U.S. patent number 8,206,914 [Application Number 12/834,072] was granted by the patent office on 2012-06-26 for evolving new molecular function.
This patent grant is currently assigned to President and Fellows of Harvard College. Invention is credited to Christopher T. Calderone, Jeffrey B. Doyon, Zev J. Gartner, Matthew W. Kanan, Xiaoyu Li, David R. Liu, Daniel M. Rosenbaum, Thomas M. Snyder.
United States Patent |
8,206,914 |
Liu , et al. |
June 26, 2012 |
Evolving new molecular function
Abstract
Nature evolves biological molecules such as proteins through
iterated rounds of diversification, selection, and amplification.
The power of Nature and the flexibility of organic synthesis are
combined in nucleic acid-templated synthesis. The present invention
provides a variety of template architectures for performing nucleic
acid-templated synthesis, methods for increasing the selectivity of
nucleic acid-templated reactions, methods for performing
stereoselective nucleic acid-templated reactions, methods of
selecting for reaction products resulting from nucleic
acid-templated synthesis, and methods of identifying new chemical
reactions based on nucleic acid-templated synthesis.
Inventors: |
Liu; David R. (Lexington,
MA), Gartner; Zev J. (Santa Cruz, CA), Doyon; Jeffrey
B. (Allston, MA), Calderone; Christopher T. (Boston,
MA), Kanan; Matthew W. (Cambridge, MA), Li; Xiaoyu
(Cambridge, MA), Snyder; Thomas M. (Cambridge, MA),
Rosenbaum; Daniel M. (Burlingame, CA) |
Assignee: |
President and Fellows of Harvard
College (Cambridge, MA)
|
Family
ID: |
31892407 |
Appl.
No.: |
12/834,072 |
Filed: |
July 12, 2010 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20110190141 A1 |
Aug 4, 2011 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
10950367 |
Sep 24, 2004 |
7771935 |
|
|
|
10643752 |
Aug 19, 2003 |
7491494 |
|
|
|
60404395 |
Aug 19, 2002 |
|
|
|
|
60419667 |
Oct 18, 2002 |
|
|
|
|
60432812 |
Dec 11, 2002 |
|
|
|
|
60444770 |
Feb 4, 2003 |
|
|
|
|
60457789 |
Mar 26, 2003 |
|
|
|
|
60469866 |
May 12, 2003 |
|
|
|
|
60479494 |
Jun 18, 2003 |
|
|
|
|
Current U.S.
Class: |
435/6.1 |
Current CPC
Class: |
C12N
15/1068 (20130101); C12Q 1/68 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
19646372 |
|
Jun 1997 |
|
DE |
|
0324616 |
|
Jul 1989 |
|
EP |
|
0643778 |
|
Mar 1995 |
|
EP |
|
0604552 |
|
Feb 1997 |
|
EP |
|
0773227 |
|
May 1997 |
|
EP |
|
WO-9105058 |
|
Apr 1991 |
|
WO |
|
WO-9202536 |
|
Feb 1992 |
|
WO |
|
WO-9306121 |
|
Apr 1993 |
|
WO |
|
WO-9320242 |
|
Oct 1993 |
|
WO |
|
WO-9609316 |
|
Mar 1996 |
|
WO |
|
WO-99/43853 |
|
Sep 1999 |
|
WO |
|
WO-0023458 |
|
Apr 2000 |
|
WO |
|
WO-0032823 |
|
Jun 2000 |
|
WO |
|
WO-0047775 |
|
Aug 2000 |
|
WO |
|
WO-0061775 |
|
Oct 2000 |
|
WO |
|
WO-0116352 |
|
Mar 2001 |
|
WO |
|
WO-02074929 |
|
Sep 2002 |
|
WO |
|
WO-02102820 |
|
Dec 2002 |
|
WO |
|
WO-02103008 |
|
Dec 2002 |
|
WO |
|
WO-03031591 |
|
Apr 2003 |
|
WO |
|
WO-03078050 |
|
Sep 2003 |
|
WO |
|
WO-03078445 |
|
Sep 2003 |
|
WO |
|
WO-03078446 |
|
Sep 2003 |
|
WO |
|
WO-03078625 |
|
Sep 2003 |
|
WO |
|
WO-03078626 |
|
Sep 2003 |
|
WO |
|
WO-03078627 |
|
Sep 2003 |
|
WO |
|
WO-03082901 |
|
Oct 2003 |
|
WO |
|
WO-04001042 |
|
Dec 2003 |
|
WO |
|
WO-2004010101 |
|
Jan 2004 |
|
WO |
|
WO-2004013070 |
|
Feb 2004 |
|
WO |
|
WO-2004016767 |
|
Feb 2004 |
|
WO |
|
WO-2004024929 |
|
Mar 2004 |
|
WO |
|
WO-2004039825 |
|
May 2004 |
|
WO |
|
WO-2004056994 |
|
Jul 2004 |
|
WO |
|
WO-2004074429 |
|
Sep 2004 |
|
WO |
|
WO-2004074501 |
|
Sep 2004 |
|
WO |
|
WO-2004083427 |
|
Sep 2004 |
|
WO |
|
WO-2004110964 |
|
Dec 2004 |
|
WO |
|
WO-2005003778 |
|
Jan 2005 |
|
WO |
|
Other References
Acevedo et al., "Non-Enzymatic Transcription of an
Oligodeoxynucleotide 14 Residues Long" J. Mol. Biol. 197: 187-193
(1987). cited by other .
Alvarez et al., "Photocleavable Protecting Groups as Nucleobase
Protections Allowed the Solid-Phase Synthesis of Base-Sensitive
Sate-Prooligonucleotides" J. Org. Chem. 64: 6319-6328 (1999). cited
by other .
Anderson et al. "A Comparison of Selected mRNA and Protein
Abundances in Human Liver" Electrophoresis 18: 533-537 (1997).
cited by other .
Arap et al., "Steps Toward Mapping the Human Vasculature by Phage
Display" Nat. Med. 8(2) 121-127 (2002). cited by other .
Arnold et al., "Directed Evolution of Biocatalysts" Curr. Opin.
Chem. Biol. 3: 54-59 (1999). cited by other .
Arnold et al, "Design by Directed Evolution" Acc. Chem. Res. 31:
125-131 (1998). cited by other .
Bain et al. "Ribosome-Mediated Incorporation of a Non-Standard
Amino Acid into a Peptide Through Expansion of the Genetic Code"
Nature 356: 537-539 (1992). cited by other .
Baldwin et al. "Enzymes in Synthetic Organic Chemistry" Tetrahedron
Organic Chemistry Series 12:1-40, 1994. cited by other .
Ban et al., "The Complete Atomic Structure of the Large Ribosomal
Subunit at 2.4 .ANG. Resolution" Science 289: 905-920 (2000). cited
by other .
Bannwarth et al., "A Simple and Effective Chemical Phosphyorylation
Procedure for Biomolecules" Helv. Chim. Acta 70: 175-186 (1987).
cited by other .
Barbas et al., "Phage Display: A Laboratory Manual" Cold Spring
Harbor Laboratory Press New York 736 pages (2001) (copy not
enclosed). cited by other .
Barbas et al., Chem. Int. Ed. vol. 37, 1998. 2872-2875 Benner
Reviews. cited by other .
Becker et al., "Synthesis, Sar and In Vivo Activity of Novel
Thienopyridine Sulfonamide Pyrrolidinones as Factor Za Inhibitors"
Bioorg. Med. Chem. Lett. 9: 2753-2758 (1999). cited by other .
Berger et al., "Universal Bases for Hybridization, Replication and
Chain Termination" Nucleic Acids Research 28(15): 2911-2914 (2000).
cited by other .
Blanco et al., "A Method for Detecting Protein-DNA Interactions at
Sites of Chromatin Replication" Analytical Biochemistry 163:
537-545 (1987). cited by other .
Bogarad et al., "A Hierarchical Approach to Protein Molecular
Evolution" Proc. Natl. Acad. Sci. USA 96: 2591-2595 (1999). cited
by other .
Bohler et al., "Template Switching Between PNA and RNA
Oligonucleotides" Nature 376: 578-581 (1995). cited by other .
Bolli et al., "Pyranosyl-RNA: Chiroselective Self-Assembly of Base
Sequences by Ligative Oligomerization of
Tetranucleotide-2'3'-Cyclophosphates (with a Commentary Concerning
the Origin of Biomolecular Homochirality)" Chem. Biol. 4: 309-320
(1997). cited by other .
Boschelli et al., "Synthesis of Amphotericin B. 2. Fragment C-D of
the Aglycone" Tetrahedron Lett. 26: 5239-5242 (1985). cited by
other .
Bostwick et al., "RPR120844, A Novel, Specific Inhibitor of
Coagulation Factor Xa Inhibits Venous Thrombosis in the Rabbit"
Thromb Haemost 81: 157-160 (1999). cited by other .
Brenner et al., "Encoded Combinatorial Chemistry" Proc. Natl. Acad.
Sci. 89: 5381-5383 (1992). cited by other .
Brenner et al., "In Vitro Cloning of Complex Mixtures of DNA on
Microbeads: Physical Separation of Differentially Expressed cDNAs"
Proc. Natl. Acad. Sci. USA 97(4): 1665-1670 (2000). cited by other
.
Bresler et al., "Stability of Peptidyl-tRNA--The Intermediate of
Protein Synthesis" Biochimica et Biophysica Acta 155: 465-475
(1968). cited by other .
Brooks et al., "Antiintegrin av.beta..sub.3 Blocks Human Breast
Cancer Growth and Angiogenesis in Human Skin" J. Clin. Invest. 96:
1815-1822 (1995). cited by other .
Brooks et al., "Disruption of Angiogenesis by PEX, a Noncatalytic
Metalloproteinase Fragment with Integrin Binding Activity" Cell 92:
391-400 (1998). cited by other .
Brooks et al., Integrin .alpha..sub.v.beta..sub.3 Antagonists
Promote Tumor Regression by Inducing Apoptosis of Angiogenic Blood
Vessels Cell 79: 1157-1164 (1994). cited by other .
Bruick et al., "Template-Directed Ligation of Peptides to
Oligonucleotides" Chem. Biol. 3: 49-56 (1996). cited by other .
Cadwell et al., "Randomization of Genes by PCR Mutagenesis" PCR
Methods Appl. 2: 28-33 (1992). cited by other .
Celewicz et al., "Mass Spectrometry of Some Derivatives of
5-(Indol-2-yl) Pyrimidine" Pol. J. Chem. 72: 725-734 (1998). cited
by other .
Chan et al., "Intra-tRNA distance measurements for nucleocapsid
protein-dependent tRNA unwinding during priming of HIV reverse
transcription" Proc. Natl. Acad. Sci. USA 96: 459-464 (1999). cited
by other .
Chen et al., "Template-Directed Synthesis on Oligodeoxycytidylate
and Polydeoxycytidylate Templates" J. Mol. Biol. 181: 271-279
(1985). cited by other .
Cho et al., "An Unnatural Biopolymer" Science 261: 1303-1305
(1993). cited by other .
Choi et al., "Inhibition of Neointimal Hyperplasia by Blocking
.alpha..sub.v.beta..sub.3 Integrin with a Small Peptide Antagonist
Gpen GRGDSPCA" J. Vasc. Surg. 19: 125-134 (1994). cited by other
.
Choi-Sledeski et al., "Sulfonamidopyrrolidinone Factor Xa
Inhibitors: Potency and Selectivity Enhancements via P-1 and P-4
Optimization" J. Med. Chem. 42: 3572-3587 (1999). cited by other
.
Collado et al., "Diastereoselective Functionalization of 5-Hydroxy
Prolinates by Tandem Horner-Emmons-Michael Reaction" Tetrahedron
Lett. 35: 8037 (1994). cited by other .
Compton, "Nucleic Acid Sequence-Based Amplification" Nature 350:
91-92 (1991). cited by other .
Czlapinski et al., "Nucleic Acid Template-Directed Assembly of
Metallosalen-DNA Conjugates" J. Am. Chem. Soc. 123: 8618-8619
(2001). cited by other .
Davis, "Intermediates in Amino Acid Biosynthesis" Adv. Enzymol. 16:
287-295 (1955). cited by other .
Dechantsreiter et al., "N-Methylated Cyclic RGD Peptides as Highly
Active and Selective .alpha..sub.v.beta..sub.3 Integrin
Antagonists" J. Med. Chem. 42: 3033-3040 (1999). cited by other
.
Dewey et al., "New Uridine Derivatives for Systematic Evolution of
RNA Ligands b Exponential Enrichment" J. Am. Chem. Soc. 117:
8474-8475 (1995). cited by other .
Dietz et al., Photochemical Reduction of 5-Bromouracil by Cystine
Derivatives and Coupling of 5-Bromouracil to Cystine Derivatives:
Photochemistry and Photobiology 49(2): 121-129 (1989). cited by
other .
Drews, "Drug Discovery: A Historical Perspective" Science 287:
1960-1964 (2000). cited by other .
Eaton, "The Joys of In Vitro Selection: Chemically Dressing
Oligonucleotides to Satiate Protein Targets" Current Opinion in
Chemical Biology 1: 10-16 (1997). cited by other .
El-Dorry, "Purification of mRNA Coding for Rat-Liver Fructose-
1,6-bisphosphatase by polysome immunoabsorption" Biochimica et
Biophysica Acta 867: 252-255 (1986). cited by other .
Eliseev et al., "Dynamic Combinatorial Chemistry: Evolutionary
Formation and Screening of Molecular Libraries" Combinatorial
Chemistry in Biology 243: 159-172 (1999). cited by other .
Ellis et al., "Functional Analysis of the T-Cell Restricted Protein
Tyrosine Kinase TxK" Biochem. J. 335: 277-284 (1998). cited by
other .
Ewing et al., "Design and Structure--Activity Relationships of
Potent and Selective Inhibitors of Blood Coagulation Factor Xa" J.
Med. Chem. 42: 3557-3571 (1999). cited by other .
Famulok et al., "Oligonucleotide Libraries-Variatio Delectat" Curr.
Opin. Chem. Biol. 2: 320-327 (1998). cited by other .
Fenn et al., "Direct Quantitation of Biotin-Labeled Nucleotide
Analogs in RNA Transcripts" Analytical Chemistry 190: 78-83 (1990).
cited by other .
Fleet et al., "Enantiospecific Synthesis of Shikimic Acid from
D-Mannose: Formation of a Chiral Cyclohexene by Intramolecular
Olefination of a Carbohydrate-Derived Intermediate" J. Chem. Soc.
Perkins. Trans. I: 905-908 (1984). cited by other .
Fleischer et al., "Conversion of Aliphatic and Alicyclic
Polyalcohols to the Corresponding Primary Polyamines" J. Org. Chem.
36(20): 3042-3044 (1971). cited by other .
Francis et al., "Combinatorial Libraries of Transition-Metal
Complexes, Catalysts and Materials" Curr. Opin. Chem. Biol. 2:
422-428 (1998). cited by other .
Francis et al., "Discovery of Novel Catalysts for Alkene
Epoxidation from Metal-Binding Combinatorial Libraries" Angew.
Chem. Int. Ed. Engl. 38: 937-941 (1999). cited by other .
Frankel et al., "Encodamers: Unnatural Peptide Oligomers Encoded in
RNA" Chemistry and Biology 10: 1043-1050 (2003). cited by other
.
Friedlander et al., "Definition of Two Angiogenic Pathways by
Distinct .alpha.v Integrins" Science 270: 1500-1502 (1995). cited
by other .
Fruchart et al., "A New Linker for the Synthesis of C-Terminal
Peptide .alpha.-oxo-Aldehydes" Tetrahedron Lett. 40: 6225 (1999).
cited by other .
Fruchtel et al., "Organic Chemistry on Solid Supports" Angew. Chem.
Int. Ed. Engl. 35: 17-42 (1996). cited by other .
Gad, "Synaptic Vesicle endocytosis studied in a living synapse"
Nobel Institute for Neurophysiology, Karolinska Institutet, Sweden
1-48 (2000). cited by other .
Gallop et al., "Applications of Combinatorial Technologies to Drug
Discovery, 1. Background and Peptide Combinatorial Libraries" J.
Med. Chem. 37: 1233-1251 (1994). cited by other .
Gartner et al., "The Generality of DNA-Templated Synthesis as a
Basis for Evolving Non-Natural Small Molecules" J. Am. Chem. Soc.
123: 6961-6963 (2001). cited by other .
Gat et al., "Reading DNA Differently" Biopolymers 48: 19-28 (1998).
cited by other .
Gevorkian et al. "Rapid Communication Identification of Autoimmune
Thrombocytopenic Purpura-Related Epitopes using Phage-Display
Peptide Library" Clin. Immunol. lmmunopathol 86: 305-309 (1998).
cited by other .
Geyer et al., "Conformational Analysis of a Cyclic RGD Peptide
Containing a .PSI.[CH2-NH] Bond: A Positional Shift in Backbone
Structure Caused by a Single Dipeptide Mimetic" J. Am. Chem. Soc.
116: 7735-7743 (1994). cited by other .
Gilbertson et al., "Asymmetric Catalysis with Libraries of
Palladium .beta.-Turn Phosphine Complexes" J. Am. Chem. Soc. 122:
6522-6523 (2000). cited by other .
Gocke, "Mechanism of Quinolone Mutagenicity in Bacteria" Mutation
Research 248: 135-143 (1991). cited by other .
Gordon et al., Applications of Combinatorial Technologies to Drug
Discovery. 2. Combinatorial Organic Synthesis, Library Screening
Strategies, and Future Directions, J. Med. Chem. 37(10): 1385-1401
(1994). cited by other .
Gourlain et al., "Enhancing the Catalytic Repertoire of Nucleic
Acids. II. Simultaneous Incorporation of Amino and Imidazolyl
Functionalities by Two Modified Triphosphates During PCR" Nucleic
Acids Res. 29: 1898-1905 (2001). cited by other .
Greene et al., "Protective Groups in Organic Synthesis", 780 pages
Wiley & Sons (1999) (copy not enclosed). cited by other .
Grubina et al., "Summer Research Report: DNA-Templated Synthesis of
a Synthetic Small Molecule Library" The Nucleus 10-14, Jan. 2004.
cited by other .
Gryaznov et al., "Chemical Ligation of Oligonucleotides in the
Presence and Absence of a Template" J. Am. Chem. Soc. 115:
3808-3809 (1993). cited by other .
Gryaznov et al., "Template Controlled Coupling and Recombination of
Oligonucleotide Blocks Containing Thiophosphoryl Groups" Nucleic
Acids Research 21(6): 1403-1408 (1993). cited by other .
Guatelli et al., "Isothermal, In Vitro Amplification of Nucleic
Acids by a Multienzyme Reaction Modeled After Retroviral
Replication" Proc. Natl. Acad. Sci. 87: 1874-1878 (1990). cited by
other .
Gyllensten et al., "Generation of Single-Stranded DNA by the
Polymerase Chain Reaction and its Application to Direct Sequencing
of the HLA-DQA locus", PNAS 85: 7652-7656 (1988). cited by other
.
Haaima et al., "Peptide Nucleic Acids (PNAs) Containing Thymine
Monomers Derived from Chiral Amino Acids: Hybridization and
Solubility Properties of D-Lysine PNA" Angew. Chem. Int. Ed. Engl.
35: 1939-1942 (1996). cited by other .
Haeuptle et al., "Translation Arrest by Oligodeoxynucleotides
Complementary to mRNA Coding Sequences Yields Polypeptides of
Predetermined Length" Nucleic Acids Research 14(3): 1427-1448
(1986). cited by other .
Hamburger et al., "Peptidyl-tRNA XI. The Chemical Synthesis of
Phenylalanine-Containing Oligopeptidyl-tRNA" Biochimica et
Biophysica Acta, 213: 115-123 (1970). cited by other .
Haubner et al. "Structural and Functional Aspects of RGD-Containing
Cyclic Pentapeptides as Highly Potent and Selective Integrin
.alpha.v.beta..sub.3 Antagonists" J. Am. Chem. Soc. 118: 7461-7472
(1996). cited by other .
Herrera-Estrella et al., "VirD Proteins of Agrobacterium
Tumefaciens are Required for the Formation of a Covalent
DNA--Protein Complex at the 5' Terminus of T-Strand Molecules" The
EMBO Journal 7(13): 4055-4062 (1988). cited by other .
Herrlein et al., "A Covalent Lock for Self-Assembled
Oligonucleotide Conjugates" J. Am. Chem. Soc. 117: 1-151-10152
(1995). cited by other .
Heywood et al., "A Study of Muscle Polyribosomes and the
Coprecipitation of Polyribosomes with Myosin" J. Biol. Chem. 7:
3289-3296 (1968). cited by other .
Heywood et al., "The Identification of Polyribosomes Synthesizing
Myosin" PNAS 57: 1002-1009 (1967). cited by other .
Hirama et al., "Asymmetric Induction in the Intramolecular
Conjugate Addition of - or .delta.-Carbamoyloxy- ,
.beta.-Unsaturated Esters. A New Method for Diastereoselective
Amination and Divergent Synthesis of 3-Amino-2,3,6-Trideoxyhexoses"
Heterocycles 28: 1229-1247 (1989). cited by other .
Hirama et al., "Intramolecular Michael Addition of O-Carbamates to
.alpha.,.beta. Unsaturated Esters: A New Diastereoselective
Amination in an Acyclic System" J. Am. Chem. Soc. 107: 1797-1798
(1985). cited by other .
Hooper et al., "Mode of Action of the New Quinolones: New Data"
Eur. J. Clin. Microbiol. Infect. Dis. 10(4): 223-231 (1991). cited
by other .
Houdebine et al., "Purification of the mRNAs for Ewe
.alpha..sub.s-Casein and .beta.-Casein by Immunoprecipitation of
Polysomes" Eur. J. Biochem. 63: 9-14 (1976). cited by other .
House et al., "The Chemistry of Carbanions. XVII. The Addition of
Methyl Organometallic Reagents to Cyclohexenone Derivatives" J.
Org. Chem. 33: 949 (1968). cited by other .
Hughes, "Application of Polymer-Bound Phosphonium Salts as
Traceless Supports for Solid" Tetrahedron Lett. 37: 7595-7598
(1996). cited by other .
Hyrup et al., "Peptide Nucleic Acids (PNA): Synthesis, Properties
and Potential Applications" Bioorganic & Medical Chemistry
4(1): 5-23 (1996). cited by other .
Illuminati et al., "Ring Closure Reactions of Bifunctional Chain
Molecules" Acc. Chem. Res. 14: 95-102 (1981). cited by other .
Inoue et al., "Oligomerization of (Guanosine 5'
-Phosphor)-2-Methylimidazolide on Poly(C): An RNA Polymerase Model"
J.Mol. Biol. 162: 201-217 (1982). cited by other .
Inoue et al., "Substituent Control of the Poly(C)--Directed
Oligomerization of Guanosine 5'--Phosphoroimidazolide" J. Am. Chem.
Soc. 103: 7666-7667 (1981). cited by other .
Inoue et al., "Template-Directed Synthesis on the Pentanucleotide
CpCpGpCpC" J. Mol. Biol. 178: 669-676 (1984). cited by other .
International Search Report for Application No. PCT/US02/08546
dated Dec. 17, 2002. cited by other .
International Search Report for Application No. PCT/US03/25984
dated Jan. 18, 2005. cited by other .
Ito et al., "Acetone-Sensitized Photocoupling of 5-Bromouridine to
Trytophan Derivatives via Electron-Transfer Process" J. Amer. Chem.
Soc. 102: 7535-7541 (1980). cited by other .
Jemth et al., "Kinetic Characterization of Recombinant Human
Glutathione Transferase T1-1, A Polymorphic Detoxication Enzyme"
Arch. Biochem. Biophys. 348(2): 247-54 (1997). cited by other .
Johansson et al., "Regioselective Reductive Ring-Opening of
4-Methoxybenzylidene Acetals of Hexopyranosides. Access to a Novel
Protecting-Group Strategy. Part 1" J. Chem. Soc. Perkins Trans. I:
2371-2374 (1984). cited by other .
Johnson et al. "Evidence for Posttranslational O-Glycosylation of
Fetuin" Biochemistry 25: 5518-5525 (1986). cited by other .
Johnston et al., "RNA-Catalyzed RNA Polymerization: Accurate and
General RNA-Templated Primer Extension" Science 292: 1319-1325
(2001). cited by other .
Jost et al., "Quantitative Precipitation of Short Oligonucleotides
with Low Concentrations of Cetyltrimethylammonium Bromide" Nucleic
Acids Res. 17: 2143 (1989). cited by other .
Kahl et al., "Introducing Structural Diversity in Oligonucleotides
via Photolabile, Convertible C5-Substituted Nucleotides" J. Am.
Chem. Soc. 121(4): 597-604 (1999). cited by other .
Keiler et al., "Role of a Peptide Tagging System in Degradation of
Proteins Synthesized from Damaged Messenger RNA" Science 271:
990-993 (1996). cited by other .
King et al., "Bis (Dialkylamino) Phosphines" J. Org. Chem. 49:
1784-1789 (1984). cited by other .
Kinoshita et al., "Enzymatic Synthesis of Code Regions for Encoded
combinatorial Chemistry (ECC)" Nucleic Acids Symposium Series 34:
201-202 (1995). cited by other .
Kuntz et al., "Combinatorial Catalyst Discovery" Current Opinion in
Chemical Biology 3: 313-319 (1999). cited by other .
Kupsch et al., "Isolation of Human Tumor-Specific Antibodies by
Selection of an Antibody Phage Library on Melanoma Cells" Clin
Cancer Res. 5: 925-931 (1999). cited by other .
Latham et al. "The Application of a Modified Nucleotide in Aptamer
Selection: Novel Thrombin Aptamers Containing 5-(Pentynyl)-2'-
Deoxyuridine" Nucleic Acids Res. 22: 2817-2822 (1994). cited by
other .
Leadley et al., "Pharmacodynamic Activity and Antithrombotic
Efficacy of RPR120844, a Novel Inhibitor of Coagulation Factor Xa"
J. Cardiovasc. Pharmacol. 34: 791-799 (1999). cited by other .
Lee et al., "Enhancing the Catalytic Repertoire of Nucleic Acids: a
Systematic Study of Linker Length and Rigidity" Nucleic Acids Res.
29: 1565-1573 (2001). cited by other .
Leon et al., "Covalent Coupling of 4-Thiouridine in the Initiator
Methionine tRNA to Specific Lysine Residues in Escherichia coli
Methionyl-tRNA Synthetase" Biochemistry 26: 7113-7121 (1987). cited
by other .
Li et al. "DNA-Catalyzed Polymerization" J. Am. Chem. Soc. 124:
746-747 (2002). cited by other .
Li et al., "A Catalytic DNA for Porphyrin Metallation" Nat. Struct.
Biol. 3: 743-747 (1996). cited by other .
Li et al., "Capping DNA with DNA" Biochemistry 39: 3106-3114
(2000). cited by other .
Li et al., "Chemical Self-Replication of Palindromic Duplex DNA"
Nature 369: 218-221 (1994). cited by other .
Li et al., "Phosphorylating DNA with DNA" Proc. Natl. Acad. Sci.
USA 96: 2746-2751 (1999). cited by other .
Li et al., "Toward an Efficient DNAzyme" Biochemistry 36: 5589-5599
(1997). cited by other .
Lin et al. "Formation of an Amino-Acid-Binding Pocket Through
Adaptive Zippering-Up of a Large DNA Hairpin Loop" Chem. Biol. 5:
555-572 (1998). cited by other .
Lin et al., "Structural Basis of DNA Folding and Recognition in an
AMP-DNA Aptamer Complex: Distinct Architectures But Common
Recognition Motifs for DNA and RNA Aptamers Complexed to AMP" Chem.
Biol. 4: 817-832 (1997). cited by other .
Liu et al. "Generating New Molecular Function: A Lesson from
Nature" Angew. Chem. Intl. Ed. Eng. 38: 37-54 (1999). cited by
other .
Loss, "Spin-based Quantum Information Processing in Nanostructures"
Dept. of Phys., Univ. of Basel, Switzerland, 2002. cited by other
.
Luo et al., "Analysis of the Structure and Stability of a
Backbone-Modified Oligonucleotide: Implications for Avoiding
Product Inhibition in Catalytic Template-Directed Synthesis" J. Am.
Chem. Soc. vol. 120, No. 13: 3019-3031 (1998). cited by other .
Luther et al., "Surface-Promoted Replication and Exponential
Amplification of DNA Analogues" Nature 396: 245-248 (1998). cited
by other .
Lynn et al., "Water-Soluble Ruthenium Alkylidenes: Synthesis,
Characterization, and Application to Olefin Metathesis in Protic
Solvents" J. Am. Chem. Soc. 122: 6601-6609 (2000). cited by other
.
Lynn et al., Living Ring-Opening Metathesis Polymerization in Water
J. Am. Chem. Soc. 12: 1627-1628 (1998). cited by other .
MacLean et al., "Encoded Combinatorial Chemistry Synthesis and
Screening of a Library of Highly Functionalized Pyrrolidines" Proc.
Natl. Acad. Sci. USA 94: 2805-2810 (1997). cited by other .
Magid, "Nucleophilic and Organometallic Displacement Reactions of
Allylic Compounds: Stereo- and Regiochemistry" Tetrahedron 36:
1901-1930 (1980). cited by other .
Mahal et al., "Engineering Chemical Reactivity on Cell Surfaces
Through Oligosaccharide Biosynthesis" Science 276: 1 125-1 128
(1997). cited by other .
Maignan et al., "Crystal Structures of Human FactorXa Complexed
with Potent Inhibitors" J. Med. Chem. 43: 3226-3232 (2000). cited
by other .
Marks et al., "Molecular Evolution of Proteins on Filamentous
Phage" J. Biol.Chem. 267(23): 16007-16010 (1992). cited by other
.
Marlowe et al., "Design, Synthesis and Structure-Activity
Relationship of a Series of Arginine Aldehyde Factor Xa Inhibitors.
Part 1: Structures Based on the (D)-Arg-Gly-Arg Tripeptide
Sequence" Bioorg. Med. Chem. Lett. 10: 13-16 (2000). cited by other
.
Mattheakis et al., "An In Vitro Polysome Display System for
Identifying Ligands from Very Large Peptide Libraries" Proc. Natl.
Acad. Sci. USA 91: 9022-9026 (1994). cited by other .
Mel'nikov et al., "Solubilization of DNA-Cationic Lipid Complexes
in Hydrophobic Solvents. A Single-Molecule Visualization by
Fluorescence Microscopy" Langmuir 15: 1923-1928 (1999). cited by
other .
Minshull et al., "Protein Evolution by Molecular Breeding" Curr.
Opin. Chem. Biol. 3: 284-290 (1999). cited by other .
Mirza et al., "Synthesis of Shikimic Acid and Its Phosphonate
Analogue Via Knoevenagel Condensation" Tetrahedron Lett. 32: No.
33, 4111-4114 (1991). cited by other .
Miyamoto-Sato et al., "Highly stable and efficient mRNA templates
for mRNA-protein fusions and C-terminally labeled proteins" Nucleic
Acids Research vol. 31 No. 15 e78 (2003). cited by other .
Mohr et al., "Synthesis of Water-Soluble, Aliphatic Phoshines and
Their Application to Well-Defined Ruthenium Olefin Metathesis
Catalysts" Organometallics 15: 4317-4325 (1996). cited by other
.
Muth et al., "A Single Adenosine with a Neutral pKa in the
Ribosomal Peptidyl Transferase Center" Science 289: 947-950 (2000).
cited by other .
Nagasaka et al.,"Wittig Reactions of
1-Alkoxycarbony1-2-Hydroxypyrrolidines and -Piperidines: Synthesis
of (.+-.)--Hygrine and ((.+-.)-2-Epilasubine II" Heterocycles 29:
155 (1989). cited by other .
Nakano et al., "General Acid-Base Catalysis in the Mechanism of a
Hepatitis Delta Virus Ribozyme" Science 287: 1493-1497 (2000).
cited by other .
Nazarenko et al., "A closed tube format for amplification and
detection of DNA based on energy transfer" Nucleic Acid Research
25(12): 2516-2521 (1997). cited by other .
Nemoto et al., "In vitro virus: Bonding of mRNA bearing puromycin
at the 3'-terminal end to the C-terminal end of its encoded protein
on the ribosome in vitro" European Biochemical Societies Letters
414: 405-408 (1997). cited by other .
Nissen et al., "The Structural Basis of Ribosome Activity in
Peptide Bond Synthesis" Science 289: 920-930 (2000). cited by other
.
Nolte et al., "Mirror-Design of L-Oligonucleotide Ligands Binding
to L-Arginine" Nature Biotechnology 14: 1116-1121 (1996). cited by
other .
Norris et al., "Mechanistic Studies of the 5-lodouracil Chromophore
Relevant to Its Use in Nucleoprotein Photo-Cross-Linking" J. Amer.
Chem. Soc. 118: 5796-5803 (1996). cited by other .
Olofson et al., "Selective N-Dealkylation of Teritiary Amines with
Vinyl Chloroformate: An Improved Synthesis of Naloxone" Tetrahedron
Lett. 18: 1567-1570 (1977). cited by other .
Olofson et al., "Use of the Vinyloxycarbonyl Group for Amino
Protection in Peptide Synthesis" Tetrahedron Lett. 18: 1563-1566
(1977). cited by other .
Olofson et al., "Value of Vinyloxycarbonyl Unit in Hydroxyl
Protection: Application to the Synthesis of Nalorphine" Tetrahedron
Lett. 18: 1571-1574 (1977). cited by other .
Orgel et al., "Unnatural Selection in Chemical Systems" Acc. Chem.
Res. 28: 109-118 (1995). cited by other .
Pagratis et al., "Potent 2'-Amino-, and 2'-Fluoro-2'-
Deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor"
Nature Biotechnology 15: 68-72 (1997). cited by other .
Pasqualini et al., "Aminopeptidase N Is a Receptor for Tumor-homing
Peptides and a Target for Inhibiting Angiogenesis" Cancer Res. 60:
722-727 (2000). cited by other .
Pasqualini et al., "Organ Targeting In Vivo Using Phage Display
Peptide Libraries" Nature 380: 364-366 (1996). cited by other .
Pedersen et al., "A Method for Directed Evolution and Functional
Cloning of Enzymes" Proc. Natl. Acad. Sci. USA 95: 10523-10528
(1998). cited by other .
Perrin et al., "Bridging the Gap Between Protein and Nucleic Acids:
A Metal-Independent RNAseA Mimic with Two Protein-Like
Functionalities" J. Am. Chem. Soc. 123: 1556-1563 (2001). cited by
other .
Perrin et al., "Expanding the Catalytic Repertoire of Nucleic Acid
Catalysts: Simultaneous Incorporation of Two Modified
Deoxyribonucleoside Triphosphates Bearing Ammonium and Imidazolyl
Functionalities" Nucleosides & Nucleotides 18: 377-391 (1999).
cited by other .
Pfaff et al., "Selective Recognition of Cyclic RGD Peptides of NMR
Defined Conformation of .alpha.llb.beta.3, .alpha.5.beta.1
Integrins" J. Biol. Chem. 269: 20233-20238 (1994). cited by other
.
Polacek et al., "Ribosomal Peptidyl Transferase can Withstand
Mutations at the Putative Catalytic Nucleotide" Nature 411: 498-501
(2001). cited by other .
Puschl et al., "Peptide Nucleic Acids (PNAs) with a Functional
Backbone" Tetrahedron Lett. 39: 4707-4710 (1998). cited by other
.
Rai et al., "Development of Potent and Selective Factor Xa
Inhibitors" Bioorg. Med. Chem. Lett. 11: 1797-1800 (2001). cited by
other .
Rembold et al., "Single-Strand Regions of Poly(G) Act as Templates
for Oligo(C) Synthesis" J. Mol. Evol. 38: 205-210 (1994). cited by
other .
Roberts et al., "RNA-Peptide Fusions for the In Vitro Selection of
Peptides and Proteins" Proc. Natl. Acad. Sci. USA 94: 12297-12302
(1997). cited by other .
Rodriguez et al., "Template-Directed Extension of a Guanosine
5'-Phosphate Covalently Attached to an Oligodeoxycytidylate
Template" J. Mol. Evol. 33: 477-482 (1991). cited by other .
Saiki et al., "Enzymatic Amplification of .beta.-Globin Genomic
Sequences and Restriction Site Analysis for Diagnosis of Sickle
Cell Anemia" Science 230: 1350-1354 (1985). cited by other .
Sakthivel et al., "Expanding the Potential of DNA for Binding and
Catalysis: Highly Functionalized dUTP Derivatives That Are
Substrates for Thermostable DNA Polymerases" Angew. Chem. Int. Ed.
37: 2872-2875 (1998). cited by other .
Salas et al., "Biosynthetic Polydeoxynucleotides as Direct
Templates for Polypeptide Synthesis" Journal of Biological
Chemistry 243(5): 1012-1015 (1968). cited by other .
Santoro et al., "A General Purpose RNA-Cleaving DNA Enzyme" Proc.
Natl. Acad. Sci. USA 94: 4262-4266 (1997). cited by other .
Saxon et al., "A `Traceless` Staudinger Ligation for the
Chemoselective Synthesis of Amide Bonds" Organic Letters 2(14):
2141-2143 (2000). cited by other .
Scharf et al., "Direct Cloning and Sequence Analysis of
Enzymatically Amplified Genomic Sequences" Science 233: 1076-1078
(1986). cited by other .
Scheffer et al., "Selection and Characterisation of a
Phage-Displayed Human Antibody (Fab) Reactive to the Lung
Resistance-Related Major Vault Protein" Br. J. Cancer 86: 954-962
(2002). cited by other .
Schmidt et al., "Information Transfer from DNA to Peptide Nucleic
Acids by Template-Directed Syntheses" Nucleic Acids Research
25(23): 4792-4796 (1997). cited by other .
Schmidt-Dannert et al., "Directed Evolution of Industrial Enzymes"
Trends Biotechnol. 17: 135-136 (1999). cited by other .
Scholl et al., "Synthesis and Activity of a New Generation of
Ruthenium-Based Olefin Metathesis Catalysts Coordinated with
1,3-Dimesity1-4,5-Dihydroimidazol-2-Ylidene Ligands" Org. Lett.
1(6): 953-956 (1999). cited by other .
Schultze et al., Three-Dimensional Solution Structure of the
Thrombin-Binding DNA Aptamer d(GGTTGGTGTGGTTGG) J. Mol. Biol. 235:
1532-1547 (1994). cited by other .
Schwartz et al., "Template-Directed Synthesis of Novel, Nucleic
Acid-Like Structures" Science 228: 585-587 (1985). cited by other
.
Scott, "How Were Porphyrins and Lipids Synthesized in the RNA
World?" Tetrahedron Lett. 38: 4961-4964 (1997). cited by other
.
Seeberger et al., "Solid-Phase Oligosaccharide Synthesis and
Combinatorial Carbohydrate Libraries" Chem. Rev. 100: 4349-4393
(2000). cited by other .
Seeberger, P.H., Ed., "Solid Support Oligosaccharide Synthesis and
Combinatorial Carbohydrate Libraries" Wiley-Interscience: New York
2001 (copy not enclosed). cited by other .
Seela et al., "Oligonucleotides Containing 7-Deazaadenines: The
Influence of the 7-Substituent Chain Length and Charge on the
Duplex Stability" Helv. Chem. Acta. 82: 1878-1898 (1999). cited by
other .
Seela et al., "Palladium-Catalyzed Cross Coupling of 7-lodo-2'
Deoxytubercidin with Terminal Alkynes" Synthesis: 726-730 (1996).
cited by other .
Shao et al., "Random-Priming in Vitro Recombination: An Effective
Tool for Directed Evolution" Nucleic Acids Research 26(2): 681-83
(1998). cited by other .
Sheppard et al., "A DNA Enzyme with N-Glycosylase Activity" Proc.
Natl. Acad. Sci. USA 97: 7802-7807 (2000). cited by other .
Shimizu et al., "Search for Chiral Catalysts Through Ligand
Diversity: Substrate-Specific Catalysts and Ligand Screening on
Solid Phase" Angew. Chem. Int. Ed. 36(16): 1704-1707 (1997). cited
by other .
Shishido et al., "1,2-Asymmetric Induction in Intramolecular
Michael Reaction. A Novel and Enantioselective Route to (+)
Geissman Lactone" J. Chem. Soc. Perkins Trans. I: 993-1004 (1987).
cited by other .
Siegel et al., "Isolation of Cell Surface-Specific Human Monoclonal
Antibodies Using Phage Display and Magnetically-Activated Cell
Sorting: Applications in Immunohematology" J. Immunol. Methods 206:
73-85 (1997). cited by other .
Smith, G., "Filamentous Fusion Phage: Novel Expression Vectors That
Display Cloned Antigens on the Virion Surface" Science 228:
1315-1317 (1985). cited by other .
Smith, G., "The Progeny of Sexual PCR" Nature 370: 324-325 (1995).
cited by other .
Soumillion et al., "Selection of .beta.-Lactamase on Filamentous
Bacteriophage by Catalytic Activity" J. Mol. Biol. 237: 415-22
(1994). cited by other .
Stemmer, "DNA Shuffling by Random Fragmentation and Reassembly: In
Vitro Recombination for Molecular Evolution" Proc. Natl. Acad. Sci.
USA 91: 10747-10751 (1994). cited by other .
Stemmer, "Rapid Evolution of a Protein In Vitro by DNA Shuffling"
Nature 370: 389-391 (1994). cited by other .
Still et al., "Chemical Consequences of Conformation in Macrocyclic
Compounds," Tetrahedron 37: 3981-3996 (1981). cited by other .
Summerer D. et al., "DNA-Templated Synthesis: More Versatile Than
Expected" Angewandte Chemie. Int'l Edit., Verlag Chemie. Weinheim,
DE, vol. 41, No. 1: 89-90 (2002). cited by other .
Supplementary European Search Report for Application No. EP 02 75
3671 dated Sep. 21, 2004. cited by other .
Sutherlin et al., "Stereoselective Synthesis of Dipyranyl
C-Disaccharides" Tetrahedron Lett. 34(31): 4897-4900 (1993). cited
by other .
Tamura et al., "Oligonucleotide-Directed Peptide Synthesis in a
Ribosome- and Ribozyme-Free System" Proc. Natl. Acad. Sci. USA 98:
1393-1397 (2001). cited by other .
Tarasow et al., "Dressed for Success: Realizing the Catalytic
Potential of RNA" Biopolymers 48: 29-37 (1998). cited by other
.
Tseng-Law et al., "Identification of a Peptide Directed Against the
Anti-CD34 Antibody, 9C5, by Phage Display and Its Use in
Hematopoietic Stem Cell Selection" Exp. Hematol 27: 936-945 (1999).
cited by other .
Uhlmann et al., "Synthesis and Properties of PNA/DNA Chimeras"
Angew. Chem. Int. Ed. Engl. 35: 2632-2635 (1996). cited by other
.
Vacca, "New Advances in the Discovery of Thrombin and Factor Xa
Inhibitors" Curr. Opin. Chem. Biol. 4: 394-400 (2000). cited by
other .
Van Gelder et al., PNAS, 85: 77652-77656 (1988). cited by other
.
Varner et al., "Review: .alpha..sub.v.beta..sub.3: The Integrin
Angiogenesis and Apoptosis" Cell Adhes Commun 3: 367-374 (1995).
cited by other .
Visscher et al., "Template-Directed Synthesis of Acyclic
Oligonucleotide Analogs" Journal of Molecular Evolution 28: 3-6
(1988). cited by other .
Walder et al., "Complementary Carrier Peptide Synthesis: General
Strategy and Implications for Prebiotic Origin of Peptide
Synthesis" Proc. Nat. Acad. Sci. USA 76(1): 51-55 (1979). cited by
other .
Wells et al., "Rapid Evolution of Peptide and Protein Binding
Properties in Vitro" Curr. Opin. Struct. Biol. 2: 597-604 (1992).
cited by other .
Wermuth et al., "Stereoisomerism and Biological Activity of the
Selective and Superactive .alpha..sub.v.beta..sub.3 Integrin
Inhibitor Cyclo (-RGDfV -) and Its Retro-Inverso Peptide"J. Am.
Chem. Soc. 119: 1328-1335 (1997). cited by other .
Wiegand et al., "Selection of RNA Amide Synthases" Chemistry and
Biology 4: 675-683 (1997). cited by other .
Wilson et al., "In Vitro Selection of Functional Nucleic Acids"
Annu. Rev. Biochem. 68: 611-647 (1999). cited by other .
Winter et al., "Making Antibodies by Phage Display Technology"
Annu. Rev. Immunol. 12: 433-455 (1994). cited by other .
Wong et al., "Enzymes in Synthetic Organic Chemistry" 388 pages
Pergamon: Tetrahedron Organic Chemistry Series 12: 1994 (Index only
enclosed). cited by other .
Woodward et al., "Asymmetric Total Synthesis of Erythromycin. 1.
Synthesis of an Erythronolide A Seco Acid Derivative via Asymmetric
Induction" J. Am. Chem. Soc. 103: 3210-3213 (1981). cited by other
.
Xu et al., "Nonenzymatic Autoligation in Direct Three-Color
Detection of RNA and DNA Point Mutations" Nature Biotechnology 19:
148-152 (2001). cited by other .
Xu et al., "Rapid and Selective Selenium-Mediated Autoligation of
DNA Strands" J. Am. Chem. Soc. 122: 9040-9041 (2000). cited by
other .
Zarling et al., "Mapping of Lymphocyte Surface Polypeptide Antigens
by Chemical Cross-Linking with Bsocoes" J. Immunology 124: 913-920
(1980). cited by other .
Zhan et al. "Chemical Amplification through Template-Directed
Synthesis" J. Am. Chem. Soc. vol. 119, No. 50: 12420-12421 (1997)
see entire document. cited by other .
Zhang et al., "Lactone and Lactam Library Synthesis by Silver
Ion-Assisted Orthogonal Cyclization of Unprotected Peptides" J. Am.
Chem. Soc. 121: 3311-3320 (1999). cited by other .
Zhao et al., "A Methodological Comparison: The Advantage of
Phosphorimidates in Expanding the Sugar Nucleotide Repertoire" J.
Org. Chem. 63: 7568-7572 (1998). cited by other .
Zhao et al., "Molecular Evolution by Staggered Extension Process
(StEP) in Vitro Recombination" Nature Biotechnology 16(3): 258-61
(1998). cited by other .
Zhao et al., "Optimization of DNA Shuffling for High Fidelity
Recombination" Nucleic Acids Research 25(6): 1307-1308 (1997).
cited by other .
Schmidt et al., "Information Transfer from Peptide Nucleic Acids to
RNA by Template-Directed Syntheses" Nucleic Acids Research 25(23):
4797-4802 (1997). cited by other .
Dewey et al., "Integrated drug discovery technology in a test
tube," www.currentdrugdiscovery.com (Jul. 2002). cited by other
.
Kanavarioti et al., Journal of Organic Chemistry vol. 64, pp.
8323-8333 (Oct. 1999). cited by other .
Letter from Mr. Iver P. Cooper to the Office of Naval Research,
dated May 25, 2004. cited by other .
Letter from the Office of Naval Research to Mr. Iver P. Cooper,
dated Feb. 1, 2005. cited by other .
Appeal letter and memorandum to the General Counsel of the Navy on
behalf of Mr. Iver P. Cooper, dated Apr. 1, 2005. cited by other
.
Letter from the Office of the General Counsel of the Navy to Mr.
Iver P. Cooper, dated Aug. 5, 2005. cited by other .
Slides 1, 2, 3, and 30 of Professor David Liu's slide presentation
entitled "Unnatural Molecule Evolution.", 2000. cited by other
.
Plaintiff's Complaint, filed Nov. 18, 2005, Iver P. Cooper v. U.S.
Department of Navy, Case 1 :05-cv-02252-EGS. cited by other .
Defendants Answer to Plaintiff's Complaint, filed Feb. 10, 2006,
Iver P. Cooper v. U.S. Department of Navy, Case 1:05-cv-02252-EGS.
cited by other .
Motion of Plaintiff Iver Cooper for Summary Judgment, filed May 15,
2006, Iver P. Cooper v. U.S. Department of Navy, Case
1:05-cv-02252-EGS. cited by other .
Plaintiff's Memorandum of Points & Authorities of Plantiff Iver
Cooper in Support of his Motion for Summary Judgment, filed May 15,
2006, Iver P. Cooper v. U.S. Department of Navy, Case
1:05-cv-02252-EGS. cited by other .
Defendant's Motion for Summary Judgment, filed May 15, 2006, Iver
P. Cooper v. U.S. Department of Navy, Case 1:05-cv-02252-EGS. cited
by other .
Defendant's Memorandum of Law in Support of Defendant's Motion for
Summary Judgment, filed May 15, 2006, Iver P. Cooper v. U.S.
Department of Navy, Case 1:05-cv-02252-EGS. cited by other .
Defendant's Opposition to Plaintiff's Cross Motion for Summary
Judgment, filed Jun. 21, 2006, Iver P. Cooper v. U.S. Department of
Navy, Case 1:05-cv-02252-EGS. cited by other .
Plaintiff's Memorandum of Points & Authorities of Plantiff Iver
Cooper in Opposition to Defendants Motion for Summary Judgment,
filed Jun. 21, 2006, Iver P. Cooper v. U.S. Department of Navy,
Case 1:05-cv-02252-EGS. cited by other .
Defendant's Reply to Plaintiffs Opposition to Defendant's Motion
for Summary Judgment, Iver P. Cooper v. U.S. Department of Navy,
Case 1:05-cv-02252-EGS, 2006. cited by other .
Plaintiff's Reply in Support of His Motion for Summary Judgment,
Iver P. Cooper v. U.S. Department of Navy, Case 1:05-cv-02252-EGS,
2006. cited by other .
Kang and Rokita, "Site Specific and photo-induced alkylation of DNA
by a dimethylanthraquinone-oligodeoxynucleotide conjugate," Nucleic
Acid Res. (Oct. 15, 1996) 24(20): 3896-902. cited by other .
Supplementary European Partial Search Report for European Patent
Application No. 03788662 dated Feb. 22, 2006 (2 pages). cited by
other .
Landegren et al. (1988) Science 241 (4869): 1077-1080. cited by
other .
Li et al. (2004) "DNA-templated organic synthesis: nature's
strategy for controlling chemical reactivity applied to synthetic
molecules," Angewandte Chemie (Intl. Ed. In English) 43(37):
4848-70. cited by other .
New England Biolabs 1998/99 Catalog. Cover and p. 284. cited by
other .
Podyminogin et al., "Sequence-specific covalent modification of DNA
by cross-linking oligonucleotides. Catalysis by RecA and
implication for the mechanism of synaptic joint formation,"
Biochemistry (Oct. 10, 1995) 34(40): 13098-108. cited by other
.
International Search Report for Application No. PCT/US06/02420
dated Jul. 28, 2006 (3 pages). cited by other .
Dorner et al. (1984) Journal of Virology 50(3): 507-514. cited by
other .
Brooker, Genetics Analysis and Principles ed. 1, 1999, Menlo Park,
CA, pp. 326, 368, 372, 373, and 379. cited by other .
Gartner et al. (2001) Supporting Materials (2 pages) for "The
Generality of DNA-Templated Synthesis as a Basis for Evolving
Non-Natural Small Molecules" J. Am. Chem. Soc. 123:
6961-6963(2001). cited by other .
Stryer (1995) Biochemistry, 4th Edition, Chapter 37. cited by other
.
Rohatgi et al. (1996) J. Am. Chem. Soc. 118:3332-39. cited by other
.
Rohatgi et al. (1996) J. Am. Chem. Soc. 118:3340-44. cited by other
.
Suga et al. (1998) J. Am. Chem. Soc. 120: 1151-1156. cited by other
.
Suga et al. (1998) Biochem. 37: 10118-25. cited by other .
Lee et al. (2000) Nature Struct. Biol. 7: 28-33. cited by other
.
Bartel et al. (1993) Science 261 1411-18. cited by other .
Xu et al. (1999) Nucl. Acids Res. 27: 875-81. cited by other .
Ekland et al. (1995) Science 269: 364-70. cited by other .
Jenne et al. (1998) Chem. Biol. 5: 23-34. cited by other .
Goodwin et al. (1992) J. Am. Chem. Soc. 114: 9197-98. cited by
other .
Xu et al. (1998) Nucl. Acids Res. 26(13): 3159-64. cited by other
.
Homepage of David R. Liu (http://evolve.harvard.edu) available at
Mar. 11, 2000 according to the Wayback Machine
(http://web.archive.org). cited by other .
Homepage of David R. Liu (http://evolve.harvard.edu) available at
Oct. 15, 2000 according to the Wayback Machine
(http://web.archive.org). cited by other .
Opposition to European Patent No. EP1423400, filed May 9, 2007
(Communication issued from EPO on May 15, 2007). cited by other
.
Harris et al. (1999) "Directed Molecular Evolution," Origins of
Life and Evolution of the Biosphere 29: 425-435. cited by other
.
Gartner Z.J. et al., "Expanding the Reaction Scope of DNA-Templated
Synthesis" Angewandte Chemie (2002), vol. 41, No. 10, pp.
1796-1800. cited by other .
Gartner Z.J. et al., "Multistep Small-Molecule Synthesis Programmed
by DNA Templates" Journal of the American Chemical Society, (2002)
vol. 124, No. 35, pp. 10304-10306. cited by other .
European Patent Office (EPO) Examination Report; European
Application No. EP 03788662.9, mailed Nov. 21, 2007 (15 pages).
cited by other .
Tyagi et al. (1996) "Molecular Beacons: Probes that Fluoresce Upon
Hybridization," Nature Biotechnology 14(1): 303-08. cited by other
.
Mag et al. (1991) "Synthesis and Selective Cleavage of an
Oligodeoxynucleotide Containing a Bridged Internucleotide
5'-Phosphorothioate Linkage," Nucl. Acids Res. cited by other .
Kuimelis et al. (1995) "Cleavage Properties of an Oligonucleotide
Containing a Bridged Internucleotide 5'-Phosphothioate RNA
Linkage," Nucl. Acids Res. 23(23): 4753-60. cited by other .
Metelev et al. (2001) "New Chemically Reactive dsDNAs Containing
Single Internucleotide Monophosphoryldithio links: reactivity of
5'-mercapto-oligodeoxyribonucleotides," Nucl. Acids Res. 29(19):
4062-69. cited by other .
Calderone et al. (2002) "Directing Otherwise Incompatible Reactions
in a Single Solution by Using DNA-Templated Organic Synthesis,"
Angewandte Chemie 41(21): 4104-08. cited by other .
Arnold et al. (1989) "Assay Formats Involving
Acridinium-Ester-Labeled DNA Probes" Clin. Chem. 35(8): 1588-94.
cited by other .
Balachander et al. (1990) "Monolayer Transformation by Nucleophilic
Substitution: Applications to the Creation of New Monolayer
Assemblies," Langmuir 6(11): 1621-1627. cited by other .
Knight et al. (1999) "Accuracy of Genotyping of Single-Nucleotide
Polymorphisms by PCR-ELISA Allele-Specific Oligonucleotide
Hybridization Typing and by Amplification Refractory Mutation
System," Clinical Chemistry 45(10): 1860-1863. cited by other .
Tamura et al. (Jul. 11, 2003) "Peptide Synthesis with a
Template-like RNA guide and aminoacyl phosphate adaptors" Proc.
Natl. Acad. Sci. USA 100(15): 8666-8669. cited by other .
Gartner et al.(2003) "Two-Enabling Architectures for DNA-templated
Organic Synthesis," Angewandte Chemie 42(12): 1370-75. cited by
other .
Sando et al. (2002) "Quencher as leaving group: Efficient detection
of DNA-joining reactions," JACS 124(10): 2096-97. cited by other
.
Ma et al. (2000) "Nucleic acid-triggered catalytic drug release,"
PNAS USA: 97(21): 11159-63. cited by other .
Amato (1992) "Speeding Up a Chemical Game of Chance," Science
257:330-331. cited by other .
European Search Report for European Application No. EP06016511.5,
mailed on Jul. 24, 2009, 4 pages. cited by other.
|
Primary Examiner: Horlick; Kenneth R.
Assistant Examiner: Thomas; David
Attorney, Agent or Firm: Goodwin Procter LLP
Government Interests
GOVERNMENT FUNDING
This invention was made with Government support under the Office
for Naval Research under Contract No. N00014-00-1-0596 and Grant
No. 00014-03-1-0749. The United States Government has certain
rights in the invention.
Parent Case Text
PRIORITY INFORMATION
This application is a continuation of U.S. patent application Ser.
No. 10/950,367, filed Sep. 24, 2004, which is a continuation of
U.S. patent application Ser. No. 10/643,752, filed Aug. 19, 2003,
which claims the benefit of (i) U.S. Provisional Patent Application
No. 60/404,395, filed Aug. 19, 2002, (ii) U.S. Provisional Patent
Application No. 60/419,667, filed Oct. 18, 2002, (iii) U.S.
Provisional Patent Application No. 60/432,812, filed Dec. 11, 2002,
(iv) U.S. Provisional Patent Application No. 60/444,770, filed Feb.
4, 2003, (v) U.S. Provisional Patent Application No. 60/457,789,
filed Mar. 26, 2003, (vi) U.S. Provisional Patent Application No.
60/469,866, filed May 12, 2003, and (vii) U.S. Provisional Patent
Application No. 60/479,494, filed Jun. 18, 2003, the disclosures of
each of which are incorporated by reference herein. The application
is also related to U.S. Provisional Patent Application Nos.
60/277,081 (filed Mar. 19, 2001), 60/277,094 (filed Mar. 19, 2001),
60/306,691 (filed Jul. 20, 2001), and 60/353,565 (filed Feb. 1,
2002), as well as to U.S. patent application Ser. Nos. 10/101,030
(filed Mar. 19, 2002) and 10/102,056 (filed Mar. 19, 2002), and to
International Patent Application serial number US02/08546 (filed
Mar. 19, 2002).
Claims
What is claimed is:
1. An in vitro method of enriching a product of a nucleic
acid-templated synthesis, the method comprising the steps of: (a)
providing a first library of molecules comprising a plurality of
reaction products of a nucleic acid templated synthesis, which are
not nucleic acids, wherein each reaction product is covalently
attached to a corresponding oligonucleotide that templated the
synthesis of the reaction product, and wherein each oligonucleotide
comprises a nucleotide sequence indicative of the reaction product
associated therewith, and wherein a portion of said reaction
products are capable of binding to a preselected binding moiety;
(b) exposing said first library of molecules to said binding moiety
under conditions to permit reaction product capable of binding said
binding moiety to bind thereto, wherein the reaction product has a
K.sub.d for the binding moiety of no less than 0.9 nM; (c) removing
unbound reaction products; and (d) eluting bound reaction product
from said binding moiety to produce a second library of molecules
enriched at least 50-fold for reaction product that binds said
binding moiety relative to said first library.
2. The method of claim 1, wherein in step (b), said binding moiety
is immobilized on a solid support.
3. The method of claim 1, wherein said binding moiety is a target
biomolecule.
4. The method of claim 3, wherein said target biomolecule is a
protein.
5. The method of claim 1, wherein in step (d), said second library
is enriched at least 100-fold for reaction product that binds said
binding moiety.
6. The method of claim 5, wherein in step (d), said second library
is enriched at least 1,000-fold for reaction product that binds
said binding moiety.
7. The method of claim 1, further comprising repeating steps (b),
(c), and (d).
8. The method of claim 7, wherein repeating steps (b), (c), and (d)
produces a third library enriched by at least 10,000-fold for
reaction product that binds said binding moiety.
9. The method of claim 8, wherein said library is enriched by at
least 100,000-fold for reaction product that binds said binding
moiety.
10. The method of claim 1, wherein said oligonucleotide comprises a
first sequence that identifies a first reactive unit that produced
said reaction product capable of binding said preselected binding
moiety.
11. The method of claim 10, wherein said oligonucleotide comprises
a second sequence that identifies a second reactive unit that
produced said reaction product capable of binding said preselected
binding moiety.
12. The method of claim 1, comprising the additional step of
amplifying oligonucleotide associated with the enriched reaction
product.
13. The method of claim 1, comprising the additional step of
determining the sequence of the oligonucleotide associated with the
enriched reaction product.
14. The method of claim 12, comprising the additional step of
determining the sequence of the amplified oligonucleotide.
15. The method of claim 13, further comprising the step of
characterizing said reaction product from information in said
sequence of said oligonucleotide.
16. The method of claim 15, further comprising the step of
identifying a new chemical reaction that produced said reaction
product.
17. The method of claim 14, further comprising the step of
characterizing the reaction product from information in said
sequence of said oligonucleotide.
18. The method of claim 17, further comprising the step of
identifying a new chemical reaction that produced said reaction
product.
19. An in vitro method of enriching a product of a nucleic
acid-templated synthesis, the method comprising the steps of: (a)
providing a first library of molecules comprising a plurality of
reaction products of a nucleic acid templated synthesis, which are
not nucleic acids, wherein each reaction product is covalently
attached to a corresponding oligonucleotide that templated the
synthesis of the reaction product, wherein each oligonucleotide
comprises a nucleotide sequence indicative of the reaction product
associated therewith, wherein no oligonucleotide is linked by a
direct or indirect covalent or non-covalent interaction to a
capturable moiety selected from the group consisting of biotin,
avidin and streptavidin; and wherein a portion of said reaction
products are capable of binding to a preselected binding moiety;
(b) exposing said first library of molecules to said binding moiety
under conditions to permit reaction product capable of binding said
binding moiety to bind thereto; (c) removing unbound reaction
products; and (d) eluting bound reaction product from said binding
moiety to produce a second library of molecules enriched at least
50-fold for reaction product that binds said binding moiety
relative to said first library.
Description
BACKGROUND OF THE INVENTION
The classic "chemical approach" to generating molecules with new
functions has been used extensively over the last century in
applications ranging from drug discovery to synthetic methodology
to materials science. In this approach, researchers synthesize or
isolate candidate molecules, assay these candidates for desired
properties, determine the structures of active compounds if
unknown, formulate structure-activity relationships based on
available assay and structural data, and then synthesize a new
generation of molecules designed to possess improved properties.
While combinatorial chemistry methods (see, for example, Eliseev et
al. (1999) COMBINATORIAL CHEMISTRY IN BIOLOGY 243: 159-172; Kuntz
et al. (1999) CURRENT OPINION IN CHEMICAL BIOLOGY 3: 313-319; Liu
et al. (1999) ANGEW. CHEM. INTL. ED. ENG. 38: 36) have increased
the throughput of this approach, its fundamental limitations remain
unchanged. Several factors limit the effectiveness of the chemical
approach to generating molecular function. First, the ability to
accurately predict the structural changes that will lead to new
function is often inadequate due to subtle conformational
rearrangements of molecules, unforeseen solvent interactions, or
unknown stereochemical requirements of binding or reaction events.
The resulting complexity of structure-activity relationships
frequently limits the success of rational ligand or catalyst
design, including those efforts conducted in a high-throughput
manner. Second, the need to assay or screen, rather than select,
each member of a collection of candidates limits the number of
molecules that can be searched in each experiment. Finally, the
lack of a way to amplify synthetic molecules places requirements on
the minimum amount of material that must be produced for
characterization, screening, and structure elucidation. As a
result, it can be difficult to generate libraries of more than
roughly 10.sup.6 different synthetic compounds.
In contrast, Nature generates proteins with new functions using a
fundamentally different method that overcomes many of these
limitations. In this approach, a protein with desired properties
induces the survival and amplification of the information encoding
that protein. This information is diversified through spontaneous
mutation and DNA recombination, and then translated into a new
generation of candidate proteins using the ribosome. Unlike the
linear chemical approach described above, the steps used by Nature
form a cycle of molecular evolution. Proteins emerging from this
process have been directly selected, rather than simply screened,
for desired activities. Because the biomolecules that encode
evolving proteins (e.g., DNA) can be amplified, a single protein
molecule with desired activity can in theory lead to the survival
and propagation of the DNA encoding its structure.
Acknowledging the power and efficiency of Nature's approach,
researchers have used molecular evolution to generate many proteins
and nucleic acids with novel binding or catalytic properties (see,
for example, Minshull et al. (1999) CURR. OPIN. CHEM. BIOL. 3:
284-90; Schmidt-Dannert et al. (1999) TRENDS BIOTECHNOL. 17: 135-6;
Wilson et al. (1999) ANNU. REV. BIOCHEM. 68: 611-47). Proteins and
nucleic acids evolved by researchers have demonstrated value as
research tools, diagnostics, industrial reagents, and therapeutics,
and have greatly expanded the understanding of the molecular
interactions that endow proteins and nucleic acids with binding or
catalytic properties (see, Famulok et al. (1998) CURR. OPIN. CHEM.
BIOL. 2: 320-7).
Despite Nature's efficient approach to generating function,
Nature's molecular evolution is limited to two types of "natural"
molecules (proteins and nucleic acids) because thus far the
information in nucleic acids can only be translated into proteins
or into other nucleic acids. Unfortunately, many synthetic
molecules of interest do not in general have nucleic acid or
protein backbones. An ideal approach to generating functional
molecules merges the most powerful aspects of molecular evolution
with the flexibility of synthetic chemistry. Clearly, enabling the
evolution of non-natural synthetic small molecules and polymers,
much as Nature evolves biomolecules, would lead to much more
effective methods of discovering new synthetic ligands, receptors,
and catalysts difficult or impossible to generate using rational
design.
Although these concepts have been brought together to permit
nucleic acid-templated synthesis of small molecules (see, for
example, Gartner & Liu (2001) J. AM. CHEM. SOC. 123: 6961-6963)
there is still an ongoing need for improvements in these core
technologies to permit the more efficient synthesis, selection,
amplification, and evolution of molecules of interest.
SUMMARY OF THE INVENTION
The invention provides a variety of methods and compositions that
expand the scope of template-directed synthesis, selection,
amplification and evolution of molecules of interest. During
nucleic acid-templated synthesis, the information encoded within a
nucleic acid template is used to bring two or more reactants
together into reactive proximity. These methods permit the creation
of, for example, small molecule and polymer libraries that have not
been possible to create to date using conventional combinational
chemistries.
In one aspect, the invention provides a method of performing
nucleic acid-templated synthesis using a template having an "omega"
or ".OMEGA." type architecture. This type of template permits
distance-dependent nucleic acid-templated reactions to be encoded
by bases far removed from the associated reactive unit. The method
involves providing (i) a template comprising a first reactive unit
associated with a first oligonucleotide comprising a codon and (ii)
a transfer unit comprising a second reactive unit associated with a
second oligonucleotide comprising an anti-codon that is capable of
annealing to the codon. The codon and/or the anti-codon include
first and second regions spaced apart from one another. The
oligonucleotides then are annealed together to bring the reactive
units into reactive proximity. When the oligonucleotides anneal to
one another, the codon (or anti-codon) with the spaced-apart
regions produce a loop of oligonucleotides not annealed to the
corresponding anti-codon (or codon). A covalent bond-forming
reaction then is induced between the reactive units to produce the
reaction product.
In one embodiment, at least one of the reactive units are attached
adjacent a terminal region of its corresponding oligonucleotide. In
another embodiment, the codon or anti-codon is disposed more than
one base away (for example, 10, 20, 30 bases or more) from its
corresponding reactive unit. The first spaced apart region
typically is disposed directly adjacent a terminus of its
corresponding oligonucleotide. The first spaced apart region
preferably includes, for example, three, four, or five nucleotides,
although other embodiments (e.g., more than five nucleotides) are
also envisioned. The second region may be disposed, for example, at
least twenty or at least thirty bases away from its corresponding
reactive unit. More particularly, the end of the second region
closest to the reactive unit may be disposed, for example, at least
ten, twenty, thirty or more bases from the end of the
oligonucleotide attached to its reactive unit. The template may
include additional (e.g., 2, 3, 4, or more than 4) codons, in which
case a corresponding number of transfer units can be annealed to
the template, optionally permitting multi-step or alternative
syntheses.
In another aspect, the invention provides a method of performing a
nucleic acid-templated synthesis using a template having a "T" type
architecture. The T architecture permits two nucleic acid-templated
reactions to take place on a single template in a single step. The
method involves providing (i) a template comprising a first
reactive unit (e.g., a scaffold molecule) associated with a first
oligonucleotide having a codon, and (ii) a transfer unit comprising
a second reactive unit associated with a second oligonucleotide
having an anti-codon capable of annealing to the codon. The first
reactive unit is attached, preferably covalently, to an attachment
site intermediate the proximal and distal ends of the first
oligonucleotide of the template. During synthesis, the
oligonucleotides of the template and transfer unit are annealed to
one another to bring the reactive units into reactive proximity,
and a covalent bond-forming reaction between the reactive units is
induced.
In one embodiment of the T type architecture, the template also
includes a second, different codon capable of annealing to a
second, different anti-codon sequence of a second, different
transfer unit. In this embodiment, the first codon is located
proximal to the attachment site and the second codon, if present,
is located distal to the attachment site. If a second transfer unit
comprising a third reactive unit associated with a third
oligonucleotide having a second, different anti-codon sequence
capable of annealing to the second codon is provided, the second
transfer unit may bind to the template at the second codon
position. Accordingly, when the first and second transfer units are
combined with the template, the first anti-codon of the first
transfer unit anneals to the first codon of the template and the
second anti-codon of the second transfer unit anneals to the second
codon of the template. This system permits two reactions to occur
simultaneously or sequentially on a single template in a single
step.
In another aspect, the invention provides a series of methods for
increasing reaction selectivity between reactants in a templated
synthesis. In one approach, the method comprises providing a
template and at least two transfer units. The template comprises a
first reactive unit associated with a first oligonucleotide
comprising a predetermined codon sequence. The first transfer unit
comprises a second reactive unit associated with a second
oligonucleotide comprising an anti-codon sequence capable of
annealing to the codon sequence. The second transfer unit comprises
a third reactive unit, different from the second reactive unit. The
third reactive unit, however, is associated with a third
oligonucleotide that lacks an anti-codon sequence capable of
annealing to the codon sequence. The template and transfer units
are mixed under conditions to permit annealing of the second
oligonucleotide to the first oligonucleotide, thereby to enhance
covalent bond formation between the second and first reactive units
relative to covalent bond formation between the third and first
reactive units.
This method may be particularly helpful when the second and third
reactive units are each capable of reacting independently with the
first reactive unit. Furthermore, the method may also be helpful
when the second and third reactive units are capable of reacting
with one another, for example, to modify or inactivate one another.
Accordingly, this type of method permits a series of otherwise
incompatible reactions to occur in the same solution, for example,
where a reaction between the second and third reactive units is
incompatible with a reaction between the second reactive unit and
the first reactive unit. The method may enhance covalent bond
formation between the first and second reactive units by at least
2-fold, at least 5-fold, at least 10-fold, or at least 50-fold
relative to covalent bond formation between the first and third
reactive units. Collectively, these advantages permit a one-pot
ordered multi-step synthesis, in which a sequence of reactions is
programmed by the sequence of a template oligonucleotide. Thus, a
sequence of at least 2, 3, 4, 5, 6, or more reactions can take
place in an ordered manner in a single solution, even when the
reactants would interfere with each other using conventional,
non-templated chemistries.
In one embodiment, the template, the first transfer unit, and/or
the second transfer unit are associated with a capturable moiety,
for example, biotin, avidin, or streptavidin. If a capturable
moiety is present, the method may include capturing the capturable
moiety as a way to enrich a reaction product from a reaction
mixture.
In another approach, the method comprises providing (i) a template
comprising a first oligonucleotide having first and second codon
sequences (ii) a first transfer unit, (iii) a second transfer unit,
and (iv) a third transfer unit. The first transfer unit comprises a
first reactive unit associated with a second oligonucleotide
comprising a first anti-codon sequence capable of annealing to the
first codon sequence. The second transfer unit comprises a second
reactive unit associated with a third oligonucleotide comprising a
second anti-codon sequence capable of annealing to the second codon
sequence. The third transfer unit comprises a third reactive unit
associated with a fourth oligonucleotide sequence that lacks an
anti-codon sequence capable of annealing to the first or second
codon sequences. The template, first transfer unit, second transfer
unit, and third transfer unit then are mixed under conditions to
permit (i) annealing of the first anti-codon sequence to the first
codon sequence and (ii) annealing of the second anti-codon sequence
to the second codon sequence thereby to enhance covalent bond
formation between the first and second reactive units relative to
covalent bond formation between the third reactive unit and the
first reactive unit and/or between the third reactive unit the
second reactive unit. This type of method may be particularly
useful for producing non-natural polymers by nucleic acid-templated
synthesis.
In one embodiment, the template is associated with a capturable
moiety, for example, biotin, avidin, or streptavidin. The
capturable moiety may also be a reaction product resulting from a
reaction between the first and second reactive units when the first
and second reactive units are annealed to a template. If a
capturable moiety is present, the method may include capturing the
capturable moiety as a way to enrich a reaction production from the
reaction mixture.
This type of method is also helpful when the third reactive unit is
capable of reacting with the first and/or second reactive units. In
other words, the reaction between the first and third reactive
units and/or between the second and third reactive units may be
incompatible with the reaction between the first and second
reactive units. The method may enhance covalent bond formation
between the first and second reactive units by at least 2-fold, at
least 5-fold, at least 10-fold, or at least 50-fold relative to
covalent bond formation between the first and third reactive
units.
In another aspect, the invention provides a series of methods for
performing stereoselective nucleic acid-templated synthesis. The
stereoselectivity of the synthesis may result from the choice of a
particular template, transfer unit, reactive unit, hybridized
template and transfer unit, stereoselective catalyst, or any
combination of the above. The resulting product may be at least
60%, at least 70%, at least 80%, at least 90%, at least 95%, at
least 98%, or at least 99% stereochemically pure.
Generally, the method involves providing (i) a template comprising
a first oligonucleotide that optionally is associated with a
reactive unit and (ii) one or more transfer units, each comprising
a second oligonucleotide associated with a reactive unit. Annealing
of the first and second oligonucleotides brings at least two
reactive units into reactive proximity and to react to produce a
reaction product where the reaction product contains a chiral
center and is of at least 60%, more preferably at least 80%, and
more preferably at least 95% stereochemically pure at the chiral
center. It is contemplated that this method can be accomplished
when one reactive unit is associated with the template and the
other reactive unit is associated with the transfer unit. Also, it
is contemplated that this method can be accomplished when the
template does not provide a reactive unit and two transfer units
when they anneal to the template provide the two reactive units
that come into reactive proximity to produce the reaction
product.
In one approach, the method involves providing at least two
templates and at least one transfer unit. One template includes a
first oligonucleotide associated with a first reactive unit
comprising a first stereochemical configuration, and the other
template includes another first oligonucleotide associated with
another first reactive unit having a second, different
stereochemical configuration. The transfer unit comprises a second
reactive unit associated with a second oligonucleotide including a
sequence complementary to a sequence of the first oligonucleotide
of the template. The first and second oligonucleotides then are
annealed under conditions to permit the second reactive unit of the
transfer unit to react preferentially with either the first
reactive unit of the first stereochemical configuration or the
first reactive unit of the second stereochemical configuration to
produce a reaction product.
The resulting reaction product may have a particular stereochemical
configuration. In one embodiment, a stereochemical configuration or
macromolecular conformation of the first oligonucleotide of the
template determines which one of the first reactive units reacts
with the second reactive unit.
In a second approach, the method involves providing at least one
template and at least two transfer units. The template includes a
first oligonucleotide associated with a first reactive unit. One
transfer unit comprises a second oligonucleotide associated with a
second reactive unit having a first stereochemical configuration,
and the other transfer unit comprises another second
oligonucleotide associated with a second reactive unit having a
second, different stereochemical configuration. A sequence of the
second oligonucleotides is complementary to a sequence of the first
oligonucleotide. The first and second oligonucleotides then are
annealed under conditions to permit the first reactive unit of the
template to react preferentially with either the second reactive
unit having the first stereochemical configuration or with the
second reactive unit having the second stereochemical configuration
to produce a reaction product.
The resulting reaction product may have a particular stereochemical
configuration. In one embodiment, a stereochemical configuration or
macromolecular conformation of the second oligonucleotide
determines which of the second reactive units reacts with the first
reactive unit.
In a third approach, the method involves providing at least one
template and at least two transfer units, wherein one or optionally
both of the transfer units comprise a pair of reactive units with
one reactive unit of the pair having a first stereochemical
configuration and the other reactive unit of the pair having a
second, different stereochemical configuration. The template
comprises a first oligonucleotide comprising a first codon sequence
and a second codon sequence. One transfer unit of a first pair of
transfer units includes a second oligonucleotide with a first
anti-codon sequence associated with a first reactive unit having a
first stereochemical configuration. The other transfer unit of the
first pair of transfer units includes another second
oligonucleotide associated with a second stereochemical
configuration of the first reactive unit. The second transfer unit
includes a third oligonucleotide with a second anti-codon sequence
associated with a second reactive unit. The template, the first
pair of transfer units, and the second transfer unit are annealed
to permit a member of the first pair of transfer units to react
preferentially with the second transfer unit to produce a reaction
product. The resulting reaction product may have a particular
stereochemical configuration.
In one embodiment, a stereochemical configuration or macromolecular
conformation of the second oligonucleotide determines which member
of the first pair of transfer units reacts preferentially to
produce the reaction product.
In one embodiment, the method involves providing a template and at
least two pairs of transfer units. The template comprises a first
oligonucleotide comprising first and second codon sequences. One
transfer unit of the first pair comprises a second oligonucleotide
with a first anti-codon sequence associated with a first reactive
unit having a first stereochemical configuration. The other
transfer unit of the first pair comprises the second
oligonucleotide with the first anti-codon sequence associated with
a first reactive unit having a second, different stereochemical
configuration. One transfer unit of the second pair of transfer
units comprises a third oligonucleotide having a second, different
anti-codon sequence associated with a second reactive unit having a
first stereochemical configuration. The other transfer unit of the
second pair comprises the third oligonucleotide with the second
anti-codon sequence associated with the second reactive unit having
a second, different stereochemical configuration. The template, the
first pair of transfer units and the second pair of transfer units
are annealed to permit a member of the first pair of transfer units
to react preferentially with a member of the second pair of
transfer units to produce a reaction product.
In one embodiment, a stereochemical configuration or macromolecular
conformation of the second oligonucleotide determines which member
of the first pair of transfer units reacts preferentially to
produce the reaction product. In addition, a stereochemical
configuration or macromolecular conformation of the third
oligonucleotide determines which member of the second pair of
transfer units reacts preferentially to produce the reaction
product.
In another aspect, the invention provides a method for enriching a
product of a templated synthesis reaction. The method comprises
providing a first library of molecules comprising a plurality of
reaction products associated with a corresponding plurality of
oligonucleotides, wherein each oligonucleotide comprises a
nucleotide sequence indicative of the associated reaction product.
A portion of the reaction products in the first library are capable
of binding to a preselected moiety. The first library then is
exposed to the binding moiety under conditions to permit reaction
product capable of binding the binding moiety to do so. Unbound
reaction products are removed, and bound reaction product then is
eluted from the binding moiety to produce a second library of
molecules enriched at least 10-fold, more preferably at least
50-fold, relative to the first library, for reaction products that
bind the binding moiety.
In one embodiment, the binding moiety, for example, a target
biomolecule, for example, a protein, is immobilized on a solid
support. In another embodiment, the second library is enriched at
least 100-fold or at least 1,000-fold for reaction products that
bind to the binding moiety. Furthermore, it is contemplated that
the steps of exposing the library to the binding moiety, removing
unbound reaction products, and eluting bound reaction products can
be repeated (e.g., repeated one, two, three or more times).
Repetition of these steps preferably yields a second library
enriched at least 1,000-fold, more preferably, at least
10,000-fold, or, more preferably, at least 100,000-fold, for
reaction products that bind to the binding moiety.
In one embodiment, the oligonucleotide attached to the selected
library member includes a first sequence that identifies a first
reactive unit that produced the reaction product bindable by the
preselected binding moiety. Preferably, the oligonucleotide also
includes a second sequence that identifies a second reactive unit
that produced the reaction product bindable by the preselected
binding moiety. By sequencing the oligonucleotide attached to the
selected library member it is possible to determine what reactants
reacted with one another to produce the reaction product.
Accordingly, using this approach it is possible to deduce the
structure of the selected library member from the reaction
history.
The method may further comprise the step of amplifying the
oligonucleotide associated with the enriched reaction product and,
preferably, determining the sequence of the amplified
oligonucleotide. Furthermore, the reaction product can be further
characterized by using information encoded within the sequence of
the oligonucleotide. For example, the sequence of the
oligonucleotide may be determined and then from the sequence it is
possible to determine what reactive units reacted to produce the
reaction product. Using a similar approach, it is possible to
identify the existence of new chemical reactions that produced the
reaction product.
In another aspect, the invention provides a variety of methods for
identifying the existence of new chemical reactions. One approach
involves, providing a library of molecules comprising a plurality
of reaction products associated with a corresponding plurality of
oligonucleotides, wherein each oligonucleotide includes a
nucleotide sequence indicative of an associated reaction product. A
particular reaction product associated with its corresponding
oligonucleotide then is selected, and characterized. Following
characterization of the reaction product and identification of the
reactive units that reacted to create the reaction product, it is
possible to identify one or more new chemical reactions necessary
to produce the reaction product.
In one embodiment, the method further includes, after selecting the
reaction product, amplifying its corresponding oligonucleotide. The
amplified oligonucleotide can then be sequenced to identify what
reactive units reacted to produce the reaction product. The
oligonucleotide may also be amplified for use in preparing more of
the selected reaction product. In other embodiments, the
oligonucleotide may be mutated, and the resulting mutated
oligonucleotide may be used in the creation of a second generation
library.
A second approach involves providing (i) a template and (ii) a
first transfer unit. The template comprises a first reactive unit
associated with a first oligonucleotide comprising a codon. The
transfer unit comprises a second reactive unit associated with a
second oligonucleotide comprising an anti-codon capable of
annealing to the codon. The oligonucleotides are annealed to bring
the first and second reactive units into reactive proximity. A
covalent bond-forming reaction is induced between the reactive
units to produce a reaction product. The reaction product then is
characterized, and a new chemical reaction necessary to make the
reaction product is identified using information encoded by the
template to identify the first and second reactive units that
reacted to produce the reaction product. The method may also
include the step of selecting the reaction product prior to its
characterization.
In a third approach, the invention involves providing at least (i)
a template, (ii) a first transfer unit and (iii) a second transfer
unit. The first transfer unit comprises a first reactive unit
associated with a first oligonucleotide. The second transfer unit
comprises a second reactive unit associated with a second
oligonucleotide. The template includes sequences capable of
annealing to the first and second oligonucleotides. During the
method, the oligonucleotides are annealed to the template to bring
the reactive units into reactive proximity and a covalent
bond-forming reaction is induced between the reactive units to
produce a reaction product. The reaction product then is
characterized, for example, by using information encoded by the
template to identify the first and second reactive units that
reacted with one another to produce the reaction product. Based on
the characterization, it is then possible to identify one or more
new chemical reactions that were necessary to make the reaction
product. The method may also include the step of selecting the
reaction product prior to its characterization.
Although the methods of the invention are useful with small numbers
of templates and transfer units, use of larger numbers of templates
(e.g., 10, 50, 100, 1000, or more) and of transfer units for each
codon (e.g., 10, 20, 30, 50, or more) permits the synthesis of
large libraries of molecules that can be screened simultaneously
using the sensitivity afforded by amplification.
DEFINITIONS
The term, "associated with" as used herein describes the
interaction between or among two or more groups, moieties,
compounds, monomers, etc. When two or more entities are "associated
with" one another as described herein, they are linked by a direct
or indirect covalent or non-covalent interaction. Preferably, the
association is covalent. The covalent association may be, for
example, but without limitation, through an amide, ester,
carbon-carbon, disulfide, carbamate, ether, thioether, urea, amine,
or carbonate linkage. The covalent association may also include a
linker moiety, for example, a photocleavable linker. Desirable
non-covalent interactions include hydrogen bonding, van der Waals
interactions, dipole-dipole interactions, pi stacking interactions,
hydrophobic interactions, magnetic interactions, electrostatic
interactions, etc. Also, two or more entities or agents may be
"associated with" one another by being present together in the same
composition.
The term, "biological macromolecule" as used herein refers to a
polynucleotide (e.g., RNA, DNA, RNA/DNA hybrid), protein, peptide,
lipid, or polysaccharide. The biological macromolecule may be
naturally occurring or non-naturally occurring. In a preferred
embodiment, a biological macromolecule has a molecular weight
greater than about 5,000 Daltons.
The terms, "polynucleotide," "nucleic acid", or "oligonucleotide"
as used herein refer to a polymer of nucleotides. The polymer may
include, without limitation, natural nucleosides (i.e., adenosine,
thymidine, guanosine, cytidine, uridine, deoxyadenosine,
deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside
analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine,
pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine,
C5-bromouridine, C5-fluorouridine, C5-iodouridine,
C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine), chemically modified bases,
biologically modified bases (e.g., methylated bases), intercalated
bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose), or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).
Nucleic acids and oligonucleotides may also include other polymers
of bases having a modified backbone, such as a locked nucleic acid
(LNA), a peptide nucleic acid (PNA), a threose nucleic acid (TNA)
and any other polymers capable of serving as a template for an
amplification reaction using an amplification technique, for
example, a polymerase chain reaction, a ligase chain reaction, or
non-enzymatic template-directed replication.
The term, "small molecule" as used herein, refers to an organic
compound either synthesized in the laboratory or found in nature
having a molecular weight less than 10,000 grams per mole,
optionally less than 5,000 grams per mole, and optionally less than
2,000 grams per mole.
The terms "small molecule scaffold" or "molecular scaffold" as used
herein, refer to a chemical compound having at least one site or
chemical moiety suitable for functionalization. The small molecule
scaffold or molecular scaffold may have two, three, four, five or
more sites or chemical moieties suitable for functionalization.
These functionalization sites may be protected or masked as would
be appreciated by one of skill in this art. The sites may also be
found on an underlying ring structure or backbone.
The term, "transfer unit" as used herein, refers to a molecule
comprising an oligonucleotide having an anti-codon sequence
associated with a reactive unit including, for example, but not
limited to, a building block, monomer, monomer unit, molecular
scaffold, or other reactant useful in template mediated chemical
synthesis.
The term, "template" as used herein, refers to a molecule
comprising an oligonucleotide having at least one codon sequence
suitable for a template mediated chemical synthesis. The template
optionally may comprise (i) a plurality of codon sequences, (ii) an
amplification means, for example, a PCR primer binding site or a
sequence complementary thereto, (iii) a reactive unit associated
therewith, (iv) a combination of (i) and (ii), (v) a combination of
(i) and (iii), (vi) a combination of (ii) and (iii), or a
combination of (i), (ii) and (iii).
The terms, "codon" and "anti-codon" as used herein, refer to
complementary oligonucleotide sequences in the template and in the
transfer unit, respectively, that permit the transfer unit to
anneal to the template during template mediated chemical
synthesis.
Throughout the description, where compositions are described as
having, including, or comprising specific components, or where
processes are described as having, including, or comprising
specific process steps, it is contemplated that compositions of the
present invention also consist essentially of, or consist of, the
recited components, and that the processes of the present invention
also consist essentially of, or consist of, the recited processing
steps. Further, it should be understood that the order of steps or
order for performing certain actions are immaterial so long as the
invention remains operable. Moreover, two or more steps or actions
may be conducted simultaneously.
DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts known sequence-specific oligomerizations of
complimentary oligonucleotides catalyzed by single-stranded nucleic
acid templates.
FIG. 2 is a schematic representation of one embodiment of nucleic
acid-templated synthesis where a reactive unit is attached to a
template at the start of synthesis.
FIG. 3 is a schematic representation of a second embodiment of
nucleic acid-templated synthesis where a reactive unit is not
attached to the template at the start of synthesis.
FIG. 4 is a schematic representation of a third embodiment of
nucleic acid-templated synthesis suitable for polymer
synthesis.
FIGS. 5A-F are schematic representations of various exemplary
templates useful in nucleic acid-templated synthesis.
FIGS. 6A-E are schematic representations of desirable and
undesirable possible interactions between a codon of a template and
an anti-codon of a transfer unit.
FIGS. 7A-G are schematic representations of various template
architectures useful in nucleic acid-templated synthesis.
FIG. 8 is a schematic representation of a method for producing a
template, containing, from the 5'-end to the 3'-end, a small
molecule functional group, a DNA hairpin, an annealing region, a
coding region, and a PCR primer binding site.
FIG. 9 is a schematic representation of a general method for making
a library of reaction products.
FIG. 10 is a graph showing the relationship between the effective
concentration of target protein and the fraction of ligand that
binds the target.
FIGS. 11A-B are schematic representations of methods for screening
a library for bond-cleavage (FIG. 11A) and bond-formation (FIG.
11B) catalysts.
FIG. 12 is a schematic representation of an in vitro selection
scheme for identifying non-natural polymer catalysts of
bond-forming reactions.
FIG. 13 is a schematic representation of an in vitro selection
scheme for identifying non-natural polymer catalysts of
bond-cleaving reactions.
FIG. 14 is a schematic representation of exemplary reagents and
their use in a recombination method for diversifying a template
library.
FIG. 15 depicts synthetic reactions directed by hairpin (H) and
end-of-helix (E) DNA templates. Reactions were analyzed by
denaturing polyacrylamide gel electrophoresis (PAGE) after the
indicated reaction times. Lanes 3 and 4 contained templates
quenched with excess .beta.-mercaptoethanol prior to reaction.
FIG. 16 depicts the results of reactions between matched (M) or
mismatched (X) reagents linked to thiols (S) or primary amines (N)
and templates functionalized with the variety of electrophiles.
FIGS. 17A-17B depict various mismatch reactions analyzed by
denaturing PAGE. FIG. 17A depicts results of reactions in which H
templates linked to an iodoacetamide group were reacted with thiol
reagents containing 0, 1, or 3 mismatches at 25.degree. C. FIG. 17B
depicts results of reactions in which the reactions in FIG. 17A
were repeated at the indicated temperatures for 16 hours.
FIG. 18 depicts a reaction performed using a 41-base E template and
a 10-base reagent designed to anneal 1-30 bases from the 5' end of
the template.
FIG. 19 depicts a repeat of the n=10 reaction in FIG. 18 in which
the nine bases following the 5'-NH2-dT were replaced with various
backbone analogues.
FIG. 20 depicts the n=1, n=10, and n=1 mismatched (mis) reactions
described in FIG. 18 which were repeated with template and reagent
concentrations of 12.5, 25, 62.5 or 125 nM.
FIGS. 21A-21B are a schematic representation of a method for
translating, selecting, and amplifying a synthetic molecule that
binds streptavidin from a DNA-encoded library.
FIG. 22A depicts DNA sequencing results of a PCR amplified pool of
nucleic acid templates of FIGS. 21A-21B before and after
selection.
FIG. 22B is a schematic representation of a method for creating and
evolving libraries of non-natural molecules using nucleic
acid-templated synthesis, where --R.sub.1 represents the library of
product functionality transferred from reagent library 1 and
--R.sub.1B represents a selected product.
FIGS. 23A-23D are schematic representations of exemplary
DNA-templated reactions.
FIG. 24 depicts analysis by denaturing PAGE of representative
DNA-templated reactions listed in FIGS. 23 and 25.
FIGS. 25A-25B are schematic representations of DNA-templated amide
bond formation reactions mediated by EDC and sulfo-NHS or by DMT-MM
for a variety of substituted carboxylic acids and amines.
FIG. 26A-26B depict an analysis of the distance independent nature
of certain nucleic acid-templated reactions. FIG. 26A is a
schematic representation showing a model for distance-independent
nucleic acid-templated synthesis. FIG. 26B depicts the results of
denaturing PAGE of a DNA-templated Wittig olefination between
complementary aldehyde-linked template 11 and phosphorous ylide
reagent 13 from FIG. 23B with either zero bases (lanes 1-3) or ten
bases (lanes 4-6) separating annealed reactants.
FIG. 27 is a schematic representation of exemplary nucleic
acid-templated complexity building reactions.
FIGS. 28A-28B depict strategies for DNA-templated synthesis using
autocleaving linkers (FIGS. 28A and 28B), scarless linkers (FIG.
28C), and useful scar linkers (FIG. 28D).
FIG. 29 depicts results from nucleic acid-templated reactions with
various linkers.
FIGS. 30A-30B are schematic representations depicting strategies
for purifying products of DNA-templated synthesis using an
autocleaving reagent linker (FIG. 30A) or scar and non scar linkers
(FIG. 30B).
FIGS. 31A-B depict an exemplary DNA-templated multi-step tripeptide
synthesis.
FIGS. 32A-B depict an exemplary DNA-templated multi-step
synthesis.
FIG. 33 depicts DNA-templated amide bond formation reactions in
which reagents and templates are complexed with
dimethyldidodecylammonium cations.
FIG. 34 shows denaturing PAGE gels with representative
DNA-templated amine acylation, Wittig olefination, 1,3-dipolar
cycloaddition, and reductive amination reactions using the
end-of-helix (E) and omega (.OMEGA.) architectures.
FIGS. 35A-35D are bar charts showing a comparison of end-of-helix
(E), hairpin (H), and omega (.OMEGA.) architectures for mediating
DNA-templated amine acylation (FIG. 35A), Wittig olefination (FIG.
35B), 1,3-dipolar cycloaddition (FIG. 35C), or reductive amination
reactions (FIG. 35D).
FIG. 36 is a table showing the melting temperatures of selected
template-reagent combinations using the omega (.OMEGA.) and
end-of-helix (E) architectures.
FIG. 37 is a bar chart showing the efficiencies of DNA-templated
reactions mediated by a template having the T architecture.
FIGS. 38A-38C depict two DNA-templated reactions on a single
template in one solution mediated by templates having a T
architecture.
FIG. 39A-39C are schematic illustrations showing the relative rates
of product formation from (S)- and (R)-bromides in H template (FIG.
39A) or E template (FIGS. 39B and 39C) mediated stereoselective
DNA-templated substitution reactions.
FIGS. 40A-40D depict results on reaction stereoselectivity when
aromatic bases between the reactive groups are deleted and
restored. The Figures show changes in stereoselectivity as a result
of restoring aromatic DNA bases from the 5' end (FIGS. 40A-40C) or
from the 3' end (FIG. 40D) of the 12-base intervening region.
FIGS. 41A-41B show the stereoselectivities of DNA-templated
reactions mediated by right-handed helix (B-form) (FIG. 41A) or
left-handed helix (Z-form) (FIGS. 41A and 41B) hairpin
architectures.
FIGS. 42A-42D shows graphical representations of product yield
versus time for exemplary stereoselective DNA-templated reactions
used to calculate k.sub.S/k.sub.R. FIG. 42A corresponds to the
reaction shown in FIG. 39A; FIG. 42B corresponds to the reaction
shown in FIG. 39B; FIG. 42C corresponds to the reaction shown in
FIG. 44A and FIG. 42D corresponds to the reaction shown in FIG.
44B.
FIGS. 43A-43F are a schematic representations showing template and
reagent structures that incorporate achiral, flexible linkers.
FIG. 44A-44B are graphical representations of circular dichroism
spectra obtained for B-form (FIG. 44A) and Z-form (FIG. 44B)
template-reagent complexes.
FIG. 45 shows a representative denaturing PAGE analysis of
reactions using the CG-rich sequences at low and high salt
concentrations.
FIG. 46 is a schematic representation of a DNA-templated synthesis
in which maleimides, aldehydes, or amines are subjected to multiple
DNA-templated reaction types in a single solution.
FIG. 47 depicts templates and reagents used pairwise in 12-reactant
one-pot DNA-templated reactions.
FIG. 48 depicts a "one-pot" DNA-templated reaction containing 12
reactants and at least seven possible reaction types which
generates only 6 sequence-programmed products out of at least 28
possible products.
FIG. 49 is a schematic representation of a method for diversifying
a DNA-templated library by sequentially exposing or creating
reactive groups.
FIGS. 50A-50E are schematic representations of exemplary nucleic
acid-templated deprotections useful in the practice of the
invention.
FIGS. 51A-51B are schematic representations of exemplary nucleic
acid-templated functional group interconversions useful in the
practice of the invention.
FIG. 52 is a schematic representation showing the assembly of
transfer units along a nucleic acid template.
FIG. 53 is a schematic representation showing the polymerization of
dicarbamate units along a nucleic acid template to form a
polycarbamate.
FIG. 54 is a schematic representation showing cleavage of a
polycarbamate polymer from a nucleotide backbone.
FIG. 55 is a schematic representation showing the synthesis of a
DNA-templated macrocyclic fumaramide library.
FIG. 56 is a schematic representation of the amine acylation and
cyclization steps of various fumaramide library members of FIG.
55.
FIG. 57 shows exemplary amino acid building blocks for the
synthesis of a DNA-templated macrocyclic fumaramide library.
FIG. 58 is a schematic representation of a method of creating a
template used in the synthesis of a DNA-templated macrocyclic
fumaramide library.
FIG. 59 is a schematic representation of an amine acylation and
cyclization reaction useful in the synthesis of macrocyclic
fumaramide library.
FIG. 60 depicts representative monomer structures that can be
incorporated into a PNA polymer.
FIG. 61 is a schematic representation of a method for making
functional polymers. As shown the polymer is still associated with
the template.
FIG. 62 depicts a DNA-templated aldehyde polymerization
reaction.
FIG. 63 depicts PNA polymerization reactions using a 40 base
template with mismatched codons located at certain positions of the
template.
FIG. 64 shows the specificity of DNA-templated polymerization
reactions.
FIG. 65A is a schematic representation showing a method of using a
nucleic acid to direct the synthesis of new polymers and plastics.
FIG. 65B is a schematic representation showing the use of Grubbs'
ring-opening metathesis polymerization catalysis to evolve
plastics.
FIG. 66 is a schematic representation showing the evolution of
plastics through iterative cycles of ligand diversification,
selection, and amplification to create polymers with desired
properties.
FIG. 67 depicts exemplary functionalized nucleotides that can be
incorporated by DNA polymerase.
FIG. 68 depicts exemplary metal binding uridine and
7-deazaadenosine analogs.
FIG. 69 depicts an exemplary synthesis of analog 7 from FIG.
67.
FIG. 70 depicts an exemplary synthesis of compound 30, a precursor
to compound 13 from FIG. 67.
FIG. 71 depicts an exemplary synthesis of compound 40, a precursor
to compound 13 from FIG. 67.
FIG. 72 depicts an exemplary synthesis of compound 38, a precursor
to compound 40 from FIG. 71.
FIG. 73 depicts exemplary deoxyadenosine derivatives.
FIG. 74 depicts an exemplary synthesis of modified deoxyadenosine
triphosphates.
FIG. 75 depicts a summary of modified nucleotide triphosphates
containing metal-binding functionalities which are or are not
incorporated by DNA-polymerase.
FIG. 76 depicts a non-natural polymer library containing a
synthetic metal-binding nucleotide that is compatible with DNA
polymerases.
FIG. 77 is a schematic representation showing the generation of
libraries of nucleic acids containing polymerase-accepted metal
binding nucleotides.
FIGS. 78A-78C show reaction schemes for identifying certain
reaction catalysts. FIG. 78A is a schematic representation of an
exemplary scheme for the in vitro selection of synthetic polymers
containing polymerase-accepted metal-binding nucleotides that
catalyze Heck reactions. FIG. 78B is a schematic representation of
an exemplary scheme for the in vitro selection of synthetic
polymers containing polymerase-accepted metal-binding nucleotides
that catalyze hetero Diels-Alder reactions. FIG. 78C is a schematic
representation of an exemplary scheme for the in vitro selection of
synthetic polymers containing polymerase-accepted metal-binding
nucleotides that catalyze aldol reactions.
FIG. 79 depicts exemplary DNA-linked synthetic molecules subjected
to protein binding selections, and enrichment factors for a single
round of selection.
FIG. 80 depicts the results of an exemplary selection scheme.
FIG. 81 depicts the net enrichment realized by three rounds of
enrichment.
FIG. 82 depicts the separation of target-specific and non-specific
DNA-linked synthetic molecules from a single solution.
FIG. 83 depicts exemplary specific DNA-linked synthetic molecules
selected in FIG. 79.
FIG. 84 depicts an exemplary iterated carbonic anhydrase selection
scheme.
FIG. 85 is a schematic representation of a method for performing
one-pot selections for bond-forming reactions.
FIG. 86 is a schematic representation of a method for validating
the discovery of new bond-forming reactions using DNA-templated
synthesis.
FIG. 87 depicts an example of reaction discovery using nucleic
acid-templated synthesis.
FIG. 88 depicts the discovery of Cu-mediated coupling reactions
identified using nucleic acid-templated synthesis.
FIG. 89 depicts the discovery of Pd-mediated coupling reactions
identified using nucleic acid-templated synthesis.
FIG. 90 is a schematic representation of a microarray based
sequence analysis protocol.
FIG. 91 depicts the analysis of the Pd-mediated reactions
identified via microarray based sequence analysis.
DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION
Nucleic-acid templated synthesis as described herein permits the
production, selection, amplification and evolution of a broad
variety of chemical compounds such as synthetic small molecules and
non-natural polymers. In nucleic acid-templated synthesis, the
information encoded by a DNA or other nucleic acid sequence is
translated into the synthesis of a reaction product. The nucleic
acid template typically comprises a plurality of coding regions
which anneal to complementary anti-codon sequences associated with
reactive units, thereby bringing the reactive units together in a
sequence-specific manner to create a reaction product. Since
nucleic acid hybridization is sequence-specific, the result of a
nucleic acid-templated reaction is the translation of a specific
nucleic acid sequence into a corresponding reaction product.
As shown in FIG. 1, the ability of single stranded nucleic acid
templates to catalyze the sequence-specific oligomerization of
complementary oligonucleotides has been demonstrated (Inoue et al.
(1981) J. AM. CHEM. SOC. 103: 7666; Inoue et al. (1984) J. MOL.
BIOL. 178: 669-76). This discovery was soon followed by findings
that DNA or RNA templates can catalyze the oligomerization of
complementary DNA or RNA mono-, di-, tri-, or oligonucleotides
(Inoue et al. (1981) J. AM. CHEM. SOC. 103: 7666; Orgel et al.
(1995) ACC. CHEM. RES. 28: 109-118; Rembold et al. (1994) J. MOL.
EVOL. 38: 205; Rodriguez et al. (1991) J. MOL. EVOL. 33: 477; Chen
et al. (1985) J. MOL. BIOL. 181: 271). DNA or RNA templates have
since been shown to accelerate the formation of a variety of
non-natural nucleic acid analogs, including peptide nucleic acids
(Bohler et al. (1995) NATURE 376: 578), phosphorothioate- (Herrlein
et al. (1995) J. AM. CHEM. SOC. 117: 10151-10152),
phosphoroselenate- (Xu et al. (2000) J. AM. CHEM. SOC. 122:
9040-9041; Xu et al. (2001) NAT. BIOTECHNOL. 19: 148-152) and
phosphoramidate- (Luther et al. (1998) NATURE 396: 245-8)
containing nucleic acids, non-ribose nucleic acids (Bolli et al.
(1997) CHEM. BIOL. 4: 309-20), and DNA analogs in which a phosphate
linkage has been replaced with an aminoethyl group (Gat et al.
(1998) BIOPOLYMERS 48: 19-28). Nucleic acid templates can also
catalyze amine acylation between nucleotide analogs (Bruick et al.
(1996) CHEM. BIOL. 3: 49-56).
Although nucleic acid templates have been demonstrated to
accelerate the formation of a variety of non-natural nucleic acid
analogues, nearly all of these reactions were designed to proceed
through transition states closely resembling the natural nucleic
acid backbone (FIG. 1), typically affording products that preserve
the same six-bond backbone spacing between nucleotide units. The
motivation behind this design presumably was the assumption that
the rate enhancement provided by nucleic acid templates depends on
a precise alignment of reactive groups, and the precision of this
alignment is maximized when the reactants and products mimic the
structure of the DNA and RNA backbones. Evidence in support of the
hypothesis that nucleic acid-templated synthesis can only generate
products that resemble the nucleic acid backbone comes from the
well-known difficulty of macrocyclization in organic synthesis
(Illuminati et al., (1981) ACC. CHEM. RES. 14: 95-102; Woodward et
al. (1981) J. AM. CHEM. SOC. 103: 3210-3213). The rate enhancement
of intramolecular ring closing reactions compared with their
intermolecular counterparts is known to diminish quickly as
rotatable bonds are added between reactive groups, such that
linking reactants with a flexible 14-carbon linker hardly affords
any rate acceleration (Illuminati et al. (1981) supra).
Because synthetic molecules of interest do not in general resemble
nucleic acid backbones, the use of nucleic acid-templated synthesis
to translate nucleic acid sequences into synthetic molecules is
useful broadly only if synthetic molecules other than nucleic acids
and nucleic acid analogs can be synthesized in a nucleic
acid-templated fashion. Significantly, as shown herein, nucleic
acid-templated synthesis is indeed a general phenomenon and can be
used for a variety of reactions and conditions to generate a
diverse range of compounds, specifically including compounds that
are not, and do not resemble, nucleic acids or nucleic acid
analogs. More specifically, the present invention extends the
ability to amplify and evolve libraries of chemical compounds
beyond natural biopolymers. The ability to synthesize chemical
compounds of arbitrary structure allows researchers to write their
own genetic codes incorporating a wide range of chemical
functionality into novel backbone and side-chain structures, which
permits the development of novel catalysts, drugs, and polymers, to
name a few examples. For example, the direct amplification and
evolution of molecules by genetic selection permits the discovery
of entirely new families of artificial catalysts which possess
activity, bioavailability, solvent, or thermal stability, or other
physical properties (such as fluorescence, spin-labeling, or
photolability) that may be difficult or impossible to achieve using
the limited set of natural protein and nucleic acid building
blocks. Similarly, developing methods to amplify and directly
evolve synthetic small molecules by iterated cycles of mutation and
selection permits the isolation of novel ligands or drugs with
properties superior to those isolated by traditional rational
design or combinatorial screening drug discovery methods.
Additionally, applying this approach to the identification and
development of polymers of significance in material science can
permit the evolution of new plastics or other polymers.
In general, nucleic acid-templated synthesis as performed herein
involves 1) providing one or more nucleic acid templates optionally
associated with a reactive unit, and 2) contacting the one or more
nucleic acid templates with one or more transfer units including an
anti-codon associated with a reactive unit. The anti-codons of the
transfer units are designed to hybridize to the nucleic acid
template. In certain embodiments of the invention, the transfer
unit comprises a single moiety simultaneously incorporating the
hybridization capability of the anti-codon unit and the chemical
functionality of the reaction unit. After the transfer units have
hybridized to the nucleic acid template in a sequence-specific
manner, the reactive units present on the transfer units and/or the
nucleic acid template come into reactive proximity to react and
generate a reaction product. Preferably, the oligonucleotide
portion of the transfer unit is removed once the reactive units
have reacted to generate the reaction product or an intermediate of
the reaction product. Significantly, the sequence of the nucleic
acid template can later be determined, to permit decoding of the
synthetic history of the attached reaction product and, thereby,
its structure. This method may be used to synthesize one molecule
at a time or may be used to synthesize thousands to millions of
compounds using combinatorial methods.
In one embodiment, the template molecule optionally is associated
with a reactive unit prior to interaction with any transfer units.
Thus, as shown in FIG. 2, the template can be connected by a
covalent bond to a reactive unit, either directly or via a linker.
Alternatively, the template can be connected by a noncovalent
linkage. For example, the template can be biotinylated, generally
at a fixed location on the molecule, and can stably interact with a
reactive unit associated with an avidin or streptavidin moiety. For
ease of synthesis, the reactive unit is preferably placed at or
near the 5' end of the template in some embodiments as shown in
FIG. 2. In other embodiments, placement of the reactive unit at an
internal position of the template or at the 3' end is preferred.
The template molecule also includes at least one codon capable of
annealing to an anti-codon of a transfer unit. During synthesis,
the transfer unit anneals to the codon, bringing its reactive unit
into reactive proximity with the reactive unit of the template to
produce a reaction product.
In another embodiment, as shown in FIG. 3, the template is not
initially associated with a reactive unit, but permits the nucleic
acid-templated synthesis of at least two reactive units disposed
with two transfer units. The template molecule includes at least
two codons, each capable of annealing to a different anti-codon
disposed within each transfer unit. The anti-codon in each transfer
unit anneals to the corresponding codon in the template to bring
the reactive units of each transfer unit into reactive proximity
with one another to produce a reaction product.
In another embodiment, as shown in FIG. 4, the template can bring
together, either simultaneously or sequentially, a plurality of
transfer units in a sequence-specific manner. The reactive units on
each annealed transfer unit can then be reacted with one another in
a polymerization process to produce a polymer. Using this approach
it is possible to generate a variety of non-natural polymers. The
polymerization may be a step-by step process or may be a
simultaneous process whereby all the annealed monomers are reacted
in one reaction sequence.
I. Template Considerations
The nucleic acid template can direct a wide variety of chemical
reactions without obvious structural requirements by
sequence-specifically recruiting reactants linked to complementary
oligonucleotides. As discussed, the nucleic acid mediated format
permits reactions that may not be possible using conventional
synthetic approaches. During synthesis, the template hybridizes or
anneals to one or more transfer units to direct the synthesis of a
reaction product, which during certain steps of templated synthesis
remain associated with the template. A reaction product then is
selected or screened based on certain criteria, such as the ability
to bind to a preselected target molecule. Once the reaction product
has been identified, the associated template can then be sequenced
to decode the synthetic history of the reaction product.
Furthermore, as will be discussed in more detail below, the
template may be evolved to guide the synthesis of another chemical
compound or library of chemical compounds.
(i) Template Format
The template may be based on a nucleic acid sequence, for example,
a DNA, an RNA, a hybrid of DNA and RNA, or a derivative of DNA and
RNA, and may be single- or double-stranded. The design of a
particular template may vary depending upon the type of nucleic
acid templated synthesis contemplated.
FIG. 5 shows a variety of templates that may be useful in the
practice of the invention. FIGS. 5A-C are schematic representations
of templates including two codons for interaction with
complementary anti-codons of two transfer units. These templates
can be used in the type of nucleic acid-templated synthesis where
no reactive units are linked to the template at the initiation of
synthesis; for example, when two transfer units anneal to the
template to bring their reactive units into reactive proximity to
create a reaction product. One such example is polymerization.
Nevertheless, the templates can be associated with a reactive unit
prior to annealing of the transfer units. FIGS. 5D-F are schematic
representations of templates that can be used in the type of
nucleic acid-templated synthesis where one reactive unit is linked
to the template at the initiation of synthesis, for example, when
one transfer unit anneals to the template to bring its reactive
unit into reactive proximity with the other reactive unit linked to
the template to create a reaction product.
FIG. 5A shows a template comprising in a 5' to 3' direction, a
nucleotide sequence encoding a first primer binding site (PBS1) or
a sequence complementary thereto, a nucleotide sequence encoding a
first codon (C1) that anneals to an anti-codon sequence of a first
transfer unit, a nucleotide sequence encoding a second codon (C2)
that anneals to an anti-codon sequence of a second, different
transfer unit, and a nucleotide sequence encoding a second primer
binding site (PBS2) or a sequence complementary thereto. The primer
binding sites, although optional, are preferred in some embodiments
to facilitate PCR-based amplification of templates. As will be
discussed in more detail below, the C1 sequence is selected so as
to minimize cross-reactivity with the anti-codon sequence of the
second transfer unit, and the C2 sequence is selected so as to
minimize cross-reactivity with the anti-codon sequence of the first
transfer unit. As shown in FIG. 5A, the C1 and C2 sequences are
separated by one or more intervening bases. In other words the C1
and C2 sequences do not directly abut one another. During nucleic
acid templated synthesis, both the first and second transfer units
are capable of binding to the template at the same time.
FIG. 5B shows a template similar to that shown in FIG. 5A, except
there are no intervening bases disposed between C1 and C2. In other
words, the C1 and C2 sequences directly abut one another. As with
the template of FIG. 5A, during nucleic acid templated synthesis,
both the first and second transfer units are capable to binding to
the template at the same time.
FIG. 5C shows a template similar to those shown in FIGS. 5A and 5B,
except that the sequence of C1 overlaps the sequence of C2. Unlike
the templates of FIGS. 5A and 5B, during nucleic acid templated
synthesis, the first and second transfer units cannot both bind to
the template at the same time. Thus, unless the template is
associated with a reactive unit prior to the initiation of
synthesis, a third codon should normally be present, so that two
reactive units can anneal simultaneously to the template to permit
the reaction to proceed. This type of template can require a
step-by-step approach to the synthesis of the reaction product. For
example, the transfer units with anti-codons to C1 are added first,
allowed to hybridize and react, and then removed before the
transfer units with anti-codons to C2 are added.
FIGS. 5D-5F show templates similar to the template shown in FIG.
5A, except that the template also includes a reactive unit (R)
associated with, for example, covalently linked to, the template.
It is understood, however, that the templates shown in both FIG. 5B
and FIG. 5C may also comprise a reactive unit (R) associated with
the corresponding template, as shown in FIGS. 5D-5F. To the extent
that a template is associated with a reactive unit, the nucleotide
sequence of the template further comprises a sequence of
nucleotides or sequence tag that uniquely identifies the reactive
unit associated with the template. Following template mediated
synthesis, the reactive unit actually attached to the template that
participated in the reaction to generate the reaction product may
be identified by reading the sequence of the sequence tag.
In FIG. 5D, R is linked to the template at a location in the
vicinity of the 5' terminal end, for example, at the 5' end of the
template or downstream of the 5' end of the template. In FIG. 5E, R
is linked to the template at a location between the 5' terminal end
and the 3' terminal end. In this particular case, R is located at a
position between C1 and C2, and represents an example of the T type
template architecture discussed in more detail below. In FIG. 5F, R
is linked to the template at a location in the vicinity of the 3'
terminal end, for example, at the 3' end of the template or
upstream of the 3' end of the template.
It is contemplated that each of the templates shown in FIGS. 5A-F,
may comprise one or more restriction endonuclease sites. For
example, with reference to FIG. 5A, the template may comprise a
restriction endonuclease site disposed between (i) PBS1 and C1,
(ii) C1 and C2, and (iii) C2 and PBS2. The restriction endonuclease
sites facilitate the use of nucleic acid cassettes to easily
introduce various sequences to replace the PBS1 sequence, the C1
sequence, the C2 sequence, the PBS2 sequence, or any combination
thereof.
In addition, the template may also incorporate a hairpin loop on
one end terminating in a reactive unit that can interact with one
or more reactive units associated with transfer units. For example,
a DNA template can comprise a hairpin loop terminating in a
5'-amino group, which may or may not be protected. The amino group
may act as an initiation point for formation of an unnatural
polymer, or may be modified to bind a small molecule scaffold for
subsequent modification by reactive units of other transfer
units.
The length of the template may vary greatly depending upon the type
of the nucleic acid-templated synthesis contemplated. For example,
in certain embodiments, the template may be from 10 to 10,000
nucleotides in length, from 20 to 1,000 nucleotides in length, from
20 to 400 nucleotides in length, from 40 to 1,000 nucleotides in
length, or from 40 to 400 nucleotides in length. The length of the
template will of course depend on, for example, the length of the
codons, the complexity of the library, the complexity and/or size
of a reaction product, the use of spacer sequences, etc.
(ii) Codon Usage
It is contemplated that the sequence of the template may be
designed in a number of ways without going beyond the scope of the
present invention. For example, the length of the codon must be
determined and the codon sequences must be set. If a codon length
of two is used, then using the four naturally occurring bases only
16 possible combinations are available to be used in encoding the
library. If the length of the codon is increased to three (the
number Nature uses in encoding proteins), the number of possible
combinations increases to 64. If the length of the codon is
increased to four, the number of possible combinations increases to
256. Other factors to be considered in determining the length of
the codon are mismatching, frame-shifting, complexity of library,
etc. As the length of the codon is increased up to a certain point
the number of mismatches is decreased; however, excessively long
codons likely will hybridize despite mismatched base pairs.
Although the length of the codons may vary, the codons may range
from 2 to 50 nucleotides, from 2 to 40 nucleotides, from 2 to 30
nucleotides, from 2 to 20 nucleotides, from 2 to 15 nucleotides,
from 2 to 10 nucleotides, from 3 to 50 nucleotides, from 3 to 40
nucleotides, from 3 to 30 nucleotides, from 3 to 20 nucleotides,
from 3 to 15 nucleotides, from 3 to 10 nucleotides, from 4 to 50
nucleotides, from 4 to 40 nucleotides, from 4 to 30 nucleotides,
from 4 to 20 nucleotides, from 4 to 15 nucleotides, from 4 to 10
nucleotides, from 5 to 50 nucleotides, from 5 to 40 nucleotides,
from 5 to 30 nucleotides, from 5 to 20 nucleotides, from 5 to 15
nucleotides, from 5 to 10 nucleotides, from 6 to 50 nucleotides,
from 6 to 40 nucleotides, from 6 to 30 nucleotides, from 6 to 20
nucleotides, from 6 to 15 nucleotides, from 6 to 10 nucleotides,
from 7 to 50 nucleotides, from 7 to 40 nucleotides, from 7 to 30
nucleotides, from 7 to 20 nucleotides, from 7 to 15 nucleotides,
from 7 to 10 nucleotides, from 8 to 50 nucleotides, from 8 to 40
nucleotides, from 8 to 30 nucleotides, from 8 to 20 nucleotides,
from 8 to 15 nucleotides, from 8 to 10 nucleotides, from 9 to 50
nucleotides, from 9 to 40 nucleotides, from 9 to 30 nucleotides,
from 9 to 20 nucleotides, from 9 to 15 nucleotides, from 9 to 10
nucleotides. Codons, however, preferably are 3, 4, 5, 6, 7, 8, 9 or
10 nucleotides in length.
In one embodiment, the set of codons used in the template maximizes
the number of mismatches between any two codons within a codon set
to ensure that only the proper anti-codons of the transfer units
anneal to the codon sites of the template. Furthermore, it is
important that the template has mismatches between all the members
of one codon set and all the codons of a different codon set to
ensure that the anti-codons do not inadvertently bind to the wrong
codon set. For example, with regard to the choice of codons n bases
in length, each of the codons within a particular codon set (for
example, C1 in FIG. 5A) should differ with one another by k
mismatches, and all of the codons in one codon set (for example, C1
in FIG. 5A) should differ by m mismatches with all of the codons in
the other codon set (for example, C2 in FIG. 5A). Exemplary values
for n, k, and m, for a variety of codon sets suitable for use on a
template are summarized in Table 1.
TABLE-US-00001 TABLE 1 n k m 2 1 1 3 1 1 3 2 1 3 2 2 4 1 1 4 2 1 4
2 2 4 3 1 4 3 2 4 3 3 5 1 1 5 2 1 5 2 2 5 3 1 5 3 2 5 3 3 5 4 1 5 4
2 5 4 3 5 4 4 6 1 1 6 2 1 6 2 2 6 3 1 6 3 2 6 3 3 6 4 1 6 4 2 6 4 3
6 4 4 6 5 1 6 5 2 6 5 3 6 5 4 6 5 5 7 1 1 7 2 1 7 2 2 7 3 1 7 3 2 7
3 3 7 4 1 7 4 2 7 4 3 7 4 4 7 5 1 7 5 2 7 5 3 7 5 4 7 5 5 7 6 1 7 6
2 7 6 3 7 6 4 7 6 5 7 6 6 8 1 1 8 2 1 8 2 2 8 3 1 8 3 2 8 3 3 8 4 1
8 4 2 8 4 3 8 4 4 8 5 1 8 5 2 8 5 3 8 5 4 8 5 5 8 6 1 8 6 2 8 6 3 8
6 4 8 6 5 8 6 6 8 7 1 8 7 2 8 7 3 8 7 4 8 7 5 8 7 6 8 7 7 9 1 1 9 2
1 9 2 2 9 3 1 9 3 2 9 3 3 9 4 1 9 4 2 9 4 3 9 4 4 9 5 1 9 5 2 9 5 3
9 5 4 9 5 5 9 6 1 9 6 2 9 6 3 9 6 4 9 6 5 9 6 6 9 7 1 9 7 2 9 7 3 9
7 4 9 7 5 9 7 6 9 7 7 9 8 1 9 8 2 9 8 3 9 8 4 9 8 5 9 8 6 9 8 7 9 8
8 10 1 1 10 2 1 10 2 2 10 3 1 10 3 2 10 3 3 10 4 1 10 4 2 10 4 3 10
4 4 10 5 1 10 5 2 10 5 3 10 5 4 10 5 5 10 6 1 10 6 2 10 6 3 10 6 4
10 6 5 10 6 6 10 7 1 10 7 2 10 7 3 10 7 4 10 7 5 10 7 6 10 7 7 10 8
1 10 8 2 10 8 3 10 8 4 10 8 5 10 8 6 10 8 7 10 8 8 10 9 1 10 9 2 10
9 3 10 9 4 10 9 5 10 9 6 10 9 7 10 9 8 10 9 9 11 1 1 11 2 1 11 2 2
11 3 1 11 3 2 11 3 3 11 4 1 11 4 2 11 4 3 11 4 4 11 5 1 11 5 2 11 5
3 11 5 4 11 5 5 11 6 1 11 6 2 11 6 3 11 6 4 11 6 5 11 6 6 11 7 1 11
7 2 11 7 3 11 7 4 11 7 5 11 7 6 11 7 7 11 8 1 11 8 2 11 8 3 11 8 4
11 8 5 11 8 6 11 8 7 11 8 8 11 9 1 11 9 2 11 9 3 11 9 4 11 9 5 11 9
6 11 9 7 11 9 8 11 9 9 11 10 1 11 10 2 11 10 3 11 10 4 11 10 5 11
10 6 11 10 7 11 10 8 11 10 9 11 10 10 12 1 1 12 2 1 12 2 2 12 3 1
12 3 2 12 3 3 12 4 1 12 4 2 12 4 3 12 4 4 12 5 1 12 5 2 12 5 3 12 5
4 12 5 5 12 6 1 12 6 2 12 6 3 12 6 4 12 6 5 12 6 6 12 7 1 12 7 2 12
7 3 12 7 4
12 7 5 12 7 6 12 7 7 12 8 1 12 8 2 12 8 3 12 8 4 12 8 5 12 8 6 12 8
7 12 8 8 12 9 1 12 9 2 12 9 3 12 9 4 12 9 5 12 9 6 12 9 7 12 9 8 12
9 9 12 10 1 12 10 2 12 10 3 12 10 4 12 10 5 12 10 6 12 10 7 12 10 8
12 10 9 12 10 10 12 11 1 12 11 2 12 11 3 12 11 4 12 11 5 12 11 6 12
11 7 12 11 8 12 11 9 12 11 10 12 11 11 13 1 1 13 2 1 13 2 2 13 3 1
13 3 2 13 3 3 13 4 1 13 4 2 13 4 3 13 4 4 13 5 1 13 5 2 13 5 3 13 5
4 13 5 5 13 6 1 13 6 2 13 6 3 13 6 4 13 6 5 13 6 6 13 7 1 13 7 2 13
7 3 13 7 4 13 7 5 13 7 6 13 7 7 13 8 1 13 8 2 13 8 3 13 8 4 13 8 5
13 8 6 13 8 7 13 8 8 13 9 1 13 9 2 13 9 3 13 9 4 13 9 5 13 9 6 13 9
7 13 9 8 13 9 9 13 10 1 13 10 2 13 10 3 13 10 4 13 10 5 13 10 6 13
10 7 13 10 8 13 10 9 13 10 10 13 11 1 13 11 2 13 11 3 13 11 4 13 11
5 13 11 6 13 11 7 13 11 8 13 11 9 13 11 10 13 11 11 13 12 1 13 12 2
13 12 3 13 12 4 13 12 5 13 12 6 13 12 7 13 12 8 13 12 9 13 12 10 13
12 11 13 12 12 14 1 1 14 2 1 14 2 2 14 3 1 14 3 2 14 3 3 14 4 1 14
4 2 14 4 3 14 4 4 14 5 1 14 5 2 14 5 3 14 5 4 14 5 5 14 6 1 14 6 2
14 6 3 14 6 4 14 6 5 14 6 6 14 7 1 14 7 2 14 7 3 14 7 4 14 7 5 14 7
6 14 7 7 14 8 1 14 8 2 14 8 3 14 8 4 14 8 5 14 8 6 14 8 7 14 8 8 14
9 1 14 9 2 14 9 3 14 9 4 14 9 5 14 9 6 14 9 7 14 9 8 14 9 9 14 10 1
14 10 2 14 10 3 14 10 4 14 10 5 14 10 6 14 10 7 14 10 8 14 10 9 14
10 10 14 11 1 14 11 2 14 11 3 14 11 4 14 11 5 14 11 6 14 11 7 14 11
8 14 11 9 14 11 10 14 11 11 14 12 1 14 12 2 14 12 3 14 12 4 14 12 5
14 12 6 14 12 7 14 12 8 14 12 9 14 12 10 14 12 11 14 12 12 14 13 1
14 13 2 14 13 3 14 13 4 14 13 5 14 13 6 14 13 7 14 13 8 14 13 9 14
13 10 14 13 11 14 13 12 14 13 13 15 1 1 15 2 1 15 2 2 15 3 1 15 3 2
15 3 3 15 4 1 15 4 2 15 4 3 15 4 4 15 5 1 15 5 2 15 5 3 15 5 4 15 5
5 15 6 1 15 6 2 15 6 3 15 6 4 15 6 5 15 6 6 15 7 1 15 7 2 15 7 3 15
7 4 15 7 5 15 7 6 15 7 7 15 8 1 15 8 2 15 8 3 15 8 4 15 8 5 15 8 6
15 8 7 15 8 8 15 9 1 15 9 2 15 9 3 15 9 4 15 9 5
15 9 6 15 9 7 15 9 8 15 9 9 15 10 1 15 10 2 15 10 3 15 10 4 15 10 5
15 10 6 15 10 7 15 10 8 15 10 9 15 10 10 15 11 1 15 11 2 15 11 3 15
11 4 15 11 5 15 11 6 15 11 7 15 11 8 15 11 9 15 11 10 15 11 11 15
12 1 15 12 2 15 12 3 15 12 4 15 12 5 15 12 6 15 12 7 15 12 8 15 12
9 15 12 10 15 12 11 15 12 12 15 13 1 15 13 2 15 13 3 15 13 4 15 13
5 15 13 6 15 13 7 15 13 8 15 13 9 15 13 10 15 13 11 15 13 12 15 13
13 15 14 1 15 14 2 15 14 3 15 14 4 15 14 5 15 14 6 15 14 7 15 14 8
15 14 9 15 14 10 15 14 11 15 14 12 15 14 13 15 14 14
Using an appropriate algorithm, it is possible to generate sets of
codons that maximize mismatches between any two codons within the
same set, where the codons are n bases long having at least k
mismatches between any two codons. Since between any two codons,
there must be at least k mismatches, any two subcodons of n-(k-1)
bases must have at least one mismatch. This sets an upper limit of
4.sup.n-k+1 on the size of any (m, k) codon set. Such an algorithm
preferably starts with the 4.sup.n-k+1 possible subcodons of length
n-(k-1) and then tests all combinations of adding k-1 bases for
those that always maintain k mismatches. All possible (m, k) sets
can be generated for n.ltoreq.6. For n>6, the 4.sup.n-k+1 upper
limits of codons cannot be met and a "full" packing of viable
codons is mathematically impossible. In addition to there being at
least one mismatch k between codons within the same codon set,
there should also be at least one mismatch m between all the codons
of one codon set and all the codons of another codon set. Using
this approach, different sets of codons can be generated so that no
codons are repeated.
By way of example, four (n=5, k=3, m=1) sets, each with 64 codons,
can be chosen that always have at least one mismatch between any
two codons in different sets and at least three mismatches between
codons in the same set.
TABLE-US-00002 TABLE 2 Sequences of (5, 3, 1) Codon Set 1 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCTC
CCGAG CCTCT CCAGA CGCGT CGGCA CGTAC CGATG CTCCG CTGGC CTTTA CTAAT
CACAA CAGTT CATGG CAACC GCCCA GCGGT GCTTG GCAAC GGCAG GGGTC GGTGA
GGACT GTCTT GTGAA GTTCC GTAGG GACGC GAGCG GATAT GAATA TCCGG TCGCC
TCTAA TCATT TGCTA TGGAT TGTCG TGAGC TTCAC TTGTG TTTGT TTACA TACCT
TAGGA TATTC TAAAG ACCAT ACGTA ACTGC ACACG AGCCC AGGGG AGTTT AGAAA
ATCGA ATGCT ATTAG ATATC AACTG AAGAC ATCA AAAGT
TABLE-US-00003 TABLE 3 Sequences of (5, 3, 1) Codon Set 2 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCAC
CCGTG CCTGT CCACA CGCCT CGGGA CGTTC CGAAG CTCGG CTGCC CTTAA CTATT
CACTA CAGAT CATCG CAAGC GCCGA GCGCT GCTAG GCATC GGCTG GGGAC GGTCA
GGAGT GTCAT GTGTA GTTGC GTACG GACCC GAGGG GATTT GAAAA TCCCG TCGGC
TCTTA TCAAT TGCAA TGGTT TGTGG TGACC TTCTC TTGAG TTTCT TTAGA TACGT
TAGCA TATAC TAATG ACCTT ACGAA ACTCC ACAGG AGCGC AGGCG AGTAT AGATA
ATCCA ATGGT ATTTG ATAAC AACAG AAGTC AATGA AAACT
TABLE-US-00004 TABLE 4 Sequences of (5, 3, 1) Codon Set 3 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCTG
CCGAC CCTCA CCAGT CGCAT CGGTA CGTGC CGACG CTCCC CTGGG CTTTT CTAAA
CACGA CAGCT CATAG CAATC GCCAA GCGTT GCTGG GCACC GGCTC GGGAG GGTCT
GGAGA GTCGT GTGCA GTTAC GTATG GACCG GAGGC GATTA GAAAT TCCGC TCGCG
TCTAT TCATA TGCCA TGGGT TGTTG TGAAC TTCAG TTGTC TTTGA TTACT TACTT
TAGAA TATCC TAAGG ACCCT ACGGA ACTTC ACAAG AGCGG AGGCC AGTAA AGATT
ATCTA ATGAT ATTCG ATAGC AACAC AAGTG AATGT AAACA
TABLE-US-00005 TABLE 5 Sequences of (5, 3, 1) Codon Set 4 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCAG
CCGTC CCTGA CCACT CGCTT CGGAA CGTCC CGAGG CTCGC CTGCG CTTAT CTATA
CACCA CAGGT CATTG CAAAC GCCTA CGAT GCTCG GCAGC GGCAC GGGTG GGTGT
GGACA GTCCT GTGGA GTTTC GTAAG GACGG GAGCC GATAA GAATT TCCCC TCGGG
TCTTT TCAAA TGCGA TGGCT TGTAG TGATC TTCTG TTGAC TTTCA TTAGT TACAT
TAGTA TATGC TAACG ACCGT ACGCA ACTAC ACATG AGCCG AGGGC AGTTA AGAAT
ATCAA ATGTT ATTGG ATACC AACTC AAGAG AATCT AAAGA
Similarly, four (n=6, k=4, m=2) sets as shown below, each with 64
codons, can be chosen that always have at least two mismatches
between any two codons in different codon sets and at least four
mismatches between codons in the same codon set.
TABLE-US-00006 TABLE 6 Sequences of (6, 4, 2) Codon Set 1 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCTCC
TCGAAC CCGCTG TCTCCA CGGTAT TCATTT CCAGAA TGCACT CGCCGA TGGGTA
CTCAAG TGTTGC CGTGCG TGACAG CGAATC TTCCTC CTACCT TTGTCG CTGGGC
TTTGAT CTTTTA TTAAGA CATCAC TACTAA CACGTT TAGCGT CAGACA TATATG
GCGGCT TAAGCC CAATGG ACCCAT GCCATA ACGTGA GGCGAC ACTGTC GCTTAG
ACAACG GCACGC AGCTTG GGATCA AGGCCC GGGAGG AGTAAA GGTCTT AGAGGT
GTTACC ATCGCA GTCTGT ATGATT GTGCAA ATTCGG GAGTTC ATATAC GTAGTG
AACAGC GACCCG AAGGAG TCCGGG AATTCT GATGGA AAACTA GAAAAT CCTAGT
TABLE-US-00007 TABLE 7 Sequences of (6, 4, 2) Codon Set 2 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCCTC
TCGGGC CCGTCG TCTTTA CGGCGT TCACCT CCAAGA TGCGTT CGCTAA TGGACA
CTCGGG TGTCAC CGTATG TGATGG CGAGCC TTCTCC CTATTT TTGCTG CTGAAC
TTTAGT CTTCCA TTAGAA CATTGC TACCGA CACACT TAGTAT CAGGTA TATGCG
GCGATT TAAATC CAACAG ACCTGT GCCGCA ACGCAA GGCAGC ACTACC GCTCGG
ACAGTG GCATAC AGCCCG GGACTA AGGTTC GGGGAG AGTGGA GGTTCT AGAAAT
GTTGTC ATCATA GTCCAT ATGGCT GTGTGA ATTTAG GAGCCC ATACGC GTAACG
AACGAC GACTTG AAGAGG TCCAAG AATCTT GATAAA AAATCA GAAGGT CCTGAT
TABLE-US-00008 TABLE 8 Sequences of (6, 4, 2) Codon Set 3 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCGAC
TCGCCC CCGAGG TCTAAA CGGGCT TCAGGT CCATCA TGCCAT CGCATA TGGTGA
CTCCCG TGTGTC CGTTAG TGAACG CGACGC TTCAGC CTAAAT TTGGAG CTGTTC
TTTTCT CTTGGA TTACTA CATACC TACGCA CACTGT TAGATT CAGCAA TATCGG
GCGTAT TAATAC CAAGTG ACCACT GCCCGA ACGGTA GGCTCC ACTTGC GCTGCG
ACACAG GCAATC AGCGGG GGAGAA AGGAAC GGGCTG AGTCCA GGTAGT AGATTT
GTTCAC ATCTAA GTGGTT ATGCGT GTGACA ATTATG GAGGGC ATAGCC GTATGG
AACCTC GACAAG AAGTCG TCCTTG AATGAT GATTTA AAAAGA GAACCT CCTCTT
TABLE-US-00009 TABLE 9 Sequences of (6, 4, 2) Codon Set 4 Codon
Codon Codon Codon Codon Codon Seq. Seq. Seq. Seq. Seq. Seq. CCCAGC
TCGTTC CCGGAG TCTGGA CGGATT TCAAAT CCACTA TGCTGT CGCGCA TGGCAA
CTCTTG TGTACC CGTCGG TGAGTG CGATAC TTCGAC CTAGGT TTGAGG CTGCCC
TTTCTT CTTAAA TTATCA CATGTC TACATA CACCAT TAGGCT CAGTGA TATTAG
GCGCGT TAACGC CAAACG ACCGTT GCCTAA ACGACA GGCCTC ACTCAC GCTATG
ACATGG GCAGCC AGCAAG GGAAGA AGGGGC GGGTCG AGTTTA GGTGAT AGACCT
GTTTGC ATCCGA GTCACT ATGTAT GTGGTA ATTGCG GAGAAC ATAATC GTACAG
AACTCC GACGGG AAGCTG TCCCCG AATAGT GATCCA AAAGAA GAATTT CCTTCT
Codons can also be chosen to increase control over the GC content
and, therefore, the melting temperature of the codon and
anti-codon. Codons sets with a wide range in GC content versus AT
content may result in reagents that anneal with different
efficiencies due to different melting temperatures. By screening
for GC content among different (m, k) sets, the GC content for the
codon sets can be optimized. For example, the four (6, 4, 2) codon
sets set forth in Tables 6-9 each contain 40 codons with identical
GC content (i.e., 50% GC content). By using only these 40 codons at
each position, all the reagents in theory will have comparable
melting temperatures, removing potential biases in annealing that
might otherwise affect library synthesis. Longer codons that
maintain a large number of mismatches such as those appropriate for
certain applications such as the reaction discovery system can also
be chosen using this approach. For example, by combining two (6, 4)
sets together while matching low GC to high GC codons, (12, 8) sets
with 64 codons all with 50% GC content can be generated for use in
reaction discovery selections as well as other application where
multiple mismatches might be advantageous. These codons satisfy the
requirements for encoding a 30.times.30 matrix of functional group
combinations for reaction discovery.
Although an anti-codon is intended to bind only to a codon, as
shown in FIG. 6A, an anti-codon may also bind to an unintended
sequence on a template if complementary sequence is present. Thus,
an anti-codon may inadvertently bind to a non-codon sequence as
shown in FIG. 6B. Alternatively, as shown in FIGS. 6C and 6D, an
anti-codon might inadvertently bind out-of-frame by annealing in
part to one codon and in part to another codon (FIG. 6C) or to a
non-codon sequence (FIG. 6D). Finally, as shown in FIG. 6E, an
anti-codon might bind in-frame to an incorrect codon, an issue
addressed by the codon sets described above by requiring at least
one base difference distinguishing each codon. In Nature, the
problems of noncoding sequences and out-of-frame binding (FIGS.
6B-D) are avoided by the ribosome. The nucleic acid-templated
methods described herein, however, do not take advantage of the
ribosome's fidelity. Therefore, in order to avoid erroneous
annealing as in FIGS. 6B-D, the templates can be designed such that
sequences complementary to anti-codons are found exclusively at
in-frame codon positions. For example, codons can be designed to
begin, or end, with a particular base (e.g., "G"). If that base is
omitted from all other positions in the template (i.e., all other
positions are restricted to T, C, and A), only perfect codon
sequences in the template will be at the in-frame codon sequences.
Similarly, the codon may be designed to be sufficiently long such
that its sequence is unique and does not appear elsewhere in a
template.
When the nucleic acid-templated synthesis is used to produce a
polymer, spacer sequences may also be placed between the codons to
prevent frame shifting. More preferably, the bases of the template
that encode each polymer subunit (the "genetic code" for the
polymer) may be chosen from Table 10 to preclude or minimize the
possibility of out-of-frame annealing. These genetic codes reduce
undesired frameshifted nucleic acid-templated polymer translation
and differ in the range of expected melting temperatures and in the
minimum number of mismatches that result during out-of-frame
annealing.
TABLE-US-00010 TABLE 10 Representative Genetic Codes for Nucleic
Acid-templated Polymers That Preclude Out-Of-Frame Annealing
Sequence Number of Possible Codons VVNT 36 possible codons NVVT 36
possible codons SSWT 8 possible codons SSST 8 possible codons SSNT
16 possible codons VNVNT or NVNVT 144 possible codons SSSWT or
SSWST 16 possible codons SNSNT or NSNST 64 possible codons SSNWT or
SWNST 32 possible codons WSNST or NSWST 32 possible codons where, V
= A, C, or G, S = C or G, W = A or T, and N = A, C, G, or T
As in Nature, start and stop codons are useful, particularly in the
context of polymer synthesis, to restrict erroneous anti-codon
annealing to non-codons and to prevent excessive extension of a
growing polymer. For example, a start codon can anneal to a
transfer unit bearing a small molecule scaffold or a start monomer
unit for use in polymer synthesis; the start monomer unit can be
masked by a photolabile protecting group as shown in Example 9A. A
stop codon, if used to terminate polymer synthesis, should not
conflict with any other codons used in the synthesis and should be
of the same general format as the other codons. Generally, a stop
codon can encode a monomer unit that terminates polymerization by
not providing a reactive group for further attachment. For example,
a stop monomer unit may contain a blocked reactive group such as an
acetamide rather than a primary amine as shown in Example 9A. In
other embodiments, the stop monomer unit can include a biotinylated
terminus that terminates the polymerization and facilitates
purification of the resulting polymer.
(iii) Template Architecture
As discussed previously, depending upon the type of nucleic
acid-templated synthesis contemplated, the template may be further
associated (for example, covalently coupled) with a particular
reactive unit. Various templates useful in nucleic acid-templated
synthesis are shown in FIGS. 7A-7G, and include templates referred
to as the "end-of helix" or "E" templates (see, FIG. 7A-C),
"Hairpin" or "H" templates (see, FIG. 7D), "Omega" or ".OMEGA."
templates (see, FIG. 7E-F), or "T" templates (see, FIG. 7G).
FIGS. 7A-C show E type template architectures where the reactive
units on the annealed templates (denoted by A) and transfer units
(denoted by B) are separated by 1 base (FIG. 7A), 10 bases (FIG.
7B) and 20 bases (FIG. 7C). FIG. 7D, shows a H type template
architecture where the reactive unit is attached to the template
(denoted by A) and the template folds back on itself to create a
hairpin loop stabilized by a plurality of intramolecular bonds. As
shown, the reactive units on the annealed template (denoted by A)
and the transfer unit (denoted by B) are separated by 1 base. FIGS.
7E-F show omega type template architecture where the codon for the
transfer unit, bearing reactive unit B, is separated from reactive
unit A on the template by 10 intervening template bases (FIG. 7E)
or by 20 bases (FIG. 7F). In FIG. 7E, the omega template comprises
a three base constant region (.OMEGA.-3) and creates a seven base
loop when the transfer unit anneals to the template. In FIG. 7F,
the omega template includes a five base constant region (.OMEGA.-5)
and creates a fifteen base loop when the transfer unit anneals to
the template. The loop gets larger as transfer units anneal to
codons further away from the constant region of the template. FIG.
7G shows a T-type template architecture where the reactive units on
the annealed template (denoted by A) and the transfer unit (denoted
by B) are separated by 1 base. In FIG. 7G, reactive unit A is
attached at a location intermediate the 5' and 3' terminal ends of
the template. Using this architecture, it is contemplated that the
reactive unit may be attached to the template at a location at
least 10, 20, 30, 40, 50, 60, 70 bases or more downstream of the 5'
end of the template and/or at least 10, 20, 30, 40, 50, 60, 70
bases or more upstream of the 3' end of the template.
The ability of the E type template architecture and the H type
template architecture to facilitate nucleic acid mediated chemical
syntheses is described in detail in Example 1. However, as a result
of performing nucleic acid mediated syntheses, it has been
discovered that certain reactions, referred to as distance
dependent reactions, do not proceed efficiently when the annealed
reactive units on the template and transfer unit are separated by
even small numbers of bases. Using the E and H type templates,
certain distance dependent reactions may only be encoded by
template bases at the reactive end of the template. The new .OMEGA.
type template overcomes the distance dependence problems that can
be experienced with the E and H type templates (see, Example 5).
Furthermore, it has been discovered that the presence of
double-stranded nucleic acids between annealed reactive units can
greatly reduce the efficiency of templated reactions because the
flexibility of a single-stranded template is required. This may
hinder performing two or more reactions in a single nucleic acid
templated step using the E or H architectures even though the
template may contain enough bases to encode multiple reactions. The
new T type template overcomes this problem that can be experienced
with the E and H type templates (see, Example 5).
.OMEGA. Templates
The omega architecture permits distance dependent reactions to be
directed efficiently by nucleotide bases far away from the reaction
end of the template, effectively overcoming their distance
dependence. By way of example, in the omega architecture, five
bases of the template are held constant at the 5'-end of the
template (see, FIG. 7F). The transfer units contain at their
3'-ends the complementary five bases but otherwise possess
sequences that complement distal coding regions of the template.
This permits the transfer unit to anneal to the distal coding
regions of the template while still placing the reactive group of
the transfer unit in close proximity by looping out large numbers
of template bases that would ordinarily prevent a distance
dependent reaction from proceeding. The omega architecture retains
sequence specificity because the five bases of the transfer unit
that complement the end of the template are insufficient by
themselves to anneal to the template at room temperature.
The usefulness of this type of template architecture is apparent,
for example, in nucleic acid-templated reductive amination
reactions. These reactions are strongly distance dependent and very
little product is produced when the reaction is attempted using the
hairpin or end-of-helix architectures with more than one base of
distance between the annealed amine and aldehyde groups. In
contrast, product forms efficiently using the omega architecture
even when a region of the template 20 bases away from the reactive
end is used to recruit the reagent (see, Example 5). No product is
observed when the coding region of the transfer unit is mismatched,
despite the presence of five bases at the end of the transfer unit
that are complementary to the end of the template.
By enabling distance-dependent nucleic acid mediated reactions to
be encoded by bases far away from the reactive end of the template,
the omega architecture expands the types of reactions that can be
encoded anywhere on the template.
T Templates
The T architecture permits a single template to encode two
distance-dependent reactions and in addition permits a template to
undergo two different nucleotide-templated reactions in a single
solution or in "one-pot." Using this architecture, the template can
present a molecular scaffold through the non-Watson-Crick face of a
base located in the center, rather than the end, of the template
(see, FIG. 7G). This permits two transfer units to anneal to either
side of the reactive unit attached to the template and react either
simultaneously or in successive steps to give the product of two
nucleotide-templated transformations. As expected, distance
dependent reactions tolerate this architecture when reactive groups
are proximal. Thus, the T-type architecture permits two
sequence-specific nucleic acid-templated reactions to take place on
one template in one solution, i.e., in one step. In addition to
reducing the number of separate DNA-templated steps needed to
synthesize a target structure, this architecture may permit three-
or more component reactions commonly used to build structural
complexity in synthetic libraries.
The omega and T architectures permit a broader range of template
mediated reactions that can be performed in fewer steps with other
template architectures and are especially useful in
distance-dependent reactions. The variety of available
architectures provide significant flexibility in the placement of
reactive units on templates, particularly for the synthesis of
small molecules. It is contemplated that the reactive unit
including, for example, molecular scaffold may be associated with a
template at any site along the template including the 5'-end (e.g.,
end-of-helix architecture, omega architecture), the 3'-end (e.g.,
end-of-helix architecture, omega architecture), at the end of a
hairpin loop (e.g., hairpin architecture), or in the middle of the
template (e.g., T architecture). Preferably, the molecular scaffold
is attached covalently to the template. However, in certain
embodiments, the molecular scaffold, like the other reactive units,
can be brought to the template using a transfer unit, in which case
the molecular scaffold is only associated with the template through
a non-covalent (here, hydrogen bonding) interaction. It is
contemplated, however, that under certain circumstances it may be
advantageous to covalently link the molecular scaffold or another
reactive unit to the template to produce a T- or E-type template
architecture. For reactions that are not distance dependent, the
position of the molecular scaffold along the template is more
flexible because the reactive units brought to the template by the
transfer units are able to react with the scaffold even if the
scaffold and reactive group are separated by many bases.
(iv) Template Synthesis
The templates may be synthesized using methodologies well known in
the art. For example, the nucleic acid sequence may be prepared
using any method known in the art to prepare nucleic acid
sequences. These methods include both in vivo and in vitro methods
including PCR, plasmid preparation, endonuclease digestion, solid
phase synthesis (for example, using an automated synthesizer), in
vitro transcription, strand separation, etc. Following synthesis,
the template, when desired may be associated (for example,
covalently or non covalently coupled) with a reactive unit of
interest using standard coupling chemistries known in the art.
By way of example, it is possible to create a library of templates
via a one-pot modular ligation reaction using oligonucleotide
cassettes shown as discussed, for example, in Example 9C.
Specifically, it is possible to combine short oligonucleotides
representing all transfer unit annealing regions together with T4
DNA ligase in a single solution. Due to the sequence design of the
oligonucleotide termini, the desired assembled template library is
the only possible product when the ligation is complete. This
strategy requires 2n.times.m short oligonucleotides to assemble a
library of n.sup.m templates, where n refers to the number of
different sequences per codon position and m refers to the number
of codons per library member. Thus, for a two-codon template with
64 possible sequences per codon, 2.times.64.times.2 (256)
oligonucleotides are required to assemble a library of 64.sup.2
(4096) templates. The one-pot assembly of the templates for the
83-membered macrocyclic fumaramide library is discussed in Example
9B. Excellent yields of the desired template library resulted from
a 4 hour ligation reaction. Following ligation, T7 exonuclease was
added to degrade the non-coding template strand (the desired coding
strand is protected by its non-natural 5'-aminoethylene glycol
linker). This procedure can provide 20 nmoles of the 5'
functionalized single-stranded template library (sufficient
material for thousands of DNA-templated library syntheses and
selections) in about 6 hours. The constant 10-base primer binding
regions at the ends of each template were sufficient to permit PCR
amplification of as few as 1,000 molecules (10.sup.-21 mol) of
template from this assembled material.
Another approach for synthesizing templates is shown in FIG. 8. In
particular, FIG. 8 shows a protocol for producing a template
containing in a 5' to 3' direction, a small molecule reactant, a
hairpin loop, an annealing region, a coding region, and a primer
binding site. This type of protocol may be used to synthesize a
wide variety of templates, in particular, H type templates useful
in the practice of the invention.
An efficient method to synthesize a large variety of templates is
to use a "split-pool" technique. The oligonucleotides are
synthesized using standard 3' to 5' chemistries. First, the
constant 3' end is synthesized. This is then split into n different
vessels, where n is the number of different codons to appear at
that position in the template. For each vessel, one of the n
different codons is synthesized on the (growing) 5' end of the
constant 3' end. Thus, each vessel contains, from 5' to 3', a
different codon attached to a constant 3' end. The n vessels are
then pooled, so that a single vessel contains n different codons
attached to the constant 3' end. Any constant bases adjacent the 5'
end of the codon are now synthesized. The pool then is split into m
different vessels, where m is the number of different codons to
appear at the next (more 5') position of the template. A different
codon is synthesized (at the 5' end of the growing oligonucleotide)
in each of the m vessels. The resulting oligonucleotides are pooled
in a single vessel. Splitting, synthesizing, and pooling are
repeated as required to synthesize all codons and constant regions
in the oligonucleotides.
II. Transfer Units
A transfer unit comprises an oligonucleotide containing an
anti-codon sequence and a reactive unit. The anti-codons are
designed to be complementary to the codons present in the template.
Accordingly, the sequences used in the template and the codon
lengths should be considered when designing the anti-codons. Any
molecule complementary to a codon used in the template may be used,
including natural or non-natural nucleotides. In certain
embodiments, the codons include one or more bases found in nature
(i.e., thymidine, uracil, guanidine, cytosine, and adenine). Thus,
the anti-codon can include one or more nucleotides normally found
in Nature with a base, a sugar, and an optional phosphate group.
Alternatively, the bases may be connected via a backbone other than
the sugar-phosphate backbone normally found in Nature (e.g.,
non-natural nucleotides).
As discussed above, the anti-codon is associated with a particular
type of reactive unit to form a transfer unit. The reactive unit
may represent a distinct entity or may be part of the functionality
of the anti-codon unit. In certain embodiments, each anti-codon
sequence is associated with one monomer type. For example, the
anti-codon sequence ATTAG may be associated with a carbamate
residue with an isobutyl side chain, and the anti-codon sequence
CATAG may be associated with a carbamate residue with a phenyl side
chain. This one-for-one mapping of anti-codon to monomer units
allows the decoding of any polymer of the library by sequencing the
nucleic acid template used in the synthesis and allows synthesis of
the same polymer or a related polymer by knowing the sequence of
the original polymer. By changing (e.g., mutating) the sequence of
the template, different monomer units may be introduced, thereby
allowing the synthesis of related polymers, which can subsequently
be selected and evolved. In certain preferred embodiments, several
anti-codons may code for one monomer unit as is the case in
Nature.
In certain other embodiments, where a small molecule library is to
be created rather than a polymer library, the anti-codon generally
is associated with a reactive unit or reactant used to modify a
small molecule scaffold. In certain embodiments, the reactant is
linked to the anti-codon via a linker long enough to allow the
reactant to come into reactive proximity with the small molecule
scaffold. The linker preferably has a length and composition to
permit intramolecular reactions but yet minimize intermolecular
reactions. The reactants include a variety of reagents as
demonstrated by the wide range of reactions that can be utilized in
nucleic acid-templated synthesis (see, Examples 2, 4 and 7) and can
be any chemical group, catalyst (e.g., organometallic compounds),
or reactive moiety (e.g., electrophiles, nucleophiles) known in the
chemical arts.
Additionally, the association between the anti-codon and the
reactive unit, for example, a monomer unit or reactant, in the
transfer unit may be covalent or non-covalent. The association
maybe through a covalent bond and, in certain embodiments, the
covalent bond may be severable.
Thus, the anti-codon can be associated with the reactant through a
linker moiety (see Example 3). The linkage can be cleavable by
light, oxidation, hydrolysis, exposure to acid, exposure to base,
reduction, etc. Fruchtel et al., (1996) ANGEW. CHEM. INT. ED. ENGL.
35: 17 describes a variety of linkages useful in the practice of
the invention. The linker facilitates contact of the reactant with
the small molecule scaffold and in certain embodiments, depending
on the desired reaction, positions DNA as a leaving group
("autocleavable" strategy), or may link reactive groups to the
template via the "scarless" linker strategy (which yields product
without leaving behind an additional atom or atoms having chemical
functionality), or a "useful scar" strategy (in which a portion of
the linker is left behind to be functionalized in subsequent steps
following linker cleavage).
With the "autocleavable" linker strategy, the DNA-reactive group
bond is cleaved as a natural consequence of the reaction. In the
"scarless" linker strategy, DNA-templated reaction of one reactive
group is followed by cleavage of the linker attached through a
second reactive group to yield products without leaving behind
additional atoms capable of providing chemical functionality.
Alternatively, a "useful scar" may be utilized on the theory that
it may be advantageous to introduce useful atoms and/or chemical
groups as a consequence of linker cleavage. In particular, a
"useful scar" is left behind following linker cleavage and can be
functionalized in subsequent steps.
The anti-codon and the reactive unit (monomer unit or reactant) may
also be associated through non-covalent interactions such as ionic,
electrostatic, hydrogen bonding, van der Waals interactions,
hydrophobic interactions, pi-stacking, etc. and combinations
thereof. To give but one example, an anti-codon may be linked to
biotin, and a monomer unit linked to streptavidin. The propensity
of streptavidin to bind biotin leads to the non-covalent
association between the anti-codon and the monomer unit to form the
transfer unit.
The specific annealing of transfer units to templates permits the
use of transfer units at concentrations lower than concentrations
used in many traditional organic syntheses. Thus, transfer units
can be used at submillimolar concentrations (e.g. less than 100
.mu.M, less than 10 .mu.M, less than 1 .mu.M, less than 100 nM, or
less than 10 nM).
III. Chemical Reactions
A variety of compounds and/or libraries can be prepared using the
methods described herein. In certain embodiments, compounds that
are not, or do not resemble, nucleic acids or analogs thereof, are
synthesized according to the method of the invention. In certain
other embodiments, compounds that are not, or do not resemble,
proteins, peptides, or analogs thereof, are synthesized according
to the method of the invention.
(i) Coupling Reactions for Small Molecule Synthesis
In some embodiments, it is possible to create compounds such as
small molecules using the methods described herein. These small
molecules may be like natural products, non-polymeric, and/or
non-oligomeric. The substantial interest in small molecules is due
in part to their use as the active ingredient in many
pharmaceutical preparations although they may also be used, for
example, as catalysts, materials, or additives.
In synthesizing small molecules using the method of the present
invention, an evolvable template also is provided. The template can
include a small molecule scaffold upon which the small molecule is
to be built, or a small molecule scaffold may be added to the
template. The small molecule scaffold can be any chemical compound
with two or more sites for functionalization. For example, the
small molecule scaffold can include a ring system (e.g., the ABCD
steroid ring system found in cholesterol) with functionalizable
groups coupled to the atoms making up the rings. In another
example, the small molecule may be the underlying structure of a
pharmaceutical agent such as morphine, epothilone or a
cephalosporin antibiotic. The sites or groups to be functionalized
on the small molecule scaffold may be protected using methods and
protecting groups known in the art. The protecting groups used in a
small molecule scaffold may be orthogonal to one another so that
protecting groups can be removed one at a time.
In this embodiment, the transfer units comprise an anti-codon
associated with a reactant or a building block for use in
modifying, adding to, or taking away from the small molecule
scaffold. The reactants or building blocks may be, for example,
electrophiles (e.g., acetyl, amides, acid chlorides, esters,
nitriles, imines), nucleophiles (e.g., amines, hydroxyl groups,
thiols), catalysts (e.g., organometallic catalysts), or side
chains. The transfer units are allowed to contact the template
under hydridizing conditions. As a result of oligonucleotide
annealing, the attached reactant or building block is allowed to
react with a site on the small molecule scaffold. In certain
embodiments, protecting groups on the small molecule template are
removed one at a time from the sites to be functionalized so that
the reactant of the transfer unit will react at only the desired
position on the scaffold.
The reaction conditions, linker, reactant, and site to be
functionalized are chosen to avoid intermolecular reactions and
accelerate intramolecular reactions. Sequential or simultaneous
contacting of the template with transfer units can be employed
depending on the particular compound to be synthesized. In certain
embodiments of special interest, the multi-step synthesis of
chemical compounds is provided in which the template is contacted
sequentially with two or more transfer units to facilitate
multi-step synthesis of complex chemical compounds.
After the sites on the scaffold have been modified, the newly
synthesized small molecule remains associated with the template
that encoded its synthesis. Decoding the sequence of the template
permits the deconvolution of the synthetic history and thereby the
structure of the small molecule. The template can also be amplified
in order to create more of the desired small molecule and/or the
template can be evolved (mutagenized) to create related small
molecules. The small molecule can also be cleaved from the template
for purification or screening.
(ii) Coupling Reactions for Polymer Synthesis
In certain embodiments, polymers, specifically unnatural polymers,
are prepared according to the method of the present invention. The
unnatural polymers that can be created using the inventive method
and system include any unnatural polymers. Exemplary unnatural
polymers include, but are not limited to, peptide nucleic acid
(PNA) polymers, polycarbamates, polyureas, polyesters,
polyacrylate, polyalkylene (e.g., polyethylene, polypropylene),
polycarbonates, polypeptides with unnatural stereochemistry,
polypeptides with unnatural amino acids, and combination thereof.
In certain embodiments, the polymers comprise at least 10, 25, 75,
100, 125, 150 monomer units or more. The polymers synthesized using
the inventive system may be used, for example, as catalysts,
pharmaceuticals, metal chelators, or catalysts.
In preparing certain unnatural polymers, the monomer units attached
to the anti-codons may be any monomers or oligomers capable of
being joined together to form a polymer. The monomer units may be,
for example, carbamates, D-amino acids, unnatural amino acids,
PNAs, ureas, hydroxy acids, esters, carbonates, acrylates, or
ethers. In certain embodiments, the monomer units have two reactive
groups used to link the monomer unit into the growing polymer
chain, as depicted in FIG. 4. Preferably, the two reactive groups
are not the same so that the monomer unit may be incorporated into
the polymer in a directional sense, for example, at one end may
bean electrophile and at the other end a nucleophile. Reactive
groups may include, but are not limited to, esters, amides,
carboxylic acids, activated carbonyl groups, acid chlorides,
amines, hydroxyl groups, and thiols. In certain embodiments, the
reactive groups are masked or protected (Greene et al. (1999)
PROTECTIVE GROUPS IN ORGANIC SYNTHESIS 3rd Edition, Wiley) so that
polymerization may not take place until a desired time when the
reactive groups are deprotected. Once the monomer units are
assembled along the nucleic acid template, initiation of the
polymerization sequence results in a cascade of polymerization and
deprotection steps wherein the polymerization step results in
deprotection of a reactive group to be used in the subsequent
polymerization step.
The monomer units to be polymerized can include two or more
monomers depending on the geometry along the nucleic acid template.
The monomer units to be polymerized must be able to stretch along
the nucleic acid template and particularly across the distance
spanned by its encoding anti-codon and optional spacer sequence. In
certain embodiments, the monomer unit actually comprises two
monomers, for example, a dicarbamate, a diurea, or a dipeptide. In
yet other embodiments, the monomer unit comprises three or more
monomers. Example 9C, for example, discloses the synthesis of PNA
based polymers wherein each monomer unit comprises four PNA
molecules.
The monomer units may contain any chemical groups known in the art.
Reactive chemical groups especially those that would interfere with
polymerization, hybridization, etc., are preferably masked using
known protecting groups (Greene et al. (1999) supra). In general,
the protecting groups used to mask these reactive groups are
orthogonal to those used in protecting the groups used in the
polymerization steps.
It has been discovered that, under certain circumstances, the type
of chemical reaction may affect the fidelity of the polymerization
process. For example, distance independent chemical reactions (for
example, reactions that occur efficiently when the reactive units
are spaced apart by intervening bases, for example, amine acylation
reactions) may result in the spurious incorporation of the wrong
monomers at a particular position of a polymer chain. In contrast,
by choosing chemical reactions for template mediated syntheses that
are distance dependent (for example, reactions that become
inefficient the further the reactive units are spaced part via
intervening bases, for example, reductive amination reactions), it
is possible control the fidelity of the polymerization process.
Example 9 discusses in detail effect of using distance dependent
chemical reactions to enhance the fidelity of the polymerization
process during template mediated synthesis.
(iii) Functional Group Transformations
Nucleic acid-templated synthesis can be used to effect functional
group transformations that either (i) unmask or (ii) interconvert
functionality used in coupling reactions. By exposing or creating a
reactive group within a sequence-programmed subset of a library,
nucleic acid-templated functional group interconversions permit the
generation of library diversity by sequential unmasking. The
sequential unmasking approach offers the major advantage of
enabling reactants that would normally lack the ability to be
linked to a nucleic acid (for example, simple alkyl halides) to
contribute to library diversity by reacting with a
sequence-specified subset of templates in an intermolecular,
non-templated reaction mode. This advantage significantly increases
the types of structures that can be generated.
One embodiment of the invention involves deprotection or unmasking
of functional groups present in a reactive unit. According to this
embodiment, a nucleic acid-template is associated with a reactive
unit that contains a protected functional group. A transfer unit,
comprising an oligonucleotide complimentary to the template codon
region and a reagent capable of removing the protecting group, is
annealed to the template, and the reagent reacts with the
protecting group, removing it from the reactive unit. To further
functionalize the reactive unit, the exposed functional group then
is subjected to a reagent not linked to a nucleic acid. In some
embodiments, the reactive unit contains two or more protected
functional groups. In still other embodiments, the protecting
groups are orthogonal protecting groups that are sequentially
removed by iterated annealing with reagents linked to transfer
units.
Another embodiment of the invention involves interconversions of
functional groups present on a reactive unit. According to this
embodiment, a transfer unit associated with a reagent that can
catalyze a reaction is annealed to a template bearing the reactive
unit. A reagent not linked to a nucleic acid is added to the
reaction, and the transfer unit reagent catalyzes the reaction
between the unlinked reagent and the reactive unit, yielding a
newly functionalized reactive unit. In some embodiments, the
reactive unit contains two or more functional groups which are
sequentially interconverted by iterative exposure to different
transfer unit-bound reagents.
(iv) Reaction Conditions
Nucleic acid-templated reactions can occur in aqueous or
non-aqueous (i.e., organic) solutions, or a mixture of one or more
aqueous and non-aqueous solutions. In aqueous solutions, reactions
can be performed at pH ranges from about 2 to about 12, or
preferably from about 2 to about 10, or more preferably from about
4 to about 10. The reactions used in DNA-templated chemistry
preferably should not require very basic conditions (e.g.,
pH>12, pH>10) or very acidic conditions (e.g., pH<1,
pH<2, pH<4), because extreme conditions may lead to
degradation or modification of the nucleic acid template and/or
molecule (for example, the polymer, or small molecule) being
synthesized. The aqueous solution can contain one or more inorganic
salts, including, but not limited to, NaCl, Na.sub.2SO.sub.4, KCl,
Mg.sup.+2, Mn.sup.+2, etc., at various concentrations.
Organic solvents suitable for nucleic acid-templated reactions
include, but are not limited to, methylene chloride, chloroform,
dimethylformamide, and organic alcohols, including methanol and
ethanol. To permit quantitative dissolution of reaction components
in organic solvents, quaternized ammonium salts, such as, for
example, long chain tetraalkylammonium salts, can be added (Jost et
al. (1989) NUCLEIC ACIDS RES. 17: 2143; MeI'nikov et al. (1999)
LANGMUIR 15: 1923-1928).
Nucleic acid-templated reactions may require a catalyst, such as,
for example, homogeneous, heterogeneous, phase transfer, and
asymmetric catalysis. In other embodiments, a catalyst is not
required. The presence of additional, accessory reagents not linked
to a nucleic acid are preferred in some embodiments. Useful
accessory reagents can include, for example, oxidizing agents
(e.g., NaIO.sub.4); reducing agents (e.g., NaCNBH.sub.3);
activating reagents (e.g., EDC, NHS, and sulfo-NHS); transition
metals such as nickel (e.g., Ni(NO.sub.3).sub.2), rhodium (e.g.
RhCl.sub.3), ruthenium (e.g. RuCl.sub.3), copper (e.g.
Cu(NO.sub.3).sub.2), cobalt (e.g. CoCl.sub.2), iron (e.g.
Fe(NO.sub.3).sub.3), osmium (e.g. OsO.sub.4), titanium (e.g.
TiCl.sub.4 or titanium tetraisopropoxide), palladium (e.g.
NaPdCl.sub.4), or Ln; transition metal ligands (e.g., phosphines,
amines, and halides); Lewis acids; and Lewis bases.
Reaction conditions preferably are optimized to suit the nature of
the reactive units and oligonucleotides used.
(v) Classes of Chemical Reactions
Known chemical reactions for synthesizing polymers, small
molecules, or other chemical compounds can be used in nucleic
acid-templated reactions. Thus, reactions such as those listed in
March's Advanced Organic Chemistry, Organic Reactions, Organic
Syntheses, organic text books, journals such as Journal of the
American Chemical Society Journal of Organic Chemistry, Tetrahedra,
etc., and Carruther's Some Modern Methods of Organic Chemistry can
be used. The chosen reactions preferably are compatible with
nucleic acids such as DNA or RNA or are compatible with the
modified nucleic acids used as the template.
Reactions useful in nucleic-acid templated chemistry include, for
example, substitution reactions, carbon-carbon bond forming
reactions, elimination reactions, acylation reactions, and addition
reactions. An illustrative but not exhaustive list of aliphatic
nucleophilic substitution reactions useful in the present invention
includes, for example, S.sub.N2 reactions, S.sub.N1 reactions,
S.sub.Ni reactions, allylic rearrangements, nucleophilic
substitution at an aliphatic trigonal carbon, and nucleophilic
substation at a vinylic carbon.
Specific aliphatic nucleophilic substitution reactions with oxygen
nucleophiles include, for example, hydrolysis of alkyl halides,
hydrolysis of gen-dihalides, hydrolysis of 1,1,1-trihalides,
hydrolysis of alkyl esters or inorganic acids, hydrolysis of diazo
ketones, hydrolysis of acetal and enol ethers, hydrolysis of
epoxides, hydrolysis of acyl halides, hydrolysis of anhydrides,
hydrolysis of carboxylic esters, hydrolysis of amides, alkylation
with alkyl halides (Williamson Reaction), epoxide formation,
alkylation with inorganic esters, alkylation with diazo compounds,
dehydration of alcohols, transetherification, alcoholysis of
epoxides, alkylation with onium salts, hydroxylation of silanes,
alcoholysis of acyl halides, alcoholysis of anhydrides,
esterfication of carboxylic acids, alcoholysis of carboxylic esters
(transesterfication), alcoholysis of amides, alkylation of
carboxylic acid salts, cleavage of ether with acetic anhydride,
alkylation of carboxylic acids with diazo compounds, acylation of
caroxylic acids with acyl halides, acylation of carboxylic acids
with carboxylic acids, formation of oxonium salts, preparation of
peroxides and hydroperoxides, preparation of inorganic esters
(e.g., nitrites, nitrates, sulfonates), preparation of alcohols
from amines, and preparation of mixed organic-inorganic
anhydrides.
Specific aliphatic nucleophilic substitution reactions with sulfur
nucleophiles, which tend to be better nucleophiles than their
oxygen analogs, include, for example, attack by SH at an alkyl
carbon to form thiols, attack by S at an alkyl carbon to form
thioethers, attack by SH or SR at an acyl carbon, formation of
disulfides, formation of Bunte salts, alkylation of sulfonic acid
salts, and formation of alkyl thiocyanates.
Aliphatic nucleophilic substitution reactions with nitrogen
nucleophiles include, for example, alkylation of amines,
N-arylation of amines, replacement of a hydroxy by an amino group,
transamination, transamidation, alkylation of amines with diazo
compounds, amination of epoxides, amination of oxetanes, amination
of aziridines, amination of alkanes, formation of isocyanides,
acylation of amines by acyl halides, acylation of amines by
anhydrides, acylation of amines by carboxylic acids, acylation of
amines by carboxylic esters, acylation of amines by amides,
acylation of amines by other acid derivatives, N-alkylation or
N-arylation of amides and imides, N-acylation of amides and imides,
formation of aziridines from epoxides, formation of nitro
compounds, formation of azides, formation of isocyanates and
isothiocyanates, and formation of azoxy compounds.
Aliphatic nucleophilic substitution reactions with halogen
nucleophiles include, for example, attack at an alkyl carbon,
halide exchange, formation of alkyl halides from esters of sulfuric
and sulfonic acids, formation of alkyl halides from alcohols,
formation of alkyl halides from ethers, formation of halohydrins
from epoxides, cleavage of carboxylic esters with lithium iodide,
conversion of diazo ketones to .alpha.-halo ketones, conversion of
amines to halides, conversion of tertiary amines to cyanamides (the
von Braun reaction), formation of acyl halides from carboxylic
acids, and formation of acyl halides from acid derivatives.
Aliphatic nucleophilic substitution reactions using hydrogen as a
nucleophile include, for example, reduction of alkyl halides,
reduction of tosylates, other sulfonates, and similar compounds,
hydrogenolysis of alcohols, hydrogenolysis of esters
(Barton-McCombie reaction), hydrogenolysis of nitriles, replacement
of alkoxyl by hydrogen, reduction of epoxides, reductive cleavage
of carboxylic esters, reduction of a C--N bond, desulfurization,
reduction of acyl halides, reduction of carboxylic acids, esters,
and anhydrides to aldehydes, and reduction of amides to
aldehydes.
Although certain carbon nucleophiles may be too nucleophilic and/or
basic to be used in certain embodiments of the invention, aliphatic
nucleophilic substitution reactions using carbon nucleophiles
include, for example, coupling with silanes, coupling of alkyl
halides (the Wurtz reaction), the reaction of alkyl halides and
sulfonate esters with Group I (I A) and II (II A) organometallic
reagents, reaction of alkyl halides and sulfonate esters with
organocuprates, reaction of alkyl halides and sulfonate esters with
other organometallic reagents, allylic and propargylic coupling
with a halide substrate, coupling of organometallic reagents with
esters of sulfuric and sulfonic acids, sulfoxides, and sulfones,
coupling involving alcohols, coupling of organometallic reagents
with carboxylic esters, coupling of organometallic reagents with
compounds containing an esther linkage, reaction of organometallic
reagents with epoxides, reaction of organometallics with aziridine,
alkylation at a carbon bearing an active hydrogen, alkylation of
ketones, nitriles, and carboxylic esters, alkylation of carboxylic
acid salts, alkylation at a position .alpha. to a heteroatom
(alkylation of 1,3-dithianes), alkylation of dihydro-1,3-oxazine
(the Meyers synthesis of aldehydes, ketones, and carboxylic acids),
alkylation with trialkylboranes, alkylation at an alkynyl carbon,
preparation of nitriles, direct conversion of alkyl halides to
aldehydes and ketones, conversion of alkyl halides, alcohols, or
alkanes to carboxylic acids and their derivatives, the conversion
of acyl halides to ketones with organometallic compounds, the
conversion of anhydrides, carboxylic esters, or amides to ketones
with organometallic compounds, the coupling of acyl halides,
acylation at a carbon bearing an active hydrogen, acylation of
carboxylic esters by carboxylic esters (the Claisen and Dieckmann
condensation), acylation of ketones and nitriles with carboxylic
esters, acylation of carboxylic acid salts, preparation of acyl
cyanides, and preparation of diazo ketones, ketonic
decarboxylation.
Reactions which involve nucleophilic attack at a sulfonyl sulfur
atom may also be used in the present invention and include, for
example, hydrolysis of sulfonic acid derivatives (attack by OH),
formation of sulfonic esters (attack by OR), formation of
sulfonamides (attack by nitrogen), formation of sulfonyl halides
(attack by halides), reduction of sulfonyl chlorides (attack by
hydrogen), and preparation of sulfones (attack by carbon).
Aromatic electrophilic substitution reactions may also be used in
nucleotide-templated chemistry. Hydrogen exchange reactions are
examples of aromatic electrophilic substitution reactions that use
hydrogen as the electrophile. Aromatic electrophilic substitution
reactions which use nitrogen electrophiles include, for example,
nitration and nitro-de-hydrogenation, nitrosation of
nitroso-de-hydrogenation, diazonium coupling, direct introduction
of the diazonium group, and amination or amino-de-hydrogenation.
Reactions of this type with sulfur electrophiles include, for
example, sulfonation, sulfo-de-hydrogenation, halosulfonation,
halosulfo-de-hydrogenation, sulfurization, and sulfonylation.
Reactions using halogen electrophiles include, for example,
halogenation, and halo-de-hydrogenation. Aromatic electrophilic
substitution reactions with carbon electrophiles include, for
example, Friedel-Crafts alkylation, alkylation,
alkyl-de-hydrogenation, Friedel-Crafts arylation (the Scholl
reaction), Friedel-Crafts acylation, formylation with disubstituted
formamides, formylation with zinc cyanide and HCl (the Gatterman
reaction), formylation with chloroform (the Reimer-Tiemann
reaction), other formylations, formyl-de-hydrogenation,
carboxylation with carbonyl halides, carboxylation with carbon
dioxide (the Kolbe-Schmitt reaction), amidation with isocyanates,
N-alkylcarbamoyl-de-hydrogenation, hydroxyalkylation,
hydroxyalkyl-de-hydrogenation, cyclodehydration of aldehydes and
ketones, haloalkylation, halo-de-hydrogenation, aminoalkylation,
amidoalkylation, dialkylaminoalkylation,
dialkylamino-de-hydrogenation, thioalkylation, acylation with
nitriles (the Hoesch reaction), cyanation, and
cyano-de-hydrogenation. Reactions using oxygen electrophiles
include, for example, hydroxylation and
hydroxy-de-hydrogenation.
Rearrangement reactions include, for example, the Fries
rearrangement, migration of a nitro group, migration of a nitroso
group (the Fischer-Hepp Rearrangement), migration of an arylazo
group, migration of a halogen (the Orton rearrangement), migration
of an alkyl group, etc. Other reaction on an aromatic ring include
the reversal of a Friedel-Crafts alkylation, decarboxylation of
aromatic aldehydes, decarboxylation of aromatic acids, the Jacobsen
reaction, deoxygenation, desulfonation, hydro-de-sulfonation,
dehalogenation, hydro-de-halogenation, and hydrolysis of
organometallic compounds.
Aliphatic electrophilic substitution reactions are also useful.
Reactions using the S.sub.E1, S.sub.E2 (front), S.sub.E2 (back),
S.sub.Ei, addition-elimination, and cyclic mechanisms can be used
in the present invention. Reactions of this type with hydrogen as
the leaving group include, for example, hydrogen exchange
(deuterio-de-hydrogenation, deuteriation), migration of a double
bond, and keto-enol tautomerization. Reactions with halogen
electrophiles include, for example, halogenation of aldehydes and
ketones, halogenation of carboxylic acids and acyl halides, and
halogenation of sulfoxides and sulfones. Reactions with nitrogen
electrophiles include, for example, aliphatic diazonium coupling,
nitrosation at a carbon bearing an active hydrogen, direct
formation of diazo compounds, conversion of amides to .alpha.-azido
amides, direct amination at an activated position, and insertion by
nitrenes. Reactions with sulfur or selenium electrophiles include,
for example, sulfenylation, sulfonation, and selenylation of
ketones and carboxylic esters. Reactions with carbon electrophiles
include, for example, acylation at an aliphatic carbon, conversion
of aldehydes to .beta.-keto esters or ketones, cyanation,
cyano-de-hydrogenation, alkylation of alkanes, the Stork enamine
reaction, and insertion by carbenes. Reactions with metal
electrophiles include, for example, metalation with organometallic
compounds, metalation with metals and strong bases, and conversion
of enolates to silyl enol ethers. Aliphatic electrophilic
substitution reactions with metals as leaving groups include, for
example, replacement of metals by hydrogen, reactions between
organometallic reagents and oxygen, reactions between
organometallic reagents and peroxides, oxidation of trialkylboranes
to borates, conversion of Grignard reagents to sulfur compounds,
halo-de-metalation, the conversion of organometallic compounds to
amines, the conversion of organometallic compounds to ketones,
aldehydes, carboxylic esters and amides, cyano-de-metalation,
transmetalation with a metal, transmetalation with a metal halide,
transmetalation with an organometallic compound, reduction of alkyl
halides, metallo-de-halogenation, replacement of a halogen by a
metal from an organometallic compound, decarboxylation of aliphatic
acids, cleavage of alkoxides, replacement of a carboxyl group by an
acyl group, basic cleavage of .beta.-keto esters and
.beta.-diketones, haloform reaction, cleavage of non-enolizable
ketones, the Haller-Bauer reaction, cleavage of alkanes,
decyanation, and hydro-de-cyanation. Electrophlic substitution
reactions at nitrogen include, for example, diazotization,
conversion of hydrazines to azides, N-nitrosation,
N-nitroso-de-hydrogenation, conversion of amines to azo compounds,
N-halogenation, N-halo-de-hydrogenation, reactions of amines with
carbon monoxide, and reactions of amines with carbon dioxide.
Aromatic nucleophilic substitution reactions may also be used in
the present invention. Reactions proceeding via the S.sub.NAr
mechanism, the S.sub.N1 mechanism, the benzyne mechanism, the
S.sub.RN1 mechanism, or other mechanism, for example, can be used.
Aromatic nucleophilic substitution reactions with oxygen
nucleophiles include, for example, hydroxy-de-halogenation, alkali
fusion of sulfonate salts, and replacement of OR or OAr. Reactions
with sulfur nucleophiles include, for example, replacement by SH or
SR. Reactions using nitrogen nucleophiles include, for example,
replacement by NH.sub.2, NHR, or NR.sub.2, and replacement of a
hydroxy group by an amino group. Reactions with halogen
nucleophiles include, for example, the introduction halogens.
Aromatic nucleophilic substitution reactions with hydrogen as the
nucleophile include, for example, reduction of phenols and phenolic
esters and ethers, and reduction of halides and nitro compounds.
Reactions with carbon nucleophiles include, for example, the
Rosenmund-von Braun reaction, coupling of organometallic compounds
with aryl halides, ethers, and carboxylic esters, arylation at a
carbon containing an active hydrogen, conversions of aryl
substrates to carboxylic acids, their derivatives, aldehydes, and
ketones, and the Ullmann reaction. Reactions with hydrogen as the
leaving group include, for example, alkylation, arylation, and
amination of nitrogen heterocycles. Reactions with N.sub.2.sup.+ as
the leaving group include, for example, hydroxy-de-diazoniation,
replacement by sulfur-containing groups, iodo-de-diazoniation, and
the Schiemann reaction. Rearrangement reactions include, for
example, the von Richter rearrangement, the Sommelet-Hauser
rearrangement, rearrangement of aryl hydroxylamines, and the Smiles
rearrangement.
Reactions involving free radicals can also be used, although the
free radical reactions used in nucleotide-templated chemistry
should be carefully chosen to avoid modification or cleavage of the
nucleotide template. With that limitation, free radical
substitution reactions can be used in the present invention.
Particular free radical substitution reactions include, for
example, substitution by halogen, halogenation at an alkyl carbon,
allylic halogenation, benzylic halogenation, halogenation of
aldehydes, hydroxylation at an aliphatic carbon, hydroxylation at
an aromatic carbon, oxidation of aldehydes to carboxylic acids,
formation of cyclic ethers, formation of hydroperoxides, formation
of peroxides, acyloxylation, acyloxy-de-hydrogenation,
chlorosulfonation, nitration of alkanes, direct conversion of
aldehydes to amides, amidation and amination at an alkyl carbon,
simple coupling at a susceptible position, coupling of alkynes,
arylation of aromatic compounds by diazonium salts, arylation of
activated alkenes by diazonium salts (the Meerwein arylation),
arylation and alkylation of alkenes by organopalladium compounds
(the Heck reaction), arylation and alkylation of alkenes by
vinyltin compounds (the Stille reaction), alkylation and arylation
of aromatic compounds by peroxides, photochemical arylation of
aromatic compounds, alkylation, acylation, and carbalkoxylation of
nitrogen heterocycles Particular reactions in which N.sub.2.sup.+
is the leaving group include, for example, replacement of the
diazonium group by hydrogen, replacement of the diazonium group by
chlorine or bromine, nitro-de-diazoniation, replacement of the
diazonium group by sulfur-containing groups, aryl dimerization with
diazonium salts, methylation of diazonium salts, vinylation of
diazonium salts, arylation of diazonium salts, and conversion of
diazonium salts to aldehydes, ketones, or carboxylic acids. Free
radical substitution reactions with metals as leaving groups
include, for example, coupling of Grignard reagents, coupling of
boranes, and coupling of other organometallic reagents. Reaction
with halogen as the leaving group are included. Other free radical
substitution reactions with various leaving groups include, for
example, desulfurization with Raney Nickel, conversion of sulfides
to organolithium compounds, decarboxylative dimerization (the Kolbe
reaction), the Hunsdiecker reaction, decarboxylative allylation,
and decarbonylation of aldehydes and acyl halides.
Reactions involving additions to carbon-carbon multiple bonds are
also used in nucleotide-templated chemistry. Any mechanism may be
used in the addition reaction including, for example, electrophilic
addition, nucleophilic addition, free radical addition, and cyclic
mechanisms. Reactions involving additions to conjugated systems can
also be used. Addition to cyclopropane rings can also be utilized.
Particular reactions include, for example, isomerization, addition
of hydrogen halides, hydration of double bonds, hydration of triple
bonds, addition of alcohols, addition of carboxylic acids, addition
of H.sub.2S and thiols, addition of ammonia and amines, addition of
amides, addition of hydrazoic acid, hydrogenation of double and
triple bonds, other reduction of double and triple bonds, reduction
of the double and triple bonds of conjugated systems, hydrogenation
of aromatic rings, reductive cleavage of cyclopropanes,
hydroboration, other hydrometalations, addition of alkanes,
addition of alkenes and/or alkynes to alkenes and/or alkynes (e.g.,
pi-cation cyclization reactions, hydro-alkenyl-addition), ene
reactions, the Michael reaction, addition of organometallics to
double and triple bonds not conjugated to carbonyls, the addition
of two alkyl groups to an alkyne, 1,4-addition of organometallic
compounds to activated double bonds, addition of boranes to
activated double bonds, addition of tin and mercury hydrides to
activated double bonds, acylation of activated double bonds and of
triple bonds, addition of alcohols, amines, carboxylic esters,
aldehydes, etc., carbonylation of double and triple bonds,
hydrocarboxylation, hydroformylation, addition of aldehydes,
addition of HCN, addition of silanes, radical addition, radical
cyclization, halogenation of double and triple bonds (addition of
halogen, halogen), halolactonization, halolactamization, addition
of hypohalous acids and hypohalites (addition of halogen, oxygen),
addition of sulfur compounds (addition of halogen, sulfur),
addition of halogen and an amino group (addition of halogen,
nitrogen), addition of NOX and NO.sub.2X (addition of halogen,
nitrogen), addition of XN.sub.3 (addition of halogen, nitrogen),
addition of alkyl halides (addition of halogen, carbon), addition
of acyl halides (addition of halogen, carbon), hydroxylation
(addition of oxygen, oxygen) (e.g., asymmetric dihydroxylation
reaction with OsO.sub.4), dihydroxylation of aromatic rings,
epoxidation (addition of oxygen, oxygen) (e.g., Sharpless
asymmetric epoxidation), photooxidation of dienes (addition of
oxygen, oxygen), hydroxysulfenylation (addition of oxygen, sulfur),
oxyamination (addition of oxygen, nitrogen), diamination (addition
of nitrogen, nitrogen), formation of aziridines (addition of
nitrogen), aminosulfenylation (addition of nitrogen, sulfur),
acylacyloxylation and acylamidation (addition of oxygen, carbon or
nitrogen, carbon), 1,3-dipolar addition (addition of oxygen,
nitrogen, carbon), Diels-Alder reaction, heteroatom Diels-Alder
reaction, all carbon 3+2 cycloadditions, dimerization of alkenes,
the addition of carbenes and carbenoids to double and triple bonds,
trimerization and tetramerization of alkynes, and other
cycloaddition reactions.
In addition to reactions involving additions to carbon-carbon
multiple bonds, addition reactions to carbon-hetero multiple bonds
can be used in nucleotide-templated chemistry. Exemplary reactions
include, for example, the addition of water to aldehydes and
ketones (formation of hydrates), hydrolysis of carbon-nitrogen
double bond, hydrolysis of aliphatic nitro compounds, hydrolysis of
nitriles, addition of alcohols and thiols to aldehydes and ketones,
reductive alkylation of alcohols, addition of alcohols to
isocyanates, alcoholysis of nitriles, formation of xanthates,
addition of H.sub.2S and thiols to carbonyl compounds, formation of
bisulfite addition products, addition of amines to aldehydes and
ketones, addition of amides to aldehydes, reductive alkylation of
ammonia or amines, the Mannich reaction, the addition of amines to
isocyanates, addition of ammonia or amines to nitriles, addition of
amines to carbon disulfide and carbon dioxide, addition of
hydrazine derivative to carbonyl compounds, formation of oximes,
conversion of aldehydes to nitriles, formation of gem-dihalides
from aldehydes and ketones, reduction of aldehydes and ketones to
alcohols, reduction of the carbon-nitrogen double bond, reduction
of nitriles to amines, reduction of nitriles to aldehydes, addition
of Grignard reagents and organolithium reagents to aldehydes and
ketones, addition of other organometallics to aldehydes and
ketones, addition of trialkylallylsilanes to aldehydes and ketones,
addition of conjugated alkenes to aldehydes (the Baylis-Hillman
reaction), the Reformatsky reaction, the conversion of carboxylic
acid salts to ketones with organometallic compounds, the addition
of Grignard reagents to acid derivatives, the addition of
organometallic compounds to CO.sub.2 and CS.sub.2, addition of
organometallic compounds to C.dbd.N compounds, addition of carbenes
and diazoalkanes to C.dbd.N compounds, addition of Grignard
reagents to nitriles and isocyanates, the Aldol reaction, Mukaiyama
Aldol and related reactions, Aldol-type reactions between
carboxylic esters or amides and aldehydes or ketones, the
Knoevenagel reaction (e.g., the Nef reaction, the Favorskii
reaction), the Peterson alkenylation reaction, the addition of
active hydrogen compounds to CO.sub.2 and CS.sub.2, the Perkin
reaction, Darzens glycidic ester condensation, the Tollens'
reaction, the Wittig reaction, the Tebbe alkenylation, the Petasis
alkenylation, alternative alkenylations, the Thorpe reaction, the
Thorpe-Ziegler reaction, addition of silanes, formation of
cyanohydrins, addition of HCN to C.dbd.N and C.dbd.N bonds, the
Prins reaction, the benzoin condensation, addition of radicals to
C.dbd.O, C.dbd.S, C.dbd.N compounds, the Ritter reaction, acylation
of aldehydes and ketones, addition of aldehydes to aldehydes, the
addition of isocyanates to isocyanates (formation of
carbodiimides), the conversion of carboxylic acid salts to
nitriles, the formation of epoxides from aldehydes and ketones, the
formation of episulfides and episulfones, the formation of
.beta.-lactones and oxetanes (e.g., the Paterno-Buchi reaction),
the formation of .beta.-lactams, etc. Reactions involving addition
to isocyanides include the addition of water to isocyanides, the
Passerini reaction, the Ug reaction, and the formation of metalated
aldimines.
Elimination reactions, including .alpha., .beta., and .gamma.
eliminations, as well as extrusion reactions, can be performed
using nucleotide-templated chemistry, although the strength of the
reagents and conditions employed should be considered. Preferred
elimination reactions include reactions that go by E1, E2, E1cB, or
E2C mechanisms. Exemplary reactions include, for example, reactions
in which hydrogen is removed from one side (e.g., dehydration of
alcohols, cleavage of ethers to alkenes, the Chugaev reaction,
ester decomposition, cleavage of quarternary ammonium hydroxides,
cleavage of quaternary ammonium salts with strong bases, cleavage
of amine oxides, pyrolysis of keto-ylids, decomposition of
toluene-p-solfonylhydrazones, cleavage of sulfoxides, cleavage of
selenoxides, cleavage of sulfornes, dehydrogalogenation of alkyl
halides, dehydrohalogenation of acyl halides, dehydrohalogenation
of sulfonyl halides, elimination of boranes, conversion of alkenes
to alkynes, decarbonylation of acyl halides), reactions in which
neither leaving atom is hydrogen (e.g., deoxygenation of vicinal
diols, cleavage of cyclic thionocarbonates, conversion of epoxides
to episulfides and alkenes, the Ramberg-Backlund reaction,
conversion of aziridines to alkenes, dehalogenation of vicinal
dihalides, dehalogenation of .alpha.-halo acyl halides, and
elimination of a halogen and a hetero group), fragmentation
reactions (i.e., reactions in which carbon is the positive leaving
group or the electrofuge, such as, for example, fragmentation of
.gamma.-amino and .gamma.-hydroxy halides, fragmentation of
1,3-diols, decarboxylation of .beta.-hydroxy carboxylic acids,
decarboxylation of .beta.-lactones, fragmentation of
.alpha.,.beta.-epoxy hydrazones, elimination of CO from bridged
bicyclic compounds, and elimination of CO.sub.2 from bridged
bicyclic compounds), reactions in which C.ident.N or C.dbd.N bonds
are formed (e.g., dehydration of aldoximes or similar compounds,
conversion of ketoximes to nitriles, dehydration of unsubstituted
amides, and conversion of N-alkylformamides to isocyanides),
reactions in which C.dbd.O bonds are formed (e.g., pyrolysis of
.beta.-hydroxy alkenes), and reactions in which N.dbd.N bonds are
formed (e.g., eliminations to give diazoalkenes). Extrusion
reactions include, for example, extrusion of N.sub.2 from
pyrazolines, extrusion of N.sub.2 from pyrazoles, extrusion of
N.sub.2 from triazolines, extrusion of CO, extrusion of CO.sub.2,
extrusion of SO.sub.2, the Story synthesis, and alkene synthesis by
twofold extrusion.
Rearrangements, including, for example, nucleophilic
rearrangements, electrophilic rearrangements, prototropic
rearrangements, and free-radical rearrangements, can also be
performed using nucleotide-templated chemistry. Both 1,2
rearrangements and non-1,2 rearrangements can be performed.
Exemplary reactions include, for example, carbon-to-carbon
migrations of R, H, and Ar (e.g., Wagner-Meerwein and related
reactins, the Pinacol rearrangement, ring expansion reactions, ring
contraction reactions, acid-catalyzed rearrangements of aldehydes
and ketones, the dienone-phenol rearrangement, the Favorskii
rearrangement, the Arndt-Eistert synthesis, homologation of
aldehydes, and homologation of ketones), carbon-to-carbon
migrations of other groups (e.g., migrations of halogen, hydroxyl,
amino, etc.; migration of boron; and the Neber rearrangement),
carbon-to-nitrogen migrations of R and Ar (e.g., the Hofmann
rearrangement, the Curtius rearrangement, the Lossen rearrangement,
the Schmidt reaction, the Beckman rearrangement, the Stieglits
rearrangement, and related rearrangements), carbon-to-oxygen
migrations of R and Ar (e.g., the Baeyer-Villiger rearrangement and
rearrangement of hydroperoxides), nitrogen-to-carbon,
oxygen-to-carbon, and sulfur-to-carbon migration (e.g., the Stevens
rearrangement, and the Wittig rearrangement), boron-to-carbon
migrations (e.g., conversion of boranes to alcohols (primary or
otherwise), conversion of boranes to aldehydes, conversion of
boranes to carboxylic acids, conversion of vinylic boranes to
alkenes, formation of alkynes from boranes and acetylides,
formation of alkenes from boranes and acetylides, and formation of
ketones from boranes and acetylides), electrocyclic rearrangements
(e.g., of cyclobutenes and 1,3-cyclohexadienes, or conversion of
stilbenes to phenanthrenes), sigmatropic rearrangements (e.g.,
(l,j) sigmatropic migrations of hydrogen, (l,j) sigmatropic
migrations of carbon, conversion of vinylcyclopropanes to
cyclopentenes, the Cope rearrangement, the Claisen rearrangement,
the Fischer indole synthesis, (2,3) sigmatropic rearrangements, and
the benzidine rearrangement), other cyclic rearrangements (e.g.,
metathesis of alkenes, the di-.pi.-methane and related
rearrangements, and the Hofmann-Loffler and related reactions), and
non-cyclic rearrangements (e.g., hydride shifts, the Chapman
rearrangement, the Wallach rearrangement, and dyotropic
rearrangements).
Oxidative and reductive reactions may also be performed using
nucleotide-templated chemistry. Exemplary reactions may involve,
for example, direct electron transfer, hydride transfer,
hydrogen-atom transfer, formation of ester intermediates,
displacement mechanisms, or addition-elimination mechanisms.
Exemplary oxidations include, for example, eliminations of hydrogen
(e.g., aromatization of six-membered rings, dehydrogenations
yielding carbon-carbon double bonds, oxidation or dehydrogenation
of alcohols to aldehydes and ketones, oxidation of phenols and
aromatic amines to quinones, oxidative cleavage of ketones,
oxidative cleavage of aldehydes, oxidative cleavage of alcohols,
ozonolysis, oxidative cleavage of double bonds and aromatic rings,
oxidation of aromatic side chains, oxidative decarboxylation, and
bisdecarboxylation), reactions involving replacement of hydrogen by
oxygen (e.g., oxidation of methylene to carbonyl, oxidation of
methylene to OH, CO.sub.2R, or OR, oxidation of arylmethanes,
oxidation of ethers to carboxylic esters and related reactions,
oxidation of aromatic hydrocarbons to quinones, oxidation of amines
or nitro compounds to aldehydes, ketones, or dihalides, oxidation
of primary alcohols to carboxylic acids or carboxylic esters,
oxidation of alkenes to aldehydes or ketones, oxidation of amines
to nitroso compounds and hydroxylamines, oxidation of primary
amines, oximes, azides, isocyanates, or notroso compounds, to nitro
compounds, oxidation of thiols and other sulfur compounds to
sulfonic acids), reactions in which oxygen is added to the
substrate (e.g., oxidation of alkynes to .alpha.-diketones,
oxidation of tertiary amines to amine oxides, oxidation of
thioesters to sulfoxides and sulfones, and oxidation of carboxylic
acids to peroxy acids), and oxidative coupling reactions (e.g.,
coupling involving carbanoins, dimerization of silyl enol ethers or
of lithium enolates, and oxidation of thiols to disulfides).
Exemplary reductive reactions include, for example, reactions
involving replacement of oxygen by hydrogen (e.g., reduction of
carbonyl to methylene in aldehydes and ketones, reduction of
carboxylic acids to alcohols, reduction of amides to amines,
reduction of carboxylic esters to ethers, reduction of cyclic
anhydrides to lactones and acid derivatives to alcohols, reduction
of carboxylic esters to alcohols, reduction of carboxylic acids and
esters to alkanes, complete reduction of epoxides, reduction of
nitro compounds to amines, reduction of nitro compounds to
hydroxylamines, reduction of nitroso compounds and hydroxylamines
to amines, reduction of oximes to primary amines or aziridines,
reduction of azides to primary amines, reduction of nitrogen
compounds, and reduction of sulfonyl halides and sulfonic acids to
thiols), removal of oxygen from the substrate (e.g., reduction of
amine oxides and azoxy compounds, reduction of sulfoxides and
sulfones, reduction of hydroperoxides and peroxides, and reduction
of aliphatic nitro compounds to oximes or nitriles), reductions
that include cleavage (e.g., de-alkylation of amines and amides,
reduction of azo, azoxy, and hydrazo compounds to amines, and
reduction of disulfides to thiols), reductive couplic reactions
(e.g., bimolecular reduction of aldehydes and ketones to 1,2-diols,
bimolecular reduction of aldehydes or ketones to alkenes, acyloin
ester condensation, reduction of nitro to azoxy compounds, and
reduction of nitro to azo compounds), and reductions in which an
organic substrate is both oxidized and reduced (e.g., the
Cannizzaro reaction, the Tishchenko reaction, the Pummerer
rearrangement, and the Willgerodt reaction).
(vi) Stereoselectivity
The chiral nature of nucleic acids raises the possibility that
nucleic acid-templated synthesis can proceed stereoselectively
without the assistance of chiral groups beyond those present in the
nucleic acid, thereby transferring not only sequence but also
stereochemical information from the template to the product.
Previous studies have demonstrated that the chirality of nucleic
acid templates can induce a preference for the template-directed
ligation of (D)-nucleotides over (L)-nucleotides (Kozlov et al.
(2000) ANGEW. CHEM. INT. ED. 39: 4292-4295; Bolli et al. (1997) A.
CHEM. BIOL. 4: 309-320).
During nucleic acid-templated synthesis it is possible to transfer
the chirality of a nucleic acid template transfer unit, catalyst or
a combination of the foregoing to reaction products that do not
resemble the nucleic acid backbone. In some embodiments, the
reactive unit with a chiral center is associated with the template
and the reactive unit associated with the transfer unit is achiral,
while in other embodiments, the transfer unit's reactive unit is
chiral and the template's reactive unit is achiral. Alternatively,
both reactive units can possess chiral centers. In each of these
cases, the chirality of the template directs which of the chiral
reactive unit's stereoisomers reacts preferentially (i.e., with a
higher rate constant) with the other reactive unit.
Useful template architectures include the H type, E type, .OMEGA.
type and T type architecture. One or more template or transfer unit
nucleotides may be replaced with non-nucleotide linkers, however,
replacement of the nucleotides nearest the reactive units may
result in loss of stereoselectivity. Preferably, 5 or more
consecutive aromatic nucleotides are adjacent to the reactive
units, and more preferably 6 or more consecutive aromatic
nucleotides are adjacent to the reactive units.
At high salt concentrations, double-stranded DNA sequences rich in
(5-Me-C)G repeats can adopt a left-handed helix (Z-form) rather
than the usual right-handed helix (B-form). During DNA-templated
synthesis, template-transfer unit complexes in the Z-form cause
preferential reaction with one stereoisomer of a reactive unit,
while template-transfer unit complexes in the B-form cause
preferential reaction with the other stereoisomer of a reactive
unit. Therefore, in some embodiments, a high concentration (e.g.,
at least 2.5 M, or at least 5 M) of a salt, such as, for example,
sodium chloride (NaCl) or sodium sulfate (Na.sub.2SO.sub.4) is used
during DNA-templated synthesis. In other embodiments, the
concentration of salt is low (e.g., not greater than 100 mM) or is
not present at all. The principles of DNA-templated stereospecific
reactions are discussed in more detail in Example 6.
(vii) Otherwise Incompatible Reactions
It has been discovered that during nucleic acid-templated
synthesis, oligonucleotides can simultaneously direct several
different types of synthetic reactions within the same solution,
even though the reactants involved would be cross-reactive and
therefore incompatible under traditional synthesis conditions (see,
Example 7). As a result, nucleic acid-templated synthesis permits
one-pot diversification of synthetic library precursors into
products of multiple reaction types.
In one embodiment, one or more templates associated with a single
reactive unit are exposed to two or more transfer units, each
associated with a different reagent that is capable of reacting
with the templates reactive unit. In other embodiments, one or more
transfer units associated with a single reagent are exposed to two
or more templates, each associated with a different reactive unit
that is capable of reacting with the reagent. Under the conditions
of nucleic acid-templated synthesis, it is possible to have in a
single solution multiple reactive units (attached to the template
and/or the transfer units) that in normal synthetic reactions would
cross react with one another. The nucleic acid-templated
chemistries described herein use very low concentrations of
reactants that because of concentration effects do not react with
one another. It is only when the reactants are brought together via
annealing of the oligonucleotide in the transfer unit to the
template that their local concentrations are increased to permit a
reaction occur. In some embodiments, a single accessory reagent
(i.e., a reagent not linked to a nucleic acid or nucleic acid
analog), such as, for example, a reducing agent, an oxidizing
agent, or an activating agent, is added to the reaction. In other
embodiments, no accessory reagent is added. In all cases, only the
reactive units and reagents that are associated with complimentary
oligonucleotides (i.e., that contain complimentary codon/anti-codon
sequences) react to form a reaction product, demonstrating the
ability of nucleic acid-templated synthesis to direct the selective
one-pot transformation of a single functional group into multiple
distinct types of products.
In another embodiment, templates and transfer units are provided as
described above, but the template reactive units and transfer unit
reagents react with one another using multiple different reaction
types. In some embodiments, multiple different accessory reagents
are added to the reaction. Again, only reaction products resulting
from complimentary template/transfer unit sequences are formed in
appreciable amounts.
In certain embodiments, multiple transfer unit reagents are capable
of reacting with each template reactive unit, and some of the
transfer unit reagents can cross react with one another. Even in
the presence of several different cross-reactive functional groups,
only reaction products resulting from complimentary
template/transfer unit sequences are formed in appreciable amounts.
These findings indicate that reactions of significantly different
rates requiring a variety of accessory reagents can be directed by
nucleic acid-templated synthesis in the same solution, even when
both templates and reagents contain several different
cross-reactive functional groups. The ability of nucleic acid
templates to direct multiple reactions at concentrations that
exclude non-templated reactions from proceeding at appreciable
rates mimics, in a single solution, a spatially separated set of
reactions.
(viii) Identification of New Chemical Reactions
In another aspect of the invention, as illustrated in FIG. 12,
nucleic acid-templated synthesis can be used to discover previously
unknown chemical reactions between two or more reactive units. To
facilitate reaction discovery, multiple templates are synthesized,
each comprising a different reactive unit coupled to a different
oligonucleotide. Each template oligonucleotide contains a coding
region, which identifies the reactive unit attached to the
template, and an annealing region. In some embodiments, other
sequences are included in the template oligonucleotide, including,
for example, PCR primer sites. Multiple transfer units are also
prepared, each comprising a different reagent coupled to a
different oligonucleotide.
To test for new bond-forming reactions, one or more templates are
combined with one or more transfer units under conditions that
allow for hybridization of the transfer units to the templates. In
some embodiments, non-DNA linked accessory molecules are added to
the reaction, such as, for example, an activating agent or a
catalyst. In other embodiments, reaction conditions, including, for
example, reaction duration, temperature, solvent, and pH, are
varied to select reactions that proceed at different rates and
under different conditions.
The crude reaction mixture then is selected for particular reaction
products. The reaction products preferably still are associated
with their respective templates whose nucleotide sequence encodes
the bond forming reactions that produced the reaction products. In
some embodiments, the transfer unit is coupled to a capturable
molecule, such as, for example, biotin. Following creation and
selection of the reaction products the associated templates can be
selected by capturing the biotin by streptavidin. In one
embodiment, the streptavidin is immobilized to a solid support, for
example, by linkage to a magnetic bead. The selected templates then
are amplified by PCR and subjected to DNA sequencing to determine
the identities of the reactive unit and the reagent. In another
embodiment, the reactions revealed by the above approach are
characterized in a non-DNA-templated format in both aqueous and
organic solvents using traditional reaction analysis methods
including, for example, thin-layer chromatography, NMR, HPLC, and
mass spectroscopy.
It is theoretically possible that some of the reactions discovered
will require some aspect of the DNA template to proceed
efficiently. However, the vast majority, if not all, of the
reactions discovered in this system will take place in the absence
of DNA template when performed at typical non-DNA-templated
synthesis concentrations (e.g., about 0.1 M). Reactions discovered
in this manner also are naturally well-suited for DNA-templated
small molecule library synthesis. An illustrative example of this
embodiment appears in Example 12, describing the discovery of a new
palladium-mediated coupling reaction between a terminal alkyne and
a simple alkene.
(ix) Preparing Product Libraries
A major practical difference between traditional and nucleic
acid-templated library synthesis is the scale of each manipulation.
Due to the amounts of material needed for screening and compound
identification, traditional combinatorial syntheses typically
proceed on the nmol-.mu.mol scale per library member. In contrast,
nucleic acid-templated library synthesis can take place on the
fmol-pmol scale because only minute quantities (e.g., about
10.sup.-20 mol) of each nucleic acid-linked synthetic molecule are
needed for selection and PCR amplification. This vast difference in
scale, combined with the single-solution format of the nucleic
acid-templated libraries, simplifies significantly the preparation
of materials required for nucleic acid-templated library
syntheses.
Libraries can be produced via the template mediated syntheses
described herein. For example, the template may comprise one or
more reactive units (for example, scaffold molecules). However, in
each case the template contains a coding sequence that identifies
the particular reactive unit associated with the oligonucleotide. A
library of templates is initially subjected to one or more nucleic
acid-templated bond formation reactions using reagents attached to
decoding oligonucleotides through a linker as described above.
Depending upon the circumstances, the template library can be
subjected to multiple iterations of bond formation reactions,
wherein each intermediate product is purified before the subsequent
round of reactions. In other circumstances, the intermediate
products are not purified between reaction iterations. Preferably
less than 20 bond forming reactions are required to create a
library. In other embodiments, less than 10 bond forming reaction
steps are needed, and more preferably, between 3 and 7 steps are
needed to create a full library.
After the final round of nucleic acid-templated bond formation
reactions has been performed accessory reagents can be added to
protect exposed reactive functional groups on the reaction product,
if necessary. In some embodiments, accessory reagents are added to
initiate a subsequent reaction with the reaction product, such as,
for example, a cyclization reaction. The resulting library of
reaction products attached to template oligonucleotides then are
purified and/or selected as discussed herein. As would be
appreciated by one skilled in this art, libraries of small
molecules or polymers can be synthesized using the principles
discussed herein.
Using similar approaches, it is possible to create a library of
non-natural polymers from a library of template oligonucleotides
that are not initially associated with a reactive unit. In this
case, the template encodes two or more codons which when annealed
to corresponding anti-codons attached to monomer units bring
together the monomer units in a sequence specific manner. The
transfer units then are allowed to contact the template under
conditions that permit hybridization of the anti-codons on each
transfer unit to the complementary codon on the template.
Polymerization of the monomer units along the template then
produces the polymer. The polymerization may be step-by step or may
be essentially simultaneous with the chain being formed in one
large reaction with one reaction between adjacent monomers leading
to the attachment of the next monomer. In some embodiments, the
functional group or groups of each monomer are protected, and must
be deprotected prior to polymerization. The newly synthesized
polymer can then be cleaved from the anti-codons and the template,
and selected for a desired activity or characteristic, as described
herein. DNA-templated polymer synthesis reactions are described in
more detail in Example 9A and 9C.
IV. Selection and Screening
Selection and/or screening for reaction products with desired
activities (such as catalytic activity, binding affinity, or a
particular effect in an activity assay) may be performed according
to any standard protocol. For example, affinity selections may be
performed according to the principles used in library-based
selection methods such as phage display, polysome display, and
mRNA-fusion protein displayed peptides. Selection for catalytic
activity may be performed by affinity selections on
transition-state analog affinity columns (Baca et al. (1997) PROC.
NATL. ACAD. SCI. USA 94(19): 10063-8) or by function-based
selection schemes (Pedersen et al. (1998) PROC. NATL. ACAD. SCI.
USA 95(18): 10523-8). Since minute quantities of DNA
(.about.10.sup.-20 mol) can be amplified by PCR (Kramer et al.
(1999) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (ed. Ausubel, F. M.)
15.1-15.3, Wiley), these selections can be conducted on a scale ten
or more orders of magnitude less than that required for reaction
analysis by current methods, making a truly broad search both
economical and efficient.
(i) Selection for Binding to Target Molecule
The templates and reaction products can be selected (or screened)
for binding to a target molecule. In this context, selection or
partitioning means any process whereby a library member bound to a
target molecule is separated from library members not bound to
target molecules. Selection can be accomplished by various methods
known in the art.
The templates of the present invention contain a built-in function
for direct selection and amplification. In most applications,
binding to a target molecule preferably is selective, such that the
template and the resulting reaction product bind preferentially
with a specific target molecule, perhaps preventing or inducing a
specific biological effect. Ultimately, a binding molecule
identified using the present invention may be useful as a
therapeutic and/or diagnostic agent. Once the selection is
complete, the selected templates optionally can be amplified and
sequenced. The selected reaction products, if present in sufficient
quantity, can be separated from the templates, purified (e.g., by
HPLC, column chromatography, or other chromatographic method), and
further characterized.
(it) Target Molecules
Binding assays provide a rapid means for isolating and identifying
reaction products that bind to, for example, a surface (such as
metal, plastic, composite, glass, ceramics, rubber, skin, or
tissue); a polymer; a catalyst; or a target biomolecule such as a
nucleic acid, a protein (including enzymes, receptors, antibodies,
and glycoproteins), a signal molecule (such as cAMP, inositol
triphosphate, peptides, or prostaglandins), a carbohydrate, or a
lipid. Binding assays can be advantageously combined with activity
assays for the effect of a reaction product on a function of a
target molecule.
The selection strategy can be carried out to allow selection
against almost any target. Importantly, the selection strategy does
not require any detailed structural information about the target
molecule or about the molecules in the libraries. The entire
process is driven by the binding affinity involved in the specific
recognition and binding of the molecules in the library to a given
target. Examples of various selection procedures are described
below.
The libraries of the present invention can contain molecules that
could potentially bind to any known or unknown target. The binding
region of a target molecule could include a catalytic site of an
enzyme, a binding pocket on a receptor (for example, a G-protein
coupled receptor), a protein surface area involved in a
protein-protein or protein-nucleic acid interaction (preferably a
hot-spot region), or a specific site on DNA (such as the major
groove). The natural function of the target could be stimulated
(agonized), reduced (antagonized), unaffected, or completely
changed by the binding of the reaction product. This will depend on
the precise binding mode and the particular binding site the
reaction product occupies on the target.
Functional sites (such as protein-protein interaction or catalytic
sites) on proteins often are more prone to bind molecules than are
other more neutral surface areas on a protein. In addition, these
functional sites normally contain a smaller region that seems to be
primarily responsible for the binding energy: the so-called
"hot-spot regions" (Wells, et al., (1993) RECENT PROG. HORMONE RES.
48: 253-262). This phenomenon facilitates selection for molecules
affecting the biological function of a certain target.
The linkage between the template molecule and reaction product
allows rapid identification of binding molecules using various
selection strategies. This invention broadly permits identifying
binding molecules for any known target molecule. In addition, novel
unknown targets can be discovered by isolating binding molecules
against unknown antigens (epitopes) and using these binding
molecules for identification and validation. In another preferred
embodiment, the target molecule is designed to mimic a transition
state of a chemical reaction; one or more reaction products
resulting from the selection may stabilize the transition state and
catalyze the chemical reaction.
(iii) Binding Assays
The template-directed synthesis of the invention permits selection
procedures analogous to other display methods such as phage display
(Smith (1985) SCIENCE 228: 1315-1317). Phage display selection has
been used successfully on peptides (Wells et al. (1992) CURR. OP.
STRUCT. BIOL. 2: 597-604), proteins (Marks et al. (1992) J. BIOL.
CHEM. 267: 16007-16010) and antibodies (Winter et al. (1994) ANNU.
REV. IMMUNOL. 12: 433-455). Similar selection procedures also are
exploited for other types of display systems such as ribosome
display Mattheakis et al. (1994) PROC. NATL. ACAD. SCI. 91:
9022-9026) and mRNA display (Roberts, et al. (1997) PROC. NATL.
ACAD. SCI. 94:12297-302). The libraries of the present invention,
however, allow direct selection of target-specific molecules
without requiring traditional ribosome-mediated translation. The
present invention also allows the display of small molecules which
have not previously been synthesized directly from a nucleic acid
template.
Selection of binding molecules from a library can be performed in
any format to identify optimal binding molecules. Binding
selections typically involve immobilizing the desired target
molecule, adding a library of potential binders, and removing
non-binders by washing. When the molecules showing low affinity for
an immobilized target are washed away, the molecules with a
stronger affinity generally remain attached to the target. The
enriched population remaining bound to the target after stringent
washing is preferably eluted with, for example, acid, chaotropic
salts, heat, competitive elution with a known ligand or by
proteolytic release of the target and/or of template molecules. The
eluted templates are suitable for PCR, leading to many orders of
amplification, whereby essentially each selected template becomes
available at a greatly increased copy number for cloning,
sequencing, and/or further enrichment or diversification.
In a binding assay, when the concentration of ligand is much less
than that of the target (as it would be during the selection of a
DNA-templated library), the fraction of ligand bound to target is
determined by the effective concentration of the target protein
(see, FIG. 10). The fraction of ligand bound to target is a
sigmoidal function of the concentration of target, with the
midpoint (50% bound) at [target]=K.sub.d of the ligand-target
complex. This relationship indicates that the stringency of a
specific selection--the minimum ligand affinity required to remain
bound to the target during the selection--is determined by the
target concentration. Therefore, selection stringency is
controllable by varying the effective concentration of target.
The target molecule (peptide, protein, DNA or other antigen) can be
immobilized on a solid support, for example, a container wall, a
wall of a microtiter plate well. The library preferably is
dissolved in aqueous binding buffer in one pot and equilibrated in
the presence of immobilized target molecule. Non-binders are washed
away with buffer. Those molecules that may be binding to the target
molecule through their attached DNA templates rather than through
their synthetic moieties can be eliminated by washing the bound
library with unfunctionalized templates lacking PCR primer binding
sites. Remaining bound library members then can be eluted, for
example, by denaturation.
Alternatively, the target molecule can be immobilized on beads,
particularly if there is doubt that the target molecule will adsorb
sufficiently to a container wall, as may be the case for an
unfolded target eluted from an SDS-PAGE gel. The derivatized beads
can then be used to separate high-affinity library members from
nonbinders by simply sedimenting the beads in a benchtop
centrifuge. Alternatively, the beads can be used to make an
affinity column. In such cases, the library is passed through the
column one or more times to permit binding. The column then is
washed to remove nonbinding library members. Magnetic beads are
essentially a variant on the above; the target is attached to
magnetic beads which are then used in the selection.
There are many reactive matrices available for immobilizing the
target molecule, including matrices bearing --NH.sub.2 groups or
--SH groups. The target molecule can be immobilized by conjugation
with NHS ester or maleimide groups covalently linked to Sepharose
beads and the integrity of known properties of the target molecule
can be verified. Activated beads are available with attachment
sites for --NH.sub.2 or --COOH groups (which can be used for
coupling). Alternatively, the target molecule is blotted onto
nitrocellulose or PVDF. When using a blotting strategy, the blot
should be blocked (e.g., with BSA or similar protein) after
immobilization of the target to prevent nonspecific binding of
library members to the blot.
Library members that bind a target molecule can be released by
denaturation, acid, or chaotropic salts. Alternatively, elution
conditions can be more specific to reduce background or to select
for a desired specificity. Elution can be accomplished using
proteolysis to cleave a linker between the target molecule and the
immobilizing surface or between the reaction product and the
template. Also, elution can be accomplished by competition with a
known competitive ligand for the target molecule. Alternatively, a
PCR reaction can be performed directly in the presence of the
washed target molecules at the end of the selection procedure.
Thus, the binding molecules need not be elutable from the target to
be selectable since only the template is needed for further
amplification or cloning, not the reaction product itself. Indeed,
some target molecules bind the most avid ligands so tightly that
elution would be difficult.
To select for a molecule that binds a protein expressible on a cell
surface, such as an ion channel or a transmembrane receptor, the
cells themselves can be used as the selection agent. The library
preferably is first exposed to cells not expressing the target
molecule on their surfaces to remove library members that bind
specifically or non specifically to other cell surface epitopes.
Alternatively, cells lacking the target molecule are present in
large excess in the selection process and separable (by
fluorescence-activated cell sorting (FACS), for example) from cells
bearing the target molecule. In either method, cells bearing the
target molecule then are used to isolate library members bearing
the target molecule (e.g., by sedimenting the cells or by FACS
sorting). For example, a recombinant DNA encoding the target
molecule can be introduced into a cell line; library members that
bind the transformed cells but not the untransformed cells are
enriched for target molecule binders. This approach is also called
subtraction selection and has successfully been used for phage
display on antibody libraries (Hoogenboom et al. (1998) IMMUNOTECH
4: 1-20).
A selection procedure can also involve selection for binding to
cell surface receptors that are internalized so that the receptor
together with the selected binding molecule passes into the
cytoplasm, nucleus, or other cellular compartment, such as the
Golgi or lysosomes. Depending on the dissociation rate constant for
specific selected binding molecules, these molecules may localize
primarily within the intracellular compartments. Internalized
library members can be distinguished from molecules attached to the
cell surface by washing the cells, preferably with a denaturant.
More preferably, standard subcellular fractionation techniques are
used to isolate the selected library members in a desired
subcellular compartment.
An alternative selection protocol also includes a known, weak
ligand affixed to each member of the library. The known ligand
guides the selection by interacting with a defined part of the
target molecule and focuses the selection on molecules that bind to
the same region, providing a cooperative effect. This can be
particularly useful for increasing the affinity of a ligand with a
desired biological function but with too low a potency.
Other methods for selection or partitioning are also available for
use with the present invention. These include, for example:
immunoprecipitation (direct or indirect) where the target molecule
is captured together with library members; mobility shift assays in
agarose or polyacrylamide gels, where the selected library members
migrate with the target molecule in a gel; cesium chloride gradient
centrifugation to isolate the target molecule with library members;
mass spectroscopy to identify target molecules labeled with library
members. In general, any method where the library member/target
molecule complex can be separated from library members not bound to
the target is useful.
The selection process is well suited for optimizations, where the
selection steps are made in series, starting with the selection of
binding molecules and ending with an optimized binding molecule.
The procedures in each step can be automated using various robotic
systems. Thus, the invention permits supplying a suitable library
and target molecule to a fully automatic system which finally
generates an optimized binding molecule. Under ideal conditions,
this process should run without any requirement for external work
outside the robotic system during the entire procedure.
The selection methods of the present invention can be combined with
secondary selection or screening to identify reaction products
capable of modifying target molecule function upon binding. Thus,
the methods described herein can be employed to isolate or produce
binding molecules that bind to and modify the function of any
protein or nucleic acid. For example, nucleic acid-templated
chemistry can be used to identify, isolate, or produce binding
molecules (1) affecting catalytic activity of target enzymes by
inhibiting catalysis or modifying substrate binding; (2) affecting
the functionality of protein receptors, by inhibiting binding to
receptors or by modifying the specificity of binding to receptors;
(3) affecting the formation of protein multimers by disrupting the
quaternary structure of protein subunits; or (4) modifying
transport properties of a protein by disrupting transport of small
molecules or ions.
Functional assays can be included in the selection process. For
example, after selecting for binding activity, selected library
members can be directly tested for a desired functional effect,
such as an effect on cell signaling. This can, for example, be
performed via FACS methodologies.
The binding molecules of the invention can be selected for other
properties in addition to binding. For example, to select for
stability of binding interactions in a desired working environment.
If stability in the presence of a certain protease is desired, that
protease can be part of the buffer medium used during selection.
Similarly, the selection can be performed in serum or cell extracts
or in any type of medium, aqueous or organic. Conditions that
disrupt or degrade the template should however be avoided to allow
subsequent amplification.
(iv) Other Selections
Selections for other desired properties, such as catalytic or other
functional activities, can also be performed. Generally, the
selection should be designed such that library members with the
desired activity are isolatable on that basis from other library
members. For example, library members can be screened for the
ability to fold or otherwise significantly change conformation in
the presence of a target molecule, such as a metal ion, or under
particular pH or salinity conditions. The folded library members
can be isolated by performing non-denaturing gel electrophoresis
under the conditions of interest. The folded library members
migrate to a different position in the gel and can subsequently be
extracted from the gel and isolated.
Similarly, reaction products that fluoresce in the presence of
specific ligands may be selected by FACS based sorting of
translated polymers linked through their DNA templates to beads.
Those beads that fluoresce in the presence, but not in the absence,
of the target ligand are isolated and characterized. Useful beads
with a homogenous population of nucleic acid-templates on any bead
can be prepared using the split-pool synthesis technique on the
bead, such that each bead is exposed to only a single nucleotide
sequence. Alternatively, a different anti-template (each
complementary to only a single, different template) can by
synthesized on beads using a split-pool technique, and then can
anneal to capture a solution-phase library.
Biotin-terminated biopolymers can be selected for the actual
catalysis of bond-breaking reactions by passing these biopolymers
over a resin linked through a substrate to avidin (FIG. 11A). Those
biopolymers that catalyze substrate cleavage self-elute from a
column charged with this resin. Similarly, biotin-terminated
biopolymers can be selected for the catalysis of bond-forming
reactions (see, FIG. 11B). One substrate is linked to resin and the
second substrate is linked to avidin. Biopolymers that catalyze
bond formation between the substrates are selected by their ability
to react the substrates together, resulting in attachment of the
biopolymer to the resin.
Library members can also be selected for their catalytic effects on
synthesis of a polymer to which the template is or becomes
attached. For example, the library member may influence the
selection of monomer units to be polymerized as well as how the
polymerization reaction takes place (e.g., stereochemistry,
tacticity, activity). The synthesized polymers can be selected for
specific properties, such as, molecular weight, density,
hydrophobicity, tacticity, stereoselectivity, using standard
techniques, such as, electrophoresis, gel filtration, centrifugal
sedimentation, or partitioning into solvents of different
hydrophobicities. The attached template that directed the synthesis
of the polymer can then be identified.
Library members that catalyze virtually any reaction causing bond
formation between two substrate molecules or resulting in bond
breakage into two product molecules can be selected using the
schemes proposed in FIGS. 12 and 13. To select for bond forming
catalysts (for example, hetero Diels-Alder, Heck coupling, aldol
reaction, or olefin metathesis catalysts), library members are
covalently linked to one substrate through their 5' amino or thiol
termini. The other substrate of the reaction is synthesized as a
derivative linked to biotin. When dilute solutions of
library-substrate conjugate are combined with the substrate-biotin
conjugate, those library members that catalyze bond formation cause
the biotin group to become covalently attached to themselves.
Active bond forming catalysts can then be separated from inactive
library members by capturing the former with immobilized
streptavidin and washing away inactive library members (FIG.
12).
In an analogous manner, library members that catalyze bond cleavage
reactions such as retro-aldol reactions, amide hydrolysis,
elimination reactions, or olefin dihydroxylation followed by
periodate cleavage can be selected. In this case, library members
are covalently linked to biotinylated substrates such that the bond
breakage reaction causes the disconnection of the biotin moiety
from the library members (FIG. 13). Upon incubation under reaction
conditions, active catalysts, but not inactive library members,
induce the loss of their biotin groups. Streptavidin-linked beads
can then be used to capture inactive polymers, while active
catalysts are able to be eluted from the beads. Related bond
formation and bond cleavage selections have been used successfully
in catalytic RNA and DNA evolution (Jaschke et al. (2000) CURR.
OPIN. CHEM. BIOL. 4: 257-62) Although these selections do not
explicitly select for multiple turnover catalysis, RNAs and DNAs
selected in this manner have in general proven to be multiple
turnover catalysts when separated from their substrate moieties
(Jaschke et al. (2000) CURR. OPIN. CHEM. BIOL. 4: 257-62; Jaeger et
al. (1999) PROC. NATL. ACAD. SCI. USA 96: 14712-7; Bartel et al.,
(1993) SCIENCE 261: 1411-8; Sen et al., (1998) CURR. OPIN. CHEM.
BIOL. 2: 680-7).
In addition to simply evolving active catalysts, the in vitro
selections described above are used to evolve non-natural polymer
libraries in powerful directions difficult to achieve using other
catalyst discovery approaches. Substrate specificity among
catalysts can be selected by selecting for active catalysts in the
presence of the desired substrate and then selecting for inactive
catalysts in the presence of one or more undesired substrates. If
the desired and undesired substrates differ by their configuration
at one or more stereocenters, enantioselective or
diastereoselective catalysts can emerge from rounds of selection.
Similarly, metal selectivity can be evolved by selecting for active
catalysts in the presence of desired metals and selecting for
inactive catalysts in the presence of undesired metals. Conversely,
catalysts with broad substrate tolerance can be evolved by varying
substrate structures between successive rounds of selection.
(v) Iterative Selection
Iterating a selection by loading eluant from a first selection into
a second selection multiplies the net enrichment. No intervening
amplification of template is required. For example, a selection for
binding to carbonic anhydrase beads permitted a 330-fold enrichment
of a ligand. Application of the eluant directly to fresh carbonic
anhydrase beads (see, Example 11) enriched the template encoding
the carbonic anhydrase ligand .gtoreq.10,000-fold. Where the
selection was repeated a third time, a 5,000,000-fold net
enrichment of the ligand was observed. This result indicates that
iterating library selections can lead to very large enrichments of
desired molecules. In certain embodiments, a first round of
selection provides at least a 50-fold increase in the number of
binding ligands. Preferably, the increase in enrichments is over
100-fold, more preferably over 1,000 fold, and even more preferably
over 100,000-fold. Subsequent rounds of selection may further
increase the enrichment 100-fold over the original library,
preferably 1,000-fold, more preferably over 100,000-fold, and most
preferably over 1,000,000-fold.
Alternatively, following PCR amplification of DNA templates
encoding selected synthetic molecules, additional rounds of
translation, selection, and amplification can be conducted to
enrich the library for high affinity binders. The stringency of the
selection is gradually increased by increasing the salt
concentration of the binding and washing buffers, decreasing the
duration of binding, elevating the binding and washing
temperatures, and increasing the concentration of washing additives
such as template DNA or unrelated proteins.
Importantly, in vitro selections can also select for specificity in
addition to binding affinity. Library screening methods for binding
specificity typically require duplicating the entire screen for
each target or non-target of interest. In contrast, selections for
specificity can be performed in a single experiment by selecting
for target binding as well as for the inability to bind one or more
non-targets. Thus, the library can be pre-depleted by removing
library members that bind to a non-target. Alternatively, or in
addition, selection for binding to the target molecule can be
performed in the presence of an excess of one or more non-targets,
as described in Example 11. To maximize specificity, the non-target
can be a homologous molecule. If the target molecule is a protein,
appropriate non-target proteins include, for example, a generally
promiscuous protein such as an albumin. If the binding assay is
designed to target only a specific portion of a target molecule,
the non-target can be a variation on the molecule in which that
portion has been changed or removed.
(vi) Amplification and Sequencing
Once all rounds of selection are complete, the templates which are,
or formerly were, associated with the selected reaction product
preferably are amplified using any suitable technique to facilitate
sequencing or other subsequent manipulation of the templates.
Natural oligonucleotides can be amplified by any state of the art
method. These methods include, for example, polymerase chain
reaction (PCR); nucleic acid sequence-based amplification (see, for
example, Compton (1991) NATURE 350: 91-92), amplified anti-sense
RNA (see, for example, van Gelder et al. (1988) PROC. NATL. ACAD.
SCI. USA 5: 77652-77656); self-sustained sequence replication
systems (Gnatelli et al. (1990) PROC. NATL. ACAD. SCI. USA 87:
1874-1878); polymerase-independent amplification (see, for example,
Schmidt et al. (1997) NUCLEIC ACIDS RES. 25: 4797-4802, and in vivo
amplification of plasmids carrying cloned DNA fragments.
Descriptions of PCR methods are found, for example, in Saiki et al.
(1985) SCIENCE 230: 1350-1354; Scharf et al. (1986) SCIENCE 233:
1076-1078; and in U.S. Pat. No. 4,683,202. Ligase-mediated
amplification methods such as Ligase Chain Reaction (LCR) may also
be used. In general, any means allowing faithful, efficient
amplification of selected nucleic acid sequences can be employed in
the method of the present invention. It is preferable, although not
necessary, that the proportionate representations of the sequences
after amplification reflect the relative proportions of sequences
in the mixture before amplification.
For non-natural nucleotides the choices of efficient amplification
procedures are fewer. As non-natural nucleotides can be
incorporated by certain enzymes including polymerases it will be
possible to perform manual polymerase chain reaction by adding the
polymerase during each extension cycle.
For oligonucleotides containing nucleotide analogs, fewer methods
for amplification exist. One may use non-enzyme mediated
amplification schemes (Schmidt et al. (1997) NUCLEIC ACIDS RES. 25:
4797-4802). For backbone-modified oligonucleotides such as PNA and
LNA, this amplification method may be used. Alternatively, standard
PCR can be used to amplify a DNA from a PNA or LNA oligonucleotide
template. Before or during amplification the templates or
complementing templates may be mutagenized or recombined in order
to create an evolved library for the next round of selection or
screening.
(vii) Sequence Determination
Sequencing can be done by a standard dideoxy chain termination
method, or by chemical sequencing, for example, using the
Maxam-Gilbert sequencing procedure. Alternatively, the sequence of
the template (or, if a long template is used, the variable
portion(s) thereof) can be determined by hybridization to a chip
(see, Example 12). For example, a single-stranded template molecule
associated with a detectable moiety such as a fluorescent moiety is
exposed to a chip bearing a large number of clonal populations of
single-stranded nucleic acids or nucleic acid analogs of known
sequence, each clonal population being present at a particular
addressable location on the chip. The template sequences are
permitted to anneal to the chip sequences. The position of the
detectable moieties on the chip then is determined. Based upon the
location of the detectable moiety and the immobilized sequence at
that location, the sequence of the template can be determined. It
is contemplated that large numbers of such oligonucleotides can be
immobilized in an array on a chip or other solid support.
(viii) Diversification
Inventive libraries can be evolved by introducing mutations at the
DNA level, for example, using error-prone PCR (Cadwell et al.
(1992) PCR METHODS APPL. 2: 28) or by subjecting the DNA to in
vitro homologous recombination (Stemmer (1994) PROC. NATL. ACAD.
SCI. USA 91: 10747; Stemmer (1994) NATURE 370: 389).
Small molecule evolution using mutation and recombination offers
two potential advantages over simple enrichment. If the total
diversity of the library is much less than the number of molecules
made (typically 10.sup.12 to 10.sup.15), every possible library
member is present at the start of the selection. In this case,
diversification is still useful because selection conditions can
change as rounds of evolution progress. For example, later rounds
of selection can be conducted under higher stringencies and can
involve counterselections against binding to non-target molecules.
Diversification gives library members that have been discarded
during earlier rounds of selection the chance to reappear in later
rounds under altered selection conditions in which their fitness
relative to other members may be greater. In addition, it is quite
possible to generate a synthetic library that has a theoretical
diversity greater than 10.sup.15 molecules. In this case,
diversification allows molecules that never existed in the original
library to emerge in later rounds of selections on the basis of
their similarity to selected molecules, similar to the way in which
protein evolution searches the vastness of protein sequence space
one small subset at a time.
(viii)(a) Error-Prone PCR
Random point mutagenesis is performed by conducting the PCR
amplification step under error-prone PCR (Cadwell et al. (1992) PCR
METHODS APPLIC. 2: 28-33) conditions. Because the genetic code of
these molecules are written to assign related codons to related
chemical groups, similar to the way that the natural protein
genetic code is constructed, random point mutations in the
templates encoding selected molecules will diversify progeny
towards chemically related analogs. Because error-prone PCR is
inherently less efficient than normal PCR, error-prone PCR
diversification is preferably conducted with only natural dATP,
dTTP, dCTP, and dGTP and using primers that lack chemical handles
or biotin groups.
(viii)(b) Recombination
Libraries may be diversified using recombination. For example,
templates to be recombined may have the structure shown in FIG. 14,
in which codons are separated by five-base non-palindromic
restriction endonuclease cleavage sites such as those cleaved by
Avail (G/GWCC, W=A or T), Sau96I (G/GNCC, N=A, G, T, or C), DdeI
(C/TNAG), or HinFI (G/ANTC). Following selections, templates
encoding desired molecules are enzymatically digested with these
commercially available restriction enzymes. The digested fragments
then are recombined into intact templates with T4 DNA ligase.
Because the restriction sites separating codons are nonpalindromic,
template fragments can only reassemble to form intact recombined
templates (FIG. 14). DNA-templated translation of recombined
templates provides recombined small molecules. In this way,
functional groups between synthetic small molecules with desired
activities are recombined in a manner analogous to the
recombination of amino acid residues between proteins in Nature. It
is well appreciated that recombination explores the sequence space
of a molecule much more efficiently than point mutagenesis alone
(Minshull et al. (1999) CURR. OPIN. CHEM. BIOL. 3: 284-90; Bogarad
et al., (1999) PROC. NATL. ACAD. SCI. USA 96: 2591-5; Stemmer
NATURE 370: 389-391).
A preferred method of diversifying library members is through
nonhomologous random recombination, as described, for example, in
WO 02/074978; US Patent Application Publication No.
2003-0027180-A1; and Bittker et al. (2002) NATURE BIOTECH. 20(10):
1024-9.
(iiiv)(c) Random Cassette Mutagenesis
Random cassette mutagenesis is useful to create a diversified
library from a fixed starting sequence. Thus, such a method can be
used, for example, after a library has been subjected to selection
and one or more library members have been isolated and sequenced.
Generally, a library of oligonucleotides with variations on the
starting sequence is generated by traditional chemical synthesis,
error-prone PCR, or other methods. For example, a library of
oligonucleotides can be generated in which, for each nucleotide
position in a codon, the nucleotide has a 90% probability of being
identical to the starting sequence at that position, and a 10%
probability of being different. The oligonucleotides can be
complete templates when synthesized, or can be fragments that are
subsequently ligated with other oligonucleotides to form a diverse
library of templates.
V. Uses
The methods and compositions of the present invention represent new
ways to generate molecules with desired properties. This approach
marries extremely powerful genetic methods, which molecular
biologists have taken advantage of for decades, with the
flexibility and power of organic chemistry. The ability to prepare,
amplify, and evolve unnatural polymers by genetic selection may
lead to new classes of catalysts that possess activity,
bioavailability, stability, fluorescence, photolability, or other
properties that are difficult or impossible to achieve using the
limited set of building blocks found in proteins and nucleic acids.
Similarly, developing new systems for preparing, amplifying, and
evolving small molecules by iterated cycles of mutation and
selection may lead to the isolation of novel ligands or drugs with
properties superior to those isolated by slower traditional drug
discovery methods.
For example, unnatural biopolymers useful as artificial receptors
to selectively bind molecules or as catalysts for chemical
reactions can be isolated. Characterization of these molecules
would provide important insight into the ability of polycarbamates,
polyureas, polyesters, polycarbonates, polypeptides with unnatural
side chain and stereochemistries, or other unnatural polymers to
form secondary or tertiary structures with binding or catalytic
properties.
The present invention further allows the discovery of new chemical
reactions. The field of chemistry is continually being transformed
by the discovery of new chemical reactions providing access to
previously inaccessible molecules, allowing for expedited
syntheses, and revealing new chemical principles. Guided by
predictions of reactivity based on literature precedent, chemists
typically search for a new reaction to overcome a particular
shortcoming in current synthetic methodology. Until now, it has not
been feasible to conduct a broad, non-biased search for chemical
reactivity in which a large number of diverse reactants are
simultaneously evaluated for their ability to react with one
another under many different conditions. Both the amount of
material required for executing thousands of diverse reactions and
the difficulty of analyzing the outcome of such an experiment makes
this goal intractable using current reaction discovery approaches.
A broad, non-biased search for chemical reactivity is appealing
because it is not limited by conventional wisdom or by our ability
to predict functional group reactivity.
The inventive method of discovering new chemical reactions and
chemical reactivity has several advantages over existing methods.
For example, several groups have developed high-throughput screens
to test the efficiency of a particular reaction under a variety of
conditions (Kuntz et al. (1999) CURR. OPIN. CHEM. BIOL. 3: 313-319;
Francis et al. (1998) CURR. OPIN. CHEM. BIOL. 2: 422-428; Pawlas et
al. (2002) J. AM. CHEM. SOC. 124: 3669-3679; Lober et al. (2001) J.
AM. CHEM. SOC. 123: 4366-4367; Evans et al. (2002) CURR. OPIN.
CHEM. BIOL. 6: 333-338; Taylor et al. (1998) SCIENCE 280: 267-270;
and Stambuli et al. (2001) J. AM. CHEM. SOC. 123: 2677-2678);
however, the screens are limited to a small set of reaction types.
Reactions have been analyzed in a high-throughput manner using
fluorescence spectroscopy, colorimetric assay, thermographic
analysis, and traditional chromatography (Dahmen et al. (2001)
SYNTHESIS-STUTTGART 1431-1449 and Wennemers (2001) COMBINATORIAL
CHEMISTRY & HIGH THROUGHPUT SCREENING 4: 273-285). Most
high-throughput screens for chemical reactivity are useful for only
a small set of reaction types because the screen depends on a
particular property of the reaction such as the disappearance of an
amine or the production of protons. As a result, high throughput
screening methods can be useful for discovering catalysts for a
known or anticipated reason, but are poorly suited to discover
novel reactivity different from a reaction of interest. A
non-biased search for chemical reactions would examine a broad
range of both reaction conditions and reactants in a highly
efficient manner that is practical on the scale of thousands of
different reactions. The inventive method of discovering chemical
reactions offers a much greater chance of discovering unexpected
and unprecedented reactivity that may lead to new insights into
reactivity and to useful new reactions for chemical synthesis.
Discovering new reactions from very large and diverse collections
of reactants and conditions entails (1) a general assay for
reactivity that does not depend on a particular substrate or
product, and (2) increasing the overall efficiency of assaying
reactions such that both reaction condition space and reactant
space can be searched extensively. For example, researchers
evolving catalytic nucleic acids routinely select for bond
formation catalysts by attaching one reactant to the pool of
evolving nucleic acids and linking another reactant to a handle
that can be easily immobilized such as biotin (Wilson et al. (1999)
ANNU. REV. BIOCHEM. 68: 611-647; Jaschke (2001) CURR. OPIN. STRUCT.
BIOL. 11: 321-326; Jaschke et al. (2000) CURR. OPIN. CHEM. BIOL. 4:
257-262; Jaschke (2001) BIOL. CHEM. 382: 1321-1325). Active nucleic
acids become linked to the handle and are separated from the
inactive sequences. Because this type of selection does not depend
on the consumption or generation of a specific substrate or
product, the scope of reactants that can be tested in this type of
selection is much larger than the scope of reactants that can be
evaluated in current reactivity screens.
Nucleic acid-templated synthesis provides a way to use bond
formation selections to discover new chemical reactivity
independent of nucleic acid catalysis (Gartner et al. (2002) ANGEW.
CHEM. INT. ED. 41: 1796-1800; Gartner et al. (2001) supra). Nucleic
acid templates can direct a wide variety of chemical reactions in a
highly sequence-specific manner without any obvious requirements
for reaction geometry. By attaching reactants to appropriately
designed nucleic acid sequences, it becomes possible to test
thousands of unprecedented reactions in a single pot with
individual sequences encoding each reaction. Pools of nucleic
acid-linked reactants would be truly selected (not simply screened)
for covalent bond formation with members of a second nucleic
acid-linked reactant pool. PCR amplification and DNA sequencing
would reveal which combinations of reactants successfully undergo
bond formation.
In certain embodiments, the searchable reactions are those
transformations that can occur in aqueous or substantially aqueous
medium. In other embodiments, the searchable reactions are limited
to those that do not degrade nucleic acids rapidly. The known
chemical robustness of DNA suggests that a wide range of reaction
conditions spanning different temperatures, pH ranges, and
additives such as transition metals are compatible with the
proposed approach. A DNA-templated Heck reaction demonstrates that
transition metal catalyzed reactions are viable in a DNA-templated
format, consistent with extensive evidence (Patolsky et al. (2002)
J. AM. CHEM. SOC. 124: 770-772; Weizman et al. (2002) J. AM. CHEM.
SOC. 124: 1568-1569; Gartner et al. (2002) ANGEW. CHEM. INT. ED.
41: 1796-1800; Czlapinski et al. (2001) J. AM. CHEM. SOC. 123:
8618-8619; Holmlin et al. (1998) J. AM. CHEM. SOC. 120: 9724-9725;
Bashkin et al. (1994) J. AM. CHEM. SOC. 116: 5981-5982; Magda et
al. (1994) J. AM. CHEM. SOC. 116: 7439-7440; and Dandliker et al.
(1997) SCIENCE 275: 1465-1468) that DNA is compatible with many
transition metal complexes, including those containing Pd, Ni, Mn,
Pt, Ru, Os, Cu, Eu, and Rh. Further, the rapid increase in the
number of known water-compatible organic reactions (Li et al.
Organic reaction in aqueous media (Wiley and Sons, New York, 1997)
and the inherent benefits of working in aqueous solvents suggests
that water is a rich medium for discovering new reactions.
Reactions discovered in this effort may be of general utility when
performed in a standard non-nucleic acid-templated mode, and are
also natural candidates for use in generating nucleic
acid-templated synthetic libraries.
Nucleic acid-templated chemistry is combined with in vitro
selection and PCR amplification in certain embodiments to
efficiently search for novel bond-forming reactions independent of
reactant structures. The ability to select directly for covalent
bond formation, the minute scale required for analysis, and
compatibility of nucleic acids with a wide variety of reaction
conditions may permit the first search for unprecedented reactivity
that can examine thousands of combinations of reactants and
reaction conditions in one or several experiments.
The reaction generality and distance independence of DNA-templated
synthesis allows for a system for discovering new chemical
reactions by selection. DNA-linked reactants (i.e., templates
and/or transfer units) suitable for in vitro selection for bond
formation exist in one or two forms designated pool A and pool B in
FIG. 9. Each reactant in pool B contains a functional group being
tested linked to a short segment of biotinylated DNA (a coding
region) encoding that functional group. Each reactant in pool A
contains a functional group being tested, a corresponding coding
region, and an "annealing region" or anti-codon that complements
one of the pool B coding regions. Each functional group in pool A
is linked to one of every possible annealing region. This
arrangement allows any functional group in pool A to join any
functional group in pool B on the same DNA duplex, providing the
opportunity for DNA-templated bond formation if the reactants are
mutually reactive. Generating these two pools of DNA-linked
reactants in a format suitable for in vitro selection for bond
formation requires the development of methods to efficiently
assemble a small molecule reactant, a coding region, and in the
case of pool A, a library of annealing regions.
The inventive system is particularly useful for the identification
of small-molecule/target binding pairs. For instance, inventive
DNA-templated small molecule libraries may be contacted with other
solution or solid-phase libraries of potential target compounds
such that small molecules within the inventive library that bind or
interact with one or more compounds in the target libraries are
identified. Preferably, bound pairs may be identified by selection
(e.g., by tagging one of the components, combined with PCR to
identify the other). In certain particularly preferred embodiments
of this aspect of the invention, the target library or libraries
comprise polypeptides and/or proteins.
As described herein, the present invention also provides new modes
of nucleic acid-templated synthesis, including simultaneous
incompatible reactions and one pot multi-step ordered synthesis
(e.g., incubating three DNA-linked amino acids and one template so
that only a single tripeptide, of specified sequence, is produced).
The invention also provides nucleic acid-templated synthesis in
organic solvents (e.g., methylene chloride, dimethylformamide).
Yet another application of the inventive system is to identify
and/or evolve new templates for nucleic acid-templated synthesis.
For instance, the present invention allows identification of
nucleic acid templates that, when contacted with reagents that are
sufficient to participate in a reaction to generate a selectable
product, most efficiently lead to production of that product.
The invention also provides information useful to inform the
development of chemical reaction pathways. For instance, according
to the present invention, a researcher can select from within a
library of nucleic acid-templated substrates those that permit a
complex chemical reaction to take place (e.g., macrocyclization,
which can be selected for by, for example, loss of a biotin leaving
group). When successful reaction conditions have been identified,
the inventive system allows ready identification of participating
components. Thus, new chemistries can be developed without prior
knowledge of the reagents and/or pathways likely to be useful in
the reaction.
VI. Kits
The present invention also provides kits and compositions for use
in the inventive methods. The kits may contain any item or
composition useful in practicing the present invention. The kits
may include, but are not limited to, templates, (e.g.,
end-of-helix, hairpin, omega, and T architectures), anticodons,
transfer units, monomer units, building blocks, reactants, small
molecule scaffolds, buffers, solvents, enzymes (e.g., heat stable
polymerase, reverse transcriptase, ligase, restriction
endonuclease, exonuclease, Klenow fragment, polymerase, alkaline
phosphatase, polynucleotide kinase), linkers, protecting groups,
polynucleotides, nucleosides, nucleotides, salts, acids, bases,
solid supports, or any combinations thereof.
A kit for preparing unnatural polymers should contain items needed
to prepare unnatural polymers using the methods described herein.
Such a kit may include templates, anti-codons, transfer units,
monomers units, or combinations thereof. A kit for synthesizing
small molecules may include templates, anti-codons, transfer units,
building blocks, small molecule scaffolds, or combinations
thereof.
The inventive kit can also be equipped with items needed to amplify
and/or evolve a polynucleotide template such as a heat stable
polymerase for PCR, nucleotides, buffer, and primers. In certain
other embodiments, the inventive kit includes items commonly used
in performing DNA shuffling such as polynucleotides, ligase, and
nucleotides.
In addition to the templates and transfer units described herein,
the present invention also includes compositions comprising complex
small molecules, scaffolds, or unnatural polymer prepared by any
one or more of the methods of the invention as described
herein.
A kit for identifying new chemical reactions or functionality may
include template associated with reactive units (reactants),
transfer units associated with reactive units (reactants),
reagents, acids, bases, catalysts, solvents, biotin, avidin, avidin
beads, etc. The kit can also include reagents for generating the
template associated with a reactive group (e.g., biotin,
polynucleotides, reactive units, Klenow fragment of DNA pol I,
nucleotides, avidin beads, etc.). The kit can also include reagents
for PCR (e.g., buffers, heat stable polymerase, nucleotides,
primers, etc.).
The following examples contain important additional information,
exemplification and guidance that can be adapted to the practice of
this invention in its various embodiments and equivalents
thereof.
EXAMPLES
Examples 1 and 2 describe the preparation of materials for use in
nucleic acid-templated synthesis and describe specific synthetic
reactions. Example 3 discusses multi-step synthesis. Example 4
describes the compatibility of nucleic acid-templated synthesis
with organic solvents. Example 5 describes specific template
architectures useful in the practice of certain DNA-templated
syntheses. Example 6 describes stereoselectivity in nucleic
acid-templated synthesis. Example 7 describes the use of
DNA-templated synthesis to direct otherwise incompatible reactions
in a single solution. Example 8 describes functional group
transformation reactions that can be carried out by nucleic
acid-templated synthesis. Example 9 describes the synthesis of
exemplary compounds and libraries. Example 10 describes the use of
polymerases to translate DNA into nonnatural polymers. Example 11
describes in vitro selection protocols. Example 12 describes the
application of DNA-templated synthesis toward the discovery of new
chemical reactions.
Example 1
The Generality of DNA-Templated Synthesis
Nucleic acid-templated synthesis is extremely versatile and permits
the synthesis of a variety of chemical compounds. This Example
demonstrates that it is possible to perform DNA-templated synthesis
using two different DNA template architectures.
As shown in FIG. 15, templates with a hairpin (H) or end-of-helix
(E) architecture bearing electrophilic maleimide groups were
prepared to test their reactivity with a transfer unit comprising,
a complementary DNA oligonucleotide associated with a thiol
reagent. Both the H and E templates reacted efficiently with one
equivalent of the DNA-linked thiol reagent to yield the thioether
product in minutes at 25.degree. C. DNA-templated reaction rates
(k.sub.app.about.10.sup.5 M.sup.-1s.sup.-1) were similar for H and
E architectures despite significant differences in the relative
orientation of their reactive groups. In contrast, no product was
observed when using reagents containing sequence mismatches, or
when using templates pre-quenched with excess
.beta.-mercaptoethanol (see FIG. 15). Thus, both DNA templates
support a sequence-specific DNA-templated reaction even though the
structures of the resulting products differ markedly from the
structure of the natural DNA backbone. Little or no non-templated
intermolecular reaction products were observed under the reaction
conditions (pH 7.5, 25.degree. C., 250 mM NaCl, 60 nM template
transfer unit), demonstrating the specificity of the DNA-templated
reaction.
Indeed, sequence-specific DNA-templated reactions spanning a
variety of reaction types (S.sub.N2 substitutions, additions to
.alpha.,.beta.-unsaturated carbonyl systems, and additions to vinyl
sulfones), nucleophiles (thiols and amines), and reactant
structures all proceeded with good yields and excellent sequence
selectivity (see, FIG. 16). Matched (M) or mismatched (X) reagents
linked to thiols (S) or primary amines (N) were mixed with 1
equivalent of template functionalized with the variety of
electrophiles shown in FIG. 16. Reactions with thiol reagents were
conducted at pH 7.5 under the following conditions: SIAB and SBAP:
37.degree. C., 16 hours; SIA: 25.degree. C., 16 hours, SMCC, GMBS,
BMPS, SVSB: 25.degree. C., 10 minutes. Reactions with amine
reagents were conducted at 25.degree. C., pH 8.5 for 75 minutes.
Expected product masses were verified by mass spectrometry. In each
case, matched but not mismatched reagents afforded product
efficiently despite considerable variations in their transition
state geometry, steric hindrance, and conformational flexibility.
Collectively these findings indicate that nucleic acid-templated
synthesis is a general phenomenon capable of supporting a range of
reaction types, and is not limited to the creation of structures
resembling nucleic acid backbones.
Sequence discrimination is important for the faithful translation
of a nucleic acid into a synthetic reaction product. To test the
sequence discrimination of DNA-templated synthesis, hairpin
templates linked to an iodoacetamide group were reacted to
thiol-bearing transfer units containing 0, 1, or 3 mismatches. At
25.degree. C., the initial rate of reaction of the thiol-bearing
transfer unit with no mismatches was 200-fold faster than that of
transfer units bearing a single mismatch
(k.sub.app=2.4.times.10.sup.4 M.sup.-1s.sup.-1 vs.
1.1.times.10.sup.2 M.sup.-1s.sup.-1; FIG. 17A).
In addition, small amounts of products arising from the annealing
of mismatched reagents could be eliminated by elevating the
reaction temperature beyond the melting temperature T.sub.m of the
mismatched reagents (FIG. 17B). In FIG. 17B, the reactions in FIG.
17B were repeated at the indicated temperatures for 16 hours. The
calculated reagent Tm values were found to be 38.degree. C.
(matched) and 28.degree. C. (single mismatch). The inverse
relationship between product formation and temperature indicates
that product formation proceeds by a DNA-templated mechanism rather
than by a simple intermolecular mechanism.
In addition to reaction generality and sequence specificity,
DNA-templated synthesis, under certain circumstances, also
demonstrates remarkable distance independence. Both H and E
templates linked to maleimide or .alpha.-iodoacetamide groups
promoted sequence-specific reaction with matched, but not
mismatched, thiol reagents annealed anywhere on the templates
examined thus far (up to 30 bases away from the reactive group on
the template). Reactants annealed one base away reacted with
similar rates as those annealed 2, 3, 4, 6, 8, 10, 15, 20, or 30
bases away (FIG. 18). The reaction illustrated in FIG. 18 used a
41-base E template and a 10-base reagent designed to anneal 1-30
bases from the 5' end of the template. The kinetic profiles of FIG.
18 show the average of two trials (deviations <10%). The "n=1
mis" reagent contained three mismatches. In all cases, templated
reaction rates were several hundred-fold higher than the rate of
untemplated (mismatched) reaction (k.sub.app=10.sup.4-10.sup.5
M.sup.-1s.sup.-1 vs. 5.times.10.sup.1 M.sup.-1s.sup.-1). At
intervening distances of 30 bases, products were efficiently formed
presumably through transition states resembling 200-membered
rings.
In order to further characterize the basis of the distance
independence of DNA-templated synthesis, a series of modified E
templates were first synthesized in which the intervening bases
were replaced by a series of DNA analogs designed to evaluate the
possible contribution of (i) interbase interactions, (ii)
conformational preferences of the DNA backbone, (iii) the charged
phosphate backbone, and (iv) backbone hydrophilicity. Templates in
which the intervening bases were replaced with any of the analogs
in FIG. 19 showed little effect on the rates of product
formation.
In the experiment shown in FIG. 19, the n=10 reaction in FIG. 18
was repeated using templates in which the nine bases following the
5'-NH.sub.2-dT were replaced with the backbone analogues shown.
Five equivalents of a DNA oligonucleotide complementary to the
intervening bases were added to the "DNA+clamp" reaction. Reagents
were either completely matched (0) or contained three mismatches
(3). The gel shows reactions after 25 minutes at 25.degree. C. FIG.
19 shows that the backbone structural elements specific to DNA are
not responsible for the observed distance independence of
DNA-templated synthesis. However, the addition of a 10-base DNA
oligonucleotide "clamp" complementary to the single-stranded
intervening region significantly reduced product formation (FIG.
19), suggesting that the flexibility of this region is critical to
efficient DNA-templated synthesis.
The distance independent reaction rates may be explained if the
bond-forming events in a DNA-templated format are sufficiently
accelerated relative to their nontemplated counterparts such that
DNA annealing, rather than bond formation, is rate-determining. If
DNA annealing is at least partially rate limiting, then the rate of
product formation should decrease as the concentration of reagents
is lowered because annealing, unlike templated bond formation, is a
bimolecular process. FIG. 20 shows the results of experiments in
which the n=1, n=10, and n=1 mismatched (mis) reactions described
in FIG. 18 were repeated with template and reagent concentrations
of 12.5, 25, 62.5 or 125 nM. FIG. 20 shows that decreasing the
concentration of reactants in the case of the E template with one
or ten intervening bases between reactive groups resulted in a
marked decrease in the observed reaction rate. This observation
suggests that proximity effects in DNA-templated synthesis can
enhance bond formation rates to the point that DNA annealing
becomes rate-determining.
These findings raise the possibility of using DNA templated
synthesis to translate in one pot libraries of DNA into
solution-phase libraries of synthetic molecules suitable for PCR
amplification and selection. The sequence specificity described
above suggests that mixtures of reagents may be able to react
predictably with complementary mixtures of templates. Finally, the
observed distance independence suggests that different template
codons can be used to encode different reactions without impairing
reactions rates.
As a demonstration of this approach, a library of 1,025
maleimide-linked templates was synthesized, each with a different
DNA sequence in an eight-base encoding region (FIGS. 21A-21B). One
of these sequences, 5'-TGACGGGT-3', was arbitrarily chosen to code
for the attachment of a biotin group to the template. A library of
thiol reagents linked to 1,025 different oligonucleotides was also
generated. The reagent linked to 3'-ACTGCCCA-5' contained a biotin
group, while the other 1,024 reagents (transfer units) contained no
biotin. Equimolar ratios of all 1,025 templates and 1,025 reagents
were mixed in one pot for 10 minutes at 25.degree. C. and the
resulting products were selected in vitro for binding to
streptavidin. Molecules surviving the selection were amplified by
PCR and analyzed by restriction digestion and DNA sequencing.
Digestion with the restriction endonuclease Tsp45I, which cleaves
GTGAC and therefore cuts the biotin encoding template but none of
the other templates, revealed a 1:1 ratio of biotin encoding to
non-biotin encoding templates following selection. In the
experiments shown in FIG. 22A, lanes 1 and 5 represent the
PCR-amplified library before streptavidin binding selection; lanes
2 and 6 represent the PCR-amplified library after selection; lanes
3 and 7 represent the PCR amplified authentic biotin-encoding
template; and lane 4 represents a 20 bp ladder. Lanes 5-7 were
digested with Tsp45I. DNA sequencing traces of the amplified
templates before and after selection are also shown, together with
the sequences of the non-biotin-encoding and biotin-encoding
templates. The results summarized in FIG. 22A represent a
1,000-fold enrichment compared with the unselected library. DNA
sequencing of the PCR amplified pool before and after selection
suggested a similar degree of enrichment and indicated that the
biotin-encoding template is the major product after selection and
amplification (FIG. 22A). The ability of DNA-templated synthesis to
support the simultaneous sequence-specific reaction of 1,025
reagents, each of which faces a 1,024:1 ratio of non-partner to
partner templates, demonstrates its potential as a method to create
synthetic libraries in one pot.
Taken together, these results show that it is possible to
translate, select, and amplify a synthetic library member having a
specific property (for example, bind avidin) as shown in FIG. 22B.
Furthermore, these results indicate that nucleic acid-templated
synthesis is a surprisingly general phenomenon capable of
directing, rather than simply encoding, a range of chemical
reactions to form products unrelated in structure to nucleic acid
backbones. For several reactions examined, the DNA-templated format
accelerates the rate of bond formation beyond the rate of a 10-base
DNA oligonucleotide annealing to its complement, resulting in
surprising distance independence. The facile nature of
long-distance DNA-templated reactions may also arise in part from
the tendency of water to contract the volume of nonpolar reactants
(see, C.-J. Li et al. Organic Reactions in Aqueous Media, Wiley and
Sons: New York, 1997) and from possible compactness of the
intervening single-stranded DNA between reactive groups.
Materials and Methods
DNA Synthesis. DNA oligonucleotides were synthesized on a
PerSeptive Biosystems Expedite 8909 DNA synthesizer using standard
protocols and purified by reverse phase HPLC. Oligonucleotides were
quantitated spectrophotometrically and by denaturing polyacrylamide
gel electrophoresis (PAGE) followed by staining with ethidium
bromide or SYBR Green (Molecular Probes) and quantitation using a
Stratagene Eagle Eye II densitometer. Phosphoramidites enabling the
synthesis of 5'-NH.sub.2-dT, 5' tetrachlorofluorescein, a basic
backbone spacer, C3 backbone spacer, 9-bond polyethylene glycol
spacer, 12-bond saturated hydrocarbon spacer, and 5' biotin groups
were purchased from Glen Research, Sterling, Va., USA. Thiol-linked
oligonucleotide reagents were synthesized on C3 disulfide
controlled pore glass from Glen Research, Sterling, Va., USA.
Template Functionalization. Templates bearing 5'-NH.sub.2-dT groups
were transformed into a variety of electrophilic functional groups
by reaction with the appropriate electrophile-N-hydroxysuccinimide
(NHS) ester (Pierce, Rockford, Ill., USA). Reactions were performed
in 200 mM sodium phosphate pH 7.2 with 2 mg/mL electrophile-NHS
ester, 10% dimethylsulfoxide (DMSO), and up to 100 .mu.g of
5'-amino template at 25.degree. C. for 1 hours. Desired products
were purified by reverse-phase HPLC and characterized by gel
electrophoresis and MALDI mass spectrometry.
DNA-templated synthesis reactions. Reactions were initiated by
mixing equimolar quantities of reagent (transfer unit) and template
in buffer containing 50 mM N-[3-morpholinopropane]sulfonic acid
(MOPS) pH 7.5 and 250 mM NaCl at the desired temperature
(25.degree. C. unless stated otherwise). Concentrations of reagents
and templates were 60 nM unless otherwise indicated. At various
time points, aliquots were removed, quenched with excess
.beta.-mercaptoethanol, and analyzed by denaturing PAGE. Reaction
products were quantitated by densitometry using their intrinsic
fluorescence or by staining followed by densitometry.
Representative products were also verified by MALDI mass
spectrometry.
In Vitro Selection for Avidin Binding. Products of the library
translation reaction (FIG. 21A-21B) were isolated by ethanol
precipitation and dissolved in binding buffer (10 mM Tris pH 8, 1 M
NaCl, 10 mM ethylenediaminetetraacetic acid (EDTA)). Products were
incubated with 30 .mu.g of streptavidin-linked magnetic beads
(Roche Biosciences) for 10 minute at room temperature in 100 .mu.L
total volume. The beads were washed 16 times with binding buffer
and eluted by treatment with 1 .mu.mol free biotin in 100 uL
binding buffer at 70.degree. C. for 10 minutes. The eluted
molecules were isolated by ethanol precipitation and amplified by
standard PCR protocols (2 mM MgCl.sub.2, 55.degree. C. annealing,
20 cycles) using the primers 5'-TGGTGCGGAGCCGCCG [SEQ ID NO: 35]
and 5'-CCACTGTCCGTGGCGCGACCCCGGCTCCTCGGCTCGG [SEQ ID NO: 36].
Automated DNA sequencing used the primer 5'-CCACTGTCCGTGGCGCGACCC
[SEQ ID NO: 37].
DNA Sequences. Sequences not provided in the Figures are as
follows: matched reagent in FIG. 16 SIAB and SBAP reactions:
5'-CCCGAGTCGAAGTCGTACC-SH [SEQ ID NO: 38]; mismatched reagent in
FIG. 16 SIAB and SBAP reactions: 5'-GGGCTCAGCTTCCCCATAA-SH [SEQ ID
NO: 39]; mismatched reagents for other reactions in FIGS. 16, and
17A-17B; 5'-FAAATCTTCCC-SH tetrachlorofluorescein) [SEQ ID NO: 40];
reagents in FIG. 16 containing one mismatch: 5'-FAATTCTTACC-SH [SEQ
ID NO: 41]; E templates in FIGS. 15 and 16 SMCC, GMBS, BMPS, and
SVSB reactions, and FIGS. 17A-17B:
5'-(NH.sub.2dT)-CGCGAGCGTACGCTCGCGATGGTACGAATTCGACTCGGGAATAC
CACCTTCGACTCGAGG [SEQ ID NO: 42]; H template in FIG. 16 SIAB, SBAP,
and SIA reactions: 5'-(NH.sub.2dT)-CGCGAGCGTACGCTCGCGATGGTACGAATTC
[SEQ ID NO: 43]; clamp oligonucleotide in FIG. 19: 5'-ATTCGTACCA
[SEQ ID NO: 44].
Example 2
Exemplary Reactions for Use in DNA-Templated Synthesis
This Example demonstrates that DNA-templated synthesis can direct a
modest collection of chemical reactions without requiring the
precise alignment of reactive groups into DNA-like conformations.
Furthermore, this Example also demonstrates that it is possible to
simultaneously translate in one-pot a library of more than 1,000
templates into the corresponding thioether products, one of which
could be enriched by in vitro selection for binding to streptavidin
and amplification by PCR.
As described in detail herein, a variety of chemical reactions for
example. DNA-templated organometallic couplings and carbon-carbon
bond forming reactions other than pyrimidine photodimerization can
be utilized to construct small molecules. These reactions represent
an important step towards the in vitro evolution of non-natural
synthetic molecules by permitting the DNA-templated construction of
a diverse set of structures.
The ability of DNA-templated synthesis to direct reactions that
require a non-DNA-linked activator, catalyst or other reagent in
addition to the principal reactants has also been demonstrated
herein. To test the ability of DNA-templated synthesis to mediate
such reactions without requiring structural mimicry of the
DNA-templated backbone, DNA-templated reductive aminations between
an amine-linked template (1) and benzaldehyde- or glyoxal-linked
reagents (3) with millimolar concentrations of sodium
cyanoborohydride (NaBH.sub.3CN) at room temperature in aqueous
solutions can be performed (see, FIG. 23A). Significantly, products
formed efficiently when the template and reagent sequences were
complementary, while control reactions in which the sequence of the
reagent did not complement that of the template, or in which
NaBH.sub.3CN was omitted, yielded no significant product (see FIGS.
23A-23D and 24). Although DNA-templated reductive aminations to
generate products closely mimicking the structure of
double-stranded DNA have been previously reported (see, for
example, Li et al. (2002) J. AM. CHEM. SOC. 124: 746 and Gat et al.
(1998) BIOPOLYMERS 48: 19), these results demonstrate that
reductive amination to generate structures unrelated to the
phosphoribose backbone can take place efficiently and
sequence-specifically.
Referring to FIGS. 25A-25B, DNA-templated amide bond formations
between amine-linked templates 4 and 5 and carboxylate-linked
reagents 6-9 mediated by
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and
N-hydroxylsulfosuccinimide (sulfo-NHS) generated amide products in
good yields at pH 6.0, 25.degree. C. Product formation was (i)
sequence-specific, (ii) dependent on the presence of EDC, and (iii)
insensitive to the steric encumbrance of the amine or carboxylate.
Efficient DNA-templated amide formation was also mediated by the
water-stable activator
4-(4,6-dimethoxy-1,3,5-trizin-2-yl)-4-methylmorpholinium chloride
(DMT-MM) instead of EDC and sulfo-NHS (FIGS. 24 and 25A-25B). The
efficiency and generality of DNA-templated amide bond formation
under these conditions, together with the large number of
commercially available chiral amines and carboxylic acids, make
this reaction an attractive candidate in future DNA-templated
syntheses of structurally diverse small molecule libraries.
Carbon-carbon bond forming reactions are also important in both
chemical and biological syntheses and thus several such reactions
can be utilized in a nucleic acid-templated format. Both the
reaction of nitroalkane-linked reagent (10) with aldehyde-linked
template (11) (nitro-aldol or Henry reaction) and the conjugate
addition of 10 to maleimide-linked template (12) (nitro-Michael
addition) proceeded efficiently and with high sequence specificity
at pH 7.5-8.5, 25.degree. C. (FIGS. 23A and 24). In addition, the
sequence-specific DNA-templated Wittig reaction between stabilized
phosphorus ylide reagent 13 and aldehyde-linked templates 14 or 11
provided the corresponding olefin products in excellent yields at
pH 6.0-8.0, 25.degree. C. (FIGS. 23B and 24). Similarly, the DNA
templated 1,3-dipolar cycloaddition between nitrone-linked reagents
15 and 16 and olefin-linked templates 12, 17 or 18 also afforded
products sequence specifically at pH 7.5, 25.degree. C. (FIGS. 23B,
23C and 24).
In addition to the reactions described above, organometallic
coupling reactions can also be utilized in the present invention.
For example, DNA-templated Heck reactions were performed in the
presence of water-soluble Pd precatalysts. In the presence of 170
mM Na.sub.2PdCl.sub.4, aryl iodide-linked reagent 19 and a variety
of olefin-linked templates including maleimide 12, acrylamide 17,
vinyl sulfone 18 or cinnamamide 20 yielded Heck coupling products
in modest yields at pH 5.0, 25.degree. C. (FIGS. 23D and 24). For
couplings with olefins 17, 18 and 20, adding two equivalents of
P(p-SO.sub.3C.sub.6H.sub.4).sub.3 per equivalent of Pd prior to
template and reagent addition typically increased overall yields by
2-fold. Control reactions containing sequence mismatches or lacking
Pd precatalyst yielded no product.
Example 1 above shows that certain DNA-templated reactions
demonstrate distance independence. Distance independence may arise
when the rate of bond formation in the DNA-templated reaction is
greater than the rate of template-reagent annealing. Although only
a subset of chemistries fall into this category, any DNA-templated
reaction that affords comparable product yields when the reagent is
annealed at various distances from the reactive end of the template
is of special interest because it can be encoded at a variety of
template positions. In order to evaluate the ability of the
DNA-templated reactions developed in this Example to take place
efficiently when reactants are separated by distances relevant to
library encoding, the yields of reductive amination, amide
formation, nitro-aldol addition, nitro-Michael addition, Wittig
olefination, dipolar cycloaddition, and Heck coupling reactions
were compared when either zero (n=0) or ten (n=10) bases separated
the annealed reactive groups (FIG. 26A). Among the reactions
described here or in Example 1, amide bond formation, nitro-aldol
addition, Wittig olefination, Heck coupling, conjugate addition of
thiols to maleimides and S.sub.N2 reaction between thiols and
.alpha.-iodo amides demonstrate comparable product formation when
reactive groups are separated by zero or ten bases (FIG. 26B). FIG.
26B shows the results of denaturing polyacrylamide gel
electrophoresis of a DNA-templated Wittig olefination between
complementary 11 and 13 with either zero bases (lanes 1-3) or ten
bases (lanes 4-6) separating the annealed reactants. Although the
apparent second order rate constants for the n=0 and n=10 reactions
differ by three-fold (kapp (n=0)=9.9.times.10.sup.3
M.sup.-1s.sup.-1 while kapp (n=10)=3.5.times.10.sup.3
M.sup.-1s.sup.-1), product yields after 13 hours at both distances
were nearly quantitative. Control reactions containing sequence
mismatches yielded no detectable product. These findings indicate
that these reactions can be encoded during synthesis by nucleotides
that are distal from the reactive end of the template without
significantly impairing product formation.
In addition to the DNA-templated S.sub.N2 reaction, conjugate
addition, vinyl sulfone addition, amide bond formation, reductive
amination, nitro-aldol (Henry reaction), nitro Michael, Wittig
olefination, 1,3-dipolar cycloaddition and Heck coupling reactions
described directly above, a variety of additional reagents can also
be utilized in the method of the present invention. For example, as
depicted in FIG. 27, powerful aqueous DNA-templated synthetic
reactions including, but not limited to, the Lewis acid-catalyzed
aldol addition, Mannich reaction, Robinson annulation reactions,
additions of allyl indium, zinc and tin to ketones and aldehydes,
Pd-assisted allylic substitution, Diels-Alder cycloadditions, and
hetero-Diels-Alder reactions can be utilized efficiently in aqueous
solvent and are important complexity-building reactions.
Taken together, these results expand considerably the reaction
scope of DNA-templated synthesis. A wide variety of reactions can
proceed efficiently and selectively when the corresponding
reactants are programmed with complementary sequences. By
augmenting the repertoire of known DNA-templated reactions to
include carbon-carbon bond forming and organometallic reactions
(nitro-aldol additions, nitro-Michael additions, Wittig
olefinations, dipolar cycloadditions, and Heck couplings) in
addition to previously reported amide bond formation (see, Schmidt
et al. (1997) NUCLEIC ACIDS RES. 25: 4792; Bruick et al. (1996)
CHEM. BIOL. 3: 49), imine formation (Czlapinski et al. (2001) J.
AM. CHEM. SOC. 123: 8618), reductive amination (Li et al. (2002) J.
AM. CHEM. SOC. 124: 746; Gat et al. (1998) BIOPOLYMERS 48: 19),
S.sub.N2 reactions (Gartner et al. (2001) J. AM. CHEM. SOC. 123:
6961; Xu et al. (2001) NAT. BIOTECHNOL. 19: 148; Herrlein et al.
(1995) J. AM. CHEM. SOC. 117: 10151) conjugate addition of thiols
(Gartner et al. (2001) J. AM. CHEM. SOC. 123: 6961), and
phosphoester or phosphonamide formation (Orgel et al. (1995) ACC.
CHEM. RES. 28: 109; Luther et al. (1998) NATURE 396: 245), these
results may permit the sequence-specific translation of libraries
of DNA into libraries of structurally and functionally diverse
synthetic products.
Because minute quantities of templates encoding desired molecules
can be amplified by PCR, the yields of DNA-templated reactions
arguably are less critical than the yields of traditional synthetic
transformations. Nevertheless, many of the reactions discussed in
this Example proceed efficiently.
Materials and Methods
Functionalized templates and reagents were typically prepared by
reacting 5'-NH.sub.2 terminated oligonucleotides (for template 1),
5'-NH.sub.2--(CH.sub.2O).sub.2 terminated oligonucleotides (for all
other templates) or
3'-OPO.sub.3--CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH.sub.2
terminated nucleotides (for all reagents) with the appropriate NHS
esters (0.1 volumes of a 20 mg/mL solution in DMF) in 0.2 M sodium
phosphate buffer, pH 7.2, 25.degree. C., for 1 hour to provide the
template and reagent structures shown in FIGS. 23A-23D and 25A-25B.
For amino acid linked reagents 6-9, 3%
OPO.sub.3CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH.sub.2 terminated
oligonucleotides in 0.2 M sodium phosphate buffer, pH 7.2 were
reacted with 0.1 volumes of a 100 mM
bis[2-(succinimidyloxycarbonyloxy)ethyl]sulfone (BSOCOES, Pierce,
Rockford, Ill., USA) solution in DMF for 10 minutes at 25.degree.
C., followed by 0.3 volumes of a 300 mM amino acid in 300 mM sodium
hydroxide (NaOH) for 30 minutes at 25.degree. C.
Functionalized templates and reagents were purified by gel
filtration using Sephadex G-25 followed by reverse-phase HPLC (0.1
triethylammonium acetate-acetonitrile gradient) and characterized
by MALDI mass spectrometry.
For the DNA templated reactions described in FIGS. 23A-23D,
reactions were conducted at 25.degree. C. with one equivalent each
of template and reagent at 60 nM final concentration unless
otherwise specified. Conditions: (a) 3 mM NaBH.sub.3CN, 0.1 M
N-[2-morpholinoethane]sulfonic acid (MES) buffer pH 6.0, 0.5 M
NaCl, 1.5 hours; b) 0.1 M
N-tris[hydroxymethyl]methyl-3-aminopropanesulfonic acid (TAPS)
buffer pH 8.5, 300 mM NaCl, 12 hours; c) 0.1 M pH 8.0 TAPS buffer,
1 M NaCl, 5.degree. C., 1.5 hours; d) 50 mM MOPS buffer pH 7.5, 2.8
M NaCl, 22 hours; e) 120 nM 19, 1.4 mM Na.sub.2PdCL.sub.4, 0.5 M
NaOAc buffer pH 5.0, 18 hours; (f) Premix Na.sub.2PdCl.sub.4 with
two equivalents of P(p-SO.sub.3C.sub.6H.sub.4).sub.3 in water for
15 minutes, then add to reactants in 0.5 M NaOAc buffer pH 5.0, 75
mM NaCl. 2 hours (final [Pd]=0.3 mM, [19]=120 nM). The olefin
geometry of products from 13 and the regiochemistries of
cycloaddition products from 14 and 16 are presumed but not verified
(FIGS. 23A-23D). Products were characterized by denaturing
polyacrylamide gel electrophoresis and MALDI mass spectrometry. For
all reactions under the specified conditions, product yields of
reactions with matched template and reagent sequences were greater
than 20-fold higher than that of control reactions with scrambled
reagent sequences.
The conditions for the reactions described in FIGS. 25A-25B were:
60 nM template, 120 nM reagent, 50 mM DMT-MM in 0.1 M MOPS buffer
pH 7.0, 1 M NaCl, for 16 hours at, 25.degree. C.; or 60 nM
template, 120 nM reagent, 20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES
buffer pH 6.0, 1 M NaCl, for 16 hours at 25.degree. C. In each row
of the table in FIGS. 25A-25B, yields of DMT-MM-mediated reactions
between reagents and templates complementary in sequence were
followed by yields of EDC and sulfo-NHS mediated reactions. In all
cases, control reactions with mismatched reagent sequences yielded
little or no detectable product and products were characterized by
denaturing polyacrylamide gel electrophoresis and MALDI mass
spectrometry.
FIG. 24 depicts the analysis by denaturing polyacrylamide gel
electrophoresis of representative DNA-templated reactions listed in
FIGS. 23A-23D and 25A-25B. The structures of reagents and templates
correspond to the numbering in FIGS. 23A-23D and 25A-25B. Lanes 1,
3, 5, 7, 9, 11: reaction of matched (complementary or "M") reagents
and templates under conditions listed in FIGS. 23A-23D and 25A-25B
(the reaction between 4 and 6 was mediated by DMT-MM). Lanes 2, 4,
6, 8, 10, 12: reaction of mismatched (non-complementary or "X")
reagents and templates under conditions identical to those in lanes
1, 3, 5, 7, 9 and 11, respectively.
The sequences of oligonucleotide templates and reagents are as
follows (5' to 3' direction, n refers to the number of bases
between reactive groups when template and reagent are annealed as
shown in FIG. 26A). 1: TGGTACGAATTCGACTCGGG [SEQ ID NO: 45]; 2 and
3 matched: GAGTCGAATTCGTACC [SEQ ID NO: 46]; 2 and 3 mismatched:
GGGCTCAGCTTCCCCA [SEQ ID NO: 47]; 4 and 5:
GGTACGAATTCGACTCGGGAATACCACCTT [SEQ ID NO: 48]; 6-9 matched (n=10):
TCCCGAGTCG [SEQ ID NO: 49]; 6 matched (n=0): AATTCGTACC [SEQ ID NO:
50]; 6-9 mismatched: TCACCTAGCA [SEQ ID NO: 51]; 11, 12, 14, 17,
18, 20: GGTACGAATTCGACTCGGGA [SEQ ID NO: 52]; 10, 13, 16, 19
matched: TCCCGAGTCGAATTCGTACC [SEQ ID NO: 53]; 10, 13, 16, 19
mismatched: GGGCTCAGCTTCCCCATAAT [SEQ ID NO: 54]; 15 matched:
AATTCGTACC [SEQ ID NO: 55]; 15 mismatched: TCGTATTCCA [SEQ ID NO:
56]; template for n=10 vs. n=0 comparison:
TAGCGATTACGGTACGAATTCGACTCGGGA [SEQ ID NO: 57].
Reaction yields were quantitated by denaturing PAGE followed by
ethidium bromide staining, UV visualization, and charge-coupled
device (CCD)-based densitometry of product and template starting
material bands. Yield calculations assumed that templates and
products stained with equal intensity per base; for those cases in
which products were partially double-stranded during quantitation,
changes in staining intensity may have resulted in higher apparent
yields.
Example 3
Multi-Step Small Molecule Synthesis Programmed by DNA Templates
This Example demonstrates that it is possible to perform multi-step
small molecule synthesis via DNA-templated chemistries.
DNA-templated synthesis can direct a wide variety of powerful
chemical reactions with high sequence-specificity and without
requiring structural mimicry of the DNA backbone. The application
of this approach to synthetic molecules of useful complexity,
however, requires the development of general methods to permit the
product of a DNA-templated reaction to undergo subsequent
DNA-templated transformations.
Multi-step DNA-templated small molecule synthesis faces two major
challenges beyond those associated with DNA-templated synthesis in
general. First, the DNA used to direct reagents to appropriate
templates must be removed from the product of a DNA-templated
reaction prior to subsequent DNA-templated synthetic steps in order
to prevent undesired hybridization to the template. Second,
multi-step synthesis often requires the purification and isolation
of intermediate products. To address these challenges, three
distinct strategies have been developed (i) to link chemical
reagents (reactive units) with their decoding DNA oligonucleotides
and (ii) to purify product after any DNA-templated synthetic
step.
When possible, an ideal reagent-oligonucleotide linker for
DNA-templated synthesis positions the oligonucleotide as a leaving
group of the reagent. Under this "autocleaving" linker strategy,
the oligonucleotide-reagent bond is cleaved as a natural chemical
consequence of the reaction (see, FIG. 28A).
As the first example of this approach applied to DNA-templated
chemistry, a dansylated Wittig phosphorane reagent (1) was
synthesized in which the decoding DNA oligonucleotide was attached
to one of the aryl phosphine groups (Hughes (1996) TETRAHEDRON
LETT. 37: 7595). DNA-templated Wittig olefination with
aldehyde-linked template 2 resulted in the efficient transfer of
the fluorescent dansyl group from the reagent to the template to
provide olefin 3 (FIG. 28A). As a second example of an autocleaving
linker, DNA-linked thioester 4, when activated with Ag(I) at pH 7.0
(Zhang et al. (1999) J. AM. CHEM. SOC. 121: 3311) acylated
amino-terminated template 5 to afford amide product 6 (FIG.
28B).
Ribosomal protein biosynthesis uses aminoacylated tRNAs in a
similar autocleaving linker format to mediate RNA-templated peptide
bond formation. To purify desired products away from unreacted
reagents and from cleaved oligonucleotides following DNA-templated
reactions using autocleaving linkers, biotinylated reagent
oligonucleotides and washing crude reactions with
streptavidin-linked magnetic beads (see, FIG. 30A) were utilized.
Although this approach does not separate reacted templates from
unreacted templates, unreacted templates can be removed in
subsequent DNA-templated reaction and purification steps.
Reagents bearing more than one functional group can be linked to
their decoding DNA oligonucleotides through second and third linker
strategies. In the "scarless linker" approach (FIG. 28C), one
functional group of the reagent is reserved for DNA-templated bond
formation, while the second functional group is used to attach a
linker that can be cleaved without introducing additional unwanted
chemical functionality. The DNA-templated reaction then is followed
by cleavage of the linker attached through the second functional
group to afford desired products (FIG. 28C). For example, a series
of aminoacylation reagents such as (D)-Phe derivative 7 were
synthesized in which the .alpha.-amine is connected through a
carbamoylethylsulfone linker (Zarling et al. (1980) J. IMMUNOLOGY
124: 913) to its decoding DNA oligonucleotide. The product (8) of
DNA-templated amide bond formation using this reagent and an
amine-terminated template (5) was treated with aqueous base to
effect the quantitative elimination and spontaneous decarboxylation
of the linker, affording product 9 containing the cleanly
transferred amino acid group (FIG. 28C). This sulfone linker is
stable in pH 7.5 or lower buffer at 25.degree. C. for more than 24
hours yet undergoes quantitative cleavage when exposed to pH 11.8
buffer for 2 hours at 37 C.
In some cases it may be advantageous to introduce one or more atoms
new chemical groups as a consequence of linker cleavage. Under a
third linker strategy, linker cleavage generates a "useful scar"
that can be functionalized in subsequent steps (FIG. 28C). As an
example of this class of linker, amino acid reagents such as the
(L)-Phe derivative 10 were generated linked through 1,2-diols
(Fruchart et al. (1999) TETRAHEDRON LETT. 40: 6225) to their
decoding DNA oligonucleotides. Following DNA-templated amide bond
formation with amine terminated template (5), this linker was
quantitatively cleaved by oxidation with 50 mM aqueous sodium
periodate (NaIO.sub.4) at pH 5.0 to afford product 12 containing an
aldehyde group appropriate for subsequent functionalization (for
example, in a DNA-templated Wittig olefination, reductive
amination, or nitrolaldol addition).
FIG. 29 shows the results of exemplary DNA-templated synthesis
experiments using autocleaving linkers, scarless linkers, and
useful scar linkers. The depicted reactions were analyzed by
denaturing PAGE. Lanes 1-3 were visualized using UV light without
DNA staining; lanes 4-10 were visualized by staining, with ethidium
bromide following by UV transillumination. Conditions for 1 to 3
were: one equivalent each of reagent and template, 0.1 M TAPS
buffer pH 8.5, 1 M NaCl, at 25.degree. C. for 1.5 hours. Conditions
for 5 to 6 were: three equivalents of 4, 0.1 M MES buffer pH 7.0, 1
M sodium nitrite (NaNO.sub.2) 10 mM silver nitrate (AgNO.sub.3), at
37.degree. C. for 8 hours. Conditions for 8 to 9 were 0.1 M
3-(cyclohexylamino)-1-propanesulfonic acid (CAPS) buffer pH 11.8,
60 mM .beta.-mercaptoethanol (BME), at 37.degree. C. for 2 hours.
Finally, conditions for 11 to 12 were: 50 mM aqueous NaIO.sub.4, at
25.degree. C. for 2 hours. R.sub.1.dbd.NH(CH.sub.2).sub.2NH-dansyl;
R.sub.2=biotin.
Desired products generated from DNA-templated reactions using the
scarless or useful scar linkers can be readily purified using
biotinylated reagent oligonucleotides (FIG. 30B). Reagent
oligonucleotides together with desired products are first captured
on streptavidin-linked magnetic beads. Any unreacted template bound
to reagent by base pairing is removed by washing the beads with
buffer containing 5 M guanidinium chloride. Biotinylated molecules
remain bound to the streptavidin beads under these conditions.
Desired product then is isolated in pure form by eluting the beads
with linker cleavage buffer (in the examples above, either pH 11 or
sodium periodate (NaIO.sub.4)-containing buffer), while reacted and
unreacted reagents remain bound to the beads.
As one example of a specific library generated as described above,
three iterated cycles of DNA-templated amide formation, traceless
linker cleavage, and purification with streptavidin-linked beads
were used to generate a non-natural tripeptide (FIGS. 31A-B). Each
amino acid reagent was linked to a unique biotinylated 10-base DNA
oligonucleotide through the sulfone linker described above. The
30-base amine-terminated template programmed to direct the
tripeptide synthesis contained three consecutive 10-base regions
that were complementary to the three reagents, mimicking the
strategy that would be used in a multi-step DNA-templated small
molecule library synthesis.
In the first step, two equivalents of 13 were activated by
treatment with 20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES buffer pH 5.5,
and 1 M NaCl, for 10 minutes at 25.degree. C. The template then was
added in 0.1 M MOPS pH 7.5, and 1M NaCl, at 25.degree. C. and was
allowed to react for 1 hour. The free amine group in 14 then was
elaborated in a second and third round of DNA-templated amide
formation and linker cleavage to afford dipeptide 15 and tripeptide
16 using the following conditions: two equivalents of reagent, 50
mM DMT-MM, 0.1 M MOPS buffer pH 7.0, 1 M NaCl, at 25.degree. C. for
6 hours. Desired product after each step was purified by capture on
avidin-linked beads and elution with 0.1 M CAPS buffer pH 11.8, 60
mM BME, at 37.degree. C. for 2 hours. The progress of each reaction
and purification was followed by denaturing polyacrylamide gel
electrophoresis (FIG. 31B, bottom). Lanes 3, 6, and 9 represent
control reactions using reagents containing scrambled
oligonucleotide sequences.
The progress of each reaction, purification, and sulfone linker
cleavage step was followed by denaturing polyacrylamide gel
electrophoresis. The final tripeptide linked to template 16 was
digested with the restriction endonuclease EcoRI and the digestion
fragment containing the tripeptide was characterized by MALDI mass
spectrometry. Beginning with 2 nmol (.about.20 .mu.g) of starting
material, sufficient tripeptide product was generated to serve as
the template for more than 10.sup.6 in vitro selections and PCR
reactions (Kramer et al. (1999) CURRENT PROTOCOLS IN MOL. BIOL. 3:
15.1) (assuming 1/10,000 molecules survive selection). No
significant product was generated when the starting material
template was capped with acetic anhydride, or when control reagents
containing sequence mismatches were used instead of the
complementary reagents (FIG. 31B).
A non-peptidic multi-step DNA-templated small molecule synthesis
that uses all three linker strategies developed above was also
performed (FIG. 32A-32B). An amine-terminated 30-base template was
subjected to DNA-templated amide bond formation using an aminoacyl
donor reagent (17) containing the diol linker and a biotinylated
10-base oligonucleotide to afford amide 18 (two equivalents 17 in
20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES buffer pH 5.5, 1 M NaCl, 10
minutes, 25.degree. C., then add to template in 0.1 M MOPS pH 7.5,
1M NaCl at 16.degree. C. for 8 hours). The desired product then was
isolated by capturing the crude reaction on streptavidin beads
followed by cleaving the linker with NaIO.sub.4 to generate
aldehyde 19. The DNA-templated Wittig reaction of 19 with the
biotinylated autocleaving phosphorane reagent 20 afforded
fumaramide 21 (three equivalents 20, 0.1 M TAPS pH 9.0, 3 M NaCl at
25.degree. C. for 48 hours). The products from the second
DNA-templated reaction were partially purified by washing with
streptavidin beads to remove reacted and unreacted reagent. In the
third DNA-templated step, fumaramide 21 was subjected to a
DNA-templated conjugate addition (Gartner et al. (2001) J. AM.
CHEM. SOC. 123: 6961) using thiol reagent 22 linked through the
sulfone linker to a biotinylated oligonucleotide (three equivalents
22, 0.1 M TAPS pH 8.5, 1 M NaCl at 25.degree. C. for 21 hours). The
desired conjugate addition product (23) was purified by
immobilization with streptavidin beads. Linker cleavage with pH 11
buffer afforded final product 24 in 5-10% overall isolated yield
for the three bond forming reactions, two linker cleavage steps,
and three purifications (FIGS. 32A-32B).
The final product was digested with EcoRI and the mass of the small
molecule-linked template fragment was confirmed by MALDI mass
spectrometry (exact mass: 2568, observed mass: 2566.+-.5). As in
the tripeptide example, each of the three reagents used during this
multi-step synthesis annealed at a unique location on the DNA
template, and control reactions with sequence mismatches yielded no
product (FIG. 32B, bottom). In FIG. 32B, bottom lanes 3, 6, and 9
represent control reactions. As expected, control reactions in
which the Wittig reagent was omitted (step 2) also did not generate
product following the third step.
Taken together, the DNA-templated syntheses of compounds 16 and 24
demonstrate the ability of DNA to direct the sequence-programmed
multi-step synthesis of both oligomeric and non-oligomeric small
molecules unrelated in structure to nucleic acids.
Example 4
Exemplary Reactions in Organic Solvents
As demonstrated herein, a variety of DNA-templated reactions can
occur in aqueous media. It has also been discovered that
DNA-templated reactions can occur in organic solvents, thus greatly
expanding the scope of DNA-templated synthesis. Specifically, DNA
templates and reagents have been complexed with long chain
tetraalkylammonium cations (see, Jost et al. (1989) NUCLEIC ACIDS
RES. 17: 2143; Mel'nikov et al. (1999) LANGMUIR 15: 1923-1928) to
permit quantitative dissolution of reaction components in anhydrous
organic solvents including CH.sub.2Cl.sub.2, CHCl.sub.3, DMF and
methanol. Surprisingly, it was found that DNA-templated synthesis
can indeed occur in anhydrous organic solvents with high sequence
selectivity.
FIG. 33 shows DNA-templated amide bond formation reactions where
the reagents and templates are complexed with
dimethyldidodecylammonium cations either in separate vessels or
after preannealing in water, lyophilized to dryness, dissolved in
CH.sub.2Cl.sub.2, and mixed together. Matched, but not mismatched,
reactions provided products both when reactants were preannealed in
aqueous solution and when they were mixed for the first time in
CH.sub.2Cl.sub.2 (FIG. 33). DNA-templated amide formation and
Pd-mediated Heck coupling in anhydrous DMF also proceeded
sequence-specifically.
These observations of sequence-specific DNA-templated synthesis in
organic solvents imply the presence of at least some secondary
structure within tetraalkylammonium-complexed DNA in organic media,
and should permit DNA receptors and catalysts to be evolved towards
stereoselective binding or catalytic properties in organic
solvents. Specifically, DNA-templated reactions that are known to
occur in aqueous media, including conjugate additions,
cycloadditions, displacement reactions, and Pd-mediated couplings
can also be performed in organic solvents.
It is contemplated that reactions in organic solvents may be
utilized that are inefficient or impossible to perform in water.
For example, while Ru-catalyzed olefin metathesis in water has been
reported (Lynn et al., (1998) J. AM. CHEM. SOC. 120: 1627-1628;
Lynn et al. (2000) J. AM. CHEM. SOC. 122: 6601-6609; Mohr et al.
(1996) ORGANOMETALLICS 15: 4317-4325), the aqueous metathesis
system is extremely sensitive to the identities of the functional
groups. The functional group tolerance of Ru-catalyzed olefin
metathesis in organic solvents, however, is significantly more
robust. Some exemplary reactions to utilize in organic solvents
include, but are not limited to 1,3-dipolar cycloaddition between
nitrones and olefins which can proceed through transition states
that are less polar than ground state starting materials.
Example 5
New Architectures for Nucleic Acid-Templated Synthesis
This Example discloses two different template architectures that
further expand the scope of nucleic acid-templated synthesis.
During a nucleic acid-templated chemical reaction a portion of a
template anneals to a complementary sequence of an
oligonucleotide-linked reagent, holding functional groups on the
template and transfer unit in reactive proximity. Template
architecture can have a profound effect on the nature of the
resulting reaction, raising the possibility of manipulating
reaction conditions by rationally designing template-reagent
complexes with different secondary structures.
During the course of DNA templated synthesis using the end-of-helix
("E") and hairpin ("H") templates (see, Example 1), two challenges
emerged. First, some DNA-templated reactions do not proceed
efficiently when the annealed reactive groups on the template and
transfer unit (reagent) are separated by even small numbers of
bases. Using the E or H architectures, "distance-dependent"
reactions can only be encoded by template bases at the reactive end
of the template. Second, the presence of double-stranded DNA
between annealed reactive groups can greatly reduce the efficiency
of templated reactions because, under certain circumstances a
single-stranded template may need to be flexible. This may preclude
the possibility of performing two or more reactions in a single
DNA-templated step using the E or H architectures even though the
template oligonucleotide may contain enough bases to encode
multiple reactions. This Example discuses two new template
architectures, which overcome each of these challenges.
It was hypothesized that the distance dependence of certain
DNA-templated reactions such as 1,3-dipolar cycloadditions and
reductive amination could be overcome by designing a new
architecture that permits a reagent to anneal to two distinct and
spatially separated regions of the template. In the "omega" or
".OMEGA." architecture (see, FIG. 7), the template oligonucleotide
contains a small number of constant bases at, for example, the
reactive 5' end of the template in addition to distal coding
regions. The oligonucleotide of the transfer unit for the .OMEGA.
architecture contains at its reactive 3' end the bases that
complement the constant region of the template followed by bases
that complement a coding region anywhere on the template. The
constant regions were designed to be of insufficient length to
anneal in the absence of a complementary coding region. When the
coding region of the template and transfer unit are complementary
and anneal, the elevated effective molarity of the constant regions
induces their annealing. Constant region annealing forms a bulge
(resembling an .OMEGA.) in the otherwise double-stranded
template-reagent complex and places groups at the ends of the
template and reagent in reactive proximity. This design permits
distance-dependent DNA-templated reactions to be encoded by bases
distal from the reactive end of the template.
The efficiency of DNA-templated synthesis using the .OMEGA.
architecture was compared with that of the standard E and H
architectures. The .OMEGA. architectures studied comprise (i) three
to five constant bases at the 5' end of the template followed by
(ii) a five- to 17-base loop and (iii) a ten-base coding region. As
a basis for comparison, four different classes of DNA-templated
reactions were performed that collectively span the range of
distance dependence observed to date.
Amine acylation reactions are representative of distance
independent reactions that proceed efficiently even when
considerable distances (e.g., 30 bases) separate the amine and
carboxylate groups. As expected, amine acylation (20 mM DMT-MM, pH
7.0, at 30.degree. C. for 12 hours) proceeded efficiently (46-96%
yield) in all architectures with both small and large distances
between reactive groups on the reagent and template (FIG. 34, lanes
1-5; and FIG. 35A). The .OMEGA. architecture mediated efficient
amine acylation with three, four, or five constant bases at the
reactive ends of the template and reagent and 10 or 20 bases
between annealed reactants (n=10 or 20). Importantly, control
reactions in which the distal coding region contained three
sequence mismatches failed to generate significant product despite
the presence of the complementary three- to five-base constant
regions at the ends of the template and reagent (see, FIG. 34, lane
5 for a representative example). The .OMEGA. architecture,
therefore, did not impede the efficiency or sequence-specificity of
the distance-independent amine acylation reaction.
DNA-templated Wittig olefination reactions proceed at a
significantly lower rate when the aldehyde and phosphorane are
separated by larger numbers of template bases, even though product
yields typically are excellent after 12 hours or more of reaction
regardless of intervening distance. After only 2 hours of reaction
(pH 7.5, 30.degree. C.) in the E or H architectures, however,
yields of olefin products were three- to six-fold lower when
reactants were separated by ten or more bases (n=10 or 20) than
when reactants are separated by only one base (n=1) (FIG. 34, lanes
6-7, and FIG. 35B). In contrast, the .OMEGA. architecture with four
or five constant bases at the reactive end resulted in efficient
and sequence-specific Wittig product formation after 2 hours of
reaction even when 10 or 20 bases separated the coding region and
reactive end of the template (FIG. 34, lanes 8-9, and FIG. 35B).
These results suggest that the constant regions at the reactive
ends of the template and transfer unit in the .OMEGA. architecture
permit the aldehyde and phosphorane moieties to react at an
effective concentration comparable to that achieved with the
E-architecture when n=1 (FIG. 34).
Among the many DNA-templated reactions studied to date, the
1,3-dipolar cycloaddition and reductive amination reactions
demonstrate the most pronounced distance dependence. Both reactions
proceed in low to modest efficiency (7%-44% yield) under standard
reaction conditions using the E or H architectures when 10 or 20
bases separate the annealed reactive groups (FIG. 34, lanes 10-11
and 14-15, and FIGS. 35C-35D). This distance dependence limits the
positions on a DNA template that can encode these or other
similarly distant dependent reactions. In contrast, both
1,3-dipolar cycloaddition and reductive amination proceed
efficiently (up to 97% yield) and sequence-specifically when
encoded by template bases 15-25 bases away from the functionalized
end of the template using the .OMEGA. architecture with four or
five constant bases (FIG. 34, lanes 12-13 and 16-17, and FIGS.
35C-35D). These results demonstrate that the templates .OMEGA.
architecture permits distance-dependent reactions to be efficiently
directed by DNA bases far from the reactive end of the template. By
overcoming the distance dependence of these reactions while
preserving the efficiency of distant independent reactions, the
.OMEGA. architecture may permit virtually any contiguous subset of
bases in a single-stranded 30-base template to encode any viable
DNA-templated reaction. Interestingly, the .OMEGA. templates with
only three constant bases at their reactive ends do not
consistently improve the efficiency of these reactions compared
with the E-architecture (FIGS. 35C-35D), suggesting that four or
five constant bases may be required in the .OMEGA. architecture to
fully realize favorable proximity effects.
In order to probe the structural features underlying the observed
properties of the .OMEGA. architecture, the thermal denaturation of
the .OMEGA.-5 and E architectures using n=10 and n=20 reagents were
characterized. For all template-reagent combinations, only a single
cooperative melting transition was observed. Compared to the E
architecture reagent lacking the five-base constant region, the
.OMEGA.-5 reagent increased the hypochromicity upon annealing by
.about.50% but did not significantly affect melting temperature in
either phosphate-buffered saline (PBS) or in 50 mM sodium phosphate
pH 7.2 with 1 M NaCl (FIG. 36). These results are consistent with a
model in which template-reagent annealing in the .OMEGA.
architecture is dominated by coding region interactions even though
the constant region forms secondary structure once the coding
region is annealed. The entropic cost of partially ordering the
loop between the coding and constant regions may, therefore, be
offset by the favorable interactions that arise upon annealing of
the constant region.
DNA templates of arbitrary length are easy to synthesize and
undesired cross reactivity between reactants in the same solution
can be avoided using concentrations that are too low to allow
non-complementary reactants to react intermolecularly. These
features of DNA-templated synthesis permit more than one
DNA-templated reaction to take place on a single template in one
solution, saving the effort associated with additional
DNA-templated steps and product purifications.
Multiple DNA-templated reactions per step can be difficult using
the E, H, or .OMEGA. architectures, because the reagent
oligonucleotide that remains annealed to the template following the
first reaction forms a relatively rigid double helix that can
prevent a second reagent annealed further away along the template
from encountering the reactive end of the template. To overcome
this, the reactive group on the template was moved from the end of
the oligonucleotide to the middle, attaching the reactive group to
the non-Watson-Crick face of a base. This "T" architecture (see,
FIG. 7G) was designed to permit two DNA-templated reactions, one
with a reagent coupled to the 5' end of the oligonucleotide of a
first transfer unit and one with a reagent coupled to the 3' end of
the oligonucleotide of a second transfer unit, to take place
sequence-specifically in the same solution on a single
template.
To test the viability of the T architecture in DNA-templated
reactions, the efficiency of the amine acylation, Wittig
olefination, 1,3-dipolar cycloaddition, and reductive amination
reactions using the T architecture was studied. The T architecture
sequence-specifically directed these four reactions with
efficiencies comparable to or greater than those of the E or H
architectures (FIG. 37, 69-100% yield when n=1). The observed
degree of distance dependence using the T architecture for each of
the four reactions was consistent with the above findings (compare
FIG. 37 and FIG. 35). Together these results demonstrate that the T
architecture can mediate sequence-specific and efficient
DNA-templated synthesis.
Once the ability of the T architecture to support efficient
DNA-templated synthesis was established, the ability of the T
architecture to direct two DNA-templated reactions on one template
in one solution was studied. Two different two-reaction schemes
using the T architecture were performed. In the first scheme,
depicted in FIG. 38A, a benzaldehyde-linked T template (1) was
combined with a phosphine-linked reagent (2) and an
.alpha.-iodoamide-linked reagent (3) in a single solution (pH 8.5,
1 M NaCl, at 25.degree. C. for 1 hour). The phosphine-linked
oligonucleotide complemented ten bases of the template 5' of the
aldehyde (n=-4), while the iodide-linked oligonucleotide
complemented ten bases 3' of the aldehyde (n=0). DNA-templated
S.sub.N2 reaction between the phosphine and .alpha.-iodoamide
generated the corresponding phosphorane, which then participated in
a DNA-templated Wittig reaction to generate cinnanamide 4 in 52%
overall yield after 1 hour (FIG. 38B, lanes 9-10). Control
reactions containing sequence mismatches in either reagent
generated no detectable product. The additional control reaction
lacking the aldehyde group on the template generated only the
S.sub.N2 reaction product (FIG. 38B, lanes 3-4) while control
reactions lacking either the phosphine group or the
.alpha.-iodoamide group did not generate any detectable products
(FIG. 38B, lanes 5-8).
In a second two-reaction scheme mediated by the T architecture,
depicted in FIG. 38C, an amine-linked T template (5) was combined
with a propargylglycine-linked 5' reagent (6) at n=-1 and a phenyl
azide-linked 3' reagent (7) at n=1. The addition of 20 mM DMT-MM at
pH 7.0 to induce amide formation followed by the addition of 500
.mu.M copper(II) sulfate and sodium ascorbate to induce the
recently reported Sharpless-modified Huisgen 1,3-dipolar
cycloaddition provided 1,4-disubstituted triazoyl alanine adduct 8
in 32% overall yield.
Taken together, these observations show that the T architecture
permits two sequence-specific DNA-templated reactions to take place
on one template in one solution. Importantly, the T architecture
templates described above were accepted as efficient templates for
both a single cycle of primer extension as well as standard PCR
amplification using Taq DNA polymerase, consistent with the known
tolerance of several DNA polymerases for modifications to the
non-Watson-Crick face of DNA templates. In addition to reducing the
number of separate DNA-templated steps needed to synthesize a
target structure, this architecture may also permit three-component
reactions commonly used to build structural complexity in synthetic
libraries to be performed in a DNA-templated format.
In summary, the .OMEGA. and T architectures significantly expand
the scope of DNA-templated synthesis. By enabling
distance-dependent DNA-templated reactions to be encoded by bases
far away from the reactive end of the template, the omega
architecture expands the types of reactions that can be encoded
anywhere on a DNA template. The T architecture permits two
DNA-templated reactions to take place on a single template in one
step.
Materials and Methods
Oligonucleotide synthesis. Unless otherwise specified, DNA
oligonucleotides were synthesized and functionalized as previously
described using
2-[2-(4-monomethoxytrityl)aminoethoxy]ethyl-(2-cyanoethyl)-N,N-diisopropy-
l-phosphoramidite (Glen Research, Sterling, Va., USA) for
5'-functionalized oligonucleotides, and using
(2-dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-1-succ-
inoyl)-long chain alkylamino-CPG (Glen Research, Sterling, Va.,
USA) for 3'-functionalized oligonucleotides (Calderone et al.
(2002) ANGEW. CHEM. INT. ED. ENGL. 41: 4104; (2002) ANGEW. CHEM.
114: 4278). In the case of templates for the T architecture, amine
groups were added using
5'-dimethoxytrityl-5-[N-(trifluoroacetylaminohexyl)-3-acrylimido]-2'-deox-
yuridine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite
(Glen Research, Sterling, Va., USA) and then acylated as reported
previously (Calderone et al. (2002) supra).
Amine Acylation. Amine-labeled and carboxylic acid-labeled DNA were
combined in aqueous 100 mM MOPS buffer, 1 M NaCl, pH 7.0 (60 nM in
template DNA, 120 nM in reagent DNA) in the presence of 20 mM
DMT-MM. Reactions proceeded for 12 hours at 25.degree. C.
Wittig Olefination. Aldehyde-labeled and phosphorane-labeled DNA
were combined in aqueous 100 mM MOPS, 1 M NaCl, pH 7.5 (60 nM in
template DNA, 120 nM in reagent DNA). Reactions proceeded for 2
hours at 30.degree. C.
1,3-Dipolar Cycloaddition. Dialdehyde-labeled DNA was incubated in
260 mM N-methylhydroxylamine hydrochloride for 1 hour at room
temperature (Gartner et al. (2002) J. AM. CHEM. SOC. 124: 10304).
It was subsequently combined with succinimide-labeled DNA in
aqueous 50 mM MOPS, 2.8 M NaCl, pH 7.5 (final concentrations of
N-methylhydroxylamine hydrochloride 0.75 mM, 60 nM in template DNA
and 90 nM in reagent DNA). Reactions proceeded for 12 hours at
37.degree. C.
Reductive Amination. Amine-labeled and aldehyde-labeled DNA were
combined in aqueous 100 mM MES buffer, 1 M NaCl, pH 6.0 (60 nM in
template DNA, 120 nM in reagent DNA). Sodium cyanoborohydride was
added as a 5 M stock in 1 M NaOH to a final concentration of 38 mM,
and reactions proceeded for 2 hours at 25.degree. C. Reactions were
quenched by ethanol precipitation in the presence of 15 mM
methylamine.
T Architecture-mediated Conversion of Compound 1 to 4. The
5'-phosphine-linked oligonucleotide (2) was generated by coupling
N-succinimidyliodoacetate (SIA) to the amine derived from
12-(4-monomethoxytritylamino)dodecyl-(2-cyanoethyl)-(N,N-diisopropyl)-pho-
sphoramidite (Glen Research, Sterling, Va., USA) using the T (n=-4)
oligonucleotide listed below, followed by treatment with
4-diphenylphosphinobenzoic acid as described previously (Gartner et
al. (2002) supra). The 3'-.OMEGA.-iodoamide-linked reagent (3) was
prepared by reacting the T (n=1) oligonucleotide (see below) with
SIA as described previously (Gartner et al. (2001) supra).
Aldehyde-labeled template (1) was prepared by reacting the "T
template" oligonucleotide (see below) with para-formyl benzoic acid
N-hydroxysuccinimidyl ester as described previously (Gartner et al.
(2002) ANGEW. CHEM. INT. ED. 41: 1796; (2002) ANGEW. CHEM. 114:
1874). Template 1 was combined with reagents 2 and 3 in aqueous 200
mM N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES)
buffer at pH 8.5 with 1 M NaCl, (63 nM template and 125 nM of each
reagent). Reactions proceeded for up to 1 hour at 25.degree. C.
The results of denaturing polyacrylamide gel electrophoresis
analysis of these reactions is shown in FIG. 38B. The 30-base T
architecture template (1) containing an aldehyde group was present
in lanes 1-2 and lanes 5-10. A template lacking the aldehyde group
but otherwise identical to (1) was present in lanes 3 and 4.
DNA-linked phosphine reagent (2) was present in lanes 3-6 and lanes
9-10. DNA-linked .alpha.-iodoamide reagent (3) was present in lanes
3-4 and lanes 7-10. Lanes 1, 3, 5, 7, and 9 show reactions after 30
minutes. Lanes 2, 4, 6, 8, and 10 show reactions after 1 hour.
T Architecture-mediated Conversion of Compound 5 to 8. The
5'-propargylglycine linked oligonucleotide (6) was generated by
combining the corresponding T (n=-1) 5'-amine-linked reagent
oligonucleotide (see below) with 2 mg/mL
bis(sulfosuccinimidyl)suberate in 9:1 200 mM sodium phosphate pH
7.2:DMF for 10 minutes at 25.degree. C., followed by treatment with
0.3 vol of 300 mM racemic propargylglycine in 300 mM NaOH for 2
hours at 25.degree. C. The 3'-azido linked oligonucleotide (7) was
generated by combining the T (n=1) amine-linked reagent
oligonucleotide (see below) with 2 mg/mL
(N-hydroxysuccinimidyl)-4-azidobenzoate in 9:1 200 mM sodium
phosphate pH 7.2:DMF for 2 hours at 25.degree. C. Reagents 6 and 7
were purified by gel filtration and reverse-phase HPLC. Template 5
and reagents 6 and 7 were combined in aqueous 100 mM MOPS pH 7.0 in
the presence of 1 M NaCl and 20 mM DMT-MM for 12 hours (60 nM
template, 120 nM reagents) at 25.degree. C. Copper (II) sulfate
pentahydrate and sodium ascorbate were then added to 500 .mu.M
each. After 1 hour at 25.degree. C., reactions were quenched by
ethanol precipitation.
DNA Oligonucleotide Sequences Used. E or .OMEGA. template:
5'-H.sub.2N-GGT ACG AAT TCG ACT CGG GAA TAC CAC CTT [SEQ ID NO:
58]. H template: 5'-H.sub.2N-CGC GAG CGT ACG CTC GCG GGT ACG AAT
TCG ACT CGG GAA TAC CAC CTT [SEQ ID NO: 59]. T template: 5'-GGT ACG
AAT TCG AC(dT-NH.sub.2) CGG GAA TAC CAC CTT [SEQ ID NO: 60]. E or H
reagent (n=1): 5'-AAT TCG TAC C-NH.sub.2 [SEQ ID NO: 61]. E or H
reagent (n=10): 5'-TCC CGA GTC G-NH.sub.2 [SEQ ID NO: 62]. E or H
reagent (n=20): 5'-AAG GTG GTA T-NH.sub.2 [SEQ ID NO: 63].
Mismatched E or H reagent: 5'-TCC CTG ATC G-NH.sub.2 [SEQ ID NO:
64]. .OMEGA.-3 reagent (n=10): 5'-TCC CGA GTC GAC C-NH.sub.2 [SEQ
ID NO: 65]. .OMEGA.-4 reagent (n=10): 5'-TCC CGA GTC GTA
CC-NH.sub.2 [SEQ ID NO: 66]. .OMEGA.-5 reagent (n=10): 5'-TCC CGA
GTC GGT ACC-NH.sub.2-[SEQ ID NO: 67]. .OMEGA.-3 reagent (n=20):
5'-AAG GTG GTA TAC C-NH.sub.2 [SEQ ID NO: 68]. .OMEGA.-4 reagent
(n=20): 5'-AAG GTG GTA TTA CC-NH.sub.2 [SEQ ID NO: 69]. .OMEGA.-5
reagent (n=20): 5'-AAG GTG GTA TGT ACC-NH.sub.2 [SEQ ID NO: 70].
Mismatched .OMEGA.-3 reagent: 5'-TCC CTG ATC GAC C-NH.sub.2 [SEQ ID
NO: 71]. Mismatched .OMEGA.-4 reagent: 5'-TCC CTG ATC GTA
CC-NH.sub.2 [SEQ ID NO: 72]. Mismatched .OMEGA.-5 reagent: 5'-TCC
CTG ATC GGT ACC-NH.sub.2 [SEQ ID NO: 73]. T reagent (n=1): 5'-GGT
ATT CCC G-NH.sub.2 [SEQ ID NO: 74]. T reagent (n=2): 5'-TGG TAT TCC
C-NH.sub.2 [SEQ ID NO: 75]. T reagent (n=3): 5'-GTG GTA TTC
C-NH.sub.2 [SEQ ID NO: 76]. T reagent (n=4): 5'-GGT GGT ATT
C-NH.sub.2 [SEQ ID NO: 77]. T reagent (n=5): 5'-AGG TGG TAT
T-NH.sub.2 [SEQ ID NO: 78]. T reagent (n=-1): 5'-NH.sub.2-GTC GAA
TTC G [SEQ ID NO: 79]. T reagent (n=-4) for 2: 5'-[C.sub.12-amine
linker]-AAT TCG TAC C [SEQ ID NO: 80].
Reaction yields were quantitated by denaturing polyacrylamide gel
electrophoresis followed by ethidium bromide staining, UV
visualization, and CCD-based densitometry of product and template
starting material bands. Yield calculations assumed that templates
and products were denatured and, therefore, stained with comparable
intensity per base; for those cases in which products are partially
double-stranded during quantitation, changes in staining intensity
may result in higher apparent yields. Representative reaction
products were characterized by MALDI mass spectrometry in addition
to denaturing polyacrylamide gel electrophoresis.
Melting curves were obtained on a Hewlett-Packard 8453 UV-visible
spectrophotometer using a Hewlett-Packard 89090A Peltier
thermocontroller. Absorbances of template-reagent pairs (1.5 .mu.M
each) at 260 nm were measured every 1.degree. C. from 20.degree. C.
to 80.degree. C. holding for 1 minute at each temperature in either
phosphate-buffered saline ("PBS," 137 mM NaCl, 2.7 mM potassium
chloride, 1.4 mM potassium phosphate, 10 mM sodium phosphate, pH
7.4) or in high salt phosphate buffer ("HSB," 50 mM sodium
phosphate pH 7.2, 1 M NaCl).
Example 6
Stereoselectivity in Nucleic Acid-Templated Synthesis
This Example demonstrates that it is possible to perform
stereoselective nucleic acid-templated syntheses. The chiral nature
of DNA raises the possibility that DNA-templated synthesis can
proceed stereoselectively without the assistance of chiral groups
beyond those present in DNA, thereby transferring not only sequence
but also stereochemical information from the template to the
product.
Stereoselectivity was examined in the context of DNA-templated
nucleophilic substitution reactions. Hairpin architecture templates
conjugated at their 5' amino termini directly to (S)- or
(R)-2-bromopropionamide were combined with 3' thiol-linked reagent
oligonucleotides at 25.degree. C. (FIG. 39A) (Gartner et al. (2001)
supra; Gartner et al. (2003) ANGEW. CHEM. INT. ED. 42: 1370). The
exact structure of the hairpin template and its complimentary
reagent (FIG. 39A) were as follows:
TABLE-US-00011 Template: 5'-BrCH(CH.sub.3)CONH-TCG CGA GCG TAC GCT
CGC GAG GTA CGA ATT C-3' [SEQ ID NO: 81] Reagent: 5'-GAA TTC GTA
CC-(CH.sub.2).sub.3SH-3' [SEQ ID NO: 82]
The stability of the bromides under the reaction conditions was
confirmed by several independent methods. Initial rates of
thioether product formation were determined by denaturing gel
electrophoresis and the products were additionally characterized by
MALDI-TOF mass spectrometry. Apparent rates of product formation
were 4.0.+-.0.2-fold higher for (S)-bromide-linked templates than
for (R)-bromide-linked templates. Because template-reagent
annealing could be partially rate-determining, this value is a
lower limit of the actual ratio of k.sub.S/k.sub.R, assuming
annealing rates are unaffected by bromide stereochemistry.
Surprisingly, similar preferences favoring the (5)-bromide were
also observed using end-of-helix template architectures (FIG. 39B),
even when 12 nucleotides separated the thiol and bromide in the
template-reagent complexes. The exact structure of the end-of-helix
template and its complimentary reagent (FIG. 39B) were as
follows:
TABLE-US-00012 Template: 5'-BrCH(CH.sub.3)CONH-TAC GCT CGC GAT GGT
ACG AAT TC-3' [SEQ ID NO: 83] Reagent: 5'-GAA TTC GTA
CC-(CH.sub.2).sub.3SH-3'
Stereoselectivity appeared to be independent of whether the bromide
or the thiol was conjugated to the template (FIGS. 39B and 39C).
The exact structure of the end-of-helix template conjugated to the
thiol and its complimentary reagent (FIG. 39C) were as follows:
TABLE-US-00013 Template: 5'-GAA TTC GTA CAT AGC GCT CGC
AT-(CH.sub.2).sub.3SH-3' [SEQ ID NO: 84] Reagent:
5'-BrCH(CH.sub.3)CONH-TGT ACG AAT TC-3' [SEQ ID NO: 85]
Similar selectivities emerged from pseudo-kinetic resolutions
containing both bromide stereoisomers in which thioether products
arising from (S)- and (R)-bromides were distinguished using
templates of two distinct lengths (k.sub.S/k.sub.R=4.2.+-.0.4 to
4.9.+-.0.3). Taken together, these findings indicate that the
chirality of a DNA template can be transferred to products of
DNA-templated synthesis that do not resemble the DNA backbone.
In order to probe the origins of the observed stereo selectivity, a
series of template and reagent analogs were synthesized in which
nucleotides near the thiol or bromide were replaced with flexible
achiral linkers. Replacing the 12 template nucleotides separating
the bromide and thiol in either of the end-of-helix reactions with
an achiral polyethylene glycol linker of similar length (72 bonds)
resulted in the loss of stereoselectivity. Stereoselectivity was
also abolished when flexible achiral linkers consisting of three or
five consecutive methylene or ether oxygens were inserted between
the 5' end of the template oligonucleotide and the thiol or bromide
groups, or between the 3' end of the reagent oligonucleotide and
the thiol or bromide. Chiral linkers between reactants, therefore,
are required for stereoselectivity in this DNA-templated reaction.
These results also suggest that both the thiol and the bromide
participate in the rate-determining step of the reaction,
consistent with an S.sub.N2 mechanism.
The known sensitivity of single- and double-stranded DNA
conformations on distal base stacking or base pairing interactions
suggests that groups distal from the bromide or thiol could play
important roles in inducing stereoselectivity. To test these
possibilities, 11 of the 12 template nucleotides closest to the 5'
bromide were replaced in the end-of-helix reaction with chiral
abasic phosphoribose linkers in which the aromatic base was
replaced with a proton (FIG. 40A). The exact structure of the
end-of-helix template was the same as in FIG. 39, except that bases
2-12 were replaced with abasic phosphoribose units (prepared from
the corresponding phosphoramidite from Glen Research, Sterling,
Va., USA). Even though the 5' thymidine nucleotide closest to the
bromide was unchanged, the resulting reactions were not
stereoselective, indicating that the nucleotide closest to the
bromide was not sufficient to induce the observed
stereoselectivity.
Each of the 11 missing aromatic bases from the 5' end were then
restored (FIG. 40B) and measured rates of (S)-bromide and
(R)-bromide reaction for each resulting template. Surprisingly, no
stereoselectivity was observed when up to five bases were restored.
Stereoselectivity increased steadily up to k.sub.S/k.sub.R=4.3 when
6 through 11 bases were restored (FIG. 40C). Restoration of the
missing aromatic bases from the 3' end of the abasic region instead
of from the 5' end also induced stereoselectivity only after
several bases were restored (five to 11 bases in this case) (FIG.
40D). Collectively, these findings suggest that stereoselectivity
arises from the conformation of nucleotides adjacent to either
reactant, and that the conformation(s) leading to stereoselectivity
require at least 5-6 consecutive aromatic bases.
This model of stereoselectivity predicts that global conformational
changes in the template-reagent complex may alter stereoselectivity
even if the covalent structure and absolute stereochemistry of all
reactants were preserved. Double-stranded DNA sequences rich in
(5-Me-C)G repeats can adopt a left-handed helix (Z-form) rather
than the usual right-handed helix (B-form) at high salt
concentrations (Rich et al. (1984) J. ANNO. REV. BIOCHEM. 53:
791-846; Behe et al. (1981) PROC. NATL. ACAD. SCI. USA 78:
1619-1623; Mao et al. (1999) NATURE 397: 144-146). Bromide-linked
(5-Me-C)G-rich hairpin templates and complementary thiol-linked
reagents protected as unreactive disulfides were prepared. When
combined in equimolar ratios, the circular dichroism (CD) spectra
of the resulting template-reagent complexes in low salt (100 mM
NaCl) were characteristic of B-form DNA (see, for example, FIG.
42D). In the presence of high salt concentrations (5 M NaCl or 2.5
M Na.sub.2SO.sub.4), the same template-reagent complexes exhibited
CD spectra representative of Z-form DNA. In contrast, the CD
spectra of template-reagent complexes of normal sequence were
representative of B-form DNA under both low salt and high salt
conditions (see, for example, FIG. 42C).
The stereoselectivity of DNA-templated reactions between
bromide-linked templates and thiol-linked reagents using either the
mixed or (5-Me-C)G-rich sequences was examined in the presence of
low or high salt concentrations. The mixed sequence templates and
reagents (B-form DNA) in the presence of low or high salt
concentrations favored the (S)-bromide by 4.3- or 3.2-fold,
respectively (FIG. 41A). The (5-Me-C)G-rich template and reagent in
low salt concentrations (B-form DNA) exhibited a 4.4-fold
preference for reaction of the (S)-bromide (FIG. 41A). Remarkably,
repeating this reaction in the presence of high salt concentrations
that induce Z-form DNA resulted in a 14-fold change in
stereoselectivity now favoring the (R)-bromide by 3.2-fold
(k.sub.S/k.sub.R=0.31) (FIG. 41B). This inversion of
stereoselectivity as a result of changing the handedness of the DNA
double helix is consistent with the theory implicating the
conformation of the template and reagent in determining the
stereoselectivity of this DNA-templated reaction.
These experiments demonstrate that stereoselectivity can be
imparted during nucleic acid-templated organic synthesis.
Conformations of DNA dependent on base stacking together with a
partially constrained presentation of reactants appear to be
responsible for the observed stereoselectivity. These experiments
further demonstrate that a single structure with one absolute
stereochemistry can induce opposite stereoselectivities when its
macromolecular conformation is altered.
Oligonucleotides
The exact structures of the templates containing mixed and
(5-Me-C)G-rich sequence, and their corresponding reagents used, are
as follows:
TABLE-US-00014 Mixed sequence: Template: 5'-GAA TTC TGG ACA CTT AGC
TAT TCA TCG AGC GTA CGC TCG ATG AAT AGC-(CH.sub.2).sub.3SH-3' [SEQ
ID NO: 86] Reagent: 5'-BrCH(CH.sub.3)CONH-TAA GTG TCC AGA ATT C-3'
[SEQ ID NO: 87] (5-Me-C)G-rich sequence: Template: 5'-GAA TTC C*GC*
GC*G C*GC* AC*G C*GC* GC*G C*GG AGC GTA CGC TCC* GC*G C*GC*
GC*G-(CH.sub.2).sub.3SH-3' [SEQ ID NO: 88] Reagent:
5'-BrCH(CH.sub.3)CONH-TGC* GC*G C*GC* GGA ATT-3' [SEQ ID NO: 89] C*
= 5-methyl cytosine. The thiols in both the mixed and
(5-Me-C)G-rich sequences were protected as disulfides
(-(CH.sub.2).sub.3S-S(CH.sub.2).sub.3OH) for circular dichroism
measurements.
DNA Synthesis and Analysis
DNA oligonucleotides were synthesized on a PerSeptive Biosystems
Expedite 8090 DNA synthesizer using standard phosphoramidite
protocols and were purified by reverse phase HPLC with a
triethylammonium acetate (TEAA)/CH.sub.3CN gradient.
Oligonucleotides were quantitated by UV and by denaturing PAGE
after staining with ethidium bromide. Quantitation of DNA by
denaturing PAGE was performed with a Stratagene Eagle Eye II
densitometer. Synthetically modified oligonucleotide analogs were
incorporated using the corresponding phosphoramidites or controlled
pore glass (CPG) beads purchased from Glen Research, Sterling, Va.
USA.
DNA Functionalization
2-bromopropionamide-NHS esters. 200 mg N-hydroxysuccinimide
(Pierce, Rockford, Ill., USA) was dissolved in anhydrous
CH.sub.2Cl.sub.2 together with 1.1 equivalents of a
2-bromopropionic acid (either racemic, (R)-, or (S)-) and 2
equivalents of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC)
(Aldrich). The 2-bromopropionic acid enantiomers were >95%
enantiopure as judged by chiral HPLC (5% isopropanol in hexanes,
(R,R) WHELK 01 chiral phase, detection at 220 nm). The reaction was
maintained at room temperature and complete after 1.5 hours as
judged by TLC (EtOAc). The crude reaction mixture was extracted
with 2.5% sodium hydrogen sulfate (NaHSO.sub.4) to remove the
excess EDC. The organic phase was washed with brine, dried over
magnesium sulfate (MgSO.sub.4), and concentrated in vacuo. The
residue was dried and used directly for DNA functionalization.
5'-functionalization of oligonucleotides. An NHS ester prepared as
described above was dissolved in DMSO. Up to 150 .mu.g of a
5'-amino DNA oligonucleotide was combined with 3 mg/mL NHS ester
(final reaction=10% DMSO) in 200 mM sodium phosphate (pH=7.2) at
room temperature for 2 hours. The functionalized oligonucleotides
were purified by gel filtration and reverse-phase HPLC, and were
characterized by denaturing PAGE and MALDI-TOF mass
spectrometry.
3'-thiol modified oligonucleotides. The 3' thiol group was
incorporated by standard automated DNA synthesis using
3'-disulfide-linked CPG (Glen Research, Sterling, Va., USA).
Following oligonucleotide synthesis, the disulfide was cleaved with
50 mM DTT, 1M TAPS (pH=8.0) at room temperature for 1 hour and
purified by gel filtration before being used in DNA-templated
reactions.
DNA-Templated Reactions
Reactions were performed with 60 nM template and 60 nM reagent in
50 mM MOPS (pH=7.5) and 250 mM NaCl at 25.degree. C. unless
otherwise specified. Reaction aliquots were removed at time points
from 2 minutes to 120 minutes and quenched with excess
.beta.-mercaptoethanol. Starting materials and products were
ethanol-precipitated from the quenched reaction mixtures, analyzed
by denaturing PAGE, quantified as described above. Relative initial
rates of product formation were determined from the fitting the raw
yield vs. time data and were used to calculate k.sub.S/k.sub.R.
Representative data are shown in FIG. 42.
For the representative data sets shown in FIG. 42, the apparent
second order rate constants derived from the initial rates are as
follows:
FIGS. 39A and 42A: k.sub.R,app=1.94.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=7.07.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=4.58.times.10.sup.3
M.sup.-1s.sup.-1
FIGS. 39B and 42B: k.sub.R,app=5.83.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=21.9.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=13.6.times.10.sup.3
M.sup.-1s.sup.-1
FIGS. 42C and 44A, low salt: k.sub.R,app=4.00.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=17.6.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=9.88.times.10.sup.3
M.sup.-1s.sup.-1
FIGS. 42C and 44A, high salt: k.sub.R,app=5.95.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=18.8.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=10.8.times.10.sup.3
M.sup.-1s.sup.-1
FIGS. 42D and 44B, low salt: k.sub.R,app=6.11.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=25.4.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=12.1.times.10.sup.3
M.sup.-1s.sup.-1
FIGS. 42D and 44B, high salt: k.sub.R,app=24.6.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.S,app=7.66.times.10.sup.3
M.sup.-1s.sup.-1;k.sub.rac,app=13.6.times.10.sup.3 M.sup.-1s.sup.-1
Evaluating Bromide Stability
The structural and configurational stability of the bromides under
the reaction conditions was confirmed by several independent
methods. Each bromide-linked template or reagent oligonucleotide
was pre-incubated for up to 72 hours at 25.degree. C., and up to 48
hours at 37.degree. C. under the reaction conditions in the absence
of thiol. Following the pre-incubation, stereoselectivity was
measured as described above and always found to be unchanged as a
result of the pre-incubation. In addition, large-scale (250 pmol)
quantities of bromide-linked templates ((R), (S), and
pseudo-racemic) were each incubated under the reaction conditions
for 16 hours and analyzed by MALDI-TOF mass spectrometry. No
evidence of bromide displacement (by water or by chloride) was
observed as shown in Tables 11 and 12.
TABLE-US-00015 TABLE 11 End-of-helix template (expected mass =
7202.1) Isomer Observed Mass (R) bromide: before incubation =
7203.3 .+-. 7 after incubation = 7206.4 .+-. 7 (S) bromide: before
incubation = 7206.0 .+-. 7 after incubation = 7201.9 .+-. 7 (.+-.)
bromide: mass before incubation = 7201.7 .+-. 7 mass after
incubation = 7204.7 .+-. 7
TABLE-US-00016 TABLE 12 Hairpin template (expected mass = 9682.4)
Isomer Observed Mass (R) bromide: mass before incubation = 9686.6
.+-. 10 mass after incubation = 9685.7 .+-. 10 (S) bromide: mass
before incubation = 9683.8 .+-. 10 mass after incubation = 9680.6
.+-. 10 (.+-.) bromide: mass before incubation = 9680.6 .+-. 10
mass after incubation = 9684.7 .+-. 10
Finally, small molecule analogs of the above bromide-linked DNAs
(both enantiomers of N-methyl 2-bromopropionamide) were incubated
for 16 hours under the reaction conditions and analyzed by chiral
HPLC under conditions that resolve the (S)- and (R)-enantiomers. No
change in retention time was observed.
Stereoselectivities Using Achiral Flexible Linkers
FIG. 43 shows modified template or reagent structures that result
in loss of stereoselectivity during DNA-templated S.sub.N2
reactions. In all cases, k.sub.S,app/k.sub.R,app values fell within
the range of 0.95 to 1.09 (.+-.0.09), which reflects the mean and
standard deviation of at least three independent experiments. The
exact structures of the templates containing achiral linkers and
their corresponding reagents were as follows:
FIG. 43A:
TABLE-US-00017 Template
5'-BrCH(CH.sub.3)CONH-[(CH.sub.2).sub.2O].sub.2OPO.sub.3.sup.--
{[(CH.sub.2).sub.2O].sub.6OPO.sub.3.sup.-}.sub.3-GGT ACG AAT TC-3'
[SEQ ID NO: 90] Reagent: 5'-GAA TTC GTA CC-(CH.sub.2).sub.3SH-3'
[SEQ ID NO: 91]
FIG. 43B:
TABLE-US-00018 Template: 5'-GAA TTC GTA
CA-(CH.sub.2).sub.3OPO.sub.3.sup.--
{[(CH.sub.2).sub.2O].sub.6OPO.sub.3.sup.-}.sub.3-(CH.sub.2).sub.3SH-3'
[SEQ ID NO: 92] Reagent: 5'-BrCH(CH.sub.3)CONH-TGT ACG AAT TC-3'
[SEQ ID NO: 93]
FIG. 43C:
TABLE-US-00019 Template:
5'-BrCH(CH.sub.3)CONH-[(CH.sub.2).sub.2O].sub.2OPO.sub.3.sup.--A- C
GCT CGC GAT GGT ACG AAT TC-3' [SEQ ID NO: 94] Reagent: 5'-GAA TTC
GTA CC-(CH.sub.2).sub.3SH-3' [SEQ ID NO: 95]
FIG. 43D:
TABLE-US-00020 Template: 5'-GAA TTC GTA CAT AGC GCT CGC A-
(CH.sub.2).sub.3OPO.sup.--(CH2).sub.3SH-3' [SEQ ID NO: 96] Reagent:
5'-BrCH(CH.sub.3)CONH-TGT ACG AAT TC-3' [SEQ ID NO: 97]
FIG. 43E:
TABLE-US-00021 Template: 5'-BrCH(CH.sub.3)CONH-TAC GCT CGC GAT GGT
ACG AAT TC-3' [SEQ ID NO: 98] Reagent: 5'-GAA TTC GTA
CC-(CH.sub.2).sub.3OPO.sub.3.sup.--(CH.sub.2).sub.3SH-3' [SEQ ID
NO: 99]
FIG. 43F:
TABLE-US-00022 Template: 5'-GAA TTC GTA CAT AGC GCT CGC AT-
(CH.sub.2).sub.3SH-3' [SEQ ID NO: 100] Reagent:
5'-BrCH(CH.sub.3)CONH-[(CH.sub.2).sub.2O]OPO.sub.3.sup.--TGT ACG
AAT TC-3' [SEQ ID NO: 101]
Circular Dichroism (CD) of B-DNA and Z-DNA
The DNA templates and reagents were prepared as described above.
Thiol-linked reagents were not deprotected and remained in their
disulfide forms during CD analysis. CD samples contained 215 nM
template and 215 nM protected reagent in 50 mM phosphate buffer
(pH=7.5) with either 100 mM or 5 M NaCl. A background sample
lacking DNA was also prepared for each sample. The CD measurements
were performed in a 1 mm path cuvette at 25.degree. C. scanning
from 360 nm to 200 nm at 2 nm/sec on a JASCO polarized spectrometer
with a 2.0 nm resolution. The resulting CD spectra of B-form and
Z-form template-reagent complexes are shown in FIG. 44. FIG. 44A
shows circular dichroism (CD) spectra of template-reagent complexes
containing normal (mixed composition) sequences which are
characteristic of B-DNA. FIG. 44B shows CD spectra of
(5-Me-C)G-rich complexes having a B-DNA conformation at low salt
concentrations, and having a Z-DNA conformation at high salt
concentrations. The exact structures of the templates containing
mixed and (5-Me-C)G-rich sequence, and their corresponding reagents
used, are as follows:
TABLE-US-00023 Mixed sequence: Template: 5'-GAA TTC TGG ACA CTT AGC
TAT TCA TCG AGC GTA CGC TCG ATG AAT AGC-(CH.sub.2).sub.3SH-3' [SEQ
ID NO: 102] (The thiol was protected as a disulfide
[(CH.sub.2).sub.3S-S(CH.sub.2).sub.3OH] for circular dichroism
measurements). Reagent: 5'-BrCH(CH.sub.3)CONH-TAA GTG TCC AGA ATT
C-3' [SEQ ID NO: 103] (5-Me-C)G-rich sequence: Template: 5'-GAA TTC
C*GC* GC*G C*GC* AC*G C*GC* GC*G C*GG AGC GTA CGC TCC* GC*G C*GC*
GC*G-(CH.sub.2).sub.3SH-3' [SEQ ID NO: 104] (The thiol was
protected as a disulfide [(CH.sub.2).sub.3S-S(CH.sub.2).sub.3OH]
for circular dichroism measurements) Reagent:
5'-BrCH(CH.sub.3)CONH-TGC* GC*G C*GC* GGA ATT-3' [SEQ ID NO: 105]
C* = 5-methyl cytosine
Stereoselectivity Induced by B-Form and Z-Form DNA
FIG. 45 shows a representative denaturing gel electrophoresis
analysis of reactions using the CG-rich sequences at 100 mM NaCl
(lanes 1-3) or at 5 M NaCl (lanes 4-6) (6 hour time point). Lanes 1
and 4: racemic bromide; lanes 2 and 5: (R)-bromide; lanes 3 and 6:
(S)-bromide. The bromide-linked reagent is not visible. Similar
results were observed using Na.sub.2SO.sub.4 instead of NaCl.
DNA-Templated Reactions in the Presence of Na.sub.2SO.sub.4 Instead
of NaCl
In order to ascertain that the observed stereoselectivities were
not affected by the presence of chloride, the experiments shown in
FIGS. 39 and 44 were repeated in the presence of Na.sub.2SO.sub.4
instead of NaCl (keeping the concentration of sodium constant). The
results of three independent trials were very similar to those
reported in the presence of NaCl, and are as follows:
FIG. 39A with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=5.4.+-.0.5
FIG. 39B with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=3.9.+-.0.3
FIG. 39C with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=4.7.+-.0.7
FIG. 44A, low salt with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=3.7.+-.0.7
FIG. 44A, high salt with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=3.1.+-.0.6
FIG. 44B, low salt with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=3.6.+-.0.5
FIG. 44B, high salt with Na.sub.2SO.sub.4 instead of NaCl:
k.sub.S/k.sub.R=0.25.+-.0.03
MALDI-TOF Mass Spectrometry of Representative Products
The products from the representative DNA-templated reactions (240
pmol scale) in FIG. 39 were purified by preparative denaturing
polyacrylamide gel electrophoresis followed by extraction with 0.1
M triethylammonium acetate at 37.degree. C. overnight. The
lyophilized products were subjected to MALDI-TOF mass spectrometry,
the results of which are summarized in Table 13. In all cases the
observed mass is consistent with the expected mass.
TABLE-US-00024 TABLE 13 FIG. Expected Mass Observed Mass 39A
13067.5 13015.6 .+-. 65 39B 10562.0 10587.2 .+-. 53 39C 10558.1
10600.1 .+-. 53
Example 7
Directing Otherwise Incompatible Reactions in a Single Solution
This Example demonstrates that oligonucleotides can simultaneously
direct several different synthetic reaction types within the same
solution, even though the reactants involved would be
cross-reactive and, therefore, incompatible under traditional
synthesis conditions. These findings also demonstrate that it is
possible to perform a one-pot diversification of synthetic library
precursors into products using multiple, simultaneous and not
necessarily compatible reaction types.
The ability of DNA templates to mediate diversification using
different reaction types without spatial separation was initially
tested by preparing three oligonucleotide templates of different
DNA sequences (1a-3a) functionalized at their 5' ends with
maleimide groups and three oligonucleotide reagents (4a-6a)
functionalized at their 3' ends with an amine, thiol, or
nitroalkane group, respectively (FIG. 46). The DNA sequences of the
three reagents each contained a different 10-base annealing region
that was complementary to ten bases near the 5' end of each of the
templates. Combining 1a with 4a, 2a with 5a, or 3a with 6a in three
separate vessels at pH 8.0 resulted in the expected DNA-templated
amine conjugate addition, thiol conjugate addition, or
nitro-Michael addition products 7-9 (FIG. 46, lanes 1-3).
To distinguish the nine possible reaction products that could be
generated upon combining 1a-6a, the lengths of template
oligonucleotides were varied to include 11, 17, or 23 bases and the
lengths of reagent oligonucleotides were varied to include 14, 16,
or 18 bases. Differences in oligonucleotide length were achieved
using extensions distal from the reactive groups that did not
significantly affect the efficiency of DNA-templated reactions.
This design permitted all nine possible reaction products (linked
to 25, 27, 29, 31, 33, 35, 37, 39, or 41 bases of DNA) to be
distinguished by denaturing polyacrylamide gel electrophoresis.
A solution containing all three templates (1a-3a) was combined with
a solution containing all three reagents (4a-6a) at pH 8.0. The
resulting reaction exclusively generated the three desired products
7, 8, and 9 of lengths 25, 33, and 41 bases indicating that only
the three reactions corresponding to the complementary
template-reagent pairs took place (FIG. 46, lane 4). Formation of
the other six possible reaction products was not detected by
densitometry (<5% reaction). In contrast, individually reacting
templates and reagents containing the same, rather than different,
10-base annealing regions permitted the formation of all possible
products (FIG. 46, lane 5). This result demonstrates the ability of
DNA-templated synthesis to direct the selective one-pot
transformation of a single functional group into three distinct
types of products (in this Example, maleimide into secondary amine,
thioether, or .alpha.-branched nitroalkane).
To test the ability of this diversification mode to support one-pot
reactions requiring non-DNA-linked accessory reagents, an analogous
experiment was conducted with two aldehyde-linked reagents either
14 or 16 bases in length (4b or 5b, respectively) and a
complementary 11-base amine-linked template (1b) or a 17-base
phosphorane-linked template (2b). Combining 1b and 4b at pH 8.0 in
the presence of 3 mM NaBH.sub.3CN resulted in the DNA-templated
reductive amination product 10, while 2b and 5b under the same
conditions generated Wittig olefination product 11 (FIG. 46).
Mixing all four reactants together in one pot resulted in an
identical product distribution as the combined individual Wittig
olefination or reductive amination reactions (FIG. 46). No reaction
between amine 1b and aldehyde 5b or between phosphorane 2b and
aldehyde 4b was detected (FIG. 46, lane 8 versus lane 9).
The generality of this approach was explored by including multiple
reaction types that required different accessory reagents. Three
amine-linked templates (1c-3c) of length 11, 17, or 23 bases were
combined with an aldehyde-, carboxylic acid-, or maleimide-linked
reagent (4c-6c) 14, 16, or 18 bases in length, respectively, at pH
8.0 in the presence of 3 mM NaBH.sub.3CN, 10 mM
1-(3-dimethyl-aminopropyl)-3-ethylcarbodiimide (EDC), and 7.5 mM
N-hydroxylsulfosuccinimide (sulfo-NHS). The reactions containing
all six reactants afforded the same three reductive amination,
amine acylation, or conjugate addition products (12-14) that were
generated from the individual reactions containing one template and
one reagent and did not produce detectable quantities of the six
possible undesired products arising from non-DNA-templated
reactions (FIG. 46, lanes 10-14). Collectively, these results
indicate that DNA-templated synthesis can direct simultaneous
reactions between several mutually cross-reactive groups in a
single pot to yield only the sequence-programmed subset of many
possible products.
The above three examples each diversified a single functional group
(maleimide, aldehyde, or amine) into products of different reaction
types. A more general format for the one-pot diversification of a
DNA-templated synthetic library into products of multiple reaction
types would involve the simultaneous reaction of different
functional groups linked to both reagents and templates. To examine
this possibility, six DNA-linked nucleophile templates (15-20) and
six DNA-linked electrophile reagents (21-25) collectively
encompassing all of the functional groups used in the above three
examples (amine, aldehyde, maleimide, carboxylic acid, nitroalkane,
phosphorane, and thiol) were prepared (FIG. 47). These twelve
DNA-linked reactants could, in theory, undergo simultaneous amine
conjugate addition, thiol conjugate addition, nitro-Michael
addition, reductive amination, amine acylation, and Wittig
olefination in the same pot, although the apparent second order
rate constants of these six reactions vary by more than
10-fold.
Determining the outcome of combining all twelve reagents and
templates in a single pot by using oligonucleotides of varying
lengths is difficult due the large number (at least 28) of possible
products that could be generated. Accordingly, the length of the
reagents as 15, 20, 25, 30, 35, or 40 bases were varied but the
length of the templates was fixed at 11 bases (FIG. 47). Each of
the six complementary template-reagent pairs when reacted
separately at pH 8.0 in the presence of 3 mM NaBH.sub.3CN, 10 mM
EDC, and 7.5 mM sulfo-NHS generated the expected amine conjugate
addition, thiol conjugate addition, nitro-Michael addition,
reductive amination, amine acylation, or Wittig olefination
products (FIG. 47). Reaction efficiencies were greater than 50%
relative to the corresponding individual reactions despite having
to compromise between differing optimal reaction conditions.
Templates 15-20 were also prepared in a 3'-biotinylated form. The
biotinylated templates demonstrated reactivities indistinguishable
from those of their non-biotinylated counterparts (FIG. 47).
Six separate reactions each containing twelve reactants then were
performed at pH 8.0 in the presence of 3 mM NaBH.sub.3CN, 10 mM
EDC, and 7.5 mM sulfo-NHS (FIG. 48). Each reaction contained a
different biotinylated template (15, 16, 17, 18, 19, or 20)
together with five non-biotinylated templates (from 15-20) and six
reagents (21-25). These reactions were initiated by combining a
solution containing 15-20 with a solution containing 21-25. The
products that arose from each biotinylated template were captured
with streptavidin-coated magnetic beads and identified by
denaturing gel electrophoresis. Because the six reagents in each
reaction contained oligonucleotides of unique lengths, the
formation of any reaction products involving the biotinylated
templates and any of the reagents could be detected. In all six
cases, the biotinylated template formed only the single product
programmed by its DNA sequence (FIG. 48) despite the possibility of
forming up to five other products in each reaction. Taken together,
these findings indicate that reactions of significantly different
rates requiring a variety of non-DNA-linked accessory reagents can
be directed by DNA-templated synthesis in the same solution, even
when both templates and reagents contain several different
cross-reactive functional groups. The ability of DNA templates to
direct multiple reactions at concentrations that exclude
non-templated reactions from proceeding at appreciable rates
mimics, in a single solution, a spatially separated set of
reactions.
Compared to the use of traditional synthetic methods, generating
libraries of small molecules by DNA-templated synthesis is limited
by several factors including the need to prepare DNA-linked
reagents, the restriction of aqueous, DNA-compatible chemistries,
and the reliance on characterization methods such as mass
spectrometry and electrophoresis that are appropriate for molecular
biology-scale (pg to .mu.g) reactions. On the other hand,
DNA-templated synthesis (i) allows the direct in vitro selection
(as opposed to screening) and amplification of synthetic molecules
with desired properties, (ii) permits the preparation of synthetic
libraries of unprecedented diversity, and (iii) requires only
minute quantities of material for selection and identification of
active library members. In addition, this Example demonstrates that
potentially useful modes of reactivity not possible using current
synthetic methods can be achieved in a DNA-templated format. For
example, six different types of reactions can be performed
simultaneously in one solution, provided that required
non-DNA-linked accessory reagents are compatible. This reaction
mode permits the diversification of synthetic small molecule
libraries using different reaction types in a single solution.
Materials and Methods
Synthesis of Templates and Reagents
Oligonucleotides were synthesized using standard automated
solid-phase techniques. Modified phosphoramidites and
controlled-pore glass supports were obtained from Glen Research,
Sterling, Va., USA. Unless otherwise noted, functionalized
templates and reagents were synthesized by reacting
5'-H.sub.2N(CH.sub.2O).sub.2 terminated oligonucleotides (for
templates) or
3'-OPO.sub.3--CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH.sub.2
terminated oligonucleotides (for reagents) in a 9:1 mixture of
aqueous 200 mM pH 7.2 sodium phosphate buffer:DMF containing 2
mg/mL of the appropriate N-hydroxysuccinimide ester (Pierce,
Rockford, Ill., USA) at 25.degree. C.
For the aldehyde and nitroalkane-linked oligonucleotides (4b, 4c,
5b, 6a, 17, 24, and 26, FIGS. 46 and 47) the NHS esters were
generated by combining the appropriate carboxylic acid (900 mM in
DMF) with equal volumes of dicyclohexylcarbodiimide (900 mM in DMF)
and NHS (900 mM in DMF) for 90 minutes. Phosphorane-linked
oligonucleotides (2b and 20, FIGS. 46 and 47) were prepared by a 90
minute reaction of the appropriate amino-terminated oligonucleotide
with 0.1 volumes of a 20 mg/mL DMF solution of the NHS ester of
iodoacetic acid (SIA, Pierce, Rockford, Ill., USA) in pH 7.2 buffer
as above, followed by addition of 0.1 volumes of a 20 mg/mL
solution of 4-diphenylphosphinobenzoic acid in DMF. Thiol-linked
template 16 was synthesized by reacting ethylene glycol
bis(succinimidylsuccinate) (EGS, Pierce, Rockford, Ill., USA) with
the appropriate oligonucleotide for 15 minutes, followed by
addition of 0.1 volumes of 300 mM 2-aminoethanethiol. Reagent 5a
was synthesized using
3'OPO.sub.3--(CH.sub.2).sub.3SS(CH.sub.2).sub.3ODMT functionalized
controlled-pore glass (CPG) support and reduced prior to use
according to the manufacturer's protocol.
The 3'-biotinylated oligonucleotides were prepared using biotin-TEG
CPG (Glen Research, Sterling, Va., USA). Products arising from
biotinylated templates were purified by mixing with 1.05
equivalents of streptavidin-linked magnetic beads (Roche), washing
twice with 5 M guanidinium hydrochloride, and eluting with aqueous
10 mM Tris pH 7.6 with 1 mM biotin at 80.degree. C.
Synthesis of Linkers
Linkers between DNA oligonucleotides and the functional groups in
1a-6c are as follows. 1b and 1c: DNA-5'-NH.sub.2; 1a, 2a-2c, 3a,
and 3c: DNA-5'-O(CH.sub.2).sub.2O(CH.sub.2).sub.2--NH--; 5a:
DNA-3'-O-- (CH.sub.2).sub.3SH; 4a-4-c, 5b, 5c, 6a, and 6c:
DNA-3'-O--CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH--.
Oligonucleotide sequences used to generate all possible products in
FIG. 46 (lanes 5, 9, and 14), with annealing regions underlined:
R-TATCTACAGAG-3' [SEQ ID NO: 106] (1a-1c); R-TATCTACAGAGTAGTCT-3'
[SEQ ID NO: 107] (2a-2c); R-TATCTACAGAGTAGTCTAATGAC-3' [SEQ ID NO:
108] (3a-3c); 5'-CAGCCTCTGTAGAT-R [SEQ ID NO: 109] (4a-4-c);
5'-CTCAGCCTCTGTAGAT-R [SEQ ID NO: 110] (5a-5c);
5'-GGCTCAGCCTCTGTAGAT-R [SEQ ID NO: 111] (6a-6c). Functionalized
templates and reagents were purified by gel filtration (Sephadex
G-25) followed by reverse-phase HPLC (0.1 M triethylammonium
acetate/acetonitrile gradient). Representative functionalized
templates and reagents were further characterized by MALDI mass
spectrometry.
Reaction Conditions
All reactions were performed by dissolving reagents and templates
in separate vessels in pure water before combining them into a
solution of 50 mM aqueous TAPS buffer, pH 8.0, 250 mM NaCl at
25.degree. C. for 16 hours with DNA-linked reactants at 60 nM (FIG.
47) or at 12.5 nM (FIGS. 47 and 48). NaBH.sub.3CN, EDC, and
sulfo-NHS were present when appropriate as described. Products were
analyzed by denaturing polyacrylamide gel electrophoresis using
ethidium bromide staining and UV transillumination. Differences in
charge states, attached functional groups, and partial secondary
structure resulted in modest variations in gel mobility for
different functionalized oligonucleotides of the same length (FIGS.
46-48).
Example 8
DNA-Templated Functional Group Transformations
While coupling reactions are useful for building molecular
diversity, the development of DNA-templated functional group
transformations can significantly expand the types of structures
that can be generated. DNA-templated synthesis can be used to
transform functional groups by unmasking or interconverting
functionalities used in coupling reactions. By exposing or creating
a reactive group within a sequence-programmed subset of a library,
DNA-templated functional group interconversions permit library
diversity to be generated by sequential unmasking (FIG. 49). In
FIG. 49, PG1-PG3 represent three different protecting groups, and
A-F represent reactants capable of reacting with deprotected
functionalities of a scaffold molecule. The sequential unmasking
approach offers the major advantage of permitting reactants that
would normally lack the ability to be linked to DNA (for example,
simple alkyl halides) to contribute to library diversity by
reacting with a sequence-specified subset of templates in an
intermolecular, non-templated reaction mode. This advantage
significantly increases the types of structures that can be
generated. On the other hand, sequential unmasking has the drawback
of requiring more manipulations per "step" because previously used
small molecule reactants must be removed between DNA-templated
functional group unmaskings. This removal can be rapidly performed
on the entire library using a simple gel filtration cartridge.
DNA-Templated Deprotection
The first class of DNA-templated functional group transformations
sequence-specifically unmask amine, thiol, alcohol, carboxylate, or
aldehyde groups from protected forms. In the Staudinger reaction,
azides react with phosphines to yield aza-ylides (Staudinger et al.
(1919) HELV. CHIM. ACTA. 2: 635-646). When this reaction is
performed in aqueous media, the aza-ylides undergo spontaneous
hydrolysis to provide amines and phosphine oxides (Scriven et al.
(1988) CHEM. REV. 88: 297-368). DNA-linked aryl and alkyl phosphine
reagents, when combined with azide-linked DNA templates, permit
sequence-specific amine deprotection (FIG. 50A). DNA-linked
phosphines and DNA-linked azides have both been used successfully
in previous DNA-templated reactions. As an alternative
DNA-templated amine deprotection, the nucleophilic aromatic
ipso-substitution of o-nitrobenzenesulfonamides (prepared from
amines and commercially available o-nitrobenzene sulfonylchloride)
can yield free amines (FIG. 50B). This reaction is known to proceed
efficiently in the presence of deprotonated thiophenols, so at
pH>8 the DNA-templated attack of thiophenol-linked reagents on
o-nitrobenzenesulfonamide-linked templates can permit
sequence-specific amine deprotection (Fukuyama et al. (1999)
SYNLETT 8: 1301-1303).
Once optimized, DNA-templated amine deprotection reactions can be
extended to include deprotection reactions for alcohols and thiols.
Kusumoto and co-workers have reported that 4-aminobutyryl esters
undergo spontaneous intramolecular lactam formation to afford
2-pyrrolidinone and the liberated hydroxyl group in excellent
yields (Kusumoto et al. (1986) BULL. CHEM. SOC. JPN. 59:
1296-1298). Kahne and co-workers have used this reaction
effectively in aqueous media (Thomson et al. (1999) J. AM. CHEM.
SOC. 121: 1237-1244). A DNA-templated hydroxyl group deprotection
is shown in FIG. 50C. If lactam formation is slow, the reaction can
be heated or Lewis acids can be added since sequence specificity is
not required after amine deprotection. An analogous DNA-templated
thiol deprotection that uses 4-azidobutyryl thioesters is shown in
FIG. 50C. It is contemplated that these groups will be stable to
hydrolysis under a wide range of conditions.
Palladium-mediated deallylation can also be used in DNA-templated
carboxylate, amine, hydroxyl, or thiol deprotections.
Allyloxycarbonyl (Alloc) esters, carbonates, thiocarbonates, and
carbamates are treated with DNA-linked Pd ligands such as the
2,2'-bis(diphenylphosphino)-1,1'-binaphthyl (BINAP) reagent as
shown in FIG. 50D (prepared from the known BINAP-6-butanoic acid)
in the presence of pM to .mu.M concentrations of water-soluble Pd
sources such as Na.sub.2PdCl.sub.4 (Bayston et al. (1998) J. ORG.
CHEM. 63: 3137-3140). The DNA-linked Pd ligands increase the
effective molarity of Pd at complementary templates, but not at
mismatched templates, to permit the sequence-specific deprotection
of carboxylate, hydroxyl, thiol, and amine groups from the
corresponding Alloc esters, carbonates, thiocarbonates, and
carbamates, respectively (FIG. 50D) (Gen t et al. (1994)
TETRAHEDRON 50: 497-503). It is particularly encouraging that the
rates of BINAP ligand dissociation from Pd have been measured
during Pd-mediated aryl aminations and found to be much slower than
the rates of association and dissociation of substrate and products
(Singh et al. (2002) J. AM. CHEM. SOC. 124: 14104-14114). The Pd
source and the DNA-linked Pd ligands can be pre-incubated at high
concentrations, and then the resulting complexes added either to
complementary or mismatched templates at 60 nM concentrations. This
procedure also results in sequence-specific Alloc deprotection if
ligand-metal dissociation is slow relative to DNA annealing and
Pd-catalyzed deallylation.
Finally, transition metal salts including Sc.sup.3+ and Yb.sup.3+
are known to catalyze acetal hydrolysis to yield aldehydes
(Fukuzawa et al. (2001) CHEM. LETT. 5: 430-436). Conjugating the
crown ether shown in FIG. 50E to oligonucleotides permits
DNA-templated aldehyde deprotections in the presence of lanthanide
triflates. These crown ether-Ln.sup.3+ complexes have been
previously reported to catalyze aqueous aldol reactions while
completely sequestering one equivalent of Ln.sup.3+ (Kobayashi et
al. (2001) ORG. LETT. 3). Aldehyde deprotection is highly
sequence-specific because the concentration of free Ln.sup.3+
should be negligible.
DNA-Templated Functional Group Interconversions
The second class of DNA-templated functional group transformations
interconverts groups generated from or used by DNA-templated
reactions. Two functional group interconversions are shown in FIG.
51. Ruthenium(II) porphyrins in the presence of 2,6-disubstituted
pyridine N-oxides catalyze the remarkably efficient epoxidation of
a wide variety of simple and electron-deficient olefins (Higuchi et
al. (1989) TETRAHEDRON LETT. 30: 6545-6548; Groves et al. (1985) J.
AM. CHEM. SOC. 107: 5790-5792; Zhang et al. (2002) ORG. LETT. 4:
1911-1914; Yu et al. (2000) J. AM. CHEM. SOC. 122: 5337-5342).
Single-stranded DNA is stable in the presence of aqueous
tetrakis(4-carboxyphenyl) porphyrin complexed with Ru(II), and
Ru(II)-DNA conjugates have been previously reported (Hartmann et
al. (1997) J. BIOL. INORG. CHEM. 2: 427-432; Pascaly et al. (2002)
J. AM. CHEM. SOC. 124: 9083-9092). DNA-templated olefin
epoxidations using DNA-linked Ru(II) porphyrin catalysts are shown
in FIG. 51A, which are prepared by coupling commercially available
tetrakis(4-carboxyphenyl) porphyrin to amine-terminated
oligonucleotides (Hoimlin et al. (1999) BIOCONJUG. CHEM. 10:
1122-1130). The resulting DNA-linked porphyrin is metalated with
Ru.sub.3(CO).sub.12 as described previously to afford the reagent
shown in FIG. 51A. This functional group interconversion bridges
several versatile reactions by permitting products of DNA-templated
Wittig olefinations and Heck couplings to become substrates for
epoxide addition reactions.
As a second functional group interconversion, lanthanide
triflate-catalyzed aqueous Diels-Alder and hetero Diels-Alder
cycloadditions proceed efficiently in water, and DNA-linked Lewis
acid chelators such as binapthol, bis-trifylamides, or the crown
ether shown in FIG. 50E permit the sequence-specific Diels-Alder
reaction between a template-linked aldehyde and a free diene in
solution (FIG. 51B). When Danishefsky's diene is used, this
functional group transformation provides .alpha.,.beta. unsaturated
ketones that serve as substrates for subsequent DNA-templated
conjugate addition reactions. Fully coordinated Ln.sup.3+ complexes
(such as those that arise from the crown ether) have been reported
to be kinetically stable yet permit efficient catalysis through
facile ligand exchange (Chappell et al. (1998) INORG. CHEM. 37:
3989-3998). Moreover, DNA-linked lanthanide complexes have been
previously used as stable luminescent agents in aqueous solutions
and, therefore, these complexes are compatible with the
functionality present in DNA (Li et al. (1997) BIOCONJUG. CHEM. 8:
127-132).
Example 9
Synthesis of Exemplary Compounds and Libraries of Compounds
A) Synthesis of a Polycarbamate Library
This Example demonstrates a strategy for producing an amplifiable
polycarbamate library.
Overview
Of the sixteen possible dinucleotide codons used to encode the
library, one is assigned a start codon function, and one is
assigned to serve as a stop codon. An artificial genetic code then
is created assigning each of the up to 14 remaining dinucleotides
to a different monomer. For geometric reasons one monomer actually
contains a dicarbamate containing two side chains. Within each
monomer, the dicarbamate is attached to the corresponding
dinucleotide (analogous to a tRNA anticodon) through a silyl enol
ether linker which liberates the native DNA and the free carbamate
upon treatment with fluoride.
The dinucleotide moiety exists as the activated
5'-2-methylimidazole phosphate, that has been demonstrated to serve
as an excellent leaving group for template-directed oligomerization
of nucleotides yet is relatively stable under neutral or basic
aqueous conditions (Inoue et al. (1982) J. MOL. BIOL. 162: 201;
Rembold et al., (1994) J. MOL. EVOL. 38: 205; Chen et al. (1985) J.
MOL. BIOL. 181: 271; Acevedo et al. (1987) J. MOL. BIOL. 197: 187;
Inoue et al. (1981) J. AM. CHEM. SOC. 103: 7666; Schwartz et al.
(1985) SCIENCE 228: 585). The dicarbamate moiety exists in a cyclic
form linked through a vinyloxycarbonate linker. The vinylcarbonate
group has been demonstrated to be stable in neutral or basic
aqueous conditions and further has been shown to provide carbamates
in very high yields upon the addition of amines Olofson et al.
(1977) TETRAHEDRON LETT. 18: 1563; Olofson et al. (1977)
TETRAHEDRON LETT. 18: 1567; Olofson et al. (1977) TETRAHEDRON LETT.
18: 1571).
When attacked by an amine from a nascent polycarbamate chain, the
vinyl carbonate linker, driven by the aromatization of m-cresol,
liberates a free amine. This free amine subsequently serves as the
nucleophile to attack the next vinyloxycarbonate, propagating the
polymerization of the growing carbamate chain. Such a strategy
minimizes the potential for cross-reactivity and bi-directional
polymerization by ensuring that only one nucleophile is present at
any time during polymerization.
Using the monomer described above, artificial translation of DNA
into a polycarbamate can be viewed as a three-stage process. In the
first stage, single stranded DNA templates encoding the library are
used to guide the assembly of the dinucleotide moieties of the
monomers, terminating with the "stop" monomer which possesses a 3'
methyl ether instead of a 3' hydroxyl group (FIG. 52).
Once the nucleotides have assembled, the "start" monomer ending in
a o-nitrobenzylcarbamates is photodeprotected to reveal the primary
amine that initiates carbamate polymerization. Polymerization
proceeds in the 5' to 3' direction along the DNA backbone, with
each nucleophilic attack resulting in the subsequent unmasking of a
new amine nucleophile. Attack of the "stop" monomer liberates an
acetamide rather than an amine, thereby terminating polymerization
(FIG. 53). Because the DNA at this stage exists in a stable
double-stranded form, variables such as temperature and pH may be
explored to optimize polymerization efficiency.
Following polymerization, the polycarbamate can be cleaved from the
phosphate backbone of the DNA upon treatment with fluoride.
Desilylation of the enol ether linker and the elimination of the
phosphate driven by the resulting release of phenol provides the
polycarbamate covalently linked at its carboxy terminus to its
encoding single-stranded DNA (FIG. 54).
At this stage, the polycarbamate may be completely liberated from
the DNA by base hydrolysis of the ester linkage. The liberated
polycarbamate can be purified by HPLC and retested to verify that
its desired properties are intact. The free DNA can be amplified
using PCR, mutated with error-prone PCR (Cadwell et al., (1992) PCR
METHODS APPL. 2: 28) or DNA shuffling (Stemmer (1994) PROC. NATL.
ACAD. SCI. USA 91: 10747; Stemmer (1994) NATURE 370: 389; U.S. Pat.
No. 5,811,238), and/or sequenced to reveal the primary structure of
the polycarbamate polymer.
Synthesis of Monomer Units
After the monomers are synthesized, the assembly and polymerization
of the monomers on the DNA scaffold should occur spontaneously.
Shikimic acid 1, available commercially, biosynthetically (Davis
(1955) ADV. ENZYMOL. 16: 287), or by short syntheses from D-mannose
(Fleet et al. (1984) J. CHEM. SOC. 905; Harvey et al. (1991)
TETRAHEDRON LETT. 32: 4111), serves as a convenient starting point
for the monomer synthesis. The syn hydroxyl groups are protected as
the p-methoxybenzylidene, and remaining hydroxyl group as the
tert-butyldimethylsilyl ether to afford 2. The carboxylate moiety
of the protected shikimic acid then is completely reduced by
lithium aluminum hydride (LAH) reduction, tosylation of the
resulting alcohol, and further reduction with LAH to provide 3.
##STR00001##
Commercially available and synthetically accessible N-protected
amino acids can serve as the starting materials for the dicarbamate
moiety of each monomer. Reactive side chains are protected as
photolabile ethers, esters, acetals, carbamates, or thioethers.
Using chemistry previously developed (Cho et al. (1993) SCIENCE
261: 1303), a desired amino acid 4 is converted to the
corresponding amino alcohol 5 by mixed anhydride formation with
isobutylchloroformate followed by reduction with sodium
borohydride. The amino alcohol then is converted to the activated
carbonate by treatment with p-nitrophenylchloroformate to afford 6,
which then is coupled to a second amino alcohol 7 to provide,
following hydroxyl group silylation and FMOC deprotection,
carbamate 8.
##STR00002##
Coupling of carbamate 8 onto the shikimic acid-derived linker
proceeds as follows. The allylic hydroxyl group of 3 is deprotected
with tetra-butylammonium fluoride (TBAF), treated with triflic
anhydride to form the secondary triflate, then displaced with
aminocarbamate 8 to afford 9. Presence of the vinylic methyl group
in 3 should assist in minimizing the amount of undesired product
resulting from S.sub.N2' addition (Magid (1980) TETRAHEDRON 36:
1901). Michael additions of deprotonated carbamates to
.alpha.,.beta.-unsaturated esters have been well documented
(Collado et al. (1994) TETRAHEDRON LETT. 35: 8037; Hirama et al.
(1985) J. AM. CHEM. SOC. 107: 1797; Nagasaka et al. (1989)
HETEROCYCLES 29: 155; Shishido et al. (1987) J. CHEM. SOC. 993;
Hirama et al. (1989) HETEROCYCLES 28: 1229). By analogy, the
secondary amine is protected as the o-nitrobenzyl carbamate (NBOC),
and the resulting compound is deprotonated at the carbamate
nitrogen. This deprotonation can typically be performed with either
sodium hydride or potassium tert-butyloxide (Collado et al. (1994)
supra; Hirama et al. (1985) supra; Nagasaka et al. (1989) supra;
Shishido et al. (1987) supra; Hirama et al. (1989) supra), although
other bases may be utilized to minimize deprotonation of the
nitrobenzylic protons. Additions of the deprotonated carbamate to
.alpha.,.beta.-unsaturated ketone 10, followed by trapping of the
resulting enolate with tert-butyldimethyl silyl chloride (TBSCl),
should afford silyl enol ether 11. The previously found
stereoselectivity of conjugate additions to 5-substituted enones
such as 10 (House et al. (1968) J. ORG. CHEM. 33: 949; Still et al.
(1981) TETRAHEDRON 37: 3981) suggests that 11 should be formed
preferentially over its diastereomer. Ketone 10, the precursor to
the fluoride-cleavable carbamate-phosphate linker, may be
synthesized from 2 by one pot decarboxylation (Barton et al. (1985)
TETRAHEDRON 41: 3901) followed by treatment with tetrabutylammonium
fluoride (TBAF), Swern oxidation of the resulting alcohol to afford
12, deprotection with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone
(DDQ), selective nitrobenzyl ether formation of the less-hindered
alcohol, and reduction of the .alpha.-hydroxyl group with samarium
iodide (Molander (1994) ORGANIC REACTIONS 46: 211).
##STR00003## ##STR00004##
The p-methoxybenzylidiene group of 11 is transformed into the
.alpha.-hydroxy p-methoxybenzyl (PMB) ether using sodium
cyanoborohydride and trimethylsilyl chloride (TMSCl) (Johansson et
al. (1984) J. CHEM. SOC. 2371) and the TES group deprotected with
2% HF (conditions that should not affect the TBS ether (Boschelli
et al. (1985) TETRAHEDRON LETT. 26: 5239)) to provide 13. The PMB
group, following precedent (Johansson et al. (1984) J. CHEM. SOC.
2371; Sutherlin et al. (1993) TETRAHEDRON LETT. 34: 4897), should
remain on the more hindered secondary alcohol. The two free
hydroxyl groups may be macrocyclized by very slow addition of 13 to
a solution of p-nitrophenyl chloroformate (or another phosgene
analog), providing 14. The PMB ether is deprotected, and the
resulting alcohol is converted into a triflate and eliminated under
kinetic conditions with a sterically hindered base to afford
vinyloxycarbonate 15. Photodeprotection of the nitrobenzyl either
and nitrobenzyl carbamate yields alcohol 16.
##STR00005##
The monomer synthesis is completed by the sequential coupling of
three components. Chlorodiisopropylaminophosphine 17 is synthesized
by the reaction of PCl.sub.3 with diisopropylamine (King et al.,
(1984) J. ORG. CHEM. 49: 1784). Resin-bound (or
3'-o-nitrobenzylether protected) nucleoside 18 is coupled to 17 to
afford phosphoramidite 19. Subsequent coupling of 19 with the
nucleoside 20 (Inoue et al. (1981) J. AM. CHEM. SOC. 103: 7666)
provides 21. Alcohol 16 then is reacted with 21 to yield, after
careful oxidation using m-chloroperbenzioc acid (MCPBA) or I.sub.2
followed by cleavage from the resin (or photo-deprotection), the
completed monomer 22. This strategy of sequential coupling of 17
with alcohols has been successfully used to generate phosphates
bearing three different alkoxy substituents in excellent yields
(Bannwarth et al. (1987) HELV. CHIM. ACTA 70: 175).
##STR00006##
The unique start and stop monomers used to initiate and terminate
carbamate polymerization may be synthesized by simple modification
of the above scheme.
B) Macrocyclic Fumaramide Library
This Example demonstrates that DNA templated-synthesis can be used
to create a library of small molecules. In particular, it has been
possible to create a DNA-templated macrocyclic fumaramide library
as shown in FIG. 55.
The library synthesis scheme employs robust DNA-templated amine
acylation and intramolecular Wittig olefination reactions to
generate diverse and partially rigid macrocyclic fumaramides. The
fumaramide group is stable to neutral solutions but is sufficiently
electrophilic to covalently capture nucleophiles when presented at
elevated effective molarities. Nucleophilic side chains found in
target protein active sites may, therefore, be covalently trapped
by the fumaramide functionality. The key steps in the library
synthesis are (i) DNA-templated amine acylation using the sulfone
linker, (ii) DNA-templated amine acylation using the diol linker,
(iii), DNA-templated amine acylation using a phosphorane linker,
and (iv) intramolecular Wittig olefination to afford macrocyclic
fumaramides linked to their corresponding DNA templates (FIG.
55).
macrocyclization is potentially the most challenging step of the
library synthesis. To test this, seven model step 3 substrates were
prepared to validate the third DNA-templated step and the
subsequent macrocyclization (FIG. 56). Each substrate contained a
variety of R.sub.1 and R.sub.2 groups of varying steric hindrances,
stereochemistries, and backbone chain lengths. The model substrates
were each mixed with one of four biotinylated DNA-linked reagents
containing both a carboxylic acid and a phosphorane under
DNA-templated amine acylation conditions. To evaluate both amide
bond formation and Wittig macrocyclization, a two-stage
purification strategy was implemented. The ten products of the
DNA-templated amine acylation (FIG. 56 and step 3 in FIG. 55) were
purified away from unreacted templates by capture with
streptavidin-linked magnetic beads. The captured intermediates then
were treated with pH 8.0 buffer to induce Wittig
olefination-mediated macrocyclization. Macrocyclization created the
fumaramide products (lacking the biotinylated reagent
oligonucleotide) to self-elute from the magnetic beads. In every
case, amine acylation and macrocyclization proceeded efficiently
(FIG. 56) despite the wide range of steric, stereochemical, and
backbone diversity in the intermediates. Control reactions at
pH.ltoreq.6 (too low to form the phosphorane), or at pH 8.0 but
lacking the aldehyde group, failed to elute any product. In
summary, the DNA-templated amine acylation-Wittig macrocyclization
sequence is a highly efficient route to produce desired macrocyclic
fumaramides.
After validating the macrocyclization step, a DNA-templated
macrocyclic fumaramide library was synthesized. The pilot library
was restricted to 83 macrocyclic fumaramides containing
4.times.4.times.5=80 macrocycles plus three macrocycles containing
either an aryl sulfonamide, a desthiobiotin group, or both groups
as positive controls for binding to carbonic anhydrase or avidin.
Reagent oligonucleotides consisted of the six-base codons flanked
by two constant bases on either side conjugated at their 3' ends to
aminoacyl donors through the sulfone, diol, or phosphorane linker
as previously reported. Multi-.mu.g quantities of each of the 19
DNA-linked amine acylation reagents shown in FIG. 57 were created
in a single day starting from commercially available free amino
acids, linker precursors, and reagent oligonucleotides as described
previously. The building blocks were chosen to sample structural
and functional group diversity and include (L) and (D)
.alpha.-amino acids, .alpha.,.alpha.'-disubstituted amino acids,
and .beta.-amino acids bearing alkyl, alkenyl, aryl, polar,
heterocyclic, negatively charged, and positively charged side
chains (FIG. 57). Each of the 19 reagents was successfully tested
in single template reactions and generated product with <30%
variance in efficiency. All 19 reagents reacted with high
sequence-specificity, generating no significant product with
mismatched templates even when five equivalents of reagent were
used.
The macrocyclic fumaramide-encoding template library was prepared
from modular coding region cassettes in a single solution (FIG.
58). Oligonucleotides representing all reagent annealing regions
were combined together with T4 DNA ligase in a single solution. Due
to the sequence design of the oligonucleotide termini, the desired
assembled template library is the only possible product when the
ligation is complete. Excellent yields of the desired template
library resulted from a 4 hour ligation reaction. Following
ligation, T7 exonuclease was added to degrade the non-coding
template strand (the desired coding strand is protected by its
non-natural 5'-aminoethylene glycol linker). This procedure
provided 20 nmol of the 5' functionalized single-stranded template
library in 6 hours. The constant 10-base primer binding regions at
the ends of each template were sufficient to permit PCR
amplification of as few as 1,000 molecules (10.sup.-21 mol) of
template from this assembled material. Three positive control
templates were added to produce a library containing 83 templates
which were then combined with 3.0 equivalents of five step 1
reagents to produce the first library synthesis step. Products were
purified as described above, then subjected to the second
DNA-templated library synthesis step with five new reagents
complementing the step 2 coding regions. The efficiency of both
DNA-templated pilot library steps was judged to exceed 70% by
denaturing gel electrophoresis and densitometry.
As a model for the deprotection prior to step 3, the Pd-mediated
deprotection of DNA-linked Alloc carbamates was executed with
excellent efficiency as judged by the liberation of .about.1
equivalent of free amine groups. The products from each library
synthesis step were analyzed by mass spectrometry. In the hope of
eliminating the deprotection step, the necessity of protecting and
deprotecting the side chain amine in the starting material was
tested because the lower pK.sub.a of the .alpha.-amine may permit
selective reaction of the .alpha.-amine at a pH that ensures
protonation of the side chain amine. It was found that the
.alpha.-amine group indeed could be selectively and efficiently
acylated in a DNA-templated reaction in the presence of unprotected
side-chain amine at pH 6.0. This may eliminate the need for a
deprotection step following the second DNA-templated amide
formation in step 2.
Several model substrates then were synthesized to validate the
third DNA-templated step and the subsequent macrocyclization. Each
model substrate consisted of a template-linked intermediate
containing a free amine group and a diol linker separated by
varying numbers of bonds to simulate groups of differing sizes
during library synthesis. The model substrates were each mixed with
one of several biotinylated DNA-linked reagents containing both a
carboxylic acid and a phosphorane under DNA-templated amide
formation conditions (pH 6.0, 20 mM EDC, 15 mM sulfo-NHS).
DNA-templated amide formation proceeded in >60% yields and
products were captured with avidin-linked magnetic beads.
Bead-bound product was treated with 10 mM NaIO.sub.4 at pH 8.5 to
effect diol cleavage. The resulting aldehyde group reacted with the
phosphorane in a spontaneous Wittig olefination reaction to furnish
a cyclic fumaramide, free from the biotin group, that self-elutes
from the avidin-linked beads (FIG. 59). Importantly, all of the
model substrates under went macrocyclization in >60% yield,
suggesting that this reaction is tolerant of a variety of substrate
geometries. Control reactions confirmed that fumaramide formation
was dependent on (i) periodate cleavage, (ii) the presence of the
phosphorane group, and (iii) successful DNA-templated amide
formation (required for capture onto avidin-linked beads).
C) PNA Polymer Library Formation
Despite significant successes, the generality and
sequence-specificity of template-directed polymerization is still
largely unexplored. For example, the efficient and
sequence-specific templated polymerization of easily functionalized
synthetic monomers lacking a ribose backbone has not been reported.
Such a system would raise the possibility of evolving polymers
comprised of these synthetic monomers through iterated cycles of
translation (polymerization), selection, and amplification
presently available only to DNA, RNA, and proteins.
The minimal requirements of a system for synthetic polymer
evolution are: (i) distance-dependent nucleic acid-templated
monomer coupling reactions to ensure that oligomerization proceeds
exclusively between adjacently annealed monomers; (ii) efficient
nucleic acid-templated oligomerization to provide sufficient yields
of full-length products for in vitro selections; (iii) stable
linkage of each synthetic polymer to its encoding template to
ensure the survival of the appropriate template during polymer
selection; and (iv) a readily functionalized synthetic monomer
backbone to introduce tailor made functionality into the
polymer.
In order to test the feasibility of producing polymers by DNA
templated synthesis, DNA-templated amine acylation, Wittig
olefination, reductive amination, and olefin metathesis reactions
were tested for their ability to translate DNA sequences into
functionalized peptide nucleic acid (PNA) polymers. The proposed
PNA monomers are stable and can be easily synthesized from
commercially available .alpha.-amino acids containing a wide
variety of functional groups (Haaima et al. (1996) ANGEW. CHEM.
INT. ED. ENGL. 35: 1939-1942; Puschl et al. (1998) TETRAHEDRON
LETT. 39: 4707). PNAs containing functionalized side chains are
known to retain their ability to hybridize to DNA
sequence-specifically (Haaima et al. (1996) supra; Puschl et al.
(1998) supra).
In the first strategy, PNA serves as the backbone of the functional
polymer and displays the functional groups of each monomer. In
another strategy, the DNA-templated PNA polymerizations organize
reactive functional groups, enabling a second polymerization
reaction between these functional groups (for example, an olefin
metathesis or Wittig olefination reaction) to form the synthetic
polymer backbone of interest.
In both strategies templates consist of 5'-functionalized, single
stranded DNA libraries 50-200 bases long that contain a central
region of variable bases. These templates are made by standard
solid-phase oligonucleotide synthesis combined with
enzyme-catalyzed ligation for longer templates. Monomer structures
are chosen to provide chemical functionalities including (i)
Bronsted acidic and basic groups, (ii) nucleophilic and
electrophilic groups, (iii) conjugated olefins suitable for
post-PNA polymerization metathesis, and (iv) metal-binding groups
capable of forming complexes with chemically potent transition
metals. Representative monomer structures containing these
functionalities are shown in FIG. 60. The DNA bases encoding each
monomer (the "genetic code" of these polymers) are chosen from the
examples shown in Table 10 to preclude the possibility of
out-of-frame annealing. These genetic codes should prevent
undesired frameshifted DNA-templated polymer translation.
Libraries of 5'-functionalized hairpin DNA templates containing up
to 10.sup.15 different sequences are combined with sets of monomers
under conditions that optimize the efficiency and sequence fidelity
of each DNA-templated polymerization. Synthetic polymer strands
then are de-annealed from their DNA templates by denaturation, and
the 3' DNA hairpin primer extended using DNA polymerase to generate
hairpin DNA templates linked to now liberated single-stranded
synthetic polymers (FIG. 61). Libraries are characterized by gel
electrophoresis and MALDI mass spectrometry, and individual
representative library members are also characterized from single
template reactions to confirm expected reaction efficiencies.
Once the libraries of DNA-linked PNAs are characterized, they can
be subjected to three types of in vitro selections for: (i)
folding, (ii) target binding, or (iii) catalysis. Prior to
selection, polymers with anticipated metal binding ability are
incubated with one or more water-compatible metal sources.
Selections for folding are performed using the gel electrophoresis
selection described in Example 10. Polymers capable of folding in
the presence, but not in the absence, of metals serve as especially
attractive starting points for the next two types of
selections.
Selections for target binding can be conducted by incubating the
solution-phase polymer library with either immobilized target or
with biotinylated target followed by streptavidin-linked beads.
Non-binders are removed by washing, and polymers with desired
binding properties are eluted by chemical denaturation or by adding
excess authentic free ligand. To complete one cycle of
functionalized PNA evolution, the DNA templates corresponding to
the desired PNA library members are amplified by PCR using one
primer containing the 5'-functionalized hairpin primer and a
biotinylated second primer, optionally diversified by error-prone
PCR (Caldwell et al. (1992) PCR METHODS APPLIC. 2: 28-33), and then
denatured into single stranded DNA and washed with streptavidin
beads to remove the non-coding template strand. The resulting pool
of selected single-stranded, 5'-functionalized DNA completes the
evolution cycle and enters subsequent rounds of DNA-templated
translation, selection, diversification, and amplification.
Selection for synthetic polymers that catalyze bond-forming or
bond-cleaving reactions can also be performed. To select for
bond-forming catalysts (for example, hetero Diels-Alder, Heck
coupling, aldol reaction, or olefin metathesis catalysts),
functionalized PNA library members are covalently linked to one
substrate through their 5' hairpin termini. The other substrate of
the reaction is synthesized as a derivative linked to biotin. When
dilute solutions of library-substrate conjugate are reacted with
the substrate-biotin conjugate, those library members that catalyze
bond formation induce self-biotinylation. Active bond forming
catalysts then are separated from inactive library members by
capturing the former with immobilized streptavidin. In an analogous
manner, functionalized PNAs that catalyze bond cleavage reactions
such as retro-aldol reactions, amide hydrolysis, elimination
reactions, or olefin dihydroxylation followed by sodium periodate
cleavage can also be selected. In this case, library members are
linked to biotinylated substrates such that the bond breakage
reaction causes the disconnection of the biotin moiety from the
library members. Active catalysts self-elute from
streptavidin-linked beads while inactive catalysts remain
bound.
Validation of PNA Polymer Library Formation
Peptide nucleic acids (PNAs) are attractive candidates for
synthetic polymer evolution because of their known ability to bind
DNA sequence-specifically, and their simple preparation from
synthetically accessible amino acids. Previous efforts to
oligomerize PNAs on DNA or RNA templates have used amine acylation
as the coupling reaction and proceeded with modest efficiency and
sequence specificity (Bohler et al. (1995) NATURE 376: 578-581;
Schmidt et al. (1997) NUC. ACIDS RES. 25: 4792-4796).
When five PNA tetramers were combined using a variety of aqueous
amine acylation conditions in the presence of DNA templates
containing complementary 20-base annealing regions, only modest
formation (<20% yield) of full-length PNAs, representing five
successive coupling reactions, were observed. Even more
problematic, however, was the formation of higher molecular weight
products independent of the position of a mismatched 4-base
annealing region in the template. These observations indicate that
PNAs are able to couple using amine acylation chemistry even when
not adjacently annealed, leading to an unpredictable mixture of
products.
It was contemplated that the distance independence previously
observed in DNA-templated amine acylation reactions was the origin
of the poor regiospecificity of amine acylation-mediated PNA
couplings. This Example shows that it is possible to overcome this
problem by replacing the distance independent amine acylation
reaction with a distance dependent DNA-templated reaction, such as
a reductive amination reaction.
In order to test this, a thymine-containing PNA monomer amino
aldehyde was synthesized and coupled to threonine-linked resin
following the method of Ede and Bray (Ede et al. (1997) TETRAHEDRON
LETTERS 38, 7119-7122). Standard FMOC peptide synthesis was used to
extend the peptide by three PNA monomers (final sequence:
NH.sub.2-gact-CHO), and aqueous acidic cleavage from the resin
yielded the desired tetrameric peptide aldehyde 1 (FIG. 62).
A DNA template containing a 5'-amine-terminated hairpin and five
successive repeats of the "codon" complementary to 1 (5'-AGTC-3')
was combined with 8 .mu.M 1 in aqueous pH 8.5 buffer. The reactants
were annealed (95.degree. C. to 25.degree. C.) and NaCNBH.sub.3 was
added to 80 mM. The reactions were quenched by buffer exchange with
a Sephadex column, and subjected to denaturation (95.degree. C. for
10 minutes in 50% formamide) and 15% denaturing PAGE. In FIG. 62,
lanes 1 and 2 show that the starting template was almost entirely
consumed, and the higher molecular weight product was formed in
>90% yield. Gel purification of the product following removal of
the DNA template with DNase I and MALDI-TOF mass spectrometry
confirmed full-length pentamer of the gact PNA aldehyde. This
result indicates that DNA-templated reductive amination can mediate
the highly efficient oligomerization of PNA aldehydes.
In order to examine the regio- and sequence-specificity of this
reaction, the oligomerization reactions were repeated using a
variety of template sequences. When a mismatched DNA template codon
(5'-ATGC-3') was introduced at the second, third, fourth, or fifth
4-base coding region (i.e., the codon) of the template, highly
efficient formation of products corresponding to the coupling of
exactly one, two, three, or four copies of 1, respectively, was
observed (see, FIG. 62, lanes 4-14). When the mismatched codon was
placed at only the first coding position, or at all five coding
positions, no product formation was observed (see, FIG. 62, lanes 3
and 15). The termination of oligomerization at the first mismatched
codon in every case indicates that the DNA-templated PNA aldehyde
coupling requires functional group adjacency (i.e., is highly
distance dependent), and, therefore, is ideally suited for
templated polymerization.
The sequence specificity of this system was probed by performing
oligomerization experiments using DNA templates containing eight
different mismatched codons (ATTC, ATGC, ATCC, AGGC, AGCC, ACTC,
ACGC, or ACCC) in the third coding region. Even though four of
these codons differ from the matched sequence (ATGC) in only one
base, in each case only two copies of 1 were coupled to the
template (see FIG. 62, lanes 5-12). This high degree of sequence
specificity raises the possibility that libraries of different DNA
sequences may be faithfully translated into libraries of
corresponding polymers using this system, analogous to
DNA-templated small molecule synthesis.
It is contemplated that synthetic polymers with desired properties
(e.g., binding or catalytic properties) may require lengths beyond
those previously achieved efficiently using nucleic acid-templated
synthesis. In order to test the ability of the above system to
generate longer polymers in an efficient and sequence-specific
manner, DNA templates were translated with 40-base coding regions
encoding ten repeats of the above matched or mismatched codon into
corresponding PNA aldehyde polymers. Polymerizations were carried
out as in FIG. 62, except that the PNA peptide aldehyde
concentration was 16 .mu.M and the reaction time with NaCNBH.sub.3
was 15 minutes. The results of these experiments are shown in FIG.
63, where the lanes alternate between template (with mismatch at
indicated position) and reactions (template plus the gact monomer).
As FIG. 63 illustrates, both denaturing PAGE and MALDI-TOF mass
spectrometry revealed a single predominant product corresponding to
the polymerization of a full length 40-mer PNA after 15 minutes.
Introducing a mismatched codon in the first, third, fifth, seventh,
or ninth coding positions on the template again resulted in
truncation (FIG. 63, lanes 4, 6, 8, 10, and 12, respectively). This
efficient translation of DNA sequences into 40 PNA bases (10
couplings) provides a polymer of length similar to DNA and RNA
oligonucleotides with binding or catalytic properties, but made
entirely of synthetic building blocks.
A challenging requirement of creating libraries of sequence-defined
synthetic polymers in this manner is maintaining sequence
specificity in the presence of multiple monomers of closely related
sequence. In order to study the specificity of DNA-templated
polymerization using multiple PNA building blocks in a single
solution, nine PNA aldehyde tetramers of the sequence
NH.sub.2-gvvt-CHO (v=g, a, or c) were synthesized. In addition,
nine DNA templates containing one of nine codons complementary to
gvvt at codon 5, and containing AGTC at the other nine positions
were prepared. Reaction conditions were identical to those from
FIG. 63, except that the reaction time with NaCNBH.sub.3 was
further shortened to 5 minutes and incubation was carried out at
37.degree. C. The first two lanes of each panel in FIG. 64 show a
positive control polymerization. Each additional set of four lanes
corresponds to: (i) 20 pmol template, (ii) reaction with 14.4 .mu.M
gact, (iii) reaction with 14.4 .mu.M gact plus 1.6 .mu.M PNA
aldehyde complementary to the highlighted codon, and (iv) reaction
with 14.4 .mu.M gact plus 0.2 .mu.M of each PNA aldehyde of the
sequence gvvt except the PNA complementary to the highlighted
codon. As expected, each of the nine templates was translated into
a single predominant truncated product corresponding to the
incorporation of four copies of 1 when 1 was the only PNA building
block included in the reaction (37.degree. C., 5 min) (see, FIG.
64). Full-length product was efficiently generated for all nine
templates, however, when the PNA aldehyde complementary to the
fifth coding sequence was included in addition to 1. When all PNA
aldehyde tetramers were included in the reaction except the PNA
complementary to the fifth coding region, only the truncated
product was efficiently generated (see, FIG. 64).
Taken together, these experiments reveal that DNA-templated PNA
aldehyde polymerizations maintain sequence specificity even when a
mixture of different PNA building blocks are present in a single
solution.
D) Evolving Plastics
In yet another embodiment, a nucleic acid (e.g., DNA, RNA,
derivative thereof) is attached to a polymerization catalyst. Since
nucleic acids can fold into complex structures, the nucleic acid
can be used to direct and/or affect the polymerization of a growing
polymer chain. For example, the nucleic acid may influence the
selection of monomer units to be polymerized as well as how the
polymerization reaction takes place (e.g., stereochemistry,
tacticity, activity). The synthesized polymers may be selected for
specific properties such molecular, weight, density,
hydrophobicity, tacticity, stereoselectivity, etc., and the nucleic
acid which formed an integral part of the catalyst which directed
its synthesis may be amplified and evolved (FIG. 65A). Iterated
cycles of ligand diversification, selection, and amplification
allow for the true evolution of catalysts and polymers towards
desired properties.
By way of example, a library of DNA molecules is attached to
Grubbs' ruthenium-based ring opening metathesis polymerization
(ROMP) catalyst through a dihydroimidazole ligand (Scholl et al.
(1999) ORG. LETT. 1(6): 953) creating a large, diverse pool of
potential catalytic molecules, each unique by nature of the
functionalized ligand (see, FIG. 65B). Functionalizing the catalyst
with a relatively large DNA-dehydroimidazole (DNA-DHI) ligand can
alter the activity of the catalyst. Each DNA molecule has the
potential to fold into a unique stereoelectronic shape which
potentially has different selectivities and/or activities in the
polymerization reaction (FIG. 66). Therefore, the library of DNA
ligands can be "translated" into a library of plastics upon the
addition of various monomers. In certain embodiments, DNA-DHI
ligands capable of covalently inserting themselves into the growing
polymer, thus creating a polymer tagged with the DNA that encoded
its creation, are used. Using the synthetic scheme shown in FIG.
65A, dehydroimidazole (DHI) ligands are produced containing two
chemical handles, one used to attach the DNA to the ligand, the
other used to attach a pedant olefin to the DHI backbone. Rates of
metathesis are known to vary widely based upon olefin substitution
as well as the identity of the catalyst. Through alteration of
these variable, the rate of pendant olefin incorporation can be
modulated such that k.sub.pendant olefin
metathesis<<k.sub.ROMP, thereby, allowing polymers of
moderate to high molecular weights to be formed before insertion of
the DNA tag and corresponding polymer termination. Vinylic ethers
are commonly used in ROMP to functionalize the polymer termini
(Gordon et al., (2000) CHEM. BIOL. 7: 9-16), as well as produce
polymers of decreased molecular weight.
A polymer from the library is subsequently selected based on a
desired property by electrophoresis, gel filtration, centrifugal
sedimentation, partitioning into solvents of different
hydrophobicities, etc. Amplification and diversification of the
coding nucleic acid via techniques such as error-prone PCR or DNA
shuffling followed by attachment to a DHI backbone will allow for
production of another pool of potential ROMP catalysts enriched in
the selected activity (FIG. 66). This method provides a new
approach to generating polymeric materials and the catalysts that
create them.
Example 10
Development of Catalysts by Templated Synthesis
An alternative approach to translating DNA into non-natural,
evolvable polymers takes advantage of the ability of some DNA
polymerases to accept certain modified nucleotide triphosphate
substrates (Perrin et al. (2001) J. AM. CHEM. SOC. 123: 1556;
Perrin et al. (1999) NUCLEOSIDES NUCLEOTIDES 18: 377-91; Gourlain
et al. (2001) NUCLEIC ACIDS RES. 29: 1898-1905; Lee et al. (2001)
NUCLEIC ACIDS RES. 29: 1565-73; Sakthievel et al. (1998) ANGEW.
CHEM. INT. ED. 37: 2872-2875). Several deoxyribonucleotides and
ribonucleotides bearing modifications to groups that do not
participate in Watson-Crick hydrogen bonding are known to be
inserted with high sequence fidelity opposite natural DNA
templates. Importantly, single-stranded DNA containing modified
nucleotides can serve as efficient templates for the
DNA-polymerase-catalyzed incorporation of natural or modified
mononucleotides.
The functionalized nucleotides incorporated by DNA polymerases to
date are shown in FIG. 67. In one of the earliest examples of
modified nucleotide incorporation by DNA polymerase, Toole and
co-workers reported the acceptance of 5-(1-pentynyl)-deoxyuridine 1
by Vent DNA polymerase under PCR conditions (Latham et al. (1994)
NUCLEIC ACIDS RES. 22: 2817-22). Several additional
5-functionalized deoxyuridines (2-7) derivatives were subsequently
found to be accepted by thermostable DNA polymerases suitable for
PCR (Sakthievel et al. (1998) supra). The first functionalized
purine accepted by DNA polymerase, deoxyadenosine analog 8, was
incorporated into DNA by T7 DNA polymerase together with
deoxyuridine analog 7 (Perrin et al. (1999) NUCLEOSIDES NUCLEOTIDES
18: 377-91). DNA libraries containing both 7 and 8 were
successfully selected for metal-independent RNA cleaving activity
(Perrin et al. (2001) J. Am. Chem. Soc. 123: 1556-63). Williams and
co-workers recently tested several deoxyuridine derivatives for
acceptance by Taq DNA polymerases and concluded that acceptance is
greatest when using C5-modified uridines bearing rigid alkyne or
trans-alkene groups such as 9 and 10 (Lee et al. (2001) NUCLEIC
ACIDS RES. 29: 1565-73). A similar study (Gourlain et al. (2001)
NUCLEIC ACIDS RES. 29: 1898-1905) on C7-functionalized
7-deaza-deoxyadenosines revealed acceptance by Taq DNA polymerase
of 7-aminopropyl- (11), cis-7-aminopropenyl-(12), and
7-aminopropynyl-7-deazadeoxyadenosine (13).
With simple general acid and general base functionality, chiral
metal centers would expand considerably the chemical scope of
nucleic acids. Functionality aimed at binding chemically potent
metal centers has yet to been incorporated into nucleic acid
polymers. Natural DNA has demonstrated the ability to fold in
complex three-dimensional structures capable of stereospecifically
binding target molecules (Lin et al. (1997) CHEM. BIOL. 4: 817-32;
Lin et al. (1998) CHEM. BIOL. 5: 555-72; Schultze et al. (1994) J.
MOL. BIOL. 235: 1532-47) or catalyzing phosphodiester bond
manipulation (Santoro et al. (1997) PROC. NATL. ACAD. SCI. USA 94:
4262-6; Breaker et al. (1995) CHEM. BIOL. 2: 655-60; Li et al.
(2000) BIOCHEMISTRY 39: 3106-14; Li et al. (1999) PROC. NATL. ACAD.
SCI. USA 96: 2746-51), DNA depurination (Sheppard et al. (2000)
PROC. NATL. ACAD. SCI. USA 97: 7802-7807) and porphyrin metallation
(Li et al. (1997) BIOCHEMISTRY 36: 5589-99; Li et al. (1996) NAT.
STRUCT. BIOL. 3: 743-7). Non-natural nucleic acids augmented with
the ability to bind chemically potent, water-compatible metals such
Cu, La, Ni, Pd, Rh, Ru, or Sc may possess greatly expanded
catalytic properties. For example, a Pd-binding oligonucleotide
folded into a well-defined structure may possess the ability to
catalyze Pd-mediated coupling reactions with a high degree of
regiospecificity or stereospecificity. Similarly, non-natural
nucleic acids that form chiral Sc binding sites may serve as
enantioselective cycloaddition or aldol addition catalysts. The
ability of DNA polymerases to translate DNA sequences into these
non-natural polymers coupled with in vitro selections for catalytic
activities would therefore permit the direct evolution of desired
catalysts from random libraries.
Evolving catalysts in this approach addresses the difficulty of
rationally designing catalytic active sites with specific chemical
properties that has inspired recent combinatorial approaches (Kuntz
et al. (1999) CURR. OPIN. CHEM. BIOL. 3: 313-319; Francis et al.
(1998) CURR. OPIN. CHEM. BIOL. 2: 422-8) to organometallic catalyst
discovery. For example, Hoveyda and co-workers identified Ti-based
enantioselective epoxidation catalysts by serial screening of
peptide ligands (Shimizu et al. (1997) ANGEW. CHEM. INT. ED. 36).
Serial screening was also used by Jacobsen and co-workers to
identify peptide ligands that form enantioselective epoxidation
catalysts when complexed with metal cations (Francis et al. (1999)
ANGEW. CHEM. INT. ED. ENGL. 38: 937-941). Recently, a peptide
library containing phosphine side chains was screened for the
ability to catalyze malonate ester addition to cyclopentenyl
acetate in the presence of Pd (Gilbertson et al. (2000) J. AM.
CHEM. SOC. 122: 6522-6523).
The current approach differs fundamentally from previous
combinatorial catalyst discovery efforts in that it permits
catalysts with desired properties to spontaneously emerge from one
pot, solution-phase libraries after evolutionary cycles of
diversification, amplification, translation, and selection. This
strategy allows up to 10.sup.15 different catalysts to be generated
and selected for desired properties in a single experiment. The
compatibility of this approach with one-pot in vitro selections
allows the direct selection for reaction catalysis rather than
screening for a phenomenon associated with catalysis such as metal
binding or heat generation. In addition, properties difficult to
screen rapidly such as substrate stereospecificity or metal
selectivity can be directly selected using approaches disclosed
herein.
Key intermediates for a number of C5-functionalized uridine analogs
and C7-functionalized 7-deazaadenosine analogs have been
synthesized for incorporation into non-natural DNA polymers. In
addition, the synthesis of six C8-functionalized adenosine analogs
as deoxyribonucleotide triphosphates has been completed.
Synthesis of Metal-Binding Nucleotides
A strategy for synthesizing metal-binding uridine and
7-deazaadenosine analogs is shown in FIG. 68. Both routes end with
amide bond formation between NHS esters of metal-binding functional
groups and amino modified deoxyribonucleotide triphosphates (7 and
13). Analogs 7 and 13 as well as acetylated derivatives of 7 have
been previously shown to be tolerated by DNA polymerases, including
thermostable DNA polymerases suitable for PCR (Perrin et al. (2001)
supra; Perrin et al. (1999) supra; Latham et al. (1994) NUCLEIC
ACIDS RES. 22: 2817-22; Gourlain et al. (2001) Nucleic Acids Res.
29: 1898-1905; Lee et al. (2001) NUCLEIC ACIDS RES. 29: 1565-73;
Sakthivel et al. (1998) ANGEW. CHEM. INT. ED. ENGL. 37: 2872-2875).
This approach allows a wide variety of metal-binding ligands to be
rapidly incorporated into either nucleotide analog. Amino modified
deoxy-ribonucleotide triphosphate 7 has been synthesized using a
previously reported route (Sakthivel et al. (1998) supra). As
illustrated in FIG. 69, Heck coupling of commercially available
5-iodo-2'-deoxyuridine (22) with N-allyltrifluoroacetamide provided
compound 23. The 5'-triphosphate group was incorporated by
treatment of compound 23 with trimethylphosphate, phosphorous
oxychloride (POCl.sub.3), and proton sponge
(1,8-bis(dimethylamino)-naphthalene) followed by
tri-n-butylammonium pyrophosphate, and the trifluoroacetamide group
then removed with aqueous ammonia to afford C5-modified uridine
intermediate 7.
C7-modified 7-deazaadenosine intermediate 13, the key intermediate
for 7-deazaadenosine analogs, has been synthesized. As shown in
FIG. 70, diethoxyethylcyanoacetate 24 was synthesized from
bromoacetal 25 and ethyl cyanoacetate 26 following a known protocol
(Davoll (1960) J. AM. CHEM. SOC. 82: 131-138). Condensation of 24
with thiourea provided pyrimidine 27, which was desulfurized with
Raney nickel and then cyclized to pyrrolopyrimidine 28 with dilute
aqueous HCl. Treatment of 28 with POCl.sub.3 afforded
4-chloro-7-deazaadenine 29. The aryl iodide group which can serve
as a Sonogashira coupling partner for installation of the
propargylic amine in 13 was incorporated by reacting 29 with
N-iodosuccinimide to generate 4-chloro-7-iodo-7-deazaadenine 30 in
13% overall yield from bromoacetal 25. FIG. 71 shows glycosylation
of compound 30 with protected deoxyribosyl chloride 38 (generated
from deoxyribose as shown in FIG. 72), followed by ammonolysis
afforded 7-iodo-adenosine 39 (Gourlain et al. (2001) NUCLEIC ACIDS
RES. 29: 1898-1905). Pd-mediated Sonogashira coupling (Seela et al.
(1999) HELV. CHEM. ACTA 82: 1878-1898) of 39 with
N-propynyltrifluoroacetamide provides 40, which is then converted
to the 5' nucleotide triphosphate and deprotected with ammonia to
yield C7-modified 7-deazaadenosine intermediate 13.
In order to create a library of metal-binding uridine and adenosine
analogs, a variety of metal-binding groups as NHS esters can be
coupled to C5-modified uridine intermediate 7 and C7-modified
7-deazaadenosine intermediate 13. Exemplary metal binding groups
are shown in FIG. 68 and include phosphines, thiopyridyl groups,
and hemi-salen moieties. Additional deoxyadenosine derivatives,
such as, for example, compounds 41 and 42 shown in FIG. 73, can be
prepared by coupling alkyl- and vinyl trifluoroacetamides to
8-bromo-deoxyadenosine (31). These intermediates then are coupled
with the NHS esters shown in FIG. 68 to generate a variety of
metal-binding 8-functionalized deoxyadenosine triphosphates.
As alternative functionalized adenine analogs that will both probe
the structural requirements of DNA polymerase acceptance and
provide potential metal-binding functionality, six 8-modified
deoxyadenosine triphosphates (FIG. 74) have been synthesized. All
functional groups were installed by addition to
8-bromo-deoxyadenosine (31), which was prepared by bromination of
deoxyadenosine in the presence of scandium chloride (ScCl.sub.3),
which we found to greatly increase product yield. Methyl- (32),
ethyl- (33), and vinyladenosine (34) were synthesized by
Pd-mediated Stifle coupling of the corresponding alkyl tin reagent
and 31 (Mamos et al. (1992) TETRAHEDRON LETT. 33: 2413-2416).
Methylamino- (35) (Nandanan et al. (1999) J. MED. CHEM. 42:
1625-1638), ethylamino- (36), and histaminoadenosine (37) were
prepared by treatment of 23 with the corresponding amine in water
or ethanol. The 5'-nucleotide triphosphates of 32-37 were
synthesized as described above.
Acceptance of Nucleotides by Polymerase
The ability of the modified nucleotide triphosphates containing
metal-binding functionality shown in FIG. 75 to be accepted by DNA
polymerase enzymes was studied. Synthetic nucleotide triphosphates
were purified by ion exchange and reverse-phase HPLC and were added
to PCR reactions containing Taq DNA polymerase, three natural
deoxynucleotide triphosphates, pUC19 template DNA, and two DNA
primers. The primers were chosen to generate PCR products ranging
from 50 to 200 base pairs in length. Control PCR reactions
contained the four natural deoxynucleotide triphosphates and no
non-natural nucleotides. PCR reactions were analyzed by gel
electrophoresis and the results indicate that functionalized
uridine analogs 2, 3, 7, 13, 28, 29, and 30 were efficiently
incorporated by Taq DNA polymerase over 30 PCR cycles, while
uridine analogs 31 and 32 were not efficiently incorporated (see,
FIG. 75). These results demonstrate that synthetic nucleotides
containing metal binding functionality can both be read as
templates and incorporated as building blocks into non-natural
nucleic acids using DNA polymerases. The 8-modified adenosine
triphosphates 32 and 33 were not accepted by Taq DNA polymerase,
suggesting possible rejection of modifications at C8 (see, FIG.
75).
Functionalized nucleotides that are especially interesting yet are
not compatible with Taq, Pfu, or Vent thermostable DNA polymerases
can be tested for their ability to participate in primer extension
using other commercially available DNA polymerases including the
Klenow fragment of E. coli DNA polymerase I, T7 or T4 DNA
polymerase, or M-MuLV reverse transcriptase.
Generation of Polymer Libraries
Non-natural polymer libraries containing synthetic metal-binding
nucleotides that are compatible with DNA polymerases have been
created. Libraries of 10.sup.15 different modified nucleic acids
consisting of 40 random bases flanked by two primer binding regions
and containing the imidazole-linked thymine base shown in FIG. 76
have been created. These libraries were efficiently generated by
three methods: standard PCR, error-prone PCR, and primer extension
using large quantities of template and stoichiometric quantities of
only one primer. The resulting double-stranded libraries were
denatured and the desired strand isolated using the avidin-based
purification system described hereinabove. Two rounds of in vitro
selection on this library for polymers that fold only in the
presence of Cu.sup.2+ have been performed using the gel
electrophoresis selection for folded nucleic acids as described
herein.
Libraries of nucleic acids containing the most promising
polymerase-accepted metal-binding nucleotides, including 28-30
(FIG. 75), can also be generated. Libraries can be generated by PCR
amplification or by primer extension of a synthetic DNA template
library consisting of a random region of 20 or 40 nucleotides
flanked by two 15-base constant priming regions (FIG. 77). The
priming regions contain restriction endonuclease cleavage sites to
allow DNA sequencing of pools or individual library members. One
primer contains a primary amine group at its 5' terminus and will
become the coding strand of the library. The other primer contains
a biotinylated 5' terminus and will become the non-coding strand.
The PCR reaction includes one or two non-natural metal-binding
deoxyribonucleotide triphosphates, three or two natural
deoxyribonucleotide triphosphates, and a DNA polymerase compatible
with non-natural nucleotides. Following PCR to generate the
double-stranded form of the library, library members then are
denatured and the non-coding strands removed by washing with
streptavidin-linked magnetic beads to ensure that no biotinylated
strands remain in the library. Libraries of up to 10.sup.15
different members can be generated by this method, far exceeding
the combined diversity of previously reported combinatorial
metal-binding catalyst discovery efforts.
Each library then is incubated in aqueous solution with a metal of
interest from the following non-limiting list of water compatible
metal salts: ScCl.sub.3, CrCl.sub.3, MnCl.sub.2, FeCl.sub.2,
FeCl.sub.3, CoCl.sub.2, NiCl.sub.2, CuCl.sub.2, ZnCl.sub.2,
GaCl.sub.3, YCl.sub.3, RuCl.sub.3, RhCl.sub.3, Na.sub.2PdCl.sub.4,
AgCl, CdCl.sub.2, InCl.sub.3, SnCl.sub.2, La(OTf).sub.3,
Ce(OTf).sub.3, Pr(OTf).sub.3, Nd(OTf).sub.3, Sm(OTf).sub.3,
Eu(OTf).sub.3, Gd(OTf).sub.3, Tb(OTf).sub.3, Dy(OTf).sub.3,
Ho(OTf).sub.3, Er(OTf).sub.3, Tm(OTf).sub.3, Yb(OTf).sub.3,
Lu(OTf).sub.3, IrCl.sub.3, PtCl.sub.2, AuCl, HgCl.sub.2, HgCl,
PbCl.sub.2, and BiCl.sub.3 (Kobayashi et al. (1998) J. AM. CHEM.
SOC. 120: 8287-8288; Fringuelli et al. (2001) EUR. J. ORG. CHEM.
2001: 439-455). The metals are chosen in part based on the specific
chemical reactions to be catalyzed. For example, libraries aimed at
reactions such as aldol condensations or hetero Diels-Alder
reactions that are known to be catalyzed by Lewis acids are
incubated with ScCl.sub.3 or with one of the lanthanide triflates
(Fringuelli et al. (2001) supra). In other cases, metals not
previously known to catalyze the transformations of interest are
also used to evolve polymers with unprecedented activity. The
metal-incubated library is purified away from unbound metal salts
using gel filtration cartridges (available from, for example,
Princeton Separations) that separate DNA oligonucleotides 25 bases
or longer from unbound smaller reaction components.
The ability of the polymer library (or of individual library
members) to bind metals of interest is verified by treating the
metalated library free of unbound metals with metal staining
reagents, such as dithiooxamide, dimethylglyoxime, or potassium
isothiocyanate (KSCN) (Francis et al. (1998) CURR. OPIN. CHEM.
BIOL. 2: 422-8) or EDTA (Zaitoun et al. (1997) J. PHYS. CHEM. B
101: 1857-1860), that become distinctly colored in the presence of
different metals. The approximate level of metal binding is
measured by spectrophotometric comparison with solutions of free
metals of known concentration and with solutions of positive
control oligonucleotides containing an EDTA group (which can be
introduced using a commercially available phosphoramidite from Glen
Research, Sterling, Va., USA).
Selecting Nucleic Acid Polymers
Once the libraries of functionalized DNAs are synthesized and
characterized, they are subjected to three types of in vitro
selections for: (i) folding, (ii) target binding, or (iii)
catalysis.
(i) Folding. Non-denaturing gel electrophoresis can be used as a
simple selection, to be applied to inventive libraries of modified
nucleic acids, to select for nucleic acid folding in the presence
of specific metals of interest. In order to test this selection
approach on molecules similar to future library members, three
60-base DNA oligonucleotides known (Schultze et al. (1994) J. MOL.
BIOL. 235: 1532-1547) or predicted (SantaLucia (1998) PROC. NATL.
ACAD. SCI. USA 95: 1460-1465) to have very different folded states
were synthesized. Each oligonucleotide contained a core 30-base
sequence flanked by two 15-base primer binding sequences. The
unstructured control oligonucleotide contained a poly T core and an
EcoR I restriction site. The second core sequence contained a
perfect inverted repeat predicted to form a highly stable hairpin,
while the third core sequence contained a poly G core known to fold
in solution into an intramolecular G-quartet (Cheng et al. (1997)
GENE 197: 253-260). The three DNA sequences were combined in
equimolar ratios and the mixture subjected to preparative
non-denaturing gel electrophoresis. The high mobility portion of
the DNA was captured and compared by analytic electrophoresis to
authentic poly T, hairpin, and poly G oligonucleotides. The results
indicate that folded DNA sequences can be readily separated from a
mixture of folded and unfolded DNA molecules by non-denaturing gel
electrophoresis. This selection approach can be applied to the
metal-binding polymer libraries, wherein polymers with anticipated
metal binding ability will be incubated with one or more
water-compatible metal sources prior to selection. Polymers capable
of folding in the presence, but not in the absence, of metals will
serve as especially attractive starting points for the next two
types of selections.
(ii) Target Binding. Selections for target binding can be performed
by incubating the solution-phase polymer library with either
immobilized target or with biotinylated target followed by
streptavidin-linked beads. Non-binders are removed by washing, and
polymers with desired binding properties are eluted by chemical
denaturation or by adding excess authentic free ligand. In order to
complete one cycle of functionalized DNA evolution, the DNA
templates are amplified by PCR using one primer containing the
5'-functionalized hairpin primer and a biotinylated second primer,
optionally diversified by error-prone PCR (Caldwell (1992) PCR
METHODS APPLIC. 2: 28-33) or by nonhomologous random recombination
method, and then denatured into single stranded DNA and washed with
streptavidin beads to remove the non-coding template strand. The
resulting pool of selected single-stranded, 5'-functionalized DNA
completes the evolution cycle and enters subsequent rounds of
DNA-templated translation, selection, diversification, and
amplification.
(iii) Catalysis. Selection for synthetic polymers that catalyze
bond-forming or bond-cleaving reactions can also be performed.
Library members that catalyze virtually any reaction that causes
bond formation between two substrate molecules or that results in
bond breakage into two product molecules can be selected using the
schemes proposed in FIGS. 12 and 13. As illustrated in FIG. 12, in
order to select for bond forming catalysts (for example, hetero
Diels-Alder, Heck coupling, aldol reaction, or olefin metathesis
catalysts), library members are covalently linked to one substrate
through their 5' amino or thiol termini. The other substrate of the
reaction is synthesized as a derivative linked to biotin. When
dilute solutions of library-substrate conjugate are reacted with
the substrate-biotin conjugate, those library members that catalyze
bond formation cause the biotin group to become covalently attached
to themselves. Active bond forming catalysts can then be separated
from inactive library members by capturing the former with
immobilized streptavidin and washing away inactive polymers. By way
of example, the synthesis and selection of active Heck coupling
catalysts, active hetero diels-alder catalysts and active aldol
addition catalysts may be performed as shown in FIGS. 78A, 78B, and
78C, respectively.
In an analogous manner, library members that catalyze bond cleavage
reactions such as retro-aldol reactions, amide hydrolysis,
elimination reactions, or olefin dihydroxylation followed by
periodate cleavage can also be selected, as illustrated in FIG. 13.
In this case, metalated library members are covalently linked to
biotinylated substrates such that the bond breakage reaction causes
the disconnection of the biotin moiety from the library members.
Upon incubation under reaction conditions, active catalysts, but
not inactive library members, induce the loss of their biotin
groups. Streptavidin-linked beads can then be used to capture
inactive polymers, while active catalysts are able to elute from
the beads. Related bond formation and bond cleavage selections have
been used successfully in catalytic RNA and DNA evolution (Jaschke
et al. (2000) CURR. OPIN. CHEM. BIOL. 4: 257-62). Although these
selections do not explicitly select for multiple turnover
catalysis, RNAs and DNAs selected in this manner have in general
proven to be multiple turnover catalysts when separated from their
substrate moieties (Jaschke et al. (2000) CURR. OPIN. CHEM. BIOL.
4: 257-62; Jaeger et al. (1999) PROC. NATL. ACAD. SCI. USA 96:
14712-7; Bartel et al. (1993) SCIENCE 261: 1411-8; Sen et al.
(1998) CURR. OPIN. CHEM. BIOL. 2: 680-7).
It is contemplated that catalysts of three important and diverse
bond-forming reactions (Heck coupling, hetero Diels-Alder
cycloaddition, and aldol addition) can be created using the
technologies described herein. All three reactions are water
compatible (Kobayashi et al. (1998) J. AM. CHEM. SOC. 120:
8287-8288; Fringuelli et al. (2001) EUR. J. ORG. CHEM. 2001:
439-455; Li et al. (1997) ORGANIC REACTIONS IN AQUEOUS MEDIA) and
are known to be catalyzed by metals.
Evolving Functionalized DNA Polymers
Following each round of selection, active library members can be
amplified directly by PCR with the non-natural nucleotides and
subjected to additional rounds of selection to enrich the library
for desired catalysts. Libraries may be diversified by random
mutagenesis using error-prone PCR or by nonhomologous recombination
and characterized by DNA sequencing before and after selection.
Because error-prone PCR is inherently less efficient than normal
PCR, error-prone PCR diversification is conducted with only natural
nucleotides. The mutagenized DNA templates then are translated into
non-natural nucleic acid polymers as described above.
In addition to simply evolving active catalysts, the in vitro
selections described herein may be used to evolve catalysts with
properties difficult to achieve using current catalyst discovery
approaches. For example, substrate specificity among catalysts can
be evolved by selecting for active catalysts in the presence of the
desired substrate and then selecting for inactive catalysts in the
presence of one or more undesired substrates. Using this strategy,
it is contemplated that it will be possible to evolve libraries of
catalysts with unprecedented regio- and stereoselectivity. By way
of example, four types of substrate specificity currently
unachievable by known catalysts nor likely to be solvable by
current catalyst discovery methods include: (i) Heck catalysts that
operate on para- but not meta-aryl chlorides, (ii) aldol catalysts
that accept ketones but not aldehydes as enolate acceptors, (iii)
hetero Diels-Alder catalysts that reject olefin dienophiles, and
(iv) hetero Diels-Alder catalysts that accept trans-trans but
reject cis-trans or terminal dienes. Metal-binding polymers
containing well-ordered, three-dimensional dispositions of key
steric and electronic groups may be ideally suited to solving these
problems. Similarly, metal selectivity can be evolved by selecting
for active catalysts in the presence of desired metals and
selecting against activity in the presence of undesired metals.
Catalysts with broad substrate tolerance may be evolved by varying
substrate structures between successive rounds of selection.
Characterizing catalysts evolved by the above methods may provide
new insights into developing analogous small molecule catalysts
with powerful and unprecedented selectivities.
In addition, the observations of sequence-specific DNA-templated
synthesis in DMF and CH.sub.2Cl.sub.2 suggested that
DNA-tetralkylammonium cation complexes may form base-paired
structures in organic solvents. These findings raise the
possibility of evolving non-natural nucleic acid catalysts in
organic solvents using slightly modified versions of the selections
described above. The actual bond forming and bond cleavage
selection reactions may be conducted in organic solvents, the crude
reactions then will be ethanol precipitated to remove the
tetraalkylammonium cations, and the immobilized avidin separation
of biotinylated and non-biotinylated library members in aqueous
solution will be performed. PCR amplification of selected members
will then take place as described hereinabove. Successful evolution
of reaction catalysts that function in organic solvents would
expand considerably both the scope of reactions that can be
catalyzed and the utility of the resulting evolved non-natural
polymer catalysts.
Example 11
In Vitro Selection for Protein Binding and Affinity
This Example demonstrates that it is possible to perform in vitro
selections for nucleic acid-linked synthetic small molecules with
protein binding affinity. These selections (i) offer much greater
sensitivities (10.sup.-20 mol) than previously reported synthetic
molecule screens for protein binding, (ii) can be rapidly iterated
to achieve >10.sup.6-fold net enrichments of active molecules,
and (iii) can be adapted to select for binding specificity.
Because all molecules in a selection are processed simultaneously,
selections offer much higher potential throughput than screens.
Selections typically do not require sophisticated equipment and can
be iterated to multiply the net enrichment of desired molecules.
Certain properties such as binding specificity, although difficult
to screen, can be readily selected. Finally, the outcomes of
laboratory and natural selections usually are linked to amplifiable
nucleic acids, permitting the selections to offer far greater
sensitivities than screens. The covalent linkage of
oligonucleotides to corresponding synthetic molecules, either as a
consequence of nucleic acid-templated organic synthesis or as a
result of conjugating a nucleic acid to synthetic molecules, allows
synthetic molecules to be selected and then identified. Despite
these attractions, selections for synthetic molecules have been
largely unexplored.
At the outset, a variety of synthetic small molecules conjugated to
36- to 42-base DNA oligonucleotides (see, FIG. 79) were synthesized
such that each small molecule was linked to a unique DNA sequence.
The small molecules were chosen either for their known binding
affinities to six proteins (see, FIG. 79), or as nonbinding
negative controls. Solutions containing mixtures of DNA-linked
protein ligands and DNA-linked negative controls were used to
simulate DNA-templated synthetic small molecule libraries
containing small fractions of library members with protein binding
activities.
Selections for protein affinity were performed by incubating
mixtures of DNA-linked synthetic small molecules for 1-2 hours with
target proteins covalently conjugated to beads. The non-binders
were removed by washing the beads with high salt buffer. The bound
molecules were then PCR amplified to amplify the DNA
oligonucleotides surviving selection. Sequences encoding known
protein binding ligands were distinguished from DNA encoding
non-binders by digestion with sequence-specific restriction
endonucleases, permitting their relative ratio to be quantitated by
gel electrophoresis and densitometry. The efficiency of each
selection was assessed by the degree to which DNA-linked protein
ligands were enriched relative to DNA-linked non-binders (the
"enrichment factor").
Among the protein-small molecule interactions considered, the
binding of glutathione amide to glutathione S-transferase (GST) is
among the lowest affinity (K.sub.d=.about.10 .mu.M) and, therefore,
represents a stringent test of protein binding selections for
DNA-linked synthetic small molecules. To measure the sensitivity
and efficiency of these selections (see, FIG. 80), the number of
DNA-linked glutathione molecules (1) were varied from 10.sup.3 to
10.sup.7 molecules. A 100- to 10.sup.6-fold molar excess of the
negative control N-formyl-Met-Leu-Phe linked DNA (2) was combined
with (1) and the resulting mixture was selected for binding to
GST-linked agarose beads. The selection strongly enriched as few as
10,000 copies of the DNA-linked glutathione by 100- to
>10.sup.4-fold relative to the negative control (FIG. 80).
Although the concentrations of DNA-linked molecules during
selections were much lower than .mu.M, the selections were
successful because GST was immobilized at an effective
concentration exceeding .about.10 .mu.M and, therefore, permitted a
significant fraction of (1) to remain bound to GST. These results
demonstrate that selections for modest protein affinities (for
example, K.sub.d=10 .mu.M) are possible in this format.
In order to evaluate the generality of this approach, analogous
selections were performed for binding to streptavidin, carbonic
anhydrase, papain, trypsin, and chymotrypsin in addition to GST
(FIG. 79). Collectively these six functionally diverse proteins
bind the ligands shown in FIG. 79 with predicted affinities that
span more than eight orders of magnitude (K.sub.d=.about.14 .mu.M
to .about.40 fM) (D'Silva (1990) BIOCHEM. J. 271: 161-165) (Jain et
al. (1994) J. MED. CHEM. 37: 2100-2105; Green (1990) METHODS ENZ.
184: 51-67; Otto et al. (1997) CHEM. REV. 97: 133-172). In each of
these cases, selection enriched .ltoreq.10.sup.-16 mol of a known
small molecule ligand conjugated to DNA by at least 50-fold over a
non-binding negative control (FIG. 79), indicating that DNA
conjugation does not impair the ability of the ligands in FIG. 79
to bind their cognate protein targets and suggesting that these
selections may be applicable to a wide variety of unrelated
proteins.
Furthermore, selections can be iterated to multiply the net
enrichment of desired molecules. To test this possibility with
DNA-linked synthetic molecules, a 1:1,000 mixture of DNA-linked
phenyl sulfonamide (3):DNA-linked N-formyl-Met-Leu-Phe (2) was
subjected to a selection for binding carbonic anhydrase. The
molecules surviving the first selection were eluted and directly
subjected to a second selection using fresh immobilized carbonic
anhydrase. PCR amplification and restriction digestion revealed
that the first round of selection yielded a 1:3 ratio of (3):(2),
representing a 330-fold enrichment for the DNA-linked phenyl
sulfonamide. The second round of selection further enriched 3 by
more than 30-fold, such that the ratio of (3):(2) following two
rounds of selection exceeded 10:1 (>10.sup.4-fold net
enrichment). Similarly, three rounds of iterated selection were
used to enrich a 1:10.sup.6 starting ratio of (3):DNA-linked biotin
(4) by a factor of 5.times.10.sup.6 into a solution containing
predominantly DNA-linked phenyl sulfonamide (3) (see, FIG. 81).
These findings demonstate that enormous net enrichments for
DNA-linked synthetic molecules can be achieved through iterated
selection, and suggest that desired molecules represented as rarely
as 1 part in 10.sup.6 (approximately the largest number of
different small molecules generated in a single library to date)
within DNA-templated synthetic libraries may be efficiently
isolated in this manner.
In addition to binding affinity, binding specificity is a broadly
important property of synthetic molecules. Library screening
methods for binding specificity typically require duplicating the
entire screen for each target or non-target of interest. In
contrast, selections for specificity in principle can be performed
in a single experiment by selecting for target binding as well as
for the inability to bind one or more non-targets. In order to
validate selections for specificity among DNA-linked synthetic
small molecules, DNA-linked biotin (4), DNA-linked chymostatin (5),
and DNA-linked antipain (6) were combined into a single solution in
a 24:4:1 ratio, respectively. Because biotin has no significant
affinity for chymotrypsin or papain, chymostatin binds to both
proteases, and antipain binds only to papain, (see, FIG. 82) this
mixture simulates a library containing predominantly nonbinding
molecules with a minor fraction of nonspecific binders and an even
smaller fraction of a target-specific binder.
When this mixture was subjected to two rounds of selection for
binding to papain, both 5 and 6 were enriched at the expense of 4,
as expected (FIG. 82). However, when the above mixture was washed
with chymotrypsin-linked beads and selected for binding to papain
in the presence of excess free chymotrypsin, only the
papain-specific ligand (6) was enriched (FIG. 82). The ability of
the selections described above to separate target-specific and
non-specific DNA-linked synthetic molecules from a single solution
suggests their use to discover synthetic molecules that exclusively
bind a single member of a large family of related proteins (e.g.,
kinases, proteases, or glycotransferases), and that do not bind
proteins that commonly reduce the biological efficacy of small
molecules (e.g. by sequestering, exporting, or metabolizing
them).
In summary, this Example demonstrates the feasibility of performing
in vitro selections for DNA-linked synthetic small molecules with
protein binding activities. The application of methods developed
here to nucleic acid-templated (or nucleic acid-conjugated)
libraries may play an important role in the discovery of synthetic
molecules with desired properties using powerful selection and
amplification strategies previously available only to biological
molecules.
Materials and Methods
DNA Synthesis
DNA oligonucleotides were synthesized on a PerSeptive Biosystems
Expedite 8090 DNA synthesizer using standard phosphoramidite
protocols. All reagents were purchased from Glen Research,
Sterling, Va., USA. The templates for the glutathione S-transferase
(GST) selection were synthesized using a 5'-amino-modifier C12 and
all other templates were synthesized using 5'-amino-modifier
C5.
Preparation of Compound (1)
Glutathione was synthesized on the solid phase using standard Boc
chemistry at room temperature. 200 mg PAM Resin (Advanced ChemTech)
was swelled in 2 mL DMF for 20 minutes. N-Boc-glycine (Sigma, 640
.mu.mol, 112 mg), diisopropylcarbodiimide (570 .mu.mol, 89 .mu.L),
and 4-dimethylaminopyridine (DMAP, 57 .mu.mol, 7 mg) were added to
the resin and stirred for 4 hours. The resin was washed with DMF
and then with DMF/CH.sub.2Cl.sub.2 (1:1). The N-Boc protecting
group was removed using two 3 minute washes of trifluoroacetic acid
(TFA):m-cresol (95:5). The resin then was washed with
DMF:CH.sub.2Cl.sub.2 (1:1) and DMF:pyridine (1:1). A solution of
N-Boc-Cys(Fm)-OH (ChemImpex, 800 .mu.mol, 320 mg),
O-(7-Azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (Aldrich, 720 .mu.mol, 274 mg), 2,6-lutidine
(1.2 mmol, 131 .mu.l) and N,N-diisopropylethylamine (DIPEA, 750
.mu.mol, 131 .mu.l) in 800 .mu.L of 1-methyl-2pyrrolidinone was
stirred for 15 minutes and then added to the resin, stirring for 30
minutes. The resin then was washed with DMF/CH.sub.2Cl.sub.2 (1:1).
To remove the N-Boc protecting group on cysteine, a solution of
trimethylsilyl triflate (TMS-Otf) (2.8 mmol, 0.5 mL) and
2,6-lutidine (4.58 mmol, 0.5 mL) in 1.75 mL CH.sub.2Cl.sub.2 was
added to the resin and stirred for 1 hour. The resin then was
washed with methanol and then with DMF:CH.sub.2Cl.sub.2 (1:1).
Fmoc-Glu-OFm (ChemImpex, 800 .mu.mol, 438 mg) was coupled as
described above. The fully protected glutathione was cleaved from
the resin with a solution of trifluoromethanesulfonic
acid:m-cresol:thioanisole:TFA (2:1:1:8), stirring for 1 hours. The
mixture was filtered and the filtrate was extracted into hexane.
The crude extract was purified using preparative thin layer
chromatography in hexane. The silica containing the crude product
(R.sub.f=0.35) was washed extensively with hexane:ethyl acetate
(4:1). The filtrate was isolated under vacuum to afford a yellowish
solid. Yields for this synthesis were not optimized.
A solution of protected glutathione (1.1 .mu.mol, 1.3 mg) in 90
.mu.l DMF with N-hydroxysuccinimide (NHS, 11 .mu.mol, 1.3 mg),
dicyclohexylcarbodiimide (DCC, 11 .mu.mol, 2.3 mg), and DMAP (5.7
.mu.mol, 0.7 mg) was agitated for 1 hour. The mixture was spun down
and the supernatant was added to 5'-amino-terminated protected DNA
on CPG beads. This mixture was agitated for 2 hours and then the
beads were washed with DMF, with CH.sub.3CN, and dried with
nitrogen.
Preparation of Compound (2a)
N-formyl-Met-Leu-Phe (MLF) was purchased from Sigma and coupled to
5'-amino-terminated protected DNA on CPG beads using the conditions
described for compound (1).
Preparation of Compound (2b)
MLF (10-100 .mu.mol, 0.17 M) was dissolved in dry DMF with 1 equiv.
1-hydroxybenzotriazole (Novabiochem), 0.9 equiv.
O-Benzotriazol-1-yl-N,N,N',N'-tetramethyluronium
hexafluorophosphate (Aldrich), and 2.3 equivalents of DIPEA. The
solution was agitated at room temperature for 1 hour and then added
to a unique sequence of 5'-amino-terminated protected DNA on CPG
beads. The mixture was agitated for 1 hour at room temperature. The
beads then were washed with DMF, then with CH.sub.3CN, and dried
under nitrogen.
Preparation of Compound (3)
Fmoc-Lys(Mmt)-OH (Novabiochem) was attached to amino-terminated
protected DNA on CPG beads using the method described for compound
(2b). The Fmoc group was removed with three 2 minute washes with
20% piperidine in DMF. The mixture then was washed with DMF and
then with CH.sub.3CN. The .alpha.-amine then was capped with a
solution of 5% 1-methylimidazole in acetic
anhydride/pyridine/tetrahydrofuran (1:1.1:18) for 10 minutes at
room temperature. The beads then were washed with DMF and
CH.sub.3CN, and then treated with 3% trichloroacetic acid, 1%
thioanisole in CH.sub.2Cl.sub.2 for 5 minutes at room temperature
to remove the Mmt protecting group. The mixture was washed with
CH.sub.3CN and dried with nitrogen. Fmoc-Phg-OH (Novabiochem) was
attached to the .epsilon.-amine of the Lys-linked DNA using the
method described for compound (2b). After removal of the Fmoc
protecting group, 4-carboxybenzenesulfonamide (Aldrich) was
attached to the beads using the method described for compound (2b).
The beads were washed with DMF, then with CH.sub.3CN, and dried
with nitrogen.
Preparation of Compounds (4a, 4b)
A 5'-biotin modified phosphoramidite (Glen Research, Sterling, Va.,
USA) was used as the final monomer in the DNA synthesis.
Preparation of Compound (5)
Chymostatin (Sigma) was attached to amino-terminated protected DNA
on CPG beads using the conditions described for compound (2b).
Preparation of Compound (6)
Antipain (Sigma, 1.5 .mu.mol, 0.9 mg) was added to a 30 .mu.L
solution of 300 mM DCC and 300 mM NHS in DMF. After agitating for 1
hour at room temperature, this solution was added to 45 .mu.L of
5'-amino terminated DNA (.about.200-300 .mu.M) in 0.1 M MES buffer
pH 6.0. This DNA had previously been cleaved from the CPG beads and
purified by HPLC as described in the next section. After 2 hours,
this solution was purified by gel filtration using Sephadex G-25
followed by reverse-phase HPLC.
The complete structures of synthetic groups 1-6 linked to DNA are
shown in FIG. 83.
Characterization of DNA-Linked Synthetic Molecules
Small molecule DNA conjugates were cleaved from the CPG beads with
a solution of methylamine:ammonium hydroxide (1:1) at 55.degree. C.
for 1 hour. The solution was dried under vacuum and then purified
by reverse phase HPLC using TEAA/CH.sub.3CN gradient and analyzed
by MALDI-TOF mass spectrometry. Stock solution concentrations were
determined using UV-Vis spectroscopy and serial dilutions were
prepared for the selection experiments. Samples were stored in
water at -20.degree. C.
Preparation of Immobilized Target Proteins
NHS activated Sepharose 4 Fast Flow (Amersham Pharmacia) was
prepared in accordance with the manufacturer's instructions. Equine
GST, bovine carbonic anhydrase (CA), papain,
N.alpha.-p-tosyl-L-lysine chloromethyl ketone (TLCK)-treated bovine
chymotrypsin, and N-p-tosyl-L-phenylalanine chloromethyl ketone
(TPCK)-treated bovine trypsin were purchased from Sigma. Typically,
proteins were dissolved in phosphate buffered saline (PBS) buffer
pH 7.4-7.6 at concentrations of 20-100 .mu.M. Protein
concentrations were determined using UV-Vis spectrometry. Proteins
were incubated with beads for 16 hours at 4.degree. C. The beads
were capped for two hours with Tris buffer, then washed extensively
with the appropriate selection buffer containing 1 M NaCl and then
exchanged into the appropriate selection buffer (see, Table 14).
Beads were stored for up to 1 month at 4.degree. C. in a volume of
selection buffer equal to the initial volume of beads used. Before
use, papain beads were activated using a solution of 5.5 mM
cysteine HCl, 1.1 mM EDTA, and 0.067 mM .beta.-mercaptoethanol for
30 minutes at 4.degree. C. Streptavidin magnetic particles (Roche)
were washed 3.times. with selection buffer before use.
TABLE-US-00025 TABLE 14 Selection and Wash Buffers Protein
Composition of Selection Buffer Composition of Wash Buffers GST PBS
pH 7.4 Carbonic 10 mM Tris pH 7.4, 0.1M NaCl 10 mM Tris pH 7.4,
0.25-0.5M NaCl Anhydrase Papain 50 mM Tris pH 7.4, 0.1M NaCl, 1 mM
50 mM Tris pH 7.4, 0.5M NaCl, 1 mM EDTA EDTA Trypsin 50 mM Tris pH
8.0, 0.1M NaCl, 10 mM 50 mM Tris pH 8.0, 0.5M NaCl, 10 mM
CaCl.sub.2 CaCl.sub.2 Chymotrypsin 50 MM Tris pH 8.0, 0.1M NaCl, 10
mM 50 mM Tris pH 8.0, 0.5M NaCl, 10 mM CaCl.sub.2 CaCl.sub.2
Streptavidin 10 mM Tris pH 7.4, 0.1M NaCl, 1 mM 10 mM Tris pH 7.4,
1.0M NaCl, 1 mM EDTA EDTA
GST Selection
The amount of compound (1), the binding ligand, was varied between
10.sup.3 and 10.sup.7 molecules and compound (2a), the non-binding
ligand, was used in 10.sup.2-10.sup.6 molar excess. (1) and (2a)
were added to 40 .mu.l, of GST beads and agitated at 4.degree. C.
for 1 hour. The mixture was transferred to a 5.0 .mu.m low-binding
Durapore membrane spin filter (Millipore), washed with 2.times.150
.mu.L PBS pH 7.4, 1.times.100 .mu.L 0.1 M Tris pH 8.0, 0.5 M NaCl,
and 1.times.150 .mu.L PBS. The bound ligands were eluted by
agitating the beads with 100 .mu.L 0.1 M glutathione (Sigma) at
room temperature. The eluant was ethanol precipitated with 3 M
sodium acetate and 1 .mu.l, glycogen. The precipitate was used
directly for PCR.
Carbonic Anhydrase Selection
Compound (2b), the non-binding ligand, and compound (3), the
binding ligand, were added to 40 .mu.L of resuspended beads and
were diluted to 400 .mu.L with selection buffer. Ratios were
similar to those for the GST selection. The mixture was agitated at
4.degree. C. for 1-2 hours. Selections then were carried out at
room temperature. Each mixture was transferred to a spin filter and
washed 3.times. with 400 .mu.L of wash buffer and 1.times.400 .mu.L
with selection buffer. The resin was removed from the spin filter
with 60 .mu.L of selection buffer and the resulting beads were
subjected to PCR.
Papain Selection
Compound (4a), the non-binding ligand, and compounds (5) or (6),
the binding ligands, were incubated with papain beads and selected
as described for the carbonic anhydrase selection.
Chymotrypsin Selection
Compound (4a), the non-binding ligand, and compound (5), the
binding ligand, were incubated with chymotrypsin beads and selected
as described for the carbonic anhydrase selection.
Trypsin Selection
Compound (4a), the non-binding ligand, and compound (6), the
binding ligand, were incubated with trypsin beads and selected as
described for carbonic anhydrase.
Streptavidin Selection
Compound (3), the non-binding ligand, and compound (4b), the
binding ligand, were incubated with 15 .mu.L streptavidin magnetic
particles and agitated at room temperature for 20 minutes. Using a
MPC-S magnet (Dynal), the beads were washed 2.times. with 0.1 M
NaOH, 1 mM EDTA (100-200 pt), 4.times. with wash buffer (100-200
.mu.L), and 1.times. with selection buffer. The beads then were
resuspended in 15 .mu.L double distilled H.sub.2O.
Iterated Carbonic Anhydrase Selection
10.sup.8 molecules of compound (3) and 10.sup.11 molecules of
compound (2b) were incubated with 40 .mu.L carbonic anhydrase beads
for 1 hours and then selected as described. After the first round
of selection, 5 .mu.L of resuspended agarose beads were removed for
PCR. 6 M guanidinium HCl, 10 mM EDTA (40 .mu.L) was added to the
beads and the mixture was heated to 90.degree. C. for 15 minutes.
The beads were filtered away using a Wizard Minicolumn (Promega).
The filtrate was buffer exchanged into selection buffer using a
Centrisep Spin Column (Princeton Separations). A new aliquot of
carbonic anhydrase beads was added to the eluted templates. After a
second round of selection, the agarose beads were suspended in 30
.mu.L of H.sub.2O and 15 .mu.L were used for PCR. The PCR products
were digested with Hind III, generating the results in FIG. 84.
The triple iteration selection was carried out essentially as
described above with a few minor changes. The prepared carbonic
anhydrase beads were incubated with ZnSO.sub.4 (1 mM) for 1 hour
and then washed extensively with selection buffer containing 2 M
NaCl. The beads were exchanged back into selection buffer and used
directly for the iterated selection. 10.sup.9 molecules of compound
(3) and 10.sup.15 molecules of compound (4b) were added to the
beads and selected as described above. After the first round of
selection, 3 .mu.L aliquot was removed for PCR. A second round of
selection was carried out as described above and 8 .mu.L aliquot of
beads was removed for PCR. After a third round of selection, the
resulting beads were removed from the spin filter using 30 .mu.L of
double distilled H.sub.2O and 15 .mu.L of resuspended beads were
used for PCR.
Papain Affinity and Papain Specificity Selections
Affinity selection: 6.times.10.sup.9 molecules of compound (6),
2.3.times.10.sup.10 molecules compound (5), and 1.4.times.10.sup.11
molecules of compound (4a) were added to 40 .mu.A papain beads for
1 hour. The beads were washed with papain wash buffer (3.times.100
.mu.L) and once with 100 .mu.L papain selection buffer. The beads
were removed from the spin filter with 30 .mu.L of double distilled
H.sub.2O. A 3 .mu.L aliquot of resuspended beads were removed for
PCR. The DNA conjugates were eluted from the beads by adding 70
.mu.L 6 M guanidinium HCl and heating the mixture to 90.degree. C.
for 15 minutes. The eluted material was buffer exchanged as
described in the iterated carbonic anhydrase selection. After a
second round of selection, the agarose beads were removed from the
spin filter using 30 .mu.L H.sub.2O and 15 .mu.L of resuspended
beads were used for PCR.
Specificity selection: The same amounts of antipain, chymostatin,
and biotin were added to 40 .mu.L chymotrypsin agarose beads in
chymotrypsin selection buffer and incubated for 1 hour. The beads
were spun down and the flow through was added to 40 .mu.L fresh
chymotrypsin beads and incubated for 1 hour. The beads were spun
down and 15 .mu.L of 100 .mu.M chymotrypsin in papain selection
buffer was added to the flow through and then incubated for 1 hour.
This solution was added to 40 .mu.L of papain beads and selected as
described above. The small molecule-DNA conjugates were eluted and
buffer exchanged as described, incubated with 15 .mu.L 100 .mu.M
chymotrypsin for 1 hour and then subjected to a second round of
selection. The beads were removed from the spin filter with 30
.mu.L of H.sub.2O and 15 .mu.L were used for PCR.
Contamination Controls
Due to the high sensitivity of these experiments, two important
contamination controls were used throughout these studies. First,
each selection was carried out as described above except no
ligand-DNA conjugates were added to the protein-linked beads, which
permitting testing for buffer contamination and any
cross-contamination among samples. Secondly, a PCR reaction in
which no material from the selection was added was used to test for
contamination in primers, dNTPs, and PCR buffers.
PCR Conditions and Gel Electrophoresis Analysis
Templates surviving the selection were amplified using PCR. All
reactions contained 1 .mu.M of each primer and 250 .mu.M of each
dNTP (Promega). For the GST selection, the precipitated DNA was
used in the PCR reaction and amplified with Platinum Taq
(Invitrogen). PCR conditions were step 1: 94.degree. C. 2'; step 2:
94.degree. C., 30 s; step 3: 55.degree. C. 1'; step 4:72.degree.
C., 30 s; step 5: go to step 2, .times.29; step 6: 72.degree. C.,
5'; step 7: hold at 4.degree. C. For all other selections, the
agarose beads (3-15 .mu.L) were used directly in the PCR reaction
with Taq polymerase (Promega). PCR conditions were step 1:
94.degree. C., 2' step 2: 94.degree. C., 30 s; step 3: 55.degree.
C., 1'; step 4: 72.degree. C., 30 s; step 5: go to step 2,
.times.24; step 6: 4.degree. C.
The PCR products then were digested for 1-2 hours with the
restriction enzymes (New England Biolabs, 5-10 units) that digest
the ligand-encoding DNA. Digestion products were analyzed by
electrophoresis on 3% agarose gels and quantitated by ethidium
bromide staining and densitometry on a Strategene Eagle Eye II
system.
Enrichment Calculations
Enrichment ratios are calculated as the ratio of the fraction of
binding ligand surviving the selection as determined by restriction
digestion to the fraction of binding ligand entering the selection
as determined by the known concentrations of the stock
solutions.
DNA Sequences of Templates and Primers
Restriction endonuclease cleavage sites are underlined.
DNA Sequences for Glutathione S Transferase Selections:
TABLE-US-00026 GSH template (1): 5'-GCC TCT GCG ACC GTT CGG AAG CTT
CGC GAG TTG CCC AGC GCG (Hind III) [SEQ ID NO: 112] MLF-template
(2a): 5'-GCC TCT GCG ACC GTT CGG GAA TTC CGC GAG TTG CCC AGC GCG
(Eco RI) [SEQ ID NO: 113] Primer 1: 5'-GCC TCT GCG ACC GTT CGG [SEQ
ID NO: 114] Primer 2: 5'-CGC GCT GGG CAA CTC GCG [SEQ ID NO:
115]
DNA Sequences for Carbonic Anhydrase Selections:
TABLE-US-00027 Phenyl sulfonamide- 5'-CGA TGC TAG CGA AGG AAG
template (3): CTT CCA CTG CAC GTC TGC (Hind III) [SEQ ID NO: 116]
MLF-template (2b): 5'-CGA TGC TAG CGA AGG GAA TTC CCA CTG CAC GTC
TGC (Eco RI) [SEQ ID NO: 117] Biotin-template (4b): 5'-CGA TGC TAG
CGA AGG GAA TTC CCA CTG CAC GTC TGC (Eco RI) [SEQ ID NO: 118]
Primer 1: 5'CGA TGC TAG CGA AGG [SEQ ID NO: 119] Primer 2: 5'-GCA
GAC GTG CAG TGG [SEQ ID NO: 120]
DNA Sequences for Protease Selections:
TABLE-US-00028 Chymostatin-template (5): 5'-GCA GTC GAC TCG ACC GGA
TCC GGC TAC GAC GTG CAC (BaM HI) [SEQ ID NO: 121] Antipain template
(6): 5'-GCA GTC GAC TCG ACC CAG CTG GGC TAC GAC GTG CAC (Pvu II)
[SEQ ID NO: 122] Biotin-template (4a): 5'-GCA GTC GAC TCG ACC AAG
CTT GGC TAC GAC GTG CAC (Hind III) [SEQ ID NO: 123] Primer 1:
5'-GCA GTC GAC TCG ACC [SEQ ID NO: 124] Primer 2: 5'-GTG CAC GTC
GTA GCC. [SEQ ID NO: 125]
Example 12
Identification of New Chemical Reactions
This Example demonstrates that it is possible to identify the
existence of new chemical reactions via nucleic acid-templated
synthesis. New chemical reactions have been identified as a result
of experiments to select for, and characterize, bond forming
reactions.
A one-pot selection scheme to identify new bond forming reactions
is summarized in FIG. 85. Briefly, when n pool A reactants and
combined with m pool B biotinylated reactants, n.times.m possible
reaction combinations are available. When the templated reaction is
performed under a particular set of reaction conditions certain
combinations of the template (e.g., reactant A27) reacts with
certain combinations of the transfer unit (e.g., the reactant
biotinylated B11). The reaction products are captured by avidin
linked beads. Unreacted templates are not captured by the avidin
and can be removed by washing. The avidin captured reaction product
can then be amplified, for example, by PCR, and the template
sequenced to determine its codon sequence. As shown, the amplified
template included a sequence tag (coding region) for reactant A27
and a codon sequence (annealing region) for reactant B11.
FIG. 86 provides a schematic overview of a scheme for producing a
library of compounds, members of which were created by new
identified chemical reactions. In order to select for bond-forming
reactions, four pool A reactants presenting either a phenyl group
(A1B1 and A1B2) or a primary amine (A2B1 and A2B2) and two
biotinylated pool B reactants presenting either a carboxylic acid
(B1) or a methyl ester (B2) were prepared. The two coding and two
annealing regions contained different restriction digestion sites
to permit the relative quantitation of each of the four pool A
members from within a mixture. All six reactants (250 mol of each
pool A reactant and 500 fmol of each of B1 and B2) were combined in
a single pot either in the presence or absence of DMT-MM, which is
known to mediate amide formation between amines and carboxylic
acids (Gartner et al. (2002) AGNEW. CHEM. INT. ED. 41: 1796-1800;
Kunishima et al. (2002) TETRAHEDRON 57: 1551-1558). The crude
reactions were passed over streptavidin-linked magnetic beads to
select for templates encoding bond-forming reactions and washed
with denaturant to remove pool A members that did not undergo bond
formation with a pool B member. The selected molecules were eluted
with free biotin and formamide. A fraction of the eluant
corresponding to 5 Fmol of initial total reactants was amplified by
PCR and subjected to DNA sequencing and restriction digestion to
determine the ratio of the four possible reaction-encoding
sequences (i.e., reaction of the phenyl group with the carboxylic
acid, reaction of the phenyl group with the ester, reaction of the
amine group with the carboxylic acid, and reaction of the amine
group with the ester) (FIG. 86).
Combining the reactants in the absence of DMT-MM resulted in very
little PCR product formation following selection. In contrast,
strong PCR product was observed when the reactants were combined in
the presence of DMT-MM (FIG. 86), consistent with the effectiveness
of capturing reacted pool A members and the thoroughness of the
washing steps. This result suggests that the yield of PCR product
following selection for bond-forming reactions can serve as a
simple screen for the presence of bond formation within a pool of
reactants. To determine the identity of the bond-forming reactants,
the PCR products were digested with Mse I, which cleaves the coding
region for A2 but not A1, and Tsp45 I, which cleaves the annealing
region for B2 but not B1. An analysis of the digestion fragments
revealed that reaction in the absence of DMT-MM followed by
selection resulted in a mixture of all four possible
reaction-encoding pool A members (FIG. 86). In contrast, reaction
in the presence of DMT-MM followed by selection generated the A2B1
sequence and no significant amount of the other three sequences
(FIG. 86), indicating strong enrichment for the DNA encoding bond
formation between the amine and the carboxylic acid. DNA sequencing
of the selected PCR products was consistent with the restriction
digestion analysis. These results validate the basic principle of
the proposed method and system for discovering new reactions.
In order to test the ability of the proposed reaction discovery
system to select a single reactive combination out of an even
larger excess of unreactive combinations, the system was programmed
with three reaction possibilities (amine+carboxylic acid,
amide+ester, and amine+ester) and combined the corresponding
DNA-linked reactants in proportions that favor the unreactive
combinations (amide+ester and amine+ester) by 100-fold. In the
presence of amide coupling reagent DMT-MM, in vitro selection of
the resulting mixture for bond-forming reactions resulted in a
>1.000-fold enrichment of the template encoding bond formation
between the amine and carboxylic acid. No enrichment was observed
when DMT-MM was omitted. This result further supports the
possibility of selecting and decoding a single reactive
bond-forming combination from the planned 30 by 30 matrix of 900
reaction possibilities.
Validation of New Reaction Discovery
Example A
This Example shows that it is indeed possible to discover new
chemical reactions using DNA-templated synthesis. A 25-reaction
matrix containing the DNA-linked functional groups shown in FIG. 87
was generated essentially as described in FIG. 9 using the omega
architecture, the one-pot assembly method for pool A reactants, and
an optimized codon set. Among the 25 possible reactions in this set
is the Huisgen 1,3-dipolar cycloaddition (Huisgen et al. (1989)
PURE APPL. CHEM. 61: 613) between an azide and an alkyne. Sharpless
and co-workers recently reported (Rostoutseu et al., (2002) ANGEW
CHEM. INT. ED. ENGL. 41: 2596) that catalytic CuSO.sub.4 and sodium
ascorbate dramatically improve the regioselectivity and efficiency
of this process, permitting a robust reaction at room temperature.
A reaction discovery selection was performed on a 1 pmol scale
using this 25-reaction matrix either in the presence or the absence
of CuSO.sub.4 and sodium ascorbate.
In the presence of copper and ascorbate, selection for bond-forming
reactions followed by PCR amplification and sequence analysis by
restriction digestion highly enriched the pool A template encoding
the alkyne- and azide-encoding reactants (see, Lane 2 in FIG. 87B).
In contrast, omitting copper and ascorbate resulted in no
enrichment for the alkyne- and azide-encoding template (see, Lane 3
in FIG. 87B The reaction discovery selection system therefore
successfully "rediscovered" the Cu(I)-mediated coupling of an
alkyne and azide.
Validation of New Reaction Discovery
Example B
This Example shows that the reaction identified in Example A can
also be identified in a 96-reaction matrix. Briefly, a 96-reaction
matrix containing the DNA-linked functional groups shown in FIG. 88
was generated. Pool A contained 12 reactants (A1-A12) and pool B
contained 8 biotinylated reactants (B1-B8). When combined, 96
different reactions were possible.
The reactants (10 fmol each) were combined in the presence of 500
.mu.M Cu (I) at pH 6.0. Following reaction selection and
amplification, one oligonucleotide sequence was enriched. In
particular, there was a 27-fold enrichment for the template
encoding the reaction between reactant A2 and reactant B5. The
reaction product, like Example A appears to have resulted from a
Huisgen cycloaddition reaction. In contrast, when no Cu (I) was
present, there was very little PCR product with no enrichment for
any combination of the reactants.
Validation of New Reaction Discovery
Example C
This Example shows another example that it is possible to discover
new chemical reactions using nucleic acid-templated synthesis. In
particular, this Example demonstrates the discovery of a novel
Pd-mediated coupling reaction.
A library of reactants were created and combined to test for the
ability of nucleic acid-templated Pd-mediated coupling reactions.
Two pools of reactants (see, FIG. 89) were synthesized to give 12
pool A reactants (A1-A12) and 8 biotinylated pool B reactants
(B1-B8). When combined, 96 different reactions were possible. The
reactants (10 fmol each) were combined in the presence of 1 mM
Pd(II) at pH 7.0. Following reaction selection and amplification,
five oligonucleotide sequences were enriched between 10-fold and
22-fold. Analysis of the five oligonucleotide sequences revealed
that reactions occurred between (i) reactant A2 and reactant B1
(ii) reactant A2 and reactant B4, (iii) reactant A2 and reactant B8
(iv) reactant A9 and reactant B1, and (v) reactant A 10 and
reactant B4.
As an alternative to sequencing the enriched oligonucleotides, the
identity of the oligonucleotide sequences attached to the reaction
products were determined by microarray analysis (see, FIG. 90). A
library of anti-sense oligonucleotides complementary to each of the
templates to be included in the reaction matrix are synthesized.
Then, individual antisense oligonucleotides (1'-9' in FIG. 90)
complementary to each template are immobilized at separate
addressable locations of a microarray. The sequence of each
anti-sense oligonucleotide immobilized in the microarray is known.
After nucleic acid-templated synthesis, the oligonucleotides
attached to the resulting reaction products (for example, P1
attached to template 1 and product P8 attached to template 8 in
FIG. 90) are amplified under conditions to permit incorporation of
a detectable moiety, for example, a fluorophore, into the amplified
template. The amplified oligonucleotides then are denatured and
combined with the microarray under conditions to permit the
template oligonucleotide (for example, oligonucleotide 1 and
oligonucleotide 8 in FIG. 90) to hybridize to its immobilized,
complementary oligonucleotide. After washing to remove unbound
material, the microarray may then be scanned to detect a specific
binding event via detection of the detectable moiety at a
particular location. Based on the location of the detectable moiety
and the known sequence of the complementary oligonucleotide
immobilized at that location, it is possible to determine the
sequence of the bound template and thus the reactants that produced
the reaction product.
This type of microarray analysis approach was used following
reactions similar to those described in Example B (96-reaction
matrix with Cu (I)) and in Example C hereinabove (96-reaction
matrix with Pd (II)). The microarray analysis was found to agree
with the DNA sequencing results. Furthermore, the microarray
analysis was found to be more direct, more sensitive, and
significantly faster (at least 5-fold faster) than standard
sequencing methodologies.
By way of example, various products of the Pd (II) mediated
reactions were detected via the microarray system, the results of
which are summarized in FIG. 91. FIG. 91 summarizes which reactants
in pool A reacted with which biotinylated reactants in pool B to
create a product. FIG. 91 also summarizes the level of signal over
background and DNA-templated reaction yield for each product. Of
particular interest is the discovery using both sequence analysis
approaches of a bond-forming reaction between DNA-linked terminal
alkyne A2 and DNA-linked acrylamide B8 in the presence of 1 mM
Pd(II) at pH 7 (see. FIGS. 89 and 91). This reaction is comparable
in efficiency a DNA-templated Heck coupling reactions of aryl
iodides and olefins and does not proceed in the absence of a Pd
source. Although Pd-mediated couplings between terminal alkynes and
aryl iodides are known (Amatore et al., (1995) J. ORG. CHEM. 60:
6829), the Pd-mediated coupling of terminal alkynes with simple or
electron deficient olefins appears to be a new type of reaction
scheme. This newly discovered reaction scheme may now be
characterized in greater detail using more conventional larger
scale reactions.
INCORPORATION BY REFERENCE
The entire contents of each of the publications, patents and patent
applications cited herein are incorporated by reference into this
application for all purposes.
EQUIVALENTS
The invention may be embodied in other specific forms without
departing form the spirit or essential characteristics thereof. The
foregoing embodiments are therefore to be considered in all
respects illustrative rather than limiting on the invention
described herein. Scope of the invention is thus indicated by the
appended claims rather than by the foregoing description, and all
changes that come within the meaning and range of equivalency of
the claims are intended to be embraced therein.
SEQUENCE LISTINGS
1
125164DNAArtificial SequenceTemplate Encoding Parent Molecule 1
1cgagcagcac cagcgcactc cgcctggatc cgccccgggt gcacgcgact cctacgggct
60ccaa 64264DNAArtificial SequenceTemplate Encoding Parent Molecule
2 2cgagcagcac cagcgagtcc cgcctgggga tgccccgggt gggcgcgact
ccaacgggct 60ccaa 64364DNAArtificial SequenceRecombined Daughter
Template 3cgagcagcac cagcgcactc cgcctgggga tgccccgggt gggcgcgact
cctacgggct 60ccaa 64464DNAArtificial SequenceRecombined Daughter
Template 4cgagcagcac cagcgagtcc cgcctggatc cgccccgggt gcacgcgact
ccaacgggct 60ccaa 64510DNAArtificial SequenceSynthetic
oligonucleotide linked to a thiol reagent 5aattcgtacc
10611DNAArtificial SequenceTemplate E 6tggtacgaat t
11731DNAArtificial SequenceTemplate H 7tcgcgagcgt acgctcgcga
tggtacgaat t 31820DNAArtificial SequenceTemplate 8tggtacgaat
tcgactcggg 20910DNAArtificial SequenceSynthetic oligonucleotide
linked to a thiol reagent 9cccgagtcga 101050DNAArtificial
SequenceTemplate 10tggtgcggag ccgccgtgac gggtgatacc acctccgagc
cgaggagccg 501150DNAArtificial SequenceTemplate 11tggtgcggag
ccgccgncna ncnngatacc acctccgagc cgaggagccg 501210DNAArtificial
SequenceSynthetic oligonucleotide 12cacccgtcac 101310DNAArtificial
SequenceSynthetic oligonucleotide 13cnngntngnc 101411DNAArtificial
SequenceTemplate 1a-1c 14tggtacgaat t 111517DNAArtificial
SequenceTemplate 2a-2c 15ttaacgagag atagtct 171623DNAArtificial
SequenceTemplate 3a-3c 16tatctacaga gtagtctaat gac
231714DNAArtificial SequenceSynthetic oligonucleotide 4a-4c
17cagcaattcg tacc 141816DNAArtificial SequenceSynethetic
oligonucleotide 5a-5c 18ctcagctctc tcgtta 161918DNAArtificial
SequenceSynthetic oligonucleotide 6a-6c 19ggctcagcct ctgtagat
182011DNAArtificial SequenceTemplate 15 20tatagatcag c
112111DNAArtificial SequenceTemplate 17 21ttaacgagag a
112211DNAArtificial SequenceTemplate 18 22tatctacaga g
112311DNAArtificial SequenceTemplate 19 23tcctgatgta a
112411DNAArtificial SequenceTemplate 20 24taagatctgc t
112515DNAArtificial SequenceSynthetic oligonucleotide linked to a
functional group 21 25tcagcgctga tctat 152620DNAArtificial
SequenceSynthetic oligonucleotide linked to functional group 22
26agggctcagc aattcgtacc 202725DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 23 27acgtaagggc
tcagctctct cgtta 252831DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 24 28ttccagccgt
aagggctcag cctctgtaga t 312935DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 25 29ggcatttccg
acctaagggc tcagcttaca tcagg 353040DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 26 30tctatggcat
ttccgacgta agggctcagc agcagatctt 403148DNAArtificial
SequenceTemplate 31tcggacgtgt nnnnnngagt cnnnnnnctc agnnnnnngt
agacatgc 483215DNAArtificial SequenceSynthetic oligonucleotide
linked to NH2 32tgggctcgat gacgg 153316DNAArtificial
SequenceSynthetic oligonucleotide linked to biotin 33tacgtagcgg
cgtcgc 163451DNAArtificial SequenceTemplate 34tacgtagcgg cgtcgcnnnn
nnnnnnnnnn nnnnnnccgt catcgagccc a 513516DNAArtificial
SequencePrimer 1 35tggtgcggag ccgccg 163637DNAArtificial
SequencePrimer 36ccactgtccg tggcgcgacc ccggctcctc ggctcgg
373721DNAArtificial SequencePrimer 37ccactgtccg tggcgcgacc c
213819DNAArtificial SequenceSynthetic oligonucleotide linked to SH
38cccgagtcga agtcgtacc 193919DNAArtificial SequenceSynthetic
oligonucleotide linked to SH 39gggctcagct tccccataa
194010DNAArtificial SequenceSynthetic oligonucleotide linked to SH
40aaatcttccc 104110DNAArtificial SequenceSynthetic oligonucleotide
linked to SH 41aattcttacc 104260DNAArtificial SequenceE Template
42cgcgagcgta cgctcgcgat ggtacgaatt cgactcggga ataccacctt cgactcgagg
604331DNAArtificial SequenceH Template 43cgcgagcgta cgctcgcgat
ggtacgaatt c 314410DNAArtificial SequenceClamp Oligonucleotide
44attcgtacca 104520DNAArtificial SequenceTemplate 1 45tggtacgaat
tcgactcggg 204616DNAArtificial SequenceSynthetic oligonucleotides 2
and 3 matched 46gagtcgaatt cgtacc 164716DNAArtificial
SequenceSynthetic oligonucleotides 2 and 3 mismatched 47gggctcagct
tcccca 164830DNAArtificial SequenceTemplates 4 and 5 48ggtacgaatt
cgactcggga ataccacctt 304910DNAArtificial SequenceSynthetic
oligonucleotides 6-9 matched, n=10 49tcccgagtcg 105010DNAArtificial
SequenceSynthetic oligonucleotide 6 matched, n=0 50aattcgtacc
105110DNAArtificial SequenceSynthetic oligonucleotides 6-9
mismatched 51tcacctagca 105220DNAArtificial SequenceTemplates 11,
12, 14, 17, 18, 20 52ggtacgaatt cgactcggga 205320DNAArtificial
SequenceSynthetic oligonucleotides 10, 13, 16, 19 matched
53tcccgagtcg aattcgtacc 205420DNAArtificial SequenceSynthetic
oligonucletides 10, 13, 16, 19 mismatched 54gggctcagct tccccataat
205510DNAArtificial SequenceSynthetic oligonucleotide 15 matched
55aattcgtacc 105610DNAArtificial SequenceSynthetic oligonucleotide
15 mismatched 56tcgtattcca 105730DNAArtificial SequenceTemplate for
n=10 vs. n=0 comparison 57tagcgattac ggtacgaatt cgactcggga
305830DNAArtificial SequenceE or Omega Template 58ggtacgaatt
cgactcggga ataccacctt 305948DNAArtificial SequenceH Template
59cgcgagcgta cgctcgcggg tacgaattcg actcgggaat accacctt
486029DNAArtificial SequenceT Template 60ggtacgaatt cgancgggaa
taccacctt 296110DNAArtificial SequenceE or H synthetic
oligonucleotide (n=1) 61aattcgtacc 106210DNAArtificial SequenceE or
H synthetic nucleotide (n=10) 62tcccgagtcg 106310DNAArtificial
SequenceE or H synthetic oligonucleotide (n=20) 63aaggtggtat
106410DNAArtificial SequenceMismatched E or H synthetic
oligonucleotide 64tccctgatcg 106513DNAArtificial SequenceOmega-3
synthetic oligonucleotide (n=10) 65tcccgagtcg acc
136613DNAArtificial SequenceOmega-4 synthetic oligonucleotide
(n=10) 66tcccgagtcg acc 136715DNAArtificial SequenceOmega-5
synthetic oligonucleotide (n=10) 67tcccgagtcg gtacc
156813DNAArtificial SequenceOmega-3 synthetic oligonucleotide
(n=20) 68aaggtggtat acc 136914DNAArtificial SequenceOmega-4
synthetic oligonucleotide (n=20) 69aaggtggtat tacc
147015DNAArtificial SequenceOmega-5 synthetic oligonucleotide
(n=20) 70aaggtggtat gtacc 157113DNAArtificial SequenceMismatched
Omega-3 synthetic oligonucleotide 71tccctgatcg acc
137214DNAArtificial SequenceMismatched Omega-4 synthetic
oligonucleotide 72tccctgatcg tacc 147315DNAArtificial
SequenceMismatched Omega-5 synthetic oligonucleotide 73tccctgatcg
gtacc 157410DNAArtificial SequenceSynthetic T-oligonucleotide (n=1)
74ggtattcccg 107510DNAArtificial SequenceSynthetic
T-oligonucleotide (n=2) 75tggtattccc 107610DNAArtificial
SequenceSynthetic T-oligonucleotide (n=3) 76gtggtattcc
107710DNAArtificial SequenceSynthetic T-oligonucleotide (n=4)
77ggtggtattc 107810DNAArtificial SequenceSynthetic
T-oligonucleotide (n=5) 78aggtggtatt 107910DNAArtificial
SequenceSynthetic T-oligonucleotide (n=-1) 79gtcgaattcg
108010DNAArtificial SequenceSynthetic T-oligonucleotide (n=-4)
80aattcgtacc 108131DNAArtificial SequenceTemplate 81tcgcgagcgt
acgctcgcga ggtacgaatt c 318211DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 82gaattcgtac c
118323DNAArtificial SequenceSynthetic oligonucleotide linked to a
functional group 83tacgctcgcg atggtacgaa ttc 238423DNAArtificial
SequenceTemplate 84gaattcgtac atagcgctcg cat 238511DNAArtificial
SequenceSynthetic oligonucleotide linked to a functional group
85tgtacgaatt c 118648DNAArtificial SequenceTemplate 86gaattctgga
cacttagcta ttcatcgagc gtacgctcga tgaatagc 488715DNAArtificial
SequenceSynthetic oligonucleotide linked to a functional group
87taagtgtcca gaatt 158848DNAArtificial SequenceTemplate
88gaattccgcg cgcgcacgcg cgcgcggagc gtacgctccg cgcgcgcg
488915DNAArtificial SequenceSynthetic oligonucleotide linked to a
functional group 89tgcgcgcgcg gaatt 159011DNAArtificial
SequenceTemplate 90ggtacgaatt c 119111DNAArtificial
SequenceSynthetic oligonucleotide linked to a functional group
91gaattcgtac c 119211DNAArtificial SequenceTemplate 92gaattcgtac a
119311DNAArtificial SequenceSynthetic oligonucleotide linked to a
functional group 93tgtacgaatt c 119422DNAArtificial
SequenceTemplate 94acgctcgcga tggtacgaat tc 229511DNAArtificial
sequenceSynthetic oligonucleotide linked to a functional group
95gaattcgtac c 119622DNAArtificial SequenceTemplate 96gaattcgtac
atagcgctcg ca 229711DNAArtificial SequenceSynthetic oligonucleotide
linked to a functional group 97tgtacgaatt c 119823DNAArtificial
SequenceTemplate 98tacgctcgcg atggtacgaa ttc 239911DNAArtificial
SequenceSynthetic oligonucleotide linked to a functional group
99gaattcgtac c 1110023DNAArtificial SequenceTemplate 100gaattcgtac
atagcgctcg cat 2310111DNAArtificial SequenceSynthetic
oligonucleotide linked to a functional group 101tgtacgaatt c
1110248DNAArtificial SequenceTemplate 102gaattctgga cacttagcta
ttcatcgagc gtacgctcga tgaatagc 4810316DNAArtificial
SequenceSynthetic oligonucleotide linked to a functional group
103taagtgtcca gaattc 1610448DNAArtificial SequenceTemplate
104gaattccgcg cgcgcacgcg cgcgcggagc gtacgctccg cgcgcgcg
4810515DNAArtificial SequenceSynthetic oligonucleotide linked to a
functional group 105tgcgcgcgcg gaatt 1510611DNAArtificial
SequenceOlignucleotide used to generate products 106tatctacaga g
1110717DNAArtificial SequenceOligonucleotide used to generate
products 107tatctacaga gtagtct 1710823DNAArtificial
SequenceOligonucleotide used to generate products 108tatctacaga
gtagtctaat gac 2310914DNAArtificial SequenceOligonucleotide used to
generate products 109cagcctctgt agat 1411016DNAArtificial
SequenceOligonucleotide used to generate products 110ctcagcctct
gtagat 1611118DNAArtificial SequenceOligonucleotide used to
generate products 111ggctcagcct ctgtagat 1811242DNAArtificial
SequenceGSH-Template (1) 112gcctctgcga ccgttcggaa gcttcgcgag
ttgcccagcg cg 4211342DNAArtificial SequenceMLF-template (2a)
113gcctctgcga ccgttcggga attccgcgag ttgcccagcg cg
4211418DNAArtificial SequencePrimer 1 114gcctctgcga ccgttcgg
1811518DNAArtificial SequencePrimer 2 115cgcgctgggc aactcgcg
1811636DNAArtificial SequencePhenyl sulfonamide-template (3)
116cgatgctagc gaaggaagct tccactgcac gtctgc 3611736DNAArtificial
SequenceMLF-template 117cgatgctagc gaagggaatt cccactgcac gtctgc
3611836DNAArtificial SequenceBiotin-template (4b) 118cgatgctagc
gaagggaatt cccactgcac gtctgc 3611915DNAArtificial SequencePrimer 1
119cgatgctagc gaagg 1512015DNAArtificial SequencePrimer 2
120gcagacgtgc agtgg 1512136DNAArtificial
SequenceChymostatin-template (5) 121gcagtcgact cgaccggatc
cggctacgac gtgcac 3612236DNAArtificial SequenceAntipain-template
(6) 122gcagtcgact cgacccagct gggctacgac gtgcac 3612336DNAArtificial
SequenceBiotin-template (4a) 123gcagtcgact cgaccaagct tggctacgac
gtgcac 3612415DNAArtificial SequencePrimer 1 124gcagtcgact cgacc
1512515DNAArtificial SequencePrimer 2 125gtgcacgtcg tagcc 15
* * * * *
References