U.S. patent number 8,227,191 [Application Number 07/402,450] was granted by the patent office on 2012-07-24 for method for amplification and detection of rna sequences.
This patent grant is currently assigned to City of Hope. Invention is credited to George J. Murakawa, John J. Rossi, R. Bruce Wallace, John A. Zaia.
United States Patent |
8,227,191 |
Murakawa , et al. |
July 24, 2012 |
**Please see images for:
( Certificate of Correction ) ** |
Method for amplification and detection of RNA sequences
Abstract
A process for identifying a viral RNA nucleotide sequence
present in a sample of peripheral blood cells which comprises
amplifying such RNA simultaneously with at least one other RNA
nucleotide sequence present in a virus infected cell in said
sample, and thereafter separately and sequentially analyzing the
amplification reaction products with probes homologous with
authentic RNA and with such other RNA sequence to identify one or
both of said RNA nucleotide sequences.
Inventors: |
Murakawa; George J. (Cypress,
CA), Wallace; R. Bruce (Pasadena, CA), Zaia; John A.
(Arcadia, CA), Rossi; John J. (Glendora, CA) |
Assignee: |
City of Hope (Duarte,
CA)
|
Family
ID: |
46513020 |
Appl.
No.: |
07/402,450 |
Filed: |
September 1, 1989 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
07355296 |
May 22, 1989 |
|
|
|
|
06941379 |
Dec 15, 1986 |
|
|
|
|
07402450 |
|
|
|
|
|
07143045 |
Jan 12, 1988 |
|
|
|
|
06941379 |
Dec 15, 1986 |
|
|
|
|
07402450 |
|
|
|
|
|
07148959 |
Jan 27, 1988 |
|
|
|
|
Current U.S.
Class: |
435/6.12;
536/24.32; 536/24.33; 536/24.31 |
Current CPC
Class: |
C12Q
1/6818 (20130101); C12Q 1/6818 (20130101); C12Q
2545/101 (20130101); C12Q 2600/16 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C07H 21/04 (20060101) |
Field of
Search: |
;435/6,91,91.2,91.21
;436/501,811 ;935/3,20,77,78 ;536/23.1,24.31,24.32,24.33 |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Wathen et al. J. Virol 41(2):462 (1982). cited by examiner .
Demaechi. Virol. 114:23- (1981). cited by examiner .
Ratner et al. Nature 313(2):277 (1985). cited by examiner .
Starcich et al. Science 229:537 (1985). cited by examiner .
Ruger et al. J. of Virol 61(2):446 (1987). cited by examiner .
Akusjarvi et al P.N.A.S. 75(12):5822 (1978). cited by examiner
.
Hennighausen et al. EMBO J. 5(6):1367 (1986). cited by examiner
.
Harper et al. PNAS 83:772 (1986). cited by examiner .
Stratagene 1988 Catalog [Published by Stratagene, 11011 North
Torrey Pines Road, La Jolla, CA, USA], p. 39, 1988. cited by
examiner .
Diaco, PCR Strategies, ed. Innis et al., Academic Press, Inc., ch.
7, pp. 84-108 (1995). cited by examiner .
Slamon, et al., "Expression of Cellular Oncogenes in Human
Malignancies" Science 224:256-262 (1984). cited by other .
Kraus, et al., "Overexpression of the EGF receptor-related
proto-oncogene erbB-2 in human mammary turmor cell lines by
different molecular mechanisma", The EMBO Journal 6(3):605-610
(1987). cited by other .
Chelly, et al., "Transcription of the dystophin gene in human
muscle and non-muscle tissues" Nature 333:858-860 (1988). cited by
other .
S.K. Arya, 3'-orf and sor genes of human immunodeficiency virus: In
vitro transcription-translation and immunoreactive domains, Proc.
Natl. Acad. Sci., vol. 84, Aug. 1987, pp. 5429-5433. cited by other
.
F. Zhang, "Fine-Structure Analysis of the Processing and
Polyadenylation Region of the Herpes Simplex Virus Type 1 Thymidine
Kinase Gene by Using Linker Scanning, Internal Deletion, and
Insertion Mutations," Molecular and Cellular Biology, vol. 6, No.
12, Dec. 1986, pp. 4611-4623. cited by other .
G. J. Murakawa, et al., "Laboratory Methods: Direct Detection of
HIV-1 RNA from AIDS and ARC Patient Samples," DNA, vol. 7, No. 4,
1988, pp. 287-295. cited by other .
J. A. Zaia, M.D. et al., "Confirmation of HIV Infection Using Gene
Amplification," Testtrends, vol. 3, No. 1, Jun. 1989, pp. 4-5.
cited by other .
J.A. Zaia, "Confirmation of HIV Infection Using Gene
Amplification," Transfusion Medicine Reviews, vol. 3, No. 1, Suppl.
1, Jan. 1989, pp. 27-30. cited by other.
|
Primary Examiner: Chunduru; Prabha
Attorney, Agent or Firm: Rothwell, Figg, Ernst & Manbeck
PC
Government Interests
This invention was made with government support under Grant Nos.
U01 CA34991 and P01 CA30206 awarded by the National Institutes of
Health. The government has certain rights in the invention.
Parent Case Text
This application is a continuation-in-part of each of application
Ser. No. 07/355,296 filed May 22, 1989, now abandoned (which is a
file-wrapper-continuation of application Ser. No. 06/941,379, filed
Dec. 15, 1986) now abandoned application Ser. No. 07/143,045 filed
Jan. 12, 1988 now abandoned (which is a continuation-in-part of
application Ser. No. 06/941,379), now abandoned and application
Ser. No. 07/148,959 filed Jan. 27, 1988 now abandoned application
Ser. Nos. 07/355,296, 07/143,045 and 07/148,959 are incorporated in
this application by reference.
Claims
We claim:
1. A process for amplification of a target viral RNA and a
reference RNA in a sample which comprises: (i) selecting a sequence
present in the target viral RNA; (ii) adding a known quantity of a
reference RNA sequence to the sample, wherein the reference RNA
sequence comprises a sequence present in the selected target viral
RNA sequence and a sequence not present in the selected target
viral RNA sequence, wherein the reference RNA sequence and the
selected target viral RNA sequence can be amplified by different
oligonucleotides and wherein following amplification amplified
reference RNA sequence and amplified selected target viral RNA
sequence are distinguishable by size or by probes; (iii)
simultaneously subjecting the selected target viral RNA sequence
and the reference RNA sequence in the sample to polymerase chain
reaction amplification under conditions appropriate to
simultaneously amplify the selected target viral RNA sequence if
present in the sample and the reference RNA sequence; and (iv)
measuring the amounts of the amplified selected target viral RNA
sequence and the amplified reference RNA sequence.
2. The process of claim 1, wherein the reference RNA sequence
consists of a linear arrangement of a sequence present in the
selected target viral RNA sequence, a sequence not present in the
selected target viral RNA sequence and a sequence present in the
selected target viral RNA sequence.
3. The process of claim 1, wherein the target viral RNA sequence is
a human immunodeficiency virus (HIV) RNA sequence or a human
cytomegalovirus (HCMV) RNA sequence.
4. The process of claim 1, wherein a primer utilized in the
polymerase chain reaction amplification includes a T-7 RNA
polymerase binding sequence.
5. The process of claim 1, wherein the amount of the amplified
target viral RNA sequence and the amount of the amplified reference
RNA sequence are measured by measuring (i) the amount of signal
obtained from the amplified target viral RNA sequence and (ii) the
amount of signal obtained from the amplified reference RNA
sequence.
6. The process of claim 5, wherein the amounts of the signals are
determined by the use of labeled probes.
7. The process of claim 6, wherein the label is an isotope or a
fluorophore.
8. The process of claim 5, wherein the amounts of the signals are
determined by the use of labeled primers in the polymerase chain
reaction.
9. The process of claim 8, wherein the label is an isotope or a
fluorophore.
10. A process for amplification of a target viral RNA and a
reference RNA in a sample which comprises: (i) selecting a sequence
present in the target viral RNA; (ii) adding a known quantity of a
reference RNA sequence to the sample, wherein the reference RNA
sequence comprises a sequence present in the selected target viral
RNA sequence and a sequence not present in the selected target
viral RNA sequence, wherein the reference RNA sequence and the
selected target viral RNA sequence can be amplified by different
oligonucleotides and wherein following amplification amplified
reference RNA sequence and amplified selected target viral RNA
sequence are distinguishable by size or by probes; (iii)
simultaneously subjecting the selected target viral RNA sequence
and the reference RNA sequence in the sample first to a reverse
transcription reaction and then to polymerase chain reaction
amplification under conditions appropriate to simultaneously
amplify the selected target viral RNA sequence if present in the
sample and the reference RNA sequence; (iv) measuring the amounts
of the amplified selected target viral RNA sequence and the
amplified reference RNA sequence.
11. The process of claim 10, wherein the reference RNA sequence
consists of a linear arrangement of a sequence present in the
selected target viral RNA sequence, a sequence not present in the
selected target viral RNA sequence and a sequence present in the
selected target viral RNA sequence.
12. The process of claim 10, wherein the target viral RNA sequence
is a human immunodeficiency virus (HIV) RNA sequence or a human
cytomegalovirus (HCMV) RNA sequence.
13. The process of claim 10, wherein a primer utilized in the
polymerase chain reaction amplification includes a T-7 RNA
polymerase binding sequence.
14. The process of claim 10, wherein the amount of the amplified
target viral RNA sequence and the amount of the amplified reference
RNA sequence are measured by measuring (i) the amount of signal
obtained from the amplified target viral RNA sequence and (ii) the
amount of signal obtained from the amplified reference RNA
sequence.
15. The process of claim 14, wherein the amounts of the signals are
determined by the use of labeled probes.
16. The process of claim 15, wherein the label is an isotope or a
fluorophore.
17. The process of claim 14, wherein the amounts of the signals are
determined by the use of labeled primers in the polymerase chain
reaction.
18. The process of claim 17, wherein the label is an isotope or a
fluorophore.
19. A process for amplification of a target viral RNA sequence and
a reference RNA sequence in a sample which comprises: combining a
known quantity of a reference RNA sequence with the sample, wherein
the reference RNA sequence comprises a sequence present in the
target viral RNA sequence and a sequence not present in the target
viral RNA sequence, wherein the reference RNA sequence and the
target viral RNA sequence can be amplified by different
oligonucleotides and wherein following amplification amplified
reference RNA sequence and amplified target viral RNA sequence are
distinguishable by size or by probes; simultaneously subjecting the
target viral RNA sequence and the reference RNA sequence to
polymerase chain reaction amplification under conditions
appropriate to simultaneously amplify the target viral RNA sequence
and the reference RNA sequence; measuring the amounts of amplified
target viral RNA sequence and amplified reference RNA sequence.
20. The process of claim 19, wherein the reference RNA sequence
consists of a linear arrangement of a sequence present in the
target viral RNA sequence, a sequence not present in the target
viral RNA sequence and a sequence present in the target viral RNA
sequence.
21. The process of claim 19, wherein the target viral RNA sequence
is a human immunodeficiency virus (HIV) RNA sequence or a human
cytomegalovirus (HCMV) RNA sequence.
22. The process of claim 19, wherein a primer utilized in the
polymerase chain reaction amplification includes a T-7 RNA
polymerase binding sequence.
23. The process of claim 19, wherein the amount of the amplified
target viral RNA sequence and the amount of the amplified reference
RNA sequence are measured by measuring (i) the amount of signal
obtained from the amplified target viral RNA sequence and (ii) the
amount of signal obtained from the amplified reference RNA
sequence.
24. The process of claim 23, wherein the amounts of the signals are
determined by the use of labeled probes.
25. The process of claim 24, wherein the label is an isotope or a
fluorophore.
26. The process of claim 23, wherein the amounts of the signals are
determined by the use of labeled primers in the polymerase chain
reaction.
27. The process of claim 26, wherein the label is an isotope or a
fluorophore.
28. A process for amplification of a target viral RNA sequence and
a reference RNA sequence in a sample which comprises: combining a
known quantity of a reference RNA sequence with the sample, wherein
the reference RNA sequence comprises a sequence present in the
target viral RNA sequence and a sequence not present in the target
viral RNA sequence, wherein the reference RNA sequence and the
target viral RNA sequence can be amplified by different
oligonucleotides and wherein following amplification amplified
reference RNA sequence and amplified target viral RNA sequence are
distinguishable by size or by probes; simultaneously subjecting the
target viral RNA sequence and the reference RNA sequence in the
sample first to a reverse transcription reaction and then to
polymerase chain reaction amplification under conditions
appropriate to simultaneously amplify the target viral RNA sequence
if present in the sample and the reference RNA sequence; measuring
the amounts of amplified target viral RNA sequence and amplified
reference RNA sequence.
29. The process of claim 28, wherein the reference RNA sequence
consists of a linear arrangement of a sequence present in the
target viral RNA sequence, a sequence not present in the target
viral RNA sequence and a sequence present in the target viral RNA
sequence.
30. The process of claim 28, wherein the target viral RNA sequence
is a human immunodeficiency virus (HIV) RNA sequence or a human
cytomegalovirus (HCMV) RNA sequence.
31. The process of claim 28, wherein a primer utilized in the
polymerase chain reaction amplification includes a T-7 RNA
polymerase binding sequence.
32. The process of claim 28, wherein the amount of the amplified
target viral RNA sequence and the amount of the amplified reference
RNA sequence are measured by measuring (i) the amount of signal
obtained from the amplified target viral RNA sequence and (ii) the
amount of signal obtained from the amplified reference RNA
sequence.
33. The process of claim 32, wherein the amounts of the signals are
determined by the use of labeled probes.
34. The process of claim 33, wherein the label is an isotope or a
fluorophore.
35. The process of claim 32, wherein the amounts of the signals are
determined by the use of labeled primers in the polymerase chain
reaction.
36. The process of claim 35, wherein the label is an isotope or a
fluorophore.
37. The process of claim 1, wherein the sequence not present in the
selected target viral RNA sequence is about 21 nucleotides in
length.
38. The process of claim 10, wherein the sequence not present in
the selected target viral RNA sequence is about 21 nucleotides in
length.
39. The process of claim 19, wherein the sequence not present in
the selected target viral RNA sequence is about 21 nucleotides in
length.
40. The process of claim 28, wherein the sequence not present in
the selected target viral RNA sequence is about 21 nucleotides in
length.
41. A process for quantitation of a target viral RNA in a sample
which comprises: (i) selecting a sequence present in the target
viral RNA; (ii) adding a known quantity of a reference RNA sequence
to the sample, wherein the reference RNA sequence comprises a
sequence present in the selected target viral RNA sequence and a
sequence not present in the selected target viral RNA sequence,
wherein the reference RNA sequence and the selected target viral
RNA sequence can be amplified by different oligonucleotides and
wherein following amplification amplified reference RNA sequence
and amplified selected target viral RNA sequence are
distinguishable by size or by probes; (iii) simultaneously
subjecting the selected target viral RNA sequence and the reference
RNA sequence in the sample to polymerase chain reaction
amplification under conditions appropriate to simultaneously
amplify the selected target viral RNA sequence if present in the
sample and the reference RNA sequence; (iv) measuring the amounts
of the amplified selected target viral RNA sequence and the
amplified reference RNA sequence; and (v) determining the relative
amount of the target viral RNA present in the sample before
amplification from the amount of the amplified selected target
viral RNA sequence and the amount of the amplified reference RNA
sequence.
42. A process for quantitation of a target viral RNA in a sample
which comprises: (i) selecting a sequence present in the target
viral RNA; (ii) adding a known quantity of a reference RNA sequence
to the sample, wherein the reference RNA sequence comprises a
sequence present in the selected target viral RNA sequence and a
sequence not present in the selected target viral RNA sequence,
wherein the reference RNA sequence and the selected target viral
RNA sequence can be amplified by different oligonucleotides and
wherein following amplification amplified reference RNA sequence
and amplified selected target viral RNA sequence are
distinguishable by size or by probes; (iii) simultaneously
subjecting the selected target viral RNA sequence and the reference
RNA sequence in the sample first to a reverse transcription
reaction and then to polymerase chain reaction amplification under
conditions appropriate to simultaneously amplify the selected
target viral RNA sequence if present in the sample and the
reference RNA sequence; (iv) measuring the amounts of the amplified
selected target viral RNA sequence and the amplified reference RNA
sequence; and (v) determining the relative amount of the target
viral RNA present in the sample before amplification from the
amount of the amplified selected target viral RNA sequence and the
amount of the amplified reference RNA sequence.
43. A process for quantitation of a target viral RNA sequence in a
sample which comprises: combining a known quantity of a reference
RNA sequence with the sample, wherein the reference RNA sequence
comprises a sequence present in the target viral RNA sequence and a
sequence not present in the target viral RNA sequence, wherein the
reference RNA sequence and the target viral RNA sequence can be
amplified by different oligonucleotides and wherein following
amplification amplified reference RNA sequence and amplified target
viral RNA sequence are distinguishable by size or by probes;
simultaneously subjecting the target viral RNA sequence and the
reference RNA sequence to polymerase chain reaction amplification
under conditions appropriate to simultaneously amplify the target
viral RNA sequence and the reference RNA sequence; measuring the
amounts of amplified target viral RNA sequence and amplified
reference RNA sequence; and determining the relative amount of the
target viral RNA sequence present in the sample before
amplification from the amount of the amplified target viral RNA
sequence and the amount of the amplified reference RNA
sequence.
44. A process for quantitation of a target viral RNA sequence in a
sample which comprises: combining a known quantity of a reference
RNA sequence with the sample, wherein the reference RNA sequence
comprises a sequence present in the target viral RNA sequence and a
sequence not present in the target viral RNA sequence, wherein the
reference RNA sequence and the target viral RNA sequence can be
amplified by different oligonucleotides and wherein following
amplification amplified reference RNA sequence and amplified target
viral RNA sequence are distinguishable by size or by probes;
simultaneously subjecting the target viral RNA sequence and the
reference RNA sequence in the sample first to a reverse
transcription reaction and then to polymerase chain reaction
amplification under conditions appropriate to simultaneously
amplify the target viral RNA sequence if present in the sample and
the reference RNA sequence; measuring the amounts of amplified
target viral RNA sequence and amplified reference RNA sequence; and
determining the relative amount of the target viral RNA sequence
present in the sample before amplification from the amount of the
amplified target viral RNA sequence and the amount of the amplified
reference RNA sequence.
45. An amplification reaction mixture for the quantitation of a
target viral RNA sequence in a biological sample, said reaction
mixture comprising: a target viral RNA sequence; a known quantity
of a reference RNA sequence, wherein the reference RNA sequence
comprises a sequence present in the target viral RNA sequence and a
sequence not present in the target viral RNA sequence, wherein the
reference RNA sequence and the target viral RNA sequence can be
amplified by different oligonucleotides and wherein following
amplification amplified reference RNA sequence and amplified target
viral RNA sequence are distinguishable by size or by probes; and an
oligonucleotide primer pair for each of the target viral RNA
sequence and the reference RNA sequence to be amplified.
46. A reverse transcription reaction mixture for reverse
transcribing a target viral RNA sequence suspected of being present
in a biological sample, said reaction mixture comprising: a target
viral RNA sequence; a known quantity of a reference RNA sequence,
wherein the reference RNA sequence comprises a sequence present in
the target viral RNA sequence and a sequence not present in the
target viral RNA sequence, wherein the reference RNA sequence and
the target viral RNA sequence can be amplified by different
oligonucleotides and wherein following amplification amplified
reference RNA sequence and amplified target viral RNA sequence are
distinguishable by size or by probes; and an oligonucleotide primer
pair for each of the target viral RNA sequence and the reference
RNA sequence to be amplified for initiating cDNA synthesis to
provide a target viral cDNA and a reference sequence cDNA, whereby
following reverse transcription the resulting target viral and
reference sequence cDNAs can serve as templates for amplification
for providing amplified reference RNA sequence and amplified target
viral RNA sequence.
47. A kit for the quantitation of a target viral RNA sequence in a
biological sample comprising individual containers which provide: a
known quantity of a reference RNA sequence, wherein the reference
RNA sequence comprises a sequence present in the target viral RNA
sequence and a sequence not present in the selected target viral
RNA sequence, wherein the reference RNA sequence and the target
viral RNA sequence can be amplified by different oligonucleotides
and wherein following amplification amplified reference RNA
sequence and amplified target viral RNA sequence are
distinguishable by size or by probes; and an oligonucleotide primer
pair for each of the target viral RNA sequence and the reference
RNA sequence to be amplified.
Description
BACKGROUND
It is known to utilize the polymerase chain reaction (PCR) to
amplify RNA and DNA sequences present in small samples. The
amplification procedure can be simultaneously performed on more
than one sequence. The presence or absence of a specific sequence
in the amplification product may be determined by oligonucleotide
hybridization assays. See generally Mullis, U.S. Pat. No.
4,683,195.
Virus etiology generally and retrovirus etiology in particular are
complex. See Varmus, Retroviruses, Science 240:1427-1435 (1988).
Known PCR techniques, as applied to rapidly diagnose or confirm
potential retroviral positive patients, are of limited sensitivity,
lack positive controls and may otherwise be unreliable. For
example, persons who were seropositive but both virus
culture-negative and PCR-negative are reported by Ou et al. Science
239:295-297 (1988). As a first explanation for this observation, Ou
suggests that these persons may have contained an insufficient
number of provirus copies to be directly detected by the PCR
technique utilized.
SUMMARY OF THE INVENTION
This invention provides a PCR technique of improved sensitivity
which includes a positive control for determination of the presence
or absence of a target sequence in viral RNA sample.
Increased sensitivity is provided by utilizing viral RNA as the
original PCR template. The viral RNA is converted to complementary
DNA which is then amplified. Unique sequences in samples containing
as few as 100 molecules of RNA and retroviral RNA in samples from
as little as 10 nanograms (ng) of total cellular RNA can be
detected by the invention. Positive controls are provided by
amplification of at least one synthetic RNA sequence simultaneously
with the RNA sample.
Clinical applications of the invention include the identification
and quantification of viral RNA present in peripheral blood samples
and laboratory cell lines. Patients who harbor a viral genome but
are not yet producing anti-viral antibodies may be diagnosed as
uninfected by known screening methods. In contrast, this invention
enables detection of viral transcripts, such as those of the AIDS
virus which may accumulate in the absence of viral protein
translation during the early stages of infection.
DETAILED DESCRIPTION OF THE INVENTION
In general the method of the invention entails utilizing a sample
RNA which has or may have a target viral sequence as a template for
amplification by PCR. A first oligonucleotide primer for the target
viral sequence is annealed to the template for extension through
the target sequence to produce a first extension product having an
RNA template strand and a DNA primer extension strand. The first
extension product is denatured and the separated RNA template and
DNA primer extension strands are annealed, respectively to the
first primer and to a second primer complementary to the DNA primer
extension strand. The first and second primers are positioned for
extension through the target sequence on the template and its
complement on the primer extension strand. The first and second
primers are extended to produce a second primer extension product
which is denatured, the first and second primers are again annealed
to the separated template and primer extension strands, and again
extended and the resulting extension products denatured. The
process is repeated for the number of cycles deemed appropriate to
achieve the desired degree of amplification.
After the final round of amplification and denaturation, the
product is analyzed, for example, by oligonucleotide hybridization
assay to determine the presence or absence of a sequence indicative
of the presence of the target sequence in the sample.
In the early cycles, e.g., the first five cycles after the
production and denaturing of the first extension product, the
amplification steps are conducted in the presence of both reverse
transcriptase and the large fragment of DNA polymerase I (Klenow)
or similarly functioning enzyme. Subsequent cycles may
appropriately be conducted in the absence of reverse transcriptase.
Ribonuclease A is preferably added after about 5 to about 7 cycles
of DNA amplification to destroy residual RNA and reduce sequence
complexity of the mixture.
In the preferred practice of the invention, both the first and
second primer are present throughout the amplification procedure.
Alternatively the second primer can be added at any stage of the
process prior to the amplification of the denatured first extension
product.
For identification and quantification purposes it is preferred to
amplify the viral RNA sample, typically from virus infected T-4
lymphocytes present in peripheral blood, simultaneously with at
least one other RNA sequence to provide a positive control and
reduce the risk of false negative data. A plurality of first and
second primer pairs is provided, one such pair for each RNA
sequence to be amplified. The amplification procedure is otherwise
accomplished as previously described.
The T-4 lymphocyte cell population which is primarily infected by a
virus expresses the T-cell receptor. Hence sequences unique to the
T-cell receptor provide appropriate positive control sequences
useful in the invention. Although other such unique sequences may
be selected, at least a portion of the constant region of the
relevant T-cell receptor .beta. chain is preferred for use as a
control sequence.
Additional control sequences include those which are present in the
expression products of all or virtually all of the cells of a
patient sample even when the T-cell count is low or which can be
amplified and detected by the same oligonucleotide as those used
for authentic virus RNA samples.
Primers useful for the amplification of HIV-1 sequences
include:
TABLE-US-00001 Sequence Location 5' LTR 88-284 (Starcich, et. al.
Science 227: 538-540 (1985) gag 1551-1665 (Ratner, et al. Nature
313: 277-284 (1985) env 7801-9081 (Ratner, et al. Nature 313:
277-284 (1985) 3'ORF (nef) 8950-9081 (Ratner, et al. Nature 313:
277-284 (1985)
Specifically preferred first and second HIV-1 primers and a useful
probe when the target is the 3' ORF (nef) sequence comprising the
following synthetic oligonucleotides:
TABLE-US-00002 HIVA: 5' ATG CCG ATT GTG CTT GGC TA 3' or 5' ATG CTG
ATT GTG CCT GGC TA 3' HIVB: 5' TGA ATT AGC CCT TCC AGT CC 3' HIVC
(PROBE): 5' AAG TGG CTA AGA TCT ACA GCT GCC T 3'
When the target is the HIV-1 5' LTR sequence the following primer
and probe sequences are appropriate:
TABLE-US-00003 HIVD Primer: 5' TGA GTG CTT CAA GTA AGTG TGT GCC C
3' HIVE Primer: 5' GTC GCC GCC CCT CGC CTC TTG CCG T 3' HIVF Probe:
5' CGA AAG GGA AAC CAG AGC TCT CTC G 3'
As applied to human cytomegalovirus (HCMV), a target for
amplification is a region of the HCMV major IE gene (IE1) region
between nucleotides 1154 and 1331. Oligodeoxyribonucleotides
complementary to sequences in this region are used with RNA from
HCMV infected cells, or from patient peripheral blood samples.
Suitable oligonucleotide primers and probes have the following
sequences:
TABLE-US-00004 HCMV 1154 5' CGAGACACCCGTGACCAAGG 3' 1173 HCMVB 1311
3' CTCTTTCTACAGGACCGTCT 5' 1330 HCMV 1182 3'
AAGGACGTCTGATACAACTCCTT 5' 1204 (Probe I)
An additional amplification system is needed for detection of RNA
from the transcripts of late HCMV genes, which are important
markers for active infection. For this purpose, sequences 866-1025
from the coding sequence of p64 (see, Ruger, B., et al. J. Virol.
61:446 (1987)) may be amplified. Suitable oligonucleotide primers
and probes have the following sequences:
TABLE-US-00005 HCMVD 866 5' AAAGAGCCCGACGTCTACTACACGT 3' 890 HCMVE
1001 3' CTGGTCATGCAGTTCCACATGGACC 5' 1025 HCMV 941 3'
CGCGTGCTCGACCAAACGAGGTACCTCTTG 5' 970 Probe II
When the T-cell receptor ps chain is used to provide a construct,
appropriate primers and probes may have the sequences:
TABLE-US-00006 Primer A: 5' GTC CAC TCG TCA TTC TCC GA 3' or 5' GTC
CAC TCG TCA TTC TCC GAG 3' Primer B: 5' TCA AGA CTC CAG ATA CTG CCT
3' or 5' TAA TAC GAC TCA TAT AGG GAC TCC AGA TTA CGC CTG AGC 3'
Probe C: 5' CAG AAG GTG GCC GAG ACC CTC AGG C 3' or 5' CAG AAG GTG
GCC GAG ACC CTC CGG C 3'
Sequences unique to .beta.-actin tend to be ubiquitously present in
the expression products of all of the cells of the patient sample
and hence provide useful controls. Preferred synthetic
oligonucleotide primer and probe sequences for use in connection
with .beta.-actin controls are:
TABLE-US-00007 Primer A: 5' CTC ATT GCC AAT GGT GAT GAC CTG 3'
Primer B: 5' GCT ATC CCT GTA CGC CTC TGG C' or 5' GCT ATC CCT GTA
CGC CTC ACC G' Probe C: 5' CGG TGA GGA TCT TCA TGA GGT AGT C' 3' or
5' CGG TGA GGA TCT TCA TGA GCT AGT C 3'
An additional aid to quantitation of virus levels in patient
samples is provided by a reference RNA which can be amplified and
detected by the same oligonucleotides used for authentic virus RNA
samples.
Such a reference RNA may be a "minigene" or a "maxigene" formed by
a multi-base pair insert into or deletion of at least about 20
nucleotides from a unique site. For example a preferred reference
RNA includes a 21 base pair insert into the KpnI site of the HIV-1
3' ORF (nef) region of the pGEM92 clone described in Example I. An
insert of sequence: 5'CACACAAGGCTACTTCGGTAC 3',
3'GTGTGTTCCGATGAAGCCATG5' is appropriate.
The transcription product of this clone is 21 bases longer than the
authentic HIV-sequence but still hybridizes with the 25-mer probe
HIVC. It is therefore distinguishable by size from the authentic
viral product.
Such "minigenes" and "maxigenes" not only provide an internal
control but also an additional aid to quantitation. Because the
quantity of "maxigene" minigene RNA originally included in the
amplification reaction is known, the amount of signal obtained from
the maxi or minigene amplification product can be related to the
signal obtained from the patient sample. Hence, the relative
quantitation of the original amount of authentic HIV-1 in the
patient sample is provided.
Similar procedures can be used as a quantitative assay of HCMV
sequences. A segment of the cDNA derived from the major IE gene IE1
is subcloned into the transcription vector pTZ18U (BioRad), and
includes nucleotides 1185-1331. A small insertion accomplished
either by cloning or by site directed mutagenesis is made in this
segment which permits distinction between the PCR-amplified viral
RNA and cellular amplified transcripts. By including a fixed amount
of this plasmid HCMV RNA or DNA in every sample to be amplified, it
is possible to measure the amount of viral DNA or RNA using the in
vitro sample as an internal standard.
To provide appropriate signals either the primers or the probes are
labelled, e.g., with an isotope such as p.sup.32 or a fluorophore.
Preferably, the probes are labelled.
For purposes of identification and quantification, the
amplification products may be electrophoresed in a gel, e.g.,
agarose or 6% polyacrylamide, 7 M. urea gel. Labelled probes
complementary to each of the amplified sequences are used
sequentially. Hybridization of the probes with amplification
products other than of authentic viral sequence, e.g., HIV or HCMV
provides positive controls thus minimizing the possibility of false
negative data regarding the authenticity of the original sample.
More particularly, if the authentic, e.g., HIV probe yields
negative data, but one or both the T-cell receptor and beta actin
probes yield positive data, the conclusion may be feasibly drawn
that the original sample was viable notwithstanding the negative
HIV probe result. Thus, the invention includes a process for
discerning false negative data or positive data in the
identification of a target viral RNA sequence in a peripheral blood
cell sample which process comprises: (i) selecting said target
viral RNA sequence; (ii) simultaneously subjecting (a) said sample
and (b) at least one synthetic RNA reference sequence which does
not include said target sequence or which includes substantially
more nucleotides than said target sequence or which includes at
least about 20 nucleotides less than said target sequence to
polymerase chain reaction amplification under conditions
appropriate to simultaneously amplify said target sequence if
present in said sample and said reference sequence; (iii)
denaturing the amplification product or products produced by step
(ii); (iv) subjecting said denatured amplification product or
products of step (iii) to hybridization conditions separately and
sequentially with probes homologous to said target sequence and to
said reference sequence, each of said probes being removed from a
sequence with which it is hybridized prior to the separate and
sequential subjection of said amplification products to
hybridization with another of said probes; (v) determining whether
said amplified target and reference sequences are hybridized with
said probes homologous therewith, false negative data being
indicated by failure of said probes to hybridize either to the
sample or to the reference sequence and false positive data being
indicated by hybridization of the target sequence probe and by the
absence of hybridization of the reference sequence probe.
The process of the invention is useful to amplify and detect viral
RNA from any source. It has particular application to the detection
and quantification of AIDS (HIV-1) virus and cytomegalovirus
(HCMV).
Example I
This example illustrates the amplification of in vitro synthesized
RNA by the use of the plasmid pSP64-BH10-R3 (Biotech Research
Laboratories, Inc.), containing the entire HTLV-III (HIV-1) virus
excluding the LTRs, as the starting material for the following
subclone vectors. A 1.1 kb BamHI restriction fragment including
HIV-1 sequences 8052 to 9149 was subcloned in both orientations
into the BamHI site of the transcription vector pGEM2 (Promega
Biotec). The resulting plasmids, pGM92 (+strand) and pGM93 (-
strand), were digested with EcoR1 and transcribed with T7 RNA
polymerase using a T7 transcription kit (BioRad Laboratories,
Inc.).
10.sup.-1 pmol of RNA from pGM92 was subjected to 4, 5, 8 and 10
cycles of amplification. Amplification was performed using I-X
amplification buffer (10 mM tris-HCl, pH 7.5; 10 mM MgCl.sub.2; 66
mM NaCl; 1 mM dithiothreitol), 1.5 mM of each dNTP, and 1.0 uM of
each oligodeoxyribonucleotide (HIVA and HIVB, supra) in a final
reaction volume of 100 ul. Samples were denatured by heating to
95.degree. C. for 2 minutes, spun in a microfuge for 5 seconds,
cooled to 37.degree. C. for 2 minutes, at which time 1.0 ul of
reverse transcriptase (2.0 units, BioRad), diluted in amplification
buffer, was added for 2 minutes. Cycles 2-5 were performed as
described above, except both reverse transcriptase and Klenow (0.5
units, Boehringer Mannheim) were added. In cycle 6, RNase A was
added (0.45 ug) and only DNA pol I was used. All subsequent cycles
of amplification were performed with only the presence of DNA pol
I. After completion of the last cycle of amplification, samples
were placed on ice and a 10.0 ul portion was electrophoresed in a
1.8% agarose gel. The DNA was transferred to Zeta probe (BioRad)
using an alkaline blotting procedure (see Reed, K. G., et al.
Nucleic Acids Res. 13:7207-7221 (1988)) and prehybridized and
hybridized as follows: The prehybridization reaction was performed
at 65.degree. C. for 1 to 3 hours in 20 ml of 6.times.SSPE (1.0 M
NaCl, 0.06 M NaPO.sub.4, 0.006 M EDTA); 1.0% SDS; 0.5% rehydrated,
powder skim milk; and 10 ug per ml of sonicated, denatured salmon
sperm DNA. The hybridization reaction was in 20 ml of the same
buffer, except the salmon sperm DNA was omitted and replaced with
20 pmol of 5'-.sup.32P-labelled oligodeoxyribonucleotide probe HIVC
(ca. 3.times.10.sup.8 cpm). Hybridization was for 1 hour to
overnight at 65.degree. C. The hybridized filter was washed with
three 250 ml volumes of 6.times.SSC (0.95 M NaCl, 0.095 M Na
Citrate), 0.1% SDS at 65.degree. C. for 5 minutes each, and
autoradiographed at -70.degree. C. for 1 hour on Kodak XAR-5 film
with an intensifying screen.
A 3.81 fold level of amplification was revealed by densitometric
scanning and integration of the peak areas. Thus, if 21 cycles were
performed with this template, and since only one strand is
synthesized during the first cycle, the calculated theoretical
amplification is over 400,000 fold.
Example II
To test the sensitivity of amplification, samples in which
10.sup.-9, 10.sup.-7, and 10.sup.-5, pmol of pGM92 RNA were used in
repetitions of Example I. After 21 cycles of replication, bands
from each of the samples could be detected after Southern blot
hybridization. Since only one tenth of the reaction was used in the
detection of the positive sequence in a sample from only 10.sup.-9
pmol, this result shows that as few as 100 molecules of RNA are
sufficient for detection after amplification.
Example III
This example demonstrates amplification of an RNA template in the
presence of non-specific RNA. 5.5 ug of bovine rRNA was added to a
reaction mixture as described in Example I containing 10.sup.-3
pmol of GM92 RNA. Specific amplification was seen at high
efficiency.
Example IV
This example demonstrates that RNA isolated from HIV infected cells
can be efficiently utilized for amplification and detection
pursuant to this invention. Polymerase chain reaction using only 10
ng of total RNA from HIV infected H9 cells was performed as
described in Example I. A specific hybridizing band, about two
orders of magnitude lower than the 1.0 ug sample, was observed. To
test if the amplification of the in vivo sample was from RNA or
residual DNA contamination, a control sample in which RNase A was
added prior to amplification was examined. In this experiment, no
hybridization band was detected after prolonged autoradiographic
exposure.
Amplification using an oligonucleotide primer containing the T-7
RNA polymerase (BioRad Laboratories) increases the sensitivity of
detection when the amplification is followed by a transcription
step. The following HIV T7 sequence is illustrative:
HIV T7-5'TTAATACGACTCACTATAGGG 3'.
Example V
Amplification is performed using 1-X amplification buffer (10 mM
Tris-HCl, pH 7.5; 10 mM MgCl.sub.2; 66 mM NaCl; 1 mM
dithiothreitol), 1.5 mM of each dNIP). To this buffer, about 1 mM
total peripheral blood lymphocyte RNA from an AIDS infected patient
in about 1.0 mM of each of the priming nucleotides HIVA, HIVB
T-cell receptor A and T-cell receptor B are added providing a final
reaction volume of approximately 100 .mu.l. The sample is heated at
95.degree. C. for 2 minutes, centrifuged for 5 seconds, cooled to
37.degree. C. for about 2 minutes at which time 1.0 .mu.l of AMV
reverse transcriptase (Life Sciences or BioRad Laboratories)
diluted in the amplification buffer were added and incubation was
continued for 2 minutes at 37.degree. C. A second amplification
cycle was performed in like manner. Thereafter the final 28 rounds
of amplification were accomplished using a buffer consisting of 2.5
units of Thermus aquatus DNA polymerase (Perkin-Elmer Cetus or New
England Biolabs): 50 mM KC1, 10 mM Tris, pH 8.3, 1.5 mM MgCl.sub.2,
0.01% gelatin, 200 .mu.M each dNTP, and 50 pmoles of each primer in
a final volume of 50 microliters overlain with 10 microliters of
paraffin oil. The polymerizations are carried out from 1 to 2
minutes at 65.degree. C., with 1 minute of denaturation at
95.degree. C., and 1 minute of annealing at 37.degree. C.
After completion of the last cycle of amplification, the products
are placed on ice and a 10 .mu.l portion was electrophoresed in a
1.8% agarose gel. The DNA was transferred to Zeta probe (BioRad)
using an alkaline blotting procedure and prehybridized and
hybridized as follows: The prehybridization reaction was performed
at 65.degree. C. for 1 to 3 hours in 20 ml of 6.times.SSPE (1.0 M
NaCl, 0.06 NaPO.sub.4, 0.006 M EDTA); 1.0% SDS; 0.5% rehydrated,
powder skim milk (Alba); and 10 .mu.g per ml of sonicated,
denatured salmon sperm DNA. The hybridization reaction was in 20 ml
of the same buffer, except the salmon sperm DNA was omitted and
replaced with 20 pmol of 5'-.sup.32P-labelled
oligodeoxyribonucleotide HIVC (ca. 3.times.10.sup.8 cpm).
Hybridization was for 1 hour to overnight at 65.degree. C. The
hybridized filter was washed with three 250 ml volumes of
6.times.SSC (0.95 M NaCl, 0.095 M Na Citrate), 0.1% SDS at
65.degree. C. for 5 minutes each, and autoradiographed at
-70.degree. C. for 1 hour on Kodak XAR-5 film with an intensifying
screen.
Each of the HIVC and T-cell receptor C probes is used separately
and sequentially. After the results with the HIVC probe are
obtained, that probe is stripped from the filter by treatment with
100 C 0.1.times.SSC, 0.1% SDS, two times for 15 minutes each. The
filter is then rehybridized to the T-cell receptor C probe.
Bands from each of the authentic HIV and T-cell receptor samples
are detected after Southern Blot hybridization.
Example VI
Example I is repeated with the exception that the primer pair beta
actin A and beta actin B is included in the amplification reaction
mixture.
The amplification products are analyzed separately and sequentially
by probes which hybridize with authentic viral RNA, the amplified
T-cell receptor RNA sequence and the amplified beta actin A
sequence. Bands from each such sequence are detected after Southern
blot hybridization.
Example VII
Example I is repeated with the exception that the maxigene primer
is included in the reaction mixture.
Kits contemplated by the invention include self-contained
appropriate quantities of primers and probes for use in the
practice of the invention.
A typical kit for the detection and quantification of HIV-1 virus
in a patient peripheral blood sample includes vials or similar
separate containers filled with, for example, 20
picomoles/microliters (in sterile H.sub.2O) each of HIVA, HIVB or
HIVC. A reference RNA (.about.10,000 copies/microliter) is prepared
in sterile DEPC treated water. Such kits include reagents and
instructions necessary to conduct the appropriate amplification and
hybridization procedures.
* * * * *