U.S. patent number 9,229,003 [Application Number 12/503,434] was granted by the patent office on 2016-01-05 for method for detecting thyroid carcinoma.
This patent grant is currently assigned to FUJIFILM Corporation, NATIONAL UNIVERSITY CORPORATION TOKYO MEDICAL AND DENTAL UNIVERSITY. The grantee listed for this patent is Issei Imoto, Johji Inazawa, Takaya Ishihara, Hitoshi Tsuda. Invention is credited to Issei Imoto, Johji Inazawa, Takaya Ishihara, Hitoshi Tsuda.
United States Patent |
9,229,003 |
Inazawa , et al. |
January 5, 2016 |
Method for detecting thyroid carcinoma
Abstract
It is an object of the present invention to identify a gene that
exhibits behavior which is characteristic of carcinomas such as
thyroid carcinoma, so as to provide a method for detecting
carcinoma and a cell growth suppressing agent. The present
invention provides a method for detecting carcinoma, which
comprises detecting malignant transformation by detecting at least
one alteration of gene existing in chromosomal regions 1q41, 3q28,
7q31.2, 8p12, 8q22.2, 8q24.21, 11q4.1, 17q12, 20q11, 9p21.3,
16q13.2, and 16q23.1 in a specimen.
Inventors: |
Inazawa; Johji (Tokyo,
JP), Imoto; Issei (Tokyo, JP), Ishihara;
Takaya (Tokyo, JP), Tsuda; Hitoshi (Tokyo,
JP) |
Applicant: |
Name |
City |
State |
Country |
Type |
Inazawa; Johji
Imoto; Issei
Ishihara; Takaya
Tsuda; Hitoshi |
Tokyo
Tokyo
Tokyo
Tokyo |
N/A
N/A
N/A
N/A |
JP
JP
JP
JP |
|
|
Assignee: |
FUJIFILM Corporation (Tokyo,
JP)
NATIONAL UNIVERSITY CORPORATION TOKYO MEDICAL AND DENTAL
UNIVERSITY (Tokyo, JP)
|
Family
ID: |
41653279 |
Appl.
No.: |
12/503,434 |
Filed: |
July 15, 2009 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20100035262 A1 |
Feb 11, 2010 |
|
Foreign Application Priority Data
|
|
|
|
|
Jul 16, 2008 [JP] |
|
|
2008-184982 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N
33/57407 (20130101); A61P 35/00 (20180101); C12Q
1/6886 (20130101); C12Q 2600/156 (20130101); C12Q
2600/112 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12Q 1/70 (20060101); C12P
19/34 (20060101); G01N 33/574 (20060101) |
Other References
Roque et al. (Genes Chromosome and cancer 2003 vol. 36 p. 292).
cited by examiner .
Izzi et al. (Neoplasia 2006 vol. 8 p. 677). cited by examiner .
Ishihara et al. (Cancer Science Oct. 2008 vol. 99 p. 1940). cited
by examiner .
Staub et al. (Molecular Cancer 2006 vol. 5 p. 1-44). cited by
examiner .
Heldin et al. (Molecular and Cellular Endocrinology 1999 vol. 153
p. 79). cited by examiner .
Courbard et al. (Journal of Biological Chemistry 2002 vol. 277 p.
45267). cited by examiner .
Enard et al. (Science 2002 vol. 296 p. 340). cited by examiner
.
Cobb et al (Crit Care Med 2002 vol. 30 p. 2711). cited by examiner
.
Cheung et al (Nature Genetics 2003 vol. 33 p. 422). cited by
examiner .
Wu (Journal of pathology 2001 vol. 195 p. 53). cited by examiner
.
Newton et al (Journal of Computational Biology 2001 vol. 8 p. 37).
cited by examiner .
Japanese Office Action for Japanese Application No. 2008-184982,
mailed Aug. 6, 2013, along with an English translation thereof.
cited by applicant .
Inazawa et al., "Comparative genomic hybridization (CGH)-arrays
pave the way for identification of novel cancer-related genes,"
Cancer Sci., vol. 95, No. 7, Jul. 2004, pp. 559-563. cited by
applicant .
Japanese Office Action, dated May 14, 2013, for Japanese
Application No. 2008-184982, with partial English translation.
cited by applicant .
Mori et al., "Detection of numerical abberations on chromosome 17
in human thyroid tumors," J. Jpn. Soc. Clin. Cytol., vol. 33, No.
6, Nov. 1994, pp. 1167-1168. cited by applicant.
|
Primary Examiner: Salmon; Katherine
Attorney, Agent or Firm: Birch, Stewart, Kolasch &
Birch, LLP
Claims
The invention claimed is:
1. A method for detecting an increased risk of anaplastic thyroid
carcinoma in a human, which comprises: a) detecting mRNA of an
itchy homolog E3 ubiquitin protein ligase (ITCH) gene in a thyroid
biopsy sample from the human by performing an RT-PCR method using
primers consisting of SEQ ID NO: 17 and 18 and determining an
increased level of mRNA in the sample as compared with a
non-anaplastic thyroid carcinoma sample from a human; b) detecting
protein expression of an ITCH gene in the sample by performing an
immunohistochemical method; and c) determining an increase risk of
anaplastic thyroid carcinoma in the human when an increased level
of mRNA and protein expression is detected.
Description
TECHNICAL FIELD
The present invention relates to a method for detecting carcinoma,
which comprises detecting alteration of gene that exists in the
specific chromosomal regions of a specimen.
BACKGROUND ART
Anaplastic thyroid carcinoma (hereinafter referred to as "ATC")
accounts for 2% to 5% of thyroid carcinoma, and it is one type of
carcinoma having an extremely high degree of malignancy.
Well-differentiated thyroid carcinoma (WDTC), namely, papillary
thyroid carcinoma (PTC) and follicular thyroid carcinoma have a
good prognosis. In contrast, ATC is considered as a solid cancer
having an extremely poor prognosis. The median survival period of
ATC is said to be 4 to 12 months. It has been known that ATC shares
several genetic abnormalities with WDTC (point mutations of RAS
gene and BRAF gene, point mutation or gene amplification of PIK3CA
gene, etc.). On the other hand, mutation of a TP53 gene rarely
occurs in WDTC, but it has been known that TP53 gene has been
mutated in 70% or more of ATC. Based on the histological
correlation of ATC with WDTC, it has been considered that ATC
develops from WDTC serving as a previous stage. However, several
types of ATCs newly develop (de novo ATC). Thus, under the current
circumstances, the molecular mechanism of ATC in terms of the
degree of malignancy has hardly been clarified.
As a result of recent progress in molecular-targeted therapy for
cancer genes, it is considered that detailed clarification of the
mutated regions of gene in ATC leads to the development of an
effective therapy.
A change in the copy number of a gene, such as amplification or
homozygous deletion, becomes a marker useful in identifying cancer
genes causing malignant transformation or cancer-suppressing
genes.
The present inventors had analyzed various cancer cell lines using
a conventional high throughput array CGH method, so that they had
accomplished identification of new genes that cause malignant
transformation. The inventors had analyzed ATC using MCG Cancer
Array800 (Yu et al., Oncogene 26, 1178-1187, 2007) as one type of
high throughput array. As a result, they had discovered a DUSP26
gene acting as a novel marker gene. However, clarification of the
molecular mechanism of ATC has been still insufficient, and thus
further analyses have been desired.
DISCLOSURE OF THE INVENTION
If the mechanism of malignant transformation of ATC having a
particularly poor prognosis among thyroid tumors were clarified at
a genetic level, it would enable the early discovery of malignant
transformation of thyroid gland-derived cells at a genetic level,
the diagnosis of degree of malignancy of thyroid carcinoma, and
suppression of cancer progression. Moreover, it would further
enable selection of a drug based on such mechanism, the development
of a therapeutic drug, and the establishment of therapy.
Specifically, it is considered that the aforementioned problems can
be solved by identifying a gene that exhibits behavior which is
characteristic of anaplastic thyroid carcinoma and then performing
technical analyses on the gene and others. That is to say, it is an
object of the present invention to identify a gene that exhibits
behavior which is characteristic of carcinomas such as thyroid
carcinoma, so as to provide a method for detecting carcinoma and a
cell growth suppressing agent.
Comparative Genomic Hybridization (CGH) is the best method for
conveniently and rapidly analyzing genetic abnormalities
accompanying amplification or deletion of numerous genes in the
genome or inactivation of genes. In order to analyze genetic
abnormalities in the genome involved in malignant transformation
and higher cancer malignancy, the present inventors have selected
4500 types of BAC/PAC DNA to be subjected to a CGH array (MCG Whole
Genome-4500; Inazawa J., et al., Cancer Sci. 95, 559-563, 2004). As
a result, the present inventors have discovered 12 characteristic
chromosomal regions that alter in thyroid carcinoma (1q41, 3q28,
7q31.2, 8p12, 8q22.2, 8q24.21, 11q14.1, 17q12, 20q11, 9p21.3,
16q13.2, and 16q23.1), and they have also discovered 9
cancer-associated genes, which promote the malignant transformation
of thyroid gland-derived cells (an ITCH gene, an AHCY gene, a
DYNLRB1 gene, an MAP1LC3A gene, a PIGU gene, a TP531PN2 gene, an
NCOA6 gene, an HMG4L gene, and an ASIP1 gene). Also, the inventors
have succeeded in identifying a new copy number abnormality of
20q11 comprising the ITCH (itchy homolog E3 ubiquitin protein
ligase) gene that is particularly preferable as a marker. Moreover,
the inventors have clarified excessive expression of an ITCH
protein in primary thyroid carcinoma including ATC by
immunohistorical analyses. Further, the inventors have succeeded in
discovering that an increase in the ITCH protein significantly
promotes the growth of ATC cells, and that the growth of ATC cells
is significantly reduced if the transcription product of the ITCH
gene is suppressed, thereby completing the present invention.
The present invention provides a method for detecting carcinoma,
which comprises detecting malignant transformation by detecting at
least one alteration of gene existing in chromosomal regions 1q41,
3q28, 7q31.2, 8p12, 8q22.2, 8q24.21, 11q14.1, 17q12, 20q11, 9p21.3,
16q13.2, and 16q23.1 in a specimen.
Preferably, at least one amplification of gene existing in
chromosomal regions 1q41, 3q28, 7q31.2, 8p12, 8q22.2, 8q24.21,
11q14.1, 17q12, and 20q11 and/or at least one deletion of gene
existing in chromosomal regions 9p21.3, 16q13.2, and 16q23.1 is
detected.
Preferably, amplification of gene existing in chromosomal region
20q11 is detected in a specimen.
Preferably, the gene is at least one selected from among ITCH,
AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, and
ASIP1.
Preferably, as an indicator of amplification, the amplification
rate of the specimen is higher than that of a normal specimen by a
factor of 1.32 or more.
Preferably, the gene is an ITCH gene.
Preferably, the specimen is a tissue derived from the thyroid
gland.
Preferably, the carcinoma is thyroid carcinoma.
Preferably, the gene alteration is detected using a DNA chip
method, a Southern blot method, a Northern blot method, a real-time
RT-PCR method, a FISH method, a CGH method, an array CGH method, a
bisulfite sequencing method, or a COBRA method.
The present invention further provides a method for detecting
carcinoma, which comprises detecting the amount of a protein
translated from at least one gene selected from among ITCH, AHCY,
DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, and ASIP1 in a
specimen.
Preferably, the amount of a protein is detected by an
immunohistochemical method.
Preferably, malignant transformation including the degree of
malignancy of the specimen is detected.
The present invention further provides a method for suppressing
cell growth, which comprises introducing into cells in vitro an
siRNA, an antisense oligonucleotide or a loss-of-function type gene
of at least one gene selected from among ITCH, AHCY, DYNLRB1,
MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, and ASIP1.
The present invention further provides a cell growth suppressing
agent, which comprises an siRNA, an antisense oligonucleotide or a
loss-of-function type gene of at least one gene selected from among
ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, and
ASIP1.
The present invention further provides a method for activating cell
growth, which comprises introducing into cells in vitro at least
one gene selected from among ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU,
TP531PN2, NCOA6, HMG4L, and ASIP1.
The present invention further provides a cell growth activating
agent, which comprises at least one gene selected from among ITCH,
AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, and
ASIP1.
According to the present invention, it has become possible to
precisely understand the malignant transformation and the
malignancy degree in a thyroid gland-derived cell specimen.
Furthermore, proliferation of thyroid carcinoma, and particularly
anaplastic thyroid carcinoma, can be suppressed by introducing the
transcription product of the gene of the present invention that
inactivates gene expression into the thyroid carcinoma.
BRIEF DESCRIPTION OF DRAWING
FIG. 1 shows amplification and excessive expression of the ITCH
genes of ATC cell lines. FIG. 1(A) shows array CGH analysis images
obtained using MCG Whole Genome Array-4500. A significant increase
in the copy number was detected as a clear green signal in the
20q11.22 region in two ATC cell lines (a 8305C cell line and a
KTA-4 cell line) (red arrows). FIG. 1(B) shows the FISH analysis
images of metaphase chromosomes produced from 8305C and KTA-4
cells. A BAC clone RP11-318N1 (green luminescence) was used as a
probe. As a control probe, chromosome 20 BAC (RP11-7F10, 20p1.22;
red luminescence) was used. The KTA-4 cells showed amplification
due to a tandem repeat pattern (arrow portion), whereas clear
amplification attended with double minute chromosomes (dmin) was
detected in the 8305C cells. FIG. 1(C) shows a map of a region
comprising 20q11.22 amplified in ATC cell lines. Eight BACs used in
the FISH analysis are shown with black horizontal bars. The figure
also shows 9 transcription products in the sequence. All markers
and transcription products in SRO are disposed based on human
genome database (ncbi.nlm.nih.gov and http://www.genome.ucsc.edu/).
FIG. 1(D) shows expression of genes existing in the 20q11.22 region
in ATC cell lines, which has been determined by RT-PCR. DW
(distilled water) indicates a negative control. The amplified
portion of 20q11.22 detected by array CGH is indicated with an
arrow point. The copy number of the ATC cell lines correlated with
the expression pattern of ITCH. FIG. 1(E) shows the Western
blotting analysis of ITCH proteins in ATC cell lines. The
expression level of the ITCH protein also correlated with the copy
number of this gene. FIG. 1(F) shows the RT-PCR analysis of ITCH
gene expression in 7 primary ATC specimens and normal thyroid
tissues. Bands were quantified using LAS-3000 (manufactured by Fuji
Photo Film Co., Ltd.) and Multi Gage software (manufactured by Fuji
Photo Film Co., Ltd.). A numerical value obtained by dividing the
expression level of ITCH in each specimen normalized with GAPDH by
the expression level of ITCH in normal thyroid tissues is indicated
as an increased amount.
FIG. 2 shows examples of the ITCH immunostaining of primary thyroid
carcinomas and benign thyroid tumors. (A) ATC (strength 3); (B) ATC
(strength 2); (C) ATC (strength 0); (D) PMC (strength 3); (E) PTC
(strength 2); and (F) thyroid tumor (strength 1). Based on the
strength of immunostaining, the aforementioned carcinomas and
tumors were classified into 4 strength levels. The horizontal bar
indicates 20 .mu.m.
FIG. 3(A)-(C) show the effect of ITCH to suppress the growth of ATC
cells. In comparison with si-RNA-Luc-introduced cells or only a
solvent added, FIGS. 3(A) and (B) show the results obtained by
performing Western blotting on 8305C cells (A) and KTA-4 cells (B),
into which ITCH-specific siRNA (siRNA-ITCH) was introduced, and the
growth curves thereof. Knock-down effect by siRNA was examined from
24 to 72 hours after gene transduction. The number of surviving
cells 24 to 72 hours after the gene transduction was counted by a
WST test method. The data show the average number obtained from 3
times of measurements. The symbol .asterisk-pseud. indicates
P<0.05 (statistical analysis by Mann-Whitney U method). FIG.
3(C) shows cell number distribution at each cell cycle measured by
FACS 72 hours after introduction of siRNA-ITCH and siRNA-Luc into
8305C cells. The figure shows that G0/G1-phase cells are
accumulated by introduction of ITCH-specific siRNA. FIGS. 3(D) and
(E) show a colony formation method using TTA-1 cells (D) and 8505C
cells (E). Two plasmids for expressing the Myc tag of the ITCH gene
(a wild type: pCMV-Tag3B-ITCH WT; a mutant type having-no
ubiquitin-conjugating enzyme activity: pCMV-3Tag4-ITCH MUT) and an
empty vector (pCMV-3Tag4-mock), into which no ITCH gene had been
inserted, were introduced into cells in which the expression level
of the ITCH gene was relatively low. Thereafter, the cells were
allowed to grow for 3 weeks in the presence of G418 that was a
neomycin agent. The transduction was confirmed by Western blotting
(left), and a colony was formed as a result of the transduction
(right).
PREFERRED EMBODIMENT OF THE INVENTION
Hereafter, the present invention will be described more in
detail.
(1) Method for Detecting Carcinoma
The method for detecting carcinoma according to the present
invention is characterized in that it comprises detecting at least
one alteration of gene existing in chromosomal regions 1q41, 3q28,
7q31.2, 8p12, 8q22.2, 8q24.21, 11q14.1, 17q12, 20q11, 9p21.3,
16q13.2, and 16q23.1 in a specimen. Preferably, a gene to be
detected is an ITCH gene.
The ITCH gene (itchy homolog E3 ubiquitin protein ligase) is also
referred to as AIP4 (atrophin-1 interacting protein 4), and it
belongs to Nedd4-like protein family which is E3 ubiquitin ligase.
The ITCH gene has a structure in which a C2 region relating to
protein kinase-C exists on the N-terminal side and four WW regions
and an HECT (homologous to the E6-associated protein
carboxyl-terminus) ubiquitin protein ligase region exist on the
C-terminal side. A mouse having no Itch gene (Itchy) exhibits fetal
symptoms attended with constant itching of the skin, severe
inflammation, and immunodeficiency. It is considered that
Nedd4-like E3 plays an important role in the carcinogenesis of
esophageal squamous cell carcinoma, breast carcinoma, prostatic
carcinoma, and pancreatic carcinoma. However, there have been
almost no reports regarding the relationship between the ITCH gene
and carcinoma.
As described above, the present detection method is characterized
in that it comprises detecting mutation of the chromosomal regions
of the present invention and the multiple genes of the present
invention in thyroid gland-derived cells or in thyroid
carcinoma.
Preferred examples of thyroid gland-derived cells or thyroid
carcinoma to be subjected to detection of mutation of the
chromosomal regions of the present invention and the multiple genes
of the present invention include biopsied tissue cells of specimen
donors.
Such biopsied tissue cells of specimen donors may be either the
thyroid gland-derived cells of a healthy subject or the cancerous
tissues of a thyroid carcinoma patient. In practice, examples of a
major target tissue specimen that can be used herein include: a
tissue obtained from a lesion in which suspected malignant
transformation is observed by a test or the like; and a thyroid
carcinoma tissue that has been confirmed to be derived from thyroid
carcinoma and thus must be subjected to determination of malignancy
or the stage progression of the thyroid carcinoma.
When the mutation of the chromosomal regions of the present
invention and the multiple genes of the present invention is
confirmed by the method of the present invention in the "pathologic
tissue of thyroid glands having a lesion suspected to be malignant
as confirmed by a test or the like", it is revealed that the
pathologic tissue is undergoing a process toward canceration or is
already in the malignant state, and that the malignancy thereof is
increasing. Thus, the need to carry out immediate full-scale
treatment (such as lesion removal by operation or the like and
full-scale chemotherapy) is demonstrated. Moreover, when the
mutation of the chromosomal regions of the present invention and
the multiple genes of the present invention is confirmed in the
"tissue that is confirmed to be thyroid carcinoma and for which
determination of malignancy or the stage progression thereof is
required", it is revealed that the malignancy of the cancer tissue
is increasing. Hence, the need to carry out immediate full-scale
treatment (such as lesion removal by operation or the like or
full-scale chemotherapy) is demonstrated. A thyroid carcinoma
tissue sampled as a specimen can be subjected to the present
detection method after applying necessary treatment such as with
the preparation of DNA or RNA from the sampled tissue.
In the detection method of the present invention, the mutation of
the chromosomal regions of the present invention and the multiple
genes of the present invention is detected in thyroid gland-derived
cells or thyroid carcinoma cells as mentioned above, so that
tumorigenic transformation of said cells is detected and
classified.
Next, detection of the mutation of the chromosomal regions of the
present invention and the multiple genes of the present invention
is described below.
Examples of a typical method by which amplification or deletion of
the chromosomal regions of the present invention and the multiple
genes of the present invention can be directly detected include a
CGH (Comparative Genomic Hybridization) method and a FISH
(Fluorescence in situ hybridization) method. According to the
detection method in this embodiment, BAC (Bacterial Artificial
Chromosome) DNA, YAC (Yeast Artificial Chromosome) DNA, or PAC
(P1-drived Artificial Chromosome) DNA (hereinafter, also referred
to as BAC DNA, for example) having the chromosomal regions of the
present invention and the multiple genes of the present invention
is labeled and then FISH is performed, so that the presence or the
absence of the chromosomal regions of the present invention and the
multiple genes of the present invention can be detected.
It is preferable and practical to carry out the method in the above
embodiment with the use of a genomic DNA-immobilized matrix.
The amount of BAC DNA or the like obtained in a conventional manner
is so small that a large number of genomic DNA-immobilized matrices
cannot be produced for practical application. Thus, it is necessary
to obtain gene amplification products of such DNA. (A gene
amplification process for this purpose is referred to as "infinite
amplification" in some cases.) Upon infinite amplification, BAC DNA
or the like is first digested with a four-base recognition enzyme
such as Rsa I, Dpn I, Hae III, or the like, followed by ligation
with the addition of an adaptor. An adaptor comprises
oligonucleotides having 10 to 30 bases and preferably 15 to 25
bases. Double strands of such adaptor have sequences complementary
to each other. After annealing, the 3' end of one of the
oligonucleotides, at which a blunt end is formed, must be
phosphorylated. Next, a primer having a sequence identical to the
other oligonucleotide of the adaptor is used for amplification via
PCR (polymerase chain reaction). Thus, infinite amplification can
be carried out. Meanwhile, it is also possible to use, as a
detection probe, an aminated oligonucleotide comprising 50 to 70
bases, which is inherent to BAC DNA or the like.
BAC DNAs or the like subjected to infinite amplification are
immobilized on a matrix and preferably on a solid matrix.
Accordingly, a desired DNA-immobilized matrix can be produced. An
example of such solid matrix is more preferably a glass plate. Such
a solid matrix made of glass or the like is more preferably coated
via adhesion with poly-L-lysine, aminosilane, gold, aluminium, or
the like.
The concentration of DNA subjected to infinite amplification to be
spotted on a matrix is preferably 10 pg/.mu.l to 5 .mu.g/.mu.l and
more preferably 1 ng/.mu.l to 200 ng/.mu.l. The amount of the same
to be spotted on the matrix is preferably 1 nl to 1 .mu.l and more
preferably 10 nl to 100 nl. In addition, the size and the shape of
each spot that is immobilized on the matrix are not particularly
limited. In terms of size, such spot may have a diameter ranging
from 0.01 to 1 mm, for example. In addition, the shape of such spot
may be a circle or ellipse from an overhead view. The thickness of
a dry spot is not particularly limited; however, it may be 1 to 100
.mu.m. Further, the number of spots is not particularly limited;
however, it may be 10 to 50,000 spots and more preferably 100 to
5,000 spots on the matrix used. DNAs are spotted singly to
quadruplicate. However, preferably, DNAs are spotted in duplicate
or triplicate.
Regarding preparation of dry spots, it is possible to produce dry
spots by, for example, spotting BAC DNAs or the like subjected to
infinite amplification on a matrix with the use of a spotter,
forming a plurality of spots thereon, and drying the spots.
Examples of a spotter that can be used include an inkjet printer, a
pin-array printer, and a bubble jet (trademark) printer. An inkjet
printer is desirably used. For instance, GENESHOT (NGK INSULATORS;
Nagoya, Japan) or the like can be used.
As described above, it is possible to produce a desired
DNA-immobilized matrix by immobilizing BAC DNAs or the like
subjected to infinite amplification onto a matrix, and preferably,
onto a solid matrix.
In addition, an example of a means of directly detecting the
deletion of the chromosomal regions of the present invention and
the multiple genes of the present invention is the Southern blot
method. The Southern blot method is a method for detecting the
presence of the chromosomal regions of the present invention and
the multiple genes of the present invention in a specimen by
separating and immobilizing genomic DNA obtained from the specimen
and detecting hybridization of such genomic DNA with the
chromosomal regions of the present invention and the multiple genes
of the present invention.
Furthermore, the amplification of the chromosomal regions of the
present invention and the multiple genes of the present invention
can also be directly detected by the PCR method. Genomic DNA is
separated from a test sample, and is amplified using a primer which
can amplify a full length of said gene or a part thereof, and the
amplified product is quantified so that the amplification of the
gene can be detected.
In the present invention, malignant transformation including the
degree of malignancy of the specimen can be detected by detecting
at least one alteration of gene existing in chromosomal regions
1q41, 3q28, 7q31.2, 8p12, 8q22.2, 8q24.21, 11q14.1, 17q12, 20q11,
9p21.3, 16q13.2, and 16q23.1.
With regard to detection of mutation, mutation is preferably
detected in chromosomal regions 1q41, 3q28, 7q31.2, 8p12, 8q22.2,
8q24.21, 11q14.1, 17q12, and 20q11, whereas deletion is preferably
detected in chromosomal regions 9p21.3, 16q13.2, and 16q23.1.
It is more preferable to use gene amplification of the 20q11 region
in a specimen as an indicator. It is further preferable to detect
at least one mutation of gene selected from among genes in the
20q11 region, namely, ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU,
TP531PN2, NCOA6, HMG4L, and ASIP1, and to detect malignant
transformation including the degree of malignancy of the
specimen.
In addition, it is preferable that, as an indicator of
amplification, the amplification rate of the specimen be higher
than that of a normal specimen by a factor of 1.32 or more.
It is particularly preferable to use the gene amplification of the
ITCH gene as an indicator.
Moreover, the specimen is preferably a tissue derived from thyroid
gland, and more preferably thyroid carcinoma.
Specifically, in a method for detecting mutation of the chromosomal
region 1q41, RP11-124A11, RP11-5F19, RP11-79H5, RP11-45L21,
RP11-66M7, or the like is preferably used as BAC-DNA. In a method
for detecting mutation of the chromosomal region 3q28, RP11-54L9,
RP11-455C22, RP11-88H6, or the like is preferably used as BAC-DNA.
In a method for detecting mutation of the chromosomal region
7q31.2, RP11-51M22 or the like is preferably used as BAC-DNA. In a
method for detecting mutation of the chromosomal region 8p12,
RP11-451018, RP11-258M15, RP11-91P13, or the like is preferably
used as BAC-DNA. In a method for detecting mutation of the
chromosomal region 8q22.2, RP11-142F22 or the like is preferably
used as BAC-DNA. In a method for detecting mutation of the
chromosomal region 8q24.21, RP11-89K10, RP11-89L16, or the like is
preferably used as BAC-DNA. In a method for detecting mutation of
the chromosomal region 11q14.1, RP11-91M10 or the like is
preferably used as BAC-DNA. In a method for detecting mutation of
the chromosomal region 17q12, RP11-19G24 or the like is preferably
used as BAC-DNA. In a method for detecting mutation of the
chromosomal region 20q11, RP11-318N1 or the like is preferably used
as BAC-DNA.
Moreover, in a method for detecting mutation of the chromosomal
region 9p21.3, RP11-113D19, RP11-344A7, RP11-408N14, RP11-44115,
RP-11-11J1, RP11-782K2, RP11-346N23, RP11-33015, RP11-482110, or
the like is preferably used as BAC-DNA. In a method for detecting
mutation of the chromosomal region 16q13.2, RP11-185J20 or the like
is preferably used as BAC-DNA. In a method for detecting mutation
of the chromosomal region 16q23.1, RP11-61L1 or the like is
preferably used as BAC-DNA.
Furthermore, an example of BAC-DNA having an ITCH gene that is the
most preferable marker gene is RP11-318N1.
For handling the multiple genes of the present invention, cDNAs
obtained from cultured cells through publicly known methods to
those skilled in the art may be used, or enzymatically synthesized
ones through PCR method may be also used. When DNA having a known
nucleotide sequence is obtained through PCR method, PCR is
performed using human chromosomal DNA or cDNA library as a
template, and primers designed to amplify a nucleotide sequence of
interest. DNA fragments amplified through PCR can be cloned in an
appropriate vector which can proliferate in a host such as E.
coli.
Manipulations such as preparation of detection probes or primers
for the chromosomal regions of the present invention and the
multiple genes of the present invention and cloning of target genes
are already known to those skilled in the art. For example, such
manipulations can be performed according to methods described in
Molecular Cloning: A Laboratory Manual, 2.sup.nd Ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1989, Current
Protocols in Molecular Biology, Supplement 1 to 38, John Wiley
& Sons (1987-1997), or the like.
(2) Method for Suppressing Cell Growth and Cell Growth Suppressing
Agent
According to the present invention, there are provided a method for
suppressing cell growth which comprises introducing an siRNA, an
shRNA, an antisense oligonucleotide, or a loss-of-function type
gene of the ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6,
HMG4L, and ASIP1 into cells in vitro, and a cell growth suppressing
agent which comprises said siRNA, shRNA, antisense oligonucleotide,
or loss-of-function type gene.
siRNA is a double-strand RNA having a length of about 20
nucleotides (for example, 21 to 23 nucleotides) or shorter.
Expression of such an siRNA in a cell enables to suppress the
expression of a gene targeted by the siRNA (ITCH, AHCY, DYNLRB1,
MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, or ASIP1 gene in the
present invention).
The siRNA to be used in the present invention may take any form as
long as it is capable of inducing RNAi. Here, the term "siRNA" is
an abbreviation for "short interfering RNA", which refers to a
short-chain double-strand RNA of 10 nucleotides or longer obtained
by: chemical or biochemical synthesis in an artificial manner; in
vivo synthesis; or in vivo degradation of double-strand RNA of
about 40 nucleotides or longer. The siRNA normally has a structure
comprising 5'-phosphoric acid and 3'-OH, where the 3' terminal
projects by about 2 nucleotides. A specific protein binds to the
siRNA to form RISC(RNA-induced-silencing-complex). This complex
recognizes mRNA having the homologous sequence to that of siRNA and
binds thereto. Then, the mRNA is cleaved at the central part of the
siRNA with an RNase III-like enzymatic activity.
The siRNA sequence and the mRNA sequence being the target of
cleavage preferably match 100%. However, such 100% match is not
always required, when unmatched nucleotides are located away from
the central part of the siRNA. This is because the RNAi cleaving
activity often partially remains.
Preferably, the homologous region between the siRNA nucleotide
sequence and the nucleotide sequence of the ITCH, AHCY, DYNLRB1,
MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, or ASIP1 gene whose
expression has to be suppressed, does not include the translation
initiation region of the concerned gene. Since various
transcriptional factors and translational factors are predicted to
bind to the translation initiation region, it is anticipated that
the siRNA be unable to effectively bind to the mRNA, leading to
lowered effect. Accordingly, the homologous sequence is preferably
away from the translation initiation region of the concerned gene
by 20 nucleotides, and more preferably by 70 nucleotides. The
homologous sequence may be, for example, a sequence in the vicinity
of the 3' terminal of the concerned gene.
According to another aspect of the present invention, an shRNA
(short hairpin RNA) comprising a short hairpin structure having a
projection at the 3' terminal may also be used as a factor which
can suppress the expression of a target gene through RNAi. The term
shRNA refers to a molecule of about 20 or more nucleotides, in
which the single-strand RNA includes partially palindromic
nucleotide sequences to thereby have a double-strand structure
within the molecule, forming a hairpin-like structure. Such an
shRNA is broken down into a length of about 20 nucleotides
(typically 21 nucleotides, 22 nucleotides, and 23 nucleotides, for
example) within a cell after being introduced into the cell, and
thus is capable of inducing RNAi in a similar manner to that of
siRNA. As described above, the shRNA induces RNAi in a similar
manner to that of siRNA, and thus can be effectively used in the
present invention.
The shRNA preferably has a projection at the 3' terminal. There is
no particular limitation on the length of the double-strand
portion, although it is preferably about 10 or more nucleotides,
and more preferably about 20 or more nucleotides. Here, the
projecting 3' terminal is preferably a DNA, more preferably a DNA
of at least 2 or more nucleotides, and yet more preferably a DNA of
2 to 4 nucleotides.
As described above, in the present invention, siRNA or shRNA can be
used as a factor which can suppress the expression of the ITCH,
AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, or ASIP1
gene through RNAi. The advantages of siRNA are such that: (1) RNA
itself, even when introduced into a cell, is not incorporated into
a chromosome of normal cell, and therefore the treatment do not
cause any inheritable mutations and the safety is high; (2) it is
relatively easy to chemically synthesize short-chain double-strand
RNA, and the form of double-strand RNA is more stable; and the
like. The advantages of shRNA are such that: treatment through
long-term suppression of gene expression can be achieved by
producing a vector which can transcribe shRNA within a cell and
introducing such a vector into the cell; and the like.
The siRNA or shRNA to be used in the present invention which can
suppress the expression of the ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU,
TP531PN2, NCOA6, HMG4L, or ASIP1 gene through RNAi, may be
chemically synthesized in an artificial manner, and may also be
produced through in vitro RNA synthesis using DNA of a hairpin
structure in which a sense strand DNA sequence and an antisense
strand DNA sequence are linked in opposite directions, with a T7
RNA polymerase. In the case of in vitro synthesis, antisense and
sense RNAs can be synthesized from a template DNA using the T7 RNA
polymerase and a T7 promoter. After in vitro annealing thereof,
transfection of the resultant RNA into cells induces RNAi to
suppress the expression of a target gene. Here, for example,
transfection of such RNA into cells can be carried out by a calcium
phosphate method or a method using various transfection reagents
(such as oligofectamine, lipofectamine, and lipofection).
The abovementioned siRNA and shRNA are also useful as cell growth
suppressing agents. The administration method of the cell growth
suppressing agent of the present invention may include oral
administration, parenteral administration (such as intravenous
administration, intramuscular administration, subcutaneous
administration, intradermal administration, transmucosal
administration, intrarectal administration, intravaginal
administration, local administration to affected area, and skin
administration), and direct administration to affected area. The
agent of the present invention, if used as a medical composition,
may be mixed with a pharmaceutically acceptable additive as
required. Specific examples of such a pharmaceutically acceptable
additive include, but not limited to, an antioxidant, a
preservative, a coloring agent, a flavoring agent, a diluent, an
emulsifier, a suspending agent, a solvent, a filler, an extending
agent, a buffer agent, a delivery vehicle, a diluting agent, a
carrier, an excipient, and/or a pharmaceutical adjuvant.
The form of the pharmaceutical preparation of the agent of the
present invention is not particularly limited, and examples thereof
include a liquid agent, an injectable agent, and a sustained
release agent. A solvent to be used for prescribing the agent of
the present invention as the above pharmaceutical preparation may
be either aqueous or non-aqueous.
Furthermore, the siRNA or shRNA serving as an active ingredient of
the cell growth suppressing agent of the present invention can be
administered in the form of a nonviral vector or a viral vector. In
the case of a nonviral vector, there can be employed methods in
which nucleic acid molecules are introduced using liposomes (such
as a liposome method, an HVJ-liposome method, a cationic liposome
method, a lipofection method, and a lipofectamine method),
microinjection methods, methods in which nucleic acid molecules are
transferred together with carriers (metal particles) into cells
using a gene gun. If the siRNA or shRNA is administered in vivo
using a viral vector, viral vectors such as a recombinant
adenovirus and a recombinant retrovirus can be employed.
Introduction of siRNA or shRNA gene into a cell or tissue can be
achieved through introduction of DNA which expresses siRNA or shRNA
into a detoxified DNA or RNA virus such as retrovirus, adenovirus,
adeno-associated virus, herpes virus, vaccinia virus, poxvirus,
poliovirus, Sindbis virus, Sendai virus, and SV40, followed by
infection with the recombinant virus into the cell or tissue.
The dose of the cell growth suppressing agent of the present
invention can be determined by those skilled in the art with a
consideration of the purpose of administration, the disease
severity, the age, weight, gender, and previous history of the
patient, and the type of siRNA or shRNA serving as an active
ingredient. The dose of siRNA or shRNA is not particularly limited,
and examples thereof include about 0.1 ng/kg/day to about 100
mg/kg/day, and preferably about 1 ng/kg/day to about 10 mg/kg/day.
RNAi effect is typically exerted for one to three days after the
administration. Therefore, administration is preferably performed
at a frequency of everyday to every third day. When an expression
vector is used, the administration can be performed approximately
once a week.
In the present invention, an antisense oligonucleotide can also be
used as a cell growth suppressing agent. Antisense oligonucleotides
to be used in the present invention are nucleotides that are
complementary or hybridize to consecutive 5 to 100 nucleotide
sequences within the DNA sequence of the ITCH, AHCY, DYNLRB1,
MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L, or ASIP1 gene. Such an
antisense oligonucleotide may be either DNA or RNA, or may also be
modified as long as its functions remain unaffected. The term
"antisense oligonucleotide" used in this description includes not
only oligonucleotides wherein all nucleotides corresponding to
nucleotides composing a predetermined DNA or mRNA region are
complementary to their counterparts, but also oligonucleotides that
contain some mismatching nucleotides, as long as such
oligonucleotides can stably hybridize to DNA or mRNA.
In addition, the antisense oligonucleotides may be modified. After
appropriate modification, resulting modified antisense
oligonucleotides will be hardly degraded in vivo. This enables more
stable inhibition of the target. Examples of such modified
oligonucleotide include S-oligo type (phosphorothioate-type), C-5
thyazole type, D-oligo type (phosphodiester-type), M-oligo type
(methylphosphonate-type), peptide nucleic acid type, phosphodiester
binding type, C-5 propinyl pyrimidine type, 2-O-propylribose, and
2'-methoxyribose type antisense oligonucleotides. Furthermore, such
antisense oligonucleotide may also be an antisense oligonucleotide
wherein at least some of the oxygen atoms composing phosphate
groups are substituted with sulfur atoms or otherwise modified.
Such an antisense oligonucleotide is particularly excellent in
terms of nuclease resistance, water solubility, and affinity for
RNA. As such an antisense oligonucleotide wherein at least some of
the oxygen atoms composing phosphate groups are substituted with
sulfur atoms or otherwise modified, an S-oligo type oligonucleotide
can be enumerated.
The number of nucleotides in such antisense oligonucleotide is
preferably 50 or less and more preferably 25 or less. Too large
number of nucleotides results in increased effort and cost in
oligonucleotide synthesis and lowered yields. Furthermore, the
number of nucleotides of such antisense oligonucleotide is 5 or
more and preferably 9 or more. A number of nucleotides of 4 or less
is undesirable because of the resulting lowered specificity to a
target gene.
Such antisense oligonucleotide (or a derivative thereof) can be
synthesized by a usual method. For example, an antisense
oligonucleotide or a derivative thereof can be easily synthesized
using a commercially available DNA synthesizer (such as one
produced by Applied Biosystems). It can be obtained by a synthesis
method such as a solid-phase synthesis method using
phosphoroamidite or a solid-phase synthesis method using hydrogen
phosphonate.
When an antisense oligonucleotide is used as a cell growth
suppressing agent in the present invention, it is generally
provided in the form of a medical composition containing the
antisense oligonucleotide and additive(s) for pharmaceutical
preparation (such as a carrier and an excipient). The antisense
oligonucleotide can be administered as a medicament to mammals
including humans. The route of administration for such an antisense
oligonucleotide is not particularly limited and may be either of
oral administration or parenteral administration (such as
intramuscular administration, intravenous administration,
subcutaneous administration, peritoneal administration,
transmucosal administration in the nasal cavity or the like, and
inhalation administration).
The form of the pharmaceutical preparation of such an antisense
oligonucleotide is not particularly limited. Examples of the
pharmaceutical preparation for oral administration include tablets,
capsules, fine granules, powders, granules, liquids, and syrups.
Examples of the pharmaceutical preparation for parenteral
administration include injections, infusions, suppositories,
inhalants, transmucosal absorption systems, transdermal absorption
systems, nasal drops, and ear drops. The form of a drug containing
the antisense oligonucleotide, additive(s) to be used for the
pharmaceutical preparation, a method for producing the
pharmaceutical preparation, and the like can be appropriately
selected by those skilled in the art.
The dose of the antisense oligonucleotide can be appropriately
determined with a comprehensive consideration of the gender, age,
and weight of the patient, the symptom severity, the purpose of
administration such as prevention or treatment, and the
presence/absence of other complication symptoms. The dose is
generally 0.1 .mu.g/kg of body weight/day to about 100 mg/kg of
body weight/day, and preferably 0.1 .mu.g/kg of body weight/day to
about 10 mg/kg of body weight/day.
Furthermore, in the present invention, a loss-of-function type gene
of the ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L,
or ASIP1 gene can also be used as a cell growth suppressing agent.
The loss-of-function type gene refers to a mutated gene which
causes loss of function of the corresponding gene. Specific
examples thereof include genes which translate proteins lacking
their original functions, generally called muteins, including those
lacking at least one constituent amino acid(s), those having at
least one constituent amino acid(s) replaced by other amino
acid(s), and those added with at least one amino acid(s), within
the amino acid sequence produced by the concerned gene.
When such a loss-of-function type gene is used as the cell growth
suppressing agent, it can be produced by mixing the abovementioned
gene serving as an active ingredient with a base that is commonly
used for gene therapeutic agents. Moreover, when such a gene is
incorporated into a viral vector, virus particles containing the
recombinant vector are prepared, and are then mixed with a base
that is commonly used for gene therapeutic agents.
As to the base, bases commonly used for injectable agents can be
used. Examples thereof include: distilled water: salt solutions
containing sodium chloride, a mixture of sodium chloride and
mineral salts, or the like: solutions of mannitol, lactose,
dextran, glucose, or the like: amino acid solutions of glycine,
arginine, or the like: and mixed solutions having glucose solution
with an organic acid solution or salt solution. Alternatively,
these bases can also be prepared into injectable agents in the form
of a solution, suspension, or dispersion, with use of auxiliary
agents such as an osmoregulator, a pH adjuster, a vegetable oil,
and a surfactant, in accordance with usual methods which are
already known to those skilled in the art. These injectable agents
can also be prepared in the form of a pharmaceutical preparation to
be dissolved at the time of use, through operations such as
powderization or lyophilization.
The form of administration of the loss-of-function allele may be
either systemic administration such as usual intravenous
administration and intraarterial administration, or local
administration such as local injection and oral administration.
Furthermore, administration may also take a combined form with
catheterization, gene introduction technology, or surgical
operation.
The administration dose of the loss-of-function type gene varies
depending on the age and gender of the patient, the symptom, the
administration route, the frequency of administration, and the
dosage form. Generally, the daily dose for an adult is within a
range of about 1 .mu.g/kg of body weight to 1000 mg/kg of body
weight, and preferably a range of about 10 .mu.g/kg of body weight
to 100 mg/kg of body weight, in terms of weight of recombinant
gene. The frequency of administration is not particularly
limited.
Moreover, the abovementioned various gene therapeutic agents of the
present invention can also be produced by adding a gene into a
suspension of liposomes prepared by a usual method, followed by
freezing and subsequent thawing. Examples of the method for
preparing liposomes include a membrane shaking method, a sonication
method, a reverse phase evaporation method, and a surfactant
removal method. The suspension of liposomes is preferably subjected
to sonication treatment before addition of a gene, so as to improve
the efficiency of encapsulation of the gene. The liposomes having
the gene encapsulated therein may be intravenously administered
either directly or in the form of a suspension with water,
physiological salt solution, or the like.
The cell growth suppressing agent of the present invention is
useful as an anti-tumor agent. The term "anti-tumor" used herein
has its broadest meaning which includes both of a preventive
function of preventing generation, metastasis or implantation of
tumor and a therapeutic function of suppressing the growth of tumor
cells, regressing tumor to inhibit progress of tumor or improving
the symptom. The term "anti-tumor" is not interpreted in a limited
way.
Specific examples of cancer to be treated with the anti-tumor agent
of the present invention include, but are not limited to, malignant
melanoma, malignant lymphoma, lung cancer, esophageal cancer,
gastric cancer, large bowel cancer, rectal cancer, colonic cancer,
ureteral tumor, gallbladder cancer, bile duct cancer, biliary tract
cancer, mammary cancer, liver cancer, pancreatic cancer, testicular
tumor, maxillary cancer, lingual cancer, labial cancer, oral cavity
cancer, pharyngeal cancer, laryngeal cancer, ovarian cancer,
uterine cancer, prostate cancer, thyroid gland cancer, brain tumor,
Kaposi's sarcoma, angioma, leukemia, polycythemia vera,
neuroblastoma, retinoblastoma, myeloma, bladder tumor, sarcoma,
osteosarcoma, myosarcoma, skin cancer, basal cell cancer, skin
appendage carcinoma, metastatic skin cancer, and cutaneous
melanoma. Preferably, the cancer is thyroid gland cancer.
(3) Method for Activating Cell Growth and Cell Growth Activating
Agent
The present invention further provides a method for activating cell
growth which comprises introducing in vitro a gene selected from
among ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L
or ASIP1 gene, or a protein which is am expressed product of said
gene into a cell, and a cell growth activating agent comprising
said gene or protein.
When a gene selected from among the ITCH, AHCY, DYNLRB1, MAP1LC3A,
PIGU, TP531PN2, NCOA6, HMG4L or ASIP1 gene is handled, cDNA
obtained from a cultured cell in accordance with a technique known
in the art or cDNA enzymatically synthesized via PCR method or the
like may be used. When DNA is obtained via PCR, PCR is carried out
using a human chromosome DNA or cDNA library as a template and a
primer designed to be capable of amplifying the nucleotide sequence
of interest. The PCR-amplified DNA fragment can be cloned into an
adequate vector that is capable of amplification in an E. coli host
or the like.
Methods for preparing a detection probe or primer for the gene
selected from among the ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU,
TP531PN2, NCOA6, HMG4L or ASIP1 gene and for cloning the target
gene are known in the art. For example, such procedures can be
implemented in accordance with a method described in Molecular
Cloning: A laboratory Manual, 2.sup.nd Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989, Current Protocols in
Molecular Biology, Supplement 1 to 38, John Wiley & Sons
(1987-1997), or the like.
At least one gene selected from among the ITCH, AHCY, DYNLRB1,
MAP1LC3A, PIGU, TP531PN2, NCOA6, HMG4L or ASIP1 gene may be
incorporated into a vector and may then be used in the form of a
recombinant vector. A viral vector or an expression vector for an
animal cell may be used, and the use of a viral vector is
preferable. Examples of viral vectors include retrovirus vector,
adenovirus vector, adeno-associated virus vector, baculovirus
vector, vaccinia virus vector, and lentiviral vector. Use of a
retroviral vector is particularly preferable for the following
reasons. That is, after a host cell is infected with a retroviral
vector, a virus genome is incorporated into a host cell chromosome,
and a foreign gene incorporated into the vector may be expressed
stably for a long period of time.
Examples of an expression vector for an animal cell include pCXN2
(Gene, 108, 193-200, 1991), PAGE207 (JP Patent Publication (Kokai)
No. 6-46841 A (1994)), and a modified form of either thereof.
The aforementioned recombinant vector can be produced by
introducing a vector into an adequate host for transformation and
culturing the resulting transformant. When a recombinant vector is
a viral vector, a host cell into which such vector is to be
introduced is an animal cell that is capable of virus production.
Examples thereof include COS-7 cell, CHO cell, BALB/3T3 cell, and
HeLa cell. Examples of host cells for a retroviral vector include
.PSI.CRE, .PSI.CRIP, and MLV. An example of a host cell for an
adenoviral vector and an adeno-associated virus is the 293 cell
obtained from the human embryonic kidney cell. A viral vector can
be introduced into an animal cell by the calcium phosphate method,
for example. When a recombinant vector is an expression vector for
an animal cell, the E. coli K12 strain, HB101 strain, or DH5.alpha.
strain can be used as a host cell into which such vector is to be
introduced. A method of E. coli transformation is known in the
art.
The obtained transformants are cultured in a medium under culture
conditions that are suitable for each transformant. For example, E.
coli transformants can be cultured in a liquid medium (pH: about 5
to 8) containing a carbon source, a nitrogen source, inorganic
matter, and other substances that are necessary for growth. In
general, culture is conducted at 15.degree. C. to 43.degree. C. for
about 8 to 24 hours. In such a case, a recombinant vector of
interest can be obtained by a common DNA isolation/purification
technique after the completion of culture.
Animal cell transformants can be cultured in medium such as a 199
medium, MEM medium, or DMEM medium containing about 5% to 20% fetal
bovine serum, for example. The pH level of a medium is preferably
about 6 to 8. In general, culture is conducted at about 30.degree.
C. to 40.degree. C. for about 18 to 60 hours. In such a case, virus
particles containing recombinant vectors of interest are released
in a culture supernatant. Thus, the recombinant vectors of interest
can be obtained by concentrating and purifying the virus particles
by cesium chloride centrifugation, polyethylene glycol
precipitation, filter-concentration, or the like.
The cell growth activating agent of the present invention can be
produced by mixing the aforementioned gene as an active ingredient
with a base material that is usually used for a gene therapeutic
agent. When the aforementioned gene is incorporated into a viral
vector, viral particles containing a recombinant vector are
prepared, and such viral particles are mixed with a base material
that is commonly used for a gene therapeutic agent.
In order to mix the above-mentioned gene or protein as an active
ingredient, a base material that is usually used for injections can
be used. For example, distilled water, a salt solution of sodium
chloride or a salt solution mixture of sodium chloride and an
inorganic salt, a solution of mannitol, lactose, dextran, or
glucose, an amino acid solution of glycine or arginine, or a mixed
solution of an organic acid solution or salt solution with a
glucose solution can be used. Alternatively, in accordance with a
method known to persons skilled in the art, an adjuvant such as an
osmotic regulator, a pH adjuster, vegetable oil, or a surfactant
may be added to such base material to obtain an injection in the
form of a solution, suspension, or dispersion. Such injection can
also be prepared as a preparation to be dissolved before use via
pulverization or lyophilization.
The administration route of the cell growth activating agent of the
present invention may be systemic administration, such as general
intravenous or intraarterial administration, or topical
administration, such as topical injection or oral administration.
Further, administration of the cell growth activating agent can be
carried out in combination with catheterization, gene introduction,
surgery, or the like.
The dose of the cell growth activating agent of the present
invention varies in accordance with the age, sex, condition of a
patient, route of administration, the number of times of
administration, or dosage form. In general, the dose is about 1
.mu.g/kg body-weight to 1,000 mg/kg body-weight, and preferably
about 10 .mu.g/kg body-weight to 100 mg/kg body-weight, per day per
adult in terms of the weight of a recombinant gene. The number of
times of administration is not particularly limited.
(4) Method for Detection of Tumor Using ITCH Gene
The detection method for selecting target tumor, to which the cell
growth suppressing agent (antitumor agent) of the present invention
can be applied, comprises a step of analyzing an ITCH gene in a
specimen, using DNA or RNA comprising the entire or a part of the
ITCH gene. The term "a part of the ITCH gene" is used herein to
mean an oligonucleotide consisting of, for example, approximately
10 to 30 contiguous nucleotides in the nucleotide sequence of the
ITCH gene. As a specimen, there can be used a tissue section,
blood, lymph, sputum, lung wash solution, urine, feces, tissue
culture supernatant, or the like, which are suspected to comprise
tumor cells.
The aforementioned expression such as "detection for selecting
target tumor to which the antitumor agent can be applied" is used
to mean examination of the presence or absence of tumor in tissues
or the like, on which the antitumor agent of the present invention
effectively acts.
The detection for selecting tumor is carried out by analyzing an
ITCH gene in a specimen, using DNA or RNA comprising the entire or
a part of the ITCH gene as a primer or a probe. The term "to
analyze an ITCH gene" is used herein to specifically mean detection
of amplification or deletion of the ITCH gene in genomic DNA, or
detection of the abnormality of the expression level of the
gene.
In the case of using the aforementioned DNA or RNA as a primer,
mutation of the ITCH gene can be detected, for example, by
amplifying a partial sequence of DNA prepared from a specimen
according to a PCR method using two types of selected primers and
then confirming the presence thereof, or by confirming the sequence
of an amplification product or the sequence of an amplification
product that has been incorporated into various types of plasmid
vectors.
On the other hand, the abnormality of the expression level of the
ITCH gene can be detected by a Northern hybridization method or an
RT-PCR (reverse transcription-polymerase chain reaction) method
using a probe comprising the aforementioned RNA sequence.
(5) Detection Method for Selecting Tumor Using Antibody Against
ITCH Protein, or Fragment Thereof
A detection method for selecting target tumor, to which the cell
growth suppressing agent (antitumor agent) of the present invention
can be applied, comprises a step of analyzing the amount of an ITCH
protein contained in a specimen, using an antibody against the ITCH
protein, or a fragment of said antibody.
An antibody against the ITCH protein used in the present invention
(hereinafter referred to as an "ITCH antibody") can be produced by
an ordinary method using the entire or a part of ITCH protein as an
antigen. A part of ITCH protein means a polypeptide consisting of,
for example, at least 6, preferably at least approximately 8 to 10,
and more preferably at least approximately 11 to 20 contiguous
amino acids in the amino acid sequence of the ITCH protein as shown
in SEQ ID NO: 2. As a method of preparing the entire or a part of
ITCH protein used as an antigen, either a biological method or a
chemical synthesis method may be applied.
A polyclonal antibody can be produced, for example, by sufficiently
immunizing an animal such as a mouse, a guinea pig, or a rabbit
with the aforementioned antigen via inoculating the antigen into
the subcutis, muscle, abdominal cavity, vein, or the like of such
animal several times, and then collecting blood from such animal,
followed by separation of serum. A monoclonal antibody can be
produced, for example, by preparing hybridomas via cell fusion
between the splenic cells of the mouse immunized with the
aforementioned antigen and commercially available mouse myeloma
cells, and then producing the monoclonal antibody from a culture
supernatant of the hybridomas or from the ascites fluid of the
mouse to which the hybridomas have been applied.
Using the thus prepared antibody against ITCH protein or a fragment
thereof, the expression level of an ITCH protein contained in a
specimen can be measured. For such measurement, immunological
methods such as immunoblotting, enzyme immunoassay (EIA),
radioimmunoassay (RIA), a fluorescence antibody method or
immunocytostaining, or a Western blotting method may be applied,
for example. Herein, a fragment of the antibody against ITCH
protein means a single chain antibody fragment (scFv) of the
antibody, etc. In addition, as a specimen, there can be used a bone
marrow sample, a tissue section, blood, lymph, sputum, lung wash
solution, urine, feces, tissue culture supernatant, or the like,
which are suspected to comprise tumor cells. When the thus measured
expression level of the ITCH protein in the specimen is low,
expression of the ITCH gene is suppressed in tissues or cells used
as specimens, and thus a target tumor, to which the antitumor agent
of the present invention can be applied, can be selected.
The present invention is hereafter described in greater detail with
reference to the following examples, although the technical scope
of the present invention is not limited to these examples.
EXAMPLES
Experiment Materials
As 14 types of ATC cell lines used (KTA-1, KTA-2, KTA-3, KTA-4,
ARO, FRO, TTA-1, TTA-2, TTA-3, 8305C, 8505C, HTC/C3, TCO-1, and
KHM/5M), cell lines established from clinical samples were used.
These cell lines were cultured in a medium containing 100 U/ml
penicillin, 100 .mu.g/ml streptomycin and 10% fetal bovine serum.
116 clinical specimens of primary thyroid carcinoma were obtained
from Ito Hospital. After the patients' consent had been secured and
approval had been given from an ethics committee of the
aforementioned organization, these clinical specimens were
used.
Example 1
Amplification and Deletion of Gene Regions in ATC Cell Lines
In order to detect a novel gene alteration in anaplastic thyroid
carcinoma, using genomic DNA prepared from the aforementioned 14
types of ATC cell lines, CGH array analysis was carried out
employing MGC Whole Genome Array-4500 (Inazawa J., et al., Cancer
Sci. 95, 559-563, 2004). Genome extracted from normal cells derived
from thyroid gland was used as a target, and this genome was
labeled with Cy5. Genomic DNA prepared from an anaplastic thyroid
carcinoma cell line was used as test DNA, and this genomic DNA was
labeled with Cy3.
A specific analysis method will be described below. Specifically,
DpnII-digested genomic DNA (0.5 .mu.g) was labeled with BioPrime
Array CGH Genomic Labeling System (Invitrogen) in the presence of
0.6 mM dATP, 0.6 mM dTTP, 0.6 mM dGTP, 0.3 mM dCTP, and 0.3 mM
Cy3-dCTP (anaplastic thyroid carcinoma cell line) or 0.3 mM
Cy5-dCTP (normal cells). Cy3- and Cy5-labeled dCTPs were acquired
from GE Healthcare. Either Cy3- or Cy5-labeled genomic DNA was
added to ethanol in the presence of Cot-1 DNA (Invitrogen), so that
it was precipitated. The precipitate was dissolved in 120 .mu.l of
a hybridization mixed solution (50% formamide, 10% dextran sulfate,
2.times.SSC (1.times.SSC; 150 mM NaCl/15 mM sodium citrate), 4%
sodium dodecyl sulfate, pH 7.0). After 30 minutes of incubation at
37.degree. C., the CGH array was set in a hybridization machine
(GeneTAC; Harvard Bioscience), followed by 48 to 72 hours of
hybridization. Subsequently, the CGH array was washed in a 50%
formamide/2.times.SSC (pH 7.0) solution at 50.degree. C. for 15
minutes and then washed in 2.times.SSC/0.1% SDS at 50.degree. C.
for 15 minutes. After air-drying, the CGH array was monitored for
fluorescence derived from Cy3 and Cy5 using a GenePix 4000B scanner
(Axon Instruments, CA, U.S.A.). The thus obtained results were
analyzed using a GenePix Pro 6.0 imaging software (Axon
Instruments, CA, U.S.A.). The average fluorescence intensity
derived from Cy3 was adjusted to be the same as that of
fluorescence intensity derived from Cy5, and the ratio of Cy3/Cy5
was determined.
When a genome has no abnormality, the resulting ratio becomes 1:1
(log 2 ratio=0). Determination was performed as follows. A ratio of
1.32 (or higher):1 (log 2 ratio is 0.4 or more) indicates the
presence of genome amplification, and a ratio of 4 (or higher):1
(log 2 ratio is 2 or more) indicates the confirmation of
significant amplification. A ratio of 0.75 (or lower):1 (log 2
ratio=-0.4 or less) indicates possible heterozygote deletion in the
genome, and a ratio of 0.25 (or lower):1 (log 2 ratio=-2 or less)
indicates an extremely high possibility of homozygote deletion in
the genome. The results are shown in Tables 1 and 2.
TABLE-US-00001 TABLE 1 Loci of high-level amplification (log2 ratio
>2.0) detected in ATC cell lines by array-CGH analysis using MCG
Whole Genome Array-4500 Number of known Locus Locus* Cell line
genes No. BAC Chr. band Position n Name Possible candidate
gene.sup.b within each locus 1 RP11-124A11 1q41
213,712,056-213,886,235 1 TTA-1 3 RP11-5F19 1q41
213,843,888-214,005,804 1 TTA-1 RP11-79H5 1q41
214,152,848-214,333,834 1 TTA-1 RP11-45L21 1q41
215,048,055-215,223,099 1 TTA-1 RP11-66M7 1q41
215,209,941-215,373,866 1 TTA-1 2 RP11-54L9 3q28
191,443,377-191,627,661 1 TTA-1 8 RP11-455C22 3q28
191,341,029-191,525,722 1 TTA-1 RP11-88H6 3q28
192,493,851-192,676,936 1 TTA-1 3 RP11-51M22 7q31.2
115,628,304-115,790,622 1 TTA-1 1 4 RP11-451O18 8p12
33,148,264-33,325,914 1 8305C DUSP26, RNF122 5 RP11-258M15 8p12
33,641,086-33,802,158 1 8305C RP11-91P13 8p12 33,915,031-34,077,419
1 8305C 5 RP11-142F22 8q22.2 100,024,093-100,777,928 1 KTA-3 1 6
RP11-89K10 8q24.21 127,636,847-127,799,456 1 TTA-1 MYC 2 RP11-89L16
8q24.21 129,633,607-129,784,954 1 TTA-1 7 RP11-91M10 11q14.1
84,821,843-84,975,001 1 KTA-3 0 8 RP11-134G19 11q22.2
101,600,032-101,600,600 1 KTA-3 YAP1, BIRC2, BIRC3 8 RP11-28124
11q22.2 101,722,105-101,886,737 1 KTA-3 RP11-817J15 11q22.2
101,922,842-102,095,829 1 KTA-3 9 RP11-19G24 17q12
32,528,985-32,674,877 1 ARO 1 10 RP11-318N1 20q11.22
32,349,241-32,542,223 1 8305C 2 *Based on UCSC Genome Browser.
March 2006 Assembly (http://genome.ucsc.edu/cgi-bin/hgGateway).
.sup.bRepresentative candidate oncogene located around BAC.
TABLE-US-00002 TABLE 2 Loci of homozygous deletion (log2 ratio
<-2.0) delected in ATC cell lines by array-CGH analysis using
MCG Whole Genome Array-4500 Number of known Locus Locus* Cell line
genes within each No. BAC Chr. band Position n Name Possible
candidate gene.sup.b locus 1 RP11-113D19 9p21.3
20,996,401-21,158,464 1 TTA-1 MTAP, CDKN2A, CDK2B 23 RP11-344A7
9p21.3 21,506,374-21,676,227 2 TTA-1, TTA-3 RP11-408N14 9p21.3
22,155,847-22,309,629 2 TTA-2, TCO-1 RP11-441I5 9p21.3
22,309,630-22,479,595 2 TTA-1, TTA-2 RP11-11J1 9p21.3
22,479,496-22,579,721 2 TTA-1, TTA-2 RP11-782K2 9p21.3
22,584,981-22,585,358 2 TTA-1. TTA-2 RP11-346N23 9p21.3
22,604,694-22,796,769 2 TTA-1, TTA-2 RP11-33O15 9p21.3
22,823,087-22,823,490 1 TTA-1 RP11-482I10 9p21.3
24,547,905-24,738,555 1 TTA-1 2 RP11-185J20 16q13.2
6,588,011-6,758,741 1 ARO 1 3 RP11-61L1 16q23.1
77,344,719-77,345,302 1 KTA-4 WWOX 1 *Based on UCSC Genome Browser.
March 2008 Assembly (http:// genome.ucso.edu/cgi-bin/hgGateway).
.sup.bRepresentative candidate humor suppressor located around
BAC.
Amplification was found in 1q41, 3q28, 7q31.2, 8p12, 8q22.2,
8q24.21, 11q14.1, 11q22.2, 17q12, and 20q11. Among these mutations,
alterations in the chromosomal regions other than 11q22.2 were
discovered for the first time in the present invention.
In addition, homozygous deletion was found from 3 sites (9p21.3,
16q13.2, and 16q23.1) in 6 out of the 14 cell lines (ARO, KTA-4,
TCO-1, TTA-1, TTA-2, and TTA-3). Of these, deletion of the 9p21.3
region comprising a CDKN2A/p16 gene was observed most frequently.
Homozygous deletion of 16q23 comprising a WWOX gene that was
assumed to be a cancer-suppressing gene was detected only in the
KTA-4 cell line. Homozygous deletion was detected in a novel region
16q13.2 in the ARO cell line. High-level amplification was detected
from 10 regions in 4 out of the 14 cell lines (ARO, KTA-3, TTA-1,
and 8305C).
From these results, it is considered that malignant transformation
of thyroid gland can be detected by detecting alterations existing
in the chromosomal regions shown in Tables 1 and 2.
Moreover, among these regions, high-level amplification of 20q11.22
has not yet been reported to date. It was revealed that this region
was moderately amplified (log 2 ratio=1.6:BACPR11-318N1) not only
in 8305C cells but also in KTA-4 (FIG. 1A). Pathological and
clinical significance of gene amplification in tumor is greatly
associated with the therapy of the tumor. Thus, attention was drawn
to the 20q11.22 region, and analysis was carried out.
Example 2
Narrowing Down of Amplification Regions in 8305C and KTA-4 Cells by
FISH Analysis, and Analysis of Expression of Genes Constituted
In order to narrow down the amplification region of 20q11.22, seven
BACs mainly including RP11-318N1 and the BAC of the 20q11 region
used as a control probe were subjected to FISH analysis according
to an ordinary method (Inoue J., Otsuki T., Hirasawa A., et al., Am
J. Pathol; 165: 71-81, 2004).
Using the RP1-318N1 probe, a large number of signals attended with
double minute chromosomes were found in the 8305C cells (FIG.
1B).
On the other hand, 6 BACs (RP11-13418, 318O16, 318N1, 160I20,
353C18, and 382A12) detected 8 signals attended with a tandem
repeat pattern in the KTA-4 cell line (FIG. 1B). From the results
of the two types of cell lines, an amplification region as a target
candidate was narrowed down to RP11-318N1, and through the human
genome database (http://genome.ucsc.edu/), it was found that such
amplification region has a size of approximately 0.6 Mb and
comprises 9 genes consisting of ASIP1, AHCY, ITCH, DYNLRB1,
MAP1LC3A, TP531PN2, PIGU, NCOA6, and HMG4L (FIG. 1C).
From the aforementioned results, it was found that malignant
transformation of thyroid gland-derived cells can be detected by
detecting increases in copy numbers of ASIP1, AHCY, ITCH, DYNLRB1,
MAP1LC3A, TP531PN2, PIGU, NCOA6, and HMG4L.
Further, in order to clarify more preferred targets from among
these target genes, the relationship between gene amplification and
an expression state was tried to be determined.
Next, for the purpose of simple determination, a PCR reaction was
performed on the 9 genes consisting of ASIP1, AHCY, ITCH, DYNLRB1,
MAP1LC3A, TP53IPN2, PIGU, NCOA6, and HMG4L, which existed in the
narrowed region. As a control of the expression level by RT-PCR,
there was used GAPDH whose expression level had reportedly hardly
changed depending on cell species or conditions. Total RNA was
collected from each type of cells during the logarithmic growth
phase, and cDNA was then produced by a common method. Primers
specific for each gene (the nucleotide sequences of primers are
shown in Table 3 (SEQ ID NOS: 1-18)) and conditions had been
determined in advance, and a PCR reaction was then performed,
followed by electrophoresis on 3% agarose gels.
TABLE-US-00003 TABLE 3 Supplementary Table S1 Primer sequences used
in RT-PCR analysis Target gene Forward primer Reverse primer ASIP
5'-CAAACAGATCGGCAGAAA 5'-AAGAAGCGGCACTGGCAG AGC GA AHCY
5'-CGCATCATCCTGCTGGCC 5'-TCAGCCACTGCGTCATCC GA AG DYNLRB1
5'-CACCACCACCCAGTATGC 5'-GTTGGATTCTGAATCACA CAG ATCAGG MAP1LC3A
5'-TCCCGGACCATGTCAACA 5'-CCATATAGAGGAAGCCGT TG CCT PIGU
5'-CTGTCCTGTGGCACCTCT 5'-CTGTGCCATCCTTGGCGG GG T NCOA6
5'-ATCCCAGGCCGAAGAAAC 5'-TTACTTGGATTTTCTTCG TC CTTGG TP53INP2
5'-CATGGGGTGAAGCCATCC 5'-GACTCCTACTCAGGACTG CA CTG HMG4L
5'-GTGCAGACGTGCAGAGAA 5'-CCTTAGCTGGTCCATAAT GA CCTTC ITCH
5'-TGCCATCTACCGTCATTA 5'-CCATGAGATCAGCAAATC TGC CTC
A gel image was obtained using LAS-3000 (Fuji Photo Film Co.,
Ltd.), and the image was then analyzed using Multi Gauge software
(Fuji Photo Film Co., Ltd.) (FIG. 1D). The 14 cell lines were
analyzed by a semi-quantitative RT-PCR method. As a result, it was
found that the ITCH gene was clearly expressed at an excessive
level in the 8305C cells and in the KTA-4 cells. Thus, it was found
that the ITCH gene would become the most preferred target gene.
Example 3
Confirmation of Protein Expression Level of ITCH Gene in ATC Cell
Lines
In order to confirm excessive expression of ITCH in 8305C and
KTA-4, protein expression was confirmed by a Western blotting
method using a specific antibody.
Specifically, each type of cells were dissolved in an RIPA buffer
(10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate,
0.1% SDS, 1% Triton X-100, pH 7.4) containing protease-inhibitor
cocktail (Roche Diagnostics). Thereafter, a protein concentration
was measured using BCA assay (Pierce Chemical), and 30 .mu.g each
of the cells was electrophoresed on SDS-polyacrylamide gels. The
resultant was transferred on a difluoride membrane. After a primary
detection with an anti-ITCH antibody (Santa Cruz Biotechnology) and
an anti-.beta.-actin antibody (Sigma) used as a control, a
peroxidase-bound secondary antibody was used to develop color with
an enhanced electrochemiluminescence system (Amersham), and it was
then detected (FIG. 1E).
Moreover, the expression level of ITCH mRNA in each of 7 specimens
of primary anaplastic thyroid carcinomas was analyzed by an RT-PCR
method. As a result, it was confirmed that ITCH mRNA was
excessively expressed even in primary anaplastic thyroid carcinomas
(FIG. 1F).
Example 4a
Excessive Expression of ITCH in Primary Thyroid Carcinomas
In order to examine the expression state of ITCH in primary thyroid
carcinomas including ATC, 109 primary thyroid carcinoma specimens
(ATC: 49 specimens; PTC: 25 specimens, PMC: 25 specimens; and
adenomatous goiters: 10 specimens) were evaluated by
immunohistochemical staining, in terms of the expression level of
an ITCH protein.
As a specific method, a tissue section embedded in paraffin was
fixed with formalin. A section placed on a glass slide coated with
silane was subjected to deparaffinization and stepwise dehydration
with ethanol. The antigen was subjected to a microwave pretreatment
at 95.degree. C. for 15 minutes in a 10 mM citrate buffer (pH 6.0),
so that it was taken out. Endogenous peroxidase was inhibited using
5% hydrogen peroxide. Non-specific staining was inhibited using 2%
standard pig serum. The slide was incubated at 4.degree. C.
overnight using an anti-human CTGF goat polyclonal antibody (L-20;
1:100 diluted; Santa Cruz Biotechnology). The slide was reacted
with Histofine simple stain MAX PO (G) (Nichirei) at room
temperature for 2 hours. The antigen-antibody reaction was
visualized using 0.2% diaminobenzidine tetrahydrochloride and
hydrogen peroxide. The slide was counterstained using Mayer's
hematoxylin. The immunostaining pattern of ITCH is shown in FIG. 2,
and the summary is shown in Table 4. The ATC specimens, PMC
specimens, and PTC specimens were found to be positive in the
immunostaining. On the other hand, thyroid tumors that were
classified into benign tumors were not stained or were stained at
an extremely weak level.
TABLE-US-00004 TABLE 4 Intensity Tumor type n (grade).sup.a
Frequency (%) Malignant tumor.sup.b ATC 49 3 3 (6.1%) 2 11 (22.4%)
1 27 (55.1%) 0 8 (16.3%) PTC 25 3 0 (0%) 2 14 (56.0%) 1 11 (44.0%)
0 0 (0%) PMC 25 3 1 (4.0%) 2 10 (40.0%) 1 14 (56.0%) 0 0 (0%)
Benign tumor Adenomatous goiter 10 3 0 (0%) 2 0 (0%) 1 9 (90.0%) 0
1 (10.0%) Normal thyroid 0 .sup.aICTH protein expression level was
evaluated by immunohistochemical analysis as described in Materials
and Methods. .sup.bATC, anaplastic thyroid carcinoma: PTC,
papillary thyroid carcinoma; PMC, papillary microcarcinoma.
Example 4b
Oncogenic Activity in ATC Cells
In order to examine the effect of excessive expression of ITCH on
the growth of ATC cells, a cell growth test was carried out after
suppression of the expression of ITCH with specific siRNA.
The siRNA corresponding to the ITCH gene was designed to be
GGUGACAAAGAGCCAACAAGAG (SEQ ID NO: 19), and it was then purchased
(from Sigma). Moreover, as control siRNA, CGUACGCGGAAUACUUCGA (SEQ
ID NO: 20) that corresponded to a luciferase gene was purchased
(from Sigma). The synthesized siRNA (10 nmol/L) was introduced into
each ATC cell line, using Lipofectamine siRNA MAX reagent
(Invitrogen) (by treating with production protocols). After
introduction of the gene, the efficiency was analyzed by a Western
blotting method in the same manner as that of Example 3. The number
of surviving cells was measured by a water-soluble tetrazolium salt
(WST) assay (Cell counting kit-8; Dojindo Laboratories). As a
control, an anti-.beta.-actin antibody was used. As predicted, in
the 8305C and KTA-4 cells in which ITCH had been
amplified/excessively expressed, the amount of an endogenous ITCH
protein was suppressed by the ITCH-specific siRNA, 24 to 72 hours
after the gene introduction, as compared with the case of using the
non-specific siRNA control. This result was confirmed by a Western
blotting method (FIGS. 3A and B).
Furthermore, each of the two above types of cell lines was seeded
in a 24-well plate, and they were then transfected with the siRNA.
Thereafter, the number of surviving cells was measured over time,
using a water-soluble tetrazolium salt (WST) assay (Cell counting
kit-o; Dojindo Laboratories), so as to examine the effect of ITCH
on the cell growth (FIGS. 3A and B).
The growth of the 8305C cells was clearly suppressed by the
ITCH-specific siRNA. The same results were obtained from the KTA-4
cells in which ITCH had been excessively expressed. However, the
effect of ITCH to suppress the growth of the KTA-4 cells was
smaller than in the case of the 8305C cells. Thus, it is considered
that such cell growth-suppressing effect depends on the expression
level of the ITCH protein. The effect of ITCH to suppress cell
growth was 77% in the case of the 8305C cells and was 69% in the
case of the KTA-4 cells.
Example 5
Analysis of Mode of Action of ITCH Gene Using
Fluorescence-Activated Cell Sorting (FACS) Method
In order to clarify the mode of action of ITCH on the growth of ATC
cells, the cell cycle of 8305C cells into which ITCH-specific siRNA
had been introduced and that of control cells were analyzed by
FACS.
Specifically, the cells were treated with trypsin and were then
fixed with a 70% ethanol solution overnight. Thereafter, the cells
were treated with RNaseA (40 U/ml) for 30 minutes, and then with a
PI solution of PBS buffer (20 g/ml) for 30 minutes. The amount of
DNA in the cells was analyzed using FACSCaliber cytometer and Cell
Quest software (both products manufactured by Becton-Dickinson).
The experiment was carried out 3 times.
As a result of the analysis, it was found that, when the expression
of ITCH was suppressed, G0/G1 increased, and S and G2/M decreased.
This result clearly demonstrated that the cell cycle was terminated
at a G1 phase (FIG. 3C).
Example 6
Confirmation of Effect of ITCH Gene to Promote Cell Growth
Based on the aforementioned results, whether or not the growth of
the ATC cells is promoted by activation of expression of the ITCH
gene was analyzed. First, there were constructed two plasmids for
expressing the Myc tag of the ITCH gene (a wild type:
pCMV-Tag3B-ITCH WT; a mutant type having no ubiquitin-conjugating
enzyme activity: pCMV-Tag3B-ITCH MUT). These plasmids were produced
by inserting the cDNA of ITCH WT or MUT amplified by RT-PCR into a
pCMV-3Tag4 vector (Stratagene) such that the Myc tag could be
matched with a translation frame. As a control, an empty vector in
which no ITCH gene had been inserted was used (pCMV-Tag3B-mock).
These expression plasmids were mixed with Lipofectamine 2000
(Invitrogen) used as a transfection reagent. Thereafter, TTA-1
cells or 8505C cells were transfected with the obtained mixture.
Forty-eight hours later, the cells were recovered, and were then
subjected to Western blotting using an anti-Myc antibody (Cell
Signaling Technology), so as to confirm the expression of an ITCH
protein (FIGS. 3D and E).
Further, 3 weeks after the transfection, the cells that had grown
in the presence of G418 used as a neomycin agent were fixed with
70% ethanol, and they were then stained with crystal violet, so
that they were counted. As a result, in comparison with the cells
transfected with the empty vector, the number of colonies was
significantly increased in the case of the cells transfected with
pCMV-Tag3B-ITCH WT or MUT (FIGS. 3D and E). From this result, it
became clear that the growth of the ATC cells can be promoted by
activating the expression of the ITCH gene, and that such cell
growth occurs in a manner independent from ubiquitin-conjugating
enzyme.
CONCLUSION
(1) As a result of the screening by an array CGH method, it was
found that gene regions 1q41, 3q28, 7q31.2, 8p12, 8q22.2, 8q24.21,
11q14.1, 11q22.2, 17q12, 20q11, 9p21.3, 16q13.2, and 16q23.1 can be
used as novel cancer markers for thyroid carcinoma.
(2) It was found that, among these gene regions, the 22q11 region
and 9 genes (ITCH, AHCY, DYNLRB1, MAP1LC3A, PIGU, TP531PN2, NCOA6,
HMG4L, and ASIP1) included therein can be used as more preferred
cancer markers.
(3) As a result of confirmation by the combined use of the
screening for a DNA amplification gene in cells derived from 14
types of anaplastic thyroid carcinomas with the expression analysis
data, the ITCH gene was identified as a particularly preferred
novel cancer marker. (4) It was clarified that expression of the
ITCH gene promotes the cell growth of thyroid carcinoma.
SEQUENCE LISTINGS
1
20121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 1caaacagatc ggcagaaaag c 21220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
2aagaagcggc actggcagga 20320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA 3cgcatcatcc tgctggccga
20420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 4tcagccactg cctcatccag 20521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
5caccaccacc cagtatgcca g 21624DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA 6gttggattct gaatcacaat cagg
24720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 7tcccggacca tgtcaacatg 20821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
8ccatatagag gaagccgtcc t 21920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA 9ctgtcctgtg gcacctctgg
201019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 10ctgtgccatc cttggcggt 191120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
11atcccaggcc gaagaaactc 201223DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA 12ttacttggat tttcttcgct tgg
231320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 13catggggtga agccatccca 201421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
14gactcctact caggactgct g 211520DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA 15gtgcagacgt gcagagaaga
201623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA 16ccttagctgg tccataatcc ttc 231721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
17tgccatctac cgtcattatg c 211821DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA 18ccatgagatc agcaaatcct c
211922RNAArtificial SequenceDescription of Artificial Sequence
Synthetic RNA 19ggugacaaag agccaacaag ag 222019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic RNA
20cguacgcgga auacuucga 19
* * * * *
References