U.S. patent number 7,862,821 [Application Number 11/444,698] was granted by the patent office on 2011-01-04 for recombinant vaccine against bluetongue virus.
This patent grant is currently assigned to Merial Limited, The Regents of the University of California. Invention is credited to Jean Christophe Francis Audonnet, Kemal Karaca, Nigel James MacLachlan, Jiansheng Yao.
United States Patent |
7,862,821 |
Audonnet , et al. |
January 4, 2011 |
Recombinant vaccine against bluetongue virus
Abstract
The present invention relates to an immunogenic or vaccine
composition to induce an immune response or protective immune
response against Orbiviruses, more specifically bluetongue virus
(BTV) in an animal susceptible to BTV infection. The composition
may include a pharmaceutically or veterinarily acceptable vehicle
or excipient, and a vector. The vector may contain heterologous
nucleic acid molecule(s), expresses in vivo in the animal BTV
antigen, immunogen or epitope thereof, e.g., BTV VP2; BTV VP2 and
VP5; BTV VP2 and VP5 and VP3 and/or VP7. The composition can
contain an adjuvant, such as carbomer. Methods for making and using
such a composition, including prime-boost regimes and including as
to differential diagnosis, are also contemplated. TABLE-US-00001
AGACAGTGGTCAATTCCAATGGTACTGTTTGACGATAC
Inventors: |
Audonnet; Jean Christophe
Francis (Lyons, FR), Karaca; Kemal (Athens,
GA), Yao; Jiansheng (North York, CA), MacLachlan;
Nigel James (Davis, CA) |
Assignee: |
Merial Limited (Duluth, GA)
The Regents of the University of California (Oakland,
CA)
|
Family
ID: |
38790493 |
Appl.
No.: |
11/444,698 |
Filed: |
June 1, 2006 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20070280960 A1 |
Dec 6, 2007 |
|
Current U.S.
Class: |
424/185.1;
424/215.1; 424/232.1; 435/7.1; 424/186.1; 435/5; 435/235.1 |
Current CPC
Class: |
C07K
14/005 (20130101); A61P 37/04 (20180101); G01N
33/6854 (20130101); A61P 31/14 (20180101); C12N
15/86 (20130101); A61P 31/04 (20180101); G01N
33/56983 (20130101); C12N 2710/24043 (20130101); C12N
2720/12134 (20130101); C12N 2720/12122 (20130101); A61K
2039/5256 (20130101) |
Current International
Class: |
A61K
39/15 (20060101); A61K 39/275 (20060101); C12N
7/01 (20060101); C12Q 1/70 (20060101); G01N
33/569 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 2004/059556 |
|
Jul 2004 |
|
WO |
|
Other References
Lobato et al. Veterinary Immunology and Immunopathology, 1997, vol.
59, pp. 293-309. cited by examiner .
Taylor et al. Vaccine, 1995, vol. 13, No. 6, pp. 539-549. cited by
examiner .
Minke et al. Veterinary Research, 2004, vol. 35, pp. 425-443. cited
by examiner .
Harpin et al. Journal of General Virology, 1999, vol. 80, pp.
3137-3144. cited by examiner .
Abaza et al. Journal of Protein Chemistry, 1992, vol. 11, No. 5,
pp. 433-444. cited by examiner .
Riffkin et al. Gene, 1995, vol. 167, pp. 279-283. cited by examiner
.
Martyn et al., "Expression of the outer capsid proteins VP2 and VP5
of bluetongue virus in Saccharomyces cereuisiae ," Virus Research,
vol. 33 No. 1, pp. 11-25 (Jul. 1994). cited by examiner .
GenBank AAB70533., "outer capsid protein VP2 [Bluetongue virus],"
Sep. 1997. cited by examiner .
GenBank AAA42823, "capsid protein VP5 [Bluetongue virus]," Apr.
1993. cited by examiner .
Roy Pet al., Vaccine, Butterworth Scientific. Guildford, GB, vol.
12, No. 9, Jan. 1, 1994, pp. 805-811. cited by other .
Roy P et al. , Vaccine, Butterworth Scientific. Guildford, GB, vol.
10, No. 1, Jan. 1, 1992, pp. 28-32. cited by other .
Anderson J et al., Journal of Virological Methods, Elsevier BV, NL,
vol. 43, No. 2, Jul. 1, 1993, pp. 167-175. cited by other .
Karaca K et al., Vaccine, Butterworth Scientific. Guildford, GB,
vol. 23, No. 29, May 31, 2005, pp. 3808-3813. cited by other .
Bradel-Tretheway B Get al., Journal of Virological Methods,
Elsevier BV, NL, vol. 111, No. 2, Aug. 1, 2003, pp. 145-156. cited
by other .
Disbrow G L et al., Virology, Academic Press,Orlando, US, vol. 311,
No. 1, Jun. 20, 2003, pp. 105-114. cited by other .
Murray P K et al., Australian Veterinary Journal, Australian
Veterinary Association, Brunswick, AU, vol. 73, No. 6, Jan. 1,
1996, pp. 207-210. cited by other .
Aucouturier et al. Vaccine 19 (2001) 2666-2672 "Adjuvants designed
for veterinary and human vaccines". cited by other .
Edelman R. et al. AIDS Rfsearch and Human Retroviruses vol. 8, No.
8, 1992 "An Update on Vaccine Adjuvants in Clinical Trial". cited
by other .
McElrath, MJ. Seminars in Cancer Biology, vol. 6, 1995: pp. 375-385
Selection of potent immunological adjuvants for vaccine
construction. cited by other .
Willson, PJ et al. Tissue Reaction and Immunity in Swine Immunized
with Actinobacillus pleuropneumoniae Vaccines. Can J Vet Res 1995;
59: 299-305. cited by other .
Boone JD et al., "Recombinant canarypox virus vaccine co-expressing
genes encoding the VP2 and VP5 . . . ", Vaccine. Jan. 8,
2007;25(4):672-8. cited by other .
Verwwoerd DW et al., "Structure of the bluetongue virus capsid", J
Virol. Oct. 1972;10(4):783-94. cited by other .
Roy P et al., "Recombinant virus vaccine for bluetongue disease in
sheep", J Virol. May 1990;64(5):1998-2003. cited by other .
Hassan SS, et al., "Expression and functional characterization of
bluetongue virus VP2 protein: role in cell entry", J Virol. Dec.
1999;73(12):9832-42. cited by other .
Perrin A et al., "Recombinant capripoxviruses expressing proteins
of bluetongue virus: Evaluation of immune . . . ",Vaccine 25 Jul.
2007 6774-6783. cited by other .
Andrew M et al., "Antigen specificity of the ovine cytotoxic T
lymphocyte response to bluetongue virus", Vet Immunol Immunopathol
Aug. 1995 47(3-4) 311-22. cited by other .
Lobato Z et al., "Antibody responses and protective immunity to
recombinant vaccinia virus-expressed bluetongue", Vet Immunol
Immunopathol Nov. 1997 59(3-4) 293-309. cited by other .
Huismans H et al., "Isolation of a Capsid Protein of Bluetongue
Virus That Induces a Protective Immune Response in Sheep", Virology
Mar. 1987 157(1) 172-9. cited by other .
Roy P, "Orbivirus Structure and Assembly", Virology Feb. 1996
216(1) 1-11. cited by other .
De Mattos C et al.,"Heterogeneity of the L2 gene of field isolates
of bluetongue virus serotype 17 from the San Joaquin", Virus Res
Jan. 1994 31(1) 67-87. cited by other .
Demaula C et al., "Changes in the outer capsid proteins of
bluetongue virus serotype ten that abrogate neutralization . . . ",
Virus Research 67 Jan. 2000 59-66. cited by other .
Jones L et al., "The non-structural proteins of bluetongue virus
are a dominant source of cytotoxic T cell peptide determinants . .
. ", J. General Virology (1996), 77, 99. UK. cited by other .
Hyatt A et al., "Localization of the non-structural protein NS3 in
bluetongue virus-infected cells", J. General Virology (1991), 72,
2263-2267. Printed in UK. cited by other .
Roy P et al., "Evidence for genetic relationship between RNA and
DNA viruses from the sequence homology of a putative polymerase
gene of Bluetongue virus . . . ", NAR 1988, 16(28). cited by other
.
Janardhana V et al., "The ovine cytotoxic T lymphocyte responses to
bluetongue virus", Res Vet Sci. Dec. 1999;67(3):213-21. cited by
other .
Wilson et al., "Molecular Evolution of Orbiviruses", The British
Library--"The World's Knowledge", pp. 169-180. cited by other .
Andrew M et al., "Antigen specificity of the ovine cytotoxic T
lymphocyte response to bluetongue virus", Vet Immunol Immunopathol.
Aug. 1995;47(3-4):311-22. cited by other .
Cloete M et al., "Vaccinia virus expression of the VP7 protein of
South African bluetongue virus serotype 4 . . . ", Arch Virol.
1994;135(3-4):405-18. cited by other .
Eaton BT et al., "A bluetongue serogroup-reactive epitope in the
amino terminal half of the major core protein VP7 is accessible . .
. ", Virology. Feb. 1991;180(2):687-96. cited by other .
Takamatsu H et al., "Identification of a bluetongue virus serotype
1-specific ovine helper T-cell determinant . . . ", Virology. Jul.
1990;177(1):396-400. cited by other .
Wade-Evans AM et al., "Expression of the outer capsid protein, VP2,
from a full length cDNA clone of genome segment 2 . . . ", Virus
Res. Mar. 1990;15(3):213-29. cited by other .
Roy et al., "Orbiviruses and their Replication", Fields Virology,
3rd Edition, 1996, Chapter 56, pp. 1709-1734. cited by other .
Identification of the Serotype-specific and Group-Specific antigens
of Bluetongue Virus, Onderstepoort J. Vet Research, 1981, 48,
51-58. cited by other.
|
Primary Examiner: Lucas; Zachariah
Attorney, Agent or Firm: Jarecki-Black; Judy Chen; Ruoying
Merial Limited
Claims
What is claimed is:
1. An immunogenic composition comprising a recombinant poxvirus,
wherein the recombinant poxvirus comprises nucleic acid molecules
encoding Bluetongue Virus (BTV) VP2 having the sequence as set
forth in SEQ ID NO:20 and BTV VP5 having the sequence as set forth
in SEQ ID NO:21.
2. An immunogenic composition comprising a recombinant poxvirus
comprising one or more nucleic acid molecules, wherein the one or
more nucleic acid molecules comprise the sequence as set forth in
SEQ ID NO:1, or the sequence as set forth in SEQ ID NO:2, or
combinations thereof.
3. The immunogenic composition of claim 1 or 2, wherein the
recombinant poxvirus is a recombinant avipox virus.
4. The immunogenic composition of claim 3 wherein the recombinant
avipox virus is a canarypox virus.
5. The immunogenic composition of claim 4 wherein the
canarypoxvirus is ALVAC.
6. The immunogenic composition of claim 1 or 2, further comprising
an adjuvant.
7. The immunogenic composition according to claim 6, wherein the
adjuvant is a carbomer.
8. The immunogenic composition of claim 1 or 2 further comprising
an antigen or immunogen or epitope thereof of a pathogen other than
BTV of the animal, or a vector that contains and expresses in vivo
in the animal a nucleic acid molecule encoding the antigen,
immunogen or epitope thereof, or an inactivated or attenuated
pathogen other than BTV of the animal.
9. The immunogenic composition of claim 1 or 2, wherein the animal
is ovine, bovine, feline or eqauine.
10. The immunogenic composition of claim 1 or 2, wherein the one or
more nucleic acid molecules are operably linked to one or more
promoters.
11. The immunogenic composition of claim 10, wherein the one or
more nucleic acid molecules have the sequence as set forth in SEQ
ID NO:1 operably linked to the promoter H6, and/or wherein the
nucleic acid molecules have the sequence as set forth in SEQ ID
NO:2 operably linked to the promoter 42K.
12. A kit for performing a method of administering to an animal (a)
an immunogenic composition of claim 1 or 2, and/or (b) a BTV
antigen, immunogen or epitope, and testing the animals for presence
or absence of a BTV protein or antibody, the kit comprising (a) and
(b) in separate containers, optionally with instructions for
admixture and/or administration.
13. The kit of claim 12, wherein the animal is ovine, bovine,
feline or equine.
14. A kit comprising (a) the immunogenic composition according to
claim 1 or 2, and (b) an antigen or immunogen, or epitope thereof
of a pathogen other than BTV of the animal, or a vector that
contains and expresses in vivo in the animal a nucleic acid
molecule encoding the antigen, immunogen, or epitope thereof, or
the inactivated or attenuated pathogen other than BTV of the
animal, the kit comprising (a) and (b) in separate containers, and
the kit optionally contains instructions for admixture and/or
administration of (a) and (b).
15. The kit of claim 14, wherein the animal is a feline, an ovine,
a bovine or an equine.
16. A method for inducing an immunological or protective response
against BTV in an animal comprising administering to the animal the
immunogenic composition of claim 1 or 2.
17. A method for inducing an immunological response against BTV in
an animal comprising administering to the animal the immunogenic
composition of claim 1 or 2.
18. The method according to claim 17 further comprising a carbomer
adjuvant.
19. A method for inducing an immunological response against BTV in
an animal comprising administering to the animal (a) the
immunogenic composition according to claim 1 or 2, and (b) a BTV
isolated antigen, immunogen or epitope thereof, wherein (a) is
administered prior to (b) in a prime-boost regimen, or (b) is
administered prior to (a) in a prime-boost regimen, or (a) and (b)
are administered together, either sequentially or in admixture.
20. The method of claim 16, wherein the animal is an ovine, a
bovine, a feline, or an equine.
21. A differential diagnosis method comprising administering to
animals an immunogenic composition of claim 1 or 2, and testing the
animals for the presence or absence of a BTV protein or antibody
thereto not expressed by the administered poxvirus.
22. The method of claim 21, wherein the animal is an ovine, a
bovine, a feline, or an equine.
Description
RELATED APPLICATIONS/INCORPORATION BY REFERENCE
Each of the above applications, together with each document cited
therein, and each of the documents referenced or cited in documents
cited therein, are hereby incorporated herein by reference.
Each document cited in this text ("application cited documents")
and each document cited or referenced in each of the application
cited documents, and any manufacturer's specifications or
instructions for any products mentioned in this text and in any
document incorporated into this text, are hereby incorporated
herein by reference; and, technology in each of the documents
incorporated herein by reference can be used in the practice of
this invention.
FIELD OF THE INVENTION
The present invention relates to vectors containing at least one
polynucleotide of the Orbivirus genus of the Reoviridae family,
more specifically, bluetongue virus (or BTV) or at least one
nucleic acid molecule encoding at least one BTV antigen, immunogen
or epitope, e.g., in vivo and in vitro expression vectors which may
comprise and express at least one polynucleotide of the BTV or in
vivo and in vitro expression vectors which may comprise and express
at least one BTV antigen, immunogen or epitope, as well as
immunogenic compositions and vaccines against bluetongue disease;
for instance, such compositions or vaccines that may contain one or
more of the vectors and/or one or more of the expression products
of the vectors. The invention also relates to methods for using the
vectors, compositions and vaccines, including immunizing and
vaccinating against this virus, expressing expression products of
the polynucleotide(s), using the expression products in assays or
to generate antibodies useful in assays, as well as to methods for
making the, polynucleotide(s), vectors, compositions vaccines,
assays, inter alia.
BACKGROUND OF THE INVENTION
Bluetongue (BT) is an arthropod-borne infectious viral disease of
ruminants. Cattle and goats may be readily infected with the
causative BTV but without extensive vascular injury and therefore
these species generally fail to show pronounced clinical signs. In
contrast, the disease in sheep is characterized by catarrhal
inflammation of the mucous membranes of the mouth, nose and
forestomachs, and by inflammation of the coronary bands and laminae
of the hoofs. There is an excoriation of the epithelium, and
ultimately necrosis of the buccal mucosa; the swollen and inflamed
tongue and mouth can take on a blue color from which the disease is
named (Spreull 1905). The mortality rate in sheep is estimated at
1-30%.
BTV is the prototype virus of the Orbivirus genus (Reoviridae
family) and is made up of at least 24 different serotypes(Wilson
and Mecham 2000). Different strains of BTV have been identified
world-wide throughout tropical and temperate zones. BTV infection
has occurred as far as 45.degree. N in Europe, as far as 50.degree.
N in Asia and North America, and as far South as 35.degree.. BTV is
not contagious between ruminants thus the distribution of BTV is
dependent on the presence of arthropod vector species of coides sp.
(biting midges), with different vector species occurring in
different regions of the world. Recent data suggests that genetic
drift and founder effect contribute to diversification of
individual gene segments of field strains of BTV (Bonneau, Mullens
et al. 2001). It has been shown that BTV seropositive animals are
resistant to reinfection with the homologous BTV serotype.
BTV infection of ruminants is transient, while infection of the
Culicoides insect vector is persistent. The duration of viremia
depends on the animal species and the strain of BTV. It has been
reported that viremia can be very transient in sheep and may last
for up to 41 days in BTV-infected individuals, up to 42 days in
goats, and up to 100 days in cattle. Since BTV infection of cattle
often results in prolonged but not persistent viremia, cattle serve
as a reservoir from which virus may be ingested by the Culicoides
vector and then transmitted to other ruminants (Anderson, Stott et
al. 1985; MacLachlan 1994; MacLachlan and Pearson 2004). The
ecology of many species of Culicoides vectors is poorly understood
and their breeding sites are largely uncharacterized, and their
rates of dispersal unknown. Culicoides sonorensis is the principal
vector of BTV in North America. Female Culicoides insects become
persistently infected with BTV and can transmit the virus after an
extrinsic incubation period of up to 14 days (Mullens, Tabachnick
et al. 1995). BTV overwintering in temperate zones may occur
through vertically infected insect vectors, although recent data
indicates that there is reduced expression of the outer capsid
genes during persistent BTV infection in larval stages of the
insect vectors (White, Wilson et al. 2005).
The virions of BTV have a diameter of .about.69 nm with a
double-shelled coat (capsid) that sometimes is surrounded by a
lipoprotein "pseudo-envelope" derived from the cell membranes of
infected cells. The BTV genome includes 10 distinct segments of
double-stranded RNA that collectively encode seven structural (VP1
through VP7) and four non-structural (NS1, NS2, NS3 and NS3a)
proteins (Roy 1996); 9 of the genome segments are monocistronic
whereas segment 10 encodes both NS3 and NS3A using a second,
inframe initiation codon. Genomic RNA is encapsidated in the
icosahedral virion particle by a double layered protein capsid
(Verwoerd, Els et al. 1972). The icosahedral core consists of two
major (VP3 and VP7) and three minor proteins (VP1, VP4, VP6) and is
surrounded by the outer capsid which consists of VP2 and VP5 that
respectively are encoded by genomic segments 2 and 5 (Roy 1996).
VP2 is responsible for binding and entry of BTV into cells,
neutralization, serotype-specificity and hemagglutination.
Multimeric forms of VP2 (dimers and trimers) decorate much of the
surface of a VP5 scaffold on the outer surface of viral particles
(Hassan and Roy 1999). VP2 varies most amongst the 24 BTV
serotypes, and levels of anti-VP2 antibody correlate with virus
neutralization in vitro and in vivo (Huismans and Erasmus 1981).
VP5 also varies markedly between different serotypes and strains of
BTV (de Mattos, de Mattos et al. 1994; DeMaula, Bonneau et al.
2000) and although no VP5-specific neutralizing MAb's have been
identified to date, data suggests that this protein has a role in
neutralization and serotype determination through its
conformational influence on VP2 (Huismans and Erasmus 1981; Roy,
Urakawa et al. 1990; DeMaula et al., 2000). Purified VP2,
immunoadsorbed with BTV anti-core serum to remove trace amounts of
VP7, was injected into sheep. An initial dose of 50 micrograms of
VP2 was sufficient to induce VP2-precipitating antibodies as well
as neutralizing and hemagglutination-inhibiting antibodies. These
sheep were fully protected against challenge with a virulent strain
of the same BTV serotype. Lower doses of VP2 still provided a
significant level of protection even though no neutralizing
antibodies were not detected prior to challenge (Huismans, van der
Walt et al. 1987). Recent results show that VP2 and NS1 express
epitopes recognized by cytotoxic T-lymphocytes (CTL) (Andrew,
Whiteley et al. 1995) while it is unlikely that VP7 and VP5 have
CTL epitopes. So far, VP3, VP4, VP6, NS2 and NS3 have not
stimulated a CTL response in sheep (Lobato, Coupar et al. 1997)
Table 1 (modified from, (Wilson and Mecham 2000)), below summarizes
the genes of BTV and their protein function:
TABLE-US-00002 TABLE 1 Bluetongue virus genes and encoded proteins
with location, properties, and function of proteins. Genome Segment
Protein Location Properties & Function L1 VP1 Within the
sub-core at the RNA dependent RNA polymerase (3954 bp) (150 kDa)
5-fold axis L2 VP2 Outer capsid Outer capsid, serotype specific
(2926 bp) (111 kDa) (trimer) antigen, mammalian cell attachment
protein, neutralizing epitopes L3 VP3 Sub-core capsid layer
Innermost protein capsid shell, (2770 bp) (103 kDa) (T = 2
symmetry) sub-core capsid layer, self assembles, retains
icosahedral symmetry, RNA binding, interacts with internal minor
proteins M4 VP4 Within the sub-core at the Capping enzyme. (2011
bp) (76 kDa) 5-fold axis (dimer) guanylyltransferase M5 VP5 Outer
capsid Inner outer capsid protein, can (1638 bp) (59 kDa) (trimer)
affect virus serotype characteristics M6 NS1 Cytoplasm Forms
tubules in the cell (1769 bp) (64 kDa) cytoplasm S7 VP7 Outer core
Outer core surface protein, (1156 bp) (38 kDa) (T = 13 symmetry,
trimer) immuno-dominant major serogroup specific antigen,
attachment protein for vector insect cells, reacts with `core
neutralizing` antibodies S8 NS2 Cytoplasm, viral Important viral
inclusion body (1124 bp) (41 kDa) inclusion bodies (VIB) matrix
protein, ssRNA binding, phosphorylated, can be associated with
outer capsid S9 VP6 Within the sub-core at the ssRNA and dsRNA
binding, (1046 bp) (36 kDa) 5-fold axis helicase, NTPase S10 NS3,
Cell membranes Glycoproteins, membrane proteins, (822 bp) (24 kDa)
NS3a involved in cell exit
Lobato and Coupar (Lobato, Coupar et al. 1997) developed vaccinia
virus-based expression vectors containing various inserts
corresponding to nucleotide sequences encoding for structural
proteins VP2, VP5 and VP7 of BTV for both in vivo and in vitro
studies. These expression vectors were administered to rabbits and
sheep to evaluate the immune response with respect to ELISA and
neutralizing antibody titer, and the protective efficacy of the VP2
and VP5 constructs was tested in sheep. Vaccinia virus-expressed
VP2, VP5 and VP2+VP5 were protective, with the most reproducible
protection occurring in animals immunized with both VP2 and VP5
however protection even with this construct was variable.
It would be advantageous to provide improved immunogenic and
vaccine compositions against BTV, and methods for making and using
such compositions, including such compositions that provide for
differential diagnostic methods, assays and kits.
Citation or identification of any document in this application is
not admission that such document is available as prior art to the
present invention.
OBJECTS AND/OR SUMMARY OF THE INVENTION
The invention provides an immunogenic or vaccine composition to
induce an immune response or protective immune response against
Orbiviruses, especially bluetongue virus (BTV) in an animal
susceptible to BTV or related virus comprising or consisting
essentially of a pharmaceutically or veterinarily acceptable
vehicle or excipient and a vector that contains or consists
essentially of heterologous nucleic acid molecule(s), and that
expresses in vivo in the animal an Orbivirus-BTV protein, antigen,
immunogen or epitope thereof, such as but is not limited to, BTV
VP2 (L2) and BTV VP5 (M5) polypeptides.
The vector may be a recombinant DNA plasmid or a recombinant virus,
such as a recombinant adenovirus, herpesvirus or poxvirus, e.g., an
avipox virus, such as a canarypox virus or a fowlpox virus. The
animal may be selected from the ungulate group consisting of an
ovine, a bovine, a porcine, a goat, an antelope, an equine, a llama
and others.
Advantageously, the nucleic acid molecule comprises or consists
essentially of nucleotides 20-2887 (SEQ ID NO:3 and 1) encoding BTV
VP2 (L2) and respectively, nucleotides 30-1610 (SEQ ID NO:4 and 2)
encoding BTV protein VP5 (M5). A preferred embodiment comprises or
consists of mammalian codon optimized nucleic acid molecules.
The immunogenic or vaccine composition may further comprise an
adjuvant, such as a carbomer.
The immunogenic or vaccine composition may further comprise an
antigen or immunogen or epitope thereof of a pathogen other than
BTV of the animal, or a vector that contains a nucleic acid
molecule encoding the antigen, immunogen or epitope thereof and
expresses it in vivo in the animal, or an inactivated or attenuated
pathogen other than BTV.
The invention additionally involves a kit comprising or consisting
essentially of (a) the immunogenic or vaccine composition, and (b)
the antigen or immunogen or epitope thereof of a pathogen other
than BTV of the animal, or the vector that contains a nucleic acid
molecule encoding the antigen, immunogen or epitope thereof and
expresses it in vivo in the animal, or the inactivated or
attenuated pathogen other than BTV of the animal, wherein (a) and
(b) are in separate containers, and the kit optionally contains
instructions for admixture and/or administration of (a) and
(b).
The invention also comprehends a method for inducing an
immunological or protective immune response against BTV in an
animal that may comprise administering to the animal the
immunogenic or vaccine composition that contains a nucleic acid
molecule encoding the antigen, immunogen or epitope thereof.
The invention further comprehends a method for inducing an
immunological or protective immune response against BTV in an
animal which may comprise administering to the animal (a) the
immunogenic or vaccine composition, and (b) a BTV isolated antigen,
immunogen or epitope thereof, wherein (a) is administered prior to
(b) in a prime-boost regimen, or (b) is administered prior to (a)
in a prime-boost regimen, or (a) and (b) are administered together,
either sequentially or in admixture. The invention also involves a
kit for performing this which may comprise (a) and (b) in separate
containers, optionally with instructions for admixture and/or
administration.
The invention even further comprehends a prime-boost immunization
or vaccination against BTV, wherein the priming with (a) DNA
vaccine(s) or immunological or immunogenic composition(s) that
contains or consists essentially of (a) nucleic acid molecule(s)
encoding and express(es) in vivo a BTV immunogen, antigen or
epitope and the boost is done with (a) vaccine(s) or immunological
or immunogenic composition(s) that is a BTV inactivated or
attenuated or subunit (antigen, immunogen and/or epitope)
preparation(s) and/or (a) recombinant or modified virus vaccine or
immunological or immunogenic composition(s) that contains or
consists essentially of (a) nucleic acid molecule encoding and
express(es) in vivo (a) BTV immunogen(s), antigen(s) or epitope(s).
Thus, the invention provides a prime-boost immunization or
vaccination method against BTV, such as a prime-boost immunization
or vaccination which may comprise administering to a target species
animal (a) DNA vaccine(s) or immunological or immunogenic
composition(s) of the invention (that contains or consists
essentially of nucleic acid molecule(s) encoding and express(es) in
vivo BTV antigen(s), immunogen(s) or epitope(s) (as the prime) and
thereafter administering (as the boost) administering inactivated
BTV and/or attenuated BTV or a BTV subunit (antigen, immunogen
and/or epitope) preparation(s)) and/or a recombinant or modified
virus vaccine or immunological or immunogenic composition that may
comprise nucleic acid molecule(s) encoding and express(es) in vivo
BTV immunogen(s), antigen(s) or epitope(s), advantageously (a)
recombinant vaccine or immunological or immunogenic composition(s)
that expresses the BTV immunogen. antigen or epitope in vivo. The
boost may be advantageously matched to the prime, e.g., the boost
contains or consists essentially of or expresses at least one
antigen, epitope or immunogen that is expressed by the prime.
The prime-boost regimen according to the invention may be used in
animals of any age, advantageously young animals (e.g., animals
that have detectable maternal antibodies and/or are suckling or
nursing or breast-feeding), pre-adult animals (animals that are
older than being a young animal but have not yet reached maturity
or adulthood or an age to mate or reproduce), adult animals (e.g.,
animals that are of an age to mate or reproduce or are beyond such
a period in life), and it is advantageous to employ the prime-boost
regimen in pregnant females or females prior to giving birth,
laying, or insemination.
The invention also relates to such immunogenic and vaccine
compositions and kits thereof suitable for use in such prime-boost
regimens and prime-boost regimens. The host or target species upon
which the prime-boost regimen can be practiced includes any animal
(target or host) species susceptible to disease caused by Orbivirus
infection, including mammals, reptiles, birds, especially humans,
companion mammals or animals such as but not limited to canines,
felines, equines, zoo mammals or animals, such as aquatic mammals
e.g. seals, felines, equines, zoo reptiles such as snakes,
crocodiles, alligators, and avian species.
The prime-boost regimen is especially advantageous to practice in a
young animal, as it allows vaccination or immunization at an early
age, for instance, the first administration in the prime-boost
regimen when practiced on a young animal can be at an age at which
the young animal has maternal antibodies. Another advantage of this
regimen is that it can provide a degree of safety for pregnant
females present in the same location or in close proximity to the
young or to each other. Thus, the invention provides a prime-boost
immunization or vaccination method against BTV, and the method may
be practiced upon a young animal, such as a lamb, puppy or kitten,
for instance, wherein the priming is done at a time that the young
animal has maternal antibodies against BTV, with the boost
advantageously at a time when maternal antibodies may be waning or
decreasing or normally not present, such as a period of time
post-nursing. breastfeeding.
Accordingly, the invention also involves kits for performing a
prime-boost regimen comprising or consisting essentially of a
priming vaccine or immunological or immunogenic composition and a
boost vaccine or immunological or immunogenic compositions, in
separate containers, optionally with instructions for admixture
and/or administration.
Further still, the invention provides a differential diagnosis
method comprising administering to animals an immunogenic or
vaccine composition and/or a BTV antigen, immunogen or epitope, and
testing the animals for presence or absence of a BTV protein or
antibody thereto not expressed by the immunogenic or vaccine
composition and/or not present in the BTV antigen, immunogen or
epitope. The invention additionally involves a kit for performing
this method comprising the immunogenic or vaccine composition
and/or the BTV antigen, immunogen or epitope, and an assay for
testing for the presence or absence of the BTV protein, in separate
containers, optionally with instructions for administration of the
immunogenic or vaccine composition and/or the BTV antigen,
immunogen or epitope and/or for performing the assay.
It is noted that in this disclosure and particularly in the claims
and/or paragraphs, terms such as "comprises", "comprised",
"comprising" and the like, and that terms such as "consisting
essentially of" and "consists essentially of" have the meaning
ascribed to them in U.S. Patent law, e.g., they allow for elements
not explicitly recited, but exclude elements that are found in the
prior art or that affect a basic or novel characteristic of the
invention.
These and other embodiments are disclosed or are obvious from and
encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description, given by way of example, but
not intended to limit the invention solely to the specific
embodiments described, may best be understood in conjunction with
the accompanying drawings.
FIG. 1 depicts the nucleic acid sequence of BTV-17 native VP2 (SEQ
ID NO: 3) versus synthetic BTV17 codon optimized VP2 (SEQ ID NO:
1).
FIG. 2 depicts the nucleic acid sequence of BTV-17 native VP5 (SEQ
ID NO: 4) versus synthetic BTV17 codon optimized VP5 (SEQ ID NO:
2).
FIG. 3 is a schematic showing construction of plasmid
043004pPCR-Script encoding the optimized synthetic BTV VP2
protein.
FIG. 4 is a schematic showing a restriction endonuclease map of the
pNVH6C5LSP-18 donor plasmid
FIG. 5 is a schematic showing construction of pCXL148.2, an ALVAC
donor plasmid.
FIG. 6 provides the nucleic sequence of pCXL148.2 donor plasmid
(SEQ ID NO: 13).
FIG. 7 is a schematic showing construction of pALVAC
C5H6p-synthetic BTV VP2 (pLH2030.2), donor plasmid.
FIG. 8 is a schematic showing construction of plasmid
043005pPCR-Script encoding the optimized synthetic BTV VP5 protein
for addition of the 42Kpsynthetic promoter sequence of
Entomopoxvirus Amsacta moorei to the BTV-VP5 fragment.
FIG. 9 is a schematic showing the cloning scheme for the 42Kp
promoter-driven optimized synthetic BTV VP5 in the pCR2.1 TOPO
cloning/shuttle vector (creating pCR2-42KpVP5) for amplification of
the 42KpVP5 cassette.
FIG. 10 is a schematic showing construction of the final donor
homology vector pC5H6pVP2 42KpVP5 (pLH2078.15) containing optimized
VP2 driven by H6 promoter and optimized BTV VP5 driven by the 42K
promoter with vector homology to the C5R region of ALVAC.
FIG. 11 provides nucleic acid and protein sequence data for
pLH2078.15 (pC5 H6p synthetic BTV-VP2 42Kp synthetic BTV-VP5), the
final homology vector for creation of recombinant ALVAC+BTV. A
discloses SEQ ID NOS: 20-21, respectively, in order of appearance.
B discloses SEQ ID NO: 19 coding SEQ ID NOS: 20-21. C discloses
nucleotides 1800-6293 of SEQ ID NO: 19 coding SEQ ID NOS: 20-21. D
discloses SEQ ID NO: 22.
FIG. 12 depicts a flow diagram illustrating construction of
recombinant ALVAC viral vector encoding the BTV optimized synthetic
VP2 and VP5 (vCP2289).
FIG. 13 is a theoretical RE digest map for recombinant ALVAC-BTV
vCP2289 generated from plasmid and ALVAC nucleic acid sequences
made by Vector NTI (Invitrogen, Carlsbad, Calif.
FIG. 14 is a stained agarose gel showing restriction endonuclease
digestion of genomic. DNA prepared from ALVAC+BTV recombinant virus
vCP2289 (compare with theoretical expected banding pattern as
illustrated in FIG. 13, above).
FIG. 15 shows a southern blot analysis of restriction endonuclease
digested vCP2289 genomic DNA probed with a BTV-specific DNA
probe.
FIG. 16 presents a Western Blot of CEF lysate and supernatant
fractions prepared after infection with two different isolates of
vCP2289 probing for expression of VP5 from the ALVAC recombinant
virus. Primary antibody probe was rabbit anti-BTV-17 VP5 specific
polyclonal sera used at a 1:2000 dilution.
FIG. 17 is a chart of the mean body temperatures of sheep immunized
with vCP2289 compared to the WNV-CP control vaccine after challenge
with virulent wild-type BTV-17.
FIG. 18 is a chart showing the mean white blood cell count (WBC) of
sheep immunized with vCP2289 compared to a WNV-CP control vaccine
after challenge with virulent wild-type BTV-17.
FIG. 19 is a chart showing the mean lymphocyte count of sheep
immunized with vCP2289 compared to a WNV-CP control vaccine after
challenge with virulent wild-type BTV-17.
FIG. 20 is a chart showing the mean platelet count of sheep
immunized with vCP2289 compared to a WNV-CP control vaccine after
challenge with virulent wild-type BTV-17.
DETAILED DESCRIPTION
As discussed herein, the present invention relates to vectors
containing at least one polynucleotide of BTV or at least one
nucleic acid molecule encoding at least one BTV antigen, immunogen
or epitope, e.g., in vivo and in vitro expression vectors
comprising at least one polynucleotide of BTV or in vivo and in
vitro expression vectors comprising and expressing at least one BTV
antigen, immunogen or epitope, as well as immunogenic compositions
and vaccines against bluetongue disease; for instance, such
compositions or vaccines that contain one or more of the vectors
and/or one or more of the expression products of the vectors.
Advantageously, the immunogens, antigens comprise the outer capsid
protein VP2 (L2), or the outer capsid protein VP5 (M5), or epitopes
or combinations thereof, e.g., VP2 and VP5; VP2; and VP5 or a
fragment thereof. The combinations can be separate proteins or
polyproteins. The compositions or vaccines can thus contain one or
more vectors expressing more than one of the proteins, e.g.,
different proteins. The compositions or vaccines can comprise, or
vectors thereof express, proteins from different strains or
isolates of BTV. Thus, the compositions or vaccines can comprise,
or the vectors thereof express, VP2, VP5 or combinations thereof,
wherein the VP2 and VP5 are from different strains or isolates.
In this regard, it is noted that there is the serotype 17 BTV
isolate or strain, e.g., field isolates (deposited as segments in
GenBank: (de Mattos, de Mattos et al. 1994)[VP2] isolate 17B81, SEQ
ID No. S72158; (Mecham and Johnson 2005)[VP5] isolate FL99, SEQ ID
No: AY855281); and/or American Type Culture Collection VR-875.TM.
(deposited as BTV serotype 17; blood from sheep with typical
bluetongue disease, Wyoming, 1962). Due to the segmented nature of
the BTV genome, genomic nucleotide sequences for each segment are
determined individually for each serotype segment. Table 2 lists
the sequences available for BTV serotype 17.
TABLE-US-00003 TABLE 2 BTV-17 - Number of available RNA sequences
for BTV serotype 17. Genome Segment Number 1 2 3 4 5 6 7 8 9 10
(VP1(Pol)) (VP2) (VP3(T2)) (VP4(CaP)) (NS1(ATuP)) (VP5) (VP7(T13))
(NS2(Vi- P)) (VP6(Hel)) (NS3) 1 5 2 1 2 2 6 1 7 8
Also, it is noted that comparative phylogenetic analysis of VP2
sequences within serotypes indicates a degree of homology but
enough inherent variability exists to allow distinction of virus
lineages within a single serotype. BTV serotype is controlled
primarily by the viral outer capsid protein VP2, encoded by genome
segment 2. It is envisaged that sequence analysis of segment 2
could be used not only to identify virus serotype but also, by
comparison to sequences of reference strains, to identify the
origins of individual virus strains.
Advantageously in embodiments involving at least one epitope
present in, or expressed by vector or vectors in, compositions or
vaccines of the invention, the epitope or epitopes are from VP2,
VP5 or combinations thereof, and the epitope or epitopes can be
from different strains or isolates. In this regard, it is noted
that one can locate or map epitopes in BTV antigens or immunogens,
such as the VP5 protein; see, e.g., (Martinez-Torrecuadrada,
Langeveld et al. 1999) and (Wang, Du Plessis et al. 1995), VP2
protein (Heidner, Rossitto et al. 1990; Rossitto and MacLachlan
1992; DeMaula, Bonneau et al. 2000) and VP1 protein (Huang, Hwang
et al. 1995).
Also as discussed herein, the invention relates to methods for
using the vectors, immunological compositions and vaccines,
including for immunizing and vaccinating against this virus, for
expressing polypeptides encoded by the polynucleotide(s), and
methods for using the expression products in assays or to generate
antibodies useful in assays, as well as to methods for making the
polynucleotide(s), vectors, compositions vaccines, assays, inter
alia.
The present invention thus relates to means for preventing and/or
combating diseases caused by the BTV, so as to decrease or to
abolish clinical signs and/or viremia, and/or lesions.
The invention relates to such immunogenic and vaccine compositions
suitable for use in different animal (target or host) species
susceptible to disease caused by BTV, including, but not limited
to, mammals, reptiles, birds, especially humans, companion mammals
or animals such as canines, felines, equines, zoo mammals or
animals, such as aquatic mammals, felines, equines, zoo reptiles,
and avian species.
The invention further relates to immunization and vaccination
methods involving the immunogenic and vaccine compositions, for the
target or host species. And on this aspect of the invention,
mention is made that as to wild or non-domesticated animals, such
as, but not limited to, wild or non-domesticated birds or mammals
compositions comprising one or more vectors that express one or
more BTV epitopes or antigens or immunogens can be delivered via
food, e.g., a bait drop, or mammal or bird food, left for
consumption by wild or non-domesticated birds or mammals, that
includes or contains the one or more vectors, so there may be
administration thereof orally by the mammal or bird consuming the
food. This route of administration may be advantageous when the one
or more vectors is one or more poxviruses, e.g., an avipox virus
such as an attenuated canarypox virus, for instance ALVAC, or an
attenuated fowlpox virus, for instance TROVAC, or a vaccinia virus,
such as an attenuated vaccinia virus, for instance NYVAC.
Accordingly, the invention envisions oral or mucosal
administration, as well as edible compositions that contain one or
more of the inventive vectors, akin to the MERIAL rabies product
RABORAL.TM.. From this disclosure and the knowledge in the art, the
skilled artisan can formulate edible animal feed for a bird or
mammal that contains a suitable dose of one or more inventive
vectors. Furthermore, the invention comprehends topical
administration of compositions containing vectors, see, e.g., U.S.
Pat. No. 6,348,450 regarding topical administration of vector
compositions, and devices for topical administration of
compositions to wild or non-domesticated animals, see, e.g.,
WO01/95715, U.S. application Ser. No. 10/374,627, filed Feb. 26,
2003, for such devices for rodents and birds; each of which,
together with each document cited or referenced therein, as with
each document cited herein and each document referenced or cited in
each document cited herein, is hereby incorporated herein by
reference.
The invention further relates to means and methods that make
differential diagnosis possible, e.g., methods that make it
possible to make, or allow for, a distinction between an animal
infected by pathogenic BTV and an animal administered a vaccine or
immunogenic composition according to the invention.
In addition to the polynucleotide encoding VP2 and VP5, the
expression vectors according to the invention can comprise one or
more other polynucleotides encoding other proteins of BTV,
preferably structural proteins of BTV and said sequences are
preferably chosen from among those encoding the structural viral
proteins.
The vector preferably comprises a polynucleotide encoding regions
corresponding e.g. to VP2, VP5, or advantageously VP2 and VP5, or
epitopes thereof; that is, expression of multiple proteins or
epitopes thereof are considered advantageous. A vector comprising
several separate polynucleotides encoding the different proteins
(e.g. VP2 and/or VP5 or epitopes thereof) also falls within the
scope of the present invention. The vector, especially for in vivo
expression, can also comprise polynucleotides corresponding to more
than one BTVserotype, strain or isolate, for instance, two or more
polynucleotides encoding VP2 or VP5, or epitope(s) thereof, of
different strains. From all different serotypes such as, but not
limited to, serotypes 1, 2, 4, 9, 10, 11, 13, 16, and 17.
Likewise, an immunogenic or vaccine composition can comprise one or
more vectors for expression of polynucleotides corresponding to
more than one BTV serotype, strain or isolate, for instance, two or
more polynucleotides encoding VP2 or VP5, or epitope(s) thereof, of
different strains. The vector, especially for in vivo expression,
can additionally comprise one or more nucleotide sequences encoding
immunogens of other pathogenic agents and/or cytokines.
The term polynucleotide encoding a protein of BTV primarily means a
DNA fragment or isolated DNA molecule encoding said protein, or the
complementary strand thereto; but, RNA is not excluded, as it is
understood in the art that thymidine (T) in a DNA sequence is
considered equal to uracil (U) in an RNA sequence. Thus, RNA
sequences for use in the invention, e.g., for use in RNA vectors,
can be derived from DNA sequences, by thymidine (T) in the DNA
sequence being considered equal to uracil (U) in RNA sequences.
The term protein includes peptides and polypeptides. A protein
fragment is immunologically active in the sense that once
administered to the host; it is able to evoke an immune response of
the humoral and/or cellular type directed against the protein.
Preferably the protein fragment is such that it has substantially
the same immunological activity as the total protein. Thus, a
protein fragment according to the invention comprises or consists
essentially of or consists of at least one epitope or antigenic
determinant. The term epitope relates to a protein site able to
induce an immune reaction of the humoral type (B cells) and/or
cellular type (T cells).
Accordingly, a minimum structure of the polynucleotide is that it
comprises or consists essentially of or consists of nucleotides
that encode an epitope or antigenic determinant of the BTV protein.
A polynucleotide encoding a fragment of the total protein, more
advantageously, comprises or consists essentially of or consists of
a minimum of 21 nucleotides, advantageously at least 42
nucleotides, and preferably at least 57, 87 or 150 consecutive or
contiguous nucleotides of the sequence encoding the total protein
or polyprotein. As mentioned earlier, epitope determination
procedures, such as, generating overlapping peptide libraries
(Hemmer, Pinilla et al. 1998), Pepscan (Geysen, Meloen et al.
1984); (Geysen, Barteling et al. 1985); (Van der Zee, Van Eden et
al. 1989); (Geysen 1990); Multipin.RTM. Peptide Synthesis Kits de
Chiron) and algorithms (De Groot and Rothman 1999), can be used in
the practice of the invention, without undue experimentation. Other
documents cited and incorporated herein may also be consulted for
methods for determining epitopes of an immunogen or antigen and
thus nucleic acid molecules that encode such epitopes.
Elements for the expression of the polynucleotide or
polynucleotides are advantageously present in an inventive vector.
In minimum manner, this comprises, consists essentially of, or
consists of an initiation codon (ATG), a stop codon and a promoter,
and optionally also a polyadenylation sequence for certain vectors
such as plasmid and certain viral vectors, e.g., viral vectors
other than poxviruses. When the polynucleotide encodes a protein
fragment, e.g., advantageously, in the vector, an ATG is placed at
5' of the reading frame and a stop codon is placed at 3'. Other
elements for controlling expression may be present, such as
enhancer sequences, stabilizing sequences and signal sequences
permitting the secretion of the protein.
Methods for making and/or administering a vector or recombinants or
plasmid for expression of gene products of genes of the invention
either in vivo or in vitro can be any desired method, e.g., a
method which is by or analogous to the methods disclosed in, or
disclosed in documents cited in: U.S. Pat. Nos. 6,130,066,
5,494,807, 5,514,375, 5,744,140, 5,744,141, 5,756,103, 5,762,938,
5,766,599, 5,990,091, 6,004,777, 6,130,066, 6,497,883, 6,464,984,
6,451,770, 6,391,314, 6,387,376, 6,376,473, 6,368,603, 6,348,196,
6,306,400, 6,228,846, 6,221,362, 6,217,883, 6,207,166, 6,207,165,
6,159,477, 6,153,199, 6,090,393, 6,074,649, 6,045,803, 6,033,670,
6,485,729, 6,103,526, 6,224,882, 6,312,682, 6, 312,683, 6,348,450,
4,603,112; 4,769,330; 5,174,993; 5,505,941; 5,338,683; 5,494,807;
4,394,448; 4,722,848; 4,745,051; 4,769,331; 5,591,639; 5,589,466;
4,945,050; 5,677,178; 5,591,439; 5,552,143; and 5,580,859; U.S.
patent application Ser. No. 920,197, filed Oct. 16, 1986; WO
94/16716; WO 96/39491; WO91/11525; WO 98/33510; WO 90/01543; EP 0
370 573; EP 265785; (Paoletti 1996); (Moss 1996); Richardson (Ed)
(1995) Methods in Molecular Biology 39, "Baculovirus Expression
Protocols," Humana Press Inc.; (Smith, Summers et al. 1983);
(Pennock, Shoemaker et al. 1984); (Roizman 1996); (Andreansky, He
et al. 1996); (Robertson, Ooka et al. 1996); (Frolov, Hoffman et
al. 1996); (Kitson, Burke et al. 1991); (Ballay, Levrero et al.
1985); (Graham 1990); (Prevec, Schneider et al. 1989); (Felgner,
Kumar et al. 1994); (Ulmer, Donnelly et al. 1993); (McClements,
Armstrong et al. 1996);(Ju, Edelstein et al. 1998); and (Robinson
and Torres 1997). Thus, the vector in the invention can be any
suitable recombinant virus or virus vector, such as a poxvirus
(e.g., vaccinia virus, avipox virus, canarypox virus, fowlpox
virus, raccoonpox virus, swinepox virus, etc.), adenovirus (e.g.,
canine adenovirus), herpesvirus, baculovirus, retrovirus, etc. (as
in documents incorporated herein by reference); or the vector can
be a plasmid. The herein cited and incorporated herein by reference
documents, in addition to providing examples of vectors useful in
the practice of the invention, can also provide sources for non-BTV
proteins or epitopes thereof, e.g., non-BTV immunogens or epitopes
thereof, cytokines, etc. to be expressed by vector or vectors in,
or included in, multivalent or cocktail immunogenic compositions or
vaccines of the invention.
The present invention also relates to preparations comprising
vectors, such as expression vectors, e.g., vaccines or immunogenic
compositions. The preparations can comprise, consist essentially
of, or consist of one or more vectors, e.g., expression vectors,
such as in vivo expression vectors, comprising, consisting
essentially or consisting of (and advantageously expressing) one or
more of the BTV polynucleotides encoding VP2, VP5, or combinations
or polyproteins thereof, especially as above-mentioned (e.g., VP2,
VP5, VP2 and VP5 or at least an epitope thereof); and,
advantageously, the vector contains and expresses a polynucleotide
that includes, consists essentially of, or consists of a coding
region encoding BTV VP2 and/or VP5, in a pharmaceutically or
veterinarily acceptable carrier, excipient or vehicle. Thus,
according to an embodiment of the invention, the other vector or
vectors in the preparation comprises, consists essentially of or
consists of a polynucleotide that encodes, and under appropriate
circumstances the vector expresses one or more other proteins of
BTV, e.g. VP2, VP5, or an epitope thereof.
According to another embodiment, the vector or vectors in the
preparation comprise, or consist essentially of, or consist of
polynucleotide(s) encoding one or more proteins or epitope(s)
thereof of BTV, e.g., of one or more BTV serotypes, strains or
isolates; and, advantageously, in a suitable host cell or under
appropriate conditions, the vector or vectors express polypeptides
encoded by the polynucleotide(s). The inventive preparation
advantageously comprises, consists essentially of, or consists of,
at least two vectors comprising, consisting essentially of, or
consisting of, and advantageously also expressing, preferably in
vivo under appropriate conditions or suitable conditions or in a
suitable host cell, polypeptides encoded by polynucleotides from
different BTV serotypes, strains or isolates encoding the same
proteins and/or for different proteins, but preferably for the same
proteins. As to preparations containing one or more vectors
containing, consisting essentially of or consisting of
polynucleotides encoding, and preferably expressing, advantageously
in vivo, BTV VP2, or VP5, or an epitope thereof, it is preferred
that the expression products be from two, three or more different
BTV serotypes, strains or isolates, advantageously strains. The
invention is also directed at mixtures of vectors that contain,
consist essentially of, or consist of coding for, and express, VP2,
or VP5 of different strains. It is preferred that in such mixtures,
at least one vector contain, consist essentially of, or consist of,
coding for, and express, VP2.
According to yet another embodiment and as will be shown in greater
detail hereinafter, the other vector or vectors in the preparation
comprise and express one or more cytokines and/or one or more
immunogens of one or more other pathogenic agents. Sources for
cytokines, immunogens for other pathogenic agents or epitope(s)
thereof, and nucleic acid molecules encoding the same, may be found
in herein cited documents, as well as in, WO02096349, WO0208162,
WO0020025, WO00152888, WO0145735, WO00127097, WO0116330, WO0077210,
WO0077188, WO0077043, WO9842743, WO9833928, WO9749826, WO9749825,
U.S. Pat. Nos. 6,387,376, 6,306,400, 6,159,477, 6,156,567,
6,153,199, 6,090,393, 6,074,649, 6,033,670.
The invention also relates to various combinations of different
embodiments herein disclosed, e.g., compositions or vaccines
containing various vectors, compositions or vaccines containing a
vector and a protein (BTV and/or non-BTV) and/or cytokine, etc.
The preparations comprising an in vitro or in vivo expression
vector comprising and expressing a polynucleotide encoding VP2, VP5
constitute a preferred embodiment of the invention.
According to a further advantageous embodiment, one or more of the
additional structural proteins VP7, and/or VP3 are expressed
jointly with the VP2 and VP5 structural proteins according to the
invention, either via the same expression vector, or via their own
expression vector. They are preferably expressed together on the
basis of a single polynucleotide, e.g., as a polyprotein. That is,
in certain embodiments, the vector further contains, consists
essentially of or consists of, one or more nucleotides encoding
VP7, and/or VP3, or a composition or vaccine further contains,
consists essentially of or consists of one or more additional
vectors that contains, consists essentially of or consists of, one
or more nucleotides encoding VP7, and/or VP3; this vector or these
vectors advantageously express(es) the structural protein(s); and,
VP7 and VP3 are advantageously expressed jointly, and more
advantageously, as a polyprotein.
According to a further advantageous embodiment, one or more of the
non-structural proteins NS1, NS2 and NS3 and/or VP1, VP4 are
expressed jointly with the VP2 and VP5 structural proteins
according to the invention, either via the same expression vector,
or via their own expression vector. That is, in certain
embodiments, the vector further contains, consists essentially of
or consists of, one or more nucleotides encoding VP1, VP4, NS1,
NS2, and/or NS3, or a composition or vaccine further contains,
consists essentially of or consists of one or more additional
vectors that contains, consists essentially of or consists of, one
or more nucleotides encoding VP1, VP4, NS1, NS2 and/or NS3; this
vector or these vectors advantageously express(es) the structural
protein(s); and, VP1, VP4, NS1, NS2 and/or NS3 are advantageously
expressed. Thus, the invention also relates to vector such as an in
vivo or in vitro expression vector comprising, consisting
essentially of or consisting of the polynucleotide(s) encoding VP1,
VP4, NS1, NS2 and NS3, combinations thereof, including polyproteins
thereof. The vector can be one of the above-described vectors
comprising, consisting essentially of or consisting of a
polynucleotide encoding one or more structural proteins, e.g., VP2,
VP5, VP7 and/or VP3 combinations and polyproteins thereof e.g.,
such a vector that contains or consists essentially of
polynucleotides encoding structural protein or proteins or epitopes
thereof can also contain or consist essentially thereof
polynucleotides encoding one or more non-structural proteins,
combination thereof, polyproteins thereof, or epitopes thereof. As
an alternative, the invention relates to a preparation as described
hereinbefore, also incorporating at least one of the vectors that
contain polynucleotide(s) encoding and advantageously expressing a
non-structural protein and optionally a pharmaceutically or
veterinarily acceptable carrier, vehicle or excipient.
For preparing vectors, e.g., expression vectors, according to the
invention, the skilled artisan has available various serotypes,
strains and isolates of BTV and the description of the nucleotide
sequence of their genome, see, e.g., discussion herein, also
referring to 24 BTV serotypes where nucleic acid sequence
information is available(Wilson and Mecham 2000).
Reference is, for example, made to strain BTV-17. For each protein
the corresponding nucleotide sequence is provided (de Mattos, de
Mattos et al. 1994; Huang, Hwang et al. 1995; Bernard, Israel et
al. 1997). By comparison and alignment of the sequences, the
determination of a polynucleotide encoding such a protein in
another BTV serotype or strain is readily determined.
As discussed herein, the term polynucleotide is understood to mean
a nucleic acid sequence encoding a protein or a fragment thereof or
an epitope thereof specific to a particular BTV strain; and, by
equivalence, the term polynucleotide is understood to include the
corresponding nucleotide sequences of different strains of BTV and
nucleotide sequences differing due to codon degeneracy. Thus, a
polynucleotide encoding BTV VP2 is understood as comprising,
consisting essentially of or consisting of (a) nt 20-2887 of BTV-17
(SEQ ID NO:3), (b) corresponding sequences of different BTV
strains, and (c) nucleotide sequences that encode BTV VP2 but
differ from (a) and (b) due to codon degeneracy.
The L2 gene of BTV that encodes the outer capsid protein, VP2, has
the greatest degree of genetic variability between global strains
of BTV. This is not surprising as this protein is responsible for
both virus neutralization and serotype-specificity (Mecham, Dean et
al. 1986; Roy 1992) and is likely to be affected by genetic drift
and founder effect selection. Genetic drift and founder effect may
result in variants with increased virulence (Bernard, Israel et al.
1997). A number of neutralization determinants have been identified
(Ghiasi, Fukusho et al. 1987; DeMaula, Heidner et al. 1993; Jewell
and Mecham 1994). VP2 has been shown to be the protein primarily
responsible for attachment and entry into mammalian host cells
(Hassan and Roy 1999). The variation between serotypes generally
results in segregation of viruses based on serotype regardless of
geographic origin of isolation when phylogenetic analysis is used
(Pritchard and Gould 1995; Bonneau, Zhang et al. 1999). The M5 gene
of BTV encodes the inner outer capsid protein, VP5, and has the
second greatest degree of genetic variability amongst BTV genes,
showing 51-71% identity within a given serogroup. VP5 can cause
conformational alterations of the outer capsid structure, and
changes in neutralization characteristics (Cowley and Gorman 1989;
DeMaula, Bonneau et al. 2000). VP5 may also contribute to host cell
recognition (Roy 1992).
Due to the inherent genetic variability within and without
serotypes, the invention covers polynucleotides encoding proteins
having amino acid sequences, whose sequence identity or homology
with the consensus BTV amino acid sequence for the protein exhibits
functional equivalency. For instance, an expressed VP2 capsid
protein can have greater than 20% identity with the corresponding
capsid sequence of the polypeptide expressed from (a) comprising
nucleotides 20-2887 of BTV-17 segment 2 (SEQ ID NO:3), (b)
corresponding sequences of different BTV strains, and/or (c)
nucleotide sequences that encode BTV VP2 but differ from (a) and
(b) due to codon degeneracy, and from (a) and (b) due to strain,
serotype and serogroup genetic variability. Despite this
variability, functionally the polynucleotides encode the VP2 capsid
polypeptide.
Therefore, the invention comprehends polynucleotides that express
such functionally homologous polypeptides; and the corresponding
degrees of homology or identity of those polynucleotides to
polynucleotides encoding polypeptides to which homologous
polypeptides have homology or identity. Homologous polypeptides
advantageously contain one or more epitopes of the polypeptide to
which there is identity or homology, such that homologous
polypeptides exhibit immunological similarity or identity to the
polypeptide to which there is identity or homology, e.g., the
homologous polypeptide elicits similar or better immune response
(to the skilled immunologist) than polypeptide to which there is
identity or homology and/or the homologous polypeptide binds to
antibodies elicited by and/or to which the polypeptide to which
there is identity or homology binds, advantageously and not to
other antibodies.
Accordingly, fragments of homologous polypeptides and of
polypeptides to which there is identity or homology, advantageously
those fragments which exhibit immunological similarity or identity
to homologous polypeptides or polypeptides to which there is
identity or homology, are envisioned as being expressed, and
therefore, polynucleotides therefore which may represent fragments
of polynucleotides of homologous polypeptides and of polypeptides
to which there is identity or homology, are also envisioned by and
useful in the instant invention.
The term "sequence identity" indicates a quantitative measure of
the degree of homology between two amino acid sequences of equal
length or between two nucleotide sequences of equal length. If the
two sequences to be compared are not of equal length, they must be
aligned to best possible fit possible with the insertion of gaps or
alternatively, truncation at the ends of the protein sequences. The
sequence identity can be calculated as
((N.sub.ref-N.sub.dif)/N.sub.ref).times.100, wherein N.sub.dif is
the total number of non-identical residues in the two sequences
when aligned and wherein N.sub.ref is the number of residues in one
of the sequences. Hence, the DNA sequence AGTCAGTC will have a
sequence identity of 75% with the sequence AATCAATC (N.sub.dif=2
and N.sub.ref=8). A gap is counted as non-identity of the specific
residue(s), i.e. the DNA sequence AGTGTC will have a sequence
identity of 75% with the DNA sequence AGTCAGTC (N.sub.dif=2 and
N.sub.ref=8). Sequence identity can alternatively be calculated by
the BLAST program e.g. the BLASTP program (Pearson and Lipman
1988)(www.ncbi.nlm.nih.gov/cgi-bin/BLAST). In one aspect of the
invention, alignment is performed with the sequence alignment
method ClustalW with default parameters as described by (Thompson,
Higgins et al. 1994), available at http://www2.ebi.ac.uk/clustalw/.
Thus, a polynucleotide can be any nucleic acid molecule including
DNA, RNA, LNA (locked nucleic acids), PNA, RNA, dsRNA,
RNA-DNA-hybrid, and non-naturally occurring nucleosides.
And from the herein disclosure, advantageously, proteins or
polypeptides expressed by vectors of the invention are
immunologically active peptides and polypeptides, e.g., with
respect to polypeptides or proteins of BTV-17, proteins or
polypeptides expressed by vectors of the invention can be:
a) corresponding proteins or polypeptides of one or more different
BTV serotypes, strains or isolates,
b) proteins differing therefrom (from BTV-17 and/or a), but
maintaining with a native BTV protein an identity equal to or
greater than 20%. Thus, a reference to a BTV protein may involve
additional proteins as herein discussed.
Different BTV serotypes and strains are accessible in collections,
especially in the American Type Culture Collection (ATCC), e.g.
under access numbers VR-875, VR-1231, VR-187, VR-873, VR-983,
VR-1231AF, or VR-1231CAF, and as otherwise herein discussed, the
full gene can also be chemically synthesized.
In the invention, preferably the polynucleotide also comprises a
nucleotide sequence encoding a signal peptide, located upstream of
the coding region of the expressed protein to facilitate the
secretion thereof; and accordingly, the invention comprehends the
expression of a BTV polypeptide, such as a BTV antigen, immunogen,
or fragment thereof, e.g., epitope, with a leader or signal
sequence. The leader or signal sequence can be an endogenous
sequence, e.g. the natural signal sequence of a BTV polypeptide.
The leader or signal sequence can also be a heterologous sequence,
and thus encoded by a nucleotide sequence that is heterologous to
BTV. For example, the leader or signal sequence can be endogenous
to the vector, or a leader or signal sequence that is heterologous
to both the vector and BTV, such as a signal peptide of tissue
plasminogen activator (tPA), e.g., human tPA, and thus, the vector
or the polynucleotide therein can include a sequence encoding the
leader or signal peptide, e.g., the leader or signal peptide of
human tissue plasminogen activator (tPA) (Hartikka, Sawdey et al.
1996). The nucleotide sequence encoding the signal peptide is
advantageously inserted in frame and upstream of the sequence
encoding the BTV polypeptide, e.g., VP2, VP5 or combinations, e.g.
VP2 and VP5.
According to an embodiment of the invention, the vectors, e.g., in
vivo expression vectors are viral vectors.
Viral vectors, e.g., viral expression vectors are advantageously:
poxviruses, e.g. vaccinia virus or an attenuated vaccinia virus,
(for instance, MVA, a modified Ankara strain obtained after more
than 570 passages of the Ankara vaccine strain on chicken embryo
fibroblasts; see (Stickl and Hochstein-Mintzel 1971; Sutter and
Moss 1992); available as ATCC VR-1508; or NYVAC, see U.S. Pat. No.
5,494,807, for instance, Examples 1 to 6 and et seq of U.S. Pat.
No. 5,494,807 which discuss the construction of NYVAC, as well as
variations of NYVAC with additional ORFs deleted from the
Copenhagen strain vaccinia virus genome, as well as the insertion
of heterologous coding nucleic acid molecules into sites of this
recombinant, and also, the use of matched promoters; see also
WO96/40241), avipox virus or an attenuated avipox virus (e.g.,
canarypox, fowlpox, dovepox, pigeonpox, quailpox, ALVAC or TROVAC;
see, e.g. U.S. Pat. No. 5,505,941, 5,494,807), swinepox,
raccoonpox, camelpox, or myxomatosis virus; adenoviruses, such as
avian, canine, porcine, bovine, human adenoviruses; or herpes
viruses, such as ovine herpes virus (OHV 1 and 2), equine herpes
virus (EHV serotypes 1 and 4), canine herpes virus (CHV), feline
herpes virus (FHV), bovine herpes viruses (BHV serotypes 1 and 4),
porcine herpes virus (PRV), Marek's disease virus (MDV serotypes 1
and 2), turkey herpes virus (HVT or MDV serotype 3), or duck herpes
virus. When a herpes virus is used, the vector HVT is preferred for
the vaccination of the avian species, the bovine vector for the
vaccination of cattle, the ovine vector for the vaccination of
sheep, and the vector EHV for the vaccination of horses.
More generally in certain embodiments, it may be advantageous to
match a vector to a host, such as an equine virus, e.g., EHV to use
in equines, or a vector that is an avian pathogen, such as fowlpox,
HVT, MDV or duck herpes to use in avians such as poultry or
chickens, or a vector that is an ovine pathogen such as OHV, a
bovine pathogen such as BHV to use in bovines such as cows, or a
vector that is a porcine pathogen such a porcine herpes virus to
use in porcines, or a vector that is a canine pathogen such as
canine adenovirus or canine herpes virus to use in canines such as
dogs, a vector that is a feline pathogen such as FHV to use in
felines, as this may allow for an immune response against the
vector and thus provide an immune response against a pathogen of
the host or target species in addition to an immune response
against an orbivirus.
However, it is also noted that it can be advantageous that the
vector not be a natural pathogen of the host; for instance, so that
the vector can have expression of the exogenous, e.g., BTV coding
sequences, but with limited or no replication; for example, the use
of an avipox vector in a mammalian host, as in U.S. Pat. No.
5,174,993. It is also noted that the invention comprehends
vaccines, immunological and immunogenic compositions, with those
terms being used in the sense attributed to them in the art; see,
e.g., documents cited herein, such as U.S. Pat. No. 6,497,883.
According to another embodiment of the invention, the poxvirus
vector, e.g., expression vector is a canarypox virus or a fowlpox
virus vector, advantageously an attenuated canarypox virus or
fowlpox virus. In this regard, is made to the canarypox available
from the ATCC under access number VR-111. Attenuated canarypox
viruses are described in U.S. Pat. No. 5,756,103 (ALVAC) and
WO01/05934. Numerous fowipox virus vaccination strains are also
available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the
NOBILIS VARIOLE vaccine marketed by Intervet; and, reference is
also made to U.S. Pat. No. 5,766,599 which pertains to the
attenuated fowlpox strain TROVAC.
For information on poxviruses and how to generate recombinants
thereof and how to administer recombinants thereof, the skilled
artisan can refer documents cited herein and to WO90/12882, e.g.,
as to vaccinia virus mention is made of U.S. Pat. Nos. 4,769,330,
4,722,848, 4,603,112, 5,110,587, 5,494,807, and 5,762,938 inter
alia; as to fowlpox, mention is made of U.S. Pat. Nos. 5,174,993,
5,505,941 and U.S. Pat. No. 5,766,599 inter a/ia; as to canarypox
mention is made of U.S. Pat. No. 5,756,103 inter alia; as to
swinepox mention is made of U.S. Pat. No. 5,382,425 inter alia;
and, as to raccoonpox, mention is made of WO0/03030 inter alia.
When the expression vector is a vaccinia virus, insertion site or
sites for the polynucleotide or polynucleotides to be expressed are
advantageously at the thymidine kinase (TK) gene or insertion site,
the hemagglutinin (HA) gene or insertion site, the region encoding
the inclusion body of the A type (ATI); see also documents cited
herein, especially those pertaining to vaccinia virus. In the case
of canarypox, advantageously the insertion site or sites are ORF(s)
C3, C5 and/or C6; see also documents cited herein, especially those
pertaining to canarypox virus. In the case of fowlpox,
advantageously the insertion site or sites are ORFs F7 and/or F8;
see also documents cited herein, especially those pertaining to
fowlpox virus. The insertion site or sites for MVA virus area
advantageously as in various publications, including (Carroll,
Overwijk et al. 1997); (Stittelaar, Wyatt et al. 2000); (Sutter,
Wyatt et al. 1994); and, in this regard it is also noted that the
complete MVA genome is described in (Antoine, Scheiflinger et al.
1998), which enables the skilled artisan to use other insertion
sites or other promoters.
Preferably, when the expression vector is a poxvirus, the
polynucleotide to be expressed is inserted under the control of a
specific poxvirus promoter, e.g., the vaccinia promoter 7.5 kDa
(Cochran, Puckett et al. 1985), the vaccinia promoter I3L (Riviere,
Tartaglia et al. 1992), the vaccinia promoter HA (Shida 1986), the
cowpox promoter ATI (Funahashi, Sato et al. 1988), the vaccinia
promoter H6 (Taylor, Weinberg et al. 1988); (Guo, Goebel et al.
1989); (Perkus, Limbach et al. 1989)), inter alia.
Preferably, for the vaccination of mammals the expression vector is
a canarypox or a fowlpox. In this way, there can be expression of
the heterologous proteins, e.g., BTV proteins, with limited or no
productive replication. Preferably, for the vaccination of avians,
e.g., chickens, ducks, turkeys and geese, the expression vector is
a canarypox or a fowlpox.
When the expression vector is a herpes virus of turkeys or HVT,
advantageous insertion site or sites are located in the BamHI I
fragment or in the BamHI M fragment of HVT. The HVT BamHI I
restriction fragment comprises several open reading frames (ORFs)
and three intergenic regions and comprises several preferred
insertion zones, such as the three intergenic regions 1, 2 and 3,
which are preferred regions, and ORF UL55 (see, e.g., FR-A-2 728
795, U.S. Pat. No. 5,980,906). The HVT BamHI M restriction fragment
comprises ORF UL43, which is also a preferred insertion site (see,
e.g., FR-A-2 728 794, U.S. Pat. No. 5,733,554).
When the expression vector is an EHV-1 or EHV-4 herpes virus,
advantageous insertion site or sites include TK, UL43 and UL45
(see, e.g., EP-A-668355).
Preferably, when the expression vector is a herpes virus, the
polynucleotide to be expressed is inserted under the control of a
eukaryotic promoter, such as a strong eukaryote promoter,
preferably a CMV-IE (murine or human) promoter; that is, in
embodiments herein, the polynucleotide to be expressed is operably
linked to a promoter, and in herpes virus embodiments,
advantageously the polynucleotide to be expressed is operably
linked to a strong eukaryotic promoter such as a mCMV-IE or hCMV-IE
promoter. Strong promoters are also discussed herein in relation to
plasmids as vectors.
According to a yet further embodiment of the invention, the vector,
e.g., in vivo expression vector, is a plasmid vector or a DNA
plasmid vector, e.g., the type of plasmid vector employed in that
which is known as a DNA vaccine (in contrast with a transfection
plasmid used in homologous recombination to generate a recombinant
virus, which is not used in a DNA vaccine).
The term plasmid covers any DNA transcription unit in the form of a
polynucleotide sequence comprising a polynucleotide according to
the invention and the elements necessary for in vivo expression of
that which is encoded by the polynucleotide in a cell or cells of
the desired host or target; and, in this regard, it is noted that
there are supercoiled and non-supercoiled circular plasmid, as well
as linear and multimeric forms, all of which are intended to be
within the scope of the invention.
Each plasmid comprises or contains or consists essentially of, in
addition to the polynucleotide encoding the antigen(s) or
epitope(s) of the pathogen or pathogens, e.g., BTV (or BTV and
another pathogen), a promoter for expression, in the host cells of
the polynucleotide; and, the polynucleotide may be said to be
operably linked to the promoter or under the control of the
promoter or dependent upon the promoter. In general, it is
advantageous to employ a eukaryotic promoter, e.g., a strong
eukaryotic promoter. The preferred strong eukaryote promoter is the
immediate early cytomegalovirus promoter (CMV-IE) of human or
murine origin, or optionally having another origin such as the rat
or guinea pig. The CMV-IE promoter can comprise the actual promoter
part, which may or may not be associated with the enhancer part.
Reference can be made to EP-A-260 148, EP-A-323 597, U.S. Pat. Nos.
5,168,062, 5,385,839, and 4,968,615, as well as to PCT WO87/03905.
The CMV-IE promoter is preferably a human CMV-IE (Boshart, Weber et
al. 1985) or murine CMV-IE.
In more general terms, the promoter has either a viral or a
cellular origin. A strong viral promoter other than CMV-IE that may
be usefully employed in the practice of the invention is the
early/late promoter of the SV40 virus or the LTR promoter of the
Rous sarcoma virus. A strong cellular promoter that may be usefully
employed in the practice of the invention is the promoter of a gene
of the cytoskeleton, such as e.g. the desmin promoter (Kwissa, van
Kampen et al. 2000), or the actin promoter (Miyazaki, Takaki et al.
1989).
Functional subfragments of these promoters, i.e., portions of these
promoters that maintain an adequate promoting activity, are
included within the present invention, e.g. truncated CMV-IE
promoters according to WO98/00166 or U.S. Pat. No. 6,156,567 can be
used in the practice of the invention. A promoter in the practice
of the invention consequently includes derivatives and subfragments
of a full-length promoter that maintain an adequate promoting
activity and hence function as a promoter, preferably promoting
activity substantially similar to that of the actual or full-length
promoter from which the derivative or subfragment is derived, e.g.,
akin to the activity of the truncated CMV-IE promoters of U.S. Pat.
No. 6,156,567 to the activity of full-length CMV-IE promoters.
Thus, a CMV-IE promoter in the practice of the invention can
comprise or consist essentially of or consist of the promoter
portion of the full-length promoter and/or the enhancer portion of
the full-length promoter, as well as derivatives and
subfragments.
Preferably, the plasmids comprise or consist essentially of other
expression control elements. It is particularly advantageous to
incorporate stabilizing sequence(s), e.g., intron sequence(s),
preferably intron II of the rabbit .beta.-globin gene (van Ooyen,
van den Berg et al. 1979).
As to the polyadenylation signal (polyA) for the plasmids and viral
vectors other than poxviruses, use can more be made of the polyA
signal of the bovine growth hormone (bGH) gene (see U.S. Pat. No.
5,122,458), or the poly(A) signal of the rabbit .beta.-globin gene
or the poly(A) signal of the SV40 virus.
As to other expression control elements usable in plasmids,
attention is directed to expression control elements that are
useful in herpes virus expression vectors.
According to another embodiment of the invention, the expression
vectors are expression vectors used for the in vitro expression of
proteins in an appropriate cell system. The expressed proteins can
be harvested in or from the culture supernatant after, or not after
secretion (if there is no secretion a cell lysis typically occurs
or is performed), optionally concentrated by concentration methods
such as ultrafiltration and/or purified by purification means, such
as affinity, ion exchange or gel filtration-type chromatography
methods.
Protein production can take place by the transfection of mammalian
cells by plasmids, by replication or expression without productive
replication of viral vectors in mammalian cells or avian cells, or
by Baculovirus replication (see, e.g., U.S. Pat. No. 4,745,051;
(Vialard, Lalumiere et al. 1990); Luckow (Luckow and Summers 1988),
e.g. Autographa californica Nuclear Polyhedrosis Virus AcNPV, on
insect cells (e.g. Sf9 Spodoptera frugiperda cells, ATCC CRL 1711;
see also U.S. Pat. Nos. 6,228,846, 6,103,526). Mammalian cells
which can be used are advantageously hamster cells (e.g. CHO or
BHK-21) or monkey cells (e.g. COS or VERO). Thus, the invention
accordingly comprehends expression vectors incorporating a
polynucleotide according to the invention, as well as the thus
produced or expressed BTV proteins or fragments thereof from in
vitro expression, and the preparations containing the same.
Accordingly, the present invention also relates to BTV
protein-concentrated and/or purified preparations. When the
polynucleotide encodes several proteins, they are cleaved, and the
aforementioned preparations then contain cleaved proteins.
The present invention also relates to immunogenic compositions and
vaccines against BTV comprising at least one in vivo expression
vector according to the invention and a pharmaceutically or
veterinarily acceptable excipient or carrier or vehicle, and
optionally an adjuvant.
An immunogenic composition covers any composition which, once
administered to the target species, induces an immune response
against BTV. The term vaccine is understood to mean a composition
able to induce an effective protection. The target species include
mammals, e.g., equines, canines, felines, bovines, ovines, porcines
and humans; reptiles, and birds or avians. This list is meant to
include reproducing animals, egg-laying animals, production
animals, and companion animals.
The pharmaceutically or veterinarily acceptable carriers or
vehicles or excipients are well known to the one skilled in the
art. For example, a pharmaceutically or veterinarily acceptable
carrier or vehicle or excipient can be a 0.9% NaCl saline solution
or a phosphate buffer. The pharmaceutically or veterinarily
acceptable carrier or vehicle or excipients may be any compound or
combination of compounds facilitating the administration of the
vector (or protein expressed from an inventive vector in vitro);
advantageously, the carrier, vehicle or excipient may facilitate
transfection and/or improve preservation of the vector (or
protein). Doses and dose volumes are herein discussed in the
general description of immunization and vaccination methods, and
can also be determined by the skilled artisan from this disclosure
read in conjunction with the knowledge in the art, without any
undue experimentation.
The immunogenic compositions and vaccines according to the
invention preferably comprise or consist essentially of one or more
adjuvants. Particularly suitable adjuvants for use in the practice
of the present invention are (1) polymers of acrylic or methacrylic
acid, maleic anhydride and alkenyl derivative polymers, (2)
immunostimulating sequences (ISS), such as oligodeoxyribonucleotide
sequences having one ore more non-methylated CpG units (Klinman, Yi
et al. 1996); WO98/16247), (3) an oil in water emulsion, such as
the SPT emulsion described on p 147 of "Vaccine Design, The Subunit
and Adjuvant Approach" published by M. Powell, M. Newman, (Powell
and Newman 1995), and the emulsion MF59 described on p 183 of the
same work, (4) cation lipids containing a quaternary ammonium salt,
(5) cytokines, (6) aluminum hydroxide or aluminum phosphate or (7)
other adjuvants discussed in any document cited and incorporated by
reference into the instant application, or (8) any combinations or
mixtures thereof.
The oil in water emulsion (3), which is especially appropriate for
viral vectors, can be based on: light liquid paraffin oil (European
pharmacopoeia type), isoprenoid oil such as squalane, squalene, oil
resulting from the oligomerization of alkenes, e.g. isobutene or
decene, esters of acids or alcohols having a straight-chain alkyl
group, such as vegetable oils, ethyl oleate, propylene glycol,
di(caprylate/caprate), glycerol tri(caprylate/caprate) and
propylene glycol dioleate, or esters of branched, fatty alcohols or
acids, especially isostearic acid esters.
The oil is used in combination with emulsifiers to form an
emulsion. The emulsifiers may be nonionic surfactants, such as:
esters of on the one hand sorbitan, mannide (e.g. anhydromannitol
oleate), glycerol, polyglycerol or propylene glycol and on the
other hand oleic, isostearic, ricinoleic or hydroxystearic acids,
said esters being optionally ethoxylated,
polyoxypropylene-polyoxyethylene copolymer blocks, such as
Pluronic, e.g., L121.
Among the type (1) adjuvant polymers, preference is given to
polymers of crosslinked acrylic or methacrylic acid, especially
crosslinked by polyalkenyl ethers of sugars or polyalcohols. These
compounds are known under the name carbomer (Pharmeuropa, vol. 8,
no. 2, June 1996). One skilled in the art can also refer to U.S.
Pat. No. 2,909,462, which provides such acrylic polymers
crosslinked by a polyhydroxyl compound having at least three
hydroxyl groups, preferably no more than eight such groups, the
hydrogen atoms of at least three hydroxyl groups being replaced by
unsaturated, aliphatic radicals having at least two carbon atoms.
The preferred radicals are those containing 2 to 4 carbon atoms,
e.g. vinyls, allyls and other ethylenically unsaturated groups. The
unsaturated radicals can also contain other substituents, such as
methyl. Products sold under the name Carbopol (BF Goodrich, Ohio,
USA) are especially suitable. They are crosslinked by allyl
saccharose or by allyl pentaerythritol. Among them, reference is
made to Carbopol 974P, 934P and 971P.
As to the maleic anhydride-alkenyl derivative copolymers,
preference is given to EMA (Monsanto), which are straight-chain or
crosslinked ethylene-maleic anhydride copolymers and they are, for
example, crosslinked by divinyl ether. Reference is also made to
(Regelson, Kuhar et al. 1960).
With regard to structure, the acrylic or methacrylic acid polymers
and EMA are preferably formed by basic units having the following
formula:
##STR00001## in which: R.sub.1 and R.sub.2, which can be the same
or different, represent H or CH.sub.3 x=0 or 1, preferably x=1 y=1
or 2, with x+y=2.
For EMA, x=0 and y=2 and for carbomers x=y=1.
These polymers are soluble in water or physiological salt solution
(20 g/l NaCl) and the pH can be adjusted to 7.3 to 7.4, e.g., by
soda (NaOH), to provide the adjuvant solution in which the
expression vector(s) can be incorporated. The polymer concentration
in the final vaccine composition can range between 0.01 and 1.5%
w/v, advantageously 0.05 to 1% w/v and preferably 0.1 to 0.4%
w/v.
The cationic lipids (4) containing a quaternary ammonium salt which
are advantageously but not exclusively suitable for plasmids, are
preferably those having the following formula:
##STR00002## in which R.sub.1 is a saturated or unsaturated
straight-chain aliphatic radical having 12 to 18 carbon atoms,
R.sub.2 is another aliphatic radical containing 2 or 3 carbon atoms
and X is an amine or hydroxyl group.
Among these cationic lipids, preference is given to DMRIE
(N-(2-hydroxyethyl)-N, N-dimethyl-2,3-bis(tetradecyloxy)-1-propane
ammonium; WO96/34109), preferably associated with a neutral lipid,
preferably DOPE (dioleoyl-phosphatidyl-ethanol amine; Behr J. P.,
1994, Bioconjugate Chemistry, 5, 382-389), to form DMRIE-DOPE.
Preferably, the plasmid mixture with the adjuvant is formed
extemporaneously and preferably contemporaneously with
administration of the preparation or shortly before administration
of the preparation; for instance, shortly before or prior to
administration, the plasmid-adjuvant mixture is formed,
advantageously so as to give enough time prior to administration
for the mixture to form a complex, e.g. between about 10 and about
60 minutes prior to administration, such as approximately 30
minutes prior to administration.
When DOPE is present, the DMRIE:DOPE molar ratio is preferably
about 95: about 5 to about 5:about 95, more preferably about 1:
about 1, e.g., 1:1.
The DMRIE or DMRIE-DOPE adjuvant:plasmid weight ratio can be
between about 50:about 1 and about 1:about 10, such as about
10:about 1 and about 1:about 5, and preferably about 1:about 1 and
about 1:about 2, e.g., 1:1 and 1:2.
The cytokine or cytokines (5) can be in protein form in the
immunogenic or vaccine composition, or can be co-expressed in the
host with the immunogen or immunogens or epitope(s) thereof.
Preference is given to the co-expression of the cytokine or
cytokines, either by the same vector as that expressing the
immunogen or immunogens or epitope(s) thereof, or by a separate
vector therefore.
The cytokine(s) can be chosen from: interleukin 18 (IL-18),
interleukin 12 (IL-12), interleukin 15 (IL-15), MIP-1.alpha.
(macrophage inflammatory protein 1.alpha.; (Marshall, Woolford et
al. 1997), GM-CSF (Granulocyte-Macrophage Colony-Stimulating
Factor). Particular reference is made to avian cytokines, for
instance, those of the chicken, such as cIL-18 (Schneider, Puehler
et al. 2000), cIL-15 (Xin, Hamajima et al. 1999), and equine
cytokines, for instance equine GM-CSF (WO00/77210). Preferably, use
is made of cytokines of the species to be vaccinated; that is,
advantageously, the cytokine is matched to the target or host
species, and, note for example, canine GM-CSF (example 8 of
WO00/77043), feline GM-CSF (example 9 of WO00/77043).
WO00/77210 provides the nucleotide sequence and the amino acid
sequence corresponding to equine GM-CSF, the in vitro GM-CSF
production and the construction of vectors (e.g., plasmids and
viral vectors) permitting in vivo equine GM-CSF expression. These
proteins, plasmids and viral vectors can be used in immunogenic
compositions and equine vaccines according to the invention. For
example, use can be made of the plasmid pJP097 described in example
3 of WO00/77210 or use can be made of the teaching of the latter in
order to produce other vectors or for the in vitro production of
equine GM-CSF and the incorporation of the vectors or the equine
GM-CSF into immunogenic compositions or equine vaccines according
to the invention.
The present invention also relates to immunogenic compositions and
so-called subunit vaccines, incorporating or comprising or
consisting essentially of the protein VP2 and optionally one or
more other herein mentioned proteins of BTV, e.g., VP5 or VP7 and
advantageously produced by in vitro expression in the manner
described herein, as well as a pharmaceutically or veterinarily
acceptable carrier or vehicle or excipient.
The pharmaceutically or veterinarily acceptable carrier or vehicle
or excipient can be determined by the skilled artisan without undue
experimentation from the disclosure herein and the knowledge in the
art, e.g., by reference to documents cited and incorporated herein
or documents referenced in herein cited documents and incorporated
herein by reference; and, can for example, be 0.9% NaCl saline
solution or phosphate buffer.
The immunogenic compositions and subunit vaccines according to the
invention preferably comprise or consist essentially of one or more
adjuvants. Especially suitable for use in the present invention are
(1) an acrylic or methacrylic acid polymer, or a maleic anhydride
and alkenyl derivative polymer, (2) an immunostimulating sequence
(ISS), such as an oligodeoxyribonucleotide sequence having one or
more non-methylated CpG units (Klinman, Yi et al. 1996), (3) an oil
in water emulsion, such as the emulsion SPT described on p 147 of
"Vaccine Design, The Subunit and Adjuvant Approach", published by
M. Powell, M. Newmann, (Powell and Newman 1995), and the emulsion
MF59 described on p 183 of the same work, (4) a water in oil
emulsion (EP-A-639 071), (5) saponin, such as Quil-A, or (6)
alumina hydroxide or an equivalent. The different types of
adjuvants defined under 1), 2) and 3) have been described in
greater detail herein in connection with the expression
vector-based vaccines and immunogenic compositions.
The doses and dose volumes are discussed herein in connection with
the general description of immunization and vaccination
methods.
Animals immunized with immunogenic compositions or vaccines
according to the invention develop a specific immunity against BTV,
which during a BTV infection involves a decrease of the viremia,
and indeed can totally block the virus, as compared with
unvaccinated control animals. This advantageous aspect of the
invention may be used to stop the transmission of BTV to limit the
existence of mammalian viral reservoirs, and to prevent outbreaks
of bluetongue disease.
Another advantageous aspect of the invention is that protective
immunity can be transmitted from vaccinated subjects to the
offspring.
According to the invention, the vaccination against BTV can be
combined with other vaccinations within the framework of
vaccination programs, in the form of immunization or vaccination
kits or methods, or in the form of multivalent immunogenic
compositions and multivalent vaccines, i.e. comprising or
consisting essentially of at least one vaccine component against
BTV and at least one vaccine component against at least one other
pathogenic agent. This also includes the expression by the same
expression vector of genes of at least two pathogenic agents,
including BTV.
The invention thus also relates to a multivalent or "cocktail"
immunogenic composition or a multivalent or "cocktail" vaccine
against BTV against at least one other pathogen of the target
species, using the same in vivo expression vector containing and
expressing at least one polynucleotide of BTV according to the
invention and at least one polynucleotide expressing an immunogen
of another pathogen. As to combination or multivalent or "cocktail"
immunogenic compositions or vaccines, as well as to immunogens or
antigens or epitopes thereof to be in or expressed by such
compositions or vaccines, attention is directed to herein cited and
incorporated by reference documents, as well as to U.S. Pat. Nos.
5,843,456 and 6,368,603.
The "immunogen" expressed by a vector of the invention or used in
multivalent or "cocktail" compositions or vaccines is understood to
mean a protein, glycoprotein, polypeptide, peptide, epitope or
derivative, e.g. fusion protein, inducing an immune response,
preferably of a protective nature.
As discussed herein, these multivalent compositions or vaccines can
also comprise or consist essentially of a pharmaceutically or
veterinarily acceptable carrier or vehicle or excipient, and
optionally an adjuvant.
The invention also relates to a multivalent immunogenic composition
or a multivalent vaccine comprising at least one in vivo expression
vector in which at least one polynucleotide of the Bluetongue virus
is inserted (and expressed in vivo) and at least a second
expression vector in which a polynucleotide encoding an immunogen
of another pathogenic agent is inserted (and expressed in vivo).
Such multivalent compositions or vaccines also comprise or consist
essentially of a pharmaceutically or veterinarily acceptable
carrier or vehicle or excipient, and optionally an adjuvant.
For antigen(s) or immunogen(s) or epitope(s) to be included in or
expressed by a multivalent immunogenic composition or vaccine (in
addition to BTV antigen(s), immunogen(s) or epitope(s)), including
as to determining or ascertaining epitope(s), the skilled artisan
may consult herein cited documents and documents cited in herein
cited documents, all of which are incorporated by reference into
the instant application.
For ovine multivalent immunogenic compositions and multivalent
vaccines, the additional ovine pathogen(s), as to which additional
ovine antigen(s) or immunogen(s) or epitope(s) thereof are included
in and/or expressed by the multivalent immunogenic compositions and
multivalent vaccines, are advantageously chosen from among the
group including viruses of the ovine herpesvirus type 1 (OHV-1),
ovine herpesvirus type 2 (OHV-2), Border Disease Virus (BDV), Boma
disease virus, Pestes des petit ruminants, Nairobi sheep disease
virus (NSDV), Ecthyrna virus (sheep parapox virus), rabies virus
(rhabdovirus), feline parvovirus (FPV), ovine rotavirus, ovine
pestivirus, ovine adenovirus, Foot and Mouth Disease Virus (FMDV),
Rift Valley Fever virus, and mixtures thereof. Additional antigens
suitable for use in the compositions of the present invention
include antigens derived from bacterial and viral pathogens of
sheep. Preferred bacterial and parasitic antigens include
Cryptosporidium parvum, Chlamydia, Coxiella bumetti, Clostridium
sp., Pasteurella multocida, Pasteurella haemolytica, Salmonella
typhimurium, Brucella, Erysipelothrix rhusiopathiae, Haemonchus
contortis, Ostertagia, Coccidia and Escherichia coli.
For bovine multivalent immunogenic compositions and multivalent
vaccines, the additional equine pathogen(s), as to which additional
equine antigen(s) or immunogen(s) or epitope(s) thereof are
included in and/or expressed by the multivalent immunogenic
compositions and multivalent vaccines, are advantageously chosen
from among the group including: bovine herpesvirus type 1 (BHV-1)
also called infectious bovine rhinotrachitis (IBR), bovine
respiratory syncytial virus (BRSV), mucosal disease virus also
called bovine pestivirus type 1 or type 2 (bovine viral diarrhea
virus or BVDV-1 and BVDV-2), and type 3 parainfluenza virus, for
each valency, one or more of the genes selected from the group
consisting of gB and gD for the bovine herpesvirus, F and G for the
bovine respiratory syncytial virus, E2, C+E1+E2 and E1+E2 for the
mucosal disease virus, and HN and F for the type 3 parainfluenza
virus. Additional antigens suitable for use in the compositions of
the present invention include antigens derived from bacterial and
viral pathogens of cattle. Preferred bacterial antigens include
Clostridial antigens such as Clostridium botulinum C and D,
Clostridium perfringens type A, B, C and D, Clostridium septicum,
Clostridium tetani, Clostridium chauvoei, Clostridium novyi type B,
Clostridium sordellii, Clostridium haemolyticum; Leptospira
antigens, for example, Leptospira interrogans such as Leptospira
hardjo, Leptospira Pomona, Leptospira copenhageni, Leptospira
zanoni, Leptospira tarassovi; Pasteurella antigens such as
Pasteurella multocida and Pasteurella haemolytica; Corynebacterium
antigens such as Corynebacterium pseudotuberculosis,
Corynebacterium renale, Corynebacterium cystitis, Corynebacterium
pilosum and Corynebacterium bovis; and Haemophilus antigens such as
Haemophilus somnus and Haemophilus pleuropneumoniae; Dichelobacter
nodosus pilus; Mycoplasma antigens such as Mycoplasma agalactiae,
Mycoplasma bovis and Mycoplasma ovipneumoniae. Preferred viral
antigens include Bovine Viral Diarrhea (BVD) antigens, Bovine
Rhinotracheitus Virus (IBR) antigens, Parainfluenza-3 antigens,
Respiratory Syncytial Virus (RSV) antigens and Bovine Ephemeral
Fever (BEF) antigens. Thus, the invention comprehends the use of
polynucleotide(s) encoding (an) immunologically active fragment(s)
or (an) epitope(s) of such immunogen(s).
For equine multivalent immunogenic compositions and multivalent
vaccines, the additional equine pathogen(s), as to which additional
equine antigen(s) or immunogen(s) or epitope(s) thereof are
included in and/or expressed by the multivalent immunogenic
compositions and multivalent vaccines, are advantageously chosen
from among the group including viruses of equine influenza (EI),
African Horse Sickness ([AHSV]preferably with a combination of
immunogens VP2 and VP5), equine encephalosis virus ([EEV] also with
a combination of VP2 and VP5), Western Equine Encephalitis Virus
(WEEV), Venezuelan Equine Encephalitis Virus (VEEV) Eastern Equine
Encephalitis Virus (EEEV), West Nile Virus (WNV), Clostridium
tetani (tetanus), and mixtures thereof. Preferably, for AHSV the
immunogens are VP2 and/or VP5, for EIV the immunogen is
advantageously HA, NP and/or N; for viruses of encephalitis, the
immunogen is advantageously C and/or E2; and for Clostridium tetani
the immunogen is all or part of the subunit C of the tetanic toxin.
Thus, the invention comprehends the use of polynucleotide(s)
encoding (an) immunologically active fragment(s) or (an) epitope(s)
of such immunogen(s).
For canine multivalent immunogenic compositions and multivalent
vaccines, the additional canine pathogen(s), as to which additional
canine antigen(s) or immunogen(s) or epitope(s) thereof are
included in and/or expressed by the multivalent immunogenic
compositions and multivalent vaccines, are advantageously chosen
from among the group including viruses of measles disease virus,
canine adenovirus 1 (CAV-1), canine adenovirus 2 (CAV-2), canine
distemper virus (CDV), canine parainfluenza type 2 virus (CPI-2),
canine herpesvirus type 1 (CHV-1), rabies virus (rhabdovirus),
canine parvovirus (CPV), canine coronavirus (CCV), canine
adenovirus, Borrelia burgdorferi, Leptospira and mixtures thereof.
Preferably, for CDV the immunogen is advantageously F and/or HA
(see also U.S. Pat. Nos. 6,309,647, 5,756,102 regarding CDV
immunogens and constructs); for CPV the immunogen is advantageously
VP2; for CCV the immunogen is advantageously S and/or M; for CHV-1
the immunogen is advantageously gB and/or gC and/or gD (see also
U.S. Pat. No. 5,688,920, 5,529,780, regarding CHV immunogens and
constructs); for rabies virus the immunogen is advantageously G
(see also U.S. Pat. No. 5,843,456 regarding rabies combination
compositions); for Borrelia burgdorferi the immunogen is
advantageously OspA (see also U.S. Pat. No. 6,368,603 regarding
OspA combination compositions). The invention thus comprehends the
use of polynucleotide(s) encoding (an) immunologically active
fragment(s) or an epitope(s) of such immunogen(s).
For feline multivalent immunogenic compositions and multivalent
vaccines, the additional feline pathogen(s), as to which additional
feline antigen(s) or immunogen(s) or epitope(s) thereof are
included in and/or expressed by the multivalent immunogenic
compositions and multivalent vaccines, are advantageously chosen
from among the group including viruses of the feline herpesvirus
type 1 (FHV-1), feline calicivirus (FCV), rabies virus
(rhabdovirus), feline parvovirus (FPV), feline infectious
peritonitis virus (FIPV), feline leukemia virus (FeLV), feline
immunodeficiency virus (FIV), Chlamydia and mixtures thereof.
Preferably, for FeLV the immunogen is advantageously A and/or B
and/or gag and/or pol, e.g., gag/pol; for FPV the immunogen is
advantageously VP2; for FIPV the immunogen is advantageously S
and/or M and/or N, e.g., S and M and/or N (see also U.S. Pat. Nos.
6,348,196 and 5,858,373 and immunogens and constructs thereof); for
FHV the immunogen is advantageously gB and/or gC and/or gD, e.g.,
gB and gC and/or gD (see also U.S. Pat. Nos. 5,338,683, 6,183,750;
for herpesvirus immunogens and constructs expressing the same); for
FCV the immunogen is advantageously C; for FIV the immunogen is
advantageously env and/or gag and/or pro, e.g., gag/pro, env, or
env and gag/pro (see also immunogens and constructs discussed in
Tartaglia et al., U.S. application Ser. No. 08/746,668, filed Nov.
14, 1996); for rabies virus the immunogen is advantageously G. The
invention thus comprehends the use of polynucleotide(s) encoding
(an) immunologically active fragment(s) or (an) epitope(s) of said
immunogen(s).
For avian multivalent immunogenic compositions and multivalent
vaccines, the additional avian pathogen(s), as to which additional
avian antigen(s) or immunogen(s) or epitope(s) thereof are included
in and/or expressed by the multivalent immunogenic compositions and
multivalent vaccines, are advantageously chosen from among the
group including viruses of the Marek's disease virus (MDV) (e.g.,
serotypes 1 and 2, preferably 1), Newcastle disease virus (NDV),
Gumboro disease virus or infectious bursal disease virus (IBDV),
infectious bronchitis virus (IBV), infectious anemia virus or
chicken anemia virus (CAV), infectious laryngotracheitis virus
(ILTV), encephalomyelitis virus or avian encephalomyelitis virus
(AEV or avian leukosis virus ALV), virus of hemorrhagic enteritis
of turkeys (HEV), pneumovirosis virus (TRTV), fowl plague virus
(avian influenza), chicken hydropericarditis virus, avian
reoviruses, Escherichia coli, Mycoplasma gallinarum, Mycoplasma
gallisepticum, Haemophilus avium, Pasteurella gallinarum,
Pasteurella multocida gallicida, and mixtures thereof. Preferably,
for MDV the immunogen is advantageously gB and/or gD, e.g., gB and
gD, for NDV the immunogen is advantageously HN and/or F, e.g., HN
and F; for IBDV the immunogen advantageously is VP2; for IBV the
immunogen is advantageously S (more advantageously S1) and/or M
and/or N, e.g., S (or S1) and M and/or N; for CAV the immunogen is
advantageously VP1 and/or VP2; for ILTV the immunogen is
advantageously gB and/or gD; for AEV the immunogen advantageously
is env and/or gag/pro, e.g., env and gag/pro or gag/pro; for HEV
the immunogen is advantageously the 100K protein and/or hexon; for
TRTV the immunogen is advantageously F and/or G, and for fowl
plague the immunogen is advantageously HA and/or N and/or NP, e.g.,
HA and N and/or NP. The invention thus comprehends the use of
polynucleotide(s) encoding (an) immunologically active fragment(s)
or (an) epitope(s) of said immunogen(s).
By way of example, in a multivalent immunogenic composition or a
multivalent vaccine according to the invention, to which one or
more adjuvants has optionally been added (and hence the composition
contains or consists essentially of or consists of one or more
adjuvants) as discussed herein, and which is intended for equine
species, it is possible to incorporate (and hence for the
composition or vaccine to comprise, consist essentially of or
consist of) one or more of the plasmids described in WO98/03198,
advantageously as discussed in examples 8 to 25 thereof, and/or
those described in WO00/77043 and which relate to the equine
species, advantageously those described in examples 6 and 7
thereof. For the canine species, a multivalent composition or
vaccine may contain or consist essentially of or consist of one or
more of the plasmids described in WO98/03199, advantageously as
discussed in examples 8 to 16 thereof, and/or those described in
WO00/77043 and which relate to the canine species, advantageously
those described in examples 2, 3 and 4 thereof; and, such
compositions or vaccines can contain, consist essentially of or
consist of one or more adjuvants. For the feline species, a
multivalent composition or vaccine may contain or consist
essentially of or consist of one or more of the plasmids described
in WO98/03660, advantageously in examples 8 to 19 thereof, and/or
those described in WO00/77043 and which relate to the feline
species, advantageously those described in example 5 thereof; and,
such compositions or vaccines can contain, consist essentially of
or consist of one or more adjuvants. And for the avian species, a
multivalent composition or vaccine may contain or consist
essentially of or consist of one or more of the plasmids described
in WO98/03659, advantageously in examples 7 to 27 thereof; and,
such compositions or vaccines can contain, consist essentially of
or consist of one or more adjuvants.
The immunogenic compositions or vaccines as discussed herein can
also be combined with at least one conventional vaccine (e.g.,
inactivated, live attenuated, or subunit) directed against the same
pathogen or at least one other pathogen of the species to which the
composition or vaccine is directed. The immunogenic compositions or
vaccines discussed herein can be administered prior to or after the
conventional vaccine, e.g., in a "prime-boost" regimen.
The invention further comprehends combined vaccination employing
immunogenic composition(s) and subunit vaccine(s) according to the
invention. Thus, the invention also relates to multivalent
immunogenic compositions and multivalent vaccines comprising one or
more proteins according to the invention and one or more immunogens
(as the term immunogen is discussed herein) of at least one other
pathogenic agent (advantageously from among those herein and in
documents cited and incorporated herein by reference) and/or
another pathogenic agent in inactivated or attenuated form or as a
subunit. In the manner described, these multivalent vaccines or
compositions also contain, consist essentially of or consist of a
pharmaceutically or veterinarily acceptable vehicle or excipient
and optionally one or more adjuvants.
The present invention also relates to methods for the immunization
and vaccination of a target species, e.g., as discussed herein.
The present invention also relates to methods for the immunization
and/or vaccination of a target species, using a prime-boost
regimen. The term of "prime-boost" refers to the successive
administrations of two different vaccine types or immunogenic or
immunological composition types having at least one immunogen in
common. The priming administration (priming) is the administration
of a first vaccine or immunogenic or immunological composition type
and may comprise one, two or more administrations. The boost
administration is the administration of a second vaccine or
immunogenic or immunological composition type and may comprise one,
two or more administrations, and, for instance, may comprise or
consist essentially of annual administrations.
An embodiment of a prime-boost immunization or vaccination against
BTV according to the invention is a prime-boost immunization or
vaccination wherein the animal is first administered a (priming)
DNA vaccine or immunological or immunogenic composition comprising
or consisting essentially of and expressing in vivo at least one
immunogen, antigen or epitope of BTV, and thereafter is
administered (boosted with) a second type of vaccine or immunogenic
or immunological composition containing or consisting essentially
of or expressing at least one immunogen, antigen or epitope that is
common to the priming vaccine or immunogenic or immunological
composition. This second type of vaccine can be an inactivated or
attenuated or subunit vaccine or immunogenic or immunological
composition or a vector, e.g., recombinant or modified virus
vaccine or immunogenic or immunological composition that has in
vivo expression (e.g. poxvirus, herpesvirus, adenovirus).
Poxviruses may be advantageously employed, e.g., attenuated
vaccinia viruses, like MVA or NYVAC, and avipox viruses, like
canarypox viruses and fowlpox viruses.
Advantageously, the DNA vaccine is intended to induce a priming
immune response specific for the expressed immunogen, antigen or
epitope or "DNA induced immune response" (such as a
gamma-interferon+(IFN.sub..gamma.+) T cell memory response specific
for the expressed immunogen, antigen or epitope) which is boostable
(can be boosted) by a subsequent administration (boost) of an
inactivated vaccine or immunological composition or a live
recombinant vaccine comprising or consisting essentially of a viral
vector, such as a live recombinant poxvirus, containing or
consisting essentially of and expressing in vivo at least the same
immunogen(s) or antigen(s) or epitope(s) expressed by the DNA
vaccine. The IFN.sub..gamma.+T cell memory response specific for
the expressed BTV immunogen can be shown in a quantitative
enzyme-linked immune spot (ELISPOT) assay using peripheral blood
mononuclear cells (PBMCs) (Laval, Paillot et al. 2002).
The "boost" may be administered from about 2 weeks to about 6
months after the "priming", such as from about 3 to about 8 weeks
after the priming, and advantageously from about 3 to about 6 weeks
after the priming, and more advantageously, about 4 weeks after the
priming.
For ovine, bovine, or equine, the priming can be done with a DNA
vaccine or immunogenic or immunological composition comprising or
consisting essentially of and expressing in vivo nucleic acid
molecule(s) encoding a BTV immunogen, antigen or epitope according
to the invention and the boost is advantageously done with a
vaccine or immunogenic or immunological composition comprising a
recombinant live viral vector (e.g. poxvirus, herpesvirus,
adenovirus), such as a recombinant fowlpox virus or recombinant
canarypox virus, recombinant, OHV-1 or OHV-2, BHV-1 or BHV-2, EHV-1
or EHV-4, comprising or consisting essentially of nucleic acid
molecule(s) encoding and expressing in vivo at least one of the
same BTV immunogen(s), antigen(s) or epitope(s) as the DNA vaccine
or immunogenic or immunological composition expresses. In another
embodiment these priming and boost vaccines or immunological or
immunogenic compositions can be adjuvanted, for instance, by
DMRIE-DOPE for the priming DNA vaccine or immunological or
immunogenic composition and by Carbopol.RTM. for the boost
recombinant vaccine or immunological or immunogenic
composition.
The priming may be performed on a young sheep, calf, or foal that
can have maternal antibodies against BTV (against which
immunization or vaccination is directed). Advantageously, the DNA
vaccine or immunological or immunogenic composition is administered
to the young animal from birth up to and including about 16 weeks
of age, such as from birth up to and including about 8 weeks of
age, for instance, from birth up to and including about 6 weeks of
age, e.g., from birth up to and including about 4 weeks of age.
For felines, the priming can be done with a DNA vaccine or
immunogenic or immunological composition according to the invention
comprising or consisting essentially of and expressing in vivo,
nucleic acid molecule(s) encoding a BTV immunogen, antigen or
epitope and the boost is advantageously done with a vaccine or
immunogenic or immunological composition comprising or consisting
essentially a recombinant live viral vector (e.g. poxvirus,
herpesvirus, adenovirus, advantageously recombinant fowlpox virus
or recombinant canarypox virus, recombinant FHV, recombinant canine
adenovirus), comprising or consisting essentially of nucleic acid
molecule(s) encoding and expressing in vivo at least one BTV
immunogen, antigen or epitope that is the same as that expressed by
the DNA vaccine do. In another embodiment these priming and boost
vaccines or immunological or immunogenic compositions can be
adjuvanted, for instance, by DMRIE-DOPE for the priming DNA vaccine
or immunological or immunogenic composition and by Carbopole for
the boost recombinant vaccine or immunological or immunogenic
composition.
The priming may be performed on a young kitten that can have
maternal antibodies against BTV (against which immunization or
vaccination is directed). The DNA vaccine or immunological or
immunogenic composition can be administered to the young kitten
from birth up to and including about 12 weeks of age, for instance,
from birth up to and including about 8 weeks of age, advantageously
from birth up to and including about 6 weeks of age, e.g., from
birth up to and including about 4 weeks of age.
For canines, the priming can be done with a DNA vaccine or
immunogenic or immunological composition according to the invention
comprising or consisting essentially of and expressing in vivo
nucleic acid molecule(s) encoding a BTV immunogen, antigen or
epitope and the boost is advantageously done with a vaccine or
immunogenic or immunological composition comprising or consisting
essentially a recombinant live viral vector (e.g. poxvirus,
herpesvirus, adenovirus, advantageously recombinant fowlpox virus
or recombinant canarypox virus, recombinant CHV, recombinant canine
adenovirus), comprising or consisting essentially of nucleic acid
molecule(s) encoding and expressing in vivo at least one BTV
immunogen, antigen or epitope that is the same as that expressed by
the DNA vaccine do. In another embodiment these priming and boost
vaccines or immunological or immunogenic compositions can be
adjuvanted, for instance, by DMRIE-DOPE for the priming DNA vaccine
or immunological or immunogenic composition and by Carbopol.RTM.
for the boost recombinant vaccine or immunological or immunogenic
composition.
The priming may be performed on a young puppy that can have
maternal antibodies against BTV (against which immunization or
vaccination is directed).The DNA vaccine or immunological or
immunogenic composition can be administered to the young puppy from
birth up to and including about 12 weeks of age, for instance, from
birth up to and including about 8 weeks of age, advantageously from
birth up to and including about 6 weeks of age, e.g., from birth up
to and including about 4 weeks of age.
For avians, the priming can be done with a DNA vaccine or
immunogenic or immunological composition according to the invention
comprising or consisting essentially of and expressing in vivo
nucleic acid molecule(s) encoding a BTV immunogen, antigen or
epitope and the boost is advantageously done with a vaccine or
immunogenic or immunological composition comprising or consisting
essentially a recombinant live viral vector (e.g. poxvirus,
herpesvirus, adenovirus, advantageously recombinant fowlpox virus
or recombinant canarypox virus, recombinant HVT, recombinant MDV,
recombinant avian adenovirus), comprising or consisting essentially
of nucleic acid molecule(s) encoding and expressing in vivo at
least one BTV immunogen, antigen or epitope that is the same as
that expressed by the DNA vaccine do. In another embodiment these
priming and boost vaccines or immunological or immunogenic
compositions can be adjuvanted, for instance, by DMRIE-DOPE for the
priming DNA vaccine or immunological or immunogenic composition and
by Carbopol.RTM. for the boost recombinant vaccine or immunological
or immunogenic composition.
In an embodiment, the priming DNA vaccine or immunological or
immunogenic composition comprises or consists essentially of a
plasmid encoding and expressing VP2, VP5, or VP2 and VP5
polypeptides, such as the plasmid pLH2078.15 (FIG. 10) to which has
been incorporated a ubiquitous eukaryotic promoter, i.e., the Human
Cytomegalovirus Immediate Early (CMV-IE) so as to obtain efficient
expression of the VP2 and VP5 proteins, and the boost of the
recombinant vaccine or immunological or immunogenic composition
comprises or consists essentially of a poxvirus such as a canarypox
virus, for instance, the recombinant canarypox virus vCP2289
(Example 9). In another embodiment these priming and boost vaccines
or immunological or immunogenic compositions can be adjuvanted: the
DNA vaccine or immunological or immunogenic composition containing
the plasmid pLH2078.15 (FIG. 10), comprising, but not limited to,
the CMV-IE promoter can be adjuvanted by DMRIE-DOPE, such as
described US patent application 20050255127; and the recombinant
vaccine or immunological or immunogenic composition containing
vCP2289 can be adjuvanted by Carbopol.RTM., such as described in US
patent application 20050255127.
The invention also relates to kits for performing prime-boost
methods comprising or consisting essentially of a priming vaccine
or immunological or immunogenic composition and a boost vaccine or
immunological or immunogenic compositions in separate containers,
optionally with instructions for admixture and/or
administration.
The amounts (doses) administered in the priming and the boost and
the route of administration for the priming and boost can be as
herein discussed, such that from this disclosure and the knowledge
in the art, the prime-boost regimen can be practiced without undue
experimentation. Furthermore, from the disclosure herein and the
knowledge in the art, the skilled artisan can practice the methods,
kits, etc. herein with respect to any of the herein-mentioned
target species.
These methods can comprise, consist essentially of or consist of
the administration of an effective quantity of an immunogenic
composition or vaccine according to the invention. This
administration can be by the parenteral route, e.g. by
subcutaneous, intradermic or intramuscular administration, and/or
by oral and/or nasal routes. Advantageously, this administration is
intramuscularly or subcutaneously. One or more administrations can
take place, such as two administrations.
Vaccines or immunogenic compositions can be injected by a
needleless, liquid jet injector or powder jet injector. For
plasmids it is also possible to use gold particles coated with
plasmid and ejected in such a way as to penetrate the cells of the
skin of the subject to be immunized (Tang, DeVit et al. 1992).
Other documents cited and incorporated herein may be consulted for
administration methods and apparatus of vaccines or immunogenic
compositions of the invention. The needleless injector can also be
for example Biojector 2000 (Bioject Inc., Portland Oreg., USA).
Advantageously, the immunogenic compositions and vaccines according
to the invention comprise or consist essentially of or consist of
an effective quantity to elicit an immunological response such as,
but not limited to, neutralizing antibodies and/or a protective
immunological response of one or more expression vectors and/or
polypeptides as discussed herein; and, an effective quantity can be
determined from this disclosure, including the documents
incorporated herein, and the knowledge in the art, without undue
experimentation. Advantageously, the immunogenic compositions and
vaccines according to the invention comprise or consist essentially
of or consist of an effective quantity of one or more expression
vectors and/or polypeptides as discussed herein a protective
response such as, but not limited to, a reduction or extinction of
the clinical symptoms such as, but not limited to, hyperthermia,
leucopenia, lymphopenia, thrombocytopenia and /or a reduction or
extinction of the viremia.
In the case of immunogenic compositions or vaccines based on a
plasmid vector, a dose can comprise, consist essentially of or
consist of, in general terms, about in 10 .mu.g to about 2000
.mu.g, advantageously about 50 .mu.g to about 1000 .mu.g. The dose
volumes can be between about 0.1 and about 2 ml, preferably between
about 0.2 and about 1 ml.
These doses and dose volumes are suitable for the vaccination of
equines and other target species that are mammals such as ovines,
bovines, canines, felines.
For the vaccination or immunization of an avian, a dose is
advantageously between about 10 .mu.g and about 500 .mu.g and
preferably between about 50 .mu.g and about 200 .mu.g. The dose
volumes can be between about 0.1 and about 1 ml, preferably between
about 0.2 and about 0.5 ml.
One skilled in the art can determine the effective plasmid dose to
be used for each immunization or vaccination protocol and species
from this disclosure and the knowledge in the art.
In the case of immunogenic compositions or vaccines based on a
poxvirus, a dose can be between about 10.sup.2 pfu and about
10.sup.9 pfu.
For ovines, bovines, equines and other target species that are
mammals such as felines and canines, when the vector is a vaccinia
virus, the dose is more advantageously between about 10.sup.4 pfu
and about 10.sup.9 pfu, preferably between about 10.sup.6 pfu and
about 10.sup.8 pfu and when the vector is a canarypox virus, the
dose is more advantageously between about 10.sup.5 pfu and about
10.sup.9 pfu and preferably between about 10.sup.5.5 pfu or about
10.sup.6 pfu and about 10.sup.8 pfu.
For an avian, when the vector is a poxvirus such as a canarypox
virus, the dose is more advantageously between about 10.sup.3 pfu,
and about 10.sup.7 pfu, preferably between about 10.sup.4 pfu and
about 10.sup.6 pfu; and, when the vector is a poxvirus such as a
fowlpox virus, the dose is more advantageously between about
10.sup.2 pfu and about 10.sup.5 pfu, preferably between about
10.sup.3 pfu and about 10.sup.5 pfu. From this disclosure and the
knowledge in the art, the skilled artisan can determine the
suitable dose when the vector is another avipox virus, such as a
dovepox, pigeonpox, etc.
In the case of immunogenic compositions or vaccines for a mammalian
target species, based on a viral vector other than a poxvirus, such
as a herpes viruses or adenovirus, a dose is generally between
about 10.sup.3 pfu and about 10.sup.8 pfu; and, in the case of such
non-poxvirus-viral-vector-based immunogenic compositions for avian
species or avian vaccines, a dose is generally between about
10.sup.3 pfu and about 10.sup.6 pfu. For such
non-poxvirus-viral-vector-based immunogenic or vaccine compositions
for larger target mammal species, e.g., larger cats (e.g., kept in
a zoo) or equines, e.g., in the case of equine immunogenic or
vaccine compositions, a dose is advantageously between about
10.sup.6 pfu and about 10.sup.8 pfu.
The dose volume of immunogenic and vaccine compositions for target
species that are mammals, e.g., the dose volume of equine
immunogenic or vaccine compositions, based on viral vectors, e.g.,
non-poxvirus-viral-vector-based immunogenic or vaccine
compositions, is generally between about 0.5 and about 2.5 ml, such
as between about 0.5 and about 2.0 ml, preferably between about 1.0
and about 2.0 ml, preferably about 1.0 ml. The dose volume of
immunogenic or vaccine compositions for avians based on viral
vectors, e.g., the dose volume of non-poxvirus-viral-vector-based
avian immunogenic or vaccine compositions, is generally between
about 0.1 and about 1.0 ml, preferably between about 0.1 and about
0.5 ml and more advantageously between about 0.2 and about 0.3 ml.
Also in connection with such a vaccine or immunogenic composition,
from the disclosure herein and the knowledge in the art, the
skilled artisan can determine the number of administrations, the
administration route, and the doses to be used for each
immunization or vaccination protocol, without any undue
experimentation. For instance, there can be two administrations to
a sheep, cow or horse, e.g. at 35 day intervals.
In the case of subunit immunogenic compositions or subunit
vaccines, with reference to the amount of active ingredient, e.g.,
subunit (antigen, immunogen, epitope) a dose comprises or consists
essentially of or consists of, in general terms, about 10 .mu.g to
about 2000 .mu.g, advantageously about 50 .mu.g to approximately
1000 .mu.g. The dose volume of such immunogenic or vaccine
compositions for target species that are mammals, e.g., for
equines, is generally between about 1.0 and about 2.0 ml,
preferably between about 0.5 and about 2.0 ml and more
advantageously about 1.0 ml. The dose volumes of such immunogenic
or vaccine compositions avians is generally between about 0.1 and
about 1.0 ml, preferably between about 0.1 and about 0.5 ml, and
more advantageously between 0.2 and 0.3 ml. Also for such a vaccine
or immunogenic composition, the skilled artisan, from this
disclosure and the knowledge in the art, can, without any undue
experimentation, determine the number of administrations, the
administration route and the doses to be used for each immunization
or vaccination protocol.
The invention also relates to the use of an in vivo expression
vector or a preparation of vectors and/or polypeptides according to
the invention, for the formulation of an immunogenic composition or
a vaccine intended to protect a target species, or elicit in the
target species an immunological response, against BTV, and in
certain embodiments, against at least one other pathogenic
agent.
A vaccine based on plasmid or a viral vaccine expressing one or
more proteins of BTV or a BTV subunit vaccine according to the
present invention will not induce in the immunized or vaccinated
animal antibodies against other proteins of the virus, which are
not presented in or by the immunogenic composition or vaccine
(e.g., not present in the immunogenic composition or vaccine and/or
not expressed by the immunogenic composition or vaccine). By this
feature, the instant invention provides differential diagnostic
methods. The present invention makes it possible to make a
distinction between animals infected by the pathogenic field
strains of BTV and animals vaccinated or immunized with vaccines or
compositions according to the invention. In the former, proteins
and/or antibodies directed against them are present and can be
detected by an antigen-antibody reaction. In the latter (the
animals vaccinated or immunized according to the invention), this
is not the case as such animals remain negative in such an
antigen-antibody reaction as to proteins not presented in or by the
immunogenic or vaccine composition or antibodies thereto. In order
to bring about this discrimination, the diagnostic method employs a
protein which is not represented in or by the vaccine or
immunogenic composition (not present and/or not expressed), e.g.
protein VP7, NS1, NS2, or NS3 when it is not represented in the
vaccine or immunogenic composition.
Accordingly, the instant invention comprehends diagnostic assays or
kits that employ a protein or antibody thereto that is not
presented in or by a vaccine or immunogenic composition of the
invention; and, kits that contain such a diagnostic assay or kit
and such a vaccine or immunogenic composition, whereby the user can
inoculate and/or vaccinate animals and thereafter test the animals,
to determine those animals that have been exposed to BTV versus
those animals that have only been immunized and/or vaccinated
against BTV.
Thus, the present invention relates to the use of vectors,
preparations and polypeptides according to the invention for the
preparation of immunogenic compositions and vaccines making it
possible to discriminate between vaccinated or immunized animals
and infected animals.
The instant invention also relates to an immunization and
vaccination method associated with a diagnostic method permitting
such discrimination.
The protein selected for the diagnosis or one of its fragments or
epitopes is used as the antigen in the diagnostic test and/or is
used for producing polyclonal or monoclonal antibodies.
The one skilled in the art has sufficient practical knowledge to
produce these antibodies and to implement antigens and/or
antibodies in conventional diagnostic methods, e.g. ELISA tests,
and thereby perform differential diagnostic tests according to the
instant invention.
The invention will now be further described and illustrated by way
of the following, non-limiting examples.
EXAMPLES
All the constructions are implemented using standard molecular
biology methods (cloning, digestion by restriction enzymes,
synthesis of a complementary single-strand DNA, polymerase chain
reaction, elongation of an oligonucleotide by DNA polymerase, etc.)
described by Sambrook J. et al. (Sambrook and Russell 2001). All
the restriction fragments used for these examples of the present
invention, as well as the various polymerase chain reaction (PCR)
products are isolated and purified using the Qiagen gel extraction
or PCR purification kits
Example 1
Culture of the Bluetongue (BTV) Challenge Virus
BTV serotype 17, a strain that was originally isolated from the
blood of sheep from Tulare County, Calif. (USA) that died of
bluetongue disease was used throughout. The virus was passaged
twice in seronegative cattle prior to isolation in primary bovine
lung microvacular endothelial cells. For amplification, this strain
of BTV serotype 17 (Bonneau, DeMaula et al. 2002; DeMaula,
Leutenegger et al. 2002) was cultured in BHK-21 cells (baby hamster
kidney cells), obtainable from the American Type Culture Collection
(ATCC) under no. CCL-10.
The BHK-21 cells were cultured in Eagle's medium (EMEM)
supplemented with 10% fetal bovine serum (Hyclone Laboratories),
10% tryptose phosphate broth, and 1% penicillin and streptomycin.
The cells were cultured at +37.degree. C. under a 5% CO.sub.2
atmosphere.
The cellular monolayer is confluent within 3 days. The culture
medium is then replaced with fresh EMEM medium supplemented with
10% FBS, and the BTV added at a rate of 5 approximately pfu/cell.
When the cytopathogenic effect (CPE) was complete (generally 48 to
72 hours after the start of culturing), the viral suspensions were
harvested and then clarified by centrifugation and frozen at
-70.degree. C. One or two successive passages were necessary for
producing a viral batch, which is stored at -70.degree. C.
Example 2
Synthesis of Optimized BTV VP2 and VP5
Codon preference among different species can be dramatically
different. To enhance the expression level of a foreign protein,
i.e. BTV VP2 & VP5 using a canarypox expression system (ALVAC)
in an ovine/bovine/equine mammalian cell, it is very important to
adjust the codon frequency of the foreign protein to match that of
the host expression system (Kim, Oh et al. 1997). For codon
optimization, bioinformaticians take many other factors into
consideration, e.g. secondary structure, GC content, repetitive
codons, restriction endonuclease sites, etc., and develop
proprietary algorithms. Geneart GmbH (Regensburg, Germany) has
developed the proprietary GeneOptimizer.TM. software (patent
pending) that implements multi-parameter optimization in one single
operation. Taking into account the most important parameters in
parallel, the software generates a total of up to 500,000 optimized
variants of the target sequence in an evolutionary approach and
selects the one that is best suited. It has been reported that such
optimized genes have up to a 100-fold increase in expression yields
compared to the original gene sequence (Bradel-Tretheway, Zhen et
al. 2003; Disbrow, Sunitha et al. 2003).
The nucleic acid sequence information for BTV-17 VP2 (SEQ ID NO:3)
(de Mattos, de Mattos et al. 1994) and for BTV-17 VP5 (SEQ ID NO:4)
were submitted to Geneart for use as the "native" BTV-17 sequences.
This sequence information was applied to the GeneOptimizer.TM.
software by Geneart, and optimized synthetic sequences for VP2 and
VP5 were derived.
FIG. 1 provides a comparison/alignment of nucleotide sequences
between VP2 native (SEQ ID NO:3) and the optimized (by Geneart) VP2
synthetic (SEQ ID NO:1). FIG. 2 provides a comparison/alignment of
nucleotide sequences between VP5 native (SEQ ID NO:4) and the
optimized VP5 synthetic (SEQ ID NO:2) The optimized sequence for
VP2 and VP5 was used by Geneart as a basis for chemical synthesis
of an array of highly accurate oligonucleotides that taken together
encompass the entire synthetic coding sequence for each of the
genes. The oligonucleotides for each gene are then assembled using
a PCR (polymerase chain reaction) based strategy to yield the
complete synthetic VP2 and VP5 coding sequence.
Example 3
pPCR-Script Cloning of Optimized BTV-17 Synthetic VP2 and Synthetic
VP5
Synthetic VP2. The cloning vector pPCR-Script.RTM. Amp SK(+)
available from Stratagene (San Diego, Calif., USA) was linearized
at its Multiple Cloning Site (MCS) region by cleavage with
Restriction Endonucleases (RE) Sac I and Kpn I. The 2,913
nucleotide linear fully assembled synthetic VP2 coding sequence
containing the 3'end of the H6 promoter immediately upstream of the
ATG start codon was then ligated into the plasmid vector with T4
DNA ligase. The ligated DNA was used to transform competent E. coli
cells. Positive transformants that were Ampicillin resistant (carry
plasmid vector) and that harbored the VP2 synthetic gene sequence
by virtue of their `white` phenotype on XGal indicator plates
(.beta.-galatosidase gene disrupted by insertion of VP2 in MCS of
pPCR-Script.RTM.) were selected for further characterization. One
clone, 043004 pPCR-Script (5,779 bp) was isolated and determined to
be correct by DNA sequence analysis. FIG. 3 illustrates the
preceding cloning strategy. The 043004 clone was used for
subsequent cloning operations.
Synthetic VP5. The cloning vector pPCR-Script.RTM. Amp SK(+)
available from Stratagene (San Diego, Calif., USA) was linearized
in its MCS region by cleavage with REs Sac I and Kpn I The 1,638
nucleotide linear fully assembled synthetic VP5 coding sequence was
then ligated to the plasmid vector with T4 DNA ligase. The ligated
DNA was used to transform ultracompetent E. coli cells. Positive
transformants that were Ampicillin resistant (carry plasmid vector)
and that harbored the VP5 synthetic gene sequence by virtue of
their `white` phenotype on XGal indicator plates
(.beta.-galatosidase gene disrupted by insertion of VP2 in MCS of
pPCR-Script.RTM.) were selected for further characterization. One
clone, 043005 pPCR-Script (4,492 bp) was isolated and determined to
be correct by DNA sequence analysis. FIG. 8 illustrates the
preceding cloning strategy. This clone was used in subsequent
cloning strategies.
Example 4
pNVQH6C5LSP-18 ALVAC Donor Plasmid
Construction of the ALVAC donor plasmid pNVQH6C5LSP-18 is described
(US patent application 20050255127). A 5 kb locus of canarypox DNA,
encoding an ORF designated C5 initiating at position 1864 and
terminating at position 2187 of the viral genome was identified.
The following describes a C5 insertion plasmid constructed by
deleting the majority of the C5 ORF and replacing it with, the H6
promoter, a multiple cloning site (MCS) and transcriptional and
translational termination sequences in all reading frames. A 1590
bp PCR fragment, containing the upstream C5R arm is amplified from
genomic canarypox DNA using primers C5A1 and C5B1
TABLE-US-00004 (SEQ ID NO: 5) C5A: 5'
GGCCGAATTCTGAATGTTAAATGTTATACTTT 3' (SEQ ID NO: 6): C5B1: 5'
CCCGGGATCGATGGATCCTTTTTATAGCTAATTAGTCACGTACCTTT GAGAGTACCACTTCAGCTA
3'
The amplified fragment includes an EcoR I site at the 5'-end,
termination sequences and an MCS containing BamH I, Cla I and Xma I
sites at the 3'-end.
A 458 bp PCR fragment, containing the downstream C5L arm is
amplified from genomic canarypox DNA using primers C5C1 and
C5D1:
TABLE-US-00005 (SEQ ID NO: 7) C5C1: 5'
GGATCCATCGATCCCGGGTTTTTATGACTAGTTAATCACGGCCGCTT ATAAAGATCTAAAATGCAT
3' (SEQ ID NO: 8) C5D1 5' GGCTGCAGGTATTCTAAACTAGGAATAGAT 3'
The amplified fragment includes 5' BamH I, Cla I and Xma I
restriction endonuclease sites, termination sequences and a Pst I
site at the 3'-end.
The foregoing PCR fragments were fused together by re-amplifying
with primers C5A and C5D (above), generating a 2,030 bp EcoR I-Pst
I fragment that is cloned into the pUC 8 plasmid vector, generating
pUC/C5L/B Cia Xm/C5R. The following oligonucleotides were used to
introduce a unique Not I sequence at the 5'-end of the C5R arm, by
oligoinsertion into the EcoR I site, generating pUC/Not
I/C5R/MCS/C5L:
Oligonucleotide for introduction of Not I 5' AATTGCGGCCGC 3' (SEQ
ID NO: 18)
The vaccinia H6 promoter is contained on plasmid pBSH6-1
A 176 bp fragment (H6 fragment) containing the H6 promoter and
recognition sequences for a multiple cloning site containing Asp718
I, Xho I, Xba I, Cla I and Sma I, was amplified using primers H6A1
and H6B1:
TABLE-US-00006 (SEQ ID NO: 9) H6A1: 5'
TCGTTAATTAATTAGAGCTTCTTTAT-TCTATACTTAAAAAG 3' (SEQ ID NO: 10) H6B1:
5' AAAACCCGGGATCGATTCTAGACTCGAGGGTACCTACGATACAAACT TAACGGATA 3'
The fragments encoding H6 (above) were pooled and re-amplified
using and H6B1 to generate a 232 bp H6p/MCS fragment that was
inserted into pUC/C5L/B Cla Xm/C5R between the BamH I and Xma I
sites. FIG. 4 shows the resultant plasmid, pNH6C5LSP-18, a C5
insertion plasmid containing the H6 promoter, transcription and
translation terminators functional in all reading frames, and a
MCS.
Example 5
pCXL148.2 ALVAC Donor Plasmid Construction
Nucleotide sequence analysis of the pNVQH6C5LSP-18 donor plasmid
indicated that there is a single base mutation in the C5R region of
the ALVAC donor plasmid pNVQH6C5LSP-18 (described in US application
20050255127) relative to that of the ALVAC viral vector (sequence
not provided). Consequently, pCXL 148 was created as follows to
modify the donor plasmid sequence in order to obtain an exact match
to that of the cloned (plaque purified) ALVAC, so that any sequence
discrepancies that might arise during creation of
recombinant-derived Bluetongue ALVAC virus constructs are
minimized. FIG. 5 illustrates the construction strategy.
The plasmid pNVQH6C5LSP-18 (US application 20050255127) was
digested with restriction endonucleases SnaBI+BsrGI to generate a
3,923 bp fragment and a 962 bp fragment. The RE digests were
resolved by agarose gel electrophoresis, and the 3,923 bp fragment
was excised from the gel. The fragment DNA was purified using the
QIAquick gel extraction kit (Qiagen Inc., USA; Cat. #28704) as
described by the manufacturer.
Next, ALVAC genomic DNA was used as the template for PCR reaction
with primer set 7634CXL and 7521CXL (see below) to generate a 1.89
kb PCR fragment that spans the C5R region of the virus.
TABLE-US-00007 (SEQ ID NO: 11) 7521CXL (forward): 5'
TTATTTAGAAATTATGCATTTTAGA (SEQ ID NO: 12) 7634CXL (reverse): 5'
GTTCTCGTAGGAGAGAACTATTGAC
The 1.89 kb PCR amplified fragment was digested with SnaBI+BsrGI to
generate three fragments: 361 bp, 569 bp and 962 bp. This RE digest
was displayed by agarose gel electrophoresis, and the 962 bp
fragment was excised from the gel and the DNA was purified using
the QIAquick gel extraction kit (Qiagen Inc., USA; Cat. #28704) as
described by the manufacturer.
Reconstruction of the ALVAC donor plasmid pNVQH6C5LSP-18 in which
the mutated "T" nucleotide in the C5R encoding region of the donor
plasmid is replaced with the corresponding ALVAC wild-type
nucleotide "C" is accomplished by combining RE fragments to create
pCXL148.2 as follows: a. The purified 3,923 bp fragment from RE
(SnaBI+BsrGI) digestion of pNVQH6C5LSP-18 is directionally ligated
with T4 DNA ligase to the 962 bp SnaBI+BsrGI fragment derived from
the PCR amplified C5R region of ALVAC. b. Ligation reactions were
used to transform competent E. coli cells, and the transformation
reactions were grown under Ampicillin selection. Transformants were
selected, and their plasmid DNA was characterized by RE digests.
The nucleotide sequence of one candidate clone pCXL148.2 was found
to have the correct "C" nucleotide in the C5R region. The new C5
donor plasmid pCXL148.2 has an exact homology with the
corresponding sequences in the ALVAC viral vector. Nucleic acid
sequence of the pCXL148.2 donor plasmid in provided in FIG. 6 (SEQ
ID NO:13)
Example 6
Construction of pC5 H6pVP2
The plasmid VP2 BTV 17 (043004, FIG. 3) was RE digested with EcoR
V+Xho I to generate a unique 2,913 bp fragment comprising: a 5'
EcoR V site followed by the full-length synthetic codon optimized
BTV-VP2 followed by a 3' Xho I site. This RE digest was displayed
by agarose gel electrophoresis, and the 2,913 bp fragment was
excised from the gel and the DNA was purified using the QIAquick
gel extraction kit (Qiagen Inc., USA; Cat. #28704) as described by
the manufacturer.
pCXL148.2 (pC5 donor plasmid, see FIG. 5) was digested with EcoR V
and Xho I to generate a linearized 4879 bp homology vector
containing the C5 right arm, H6 promoter and C5 left arm.
The purified 2,913 bp fragment from RE (Eco RV+Xho I) digestion of
043004p VP2 BTV 17 is directionally ligated with T4 DNA ligase to
the 4879 bp Eco RV+Xho I digested and linearized pCXL-148.2 donor
ALVAC plasmid. The ligation reactions were used to transform
competent E. coli cells, and the transformation reactions were
grown under Ampicillin selection. Transformants were selected,
grown, and their plasmid DNA was characterized by RE digests.
Clones with the correct RE maps were probed on Southern blots with
VP2-specific nucleic acid oligonucleotides. One positive clone,
pALVAC C5H6p-syntheticBTV VP2, was selected for subsequent cloning
manipulation. The foregoing cloning strategy is provided in FIG.
7.
Example 7
PCR Amplification of VP5 Incorporating the 42K Promoter
The Entomopoxvirus Amsacta moorei 42K promoter (Barcena, Lorenzo et
al. 2000) was selected to regulate expression of the optimized
synthetic VP5 gene. The nucleic acid sequence of the 42K promoter
(see below: promoter sequence is Italicized and Underlined) was
placed adjacent to the 5' ATG start codon of the synthetic VP5 gene
using a PCR-based strategy in which the 42K promoter was embedded
in the 5' end of a forward synthetic primer. Using this primer in
conjunction with a reverse primer allows amplification directly
from the plasmid VP5 BTV 17 (043005), which serves as the template
(see FIG. 8). The pair of primers 13247.JY/13248.JY (below, and
FIG. 21) were used in a PCR reaction to amplify a DNA fragment
comprising 42Kp -VP5 expression cassette flanked by Xho I
sites.
Primers for amplification of 42Kp-BTV VP5 expressing cassette:
TABLE-US-00008 (SEQ ID NO: 14) 13247.JY forward: 5'
GCGCTCGAGTTTTTATTCAAAATTGAAAATATATAATTACAATATAAAA
TGGGCAAGATCATCAAGAGCCTG (SEQ ID NO: 15) 13247.JY reverse: 5'
ATCTCGAGATAAAAATCATCAGGCGTTCCTCAGGAACAGGGGCACGTC
A reverse transcriptase polymerase chain reaction (PCR reaction)
was carried out with the forgoing primers, and the resulting PCR
product was cloned into the Xhol site of the pCR.RTM. 2.1-TOPO
cloning vector according to the manufacturers' instructions
(Invitrogen Corp., Carlsbad, Calif., USA) to create pLH2033.1
(pCR2.1 42Kp synthetic BTV-VP5). This construct was confirmed to
contain the correct sequence. This cloning strategy is illustrated
in FIG. 9. The pLH2033.1 clone was expanded to amplify plasmid
yields as needed in subsequent cloning activities.
Example 8
Construction Donor Homology Vector pLH2078.15 (pC5H6VP242KpVP5)
pLH2033.1 harboring the 42Kp-synthetic BTV VP5 sequence was cleaved
with Xho I which releases a 1,647 bp fragment that encodes BTV VP5.
This Xho I digest was displayed by agarose gel electrophoresis, and
the 1,647 bp VP2 fragment was excised from the gel and the DNA was
purified using the QIAquick gel extraction kit (Qiagen Inc., USA;
Cat. #28704) as described by the manufacturer.
pLH2030.2 (pALVAC C5H6p-syntheticBTV VP2 the pC5 donor plasmid, see
FIG. 7) was digested with Xho I to generate a linearized 7,744 bp
homology vector containing the C5 right arm, H6 promoter, synthetic
BTV VP2, and the C5 left arm.
The purified 1,647 bp fragment from Xho I digestion of pLH2033.1 is
ligated with T4 DNA ligase to the 7,744 bp Xho I linearized
pLH2030.2 donor ALVAC plasmid. The ligation reactions were used to
transform competent E. coli cells, and the transformation reactions
were grown under Ampicillin selection. Transformants were selected,
grown, and their plasmid DNA was characterized by RE digests.
Because the ligation described is non-directional, an elemental
component of clone selection entails proper orientation of the
42Kp-synthetic VP5 insert relative to that of H6pVP2 in the donor
plasmid, in this embodiment the preferred orientation is
head-to-tail, e.g. VP2 and VP5 are transcribed and translated in
the same 5' to 3' direction on the plasmid. Clones with the correct
RE pattern were selected for further characterization. One positive
clone, pLH2978.15 was selected and sequenced. The described cloning
strategy for construction of the final ALVAC-BTV donor plasmid is
provided in FIG. 10. The annotated nucleotide sequence of
pLH2978.15 is provided in FIG. 11.
Example 9
Generation and Characterization of ALVAC BTV (vCP2289)
To generate ALVAC-based BTV recombinants, primary chick embryo
fibroblast cells (CEFs) were transfected with 15 .mu.g of Not
I-linearized pLH2078.15 donor plasmid DNA (pC5 H6p-BTV VP2-42Kp-BTV
VP5) mixed with FuGENE-6 transfection reagent (Roche). The
transfected cells were subsequently infected with ALVAC
(6.3.times.10.sup.9 pfu/ml HM1372) as the rescue virus at a MOI of
10. After 24 hours, the transfected-infected cells were harvested,
sonicated and used for plaque purification and recombinant virus
screening. 24-48 hours after plating on fresh CEFs, recombinant
plaques were transferred onto nylon membrane and hybridized with a
BTV-specific DNA probe that was labelled with horseradish
peroxidase according to the manufacturer's protocol (Amersham Cat#
RPM3001). Following 4 sequential rounds of plaque purification,
single plaques were amplified to produce stocks designated as
vCP2289.1.2.1.1 and vCP2289.1.1.1. Recombinant viruses were
confirmed by hybridization as 100% positive for the BTV insert and
100% negative for the empty C5 site.
Single plaques were selected from the final round of plaque
purification, and expanded to obtain P1 (T-25 flask), P2 (T-75
flask) and P3 (roller bottle) stocks to amplify vCP2289.1.2.1.1 and
vCP2289.2.1.1.1. The recombinants were re-confirmed at the P2 level
by hybridization and found to be 100% positive for the insert and
100% negative for the empty C5 site. The infected cell culture
fluid from the roller bottles was harvested and concentrated to
produce the virus stocks (1.8 ml of vCP2289.1.2.1.1 at
1.25.times.10.sup.10 pfu/ml, and 1.9 ml of vCP2289.2.1.1.1 at
10.times.10.sup.10 pfu/ml. FIG. 12 presents a flow diagram for the
construction of the recombinant ALVAC+BTV VP2 and VP5
(vCP2289).
Example 10
Characterization of ALVAC BTV (vCP2289)
1. Confirmation of Genetic Purity. P3 stocks were re-confirmed by
hybridization, as 100% positive for the BTV insert and 100%
negative for the empty C5 site.
2. Genomic Analysis. a. Restriction map: i. A theoretical
restriction endonuclease (RE) gel electrophoresis fragment analysis
for the genomic DNA was created in Vector NTI (Invitrogen, USA) and
is shown in FIG. 13. ii. The genomic DNA was extracted from
vCP2289.1.2.1.1 and vCP2289.2.1.1.1, digested with BamH I, Hind III
or Pst I, and separated by 0.8% agarose gel electrophoresis. The
results revealed the correct insertion of the foreign gene sequence
(see FIG. 14). b. Southern Blot: The genomic DNA digested with BamH
I, Hind III, or Pst I was transferred to nylon membrane and
Southern blot analysis was performed by probing with the BTV probe.
BTV-specific 9508 bp BamH I, 14974 bp Hind III and 2901 bp Pst I
bands were observed at the expected sizes. The results indicated
the correct insertion of the BTV insert into the C5 locus. FIG. 15
provides the results of the Southern Blot.
3. Expression Analysis: a. Western blot. 1.degree. CEF cells were
infected with the P3 stocks of vCP2289.1.2.1.1 and vCP2289.2.1.1.1
at an MOI of 10 and incubated at 37.degree. C. for 24 hrs. The
cells and culture supernatant were then harvested. Sample proteins
were separated on a 10% SDS-PAGE gel, electroblot transferred to
Immobilon nylon membrane, and probed with the rabbit anti-BTV 17
VP5 affinity purified IgG (University of California, Davis, USA) at
a dilution of 1:2000. Peroxidase conjugated goat anti-rabbit
antiserum was used as a secondary antibody and the bands were
visualized using Amersham detection reagents. Two protein bands
between 47 KDa and 60 KDa were detected in the cell pellets of
vCP2289.1.2.1.1 and vCP2289.2.1.1.1, indicating expression of the
BTV-17 VP5 protein (see FIG. 16). The expressed BTV-17 VP5 protein
was not secreted into the cell culture media. b.
Immunofluorescence. Using a mixture of four mouse anti-BTV-17 VP2
antibodies (ABX IgG 17.81 .alpha.-BTV 17; PA IgG17.815 .alpha.-BTV
17; PA IgG 17.85 .alpha.-BTV 17; PA IgG 17.813 .alpha.-BTV-17, from
University of California, Davis, USA), western blots and
immunoplaque assays for VP2 expression were negative probably due
to conformational sensitivities of the reagents and the
`denaturing-like` environments imposed by transfer and
hybridization. Consequently, 1.degree. CEF cells were infected with
P3 stocks of vCP2289.1.2.1.1 and vCP2289.2.1.1.1 at a MOI of 0.1
and incubated at 37.degree. C. for 24 hrs. The cells were then
fixed with 3% paraformaldehyde and permeabilized with 0.5% Triton
X-100. The mixture of four mouse anti-BTV 17 VP2 antibodies (ABX
IgG 17.81 anti-BTV 17, PA IgG17.815 anti-BTV 17, PA IgG 17.85
anti-BTV 17, PA IgG 17.813 anti-BTV-17, from University of
California, USA) was used as the primary antibody at 1:100 dilution
and a FITC conjugated goat anti-mouse antibody was used as a
secondary antibody. Strong green fluorescent cells were visualized
under the Nikon Eclipse TE300 fluorescence microscope, indicating
the expression of BTV VP2 protein (data not shown).
4. Sequence Analysis: A more detailed analysis of the P3 stock
genomic DNA was performed by PCR amplification and sequence
analysis of the flanking arms of the C5 locus and the BTV insert.
Primers 7931.DC and 7932.DC located beyond the arms of the C5
locus, were used to amplify the entire C5R-BTV insert-C5L
fragment.
Primers for PCR amplification of the vCP2289 C5 arms plus
insert:
TABLE-US-00009 (SEQ ID NO: 16) 7931.DC: 5'
GAATCTGTTAGTTAGTTACTTGGAT (SEQ ID NO: 17) 7932.DC: 5'
TGATTATAGCTATTATCACAGACTC
The results showed that the sequences of the BTV insert and the C5
left and right arms around the BTV insert in vCP2289.1.2.1.1 and
vCP2289.2.1.1.1 were correct.
Example 11
Production of Recombinant Vaccines
For the preparation of ovine, bovine or equine vaccines, the
recombinant canarypox vCP2289 virus (Example 9) will be adjuvanted
with carbomer solutions, namely Carbopol.TM. 974P manufactured by
BF Goodrich, Ohio, USA (molecular weight about 3,000,000).
A 1.5% Carbopol.TM. 974P stock solution was initially prepared in
distilled water containing 1 g/l of sodium chloride. This stock
solution was then used for the preparation of a 4 mg/ml
Carbopol.TM. 974P solution in physiological salt solution. The
stock solution was mixed with the adequate volume of the
physiological salt solution, either in a single stage or in several
successive stages, the pH value being adjusted in each stage with a
1N sodium hydroxide solution (or even more concentrated) in order
to obtain a final pH value of 7.3 to 7.4.
The ready-to-use Carbopol.TM. 974P solution obtained in this way
was used for taking up recombinant, lyophilized viruses or for
diluting concentrated, recombinant virus stock solutions. For
example, to obtain a viral suspension containing 10.sup.8 pfu/1 ml
dose, a viral stock solution was diluted so as to obtain a titer of
10.sup.8.3 pfu/ml, followed by dilution in equal parts with said
ready-to-use 4 mg/ml Carbopol.TM. 974P solution.
Example 12
Production of DNA Vaccines for Ovines, Bovines, or Equines
For DNA immunization, plasmids will be constructed in which the
codon optimized BTV VP2 nucleotide sequence (Drawing 1, SEQ ID: 1)
is located on one plasmid, and BTV VP5 (SEQ ID: 2) nucleotide
sequences are on a separate plasmid. Expression of the BTV
sequences from each plasmid can be driven by, but is not limited
to, CMV-IE promoter (human CMV or murine CMV)). Poly Adenine
(polyA) sequence signal (either from the bovine growth hormone gene
or rabbit beta globin gene, but not limited to) will be
incorporated at the 3' end of the BTV coding sequence in each
plasmid.
It may be desirable to express BTV VP2 and VP5 from the same
plasmid to ensure co-expression of BTV proteins in the same cell.
In this case, a plasmid similar to pLH2078.15 (Example 8, Drawing
10) will be constructed in which the poxvirus promoters have been
replaced with, but not limited to, ubiquitous eukaryotic promoters
such as the human CMV-IE promoter. Expression of BTV VP2 and VP5
will necessarily be controlled by different promoters. PolyA signal
sequences will be included at the 3' end of each BTV nucleotide
sequence.
A DNA solution containing the plasmid(s) described above will be
concentrated by ethanol precipitation in the manner described by
Sambrook et al (1989). The DNA pellet will be taken up by a 0.9%
NaCl solution so as to obtain a concentration of 1 mg/ml. A 0.75 mM
DMRIE-DOPE solution will be prepared by taking up a DMRIE-DOPE
lyophilizate by a suitable sterile H.sub.2O volume.
The formation of plasmid-lipid DNA complexes will be accomplished
by diluting in equal parts the 0.75 mM DMRIE-DOPE solution (1:1)
with the 1 mg/ml DNA solution in 0.9% NaCl. The DNA solution will
be progressively introduced with the aid of a 26G crimped needle
along the wall of the flask containing the cationic lipid solution
so as to prevent the formation of foam. Gentle stirring will take
place as soon as the two solutions are mixed. Finally a composition
comprising 0.375 mM of DMRIE-DOPE and 500 .mu.g/ml plasmid will be
obtained.
It is desirable for all the solutions used to be at ambient
temperature for all the operations described herein. DNA/DMRIE-DOPE
complexing will take place at ambient temperature for 30 minutes
before immunizing the animals.
Example 13
Vaccination of Sheep with Recombinant Canarypox Viruses
Eleven polled Dorset lambs (9 males, 2 females) were purchased from
a supplier in northwestern CA, a region free of BTV infection. The
animals were housed in insect secure isolation facilities
throughout the described studies, and prior to vaccination they
were all confirmed to be free of antibodies to BTV by competitive
ELISA. At approximately 13 months of age (Nov. 22, 2005), 6 lambs
were each inoculated SQ/IM with approximately 1 ml of BTV-CP
diluted in PBS (0.2 ml undiluted [10.sup.9.5 TCID.sub.50/ml]
vCP2289/sheep=.about.6.3.times.10.sup.8 viral particles) and 5 were
vaccinated with recombinant canary pox expressing the preM and E
proteins of West Nile virus vCP/WNV; Recombitek) that was
reconstituted and administered according to the manufacturer's
instructions. All sheep were revaccinated 22 days later (Dec. 14,
2005) with the respective vaccine construct at the same dose as the
primary immunization. The animals were co-housed regardless of
vaccine type.
Example 14
Titrating Anti-BTV Neutralizing Antibodies
Dilution series were produced for each serum at a rate of 3 in DMEM
medium to which was added 10% fetal calf serum in 96 well plates of
the cellular culture type. To 0.05 ml of diluted serum was added
0.05 ml of culture medium containing approximately 100
CCIP.sub.50/ml of BTV. This mixture was incubated for 2 hours at
37.degree. C. in an oven in an atmosphere containing 5% CO2.
0.15 ml of a suspension of BHK-21 cells containing approximately
100,000 cells/ml was then added to each mixture. The cytopathic
effect (CPE) was observed by phase contrast microscopy after 4 to 5
days culturing at 37.degree. C. in an atmosphere containing 5%
CO.sub.2. The neutralizing titers of each serum were calculated
using the Karber method. The titers were given in the form of the
largest dilution inhibiting the cytopathic effect for 50% of the
wells. The titers were expressed in log10 VN.sub.50. Each serum was
titrated at least twice and preferably four times.
Example 15
BTV Infection of Sheep and Sample Collection
All 11 lambs were challenged by subcutaneous inoculation of
10.sup.5.5 TCID.sub.50 of BTV-17 at 34 days after the second
vaccination. The animals were evaluated daily for 3 weeks after
inoculation for manifestations of bluetongue. Blood for hematology
(collected in EDTA) was collected prior to inoculation and at 3, 6,
9, 13 and 16 days post-inoculation (DPI) for complete blood counts
(CBC). Blood samples (acid citrate dextrose) were collected at 0,
1, 3, 5, 7, 9, 11, 14 and 21 DPI for virus isolation. Serum was
collected ("Tiger Top", serum separator) from all sheep at weekly
intervals immediately prior to vaccination. The sheep were all
humanely euthanized at 25 days after challenge exposure to BTV.
Example 16
BTV Virus Isolation
Virus isolation was from whole sheep blood as previously described
(Bonneau, Mullens et al. 2001; Bonneau, DeMaula et al. 2002;
DeMaula, Leutenegger et al. 2002). Briefly, Vacutainer tubes were
centrifuged at 2,500 G for 10 minutes at 4 degrees C. Serum was
decanted and discarded. Red/white blood cells were washed 1.times.
with 5 ml of sterile PBS (1.times.), re-centrifuged and the cell
pellet was resuspended in an equal volume of sterile
double-distilled water (ddH.sub.2O). The washed/lysed blood cells
were sonicated for 1-2 min. prior to dilution (10.sup.-1 through
10.sup.-4) in EMEM and inoculation (0.25 ml/well) onto confluent
BHK-21 monolayers in 24 well plates. The cultures were incubated
for 1 hr. at 37 C, when maintenance media was added. The cultures
were examined daily for 10 days and virus titers determined by the
method of Reed and Munch.
Example 17
Immunogenicity of the BTV-vCP2289 Recombinant ALVAC in Sheep
All sheep were seronegative to BTV by both competitive ELISA and
BTV-17 microneutralization assays prior to vaccination (data not
shown). The sheep vaccinated with the vCP/BTV expression vector
developed neutralizing antibodies to BTV-17, whereas those
immunized with the vCP/WNV did not (see table 3, below). All sheep
remained healthy and showed no adverse effects after
vaccination.
TABLE-US-00010 TABLE 3 Titers of BTV 17 neutralizing antibodies
Weeks Post Vaccination -1 2 4 6 Vaccinate: 353 .ltoreq.10
.ltoreq.10 80 40 355 .ltoreq.10 .ltoreq.10 80 40 359 .ltoreq.10 10
160 80 361 .ltoreq.10 .ltoreq.10 160 80 363 .ltoreq.10 10 80 160
364 .ltoreq.10 10 80 160 Controls: 354 .ltoreq.10 .ltoreq.10
.ltoreq.10 .ltoreq.10 356 .ltoreq.10 .ltoreq.10 .ltoreq.10
.ltoreq.10 357 .ltoreq.10 .ltoreq.10 .ltoreq.10 .ltoreq.10 358
.ltoreq.10 .ltoreq.10 .ltoreq.10 .ltoreq.10 362 .ltoreq.10
.ltoreq.10 .ltoreq.10 .ltoreq.10
Example 18
Protection of Sheep Immunized with BTV-CP After Challenge
The ability of vCP/BTV to protectively immunize sheep was evaluated
by comparing titers of BTV-17 in the blood of vCP/BTV vCP2289 and
vCP/WNV immunized sheep after challenge exposure to BTV-17.
Table 4. Titers of bluetongue virus in the blood of sheep
challenged with the virus following immunization with recombinant
canary pox viruses expressing coat proteins of either bluetongue
virus (vCP/BTV) or West Nile virus (vCPIWNV)
TABLE-US-00011 TABLE 4 titers of bluetongue virus in the blood of
sheep challenged with BTV-17 after immunization with recombinant
canarypox viruses expressing coat proteins of either bluetongue
virus (BTV-CP) or West Nile Virus (WNV-CP) Virus Titer log.sup.10
TCID.sub.50 per Treatment/ ml of blood (days post inoculation)
Sheep ID 1 3 5 7 9 11 14 21 Vaccinated: 353 --* -- -- -- -- -- --
-- 355 -- -- -- -- -- -- -- -- 359 -- -- -- -- -- -- -- -- 361 --
-- -- -- -- -- -- -- 363 -- -- -- -- -- -- -- -- 364 -- -- -- -- --
-- -- -- Controls: 354 -- 10.sup.4.1 10.sup.4.1 10.sup.3.6
10.sup.3.1 10.sup.3.1 10.sup.2.1 1- 0.sup.1.6 356 -- 10.sup.2.1
10.sup.3.1 10.sup.3.1 10.sup.3.1 10.sup.1.6 -- -- 357 -- --
10.sup.3.6 10.sup.3.1 10.sup.2.1 10.sup.2.1 -- -- 358 -- 10.sup.2.1
10.sup.2.6 10.sup.3.6 10.sup.3.1 10.sup.1.6 -- 10.sup.2.- 1 362 --
10.sup.3.6 10.sup.4.1 10.sup.3.1 -- -- -- -- *indicates virus was
not isolated from 50 ul of washed and lysed blood cells
Results (Table 4, above) show that control sheep (WNV-CP) are
actively infected with the BTV challenge virus at 3 days post
challenge. The controls continue to exhibit viremia as long as 21
days post challenge at which point the experiment was
terminated.
Sheep that were immunized with the BTV-CP vaccine exhibited
exquisite protection from viremia after experimental challenge
infection as no BTV was detectable in the blood in the blood of
vaccinated sheep for the 21 day duration of the study. All six
BTV-CP immunized sheep were completely resistant to virulent
challenge indicating the effectiveness of the vaccine.
Example 19
Clinical Responses of BTV Infected Sheep
Comparison of the clinical response of sheep vaccinated with BTV-CP
(vaccinates) and WNV-CP (controls) after challenge with BTV-17 is
provided in the following: 1. Body temperature (BT). For 14 days
post challenge, body temperature was monitored on a daily basis for
all 6 BTC-CP vaccinates and for all 5 control (WNV-CP immunized)
sheep. The temperature data from the challenged sheep are shown
below in Table 3 and in Drawing 17. The data show an -1.degree. C.
rise in mean BT day 3 post challenge in the controls, with no
change in the mean BT in the BTV-CP vaccinates. At day 6, a
4.degree. C. temperature spike (105.degree. C.) in the control
animals was observed. This is a typical response for a viremic
BTV-infected animal. The BTV-CP immunized animals exhibit normal
temperatures that do not significantly deviate from pre-challenge
animals. These results confirm vaccine (BTV-CP) efficacy.
TABLE-US-00012 TABLE 5 BTV 17 Challenge Temperature Data BTV
Vaccinated Day Day Sheep # Day 2 Day 3 Day 4 Day 5 Day 6 7 Day 8
Day 9 Day 10 11 Day 12 Day 13 Day 14 353 102.6 102.2 102.6 101.8
102.6 102.6 100.8 101.1 102 102 102.2 101.6 10- 1.6 355 102.2 102
102.1 101.6 102.4 102.2 101.4 102.2 102.4 102.2 102.8 102.8 - 102.2
359 102.4 102.7 101.8 101.8 102 101.8 101.2 103 101.6 102.4 102.4
102 101.- 8 361 101.2 102.8 101.8 101.2 102.6 100.6 102 102 102.4
102.4 102.4 102 101.- 8 363 102.6 102.9 102 101.2 102.2 102 102
102.8 102.6 102.4 102.6 101.8 101.- 8 364 102 102.6 102.4 101.8
102.8 101.6 102 102 102.6 102.4 102.6 104 101.9 Mean: 102.1667
102.5333 102.1167 101.5667 102.4333 101.8 101.5667 102.1833-
102.2667 102.3 102.5 102.3667 101.85 WNV Controls Sheep # Day 2 Day
3 Day 4 Day 5 Day 6 Day 7 Day 8 Day 9 Day 10 Day 11 Day 12 Day 13
Day 14 354 101.4 103.6 103.2 103.6 104.6 104.6 104 100.8 101 101.2
101.6 102 101.- 8 356 102.2 103.5 103.2 101.6 106.6 102.4 103 103.8
102 101.8 102 102.4 101.- 6 357 102.2 103 102.5 101.6 106.6 104.4
104.4 105.8 103 102 102.2 101.9 101.- 6 358 103.9 103.3 103.4 105.1
106.2 104.2 102.2 103.4 103.2 103 102.6 102.4 - 102.6 362 102.8 103
103.4 104 106.2 105 103.6 101.8 102.4 102.8 102.4 103 102.2 Mean:
102.5 103.28 103.14 103.18 106.04 104.12 103.44 103.12 102.32
102.16- 102.16 102.34 101.96
2. White blood cell count. For 16 days post challenge, white blood
cell (WBC) counts were monitored on day 0 and at approximately 3
day intervals through day 16 for all 6 BTC-CP vaccinates and for
all 5 control (WNV-CP immunized) sheep. The WBC data from the
challenged sheep are shown below in Table 6 and in Drawing 18. The
data show an initial slight decrease in meanWBC through day 8
post-challenge with a continual rise in meanWBC at day 9-16 post
challenge in the controls, with no change in the meanWBC in the
BTV-CP vaccinates. The delayed increase in WBC after challenge is a
typical response for a viremic BTV infected animal. The BTV-CP
immunized animals exhibit normal WBC's that do not significantly
deviate from pre-challenge animals. These results confirm vaccine
(BTV-CP) efficacy.
TABLE-US-00013 TABLE 6 BTV 17 Challenge Study-WBC Data Sheep # Day
0 Day 3 Day 6 Day 9 Day 13 Day 16 Day Mean BTV Vaccinated 353 3.73
4.16 4.68 3.91 3.84 4.79 0 4.9 355 5.13 4.77 5.51 4.36 4.51 3.6 3
4.94 359 6.11 6.46 7.47 6 6.07 6.86 6 5.59 361 3.69 4.25 4.62 4.44
4.32 4.46 9 5.01 363 5.86 4.61 5.69 5.66 5.68 6.7 13 4.96 364 4.9
5.36 5.59 5.7 5.32 5.91 16 5.39 Mean: 4.903333 4.935 5.593333
5.011667 4.956667 5.386667 WNV Controls 354 3.46 2.43 3.46 3.82
4.71 5.1 0 4.36 356 3.39 3.61 3.12 3.16 4.63 5.4 3 4.04 357 4.94
6.73 2.97 5.28 7.74 7.73 6 3.5 358 4.15 4.01 3.85 4.31 6.36 8.24 9
4.39 362 5.86 3.41 4.08 5.38 7.37 7.4 13 6.16 16 6.77
3. Lymphocyte count. For 16 days post challenge, Lymphocyte counts
were monitored on day 0 and at approximately 3 day intervals
through day 16 for all 6 BTC-CP vaccinates and for all 5 control
(WNV-CP immunized) sheep The lymphocyte data from the challenged
sheep are shown below in Table 7 and in Drawing 19. The data show
an initial slight decrease in meanWBC through day 8 post challenge
with a continual rise in the mean lymphocyte count at day 9-16 post
challenge in the controls, with no change in the mcan lymphocyte
number in the BTV-CP vaccinates The delayed increase in lymphocyte
counts after challenge is a typical response for a viremic BTV
infected animal. The BTV-CP immunized animals exhibit normal
lymphocyte counts that do not significantly deviate from
pre-challenge animals. These results confirm vaccine (BTV-CP)
efficacy.
TABLE-US-00014 TABLE 7 BTV 17 Challenge Study-Lymphocyte Data Sheep
# Day 0 Day 3 Day 6 Day 9 Day 13 Day 16 Day Mean BTV Vaccinated 353
2.5 2.09 2.65 1.92 1.84 2.48 0 3.17 355 3.3 3.04 3.79 3.11 3 2.43 3
3.09 359 4.33 3.88 4.73 4.03 3.62 4.33 6 3.57 361 1.84 2.9 3.2 2.85
2.64 2.67 9 3.14 363 3.51 2.9 3.6 3.25 3.42 3.93 13 2.86 364 3.56
3.74 3.44 3.69 2.66 3.34 16 3.2 Mean: 3.173333 3.091667 3.568333
3.141667 2.863333 3.196667 WNV Controls 354 2.19 1.05 2.16 2.6 2.87
3.73 0 2.92 356 1.85 1.58 1.98 2.11 2.7 2.72 3 2.18 357 3.14 3.93
1.82 3.8 5.4 6.16 6 2.37 358 2.74 2.49 3.06 3.37 5.71 6.47 9 3.35
362 4.69 1.84 2.82 4.85 5.89 6.3 13 4.51 16 5.08 Mean: 2.922 2.178
2.368 3.346 4.514 5.076
4. Platelet count. For 16 days post challenge, platelet counts were
monitored on day 0 and at approximately 3 day intervals through day
16 for all 6 BTC-CP vaccinates and for all 5 control (WNV-CP
immunized) sheep The platelet data from the challenged sheep are
shown below in Table 8 and in Drawing 20. The data show an initial
decrease in platelet counts through day 8 post challenge with a
continual rise in the mean platelet count at day 9-16 post
challenge in the controls. In the BTV-CP vaccinates there is a
gradual increase in platelets over the course of the study. In the
BTV-CP vaccinate, the platelet counts are elevated above the
controls throughout the course of the study. The decrease in
platelet count after challenge in is a typical response for a
viremic BTV infected animal. The BTV-CP immunized animals exhibit
normal platelet counts. These results confirm vaccine (BTV-CP)
efficacy.
TABLE-US-00015 TABLE 8 BTV Platelet counts. Sheep # Day 0 Day 3 Day
6 Day 9 Day 13 Day 16 Day Mean BTV Vaccinated 353 822 566 863 945
909 936 0 686.3 355 1076 935 941 905 956 1056 3 546.3 359 602 528
692 607 739 854 6 763.3 361 510 405 580 553 442 680 9 708.5 363 565
327 828 865 705 775 13 734.8 364 543 517 676 376 658 799 16 850
Mean: 686.3333 546.3333 763.3333 708.5 734.8333 850 WNV Controls
354 792 7.2 479 439 550 800 0 544 356 495 423 373 308 594 621 3
301.6 357 625 548 435 418 760 873 6 374.6 358 627 144 371 366 489
579 9 357 362 181 386 215 254 665 605 13 611.6 16 695.6 Mean: 544
301.64 374.6 357 611.6 695.6
REFERENCES
Anderson, G. A., J. L. Stott, et al. (1985). "Subclinical and
clinical bluetongue disease in cattle: clinical, pathological and
pathogenic considerations." Prog Clin Biol Res 178: 103-7.
Andreansky, S. S., B. He, et al. (1996). "The application of
genetically engineered herpes simplex viruses to the treatment of
experimental brain tumors." Proc Natl Acad Sci U S A 93(21):
11313-8. Andrew, M., P. Whiteley, et al. (1995). "Antigen
specificity of the ovine cytotoxic T lymphocyte response to
bluetongue virus." Vet Immunol Immunopathol 47(3-4): 311-22.
Antoine, G., F. Scheiflinger, et al. (1998). "The complete genomic
sequence of the modified vaccinia APakara strain: comparison with
other orthopoxviruses." Virolog 244(2): 365-96. Ballay, A., M.
Levrero, et al. (1985). "In vitro and in vivo synthesis of the
hepatitis B virus surface antigen and of the receptor for
polymerized human serum albumin from recombinant human
adenoviruses." Embo J 4(13B): 3861-5. Barcena, J., M. M. Lorenzo,
et al. (2000). "Sequence and analysis of a swinepox virus homologue
of the vaccinia virus major envelope protein P37 (F13L)." J Gen
Virol 81(Pt 4): 1073-85. Bernard, K. A., B. A. Israel, et al.
(1997). "Sequence and cognitive analyses of two
virulence-associated markers of bluetongue virus serotype 17."
Intervirology 40(4): 226 -31. Bonneau, K. R., C. D. DeMaula, et al.
(2002). "Duration of viraemia infectious to Culicoides sonorensis
in bluetongue virus-infected cattle and sheep." Vet Microbiol
88(2): 115-25. Bonneau, K. R., B. A. Mullens, et al. (2001).
"Occurrence of genetic drift and founder effect during quasispecies
evolution of the VP2 and NS3/NS3A genes of bluetongue virus upon
passage between sheep, cattle, and Culicoides sonorensis." J Virol
75(17): 8298-305. Bonneau, K. R., N. Zhang, et al. (1999).
"Sequence comparison of the L2 and S10 genes of bluetongue viruses
from the United States and the People's Republic of China." Virus
Res 61(2): 153-60. Boshart, M., F. Weber, et al. (1985). "A very
strong enhancer is located upstream of an immediate early gene of
human cytomegalovirus." Cell 41(2): 521-30. Bradel-Tretheway, B.
G., Z. Zhen, et al. (2003). "Effects of codon-optimization on
protein expression by the human herpesvirus 6 and 7 U51 open
reading frame." J Virol Methods 111(2): 145-56. Carroll, M. W., W.
W. Overwijk, et al. (1997). "Highly attenuated modified vaccinia
virus Ankara (MVA) as an effective recombinant vector: a murine
tumor model." Vaccine 15(4): 387-94. Cochran, M. A., C. Puckett, et
al. (1985). "In vitro mutagenesis of the promoter region for a
vaccinia virus gene: evidence for tandem early and late regulatory
signals." J Virol 54(1): 30-7. Cowley, J. A. and B. M. Gorman
(1989). "Cross-neutralization of genetic reassortants of bluetongue
virus serotypes 20 and 21." Vet Microbiol 19(1): 37-51. De Groot,
A. S. and F. G. Rothman (1999). "In silico predictions; in vivo
veritas." Nat Biotechnol 17(6): 533-4. de Mattos, C. A., C. C. de
Mattos, et al. (1994). "Heterogeneity of the L2 gene of field
isolates of bluetongue virus serotype 17 from the San Joaquin
Valley of California." Virus Res 31(1): 67-87. DeMaula, C. D., K.
R. Bonneau, et al. (2000). "Changes in the outer capsid proteins of
bluetongue virus serotype ten that abrogate neutralization by
monoclonal antibodies." Virus Res 67(1): 59-66. DeMaula, C. D., H.
W. Heidner, et al. (1993). "Neutralization determinants of United
States bluetongue virus serotype ten." Virology 195(1): 292-6.
DeMaula, C. D., C. M. Leutenegger, et al. (2002). "The role of
endothelial cell-derived inflammatory and vasoactive mediators in
the pathogenesis of bluetongue." Virology 296(2): 330-7. Disbrow,
G. L., I. Sunitha, et al. (2003). "Codon optimization of the HPV-16
E5 gene enhances protei expression." Virology 311(1): 105-14.
Felgner, J. H., R. Kumar, et al. (1994). "Enhanced gene delivery
and mechanism studies with a novel series of cationic lipid
formulations." J Biol Chem 269(4): 2550-61. Frolov, I., T. A.
Hoffman, et al. (1996). "Alphavirus-based expression vectors:
strategies and applications." Proc Natl Acad Sci U S A 93(21):
11371-7. Funahashi, S., T. Sato, et al. (1988). "Cloning and
characterization of the gene encoding the major protein of the
A-type inclusion body of cowpox virus." J Gen Virol 69(Pt 1):
35-47. Geysen, H. M. (1990). "Molecular technology: peptide epitope
mapping and the pin technology." Southeast Asian J Troy Med Public
Health 21(4): 523-33. Geysen, H. M., S. J. Barteling, et al.
(1985). "Small peptides induce antibodies with a sequence and
structural requirement for binding antigen comparable to antibodies
raised against the native protein." Proc Natl Acad Sci U S A 82(1):
178-82. Geysen, H. M., R. H. Meloen, et al. (1984). "Use of peptide
synthesis to probe viral antigens for epitopes to a resolution of a
single amino acid." Proc Natl Acad Sci U S A 81(13): 3998-4002.
Ghiasi, H., A. Fukusho, et al. (1987). "Identification and
characterization of conserved and variable regions in the
neutralization VP2 gene of bluetongue virus." Virology 160(1):
100-9. Graham, F. L. (1990). "Adenoviruses as expression vectors
and recombinant vaccines." Trends Biotechnol 8(4): 85-7. Guo, P.
X., S. Goebel, et al. (1989). "Expression in recombinant vaccinia
virus of the equine herpesvirus 1 gene encoding glycoprotein gp13
and protection of immunized animals." J Virol 63(10): 4189-98.
Hartikka, J., M. Sawdey, et al. (1996). "An improved plasmid DNA
expression vector for direct injection into skeletal muscle." Hum
Gene Ther 7(10): 1205-17. Hassan, S. S. and P. Roy (1999).
"Expression and functional characterization of bluetongue virus VP2
protein: role in cell entry." J Virol 73(12): 9832-42. Heidner, H.
W., P. V. Rossitto, et al. (1990). "Identification of four distinct
neutralizing epitopes on bluetongue virus serotype 10 using
neutralizing monoclonal antibodies and neutralization-escape
variants." Virology 176(2): 658-61. Hemmer, B., C. Pinilla, et al.
(1998). "The use of soluble synthetic peptide combinatorial
libraries to determine antigen recognition of T cells." J Pept Res
52(5): 338-45. Huang, I. J., G. Y. Hwang, et al. (1995). "Sequence
analyses and antigenic epitope mapping of the putative RNA-directed
RNA polymerase of five U.S. bluetongue viruses." Virology 214(1):
280-8. Huismans, H. and B. J. Erasmus (1981). "Identification of
the serotype-specific and group-specific antigens of bluetongue
virus." Onderstepoort J Vet Res 48(2): 51-8. Huismans, H., N. T.
van der Walt, et al. (1987). "Isolation of a capsid protein of
bluetongue virus that induces a protective immune response in
sheep." Virology 157(1): 172-9. Jewell, J. E. and J. O. Mecham
(1994). "Identification of an amino acid on VP2 that affects
neutralization of bluetongue virus serotype 10." Virus Res 33(2):
139-44. Ju, Q., D. Edelstein, et al. (1998). "Transduction of
non-dividing adult human pancreatic beta cells by an integrating
lentiviral vector." Diabetoloaia 41(6): 736-9. Kim, C. H., Y. Oh,
et al. (1997). "Codon optimization for high-level expression of
human erythropoietin (EPO) in mammalian cells." Gene 199(1-2):
293-301. Kitsonl, J. D., K. L. Burke, et al. (1991) "Chimeric
polioviruses that include sequences derived from two independent
antigenic sites of foot-and-mouth disease virus (FMDV) induce
neutralizing antibodies against FMDV in guinea pigs." J Virol
65(6): 3068-75. Klinman, D. M., A. K. Yi, et al. (1996). "CpG
motifs present in bacteria DNA rapidly induce lymphocytes to
secrete interleukin 6, interleukin 12, and interferon gamma." Proc
Natl Acad Sci U S A 93(7): 2879-83. Kwissa, M., K. van Kampen, et
al. (2000). "Efficient vaccination by intradermal or intramuscular
inoculation of plasmid DNA expressing hepatitis B surface antigen
under desmin promoter/enhancer control." Vaccine 18(22): 2337-44.
Laval, F., R. Paillot, et al. (2002). "Quantitative analysis of the
antigen-specific IFNgamma+T cell-mediated immune response in
conventional outbred pigs: kinetics and duration of the DNA-induced
IFNgamma+CD8+T cell response." Vet Immunol Immunopathol 90(3-4):
191-201. Lobato, Z. I., B. E. Coupar, et al. (1997). "Antibody
responses and protective immunity to recombinant vaccinia
virus-expressed bluetongue virus antigens." Vet Immunol
Immunopathol 59(3-4): 293-309. Luckow, V. A. and M. D. Summers
(1988). "Signals important for high-level expression of foreign
genes in Autographa califomica nuclear polyhedrosis virus
expression vectors." Virology 167(1): 56-71. MacLachlan, N. J.
(1994). "The pathogenesis and immunology of bluetongue virus
infection of ruminants." Comp Immunol Microbiol Infect Dis 17(3-4):
197-206. MacLachlan, N. J. and J. E. Pearson (2004). Bluetongue:
Proceedings of the Third International Symposium. Bluetongue:
Prodeedings of the Third International Symposium. N. J. MacLachlan
and J. E. Pearson, Vet Italiana. 40: 1-730. Marshall, E., L. B.
Woolford, et al. (1997). "Continuous infusion of macrophage
inflammatory protein MIP-l alpha enhances leucocyte recovery and
haemopoietic progenitor cell mobilization after cyclophosphamide."
Br J Cancer 75(12): 1715-20. Martinez-Torrecuadrada, J. L., J. P.
Langeveld, et al. (1999). "Antigenic profile of African horse
sickness virus serotype 4 VP5 and identification of a neutralizing
epitope shared with bluetongue virus and epizootic hemorrhagic
disease virus." Virology 257(2): 449-59. McClements, W. L., M. E.
Armstrong, et al. (1996). "Immunization with DNA vaccines encoding
glycoprotein D or glycoprotein B, alone or in combination, induces
protective immunity in animal models of herpes simplex virus-2
disease." Proc Natl Acad Sci U S A 93(21): 11414-20. Mecham, J. O.,
V. C. Dean, et al. (1986). "Correlation of serotype specificity and
protein structure of the five U.S. serotypes of bluetongue virus."
J Gen Virol 67 (Pt 12): 2617-24. Mecham, J. O. and D. J. Johnson
(2005). "Persistence of bluetongue virus serotype 2 (BTV-2) in the
southeast United States." Virus Res 113(2): 116-22. Miyazaki, J.,
S. Takaki, et al. (1989). "Expression vector system based on the
chicken beta-actin promoter directs efficient production of
interleukin-5." Gene 79(2): 269-77. Moss, B. (1996). "Genetically
engineered poxviruses for recombinant gene expression, vaccination,
and safety." Proc Natl Acad Sci U S A 93(21): 11341-8. Mullens, B.
A., W. J. Tabachnick, et al. (1995). "Effects of temperature on
virogenesis of bluetongue virus serotype 11 in Culicoides
variipennis sonorensis." Med Vet Entomol 9(1): 71-6. Paoletti, E.
(1996). "Applications of pox virus vectors to vaccination: an
update." Proc Natl Acad Sci U S A 93(21): 11349-53. Pearson, W. R.
and D. J. Lipman (1988). "Improved tools for biological sequence
comparison." Proc Natl Acad Sci U S A 85(8): 2444-8. Pennock, G.
D., C. Shoemaker, et al. (1984). "Strong and regulated expression
of Escherichia coli beta-galactosidase in insect cells with a
baculovirus vector." Mol Cell Biol 4(3): 399-406. Perkus, M. E., K.
Limbach, et al. (1989). "Cloning and expression of foreign genes in
vaccinia virus, using a host range selection system." J Virol
63(9): 3829-36. Powell, M. F. and M. J. Newman (1995). Vaccine
Design, The Subunit and Adjuvant Approach. A Compendium of Vaccine
Adiuvants and Excipients. F. Vogel and M. Powell. New York, Plenum
Press. 6: 147, 183. Prevec, L., M. Schneider, et al. (1989). "Use
of human adenovirus-based vectors for antigen expression in
animals." J Gen Virol 70 (Pt 2): 429-34. Pritchard, L. I. and A. R.
Gould (1995). "Phylogenetic comparison of the serotype-specific VP2
protein of bluetongue and related orbiviruses." Virus Res 39(2-3):
207-20. Regelson, W., S. Kuhar, et al. (1960). "Synthetic
polyelectrolytes as tumour inhibitors." Nature 186: 778-80.
Riviere, M., J. Tartaglia, et al. (1992). "Protection of mice and
swine from pseudorabies virus conferred by vaccinia virus-based
recombinants." J Virol 66(6): 3424-34. Robertson, E. S., T. Ooka,
et al. (1996). "Epstein-Barr virus vectors for gene delivery to B
lymphocytes." Proc Natl Acad Sci U S A 93(21): 11334-40. Robinson,
H. L. and C. A. Torres (1997). "DNA vaccines." Semin Immunol 9(5):
271-83. Roizman, B. (1996). "The function of herpes simplex virus
genes: a primer for genetic engineering of novel vectors." Proc
Natl Acad Sci U S A 93(21): 11307-12. Rossitto, P. V. and N. J.
MacLachlan (1992). "Neutralizing epitopes of the serotypes of
bluetongue virus present in the United States." J Gen Virol 73 (Pt
8): 1947-52. Roy, P. (1992). "Bluetongue virus proteins." J Gen
Virol 73 (Pt 12): 3051-64. Roy, P. (1996). "Orbivirus structure and
assembly." Virology 216(1): 1-11. Roy, P. (1996). Orbiviruses and
their replication. Fields Virology. B. N. Fields, D. M. Knipe, P.
M. Howley. Philadelphia, Pa., Lippincott-Raven: 1709-1734. Roy, P.,
T. Urakawa, et al. (1990). "Recombinant virus vaccine for
bluetongue disease in sheep." J Virol 64(5): 1998-2003. Sambrook,
J. and D. W. Russell (2001). Molecular Cloning: a laboratory
manual/Joseph Sambrook. David W. Russell. Cold Spring Harbor, N.Y.,
Cold Spring Harbor Laboratory Press. Schneider, K., F. Puehler, et
al. (2000). "cDNA cloning of biologically active chicken
interleukin-18." J Interferon Cytokine Res 20(10): 879-83. Shida,
H. (1986). "Nucleotide sequence of the vaccinia virus hemagglutinin
gene." Virology 150(2): 451-62. Smith, G. E., M. D. Summers, et al.
(1983). "Production of human beta interferon in insect cells
infected with a baculovirus expression vector." Mol Cell Biol
3(12): 2156-65. Spreull, J. (1905). "Malarial catarrhal fever
(bluetongue) of sheep in South Africa." J. Comp. Path. Ther. 18:
321-337. Stickl, H. and V. Hochstein-Mintzel (1971).
"[Intracutaneous smallpox vaccination with a weak pathogenic
vaccinia virus ("MVA virus")]." Munch Med Wochenschr 113(35):
1149-53. Stittelaar, K. J., L. S. Wyatt, et al. (2000). "Protective
immunity in macaques vaccinated with a modified vaccinia virus
Ankara-based measles virus vaccine in the presence of passively
acquired antibodies." J Virol 74(9): 4236-43. Sutter, G. and B.
Moss (1992). "Nonreplicating vaccinia vector efficiently expresses
recombinant genes." Proc Natl Acad Sci U S A 89(22): 10847-51.
Sutter, G., L. S. Wyatt, et al. (1994). "A recombinant vector
derived from the host range-restricted and highly attenuated MVA
strain of vaccinia virus stimulates protective immunity in mice to
influenza virus." Vaccine 12(11): 1032-40. Tang, D. C., M. DeVit,
et al. (1992). "Genetic immunization is a simple method for
eliciting an immune response." Nature 356(6365): 152-4. Taylor, J.,
R. Weinberg, et al. (1988). "Protective immunity against avian
influenza induced by a fowlpox virus recombinant." Vaccine 6(6):
504-8. Thompson, J. D., D. G. Higgins, et al. (1994). "CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice." Nucleic Acids Res 22(22):
4673-80. Ulmer, J. B., J. J. Donnelly, et al. (1993). "Heterologous
protection against influenza by injection of DNA encoding a viral
protein." Science 259(5102): 1745-9. Van der Zee, R., W. Van Eden,
et al. (1989). "Efficient mapping and characterization of a T cell
epitope by the simultaneous synthesis of multiple peptides." Eur J
Immunol 19(1): 43-7. van Ooyen, A., J. van den Berg, et al. (1979).
"Comparison of total sequence of a cloned rabbit beta-globin gene
and its flanking regions with a homologous mouse sequence." Science
206(4416): 337-44. Verwoerd, D. W., H. J. Els, et al. (1972).
"Structure of the bluetongue virus capsid." J Virol 10(4): 783-94.
Vialard, J., M. Lalumiere, et al. (1990). "Synthesis of the
membrane fusion and hemagglutinin proteins of measles virus, using
a novel baculovirus vector containing the beta-galactosidase gene."
J Virol 64(1): 37-50. Wang, L. F., D. H. Du Plessis, et al. (1995).
"Use of a gene-targeted phage display random epitope library to map
an antigenic determinant on the bluetongue virus outer capsid
protein VP5." J Immunol Methods 178(1): 1-12. White, D. M., W. C.
Wilson, et al. (2005). "Studies on overwintering of bluetongue
viruses in insects." J Gen Virol 86(Pt 2): 453-62. Wilson, W. C.
and J. O. Mecham (2000). "Molecular Evolution of Orbiviruses." Proc
USAHA 104: 169-180. Xin, K. Q., K. Hamajima, et al. (1999). "IL-15
expression plasmid enhances cell-mediated immunity induced by an
HIV-1 DNA vaccine." Vaccine 17(7-8): 858-66.
Having thus described in detail preferred embodiments of the
present invention, it is to be understood that the invention
defined by the appended claims is not to be limited to particular
details set forth in the above description as many apparent
variations thereof are possible without departing from the spirit
or scope of the present invention.
SEQUENCE LISTINGS
1
2612868DNAArtificial SequenceDescription of Artificial Sequence
Synthetic BTV17 codon optimized VP2 1atggaggagt tcgtgatccc
cgtgtacagc gaggacgaga tcccctacgc cctgctgagc 60agataccctc tggccatcca
gaccaacgtg aagatcgagg acgtggaggg caagcacaac 120gtggtgaaga
tccccgagag cgacatgatc gacatccccc ggctgaccat cgtggaggcc
180atgaactaca agcccgccag gaacgacggc atcgtggtgc ctagactgct
ggacatcacc 240ctgagagcct acgacgaccg gaagagcacc aagagcgcca
gaggcatcga gttcatgacc 300aacgcccggt ggatgaagtg ggccatcgac
gacaggatgg acatccagcc cctgaaggtg 360accctggacc actactgcag
cgtgaatcac cagctgttca actgcgtggt gaaggccaac 420gccgccaatg
ccgacaccat ctactacgac tacttccccc tggaggacca caagaagcgg
480tgcaaccaca ccaacctgga cctgctgagg agcctgacca acatggagct
gttccacgcc 540ctgcagggag ccgcctacag catcaagagc agctacgaac
tggtggccaa cagcgagaga 600gagagcctgg aggagaccta cgccatcggc
cagcctaagt ggatccacct gaccaggggc 660accagaatcg gcaacagcgg
cctgccttac gagagattca tcagcagcat ggtgcaggtg 720atcgtgaacg
gcaagatccc tagcgagatc gccaacgagg tggcccagct gaacagaatc
780cgggccgagt ggatcgccgc cacctacgac agaggcagga tcagagccct
ggagctgtgc 840aagatcctga gcaccatcgg ccggaagatc ctgaataccc
acgaggagcc caaggacgag 900atggacctgt ccacccggtt ccagttcaag
ctggacgaga agttcaacag gaccgacccc 960gagcacgtga atatcttcgg
agtgagggcc cctgccaccg acgagggcag attctacgcc 1020ctgatcgcca
ttgccgccac cgacacccag aagggcagag tgtggaggac caacccctac
1080ccttgcctga gaggcgccct ggtggccgcc gagtgcgagc tgggcgacgt
gtacagcacc 1140ctgcggaggg tgtacagatg gagcctgaga cctgagtacg
gccagcacga gagacagctg 1200gagaacaaca agtacgtgtt caaccggatc
aacctgttcg acagcaatct ggccgtgggc 1260gaccagatca tccactggcg
ctacgaggtg aaggcctccg ccgagaccac ctacgatagc 1320ggctacatgt
gcaggcacga ggtggaggag gacgagctgc tgtgtaagat caacgaggac
1380aagtacaagg acatgctgga ccggatgatc cagggcggct gggatcagga
gaggttcaag 1440ctgcacaaca tcctgaccga ccccaacctg ctgacaatcg
acttcgagaa ggacgcctac 1500ctgaacagca gaagcgagct ggtgttcccc
gactacttcg acaagtggat cagcagcccc 1560atgttcaacg cccggctgag
aatcaccaag ggcgagatcg gcaccagcaa gaaggacgac 1620ccctggaaca
acagagccgt gcggggctac atcaagagcc ctgccgagtc cctggacttc
1680gtgctgggcc cctactacga tctgcggctg ctgttcttcg gcgaggccct
gagcctgaag 1740caggagcaga gcgccgtgtt ccagtacctg agccagctgg
acgacttccc cgccctgacc 1800cagctgaccg gcgacgccgt gtgtcctcac
agcggcggag ccctgtacac cttcaggaag 1860gtggccctgt tcctgatcgg
caactacgag aagctgagcc ccgacctgca cgagggcatg 1920gagcaccaga
cctacgtgca ccccagcacc ggcggcacct accagaaatg cgtgctggag
1980atgaaggacc cctgccagct gatgtgcttc gtgatcgact acatcttcga
gaagcgggag 2040cagctgagag acaccaagga ggcccggtac atcgtgtacc
tgatccagag cctgaccggc 2100atccagagac tggacgtgct gaagagcacc
ttccccaact tcttccagcg gctgctgatg 2160ctgaaggaga tcaagtttgt
gcgggacctg aacgtgatca acttcctgcc cctgatgttc 2220ctggtgcacg
acaacatcag ctacagccac cggcagtgga gcatccctat ggtgctgttc
2280gacgacacca tcaagctgat ccctgtggaa gtgggcgcct acgccaacag
attcggcttc 2340aagagcttca tgaacttcac caggttccac cctggcgaga
gcaagaagaa gcagatcgcc 2400gaggacgtgc acaaggagtt cggcgtggtg
gccttcgagt actacaccaa caccaagatc 2460agccagggca gcgtgcacac
ccccgtgatg accaccaaga tggatgtgct gaaaatccac 2520ctgagcagcc
tgtgtgccgg cctggccgac agcatcgtgt acaccctgcc cgtggcccac
2580cccaagaagt gcatcgtgct gatcattgtg ggcgacgaca agctggagcc
tcacaccaga 2640tccgagcaga tcgtgtcccg gtacaactac agccggaagc
acatctgcgg cgtggtgtcc 2700gtgacagtgg gccagaacag ccagctgaga
gtgtacacca gcggcatcgt gaagcacaga 2760gtgtgcgaca agttcatcct
gaagcacaaa tgcaaggtga tcctggtgag gatgcccggc 2820tacgtgttcg
gcaacgacga gctgatgacc aagctgctga atgtgtga 286821581DNAArtificial
SequenceDescription of Artificial Sequence Synthetic BTV17 codon
optimized VP5 2atgggcaaga tcatcaagag cctgagccgc ttcggcaaga
aagtgggcaa tgccctgacc 60agcaacaccg ccaagaagat ctacagcacc atcggcaagg
ccgccgagag attcgccgag 120agcgagatcg gagccgccac catcgacggc
ctggtgcagg gcagcgtgca cagcatcatc 180accggcgaga gctacggcga
gagcgtgaag caggccgtgc tgctgaacgt gctgggcaca 240ggcgaggagc
tgcccgaccc cctgagccct ggcgagagag gcatccagac caagatcaag
300gagctggagg acgagcagag aaacgagctg gtgcggctga agtacaacaa
ggagatcacc 360aaggagttcg gcaaggaact ggaagaggtg tacgacttca
tgaacggcga ggccaaggag 420gaggaggtgg tgcaagaaca gtacagcatg
ctgtgcaagg ccgtggacag ctacgagaag 480atcctgaagg ccgaggactc
caagatggcc atgctggcca gagccctgca gagggaggcc 540agcgagagaa
gccaggacga gatcaagatg gtgaaggagt accggcagaa gatcgacgcc
600ctgaagaacg ccatcgagat cgagagggac ggcatgcagg aggaggccat
ccaagaaatc 660gccggcatga ccgccgacgt gctggaggcc gccagcgagg
aggtgcccct gattggcgcc 720ggaatggcca ccgccgtggc caccggcaga
gccatcgagg gcgcctacaa gctgaagaag 780gtgatcaacg ccctgagcgg
catcgacctg agccacatga ggagccccaa gatcgagcct 840accatcatcg
ccaccaccct ggagcaccgg ttcaaggaga tccctgacga gcagctggcc
900gtgtccgtgc tgaacaagaa aaccgccgtg accgacaact gcaacgagat
cgcccacatc 960aagcaggaga tcctgcccaa gttcaagcag atcatggacg
aggagaagga gatcgagggc 1020atcgaggaca aggtgatcca cccccgggtg
atgatgaggt tcaagatccc cagaacccag 1080cagcctcaga tccacatcta
tgccgcccct tgggacagcg acgacgtgtt cttcttccac 1140tgcgtgtccc
accaccacag gaacgagagc ttcttcctgg gcttcgacct gggcatcgac
1200gtggtgcact tcgaggatct gaccagccac tggcacgccc tgggcctggc
ccaggaggcc 1260tccggcagaa ccctgaccga ggcctacagg gagttcctga
acctgagcat cagcagcacc 1320tacagcagcg ccatccacgc ccggagaatg
atcagatcca gggccgtgca ccctatcttt 1380ctgggcagca cccactacga
catcacctac gaggccctga aaaacaacgc ccagcggatc 1440gtgtacgatg
aggagctgca gatgcacatc ctgagaggcc ctctgcactt ccagaggaga
1500gccatcctgg gcgccctgaa gttcggcatc aagatcctgg gcgacaagat
cgacgtgccc 1560ctgttcctga ggaacgcctg a 158132868DNABluetongue virus
17 3atggaggagt tcgtcattcc agtctattca gaagatgaaa ttccatacgc
tttactgagc 60agataccctt tggcgataca gacaaatgtt aaaatagagg atgttgaagg
aaaacataat 120gttgtaaaaa ttcctgaatc cgatatgata gatataccaa
gattaacaat tgtagaggcg 180atgaattata aaccagcgag aaacgatgga
atcgttgtac ctagattact tgatataaca 240ttacgtgctt atgatgatag
gaaatcgaca aaaagtgctc gagggataga gttcatgacg 300aacgctagat
ggatgaaatg ggccatagat gatagaatgg atatccaacc gcttaaagtc
360actttggatc attactgttc cgtcaaccat cagctcttta actgcgtcgt
caaagcgaat 420gctgccaacg ctgatacgat ctattatgat tatttcccac
ttgaagacca taaaaaaaga 480tgtaaccaca caaatcttga tttattgaga
agtttgacca atatggagtt gttccacgcg 540ttgcaaggtg ctgcatacag
tatcaaatcg agctacgaat tagtggcaaa ctccgaaaga 600gaaagcttgg
aggagactta tgcgatagga cagccaaagt ggatacattt gactagagga
660acgcgaatag gcaatagtgg attaccttat gaacggttta tctcaagcat
ggtccaggtg 720atcgtaaatg gcaagattcc aagcgagata gcgaacgagg
tcgcgcaact gaatagaata 780agggcagagt ggatagcggc tacatacgat
agaggcagga ttagagcgct agagctatgc 840aagatccttt ccacgattgg
gcgtaagata ctgaacacgc atgaagagcc gaaagatgaa 900atggatctat
caacaagatt tcagttcaaa cttgacgaaa aatttaacag aacagatcca
960gaacatgtta atatttttgg tgtaagagcc ccagcgacag atgaaggaag
attttacgct 1020ctgattgcaa tcgcagcgac ggatacacaa aagggtagag
tgtggagaac aaatccgtat 1080ccatgcttgc gaggtgcttt agttgcagct
gagtgtgaat taggtgacgt ttacagtacg 1140ctccgacgtg tgtatagatg
gagtctaagg ccggagtatg gacagcacga gcgacaatta 1200gagaacaata
aatacgtctt taatcgtata aatttattcg attcaaactt agcggtcggc
1260gatcagataa ttcattggcg ttatgaggtt aaagcatcgg cggagacgac
ttatgacagt 1320ggatacatgt gtcggcatga ggttgaggag gatgaactat
tatgtaaaat caatgaggac 1380aaatataaag acatgctgga cagaatgatt
cagggtgggt gggatcagga aagatttaaa 1440cttcataaca tactgacgga
ccctaactta ttgacgattg actttgaaaa agatgcgtat 1500ctgaactcac
ggtccgagtt agtttttccg gattatttcg acaaatggat cagttcacca
1560atgtttaacg cgcgcttaag aattactaaa ggggagatcg gaacatcgaa
aaaggatgat 1620ccatggaaca accgcgcagt acgtggatac atcaagtccc
ctgcggagtc gttggatttt 1680gttctcgggc cttactacga tctgcggcta
ctattttttg gcgaggcgtt gagcttaaaa 1740caggaacaat ccgcggtttt
tcaatatttg agtcagctcg atgattttcc cgcgcttacg 1800cagctaacag
gagatgccgt atgcccacat tcaggcggag cgctatatac gtttaggaaa
1860gtcgcgctat ttttaatcgg gaattatgaa aagttaagtc cggatctaca
tgaaggtatg 1920gaacatcaaa catatgtgca tccgtcgact ggtgggacgt
atcagaaatg cgtgctagag 1980atgaaggacc cttgtcaact aatgtgcttt
gtgattgatt acatctttga aaaacgtgag 2040cagctacgtg ataccaaaga
ggcgaggtac atcgtgtatc taattcaaag tctcactggg 2100atacaacggc
tggatgttct gaaatcgacg ttcccgaatt ttttccaacg attattaatg
2160ctgaaagaga tcaaatttgt gcgtgattta aatgtgatca acttcctccc
tctgatgttc 2220cttgttcatg ataacatctc gtattcgcat agacagtggt
caattccaat ggtactgttt 2280gacgatacga ttaagttaat acccgtagag
gttggcgcgt atgcaaatag atttggattc 2340aaaagtttta tgaactttac
acggtttcac cctggtgagt caaagaaaaa acagattgcc 2400gaggatgtgc
ataaggagtt tggagtggtc gctttcgaat attacaccaa tacaaaaatt
2460tcccagggga gtgtccatac accagtaatg actacgaaaa tggatgtatt
gaagatacat 2520ttgtcttctt tatgtgcagg tctggcggat tctatcgtat
atacattacc ggttgcgcat 2580cctaagaaat gcatcgttct aataattgtg
ggagatgaca aattggaacc gcatacgcgt 2640tcagaacaaa tagttagtcg
gtataattac tcacgtaagc acatttgtgg agttgtatcc 2700gtcaccgtcg
ggcagaatag tcagttgaga gtttatacct ctggaattgt taaacaccgt
2760gtatgcgaca agttcattct aaaacacaag tgcaaggtga tattagtgag
gatgccgggg 2820tacgttttcg gaaatgatga attaatgacg aaactattga atgtctag
286841581DNABluetongue virus 17 4atggggaaga taattaaatc gctaagtaga
tttggaaaga aggttgggaa tgcattgacg 60tcgaacacag cgaagaagat ttattcaacc
atcgggaaag cagcggagcg atttgctgaa 120agtgaaatcg gtgcggcaac
gatagacggt ttggtgcagg gcagtgttca ttccataatt 180acaggtgaat
cgtatggaga gtcagttaaa caagcggttc ttctcaacgt gttaggtaca
240ggtgaagaat taccagatcc tctgagcccc ggcgaacgtg gtatccaaac
gaaaataaag 300gaattagaag atgagcagcg aaatgaactt gttcgattga
agtataacaa agagataaca 360aaggagtttg ggaaggagtt agaggaagtc
tacgacttca tgaatggcga ggcgaaggag 420gaggaagtgg ttcaggaaca
atactcaatg ttatgtaaag cagtggattc ttacgagaaa 480atattaaagg
cggaagactc gaaaatggca atgttggcgc gcgcactgca acgggaggct
540tcagagagaa gtcaggacga gatcaaaatg gtaaaggagt acagacagaa
aattgatgcg 600cttaagaatg cgatcgagat tgaacgagac ggaatgcagg
aggaggcgat ccaggagatt 660gctggaatga ccgctgacgt cttagaagcg
gcttcagagg aagtgccctt aatcggtgca 720ggtatggcca ctgctgtagc
aaccggcaga gcaatagagg gcgcatataa attgaagaaa 780gttataaatg
cgttaagtgg aatcgatttg tcgcatatga ggagtccaaa gatcgaacca
840actattatcg ctacaacact ggagcaccga tttaaagaga taccagatga
gcagctagca 900gtaagtgtgt tgaataagaa gacagccgta actgataact
gcaatgaaat cgcgcatatt 960aaacaagaaa tattaccaaa gtttaagcag
attatggatg aggagaagga gattgaagga 1020atagaggaca aagtgattca
cccgcgggtg atgatgaggt tcaagattcc tagaacgcag 1080caaccgcaaa
tccacattta tgcggctccg tgggattctg atgacgtatt tttctttcat
1140tgcgtttcac accatcatcg gaatgaatct ttctttttgg gatttgattt
aggaatcgat 1200gtcgttcact tcgaagactt aaccagccat tggcacgcat
tagggctagc gcaagaggcg 1260agcgggcgta cgttaacgga ggcgtatcgt
gaatttctca atctatcaat ttcaagcacg 1320tatagtagcg cgatacatgc
gagacgcatg atcaggtcac gagcagtaca tccgatcttt 1380ttaggatcaa
cgcactacga tattacatat gaggctttaa aaaataatgc gcagagaata
1440gtctatgatg aggaactgca aatgcatatt ctaaggggac ctttgcattt
tcaacgccga 1500gccattctgg gagcgctgaa atttggaatc aaaatattag
gcgataaaat tgatgttccc 1560ctcttcttac gaaatgcatg a
1581532DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5ggccgaattc tgaatgttaa atgttatact tt
32666DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6cccgggatcg atggatcctt tttatagcta attagtcacg
tacctttgag agtaccactt 60cagcta 66766DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7ggatccatcg atcccgggtt tttatgacta gttaatcacg gccgcttata aagatctaaa
60atgcat 66830DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 8ggctgcaggt attctaaact aggaatagat
30941DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9tcgttaatta attagagctt ctttattcta tacttaaaaa g
411056DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10aaaacccggg atcgattcta gactcgaggg tacctacgat
acaaacttaa cggata 561125DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 11ttatttagaa attatgcatt ttaga
251225DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12gttctcgtag gagagaacta ttgac
25134879DNAArtificial SequenceDescription of Artificial Sequence
Synthetic pCXL148.2 donor plasmid sequence 13ttaccagtgg ctgctgccag
tggcgataag tcgtgtctta ccgggttgga ctcaagacga 60tagttaccgg ataaggcgca
gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 120ttggagcgaa
cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc
180acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt
cggaacagga 240gagcgcacga gggagcttcc agggggaaac gcctggtatc
tttatagtcc tgtcgggttt 300cgccacctct gacttgagcg tcgatttttg
tgatgctcgt caggggggcg gagcctatgg 360aaaaacgcca gcaacgcggc
ctttttacgg ttcctggcct tttgctggcc ttttgctcac 420atgttctttc
ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga
480gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag
cgaggaagcg 540gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt
ggccgattca ttaatgcagc 600tggcacgaca ggtttcccga ctggaaagcg
ggcagtgagc gcaacgcaat taatgtgagt 660tagctcactc attaggcacc
ccaggcttta cactttatgc ttccggctcg tatgttgtgt 720ggaattgtga
gcggataaca atttcacaca ggaaacagct atgaccatga ttacgaattg
780cggccgcaat tctgaatgtt aaatgttata ctttggatga agctataaat
atgcattgga 840aaaataatcc atttaaagaa aggattcaaa tactacaaaa
cctaagcgat aatatgttaa 900ctaagcttat tcttaacgac gctttaaata
tacacaaata aacataattt ttgtataacc 960taacaaataa ctaaaacata
aaaataataa aaggaaatgt aatatcgtaa ttattttact 1020caggaatggg
gttaaatatt tatatcacgt gtatatctat actgttatcg tatactcttt
1080acaattacta ttacgaatat gcaagagata ataagattac gtatttaaga
gaatcttgtc 1140atgataattg ggtacgacat agtgataaat gctatttcgc
atcgttacat aaagtcagtt 1200ggaaagatgg atttgacaga tgtaacttaa
taggtgcaaa aatgttaaat aacagcattc 1260tatcggaaga taggatacca
gttatattat acaaaaatca ctggttggat aaaacagatt 1320ctgcaatatt
cgtaaaagat gaagattact gcgaatttgt aaactatgac aataaaaagc
1380catttatctc aacgacatcg tgtaattctt ccatgtttta tgtatgtgtt
tcagatatta 1440tgagattact ataaactttt tgtatactta tattccgtaa
actatattaa tcatgaagaa 1500aatgaaaaag tatagaagct gttcacgagc
ggttgttgaa aacaacaaaa ttatacattc 1560aagatggctt acatatacgt
ctgtgaggct atcatggata atgacaatgc atctctaaat 1620aggtttttgg
acaatggatt cgaccctaac acggaatatg gtactctaca atctcctctt
1680gaaatggctg taatgttcaa gaataccgag gctataaaaa tcttgatgag
gtatggagct 1740aaacctgtag ttactgaatg cacaacttct tgtctgcatg
atgcggtgtt gagagacgac 1800tacaaaatag tgaaagatct gttgaagaat
aactatgtaa acaatgttct ttacagcgga 1860ggctttactc ctttgtgttt
ggcagcttac cttaacaaag ttaatttggt taaacttcta 1920ttggctcatt
cggcggatgt agatatttca aacacggatc ggttaactcc tctacatata
1980gccgtatcaa ataaaaattt aacaatggtt aaacttctat tgaacaaagg
tgctgatact 2040gacttgctgg ataacatggg acgtactcct ttaatgatcg
ctgtacaatc tggaaatatt 2100gaaatatgta gcacactact taaaaaaaat
aaaatgtcca gaactgggaa aaattgatct 2160tgccagctgt aattcatggt
agaaaagaag tgctcaggct acttttcaac aaaggagcag 2220atgtaaacta
catctttgaa agaaatggaa aatcatatac tgttttggaa ttgattaaag
2280aaagttactc tgagacacaa aagaggtagc tgaagtggta ctctcaaagg
tacgtgacta 2340attagctata aaaaggatcc gggttaatta attagtcatc
aggcagggcg agaacgagac 2400tatctgctcg ttaattaatt agagcttctt
tattctatac ttaaaaagtg aaaataaata 2460caaaggttct tgagggttgt
gttaaattga aagcgagaaa taatcataaa ttatttcatt 2520atcgcgatat
ccgttaagtt tgtatcgtag gtaccctcga gtctagaatc gatcccgggt
2580ttttatgact agttaatcac ggccgcttat aaagatctaa aatgcataat
ttctaaataa 2640tgaaaaaaag tacatcatga gcaacgcgtt agtatatttt
acaatggaga ttaacgctct 2700ataccgttct atgtttattg attcagatga
tgttttagaa aagaaagtta ttgaatatga 2760aaactttaat gaagatgaag
atgacgacga tgattattgt tgtaaatctg ttttagatga 2820agaagatgac
gcgctaaagt atactatggt tacaaagtat aagtctatac tactaatggc
2880gacttgtgca agaaggtata gtatagtgaa aatgttgtta gattatgatt
atgaaaaacc 2940aaataaatca gatccatatc taaaggtatc tcctttgcac
ataatttcat ctattcctag 3000tttagaatac ctgcagccaa gcttggcact
ggccgtcgtt ttacaacgtc gtgactggga 3060aaaccctggc gttacccaac
ttaatcgcct tgcagcacat ccccctttcg ccagctggcg 3120taatagcgaa
gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga
3180atggcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac
accgcatatg 3240gtgcactctc agtacaatct gctctgatgc cgcatagtta
agccagcccc gacacccgcc 3300aacacccgct gacgcgccct gacgggcttg
tctgctcccg gcatccgctt acagacaagc 3360tgtgaccgtc tccgggagct
gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc 3420gagacgaaag
ggcctcgtga tacgcctatt tttataggtt aatgtcatga taataatggt
3480ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta
tttgtttatt 3540tttctaaata cattcaaata tgtatccgct catgagacaa
taaccctgat aaatgcttca 3600ataatattga aaaaggaaga gtatgagtat
tcaacatttc cgtgtcgccc ttattccctt 3660ttttgcggca ttttgccttc
ctgtttttgc tcacccagaa acgctggtga aagtaaaaga 3720tgctgaagat
cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa
3780gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt
ttaaagttct 3840gctatgtggc gcggtattat cccgtattga cgccgggcaa
gagcaactcg gtcgccgcat 3900acactattct cagaatgact tggttgagta
ctcaccagtc acagaaaagc atcttacgga 3960tggcatgaca gtaagagaat
tatgcagtgc tgccataacc atgagtgata acactgcggc 4020caacttactt
ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat
4080gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag
ccataccaaa 4140cgacgagcgt gacaccacga tgcctgtagc aatggcaaca
acgttgcgca aactattaac 4200tggcgaacta cttactctag cttcccggca
acaattaata gactggatgg aggcggataa 4260agttgcagga ccacttctgc
gctcggccct tccggctggc tggtttattg ctgataaatc 4320tggagccggt
gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc
4380ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg
aacgaaatag 4440acagatcgct gagataggtg cctcactgat taagcattgg
taactgtcag accaagttta 4500ctcatatata ctttagattg
atttaaaact tcatttttaa tttaaaagga tctaggtgaa 4560gatccttttt
gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc
4620gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc
tgcgcgtaat 4680ctgctgcttg caaacaaaaa aaccaccgct accagcggtg
gtttgtttgc cggatcaaga 4740gctaccaact ctttttccga aggtaactgg
cttcagcaga gcgcagatac caaatactgt 4800ccttctagtg tagccgtagt
taggccacca cttcaagaac tctgtagcac cgcctacata 4860cctcgctctg
ctaatcctg 48791472DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 14gcgctcgagt ttttattcaa aattgaaaat
atataattac aatataaaat gggcaagatc 60atcaagagcc tg
721548DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15atctcgagat aaaaatcatc aggcgttcct caggaacagg
ggcacgtc 481625DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 16gaatctgtta gttagttact tggat
251725DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17tgattatagc tattatcaca gactc 251812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18aattgcggcc gc 12196795DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 19ggaaacagct atgaccatga ttacgaattg cggccgcaat tctgaatgtt
aaatgttata 60ctttggatga agctataaat atgcattgga aaaataatcc atttaaagaa
aggattcaaa 120tactacaaaa cctaagcgat aatatgttaa ctaagcttat
tcttaacgac gctttaaata 180tacacaaata aacataattt ttgtataacc
taacaaataa ctaaaacata aaaataataa 240aaggaaatgt aatatcgtaa
ttattttact caggaatggg gttaaatatt tatatcacgt 300gtatatctat
actgttatcg tatactcttt acaattacta ttacgaatat gcaagagata
360ataagattac gtatttaaga gaatcttgtc atgataattg ggtacgacat
agtgataaat 420gctatttcgc atcgttacat aaagtcagtt ggaaagatgg
atttgacaga tgtaacttaa 480taggtgcaaa aatgttaaat aacagcattc
tatcggaaga taggatacca gttatattat 540acaaaaatca ctggttggat
aaaacagatt ctgcaatatt cgtaaaagat gaagattact 600gcgaatttgt
aaactatgac aataaaaagc catttatctc aacgacatcg tgtaattctt
660ccatgtttta tgtatgtgtt tcagatatta tgagattact ataaactttt
tgtatactta 720tattccgtaa actatattaa tcatgaagaa aatgaaaaag
tatagaagct gttcacgagc 780ggttgttgaa aacaacaaaa ttatacattc
aagatggctt acatatacgt ctgtgaggct 840atcatggata atgacaatgc
atctctaaat aggtttttgg acaatggatt cgaccctaac 900acggaatatg
gtactctaca atctcctctt gaaatggctg taatgttcaa gaataccgag
960gctataaaaa tcttgatgag gtatggagct aaacctgtag ttactgaatg
cacaacttct 1020tgtctgcatg atgcggtgtt gagagacgac tacaaaatag
tgaaagatct gttgaagaat 1080aactatgtaa acaatgttct ttacagcgga
ggctttactc ctttgtgttt ggcagcttac 1140cttaacaaag ttaatttggt
taaacttcta ttggctcatt cggcggatgt agatatttca 1200aacacggatc
ggttaactcc tctacatata gccgtatcaa ataaaaattt aacaatggtt
1260aaacttctat tgaacaaagg tgctgatact gacttgctgg ataacatggg
acgtactcct 1320ttaatgatcg ctgtacaatc tggaaatatt gaaatatgta
gcacactact taaaaaaaat 1380aaaatgtcca gaactgggaa aaattgatct
tgccagctgt aattcatggt agaaaagaag 1440tgctcaggct acttttcaac
aaaggagcag atgtaaacta catctttgaa agaaatggaa 1500aatcatatac
tgttttggaa ttgattaaag aaagttactc tgagacacaa aagaggtagc
1560tgaagtggta ctctcaaagg tacgtgacta attagctata aaaaggatcc
gggttaatta 1620attagtcatc aggcagggcg agaacgagac tatctgctcg
ttaattaatt agagcttctt 1680tattctatac ttaaaaagtg aaaataaata
caaaggttct tgagggttgt gttaaattga 1740aagcgagaaa taatcataaa
ttatttcatt atcgcgatat ccgttaagtt tgtatcgta 1799atg gag gag ttc gtg
atc ccc gtg tac agc gag gac gag atc ccc tac 1847Met Glu Glu Phe Val
Ile Pro Val Tyr Ser Glu Asp Glu Ile Pro Tyr 1 5 10 15gcc ctg ctg
agc aga tac cct ctg gcc atc cag acc aac gtg aag atc 1895Ala Leu Leu
Ser Arg Tyr Pro Leu Ala Ile Gln Thr Asn Val Lys Ile 20 25 30gag gac
gtg gag ggc aag cac aac gtg gtg aag atc ccc gag agc gac 1943Glu Asp
Val Glu Gly Lys His Asn Val Val Lys Ile Pro Glu Ser Asp 35 40 45atg
atc gac atc ccc cgg ctg acc atc gtg gag gcc atg aac tac aag 1991Met
Ile Asp Ile Pro Arg Leu Thr Ile Val Glu Ala Met Asn Tyr Lys 50 55
60ccc gcc agg aac gac ggc atc gtg gtg cct aga ctg ctg gac atc acc
2039Pro Ala Arg Asn Asp Gly Ile Val Val Pro Arg Leu Leu Asp Ile Thr
65 70 75 80ctg aga gcc tac gac gac cgg aag agc acc aag agc gcc aga
ggc atc 2087Leu Arg Ala Tyr Asp Asp Arg Lys Ser Thr Lys Ser Ala Arg
Gly Ile 85 90 95gag ttc atg acc aac gcc cgg tgg atg aag tgg gcc atc
gac gac agg 2135Glu Phe Met Thr Asn Ala Arg Trp Met Lys Trp Ala Ile
Asp Asp Arg 100 105 110atg gac atc cag ccc ctg aag gtg acc ctg gac
cac tac tgc agc gtg 2183Met Asp Ile Gln Pro Leu Lys Val Thr Leu Asp
His Tyr Cys Ser Val 115 120 125aat cac cag ctg ttc aac tgc gtg gtg
aag gcc aac gcc gcc aat gcc 2231Asn His Gln Leu Phe Asn Cys Val Val
Lys Ala Asn Ala Ala Asn Ala 130 135 140gac acc atc tac tac gac tac
ttc ccc ctg gag gac cac aag aag cgg 2279Asp Thr Ile Tyr Tyr Asp Tyr
Phe Pro Leu Glu Asp His Lys Lys Arg145 150 155 160tgc aac cac acc
aac ctg gac ctg ctg agg agc ctg acc aac atg gag 2327Cys Asn His Thr
Asn Leu Asp Leu Leu Arg Ser Leu Thr Asn Met Glu 165 170 175ctg ttc
cac gcc ctg cag gga gcc gcc tac agc atc aag agc agc tac 2375Leu Phe
His Ala Leu Gln Gly Ala Ala Tyr Ser Ile Lys Ser Ser Tyr 180 185
190gaa ctg gtg gcc aac agc gag aga gag agc ctg gag gag acc tac gcc
2423Glu Leu Val Ala Asn Ser Glu Arg Glu Ser Leu Glu Glu Thr Tyr Ala
195 200 205atc ggc cag cct aag tgg atc cac ctg acc agg ggc acc aga
atc ggc 2471Ile Gly Gln Pro Lys Trp Ile His Leu Thr Arg Gly Thr Arg
Ile Gly 210 215 220aac agc ggc ctg cct tac gag aga ttc atc agc agc
atg gtg cag gtg 2519Asn Ser Gly Leu Pro Tyr Glu Arg Phe Ile Ser Ser
Met Val Gln Val225 230 235 240atc gtg aac ggc aag atc cct agc gag
atc gcc aac gag gtg gcc cag 2567Ile Val Asn Gly Lys Ile Pro Ser Glu
Ile Ala Asn Glu Val Ala Gln 245 250 255ctg aac aga atc cgg gcc gag
tgg atc gcc gcc acc tac gac aga ggc 2615Leu Asn Arg Ile Arg Ala Glu
Trp Ile Ala Ala Thr Tyr Asp Arg Gly 260 265 270agg atc aga gcc ctg
gag ctg tgc aag atc ctg agc acc atc ggc cgg 2663Arg Ile Arg Ala Leu
Glu Leu Cys Lys Ile Leu Ser Thr Ile Gly Arg 275 280 285aag atc ctg
aat acc cac gag gag ccc aag gac gag atg gac ctg tcc 2711Lys Ile Leu
Asn Thr His Glu Glu Pro Lys Asp Glu Met Asp Leu Ser 290 295 300acc
cgg ttc cag ttc aag ctg gac gag aag ttc aac agg acc gac ccc 2759Thr
Arg Phe Gln Phe Lys Leu Asp Glu Lys Phe Asn Arg Thr Asp Pro305 310
315 320gag cac gtg aat atc ttc gga gtg agg gcc cct gcc acc gac gag
ggc 2807Glu His Val Asn Ile Phe Gly Val Arg Ala Pro Ala Thr Asp Glu
Gly 325 330 335aga ttc tac gcc ctg atc gcc att gcc gcc acc gac acc
cag aag ggc 2855Arg Phe Tyr Ala Leu Ile Ala Ile Ala Ala Thr Asp Thr
Gln Lys Gly 340 345 350aga gtg tgg agg acc aac ccc tac cct tgc ctg
aga ggc gcc ctg gtg 2903Arg Val Trp Arg Thr Asn Pro Tyr Pro Cys Leu
Arg Gly Ala Leu Val 355 360 365gcc gcc gag tgc gag ctg ggc gac gtg
tac agc acc ctg cgg agg gtg 2951Ala Ala Glu Cys Glu Leu Gly Asp Val
Tyr Ser Thr Leu Arg Arg Val 370 375 380tac aga tgg agc ctg aga cct
gag tac ggc cag cac gag aga cag ctg 2999Tyr Arg Trp Ser Leu Arg Pro
Glu Tyr Gly Gln His Glu Arg Gln Leu385 390 395 400gag aac aac aag
tac gtg ttc aac cgg atc aac ctg ttc gac agc aat 3047Glu Asn Asn Lys
Tyr Val Phe Asn Arg Ile Asn Leu Phe Asp Ser Asn 405 410 415ctg gcc
gtg ggc gac cag atc atc cac tgg cgc tac gag gtg aag gcc 3095Leu Ala
Val Gly Asp Gln Ile Ile His Trp Arg Tyr Glu Val Lys Ala 420 425
430tcc gcc gag acc acc tac gat agc ggc tac atg tgc agg cac gag gtg
3143Ser Ala Glu Thr Thr Tyr Asp Ser Gly Tyr Met Cys Arg His Glu Val
435 440 445gag gag gac gag ctg ctg tgt aag atc aac gag gac aag tac
aag gac 3191Glu Glu Asp Glu Leu Leu Cys Lys Ile Asn Glu Asp Lys Tyr
Lys Asp 450 455 460atg ctg gac cgg atg atc cag ggc ggc tgg gat cag
gag agg ttc aag 3239Met Leu Asp Arg Met Ile Gln Gly Gly Trp Asp Gln
Glu Arg Phe Lys465 470 475 480ctg cac aac atc ctg acc gac ccc aac
ctg ctg aca atc gac ttc gag 3287Leu His Asn Ile Leu Thr Asp Pro Asn
Leu Leu Thr Ile Asp Phe Glu 485 490 495aag gac gcc tac ctg aac agc
aga agc gag ctg gtg ttc ccc gac tac 3335Lys Asp Ala Tyr Leu Asn Ser
Arg Ser Glu Leu Val Phe Pro Asp Tyr 500 505 510ttc gac aag tgg atc
agc agc ccc atg ttc aac gcc cgg ctg aga atc 3383Phe Asp Lys Trp Ile
Ser Ser Pro Met Phe Asn Ala Arg Leu Arg Ile 515 520 525acc aag ggc
gag atc ggc acc agc aag aag gac gac ccc tgg aac aac 3431Thr Lys Gly
Glu Ile Gly Thr Ser Lys Lys Asp Asp Pro Trp Asn Asn 530 535 540aga
gcc gtg cgg ggc tac atc aag agc cct gcc gag tcc ctg gac ttc 3479Arg
Ala Val Arg Gly Tyr Ile Lys Ser Pro Ala Glu Ser Leu Asp Phe545 550
555 560gtg ctg ggc ccc tac tac gat ctg cgg ctg ctg ttc ttc ggc gag
gcc 3527Val Leu Gly Pro Tyr Tyr Asp Leu Arg Leu Leu Phe Phe Gly Glu
Ala 565 570 575ctg agc ctg aag cag gag cag agc gcc gtg ttc cag tac
ctg agc cag 3575Leu Ser Leu Lys Gln Glu Gln Ser Ala Val Phe Gln Tyr
Leu Ser Gln 580 585 590ctg gac gac ttc ccc gcc ctg acc cag ctg acc
ggc gac gcc gtg tgt 3623Leu Asp Asp Phe Pro Ala Leu Thr Gln Leu Thr
Gly Asp Ala Val Cys 595 600 605cct cac agc ggc gga gcc ctg tac acc
ttc agg aag gtg gcc ctg ttc 3671Pro His Ser Gly Gly Ala Leu Tyr Thr
Phe Arg Lys Val Ala Leu Phe 610 615 620ctg atc ggc aac tac gag aag
ctg agc ccc gac ctg cac gag ggc atg 3719Leu Ile Gly Asn Tyr Glu Lys
Leu Ser Pro Asp Leu His Glu Gly Met625 630 635 640gag cac cag acc
tac gtg cac ccc agc acc ggc ggc acc tac cag aaa 3767Glu His Gln Thr
Tyr Val His Pro Ser Thr Gly Gly Thr Tyr Gln Lys 645 650 655tgc gtg
ctg gag atg aag gac ccc tgc cag ctg atg tgc ttc gtg atc 3815Cys Val
Leu Glu Met Lys Asp Pro Cys Gln Leu Met Cys Phe Val Ile 660 665
670gac tac atc ttc gag aag cgg gag cag ctg aga gac acc aag gag gcc
3863Asp Tyr Ile Phe Glu Lys Arg Glu Gln Leu Arg Asp Thr Lys Glu Ala
675 680 685cgg tac atc gtg tac ctg atc cag agc ctg acc ggc atc cag
aga ctg 3911Arg Tyr Ile Val Tyr Leu Ile Gln Ser Leu Thr Gly Ile Gln
Arg Leu 690 695 700gac gtg ctg aag agc acc ttc ccc aac ttc ttc cag
cgg ctg ctg atg 3959Asp Val Leu Lys Ser Thr Phe Pro Asn Phe Phe Gln
Arg Leu Leu Met705 710 715 720ctg aag gag atc aag ttt gtg cgg gac
ctg aac gtg atc aac ttc ctg 4007Leu Lys Glu Ile Lys Phe Val Arg Asp
Leu Asn Val Ile Asn Phe Leu 725 730 735ccc ctg atg ttc ctg gtg cac
gac aac atc agc tac agc cac cgg cag 4055Pro Leu Met Phe Leu Val His
Asp Asn Ile Ser Tyr Ser His Arg Gln 740 745 750tgg agc atc cct atg
gtg ctg ttc gac gac acc atc aag ctg atc cct 4103Trp Ser Ile Pro Met
Val Leu Phe Asp Asp Thr Ile Lys Leu Ile Pro 755 760 765gtg gaa gtg
ggc gcc tac gcc aac aga ttc ggc ttc aag agc ttc atg 4151Val Glu Val
Gly Ala Tyr Ala Asn Arg Phe Gly Phe Lys Ser Phe Met 770 775 780aac
ttc acc agg ttc cac cct ggc gag agc aag aag aag cag atc gcc 4199Asn
Phe Thr Arg Phe His Pro Gly Glu Ser Lys Lys Lys Gln Ile Ala785 790
795 800gag gac gtg cac aag gag ttc ggc gtg gtg gcc ttc gag tac tac
acc 4247Glu Asp Val His Lys Glu Phe Gly Val Val Ala Phe Glu Tyr Tyr
Thr 805 810 815aac acc aag atc agc cag ggc agc gtg cac acc ccc gtg
atg acc acc 4295Asn Thr Lys Ile Ser Gln Gly Ser Val His Thr Pro Val
Met Thr Thr 820 825 830aag atg gat gtg ctg aaa atc cac ctg agc agc
ctg tgt gcc ggc ctg 4343Lys Met Asp Val Leu Lys Ile His Leu Ser Ser
Leu Cys Ala Gly Leu 835 840 845gcc gac agc atc gtg tac acc ctg ccc
gtg gcc cac ccc aag aag tgc 4391Ala Asp Ser Ile Val Tyr Thr Leu Pro
Val Ala His Pro Lys Lys Cys 850 855 860atc gtg ctg atc att gtg ggc
gac gac aag ctg gag cct cac acc aga 4439Ile Val Leu Ile Ile Val Gly
Asp Asp Lys Leu Glu Pro His Thr Arg865 870 875 880tcc gag cag atc
gtg tcc cgg tac aac tac agc cgg aag cac atc tgc 4487Ser Glu Gln Ile
Val Ser Arg Tyr Asn Tyr Ser Arg Lys His Ile Cys 885 890 895ggc gtg
gtg tcc gtg aca gtg ggc cag aac agc cag ctg aga gtg tac 4535Gly Val
Val Ser Val Thr Val Gly Gln Asn Ser Gln Leu Arg Val Tyr 900 905
910acc agc ggc atc gtg aag cac aga gtg tgc gac aag ttc atc ctg aag
4583Thr Ser Gly Ile Val Lys His Arg Val Cys Asp Lys Phe Ile Leu Lys
915 920 925cac aaa tgc aag gtg atc ctg gtg agg atg ccc ggc tac gtg
ttc ggc 4631His Lys Cys Lys Val Ile Leu Val Arg Met Pro Gly Tyr Val
Phe Gly 930 935 940aac gac gag ctg atg acc aag ctg ctg aat gtg
tgatgactcg agtttttatt 4684Asn Asp Glu Leu Met Thr Lys Leu Leu Asn
Val945 950 955caaaattgaa aatatataat tacaatataa a atg ggc aag atc
atc aag agc 4736 Met Gly Lys Ile Ile Lys Ser 960ctg agc cgc ttc ggc
aag aaa gtg ggc aat gcc ctg acc agc aac acc 4784Leu Ser Arg Phe Gly
Lys Lys Val Gly Asn Ala Leu Thr Ser Asn Thr 965 970 975gcc aag aag
atc tac agc acc atc ggc aag gcc gcc gag aga ttc gcc 4832Ala Lys Lys
Ile Tyr Ser Thr Ile Gly Lys Ala Ala Glu Arg Phe Ala 980 985 990gag
agc gag atc gga gcc gcc acc atc gac ggc ctg gtg cag ggc agc 4880Glu
Ser Glu Ile Gly Ala Ala Thr Ile Asp Gly Leu Val Gln Gly Ser995 1000
1005 1010gtg cac agc atc atc acc ggc gag agc tac ggc gag agc gtg
aag cag 4928Val His Ser Ile Ile Thr Gly Glu Ser Tyr Gly Glu Ser Val
Lys Gln 1015 1020 1025gcc gtg ctg ctg aac gtg ctg ggc aca ggc gag
gag ctg ccc gac ccc 4976Ala Val Leu Leu Asn Val Leu Gly Thr Gly Glu
Glu Leu Pro Asp Pro 1030 1035 1040ctg agc cct ggc gag aga ggc atc
cag acc aag atc aag gag ctg gag 5024Leu Ser Pro Gly Glu Arg Gly Ile
Gln Thr Lys Ile Lys Glu Leu Glu 1045 1050 1055gac gag cag aga aac
gag ctg gtg cgg ctg aag tac aac aag gag atc 5072Asp Glu Gln Arg Asn
Glu Leu Val Arg Leu Lys Tyr Asn Lys Glu Ile 1060 1065 1070acc aag
gag ttc ggc aag gaa ctg gaa gag gtg tac gac ttc atg aac 5120Thr Lys
Glu Phe Gly Lys Glu Leu Glu Glu Val Tyr Asp Phe Met Asn1075 1080
1085 1090ggc gag gcc aag gag gag gag gtg gtg caa gaa cag tac agc
atg ctg 5168Gly Glu Ala Lys Glu Glu Glu Val Val Gln Glu Gln Tyr Ser
Met Leu 1095 1100 1105tgc aag gcc gtg gac agc tac gag aag atc ctg
aag gcc gag gac tcc 5216Cys Lys Ala Val Asp Ser Tyr Glu Lys Ile Leu
Lys Ala Glu Asp Ser 1110 1115 1120aag atg gcc atg ctg gcc aga gcc
ctg cag agg gag gcc agc gag aga 5264Lys Met Ala Met Leu Ala Arg Ala
Leu Gln Arg Glu Ala Ser Glu Arg 1125 1130 1135agc cag gac gag atc
aag atg gtg aag gag tac cgg cag aag atc gac 5312Ser Gln Asp Glu Ile
Lys Met Val Lys Glu Tyr Arg Gln Lys Ile Asp 1140 1145 1150gcc ctg
aag aac gcc atc gag atc gag agg gac ggc atg cag gag gag 5360Ala Leu
Lys Asn Ala Ile Glu Ile Glu Arg Asp Gly Met Gln Glu Glu1155 1160
1165 1170gcc atc caa gaa atc gcc ggc atg acc gcc gac gtg ctg gag
gcc gcc 5408Ala Ile Gln Glu Ile Ala Gly Met Thr Ala Asp Val Leu Glu
Ala Ala 1175 1180 1185agc gag gag gtg ccc ctg att ggc gcc gga atg
gcc acc gcc gtg gcc 5456Ser Glu Glu Val Pro Leu Ile Gly Ala Gly Met
Ala Thr Ala Val Ala 1190 1195 1200acc ggc aga gcc atc gag ggc gcc
tac aag ctg aag aag gtg atc aac 5504Thr Gly Arg Ala Ile Glu Gly Ala
Tyr Lys Leu Lys Lys Val Ile Asn 1205 1210 1215gcc ctg agc ggc atc
gac ctg agc cac atg agg agc ccc aag
atc gag 5552Ala Leu Ser Gly Ile Asp Leu Ser His Met Arg Ser Pro Lys
Ile Glu 1220 1225 1230cct acc atc atc gcc acc acc ctg gag cac cgg
ttc aag gag atc cct 5600Pro Thr Ile Ile Ala Thr Thr Leu Glu His Arg
Phe Lys Glu Ile Pro1235 1240 1245 1250gac gag cag ctg gcc gtg tcc
gtg ctg aac aag aaa acc gcc gtg acc 5648Asp Glu Gln Leu Ala Val Ser
Val Leu Asn Lys Lys Thr Ala Val Thr 1255 1260 1265gac aac tgc aac
gag atc gcc cac atc aag cag gag atc ctg ccc aag 5696Asp Asn Cys Asn
Glu Ile Ala His Ile Lys Gln Glu Ile Leu Pro Lys 1270 1275 1280ttc
aag cag atc atg gac gag gag aag gag atc gag ggc atc gag gac 5744Phe
Lys Gln Ile Met Asp Glu Glu Lys Glu Ile Glu Gly Ile Glu Asp 1285
1290 1295aag gtg atc cac ccc cgg gtg atg atg agg ttc aag atc ccc
aga acc 5792Lys Val Ile His Pro Arg Val Met Met Arg Phe Lys Ile Pro
Arg Thr 1300 1305 1310cag cag cct cag atc cac atc tat gcc gcc cct
tgg gac agc gac gac 5840Gln Gln Pro Gln Ile His Ile Tyr Ala Ala Pro
Trp Asp Ser Asp Asp1315 1320 1325 1330gtg ttc ttc ttc cac tgc gtg
tcc cac cac cac agg aac gag agc ttc 5888Val Phe Phe Phe His Cys Val
Ser His His His Arg Asn Glu Ser Phe 1335 1340 1345ttc ctg ggc ttc
gac ctg ggc atc gac gtg gtg cac ttc gag gat ctg 5936Phe Leu Gly Phe
Asp Leu Gly Ile Asp Val Val His Phe Glu Asp Leu 1350 1355 1360acc
agc cac tgg cac gcc ctg ggc ctg gcc cag gag gcc tcc ggc aga 5984Thr
Ser His Trp His Ala Leu Gly Leu Ala Gln Glu Ala Ser Gly Arg 1365
1370 1375acc ctg acc gag gcc tac agg gag ttc ctg aac ctg agc atc
agc agc 6032Thr Leu Thr Glu Ala Tyr Arg Glu Phe Leu Asn Leu Ser Ile
Ser Ser 1380 1385 1390acc tac agc agc gcc atc cac gcc cgg aga atg
atc aga tcc agg gcc 6080Thr Tyr Ser Ser Ala Ile His Ala Arg Arg Met
Ile Arg Ser Arg Ala1395 1400 1405 1410gtg cac cct atc ttt ctg ggc
agc acc cac tac gac atc acc tac gag 6128Val His Pro Ile Phe Leu Gly
Ser Thr His Tyr Asp Ile Thr Tyr Glu 1415 1420 1425gcc ctg aaa aac
aac gcc cag cgg atc gtg tac gat gag gag ctg cag 6176Ala Leu Lys Asn
Asn Ala Gln Arg Ile Val Tyr Asp Glu Glu Leu Gln 1430 1435 1440atg
cac atc ctg aga ggc cct ctg cac ttc cag agg aga gcc atc ctg 6224Met
His Ile Leu Arg Gly Pro Leu His Phe Gln Arg Arg Ala Ile Leu 1445
1450 1455ggc gcc ctg aag ttc ggc atc aag atc ctg ggc gac aag atc
gac gtg 6272Gly Ala Leu Lys Phe Gly Ile Lys Ile Leu Gly Asp Lys Ile
Asp Val 1460 1465 1470ccc ctg ttc ctg agg aac gcc tgatgatttt
tatctcgagt ctagaatcga 6323Pro Leu Phe Leu Arg Asn Ala1475
1480tcccgggttt ttatgactag ttaatcacgg ccgcttataa agatctaaaa
tgcataattt 6383ctaaataatg aaaaaaagta catcatgagc aacgcgttag
tatattttac aatggagatt 6443aacgctctat accgttctat gtttattgat
tcagatgatg ttttagaaaa gaaagttatt 6503gaatatgaaa actttaatga
agatgaagat gacgacgatg attattgttg taaatctgtt 6563ttagatgaag
aagatgacgc gctaaagtat actatggtta caaagtataa gtctatacta
6623ctaatggcga cttgtgcaag aaggtatagt atagtgaaaa tgttgttaga
ttatgattat 6683gaaaaaccaa ataaatcaga tccatatcta aaggtatctc
ctttgcacat aatttcatct 6743attcctagtt tagaatacct gcagccaagc
ttggcactgg ccgtcgtttt ac 679520955PRTArtificial SequenceDescription
of Artificial Sequence Synthetic protein sequence 20Met Glu Glu Phe
Val Ile Pro Val Tyr Ser Glu Asp Glu Ile Pro Tyr 1 5 10 15Ala Leu
Leu Ser Arg Tyr Pro Leu Ala Ile Gln Thr Asn Val Lys Ile 20 25 30Glu
Asp Val Glu Gly Lys His Asn Val Val Lys Ile Pro Glu Ser Asp 35 40
45Met Ile Asp Ile Pro Arg Leu Thr Ile Val Glu Ala Met Asn Tyr Lys
50 55 60Pro Ala Arg Asn Asp Gly Ile Val Val Pro Arg Leu Leu Asp Ile
Thr 65 70 75 80Leu Arg Ala Tyr Asp Asp Arg Lys Ser Thr Lys Ser Ala
Arg Gly Ile 85 90 95Glu Phe Met Thr Asn Ala Arg Trp Met Lys Trp Ala
Ile Asp Asp Arg 100 105 110Met Asp Ile Gln Pro Leu Lys Val Thr Leu
Asp His Tyr Cys Ser Val 115 120 125Asn His Gln Leu Phe Asn Cys Val
Val Lys Ala Asn Ala Ala Asn Ala 130 135 140Asp Thr Ile Tyr Tyr Asp
Tyr Phe Pro Leu Glu Asp His Lys Lys Arg145 150 155 160Cys Asn His
Thr Asn Leu Asp Leu Leu Arg Ser Leu Thr Asn Met Glu 165 170 175Leu
Phe His Ala Leu Gln Gly Ala Ala Tyr Ser Ile Lys Ser Ser Tyr 180 185
190Glu Leu Val Ala Asn Ser Glu Arg Glu Ser Leu Glu Glu Thr Tyr Ala
195 200 205Ile Gly Gln Pro Lys Trp Ile His Leu Thr Arg Gly Thr Arg
Ile Gly 210 215 220Asn Ser Gly Leu Pro Tyr Glu Arg Phe Ile Ser Ser
Met Val Gln Val225 230 235 240Ile Val Asn Gly Lys Ile Pro Ser Glu
Ile Ala Asn Glu Val Ala Gln 245 250 255Leu Asn Arg Ile Arg Ala Glu
Trp Ile Ala Ala Thr Tyr Asp Arg Gly 260 265 270Arg Ile Arg Ala Leu
Glu Leu Cys Lys Ile Leu Ser Thr Ile Gly Arg 275 280 285Lys Ile Leu
Asn Thr His Glu Glu Pro Lys Asp Glu Met Asp Leu Ser 290 295 300Thr
Arg Phe Gln Phe Lys Leu Asp Glu Lys Phe Asn Arg Thr Asp Pro305 310
315 320Glu His Val Asn Ile Phe Gly Val Arg Ala Pro Ala Thr Asp Glu
Gly 325 330 335Arg Phe Tyr Ala Leu Ile Ala Ile Ala Ala Thr Asp Thr
Gln Lys Gly 340 345 350Arg Val Trp Arg Thr Asn Pro Tyr Pro Cys Leu
Arg Gly Ala Leu Val 355 360 365Ala Ala Glu Cys Glu Leu Gly Asp Val
Tyr Ser Thr Leu Arg Arg Val 370 375 380Tyr Arg Trp Ser Leu Arg Pro
Glu Tyr Gly Gln His Glu Arg Gln Leu385 390 395 400Glu Asn Asn Lys
Tyr Val Phe Asn Arg Ile Asn Leu Phe Asp Ser Asn 405 410 415Leu Ala
Val Gly Asp Gln Ile Ile His Trp Arg Tyr Glu Val Lys Ala 420 425
430Ser Ala Glu Thr Thr Tyr Asp Ser Gly Tyr Met Cys Arg His Glu Val
435 440 445Glu Glu Asp Glu Leu Leu Cys Lys Ile Asn Glu Asp Lys Tyr
Lys Asp 450 455 460Met Leu Asp Arg Met Ile Gln Gly Gly Trp Asp Gln
Glu Arg Phe Lys465 470 475 480Leu His Asn Ile Leu Thr Asp Pro Asn
Leu Leu Thr Ile Asp Phe Glu 485 490 495Lys Asp Ala Tyr Leu Asn Ser
Arg Ser Glu Leu Val Phe Pro Asp Tyr 500 505 510Phe Asp Lys Trp Ile
Ser Ser Pro Met Phe Asn Ala Arg Leu Arg Ile 515 520 525Thr Lys Gly
Glu Ile Gly Thr Ser Lys Lys Asp Asp Pro Trp Asn Asn 530 535 540Arg
Ala Val Arg Gly Tyr Ile Lys Ser Pro Ala Glu Ser Leu Asp Phe545 550
555 560Val Leu Gly Pro Tyr Tyr Asp Leu Arg Leu Leu Phe Phe Gly Glu
Ala 565 570 575Leu Ser Leu Lys Gln Glu Gln Ser Ala Val Phe Gln Tyr
Leu Ser Gln 580 585 590Leu Asp Asp Phe Pro Ala Leu Thr Gln Leu Thr
Gly Asp Ala Val Cys 595 600 605Pro His Ser Gly Gly Ala Leu Tyr Thr
Phe Arg Lys Val Ala Leu Phe 610 615 620Leu Ile Gly Asn Tyr Glu Lys
Leu Ser Pro Asp Leu His Glu Gly Met625 630 635 640Glu His Gln Thr
Tyr Val His Pro Ser Thr Gly Gly Thr Tyr Gln Lys 645 650 655Cys Val
Leu Glu Met Lys Asp Pro Cys Gln Leu Met Cys Phe Val Ile 660 665
670Asp Tyr Ile Phe Glu Lys Arg Glu Gln Leu Arg Asp Thr Lys Glu Ala
675 680 685Arg Tyr Ile Val Tyr Leu Ile Gln Ser Leu Thr Gly Ile Gln
Arg Leu 690 695 700Asp Val Leu Lys Ser Thr Phe Pro Asn Phe Phe Gln
Arg Leu Leu Met705 710 715 720Leu Lys Glu Ile Lys Phe Val Arg Asp
Leu Asn Val Ile Asn Phe Leu 725 730 735Pro Leu Met Phe Leu Val His
Asp Asn Ile Ser Tyr Ser His Arg Gln 740 745 750Trp Ser Ile Pro Met
Val Leu Phe Asp Asp Thr Ile Lys Leu Ile Pro 755 760 765Val Glu Val
Gly Ala Tyr Ala Asn Arg Phe Gly Phe Lys Ser Phe Met 770 775 780Asn
Phe Thr Arg Phe His Pro Gly Glu Ser Lys Lys Lys Gln Ile Ala785 790
795 800Glu Asp Val His Lys Glu Phe Gly Val Val Ala Phe Glu Tyr Tyr
Thr 805 810 815Asn Thr Lys Ile Ser Gln Gly Ser Val His Thr Pro Val
Met Thr Thr 820 825 830Lys Met Asp Val Leu Lys Ile His Leu Ser Ser
Leu Cys Ala Gly Leu 835 840 845Ala Asp Ser Ile Val Tyr Thr Leu Pro
Val Ala His Pro Lys Lys Cys 850 855 860Ile Val Leu Ile Ile Val Gly
Asp Asp Lys Leu Glu Pro His Thr Arg865 870 875 880Ser Glu Gln Ile
Val Ser Arg Tyr Asn Tyr Ser Arg Lys His Ile Cys 885 890 895Gly Val
Val Ser Val Thr Val Gly Gln Asn Ser Gln Leu Arg Val Tyr 900 905
910Thr Ser Gly Ile Val Lys His Arg Val Cys Asp Lys Phe Ile Leu Lys
915 920 925His Lys Cys Lys Val Ile Leu Val Arg Met Pro Gly Tyr Val
Phe Gly 930 935 940Asn Asp Glu Leu Met Thr Lys Leu Leu Asn Val945
950 95521526PRTArtificial SequenceDescription of Artificial
Sequence Synthetic protein sequence 21Met Gly Lys Ile Ile Lys Ser
Leu Ser Arg Phe Gly Lys Lys Val Gly 1 5 10 15Asn Ala Leu Thr Ser
Asn Thr Ala Lys Lys Ile Tyr Ser Thr Ile Gly 20 25 30Lys Ala Ala Glu
Arg Phe Ala Glu Ser Glu Ile Gly Ala Ala Thr Ile 35 40 45Asp Gly Leu
Val Gln Gly Ser Val His Ser Ile Ile Thr Gly Glu Ser 50 55 60Tyr Gly
Glu Ser Val Lys Gln Ala Val Leu Leu Asn Val Leu Gly Thr 65 70 75
80Gly Glu Glu Leu Pro Asp Pro Leu Ser Pro Gly Glu Arg Gly Ile Gln
85 90 95Thr Lys Ile Lys Glu Leu Glu Asp Glu Gln Arg Asn Glu Leu Val
Arg 100 105 110Leu Lys Tyr Asn Lys Glu Ile Thr Lys Glu Phe Gly Lys
Glu Leu Glu 115 120 125Glu Val Tyr Asp Phe Met Asn Gly Glu Ala Lys
Glu Glu Glu Val Val 130 135 140Gln Glu Gln Tyr Ser Met Leu Cys Lys
Ala Val Asp Ser Tyr Glu Lys145 150 155 160Ile Leu Lys Ala Glu Asp
Ser Lys Met Ala Met Leu Ala Arg Ala Leu 165 170 175Gln Arg Glu Ala
Ser Glu Arg Ser Gln Asp Glu Ile Lys Met Val Lys 180 185 190Glu Tyr
Arg Gln Lys Ile Asp Ala Leu Lys Asn Ala Ile Glu Ile Glu 195 200
205Arg Asp Gly Met Gln Glu Glu Ala Ile Gln Glu Ile Ala Gly Met Thr
210 215 220Ala Asp Val Leu Glu Ala Ala Ser Glu Glu Val Pro Leu Ile
Gly Ala225 230 235 240Gly Met Ala Thr Ala Val Ala Thr Gly Arg Ala
Ile Glu Gly Ala Tyr 245 250 255Lys Leu Lys Lys Val Ile Asn Ala Leu
Ser Gly Ile Asp Leu Ser His 260 265 270Met Arg Ser Pro Lys Ile Glu
Pro Thr Ile Ile Ala Thr Thr Leu Glu 275 280 285His Arg Phe Lys Glu
Ile Pro Asp Glu Gln Leu Ala Val Ser Val Leu 290 295 300Asn Lys Lys
Thr Ala Val Thr Asp Asn Cys Asn Glu Ile Ala His Ile305 310 315
320Lys Gln Glu Ile Leu Pro Lys Phe Lys Gln Ile Met Asp Glu Glu Lys
325 330 335Glu Ile Glu Gly Ile Glu Asp Lys Val Ile His Pro Arg Val
Met Met 340 345 350Arg Phe Lys Ile Pro Arg Thr Gln Gln Pro Gln Ile
His Ile Tyr Ala 355 360 365Ala Pro Trp Asp Ser Asp Asp Val Phe Phe
Phe His Cys Val Ser His 370 375 380His His Arg Asn Glu Ser Phe Phe
Leu Gly Phe Asp Leu Gly Ile Asp385 390 395 400Val Val His Phe Glu
Asp Leu Thr Ser His Trp His Ala Leu Gly Leu 405 410 415Ala Gln Glu
Ala Ser Gly Arg Thr Leu Thr Glu Ala Tyr Arg Glu Phe 420 425 430Leu
Asn Leu Ser Ile Ser Ser Thr Tyr Ser Ser Ala Ile His Ala Arg 435 440
445Arg Met Ile Arg Ser Arg Ala Val His Pro Ile Phe Leu Gly Ser Thr
450 455 460His Tyr Asp Ile Thr Tyr Glu Ala Leu Lys Asn Asn Ala Gln
Arg Ile465 470 475 480Val Tyr Asp Glu Glu Leu Gln Met His Ile Leu
Arg Gly Pro Leu His 485 490 495Phe Gln Arg Arg Ala Ile Leu Gly Ala
Leu Lys Phe Gly Ile Lys Ile 500 505 510Leu Gly Asp Lys Ile Asp Val
Pro Leu Phe Leu Arg Asn Ala 515 520 525229380DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 22gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat
gcagctggca 60cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg
tgagttagct 120cactcattag gcaccccagg ctttacactt tatgcttccg
gctcgtatgt tgtgtggaat 180tgtgagcgga taacaatttc acacaggaaa
cagctatgac catgattacg aattgcggcc 240gcaattctga atgttaaatg
ttatactttg gatgaagcta taaatatgca ttggaaaaat 300aatccattta
aagaaaggat tcaaatacta caaaacctaa gcgataatat gttaactaag
360cttattctta acgacgcttt aaatatacac aaataaacat aatttttgta
taacctaaca 420aataactaaa acataaaaat aataaaagga aatgtaatat
cgtaattatt ttactcagga 480atggggttaa atatttatat cacgtgtata
tctatactgt tatcgtatac tctttacaat 540tactattacg aatatgcaag
agataataag attacgtatt taagagaatc ttgtcatgat 600aattgggtac
gacatagtga taaatgctat ttcgcatcgt tacataaagt cagttggaaa
660gatggatttg acagatgtaa cttaataggt gcaaaaatgt taaataacag
cattctatcg 720gaagatagga taccagttat attatacaaa aatcactggt
tggataaaac agattctgca 780atattcgtaa aagatgaaga ttactgcgaa
tttgtaaact atgacaataa aaagccattt 840atctcaacga catcgtgtaa
ttcttccatg ttttatgtat gtgtttcaga tattatgaga 900ttactataaa
ctttttgtat acttatattc cgtaaactat attaatcatg aagaaaatga
960aaaagtatag aagctgttca cgagcggttg ttgaaaacaa caaaattata
cattcaagat 1020ggcttacata tacgtctgtg aggctatcat ggataatgac
aatgcatctc taaataggtt 1080tttggacaat ggattcgacc ctaacacgga
atatggtact ctacaatctc ctcttgaaat 1140ggctgtaatg ttcaagaata
ccgaggctat aaaaatcttg atgaggtatg gagctaaacc 1200tgtagttact
gaatgcacaa cttcttgtct gcatgatgcg gtgttgagag acgactacaa
1260aatagtgaaa gatctgttga agaataacta tgtaaacaat gttctttaca
gcggaggctt 1320tactcctttg tgtttggcag cttaccttaa caaagttaat
ttggttaaac ttctattggc 1380tcattcggcg gatgtagata tttcaaacac
ggatcggtta actcctctac atatagccgt 1440atcaaataaa aatttaacaa
tggttaaact tctattgaac aaaggtgctg atactgactt 1500gctggataac
atgggacgta ctcctttaat gatcgctgta caatctggaa atattgaaat
1560atgtagcaca ctacttaaaa aaaataaaat gtccagaact gggaaaaatt
gatcttgcca 1620gctgtaattc atggtagaaa agaagtgctc aggctacttt
tcaacaaagg agcagatgta 1680aactacatct ttgaaagaaa tggaaaatca
tatactgttt tggaattgat taaagaaagt 1740tactctgaga cacaaaagag
gtagctgaag tggtactctc aaaggtacgt gactaattag 1800ctataaaaag
gatccgggtt aattaattag tcatcaggca gggcgagaac gagactatct
1860gctcgttaat taattagagc ttctttattc tatacttaaa aagtgaaaat
aaatacaaag 1920gttcttgagg gttgtgttaa attgaaagcg agaaataatc
ataaattatt tcattatcgc 1980gatatccgtt aagtttgtat cgtaatggag
gagttcgtga tccccgtgta cagcgaggac 2040gagatcccct acgccctgct
gagcagatac cctctggcca tccagaccaa cgtgaagatc 2100gaggacgtgg
agggcaagca caacgtggtg aagatccccg agagcgacat gatcgacatc
2160ccccggctga ccatcgtgga ggccatgaac tacaagcccg ccaggaacga
cggcatcgtg 2220gtgcctagac tgctggacat caccctgaga gcctacgacg
accggaagag caccaagagc 2280gccagaggca tcgagttcat gaccaacgcc
cggtggatga agtgggccat cgacgacagg 2340atggacatcc agcccctgaa
ggtgaccctg gaccactact gcagcgtgaa tcaccagctg 2400ttcaactgcg
tggtgaaggc caacgccgcc aatgccgaca ccatctacta cgactacttc
2460cccctggagg accacaagaa gcggtgcaac cacaccaacc tggacctgct
gaggagcctg 2520accaacatgg agctgttcca cgccctgcag ggagccgcct
acagcatcaa gagcagctac 2580gaactggtgg ccaacagcga gagagagagc
ctggaggaga cctacgccat cggccagcct 2640aagtggatcc acctgaccag
gggcaccaga atcggcaaca gcggcctgcc ttacgagaga 2700ttcatcagca
gcatggtgca ggtgatcgtg aacggcaaga tccctagcga
gatcgccaac 2760gaggtggccc agctgaacag aatccgggcc gagtggatcg
ccgccaccta cgacagaggc 2820aggatcagag ccctggagct gtgcaagatc
ctgagcacca tcggccggaa gatcctgaat 2880acccacgagg agcccaagga
cgagatggac ctgtccaccc ggttccagtt caagctggac 2940gagaagttca
acaggaccga ccccgagcac gtgaatatct tcggagtgag ggcccctgcc
3000accgacgagg gcagattcta cgccctgatc gccattgccg ccaccgacac
ccagaagggc 3060agagtgtgga ggaccaaccc ctacccttgc ctgagaggcg
ccctggtggc cgccgagtgc 3120gagctgggcg acgtgtacag caccctgcgg
agggtgtaca gatggagcct gagacctgag 3180tacggccagc acgagagaca
gctggagaac aacaagtacg tgttcaaccg gatcaacctg 3240ttcgacagca
atctggccgt gggcgaccag atcatccact ggcgctacga ggtgaaggcc
3300tccgccgaga ccacctacga tagcggctac atgtgcaggc acgaggtgga
ggaggacgag 3360ctgctgtgta agatcaacga ggacaagtac aaggacatgc
tggaccggat gatccagggc 3420ggctgggatc aggagaggtt caagctgcac
aacatcctga ccgaccccaa cctgctgaca 3480atcgacttcg agaaggacgc
ctacctgaac agcagaagcg agctggtgtt ccccgactac 3540ttcgacaagt
ggatcagcag ccccatgttc aacgcccggc tgagaatcac caagggcgag
3600atcggcacca gcaagaagga cgacccctgg aacaacagag ccgtgcgggg
ctacatcaag 3660agccctgccg agtccctgga cttcgtgctg ggcccctact
acgatctgcg gctgctgttc 3720ttcggcgagg ccctgagcct gaagcaggag
cagagcgccg tgttccagta cctgagccag 3780ctggacgact tccccgccct
gacccagctg accggcgacg ccgtgtgtcc tcacagcggc 3840ggagccctgt
acaccttcag gaaggtggcc ctgttcctga tcggcaacta cgagaagctg
3900agccccgacc tgcacgaggg catggagcac cagacctacg tgcaccccag
caccggcggc 3960acctaccaga aatgcgtgct ggagatgaag gacccctgcc
agctgatgtg cttcgtgatc 4020gactacatct tcgagaagcg ggagcagctg
agagacacca aggaggcccg gtacatcgtg 4080tacctgatcc agagcctgac
cggcatccag agactggacg tgctgaagag caccttcccc 4140aacttcttcc
agcggctgct gatgctgaag gagatcaagt ttgtgcggga cctgaacgtg
4200atcaacttcc tgcccctgat gttcctggtg cacgacaaca tcagctacag
ccaccggcag 4260tggagcatcc ctatggtgct gttcgacgac accatcaagc
tgatccctgt ggaagtgggc 4320gcctacgcca acagattcgg cttcaagagc
ttcatgaact tcaccaggtt ccaccctggc 4380gagagcaaga agaagcagat
cgccgaggac gtgcacaagg agttcggcgt ggtggccttc 4440gagtactaca
ccaacaccaa gatcagccag ggcagcgtgc acacccccgt gatgaccacc
4500aagatggatg tgctgaaaat ccacctgagc agcctgtgtg ccggcctggc
cgacagcatc 4560gtgtacaccc tgcccgtggc ccaccccaag aagtgcatcg
tgctgatcat tgtgggcgac 4620gacaagctgg agcctcacac cagatccgag
cagatcgtgt cccggtacaa ctacagccgg 4680aagcacatct gcggcgtggt
gtccgtgaca gtgggccaga acagccagct gagagtgtac 4740accagcggca
tcgtgaagca cagagtgtgc gacaagttca tcctgaagca caaatgcaag
4800gtgatcctgg tgaggatgcc cggctacgtg ttcggcaacg acgagctgat
gaccaagctg 4860ctgaatgtgt gatgactcga gtttttattc aaaattgaaa
atatataatt acaatataaa 4920atgggcaaga tcatcaagag cctgagccgc
ttcggcaaga aagtgggcaa tgccctgacc 4980agcaacaccg ccaagaagat
ctacagcacc atcggcaagg ccgccgagag attcgccgag 5040agcgagatcg
gagccgccac catcgacggc ctggtgcagg gcagcgtgca cagcatcatc
5100accggcgaga gctacggcga gagcgtgaag caggccgtgc tgctgaacgt
gctgggcaca 5160ggcgaggagc tgcccgaccc cctgagccct ggcgagagag
gcatccagac caagatcaag 5220gagctggagg acgagcagag aaacgagctg
gtgcggctga agtacaacaa ggagatcacc 5280aaggagttcg gcaaggaact
ggaagaggtg tacgacttca tgaacggcga ggccaaggag 5340gaggaggtgg
tgcaagaaca gtacagcatg ctgtgcaagg ccgtggacag ctacgagaag
5400atcctgaagg ccgaggactc caagatggcc atgctggcca gagccctgca
gagggaggcc 5460agcgagagaa gccaggacga gatcaagatg gtgaaggagt
accggcagaa gatcgacgcc 5520ctgaagaacg ccatcgagat cgagagggac
ggcatgcagg aggaggccat ccaagaaatc 5580gccggcatga ccgccgacgt
gctggaggcc gccagcgagg aggtgcccct gattggcgcc 5640ggaatggcca
ccgccgtggc caccggcaga gccatcgagg gcgcctacaa gctgaagaag
5700gtgatcaacg ccctgagcgg catcgacctg agccacatga ggagccccaa
gatcgagcct 5760accatcatcg ccaccaccct ggagcaccgg ttcaaggaga
tccctgacga gcagctggcc 5820gtgtccgtgc tgaacaagaa aaccgccgtg
accgacaact gcaacgagat cgcccacatc 5880aagcaggaga tcctgcccaa
gttcaagcag atcatggacg aggagaagga gatcgagggc 5940atcgaggaca
aggtgatcca cccccgggtg atgatgaggt tcaagatccc cagaacccag
6000cagcctcaga tccacatcta tgccgcccct tgggacagcg acgacgtgtt
cttcttccac 6060tgcgtgtccc accaccacag gaacgagagc ttcttcctgg
gcttcgacct gggcatcgac 6120gtggtgcact tcgaggatct gaccagccac
tggcacgccc tgggcctggc ccaggaggcc 6180tccggcagaa ccctgaccga
ggcctacagg gagttcctga acctgagcat cagcagcacc 6240tacagcagcg
ccatccacgc ccggagaatg atcagatcca gggccgtgca ccctatcttt
6300ctgggcagca cccactacga catcacctac gaggccctga aaaacaacgc
ccagcggatc 6360gtgtacgatg aggagctgca gatgcacatc ctgagaggcc
ctctgcactt ccagaggaga 6420gccatcctgg gcgccctgaa gttcggcatc
aagatcctgg gcgacaagat cgacgtgccc 6480ctgttcctga ggaacgcctg
atgattttta tctcgagtct agaatcgatc ccgggttttt 6540atgactagtt
aatcacggcc gcttataaag atctaaaatg cataatttct aaataatgaa
6600aaaaagtaca tcatgagcaa cgcgttagta tattttacaa tggagattaa
cgctctatac 6660cgttctatgt ttattgattc agatgatgtt ttagaaaaga
aagttattga atatgaaaac 6720tttaatgaag atgaagatga cgacgatgat
tattgttgta aatctgtttt agatgaagaa 6780gatgacgcgc taaagtatac
tatggttaca aagtataagt ctatactact aatggcgact 6840tgtgcaagaa
ggtatagtat agtgaaaatg ttgttagatt atgattatga aaaaccaaat
6900aaatcagatc catatctaaa ggtatctcct ttgcacataa tttcatctat
tcctagttta 6960gaatacctgc agccaagctt ggcactggcc gtcgttttac
aacgtcgtga ctgggaaaac 7020cctggcgtta cccaacttaa tcgccttgca
gcacatcccc ctttcgccag ctggcgtaat 7080agcgaagagg cccgcaccga
tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg 7140cgcctgatgc
ggtattttct ccttacgcat ctgtgcggta tttcacaccg catatggtgc
7200actctcagta caatctgctc tgatgccgca tagttaagcc agccccgaca
cccgccaaca 7260cccgctgacg cgccctgacg ggcttgtctg ctcccggcat
ccgcttacag acaagctgtg 7320accgtctccg ggagctgcat gtgtcagagg
ttttcaccgt catcaccgaa acgcgcgaga 7380cgaaagggcc tcgtgatacg
cctattttta taggttaatg tcatgataat aatggtttct 7440tagacgtcag
gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc
7500taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
gcttcaataa 7560tattgaaaaa ggaagagtat gagtattcaa catttccgtg
tcgcccttat tccctttttt 7620gcggcatttt gccttcctgt ttttgctcac
ccagaaacgc tggtgaaagt aaaagatgct 7680gaagatcagt tgggtgcacg
agtgggttac atcgaactgg atctcaacag cggtaagatc 7740cttgagagtt
ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta
7800tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg
ccgcatacac 7860tattctcaga atgacttggt tgagtactca ccagtcacag
aaaagcatct tacggatggc 7920atgacagtaa gagaattatg cagtgctgcc
ataaccatga gtgataacac tgcggccaac 7980ttacttctga caacgatcgg
aggaccgaag gagctaaccg cttttttgca caacatgggg 8040gatcatgtaa
ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac
8100gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact
attaactggc 8160gaactactta ctctagcttc ccggcaacaa ttaatagact
ggatggaggc ggataaagtt 8220gcaggaccac ttctgcgctc ggcccttccg
gctggctggt ttattgctga taaatctgga 8280gccggtgagc gtgggtctcg
cggtatcatt gcagcactgg ggccagatgg taagccctcc 8340cgtatcgtag
ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag
8400atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
agtttactca 8460tatatacttt agattgattt aaaacttcat ttttaattta
aaaggatcta ggtgaagatc 8520ctttttgata atctcatgac caaaatccct
taacgtgagt tttcgttcca ctgagcgtca 8580gaccccgtag aaaagatcaa
aggatcttct tgagatcctt tttttctgcg cgtaatctgc 8640tgcttgcaaa
caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta
8700ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa
tactgtcctt 8760ctagtgtagc cgtagttagg ccaccacttc aagaactctg
tagcaccgcc tacatacctc 8820gctctgctaa tcctgttacc agtggctgct
gccagtggcg ataagtcgtg tcttaccggg 8880ttggactcaa gacgatagtt
accggataag gcgcagcggt cgggctgaac ggggggttcg 8940tgcacacagc
ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag
9000ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc
ggtaagcggc 9060agggtcggaa caggagagcg cacgagggag cttccagggg
gaaacgcctg gtatctttat 9120agtcctgtcg ggtttcgcca cctctgactt
gagcgtcgat ttttgtgatg ctcgtcaggg 9180gggcggagcc tatggaaaaa
cgccagcaac gcggcctttt tacggttcct ggccttttgc 9240tggccttttg
ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt
9300accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
cagcgagtca 9360gtgagcgagg aagcggaaga 93802372DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 23gcgctcgagt ttttattcaa aattgaaaat atataattac aatataaa atg
ggc aag 57 Met Gly Lys 1atc atc aag agc ctg 72Ile Ile Lys Ser Leu
5248PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 24Met Gly Lys Ile Ile Lys Ser Leu 1
52548DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide sequence 25atctcgagat aaaaatcatc aggcgttcct
caggaacagg ggcacgtc 48269PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 26Ala Asn Arg Leu Phe Leu Pro
Val Asp 1 5
* * * * *
References