysed using gas chromatography. Based on the analysed lipids, the effect of the NEENAs on expression of desaturases and elongases can be determined since the lipid pattern of successfully transformed plant seeds will differ from the pattern of control plant seeds, e.g. of plants expressing a set of desaturases and elongases without the enhancing effect of NEENAs. Table 7 shows results of single seed measurements of the five best performing transgenic lines obtained for each binary T-plasmid. Table 8 shows the nomenclature for the fatty acids listed in the header of table 3.

Surprisingly, transgenic plants obtained from transformations with construct VC-VC-LJB1327-1qcz (SEQ-ID 39) VC-LJB2003-1qcz (SEQ-ID 40) and VC-LJB2197-1qcz (SEQ-ID 146) showed a much higher ARA to GLA ratio compared to plants transformed with VC-LJB913-1qcz (SEQ-ID 38) and was highest for plants transformed with VC-LJB2003-1qcz (ARA:GLA ratio of up to 53.3). Such a ratio is beneficial if GLA is not desired. Even more surprising was that plants of constructs VC-LJB2003-1qcz and VC-LJB2197-1qcz (incorporating NEENAs) reached higher ARA levels than VC-LJB913-1qcz and VC-LJB1327-1qcz (maximal for VC-LJB913-1qcz: 25.6%; VC-LJB1327-1qcz: 22%, VC-LJB2003-1qcz: 28.7% and for VC-LJBV2197-1qcz: 33.1%), despite removal of the expression module expressing the enzyme d6Des(Pir_GAI) compared to VC-LJB913-1qcz transformed plants.

TABLE-US-00008 TABLE 7 Gaschromatographical anaylsis of the fatty acid composition of seedoil from transgenic rapeseed plants. Sample name 16:0 16:1n-7 16:3n-3 18:0 18:1n-9 18:2n-9 18:2n-6 18:3n-6 18:3- n-3 18:4n-3 20:0 20:1n-9 20:2n-6 LJB2197_169_37 2.9 0.0 0.0 2.0 17.9 0.9 25.1 1.2 3.8 0.0 0.5 0.7 2.5 LJB2197_169_5 3.2 0.0 0.0 2.0 16.3 1.2 25.8 2.1 4.5 0.2 0.6 0.6 1.5 LJB2197_169_11 3.0 0.0 0.0 2.1 17.5 0.9 27.6 1.6 4.1 0.0 0.6 0.6 1.5 LJB2197_169_51 3.1 0.0 0.0 2.2 17.5 0.9 27.6 1.6 4.1 0.0 0.6 0.6 1.5 LJB2197_169_9 3.4 0.0 0.0 2.2 18.3 1.9 25.9 3.1 4.0 0.2 0.6 0.6 1.1 LJB2197_169_22 3.2 0.0 0.0 2.4 17.7 0.7 28.5 1.7 3.6 0.2 0.7 0.8 0.8 LJB2197_169_36 3.5 0.0 0.0 2.3 17.1 0.6 29.5 1.5 3.8 0.2 0.7 0.8 1.0 LJB2197_169_40 3.4 0.0 0.0 2.4 18.2 1.2 28.6 2.8 3.4 0.2 0.7 0.7 0.8 LJB2197_169_42 3.5 0.0 0.0 2.1 18.4 0.7 27.2 1.5 4.3 0.2 0.6 0.8 1.0 LJB2197_169_26 3.7 0.0 0.0 2.3 19.3 1.3 27.4 2.7 4.0 0.3 0.7 0.7 0.6 LJB2197_169_61 3.7 0.0 0.0 2.7 20.1 1.1 28.5 2.2 3.2 0.2 0.8 0.9 1.1 LJB2197_169_14 3.3 0.0 0.0 1.7 18.0 0.7 30.9 1.5 4.9 0.2 0.6 0.7 1.1 LJB2197_169_16 3.3 0.0 0.0 2.2 20.3 0.7 28.3 1.2 4.5 0.1 0.7 0.8 0.8 LJB2197_169_65 3.7 0.1 0.0 2.7 20.1 1.2 29.1 2.3 3.8 0.2 0.7 0.7 0.8 LJB2197_169_7 3.1 0.0 0.0 2.3 18.6 0.5 30.1 1.1 4.1 0.1 0.7 0.9 1.8 LJB2197_169_34 3.3 0.0 0.0 2.5 20.9 0.8 28.8 1.3 4.2 0.2 0.8 0.8 0.8 LJB2197_169_47 3.2 0.0 0.0 2.1 18.0 0.9 33.4 1.7 3.9 0.1 0.7 0.7 0.7 LJB2197_169_24 3.2 0.0 0.0 2.2 18.6 0.5 30.0 1.2 4.4 0.1 0.7 0.8 1.5 LJB2197_169_31 3.2 0.0 0.0 1.8 19.4 0.6 31.1 1.4 4.2 0.1 0.6 0.8 1.3 LJB2197_169_73 3.7 0.0 0.0 2.9 18.7 0.8 31.2 1.7 4.5 0.0 0.8 0.7 0.7 LJB2197_169_21 3.3 0.0 0.0 2.4 19.5 0.7 30.5 1.3 4.2 0.1 0.7 0.8 0.9 LJB2197_169_29 3.2 0.0 0.0 2.2 19.6 0.6 29.7 1.3 4.0 0.1 0.7 0.9 1.5 LJB2003_110_11 3.0 0.0 0.0 2.6 15.7 0.2 32.1 0.6 2.8 0.0 0.7 1.0 4.8 LJB2003_110_17 3.3 0.0 0.0 2.7 16.5 0.1 31.4 0.5 2.7 0.0 0.7 1.1 5.6 LJB2003_110_16 3.3 0.1 0.0 3.2 17.4 0.2 32.6 0.5 2.6 0.0 0.8 1.1 5.1 LJB2003_8_54 3.5 0.1 0.0 2.5 19.4 0.8 36.2 2.3 3.3 0.2 0.8 0.7 0.4 LJB2003_8_7 3.3 0.1 0.0 2.8 19.4 0.8 35.1 2.3 3.7 0.2 0.8 0.8 0.5 LJB2003_53_11 2.7 0.0 0.0 2.1 14.0 0.3 38.0 0.7 5.3 0.0 0.7 0.7 1.6 LJB2003_110_49 3.9 0.0 0.0 3.4 18.6 0.3 34.9 0.5 2.5 0.0 0.8 1.1 4.4 LJB2003_53_37 3.2 0.0 0.0 3.4 16.0 0.4 36.4 1.0 3.5 0.0 0.8 0.7 1.3 LJB2003_8_49 3.4 0.1 0.0 2.7 20.0 0.9 37.1 2.1 3.4 0.1 0.8 0.7 0.5 LJB2003_8_23 3.6 0.1 0.0 3.0 20.7 1.0 33.6 2.9 4.0 0.3 0.8 0.8 0.5 LJB2003_8_42 3.6 0.1 0.0 2.6 20.7 0.8 35.3 2.4 3.8 0.2 0.7 0.7 0.5 LJB2003_8_57 3.7 0.1 0.0 3.0 20.8 1.0 36.0 2.3 3.1 0.2 0.9 0.7 0.4 LJB2003_53_34 2.8 0.0 0.0 2.6 16.4 0.3 39.3 0.8 4.2 0.0 0.7 0.7 1.7 LJB2003_54_13 3.7 0.1 0.0 2.3 17.9 0.5 39.5 1.3 4.0 0.1 0.8 0.7 0.8 LJB2003_8_58 3.7 0.1 0.0 2.5 23.6 0.9 34.1 2.1 3.5 0.2 0.7 0.8 0.3 LJB2003_8_62 3.7 0.1 0.0 2.5 21.3 0.8 35.6 2.2 3.9 0.2 0.7 0.7 0.4 LJB2003_110_25 3.2 0.0 0.0 3.2 20.1 0.2 34.7 0.4 2.9 0.0 0.9 1.1 3.9 LJB2003_54_17 3.4 0.2 0.0 2.4 18.2 0.4 39.5 1.1 4.2 0.1 0.8 0.7 1.0 LJB2003_8_19 3.6 0.1 0.0 3.1 20.6 0.9 36.9 2.5 3.1 0.2 0.8 0.8 0.4 LJB2003_53_23 3.4 0.2 0.0 2.3 18.0 0.2 37.0 0.7 4.3 0.1 0.6 0.8 2.0 LJB2003_8_68 3.5 0.1 0.0 2.8 20.8 0.8 36.4 2.2 3.7 0.2 0.8 0.7 0.4 LJB1327_305_31 3.7 0.1 0.0 2.8 21.0 1.3 35.3 3.4 3.1 0.2 0.9 0.7 0.2 LJB1327_305_48 4.3 0.1 0.0 2.2 19.5 0.9 37.5 1.9 4.2 0.1 0.7 0.6 0.2 LJB1327_305_32 4.0 0.0 0.0 2.1 18.8 0.7 39.2 1.8 4.2 0.1 0.8 0.6 0.2 LJB1327_458_92 3.3 0.0 0.0 2.0 17.8 0.9 39.1 2.1 4.6 0.2 0.8 0.7 0.2 LJB1327_305_38 4.0 0.1 0.0 2.7 19.7 1.0 36.9 2.9 4.1 0.3 0.9 0.6 0.2 LJB1327_305_43 4.0 0.1 0.0 2.6 19.2 1.0 37.2 2.2 4.0 0.1 0.9 0.6 0.2 LJB1327_305_45 3.9 0.1 0.0 2.7 19.9 0.9 37.3 2.4 4.3 0.2 0.9 0.6 0.2 LJB1327_305_30 3.9 0.1 0.0 2.7 22.0 1.0 36.4 2.5 3.5 0.2 0.9 0.7 0.2 LJB1327_305_35 4.2 0.1 0.0 2.7 20.3 1.0 38.0 2.2 3.7 0.2 0.9 0.6 0.2 LJB1327_305_37 4.3 0.0 0.0 3.0 19.7 1.1 38.8 2.6 3.2 0.2 1.1 0.6 0.2 LJB1327_305_47 4.1 0.1 0.0 2.4 20.4 1.1 38.3 2.4 3.8 0.2 0.8 0.6 0.2 LJB1327_305_34 3.9 0.0 0.0 2.8 18.9 1.0 39.0 2.6 3.6 0.2 1.1 0.6 0.1 LJB1327_305_44 4.1 0.1 0.0 2.9 20.3 0.9 38.0 2.3 4.3 0.2 0.9 0.6 0.2 LJB1327_458_94 4.0 0.0 0.0 2.1 18.8 0.8 37.1 2.2 5.9 0.3 0.8 0.6 0.2 LJB1327_305_50 4.0 0.0 0.0 2.4 19.6 0.8 40.3 2.2 4.2 0.2 0.9 0.6 0.2 LJB1327_305_42 3.7 0.1 0.0 2.5 23.6 1.1 37.0 2.4 3.8 0.2 0.8 0.7 0.2 LJB1327_305_54 4.4 0.1 0.0 3.4 21.5 1.4 37.4 2.8 2.7 0.1 1.3 0.8 0.6 LJB1327_305_41 4.2 0.1 0.0 2.5 22.4 1.0 38.6 2.0 3.6 0.1 0.8 0.6 0.2 LJB1327_305_40 3.9 0.0 0.0 2.5 21.1 0.9 39.4 2.0 4.3 0.2 0.8 0.6 0.2 LJB1327_305_55 4.5 0.1 0.0 3.3 21.9 1.3 37.7 2.0 3.3 0.2 1.2 0.7 0.7 LJB1327_305_33 4.2 0.1 0.0 2.7 23.8 1.1 37.0 2.1 3.7 0.2 0.9 0.7 0.2 LJB913_64-13a 4.4 0.0 0.0 3.9 11.3 0.0 21.7 11.7 3.7 0.7 1.1 0.9 3.7 LJB913_64_9 3.8 0.0 0.2 2.7 9.8 0.0 21.8 12.7 4.3 0.8 0.9 1.0 4.5 LJB913_64_3 4.2 0.1 0.2 3.6 12.0 0.0 22.4 11.7 3.5 0.7 1.0 1.2 5.7 LJB913_64_20 3.5 0.2 0.1 3.3 14.1 0.1 25.9 8.7 3.0 0.5 0.9 1.2 5.0 LJB913_64_8 3.7 0.1 0.2 3.0 13.9 0.2 24.1 16.4 3.7 1.1 0.9 0.8 2.0 LJB913_91_5 3.5 0.1 0.1 2.8 15.7 0.1 27.1 9.0 4.9 0.5 0.8 0.9 3.1 LJB913_64_22 4.8 0.2 0.1 4.0 13.4 0.0 25.9 9.3 3.9 0.7 1.2 1.0 4.3 LJB913_64_23 4.5 0.1 0.1 3.9 13.4 0.0 25.0 9.9 3.9 0.7 1.1 1.1 5.2 LJB913_64-07a 4.2 0.0 0.0 4.5 13.7 0.0 25.9 7.3 4.4 0.0 1.3 1.4 7.6 LJB913_91_4 4.1 0.2 0.2 3.7 16.2 0.2 32.4 5.2 6.1 0.4 1.0 0.7 1.7 LJB913_64-05a 4.2 0.0 0.0 4.8 14.0 0.0 25.3 8.0 4.8 0.5 1.3 1.3 5.8 LJB913_64_10 3.9 0.0 0.1 4.6 15.0 0.0 27.3 6.0 4.5 0.3 1.2 1.3 6.2 LJB913_64_13 3.9 0.1 0.1 3.5 15.0 0.1 25.1 9.4 4.5 0.5 0.9 1.1 4.5 LJB913_91_14 3.6 0.0 0.2 3.5 17.0 0.1 26.6 9.3 5.1 0.5 0.9 0.9 2.8 LJB913_64-12a 4.8 0.0 0.0 4.8 13.9 0.0 24.1 7.1 5.0 0.0 1.4 1.3 7.7 LJB913_91_28 4.2 0.0 0.2 4.0 17.1 0.0 27.4 7.5 5.9 0.4 1.1 0.9 2.9 LJB913_91_20 3.2 0.1 0.1 3.0 18.7 0.1 28.9 7.2 4.7 0.3 0.7 0.9 2.5 LJB913_64_17 4.7 0.1 0.1 4.3 14.3 0.0 27.0 9.6 3.8 0.5 1.1 1.0 4.0 LJB913_91_18 3.6 0.0 0.1 4.0 17.8 0.1 31.0 6.1 4.6 0.3 1.0 0.9 2.5 LJB913_64_14 4.0 0.0 0.3 4.2 14.9 0.0 26.2 8.9 5.5 0.7 1.1 1.0 3.9 LJB913_91_3 3.8 0.1 0.2 3.1 18.1 0.0 29.7 6.5 6.8 0.5 0.9 0.8 1.9 20:4n-6 Ratio Ratio Ratio Ratio Sample name 20:3n-6 20:3n-3 (ARA) 20:4n-3 20:5n-3 22:0 ARA:GLA ARA:DGLA L- A:ALA ARA:EPA LJB2197_169_37 3.0 0.0 33.1 0.5 5.9 0.0 27.0 11.2 6.7 5.6 LJB2197_169_5 2.8 0.0 32.1 0.5 6.7 0.0 15.2 11.5 5.8 4.8 LJB2197_169_11 3.3 0.0 31.2 0.5 5.5 0.0 19.9 9.4 6.7 5.7 LJB2197_169_51 3.3 0.0 31.1 0.5 5.5 0.0 19.8 9.3 6.7 5.7 LJB2197_169_9 2.0 0.0 30.2 0.4 5.7 0.3 9.9 14.9 6.5 5.3 LJB2197_169_22 3.8 0.0 29.8 0.6 5.3 0.4 18.0 7.9 8.0 5.7 LJB2197_169_36 3.2 0.0 29.5 0.5 5.5 0.4 19.8 9.3 7.8 5.4 LJB2197_169_40 2.6 0.0 29.2 0.4 5.0 0.3 10.2 11.4 8.4 5.8 LJB2197_169_42 3.3 0.0 29.1 0.6 6.6 0.3 19.1 8.9 6.4 4.4 LJB2197_169_26 2.1 0.0 29.0 0.4 5.5 0.0 10.6 13.5 6.9 5.3 LJB2197_169_61 3.0 0.0 27.4 0.4 4.6 0.3 12.5 9.3 9.0 6.0 LJB2197_169_14 3.1 0.0 26.8 0.6 5.7 0.4 18.4 8.7 6.4 4.7 LJB2197_169_16 3.0 0.0 26.6 0.6 6.3 0.4 21.5 8.8 6.2 4.2 LJB2197_169_65 1.8 0.0 26.6 0.3 5.5 0.3 11.5 14.4 7.7 4.8 LJB2197_169_7 4.1 0.0 26.5 0.7 5.1 0.4 24.6 6.5 7.4 5.2 LJB2197_169_34 2.9 0.0 26.5 0.5 5.4 0.4 19.8 9.2 6.9 4.9 LJB2197_169_47 2.7 0.0 26.3 0.4 4.6 0.4 15.2 9.8 8.7 5.7 LJB2197_169_24 3.9 0.0 26.2 0.7 5.6 0.3 22.7 6.8 6.7 4.7 LJB2197_169_31 3.5 0.0 26.0 0.6 5.0 0.4 18.6 7.5 7.4 5.2 LJB2197_169_73 2.4 0.0 26.0 0.4 5.4 0.0 15.1 10.8 6.9 4.8 LJB2197_169_21 3.6 0.0 25.9 0.6 5.0 0.4 19.3 7.2 7.2 5.2 LJB2197_169_29 4.0 0.0 25.8 0.7 5.1 0.4 19.4 6.5 7.4 5.0 LJB2003_110_11 3.0 0.3 28.7 0.3 3.7 0.3 48.9 9.7 11.4 7.8 LJB2003_110_17 2.5 0.4 28.1 0.3 3.6 0.3 53.3 11.2 11.5 7.7 LJB2003_110_16 2.7 0.4 26.1 0.3 3.2 0.3 50.1 9.6 12.6 8.1 LJB2003_8_54 2.0 0.0 24.2 0.2 3.0 0.4 10.5 12.2 11.0 8.1 LJB2003_8_7 1.8 0.0 24.0 0.3 3.7 0.4 10.2 13.6 9.5 6.5 LJB2003_53_11 4.3 0.0 23.9 0.7 4.7 0.4 33.1 5.6 7.2 5.1 LJB2003_110_49 2.4 0.5 23.6 0.2 2.7 0.3 45.1 9.9 13.9 8.7 LJB2003_53_37 5.2 0.0 23.5 0.7 3.4 0.4 23.6 4.5 10.3 6.8 LJB2003_8_49 1.7 0.0 22.8 0.2 2.9 0.4 11.1 13.1 11.0 7.9 LJB2003_8_23 1.4 0.0 22.8 0.2 3.8 0.4 7.8 16.5 8.4 6.1 LJB2003_8_42 1.6 0.0 22.6 0.2 3.7 0.4 9.6 14.1 9.3 6.0 LJB2003_8_57 1.8 0.0 22.6 0.2 2.8 0.5 9.8 12.6 11.8 8.0 LJB2003_53_34 4.1 0.0 22.5 0.5 3.1 0.4 28.5 5.5 9.4 7.2 LJB2003_54_13 1.9 0.0 22.4 0.2 3.2 0.5 17.4 11.9 9.8 6.9 LJB2003_8_58 1.4 0.0 22.3 0.2 3.4 0.3 10.7 16.3 9.9 6.5 LJB2003_8_62 1.4 0.0 22.2 0.2 3.6 0.4 10.2 15.4 9.1 6.3 LJB2003_110_25 3.2 0.4 22.2 0.4 3.0 0.3 49.8 7.0 12.1 7.5 LJB2003_54_17 2.1 0.0 21.9 0.3 3.4 0.4 20.5 10.7 9.5 6.5 LJB2003_8_19 1.5 0.0 21.9 0.2 2.9 0.4 8.7 14.6 11.7 7.6 LJB2003_53_23 3.6 0.2 21.9 0.6 3.8 0.4 31.0 6.1 8.5 5.7 LJB2003_8_68 1.7 0.0 21.8 0.2 3.4 0.4 9.9 13.1 9.9 6.4 LJB1327_305_31 1.5 0.9 22.0 0.1 2.2 0.5 6.4 15.1 11.4 9.8 LJB1327_305_48 2.1 0.7 21.6 0.2 2.8 0.5 11.5 10.4 8.9 7.8 LJB1327_305_32 1.7 1.2 21.4 0.2 2.5 0.6 11.7 12.9 9.3 8.7 LJB1327_458_92 2.0 1.4 21.2 0.2 3.1 0.6 10.2 10.4 8.6 6.9 LJB1327_305_38 1.7 0.6 20.9 0.2 2.8 0.6 7.2 12.6 9.0 7.5 LJB1327_305_43 3.1 0.8 20.8 0.3 2.4 0.6 9.5 6.8 9.3 8.7 LJB1327_305_45 1.7 0.9 20.7 0.2 2.7 0.6 8.6 12.0 8.7 7.7 LJB1327_305_30 1.6 0.6 20.6 0.2 2.5 0.5 8.3 13.1 10.3 8.3 LJB1327_305_35 1.5 0.8 20.6 0.2 2.3 0.5 9.3 14.1 10.4 9.0 LJB1327_305_37 1.4 0.7 20.5 0.1 1.9 0.6 7.9 14.9 12.2 10.9 LJB1327_305_47 1.4 0.7 20.4 0.1 2.2 0.5 8.5 14.4 10.0 9.3 LJB1327_305_34 1.7 1.2 20.4 0.2 2.1 0.7 8.0 11.7 10.7 9.9 LJB1327_305_44 1.4 0.7 19.9 0.1 2.5 0.6 8.5 14.2 8.9 8.0 LJB1327_458_94 2.2 1.5 19.3 0.3 3.5 0.5 8.7 8.9 6.3 5.5 LJB1327_305_50 1.5 0.7 19.2 0.2 2.4 0.6 8.8 12.6 9.7 8.0 LJB1327_305_42 1.1 0.7 19.2 0.2 2.4 0.5 8.1 16.8 9.7 8.0 LJB1327_305_54 1.5 0.7 19.1 0.0 1.6 0.6 6.8 12.9 13.9 11.8 LJB1327_305_41 1.3 0.7 19.1 0.2 2.3 0.5 9.6 14.6 10.7 8.3 LJB1327_305_40 1.3 0.7 18.8 0.2 2.6 0.5 9.2 14.5 9.1 7.1 LJB1327_305_55 1.4 0.9 18.6 0.0 1.7 0.5 9.3 13.7 11.3 11.1 LJB1327_305_33 1.3 0.8 18.6 0.1 2.1 0.6 8.9 14.6 10.1 8.8 LJB913_64-13a 6.7 0.0 25.6 0.7 3.8 0.0 2.2 3.8 5.9 6.7 LJB913_64_9 8.7 0.6 23.6 1.0 3.8 0.0 1.8 2.7 5.1 6.1 LJB913_64_3 6.5 0.7 22.0 0.7 3.5 0.5 1.9 3.4 6.5 6.4 LJB913_64_20 7.4 0.5 21.2 0.8 3.2 0.4 2.4 2.9 8.5 6.6 LJB913_64_8 5.8 0.0 20.4 0.7 3.1 0.0 1.2 3.5 6.6 6.6 LJB913_91_5 6.0 0.4 20.3 0.7 3.5 0.4 2.2 3.4 5.5 5.8 LJB913_64_22 6.0 0.6 19.8 0.8 3.3 0.7 2.1 3.3 6.6 6.0 LJB913_64_23 6.1 0.7 19.5 0.8 3.4 0.5 2.0 3.2 6.4 5.8 LJB913_64-07a 6.2 1.0 19.4 0.0 3.1 0.0 2.7 3.1 5.9 6.3 LJB913_91_4 4.7 0.0 19.4 0.6 3.4 0.0 3.7 4.1 5.3 5.7 LJB913_64-05a 7.0 0.0 19.1 0.8 3.2 0.0 2.4 2.7 5.2 6.0 LJB913_64_10 6.4 0.7 18.9 0.6 2.5 0.5 3.2 3.0 6.0 7.6 LJB913_64_13 7.8 0.6 18.7 1.0 3.1 0.0 2.0 2.4 5.6 6.0 LJB913_91_14 6.5 0.4 18.7 0.7 3.1 0.0 2.0 2.9 5.2 6.0 LJB913_64-12a 6.5 1.2 18.5 0.0 3.5 0.0 2.6 2.8 4.8 5.2 LJB913_91_28 6.5 0.0 18.4 0.7 2.9 0.0 2.4 2.8 4.7 6.3 LJB913_91_20 7.1 0.3 18.3 0.8 2.9 0.0 2.5 2.6 6.1 6.3 LJB913_64_17 6.5 0.5 18.2 0.7 2.9 0.6 1.9 2.8 7.1 6.2 LJB913_91_18 5.6 0.3 18.2 0.6 2.8 0.5 3.0 3.2 6.8 6.6 LJB913_64_14 6.5 0.6 17.8 0.9 3.5 0.0 2.0 2.7 4.7 5.1 LJB913_91_3 5.3 0.0 17.7 0.8 3.7 0.0 2.7 3.3 4.4 4.8

TABLE-US-00009 TABLE 8 Used Nomenclature Fatty acid Nomenclature Oleic acid 18:1.DELTA.9 18:1n - 9 Linoleic acid 18:2.DELTA.6, 12 18:2n - 6 .alpha.-Linolenic acid 18:3.DELTA.9, 12, 15 .alpha.18:3n - 3 .gamma.-Linolenic acid 18:3.DELTA.6, 9, 12 .gamma.18:3n - 6 Stearidonic acid 18:4.DELTA.6, 9, 12, 15 18:4n - 3 Dihomo-.gamma.-linolenic acid 20:3.DELTA.8, 11, 14 20:3n - 6 Eicosatrienoic acid 20:3.DELTA.11, 14, 17 20:3n - 3 iso-Arachidonic acid 20:4.DELTA.8, 11, 14, 17 20:4n - 3 Arachidonic acid 20:4.DELTA.5, 8, 11, 14 20:4n - 6 Eicosapentaenoic acid 20:5.DELTA.5, 8, 11, 14, 17 20:5n - 3

SEQUENCE LISTINGS

1

15512646DNAArtificial Sequencep-VfSBP-NEENAss1 expression element 1tcgacggccc ggactgtatc caacttctga tctttgaatc tctctgttcc aacatgttct 60gaaggagttc taagactttt cagaaagctt gtaacatgct ttgtagactt tctttgaatt 120actcttgcaa actctgattg aacctacgtg aaaactgctc cagaagttct aaccaaattc 180cgtcttggga aggcccaaaa tttattgagt acttcagttt catggacgtg tcttcaaaga 240tttataactt gaaatcccat catttttaag agaagttctg ttccgcaatg tcttagatct 300cattgaaatc tacaactctt gtgtcagaag ttcttccaga atcaacttgc atcatggtga 360aaatctggcc agaagttctg aacttgtcat atttcttaac agttagaaaa atttctaagt 420gtttagaatt ttgacttttc caaagcaaac ttgacttttg actttcttaa taaaacaaac 480ttcatattct aacatgtctt gatgaaatgt gattcttgaa atttgatgtt gatgcaaaag 540tcaaagtttg acttttcagt gtgcaattga ccattttgct cttgtgccaa ttccaaacct 600aaattgatgt atcagtgctg caaacttgat gtcatggaag atcttatgag aaaattcttg 660aagactgaga ggaaaaattt tgtagtacaa cacaaagaat cctgtttttc atagtcggac 720tagacacatt aacataaaac accacttcat tcgaagagtg attgaagaag gaaatgtgca 780gttacctttc tgcagttcat aagagcaact tacagacact tttactaaaa tactacaaag 840aggaagattt taacaactta gagaagtaat gggagttaaa gagcaacaca ttaaggggga 900gtgttaaaat taatgtgttg taaccaccac tacctttagt aagtattata agaaaattgt 960aatcatcaca ttataattat tgtccttatt taaaattatg ataaagttgt atcattaaga 1020ttgagaaaac caaatagtcc tcgtcttgat ttttgaatta ttgttttcta tgttactttt 1080cttcaagcct atataaaaac tttgtaatgc taaattgtat gctggaaaaa aatgtgtaat 1140gaattgaata gaaattatgg tatttcaaag tccaaaatcc atcaatagaa atttagtaca 1200aaacgtaact caaaaatatt ctcttatttt aaattttaca acaatataaa aatattctct 1260tattttaaat tttacaataa tataatttat cacctgtcac ctttagaata ccaccaacaa 1320tattaatact tagatatttt attcttaata attttgagat ctctcaatat atctgatatt 1380tattttatat ttgtgtcata ttttcttatg ttttagagtt aacccttata tcttggtcaa 1440actagtaatt caatatatga gtttgtgaag gacacattga catcttgaaa cattggtttt 1500aaccttgttg gaatgttaaa ggtaataaaa cattcagaat tatgaccatc tattaatata 1560cttcctttgt cttttaaaaa agtgtgcatg aaaatgctct atggtaagct agagtgtctt 1620gctggcctgt gtatatcaat tccatttcca gatggtagaa actgccacta cgaataatta 1680gtcataagac acgtatgtta acacacgtcc ccttgcatgt tttttgccat atattccgtc 1740tctttctttt tcttcacgta taaaacaatg aactaattaa tagagcgatc aagctgaact 1800ggtgcttaaa cactctggtg agttctagta cttctgctat gatcgatctc attaccattt 1860cttaaatttc tctccctaaa tattccgagt tcttgatttt tgataacttc aggttttctc 1920tttttgataa atctggtctt tccatttttt tttttttgtg gttaatttag tttcctatgt 1980tcttcgattg tattatgcat gatctgtgtt tggattctgt tagattatgt attggtgaat 2040atgtatgtgt ttttgcatgt ctggttttgg tcttaaaaat gttcaaatct gatgatttga 2100ttgaagcttt tttagtgttg gtttgattct tctcaaaact actgttaatt tactatcatg 2160ttttccaact ttgattcatg atgacacttt tgttctgctt tgttataaaa ttttggttgg 2220tttgattttg taattatagt gtaattttgt taggaatgaa catgttttaa tactctgttt 2280tcgatttgtc acacattcga attattaatc gataatttaa ctgaaaattc atggttctag 2340atcttgttgt catcagatta tttgtttcga taattcatca aatatgtagt ccttttgctg 2400atttgcgact gtttcatttt ttctcaaaat tgttttttgt taagtttatc taacagttat 2460cgttgtcaaa agtctctttc attttgcaaa atcttctttt tttttttgtt tgtaactttg 2520ttttttaagc tacacattta gtctgtaaaa tagcatcgag gaacagttgt cttagtagac 2580ttgcatgttc ttgtaacttc tatttgtttc agtttgttga tgactgcttt gattttgtag 2640gtcaaa 264621119DNAArtificial Sequencep-BnNapin-NEENAss2 expression element 2taaggatgac ctacccattc ttgagacaaa tgttacattt tagtatcaga gtaaaatgtg 60tacctataac tcaaattcga ttgacatgta tccattcaac ataaaattaa accagcctgc 120acctgcatcc acatttcaag tattttcaaa ccgttcggct cctatccacc gggtgtaaca 180agacggattc cgaatttgga agattttgac tcaaattccc aatttatatt gaccgtgact 240aaatcaactt taacttctat aattctgatt aagctcccaa tttatattcc caacggcact 300acctccaaaa tttatagact ctcatcccct tttaaaccaa cttagtaaac gttttttttt 360taattttatg aagttaagtt tttaccttgt ttttaaaaag aatcgttcat aagatgccat 420gccagaacat tagctacacg ttacacatag catgcagccg cggagaattg tttttcttcg 480ccacttgtca ctcccttcaa acacctaaga gcttctctct cacagcacac acatacaatc 540acatgcgtgc atgcattatt acacgtgatc gccatgcaaa tctcctttat agcctataaa 600ttaactcatc ggcttcactc tttactcaaa ccaaaactca tcaatacaaa caagattaaa 660aacaagttct ttgctttcga agttgccgca acctaaacag gtttttcctt cttctttctt 720cttattaact acgaccttgt cctttgccta tgtaaaatta ctaggttttc atcagttaca 780ctgattaagt tcgttatagt ggaagataaa atgccctcaa agcattttgc aggatatctt 840tgatttttca aagatatgga actgtagagt ttgatagtgt tcttgaatgt ggttgcatga 900agtttttttg gtctgcatgt tattttttcc tcgaaatatg ttttgagtcc aacaagtgat 960tcacttggga ttcagaaagt tgttttctca atatgtaaca gtttttttct atggagaaaa 1020atcataggga ccgttggttt tggcttcttt aattttgagc tcagattaaa cccattttac 1080ccggtgttct tggcagaatt gaaaacagta cgtagtacc 111931441DNAArtificial Sequencep-LuCnl-NEENAss14 expression element 3ttagcagata tttggtgtct aaatgtttat tttgtgatat gttcatgttt gaaatggtgg 60tttcgaaacc agggacaacg ttgggatctg atagggtgtc aaagagtatt atggattggg 120acaatttcgg tcatgagttg caaattcaag tatatcgttc gattatgaaa attttcgaag 180aatatcccat ttgagagagt ctttacctca ttaatgtttt tagattatga aattttatca 240tagttcatcg tagtcttttt ggtgtaaagg ctgtaaaaag aaattgttca cttttgtttt 300cgtttatgtg aaggctgtaa aagattgtaa aagactattt tggtgttttg gataaaatga 360tagtttttat agattctttt gcttttagaa gaaatacatt tgaaattttt tccatgttga 420gtataaaata ccgaaatcga ttgaagatca tagaaatatt ttaactgaaa acaaatttat 480aactgattca attctctcca tttttatacc tatttaaccg taatcgattc taatagatga 540tcgatttttt atataatcct aattaaccaa cggcatgtat tggataatta accgatcaac 600tctcacccct aatagaatca gtattttcct tcgacgttaa ttgatcctac actatgtagg 660tcatatccat cgttttaatt tttggccacc attcaattct gtcttgcctt tagggatgtg 720aatatgaacg gccaaggtaa gagaataaaa ataatccaaa ttaaagcaag agaggccaag 780taagataatc caaatgtaca cttgtcattg ccaaaattag taaaatactc ggcatattgt 840attcccacac attattaaaa taccgtatat gtattggctg catttgcatg aataatacta 900cgtgtaagcc caaaagaacc cacgtgtagc ccatgcaaag ttaacactca cgaccccatt 960cctcagtctc cactatataa acccaccatc cccaatctca ccaaacccac cacacaactc 1020acaactcact ctcacacctt aaagaaccaa tcaccaccaa aaaatttcac gatttggaat 1080ttgattcctg cgatcacagg tatgacaggt tagattttgt tttgtatagt tgtatacata 1140cttctttgtg atgttttgtt tacttaatcg aatttttgga gtgttttaag gtctctcgtt 1200tagaaatcgt ggaaaatatc actgtgtgtg tgttcttatg attcacagtg tttatgggtt 1260tcatgttctt tgttttatca ttgaatggga agaaatttcg ttgggataca aatttctcat 1320gttcttactg atcgttatta ggagtttggg gaaaaaggaa gagttttttt ggttggttcg 1380agtgattatg aggttatttc tgtatttgat ttatgagtta atggtcgttt taatgttgta 1440g 144142485DNAArtificial Sequencep-LuPxr-NEENAss15 expression element 4cacgggcagg acatagggac tactacaagc atagtatgct tcagacaaag agctaggaaa 60gaactcttga tggaggttaa gagaaaaaag tgctagaggg gcatagtaat caaacttgtc 120aaaaccgtca tcatgatgag ggatgacata atataaaaag ttgactaagg tcttggtagt 180actctttgat tagtattata tattggtgag aacatgagtc aagaggagac aagaaaccga 240ggaaccatag tttagcaaca agatggaagt tgcaaagttg agctagccgc tcgattagtt 300acatctccta agcagtacta caaggaatgg tctctatact ttcatgttta gcacatggta 360gtgcggattg acaagttaga aacagtgctt aggagacaaa gagtcagtaa aggtattgaa 420agagtgaagt tgatgctcga caggtcagga gaagtccctc cgccagatgg tgactaccaa 480ggggttggta tcagctgaga cccaaataag attcttcggt tgaaccagtg gttcgaccga 540gactcttagg gtgggatttc actgtaagat ttgtgcattt tgttgaatat aaattgacaa 600ttttttttat ttaattatag attatttaga atgaattaca tatttagttt ctaacaagga 660tagcaatgga tgggtatggg tacaggttaa acatatctat tacccaccca tctagtcgtc 720gggttttaca cgtacccacc cgtttacata aaccagaccg gaattttaaa ccgtacccgt 780ccgttagcgg gtttcagatt tacccgttta atcgggtaaa acctgattac taaatatata 840ttttttattt gataaacaaa acaaaaatgt taatattttc atattggatg caattttaag 900aaacacatat tcataaattt ccatatttgt aggaaaataa aaagaaaaat atattcaaga 960acacaaattt caccgacatg acttttatta cagagttgga attagatcta acaattgaaa 1020aattaaaatt aagatagaat atgttgagga acatgacata gtataatgct gggttacccg 1080tcgggtaggt atcgaggcgg atactactaa atccatccca ctcgctatcc gataatcact 1140ggtttcgggt atacccattc ccgtcaacag gcctttttaa ccggataatt tcaacttata 1200gtgaatgaat tttgaataaa tagttagaat accaaaatcc tggattgcat ttgcaatcaa 1260attttgtgaa ccgttaaatt ttgcatgtac ttgggataga tataatagaa ccgaattttc 1320attagtttaa tttataactt actttgttca aagaaaaaaa atatctatcc aatttactta 1380taataaaaaa taatctatcc aagttactta ttataatcaa cttgtaaaaa ggtaagaata 1440caaatgtggt agcgtacgtg tgattatatg tgacgaaatg ttatatctaa caaaagtcca 1500aattcccatg gtaaaaaaaa tcaaaatgca tggcaggctg tttgtaacct tggaataaga 1560tgttggccaa ttctggagcc gccacgtacg caagactcag ggccacgttc tcttcatgca 1620aggatagtag aacaccactc cacccacctc ctatattaga cctttgccca accctcccca 1680actttcccat cccatccaca aagaaaccga catttttatc ataaatcagg gtttcgtttt 1740tgtttcatcg ataaactcaa aggtgatgat tttagggtct tgtgagtgtg cttttttgtt 1800tgattctact gtagggttta tgttctttag ctcataggtt ttgtgtattt cttagaaatg 1860tggcttcttt aatctctggg tttgtgactt tttgtgtggt ttctgtgttt ttcatatcaa 1920aaacctattt tttccgagtt tttttttaca aattcttact ctcaagcttg aatacttcac 1980atgcagtgtt cttttgtaga ttttagagtt aatgtgttaa aaagtttgga tttttcttgc 2040ttatagagct tcttcacttt gattttgtgg gtttttttgt tttaaaggtg agatttttga 2100tgaggttttt gcttcaaaga tgtcaccttt ctgggtttgt cttttgaata aagctatgaa 2160ctgtcacatg gctgacgcaa ttttgttact atgtcatgaa agctgacgtt tttccgtgtt 2220atacatgttt gcttacactt gcatgcgtca aaaaaattgg ggctttttag ttttagtcaa 2280agattttact tctcttttgg gatttatgaa ggaaagttgc aaactttctc aaattttacc 2340atttttgctt tgatgtttgt ttagattgcg acagaacaaa ctcatatatg ttgaaatttt 2400tgcttggttt tgtataggat tgtgtctttt gcttataaat gttgaaatct gaactttttt 2460tttgtttggt ttctttgagc aggag 24855936DNAArtificial Sequencep-VfUSP-NEENAss18 expression element 5ctgcagcaaa tttacacatt gccactaaac gtctaaaccc ttgtaatttg tttttgtttt 60actatgtgtg ttatgtattt gatttgcgat aaatttttat atttggtact aaatttataa 120caccttttat gctaacgttt gccaacactt agcaatttgc aagttgatta attgattcta 180aattattttt gtcttctaaa tacatatact aatcaactgg aaatgtaaat atttgctaat 240atttctacta taggagaatt aaagtgagtg aatatggtac cacaaggttt ggagatttaa 300ttgttgcaat gctgcatgga tggcatatac accaaacatt caataattct tgaggataat 360aatggtacca cacaagattt gaggtgcatg aacgtcacgt ggacaaaagg tttagtaatt 420tttcaagaca acaatgttac cacacacaag ttttgaggtg catgcatgga tgccctgtgg 480aaagtttaaa aatattttgg aaatgatttg catggaagcc atgtgtaaaa ccatgacatc 540cacttggagg atgcaataat gaagaaaact acaaatttac atgcaactag ttatgcatgt 600agtctatata atgaggattt tgcaatactt tcattcatac acactcacta agttttacac 660gattataatt tcttcatagc cagtactgtt taagcttcac tgtctctgaa tcggcaaagg 720taaacgtatc aattattcta caaacccttt tatttttctt ttgaattacc gtcttcattg 780gttatatgat aacttgataa gtaaagcttc aataattgaa tttgatctgt gtttttttgg 840ccttaatact aaatccttac ataagctttg ttgcttctcc tcttgtgagt tgagtgttaa 900gttgtaataa tggttcactt tcagctttag aagaaa 9366847DNAArabidopsis thaliana 6tggtgcttaa acactctggt gagttctagt acttctgcta tgatcgatct cattaccatt 60tcttaaattt ctctccctaa atattccgag ttcttgattt ttgataactt caggttttct 120ctttttgata aatctggtct ttccattttt ttttttttgt ggttaattta gtttcctatg 180ttcttcgatt gtattatgca tgatctgtgt ttggattctg ttagattatg tattggtgaa 240tatgtatgtg tttttgcatg tctggttttg gtcttaaaaa tgttcaaatc tgatgatttg 300attgaagctt ttttagtgtt ggtttgattc ttctcaaaac tactgttaat ttactatcat 360gttttccaac tttgattcat gatgacactt ttgttctgct ttgttataaa attttggttg 420gtttgatttt gtaattatag tgtaattttg ttaggaatga acatgtttta atactctgtt 480ttcgatttgt cacacattcg aattattaat cgataattta actgaaaatt catggttcta 540gatcttgttg tcatcagatt atttgtttcg ataattcatc aaatatgtag tccttttgct 600gatttgcgac tgtttcattt tttctcaaaa ttgttttttg ttaagtttat ctaacagtta 660tcgttgtcaa aagtctcttt cattttgcaa aatcttcttt ttttttttgt ttgtaacttt 720gttttttaag ctacacattt agtctgtaaa atagcatcga ggaacagttg tcttagtaga 780cttgcatgtt cttgtaactt ctatttgttt cagtttgttg atgactgctt tgattttgta 840ggtcaaa 8477455DNAArabidopsis thaliana 7agttctttgc tttcgaagtt gccgcaacct aaacaggttt ttccttcttc tttcttctta 60ttaactacga ccttgtcctt tgcctatgta aaattactag gttttcatca gttacactga 120ttaagttcgt tatagtggaa gataaaatgc cctcaaagca ttttgcagga tatctttgat 180ttttcaaaga tatggaactg tagagtttga tagtgttctt gaatgtggtt gcatgaagtt 240tttttggtct gcatgttatt ttttcctcga aatatgtttt gagtccaaca agtgattcac 300ttgggattca gaaagttgtt ttctcaatat gtaacagttt ttttctatgg agaaaaatca 360tagggaccgt tggttttggc ttctttaatt ttgagctcag attaaaccca ttttacccgg 420tgttcttggc agaattgaaa acagtacgta gtacc 4558377DNAArabidopsis thaliana 8tttcacgatt tggaatttga ttcctgcgat cacaggtatg acaggttaga ttttgttttg 60tatagttgta tacatacttc tttgtgatgt tttgtttact taatcgaatt tttggagtgt 120tttaaggtct ctcgtttaga aatcgtggaa aatatcactg tgtgtgtgtt cttatgattc 180acagtgttta tgggtttcat gttctttgtt ttatcattga atgggaagaa atttcgttgg 240gatacaaatt tctcatgttc ttactgatcg ttattaggag tttggggaaa aaggaagagt 300ttttttggtt ggttcgagtg attatgaggt tatttctgta tttgatttat gagttaatgg 360tcgttttaat gttgtag 3779758DNAArabidopsis thaliana 9agggtttcgt ttttgtttca tcgataaact caaaggtgat gattttaggg tcttgtgagt 60gtgctttttt gtttgattct actgtagggt ttatgttctt tagctcatag gttttgtgta 120tttcttagaa atgtggcttc tttaatctct gggtttgtga ctttttgtgt ggtttctgtg 180tttttcatat caaaaaccta ttttttccga gttttttttt acaaattctt actctcaagc 240ttgaatactt cacatgcagt gttcttttgt agattttaga gttaatgtgt taaaaagttt 300ggatttttct tgcttataga gcttcttcac tttgattttg tgggtttttt tgttttaaag 360gtgagatttt tgatgaggtt tttgcttcaa agatgtcacc tttctgggtt tgtcttttga 420ataaagctat gaactgtcac atggctgacg caattttgtt actatgtcat gaaagctgac 480gtttttccgt gttatacatg tttgcttaca cttgcatgcg tcaaaaaaat tggggctttt 540tagttttagt caaagatttt acttctcttt tgggatttat gaaggaaagt tgcaaacttt 600ctcaaatttt accatttttg ctttgatgtt tgtttagatt gcgacagaac aaactcatat 660atgttgaaat ttttgcttgg ttttgtatag gattgtgtct tttgcttata aatgttgaaa 720tctgaacttt ttttttgttt ggtttctttg agcaggag 75810252DNAArabidopsis thaliana 10actgtttaag cttcactgtc tctgaatcgg caaaggtaaa cgtatcaatt attctacaaa 60cccttttatt tttcttttga attaccgtct tcattggtta tatgataact tgataagtaa 120agcttcaata attgaatttg atctgtgttt ttttggcctt aatactaaat ccttacataa 180gctttgttgc ttctcctctt gtgagttgag tgttaagttg taataatggt tcactttcag 240ctttagaaga aa 25211718DNAArabidopsis thaliana 11gtccagaatt ttctccattg aagctggatt ctaaggtcag ttcttacttc tttatctcaa 60tctgatgatt ccatatcgaa agtcttactt tttcacttca atttcaatct gatgattcta 120agatctttga ttcgaggtcg atctctgata gttactacat gtttctgggt ttatttattt 180ttaatccata tagtaattaa aaactcttat gaggtttaat tatggttact tgagaatttg 240caatcgtcat ctttctttga ctcctatcca ttttttggtt tttcctttgt ttaatttctg 300tttcataatt gtaattgtaa attaaccaaa acaaattgat cagaaacctt tttcctatgg 360aatatttatc acacgcaagc ctgtgagttg tgactctgta atcacttcct tgttctggta 420atttcagtgg ttaaggctct ccttttttct gatgttgtca gcaaaagtta gtttttcttc 480ttctttaatg ggttaattac acctaaatct ctggttatta aacaatccag aaagaaaaaa 540agtttattcc ttcctctatg tatatagttt cacatgcaag catcacttgt ttgttctgac 600aaattgcaga gttttgagtt ctgttttttt ttttttctaa tgttttgtct ttaagaaagt 660tctgtttttt tttctgcagg aaagttatca aaagttttga gagctttgga tagtgaag 71812495DNAArabidopsis thaliana 12ctagcttaat ctcagattcg aatcgttcca tagtggtgag cttcgtgttc ttctttcgtc 60tcttactcct gattctcgat tttagggttt tcagtaattg cgtcggcggc gaaagtcttt 120atcgccgatc gatcttcctt atctagaaat tattgatcag aaactgttgg gttttgtttg 180attcttgtca agttttgatt tttcatgcga aattgctcaa tcccaattca aagttacgat 240ttttattgaa aaccctagat tggtttcttc aagtttgtca ctttgattca atctaatagc 300ttagcttaat cgttaagtct cttttttggt tttaggtttc atttgcgatt taaaggttct 360tgttttggta tttgttttgc tttggtcctt taagtttgag aggcttatgt agattataag 420agagaagagt attgctttgc atgtttaaag gaagaacttt taactgaaca tttgtatgat 480tggtatgtag atact 49513139DNAArabidopsis thaliana 13atttccacac gctttctatc atttccaccc aaaaggtaac gcgcttttta tttcctttcc 60tgcattcata aatttgtctc ctgcatgttg aaaaaaaaaa atttacatcg agattcgttt 120ttatttttta gagagagat 13914889DNAArabidopsis thaliana 14gtctactttc attacagtga ctctgcatgc ttcaggtctc gtctaattct tgaattctct 60tcttttctgt tccgtaattt actttctagg gtctctagat ttgtgtctcc tctaacaaaa 120gatcctatct ttcgacaaat ttaatttcat cattgacctt tgtcgattcc attctctctc 180tatctctctg tttcttcgaa aacctagagg ttttgaattt aatgattcct ttttatgtca 240ataaatttgc aatcaatggg agctttttaa aatcatcgtt atatctataa acaaaaaaac 300agtaattact cttcttagat ctaaaacaat taataaatct ttcccttttt tctcatcata 360attttttcgt atttaactct tgtaaaaatt tgcttagccg tttcgctttc tcaggcccca 420ggtgattcgt gtcttctagg tcagcttgtg aaacctgaga gaagccatct tttgtttgcg 480gttacaaact ttgccgcttc aatatttcat tgctgttttc tgggaaaacc tttttctagt 540tttttcggct tattatgcct tttaactttt tgtgcattta acatttattg ttagtgcttt 600gcttagtgta aagtagtagt tctctttgta atattaccat aaggttcaga agtaaatttt 660tctaaaattg ttttcttgtg ggaaattcag actgatttca gcaacatgca tgggcttaaa 720atcagcttct aagactgaga tttagtgacc agtgtggtgg tgtcttgttc tctgttcttg 780ggagaacaca aaggcagtgt ggagtctggt gagttttctg attcttgaaa agatttataa 840attttcttgc aaaattagtc tttatgttga attgtgttgc aggtaaaat 88915433DNAArabidopsis thaliana 15gcacaatctt agcttacctt gaatcacaac ttcaggtata tgtaactgat tctaaattga 60agattgtgtg caaatcttat atccattttt tattattaaa tttattgaaa aagctagcgg 120tgtaaattaa tgtcacaaaa tcagtatatt gttagttttt gttttttttg aagttttatg 180caaatcttca aaaagtatat tcagtgttgt aattgacaaa tagagactct agttcttttt 240ttttttttct tttttttaac atctgactct tatagagact ctagttcatg tacacttttt 300ttaatggaaa aacaaatttg aaactgaata tcttatttcc acgtagattg tatattagtt 360taatttgatt gttatatttg taaatgtcta ctaaacagga attggatggt gaggaggcaa

420ggcttgtgga tta 43316354DNAArabidopsis thaliana 16atcttagggt ttcgcgagat ctcactctca ctggtatgtc tgtgtttctt cttccatttt 60ctgtttctat tggaaacttc tctctccaat ttcgttttct tcacttcttt gatcctttag 120ctttgacaaa accgtagtaa aggatcaaaa gttatcatct ttggtccatg ttgtgaatcg 180tgctctgctt gggtcgtgac tcccaaatcc ggatttgaaa ccagcatatc tgagcttaat 240tcgagcatgc atgcgcttct ttttttctga ttttttttag actttggttc taaatccctt 300aactttggat taactgtcaa tctacaattt tatattaaca gagatagctt agca 35417143DNAArabidopsis thaliana 17cagaagctca tttcttcgat acgatcaacc attaggtgat ttttttctct gatcttcgag 60ttctgataat tgctcttttt tctctggctt tgttatcgat aatttctctg gattttcttt 120ctggggtgaa tttttgcgca gag 14318182DNAArabidopsis thaliana 18atttttgttg gtgaaaggta gaattcgtaa atttcttctg ctcactttat tgtttcgact 60catacccgat aatctcttct atgtttggta gagatatctt ctcaaagtct tatctttcct 120taccgtgttc tgtgtttttt gatgatttag gtgaagaaga agaagcagag acaaaaacga 180tt 18219665DNAArabidopsis thaliana 19ttaagctttt aagaatctct actcacattt tctctgtgag tgttctttta tacttctttg 60ttatttccaa tttttctttc tttcctctaa aaattttagg aactattgaa tcatttaatt 120tctgtttgtt gataaaattt cgatcaactg ttctcggctt accgatgcat tttttgtaaa 180accgtctttt tttggtgaat aaaattttaa attcatacaa aaaaaaaaca tatttgatac 240tattttagct ccattgtatc tgaatcttca tttgttaatt tttttgtttc ctctgttctc 300acttgaattt tggaatattt tctctaggtt ttaccttata ttcttcactt taagaactat 360atgaagattt gattggaagt aataatattc ggtgatagaa tctgagtttg tttgattctg 420gtgtggggct tatatctaac ttttttcttt gtaccaatac attttcaatt ttacattttt 480gattagctta aaatgtgaag gataccttgt aaataactat tacactattg cttgtcttag 540tctaatagtc ttcactaata ttttgtgcag tagaagtaaa tattataaag agttgttgtt 600tgattataga gagttgttgt ctattcttta acttgatgtg atgttgtttt tgatgacagg 660taaaa 66520252DNAArabidopsis thaliana 20tctgggaaat atcgattttg atctattaag agctggtgag agccaaagtt tcctttttgt 60ttgtttgttt gtttgtttgt tgtttgtatt tttgtatctc tgtgatcgct tctacgtgtt 120gggtcatgca gagaaactca ttttgttttg atttgcaatg tgtcaattcc actttgaaat 180ataagattca tcgcctctct ctcctttgtt ttttttcttc ttctgcagct acgagctttg 240ggatgtggtg ag 25221186DNAArabidopsis thaliana 21tattcacaat ctcctgccac ctctcatttc tctagttgag ttgttatctg cgtttttaag 60cactcgaata ctgcatgcaa attccctgat tgtttgttag taccttagag attctcgatt 120ttttagttgt ttagattgaa ccaggattac taaattgtta ttgttttctg tgtaaaggct 180acatat 18622345DNAArabidopsis thaliana 22ctttgcagct tctgcagcac ctctccctac tccaggtact tatgtttttg ataattttat 60tgatagactc tttacaatta tacttaagct tgttactttt tattgttacc aacaaaagct 120aatgtatagt tcataactca caggtcctgc gtctttcggt ccgaccactt ctcctacaga 180ttcgcaaact tctgatcctg aaggtactcg cgaacttttt actgcaactt ctagttctaa 240ctccaaaaca ttttgttcag aatttgtttc taaaagattt tcgggtttgt tgacgtcaca 300taactcgcag ggtctgcttc tttccgtccg cccacttctc cgaca 34523285DNAArabidopsis thaliana 23aacaactatg gcctgagggt aacaagagta tcaggtatat gtgaaaactc tacttttgaa 60gtttaccaaa aaaaatactc tacttttgga aagacattgc tcctaaaatc ttattagttg 120tatataattt actaaaacac atagttcttg aattcttgtt aatgagcatg ttaccttgga 180caagtgaccc tttttctaca ttttgttttt ctatcacacg tcatgcgttt tgattgtttc 240cttacgagtt ttaattttat tttttggtta aaaacagtaa gataa 28524137DNAArabidopsis thaliana 24tctaaaaata cagggcaccg aaccaaataa aggtgagaat gatgagaagc cgtttcttac 60tcttcattgt tttcttctct ctatccctct tcatttcctc tctgatcgcc agtgatttag 120gcttctgcaa cgaagag 13725664DNABrassica napus thaliana 25taaggatgac ctacccattc ttgagacaaa tgttacattt tagtatcaga gtaaaatgtg 60tacctataac tcaaattcga ttgacatgta tccattcaac ataaaattaa accagcctgc 120acctgcatcc acatttcaag tattttcaaa ccgttcggct cctatccacc gggtgtaaca 180agacggattc cgaatttgga agattttgac tcaaattccc aatttatatt gaccgtgact 240aaatcaactt taacttctat aattctgatt aagctcccaa tttatattcc caacggcact 300acctccaaaa tttatagact ctcatcccct tttaaaccaa cttagtaaac gttttttttt 360taattttatg aagttaagtt tttaccttgt ttttaaaaag aatcgttcat aagatgccat 420gccagaacat tagctacacg ttacacatag catgcagccg cggagaattg tttttcttcg 480ccacttgtca ctcccttcaa acacctaaga gcttctctct cacagcacac acatacaatc 540acatgcgtgc atgcattatt acacgtgatc gccatgcaaa tctcctttat agcctataaa 600ttaactcatc ggcttcactc tttactcaaa ccaaaactca tcaatacaaa caagattaaa 660aaca 664261064DNALinum usitatissimum thaliana 26ttagcagata tttggtgtct aaatgtttat tttgtgatat gttcatgttt gaaatggtgg 60tttcgaaacc agggacaacg ttgggatctg atagggtgtc aaagagtatt atggattggg 120acaatttcgg tcatgagttg caaattcaag tatatcgttc gattatgaaa attttcgaag 180aatatcccat ttgagagagt ctttacctca ttaatgtttt tagattatga aattttatca 240tagttcatcg tagtcttttt ggtgtaaagg ctgtaaaaag aaattgttca cttttgtttt 300cgtttatgtg aaggctgtaa aagattgtaa aagactattt tggtgttttg gataaaatga 360tagtttttat agattctttt gcttttagaa gaaatacatt tgaaattttt tccatgttga 420gtataaaata ccgaaatcga ttgaagatca tagaaatatt ttaactgaaa acaaatttat 480aactgattca attctctcca tttttatacc tatttaaccg taatcgattc taatagatga 540tcgatttttt atataatcct aattaaccaa cggcatgtat tggataatta accgatcaac 600tctcacccct aatagaatca gtattttcct tcgacgttaa ttgatcctac actatgtagg 660tcatatccat cgttttaatt tttggccacc attcaattct gtcttgcctt tagggatgtg 720aatatgaacg gccaaggtaa gagaataaaa ataatccaaa ttaaagcaag agaggccaag 780taagataatc caaatgtaca cttgtcattg ccaaaattag taaaatactc ggcatattgt 840attcccacac attattaaaa taccgtatat gtattggctg catttgcatg aataatacta 900cgtgtaagcc caaaagaacc cacgtgtagc ccatgcaaag ttaacactca cgaccccatt 960cctcagtctc cactatataa acccaccatc cccaatctca ccaaacccac cacacaactc 1020acaactcact ctcacacctt aaagaaccaa tcaccaccaa aaaa 1064271727DNALinum usitatissimum thaliana 27cacgggcagg acatagggac tactacaagc atagtatgct tcagacaaag agctaggaaa 60gaactcttga tggaggttaa gagaaaaaag tgctagaggg gcatagtaat caaacttgtc 120aaaaccgtca tcatgatgag ggatgacata atataaaaag ttgactaagg tcttggtagt 180actctttgat tagtattata tattggtgag aacatgagtc aagaggagac aagaaaccga 240ggaaccatag tttagcaaca agatggaagt tgcaaagttg agctagccgc tcgattagtt 300acatctccta agcagtacta caaggaatgg tctctatact ttcatgttta gcacatggta 360gtgcggattg acaagttaga aacagtgctt aggagacaaa gagtcagtaa aggtattgaa 420agagtgaagt tgatgctcga caggtcagga gaagtccctc cgccagatgg tgactaccaa 480ggggttggta tcagctgaga cccaaataag attcttcggt tgaaccagtg gttcgaccga 540gactcttagg gtgggatttc actgtaagat ttgtgcattt tgttgaatat aaattgacaa 600ttttttttat ttaattatag attatttaga atgaattaca tatttagttt ctaacaagga 660tagcaatgga tgggtatggg tacaggttaa acatatctat tacccaccca tctagtcgtc 720gggttttaca cgtacccacc cgtttacata aaccagaccg gaattttaaa ccgtacccgt 780ccgttagcgg gtttcagatt tacccgttta atcgggtaaa acctgattac taaatatata 840ttttttattt gataaacaaa acaaaaatgt taatattttc atattggatg caattttaag 900aaacacatat tcataaattt ccatatttgt aggaaaataa aaagaaaaat atattcaaga 960acacaaattt caccgacatg acttttatta cagagttgga attagatcta acaattgaaa 1020aattaaaatt aagatagaat atgttgagga acatgacata gtataatgct gggttacccg 1080tcgggtaggt atcgaggcgg atactactaa atccatccca ctcgctatcc gataatcact 1140ggtttcgggt atacccattc ccgtcaacag gcctttttaa ccggataatt tcaacttata 1200gtgaatgaat tttgaataaa tagttagaat accaaaatcc tggattgcat ttgcaatcaa 1260attttgtgaa ccgttaaatt ttgcatgtac ttgggataga tataatagaa ccgaattttc 1320attagtttaa tttataactt actttgttca aagaaaaaaa atatctatcc aatttactta 1380taataaaaaa taatctatcc aagttactta ttataatcaa cttgtaaaaa ggtaagaata 1440caaatgtggt agcgtacgtg tgattatatg tgacgaaatg ttatatctaa caaaagtcca 1500aattcccatg gtaaaaaaaa tcaaaatgca tggcaggctg tttgtaacct tggaataaga 1560tgttggccaa ttctggagcc gccacgtacg caagactcag ggccacgttc tcttcatgca 1620aggatagtag aacaccactc cacccacctc ctatattaga cctttgccca accctcccca 1680actttcccat cccatccaca aagaaaccga catttttatc ataaatc 1727281799DNAVicia faba 28tcgacggccc ggactgtatc caacttctga tctttgaatc tctctgttcc aacatgttct 60gaaggagttc taagactttt cagaaagctt gtaacatgct ttgtagactt tctttgaatt 120actcttgcaa actctgattg aacctacgtg aaaactgctc cagaagttct aaccaaattc 180cgtcttggga aggcccaaaa tttattgagt acttcagttt catggacgtg tcttcaaaga 240tttataactt gaaatcccat catttttaag agaagttctg ttccgcaatg tcttagatct 300cattgaaatc tacaactctt gtgtcagaag ttcttccaga atcaacttgc atcatggtga 360aaatctggcc agaagttctg aacttgtcat atttcttaac agttagaaaa atttctaagt 420gtttagaatt ttgacttttc caaagcaaac ttgacttttg actttcttaa taaaacaaac 480ttcatattct aacatgtctt gatgaaatgt gattcttgaa atttgatgtt gatgcaaaag 540tcaaagtttg acttttcagt gtgcaattga ccattttgct cttgtgccaa ttccaaacct 600aaattgatgt atcagtgctg caaacttgat gtcatggaag atcttatgag aaaattcttg 660aagactgaga ggaaaaattt tgtagtacaa cacaaagaat cctgtttttc atagtcggac 720tagacacatt aacataaaac accacttcat tcgaagagtg attgaagaag gaaatgtgca 780gttacctttc tgcagttcat aagagcaact tacagacact tttactaaaa tactacaaag 840aggaagattt taacaactta gagaagtaat gggagttaaa gagcaacaca ttaaggggga 900gtgttaaaat taatgtgttg taaccaccac tacctttagt aagtattata agaaaattgt 960aatcatcaca ttataattat tgtccttatt taaaattatg ataaagttgt atcattaaga 1020ttgagaaaac caaatagtcc tcgtcttgat ttttgaatta ttgttttcta tgttactttt 1080cttcaagcct atataaaaac tttgtaatgc taaattgtat gctggaaaaa aatgtgtaat 1140gaattgaata gaaattatgg tatttcaaag tccaaaatcc atcaatagaa atttagtaca 1200aaacgtaact caaaaatatt ctcttatttt aaattttaca acaatataaa aatattctct 1260tattttaaat tttacaataa tataatttat cacctgtcac ctttagaata ccaccaacaa 1320tattaatact tagatatttt attcttaata attttgagat ctctcaatat atctgatatt 1380tattttatat ttgtgtcata ttttcttatg ttttagagtt aacccttata tcttggtcaa 1440actagtaatt caatatatga gtttgtgaag gacacattga catcttgaaa cattggtttt 1500aaccttgttg gaatgttaaa ggtaataaaa cattcagaat tatgaccatc tattaatata 1560cttcctttgt cttttaaaaa agtgtgcatg aaaatgctct atggtaagct agagtgtctt 1620gctggcctgt gtatatcaat tccatttcca gatggtagaa actgccacta cgaataatta 1680gtcataagac acgtatgtta acacacgtcc ccttgcatgt tttttgccat atattccgtc 1740tctttctttt tcttcacgta taaaacaatg aactaattaa tagagcgatc aagctgaac 179929684DNAVicia faba 29ctgcagcaaa tttacacatt gccactaaac gtctaaaccc ttgtaatttg tttttgtttt 60actatgtgtg ttatgtattt gatttgcgat aaatttttat atttggtact aaatttataa 120caccttttat gctaacgttt gccaacactt agcaatttgc aagttgatta attgattcta 180aattattttt gtcttctaaa tacatatact aatcaactgg aaatgtaaat atttgctaat 240atttctacta taggagaatt aaagtgagtg aatatggtac cacaaggttt ggagatttaa 300ttgttgcaat gctgcatgga tggcatatac accaaacatt caataattct tgaggataat 360aatggtacca cacaagattt gaggtgcatg aacgtcacgt ggacaaaagg tttagtaatt 420tttcaagaca acaatgttac cacacacaag ttttgaggtg catgcatgga tgccctgtgg 480aaagtttaaa aatattttgg aaatgatttg catggaagcc atgtgtaaaa ccatgacatc 540cacttggagg atgcaataat gaagaaaact acaaatttac atgcaactag ttatgcatgt 600agtctatata atgaggattt tgcaatactt tcattcatac acactcacta agttttacac 660gattataatt tcttcatagc cagt 684302742DNAVicia faba 30gtcgtctcaa actcattcat cagaaccttc ttgaacttag ttatctcttg ttcagagctt 60cctgttagca atatgtcatc aacatataaa catgtcccag aagccagaag atagaagttg 120gatgatagaa gtaaagtaat gttactggtg gagtaccaca atacaagttc atacaaactt 180tattgtccag aaactaacaa agttgagttc agcatagatg aaagacaaaa agaatatatt 240aaatgacggc tgcaaaataa ggagtaatga atacattgac ctacctacta ctaggctatt 300tatacacaat attagggtat aataaaatat taaaataccc tctatcagac ttagtcaata 360agacattcct aaaatataaa ttatttccaa caataatttg tctcaaataa aatatagagg 420tgcaaaagtt aaactaagag tgcaaagtaa aattttgaga gggctcaaaa ttgaatataa 480taacaatatt agtgtagttt aagaaaactc aggggatgca gttgaactcc ctcaactgta 540cgtagctcct cccctggatg cagtgtaaag atttgaagat atattttagt actttggata 600ttgtaggcca gagggtgttg aagataaagg ttcaggaact aacacattca tccacaactt 660ctatgtgtcc atcgtcagtg aaatacatgc caaatagggg agttaagaag agtagaaagg 720gtcaagatag tgatgtgcat cgtgatcctt cataatggga gtgtggtgag ggctcgcatg 780ggagtcatac tacaaagaga tcatgcataa aaccaactag aagtcaactg tcaagtatga 840cggctgacaa ttaaccgtcc accaaatctt ccagacatgt ttacttgtcc cagttttctg 900atttcttata tccatacatt gatgacatta ttgatgttgg tggcgatgga gattggggtt 960ttcatgctat tacagcttta cttggatggg gtgaagagtc atagcctttg attcagacgc 1020agttagatac tcaagttcat caacaccctc aattgttttt taagttgttt tgtgacacga 1080tctctacagt tagaaatgcg ttacgagtag aacacttggc tgtgcagggt atagataaat 1140gaatgacgat ttatgatatg ggttacccta ttgcttctag atacaatgtc gtatttgtct 1200cccttccaaa agacttaaca tcacgttttt tcctcttgcc ttatctccac ctatgtatac 1260aagcaggcat aaaatcattg ttgttggttt tgtcaacaac aatcattgag tttaggtaaa 1320gttgaaactt gattgtccat tacctcttgt cactgactgt tgaagacaga attgtactga 1380ctgtatatat caacatatgc gagacgcgtt aggcagtgga aagacgtagt taggatgtca 1440tcataatttg tttcgtattt ttatatgtag cacagttttt atatgtatat attttatcgg 1500gtagtttttt atcgattcag ttatttgaga aaaagtaatg cagacaaaaa gtggaaaaga 1560caatctgact gtacataaga aatttccaat ttttgaaatt tttttataat tatcagaaat 1620tttaaaattt ccgataaaaa catacatgta tagatcgaaa atttcaaatt tctagtactt 1680tcaaatttct tgcagtaaaa gttgtaattt tttaaaaatt tacgataatt tacagtattt 1740aaaaaaaaat ccaatcttaa ataaagggta taagaataaa agcactcatg tggagtggca 1800ggtttcgtca caccctaaga acatccctaa atacaccaca tatgtataag tattaagtga 1860ttgatgttaa gtgaaacgaa aatatttata tgtgaaattt aatattcagc ttacttgatt 1920aaactccata gtgacccaat aagtgctaac ttttactgtc tttaccttta aatgttatat 1980tgatttattt atgcatttct ttttcctgca tctcaatagt atatagggta tcaaatagtg 2040attatccaaa cttaaataag ttagaggaaa caccaagata tgccatatac tctcaaattt 2100gacactatga ttcaaagttg cacttgcata aaacttatta attcaatagt aaaaccaaac 2160ttgtgcgtga tacagttaaa atgactaaac tactaattaa ggtccctccc attagtaaat 2220aagttatttt tttagaaaaa gaaaataata aaaagaatga cgagtctatc taaatcatat 2280taacaagtaa tacatattga ttcattcgat ggaggaggcc aataattgta gtaaacaagc 2340agtgccgagg ttaatatatg ctcaagacag taaataatct aaatgaatta agacagtgat 2400ttgcaaagag tagatgcaga gaagagaact aaagatttgc tgctacacgt atataagaat 2460agcaacagat attcattctg tctctttgtg gaatatggat atctactaat catcatctat 2520ctgtgaagaa taaaagaagc ggccacaagc gcagcgtcgc acatatgatg tgtatcaaat 2580taggactcca tagccatgca tgctgaagaa tgtcacacac gttctgtcac acgtgttact 2640ctctcactgt tctcctcttc ctataaatca ccgcgccaca gcttctccac ttcaccactt 2700caccacttca ctcacaatcc ttcattagtt gtttactatc ac 274231445DNAArabidopsis thaliana 31ggccgcagat atcagatctg gtcgacctag aggatccccg gccgcaaaga taataacaaa 60agcctactat ataacgtaca tgcaagtatt gtatgatatt aatgttttta cgtacgtgta 120aacaaaaata attacgtttg taacgtatgg tgatgatgtg gtgcactagg tgtaggcctt 180gtattaataa aaagaagttt gttctatata gagtggttta gtacgacgat ttatttacta 240gtcggattgg aatagagaac cgaattcttc aatccttgct tttgatcaag aattgaaacc 300gaatcaaatg taaaagttga tatatttgaa aaacgtattg agcttatgaa aatgctaata 360ctctcatctg tatggaaaag tgactttaaa accgaactta aaagtgacaa aaggggaata 420tcgcatcaaa ccgaatgaaa ccgat 44532216DNACauliflower mosaic virus 32tcgacaagct cgagtttctc cataataatg tgtgagtagt tcccagataa gggaattagg 60gttcctatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 120tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtactaaa 180atccagatcc cccgaattaa ttcggcgtta attcag 21633568DNAPisum sativum 33taattgattg gttcgagtat tatggcattg ggaaaactgt ttttcttgta ccatttgttg 60tgcttgtaat ttactgtgtt ttttattcgg ttttcgctat cgaactgtga aatggaaatg 120gatggagaag agttaatgaa tgatatggtc cttttgttca ttctcaaatt aatattattt 180gttttttctc ttatttgttg tgtgttgaat ttgaaattat aagagatatg caaacatttt 240gttttgagta aaaatgtgtc aaatcgtggc ctctaatgac cgaagttaat atgaggagta 300aaacacttgt agttgtacca ttatgcttat tcactaggca acaaatatat tttcagacct 360agaaaagctg caaatgttac tgaatacaag tatgtcctct tgtgttttag acatttatga 420actttccttt atgtaatttt ccagaatcct tgtcagattc taatcattgc tttataatta 480tagttatact catggatttg tagttgagta tgaaaatatt ttttaatgca ttttatgact 540tgccaattga ttgacaacat gcatcaat 56834235DNAAgrobacterium tumefaciens 34ggccgcctcg agcatgcatc tagagggccc gctagcgtta accctgcttt aatgagatat 60gcgagacgcc tatgatcgca tgatatttgc tttcaattct gttgtgcacg ttgtaaaaaa 120cctgagcatg tgtagctcag atccttaccg ccggtttcgg ttcattctaa tgaatatatc 180acccgttact atcgtatttt tatgaataat attctccgtt caatttactg attgt 23535605DNAPhaseolus vulgaris 35ctaagactcc caaaaccacc ttccctgtga cagttaaacc ctgcttatac ctttcctcct 60aataatgttc atctgtcaca caaactaaaa taaataaaat gggagcaata aataaaatgg 120gagctcatat atttacacca tttacactgt ctattattca ccatgccaat tattacttca 180taattttaaa attatgtcat ttttaaaaat tgcttaatga tggaaaggat tattataagt 240taaaagtata acatagataa actaaccaca aaacaaatca atataaacta acttactctc 300ccatctaatt tttatttaaa tttctttaca cttctcttcc atttctattt ctacaacatt 360atttaacatt tttattgtat ttttcttact ttctaactct attcatttca aaaatcaata 420tatgtttatc accacctctc taaaaaaaac tttacaatca ttggtccaga aaagttaaat 480cacgagatgg tcattttagc attaaaacaa cgattcttgt atcactattt ttcagcatgt 540agtccattct cttcaaacaa agacagcggc tatataatcg ttgtgttata ttcagtctaa 600aacaa 60536254DNASolanum tuberosum 36ggccgcctcg accgtacccc ctgcagatag actatactat gttttagcct gcctgctggc 60tagctactat gttatgttat gttgtaaaat aaacacctgc taaggtatat ctatctatat 120tttagcatgg ctttctcaat aaattgtctt tccttatcgt ttactatctt atacctaata 180atgaaataat aatatcacat atgaggaacg gggcaggttt aggcatatat atacgagtgt 240agggcggagt gggg 25437297DNAVicia faba 37atcctgcaat agaatgttga ggtgaccact ttctgtaata aaataattat aaaataaatt 60tagaattgct gtagtcaaga acatcagttc taaaatatta ataaagttat ggccttttga 120catatgtgtt

tcgataaaaa aatcaaaata aattgagatt tattcgaaat acaatgaaag 180tttgcagata tgagatatgt ttctacaaaa taataactta aaactcaact atatgctaat 240gtttttcttg gtgtgtttca tagaaaattg tatccgtttc ttagaaaatg ctcgtaa 2973824631DNAArtificial SequencePlant Expression Plasmid 38acatacaaat ggacgaacgg ataaaccttt tcacgccctt ttaaatatcc gattattcta 60ataaacgctc ttttctctta ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt 120aaactgaagg cgggaaacga caatcagatc tagtaggaaa cagctatgac catgattacg 180ccaagcttat ttaaatcgta ccgtactagt aacggccgcc agtgtgctgg aattcgccct 240taaaaaagat atcgattacg ccaagctatc aactttgtat agaaaagttg ccatgattac 300gccaagcttg gcgcgccctg cagcaaattt acacattgcc actaaacgtc taaacccttg 360taatttgttt ttgttttact atgtgtgtta tgtatttgat ttgcgataaa tttttatatt 420tggtactaaa tttataacac cttttatgct aacgtttgcc aacacttagc aatttgcaag 480ttgattaatt gattctaaat tatttttgtc ttctaaatac atatactaat caactggaaa 540tgtaaatatt tgctaatatt tctactatag gagaattaaa gtgagtgaat atggtaccac 600aaggtttgga gatttaattg ttgcaatgct gcatggatgg catatacacc aaacattcaa 660taattcttga ggataataat ggtaccacac aagatttgag gtgcatgaac gtcacgtgga 720caaaaggttt agtaattttt caagacaaca atgttaccac acacaagttt tgaggtgcat 780gcatggatgc cctgtggaaa gtttaaaaat attttggaaa tgatttgcat ggaagccatg 840tgtaaaacca tgacatccac ttggaggatg caataatgaa gaaaactaca aatttacatg 900caactagtta tgcatgtagt ctatataatg aggattttgc aatactttca ttcatacaca 960ctcactaagt tttacacgat tataatttct tcatagccag taccatggaa gttgttgaga 1020ggttctacgg agagttggat ggaaaggttt cccaaggagt gaacgctttg ttgggatctt 1080tcggagttga gttgactgat accccaacta ctaagggatt gccactcgtt gattctccaa 1140ctccaattgt gttgggagtg tctgtttact tgaccatcgt gatcggagga ttgctttgga 1200tcaaggctag agatctcaag ccaagagctt ctgagccatt cttgttgcaa gctttggtgt 1260tggtgcacaa cttgttctgc ttcgctttgt ctctttacat gtgcgtgggt atcgcttacc 1320aagctatcac ctggagatat tccttgtggg gaaacgctta taacccaaag cacaaggaga 1380tggctatcct cgtttacctc ttctacatgt ccaagtacgt ggagttcatg gataccgtga 1440tcatgatcct caagagatcc accagacaga tttctttcct ccacgtgtac caccactctt 1500ctatctccct tatctggtgg gctattgctc accacgctcc aggaggagag gcttattgga 1560gtgctgctct caactctgga gtgcacgtgt tgatgtacgc ttactacttc ttggctgctt 1620gcttgagatc ttccccaaag ctcaagaaca agtacctctt ctggggaaga tacctcaccc 1680aattccagat gttccagttc atgctcaact tggtgcaagc ttactacgat atgaaaacca 1740acgctccata tccacaatgg ctcatcaaga tcctcttcta ctacatgatc tccctcttgt 1800tcctcttcgg aaacttctac gtgcaaaagt acatcaagcc atccgatgga aagcaaaagg 1860gagctaagac cgagtgatcg acaagctcga gtttctccat aataatgtgt gagtagttcc 1920cagataaggg aattagggtt cctatagggt ttcgctcatg tgttgagcat ataagaaacc 1980cttagtatgt atttgtattt gtaaaatact tctatcaata aaatttctaa ttcctaaaac 2040caaaatccag tactaaaatc cagatccccc gaattaattc ggcgttaatt cagggccggc 2100cgatctgtcg tctcaaactc attcatcaga accttcttga acttagttat ctcttgttca 2160gagcttcctg ttagcaatat gtcatcaaca tataaacatg tcccagaagc cagaagatag 2220aagttggatg atagaagtaa agtaatgtta ctggtggagt accacaatac aagttcatac 2280aaactttatt gtccagaaac taacaaagtt gagttcagca tagatgaaag acaaaaagaa 2340tatattaaat gacggctgca aaataaggag taatgaatac attgacctac ctactactag 2400gctatttata cacaatatta gggtataata aaatattaaa ataccctcta tcagacttag 2460tcaataagac attcctaaaa tataaattat ttccaacaat aatttgtctc aaataaaata 2520tagaggtgca aaagttaaac taagagtgca aagtaaaatt ttgagagggc tcaaaattga 2580atataataac aatattagtg tagtttaaga aaactcaggg gatgcagttg aactccctca 2640actgtacgta gctcctcccc tggatgcagt gtaaagattt gaagatatat tttagtactt 2700tggatattgt aggccagagg gtgttgaaga taaaggttca ggaactaaca cattcatcca 2760caacttctat gtgtccatcg tcagtgaaat acatgccaaa taggggagtt aagaagagta 2820gaaagggtca agatagtgat gtgcatcgtg atccttcata atgggagtgt ggtgagggct 2880cgcatgggag tcatactaca aagagatcat gcataaaacc aactagaagt caactgtcaa 2940gtatgacggc tgacaattaa ccgtccacca aatcttccag acatgtttac ttgtcccagt 3000tttctgattt cttatatcca tacattgatg acattattga tgttggtggc gatggagatt 3060ggggttttca tgctattaca gctttacttg gatggggtga agagtcatag cctttgattc 3120agacgcagtt agatactcaa gttcatcaac accctcaatt gttttttaag ttgttttgtg 3180acacgatctc tacagttaga aatgcgttac gagtagaaca cttggctgtg cagggtatag 3240ataaatgaat gacgatttat gatatgggtt accctattgc ttctagatac aatgtcgtat 3300ttgtctccct tccaaaagac ttaacatcac gttttttcct cttgccttat ctccacctat 3360gtatacaagc aggcataaaa tcattgttgt tggttttgtc aacaacaatc attgagttta 3420ggtaaagttg aaacttgatt gtccattacc tcttgtcact gactgttgaa gacagaattg 3480tactgactgt atatatcaac atatgcgaga cgcgttaggc agtggaaaga cgtagttagg 3540atgtcatcat aatttgtttc gtatttttat atgtagcaca gtttttatat gtatatattt 3600tatcgggtag ttttttatcg attcagttat ttgagaaaaa gtaatgcaga caaaaagtgg 3660aaaagacaat ctgactgtac ataagaaatt tccaattttt gaaatttttt tataattatc 3720agaaatttta aaatttccga taaaaacata catgtataga tcgaaaattt caaatttcta 3780gtactttcaa atttcttgca gtaaaagttg taatttttta aaaatttacg ataatttaca 3840gtatttaaaa aaaaatccaa tcttaaataa agggtataag aataaaagca ctcatgtgga 3900gtggcaggtt tcgtcacacc ctaagaacat ccctaaatac accacatatg tataagtatt 3960aagtgattga tgttaagtga aacgaaaata tttatatgtg aaatttaata ttcagcttac 4020ttgattaaac tccatagtga cccaataagt gctaactttt actgtcttta cctttaaatg 4080ttatattgat ttatttatgc atttcttttt cctgcatctc aatagtatat agggtatcaa 4140atagtgatta tccaaactta aataagttag aggaaacacc aagatatgcc atatactctc 4200aaatttgaca ctatgattca aagttgcact tgcataaaac ttattaattc aatagtaaaa 4260ccaaacttgt gcgtgataca gttaaaatga ctaaactact aattaaggtc cctcccatta 4320gtaaataagt tattttttta gaaaaagaaa ataataaaaa gaatgacgag tctatctaaa 4380tcatattaac aagtaataca tattgattca ttcgatggag gaggccaata attgtagtaa 4440acaagcagtg ccgaggttaa tatatgctca agacagtaaa taatctaaat gaattaagac 4500agtgatttgc aaagagtaga tgcagagaag agaactaaag atttgctgct acacgtatat 4560aagaatagca acagatattc attctgtctc tttgtggaat atggatatct actaatcatc 4620atctatctgt gaagaataaa agaagcggcc acaagcgcag cgtcgcacat atgatgtgta 4680tcaaattagg actccatagc catgcatgct gaagaatgtc acacacgttc tgtcacacgt 4740gttactctct cactgttctc ctcttcctat aaatcaccgc gccacagctt ctccacttca 4800ccacttcacc acttcactca caatccttca ttagttgttt actatcacag tcacaaccat 4860ggttgatttg aagccaggag tgaagagatt ggtttcctgg aaggagatta gagagcacgc 4920tactccagct actgcttgga ttgtgatcca ccacaaggtg tacgatatct ccaagtggga 4980ttctcatcca ggtggaagtg tgatgttgac tcaggctgga gaggatgcta ctgatgcttt 5040cgctgtgttc catccatctt ccgctttgaa gctcttggag cagttctacg taagtttctg 5100cttctacctt tgatatatat ataataatta tcattaatta gtagtaatat aatatttcaa 5160atattttttt caaaataaaa gaatgtagta tatagcaatt gcttttctgt agtttataag 5220tgtgtatatt ttaatttata acttttctaa tatatgacca aaatttgttg atgtgcaggt 5280aggagatgtg gatgagactt ccaaggctga gattgaggga gaaccagctt ctgatgagga 5340gagagctaga agagagagga tcaacgagtt catcgcttct tacagaaggc tcagggttaa 5400ggttaaggga atgggactct acgatgcttc tgctctttac tacgcttgga agctcgtttc 5460taccttcgga attgctgtgc tctctatggc tatctgcttc ttcttcaact ccttcgctat 5520gtacatggtg gctggagtta ttatgggact cttctaccaa caatctggat ggcttgctca 5580cgatttcttg cacaaccagg tgtgcgagaa cagaactttg ggaaacttga tcggatgcct 5640tgttggaaat gcttggcagg gattctctat gcaatggtgg aagaacaagc acaacttgca 5700ccacgctgtg ccaaacttgc actccgctaa ggatgaggga ttcatcggag atccagatat 5760cgataccatg ccattgcttg cttggtctaa ggagatggct agaaaggctt tcgagtctgc 5820tcacggacca ttcttcatca ggaaccaggc tttcttgtac ttcccattgc tcttgttggc 5880tagattgtct tggctcgctc agtctttctt ctacgtgttc accgagttct cattcggaat 5940cttcgataag gtggagttcg atggaccaga aaaggctgga ttgatcgtgc actacatctg 6000gcaactcgct attccatact tctgcaacat gtccttgttc gagggagttg cttacttctt 6060gatgggacaa gcttcttgcg gattgctttt ggctctcgtg ttctctattg gacacaacgg 6120aatgtctgtg tacgagagag agaccaagcc agatttctgg caattgcaag tgactaccac 6180cagaaacatt agggcttccg tgttcatgga ttggttcacc ggaggactca actaccaaat 6240cgatcaccac ttgttcccat tggtgccaag acacaacttg ccaaaggtga acgtgttgat 6300caagtctctc tgcaaggagt tcgatatccc attccacgag actggattct gggagggaat 6360ctacgaggtt gtggatcacc tcgctgatat ctctaaggag ttcatcactg agttcccagc 6420tatgtgagat cctgcaatag aatgttgagg tgaccacttt ctgtaataaa ataattataa 6480aataaattta gaattgctgt agtcaagaac atcagttcta aaatattaat aaagttatgg 6540ccttttgaca tatgtgtttc gataaaaaaa tcaaaataaa ttgagattta ttcgaaatac 6600aatgaaagtt tgcagatatg agatatgttt ctacaaaata ataacttaaa actcaactat 6660atgctaatgt ttttcttggt gtgtttcata gaaaattgta tccgtttctt agaaaatgct 6720cgtaagttta aacttagcag atatttggtg tctaaatgtt tattttgtga tatgttcatg 6780tttgaaatgg tggtttcgaa accagggaca acgttgggat ctgatagggt gtcaaagagt 6840attatggatt gggacaattt cggtcatgag ttgcaaattc aagtatatcg ttcgattatg 6900aaaattttcg aagaatatcc catttgagag agtctttacc tcattaatgt ttttagatta 6960tgaaatttta tcatagttca tcgtagtctt tttggtgtaa aggctgtaaa aagaaattgt 7020tcacttttgt tttcgtttat gtgaaggctg taaaagattg taaaagacta ttttggtgtt 7080ttggataaaa tgatagtttt tatagattct tttgctttta gaagaaatac atttgaaatt 7140ttttccatgt tgagtataaa ataccgaaat cgattgaaga tcatagaaat attttaactg 7200aaaacaaatt tataactgat tcaattctct ccatttttat acctatttaa ccgtaatcga 7260ttctaataga tgatcgattt tttatataat cctaattaac caacggcatg tattggataa 7320ttaaccgatc aactctcacc cctaatagaa tcagtatttt ccttcgacgt taattgatcc 7380tacactatgt aggtcatatc catcgtttta atttttggcc accattcaat tctgtcttgc 7440ctttagggat gtgaatatga acggccaagg taagagaata aaaataatcc aaattaaagc 7500aagagaggcc aagtaagata atccaaatgt acacttgtca ttgccaaaat tagtaaaata 7560ctcggcatat tgtattccca cacattatta aaataccgta tatgtattgg ctgcatttgc 7620atgaataata ctacgtgtaa gcccaaaaga acccacgtgt agcccatgca aagttaacac 7680tcacgacccc attcctcagt ctccactata taaacccacc atccccaatc tcaccaaacc 7740caccacacaa ctcacaactc actctcacac cttaaagaac caatcaccac caaaaaacca 7800tgggaaaagg atctgaggga agatctgctg ctagagagat gactgctgag gctaacggag 7860ataagagaaa gaccatcctc attgagggag tgttgtacga tgctaccaac ttcaaacacc 7920caggaggttc cattattaac ttcctcaccg agggagaagc tggagttgat gctacccaag 7980cttacagaga gttccatcag agatccggaa aggctgataa gtacctcaag tccctcccaa 8040agttggatgc ttctaaggtg gagtctaggt tctctgctaa ggagcaggct agaagggacg 8100ctatgaccag ggattacgct gctttcagag aggagttggt tgctgaggga tacttcgatc 8160catctatccc acacatgatc tacagagtgg tggagattgt ggctttgttc gctttgtctt 8220tctggttgat gtctaaggct tctccaacct ctttggtttt gggagtggtg atgaacggaa 8280tcgctcaagg aagatgcgga tgggttatgc acgagatggg acacggatct ttcactggag 8340ttatctggct cgatgatagg atgtgcgagt tcttctacgg agttggatgt ggaatgtctg 8400gacactactg gaagaaccag cactctaagc accacgctgc tccaaacaga ttggagcacg 8460atgtggattt gaacaccttg ccactcgttg ctttcaacga gagagttgtg aggaaggtta 8520agccaggatc tttgttggct ttgtggctca gagttcaggc ttatttgttc gctccagtgt 8580cttgcttgtt gatcggattg ggatggacct tgtacttgca cccaagatat atgctcagga 8640ccaagagaca catggagttt gtgtggatct tcgctagata tatcggatgg ttctccttga 8700tgggagcttt gggatattct cctggaactt ctgtgggaat gtacctctgc tctttcggac 8760ttggatgcat ctacatcttc ctccaattcg ctgtgtctca cacccacttg ccagttacca 8820acccagagga tcaattgcac tggcttgagt acgctgctga tcacaccgtg aacatctcta 8880ccaagtcttg gttggttacc tggtggatgt ctaacctcaa cttccaaatc gagcaccact 8940tgttcccaac cgctccacaa ttcaggttca aggagatctc tccaagagtt gaggctctct 9000tcaagagaca caacctccct tactacgatt tgccatacac ctctgctgtt tctactacct 9060tcgctaacct ctactctgtt ggacactctg ttggagctga taccaagaag caggattgac 9120tgctttaatg agatatgcga gacgcctatg atcgcatgat atttgctttc aattctgttg 9180tgcacgttgt aaaaaacctg agcatgtgta gctcagatcc ttaccgccgg tttcggttca 9240ttctaatgaa tatatcaccc gttactatcg tatttttatg aataatattc tccgttcaat 9300ttactgattg tgtcgacgcg atcgcgtgcg cacgggcccc ctgcaggatt taaatcccgg 9360gggtacccaa gtttgtacaa aaaagcaggc tccatgatta cgccaagctt cccaattcga 9420ggtaccctcg acggcccgga ctgtatccaa cttctgatct ttgaatctct ctgttccaac 9480atgttctgaa ggagttctaa gacttttcag aaagcttgta acatgctttg tagactttct 9540ttgaattact cttgcaaact ctgattgaac ctacgtgaaa actgctccag aagttctaac 9600caaattccgt cttgggaagg cccaaaattt attgagtact tcagtttcat ggacgtgtct 9660tcaaagattt ataacttgaa atcccatcat ttttaagaga agttctgttc cgcaatgtct 9720tagatctcat tgaaatctac aactcttgtg tcagaagttc ttccagaatc aacttgcatc 9780atggtgaaaa tctggccaga agttctgaac ttgtcatatt tcttaacagt tagaaaaatt 9840tctaagtgtt tagaattttg acttttccaa agcaaacttg acttttgact ttcttaataa 9900aacaaacttc atattctaac atgtcttgat gaaatgtgat tcttgaaatt tgatgttgat 9960gcaaaagtca aagtttgact tttcagtgtg caattgacca ttttgctctt gtgccaattc 10020caaacctaaa ttgatgtatc agtgctgcaa acttgatgtc atggaagatc ttatgagaaa 10080attcttgaag actgagagga aaaattttgt agtacaacac aaagaatcct gtttttcata 10140gtcggactag acacattaac ataaaacacc acttcattcg aagagtgatt gaagaaggaa 10200atgtgcagtt acctttctgc agttcataag agcaacttac agacactttt actaaaatac 10260tacaaagagg aagattttaa caacttagag aagtaatggg agttaaagag caacacatta 10320agggggagtg ttaaaattaa tgtgttgtaa ccaccactac ctttagtaag tattataaga 10380aaattgtaat catcacatta taattattgt ccttatttaa aattatgata aagttgtatc 10440attaagattg agaaaaccaa atagtcctcg tcttgatttt tgaattattg ttttctatgt 10500tacttttctt caagcctata taaaaacttt gtaatgctaa attgtatgct ggaaaaaaat 10560gtgtaatgaa ttgaatagaa attatggtat ttcaaagtcc aaaatccatc aatagaaatt 10620tagtacaaaa cgtaactcaa aaatattctc ttattttaaa ttttacaaca atataaaaat 10680attctcttat tttaaatttt acaataatat aatttatcac ctgtcacctt tagaatacca 10740ccaacaatat taatacttag atattttatt cttaataatt ttgagatctc tcaatatatc 10800tgatatttat tttatatttg tgtcatattt tcttatgttt tagagttaac ccttatatct 10860tggtcaaact agtaattcaa tatatgagtt tgtgaaggac acattgacat cttgaaacat 10920tggttttaac cttgttggaa tgttaaaggt aataaaacat tcagaattat gaccatctat 10980taatatactt cctttgtctt ttaaaaaagt gtgcatgaaa atgctctatg gtaagctaga 11040gtgtcttgct ggcctgtgta tatcaattcc atttccagat ggtagaaact gccactacga 11100ataattagtc ataagacacg tatgttaaca cacgtcccct tgcatgtttt ttgccatata 11160ttccgtctct ttctttttct tcacgtataa aacaatgaac taattaatag agcgatcaag 11220ctgaaccatg cgcgccacca tgtgtgttga gaccgagaac aacgatggaa tccctactgt 11280ggagatcgct ttcgatggag agagagaaag agctgaggct aacgtgaagt tgtctgctga 11340gaagatggaa cctgctgctt tggctaagac cttcgctaga agatacgtgg ttatcgaggg 11400agttgagtac gatgtgaccg atttcaaaca tcctggagga accgtgattt tctacgctct 11460ctctaacact ggagctgatg ctactgaggc tttcaaggag ttccaccaca gatctagaaa 11520ggctaggaag gctttggctg ctttgccttc tagacctgct aagaccgcta aagtggatga 11580tgctgagatg ctccaggatt tcgctaagtg gagaaaggag ttggagaggg acggattctt 11640caagccttct cctgctcatg ttgcttacag attcgctgag ttggctgcta tgtacgcttt 11700gggaacctac ttgatgtacg ctagatacgt tgtgtcctct gtgttggttt acgcttgctt 11760cttcggagct agatgtggat gggttcaaca tgagggagga cattcttctt tgaccggaaa 11820catctggtgg gataagagaa tccaagcttt cactgctgga ttcggattgg ctggatctgg 11880agatatgtgg aactccatgc acaacaagca ccatgctact cctcaaaaag tgaggcacga 11940tatggatttg gataccactc ctgctgttgc tttcttcaac accgctgtgg aggataatag 12000acctagggga ttctctaagt actggctcag attgcaagct tggaccttca ttcctgtgac 12060ttctggattg gtgttgctct tctggatgtt cttcctccat ccttctaagg ctttgaaggg 12120aggaaagtac gaggagcttg tgtggatgtt ggctgctcat gtgattagaa cctggaccat 12180taaggctgtt actggattca ccgctatgca atcctacgga ctcttcttgg ctacttcttg 12240ggtttccgga tgctacttgt tcgctcactt ctctacttct cacacccatt tggatgttgt 12300tcctgctgat gagcatttgt cttgggttag gtacgctgtg gatcacacca ttgatatcga 12360tccttctcag ggatgggtta actggttgat gggatacttg aactgccaag tgattcatca 12420cctcttccct tctatgcctc aattcagaca acctgaggtg tccagaagat tcgttgcttt 12480cgctaagaag tggaacctca actacaaggt gatgacttat gctggagctt ggaaggctac 12540tttgggaaac ctcgataatg tgggaaagca ctactacgtg cacggacaac attctggaaa 12600gaccgcttga taattaatta aggccgcctc gaccgtaccc cctgcagata gactatacta 12660tgttttagcc tgcctgctgg ctagctacta tgttatgtta tgttgtaaaa taaacacctg 12720ctaaggtata tctatctata ttttagcatg gctttctcaa taaattgtct ttccttatcg 12780tttactatct tatacctaat aatgaaataa taatatcaca tatgaggaac ggggcaggtt 12840taggcatata tatacgagtg tagggcggag tgggggggat cgggggtacc acccagcttt 12900cttgtacaaa gtggccatga ttacgccaag ctctccaccg cggtggcggc cgctctagcc 12960caagctttaa ggatgaccta cccattcttg agacaaatgt tacattttag tatcagagta 13020aaatgtgtac ctataactca aattcgattg acatgtatcc attcaacata aaattaaacc 13080agcctgcacc tgcatccaca tttcaagtat tttcaaaccg ttcggctcct atccaccggg 13140tgtaacaaga cggattccga atttggaaga ttttgactca aattcccaat ttatattgac 13200cgtgactaaa tcaactttaa cttctataat tctgattaag ctcccaattt atattcccaa 13260cggcactacc tccaaaattt atagactctc atcccctttt aaaccaactt agtaaacgtt 13320ttttttttaa ttttatgaag ttaagttttt accttgtttt taaaaagaat cgttcataag 13380atgccatgcc agaacattag ctacacgtta cacatagcat gcagccgcgg agaattgttt 13440ttcttcgcca cttgtcactc ccttcaaaca cctaagagct tctctctcac agcacacaca 13500tacaatcaca tgcgtgcatg cattattaca cgtgatcgcc atgcaaatct cctttatagc 13560ctataaatta actcatcggc ttcactcttt actcaaacca aaactcatca atacaaacaa 13620gattaaaaac ataaggcgcg ccggatccgc catggctatt ttgaaccctg aggctgattc 13680tgctgctaac ctcgctactg attctgaggc taagcaaaga caattggctg aggctggata 13740cactcatgtt gagggtgctc ctgctccttt gcctttggag ttgcctcatt tctctctcag 13800agatctcaga gctgctattc ctaagcactg cttcgagaga tctttcgtga cctccaccta 13860ctacatgatc aagaacgtgt tgacttgcgc tgctttgttc tacgctgcta ccttcattga 13920tagagctgga gctgctgctt atgttttgtg gcctgtgtac tggttcttcc agggatctta 13980cttgactgga gtgtgggtta tcgctcatga gtgtggacat caggcttatt gctcttctga 14040ggtggtgaac aacttgattg gactcgtgtt gcattctgct ttgttggtgc cttaccactc 14100ttggagaatc tctcacagaa agcaccattc caacactgga tcttgcgaga acgatgaggt 14160tttcgttcct gtgaccagat ctgtgttggc ttcttcttgg aacgagacct tggaggattc 14220tcctctctac caactctacc gtatcgtgta catgttggtt gttggatgga tgcctggata 14280cctcttcttc aacgctactg gacctactaa gtactgggga aagtctaggt ctcacttcaa 14340cccttactcc gctatctatg ctgataggga gagatggatg atcgtgctct ccgatatttt 14400cttggtggct atgttggctg ttttggctgc tttggtgcac actttctcct tcaacaccat 14460ggtgaagttc tacgtggtgc cttacttcat tgtgaacgct tacttggtgt tgattaccta 14520cctccaacac accgatacct acatccctca tttcagagag ggagagtgga attggttgag 14580aggagctttg tgcactgtgg atagatcatt tggtccattc ctcgattctg tggtgcatag 14640aatcgtggat acccatgttt gccaccacat cttctccaag atgcctttct atcattgcga 14700ggaggctacc aacgctatta agcctctcct cggaaagttc tacttgaagg ataccactcc 14760tgttcctgtt gctctctgga gatcttacac ccattgcaag ttcgttgagg atgatggaaa 14820ggtggtgttc

tacaagaaca agctctagtt aattaaggcc gcctcgagca tgcatctaga 14880gggcccgcta gcgttaaccc tgctttaatg agatatgcga gacgcctatg atcgcatgat 14940atttgctttc aattctgttg tgcacgttgt aaaaaacctg agcatgtgta gctcagatcc 15000ttaccgccgg tttcggttca ttctaatgaa tatatcaccc gttactatcg tatttttatg 15060aataatattc tccgttcaat ttactgattg tccgtcgagc atatgctaga ggatccccgg 15120gtacccaact ttattataca tagttgataa ttcactggcc ggatatcttt tttaagggcg 15180aattctgcag atatccatca cactggcggc cgctcgaggt accatcgttc aaacatttgg 15240caataaagtt tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt 15300ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga 15360tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata 15420tagcgcgcaa actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggca 15480ttaccctgtt atccctagag gggaaaattc gaatccaaaa attacggata tgaatatagg 15540catatccgta tccgaattat ccgtttgaca gctagcaacg attgtacaat tgcttcttta 15600aaaaaggaag aaagaaagaa agaaaagaat caacatcagc gttaacaaac ggccccgtta 15660cggcccaaac ggtcatatag agtaacggcg ttaagcgttg aaagactcct atcgaaatac 15720gtaaccgcaa acgtgtcata gtcagatccc ctcttccttc accgcctcaa acacaaaaat 15780aatcttctac agcctatata tacaaccccc ccttctatct ctcctttctc acaattcatc 15840atctttcttt ctctaccccc aattttaaga aatcctctct tctcctcttc attttcaagg 15900taaatctctc tctctctctc tctctctgtt attccttgtt ttaattaggt atgtattatt 15960gctagtttgt taatctgctt atcttatgta tgccttatgt gaatatcttt atcttgttca 16020tctcatccgt ttagaagcta taaatttgtt gatttgactg tgtatctaca cgtggttatg 16080tttatatcta atcagatatg aatttcttca tattgttgcg tttgtgtgta ccaatccgaa 16140atcgttgatt tttttcattt aatcgtgtag ctaattgtac gtatacatat ggatctacgt 16200atcaattgtt catctgtttg tgtttgtatg tatacagatc tgaaaacatc acttctctca 16260tctgattgtg ttgttacata catagatata gatctgttat atcatttttt ttattaattg 16320tgtatatata tatgtgcata gatctggatt acatgattgt gattatttac atgattttgt 16380tatttacgta tgtatatatg tagatctgga ctttttggag ttgttgactt gattgtattt 16440gtgtgtgtat atgtgtgttc tgatcttgat atgttatgta tgtgcagctg aaccatggcg 16500gcggcaacaa caacaacaac aacatcttct tcgatctcct tctccaccaa accatctcct 16560tcctcctcca aatcaccatt accaatctcc agattctccc tcccattctc cctaaacccc 16620aacaaatcat cctcctcctc ccgccgccgc ggtatcaaat ccagctctcc ctcctccatc 16680tccgccgtgc tcaacacaac caccaatgtc acaaccactc cctctccaac caaacctacc 16740aaacccgaaa cattcatctc ccgattcgct ccagatcaac cccgcaaagg cgctgatatc 16800ctcgtcgaag ctttagaacg tcaaggcgta gaaaccgtat tcgcttaccc tggaggtaca 16860tcaatggaga ttcaccaagc cttaacccgc tcttcctcaa tccgtaacgt ccttcctcgt 16920cacgaacaag gaggtgtatt cgcagcagaa ggatacgctc gatcctcagg taaaccaggt 16980atctgtatag ccacttcagg tcccggagct acaaatctcg ttagcggatt agccgatgcg 17040ttgttagata gtgttcctct tgtagcaatc acaggacaag tccctcgtcg tatgattggt 17100acagatgcgt ttcaagagac tccgattgtt gaggtaacgc gttcgattac gaagcataac 17160tatcttgtga tggatgttga agatatccct aggattattg aggaagcttt ctttttagct 17220acttctggta gacctggacc tgttttggtt gatgttccta aagatattca acaacagctt 17280gcgattccta attgggaaca ggctatgaga ttacctggtt atatgtctag gatgcctaaa 17340cctccggaag attctcattt ggagcagatt gttaggttga tttctgagtc taagaagcct 17400gtgttgtatg ttggtggtgg ttgtttgaat tctagcgatg aattgggtag gtttgttgag 17460cttacgggga tccctgttgc gagtacgttg atggggctgg gatcttatcc ttgtgatgat 17520gagttgtcgt tacatatgct tggaatgcat gggactgtgt atgcaaatta cgctgtggag 17580catagtgatt tgttgttggc gtttggggta aggtttgatg atcgtgtcac gggtaagctt 17640gaggcttttg ctagtagggc taagattgtt catattgata ttgactcggc tgagattggg 17700aagaataaga ctcctcatgt gtctgtgtgt ggtgatgtta agctggcttt gcaagggatg 17760aataaggttc ttgagaaccg agcggaggag cttaagcttg attttggagt ttggaggaat 17820gagttgaacg tacagaaaca gaagtttccg ttgagcttta agacgtttgg ggaagctatt 17880cctccacagt atgcgattaa ggtccttgat gagttgactg atggaaaagc cataataagt 17940actggtgtcg ggcaacatca aatgtgggcg gcgcagttct acaattacaa gaaaccaagg 18000cagtggctat catcaggagg ccttggagct atgggatttg gacttcctgc tgcgattgga 18060gcgtctgttg ctaaccctga tgcgatagtt gtggatattg acggagatgg aagctttata 18120atgaatgtgc aagagctagc cactattcgt gtagagaatc ttccagtgaa ggtactttta 18180ttaaacaacc agcatcttgg catggttatg caatgggaag atcggttcta caaagctaac 18240cgagctcaca catttctcgg ggatccggct caggaggacg agatattccc gaacatgttg 18300ctgtttgcag cagcttgcgg gattccagcg gcgagggtga caaagaaagc agatctccga 18360gaagctattc agacaatgct ggatacacca ggaccttacc tgttggatgt gatttgtccg 18420caccaagaac atgtgttgcc gatgatcccg aatggtggca ctttcaacga tgtcataacg 18480gaaggagatg gccggattaa atactgatag ggataacagg gtaatttccc gacccaagct 18540ctagatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc 18600cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 18660gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg 18720catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 18780cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 18840tatgttacta gatcgggcct cctgtcaagc tctgcttggt aataattgtc attagattgt 18900ttttatgcat agatgcactc gaaatcagcc aattttagac aagtatcaaa cggatgttaa 18960ttcagtacat taaagacgtc cgcaatgtgt tattaagttg tctaagcgtc aatttgttta 19020caccacaata tatcctgcca ccagccagcc aacagctccc cgaccggcag ctcggcacaa 19080aatcaccacg cgttaccacc acgccggccg gccgcatggt gttgaccgtg ttcgccggca 19140ttgccgagtt cgagcgttcc ctaatcatcg accgcacccg gagcgggcgc gaggccgcca 19200aggcccgagg cgtgaagttt ggcccccgcc ctaccctcac cccggcacag atcgcgcacg 19260cccgcgagct gatcgaccag gaaggccgca ccgtgaaaga ggcggctgca ctgcttggcg 19320tgcatcgctc gaccctgtac cgcgcacttg agcgcagcga ggaagtgacg cccaccgagg 19380ccaggcggcg cggtgccttc cgtgaggacg cattgaccga ggccgacgcc ctggcggccg 19440ccgagaatga acgccaagag gaacaagcat gaaaccgcac caggacggcc aggacgaacc 19500gtttttcatt accgaagaga tcgaggcgga gatgatcgcg gccgggtacg tgttcgagcc 19560gcccgcgcac gtctcaaccg tgcggctgca tgaaatcctg gccggtttgt ctgatgccaa 19620gctggcggcc tggccggcca gcttggccgc tgaagaaacc gagcgccgcc gtctaaaaag 19680gtgatgtgta tttgagtaaa acagcttgcg tcatgcggtc gctgcgtata tgatgcgatg 19740agtaaataaa caaatacgca aggggaacgc atgaaggtta tcgctgtact taaccagaaa 19800ggcgggtcag gcaagacgac catcgcaacc catctagccc gcgccctgca actcgccggg 19860gccgatgttc tgttagtcga ttccgatccc cagggcagtg cccgcgattg ggcggccgtg 19920cgggaagatc aaccgctaac cgttgtcggc atcgaccgcc cgacgattga ccgcgacgtg 19980aaggccatcg gccggcgcga cttcgtagtg atcgacggag cgccccaggc ggcggacttg 20040gctgtgtccg cgatcaaggc agccgacttc gtgctgattc cggtgcagcc aagcccttac 20100gacatatggg ccaccgccga cctggtggag ctggttaagc agcgcattga ggtcacggat 20160ggaaggctac aagcggcctt tgtcgtgtcg cgggcgatca aaggcacgcg catcggcggt 20220gaggttgccg aggcgctggc cgggtacgag ctgcccattc ttgagtcccg tatcacgcag 20280cgcgtgagct acccaggcac tgccgccgcc ggcacaaccg ttcttgaatc agaacccgag 20340ggcgacgctg cccgcgaggt ccaggcgctg gccgctgaaa ttaaatcaaa actcatttga 20400gttaatgagg taaagagaaa atgagcaaaa gcacaaacac gctaagtgcc ggccgtccga 20460gcgcacgcag cagcaaggct gcaacgttgg ccagcctggc agacacgcca gccatgaagc 20520gggtcaactt tcagttgccg gcggaggatc acaccaagct gaagatgtac gcggtacgcc 20580aaggcaagac cattaccgag ctgctatctg aatacatcgc gcagctacca gagtaaatga 20640gcaaatgaat aaatgagtag atgaatttta gcggctaaag gaggcggcat ggaaaatcaa 20700gaacaaccag gcaccgacgc cgtggaatgc cccatgtgtg gaggaacggg cggttggcca 20760ggcgtaagcg gctgggttgt ctgccggccc tgcaatggca ctggaacccc caagcccgag 20820gaatcggcgt gagcggtcgc aaaccatccg gcccggtaca aatcggcgcg gcgctgggtg 20880atgacctggt ggagaagttg aaggccgcgc aggccgccca gcggcaacgc atcgaggcag 20940aagcacgccc cggtgaatcg tggcaagcgg ccgctgatcg aatccgcaaa gaatcccggc 21000aaccgccggc agccggtgcg ccgtcgatta ggaagccgcc caagggcgac gagcaaccag 21060attttttcgt tccgatgctc tatgacgtgg gcacccgcga tagtcgcagc atcatggacg 21120tggccgtttt ccgtctgtcg aagcgtgacc gacgagctgg cgaggtgatc cgctacgagc 21180ttccagacgg gcacgtagag gtttccgcag ggccggccgg catggccagt gtgtgggatt 21240acgacctggt actgatggcg gtttcccatc taaccgaatc catgaaccga taccgggaag 21300ggaagggaga caagcccggc cgcgtgttcc gtccacacgt tgcggacgta ctcaagttct 21360gccggcgagc cgatggcgga aagcagaaag acgacctggt agaaacctgc attcggttaa 21420acaccacgca cgttgccatg cagcgtacga agaaggccaa gaacggccgc ctggtgacgg 21480tatccgaggg tgaagccttg attagccgct acaagatcgt aaagagcgaa accgggcggc 21540cggagtacat cgagatcgag ctagctgatt ggatgtaccg cgagatcaca gaaggcaaga 21600acccggacgt gctgacggtt caccccgatt actttttgat cgatcccggc atcggccgtt 21660ttctctaccg cctggcacgc cgcgccgcag gcaaggcaga agccagatgg ttgttcaaga 21720cgatctacga acgcagtggc agcgccggag agttcaagaa gttctgtttc accgtgcgca 21780agctgatcgg gtcaaatgac ctgccggagt acgatttgaa ggaggaggcg gggcaggctg 21840gcccgatcct agtcatgcgc taccgcaacc tgatcgaggg cgaagcatcc gccggttcct 21900aatgtacgga gcagatgcta gggcaaattg ccctagcagg ggaaaaaggt cgaaaaggtc 21960tctttcctgt ggatagcacg tacattggga acccaaagcc gtacattggg aaccggaacc 22020cgtacattgg gaacccaaag ccgtacattg ggaaccggtc acacatgtaa gtgactgata 22080taaaagagaa aaaaggcgat ttttccgcct aaaactcttt aaaacttatt aaaactctta 22140aaacccgcct ggcctgtgca taactgtctg gccagcgcac agccgaagag ctgcaaaaag 22200cgcctaccct tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg cctatcgcgg 22260ccgctggccg ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg cgcggacaag 22320ccgcgccgtc gccactcgac cgccggcgcc cacatcaagg caccctgcct cgcgcgtttc 22380ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg 22440taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt 22500cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg 22560cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat 22620gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc 22680gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 22740ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 22800ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 22860atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 22920aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 22980gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 23040ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 23100ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 23160acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 23220gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 23280ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 23340ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 23400gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 23460ggaacgaaaa ctcacgttaa gggattttgg tcatgcatga tatatctccc aatttgtgta 23520gggcttatta tgcacgctta aaaataataa aagcagactt gacctgatag tttggctgtg 23580agcaattatg tgcttagtgc atctaacgct tgagttaagc cgcgccgcga agcggcgtcg 23640gcttgaacga atttctagct agacattatt tgccgactac cttggtgatc tcgcctttca 23700cgtagtggac aaattcttcc aactgatctg cgcgcgaggc caagcgatct tcttcttgtc 23760caagataagc ctgtctagct tcaagtatga cgggctgata ctgggccggc aggcgctcca 23820ttgcccagtc ggcagcgaca tccttcggcg cgattttgcc ggttactgcg ctgtaccaaa 23880tgcgggacaa cgtaagcact acatttcgct catcgccagc ccagtcgggc ggcgagttcc 23940atagcgttaa ggtttcattt agcgcctcaa atagatcctg ttcaggaacc ggatcaaaga 24000gttcctccgc cgctggacct accaaggcaa cgctatgttc tcttgctttt gtcagcaaga 24060tagccagatc aatgtcgatc gtggctggct cgaagatacc tgcaagaatg tcattgcgct 24120gccattctcc aaattgcagt tcgcgcttag ctggataacg ccacggaatg atgtcgtcgt 24180gcacaacaat ggtgacttct acagcgcgga gaatctcgct ctctccaggg gaagccgaag 24240tttccaaaag gtcgttgatc aaagctcgcc gcgttgtttc atcaagcctt acggtcaccg 24300taaccagcaa atcaatatca ctgtgtggct tcaggccgcc atccactgcg gagccgtaca 24360aatgtacggc cagcaacgtc ggttcgagat ggcgctcgat gacgccaact acctctgata 24420gttgagtcga tacttcggcg atcaccgctt cccccatgat gtttaacttt gttttagggc 24480gactgccctg ctgcgtaaca tcgttgctgc tccataacat caaacatcga cccacggcgt 24540aacgcgcttg ctgcttggat gcccgaggca tagactgtac cccaaaaaaa cagtcataac 24600aagccatgaa aaccgccact gcgttccatg g 246313924356DNAArtificial SequencePlant Expression Plasmid 39tgatcatcta aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg cggtcgctgc 60gtatatgatg cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa ggttatcgct 120gtacttaacc agaaaggcgg gtcaggcaag acgaccatcg caacccatct agcccgcgcc 180ctgcaactcg ccggggccga tgttctgtta gtcgattccg atccccaggg cagtgcccgc 240gattgggcgg ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga ccgcccgacg 300attgaccgcg acgtgaaggc catcggccgg cgcgacttcg tagtgatcga cggagcgccc 360caggcggcgg acttggctgt gtccgcgatc aaggcagccg acttcgtgct gattccggtg 420cagccaagcc cttacgacat ttgggccacc gccgacctgg tggagctggt taagcagcgc 480attgaggtca cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc gatcaaaggc 540acgcgcatcg gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc cattcttgag 600tcccgtatca cgcagcgcgt gagctaccca ggcactgccg ccgccggcac aaccgttctt 660gaatcagaac ccgagggcga cgctgcccgc gaggtccagg cgctggccgc tgaaattaaa 720tcaaaactca tttgagttaa tgaggtaaag agaaaatgag caaaagcaca aacacgctaa 780gtgccggccg tccgagcgca cgcagcagca aggctgcaac gttggccagc ctggcagaca 840cgccagccat gaagcgggtc aactttcagt tgccggcgga ggatcacacc aagctgaaga 900tgtacgcggt acgccaaggc aagaccatta ccgagctgct atctgaatac atcgcgcagc 960taccagagta aatgagcaaa tgaataaatg agtagatgaa ttttagcggc taaaggaggc 1020ggcatggaaa atcaagaaca accaggcacc gacgccgtgg aatgccccat gtgtggagga 1080acgggcggtt ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa tggcactgga 1140acccccaagc ccgaggaatc ggcgtgagcg gtcgcaaacc atccggcccg gtacaaatcg 1200gcgcggcgct gggtgatgac ctggtggaga agttgaaggc cgcgcaggcc gcccagcggc 1260aacgcatcga ggcagaagca cgccccggtg aatcgtggca aggggccgct gatcgaatcc 1320gcaaagaatc ccggcaaccg ccggcagccg gtgcgccgtc gattaggaag ccgcccaagg 1380gcgacgagca accagatttt ttcgttccga tgctctatga cgtgggcacc cgcgatagtc 1440gcagcatcat ggacgtggcc gttttccgtc tgtcgaagcg tgaccgacga gctggcgagg 1500tgatccgcta cgagcttcca gacgggcacg tagaggtttc cgcaggcccc gccggcatgg 1560ccagtgtgtg ggattacgac ctggtactga tggcggtttc ccatctaacc gaatccatga 1620accgataccg ggaagggaag ggagacaagc ccggccgcgt gttccgtcca cacgttgcgg 1680acgtactcaa gttctgccgg cgagccgatg gcggaaagca gaaagacgac ctggtagaaa 1740cctgcattcg gttaaacacc acgcacgttg ccatgcagcg taccaagaag gccaagaacg 1800gccgcctggt gacggtatcc gagggtgaag ccttgattag ccgctacaag atcgtaaaga 1860gcgaaaccgg gcggccggag tacatcgaga tcgagcttgc tgattggatg taccgcgaga 1920tcacagaagg caagaacccg gacgtgctga cggttcaccc cgattacttt ttgatcgacc 1980ccggcatcgg ccgttttctc taccgcctgg cacgccgcgc cgcaggcaag gcagaagcca 2040gatggttgtt caagacgatc tacgaacgca gtggcagcgc cggagagttc aagaagttct 2100gtttcaccgt gcgcaagctg atcgggtcaa atgacctgcc ggagtacgat ttgaaggagg 2160aggcggggca ggctggcccg atcctagtca tgcgctaccg caacctgatc gagggcgaag 2220catccgccgg ttcctaatgt acggagcaga tgctagggca aattgcccta gcaggggaaa 2280aaggtcgaaa aggtctcttt cctgtggata gcacgtacat tgggaaccca aagccgtaca 2340ttgggaaccg gaacccgtac attgggaacc caaagccgta cattgggaac cggtcacaca 2400tgtaagtgac tgatataaaa gagaaaaaag gcgatttttc cgcctaaaac tctttaaaac 2460ttattaaaac tcttaaaacc cgcctggcct gtgcataact gtctggccag cgcacagccg 2520aagagctgca aaaagcgcct acccttcggt cgctgcgctc cctacgcccc gccgcttcgc 2580gtcggcctat cgcggcctat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac 2640cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 2700cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 2760aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 2820gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 2880tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 2940agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 3000ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 3060taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 3120gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 3180gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 3240ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 3300ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 3360gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 3420caagaagatc ctttgatctt ttctacgggg tccttcaact catcgatagt ttggctgtga 3480gcaattatgt gcttagtgca tctaacgctt gagttaagcc gcgccgcgaa gcggcgtcgg 3540cttgaacgaa tttctagcta gacattattt gccaacgacc ttcgtgatct cgcccttgac 3600atagtggaca aattcttcga gctggtcggc ccgggacgcg agacggtctt cttcttggcc 3660cagataggct tggcgcgctt cgaggatcac gggctggtat tgcgccggaa ggcgctccat 3720cgcccagtcg gcggcgacat ccttcggcgc gatcttgccg gtaaccgccg agtaccaaat 3780ccggctcagc gtaaggacca cattgcgctc atcgcccgcc caatccggcg gggagttcca 3840cagggtcagc gtctcgttca gtgcttcgaa cagatcctgt tccggcaccg ggtcgaaaag 3900ttcctcggcc gcggggccga cgagggccac gctatgctcc cgggccttgg tgagcaggat 3960cgccagatca atgtcgatgg tggccggttc aaagataccc gccagaatat cattacgctg 4020ccattcgccg aactggagtt cgcgtttggc cggatagcgc caggggatga tgtcatcgtg 4080caccacaatc gtcacctcaa ccgcgcgcag gatttcgctc tcgccggggg aggcggacgt 4140ttccagaagg tcgttgataa gcgcgcggcg cgtggtctcg tcgagacgga cggtaacggt 4200gacaagcagg tcgatgtccg aatggggctt aaggccgccg tcaacggcgc taccatacag 4260atgcacggcg aggagggtcg gttcgaggtg gcgctcgatg acacccacga cttccgacag 4320ctgggtggac acctcggcga tgaccgcttc acccatgatg tttaactttg ttttagggcg 4380actgccctgc tgcgtaacat cgttgctgct ccataacatc aaacatcgac ccacggcgta 4440acgcgcttgc tgcttggatg cccgaggcat agactgtacc ccaaaaaaac agtcataaca 4500agccatgaaa accgccactg cgttccatga atattcaaac aaacacatac agcgcgactt 4560atcatggata ttgacataca aatggacgaa cggataaacc ttttcacgcc cttttaaata 4620tccgattatt ctaataaacg ctcttttctc ttaggtttac ccgccaatat atcctgtcaa 4680acactgatag tttaaactga aggcgggaaa cgacaatctg atcactgatt agtaactaag 4740gcctttaatt aatctagagg cgcgccgggc cccctgcagg gagctcggcc ggccaattta 4800aattgatatc ggtacatcga ttacgccaag ctatcaactt tgtatagaaa agttgccatg 4860attacgccaa gcttggcgcg ccctgcagca aatttacaca ttgccactaa acgtctaaac 4920ccttgtaatt tgtttttgtt ttactatgtg tgttatgtat ttgatttgcg ataaattttt 4980atatttggta ctaaatttat aacacctttt atgctaacgt ttgccaacac ttagcaattt 5040gcaagttgat taattgattc taaattattt ttgtcttcta aatacatata ctaatcaact 5100ggaaatgtaa atatttgcta atatttctac tataggagaa ttaaagtgag tgaatatggt 5160accacaaggt

ttggagattt aattgttgca atgctgcatg gatggcatat acaccaaaca 5220ttcaataatt cttgaggata ataatggtac cacacaagat ttgaggtgca tgaacgtcac 5280gtggacaaaa ggtttagtaa tttttcaaga caacaatgtt accacacaca agttttgagg 5340tgcatgcatg gatgccctgt ggaaagttta aaaatatttt ggaaatgatt tgcatggaag 5400ccatgtgtaa aaccatgaca tccacttgga ggatgcaata atgaagaaaa ctacaaattt 5460acatgcaact agttatgcat gtagtctata taatgaggat tttgcaatac tttcattcat 5520acacactcac taagttttac acgattataa tttcttcata gccagtacca tggaagttgt 5580tgagaggttc tacggagagt tggatggaaa ggtttcccaa ggagtgaacg ctttgttggg 5640atctttcgga gttgagttga ctgatacccc aactactaag ggattgccac tcgttgattc 5700tccaactcca attgtgttgg gagtgtctgt ttacttgacc atcgtgatcg gaggattgct 5760ttggatcaag gctagagatc tcaagccaag agcttctgag ccattcttgt tgcaagcttt 5820ggtgttggtg cacaacttgt tctgcttcgc tttgtctctt tacatgtgcg tgggtatcgc 5880ttaccaagct atcacctgga gatattcctt gtggggaaac gcttataacc caaagcacaa 5940ggagatggct atcctcgttt acctcttcta catgtccaag tacgtggagt tcatggatac 6000cgtgatcatg atcctcaaga gatccaccag acagatttct ttcctccacg tgtaccacca 6060ctcttctatc tcccttatct ggtgggctat tgctcaccac gctccaggag gagaggctta 6120ttggagtgct gctctcaact ctggagtgca cgtgttgatg tacgcttact acttcttggc 6180tgcttgcttg agatcttccc caaagctcaa gaacaagtac ctcttctggg gaagatacct 6240cacccaattc cagatgttcc agttcatgct caacttggtg caagcttact acgatatgaa 6300aaccaacgct ccatatccac aatggctcat caagatcctc ttctactaca tgatctccct 6360cttgttcctc ttcggaaact tctacgtgca aaagtacatc aagccatccg atggaaagca 6420aaagggagct aagaccgagt gatcgacaag ctcgagtttc tccataataa tgtgtgagta 6480gttcccagat aagggaatta gggttcctat agggtttcgc tcatgtgttg agcatataag 6540aaacccttag tatgtatttg tatttgtaaa atacttctat caataaaatt tctaattcct 6600aaaaccaaaa tccagtacta aaatccagat cccccgaatt aattcggcgt taattcaggg 6660aaacttagca gatatttggt gtctaaatgt ttattttgtg atatgttcat gtttgaaatg 6720gtggtttcga aaccagggac aacgttggga tctgataggg tgtcaaagag tattatggat 6780tgggacaatt tcggtcatga gttgcaaatt caagtatatc gttcgattat gaaaattttc 6840gaagaatatc ccatttgaga gagtctttac ctcattaatg tttttagatt atgaaatttt 6900atcatagttc atcgtagtct ttttggtgta aaggctgtaa aaagaaattg ttcacttttg 6960ttttcgttta tgtgaaggct gtaaaagatt gtaaaagact attttggtgt tttggataaa 7020atgatagttt ttatagattc ttttgctttt agaagaaata catttgaaat tttttccatg 7080ttgagtataa aataccgaaa tcgattgaag atcatagaaa tattttaact gaaaacaaat 7140ttataactga ttcaattctc tccattttta tacctattta accgtaatcg attctaatag 7200atgatcgatt ttttatataa tcctaattaa ccaacggcat gtattggata attaaccgat 7260caactctcac ccctaataga atcagtattt tccttcgacg ttaattgatc ctacactatg 7320taggtcatat ccatcgtttt aatttttggc caccattcaa ttctgtcttg cctttaggga 7380tgtgaatatg aacggccaag gtaagagaat aaaaataatc caaattaaag caagagaggc 7440caagtaagat aatccaaatg tacacttgtc attgccaaaa ttagtaaaat actcggcata 7500ttgtattccc acacattatt aaaataccgt atatgtattg gctgcatttg catgaataat 7560actacgtgta agcccaaaag aacccacgtg tagcccatgc aaagttaaca ctcacgaccc 7620cattcctcag tctccactat ataaacccac catccccaat ctcaccaaac ccaccacaca 7680actcacaact cactctcaca ccttaaagaa ccaatcacca ccaaaaaacc atgggaaaag 7740gatctgaggg aagatctgct gctagagaga tgactgctga ggctaacgga gataagagaa 7800agaccatcct cattgaggga gtgttgtacg atgctaccaa cttcaaacac ccaggaggtt 7860ccattattaa cttcctcacc gagggagaag ctggagttga tgctacccaa gcttacagag 7920agttccatca gagatccgga aaggctgata agtacctcaa gtccctccca aagttggatg 7980cttctaaggt ggagtctagg ttctctgcta aggagcaggc tagaagggac gctatgacca 8040gggattacgc tgctttcaga gaggagttgg ttgctgaggg atacttcgat ccatctatcc 8100cacacatgat ctacagagtg gtggagattg tggctttgtt cgctttgtct ttctggttga 8160tgtctaaggc ttctccaacc tctttggttt tgggagtggt gatgaacgga atcgctcaag 8220gaagatgcgg atgggttatg cacgagatgg gacacggatc tttcactgga gttatctggc 8280tcgatgatag gatgtgcgag ttcttctacg gagttggatg tggaatgtct ggacactact 8340ggaagaacca gcactctaag caccacgctg ctccaaacag attggagcac gatgtggatt 8400tgaacacctt gccactcgtt gctttcaacg agagagttgt gaggaaggtt aagccaggat 8460ctttgttggc tttgtggctc agagttcagg cttatttgtt cgctccagtg tcttgcttgt 8520tgatcggatt gggatggacc ttgtacttgc acccaagata tatgctcagg accaagagac 8580acatggagtt tgtgtggatc ttcgctagat atatcggatg gttctccttg atgggagctt 8640tgggatattc tcctggaact tctgtgggaa tgtacctctg ctctttcgga cttggatgca 8700tctacatctt cctccaattc gctgtgtctc acacccactt gccagttacc aacccagagg 8760atcaattgca ctggcttgag tacgctgctg atcacaccgt gaacatctct accaagtctt 8820ggttggttac ctggtggatg tctaacctca acttccaaat cgagcaccac ttgttcccaa 8880ccgctccaca attcaggttc aaggagatct ctccaagagt tgaggctctc ttcaagagac 8940acaacctccc ttactacgat ttgccataca cctctgctgt ttctactacc ttcgctaacc 9000tctactctgt tggacactct gttggagctg ataccaagaa gcaggattga ctgctttaat 9060gagatatgcg agacgcctat gatcgcatga tatttgcttt caattctgtt gtgcacgttg 9120taaaaaacct gagcatgtgt agctcagatc cttaccgccg gtttcggttc attctaatga 9180atatatcacc cgttactatc gtatttttat gaataatatt ctccgttcaa tttactgatt 9240gtgtcgacgc gatcgcgtgc gcacgggccc cctgcaggat ttaaatcccg ggggtaccca 9300agtttgtaca aaaaagcagg ctccatgatt acgccaagct tggccactaa ggccaattta 9360aatctactag gccggccatc gacggcccgg actgtatcca acttctgatc tttgaatctc 9420tctgttccaa catgttctga aggagttcta agacttttca gaaagcttgt aacatgcttt 9480gtagactttc tttgaattac tcttgcaaac tctgattgaa cctacgtgaa aactgctcca 9540gaagttctaa ccaaattccg tcttgggaag gcccaaaatt tattgagtac ttcagtttca 9600tggacgtgtc ttcaaagatt tataacttga aatcccatca tttttaagag aagttctgtt 9660ccgcaatgtc ttagatctca ttgaaatcta caactcttgt gtcagaagtt cttccagaat 9720caacttgcat catggtgaaa atctggccag aagttctgaa cttgtcatat ttcttaacag 9780ttagaaaaat ttctaagtgt ttagaatttt gacttttcca aagcaaactt gacttttgac 9840tttcttaata aaacaaactt catattctaa catgtcttga tgaaatgtga ttcttgaaat 9900ttgatgttga tgcaaaagtc aaagtttgac ttttcagtgt gcaattgacc attttgctct 9960tgtgccaatt ccaaacctaa attgatgtat cagtgctgca aacttgatgt catggaagat 10020cttatgagaa aattcttgaa gactgagagg aaaaattttg tagtacaaca caaagaatcc 10080tgtttttcat agtcggacta gacacattaa cataaaacac cacttcattc gaagagtgat 10140tgaagaagga aatgtgcagt tacctttctg cagttcataa gagcaactta cagacacttt 10200tactaaaata ctacaaagag gaagatttta acaacttaga gaagtaatgg gagttaaaga 10260gcaacacatt aagggggagt gttaaaatta atgtgttgta accaccacta cctttagtaa 10320gtattataag aaaattgtaa tcatcacatt ataattattg tccttattta aaattatgat 10380aaagttgtat cattaagatt gagaaaacca aatagtcctc gtcttgattt ttgaattatt 10440gttttctatg ttacttttct tcaagcctat ataaaaactt tgtaatgcta aattgtatgc 10500tggaaaaaaa tgtgtaatga attgaataga aattatggta tttcaaagtc caaaatccat 10560caatagaaat ttagtacaaa acgtaactca aaaatattct cttattttaa attttacaac 10620aatataaaaa tattctctta ttttaaattt tacaataata taatttatca cctgtcacct 10680ttagaatacc accaacaata ttaatactta gatattttat tcttaataat tttgagatct 10740ctcaatatat ctgatattta ttttatattt gtgtcatatt ttcttatgtt ttagagttaa 10800cccttatatc ttggtcaaac tagtaattca atatatgagt ttgtgaagga cacattgaca 10860tcttgaaaca ttggttttaa ccttgttgga atgttaaagg taataaaaca ttcagaatta 10920tgaccatcta ttaatatact tcctttgtct tttaaaaaag tgtgcatgaa aatgctctat 10980ggtaagctag agtgtcttgc tggcctgtgt atatcaattc catttccaga tggtagaaac 11040tgccactacg aataattagt cataagacac gtatgttaac acacgtcccc ttgcatgttt 11100tttgccatat attccgtctc tttctttttc ttcacgtata aaacaatgaa ctaattaata 11160gagcgatcaa gctgaaccct accatgtgtg ttgagaccga gaacaacgat ggaatcccta 11220ctgtggagat cgctttcgat ggagagagag aaagagctga ggctaacgtg aagttgtctg 11280ctgagaagat ggaacctgct gctttggcta agaccttcgc tagaagatac gtggttatcg 11340agggagttga gtacgatgtg accgatttca aacatcctgg aggaaccgtg attttctacg 11400ctctctctaa cactggagct gatgctactg aggctttcaa ggagttccac cacagatcta 11460gaaaggctag gaaggctttg gctgctttgc cttctagacc tgctaagacc gctaaagtgg 11520atgatgctga gatgctccag gatttcgcta agtggagaaa ggagttggag agggacggat 11580tcttcaagcc ttctcctgct catgttgctt acagattcgc tgagttggct gctatgtacg 11640ctttgggaac ctacttgatg tacgctagat acgttgtgtc ctctgtgttg gtttacgctt 11700gcttcttcgg agctagatgt ggatgggttc aacacgaggg aggacactct tctttgaccg 11760gaaacatctg gtgggataag agaatccaag ctttcactgc tggattcgga ttggctggat 11820ctggagatat gtggaactcc atgcacaaca agcaccacgc tactcctcaa aaagtgaggc 11880acgatatgga tttggatacc actcctgctg ttgctttctt caacaccgct gtggaggata 11940atagacctag gggattctct aagtactggc tcagattgca agcttggacc ttcattcctg 12000tgacttctgg attggtgttg ctcttctgga tgttcttcct ccacccttct aaggctttga 12060agggaggaaa gtacgaggag cttgtgtgga tgttggctgc tcacgtgatt agaacctgga 12120ccattaaggc tgttactgga ttcaccgcta tgcaatccta cggactcttc ttggctactt 12180cttgggtttc cggatgctac ttgttcgctc acttctctac ttctcacacc cacttggatg 12240ttgttcctgc tgatgagcac ttgtcttggg ttaggtacgc tgtggatcac accattgata 12300tcgatccttc tcagggatgg gttaactggt tgatgggata cttgaactgc caagtgattc 12360accacctctt cccttctatg cctcaattca gacaacctga ggtgtccaga agattcgttg 12420ctttcgctaa gaagtggaac ctcaactaca aggtgatgac ttatgctgga gcttggaagg 12480ctactttggg aaacctcgat aatgtgggaa agcactacta cgtgcacgga caacactctg 12540gaaagaccgc ttgattaatt aaggccgcct cgaccgtacc ccctgcagat agactatact 12600atgttttagc ctgcctgctg gctagctact atgttatgtt atgttgtaaa ataaacacct 12660gctaaggtat atctatctat attttagcat ggctttctca ataaattgtc tttccttatc 12720gtttactatc ttatacctaa taatgaaata ataatatcac atatgaggaa cggggcaggt 12780ttaggcatat atatacgagt gtagggcgga gtggggggcg cctactaccg gtaattcccg 12840ggattagcgg ccgctagtct gtgcgcactt gtatcctgca ggttaggccg gccacacggg 12900caggacatag ggactactac aagcatagta tgcttcagac aaagagctag gaaagaactc 12960ttgatggagg ttaagagaaa aaagtgctag aggggcatag taatcaaact tgtcaaaacc 13020gtcatcatga tgagggatga cataatataa aaagttgact aaggtcttgg tagtactctt 13080tgattagtat tatatattgg tgagaacatg agtcaagagg agacaagaaa ccgaggaacc 13140atagtttagc aacaagatgg aagttgcaaa gttgagctag ccgctcgatt agttacatct 13200cctaagcagt actacaagga atggtctcta tactttcatg tttagcacat ggtagtgcgg 13260attgacaagt tagaaacagt gcttaggaga caaagagtca gtaaaggtat tgaaagagtg 13320aagttgatgc tcgacaggtc aggagaagtc cctccgccag atggtgacta ccaaggggtt 13380ggtatcagct gagacccaaa taagattctt cggttgaacc agtggttcga ccgagactct 13440tagggtggga tttcactgta agatttgtgc attttgttga atataaattg acaatttttt 13500ttatttaatt atagattatt tagaatgaat tacatattta gtttctaaca aggatagcaa 13560tggatgggta tgggtacagg ttaaacatat ctattaccca cccatctagt cgtcgggttt 13620tacacgtacc cacccgttta cataaaccag accggaattt taaaccgtac ccgtccgtta 13680gcgggtttca gatttacccg tttaatcggg taaaacctga ttactaaata tatatttttt 13740atttgataaa caaaacaaaa atgttaatat tttcatattg gatgcaattt taagaaacac 13800atattcataa atttccatat ttgtaggaaa ataaaaagaa aaatatattc aagaacacaa 13860atttcaccga catgactttt attacagagt tggaattaga tctaacaatt gaaaaattaa 13920aattaagata gaatatgttg aggaacatga catagtataa tgctgggtta cccgtcgggt 13980aggtatcgag gcggatacta ctaaatccat cccactcgct atccgataat cactggtttc 14040gggtataccc attcccgtca acaggccttt ttaaccggat aatttcaact tatagtgaat 14100gaattttgaa taaatagtta gaataccaaa atcctggatt gcatttgcaa tcaaattttg 14160tgaaccgtta aattttgcat gtacttggga tagatataat agaaccgaat tttcattagt 14220ttaatttata acttactttg ttcaaagaaa aaaaatatct atccaattta cttataataa 14280aaaataatct atccaagtta cttattataa tcaacttgta aaaaggtaag aatacaaatg 14340tggtagcgta cgtgtgatta tatgtgacga aatgttatat ctaacaaaag tccaaattcc 14400catggtaaaa aaaatcaaaa tgcatggcag gctgtttgta accttggaat aagatgttgg 14460ccaattctgg agccgccacg tacgcaagac tcagggccac gttctcttca tgcaaggata 14520gtagaacacc actccaccca cctcctatat tagacctttg cccaaccctc cccaactttc 14580ccatcccatc cacaaagaaa ccgacatttt tatcataaat cggcgcgccc taccatggat 14640gcttataacg ctgctatgga taagattgga gctgctatca tcgattggag tgatccagat 14700ggaaagttca gagctgatag ggaggattgg tggttgtgcg atttcagatc cgctatcacc 14760attgctctca tctacatcgc tttcgtgatc ttgggatctg ctgtgatgca atctctccca 14820gctatggacc cataccctat caagttcctc tacaacgtgt ctcaaatctt cctctgcgct 14880tacatgactg ttgaggctgg attcctcgct tataggaacg gatacaccgt tatgccatgc 14940aaccacttca acgtgaacga tccaccagtt gctaacttgc tctggctctt ctacatctcc 15000aaagtgtggg atttctggga taccatcttc attgtgctcg gaaagaagtg gagacaactc 15060tctttcttgc acgtgtacca ccacaccacc atcttcctct tctactggtt gaacgctaac 15120gtgctctacg atggagatat cttcttgacc atcctcctca acggattcat tcacaccgtg 15180atgtacacct actacttcat ctgcatgcac accaaggatt ctaagaccgg aaagtctttg 15240ccaatctggt ggaagtcatc tttgaccgct ttccaactct tgcaattcac catcatgatg 15300tcccaagcta cctacttggt tttccacgga tgcgataagg tttccctcag aatcaccatc 15360gtgtacttcg tgtacattct ctcccttttc ttcctcttcg ctcagttctt cgtgcaatcc 15420tacatggctc caaagaagaa gaagtccgct tgatgttaat taaggccgca gatatcagat 15480ctggtcgacc tagaggatcc ccggccgcaa agataataac aaaagcctac tatataacgt 15540acatgcaagt attgtatgat attaatgttt ttacgtacgt gtaaacaaaa ataattacgt 15600ttgtaacgta tggtgatgat gtggtgcact aggtgtaggc cttgtattaa taaaaagaag 15660tttgttctat atagagtggt ttagtacgac gatttattta ctagtcggat tggaatagag 15720aaccgaattc ttcaatcctt gcttttgatc aagaattgaa accgaatcaa atgtaaaagt 15780tgatatattt gaaaaacgta ttgagcttat gaaaatgcta atactctcat ctgtatggaa 15840aagtgacttt aaaaccgaac ttaaaagtga caaaagggga atatcgcatc aaaccgaatg 15900aaaccgatgg caaacactgt acggaccgtg gcctaatagg ccggtaccac ccagctttct 15960tgtacaaagt ggccatgatt acgccaagct tggccactaa ggccaattta aatctactag 16020gccggccata aggatgacct acccattctt gagacaaatg ttacatttta gtatcagagt 16080aaaatgtgta cctataactc aaattcgatt gacatgtatc cattcaacat aaaattaaac 16140cagcctgcac ctgcatccac atttcaagta ttttcaaacc gttcggctcc tatccaccgg 16200gtgtaacaag acggattccg aatttggaag attttgactc aaattcccaa tttatattga 16260ccgtgactaa atcaacttta acttctataa ttctgattaa gctcccaatt tatattccca 16320acggcactac ctccaaaatt tatagactct catccccttt taaaccaact tagtaaacgt 16380ttttttttta attttatgaa gttaagtttt taccttgttt ttaaaaagaa tcgttcataa 16440gatgccatgc cagaacatta gctacacgtt acacatagca tgcagccgcg gagaattgtt 16500tttcttcgcc acttgtcact cccttcaaac acctaagagc ttctctctca cagcacacac 16560atacaatcac atgcgtgcat gcattattac acgtgatcgc catgcaaatc tcctttatag 16620cctataaatt aactcatcgg cttcactctt tactcaaacc aaaactcatc aatacaaaca 16680agattaaaaa caccatgcgc gccggatccg ccatggctat tttgaaccct gaggctgatt 16740ctgctgctaa cctcgctact gattctgagg ctaagcaaag acaattggct gaggctggat 16800acactcatgt tgagggtgct cctgctcctt tgcctttgga gttgcctcat ttctctctca 16860gagatctcag agctgctatt cctaagcact gcttcgagag atctttcgtg acctccacct 16920actacatgat caagaacgtg ttgacttgcg ctgctttgtt ctacgctgct accttcattg 16980atagagctgg agctgctgct tatgttttgt ggcctgtgta ctggttcttc cagggatctt 17040acttgactgg agtgtgggtt atcgctcatg agtgtggaca tcaggcttat tgctcttctg 17100aggtggtgaa caacttgatt ggactcgtgt tgcattctgc tttgttggtg ccttaccact 17160cttggagaat ctctcacaga aagcaccatt ccaacactgg atcttgcgag aacgatgagg 17220ttttcgttcc tgtgaccaga tctgtgttgg cttcttcttg gaacgagacc ttggaggatt 17280ctcctctcta ccaactctac cgtatcgtgt acatgttggt tgttggatgg atgcctggat 17340acctcttctt caacgctact ggacctacta agtactgggg aaagtctagg tctcacttca 17400acccttactc cgctatctat gctgataggg agagatggat gatcgtgctc tccgatattt 17460tcttggtggc tatgttggct gttttggctg ctttggtgca cactttctcc ttcaacacca 17520tggtgaagtt ctacgtggtg ccttacttca ttgtgaacgc ttacttggtg ttgattacct 17580acctccaaca caccgatacc tacatccctc atttcagaga gggagagtgg aattggttga 17640gaggagcttt gtgcactgtg gatagatcat ttggtccatt cctcgattct gtggtgcata 17700gaatcgtgga tacccatgtt tgccaccaca tcttctccaa gatgcctttc tatcattgcg 17760aggaggctac caacgctatt aagcctctcc tcggaaagtt ctacttgaag gataccactc 17820ctgttcctgt tgctctctgg agatcttaca cccattgcaa gttcgttgag gatgatggaa 17880aggtggtgtt ctacaagaac aagctctagt taattaataa ttgattggtt cgagtattat 17940ggcattggga aaactgtttt tcttgtacca tttgttgtgc ttgtaattta ctgtgttttt 18000tattcggttt tcgctatcga actgtgaaat ggaaatggat ggagaagagt taatgaatga 18060tatggtcctt ttgttcattc tcaaattaat attatttgtt ttttctctta tttgttgtgt 18120gttgaatttg aaattataag agatatgcaa acattttgtt ttgagtaaaa atgtgtcaaa 18180tcgtggcctc taatgaccga agttaatatg aggagtaaaa cacttgtagt tgtaccatta 18240tgcttattca ctaggcaaca aatatatttt cagacctaga aaagctgcaa atgttactga 18300atacaagtat gtcctcttgt gttttagaca tttatgaact ttcctttatg taattttcca 18360gaatccttgt cagattctaa tcattgcttt ataattatag ttatactcat ggatttgtag 18420ttgagtatga aaatattttt taatgcattt tatgacttgc caattgattg acaacatgca 18480tcaatggcgc ctactaccgg taattcccgg gattagcggc cgctagtctg tgcgcacttg 18540tatcctgcag gtcaatcgtt taaacactgt acggaccgtg gcctaatagg ccggtaccca 18600actttattat acatagttga taattcactg gccggatgta ccgaattcgc ggccgcaagc 18660ttgtacacta gtacgcgtca attggcgatc gcggatctga gatgaaaccg gtgattatca 18720gaacctttta tggtctttgt atgcatatgg taaaaaaact tagtttgcaa tttcctgttt 18780gttttggtaa tttgagtttc ttttagttgt tgatctgcct gctttttggt ttacgtcaga 18840ctactactgc tgttgttgtt tggtttcctt tctttcattt tataaataaa taatccggtt 18900cggtttactc cttgtgactg gctcagtttg gttattgcga aatgcgaatg gtaaattgag 18960taattgaaat tcgttattag ggttctaagc tgttttaaca gtcactgggt taatatctct 19020cgaatcttgc atggaaaatg ctcttaccat tggtttttaa ttgaaatgtg ctcatatggg 19080ccgtggtttc caaattaaat aaaactacga tgtcatcgag aagtaaaatc aactgtgtcc 19140acattatcag ttttgtgtat acgatgaaat agggtaattc aaaatctagc ttgatatgcc 19200ttttggttca ttttaacctt ctgtaaacat tttttcagat tttgaacaag taaatccaaa 19260aaaaaaaaaa aaaaatctca actcaacact aaattatttt aatgtataaa agatgcttaa 19320aacatttggc ttaaaagaaa gaagctaaaa acatagagaa ctcttgtaaa ttgaagtatg 19380aaaatatact gaattgggta ttatatgaat ttttctgatt taggattcac atgatccaaa 19440aaggaaatcc agaagcacta atcagacatt ggaagtagga atatttcaaa aagttttttt 19500tttttaagta agtgacaaaa gcttttaaaa aatagaaaag aaactagtat taaagttgta 19560aatttaataa acaaaagaaa ttttttatat tttttcattt ctttttccag catgaggtta 19620tgatggcagg atgtggattt catttttttc cttttgatag ccttttaatt gatctattat 19680aattgacgaa aaaatattag ttaattatag atatatttta ggtagtatta gcaatttaca 19740cttccaaaag actatgtaag ttgtaaatat gatgcgttga tctcttcatc attcaatggt 19800tagtcaaaaa aataaaagct taactagtaa actaaagtag tcaaaaattg tactttagtt 19860taaaatatta catgaataat ccaaaacgac atttatgtga aacaaaaaca atatagatcc 19920attaccctgt tatccctaga ggggaaaatt cgaatccaaa aattacggat atgaatatag 19980gcatatccgt atccgaatta tccgtttgac agctagcaac gattgtacaa ttgcttcttt 20040aaaaaaggaa gaaagaaaga aagaaaagaa tcaacatcag cgttaacaaa cggccccgtt 20100acggcccaaa cggtcatata gagtaacggc gttaagcgtt gaaagactcc tatcgaaata 20160cgtaaccgca aacgtgtcat agtcagatcc cctcttcctt caccgcctca aacacaaaaa 20220taatcttcta

cagcctatat atacaacccc cccttctatc tctcctttct cacaattcat 20280catctttctt tctctacccc caattttaag aaatcctctc ttctcctctt cattttcaag 20340gtaaatctct ctctctctct ctctctctgt tattccttgt tttaattagg tatgtattat 20400tgctagtttg ttaatctgct tatcttatgt atgccttatg tgaatatctt tatcttgttc 20460atctcatccg tttagaagct ataaatttgt tgatttgact gtgtatctac acgtggttat 20520gtttatatct aatcagatat gaatttcttc atattgttgc gtttgtgtgt accaatccga 20580aatcgttgat ttttttcatt taatcgtgta gctaattgta cgtatacata tggatctacg 20640tatcaattgt tcatctgttt gtgtttgtat gtatacagat ctgaaaacat cacttctctc 20700atctgattgt gttgttacat acatagatat agatctgtta tatcattttt tttattaatt 20760gtgtatatat atatgtgcat agatctggat tacatgattg tgattattta catgattttg 20820ttatttacgt atgtatatat gtagatctgg actttttgga gttgttgact tgattgtatt 20880tgtgtgtgta tatgtgtgtt ctgatcttga tatgttatgt atgtgcagct gaaccatggc 20940ggcggcaaca acaacaacaa caacatcttc ttcgatctcc ttctccacca aaccatctcc 21000ttcctcctcc aaatcaccat taccaatctc cagattctcc ctcccattct ccctaaaccc 21060caacaaatca tcctcctcct cccgccgccg cggtatcaaa tccagctctc cctcctccat 21120ctccgccgtg ctcaacacaa ccaccaatgt cacaaccact ccctctccaa ccaaacctac 21180caaacccgaa acattcatct cccgattcgc tccagatcaa ccccgcaaag gcgctgatat 21240cctcgtcgaa gctttagaac gtcaaggcgt agaaaccgta ttcgcttacc ctggaggtac 21300atcaatggag attcaccaag ccttaacccg ctcttcctca atccgtaacg tccttcctcg 21360tcacgaacaa ggaggtgtat tcgcagcaga aggatacgct cgatcctcag gtaaaccagg 21420tatctgtata gccacttcag gtcccggagc tacaaatctc gttagcggat tagccgatgc 21480gttgttagat agtgttcctc ttgtagcaat cacaggacaa gtccctcgtc gtatgattgg 21540tacagatgcg tttcaagaga ctccgattgt tgaggtaacg cgttcgatta cgaagcataa 21600ctatcttgtg atggatgttg aagatatccc taggattatt gaggaagctt tctttttagc 21660tacttctggt agacctggac ctgttttggt tgatgttcct aaagatattc aacaacagct 21720tgcgattcct aattgggaac aggctatgag attacctggt tatatgtcta ggatgcctaa 21780acctccggaa gattctcatt tggagcagat tgttaggttg atttctgagt ctaagaagcc 21840tgtgttgtat gttggtggtg gttgtttgaa ttctagcgat gaattgggta ggtttgttga 21900gcttacgggg atccctgttg cgagtacgtt gatggggctg ggatcttatc cttgtgatga 21960tgagttgtcg ttacatatgc ttggaatgca tgggactgtg tatgcaaatt acgctgtgga 22020gcatagtgat ttgttgttgg cgtttggggt aaggtttgat gatcgtgtca cgggtaagct 22080tgaggctttt gctagtaggg ctaagattgt tcatattgat attgactcgg ctgagattgg 22140gaagaataag actcctcatg tgtctgtgtg tggtgatgtt aagctggctt tgcaagggat 22200gaataaggtt cttgagaacc gagcggagga gcttaagctt gattttggag tttggaggaa 22260tgagttgaac gtacagaaac agaagtttcc gttgagcttt aagacgtttg gggaagctat 22320tcctccacag tatgcgatta aggtccttga tgagttgact gatggaaaag ccataataag 22380tactggtgtc gggcaacatc aaatgtgggc ggcgcagttc tacaattaca agaaaccaag 22440gcagtggcta tcatcaggag gccttggagc tatgggattt ggacttcctg ctgcgattgg 22500agcgtctgtt gctaaccctg atgcgatagt tgtggatatt gacggagatg gaagctttat 22560aatgaatgtg caagagctag ccactattcg tgtagagaat cttccagtga aggtactttt 22620attaaacaac cagcatcttg gcatggttat gcaatgggaa gatcggttct acaaagctaa 22680ccgagctcac acatttctcg gggatccggc tcaggaggac gagatattcc cgaacatgtt 22740gctgtttgca gcagcttgcg ggattccagc ggcgagggtg acaaagaaag cagatctccg 22800agaagctatt cagacaatgc tggatacacc aggaccttac ctgttggatg tgatttgtcc 22860gcaccaagaa catgtgttgc cgatgatccc gaatggtggc actttcaacg atgtcataac 22920ggaaggagat ggccggatta aatactgata gggataacag ggtaatctcg acgagatgaa 22980accggtgatt atcagaacct tttatggtct ttgtatgcat atggtaaaaa aacttagttt 23040gcaatttcct gtttgttttg gtaatttgag tttcttttag ttgttgatct gcctgctttt 23100tggtttacgt cagactacta ctgctgttgt tgtttggttt cctttctttc attttataaa 23160taaataatcc ggttcggttt actccttgtg actggctcag tttggttatt gcgaaatgcg 23220aatggtaaat tgagtaattg aaattcgtta ttagggttct aagctgtttt aacagtcact 23280gggttaatat ctctcgaatc ttgcatggaa aatgctctta ccattggttt ttaattgaaa 23340tgtgctcata tgggccgtgg tttccaaatt aaataaaact acgatgtcat cgagaagtaa 23400aatcaactgt gtccacatta tcagttttgt gtatacgatg aaatagggta attcaaaatc 23460tagcttgata tgccttttgg ttcattttaa ccttctgtaa acattttttc agattttgaa 23520caagtaaatc caaaaaaaaa aaaaaaaaat ctcaactcaa cactaaatta ttttaatgta 23580taaaagatgc ttaaaacatt tggcttaaaa gaaagaagct aaaaacatag agaactcttg 23640taaattgaag tatgaaaata tactgaattg ggtattatat gaatttttct gatttaggat 23700tcacatgatc caaaaaggaa atccagaagc actaatcaga cattggaagt aggaatattt 23760caaaaagttt ttttttttta agtaagtgac aaaagctttt aaaaaataga aaagaaacta 23820gtattaaagt tgtaaattta ataaacaaaa gaaatttttt atattttttc atttcttttt 23880ccagcatgag gttatgatgg caggatgtgg atttcatttt tttccttttg atagcctttt 23940aattgatcta ttataattga cgaaaaaata ttagttaatt atagatatat tttaggtagt 24000attagcaatt tacacttcca aaagactatg taagttgtaa atatgatgcg ttgatctctt 24060catcattcaa tggttagtca aaaaaataaa agcttaacta gtaaactaaa gtagtcaaaa 24120attgtacttt agtttaaaat attacatgaa taatccaaaa cgacatttat gtgaaacaaa 24180aacaatatgt cgaggcgatc gcagtactta atcagtgatc agtaactaaa ttcagtacat 24240taaagacgtc cgcaatgtgt tattaagttg tctaagcgtc aatttgttta caccacaata 24300tatcctgcca ccagccagcc aacagctccc cgaccggcag ctcggcacaa aatcac 243564027539DNAArtificial SequencePlant Expression Plasmid 40aaaagttgcc atgattacgc caagcttggc cactaaggcc aatttcgcgc cctgcagcaa 60atttacacat tgccactaaa cgtctaaacc cttgtaattt gtttttgttt tactatgtgt 120gttatgtatt tgatttgcga taaattttta tatttggtac taaatttata acacctttta 180tgctaacgtt tgccaacact tagcaatttg caagttgatt aattgattct aaattatttt 240tgtcttctaa atacatatac taatcaactg gaaatgtaaa tatttgctaa tatttctact 300ataggagaat taaagtgagt gaatatggta ccacaaggtt tggagattta attgttgcaa 360tgctgcatgg atggcatata caccaaacat tcaataattc ttgaggataa taatggtacc 420acacaagatt tgaggtgcat gaacgtcacg tggacaaaag gtttagtaat ttttcaagac 480aacaatgtta ccacacacaa gttttgaggt gcatgcatgg atgccctgtg gaaagtttaa 540aaatattttg gaaatgattt gcatggaagc catgtgtaaa accatgacat ccacttggag 600gatgcaataa tgaagaaaac tacaaattta catgcaacta gttatgcatg tagtctatat 660aatgaggatt ttgcaatact ttcattcata cacactcact aagttttaca cgattataat 720ttcttcatag ccagtactgt ttaagcttca ctgtctctga atcggcaaag gtaaacgtat 780caattattct acaaaccctt ttatttttct tttgaattac cgtcttcatt ggttatatga 840taacttgata agtaaagctt caataattga atttgatctg tgtttttttg gccttaatac 900taaatcctta cataagcttt gttgcttctc ctcttgtgag ttgagtgtta agttgtaata 960atggttcact ttcagcttta gaagaaacca tggaagttgt tgagaggttc tacggagagt 1020tggatggaaa ggtttcccaa ggagtgaacg ctttgttggg atctttcgga gttgagttga 1080ctgatacccc aactactaag ggattgccac tcgttgattc tccaactcca attgtgttgg 1140gagtgtctgt ttacttgacc atcgtgatcg gaggattgct ttggatcaag gctagagatc 1200tcaagccaag agcttctgag ccattcttgt tgcaagcttt ggtgttggtg cacaacttgt 1260tctgcttcgc tttgtctctt tacatgtgcg tgggtatcgc ttaccaagct atcacctgga 1320gatattcctt gtggggaaac gcttataacc caaagcacaa ggagatggct atcctcgttt 1380acctcttcta catgtccaag tacgtggagt tcatggatac cgtgatcatg atcctcaaga 1440gatccaccag acagatttct ttcctccacg tgtaccacca ctcttctatc tcccttatct 1500ggtgggctat tgctcaccac gctccaggag gagaggctta ttggagtgct gctctcaact 1560ctggagtgca cgtgttgatg tacgcttact acttcttggc tgcttgcttg agatcttccc 1620caaagctcaa gaacaagtac ctcttctggg gaagatacct cacccaattc cagatgttcc 1680agttcatgct caacttggtg caagcttact acgatatgaa aaccaacgct ccatatccac 1740aatggctcat caagatcctc ttctactaca tgatctccct cttgttcctc ttcggaaact 1800tctacgtgca aaagtacatc aagccatccg atggaaagca aaagggagct aagaccgagt 1860gatcgacaag ctcgagtttc tccataataa tgtgtgagta gttcccagat aagggaatta 1920gggttcctat agggtttcgc tcatgtgttg agcatataag aaacccttag tatgtatttg 1980tatttgtaaa atacttctat caataaaatt tctaattcct aaaaccaaaa tccagtacta 2040aaatccagat cccccgaatt aattcggcgt taattcaggg ccggccaaag taggcgccta 2100ctaccggtaa ttcccgggat tagcggccgc tagtctgtgc gcacttgtat cctgcaggtt 2160aggccggcca ttagcagata tttggtgtct aaatgtttat tttgtgatat gttcatgttt 2220gaaatggtgg tttcgaaacc agggacaacg ttgggatctg atagggtgtc aaagagtatt 2280atggattggg acaatttcgg tcatgagttg caaattcaag tatatcgttc gattatgaaa 2340attttcgaag aatatcccat ttgagagagt ctttacctca ttaatgtttt tagattatga 2400aattttatca tagttcatcg tagtcttttt ggtgtaaagg ctgtaaaaag aaattgttca 2460cttttgtttt cgtttatgtg aaggctgtaa aagattgtaa aagactattt tggtgttttg 2520gataaaatga tagtttttat agattctttt gcttttagaa gaaatacatt tgaaattttt 2580tccatgttga gtataaaata ccgaaatcga ttgaagatca tagaaatatt ttaactgaaa 2640acaaatttat aactgattca attctctcca tttttatacc tatttaaccg taatcgattc 2700taatagatga tcgatttttt atataatcct aattaaccaa cggcatgtat tggataatta 2760accgatcaac tctcacccct aatagaatca gtattttcct tcgacgttaa ttgatcctac 2820actatgtagg tcatatccat cgttttaatt tttggccacc attcaattct gtcttgcctt 2880tagggatgtg aatatgaacg gccaaggtaa gagaataaaa ataatccaaa ttaaagcaag 2940agaggccaag taagataatc caaatgtaca cttgtcattg ccaaaattag taaaatactc 3000ggcatattgt attcccacac attattaaaa taccgtatat gtattggctg catttgcatg 3060aataatacta cgtgtaagcc caaaagaacc cacgtgtagc ccatgcaaag ttaacactca 3120cgaccccatt cctcagtctc cactatataa acccaccatc cccaatctca ccaaacccac 3180cacacaactc acaactcact ctcacacctt aaagaaccaa tcaccaccaa aaaatttcac 3240gatttggaat ttgattcctg cgatcacagg tatgacaggt tagattttgt tttgtatagt 3300tgtatacata cttctttgtg atgttttgtt tacttaatcg aatttttgga gtgttttaag 3360gtctctcgtt tagaaatcgt ggaaaatatc actgtgtgtg tgttcttatg attcacagtg 3420tttatgggtt tcatgttctt tgttttatca ttgaatggga agaaatttcg ttgggataca 3480aatttctcat gttcttactg atcgttatta ggagtttggg gaaaaaggaa gagttttttt 3540ggttggttcg agtgattatg aggttatttc tgtatttgat ttatgagtta atggtcgttt 3600taatgttgta gaccatggga aaaggatctg agggaagatc tgctgctaga gagatgactg 3660ctgaggctaa cggagataag agaaagacca tcctcattga gggagtgttg tacgatgcta 3720ccaacttcaa acacccagga ggttccatta ttaacttcct caccgaggga gaagctggag 3780ttgatgctac ccaagcttac agagagttcc atcagagatc cggaaaggct gataagtacc 3840tcaagtccct cccaaagttg gatgcttcta aggtggagtc taggttctct gctaaggagc 3900aggctagaag ggacgctatg accagggatt acgctgcttt cagagaggag ttggttgctg 3960agggatactt cgatccatct atcccacaca tgatctacag agtggtggag attgtggctt 4020tgttcgcttt gtctttctgg ttgatgtcta aggcttctcc aacctctttg gttttgggag 4080tggtgatgaa cggaatcgct caaggaagat gcggatgggt tatgcacgag atgggacacg 4140gatctttcac tggagttatc tggctcgatg ataggatgtg cgagttcttc tacggagttg 4200gatgtggaat gtctggacac tactggaaga accagcactc taagcaccac gctgctccaa 4260acagattgga gcacgatgtg gatttgaaca ccttgccact cgttgctttc aacgagagag 4320ttgtgaggaa ggttaagcca ggatctttgt tggctttgtg gctcagagtt caggcttatt 4380tgttcgctcc agtgtcttgc ttgttgatcg gattgggatg gaccttgtac ttgcacccaa 4440gatatatgct caggaccaag agacacatgg agtttgtgtg gatcttcgct agatatatcg 4500gatggttctc cttgatggga gctttgggat attctcctgg aacttctgtg ggaatgtacc 4560tctgctcttt cggacttgga tgcatctaca tcttcctcca attcgctgtg tctcacaccc 4620acttgccagt taccaaccca gaggatcaat tgcactggct tgagtacgct gctgatcaca 4680ccgtgaacat ctctaccaag tcttggttgg ttacctggtg gatgtctaac ctcaacttcc 4740aaatcgagca ccacttgttc ccaaccgctc cacaattcag gttcaaggag atctctccaa 4800gagttgaggc tctcttcaag agacacaacc tcccttacta cgatttgcca tacacctctg 4860ctgtttctac taccttcgct aacctctact ctgttggaca ctctgttgga gctgatacca 4920agaagcagga ttgactgctt taatgagata tgcgagacgc ctatgatcgc atgatatttg 4980ctttcaattc tgttgtgcac gttgtaaaaa acctgagcat gtgtagctca gatccttacc 5040gccggtttcg gttcattcta atgaatatat cacccgttac tatcgtattt ttatgaataa 5100tattctccgt tcaatttact gattgtgtcg acgcgatcgc gtgcaaacac tgtacggacc 5160gtggcctaat aggccggtac ccaagtttgt acaaaaaagc aggctccatg attacgccaa 5220gcttggccac taaggccaat ttaaatctac taggccggcc atcgacggcc cggactgtat 5280ccaacttctg atctttgaat ctctctgttc caacatgttc tgaaggagtt ctaagacttt 5340tcagaaagct tgtaacatgc tttgtagact ttctttgaat tactcttgca aactctgatt 5400gaacctacgt gaaaactgct ccagaagttc taaccaaatt ccgtcttggg aaggcccaaa 5460atttattgag tacttcagtt tcatggacgt gtcttcaaag atttataact tgaaatccca 5520tcatttttaa gagaagttct gttccgcaat gtcttagatc tcattgaaat ctacaactct 5580tgtgtcagaa gttcttccag aatcaacttg catcatggtg aaaatctggc cagaagttct 5640gaacttgtca tatttcttaa cagttagaaa aatttctaag tgtttagaat tttgactttt 5700ccaaagcaaa cttgactttt gactttctta ataaaacaaa cttcatattc taacatgtct 5760tgatgaaatg tgattcttga aatttgatgt tgatgcaaaa gtcaaagttt gacttttcag 5820tgtgcaattg accattttgc tcttgtgcca attccaaacc taaattgatg tatcagtgct 5880gcaaacttga tgtcatggaa gatcttatga gaaaattctt gaagactgag aggaaaaatt 5940ttgtagtaca acacaaagaa tcctgttttt catagtcgga ctagacacat taacataaaa 6000caccacttca ttcgaagagt gattgaagaa ggaaatgtgc agttaccttt ctgcagttca 6060taagagcaac ttacagacac ttttactaaa atactacaaa gaggaagatt ttaacaactt 6120agagaagtaa tgggagttaa agagcaacac attaaggggg agtgttaaaa ttaatgtgtt 6180gtaaccacca ctacctttag taagtattat aagaaaattg taatcatcac attataatta 6240ttgtccttat ttaaaattat gataaagttg tatcattaag attgagaaaa ccaaatagtc 6300ctcgtcttga tttttgaatt attgttttct atgttacttt tcttcaagcc tatataaaaa 6360ctttgtaatg ctaaattgta tgctggaaaa aaatgtgtaa tgaattgaat agaaattatg 6420gtatttcaaa gtccaaaatc catcaataga aatttagtac aaaacgtaac tcaaaaatat 6480tctcttattt taaattttac aacaatataa aaatattctc ttattttaaa ttttacaata 6540atataattta tcacctgtca cctttagaat accaccaaca atattaatac ttagatattt 6600tattcttaat aattttgaga tctctcaata tatctgatat ttattttata tttgtgtcat 6660attttcttat gttttagagt taacccttat atcttggtca aactagtaat tcaatatatg 6720agtttgtgaa ggacacattg acatcttgaa acattggttt taaccttgtt ggaatgttaa 6780aggtaataaa acattcagaa ttatgaccat ctattaatat acttcctttg tcttttaaaa 6840aagtgtgcat gaaaatgctc tatggtaagc tagagtgtct tgctggcctg tgtatatcaa 6900ttccatttcc agatggtaga aactgccact acgaataatt agtcataaga cacgtatgtt 6960aacacacgtc cccttgcatg ttttttgcca tatattccgt ctctttcttt ttcttcacgt 7020ataaaacaat gaactaatta atagagcgat caagctgaac tggtgcttaa acactctggt 7080gagttctagt acttctgcta tgatcgatct cattaccatt tcttaaattt ctctccctaa 7140atattccgag ttcttgattt ttgataactt caggttttct ctttttgata aatctggtct 7200ttccattttt ttttttttgt ggttaattta gtttcctatg ttcttcgatt gtattatgca 7260tgatctgtgt ttggattctg ttagattatg tattggtgaa tatgtatgtg tttttgcatg 7320tctggttttg gtcttaaaaa tgttcaaatc tgatgatttg attgaagctt ttttagtgtt 7380ggtttgattc ttctcaaaac tactgttaat ttactatcat gttttccaac tttgattcat 7440gatgacactt ttgttctgct ttgttataaa attttggttg gtttgatttt gtaattatag 7500tgtaattttg ttaggaatga acatgtttta atactctgtt ttcgatttgt cacacattcg 7560aattattaat cgataattta actgaaaatt catggttcta gatcttgttg tcatcagatt 7620atttgtttcg ataattcatc aaatatgtag tccttttgct gatttgcgac tgtttcattt 7680tttctcaaaa ttgttttttg ttaagtttat ctaacagtta tcgttgtcaa aagtctcttt 7740cattttgcaa aatcttcttt ttttttttgt ttgtaacttt gttttttaag ctacacattt 7800agtctgtaaa atagcatcga ggaacagttg tcttagtaga cttgcatgtt cttgtaactt 7860ctatttgttt cagtttgttg atgactgctt tgattttgta ggtcaaaggc gcgcctacca 7920tgtgtgttga gaccgagaac aacgatggaa tccctactgt ggagatcgct ttcgatggag 7980agagagaaag agctgaggct aacgtgaagt tgtctgctga gaagatggaa cctgctgctt 8040tggctaagac cttcgctaga agatacgtgg ttatcgaggg agttgagtac gatgtgaccg 8100atttcaaaca tcctggagga accgtgattt tctacgctct ctctaacact ggagctgatg 8160ctactgaggc tttcaaggag ttccaccaca gatctagaaa ggctaggaag gctttggctg 8220ctttgccttc tagacctgct aagaccgcta aagtggatga tgctgagatg ctccaggatt 8280tcgctaagtg gagaaaggag ttggagaggg acggattctt caagccttct cctgctcatg 8340ttgcttacag attcgctgag ttggctgcta tgtacgcttt gggaacctac ttgatgtacg 8400ctagatacgt tgtgtcctct gtgttggttt acgcttgctt cttcggagct agatgtggat 8460gggttcaaca cgagggagga cactcttctt tgaccggaaa catctggtgg gataagagaa 8520tccaagcttt cactgctgga ttcggattgg ctggatctgg agatatgtgg aactccatgc 8580acaacaagca ccacgctact cctcaaaaag tgaggcacga tatggatttg gataccactc 8640ctgctgttgc tttcttcaac accgctgtgg aggataatag acctagggga ttctctaagt 8700actggctcag attgcaagct tggaccttca ttcctgtgac ttctggattg gtgttgctct 8760tctggatgtt cttcctccac ccttctaagg ctttgaaggg aggaaagtac gaggagcttg 8820tgtggatgtt ggctgctcac gtgattagaa cctggaccat taaggctgtt actggattca 8880ccgctatgca atcctacgga ctcttcttgg ctacttcttg ggtttccgga tgctacttgt 8940tcgctcactt ctctacttct cacacccact tggatgttgt tcctgctgat gagcacttgt 9000cttgggttag gtacgctgtg gatcacacca ttgatatcga tccttctcag ggatgggtta 9060actggttgat gggatacttg aactgccaag tgattcacca cctcttccct tctatgcctc 9120aattcagaca acctgaggtg tccagaagat tcgttgcttt cgctaagaag tggaacctca 9180actacaaggt gatgacttat gctggagctt ggaaggctac tttgggaaac ctcgataatg 9240tgggaaagca ctactacgtg cacggacaac actctggaaa gaccgcttga ttaattaact 9300aagactccca aaaccacctt ccctgtgaca gttaaaccct gcttatacct ttcctcctaa 9360taatgttcat ctgtcacaca aactaaaata aataaaatgg gagcaataaa taaaatggga 9420gctcatatat ttacaccatt tacactgtct attattcacc atgccaatta ttacttcata 9480attttaaaat tatgtcattt ttaaaaattg cttaatgatg gaaaggatta ttataagtta 9540aaagtataac atagataaac taaccacaaa acaaatcaat ataaactaac ttactctccc 9600atctaatttt tatttaaatt tctttacact tctcttccat ttctatttct acaacattat 9660ttaacatttt tattgtattt ttcttacttt ctaactctat tcatttcaaa aatcaatata 9720tgtttatcac cacctctcta aaaaaaactt tacaatcatt ggtccagaaa agttaaatca 9780cgagatggtc attttagcat taaaacaacg attcttgtat cactattttt cagcatgtag 9840tccattctct tcaaacaaag acagcggcta tataatcgtt gtgttatatt cagtctaaaa 9900caaggcgcct actaccggta attcccggga ttagcggccg ctagtctgtg cgcacttgta 9960tcctgcaggt taggccggcc acacgggcag gacataggga ctactacaag catagtatgc 10020ttcagacaaa gagctaggaa agaactcttg atggaggtta agagaaaaaa gtgctagagg 10080ggcatagtaa tcaaacttgt caaaaccgtc atcatgatga gggatgacat aatataaaaa 10140gttgactaag gtcttggtag tactctttga ttagtattat atattggtga gaacatgagt 10200caagaggaga caagaaaccg aggaaccata gtttagcaac aagatggaag ttgcaaagtt 10260gagctagccg ctcgattagt tacatctcct aagcagtact acaaggaatg gtctctatac 10320tttcatgttt agcacatggt agtgcggatt gacaagttag aaacagtgct taggagacaa 10380agagtcagta aaggtattga aagagtgaag ttgatgctcg acaggtcagg agaagtccct 10440ccgccagatg gtgactacca aggggttggt atcagctgag acccaaataa gattcttcgg 10500ttgaaccagt ggttcgaccg agactcttag ggtgggattt cactgtaaga tttgtgcatt 10560ttgttgaata taaattgaca atttttttta tttaattata gattatttag aatgaattac 10620atatttagtt tctaacaagg atagcaatgg atgggtatgg gtacaggtta aacatatcta 10680ttacccaccc atctagtcgt cgggttttac acgtacccac ccgtttacat aaaccagacc 10740ggaattttaa accgtacccg tccgttagcg ggtttcagat ttacccgttt aatcgggtaa 10800aacctgatta ctaaatatat attttttatt tgataaacaa aacaaaaatg ttaatatttt 10860catattggat

gcaattttaa gaaacacata ttcataaatt tccatatttg taggaaaata 10920aaaagaaaaa tatattcaag aacacaaatt tcaccgacat gacttttatt acagagttgg 10980aattagatct aacaattgaa aaattaaaat taagatagaa tatgttgagg aacatgacat 11040agtataatgc tgggttaccc gtcgggtagg tatcgaggcg gatactacta aatccatccc 11100actcgctatc cgataatcac tggtttcggg tatacccatt cccgtcaaca ggccttttta 11160accggataat ttcaacttat agtgaatgaa ttttgaataa atagttagaa taccaaaatc 11220ctggattgca tttgcaatca aattttgtga accgttaaat tttgcatgta cttgggatag 11280atataataga accgaatttt cattagttta atttataact tactttgttc aaagaaaaaa 11340aatatctatc caatttactt ataataaaaa ataatctatc caagttactt attataatca 11400acttgtaaaa aggtaagaat acaaatgtgg tagcgtacgt gtgattatat gtgacgaaat 11460gttatatcta acaaaagtcc aaattcccat ggtaaaaaaa atcaaaatgc atggcaggct 11520gtttgtaacc ttggaataag atgttggcca attctggagc cgccacgtac gcaagactca 11580gggccacgtt ctcttcatgc aaggatagta gaacaccact ccacccacct cctatattag 11640acctttgccc aaccctcccc aactttccca tcccatccac aaagaaaccg acatttttat 11700cataaatcag ggtttcgttt ttgtttcatc gataaactca aaggtgatga ttttagggtc 11760ttgtgagtgt gcttttttgt ttgattctac tgtagggttt atgttcttta gctcataggt 11820tttgtgtatt tcttagaaat gtggcttctt taatctctgg gtttgtgact ttttgtgtgg 11880tttctgtgtt tttcatatca aaaacctatt ttttccgagt ttttttttac aaattcttac 11940tctcaagctt gaatacttca catgcagtgt tcttttgtag attttagagt taatgtgtta 12000aaaagtttgg atttttcttg cttatagagc ttcttcactt tgattttgtg ggtttttttg 12060ttttaaaggt gagatttttg atgaggtttt tgcttcaaag atgtcacctt tctgggtttg 12120tcttttgaat aaagctatga actgtcacat ggctgacgca attttgttac tatgtcatga 12180aagctgacgt ttttccgtgt tatacatgtt tgcttacact tgcatgcgtc aaaaaaattg 12240gggcttttta gttttagtca aagattttac ttctcttttg ggatttatga aggaaagttg 12300caaactttct caaattttac catttttgct ttgatgtttg tttagattgc gacagaacaa 12360actcatatat gttgaaattt ttgcttggtt ttgtatagga ttgtgtcttt tgcttataaa 12420tgttgaaatc tgaacttttt ttttgtttgg tttctttgag caggagataa ggcgcgccct 12480accatggatg cttataacgc tgctatggat aagattggag ctgctatcat cgattggagt 12540gatccagatg gaaagttcag agctgatagg gaggattggt ggttgtgcga tttcagatcc 12600gctatcacca ttgctctcat ctacatcgct ttcgtgatct tgggatctgc tgtgatgcaa 12660tctctcccag ctatggaccc ataccctatc aagttcctct acaacgtgtc tcaaatcttc 12720ctctgcgctt acatgactgt tgaggctgga ttcctcgctt ataggaacgg atacaccgtt 12780atgccatgca accacttcaa cgtgaacgat ccaccagttg ctaacttgct ctggctcttc 12840tacatctcca aagtgtggga tttctgggat accatcttca ttgtgctcgg aaagaagtgg 12900agacaactct ctttcttgca cgtgtaccac cacaccacca tcttcctctt ctactggttg 12960aacgctaacg tgctctacga tggagatatc ttcttgacca tcctcctcaa cggattcatt 13020cacaccgtga tgtacaccta ctacttcatc tgcatgcaca ccaaggattc taagaccgga 13080aagtctttgc caatctggtg gaagtcatct ttgaccgctt tccaactctt gcaattcacc 13140atcatgatgt cccaagctac ctacttggtt ttccacggat gcgataaggt ttccctcaga 13200atcaccatcg tgtacttcgt gtacattctc tcccttttct tcctcttcgc tcagttcttc 13260gtgcaatcct acatggctcc aaagaagaag aagtccgctt gatgttaatt aaggccgcag 13320atatcagatc tggtcgacct agaggatccc cggccgcaaa gataataaca aaagcctact 13380atataacgta catgcaagta ttgtatgata ttaatgtttt tacgtacgtg taaacaaaaa 13440taattacgtt tgtaacgtat ggtgatgatg tggtgcacta ggtgtaggcc ttgtattaat 13500aaaaagaagt ttgttctata tagagtggtt tagtacgacg atttatttac tagtcggatt 13560ggaatagaga accgaattct tcaatccttg cttttgatca agaattgaaa ccgaatcaaa 13620tgtaaaagtt gatatatttg aaaaacgtat tgagcttatg aaaatgctaa tactctcatc 13680tgtatggaaa agtgacttta aaaccgaact taaaagtgac aaaaggggaa tatcgcatca 13740aaccgaatga aaccgatggc gcctaccggt atcggtccga ttgcggccgc ttaaagggcg 13800aattcgttta aacactgtac ggaccgtggc ctaataggcc ggtaccaccc agctttcttg 13860tacaaagtgg ccatgattac gccaagcttg gccactaagg ccaatttaaa tctactaggc 13920cggccataag gatgacctac ccattcttga gacaaatgtt acattttagt atcagagtaa 13980aatgtgtacc tataactcaa attcgattga catgtatcca ttcaacataa aattaaacca 14040gcctgcacct gcatccacat ttcaagtatt ttcaaaccgt tcggctccta tccaccgggt 14100gtaacaagac ggattccgaa tttggaagat tttgactcaa attcccaatt tatattgacc 14160gtgactaaat caactttaac ttctataatt ctgattaagc tcccaattta tattcccaac 14220ggcactacct ccaaaattta tagactctca tcccctttta aaccaactta gtaaacgttt 14280tttttttaat tttatgaagt taagttttta ccttgttttt aaaaagaatc gttcataaga 14340tgccatgcca gaacattagc tacacgttac acatagcatg cagccgcgga gaattgtttt 14400tcttcgccac ttgtcactcc cttcaaacac ctaagagctt ctctctcaca gcacacacat 14460acaatcacat gcgtgcatgc attattacac gtgatcgcca tgcaaatctc ctttatagcc 14520tataaattaa ctcatcggct tcactcttta ctcaaaccaa aactcatcaa tacaaacaag 14580attaaaaaca agttctttgc tttcgaagtt gccgcaacct aaacaggttt ttccttcttc 14640tttcttctta ttaactacga ccttgtcctt tgcctatgta aaattactag gttttcatca 14700gttacactga ttaagttcgt tatagtggaa gataaaatgc cctcaaagca ttttgcagga 14760tatctttgat ttttcaaaga tatggaactg tagagtttga tagtgttctt gaatgtggtt 14820gcatgaagtt tttttggtct gcatgttatt ttttcctcga aatatgtttt gagtccaaca 14880agtgattcac ttgggattca gaaagttgtt ttctcaatat gtaacagttt ttttctatgg 14940agaaaaatca tagggaccgt tggttttggc ttctttaatt ttgagctcag attaaaccca 15000ttttacccgg tgttcttggc agaattgaaa acagtacgta gtaccgccat ggctattttg 15060aaccctgagg ctgattctgc tgctaacctc gctactgatt ctgaggctaa gcaaagacaa 15120ttggctgagg ctggatacac tcatgttgag ggtgctcctg ctcctttgcc tttggagttg 15180cctcatttct ctctcagaga tctcagagct gctattccta agcactgctt cgagagatct 15240ttcgtgacct ccacctacta catgatcaag aacgtgttga cttgcgctgc tttgttctac 15300gctgctacct tcattgatag agctggagct gctgcttatg ttttgtggcc tgtgtactgg 15360ttcttccagg gatcttactt gactggagtg tgggttatcg ctcatgagtg tggacatcag 15420gcttattgct cttctgaggt ggtgaacaac ttgattggac tcgtgttgca ttctgctttg 15480ttggtgcctt accactcttg gagaatctct cacagaaagc accattccaa cactggatct 15540tgcgagaacg atgaggtttt cgttcctgtg accagatctg tgttggcttc ttcttggaac 15600gagaccttgg aggattctcc tctctaccaa ctctaccgta tcgtgtacat gttggttgtt 15660ggatggatgc ctggatacct cttcttcaac gctactggac ctactaagta ctggggaaag 15720tctaggtctc acttcaaccc ttactccgct atctatgctg atagggagag atggatgatc 15780gtgctctccg atattttctt ggtggctatg ttggctgttt tggctgcttt ggtgcacact 15840ttctccttca acaccatggt gaagttctac gtggtgcctt acttcattgt gaacgcttac 15900ttggtgttga ttacctacct ccaacacacc gatacctaca tccctcattt cagagaggga 15960gagtggaatt ggttgagagg agctttgtgc actgtggata gatcatttgg tccattcctc 16020gattctgtgg tgcatagaat cgtggatacc catgtttgcc accacatctt ctccaagatg 16080cctttctatc attgcgagga ggctaccaac gctattaagc ctctcctcgg aaagttctac 16140ttgaaggata ccactcctgt tcctgttgct ctctggagat cttacaccca ttgcaagttc 16200gttgaggatg atggaaaggt ggtgttctac aagaacaagc tctagttaat taataattga 16260ttggttcgag tattatggca ttgggaaaac tgtttttctt gtaccatttg ttgtgcttgt 16320aatttactgt gttttttatt cggttttcgc tatcgaactg tgaaatggaa atggatggag 16380aagagttaat gaatgatatg gtccttttgt tcattctcaa attaatatta tttgtttttt 16440ctcttatttg ttgtgtgttg aatttgaaat tataagagat atgcaaacat tttgttttga 16500gtaaaaatgt gtcaaatcgt ggcctctaat gaccgaagtt aatatgagga gtaaaacact 16560tgtagttgta ccattatgct tattcactag gcaacaaata tattttcaga cctagaaaag 16620ctgcaaatgt tactgaatac aagtatgtcc tcttgtgttt tagacattta tgaactttcc 16680tttatgtaat tttccagaat ccttgtcaga ttctaatcat tgctttataa ttatagttat 16740actcatggat ttgtagttga gtatgaaaat attttttaat gcattttatg acttgccaat 16800tgattgacaa catgcatcaa tggcgcctac taccggtaat tcccgggatt agcggccgct 16860agtctgtgcg cacttgtatc ctgcaggtca atcgtttaaa cactgtacgg accgtggcct 16920aataggccgg tacccaactt tattatacat agttgataat tcactggccg gatgtaccga 16980attcgcggcc gcaagcttgt acactagtac gcgtcaattg gcgatcgcgg atctgagatg 17040aaaccggtga ttatcagaac cttttatggt ctttgtatgc atatggtaaa aaaacttagt 17100ttgcaatttc ctgtttgttt tggtaatttg agtttctttt agttgttgat ctgcctgctt 17160tttggtttac gtcagactac tactgctgtt gttgtttggt ttcctttctt tcattttata 17220aataaataat ccggttcggt ttactccttg tgactggctc agtttggtta ttgcgaaatg 17280cgaatggtaa attgagtaat tgaaattcgt tattagggtt ctaagctgtt ttaacagtca 17340ctgggttaat atctctcgaa tcttgcatgg aaaatgctct taccattggt ttttaattga 17400aatgtgctca tatgggccgt ggtttccaaa ttaaataaaa ctacgatgtc atcgagaagt 17460aaaatcaact gtgtccacat tatcagtttt gtgtatacga tgaaataggg taattcaaaa 17520tctagcttga tatgcctttt ggttcatttt aaccttctgt aaacattttt tcagattttg 17580aacaagtaaa tccaaaaaaa aaaaaaaaaa atctcaactc aacactaaat tattttaatg 17640tataaaagat gcttaaaaca tttggcttaa aagaaagaag ctaaaaacat agagaactct 17700tgtaaattga agtatgaaaa tatactgaat tgggtattat atgaattttt ctgatttagg 17760attcacatga tccaaaaagg aaatccagaa gcactaatca gacattggaa gtaggaatat 17820ttcaaaaagt tttttttttt taagtaagtg acaaaagctt ttaaaaaata gaaaagaaac 17880tagtattaaa gttgtaaatt taataaacaa aagaaatttt ttatattttt tcatttcttt 17940ttccagcatg aggttatgat ggcaggatgt ggatttcatt tttttccttt tgatagcctt 18000ttaattgatc tattataatt gacgaaaaaa tattagttaa ttatagatat attttaggta 18060gtattagcaa tttacacttc caaaagacta tgtaagttgt aaatatgatg cgttgatctc 18120ttcatcattc aatggttagt caaaaaaata aaagcttaac tagtaaacta aagtagtcaa 18180aaattgtact ttagtttaaa atattacatg aataatccaa aacgacattt atgtgaaaca 18240aaaacaatat agatccatta ccctgttatc cctagagggg aaaattcgaa tccaaaaatt 18300acggatatga atataggcat atccgtatcc gaattatccg tttgacagct agcaacgatt 18360gtacaattgc ttctttaaaa aaggaagaaa gaaagaaaga aaagaatcaa catcagcgtt 18420aacaaacggc cccgttacgg cccaaacggt catatagagt aacggcgtta agcgttgaaa 18480gactcctatc gaaatacgta accgcaaacg tgtcatagtc agatcccctc ttccttcacc 18540gcctcaaaca caaaaataat cttctacagc ctatatatac aaccccccct tctatctctc 18600ctttctcaca attcatcatc tttctttctc tacccccaat tttaagaaat cctctcttct 18660cctcttcatt ttcaaggtaa atctctctct ctctctctct ctctgttatt ccttgtttta 18720attaggtatg tattattgct agtttgttaa tctgcttatc ttatgtatgc cttatgtgaa 18780tatctttatc ttgttcatct catccgttta gaagctataa atttgttgat ttgactgtgt 18840atctacacgt ggttatgttt atatctaatc agatatgaat ttcttcatat tgttgcgttt 18900gtgtgtacca atccgaaatc gttgattttt ttcatttaat cgtgtagcta attgtacgta 18960tacatatgga tctacgtatc aattgttcat ctgtttgtgt ttgtatgtat acagatctga 19020aaacatcact tctctcatct gattgtgttg ttacatacat agatatagat ctgttatatc 19080atttttttta ttaattgtgt atatatatat gtgcatagat ctggattaca tgattgtgat 19140tatttacatg attttgttat ttacgtatgt atatatgtag atctggactt tttggagttg 19200ttgacttgat tgtatttgtg tgtgtatatg tgtgttctga tcttgatatg ttatgtatgt 19260gcagctgaac catggcggcg gcaacaacaa caacaacaac atcttcttcg atctccttct 19320ccaccaaacc atctccttcc tcctccaaat caccattacc aatctccaga ttctccctcc 19380cattctccct aaaccccaac aaatcatcct cctcctcccg ccgccgcggt atcaaatcca 19440gctctccctc ctccatctcc gccgtgctca acacaaccac caatgtcaca accactccct 19500ctccaaccaa acctaccaaa cccgaaacat tcatctcccg attcgctcca gatcaacccc 19560gcaaaggcgc tgatatcctc gtcgaagctt tagaacgtca aggcgtagaa accgtattcg 19620cttaccctgg aggtacatca atggagattc accaagcctt aacccgctct tcctcaatcc 19680gtaacgtcct tcctcgtcac gaacaaggag gtgtattcgc agcagaagga tacgctcgat 19740cctcaggtaa accaggtatc tgtatagcca cttcaggtcc cggagctaca aatctcgtta 19800gcggattagc cgatgcgttg ttagatagtg ttcctcttgt agcaatcaca ggacaagtcc 19860ctcgtcgtat gattggtaca gatgcgtttc aagagactcc gattgttgag gtaacgcgtt 19920cgattacgaa gcataactat cttgtgatgg atgttgaaga tatccctagg attattgagg 19980aagctttctt tttagctact tctggtagac ctggacctgt tttggttgat gttcctaaag 20040atattcaaca acagcttgcg attcctaatt gggaacaggc tatgagatta cctggttata 20100tgtctaggat gcctaaacct ccggaagatt ctcatttgga gcagattgtt aggttgattt 20160ctgagtctaa gaagcctgtg ttgtatgttg gtggtggttg tttgaattct agcgatgaat 20220tgggtaggtt tgttgagctt acggggatcc ctgttgcgag tacgttgatg gggctgggat 20280cttatccttg tgatgatgag ttgtcgttac atatgcttgg aatgcatggg actgtgtatg 20340caaattacgc tgtggagcat agtgatttgt tgttggcgtt tggggtaagg tttgatgatc 20400gtgtcacggg taagcttgag gcttttgcta gtagggctaa gattgttcat attgatattg 20460actcggctga gattgggaag aataagactc ctcatgtgtc tgtgtgtggt gatgttaagc 20520tggctttgca agggatgaat aaggttcttg agaaccgagc ggaggagctt aagcttgatt 20580ttggagtttg gaggaatgag ttgaacgtac agaaacagaa gtttccgttg agctttaaga 20640cgtttgggga agctattcct ccacagtatg cgattaaggt ccttgatgag ttgactgatg 20700gaaaagccat aataagtact ggtgtcgggc aacatcaaat gtgggcggcg cagttctaca 20760attacaagaa accaaggcag tggctatcat caggaggcct tggagctatg ggatttggac 20820ttcctgctgc gattggagcg tctgttgcta accctgatgc gatagttgtg gatattgacg 20880gagatggaag ctttataatg aatgtgcaag agctagccac tattcgtgta gagaatcttc 20940cagtgaaggt acttttatta aacaaccagc atcttggcat ggttatgcaa tgggaagatc 21000ggttctacaa agctaaccga gctcacacat ttctcgggga tccggctcag gaggacgaga 21060tattcccgaa catgttgctg tttgcagcag cttgcgggat tccagcggcg agggtgacaa 21120agaaagcaga tctccgagaa gctattcaga caatgctgga tacaccagga ccttacctgt 21180tggatgtgat ttgtccgcac caagaacatg tgttgccgat gatcccgaat ggtggcactt 21240tcaacgatgt cataacggaa ggagatggcc ggattaaata ctgataggga taacagggta 21300atctcgacga gatgaaaccg gtgattatca gaacctttta tggtctttgt atgcatatgg 21360taaaaaaact tagtttgcaa tttcctgttt gttttggtaa tttgagtttc ttttagttgt 21420tgatctgcct gctttttggt ttacgtcaga ctactactgc tgttgttgtt tggtttcctt 21480tctttcattt tataaataaa taatccggtt cggtttactc cttgtgactg gctcagtttg 21540gttattgcga aatgcgaatg gtaaattgag taattgaaat tcgttattag ggttctaagc 21600tgttttaaca gtcactgggt taatatctct cgaatcttgc atggaaaatg ctcttaccat 21660tggtttttaa ttgaaatgtg ctcatatggg ccgtggtttc caaattaaat aaaactacga 21720tgtcatcgag aagtaaaatc aactgtgtcc acattatcag ttttgtgtat acgatgaaat 21780agggtaattc aaaatctagc ttgatatgcc ttttggttca ttttaacctt ctgtaaacat 21840tttttcagat tttgaacaag taaatccaaa aaaaaaaaaa aaaaatctca actcaacact 21900aaattatttt aatgtataaa agatgcttaa aacatttggc ttaaaagaaa gaagctaaaa 21960acatagagaa ctcttgtaaa ttgaagtatg aaaatatact gaattgggta ttatatgaat 22020ttttctgatt taggattcac atgatccaaa aaggaaatcc agaagcacta atcagacatt 22080ggaagtagga atatttcaaa aagttttttt tttttaagta agtgacaaaa gcttttaaaa 22140aatagaaaag aaactagtat taaagttgta aatttaataa acaaaagaaa ttttttatat 22200tttttcattt ctttttccag catgaggtta tgatggcagg atgtggattt catttttttc 22260cttttgatag ccttttaatt gatctattat aattgacgaa aaaatattag ttaattatag 22320atatatttta ggtagtatta gcaatttaca cttccaaaag actatgtaag ttgtaaatat 22380gatgcgttga tctcttcatc attcaatggt tagtcaaaaa aataaaagct taactagtaa 22440actaaagtag tcaaaaattg tactttagtt taaaatatta catgaataat ccaaaacgac 22500atttatgtga aacaaaaaca atatgtcgag gcgatcgcag tacttaatca gtgatcagta 22560actaaattca gtacattaaa gacgtccgca atgtgttatt aagttgtcta agcgtcaatt 22620tgtttacacc acaatatatc ctgccaccag ccagccaaca gctccccgac cggcagctcg 22680gcacaaaatc actgatcatc taaaaaggtg atgtgtattt gagtaaaaca gcttgcgtca 22740tgcggtcgct gcgtatatga tgcgatgagt aaataaacaa atacgcaagg ggaacgcatg 22800aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca agacgaccat cgcaacccat 22860ctagcccgcg ccctgcaact cgccggggcc gatgttctgt tagtcgattc cgatccccag 22920ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac cgctaaccgt tgtcggcatc 22980gaccgcccga cgattgaccg cgacgtgaag gccatcggcc ggcgcgactt cgtagtgatc 23040gacggagcgc cccaggcggc ggacttggct gtgtccgcga tcaaggcagc cgacttcgtg 23100ctgattccgg tgcagccaag cccttacgac atttgggcca ccgccgacct ggtggagctg 23160gttaagcagc gcattgaggt cacggatgga aggctacaag cggcctttgt cgtgtcgcgg 23220gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg cgctggccgg gtacgagctg 23280cccattcttg agtcccgtat cacgcagcgc gtgagctacc caggcactgc cgccgccggc 23340acaaccgttc ttgaatcaga acccgagggc gacgctgccc gcgaggtcca ggcgctggcc 23400gctgaaatta aatcaaaact catttgagtt aatgaggtaa agagaaaatg agcaaaagca 23460caaacacgct aagtgccggc cgtccgagcg cacgcagcag caaggctgca acgttggcca 23520gcctggcaga cacgccagcc atgaagcggg tcaactttca gttgccggcg gaggatcaca 23580ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat taccgagctg ctatctgaat 23640acatcgcgca gctaccagag taaatgagca aatgaataaa tgagtagatg aattttagcg 23700gctaaaggag gcggcatgga aaatcaagaa caaccaggca ccgacgccgt ggaatgcccc 23760atgtgtggag gaacgggcgg ttggccaggc gtaagcggct gggttgtctg ccggccctgc 23820aatggcactg gaacccccaa gcccgaggaa tcggcgtgag cggtcgcaaa ccatccggcc 23880cggtacaaat cggcgcggcg ctgggtgatg acctggtgga gaagttgaag gccgcgcagg 23940ccgcccagcg gcaacgcatc gaggcagaag cacgccccgg tgaatcgtgg caaggggccg 24000ctgatcgaat ccgcaaagaa tcccggcaac cgccggcagc cggtgcgccg tcgattagga 24060agccgcccaa gggcgacgag caaccagatt ttttcgttcc gatgctctat gacgtgggca 24120cccgcgatag tcgcagcatc atggacgtgg ccgttttccg tctgtcgaag cgtgaccgac 24180gagctggcga ggtgatccgc tacgagcttc cagacgggca cgtagaggtt tccgcaggcc 24240ccgccggcat ggccagtgtg tgggattacg acctggtact gatggcggtt tcccatctaa 24300ccgaatccat gaaccgatac cgggaaggga agggagacaa gcccggccgc gtgttccgtc 24360cacacgttgc ggacgtactc aagttctgcc ggcgagccga tggcggaaag cagaaagacg 24420acctggtaga aacctgcatt cggttaaaca ccacgcacgt tgccatgcag cgtaccaaga 24480aggccaagaa cggccgcctg gtgacggtat ccgagggtga agccttgatt agccgctaca 24540agatcgtaaa gagcgaaacc gggcggccgg agtacatcga gatcgagctt gctgattgga 24600tgtaccgcga gatcacagaa ggcaagaacc cggacgtgct gacggttcac cccgattact 24660ttttgatcga ccccggcatc ggccgttttc tctaccgcct ggcacgccgc gccgcaggca 24720aggcagaagc cagatggttg ttcaagacga tctacgaacg cagtggcagc gccggagagt 24780tcaagaagtt ctgtttcacc gtgcgcaagc tgatcgggtc aaatgacctg ccggagtacg 24840atttgaagga ggaggcgggg caggctggcc cgatcctagt catgcgctac cgcaacctga 24900tcgagggcga agcatccgcc ggttcctaat gtacggagca gatgctaggg caaattgccc 24960tagcagggga aaaaggtcga aaaggtctct ttcctgtgga tagcacgtac attgggaacc 25020caaagccgta cattgggaac cggaacccgt acattgggaa cccaaagccg tacattggga 25080accggtcaca catgtaagtg actgatataa aagagaaaaa aggcgatttt tccgcctaaa 25140actctttaaa acttattaaa actcttaaaa cccgcctggc ctgtgcataa ctgtctggcc 25200agcgcacagc cgaagagctg caaaaagcgc ctacccttcg gtcgctgcgc tccctacgcc 25260ccgccgcttc gcgtcggcct atcgcggcct atgcggtgtg aaataccgca cagatgcgta 25320aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 25380gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 25440gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 25500cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 25560aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 25620tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 25680ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 25740ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 25800cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 25860ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 25920gctacagagt

tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 25980atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 26040aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 26100aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtccttcaa ctcatcgata 26160gtttggctgt gagcaattat gtgcttagtg catctaacgc ttgagttaag ccgcgccgcg 26220aagcggcgtc ggcttgaacg aatttctagc tagacattat ttgccaacga ccttcgtgat 26280ctcgcccttg acatagtgga caaattcttc gagctggtcg gcccgggacg cgagacggtc 26340ttcttcttgg cccagatagg cttggcgcgc ttcgaggatc acgggctggt attgcgccgg 26400aaggcgctcc atcgcccagt cggcggcgac atccttcggc gcgatcttgc cggtaaccgc 26460cgagtaccaa atccggctca gcgtaaggac cacattgcgc tcatcgcccg cccaatccgg 26520cggggagttc cacagggtca gcgtctcgtt cagtgcttcg aacagatcct gttccggcac 26580cgggtcgaaa agttcctcgg ccgcggggcc gacgagggcc acgctatgct cccgggcctt 26640ggtgagcagg atcgccagat caatgtcgat ggtggccggt tcaaagatac ccgccagaat 26700atcattacgc tgccattcgc cgaactggag ttcgcgtttg gccggatagc gccaggggat 26760gatgtcatcg tgcaccacaa tcgtcacctc aaccgcgcgc aggatttcgc tctcgccggg 26820ggaggcggac gtttccagaa ggtcgttgat aagcgcgcgg cgcgtggtct cgtcgagacg 26880gacggtaacg gtgacaagca ggtcgatgtc cgaatggggc ttaaggccgc cgtcaacggc 26940gctaccatac agatgcacgg cgaggagggt cggttcgagg tggcgctcga tgacacccac 27000gacttccgac agctgggtgg acacctcggc gatgaccgct tcacccatga tgtttaactt 27060tgttttaggg cgactgccct gctgcgtaac atcgttgctg ctccataaca tcaaacatcg 27120acccacggcg taacgcgctt gctgcttgga tgcccgaggc atagactgta ccccaaaaaa 27180acagtcataa caagccatga aaaccgccac tgcgttccat gaatattcaa acaaacacat 27240acagcgcgac ttatcatgga tattgacata caaatggacg aacggataaa ccttttcacg 27300cccttttaaa tatccgatta ttctaataaa cgctcttttc tcttaggttt acccgccaat 27360atatcctgtc aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcactga 27420ttagtaacta aggcctttaa ttaatctaga ggcgcgccgg gccccctgca gggagctcgg 27480ccggccaatt taaattgata tcggtacatc gattacgcca agctatcaac tttgtatag 2753941161DNAArtificial SequencePrimer 41aagcttggcc actaaggcca atttaaatct actaggccgg ccaaagtagg cgcctactac 60cggtaattcc cgggattagc ggccgctagt ctgtgcgcac ttgtatcctg caggtcaatc 120gtttaaacac tgtacggacc gtggcctaat aggccggtac c 1614224DNAArtificial SequencePrimer 42tggtgcttaa acactctggt gagt 244326DNAArtificial SequencePrimer 43tttgacctac aaaatcaaag cagtca 264422DNAArtificial SequencePrimer 44agttctttgc tttcgaagtt gc 224523DNAArtificial SequencePrimer 45tactacgtac tgttttcaat tct 234625DNAArtificial SequencePrimer 46atttccacac gctttctatc atttc 254730DNAArtificial SequencePrimer 47ttatctctct ctaaaaaata aaaacgaatc 304821DNAArtificial SequencePrimer 48gtccagaatt ttctccattg a 214922DNAArtificial SequencePrimer 49tcttcactat ccaaagctct ca 225025DNAArtificial SequencePrimer 50gtctactttc attacagtga ctctg 255127DNAArtificial SequencePrimer 51ttatatttta cctgcaacac aattcaa 275220DNAArtificial SequencePrimer 52cactcgaata ctgcatgcaa 205326DNAArtificial SequencePrimer 53ttatgtagcc tttacacaga aaacaa 265420DNAArtificial SequencePrimer 54aacaactatg gcctgagggt 205532DNAArtificial SequencePrimer 55ttatcttact gtttttaacc aaaaaataaa at 325624DNAArtificial SequencePrimer 56atcttagggt ttcgcgagat ctca 245730DNAArtificial SequencePrimer 57tgctaagcta tctctgttaa tataaaattg 305822DNAArtificial SequencePrimer 58atttttgttg gtgaaaggta ga 225925DNAArtificial SequencePrimer 59ttacgttttt gtctctgctt cttct 256024DNAArtificial SequencePrimer 60tctgggaaat atcgattttg atct 246121DNAArtificial SequencePrimer 61tctcaccaca tcccaaagct c 216223DNAArtificial SequencePrimer 62gcacaatctt agcttacctt gaa 236325DNAArtificial SequencePrimer 63ttatttaatc cacaagcctt gcctc 256417DNAArtificial SequencePrimer 64tgtcggagaa gtgggcg 176515DNAArtificial SequencePrimer 65agaagtgggc ggacg 156625DNAArtificial SequencePrimer 66tagcttaatc tcagattcga atcgt 256728DNAArtificial SequencePrimer 67tagtatctac ataccaatca tacaaatg 286820DNAArtificial SequencePrimer 68tttcacgatt tggaatttga 206924DNAArtificial SequencePrimer 69tctacaacat taaaacgacc atta 247020DNAArtificial SequencePrimer 70agggtttcgt ttttgtttca 207123DNAArtificial SequencePrimer 71ttatctcctg ctcaaagaaa cca 237221DNAArtificial SequencePrimer 72agaagctcat ttcttcgata c 217320DNAArtificial SequencePrimer 73tctctgcgca aaaattcacc 207419DNAArtificial SequencePrimer 74tctaaaaata cagggcacc 197523DNAArtificial SequencePrimer 75ttactcttcg ttgcagaagc cta 237621DNAArtificial SequencePrimer 76actgtttaag cttcactgtc t 217720DNAArtificial SequencePrimer 77tttcttctaa agctgaaagt 207827DNAArtificial SequencePrimer 78ttaagctttt aagaatctct actcaca 277929DNAArtificial SequencePrimer 79ttaaatttta cctgtcatca aaaacaaca 298024DNAArtificial SequencePrimer 80tcgacggccc ggactgtatc caac 248148DNAArtificial SequencePrimer 81actcaccaga gtgtttaagc accagttcag cttgatcgct ctattaat 488248DNAArtificial SequencePrimer 82attaatagag cgatcaagct gaactggtgc ttaaacactc tggtgagt 488324DNAArtificial SequencePrimer 83taaggatgac ctacccattc ttga 248446DNAArtificial SequencePrimer 84gcaacttcga aagcaaagaa cttgttttta atcttgtttg tattga 468546DNAArtificial SequencePrimer 85tcaatacaaa caagattaaa aacaagttct ttgctttcga agttgc 468624DNAArtificial SequencePrimer 86ttagcagata tttggtgtct aaat 248744DNAArtificial SequencePrimer 87tcaaattcca aatcgtgaaa ttttttggtg gtgattggtt cttt 448844DNAArtificial SequencePrimer 88aaagaaccaa tcaccaccaa aaaatttcac gatttggaat ttga 448924DNAArtificial SequencePrimer 89cacgggcagg acatagggac tact 249044DNAArtificial SequencePrimer 90tgaaacaaaa acgaaaccct gatttatgat aaaaatgtcg gttt 449144DNAArtificial SequencePrimer 91aaaccgacat ttttatcata aatcagggtt tcgtttttgt ttca 449224DNAArtificial SequencePrimer 92ctgcagcaaa tttacacatt gcca 249345DNAArtificial SequencePrimer 93agacagtgaa gcttaaacag tactggctat gaagaaatta taatc 459445DNAArtificial SequencePrimer 94gattataatt tcttcatagc cagtactgtt taagcttcac tgtct 45951197DNAPhytophtora sojae 95atggctattt tgaaccctga ggctgattct gctgctaacc tcgctactga ttctgaggct 60aagcaaagac aattggctga ggctggatac actcatgttg agggtgctcc tgctcctttg 120cctttggagt tgcctcattt ctctctcaga gatctcagag ctgctattcc taagcactgc 180ttcgagagat ctttcgtgac ctccacctac tacatgatca agaacgtgtt gacttgcgct 240gctttgttct acgctgctac cttcattgat agagctggag ctgctgctta tgttttgtgg 300cctgtgtact ggttcttcca gggatcttac ttgactggag tgtgggttat cgctcatgag 360tgtggacatc aggcttattg ctcttctgag gtggtgaaca acttgattgg actcgtgttg 420cattctgctt tgttggtgcc ttaccactct tggagaatct ctcacagaaa gcaccattcc 480aacactggat cttgcgagaa cgatgaggtt ttcgttcctg tgaccagatc tgtgttggct 540tcttcttgga acgagacctt ggaggattct cctctctacc aactctaccg tatcgtgtac 600atgttggttg ttggatggat gcctggatac ctcttcttca acgctactgg acctactaag 660tactggggaa agtctaggtc tcacttcaac ccttactccg ctatctatgc tgatagggag 720agatggatga tcgtgctctc cgatattttc ttggtggcta tgttggctgt tttggctgct 780ttggtgcaca ctttctcctt caacaccatg gtgaagttct acgtggtgcc ttacttcatt 840gtgaacgctt acttggtgtt gattacctac ctccaacaca ccgataccta catccctcat 900ttcagagagg gagagtggaa ttggttgaga ggagctttgt gcactgtgga tagatcattt 960ggtccattcc tcgattctgt ggtgcataga atcgtggata cccatgtttg ccaccacatc 1020ttctccaaga tgcctttcta tcattgcgag gaggctacca acgctattaa gcctctcctc 1080ggaaagttct acttgaagga taccactcct gttcctgttg ctctctggag atcttacacc 1140cattgcaagt tcgttgagga tgatggaaag gtggtgttct acaagaacaa gctctag 1197961371DNAOstreococcus tauri 96atgtgtgttg agaccgagaa caacgatgga atccctactg tggagatcgc tttcgatgga 60gagagagaaa gagctgaggc taacgtgaag ttgtctgctg agaagatgga acctgctgct 120ttggctaaga ccttcgctag aagatacgtg gttatcgagg gagttgagta cgatgtgacc 180gatttcaaac atcctggagg aaccgtgatt ttctacgctc tctctaacac tggagctgat 240gctactgagg ctttcaagga gttccaccac agatctagaa aggctaggaa ggctttggct 300gctttgcctt ctagacctgc taagaccgct aaagtggatg atgctgagat gctccaggat 360ttcgctaagt ggagaaagga gttggagagg gacggattct tcaagccttc tcctgctcat 420gttgcttaca gattcgctga gttggctgct atgtacgctt tgggaaccta cttgatgtac 480gctagatacg ttgtgtcctc tgtgttggtt tacgcttgct tcttcggagc tagatgtgga 540tgggttcaac acgagggagg acactcttct ttgaccggaa acatctggtg ggataagaga 600atccaagctt tcactgctgg attcggattg gctggatctg gagatatgtg gaactccatg 660cacaacaagc accacgctac tcctcaaaaa gtgaggcacg atatggattt ggataccact 720cctgctgttg ctttcttcaa caccgctgtg gaggataata gacctagggg attctctaag 780tactggctca gattgcaagc ttggaccttc attcctgtga cttctggatt ggtgttgctc 840ttctggatgt tcttcctcca cccttctaag gctttgaagg gaggaaagta cgaggagctt 900gtgtggatgt tggctgctca cgtgattaga acctggacca ttaaggctgt tactggattc 960accgctatgc aatcctacgg actcttcttg gctacttctt gggtttccgg atgctacttg 1020ttcgctcact tctctacttc tcacacccac ttggatgttg ttcctgctga tgagcacttg 1080tcttgggtta ggtacgctgt ggatcacacc attgatatcg atccttctca gggatgggtt 1140aactggttga tgggatactt gaactgccaa gtgattcacc acctcttccc ttctatgcct 1200caattcagac aacctgaggt gtccagaaga ttcgttgctt tcgctaagaa gtggaacctc 1260aactacaagg tgatgactta tgctggagct tggaaggcta ctttgggaaa cctcgataat 1320gtgggaaagc actactacgt gcacggacaa cactctggaa agaccgcttg a 1371971371DNAOstreococcus tauri 97atgtgtgttg agaccgagaa caacgatgga atccctactg tggagatcgc tttcgatgga 60gagagagaaa gagctgaggc taacgtgaag ttgtctgctg agaagatgga acctgctgct 120ttggctaaga ccttcgctag aagatacgtg gttatcgagg gagttgagta cgatgtgacc 180gatttcaaac atcctggagg aaccgtgatt ttctacgctc tctctaacac tggagctgat 240gctactgagg ctttcaagga gttccaccac agatctagaa aggctaggaa ggctttggct 300gctttgcctt ctagacctgc taagaccgct aaagtggatg atgctgagat gctccaggat 360ttcgctaagt ggagaaagga gttggagagg gacggattct tcaagccttc tcctgctcat 420gttgcttaca gattcgctga gttggctgct atgtacgctt tgggaaccta cttgatgtac 480gctagatacg ttgtgtcctc tgtgttggtt tacgcttgct tcttcggagc tagatgtgga 540tgggttcaac atgagggagg acattcttct ttgaccggaa acatctggtg ggataagaga 600atccaagctt tcactgctgg attcggattg gctggatctg gagatatgtg gaactccatg 660cacaacaagc accatgctac tcctcaaaaa gtgaggcacg atatggattt ggataccact 720cctgctgttg ctttcttcaa caccgctgtg gaggataata gacctagggg attctctaag 780tactggctca gattgcaagc ttggaccttc attcctgtga cttctggatt ggtgttgctc 840ttctggatgt tcttcctcca tccttctaag gctttgaagg gaggaaagta cgaggagctt 900gtgtggatgt tggctgctca tgtgattaga acctggacca ttaaggctgt tactggattc 960accgctatgc aatcctacgg actcttcttg gctacttctt gggtttccgg atgctacttg 1020ttcgctcact tctctacttc tcacacccat ttggatgttg ttcctgctga tgagcatttg 1080tcttgggtta ggtacgctgt ggatcacacc attgatatcg atccttctca gggatgggtt 1140aactggttga tgggatactt gaactgccaa gtgattcatc acctcttccc ttctatgcct 1200caattcagac aacctgaggt gtccagaaga ttcgttgctt tcgctaagaa gtggaacctc 1260aactacaagg tgatgactta tgctggagct tggaaggcta ctttgggaaa cctcgataat 1320gtgggaaagc actactacgt gcacggacaa cattctggaa agaccgcttg a 1371981569DNAPythium irregulare 98atggttgatt tgaagccagg agtgaagaga ttggtttcct ggaaggagat tagagagcac 60gctactccag ctactgcttg gattgtgatc caccacaagg tgtacgatat ctccaagtgg 120gattctcatc caggtggaag tgtgatgttg actcaggctg gagaggatgc tactgatgct 180ttcgctgtgt tccatccatc ttccgctttg aagctcttgg agcagttcta cgtaagtttc 240tgcttctacc tttgatatat atataataat tatcattaat tagtagtaat ataatatttc 300aaatattttt ttcaaaataa aagaatgtag tatatagcaa ttgcttttct gtagtttata 360agtgtgtata ttttaattta taacttttct aatatatgac caaaatttgt tgatgtgcag 420gtaggagatg tggatgagac ttccaaggct gagattgagg gagaaccagc ttctgatgag 480gagagagcta gaagagagag gatcaacgag ttcatcgctt cttacagaag gctcagggtt 540aaggttaagg gaatgggact ctacgatgct tctgctcttt actacgcttg gaagctcgtt 600tctaccttcg gaattgctgt gctctctatg gctatctgct tcttcttcaa ctccttcgct 660atgtacatgg tggctggagt tattatggga ctcttctacc aacaatctgg atggcttgct 720cacgatttct tgcacaacca ggtgtgcgag aacagaactt tgggaaactt gatcggatgc 780cttgttggaa atgcttggca gggattctct atgcaatggt ggaagaacaa gcacaacttg 840caccacgctg tgccaaactt gcactccgct aaggatgagg gattcatcgg agatccagat 900atcgatacca tgccattgct tgcttggtct aaggagatgg ctagaaaggc tttcgagtct 960gctcacggac cattcttcat caggaaccag gctttcttgt acttcccatt gctcttgttg 1020gctagattgt cttggctcgc tcagtctttc ttctacgtgt tcaccgagtt ctcattcgga 1080atcttcgata aggtggagtt cgatggacca gaaaaggctg gattgatcgt gcactacatc 1140tggcaactcg ctattccata cttctgcaac atgtccttgt tcgagggagt tgcttacttc 1200ttgatgggac aagcttcttg cggattgctt ttggctctcg tgttctctat tggacacaac 1260ggaatgtctg tgtacgagag agagaccaag ccagatttct ggcaattgca agtgactacc 1320accagaaaca ttagggcttc cgtgttcatg gattggttca ccggaggact caactaccaa 1380atcgatcacc acttgttccc attggtgcca agacacaact tgccaaaggt gaacgtgttg 1440atcaagtctc tctgcaagga gttcgatatc ccattccacg agactggatt ctgggaggga 1500atctacgagg ttgtggatca cctcgctgat atctctaagg agttcatcac tgagttccca 1560gctatgtga 156999873DNAPhyscomitrella patens 99atggaagttg ttgagaggtt ctacggagag ttggatggaa aggtttccca aggagtgaac 60gctttgttgg gatctttcgg agttgagttg actgataccc caactactaa gggattgcca 120ctcgttgatt ctccaactcc aattgtgttg ggagtgtctg tttacttgac catcgtgatc 180ggaggattgc tttggatcaa ggctagagat ctcaagccaa gagcttctga gccattcttg 240ttgcaagctt tggtgttggt gcacaacttg ttctgcttcg ctttgtctct ttacatgtgc 300gtgggtatcg cttaccaagc tatcacctgg agatattcct tgtggggaaa cgcttataac 360ccaaagcaca aggagatggc tatcctcgtt tacctcttct acatgtccaa gtacgtggag 420ttcatggata ccgtgatcat gatcctcaag agatccacca gacagatttc tttcctccac 480gtgtaccacc actcttctat ctcccttatc tggtgggcta ttgctcacca cgctccagga 540ggagaggctt attggagtgc tgctctcaac tctggagtgc acgtgttgat gtacgcttac 600tacttcttgg ctgcttgctt gagatcttcc ccaaagctca agaacaagta cctcttctgg 660ggaagatacc tcacccaatt ccagatgttc cagttcatgc tcaacttggt gcaagcttac 720tacgatatga aaaccaacgc tccatatcca caatggctca tcaagatcct cttctactac 780atgatctccc tcttgttcct cttcggaaac ttctacgtgc aaaagtacat caagccatcc 840gatggaaagc aaaagggagc taagaccgag tga 873100819DNAThalassiosira pseudonana 100atggatgctt ataacgctgc tatggataag attggagctg ctatcatcga ttggagtgat 60ccagatggaa agttcagagc tgatagggag gattggtggt tgtgcgattt cagatccgct 120atcaccattg ctctcatcta catcgctttc gtgatcttgg gatctgctgt gatgcaatct 180ctcccagcta tggacccata ccctatcaag ttcctctaca acgtgtctca aatcttcctc 240tgcgcttaca tgactgttga ggctggattc ctcgcttata ggaacggata caccgttatg 300ccatgcaacc acttcaacgt gaacgatcca ccagttgcta acttgctctg gctcttctac 360atctccaaag tgtgggattt ctgggatacc atcttcattg tgctcggaaa gaagtggaga 420caactctctt tcttgcacgt gtaccaccac accaccatct tcctcttcta ctggttgaac 480gctaacgtgc tctacgatgg agatatcttc ttgaccatcc tcctcaacgg attcattcac 540accgtgatgt acacctacta cttcatctgc atgcacacca aggattctaa gaccggaaag 600tctttgccaa tctggtggaa gtcatctttg accgctttcc aactcttgca attcaccatc 660atgatgtccc aagctaccta cttggttttc cacggatgcg ataaggtttc cctcagaatc 720accatcgtgt acttcgtgta cattctctcc cttttcttcc tcttcgctca gttcttcgtg 780caatcctaca tggctccaaa gaagaagaag tccgcttga 8191011320DNAThraustochytrium ssp. 101atgggaaaag gatctgaggg aagatctgct gctagagaga tgactgctga ggctaacgga 60gataagagaa agaccatcct cattgaggga gtgttgtacg atgctaccaa cttcaaacac 120ccaggaggtt ccattattaa cttcctcacc gagggagaag ctggagttga tgctacccaa 180gcttacagag agttccatca gagatccgga aaggctgata agtacctcaa gtccctccca 240aagttggatg cttctaaggt ggagtctagg ttctctgcta aggagcaggc tagaagggac 300gctatgacca gggattacgc tgctttcaga gaggagttgg ttgctgaggg atacttcgat 360ccatctatcc cacacatgat ctacagagtg gtggagattg tggctttgtt cgctttgtct 420ttctggttga tgtctaaggc ttctccaacc tctttggttt tgggagtggt gatgaacgga 480atcgctcaag gaagatgcgg atgggttatg cacgagatgg gacacggatc tttcactgga 540gttatctggc tcgatgatag gatgtgcgag ttcttctacg gagttggatg tggaatgtct 600ggacactact ggaagaacca gcactctaag caccacgctg ctccaaacag attggagcac 660gatgtggatt tgaacacctt gccactcgtt gctttcaacg agagagttgt gaggaaggtt 720aagccaggat ctttgttggc tttgtggctc agagttcagg cttatttgtt cgctccagtg 780tcttgcttgt tgatcggatt gggatggacc ttgtacttgc acccaagata tatgctcagg 840accaagagac acatggagtt tgtgtggatc ttcgctagat atatcggatg gttctccttg 900atgggagctt tgggatattc tcctggaact

tctgtgggaa tgtacctctg ctctttcgga 960cttggatgca tctacatctt cctccaattc gctgtgtctc acacccactt gccagttacc 1020aacccagagg atcaattgca ctggcttgag tacgctgctg atcacaccgt gaacatctct 1080accaagtctt ggttggttac ctggtggatg tctaacctca acttccaaat cgagcaccac 1140ttgttcccaa ccgctccaca attcaggttc aaggagatct ctccaagagt tgaggctctc 1200ttcaagagac acaacctccc ttactacgat ttgccataca cctctgctgt ttctactacc 1260ttcgctaacc tctactctgt tggacactct gttggagctg ataccaagaa gcaggattga 1320102903DNAOstreococcus tauri 102atgtctgcta gcggagcttt gttgcctgct atagctttcg ctgcttacgc ttacgctacc 60tacgcttatg ctttcgagtg gagccacgct aacggaatcg ataacgtgga tgctagagag 120tggattggag ctttgtcttt gagactccct gcaattgcaa ccacaatgta cctcttgttc 180tgccttgtgg gacctagatt gatggctaag agggaggctt ttgatcctaa gggatttatg 240ctcgcttaca acgcttacca aaccgctttc aacgttgtgg tgctcggaat gttcgctaga 300gagatctctg gattgggaca acctgtttgg ggatctacta tgccttggag cgataggaag 360tccttcaaga ttttgttggg agtgtggctc cactacaaca ataagtacct cgagttgttg 420gatactgtgt tcatggtggc taggaaaaag accaagcagc tctctttctt gcacgtgtac 480caccacgctt tgttgatttg ggcttggtgg cttgtttgtc acctcatggc taccaacgat 540tgcatcgatg cttatttcgg agctgcttgc aactctttca tccacatcgt gatgtactcc 600tactacctca tgtctgcttt gggaattagg tgcccttgga agagatatat cacccaggct 660cagatgttgc aattcgtgat cgtgttcgct cacgctgttt tcgtgctcag acaaaagcac 720tgccctgtta ctttgccttg ggcacaaatg ttcgtgatga caaatatgtt ggtgctcttc 780ggaaacttct acctcaaggc ttactctaac aagtctaggg gagatggagc ttcttctgtt 840aagcctgctg agactactag agcaccttct gtgagaagaa ccaggtcaag gaagatcgat 900tga 9031031560DNATraustochytrium ssp. 103atgactgttg gatacgacga ggagatccca ttcgagcaag ttagggctca taacaagcca 60gacgacgctt ggtgtgctat tcacggacac gtgtacgacg ttaccaagtt cgcttcagtt 120cacccaggag gagatattat cttgctcgct gctggaaagg aagctactgt cctctacgag 180acctaccatg ttagaggagt gtctgacgct gtgctcagaa agtacagaat aggaaagttg 240ccagacggac aaggaggagc taacgagaag gagaagagaa ccttgtctgg attgtcctct 300gcttcttact acacctggaa ctccgatttc tacagagtga tgagggagag agttgtggct 360agattgaagg agagaggaaa ggctagaaga ggaggatacg aactctggat caaggctttc 420ttgctccttg ttggattctg gtcctctctt tactggatgt gcaccctcga tccatctttc 480ggagctatct tggctgctat gtctttggga gtgttcgctg cttttgttgg aacctgcatc 540caacacgatg gaaaccacgg agctttcgct caatctagat gggttaacaa ggtggcagga 600tggactttgg atatgatcgg agcttctgga atgacttggg agttccaaca cgtgttggga 660caccacccat acactaactt gatcgaggag gagaacggat tgcaaaaggt gtccggaaag 720aagatggata ccaagttggc tgatcaagag tctgatccag atgtgttctc cacctaccca 780atgatgagat tgcacccttg gcaccagaag aggtggtatc acaggttcca gcacatctac 840ggacctttca tcttcggatt catgaccatc aacaaggtgg tgactcaaga tgttggagtg 900gtgttgagaa agagactctt ccaaatcgat gctgagtgca gatatgcttc cccaatgtac 960gttgctaggt tctggattat gaaggctttg accgtgttgt atatggttgc tttgccttgt 1020tatatgcaag gaccttggca cggattgaaa ctcttcgcta tcgctcactt cacttgcgga 1080gaggttttgg ctaccatgtt catcgtgaac cacattatcg agggagtgtc ttacgcttct 1140aaggatgctg ttaagggaac tatggctcca ccaaagacta tgcacggagt gaccccaatg 1200aacaacacta gaaaggaggt tgaggctgag gcttctaagt ctggagctgt ggttaagtct 1260gtgccattgg atgattgggc tgctgttcag tgccaaacct ctgtgaactg gtctgttgga 1320tcttggtttt ggaaccactt ctctggagga ctcaaccacc aaatcgagca ccacctcttc 1380ccaggattgt ctcacgagac ctactaccac atccaagacg tggttcaatc tacctgtgct 1440gagtacggag ttccatacca acacgagcca tctttgtgga ctgcttactg gaagatgctc 1500gaacacctta gacaattggg aaacgaggag actcacgagt catggcagag agctgcttga 15601041563DNAPhythophtora infestance 104atgaactgcc agcgtcatcc aacacacgtc gcacatgaca tcaccttcgg cagcatcctt 60gccatcctcg ccgcgcagcc tcccattcct gtttctgcct cgcatttggc actcatggct 120tctcacgttg tctcgtcgct gagtaatgca gccactccgc tgcgattcac cttgttaaac 180cagcagctca cacaactctc ggagctcgta ggggttccag tggaccaact acgttgcgtc 240gcttgcctgt tagctgtcta cccattggca cttatcgtgc gcaagttgcc gtcggtcaca 300gctaagcatt ggctgcacat ttgcgctggt gtgagcatcg cccaattcgt ctatggaaca 360ggatggctac actcgcttct atcctcgctg gtcacgtacg cgttggtgtg cgtgctgccg 420cccaaacgcg caccgttcgt ggtgtttctc gccaatatgt tgtttgtggc ggcactgcac 480atccaccgta tgcgagtcaa ctatatgggc tggagtatgg actcgacagc gagtcagatg 540ctgctgctca tcaagctcac gagcttcgcc ttcaactacc acgatggtgt tgttcccagt 600gccacagcag tgcagaacgg cgactcagag cacacgaaaa gagtcaagca gttgcgtaaa 660caactggcga tcccacagat cccgtcactg ctggagtttt tgggcttcgt ctactgcttc 720acgacgttcc tggccggtcc ggcatttgag tacaaagagt acagcgacgc tattcaccag 780gctaggttcg tcgacaacaa cggtgtccga cgtaatgtgt cccctgcgcg tgcggcaatg 840tccaagttgg tattgggtct tggacttatg ggacttttgg tgcagttcgg agctctagcc 900gacttgaatc agattttgaa cgatgagaat cagtccatgc tcatgaagtg ggggcgacta 960tttgtcgcgt tgttcttgac tcgtgccaag tattacgtgg cgtggaaact ggcggagggg 1020gcgactgtgc tgaccggaac gggattcgaa ggattcgacg agcagaacaa ccccaaaggc 1080tgggatggtg tcagtaatgt ggacatcctg ggcttcgaac tcggcgccaa cgtgcgtgag 1140atctcgcgtg cttggaacaa gggcacgcag aactggctgg agcgttatgt gtacacacgc 1200acgggcaact cgttgcttgc cacgtactct gtatcggctc tgtggcacgg attctaccct 1260ggttactatc tcttcttcct cacggtgccg cttgcgacgt ctgtgaatcg cctggcgcga 1320cgtcacgtgc gtccgtacgt tgtggacagc ccgctgaagc cactctacga cctcgtcggt 1380atgatctgta ctgctttggt cgtcaactac ttggccgtct cgttcgtagt gctgtcgtgg 1440gaggacgcag ttgctggttt ccgctccatg cgctttactg gccacgtcgg gcttgtgggc 1500tgctacttgt tgctcacctt tgtgcctatc aagaagactg cgaacagtaa gaagaccttg 1560taa 15631051371DNAPhythophtora infestance 105atggaccgcg tcgtggactt tgtggagcac ctgcagccgt acacggagct tgccactcct 60ttggacttca gtttcctcca tgcaaaagtg gacgagctgt ccgtgtcgct cggtctgggc 120agcgaccagc tctgctacgt cctctgccta ttcgctgcgt atccgctggc tgttgtgtac 180aaactgctac ccggtgccag cctcaagcac gtgtttgatg tggtgctagg tgtgagcatc 240gctcagttcg tgctgggctc cggctgggtg cactcgttca tctcgagctt cctgacgtac 300ctgatcgtta agttcgggcc atccaagcac gcgccaggca tcgtgttcct cttcaacatg 360ctatacatgt cagcgtcaca catctaccgt ttgtatgtgg actacatggg ttggacgctg 420gacttcaccg gcccgcagat gctgctggtc atcaagctca ccagcttcgc ctacaactac 480tacgacggcg tggtggacaa gacgtttgag aagaaaggtg ccgagatgtc ccccggcata 540aagaaagtgt acgaaggacg tcagaagctc gctatccagg agatcccgtc tctgctcgag 600ttcttcggct acgtgtacag cttcaccacc ttcctggccg gcccggcgtt cgagatccgc 660gagtatttgg acgtgacgag cggcaaaaag ttccttatgg acggcaagaa caaagagccg 720tcgagtgtgc tcgctgcgtt ctctaaattc ctggtgggat cgctgttgat ggctgcgttc 780gctgtgtatg gccccatgta cccgctgtcg aacctgcacg accccaagat cgctgcgcag 840ccgttgctgt accagatccg cgacctgtac atcgcgctga tcttctgcaa ggccaagtat 900tactccgcct ggaagattgc cgagggcgcc accgtgctgt gtggcttcgg attcgagggc 960ttcaacaagg acggaaccag tcgcggctgg aacggtgtga gcaacatgga catcttgggc 1020tttgagttct cgcagagcat ccgtgcggcc tcgcgagcct ggaacaaggg gacgcagaac 1080tggctggaac gctacgtgta cacgcgcacg ggcaactcgc tgatggccac gtacttcatc 1140tcagccttct ggcacggatt ctacccgggc tactacattt tcttcatgag tctgccgctg 1200gctacggcgg tgaaccgttt ggctttcaag cgtcttcgtc cacgtttcat cgaggccgac 1260ggatcgttcg gagccaagaa gaaaatttac gacgtgctca gctacttgtt gacgctcttc 1320gctatgcact acttcgtcat gccgttccag gtacttaata agtatttgtg a 13711061458DNAPhythophtora infestance 106atgcgtgtca ctcgccgcat tcgaagactt gccgaagcgt ggatcgtgtt tcgctatcga 60gcagcagagc agagcatgga gatactgcgt ggccccgtgg acggcatcgc cctaagcgag 120aacttccctg ttgatggatt ccgcctcatg gtggcgcttg cgggttgcag cctcatcgca 180ccgctcatcc acctcacacg cggcgagaca tctcgtcact tgttcaatgt tgcggtggga 240ctattcgccg gcgtcttcgt gttcgacttg gccgtgttgc acactatcgg gacggccgtt 300gttgtgtatt tgctcatgat ggtggctcca agcttgtggg gcgcattgtg ctgccgctgc 360tgttggcgta cctctcacta ttaccgtgaa ttctacagcc cagacattgt gtgggactcg 420gcccaaatga tcctaacgct taagctcagc agcgtcgcga tcaactacag tgacggcggg 480ctgcccacgg agaagaagac gcccacaatg cttaagaacg agctgcaaga aatcccagag 540ctgatcccgt actttggctt cgttttcttc ttcccgacct acttggctgg tcctgcgttc 600gagtacaagg actacattta ctggatgaag gacgttcgcg ttgctccttt catggtccat 660ctccgcaatc tcgtcatttc cgctgctggt ttcttcgtct cgctccaatt ccccgtcgag 720gaaatcgact cccccgactt cttcccgaaa tcgtcgtggg ctgtgcgctg cctccgtatg 780tgcatccctg tcgtgttgtt ccgtttccgc tactatctgg cctggtcgct ggccgaggcg 840gcgagtgctg ctgcgggcgt gggctacgtg caagctactg gaaaatggaa cggcatcacg 900aacaacgatc tcctgtgtgt ggagcttccg acgaatttcc gagtggccat caacagctgg 960aacattggag ttgcgcgctg gattaacact tacatttacc agcgcgtcgg tctgaccaag 1020tctgggaagt ccacgatgct ctccacgatg gcgtcattct ttgtcagcgc tctgtggcat 1080ggactgtcgc ctggttacta cctgttcttc ctcttgggtg gcatctacat cgaagttggc 1140aagcaacttc gtcgtcgtct gcgtccatac ttccactaca cggaggaccg taaggctcac 1200tcgcatgcca ttttcctctc gtactttagc ggcacgtctc atccactggc cttcttgtac 1260gacatctcgg gcatgttctt cacgtgggtg gcgatgcagt acgctggtgt cgccttcgag 1320atcctggacg tgcgtcgttg cctcgccatt tggagctcgt ggtacttcct cccgcacctt 1380gtgagcatcg gcttgctggt tttctttaac ctcttcccgc aacgtcgctc cactcccacc 1440gacaagaaga cgcagtaa 14581071677DNAPhythophtora infestance 107atgagcacca ccgcgctatt acaagcctcc acttctcctc ctccttcgcg agagccggaa 60tacgcagcat tggagcagct cgagccgcct ctgtcccatg caatcgacat gggggtcaaa 120gtctcaccgt ccgagtcagc ggcgatagca ggtggggtct acgtgaccgc ctcgtccagt 180tgtggggcct ccactatcaa gcacaatccg ttcacgtaca cgacaccggt ggacacgtac 240gagaaggcca agatgaccat cttgtgtctc ttaggagtcc cattcattcg tttcgtactg 300ctactctgtg tgggcattct actcgtcatc gtaagtcact tggctctcat tgggtacaaa 360ccattggacg ctcactctgg agctcgtcca cctctgccac gttggagacg tatcgtcggt 420tcgcctgtgc cgtatctgct acggtcactg atgctcatcg tgggttacta ctgggttcca 480gtgaaatacc ctccgaattt taatcgtcat gccatgccac gcgtcatcgt aagcaaccat 540ttgaccttct tcgacggact ctacatcttc acgttgctat cgcccagtat cgccatgaag 600acggacgtag ctaacctccc attgatcagt cgaatcgtgc agatgattca accgattctg 660atcgacagag gaacacccga aggacgtaga agagcgatga atgacatcac gtcacatgtt 720gctgatccca gtaagcctcc gcttcttgta ttcccggaag gcactacatc gaatcaaacg 780gtactgtgta aattcaaggt cgggtctttc gtctcaggtg taccgtgtca gccggttgta 840ctacggtacc cctacaaaca cttcgatttg agttggccac ctggggtttc tgggttgtac 900ttggcgttac gtgtgttgtg tcaggtgtac aaccgattgg aagtggagat tctaccagcg 960tactacccgt cggagcgaga acggaaagac cctcaattat acgctattaa tgtgcgtgag 1020gtaatggcca aagcgctggg agttcccaca acgaaccacg cttttgaaga tgtagccatg 1080ttgatgcgtg tcggagacta cgccacaaaa cacgtcgtac cactgacaga cgtgggtgaa 1140gtgatctcgc taacggcact aaagcgaggt gacgtagatc gcctggtggg ctacttccgt 1200cgccacgacc ttgataagga cggccactta tctatgcagg agctacgtgc actgttccct 1260aatgacgatc ctgtgatcgt tgatcagctc ttcgacctcg ttgatttaga cgacagtggg 1320ctcatcgatt tccgggaatt gtgcttggct ctacgtgcac taaacccgca gaatatcaac 1380gagggagacg acgccttggc gaaattcgct ttccgtctct atgatcttga taacaacgga 1440gtcatcgacg cctctgaact ggaacaacta cttcgcttcc aacgcaactt ctacggcgtt 1500tctgaagcga gtgttgcagc cgcgttacgt caagctcagg cagaaaacac gaccggtatc 1560acttataaca gattcgagca gctggtatta caaaaccccg aagttttgtg gtacgtccgc 1620gacaaactcg aagtcctacg tggctccatg cgagaaagca gtctcgagat tccgtag 16771081047DNAPhythophtora infestance 108atggagaagt atagtcggtg gtcggatctg acgacaggca tcaacccgtt cgtgccgcag 60cgtcggcgct tcacgtccgg atggcccgtg accatcttgc aggtcatatc tggctccgct 120ttggcgctcg tacgcttccc gttggtgcta gtagccttcg tcgcgctatt tctagtcaac 180ctagtggtgt ccattctcgc cgtaatcccg ttcctaggac gtctgcttaa gcgcatcaca 240gaatggttgc tgtgctcact cctcctcctg cttttcggtg tgttcacctc gaacggctca 300actcgcgttg gatctggcga cgtgctggtt tgcaactaca cgagcttttt ggagatatta 360tacctggcca cgcgcttctc accagttttt gtatttgcta cagagaccaa gagtaacgac 420gaaggattgg tacacgtatg tggcctactc gaggcgctgt acaggtcgtt ggcaatgcct 480gtgagtgttg aacgtgtcaa acccacaagg aagatcgcag acgtagtgcg tcgagctgct 540gggccagtag tcgtgcttcc cgagggggct agaagcaatg gtaaggctgt gctgaagttc 600atccccgtgc tacagaacct gccggtcaag acccgcgtac acctcgtggc cttccgctac 660gagttcaagc gcttcagtcc gagtcaaagt gccggtggtg cctggtctca cctcttctgg 720actgccttcc acgtgtacca caccatgcgt gtgacggtat tgagtgctaa agacttgaat 780ctagacgact taacgccgac taaactaccg agtaacaaga gcagtaagaa gcaggagaac 840tccaagacac tgtcgactga tcaggtcgag aaactacgca cacttctagc cgctatgtta 900cgcaccaaga ccgttgactt gggaccagag gactctgtgt ctttcaataa ttactggaag 960cacgtcaaca gcggaggacg tcaaccagcg tcccaattca cggaccgcaa ggctcctcat 1020gaacacgccc aatgggccaa gagatag 10471091275DNAPhythophtora infestance 109atgtcgttcg ctacacctgc gcaggtgctg caggatgtgc gcttcgaaga gcgttttgct 60gagattgagt cgaggttgcc ggccacgttg gctttggcca aggagggatc tttagccaaa 120cgcaatcaga ccaagcgcaa gctttaccac gacagcgagc tcatccgtat cgagctggaa 180gagcgtctga atgaactagg tatcgaaagt cagtgggtca ctgccccgga gatgaaggaa 240gccaatgaga agctggacgc agtgcgtaag cagctcaaac tggacgtgct gcccgccagt 300tcctctcctc tggagaagat ctacatggtc gtgcgcatgc ttacaatggt gctggtgctc 360gtgggttggc tcagctgtgt gacagtgctg atcccactca aatggctcaa cccagtactc 420aagaagatgg gagtcaagaa gaactacctt cccatggaca ttgtgtcatg gggtacggcc 480ttcatggtct gtgtcacggc ctgtaccgac atgaaggccg agggcgtcga aaacctgctc 540aaccttaagg actctgtcgt ctgcatgttc agccactcgt ccaacttgga cggcttcatt 600gtcaatggat catcgccgat tgccttcaag tttgccgcca agaaaagcat ttttctagtc 660ccgttcctcg gctggtcgtc tcgttggggc ttcgactttg tggccatcga ccgctcgcac 720cgtaaatcag cgctgaagag tttaaaggaa cttgcagtgt cggtaaacga gcatggcaat 780tcagtctgca tctcgcctga aggcacacgc tcgaaggacg gactgcttca agaattcaag 840aaggggccat tctacctgcg tgaggacacg aagaagaacg tggtgccctc catcgtgttc 900ggcgcgtacg agctgtggcc tcctggacga ttgttcagca tccccggaca cacgttggtg 960cgttacctgc ccgagtacaa gtcagatccg aacttgaacc gtaaccagaa ccggttggcg 1020ctgcgtcgca tctatctcaa ggcgttcacg gaggatgttc cggactacat tggcactcgc 1080gtgagcacca acttcatcct gaagaacatg ttctatcact atcttgcgtg ggcgatcacg 1140ttcaaagtga cttcgtgggc actcacagtg atcagcctcg tcttgtactg gctcaacatc 1200acatatggca cctttatgct gttctcgctg gtcatgatgg tggcgggaga agccctcatg 1260ttcttcacct gctaa 12751101278DNAPhythophtora infestance 110atgagtcaaa gtgacgagtg ccaagcaacc caaacctccg tgtatccaac caagcgctgc 60gtgtcaggag gccccgtagt cgagcccgac gctgagccag tgctcaatcg cgtcatccat 120ccgagtacaa agtttgagac tgcatggacg tggtccggat gcatcatcgg ctgcagctac 180ctgctccttc tcgtagtatg tgccttcctg aacaccactt tcgtgctgtg gccactgacg 240ctgctgcaat ggagccacct cctctcaacg cgcagctgcc gatggatatg tcgctttctg 300gaggataaat acttcgctat gttaagtgga tatttggaac tagttggcgg cgtcaagatt 360atcatcactg gagacgaaga gctgcagttc gcacaccacg agcacgtgct cttgatctgc 420aatcatcgca gtgaagtcga ctggatcttc ttctggaatc tggcgctgcg tctcaatgtt 480catgaccgta ttcgagtcat gatgaagagt gtcattcgat acgcccctgg cgtcggctgg 540accatgatgc tgctgcgata cccgtacgtt aaccggaact gggccacgga ccaggacaga 600ttgaccaagg tgattgagtc gtacaaggac gtggacatgg gcacgtggct agccatgttt 660ccggaaggaa cggcgttgta tgacaagacg ctcaagaaaa gccacgagtt tgctagcaag 720caaggagaag cgaaatggaa ctacgtgttg cagcccagag tcaagggctt tgagctgtgt 780atggacaaga tggacccgga ctatgtcgtg gacctcacgg tggcgtatcc ggagctcatg 840gagggcgtga gaccgtcacc ggtgcgattt gtgagaggac agttcccgac tgaagtacac 900atgcacgtgc agcggtatca ccggtcaacg ctgctgaagc acaaggaccg catgggtcaa 960tggctgaaag atcgatttgc agaaaaagag gagcgtcttg aacatttcta cgagactggc 1020gcgtttcaag gcgaacagca gacgagcggc cagcatgcga gccgtgtcgc tctgttgccc 1080gcgcaacaga ttctcctctt cgttggtgaa aactacctca cttacttttg gtcgagaaga 1140cgcctgtctg tatacctgcg tgctttccag gttgctggtg cgtccatcca ctcgatggat 1200agccacaaga ttcacaacga gaagcaccaa gacaaacttc atactcgatc ggcagatgag 1260ttgcgcctct tcacgtga 12781111173DNAPhythophtora infestance 111atggcggtgt tccacctgta ctcggcgctg aatctgctgt ggatcctatg caacagcgcg 60tgtatcaatt tcctgcaatt ctgtctttgg tgccttgtgc ggccgtttaa caaggcactt 120tatcgccgac ttatgggctc cgtggcacaa tcactctggg tagacgtcac atccacgagc 180ttcccacaga ccaagctctc ggtcactggc gagctgccgt cagaccccac gaagcccgtg 240atcatcatag cgaaccacca agttgacgcg gactggtggt atatttggca ggccgcgcgt 300caccaacacg cagctgggaa catcaagatc gtgctcaaag accaactcaa gtacctgccc 360atcatcggct ggggcatgcg cctctttcag ttcctcttcc tacgacgccg catcgaccag 420gatgcagagc acatcaagaa gtacatgggc ggactcatca gcgataattt ccctttttgg 480ctcgtgttat tccccgaggg aacgaccatc caccgtgaat acgtggtcaa gtcacaggct 540tttgcggctc gagaagctcg tcccaagttc gagcgagtgt tgctgccacg cacgaccggg 600atgcggatca ttctggacgc tgtggcggat gccaaacccg atatttacga cctcactgtg 660gccttcccgt cgtactcggg tgaagtcccg acgttcgaca tgggatatgg acgcagagtt 720gacaccgaag tgccgtcgat gaagtcgcta ctggcaggga agcagcctgt gggccgagtg 780gctttacact caaggaagtt taagtacgag gacgctgcga cagacttgca gggattcttg 840gatgctcgct ggacggagaa ggaggagcgg atgaactatt tcatcaagca tcagcagttc 900ccggaaacgg agagcacagt ggagatgcaa ctatcgacct cgatgggagc agttttccgg 960ctgtggatgg gcatcttgct gtcgtgtgtt gtgcttcccg tcgtcatgat gctcttcttc 1020ccattgtact tcacgtgggt cgtctactgc ttcgtgtact cggtgtacga ccgcaccacg 1080aacttctggt ggccgtacat tttcaatctc ttcgtggagc gcgccactaa gacgcacgaa 1140cactttaagc gtcaccaggc taagtatctg tga 11731121110DNAPhythophtora infestance 112atgggcgtgg ctgttgtggg cgtcgtgttc ctgacgtcgc tagtggtcac gggttggaca 60ggtgtggcct ggatattgac cccatgtttc ttgctggcgg ctctcccact gccggcgttt 120ctacagacca aacgcttcta tcgccgcgtc actcgcttca tacaatgggc gtggatgggc 180caagtgaaat tgtttggaat ccaggttcga gtgctcggcg atgcggagac gaaagctcgt 240gagagcgaat tatcgaagga tcgagcgcta tggctgtcaa accaccgcac tcgtatcgac 300tggatgctgc tgtggagcgt cgcgtggcgg acgcggacgc tgcatcagtt gcggatcgtc 360ttgaaggccc cattacggaa aatgcccatc ttcgggtggg ccatgcagca cttcatcttc 420atctttctgc aacgccgttg ggctgatgac caagtgaatt tgcgcaagtt gttgccattc 480ctcacgtcga cagaaccgga ggcttcctat ctccttttcc ccgaaggcac cgatctgagc 540gagagtaacc tcgaaaagag tgctgtattt gcagagaaga aaagcctttc acctcgtcag 600tactcgctgt acccacgcac gacgggttgg acatttatgt tcccactgct gcgctcacaa 660cttaccgctg tgtacgatgt caccatgttc tacgtggact atgccgctaa cgaacgtcca

720tcggagtcgt cactgcttac cggtcgtatg ccgcgaatga tccatttcta catcgagcga 780gtggacatct cggttttgcg tgacaaaagt gagactgact tagcggcctg gttggaaaag 840cgcttcgaac gtaaggagtc tttgctcaag gccttttacg aggacaacgg caagcttcct 900catggagccg aacctctctt tcaagagaat caaggtactg cgatggtgat gctggtggcg 960ttttggctca tatccattgg tgctgccaca ctccttggat tgattggcaa cttcatctcg 1020gtcattgctg cgctggcggt tgtagttgga tacgccacca acacggcata tgggcctggc 1080gtggacgggt ttctcataaa caactcgtag 11101131344DNAPhythophtora infestance 113atgggacccc gagtggaacc tccaaacagc gggcgctcgc ccacagcgag caagaggcgc 60atgaagaagt tccgtgacgt tgtgtccccg ttggacccgg cggatgcgcg ctccggtgtg 120cacagctccg agttccgcgg cttgtacaac ctggcgatgc tgtctggggt gctctacgtg 180ttcacgacgc tcttcacgaa cctgctaatg acgaacgaac ccatcgactc gaagcttctg 240ctgtcggtgt tttactcgac gcatttactc gaggtattgg ctacattcgt gtgtcaagct 300ctgtatgcct acacggccct gatcccagtg tacatggcgg gcacggacaa gccgaaccgc 360ctgctcatca acatcgtgca ccacacgctt caaagtctgc tcttcttctt cacaatcgtc 420ttcatcgtct ggcgcgactg gaacctcatc cacgccgtgt cagcgttcat tgaaggtctc 480gtactattga tgaagatgca ctcctacatc cgcaccaagc tggagatctc acgcactgag 540aacaaaccgc ccattcctga catcaaggac tttactatgt atttactgat cccgtcgctg 600gtgtacgaac ctaacttccc acgtacctgt cggattcgct gggcttacct tgctgagaag 660actttctcgg ttatcatggg gatttcgatg ctatacatca tcgtcacgac ccatgtgatg 720cctcgcctgg aggattccgg gactgtgaac cctgtgctat cggtcgtgag tcttctgctc 780cctttcctgg gatgctactt gctcacatgg ttcatcatct ttgagtgcat ctgcaatggc 840ttcgctgaag tgacttactc agccgaccgg gacttttatg gtgactggtg gaacagcaca 900acgttcgacg agtttgcgcg caagtggaac aaaccggtgc atgagtttct actacgacat 960gtatacttgg agacgttgga ctcgtacaag atctcgaaga cttacgccac tatgttcacc 1020ttcttcatgt ctgctgcact ccacgaatgc gtcttcatcc tcatgttccg cacagtcaga 1080atgtacttct ttactcttca gatggtccag ttggttacca tcgtgtacgg acgtggcttg 1140cgtggctcgc ggatgggaaa tatcaccttc tggctcggta tgatcctcgg actcccactt 1200caagctgtca tttacagtcg cgaatatcac ggtggtgagc ccatctttat ggtcatcatg 1260atgccagcaa tgatcttcgg gttcggtgga gttctcgttg cttcactgat gcatctaagt 1320cgtttgagga agaaacaagc ctaa 1344114927DNAPhythophtora infestance 114atgacaggcc agcaacacac ttggctgctt ggtgtcggcc tcgcagtggc gacaatctcc 60ctttgcgtcg ccattcatgc aagcgcctta ataacgattg caactgcatg tgtagctgct 120tatctccctt catacttgga cggctcagag tacacggggg agcgctactg gccatggttt 180gccaccttca tcggacacgg catggcgcac attccgggga cgctggaatt cgaggagccc 240attgacgcct ccaagcaaca catcttttgt tcgcatccac atggactgct ttccacccac 300cacggacttc tcatgtctgg gcagactgtt cctccattct acgagacggt accgctgtct 360acacgacgcc acttggctgc gtccgtttgt ttccggatac cattctaccg tgaatatgta 420ctctggtctg gatgtgttga tgcacgccgt agtgtggcgg aaaagatgct tcgaaatggc 480aagagtctgg tgatcttagt cgggggtatt gcggagcaga tgctctctca gcgtggagac 540cacacgatct acgtcaaaaa gcgcaagggg cacattcgct tagcactgaa atacggggta 600cccatcgttc ccggctacgc gtttggagag accgacctgt tcacccactc aagtgtgctg 660ttgtcgttcc gccaaacgat tgcgaagaag ttttctgtgg cgttgctgct tggacgtgga 720tactccaagt ggttgttttg gctacctcat aaaggagtga ccatcaacca ggtctttggc 780aaacccattc cagtcttgaa gaaggacgac ccgagttcgg acgacatcga aaagctgcat 840caccagtacg agcgcgagct agtgcgcatt tttgacaagt acaaggagaa acatggatac 900ggaaactgta cgctgcatgt gcgctag 9271151179DNAPhythophtora infestance 115atgtcggcag cccaagtgct caacaatgct gcttacggcc gcacatcggc gtggcctgat 60tcgaataccc gtccggatct gcagacacta cgaggacgct ttctacgacg acttcatctt 120tcgcttattt atggtctctg ggtgcttggt acgcttttca atgcagcgat gtgggttttc 180tcgctcgtct gtgtagctca gtgggtttgg agtaccctca tcggtgctaa tgaagctccg 240attccacttg ccgtgcaagt atttctaagt ctcgtcgcac tctatgagag ttaccatttc 300gtgactcggc cttcgcatca cccctggcca ttcatgcggc gcttgattcg ctactcgctc 360cttcactacc cgtacttccg cctcaatgcc acggtcttcg acgagcgcga gcgggccaag 420caattaagtc aagatggtgc taccaatgac actagcgctt tcaacacgga gatcgctagc 480aagaccatcg tggagaacga tatttctcca tttgtgaaac ccaacgagag cgccatgttt 540gcttttcatc cgcacagcgt tctctccaat ggctgggtag ccaatggcgc gaatcacatg 600agtttcgaac aagctgactg tcgatggctc gtagctgaaa atctctttgg ggtccccctc 660atgagagact tgctaaactg gatggacttt agtagcgttg ccaagtcaac gttccaacag 720cgtatgtctg cccgtcaaaa tgtgtgtttg atccctggtg gcttcgaaga agcaacactc 780tacgaacgag gcaaacatcg tgtgtacatc aagaaacgct ttggcttcat caagctggct 840ttgcagtatg ggtacaaggt gcacccagtg tacacgttcg gggaggagta cgcttatcac 900acctttcctt atctgctcaa gttgcgtctc aagctgaacg agttcaagat tcctggagta 960tttttcttcg gtcttccgca ttgtttcttt ctgcctcgca ccgacgtgga ccttatcact 1020gtcgttggag aacccttggt cctaccgcgt atcgaacaac cgaccaagga agacgtgcag 1080aaatatcaag gtcagtacgt cgaggctctg caaaagctgt tcaacaagta caagtctgtg 1140tacgccgtcg atccgcaagc gcagttggaa atatactaa 11791161146DNAPhythophtora infestance 116atggcgaagc tcacgaatgc ggcttgcggt cgcacatctg cgtggccgga ctttgatact 60cgcccagagt tgcgaacgct acgagggcga ttcatgcgac gcttcgatct cttcattctc 120tacggtctct gggtcgtcgg cctcctgttt ctcgcagtaa tgtgggtctt ctcactcttc 180tgtttggtgc aatggagttg gagacgagct acacacgacc atgctcctcc gatggcattt 240tcagcccaga tatacctggg tttcatcgtg ctgcacgaaa gctaccacta cctcacaaaa 300ccttcgttgc atcagtggcc atttatgaga cgtttttttc gacaagtttt tcttcattac 360ccatacttcc gcctcaacgt cttggttttt gaagagcgtt cgaaaacttc aagtgaaaat 420ggcaaatgca acaaagaaat tgccagcaag gccgttgaag agaacaatct gtcgccattc 480gtgacccccg atgatcgcgc tctatttgcc ttccatccgc acggtgtcct ctccagtgga 540ttcgccttca acggcgcgca ccacatggga ttcttgcatg cccattgtcg ctggctcgta 600tcggagaatc tcttctggtt ccccgtcatg cgcgacctgt tgaactggat ggacttcagt 660tgcgtatctc gatcgacttt ccatcgtttc atggccacag gtcaaaatgt gtgtttgatc 720cctggcggct tcgaagacgc aacactctac gaacgaggca aacatcgtgt gtacatcaag 780aaacgctttg gctttatcaa gttggctttg cagtatgggt acaaggtgca cccagtgtac 840acgttcgggg aggagtacgc ttatcacacc tttccttatc tgctcaagtt gcgtctcaag 900ctgaacgagt tcaagattcc tggagtcttt ttcttcggtc ttccgcattg tttctttctg 960cctcgcaccg acgtggacct tatcactgtc gttggagaac ccttggtcct gccgcgtatc 1020gaacaaccga ccaaggaaga cgtgcagaaa taccatggtc agtacgtcga ggctctgcaa 1080aagctgttca acaagtacaa gtctgtgtac gcagtcgacc cagacgctga acttgaatta 1140tactga 1146117852DNAPhythophtora infestance 117atggaggctt tcgtcccagt gctgctcctc actatcacag cttacatgta cgagttcacg 60tatcgcggac acccgcacca aacgggctgt agagagcgtc ttgattggat atatggtcac 120agctttctca ttgagaccgt caagcggtac tttagcgaaa agataattcg catggcaccc 180ctggatccca agaagcaata tgtactgggc tttcatccac acggcatcac accgacctca 240gttatgtggc tccagttcag cgcagaatgg cgaaggttgt tcccgaactt ctacgcgcac 300attttaactg ccggcattat gcatgcactg ccacttgctc gggacatcct tcagttcttg 360gggtcacgag aagttacccg acaagccttc acatatactc ttcagcacaa cgagagtgtg 420ttgctggtgc cgggtggcca agccgagatg ttagagcagc gatctggtca gaaggaggtt 480cgggtgtaca cacatcacaa aggtttcatc cgcctcgcaa tcgagcatgg agtaccgttg 540gtccccgtcc tcagcttcaa cgagggcgag atgctggaca acatccaggc tcccatgctc 600cagcgctggt tcgttataaa gctcgcgttc ccattcccat ttttccccta cggtcgtgca 660ttgctgccga tcccgcgcaa agtacaaatt cctatcgtgg tgggagcacc tctggaggtg 720ccacacatga agaaacccag ccatgaagat atcgataaag tccacgccag atactttgat 780gagcttcgtg acatgttcgc aaagtacaag gatgaagctg gatgcggcga ctacaagctc 840atttacgtct ga 8521181050DNAPhythophtora infestance 118atggcgagcg aaactcaggc tgatcctgtc cagacagaca agggcctctt tgtctatgag 60cctcttggat tcttcgcgga tgatagcaaa gtacccaagt ggatgcagct cctaattact 120gacgtgttta gcttcgtgac tacgcactac ttcgtgtgga gcttgccatt cctcgcgctg 180ttctgctacc tacaccagca cgaactcgac tacgtatcgg tcgctatgat tgctctgtat 240ctgccctcat tcttcagtgg ggcgcagaag acagggaagg gcaacgagtg ggaagccgcg 300cggacgtcga gtttatgggg cctcatgaac aaatttcttc gcgtcaagat tattcgggag 360caagagctgg atccgaagaa gaagttcatt ttcggattcc accctcacgg aatcctcgta 420ctctctcgaa tcgcaggctt cggtcgaaac ttcattgacg tgtgtccggg catcacgact 480cggttccttg gagcctcggc aatgtattat attccgctag gacgtgaaat gtgtctgtgg 540atgggtggag tcgatgcctc acgctccaca ggtgaaaagg tgctgaaaga aggcaacagc 600atcatcgtct accctggcgg cgtacccgag attttcctca cggatccgaa tttaaaggag 660acccagctcg tgctgaaaaa gcgtctcggg tttatcaagc tcgccatgcg tcagggcgca 720cagctcgtcc cgacgttcgt ctttggtgaa aagtggctgt acaacatgtg gaccccgccc 780gaaagtgtga ctaacttttt ccgcaagaca ctcggcatcc ctgttctggt cttctggggg 840aaattctggt ggatgcccaa ggctccaggc gaaggaaaac gctacggact tgtgtacggg 900aagcctattg cgacgaagca cgattcaaac ccgagcgacg aagaaatccg tgctgttcat 960gccgaatacg ttagcgaaat cgagcgcatc ttcagccagt acaaatcgga attcggctac 1020gacgaggacg agacgctggc catcatttag 10501191212DNAPhythophtora infestance 119atgccgcaag cttgtggacg gacgtctgcg tggctggaca atgacgcgcg tccagagcta 60cagacgctac atggacgcat tcttcggttt gtgctgctgt ggtacctgtt cggactgtgg 120attgtcgggc tggcatcgtt cataggtatg tggctcttct cggggctctg cacgatacgg 180tcgttgttga gtttcctaca caatggaggc agttggactg cagccacgcc gctacctgtt 240cttgtccaag tgtatctggt tggtatgatc gcgtacgaaa gttatcatta tgtgacgcgg 300aacgcgctgc atgaatggcc gctaattcga cgcgtggtgc gctacgtgtt cctgcattac 360ccgtattttc gactgaacgc tgtggttttc gaagagcgag aggatgcgaa gcagaacgtc 420gagatccaag agccagagca ggagaaggat ggcaacgata gcactaccaa caagagcgac 480gacgctagat acttcagctc gaaggctgca gctgcagcta tcgaagaaaa cgatgtgacc 540ccgtacgtcg agccggacaa gcgcgcgtta tttactttcc acccacacgg agtactgacc 600tgcgggttct cgttcaacgg tgctcatcac atggccttcc agcgtgcggc gtgccgctgg 660atctcggctg agaacctctt ctacttcccg ataatgcgtg acattttgca ttggatggag 720ttcagcagta gcaccaaaac cagcatggag aacaccatgc gtacaggtca gaacttatgt 780ctactgcccg gaggcttcga agaagctacg ctctatcagc gaggcaagca ccgcgtgtac 840attcagaagc gcttcggatt catcaaactg gcgcttcagc atggctacga catctacccg 900gcgtacacat tcggcgaaga gtacacctat cacgcgtttc cttatctgca gtggctacgc 960ttgcaattga accggttccg aatcccgggc gttatcttct tcgggattcc gttctgcttc 1020ttcatgccac gctcggacgt ggacctcatt accgtcatcg gtaagccgct gcgccttcca 1080cacattgaca acccgagcag agatgaggtg aaggagaacc acgacaagta cgtcgaggct 1140ctgcgtgacc tatttgacag gtacaaatgt gtctacgctg ctgaccctga cgccgaatta 1200gaaattttct ga 12121201221DNAPhythophtora infestance 120atggtcggcg ttgcgcacgc tgctacaggg cgcacgccct tgtggcccaa caataatgct 60gttcctgagc tgcagacgct gcgcggatac gtggggcggc gcttcttgct gtggtcgctc 120ttcggtctct ggatctttgg actcggggca tacatcctta tgtggctgta ctccggctgg 180tgcgttggtc actgggcttg gacagcgctg caaaccaaaa gttgggcgct tgcaacacca 240ccgccaatta gtgtgcaggt atatctagcg ttcacggcgc tgtacgagag ctaccactac 300atcacgcgcg attcgctgca tttgtggccg cgcatgaggc gtctggcgcg gcacatcctg 360ctgcgctacc cgtacttccg tctgaacgtg accattttcg aggaacgcga gcttgagaaa 420caaaagcagc ggctaaagga cgagcagacc aacaacagcg acgacgccac agtagacacg 480gagcaggatg aaagtgaaca cctcagtccc gctgcagcta tcaaggctgt tgaagagaac 540gatatctcac cgtatgtgga gacaggaacc aagaacctgt tcgctttcca tccgcatgga 600atactgacct gtggcttctc tttcaacggc gcatatcaca tgagcttcga gcgctctgcg 660tgtcgatggc tgtcggctga gaacctcttc tggttccctc tcgtccgtga ccttctcaac 720tggatggagt acagcagctg cgcgaaagcc aacatgctca agttcatgcg cagagatcaa 780aacgtcagca tcattcctgg cggctttgaa gaagccacac tctaccagag aggcaaacat 840cgcttgtatc ttaaaaagcg cttcgggttc atcaaaattg cattgcaaca tggctacaat 900gtccatccag tatacacttt cggcgaggaa tacacgtacc acgcgttccc gtacctgcag 960tcgctgcggc tgcaattgaa ccgacttcag attcctggca caatcttctt cggagaggcc 1020tcgtgctttt acttgccacg caacgatatc gacctcatca ctgtcgttgg caagtctctg 1080cgattcccac gaatcgagca cccatcgaag gaagatgtac aaaagtatca agcgcagtac 1140atagaggcgc tgaggagtct attcgacagc tacaagggcg tgtacgctgt tgatcccaac 1200gccaccctgg agatttttta a 12211211551DNAPhythophtora infestance 121atggacgtgg agaacagtct tttgacgcgg ctagcggcca acgggccgac aatgagcgac 60gctcccatgc ttctgatggc tgtggtgctg gtgctggcgc tatctggcgt tgtgtccacc 120gtctcgcagc agcgtcaaaa gcccagcgag gacgagacgc tgcagggccg taagctcacg 180cgtaagctta gcagcatggg gctatcgacg ttggtgacag agacacctac aaacttgtcc 240atcccagtgt ctgtattaac tgtcgaaggt catctggcta aggaagacta cgtcgagcgc 300ctacgtgcgc gtatactaca cgacgccttc ttcctacgct ggcgcagcgt cgtacgtggt 360gactacaaga caggcgtcta caagtatgtg gaagttcctg gctacgacgt ggcacagaac 420gtggtggagc acacagttga agagggagag accacgatgt cgtacgttga gtcggcgtta 480gtaaacaccc cgctggactt tgacaagccg ctctgggaga tgcatgtgat ccacgacccc 540aagggcaatc ctggtaacac tagcgtcggc tggaaagtgc atcattgtct cggtgacggt 600gcttcgctgg ctacagccat ggccaagctc agtgaccaga gtgagctctt cgacgccatg 660gtcgagaagc gcctacaagc caagaagagc ccaaagaccc ccaagccacg caaacccgtg 720actcagatca ttaaagacat tttggtcttc ctgtacgtct gcatctggtc ggtctacgtg 780atctcctatc acatgttcgc actcgtgact cgtcgtgaac cggccaccgt ctttaaacgt 840cccggcggca agcaaaaacg tctgtcgtac aacatgatct actctgtgaa tgccactaag 900gccgtaggta aacacttccg cgccacagtg aacgacgtga tgcttaatgt cgtagctggt 960gccatgcgga agaccatgtt gtctgtgggc gagtctgtgg ctccaacact caaggtacgc 1020tgcgctatcc cagtggacat gcgctccagt acagaagtga tccgccacac tagcaaccgc 1080ttctcctctc tcgtcattga cctgcccatc ggcgttgagg actctgctca gcgtctgctc 1140caagtcacgg ctgctatgaa cgatgccaag aattcacttg agaagttctt cgtgtactgg 1200tcgacccacc tcgtgtcgat gttgccagcg ccgcttatgc gcttgatcgt acactttact 1260accagtcgta tctctgtggc aacgagcaat gtgcgtgcta gtgtcgtgga agtgagtcta 1320tgcaagagtc cagtgtcggg cttctacggg ttcgtgcctc caccgccata tgtgaacctt 1380ggagtagcca tcttgtcaat gggcgatgat ctcggtctta acgttcttgt ggacccatgt 1440gtcggtgtca acgcgaagca attcctggag tttgcgaagg aagagttcac tgcactgcaa 1500gaatcggtcg ctgctatgga ggcaaatgcc ggtgacaaga agacaaaata a 15511222028DNAPhythophtora infestance 122atgacactgg acgacgattc ctcagcctcg ggcgtgcgcc agcgcaagcc acacggcggc 60acctccagtg acaggccatc atcccccgag gccttggcgg aggaggccgt cgcttcggcc 120ttctcggccc ccaaggatga gcagtctcga accaaggaaa cgtttcaaca tgccgctcgc 180tcgctcggcc ggacacaaag ttggcacgcg cgggcggccg accacgtggc caggaagcgc 240atctactcca tcatggccgg cgtcattatt ggtgtcgcgg ccgttatcaa ttttcagaga 300ttttacctgg agaagcctct gatcagcgaa gactcattgc tcatggtccg ggagatgttt 360gacaacttta actggtccgt gaacgttaag gaagagctca tggctgcctt cgataaccgg 420ccacctctta tgggtgcagc cgagattcgg cccggtgtcc agttgttcca agagaacgtg 480acggccaact cgcctgttgt attggtgccc ggcttcacat ctacgggcct cgagatctgg 540aacggtagcg aatgcagcaa ggcctatttc agacaacgta tgtggggcac atccaggatg 600ttgcagcagt ttatgatgaa ccaaaagtgc tggttagagc acatgatgct caaccggtcg 660tcaggtatgg acccggacgg catcaagtta cgcgcggcca aaggcttaga agcggccgac 720tatttgatcg gcggcttctg ggtctgggga aagatggtgg agaacttggc cgagatcgga 780tacgacagca acaatctgta catggccgcg tacgactgga ggctcatgcc gcatcttttg 840gagaagcgcg acgggtattt tacgaaactc aaatacacta tcgagatggc gcgaatgtcg 900gccggcggcc acaaggtgat gctggtcacg cactcgtatg ctacgcaagt gtttttccac 960tttttgaagt gggtagagag tgagaacgga ggcaaaggtg gcgaccagtg ggtggagacc 1020aaccttgagt ccttcgttaa tattgccggc ccgaccttgg gcgtggtcaa gacgatcagt 1080gcgttgatgt cgggcgagat gaaggatacg gccgagctgg gcgggctgtc caagttcctc 1140ggctactttt tcagtgtgtc ggcgcgtacg caactggccc gctcgtggtc gagtgtgttc 1200tcgatgatgc ctatcggtgg tgaccgtatc tggggcacgg ccgactcggc ccccgacgat 1260gtggtagcgg cctccccgtt atcgaccgga aagaactcga cgatcgaccc aaggaaggtc 1320aaagagcacg tggcacgcta cggatcgaat ggccacgtcg ttcggttcgt caatacttca 1380cacgagaacg tcactatcgg aggcgtacag aagatgctgg gcaaattaga cccgtacctt 1440gaccagttcc gttcgtggct gagtaccggt attgccgaag atctgtcctt gcctgaatac 1500gatcaatcca agtactggac gaacccgttg gaggctgctc tacccaaagc tccgagcctc 1560aatgtgttct gcttttacgg tgtcggcaaa cctgttgagc gaggatacac gtacggagac 1620aacccgcccg atgaagataa cgcgacagtg aacggcaaac gtgttgctcc gtacgtgttc 1680aacacggata ccgacgatct tccgtacatc aagggtgggc tcagatactc ggacggagac 1740ggcacggtgc cgctgatctc tctgggcctc atgtgtgcca gtggctggcg gacgaagaag 1800ttcaaccccg gcaacgtcga cgtacgtgtt cgtgaatacc gacacaaccc cgtgtccatg 1860ctgttcgacg cgcgtggcgg acctgagacg gccgatcacg tcgacatcat gggcaaccac 1920ggtctcatcc gggacgttct actcgtcgcc gctagggcgt acgaccgcgt gcctgaaaac 1980attacgtcca gcatcatgga gattgccgaa cgtgtcggag agctctaa 20281232187DNAPhythophtora infestance 123atgaagttcg acgacaagaa ggtgctcaat gacacatgga cgcagttcct ggcgctgtgt 60ctgctgctca tgctggctgt cgactcgctc aaccccatca aggctgtaag taagtttcta 120ggcgttccgt cgtattactg gggcgctctg tccgtgggta ttatgctagg gctgctgttc 180cacaacgccg ccgacgtcat ctaccgttcc acacgcgtct tcctcaacag tatcctcagt 240atctcattta agagtgtgga tctcatcggt ctggataacg taccgaccga cgggcccgtc 300atcttcaccg gtaaccacgc caaccagttc gtagacggtc ttgtagtcat gatgactagt 360cctcgtaaag taggcttcat gatcgcagaa aagtcgtggc atttgcctgt cgtgggccac 420ttggctcgta tcatgggctg catcccggtg gtgcgtcctc aggactctgt agcttctggt 480gttggcagca tgaagctcgc cagtgaagat cccgtgactg tagctagctc gtccagtggt 540ggcgctagca gtagtacgcc tcagtggctc gtgcagggcg acggcaccag tttcactaag 600caggtgacgc ctggagacca gatccgcttc caagggcaga gcgtcaagga ctcggggtcg 660cctgtgaaga tcgtacaggt tctagacgac acgcagttgc tactgaacgc gccgttgaag 720agcggcgaag gcaaattagt gcttgagagt gcaccgtttg gtattctcaa gcgtgtggac 780caatccgtga cgtttgccaa ggtgtacacg cacttgaagc gtgggaactg catcggtatc 840ttcccggaag gaggctcaca cgaccgtacg gacttgttac cactaaaagc tggtgttgcc 900gtcatggctc ttggagttaa ggacaagtac aacatcaacg tgccggtggt gcctgtgggc 960ttgaactact tccgtggcca tcgcttccgt ggccgcgtga cggtggaatt cggcactccg 1020atcactgtgg accaagcgtt gatggccaag taccaggaag acaagcgtac agcgtgtaac 1080acgctcttac atcgtgtgga ggagagtatg cgctccgtga tcgtgactac gcccagctac 1140ggcgtcatgc aggaggtgtt gactgcgcgt cgtctcttcc agcgctctgg agtgcggctg 1200tcggcaaaag agacacaaga cttgaaccgc cgctttgcag aaggctacaa ggtgttgcag 1260gatgtgccag aagcccaaga agatctcgta atcttgcaac ataagctgga taactactac 1320aagacgctgc agaagatggg actcaaggac catcaagtgc cgtatatccc gtggtggaca 1380attcacgacg tgttgggctc cgcactgtac ggcacgttga tccttctact gtcctccatt 1440ccgtcgttca tcctgaatgc accggtgggg

cttctagctc gttatgtggc gaattcagcg 1500cagaagaagg cgctggaagg ctccaaggtc aaggtgttgg ctcgcgacgt tattcttagc 1560aagaagatcc agttctcgat tgtagctgtg cccgtgctgt ggttcattta ttttacgatc 1620gccgcggtgt tcacggattg gtactggtcg tcaatcatgc tgctgatggt gtcgttcccg 1680ctattttctt tcttcggtgt acgctcggta gaggctggaa tgatcgagct gaagacggtc 1740cgtccgttgt tctaccgtct gctaccgacg tacaaggcta cacaggatga gcttcctcgg 1800caacgtgctg agttgcagaa ggaagtgcgt gagtttgtga agaaatactc gcagtatctg 1860ggaaaactgg ccgagccaaa gaagctcgac tggagcgagt acatgcacga gcgctcgttg 1920gtattggctg agaagactga gcaggccgag tcgatcccgt cgcctcctcc ggtacatgag 1980gaggacgagg agccgcggga aggcgaggct gaagatgata tcggctctcc tgtgcctacg 2040atcaccaagt tccacgacat cagtatcctg ggcaagtcgg agaactcggt gctggactta 2100gcaggtctcg aacgctccat gtcttgcccg ccaggatacc aagagctagc ggaggagata 2160gccaagcaac gtaaagggtc cgtgtag 21871241533DNAPhythophtora infestance 124atgctgtcta cgctactatg gcttgcgctg gccgtcgtgg tccttgctac acagggctac 60aagatggtgg cgcgcttcct gcgactattg ctacacactt acttccgcaa aatcgtggtt 120tacggactca acaacttccc gcgtgagggg cctgtgatcc tgtgcccgaa ccaccccaac 180atgcttgtgg acgccattct cgtcatgacc gaggccgtaa gtcacggtcg caatccgtac 240gtatgggcca agggttcgct gttcagcaac cctgtcgccg ccttcttcct caagaaattc 300ggcgccgtgc cggtctatcg tccgcggcgc aaagaggaca gtctcgccga cgtggactca 360gataagactc ccgagcaact ggaggcggcc aaccgcaaaa tgttcgagca tacgtggcat 420gtacttgctg ggggcaacgt catggtgctt ttccctgaag gaacatcgta cacggctcca 480aagatgctgt cactgcgtac gggtgttgtg cgtgtcgcga cgggtttcgc taagcattat 540gaccaaccta tcccgatcat cccgctaggt ctcaactact tcaacaaaga ccacttcagg 600agccagatga cgctggaatt cggtccaccg atggtgatca cgcccgacat ggtgcaaact 660gaagctttcc aacaggacga acatggcgag gtgaagcgtc tgaccctgga gctagaggag 720cgcatgcacg atgtgacttt gaatgcatct gacttcagca ctatccacgc tgcgcgaatg 780atgcgacgcc tctatctaaa cactcctggc cccattgaca ccaacaaaga agtccgtttg 840acacagtaca ttatcaatat gctggagaag gagccccaag acgacgagca aaaggagcga 900atcgctacga tccgtgaaaa agttcttcga tacaaagagc aattggaaaa gctgcggttg 960aaagaccaag aggtgaattt gccgatgccc aaagagaaat cgcttttgca actgtttttg 1020gagcggattc tgtacctgct tgtgctgctg ccactggcca cgcccgggct tttgttgaat 1080ttaccctact attttattgg aacgaagatg aacagcctcg caggattcgt ggaatccaag 1140tcgatgttca agatcttcgc tgctgctgtg ttggtgcctg tacattggct cgtactgatc 1200cttgcaactt ggtatttcct cggatcatcg tatgcgtatg tgctggctgt tggtttgccg 1260ctgctgctgt actcgcacat ccgcgtactg gaagagagcc gctccatcgc cgagaacgtg 1320tatttcctct tcaacatcac agctcacgcc gataaggtgg cggtgcttcg aacggaacgg 1380gagctgctag cgcaagaagt ccacgagctt gtgactaagt acgtcgatgc caagtttctc 1440tcagccatac acaagtctct agcgagctcg cccgtgaaca gacgattgcg ccaccgtgcc 1500tcctccacca gcgacacact gcttactaca tag 1533125520PRTPhythophtora infestance 125Met Asn Cys Gln Arg His Pro Thr His Val Ala His Asp Ile Thr Phe1 5 10 15Gly Ser Ile Leu Ala Ile Leu Ala Ala Gln Pro Pro Ile Pro Val Ser 20 25 30Ala Ser His Leu Ala Leu Met Ala Ser His Val Val Ser Ser Leu Ser 35 40 45Asn Ala Ala Thr Pro Leu Arg Phe Thr Leu Leu Asn Gln Gln Leu Thr 50 55 60Gln Leu Ser Glu Leu Val Gly Val Pro Val Asp Gln Leu Arg Cys Val65 70 75 80Ala Cys Leu Leu Ala Val Tyr Pro Leu Ala Leu Ile Val Arg Lys Leu 85 90 95Pro Ser Val Thr Ala Lys His Trp Leu His Ile Cys Ala Gly Val Ser 100 105 110Ile Ala Gln Phe Val Tyr Gly Thr Gly Trp Leu His Ser Leu Leu Ser 115 120 125Ser Leu Val Thr Tyr Ala Leu Val Cys Val Leu Pro Pro Lys Arg Ala 130 135 140Pro Phe Val Val Phe Leu Ala Asn Met Leu Phe Val Ala Ala Leu His145 150 155 160Ile His Arg Met Arg Val Asn Tyr Met Gly Trp Ser Met Asp Ser Thr 165 170 175Ala Ser Gln Met Leu Leu Leu Ile Lys Leu Thr Ser Phe Ala Phe Asn 180 185 190Tyr His Asp Gly Val Val Pro Ser Ala Thr Ala Val Gln Asn Gly Asp 195 200 205Ser Glu His Thr Lys Arg Val Lys Gln Leu Arg Lys Gln Leu Ala Ile 210 215 220Pro Gln Ile Pro Ser Leu Leu Glu Phe Leu Gly Phe Val Tyr Cys Phe225 230 235 240Thr Thr Phe Leu Ala Gly Pro Ala Phe Glu Tyr Lys Glu Tyr Ser Asp 245 250 255Ala Ile His Gln Ala Arg Phe Val Asp Asn Asn Gly Val Arg Arg Asn 260 265 270Val Ser Pro Ala Arg Ala Ala Met Ser Lys Leu Val Leu Gly Leu Gly 275 280 285Leu Met Gly Leu Leu Val Gln Phe Gly Ala Leu Ala Asp Leu Asn Gln 290 295 300Ile Leu Asn Asp Glu Asn Gln Ser Met Leu Met Lys Trp Gly Arg Leu305 310 315 320Phe Val Ala Leu Phe Leu Thr Arg Ala Lys Tyr Tyr Val Ala Trp Lys 325 330 335Leu Ala Glu Gly Ala Thr Val Leu Thr Gly Thr Gly Phe Glu Gly Phe 340 345 350Asp Glu Gln Asn Asn Pro Lys Gly Trp Asp Gly Val Ser Asn Val Asp 355 360 365Ile Leu Gly Phe Glu Leu Gly Ala Asn Val Arg Glu Ile Ser Arg Ala 370 375 380Trp Asn Lys Gly Thr Gln Asn Trp Leu Glu Arg Tyr Val Tyr Thr Arg385 390 395 400Thr Gly Asn Ser Leu Leu Ala Thr Tyr Ser Val Ser Ala Leu Trp His 405 410 415Gly Phe Tyr Pro Gly Tyr Tyr Leu Phe Phe Leu Thr Val Pro Leu Ala 420 425 430Thr Ser Val Asn Arg Leu Ala Arg Arg His Val Arg Pro Tyr Val Val 435 440 445Asp Ser Pro Leu Lys Pro Leu Tyr Asp Leu Val Gly Met Ile Cys Thr 450 455 460Ala Leu Val Val Asn Tyr Leu Ala Val Ser Phe Val Val Leu Ser Trp465 470 475 480Glu Asp Ala Val Ala Gly Phe Arg Ser Met Arg Phe Thr Gly His Val 485 490 495Gly Leu Val Gly Cys Tyr Leu Leu Leu Thr Phe Val Pro Ile Lys Lys 500 505 510Thr Ala Asn Ser Lys Lys Thr Leu 515 520126456PRTPhythophtora infestance 126Met Asp Arg Val Val Asp Phe Val Glu His Leu Gln Pro Tyr Thr Glu1 5 10 15Leu Ala Thr Pro Leu Asp Phe Ser Phe Leu His Ala Lys Val Asp Glu 20 25 30Leu Ser Val Ser Leu Gly Leu Gly Ser Asp Gln Leu Cys Tyr Val Leu 35 40 45Cys Leu Phe Ala Ala Tyr Pro Leu Ala Val Val Tyr Lys Leu Leu Pro 50 55 60Gly Ala Ser Leu Lys His Val Phe Asp Val Val Leu Gly Val Ser Ile65 70 75 80Ala Gln Phe Val Leu Gly Ser Gly Trp Val His Ser Phe Ile Ser Ser 85 90 95Phe Leu Thr Tyr Leu Ile Val Lys Phe Gly Pro Ser Lys His Ala Pro 100 105 110Gly Ile Val Phe Leu Phe Asn Met Leu Tyr Met Ser Ala Ser His Ile 115 120 125Tyr Arg Leu Tyr Val Asp Tyr Met Gly Trp Thr Leu Asp Phe Thr Gly 130 135 140Pro Gln Met Leu Leu Val Ile Lys Leu Thr Ser Phe Ala Tyr Asn Tyr145 150 155 160Tyr Asp Gly Val Val Asp Lys Thr Phe Glu Lys Lys Gly Ala Glu Met 165 170 175Ser Pro Gly Ile Lys Lys Val Tyr Glu Gly Arg Gln Lys Leu Ala Ile 180 185 190Gln Glu Ile Pro Ser Leu Leu Glu Phe Phe Gly Tyr Val Tyr Ser Phe 195 200 205Thr Thr Phe Leu Ala Gly Pro Ala Phe Glu Ile Arg Glu Tyr Leu Asp 210 215 220Val Thr Ser Gly Lys Lys Phe Leu Met Asp Gly Lys Asn Lys Glu Pro225 230 235 240Ser Ser Val Leu Ala Ala Phe Ser Lys Phe Leu Val Gly Ser Leu Leu 245 250 255Met Ala Ala Phe Ala Val Tyr Gly Pro Met Tyr Pro Leu Ser Asn Leu 260 265 270His Asp Pro Lys Ile Ala Ala Gln Pro Leu Leu Tyr Gln Ile Arg Asp 275 280 285Leu Tyr Ile Ala Leu Ile Phe Cys Lys Ala Lys Tyr Tyr Ser Ala Trp 290 295 300Lys Ile Ala Glu Gly Ala Thr Val Leu Cys Gly Phe Gly Phe Glu Gly305 310 315 320Phe Asn Lys Asp Gly Thr Ser Arg Gly Trp Asn Gly Val Ser Asn Met 325 330 335Asp Ile Leu Gly Phe Glu Phe Ser Gln Ser Ile Arg Ala Ala Ser Arg 340 345 350Ala Trp Asn Lys Gly Thr Gln Asn Trp Leu Glu Arg Tyr Val Tyr Thr 355 360 365Arg Thr Gly Asn Ser Leu Met Ala Thr Tyr Phe Ile Ser Ala Phe Trp 370 375 380His Gly Phe Tyr Pro Gly Tyr Tyr Ile Phe Phe Met Ser Leu Pro Leu385 390 395 400Ala Thr Ala Val Asn Arg Leu Ala Phe Lys Arg Leu Arg Pro Arg Phe 405 410 415Ile Glu Ala Asp Gly Ser Phe Gly Ala Lys Lys Lys Ile Tyr Asp Val 420 425 430Leu Ser Tyr Leu Leu Thr Leu Phe Ala Met His Tyr Phe Val Met Pro 435 440 445Phe Gln Val Leu Asn Lys Tyr Leu 450 455127485PRTPhythophtora infestance 127Met Arg Val Thr Arg Arg Ile Arg Arg Leu Ala Glu Ala Trp Ile Val1 5 10 15Phe Arg Tyr Arg Ala Ala Glu Gln Ser Met Glu Ile Leu Arg Gly Pro 20 25 30Val Asp Gly Ile Ala Leu Ser Glu Asn Phe Pro Val Asp Gly Phe Arg 35 40 45Leu Met Val Ala Leu Ala Gly Cys Ser Leu Ile Ala Pro Leu Ile His 50 55 60Leu Thr Arg Gly Glu Thr Ser Arg His Leu Phe Asn Val Ala Val Gly65 70 75 80Leu Phe Ala Gly Val Phe Val Phe Asp Leu Ala Val Leu His Thr Ile 85 90 95Gly Thr Ala Val Val Val Tyr Leu Leu Met Met Val Ala Pro Ser Leu 100 105 110Trp Gly Ala Leu Cys Cys Arg Cys Cys Trp Arg Thr Ser His Tyr Tyr 115 120 125Arg Glu Phe Tyr Ser Pro Asp Ile Val Trp Asp Ser Ala Gln Met Ile 130 135 140Leu Thr Leu Lys Leu Ser Ser Val Ala Ile Asn Tyr Ser Asp Gly Gly145 150 155 160Leu Pro Thr Glu Lys Lys Thr Pro Thr Met Leu Lys Asn Glu Leu Gln 165 170 175Glu Ile Pro Glu Leu Ile Pro Tyr Phe Gly Phe Val Phe Phe Phe Pro 180 185 190Thr Tyr Leu Ala Gly Pro Ala Phe Glu Tyr Lys Asp Tyr Ile Tyr Trp 195 200 205Met Lys Asp Val Arg Val Ala Pro Phe Met Val His Leu Arg Asn Leu 210 215 220Val Ile Ser Ala Ala Gly Phe Phe Val Ser Leu Gln Phe Pro Val Glu225 230 235 240Glu Ile Asp Ser Pro Asp Phe Phe Pro Lys Ser Ser Trp Ala Val Arg 245 250 255Cys Leu Arg Met Cys Ile Pro Val Val Leu Phe Arg Phe Arg Tyr Tyr 260 265 270Leu Ala Trp Ser Leu Ala Glu Ala Ala Ser Ala Ala Ala Gly Val Gly 275 280 285Tyr Val Gln Ala Thr Gly Lys Trp Asn Gly Ile Thr Asn Asn Asp Leu 290 295 300Leu Cys Val Glu Leu Pro Thr Asn Phe Arg Val Ala Ile Asn Ser Trp305 310 315 320Asn Ile Gly Val Ala Arg Trp Ile Asn Thr Tyr Ile Tyr Gln Arg Val 325 330 335Gly Leu Thr Lys Ser Gly Lys Ser Thr Met Leu Ser Thr Met Ala Ser 340 345 350Phe Phe Val Ser Ala Leu Trp His Gly Leu Ser Pro Gly Tyr Tyr Leu 355 360 365Phe Phe Leu Leu Gly Gly Ile Tyr Ile Glu Val Gly Lys Gln Leu Arg 370 375 380Arg Arg Leu Arg Pro Tyr Phe His Tyr Thr Glu Asp Arg Lys Ala His385 390 395 400Ser His Ala Ile Phe Leu Ser Tyr Phe Ser Gly Thr Ser His Pro Leu 405 410 415Ala Phe Leu Tyr Asp Ile Ser Gly Met Phe Phe Thr Trp Val Ala Met 420 425 430Gln Tyr Ala Gly Val Ala Phe Glu Ile Leu Asp Val Arg Arg Cys Leu 435 440 445Ala Ile Trp Ser Ser Trp Tyr Phe Leu Pro His Leu Val Ser Ile Gly 450 455 460Leu Leu Val Phe Phe Asn Leu Phe Pro Gln Arg Arg Ser Thr Pro Thr465 470 475 480Asp Lys Lys Thr Gln 485128558PRTPhythophtora infestance 128Met Ser Thr Thr Ala Leu Leu Gln Ala Ser Thr Ser Pro Pro Pro Ser1 5 10 15Arg Glu Pro Glu Tyr Ala Ala Leu Glu Gln Leu Glu Pro Pro Leu Ser 20 25 30His Ala Ile Asp Met Gly Val Lys Val Ser Pro Ser Glu Ser Ala Ala 35 40 45Ile Ala Gly Gly Val Tyr Val Thr Ala Ser Ser Ser Cys Gly Ala Ser 50 55 60Thr Ile Lys His Asn Pro Phe Thr Tyr Thr Thr Pro Val Asp Thr Tyr65 70 75 80Glu Lys Ala Lys Met Thr Ile Leu Cys Leu Leu Gly Val Pro Phe Ile 85 90 95Arg Phe Val Leu Leu Leu Cys Val Gly Ile Leu Leu Val Ile Val Ser 100 105 110His Leu Ala Leu Ile Gly Tyr Lys Pro Leu Asp Ala His Ser Gly Ala 115 120 125Arg Pro Pro Leu Pro Arg Trp Arg Arg Ile Val Gly Ser Pro Val Pro 130 135 140Tyr Leu Leu Arg Ser Leu Met Leu Ile Val Gly Tyr Tyr Trp Val Pro145 150 155 160Val Lys Tyr Pro Pro Asn Phe Asn Arg His Ala Met Pro Arg Val Ile 165 170 175Val Ser Asn His Leu Thr Phe Phe Asp Gly Leu Tyr Ile Phe Thr Leu 180 185 190Leu Ser Pro Ser Ile Ala Met Lys Thr Asp Val Ala Asn Leu Pro Leu 195 200 205Ile Ser Arg Ile Val Gln Met Ile Gln Pro Ile Leu Ile Asp Arg Gly 210 215 220Thr Pro Glu Gly Arg Arg Arg Ala Met Asn Asp Ile Thr Ser His Val225 230 235 240Ala Asp Pro Ser Lys Pro Pro Leu Leu Val Phe Pro Glu Gly Thr Thr 245 250 255Ser Asn Gln Thr Val Leu Cys Lys Phe Lys Val Gly Ser Phe Val Ser 260 265 270Gly Val Pro Cys Gln Pro Val Val Leu Arg Tyr Pro Tyr Lys His Phe 275 280 285Asp Leu Ser Trp Pro Pro Gly Val Ser Gly Leu Tyr Leu Ala Leu Arg 290 295 300Val Leu Cys Gln Val Tyr Asn Arg Leu Glu Val Glu Ile Leu Pro Ala305 310 315 320Tyr Tyr Pro Ser Glu Arg Glu Arg Lys Asp Pro Gln Leu Tyr Ala Ile 325 330 335Asn Val Arg Glu Val Met Ala Lys Ala Leu Gly Val Pro Thr Thr Asn 340 345 350His Ala Phe Glu Asp Val Ala Met Leu Met Arg Val Gly Asp Tyr Ala 355 360 365Thr Lys His Val Val Pro Leu Thr Asp Val Gly Glu Val Ile Ser Leu 370 375 380Thr Ala Leu Lys Arg Gly Asp Val Asp Arg Leu Val Gly Tyr Phe Arg385 390 395 400Arg His Asp Leu Asp Lys Asp Gly His Leu Ser Met Gln Glu Leu Arg 405 410 415Ala Leu Phe Pro Asn Asp Asp Pro Val Ile Val Asp Gln Leu Phe Asp 420 425 430Leu Val Asp Leu Asp Asp Ser Gly Leu Ile Asp Phe Arg Glu Leu Cys 435 440 445Leu Ala Leu Arg Ala Leu Asn Pro Gln Asn Ile Asn Glu Gly Asp Asp 450 455 460Ala Leu Ala Lys Phe Ala Phe Arg Leu Tyr Asp Leu Asp Asn Asn Gly465 470 475 480Val Ile Asp Ala Ser Glu Leu Glu Gln Leu Leu Arg Phe Gln Arg Asn 485 490 495Phe Tyr Gly Val Ser Glu Ala Ser Val Ala Ala Ala Leu Arg Gln Ala 500 505 510Gln Ala Glu Asn Thr Thr Gly Ile Thr Tyr Asn Arg Phe Glu Gln Leu 515 520 525Val Leu Gln Asn Pro Glu Val Leu Trp Tyr Val Arg Asp Lys Leu Glu 530 535 540Val Leu Arg Gly Ser Met Arg Glu Ser Ser Leu Glu Ile Pro545 550 555129348PRTPhythophtora infestance 129Met Glu Lys Tyr Ser Arg Trp Ser Asp Leu Thr Thr Gly Ile Asn Pro1 5 10 15Phe Val Pro Gln Arg Arg Arg Phe Thr Ser Gly Trp Pro Val Thr Ile 20 25 30Leu Gln Val Ile Ser Gly Ser Ala Leu Ala Leu Val Arg Phe Pro Leu 35 40

45Val Leu Val Ala Phe Val Ala Leu Phe Leu Val Asn Leu Val Val Ser 50 55 60Ile Leu Ala Val Ile Pro Phe Leu Gly Arg Leu Leu Lys Arg Ile Thr65 70 75 80Glu Trp Leu Leu Cys Ser Leu Leu Leu Leu Leu Phe Gly Val Phe Thr 85 90 95Ser Asn Gly Ser Thr Arg Val Gly Ser Gly Asp Val Leu Val Cys Asn 100 105 110Tyr Thr Ser Phe Leu Glu Ile Leu Tyr Leu Ala Thr Arg Phe Ser Pro 115 120 125Val Phe Val Phe Ala Thr Glu Thr Lys Ser Asn Asp Glu Gly Leu Val 130 135 140His Val Cys Gly Leu Leu Glu Ala Leu Tyr Arg Ser Leu Ala Met Pro145 150 155 160Val Ser Val Glu Arg Val Lys Pro Thr Arg Lys Ile Ala Asp Val Val 165 170 175Arg Arg Ala Ala Gly Pro Val Val Val Leu Pro Glu Gly Ala Arg Ser 180 185 190Asn Gly Lys Ala Val Leu Lys Phe Ile Pro Val Leu Gln Asn Leu Pro 195 200 205Val Lys Thr Arg Val His Leu Val Ala Phe Arg Tyr Glu Phe Lys Arg 210 215 220Phe Ser Pro Ser Gln Ser Ala Gly Gly Ala Trp Ser His Leu Phe Trp225 230 235 240Thr Ala Phe His Val Tyr His Thr Met Arg Val Thr Val Leu Ser Ala 245 250 255Lys Asp Leu Asn Leu Asp Asp Leu Thr Pro Thr Lys Leu Pro Ser Asn 260 265 270Lys Ser Ser Lys Lys Gln Glu Asn Ser Lys Thr Leu Ser Thr Asp Gln 275 280 285Val Glu Lys Leu Arg Thr Leu Leu Ala Ala Met Leu Arg Thr Lys Thr 290 295 300Val Asp Leu Gly Pro Glu Asp Ser Val Ser Phe Asn Asn Tyr Trp Lys305 310 315 320His Val Asn Ser Gly Gly Arg Gln Pro Ala Ser Gln Phe Thr Asp Arg 325 330 335Lys Ala Pro His Glu His Ala Gln Trp Ala Lys Arg 340 345130424PRTPhythophtora infestance 130Met Ser Phe Ala Thr Pro Ala Gln Val Leu Gln Asp Val Arg Phe Glu1 5 10 15Glu Arg Phe Ala Glu Ile Glu Ser Arg Leu Pro Ala Thr Leu Ala Leu 20 25 30Ala Lys Glu Gly Ser Leu Ala Lys Arg Asn Gln Thr Lys Arg Lys Leu 35 40 45Tyr His Asp Ser Glu Leu Ile Arg Ile Glu Leu Glu Glu Arg Leu Asn 50 55 60Glu Leu Gly Ile Glu Ser Gln Trp Val Thr Ala Pro Glu Met Lys Glu65 70 75 80Ala Asn Glu Lys Leu Asp Ala Val Arg Lys Gln Leu Lys Leu Asp Val 85 90 95Leu Pro Ala Ser Ser Ser Pro Leu Glu Lys Ile Tyr Met Val Val Arg 100 105 110Met Leu Thr Met Val Leu Val Leu Val Gly Trp Leu Ser Cys Val Thr 115 120 125Val Leu Ile Pro Leu Lys Trp Leu Asn Pro Val Leu Lys Lys Met Gly 130 135 140Val Lys Lys Asn Tyr Leu Pro Met Asp Ile Val Ser Trp Gly Thr Ala145 150 155 160Phe Met Val Cys Val Thr Ala Cys Thr Asp Met Lys Ala Glu Gly Val 165 170 175Glu Asn Leu Leu Asn Leu Lys Asp Ser Val Val Cys Met Phe Ser His 180 185 190Ser Ser Asn Leu Asp Gly Phe Ile Val Asn Gly Ser Ser Pro Ile Ala 195 200 205Phe Lys Phe Ala Ala Lys Lys Ser Ile Phe Leu Val Pro Phe Leu Gly 210 215 220Trp Ser Ser Arg Trp Gly Phe Asp Phe Val Ala Ile Asp Arg Ser His225 230 235 240Arg Lys Ser Ala Leu Lys Ser Leu Lys Glu Leu Ala Val Ser Val Asn 245 250 255Glu His Gly Asn Ser Val Cys Ile Ser Pro Glu Gly Thr Arg Ser Lys 260 265 270Asp Gly Leu Leu Gln Glu Phe Lys Lys Gly Pro Phe Tyr Leu Arg Glu 275 280 285Asp Thr Lys Lys Asn Val Val Pro Ser Ile Val Phe Gly Ala Tyr Glu 290 295 300Leu Trp Pro Pro Gly Arg Leu Phe Ser Ile Pro Gly His Thr Leu Val305 310 315 320Arg Tyr Leu Pro Glu Tyr Lys Ser Asp Pro Asn Leu Asn Arg Asn Gln 325 330 335Asn Arg Leu Ala Leu Arg Arg Ile Tyr Leu Lys Ala Phe Thr Glu Asp 340 345 350Val Pro Asp Tyr Ile Gly Thr Arg Val Ser Thr Asn Phe Ile Leu Lys 355 360 365Asn Met Phe Tyr His Tyr Leu Ala Trp Ala Ile Thr Phe Lys Val Thr 370 375 380Ser Trp Ala Leu Thr Val Ile Ser Leu Val Leu Tyr Trp Leu Asn Ile385 390 395 400Thr Tyr Gly Thr Phe Met Leu Phe Ser Leu Val Met Met Val Ala Gly 405 410 415Glu Ala Leu Met Phe Phe Thr Cys 420131425PRTPhythophtora infestance 131Met Ser Gln Ser Asp Glu Cys Gln Ala Thr Gln Thr Ser Val Tyr Pro1 5 10 15Thr Lys Arg Cys Val Ser Gly Gly Pro Val Val Glu Pro Asp Ala Glu 20 25 30Pro Val Leu Asn Arg Val Ile His Pro Ser Thr Lys Phe Glu Thr Ala 35 40 45Trp Thr Trp Ser Gly Cys Ile Ile Gly Cys Ser Tyr Leu Leu Leu Leu 50 55 60Val Val Cys Ala Phe Leu Asn Thr Thr Phe Val Leu Trp Pro Leu Thr65 70 75 80Leu Leu Gln Trp Ser His Leu Leu Ser Thr Arg Ser Cys Arg Trp Ile 85 90 95Cys Arg Phe Leu Glu Asp Lys Tyr Phe Ala Met Leu Ser Gly Tyr Leu 100 105 110Glu Leu Val Gly Gly Val Lys Ile Ile Ile Thr Gly Asp Glu Glu Leu 115 120 125Gln Phe Ala His His Glu His Val Leu Leu Ile Cys Asn His Arg Ser 130 135 140Glu Val Asp Trp Ile Phe Phe Trp Asn Leu Ala Leu Arg Leu Asn Val145 150 155 160His Asp Arg Ile Arg Val Met Met Lys Ser Val Ile Arg Tyr Ala Pro 165 170 175Gly Val Gly Trp Thr Met Met Leu Leu Arg Tyr Pro Tyr Val Asn Arg 180 185 190Asn Trp Ala Thr Asp Gln Asp Arg Leu Thr Lys Val Ile Glu Ser Tyr 195 200 205Lys Asp Val Asp Met Gly Thr Trp Leu Ala Met Phe Pro Glu Gly Thr 210 215 220Ala Leu Tyr Asp Lys Thr Leu Lys Lys Ser His Glu Phe Ala Ser Lys225 230 235 240Gln Gly Glu Ala Lys Trp Asn Tyr Val Leu Gln Pro Arg Val Lys Gly 245 250 255Phe Glu Leu Cys Met Asp Lys Met Asp Pro Asp Tyr Val Val Asp Leu 260 265 270Thr Val Ala Tyr Pro Glu Leu Met Glu Gly Val Arg Pro Ser Pro Val 275 280 285Arg Phe Val Arg Gly Gln Phe Pro Thr Glu Val His Met His Val Gln 290 295 300Arg Tyr His Arg Ser Thr Leu Leu Lys His Lys Asp Arg Met Gly Gln305 310 315 320Trp Leu Lys Asp Arg Phe Ala Glu Lys Glu Glu Arg Leu Glu His Phe 325 330 335Tyr Glu Thr Gly Ala Phe Gln Gly Glu Gln Gln Thr Ser Gly Gln His 340 345 350Ala Ser Arg Val Ala Leu Leu Pro Ala Gln Gln Ile Leu Leu Phe Val 355 360 365Gly Glu Asn Tyr Leu Thr Tyr Phe Trp Ser Arg Arg Arg Leu Ser Val 370 375 380Tyr Leu Arg Ala Phe Gln Val Ala Gly Ala Ser Ile His Ser Met Asp385 390 395 400Ser His Lys Ile His Asn Glu Lys His Gln Asp Lys Leu His Thr Arg 405 410 415Ser Ala Asp Glu Leu Arg Leu Phe Thr 420 425132390PRTPhythophtora infestance 132Met Ala Val Phe His Leu Tyr Ser Ala Leu Asn Leu Leu Trp Ile Leu1 5 10 15Cys Asn Ser Ala Cys Ile Asn Phe Leu Gln Phe Cys Leu Trp Cys Leu 20 25 30Val Arg Pro Phe Asn Lys Ala Leu Tyr Arg Arg Leu Met Gly Ser Val 35 40 45Ala Gln Ser Leu Trp Val Asp Val Thr Ser Thr Ser Phe Pro Gln Thr 50 55 60Lys Leu Ser Val Thr Gly Glu Leu Pro Ser Asp Pro Thr Lys Pro Val65 70 75 80Ile Ile Ile Ala Asn His Gln Val Asp Ala Asp Trp Trp Tyr Ile Trp 85 90 95Gln Ala Ala Arg His Gln His Ala Ala Gly Asn Ile Lys Ile Val Leu 100 105 110Lys Asp Gln Leu Lys Tyr Leu Pro Ile Ile Gly Trp Gly Met Arg Leu 115 120 125Phe Gln Phe Leu Phe Leu Arg Arg Arg Ile Asp Gln Asp Ala Glu His 130 135 140Ile Lys Lys Tyr Met Gly Gly Leu Ile Ser Asp Asn Phe Pro Phe Trp145 150 155 160Leu Val Leu Phe Pro Glu Gly Thr Thr Ile His Arg Glu Tyr Val Val 165 170 175Lys Ser Gln Ala Phe Ala Ala Arg Glu Ala Arg Pro Lys Phe Glu Arg 180 185 190Val Leu Leu Pro Arg Thr Thr Gly Met Arg Ile Ile Leu Asp Ala Val 195 200 205Ala Asp Ala Lys Pro Asp Ile Tyr Asp Leu Thr Val Ala Phe Pro Ser 210 215 220Tyr Ser Gly Glu Val Pro Thr Phe Asp Met Gly Tyr Gly Arg Arg Val225 230 235 240Asp Thr Glu Val Pro Ser Met Lys Ser Leu Leu Ala Gly Lys Gln Pro 245 250 255Val Gly Arg Val Ala Leu His Ser Arg Lys Phe Lys Tyr Glu Asp Ala 260 265 270Ala Thr Asp Leu Gln Gly Phe Leu Asp Ala Arg Trp Thr Glu Lys Glu 275 280 285Glu Arg Met Asn Tyr Phe Ile Lys His Gln Gln Phe Pro Glu Thr Glu 290 295 300Ser Thr Val Glu Met Gln Leu Ser Thr Ser Met Gly Ala Val Phe Arg305 310 315 320Leu Trp Met Gly Ile Leu Leu Ser Cys Val Val Leu Pro Val Val Met 325 330 335Met Leu Phe Phe Pro Leu Tyr Phe Thr Trp Val Val Tyr Cys Phe Val 340 345 350Tyr Ser Val Tyr Asp Arg Thr Thr Asn Phe Trp Trp Pro Tyr Ile Phe 355 360 365Asn Leu Phe Val Glu Arg Ala Thr Lys Thr His Glu His Phe Lys Arg 370 375 380His Gln Ala Lys Tyr Leu385 390133369PRTPhythophtora infestance 133Met Gly Val Ala Val Val Gly Val Val Phe Leu Thr Ser Leu Val Val1 5 10 15Thr Gly Trp Thr Gly Val Ala Trp Ile Leu Thr Pro Cys Phe Leu Leu 20 25 30Ala Ala Leu Pro Leu Pro Ala Phe Leu Gln Thr Lys Arg Phe Tyr Arg 35 40 45Arg Val Thr Arg Phe Ile Gln Trp Ala Trp Met Gly Gln Val Lys Leu 50 55 60Phe Gly Ile Gln Val Arg Val Leu Gly Asp Ala Glu Thr Lys Ala Arg65 70 75 80Glu Ser Glu Leu Ser Lys Asp Arg Ala Leu Trp Leu Ser Asn His Arg 85 90 95Thr Arg Ile Asp Trp Met Leu Leu Trp Ser Val Ala Trp Arg Thr Arg 100 105 110Thr Leu His Gln Leu Arg Ile Val Leu Lys Ala Pro Leu Arg Lys Met 115 120 125Pro Ile Phe Gly Trp Ala Met Gln His Phe Ile Phe Ile Phe Leu Gln 130 135 140Arg Arg Trp Ala Asp Asp Gln Val Asn Leu Arg Lys Leu Leu Pro Phe145 150 155 160Leu Thr Ser Thr Glu Pro Glu Ala Ser Tyr Leu Leu Phe Pro Glu Gly 165 170 175Thr Asp Leu Ser Glu Ser Asn Leu Glu Lys Ser Ala Val Phe Ala Glu 180 185 190Lys Lys Ser Leu Ser Pro Arg Gln Tyr Ser Leu Tyr Pro Arg Thr Thr 195 200 205Gly Trp Thr Phe Met Phe Pro Leu Leu Arg Ser Gln Leu Thr Ala Val 210 215 220Tyr Asp Val Thr Met Phe Tyr Val Asp Tyr Ala Ala Asn Glu Arg Pro225 230 235 240Ser Glu Ser Ser Leu Leu Thr Gly Arg Met Pro Arg Met Ile His Phe 245 250 255Tyr Ile Glu Arg Val Asp Ile Ser Val Leu Arg Asp Lys Ser Glu Thr 260 265 270Asp Leu Ala Ala Trp Leu Glu Lys Arg Phe Glu Arg Lys Glu Ser Leu 275 280 285Leu Lys Ala Phe Tyr Glu Asp Asn Gly Lys Leu Pro His Gly Ala Glu 290 295 300Pro Leu Phe Gln Glu Asn Gln Gly Thr Ala Met Val Met Leu Val Ala305 310 315 320Phe Trp Leu Ile Ser Ile Gly Ala Ala Thr Leu Leu Gly Leu Ile Gly 325 330 335Asn Phe Ile Ser Val Ile Ala Ala Leu Ala Val Val Val Gly Tyr Ala 340 345 350Thr Asn Thr Ala Tyr Gly Pro Gly Val Asp Gly Phe Leu Ile Asn Asn 355 360 365Ser 134447PRTPhythophtora infestance 134Met Gly Pro Arg Val Glu Pro Pro Asn Ser Gly Arg Ser Pro Thr Ala1 5 10 15Ser Lys Arg Arg Met Lys Lys Phe Arg Asp Val Val Ser Pro Leu Asp 20 25 30Pro Ala Asp Ala Arg Ser Gly Val His Ser Ser Glu Phe Arg Gly Leu 35 40 45Tyr Asn Leu Ala Met Leu Ser Gly Val Leu Tyr Val Phe Thr Thr Leu 50 55 60Phe Thr Asn Leu Leu Met Thr Asn Glu Pro Ile Asp Ser Lys Leu Leu65 70 75 80Leu Ser Val Phe Tyr Ser Thr His Leu Leu Glu Val Leu Ala Thr Phe 85 90 95Val Cys Gln Ala Leu Tyr Ala Tyr Thr Ala Leu Ile Pro Val Tyr Met 100 105 110Ala Gly Thr Asp Lys Pro Asn Arg Leu Leu Ile Asn Ile Val His His 115 120 125Thr Leu Gln Ser Leu Leu Phe Phe Phe Thr Ile Val Phe Ile Val Trp 130 135 140Arg Asp Trp Asn Leu Ile His Ala Val Ser Ala Phe Ile Glu Gly Leu145 150 155 160Val Leu Leu Met Lys Met His Ser Tyr Ile Arg Thr Lys Leu Glu Ile 165 170 175Ser Arg Thr Glu Asn Lys Pro Pro Ile Pro Asp Ile Lys Asp Phe Thr 180 185 190Met Tyr Leu Leu Ile Pro Ser Leu Val Tyr Glu Pro Asn Phe Pro Arg 195 200 205Thr Cys Arg Ile Arg Trp Ala Tyr Leu Ala Glu Lys Thr Phe Ser Val 210 215 220Ile Met Gly Ile Ser Met Leu Tyr Ile Ile Val Thr Thr His Val Met225 230 235 240Pro Arg Leu Glu Asp Ser Gly Thr Val Asn Pro Val Leu Ser Val Val 245 250 255Ser Leu Leu Leu Pro Phe Leu Gly Cys Tyr Leu Leu Thr Trp Phe Ile 260 265 270Ile Phe Glu Cys Ile Cys Asn Gly Phe Ala Glu Val Thr Tyr Ser Ala 275 280 285Asp Arg Asp Phe Tyr Gly Asp Trp Trp Asn Ser Thr Thr Phe Asp Glu 290 295 300Phe Ala Arg Lys Trp Asn Lys Pro Val His Glu Phe Leu Leu Arg His305 310 315 320Val Tyr Leu Glu Thr Leu Asp Ser Tyr Lys Ile Ser Lys Thr Tyr Ala 325 330 335Thr Met Phe Thr Phe Phe Met Ser Ala Ala Leu His Glu Cys Val Phe 340 345 350Ile Leu Met Phe Arg Thr Val Arg Met Tyr Phe Phe Thr Leu Gln Met 355 360 365Val Gln Leu Val Thr Ile Val Tyr Gly Arg Gly Leu Arg Gly Ser Arg 370 375 380Met Gly Asn Ile Thr Phe Trp Leu Gly Met Ile Leu Gly Leu Pro Leu385 390 395 400Gln Ala Val Ile Tyr Ser Arg Glu Tyr His Gly Gly Glu Pro Ile Phe 405 410 415Met Val Ile Met Met Pro Ala Met Ile Phe Gly Phe Gly Gly Val Leu 420 425 430Val Ala Ser Leu Met His Leu Ser Arg Leu Arg Lys Lys Gln Ala 435 440 445135308PRTPhythophtora infestance 135Met Thr Gly Gln Gln His Thr Trp Leu Leu Gly Val Gly Leu Ala Val1 5 10 15Ala Thr Ile Ser Leu Cys Val Ala Ile His Ala Ser Ala Leu Ile Thr 20 25 30Ile Ala Thr Ala Cys Val Ala Ala Tyr Leu Pro Ser Tyr Leu Asp Gly 35 40 45Ser Glu Tyr Thr Gly Glu Arg Tyr Trp Pro Trp Phe Ala Thr Phe Ile 50 55 60Gly His Gly Met Ala His Ile Pro Gly Thr Leu Glu Phe Glu Glu Pro65 70 75 80Ile Asp Ala Ser Lys Gln His Ile Phe Cys Ser His Pro His Gly Leu 85

90 95Leu Ser Thr His His Gly Leu Leu Met Ser Gly Gln Thr Val Pro Pro 100 105 110Phe Tyr Glu Thr Val Pro Leu Ser Thr Arg Arg His Leu Ala Ala Ser 115 120 125Val Cys Phe Arg Ile Pro Phe Tyr Arg Glu Tyr Val Leu Trp Ser Gly 130 135 140Cys Val Asp Ala Arg Arg Ser Val Ala Glu Lys Met Leu Arg Asn Gly145 150 155 160Lys Ser Leu Val Ile Leu Val Gly Gly Ile Ala Glu Gln Met Leu Ser 165 170 175Gln Arg Gly Asp His Thr Ile Tyr Val Lys Lys Arg Lys Gly His Ile 180 185 190Arg Leu Ala Leu Lys Tyr Gly Val Pro Ile Val Pro Gly Tyr Ala Phe 195 200 205Gly Glu Thr Asp Leu Phe Thr His Ser Ser Val Leu Leu Ser Phe Arg 210 215 220Gln Thr Ile Ala Lys Lys Phe Ser Val Ala Leu Leu Leu Gly Arg Gly225 230 235 240Tyr Ser Lys Trp Leu Phe Trp Leu Pro His Lys Gly Val Thr Ile Asn 245 250 255Gln Val Phe Gly Lys Pro Ile Pro Val Leu Lys Lys Asp Asp Pro Ser 260 265 270Ser Asp Asp Ile Glu Lys Leu His His Gln Tyr Glu Arg Glu Leu Val 275 280 285Arg Ile Phe Asp Lys Tyr Lys Glu Lys His Gly Tyr Gly Asn Cys Thr 290 295 300Leu His Val Arg305136392PRTPhythophtora infestance 136Met Ser Ala Ala Gln Val Leu Asn Asn Ala Ala Tyr Gly Arg Thr Ser1 5 10 15Ala Trp Pro Asp Ser Asn Thr Arg Pro Asp Leu Gln Thr Leu Arg Gly 20 25 30Arg Phe Leu Arg Arg Leu His Leu Ser Leu Ile Tyr Gly Leu Trp Val 35 40 45Leu Gly Thr Leu Phe Asn Ala Ala Met Trp Val Phe Ser Leu Val Cys 50 55 60Val Ala Gln Trp Val Trp Ser Thr Leu Ile Gly Ala Asn Glu Ala Pro65 70 75 80Ile Pro Leu Ala Val Gln Val Phe Leu Ser Leu Val Ala Leu Tyr Glu 85 90 95Ser Tyr His Phe Val Thr Arg Pro Ser His His Pro Trp Pro Phe Met 100 105 110Arg Arg Leu Ile Arg Tyr Ser Leu Leu His Tyr Pro Tyr Phe Arg Leu 115 120 125Asn Ala Thr Val Phe Asp Glu Arg Glu Arg Ala Lys Gln Leu Ser Gln 130 135 140Asp Gly Ala Thr Asn Asp Thr Ser Ala Phe Asn Thr Glu Ile Ala Ser145 150 155 160Lys Thr Ile Val Glu Asn Asp Ile Ser Pro Phe Val Lys Pro Asn Glu 165 170 175Ser Ala Met Phe Ala Phe His Pro His Ser Val Leu Ser Asn Gly Trp 180 185 190Val Ala Asn Gly Ala Asn His Met Ser Phe Glu Gln Ala Asp Cys Arg 195 200 205Trp Leu Val Ala Glu Asn Leu Phe Gly Val Pro Leu Met Arg Asp Leu 210 215 220Leu Asn Trp Met Asp Phe Ser Ser Val Ala Lys Ser Thr Phe Gln Gln225 230 235 240Arg Met Ser Ala Arg Gln Asn Val Cys Leu Ile Pro Gly Gly Phe Glu 245 250 255Glu Ala Thr Leu Tyr Glu Arg Gly Lys His Arg Val Tyr Ile Lys Lys 260 265 270Arg Phe Gly Phe Ile Lys Leu Ala Leu Gln Tyr Gly Tyr Lys Val His 275 280 285Pro Val Tyr Thr Phe Gly Glu Glu Tyr Ala Tyr His Thr Phe Pro Tyr 290 295 300Leu Leu Lys Leu Arg Leu Lys Leu Asn Glu Phe Lys Ile Pro Gly Val305 310 315 320Phe Phe Phe Gly Leu Pro His Cys Phe Phe Leu Pro Arg Thr Asp Val 325 330 335Asp Leu Ile Thr Val Val Gly Glu Pro Leu Val Leu Pro Arg Ile Glu 340 345 350Gln Pro Thr Lys Glu Asp Val Gln Lys Tyr Gln Gly Gln Tyr Val Glu 355 360 365Ala Leu Gln Lys Leu Phe Asn Lys Tyr Lys Ser Val Tyr Ala Val Asp 370 375 380Pro Gln Ala Gln Leu Glu Ile Tyr385 390137381PRTPhythophtora infestance 137Met Ala Lys Leu Thr Asn Ala Ala Cys Gly Arg Thr Ser Ala Trp Pro1 5 10 15Asp Phe Asp Thr Arg Pro Glu Leu Arg Thr Leu Arg Gly Arg Phe Met 20 25 30Arg Arg Phe Asp Leu Phe Ile Leu Tyr Gly Leu Trp Val Val Gly Leu 35 40 45Leu Phe Leu Ala Val Met Trp Val Phe Ser Leu Phe Cys Leu Val Gln 50 55 60Trp Ser Trp Arg Arg Ala Thr His Asp His Ala Pro Pro Met Ala Phe65 70 75 80Ser Ala Gln Ile Tyr Leu Gly Phe Ile Val Leu His Glu Ser Tyr His 85 90 95Tyr Leu Thr Lys Pro Ser Leu His Gln Trp Pro Phe Met Arg Arg Phe 100 105 110Phe Arg Gln Val Phe Leu His Tyr Pro Tyr Phe Arg Leu Asn Val Leu 115 120 125Val Phe Glu Glu Arg Ser Lys Thr Ser Ser Glu Asn Gly Lys Cys Asn 130 135 140Lys Glu Ile Ala Ser Lys Ala Val Glu Glu Asn Asn Leu Ser Pro Phe145 150 155 160Val Thr Pro Asp Asp Arg Ala Leu Phe Ala Phe His Pro His Gly Val 165 170 175Leu Ser Ser Gly Phe Ala Phe Asn Gly Ala His His Met Gly Phe Leu 180 185 190His Ala His Cys Arg Trp Leu Val Ser Glu Asn Leu Phe Trp Phe Pro 195 200 205Val Met Arg Asp Leu Leu Asn Trp Met Asp Phe Ser Cys Val Ser Arg 210 215 220Ser Thr Phe His Arg Phe Met Ala Thr Gly Gln Asn Val Cys Leu Ile225 230 235 240Pro Gly Gly Phe Glu Asp Ala Thr Leu Tyr Glu Arg Gly Lys His Arg 245 250 255Val Tyr Ile Lys Lys Arg Phe Gly Phe Ile Lys Leu Ala Leu Gln Tyr 260 265 270Gly Tyr Lys Val His Pro Val Tyr Thr Phe Gly Glu Glu Tyr Ala Tyr 275 280 285His Thr Phe Pro Tyr Leu Leu Lys Leu Arg Leu Lys Leu Asn Glu Phe 290 295 300Lys Ile Pro Gly Val Phe Phe Phe Gly Leu Pro His Cys Phe Phe Leu305 310 315 320Pro Arg Thr Asp Val Asp Leu Ile Thr Val Val Gly Glu Pro Leu Val 325 330 335Leu Pro Arg Ile Glu Gln Pro Thr Lys Glu Asp Val Gln Lys Tyr His 340 345 350Gly Gln Tyr Val Glu Ala Leu Gln Lys Leu Phe Asn Lys Tyr Lys Ser 355 360 365Val Tyr Ala Val Asp Pro Asp Ala Glu Leu Glu Leu Tyr 370 375 380138283PRTPhythophtora infestance 138Met Glu Ala Phe Val Pro Val Leu Leu Leu Thr Ile Thr Ala Tyr Met1 5 10 15Tyr Glu Phe Thr Tyr Arg Gly His Pro His Gln Thr Gly Cys Arg Glu 20 25 30Arg Leu Asp Trp Ile Tyr Gly His Ser Phe Leu Ile Glu Thr Val Lys 35 40 45Arg Tyr Phe Ser Glu Lys Ile Ile Arg Met Ala Pro Leu Asp Pro Lys 50 55 60Lys Gln Tyr Val Leu Gly Phe His Pro His Gly Ile Thr Pro Thr Ser65 70 75 80Val Met Trp Leu Gln Phe Ser Ala Glu Trp Arg Arg Leu Phe Pro Asn 85 90 95Phe Tyr Ala His Ile Leu Thr Ala Gly Ile Met His Ala Leu Pro Leu 100 105 110Ala Arg Asp Ile Leu Gln Phe Leu Gly Ser Arg Glu Val Thr Arg Gln 115 120 125Ala Phe Thr Tyr Thr Leu Gln His Asn Glu Ser Val Leu Leu Val Pro 130 135 140Gly Gly Gln Ala Glu Met Leu Glu Gln Arg Ser Gly Gln Lys Glu Val145 150 155 160Arg Val Tyr Thr His His Lys Gly Phe Ile Arg Leu Ala Ile Glu His 165 170 175Gly Val Pro Leu Val Pro Val Leu Ser Phe Asn Glu Gly Glu Met Leu 180 185 190Asp Asn Ile Gln Ala Pro Met Leu Gln Arg Trp Phe Val Ile Lys Leu 195 200 205Ala Phe Pro Phe Pro Phe Phe Pro Tyr Gly Arg Ala Leu Leu Pro Ile 210 215 220Pro Arg Lys Val Gln Ile Pro Ile Val Val Gly Ala Pro Leu Glu Val225 230 235 240Pro His Met Lys Lys Pro Ser His Glu Asp Ile Asp Lys Val His Ala 245 250 255Arg Tyr Phe Asp Glu Leu Arg Asp Met Phe Ala Lys Tyr Lys Asp Glu 260 265 270Ala Gly Cys Gly Asp Tyr Lys Leu Ile Tyr Val 275 280139349PRTPhythophtora infestance 139Met Ala Ser Glu Thr Gln Ala Asp Pro Val Gln Thr Asp Lys Gly Leu1 5 10 15Phe Val Tyr Glu Pro Leu Gly Phe Phe Ala Asp Asp Ser Lys Val Pro 20 25 30Lys Trp Met Gln Leu Leu Ile Thr Asp Val Phe Ser Phe Val Thr Thr 35 40 45His Tyr Phe Val Trp Ser Leu Pro Phe Leu Ala Leu Phe Cys Tyr Leu 50 55 60His Gln His Glu Leu Asp Tyr Val Ser Val Ala Met Ile Ala Leu Tyr65 70 75 80Leu Pro Ser Phe Phe Ser Gly Ala Gln Lys Thr Gly Lys Gly Asn Glu 85 90 95Trp Glu Ala Ala Arg Thr Ser Ser Leu Trp Gly Leu Met Asn Lys Phe 100 105 110Leu Arg Val Lys Ile Ile Arg Glu Gln Glu Leu Asp Pro Lys Lys Lys 115 120 125Phe Ile Phe Gly Phe His Pro His Gly Ile Leu Val Leu Ser Arg Ile 130 135 140Ala Gly Phe Gly Arg Asn Phe Ile Asp Val Cys Pro Gly Ile Thr Thr145 150 155 160Arg Phe Leu Gly Ala Ser Ala Met Tyr Tyr Ile Pro Leu Gly Arg Glu 165 170 175Met Cys Leu Trp Met Gly Gly Val Asp Ala Ser Arg Ser Thr Gly Glu 180 185 190Lys Val Leu Lys Glu Gly Asn Ser Ile Ile Val Tyr Pro Gly Gly Val 195 200 205Pro Glu Ile Phe Leu Thr Asp Pro Asn Leu Lys Glu Thr Gln Leu Val 210 215 220Leu Lys Lys Arg Leu Gly Phe Ile Lys Leu Ala Met Arg Gln Gly Ala225 230 235 240Gln Leu Val Pro Thr Phe Val Phe Gly Glu Lys Trp Leu Tyr Asn Met 245 250 255Trp Thr Pro Pro Glu Ser Val Thr Asn Phe Phe Arg Lys Thr Leu Gly 260 265 270Ile Pro Val Leu Val Phe Trp Gly Lys Phe Trp Trp Met Pro Lys Ala 275 280 285Pro Gly Glu Gly Lys Arg Tyr Gly Leu Val Tyr Gly Lys Pro Ile Ala 290 295 300Thr Lys His Asp Ser Asn Pro Ser Asp Glu Glu Ile Arg Ala Val His305 310 315 320Ala Glu Tyr Val Ser Glu Ile Glu Arg Ile Phe Ser Gln Tyr Lys Ser 325 330 335Glu Phe Gly Tyr Asp Glu Asp Glu Thr Leu Ala Ile Ile 340 345140403PRTPhythophtora infestance 140Met Pro Gln Ala Cys Gly Arg Thr Ser Ala Trp Leu Asp Asn Asp Ala1 5 10 15Arg Pro Glu Leu Gln Thr Leu His Gly Arg Ile Leu Arg Phe Val Leu 20 25 30Leu Trp Tyr Leu Phe Gly Leu Trp Ile Val Gly Leu Ala Ser Phe Ile 35 40 45Gly Met Trp Leu Phe Ser Gly Leu Cys Thr Ile Arg Ser Leu Leu Ser 50 55 60Phe Leu His Asn Gly Gly Ser Trp Thr Ala Ala Thr Pro Leu Pro Val65 70 75 80Leu Val Gln Val Tyr Leu Val Gly Met Ile Ala Tyr Glu Ser Tyr His 85 90 95Tyr Val Thr Arg Asn Ala Leu His Glu Trp Pro Leu Ile Arg Arg Val 100 105 110Val Arg Tyr Val Phe Leu His Tyr Pro Tyr Phe Arg Leu Asn Ala Val 115 120 125Val Phe Glu Glu Arg Glu Asp Ala Lys Gln Asn Val Glu Ile Gln Glu 130 135 140Pro Glu Gln Glu Lys Asp Gly Asn Asp Ser Thr Thr Asn Lys Ser Asp145 150 155 160Asp Ala Arg Tyr Phe Ser Ser Lys Ala Ala Ala Ala Ala Ile Glu Glu 165 170 175Asn Asp Val Thr Pro Tyr Val Glu Pro Asp Lys Arg Ala Leu Phe Thr 180 185 190Phe His Pro His Gly Val Leu Thr Cys Gly Phe Ser Phe Asn Gly Ala 195 200 205His His Met Ala Phe Gln Arg Ala Ala Cys Arg Trp Ile Ser Ala Glu 210 215 220Asn Leu Phe Tyr Phe Pro Ile Met Arg Asp Ile Leu His Trp Met Glu225 230 235 240Phe Ser Ser Ser Thr Lys Thr Ser Met Glu Asn Thr Met Arg Thr Gly 245 250 255Gln Asn Leu Cys Leu Leu Pro Gly Gly Phe Glu Glu Ala Thr Leu Tyr 260 265 270Gln Arg Gly Lys His Arg Val Tyr Ile Gln Lys Arg Phe Gly Phe Ile 275 280 285Lys Leu Ala Leu Gln His Gly Tyr Asp Ile Tyr Pro Ala Tyr Thr Phe 290 295 300Gly Glu Glu Tyr Thr Tyr His Ala Phe Pro Tyr Leu Gln Trp Leu Arg305 310 315 320Leu Gln Leu Asn Arg Phe Arg Ile Pro Gly Val Ile Phe Phe Gly Ile 325 330 335Pro Phe Cys Phe Phe Met Pro Arg Ser Asp Val Asp Leu Ile Thr Val 340 345 350Ile Gly Lys Pro Leu Arg Leu Pro His Ile Asp Asn Pro Ser Arg Asp 355 360 365Glu Val Lys Glu Asn His Asp Lys Tyr Val Glu Ala Leu Arg Asp Leu 370 375 380Phe Asp Arg Tyr Lys Cys Val Tyr Ala Ala Asp Pro Asp Ala Glu Leu385 390 395 400Glu Ile Phe141406PRTPhythophtora infestance 141Met Val Gly Val Ala His Ala Ala Thr Gly Arg Thr Pro Leu Trp Pro1 5 10 15Asn Asn Asn Ala Val Pro Glu Leu Gln Thr Leu Arg Gly Tyr Val Gly 20 25 30Arg Arg Phe Leu Leu Trp Ser Leu Phe Gly Leu Trp Ile Phe Gly Leu 35 40 45Gly Ala Tyr Ile Leu Met Trp Leu Tyr Ser Gly Trp Cys Val Gly His 50 55 60Trp Ala Trp Thr Ala Leu Gln Thr Lys Ser Trp Ala Leu Ala Thr Pro65 70 75 80Pro Pro Ile Ser Val Gln Val Tyr Leu Ala Phe Thr Ala Leu Tyr Glu 85 90 95Ser Tyr His Tyr Ile Thr Arg Asp Ser Leu His Leu Trp Pro Arg Met 100 105 110Arg Arg Leu Ala Arg His Ile Leu Leu Arg Tyr Pro Tyr Phe Arg Leu 115 120 125Asn Val Thr Ile Phe Glu Glu Arg Glu Leu Glu Lys Gln Lys Gln Arg 130 135 140Leu Lys Asp Glu Gln Thr Asn Asn Ser Asp Asp Ala Thr Val Asp Thr145 150 155 160Glu Gln Asp Glu Ser Glu His Leu Ser Pro Ala Ala Ala Ile Lys Ala 165 170 175Val Glu Glu Asn Asp Ile Ser Pro Tyr Val Glu Thr Gly Thr Lys Asn 180 185 190Leu Phe Ala Phe His Pro His Gly Ile Leu Thr Cys Gly Phe Ser Phe 195 200 205Asn Gly Ala Tyr His Met Ser Phe Glu Arg Ser Ala Cys Arg Trp Leu 210 215 220Ser Ala Glu Asn Leu Phe Trp Phe Pro Leu Val Arg Asp Leu Leu Asn225 230 235 240Trp Met Glu Tyr Ser Ser Cys Ala Lys Ala Asn Met Leu Lys Phe Met 245 250 255Arg Arg Asp Gln Asn Val Ser Ile Ile Pro Gly Gly Phe Glu Glu Ala 260 265 270Thr Leu Tyr Gln Arg Gly Lys His Arg Leu Tyr Leu Lys Lys Arg Phe 275 280 285Gly Phe Ile Lys Ile Ala Leu Gln His Gly Tyr Asn Val His Pro Val 290 295 300Tyr Thr Phe Gly Glu Glu Tyr Thr Tyr His Ala Phe Pro Tyr Leu Gln305 310 315 320Ser Leu Arg Leu Gln Leu Asn Arg Leu Gln Ile Pro Gly Thr Ile Phe 325 330 335Phe Gly Glu Ala Ser Cys Phe Tyr Leu Pro Arg Asn Asp Ile Asp Leu 340 345 350Ile Thr Val Val Gly Lys Ser Leu Arg Phe Pro Arg Ile Glu His Pro 355 360 365Ser Lys Glu Asp Val Gln Lys Tyr Gln Ala Gln Tyr Ile Glu Ala Leu 370 375 380Arg Ser Leu Phe Asp Ser Tyr Lys Gly Val Tyr Ala Val Asp Pro Asn385 390 395 400Ala Thr Leu Glu Ile Phe 405142516PRTPhythophtora infestance 142Met Asp Val Glu Asn Ser Leu Leu Thr Arg Leu Ala Ala Asn Gly Pro1 5 10

15Thr Met Ser Asp Ala Pro Met Leu Leu Met Ala Val Val Leu Val Leu 20 25 30Ala Leu Ser Gly Val Val Ser Thr Val Ser Gln Gln Arg Gln Lys Pro 35 40 45Ser Glu Asp Glu Thr Leu Gln Gly Arg Lys Leu Thr Arg Lys Leu Ser 50 55 60Ser Met Gly Leu Ser Thr Leu Val Thr Glu Thr Pro Thr Asn Leu Ser65 70 75 80Ile Pro Val Ser Val Leu Thr Val Glu Gly His Leu Ala Lys Glu Asp 85 90 95Tyr Val Glu Arg Leu Arg Ala Arg Ile Leu His Asp Ala Phe Phe Leu 100 105 110Arg Trp Arg Ser Val Val Arg Gly Asp Tyr Lys Thr Gly Val Tyr Lys 115 120 125Tyr Val Glu Val Pro Gly Tyr Asp Val Ala Gln Asn Val Val Glu His 130 135 140Thr Val Glu Glu Gly Glu Thr Thr Met Ser Tyr Val Glu Ser Ala Leu145 150 155 160Val Asn Thr Pro Leu Asp Phe Asp Lys Pro Leu Trp Glu Met His Val 165 170 175Ile His Asp Pro Lys Gly Asn Pro Gly Asn Thr Ser Val Gly Trp Lys 180 185 190Val His His Cys Leu Gly Asp Gly Ala Ser Leu Ala Thr Ala Met Ala 195 200 205Lys Leu Ser Asp Gln Ser Glu Leu Phe Asp Ala Met Val Glu Lys Arg 210 215 220Leu Gln Ala Lys Lys Ser Pro Lys Thr Pro Lys Pro Arg Lys Pro Val225 230 235 240Thr Gln Ile Ile Lys Asp Ile Leu Val Phe Leu Tyr Val Cys Ile Trp 245 250 255Ser Val Tyr Val Ile Ser Tyr His Met Phe Ala Leu Val Thr Arg Arg 260 265 270Glu Pro Ala Thr Val Phe Lys Arg Pro Gly Gly Lys Gln Lys Arg Leu 275 280 285Ser Tyr Asn Met Ile Tyr Ser Val Asn Ala Thr Lys Ala Val Gly Lys 290 295 300His Phe Arg Ala Thr Val Asn Asp Val Met Leu Asn Val Val Ala Gly305 310 315 320Ala Met Arg Lys Thr Met Leu Ser Val Gly Glu Ser Val Ala Pro Thr 325 330 335Leu Lys Val Arg Cys Ala Ile Pro Val Asp Met Arg Ser Ser Thr Glu 340 345 350Val Ile Arg His Thr Ser Asn Arg Phe Ser Ser Leu Val Ile Asp Leu 355 360 365Pro Ile Gly Val Glu Asp Ser Ala Gln Arg Leu Leu Gln Val Thr Ala 370 375 380Ala Met Asn Asp Ala Lys Asn Ser Leu Glu Lys Phe Phe Val Tyr Trp385 390 395 400Ser Thr His Leu Val Ser Met Leu Pro Ala Pro Leu Met Arg Leu Ile 405 410 415Val His Phe Thr Thr Ser Arg Ile Ser Val Ala Thr Ser Asn Val Arg 420 425 430Ala Ser Val Val Glu Val Ser Leu Cys Lys Ser Pro Val Ser Gly Phe 435 440 445Tyr Gly Phe Val Pro Pro Pro Pro Tyr Val Asn Leu Gly Val Ala Ile 450 455 460Leu Ser Met Gly Asp Asp Leu Gly Leu Asn Val Leu Val Asp Pro Cys465 470 475 480Val Gly Val Asn Ala Lys Gln Phe Leu Glu Phe Ala Lys Glu Glu Phe 485 490 495Thr Ala Leu Gln Glu Ser Val Ala Ala Met Glu Ala Asn Ala Gly Asp 500 505 510Lys Lys Thr Lys 515143675PRTPhythophtora infestance 143Met Thr Leu Asp Asp Asp Ser Ser Ala Ser Gly Val Arg Gln Arg Lys1 5 10 15Pro His Gly Gly Thr Ser Ser Asp Arg Pro Ser Ser Pro Glu Ala Leu 20 25 30Ala Glu Glu Ala Val Ala Ser Ala Phe Ser Ala Pro Lys Asp Glu Gln 35 40 45Ser Arg Thr Lys Glu Thr Phe Gln His Ala Ala Arg Ser Leu Gly Arg 50 55 60Thr Gln Ser Trp His Ala Arg Ala Ala Asp His Val Ala Arg Lys Arg65 70 75 80Ile Tyr Ser Ile Met Ala Gly Val Ile Ile Gly Val Ala Ala Val Ile 85 90 95Asn Phe Gln Arg Phe Tyr Leu Glu Lys Pro Leu Ile Ser Glu Asp Ser 100 105 110Leu Leu Met Val Arg Glu Met Phe Asp Asn Phe Asn Trp Ser Val Asn 115 120 125Val Lys Glu Glu Leu Met Ala Ala Phe Asp Asn Arg Pro Pro Leu Met 130 135 140Gly Ala Ala Glu Ile Arg Pro Gly Val Gln Leu Phe Gln Glu Asn Val145 150 155 160Thr Ala Asn Ser Pro Val Val Leu Val Pro Gly Phe Thr Ser Thr Gly 165 170 175Leu Glu Ile Trp Asn Gly Ser Glu Cys Ser Lys Ala Tyr Phe Arg Gln 180 185 190Arg Met Trp Gly Thr Ser Arg Met Leu Gln Gln Phe Met Met Asn Gln 195 200 205Lys Cys Trp Leu Glu His Met Met Leu Asn Arg Ser Ser Gly Met Asp 210 215 220Pro Asp Gly Ile Lys Leu Arg Ala Ala Lys Gly Leu Glu Ala Ala Asp225 230 235 240Tyr Leu Ile Gly Gly Phe Trp Val Trp Gly Lys Met Val Glu Asn Leu 245 250 255Ala Glu Ile Gly Tyr Asp Ser Asn Asn Leu Tyr Met Ala Ala Tyr Asp 260 265 270Trp Arg Leu Met Pro His Leu Leu Glu Lys Arg Asp Gly Tyr Phe Thr 275 280 285Lys Leu Lys Tyr Thr Ile Glu Met Ala Arg Met Ser Ala Gly Gly His 290 295 300Lys Val Met Leu Val Thr His Ser Tyr Ala Thr Gln Val Phe Phe His305 310 315 320Phe Leu Lys Trp Val Glu Ser Glu Asn Gly Gly Lys Gly Gly Asp Gln 325 330 335Trp Val Glu Thr Asn Leu Glu Ser Phe Val Asn Ile Ala Gly Pro Thr 340 345 350Leu Gly Val Val Lys Thr Ile Ser Ala Leu Met Ser Gly Glu Met Lys 355 360 365Asp Thr Ala Glu Leu Gly Gly Leu Ser Lys Phe Leu Gly Tyr Phe Phe 370 375 380Ser Val Ser Ala Arg Thr Gln Leu Ala Arg Ser Trp Ser Ser Val Phe385 390 395 400Ser Met Met Pro Ile Gly Gly Asp Arg Ile Trp Gly Thr Ala Asp Ser 405 410 415Ala Pro Asp Asp Val Val Ala Ala Ser Pro Leu Ser Thr Gly Lys Asn 420 425 430Ser Thr Ile Asp Pro Arg Lys Val Lys Glu His Val Ala Arg Tyr Gly 435 440 445Ser Asn Gly His Val Val Arg Phe Val Asn Thr Ser His Glu Asn Val 450 455 460Thr Ile Gly Gly Val Gln Lys Met Leu Gly Lys Leu Asp Pro Tyr Leu465 470 475 480Asp Gln Phe Arg Ser Trp Leu Ser Thr Gly Ile Ala Glu Asp Leu Ser 485 490 495Leu Pro Glu Tyr Asp Gln Ser Lys Tyr Trp Thr Asn Pro Leu Glu Ala 500 505 510Ala Leu Pro Lys Ala Pro Ser Leu Asn Val Phe Cys Phe Tyr Gly Val 515 520 525Gly Lys Pro Val Glu Arg Gly Tyr Thr Tyr Gly Asp Asn Pro Pro Asp 530 535 540Glu Asp Asn Ala Thr Val Asn Gly Lys Arg Val Ala Pro Tyr Val Phe545 550 555 560Asn Thr Asp Thr Asp Asp Leu Pro Tyr Ile Lys Gly Gly Leu Arg Tyr 565 570 575Ser Asp Gly Asp Gly Thr Val Pro Leu Ile Ser Leu Gly Leu Met Cys 580 585 590Ala Ser Gly Trp Arg Thr Lys Lys Phe Asn Pro Gly Asn Val Asp Val 595 600 605Arg Val Arg Glu Tyr Arg His Asn Pro Val Ser Met Leu Phe Asp Ala 610 615 620Arg Gly Gly Pro Glu Thr Ala Asp His Val Asp Ile Met Gly Asn His625 630 635 640Gly Leu Ile Arg Asp Val Leu Leu Val Ala Ala Arg Ala Tyr Asp Arg 645 650 655Val Pro Glu Asn Ile Thr Ser Ser Ile Met Glu Ile Ala Glu Arg Val 660 665 670Gly Glu Leu 675144728PRTPhythophtora infestance 144Met Lys Phe Asp Asp Lys Lys Val Leu Asn Asp Thr Trp Thr Gln Phe1 5 10 15Leu Ala Leu Cys Leu Leu Leu Met Leu Ala Val Asp Ser Leu Asn Pro 20 25 30Ile Lys Ala Val Ser Lys Phe Leu Gly Val Pro Ser Tyr Tyr Trp Gly 35 40 45Ala Leu Ser Val Gly Ile Met Leu Gly Leu Leu Phe His Asn Ala Ala 50 55 60Asp Val Ile Tyr Arg Ser Thr Arg Val Phe Leu Asn Ser Ile Leu Ser65 70 75 80Ile Ser Phe Lys Ser Val Asp Leu Ile Gly Leu Asp Asn Val Pro Thr 85 90 95Asp Gly Pro Val Ile Phe Thr Gly Asn His Ala Asn Gln Phe Val Asp 100 105 110Gly Leu Val Val Met Met Thr Ser Pro Arg Lys Val Gly Phe Met Ile 115 120 125Ala Glu Lys Ser Trp His Leu Pro Val Val Gly His Leu Ala Arg Ile 130 135 140Met Gly Cys Ile Pro Val Val Arg Pro Gln Asp Ser Val Ala Ser Gly145 150 155 160Val Gly Ser Met Lys Leu Ala Ser Glu Asp Pro Val Thr Val Ala Ser 165 170 175Ser Ser Ser Gly Gly Ala Ser Ser Ser Thr Pro Gln Trp Leu Val Gln 180 185 190Gly Asp Gly Thr Ser Phe Thr Lys Gln Val Thr Pro Gly Asp Gln Ile 195 200 205Arg Phe Gln Gly Gln Ser Val Lys Asp Ser Gly Ser Pro Val Lys Ile 210 215 220Val Gln Val Leu Asp Asp Thr Gln Leu Leu Leu Asn Ala Pro Leu Lys225 230 235 240Ser Gly Glu Gly Lys Leu Val Leu Glu Ser Ala Pro Phe Gly Ile Leu 245 250 255Lys Arg Val Asp Gln Ser Val Thr Phe Ala Lys Val Tyr Thr His Leu 260 265 270Lys Arg Gly Asn Cys Ile Gly Ile Phe Pro Glu Gly Gly Ser His Asp 275 280 285Arg Thr Asp Leu Leu Pro Leu Lys Ala Gly Val Ala Val Met Ala Leu 290 295 300Gly Val Lys Asp Lys Tyr Asn Ile Asn Val Pro Val Val Pro Val Gly305 310 315 320Leu Asn Tyr Phe Arg Gly His Arg Phe Arg Gly Arg Val Thr Val Glu 325 330 335Phe Gly Thr Pro Ile Thr Val Asp Gln Ala Leu Met Ala Lys Tyr Gln 340 345 350Glu Asp Lys Arg Thr Ala Cys Asn Thr Leu Leu His Arg Val Glu Glu 355 360 365Ser Met Arg Ser Val Ile Val Thr Thr Pro Ser Tyr Gly Val Met Gln 370 375 380Glu Val Leu Thr Ala Arg Arg Leu Phe Gln Arg Ser Gly Val Arg Leu385 390 395 400Ser Ala Lys Glu Thr Gln Asp Leu Asn Arg Arg Phe Ala Glu Gly Tyr 405 410 415Lys Val Leu Gln Asp Val Pro Glu Ala Gln Glu Asp Leu Val Ile Leu 420 425 430Gln His Lys Leu Asp Asn Tyr Tyr Lys Thr Leu Gln Lys Met Gly Leu 435 440 445Lys Asp His Gln Val Pro Tyr Ile Pro Trp Trp Thr Ile His Asp Val 450 455 460Leu Gly Ser Ala Leu Tyr Gly Thr Leu Ile Leu Leu Leu Ser Ser Ile465 470 475 480Pro Ser Phe Ile Leu Asn Ala Pro Val Gly Leu Leu Ala Arg Tyr Val 485 490 495Ala Asn Ser Ala Gln Lys Lys Ala Leu Glu Gly Ser Lys Val Lys Val 500 505 510Leu Ala Arg Asp Val Ile Leu Ser Lys Lys Ile Gln Phe Ser Ile Val 515 520 525Ala Val Pro Val Leu Trp Phe Ile Tyr Phe Thr Ile Ala Ala Val Phe 530 535 540Thr Asp Trp Tyr Trp Ser Ser Ile Met Leu Leu Met Val Ser Phe Pro545 550 555 560Leu Phe Ser Phe Phe Gly Val Arg Ser Val Glu Ala Gly Met Ile Glu 565 570 575Leu Lys Thr Val Arg Pro Leu Phe Tyr Arg Leu Leu Pro Thr Tyr Lys 580 585 590Ala Thr Gln Asp Glu Leu Pro Arg Gln Arg Ala Glu Leu Gln Lys Glu 595 600 605Val Arg Glu Phe Val Lys Lys Tyr Ser Gln Tyr Leu Gly Lys Leu Ala 610 615 620Glu Pro Lys Lys Leu Asp Trp Ser Glu Tyr Met His Glu Arg Ser Leu625 630 635 640Val Leu Ala Glu Lys Thr Glu Gln Ala Glu Ser Ile Pro Ser Pro Pro 645 650 655Pro Val His Glu Glu Asp Glu Glu Pro Arg Glu Gly Glu Ala Glu Asp 660 665 670Asp Ile Gly Ser Pro Val Pro Thr Ile Thr Lys Phe His Asp Ile Ser 675 680 685Ile Leu Gly Lys Ser Glu Asn Ser Val Leu Asp Leu Ala Gly Leu Glu 690 695 700Arg Ser Met Ser Cys Pro Pro Gly Tyr Gln Glu Leu Ala Glu Glu Ile705 710 715 720Ala Lys Gln Arg Lys Gly Ser Val 725145510PRTPhythophtora infestance 145Met Leu Ser Thr Leu Leu Trp Leu Ala Leu Ala Val Val Val Leu Ala1 5 10 15Thr Gln Gly Tyr Lys Met Val Ala Arg Phe Leu Arg Leu Leu Leu His 20 25 30Thr Tyr Phe Arg Lys Ile Val Val Tyr Gly Leu Asn Asn Phe Pro Arg 35 40 45Glu Gly Pro Val Ile Leu Cys Pro Asn His Pro Asn Met Leu Val Asp 50 55 60Ala Ile Leu Val Met Thr Glu Ala Val Ser His Gly Arg Asn Pro Tyr65 70 75 80Val Trp Ala Lys Gly Ser Leu Phe Ser Asn Pro Val Ala Ala Phe Phe 85 90 95Leu Lys Lys Phe Gly Ala Val Pro Val Tyr Arg Pro Arg Arg Lys Glu 100 105 110Asp Ser Leu Ala Asp Val Asp Ser Asp Lys Thr Pro Glu Gln Leu Glu 115 120 125Ala Ala Asn Arg Lys Met Phe Glu His Thr Trp His Val Leu Ala Gly 130 135 140Gly Asn Val Met Val Leu Phe Pro Glu Gly Thr Ser Tyr Thr Ala Pro145 150 155 160Lys Met Leu Ser Leu Arg Thr Gly Val Val Arg Val Ala Thr Gly Phe 165 170 175Ala Lys His Tyr Asp Gln Pro Ile Pro Ile Ile Pro Leu Gly Leu Asn 180 185 190Tyr Phe Asn Lys Asp His Phe Arg Ser Gln Met Thr Leu Glu Phe Gly 195 200 205Pro Pro Met Val Ile Thr Pro Asp Met Val Gln Thr Glu Ala Phe Gln 210 215 220Gln Asp Glu His Gly Glu Val Lys Arg Leu Thr Leu Glu Leu Glu Glu225 230 235 240Arg Met His Asp Val Thr Leu Asn Ala Ser Asp Phe Ser Thr Ile His 245 250 255Ala Ala Arg Met Met Arg Arg Leu Tyr Leu Asn Thr Pro Gly Pro Ile 260 265 270Asp Thr Asn Lys Glu Val Arg Leu Thr Gln Tyr Ile Ile Asn Met Leu 275 280 285Glu Lys Glu Pro Gln Asp Asp Glu Gln Lys Glu Arg Ile Ala Thr Ile 290 295 300Arg Glu Lys Val Leu Arg Tyr Lys Glu Gln Leu Glu Lys Leu Arg Leu305 310 315 320Lys Asp Gln Glu Val Asn Leu Pro Met Pro Lys Glu Lys Ser Leu Leu 325 330 335Gln Leu Phe Leu Glu Arg Ile Leu Tyr Leu Leu Val Leu Leu Pro Leu 340 345 350Ala Thr Pro Gly Leu Leu Leu Asn Leu Pro Tyr Tyr Phe Ile Gly Thr 355 360 365Lys Met Asn Ser Leu Ala Gly Phe Val Glu Ser Lys Ser Met Phe Lys 370 375 380Ile Phe Ala Ala Ala Val Leu Val Pro Val His Trp Leu Val Leu Ile385 390 395 400Leu Ala Thr Trp Tyr Phe Leu Gly Ser Ser Tyr Ala Tyr Val Leu Ala 405 410 415Val Gly Leu Pro Leu Leu Leu Tyr Ser His Ile Arg Val Leu Glu Glu 420 425 430Ser Arg Ser Ile Ala Glu Asn Val Tyr Phe Leu Phe Asn Ile Thr Ala 435 440 445His Ala Asp Lys Val Ala Val Leu Arg Thr Glu Arg Glu Leu Leu Ala 450 455 460Gln Glu Val His Glu Leu Val Thr Lys Tyr Val Asp Ala Lys Phe Leu465 470 475 480Ser Ala Ile His Lys Ser Leu Ala Ser Ser Pro Val Asn Arg Arg Leu 485 490 495Arg His Arg Ala Ser Ser Thr Ser Asp Thr Leu Leu Thr Thr 500 505 51014626802DNAArtificial SequencePlant Expression Plasmid 146ttgacataca aatggacgaa cggataaacc ttttcacgcc cttttaaata tccgattatt 60ctaataaacg ctcttttctc ttaggtttac ccgccaatat atcctgtcaa acactgatag 120tttaaactga aggcgggaaa cgacaatctg atcactgatt agtaactaag gcctttaatt 180aatctagagg cgcgccgggc cccctgcagg gagctcggcc ggccaattta

aattgatatc 240ggtacatcga ttacgccaag ctatcaactt tgtatagaaa agttgccatg attacgccaa 300gcttggccac taaggccaat ttcgcgccct gcagcaaatt tacacattgc cactaaacgt 360ctaaaccctt gtaatttgtt tttgttttac tatgtgtgtt atgtatttga tttgcgataa 420atttttatat ttggtactaa atttataaca ccttttatgc taacgtttgc caacacttag 480caatttgcaa gttgattaat tgattctaaa ttatttttgt cttctaaata catatactaa 540tcaactggaa atgtaaatat ttgctaatat ttctactata ggagaattaa agtgagtgaa 600tatggtacca caaggtttgg agatttaatt gttgcaatgc tgcatggatg gcatatacac 660caaacattca ataattcttg aggataataa tggtaccaca caagatttga ggtgcatgaa 720cgtcacgtgg acaaaaggtt tagtaatttt tcaagacaac aatgttacca cacacaagtt 780ttgaggtgca tgcatggatg ccctgtggaa agtttaaaaa tattttggaa atgatttgca 840tggaagccat gtgtaaaacc atgacatcca cttggaggat gcaataatga agaaaactac 900aaatttacat gcaactagtt atgcatgtag tctatataat gaggattttg caatactttc 960attcatacac actcactaag ttttacacga ttataatttc ttcatagcca gtactgttta 1020agcttcactg tctctgaatc ggcaaaggta aacgtatcaa ttattctaca aaccctttta 1080tttttctttt gaattaccgt cttcattggt tatatgataa cttgataagt aaagcttcaa 1140taattgaatt tgatctgtgt ttttttggcc ttaatactaa atccttacat aagctttgtt 1200gcttctcctc ttgtgagttg agtgttaagt tgtaataatg gttcactttc agctttagaa 1260gaaaccatgg aagttgttga gaggttctac ggagagttgg atggaaaggt ttcccaagga 1320gtgaacgctt tgttgggatc tttcggagtt gagttgactg ataccccaac tactaaggga 1380ttgccactcg ttgattctcc aactccaatt gtgttgggag tgtctgttta cttgaccatc 1440gtgatcggag gattgctttg gatcaaggct agagatctca agccaagagc ttctgagcca 1500ttcttgttgc aagctttggt gttggtgcac aacttgttct gcttcgcttt gtctctttac 1560atgtgcgtgg gtatcgctta ccaagctatc acctggagat attccttgtg gggaaacgct 1620tataacccaa agcacaagga gatggctatc ctcgtttacc tcttctacat gtccaagtac 1680gtggagttca tggataccgt gatcatgatc ctcaagagat ccaccagaca gatttctttc 1740ctccacgtgt accaccactc ttctatctcc cttatctggt gggctattgc tcaccacgct 1800ccaggaggag aggcttattg gagtgctgct ctcaactctg gagtgcacgt gttgatgtac 1860gcttactact tcttggctgc ttgcttgaga tcttccccaa agctcaagaa caagtacctc 1920ttctggggaa gatacctcac ccaattccag atgttccagt tcatgctcaa cttggtgcaa 1980gcttactacg atatgaaaac caacgctcca tatccacaat ggctcatcaa gatcctcttc 2040tactacatga tctccctctt gttcctcttc ggaaacttct acgtgcaaaa gtacatcaag 2100ccatccgatg gaaagcaaaa gggagctaag accgagtgat cgacaagctc gagtttctcc 2160ataataatgt gtgagtagtt cccagataag ggaattaggg ttcctatagg gtttcgctca 2220tgtgttgagc atataagaaa cccttagtat gtatttgtat ttgtaaaata cttctatcaa 2280taaaatttct aattcctaaa accaaaatcc agtactaaaa tccagatccc ccgaattaat 2340tcggcgttaa ttcagggccg gccaaagtag gcgcctacta ccggtaattc ccgggattag 2400cggccgctag tctgtgcgca cttgtatcct gcaggttagg ccggccatta gcagatattt 2460ggtgtctaaa tgtttatttt gtgatatgtt catgtttgaa atggtggttt cgaaaccagg 2520gacaacgttg ggatctgata gggtgtcaaa gagtattatg gattgggaca atttcggtca 2580tgagttgcaa attcaagtat atcgttcgat tatgaaaatt ttcgaagaat atcccatttg 2640agagagtctt tacctcatta atgtttttag attatgaaat tttatcatag ttcatcgtag 2700tctttttggt gtaaaggctg taaaaagaaa ttgttcactt ttgttttcgt ttatgtgaag 2760gctgtaaaag attgtaaaag actattttgg tgttttggat aaaatgatag tttttataga 2820ttcttttgct tttagaagaa atacatttga aattttttcc atgttgagta taaaataccg 2880aaatcgattg aagatcatag aaatatttta actgaaaaca aatttataac tgattcaatt 2940ctctccattt ttatacctat ttaaccgtaa tcgattctaa tagatgatcg attttttata 3000taatcctaat taaccaacgg catgtattgg ataattaacc gatcaactct cacccctaat 3060agaatcagta ttttccttcg acgttaattg atcctacact atgtaggtca tatccatcgt 3120tttaattttt ggccaccatt caattctgtc ttgcctttag ggatgtgaat atgaacggcc 3180aaggtaagag aataaaaata atccaaatta aagcaagaga ggccaagtaa gataatccaa 3240atgtacactt gtcattgcca aaattagtaa aatactcggc atattgtatt cccacacatt 3300attaaaatac cgtatatgta ttggctgcat ttgcatgaat aatactacgt gtaagcccaa 3360aagaacccac gtgtagccca tgcaaagtta acactcacga ccccattcct cagtctccac 3420tatataaacc caccatcccc aatctcacca aacccaccac acaactcaca actcactctc 3480acaccttaaa gaaccaatca ccaccaaaaa atttcacgat ttggaatttg attcctgcga 3540tcacaggtat gacaggttag attttgtttt gtatagttgt atacatactt ctttgtgatg 3600ttttgtttac ttaatcgaat ttttggagtg ttttaaggtc tctcgtttag aaatcgtgga 3660aaatatcact gtgtgtgtgt tcttatgatt cacagtgttt atgggtttca tgttctttgt 3720tttatcattg aatgggaaga aatttcgttg ggatacaaat ttctcatgtt cttactgatc 3780gttattagga gtttggggaa aaaggaagag tttttttggt tggttcgagt gattatgagg 3840ttatttctgt atttgattta tgagttaatg gtcgttttaa tgttgtagac catgggaaaa 3900ggatctgagg gaagatctgc tgctagagag atgactgctg aggctaacgg agataagaga 3960aagaccatcc tcattgaggg agtgttgtac gatgctacca acttcaaaca cccaggaggt 4020tccattatta acttcctcac cgagggagaa gctggagttg atgctaccca agcttacaga 4080gagttccatc agagatccgg aaaggctgat aagtacctca agtccctccc aaagttggat 4140gcttctaagg tggagtctag gttctctgct aaggagcagg ctagaaggga cgctatgacc 4200agggattacg ctgctttcag agaggagttg gttgctgagg gatacttcga tccatctatc 4260ccacacatga tctacagagt ggtggagatt gtggctttgt tcgctttgtc tttctggttg 4320atgtctaagg cttctccaac ctctttggtt ttgggagtgg tgatgaacgg aatcgctcaa 4380ggaagatgcg gatgggttat gcacgagatg ggacacggat ctttcactgg agttatctgg 4440ctcgatgata ggatgtgcga gttcttctac ggagttggat gtggaatgtc tggacactac 4500tggaagaacc agcactctaa gcaccacgct gctccaaaca gattggagca cgatgtggat 4560ttgaacacct tgccactcgt tgctttcaac gagagagttg tgaggaaggt taagccagga 4620tctttgttgg ctttgtggct cagagttcag gcttatttgt tcgctccagt gtcttgcttg 4680ttgatcggat tgggatggac cttgtacttg cacccaagat atatgctcag gaccaagaga 4740cacatggagt ttgtgtggat cttcgctaga tatatcggat ggttctcctt gatgggagct 4800ttgggatatt ctcctggaac ttctgtggga atgtacctct gctctttcgg acttggatgc 4860atctacatct tcctccaatt cgctgtgtct cacacccact tgccagttac caacccagag 4920gatcaattgc actggcttga gtacgctgct gatcacaccg tgaacatctc taccaagtct 4980tggttggtta cctggtggat gtctaacctc aacttccaaa tcgagcacca cttgttccca 5040accgctccac aattcaggtt caaggagatc tctccaagag ttgaggctct cttcaagaga 5100cacaacctcc cttactacga tttgccatac acctctgctg tttctactac cttcgctaac 5160ctctactctg ttggacactc tgttggagct gataccaaga agcaggattg actgctttaa 5220tgagatatgc gagacgccta tgatcgcatg atatttgctt tcaattctgt tgtgcacgtt 5280gtaaaaaacc tgagcatgtg tagctcagat ccttaccgcc ggtttcggtt cattctaatg 5340aatatatcac ccgttactat cgtattttta tgaataatat tctccgttca atttactgat 5400tgtgtcgacg cgatcgcgtg caaacactgt acggaccgtg gcctaatagg ccggtaccca 5460agtttgtaca aaaaagcagg ctccatgatt acgccaagct tggccactaa ggccaattta 5520aatctactag gccggccatc gacggcccgg actgtatcca acttctgatc tttgaatctc 5580tctgttccaa catgttctga aggagttcta agacttttca gaaagcttgt aacatgcttt 5640gtagactttc tttgaattac tcttgcaaac tctgattgaa cctacgtgaa aactgctcca 5700gaagttctaa ccaaattccg tcttgggaag gcccaaaatt tattgagtac ttcagtttca 5760tggacgtgtc ttcaaagatt tataacttga aatcccatca tttttaagag aagttctgtt 5820ccgcaatgtc ttagatctca ttgaaatcta caactcttgt gtcagaagtt cttccagaat 5880caacttgcat catggtgaaa atctggccag aagttctgaa cttgtcatat ttcttaacag 5940ttagaaaaat ttctaagtgt ttagaatttt gacttttcca aagcaaactt gacttttgac 6000tttcttaata aaacaaactt catattctaa catgtcttga tgaaatgtga ttcttgaaat 6060ttgatgttga tgcaaaagtc aaagtttgac ttttcagtgt gcaattgacc attttgctct 6120tgtgccaatt ccaaacctaa attgatgtat cagtgctgca aacttgatgt catggaagat 6180cttatgagaa aattcttgaa gactgagagg aaaaattttg tagtacaaca caaagaatcc 6240tgtttttcat agtcggacta gacacattaa cataaaacac cacttcattc gaagagtgat 6300tgaagaagga aatgtgcagt tacctttctg cagttcataa gagcaactta cagacacttt 6360tactaaaata ctacaaagag gaagatttta acaacttaga gaagtaatgg gagttaaaga 6420gcaacacatt aagggggagt gttaaaatta atgtgttgta accaccacta cctttagtaa 6480gtattataag aaaattgtaa tcatcacatt ataattattg tccttattta aaattatgat 6540aaagttgtat cattaagatt gagaaaacca aatagtcctc gtcttgattt ttgaattatt 6600gttttctatg ttacttttct tcaagcctat ataaaaactt tgtaatgcta aattgtatgc 6660tggaaaaaaa tgtgtaatga attgaataga aattatggta tttcaaagtc caaaatccat 6720caatagaaat ttagtacaaa acgtaactca aaaatattct cttattttaa attttacaac 6780aatataaaaa tattctctta ttttaaattt tacaataata taatttatca cctgtcacct 6840ttagaatacc accaacaata ttaatactta gatattttat tcttaataat tttgagatct 6900ctcaatatat ctgatattta ttttatattt gtgtcatatt ttcttatgtt ttagagttaa 6960cccttatatc ttggtcaaac tagtaattca atatatgagt ttgtgaagga cacattgaca 7020tcttgaaaca ttggttttaa ccttgttgga atgttaaagg taataaaaca ttcagaatta 7080tgaccatcta ttaatatact tcctttgtct tttaaaaaag tgtgcatgaa aatgctctat 7140ggtaagctag agtgtcttgc tggcctgtgt atatcaattc catttccaga tggtagaaac 7200tgccactacg aataattagt cataagacac gtatgttaac acacgtcccc ttgcatgttt 7260tttgccatat attccgtctc tttctttttc ttcacgtata aaacaatgaa ctaattaata 7320gagcgatcaa gctgaacagt tctttgcttt cgaagttgcc gcaacctaaa caggtttttc 7380cttcttcttt cttcttatta actacgacct tgtcctttgc ctatgtaaaa ttactaggtt 7440ttcatcagtt acactgatta agttcgttat agtggaagat aaaatgccct caaagcattt 7500tgcaggatat ctttgatttt tcaaagatat ggaactgtag agtttgatag tgttcttgaa 7560tgtggttgca tgaagttttt ttggtctgca tgttattttt tcctcgaaat atgttttgag 7620tccaacaagt gattcacttg ggattcagaa agttgttttc tcaatatgta acagtttttt 7680tctatggaga aaaatcatag ggaccgttgg ttttggcttc tttaattttg agctcagatt 7740aaacccattt tacccggtgt tcttggcaga attgaaaaca gtacgtagta ccgcgcctac 7800catgtgtgtt gagaccgaga acaacgatgg aatccctact gtggagatcg ctttcgatgg 7860agagagagaa agagctgagg ctaacgtgaa gttgtctgct gagaagatgg aacctgctgc 7920tttggctaag accttcgcta gaagatacgt ggttatcgag ggagttgagt acgatgtgac 7980cgatttcaaa catcctggag gaaccgtgat tttctacgct ctctctaaca ctggagctga 8040tgctactgag gctttcaagg agttccacca cagatctaga aaggctagga aggctttggc 8100tgctttgcct tctagacctg ctaagaccgc taaagtggat gatgctgaga tgctccagga 8160tttcgctaag tggagaaagg agttggagag ggacggattc ttcaagcctt ctcctgctca 8220tgttgcttac agattcgctg agttggctgc tatgtacgct ttgggaacct acttgatgta 8280cgctagatac gttgtgtcct ctgtgttggt ttacgcttgc ttcttcggag ctagatgtgg 8340atgggttcaa cacgagggag gacactcttc tttgaccgga aacatctggt gggataagag 8400aatccaagct ttcactgctg gattcggatt ggctggatct ggagatatgt ggaactccat 8460gcacaacaag caccacgcta ctcctcaaaa agtgaggcac gatatggatt tggataccac 8520tcctgctgtt gctttcttca acaccgctgt ggaggataat agacctaggg gattctctaa 8580gtactggctc agattgcaag cttggacctt cattcctgtg acttctggat tggtgttgct 8640cttctggatg ttcttcctcc acccttctaa ggctttgaag ggaggaaagt acgaggagct 8700tgtgtggatg ttggctgctc acgtgattag aacctggacc attaaggctg ttactggatt 8760caccgctatg caatcctacg gactcttctt ggctacttct tgggtttccg gatgctactt 8820gttcgctcac ttctctactt ctcacaccca cttggatgtt gttcctgctg atgagcactt 8880gtcttgggtt aggtacgctg tggatcacac cattgatatc gatccttctc agggatgggt 8940taactggttg atgggatact tgaactgcca agtgattcac cacctcttcc cttctatgcc 9000tcaattcaga caacctgagg tgtccagaag attcgttgct ttcgctaaga agtggaacct 9060caactacaag gtgatgactt atgctggagc ttggaaggct actttgggaa acctcgataa 9120tgtgggaaag cactactacg tgcacggaca acactctgga aagaccgctt gattaattaa 9180ggccgcctcg accgtacccc ctgcagatag actatactat gttttagcct gcctgctggc 9240tagctactat gttatgttat gttgtaaaat aaacacctgc taaggtatat ctatctatat 9300tttagcatgg ctttctcaat aaattgtctt tccttatcgt ttactatctt atacctaata 9360atgaaataat aatatcacat atgaggaacg gggcaggttt aggcatatat atacgagtgt 9420agggcggagt ggggggcgcc tactaccggt aattcccggg attagcggcc gctagtctgt 9480gcgcacttgt atcctgcagg ttaggccggc cacacgggca ggacataggg actactacaa 9540gcatagtatg cttcagacaa agagctagga aagaactctt gatggaggtt aagagaaaaa 9600agtgctagag gggcatagta atcaaacttg tcaaaaccgt catcatgatg agggatgaca 9660taatataaaa agttgactaa ggtcttggta gtactctttg attagtatta tatattggtg 9720agaacatgag tcaagaggag acaagaaacc gaggaaccat agtttagcaa caagatggaa 9780gttgcaaagt tgagctagcc gctcgattag ttacatctcc taagcagtac tacaaggaat 9840ggtctctata ctttcatgtt tagcacatgg tagtgcggat tgacaagtta gaaacagtgc 9900ttaggagaca aagagtcagt aaaggtattg aaagagtgaa gttgatgctc gacaggtcag 9960gagaagtccc tccgccagat ggtgactacc aaggggttgg tatcagctga gacccaaata 10020agattcttcg gttgaaccag tggttcgacc gagactctta gggtgggatt tcactgtaag 10080atttgtgcat tttgttgaat ataaattgac aatttttttt atttaattat agattattta 10140gaatgaatta catatttagt ttctaacaag gatagcaatg gatgggtatg ggtacaggtt 10200aaacatatct attacccacc catctagtcg tcgggtttta cacgtaccca cccgtttaca 10260taaaccagac cggaatttta aaccgtaccc gtccgttagc gggtttcaga tttacccgtt 10320taatcgggta aaacctgatt actaaatata tattttttat ttgataaaca aaacaaaaat 10380gttaatattt tcatattgga tgcaatttta agaaacacat attcataaat ttccatattt 10440gtaggaaaat aaaaagaaaa atatattcaa gaacacaaat ttcaccgaca tgacttttat 10500tacagagttg gaattagatc taacaattga aaaattaaaa ttaagataga atatgttgag 10560gaacatgaca tagtataatg ctgggttacc cgtcgggtag gtatcgaggc ggatactact 10620aaatccatcc cactcgctat ccgataatca ctggtttcgg gtatacccat tcccgtcaac 10680aggccttttt aaccggataa tttcaactta tagtgaatga attttgaata aatagttaga 10740ataccaaaat cctggattgc atttgcaatc aaattttgtg aaccgttaaa ttttgcatgt 10800acttgggata gatataatag aaccgaattt tcattagttt aatttataac ttactttgtt 10860caaagaaaaa aaatatctat ccaatttact tataataaaa aataatctat ccaagttact 10920tattataatc aacttgtaaa aaggtaagaa tacaaatgtg gtagcgtacg tgtgattata 10980tgtgacgaaa tgttatatct aacaaaagtc caaattccca tggtaaaaaa aatcaaaatg 11040catggcaggc tgtttgtaac cttggaataa gatgttggcc aattctggag ccgccacgta 11100cgcaagactc agggccacgt tctcttcatg caaggatagt agaacaccac tccacccacc 11160tcctatatta gacctttgcc caaccctccc caactttccc atcccatcca caaagaaacc 11220gacattttta tcataaatct ggtgcttaaa cactctggtg agttctagta cttctgctat 11280gatcgatctc attaccattt cttaaatttc tctccctaaa tattccgagt tcttgatttt 11340tgataacttc aggttttctc tttttgataa atctggtctt tccatttttt tttttttgtg 11400gttaatttag tttcctatgt tcttcgattg tattatgcat gatctgtgtt tggattctgt 11460tagattatgt attggtgaat atgtatgtgt ttttgcatgt ctggttttgg tcttaaaaat 11520gttcaaatct gatgatttga ttgaagcttt tttagtgttg gtttgattct tctcaaaact 11580actgttaatt tactatcatg ttttccaact ttgattcatg atgacacttt tgttctgctt 11640tgttataaaa ttttggttgg tttgattttg taattatagt gtaattttgt taggaatgaa 11700catgttttaa tactctgttt tcgatttgtc acacattcga attattaatc gataatttaa 11760ctgaaaattc atggttctag atcttgttgt catcagatta tttgtttcga taattcatca 11820aatatgtagt ccttttgctg atttgcgact gtttcatttt ttctcaaaat tgttttttgt 11880taagtttatc taacagttat cgttgtcaaa agtctctttc attttgcaaa atcttctttt 11940tttttttgtt tgtaactttg ttttttaagc tacacattta gtctgtaaaa tagcatcgag 12000gaacagttgt cttagtagac ttgcatgttc ttgtaacttc tatttgtttc agtttgttga 12060tgactgcttt gattttgtag gtcaaaggcg cgccctacca tggatgctta taacgctgct 12120atggataaga ttggagctgc tatcatcgat tggagtgatc cagatggaaa gttcagagct 12180gatagggagg attggtggtt gtgcgatttc agatccgcta tcaccattgc tctcatctac 12240atcgctttcg tgatcttggg atctgctgtg atgcaatctc tcccagctat ggacccatac 12300cctatcaagt tcctctacaa cgtgtctcaa atcttcctct gcgcttacat gactgttgag 12360gctggattcc tcgcttatag gaacggatac accgttatgc catgcaacca cttcaacgtg 12420aacgatccac cagttgctaa cttgctctgg ctcttctaca tctccaaagt gtgggatttc 12480tgggatacca tcttcattgt gctcggaaag aagtggagac aactctcttt cttgcacgtg 12540taccaccaca ccaccatctt cctcttctac tggttgaacg ctaacgtgct ctacgatgga 12600gatatcttct tgaccatcct cctcaacgga ttcattcaca ccgtgatgta cacctactac 12660ttcatctgca tgcacaccaa ggattctaag accggaaagt ctttgccaat ctggtggaag 12720tcatctttga ccgctttcca actcttgcaa ttcaccatca tgatgtccca agctacctac 12780ttggttttcc acggatgcga taaggtttcc ctcagaatca ccatcgtgta cttcgtgtac 12840attctctccc ttttcttcct cttcgctcag ttcttcgtgc aatcctacat ggctccaaag 12900aagaagaagt ccgcttgatg ttaattaagg ccgcagatat cagatctggt cgacctagag 12960gatccccggc cgcaaagata ataacaaaag cctactatat aacgtacatg caagtattgt 13020atgatattaa tgtttttacg tacgtgtaaa caaaaataat tacgtttgta acgtatggtg 13080atgatgtggt gcactaggtg taggccttgt attaataaaa agaagtttgt tctatataga 13140gtggtttagt acgacgattt atttactagt cggattggaa tagagaaccg aattcttcaa 13200tccttgcttt tgatcaagaa ttgaaaccga atcaaatgta aaagttgata tatttgaaaa 13260acgtattgag cttatgaaaa tgctaatact ctcatctgta tggaaaagtg actttaaaac 13320cgaacttaaa agtgacaaaa ggggaatatc gcatcaaacc gaatgaaacc gatggcgcct 13380accggtatcg gtccgattgc ggccgcttaa agggcgaatt cgtttaaaca ctgtacggac 13440cgtggcctaa taggccggta ccacccagct ttcttgtaca aagtggccat gattacgcca 13500agcttggcca ctaaggccaa tttaaatcta ctaggccggc cataaggatg acctacccat 13560tcttgagaca aatgttacat tttagtatca gagtaaaatg tgtacctata actcaaattc 13620gattgacatg tatccattca acataaaatt aaaccagcct gcacctgcat ccacatttca 13680agtattttca aaccgttcgg ctcctatcca ccgggtgtaa caagacggat tccgaatttg 13740gaagattttg actcaaattc ccaatttata ttgaccgtga ctaaatcaac tttaacttct 13800ataattctga ttaagctccc aatttatatt cccaacggca ctacctccaa aatttataga 13860ctctcatccc cttttaaacc aacttagtaa acgttttttt tttaatttta tgaagttaag 13920tttttacctt gtttttaaaa agaatcgttc ataagatgcc atgccagaac attagctaca 13980cgttacacat agcatgcagc cgcggagaat tgtttttctt cgccacttgt cactcccttc 14040aaacacctaa gagcttctct ctcacagcac acacatacaa tcacatgcgt gcatgcatta 14100ttacacgtga tcgccatgca aatctccttt atagcctata aattaactca tcggcttcac 14160tctttactca aaccaaaact catcaataca aacaagatta aaaacatttc acgatttgga 14220atttgattcc tgcgatcaca ggtatgacag gttagatttt gttttgtata gttgtataca 14280tacttctttg tgatgttttg tttacttaat cgaatttttg gagtgtttta aggtctctcg 14340tttagaaatc gtggaaaata tcactgtgtg tgtgttctta tgattcacag tgtttatggg 14400tttcatgttc tttgttttat cattgaatgg gaagaaattt cgttgggata caaatttctc 14460atgttcttac tgatcgttat taggagtttg gggaaaaagg aagagttttt ttggttggtt 14520cgagtgatta tgaggttatt tctgtatttg atttatgagt taatggtcgt tttaatgttg 14580tagaccgcca tggctatttt gaaccctgag gctgattctg ctgctaacct cgctactgat 14640tctgaggcta agcaaagaca attggctgag gctggataca ctcatgttga gggtgctcct 14700gctcctttgc ctttggagtt gcctcatttc tctctcagag atctcagagc tgctattcct 14760aagcactgct tcgagagatc tttcgtgacc tccacctact acatgatcaa gaacgtgttg 14820acttgcgctg ctttgttcta cgctgctacc ttcattgata gagctggagc tgctgcttat 14880gttttgtggc ctgtgtactg gttcttccag ggatcttact tgactggagt gtgggttatc 14940gctcatgagt gtggacatca ggcttattgc tcttctgagg tggtgaacaa cttgattgga 15000ctcgtgttgc attctgcttt gttggtgcct taccactctt ggagaatctc tcacagaaag 15060caccattcca acactggatc ttgcgagaac gatgaggttt tcgttcctgt gaccagatct 15120gtgttggctt cttcttggaa cgagaccttg gaggattctc ctctctacca actctaccgt 15180atcgtgtaca tgttggttgt tggatggatg cctggatacc tcttcttcaa cgctactgga 15240cctactaagt actggggaaa gtctaggtct cacttcaacc cttactccgc

tatctatgct 15300gatagggaga gatggatgat cgtgctctcc gatattttct tggtggctat gttggctgtt 15360ttggctgctt tggtgcacac tttctccttc aacaccatgg tgaagttcta cgtggtgcct 15420tacttcattg tgaacgctta cttggtgttg attacctacc tccaacacac cgatacctac 15480atccctcatt tcagagaggg agagtggaat tggttgagag gagctttgtg cactgtggat 15540agatcatttg gtccattcct cgattctgtg gtgcatagaa tcgtggatac ccatgtttgc 15600caccacatct tctccaagat gcctttctat cattgcgagg aggctaccaa cgctattaag 15660cctctcctcg gaaagttcta cttgaaggat accactcctg ttcctgttgc tctctggaga 15720tcttacaccc attgcaagtt cgttgaggat gatggaaagg tggtgttcta caagaacaag 15780ctctagttaa ttaataattg attggttcga gtattatggc attgggaaaa ctgtttttct 15840tgtaccattt gttgtgcttg taatttactg tgttttttat tcggttttcg ctatcgaact 15900gtgaaatgga aatggatgga gaagagttaa tgaatgatat ggtccttttg ttcattctca 15960aattaatatt atttgttttt tctcttattt gttgtgtgtt gaatttgaaa ttataagaga 16020tatgcaaaca ttttgttttg agtaaaaatg tgtcaaatcg tggcctctaa tgaccgaagt 16080taatatgagg agtaaaacac ttgtagttgt accattatgc ttattcacta ggcaacaaat 16140atattttcag acctagaaaa gctgcaaatg ttactgaata caagtatgtc ctcttgtgtt 16200ttagacattt atgaactttc ctttatgtaa ttttccagaa tccttgtcag attctaatca 16260ttgctttata attatagtta tactcatgga tttgtagttg agtatgaaaa tattttttaa 16320tgcattttat gacttgccaa ttgattgaca acatgcatca atggcgccta ctaccggtaa 16380ttcccgggat tagcggccgc tagtctgtgc gcacttgtat cctgcaggtc aatcgtttaa 16440acactgtacg gaccgtggcc taataggccg gtacccaact ttattataca tagttgataa 16500ttcactggcc ggatgtaccg aattcgcggc cgcaagcttg tacactagta cgcgtcaatt 16560ggcgatcgcg gatctgagat gaaaccggtg attatcagaa ccttttatgg tctttgtatg 16620catatggtaa aaaaacttag tttgcaattt cctgtttgtt ttggtaattt gagtttcttt 16680tagttgttga tctgcctgct ttttggttta cgtcagacta ctactgctgt tgttgtttgg 16740tttcctttct ttcattttat aaataaataa tccggttcgg tttactcctt gtgactggct 16800cagtttggtt attgcgaaat gcgaatggta aattgagtaa ttgaaattcg ttattagggt 16860tctaagctgt tttaacagtc actgggttaa tatctctcga atcttgcatg gaaaatgctc 16920ttaccattgg tttttaattg aaatgtgctc atatgggccg tggtttccaa attaaataaa 16980actacgatgt catcgagaag taaaatcaac tgtgtccaca ttatcagttt tgtgtatacg 17040atgaaatagg gtaattcaaa atctagcttg atatgccttt tggttcattt taaccttctg 17100taaacatttt ttcagatttt gaacaagtaa atccaaaaaa aaaaaaaaaa aatctcaact 17160caacactaaa ttattttaat gtataaaaga tgcttaaaac atttggctta aaagaaagaa 17220gctaaaaaca tagagaactc ttgtaaattg aagtatgaaa atatactgaa ttgggtatta 17280tatgaatttt tctgatttag gattcacatg atccaaaaag gaaatccaga agcactaatc 17340agacattgga agtaggaata tttcaaaaag tttttttttt taagtaagtg acaaaagctt 17400ttaaaaaata gaaaagaaac tagtattaaa gttgtaaatt taataaacaa aagaaatttt 17460ttatattttt tcatttcttt ttccagcatg aggttatgat ggcaggatgt ggatttcatt 17520tttttccttt tgatagcctt ttaattgatc tattataatt gacgaaaaaa tattagttaa 17580ttatagatat attttaggta gtattagcaa tttacacttc caaaagacta tgtaagttgt 17640aaatatgatg cgttgatctc ttcatcattc aatggttagt caaaaaaata aaagcttaac 17700tagtaaacta aagtagtcaa aaattgtact ttagtttaaa atattacatg aataatccaa 17760aacgacattt atgtgaaaca aaaacaatat agatccatta ccctgttatc cctagagggg 17820aaaattcgaa tccaaaaatt acggatatga atataggcat atccgtatcc gaattatccg 17880tttgacagct agcaacgatt gtacaattgc ttctttaaaa aaggaagaaa gaaagaaaga 17940aaagaatcaa catcagcgtt aacaaacggc cccgttacgg cccaaacggt catatagagt 18000aacggcgtta agcgttgaaa gactcctatc gaaatacgta accgcaaacg tgtcatagtc 18060agatcccctc ttccttcacc gcctcaaaca caaaaataat cttctacagc ctatatatac 18120aaccccccct tctatctctc ctttctcaca attcatcatc tttctttctc tacccccaat 18180tttaagaaat cctctcttct cctcttcatt ttcaaggtaa atctctctct ctctctctct 18240ctctgttatt ccttgtttta attaggtatg tattattgct agtttgttaa tctgcttatc 18300ttatgtatgc cttatgtgaa tatctttatc ttgttcatct catccgttta gaagctataa 18360atttgttgat ttgactgtgt atctacacgt ggttatgttt atatctaatc agatatgaat 18420ttcttcatat tgttgcgttt gtgtgtacca atccgaaatc gttgattttt ttcatttaat 18480cgtgtagcta attgtacgta tacatatgga tctacgtatc aattgttcat ctgtttgtgt 18540ttgtatgtat acagatctga aaacatcact tctctcatct gattgtgttg ttacatacat 18600agatatagat ctgttatatc atttttttta ttaattgtgt atatatatat gtgcatagat 18660ctggattaca tgattgtgat tatttacatg attttgttat ttacgtatgt atatatgtag 18720atctggactt tttggagttg ttgacttgat tgtatttgtg tgtgtatatg tgtgttctga 18780tcttgatatg ttatgtatgt gcagctgaac catggcggcg gcaacaacaa caacaacaac 18840atcttcttcg atctccttct ccaccaaacc atctccttcc tcctccaaat caccattacc 18900aatctccaga ttctccctcc cattctccct aaaccccaac aaatcatcct cctcctcccg 18960ccgccgcggt atcaaatcca gctctccctc ctccatctcc gccgtgctca acacaaccac 19020caatgtcaca accactccct ctccaaccaa acctaccaaa cccgaaacat tcatctcccg 19080attcgctcca gatcaacccc gcaaaggcgc tgatatcctc gtcgaagctt tagaacgtca 19140aggcgtagaa accgtattcg cttaccctgg aggtacatca atggagattc accaagcctt 19200aacccgctct tcctcaatcc gtaacgtcct tcctcgtcac gaacaaggag gtgtattcgc 19260agcagaagga tacgctcgat cctcaggtaa accaggtatc tgtatagcca cttcaggtcc 19320cggagctaca aatctcgtta gcggattagc cgatgcgttg ttagatagtg ttcctcttgt 19380agcaatcaca ggacaagtcc ctcgtcgtat gattggtaca gatgcgtttc aagagactcc 19440gattgttgag gtaacgcgtt cgattacgaa gcataactat cttgtgatgg atgttgaaga 19500tatccctagg attattgagg aagctttctt tttagctact tctggtagac ctggacctgt 19560tttggttgat gttcctaaag atattcaaca acagcttgcg attcctaatt gggaacaggc 19620tatgagatta cctggttata tgtctaggat gcctaaacct ccggaagatt ctcatttgga 19680gcagattgtt aggttgattt ctgagtctaa gaagcctgtg ttgtatgttg gtggtggttg 19740tttgaattct agcgatgaat tgggtaggtt tgttgagctt acggggatcc ctgttgcgag 19800tacgttgatg gggctgggat cttatccttg tgatgatgag ttgtcgttac atatgcttgg 19860aatgcatggg actgtgtatg caaattacgc tgtggagcat agtgatttgt tgttggcgtt 19920tggggtaagg tttgatgatc gtgtcacggg taagcttgag gcttttgcta gtagggctaa 19980gattgttcat attgatattg actcggctga gattgggaag aataagactc ctcatgtgtc 20040tgtgtgtggt gatgttaagc tggctttgca agggatgaat aaggttcttg agaaccgagc 20100ggaggagctt aagcttgatt ttggagtttg gaggaatgag ttgaacgtac agaaacagaa 20160gtttccgttg agctttaaga cgtttgggga agctattcct ccacagtatg cgattaaggt 20220ccttgatgag ttgactgatg gaaaagccat aataagtact ggtgtcgggc aacatcaaat 20280gtgggcggcg cagttctaca attacaagaa accaaggcag tggctatcat caggaggcct 20340tggagctatg ggatttggac ttcctgctgc gattggagcg tctgttgcta accctgatgc 20400gatagttgtg gatattgacg gagatggaag ctttataatg aatgtgcaag agctagccac 20460tattcgtgta gagaatcttc cagtgaaggt acttttatta aacaaccagc atcttggcat 20520ggttatgcaa tgggaagatc ggttctacaa agctaaccga gctcacacat ttctcgggga 20580tccggctcag gaggacgaga tattcccgaa catgttgctg tttgcagcag cttgcgggat 20640tccagcggcg agggtgacaa agaaagcaga tctccgagaa gctattcaga caatgctgga 20700tacaccagga ccttacctgt tggatgtgat ttgtccgcac caagaacatg tgttgccgat 20760gatcccgaat ggtggcactt tcaacgatgt cataacggaa ggagatggcc ggattaaata 20820ctgataggga taacagggta atctcgacga gatgaaaccg gtgattatca gaacctttta 20880tggtctttgt atgcatatgg taaaaaaact tagtttgcaa tttcctgttt gttttggtaa 20940tttgagtttc ttttagttgt tgatctgcct gctttttggt ttacgtcaga ctactactgc 21000tgttgttgtt tggtttcctt tctttcattt tataaataaa taatccggtt cggtttactc 21060cttgtgactg gctcagtttg gttattgcga aatgcgaatg gtaaattgag taattgaaat 21120tcgttattag ggttctaagc tgttttaaca gtcactgggt taatatctct cgaatcttgc 21180atggaaaatg ctcttaccat tggtttttaa ttgaaatgtg ctcatatggg ccgtggtttc 21240caaattaaat aaaactacga tgtcatcgag aagtaaaatc aactgtgtcc acattatcag 21300ttttgtgtat acgatgaaat agggtaattc aaaatctagc ttgatatgcc ttttggttca 21360ttttaacctt ctgtaaacat tttttcagat tttgaacaag taaatccaaa aaaaaaaaaa 21420aaaaatctca actcaacact aaattatttt aatgtataaa agatgcttaa aacatttggc 21480ttaaaagaaa gaagctaaaa acatagagaa ctcttgtaaa ttgaagtatg aaaatatact 21540gaattgggta ttatatgaat ttttctgatt taggattcac atgatccaaa aaggaaatcc 21600agaagcacta atcagacatt ggaagtagga atatttcaaa aagttttttt tttttaagta 21660agtgacaaaa gcttttaaaa aatagaaaag aaactagtat taaagttgta aatttaataa 21720acaaaagaaa ttttttatat tttttcattt ctttttccag catgaggtta tgatggcagg 21780atgtggattt catttttttc cttttgatag ccttttaatt gatctattat aattgacgaa 21840aaaatattag ttaattatag atatatttta ggtagtatta gcaatttaca cttccaaaag 21900actatgtaag ttgtaaatat gatgcgttga tctcttcatc attcaatggt tagtcaaaaa 21960aataaaagct taactagtaa actaaagtag tcaaaaattg tactttagtt taaaatatta 22020catgaataat ccaaaacgac atttatgtga aacaaaaaca atatgtcgag gcgatcgcag 22080tacttaatca gtgatcagta actaaattca gtacattaaa gacgtccgca atgtgttatt 22140aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 22200gctccccgac cggcagctcg gcacaaaatc actgatcatc taaaaaggtg atgtgtattt 22260gagtaaaaca gcttgcgtca tgcggtcgct gcgtatatga tgcgatgagt aaataaacaa 22320atacgcaagg ggaacgcatg aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca 22380agacgaccat cgcaacccat ctagcccgcg ccctgcaact cgccggggcc gatgttctgt 22440tagtcgattc cgatccccag ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac 22500cgctaaccgt tgtcggcatc gaccgcccga cgattgaccg cgacgtgaag gccatcggcc 22560ggcgcgactt cgtagtgatc gacggagcgc cccaggcggc ggacttggct gtgtccgcga 22620tcaaggcagc cgacttcgtg ctgattccgg tgcagccaag cccttacgac atttgggcca 22680ccgccgacct ggtggagctg gttaagcagc gcattgaggt cacggatgga aggctacaag 22740cggcctttgt cgtgtcgcgg gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg 22800cgctggccgg gtacgagctg cccattcttg agtcccgtat cacgcagcgc gtgagctacc 22860caggcactgc cgccgccggc acaaccgttc ttgaatcaga acccgagggc gacgctgccc 22920gcgaggtcca ggcgctggcc gctgaaatta aatcaaaact catttgagtt aatgaggtaa 22980agagaaaatg agcaaaagca caaacacgct aagtgccggc cgtccgagcg cacgcagcag 23040caaggctgca acgttggcca gcctggcaga cacgccagcc atgaagcggg tcaactttca 23100gttgccggcg gaggatcaca ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat 23160taccgagctg ctatctgaat acatcgcgca gctaccagag taaatgagca aatgaataaa 23220tgagtagatg aattttagcg gctaaaggag gcggcatgga aaatcaagaa caaccaggca 23280ccgacgccgt ggaatgcccc atgtgtggag gaacgggcgg ttggccaggc gtaagcggct 23340gggttgtctg ccggccctgc aatggcactg gaacccccaa gcccgaggaa tcggcgtgag 23400cggtcgcaaa ccatccggcc cggtacaaat cggcgcggcg ctgggtgatg acctggtgga 23460gaagttgaag gccgcgcagg ccgcccagcg gcaacgcatc gaggcagaag cacgccccgg 23520tgaatcgtgg caaggggccg ctgatcgaat ccgcaaagaa tcccggcaac cgccggcagc 23580cggtgcgccg tcgattagga agccgcccaa gggcgacgag caaccagatt ttttcgttcc 23640gatgctctat gacgtgggca cccgcgatag tcgcagcatc atggacgtgg ccgttttccg 23700tctgtcgaag cgtgaccgac gagctggcga ggtgatccgc tacgagcttc cagacgggca 23760cgtagaggtt tccgcaggcc ccgccggcat ggccagtgtg tgggattacg acctggtact 23820gatggcggtt tcccatctaa ccgaatccat gaaccgatac cgggaaggga agggagacaa 23880gcccggccgc gtgttccgtc cacacgttgc ggacgtactc aagttctgcc ggcgagccga 23940tggcggaaag cagaaagacg acctggtaga aacctgcatt cggttaaaca ccacgcacgt 24000tgccatgcag cgtaccaaga aggccaagaa cggccgcctg gtgacggtat ccgagggtga 24060agccttgatt agccgctaca agatcgtaaa gagcgaaacc gggcggccgg agtacatcga 24120gatcgagctt gctgattgga tgtaccgcga gatcacagaa ggcaagaacc cggacgtgct 24180gacggttcac cccgattact ttttgatcga ccccggcatc ggccgttttc tctaccgcct 24240ggcacgccgc gccgcaggca aggcagaagc cagatggttg ttcaagacga tctacgaacg 24300cagtggcagc gccggagagt tcaagaagtt ctgtttcacc gtgcgcaagc tgatcgggtc 24360aaatgacctg ccggagtacg atttgaagga ggaggcgggg caggctggcc cgatcctagt 24420catgcgctac cgcaacctga tcgagggcga agcatccgcc ggttcctaat gtacggagca 24480gatgctaggg caaattgccc tagcagggga aaaaggtcga aaaggtctct ttcctgtgga 24540tagcacgtac attgggaacc caaagccgta cattgggaac cggaacccgt acattgggaa 24600cccaaagccg tacattggga accggtcaca catgtaagtg actgatataa aagagaaaaa 24660aggcgatttt tccgcctaaa actctttaaa acttattaaa actcttaaaa cccgcctggc 24720ctgtgcataa ctgtctggcc agcgcacagc cgaagagctg caaaaagcgc ctacccttcg 24780gtcgctgcgc tccctacgcc ccgccgcttc gcgtcggcct atcgcggcct atgcggtgtg 24840aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc 24900tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 24960cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 25020gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 25080gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 25140gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 25200ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 25260atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 25320tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 25380ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 25440gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 25500ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 25560ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 25620agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 25680ggtccttcaa ctcatcgata gtttggctgt gagcaattat gtgcttagtg catctaacgc 25740ttgagttaag ccgcgccgcg aagcggcgtc ggcttgaacg aatttctagc tagacattat 25800ttgccaacga ccttcgtgat ctcgcccttg acatagtgga caaattcttc gagctggtcg 25860gcccgggacg cgagacggtc ttcttcttgg cccagatagg cttggcgcgc ttcgaggatc 25920acgggctggt attgcgccgg aaggcgctcc atcgcccagt cggcggcgac atccttcggc 25980gcgatcttgc cggtaaccgc cgagtaccaa atccggctca gcgtaaggac cacattgcgc 26040tcatcgcccg cccaatccgg cggggagttc cacagggtca gcgtctcgtt cagtgcttcg 26100aacagatcct gttccggcac cgggtcgaaa agttcctcgg ccgcggggcc gacgagggcc 26160acgctatgct cccgggcctt ggtgagcagg atcgccagat caatgtcgat ggtggccggt 26220tcaaagatac ccgccagaat atcattacgc tgccattcgc cgaactggag ttcgcgtttg 26280gccggatagc gccaggggat gatgtcatcg tgcaccacaa tcgtcacctc aaccgcgcgc 26340aggatttcgc tctcgccggg ggaggcggac gtttccagaa ggtcgttgat aagcgcgcgg 26400cgcgtggtct cgtcgagacg gacggtaacg gtgacaagca ggtcgatgtc cgaatggggc 26460ttaaggccgc cgtcaacggc gctaccatac agatgcacgg cgaggagggt cggttcgagg 26520tggcgctcga tgacacccac gacttccgac agctgggtgg acacctcggc gatgaccgct 26580tcacccatga tgtttaactt tgttttaggg cgactgccct gctgcgtaac atcgttgctg 26640ctccataaca tcaaacatcg acccacggcg taacgcgctt gctgcttgga tgcccgaggc 26700atagactgta ccccaaaaaa acagtcataa caagccatga aaaccgccac tgcgttccat 26760gaatattcaa acaaacacat acagcgcgac ttatcatgga ta 268021472254DNAArtificial Sequencep-VfSBP-NEENAss2 expression element 147tcgacggccc ggactgtatc caacttctga tctttgaatc tctctgttcc aacatgttct 60gaaggagttc taagactttt cagaaagctt gtaacatgct ttgtagactt tctttgaatt 120actcttgcaa actctgattg aacctacgtg aaaactgctc cagaagttct aaccaaattc 180cgtcttggga aggcccaaaa tttattgagt acttcagttt catggacgtg tcttcaaaga 240tttataactt gaaatcccat catttttaag agaagttctg ttccgcaatg tcttagatct 300cattgaaatc tacaactctt gtgtcagaag ttcttccaga atcaacttgc atcatggtga 360aaatctggcc agaagttctg aacttgtcat atttcttaac agttagaaaa atttctaagt 420gtttagaatt ttgacttttc caaagcaaac ttgacttttg actttcttaa taaaacaaac 480ttcatattct aacatgtctt gatgaaatgt gattcttgaa atttgatgtt gatgcaaaag 540tcaaagtttg acttttcagt gtgcaattga ccattttgct cttgtgccaa ttccaaacct 600aaattgatgt atcagtgctg caaacttgat gtcatggaag atcttatgag aaaattcttg 660aagactgaga ggaaaaattt tgtagtacaa cacaaagaat cctgtttttc atagtcggac 720tagacacatt aacataaaac accacttcat tcgaagagtg attgaagaag gaaatgtgca 780gttacctttc tgcagttcat aagagcaact tacagacact tttactaaaa tactacaaag 840aggaagattt taacaactta gagaagtaat gggagttaaa gagcaacaca ttaaggggga 900gtgttaaaat taatgtgttg taaccaccac tacctttagt aagtattata agaaaattgt 960aatcatcaca ttataattat tgtccttatt taaaattatg ataaagttgt atcattaaga 1020ttgagaaaac caaatagtcc tcgtcttgat ttttgaatta ttgttttcta tgttactttt 1080cttcaagcct atataaaaac tttgtaatgc taaattgtat gctggaaaaa aatgtgtaat 1140gaattgaata gaaattatgg tatttcaaag tccaaaatcc atcaatagaa atttagtaca 1200aaacgtaact caaaaatatt ctcttatttt aaattttaca acaatataaa aatattctct 1260tattttaaat tttacaataa tataatttat cacctgtcac ctttagaata ccaccaacaa 1320tattaatact tagatatttt attcttaata attttgagat ctctcaatat atctgatatt 1380tattttatat ttgtgtcata ttttcttatg ttttagagtt aacccttata tcttggtcaa 1440actagtaatt caatatatga gtttgtgaag gacacattga catcttgaaa cattggtttt 1500aaccttgttg gaatgttaaa ggtaataaaa cattcagaat tatgaccatc tattaatata 1560cttcctttgt cttttaaaaa agtgtgcatg aaaatgctct atggtaagct agagtgtctt 1620gctggcctgt gtatatcaat tccatttcca gatggtagaa actgccacta cgaataatta 1680gtcataagac acgtatgtta acacacgtcc ccttgcatgt tttttgccat atattccgtc 1740tctttctttt tcttcacgta taaaacaatg aactaattaa tagagcgatc aagctgaaca 1800gttctttgct ttcgaagttg ccgcaaccta aacaggtttt tccttcttct ttcttcttat 1860taactacgac cttgtccttt gcctatgtaa aattactagg ttttcatcag ttacactgat 1920taagttcgtt atagtggaag ataaaatgcc ctcaaagcat tttgcaggat atctttgatt 1980tttcaaagat atggaactgt agagtttgat agtgttcttg aatgtggttg catgaagttt 2040ttttggtctg catgttattt tttcctcgaa atatgttttg agtccaacaa gtgattcact 2100tgggattcag aaagttgttt tctcaatatg taacagtttt tttctatgga gaaaaatcat 2160agggaccgtt ggttttggct tctttaattt tgagctcaga ttaaacccat tttacccggt 2220gttcttggca gaattgaaaa cagtacgtag tacc 22541482568DNAArtificial Sequencep-LuPxr-NEENAss1 expression element 148cacgggcagg acatagggac tactacaagc atagtatgct tcagacaaag agctaggaaa 60gaactcttga tggaggttaa gagaaaaaag tgctagaggg gcatagtaat caaacttgtc 120aaaaccgtca tcatgatgag ggatgacata atataaaaag ttgactaagg tcttggtagt 180actctttgat tagtattata tattggtgag aacatgagtc aagaggagac aagaaaccga 240ggaaccatag tttagcaaca agatggaagt tgcaaagttg agctagccgc tcgattagtt 300acatctccta agcagtacta caaggaatgg tctctatact ttcatgttta gcacatggta 360gtgcggattg acaagttaga aacagtgctt aggagacaaa gagtcagtaa aggtattgaa 420agagtgaagt tgatgctcga caggtcagga gaagtccctc cgccagatgg tgactaccaa 480ggggttggta tcagctgaga cccaaataag attcttcggt tgaaccagtg gttcgaccga 540gactcttagg gtgggatttc actgtaagat ttgtgcattt tgttgaatat aaattgacaa 600ttttttttat ttaattatag attatttaga atgaattaca tatttagttt ctaacaagga 660tagcaatgga tgggtatggg tacaggttaa acatatctat tacccaccca tctagtcgtc 720gggttttaca cgtacccacc cgtttacata aaccagaccg gaattttaaa ccgtacccgt 780ccgttagcgg gtttcagatt tacccgttta atcgggtaaa acctgattac taaatatata 840ttttttattt gataaacaaa acaaaaatgt taatattttc atattggatg caattttaag 900aaacacatat tcataaattt ccatatttgt aggaaaataa aaagaaaaat atattcaaga 960acacaaattt caccgacatg acttttatta cagagttgga attagatcta acaattgaaa 1020aattaaaatt aagatagaat atgttgagga acatgacata gtataatgct gggttacccg 1080tcgggtaggt atcgaggcgg atactactaa atccatccca ctcgctatcc

gataatcact 1140ggtttcgggt atacccattc ccgtcaacag gcctttttaa ccggataatt tcaacttata 1200gtgaatgaat tttgaataaa tagttagaat accaaaatcc tggattgcat ttgcaatcaa 1260attttgtgaa ccgttaaatt ttgcatgtac ttgggataga tataatagaa ccgaattttc 1320attagtttaa tttataactt actttgttca aagaaaaaaa atatctatcc aatttactta 1380taataaaaaa taatctatcc aagttactta ttataatcaa cttgtaaaaa ggtaagaata 1440caaatgtggt agcgtacgtg tgattatatg tgacgaaatg ttatatctaa caaaagtcca 1500aattcccatg gtaaaaaaaa tcaaaatgca tggcaggctg tttgtaacct tggaataaga 1560tgttggccaa ttctggagcc gccacgtacg caagactcag ggccacgttc tcttcatgca 1620aggatagtag aacaccactc cacccacctc ctatattaga cctttgccca accctcccca 1680actttcccat cccatccaca aagaaaccga catttttatc ataaatctgg tgcttaaaca 1740ctctggtgag ttctagtact tctgctatga tcgatctcat taccatttct taaatttctc 1800tccctaaata ttccgagttc ttgatttttg ataacttcag gttttctctt tttgataaat 1860ctggtctttc catttttttt tttttgtggt taatttagtt tcctatgttc ttcgattgta 1920ttatgcatga tctgtgtttg gattctgtta gattatgtat tggtgaatat gtatgtgttt 1980ttgcatgtct ggttttggtc ttaaaaatgt tcaaatctga tgatttgatt gaagcttttt 2040tagtgttggt ttgattcttc tcaaaactac tgttaattta ctatcatgtt ttccaacttt 2100gattcatgat gacacttttg ttctgctttg ttataaaatt ttggttggtt tgattttgta 2160attatagtgt aattttgtta ggaatgaaca tgttttaata ctctgttttc gatttgtcac 2220acattcgaat tattaatcga taatttaact gaaaattcat ggttctagat cttgttgtca 2280tcagattatt tgtttcgata attcatcaaa tatgtagtcc ttttgctgat ttgcgactgt 2340ttcatttttt ctcaaaattg ttttttgtta agtttatcta acagttatcg ttgtcaaaag 2400tctctttcat tttgcaaaat cttctttttt tttttgtttg taactttgtt ttttaagcta 2460cacatttagt ctgtaaaata gcatcgagga acagttgtct tagtagactt gcatgttctt 2520gtaacttcta tttgtttcag tttgttgatg actgctttga ttttgtag 25681491041DNAArtificial Sequencep-BnNapin-NEENAss14 expression element 149taaggatgac ctacccattc ttgagacaaa tgttacattt tagtatcaga gtaaaatgtg 60tacctataac tcaaattcga ttgacatgta tccattcaac ataaaattaa accagcctgc 120acctgcatcc acatttcaag tattttcaaa ccgttcggct cctatccacc gggtgtaaca 180agacggattc cgaatttgga agattttgac tcaaattccc aatttatatt gaccgtgact 240aaatcaactt taacttctat aattctgatt aagctcccaa tttatattcc caacggcact 300acctccaaaa tttatagact ctcatcccct tttaaaccaa cttagtaaac gttttttttt 360taattttatg aagttaagtt tttaccttgt ttttaaaaag aatcgttcat aagatgccat 420gccagaacat tagctacacg ttacacatag catgcagccg cggagaattg tttttcttcg 480ccacttgtca ctcccttcaa acacctaaga gcttctctct cacagcacac acatacaatc 540acatgcgtgc atgcattatt acacgtgatc gccatgcaaa tctcctttat agcctataaa 600ttaactcatc ggcttcactc tttactcaaa ccaaaactca tcaatacaaa caagattaaa 660aacatttcac gatttggaat ttgattcctg cgatcacagg tatgacaggt tagattttgt 720tttgtatagt tgtatacata cttctttgtg atgttttgtt tacttaatcg aatttttgga 780gtgttttaag gtctctcgtt tagaaatcgt ggaaaatatc actgtgtgtg tgttcttatg 840attcacagtg tttatgggtt tcatgttctt tgttttatca ttgaatggga agaaatttcg 900ttgggataca aatttctcat gttcttactg atcgttatta ggagtttggg gaaaaaggaa 960gagttttttt ggttggttcg agtgattatg aggttatttc tgtatttgat ttatgagtta 1020atggtcgttt taatgttgta g 104115046DNAArtificial SequencePrimer 150gcaacttcga aagcaaagaa ctgttcagct tgatcgctct attaat 4615146DNAArtificial SequencePrimer 151attaatagag cgatcaagct gaacagttct ttgctttcga agttgc 4615248DNAArtificial SequencePrimer 152actcaccaga gtgtttaagc accagattta tgataaaaat gtcggttt 4815348DNAArtificial SequencePrimer 153aaaccgacat ttttatcata aatctggtgc ttaaacactc tggtgagt 4815444DNAArtificial SequencePrimer 154tcaaattcca aatcgtgaaa tgtttttaat cttgtttgta ttga 4415544DNAArtificial SequencePrimer 155tcaatacaaa caagattaaa aacatttcac gatttggaat ttga 44

Claims

The invention claimed is:

1. A polynucleotide comprising: a) at least one nucleic acid sequence encoding a polypeptide having desaturase or elongase activity; b) at least one seed-specific plant promoter operatively linked to the nucleic acid sequence of a); c) at least one terminator sequence operatively linked to the nucleic acid sequence of a); and d) at least one nucleic acid expression enhancing nucleic acid (NEENA) molecule functionally linked to the promoter of b), wherein said at least one NEENA molecule is heterologous to the promoter of b) and to the polypeptide of a), wherein said at least one NEENA molecule comprises a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24, wherein said at least one NEENA molecule is not able to drive expression of the nucleic acid sequence of a) but is able to enhance expression of said nucleic acid sequence when functionally linked to the promoter of b), and wherein said at least one NEENA molecule enhances seed-specific expression of said nucleic acid sequence of a) in the plant or part thereof as compared to a corresponding control plant or part thereof.

2. The polynucleotide of claim 1, comprising: e) at least one nucleic acid sequence encoding a polypeptide having beta-ketoacyl reductase activity; f) at least one nucleic acid sequence encoding a polypeptide having dehydratase activity; and/or g) at least one nucleic acid sequence encoding a polypeptide having enoyl-CoA reductase activity, wherein the nucleic acid sequences of e) to g) are heterologous to said polypeptide having desaturase or elongase activity.

3. The polynucleotide of claim 2, comprising at least one nucleic acid sequence encoding a polypeptide having acyltransferase activity, wherein the nucleic acid sequence is heterologous to said polypeptide having desaturase, elongase, beta-ketoacyl reductase, dehydratase, or enoyl-CoA reductase activity.

4. A vector comprising the polynucleotide of claim 1.

5. A host cell comprising: a) the polynucleotide of claim 1; or b) a vector comprising said polynucleotide.

6. A method for the manufacture of a polypeptide encoded by the polynucleotide of claim 1, comprising: a) cultivating a host cell comprising the polynucleotide of claim 1 or a vector comprising said polynucleotide under conditions which allow for the production of the polypeptide; and b) obtaining the polypeptide from the host cell.

7. A non-human transgenic organism comprising the polynucleotide of claim 1 or a vector comprising said polynucleotide.

8. The non-human transgenic organism of claim 7, which is a plant or a plant part.

9. A method for the manufacture of polyunsaturated fatty acids comprising: a) cultivating the host cell of claim 5 under conditions which allow for the production of polyunsaturated fatty acids in said host cell; and b) obtaining said polyunsaturated fatty acids from the host cell.

10. A method for the manufacture of polyunsaturated fatty acids comprising: a) cultivating the non-human transgenic organism of claim 7 under conditions which allow for the production of a polyunsaturated fatty acid in said non-human transgenic organism; and b) obtaining said polyunsaturated fatty acid from the non-human transgenic organism.

11. The method of claim 9, wherein said polyunsaturated fatty acid is arachidonic acid (ARA), eicosapentaenoic acid (EPA), or docosahexaenoic acid (DHA).

12. A method for the manufacture of an oil, lipid, or fatty acid composition comprising: a) cultivating the host cell of claim 5 under conditions which allow for the production of a polyunsaturated fatty acid in said host cell; b) obtaining said polyunsaturated fatty acid from said host cell; and c) formulating said polyunsaturated fatty acid as an oil, lipid, or fatty acid composition.

13. A method for the production of foodstuffs, animal feed, a seed, a pharmaceutical, or a fine chemical, comprising: a) providing the host cell of claim 5, or a host cell culture, non-human transgenic organism, transgenic plant, plant part, or plant seed derived from a transgenic non-human organism or plant comprising said host cell; and b) preparing foodstuffs, animal feed, a seed, a pharmaceutical, or a fine chemical.

14. A method for enhancing expression of at least one enzyme of the polyunsaturated fatty acid biosynthetic pathway in a plant or part thereof, comprising transforming a plant or part thereof with a polynucleotide comprising: i) at least one nucleic acid sequence encoding a polypeptide selected from the group consisting of: a) a polypeptide having desaturase or elongase activity; b) a polypeptide having beta-ketoacyl reductase activity; c) a polypeptide having dehydratase activity; and d) a polypeptide having enoyl-CoA reductase activity; ii) at least one seed-specific plant promoter operatively linked to the nucleic acid sequence of i); iii) at least one terminator sequence operatively linked to the nucleic acid sequence of i); and iv) at least one nucleic acid expression enhancing nucleic acid (NEENA) molecule functionally linked to the promoter of ii), wherein said at least one NEENA molecule is heterologous to the promoter of ii) and to the nucleic acid sequence of i), wherein said at least one NEENA molecule comprises a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24, wherein said at least one NEENA molecule is not able to drive expression of the nucleic acid sequence of i) but is able to enhance expression of said nucleic acid sequence when functionally linked to the promoter of ii), and wherein said at least one NEENA molecule enhances seed-specific expression of said nucleic acid sequence of i) in the plant or part thereof as compared to a corresponding control plant or part thereof.

15. The method of claim 14, wherein said at least one NEENA molecule comprises the nucleotide sequence of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24.

16. The polynucleotide of claim 1, wherein said at least one NEENA molecule comprises the nucleotide sequence of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24.