U.S. patent number 7,794,929 [Application Number 10/384,491] was granted by the patent office on 2010-09-14 for genomic screen for epigenetically silenced genes associated with cancer.
This patent grant is currently assigned to The Johns Hopkins University School of Medicine. Invention is credited to Stephen B. Baylin, James Herman, David Sidransky, Hiromu Suzuki.
United States Patent |
7,794,929 |
Baylin , et al. |
September 14, 2010 |
Genomic screen for epigenetically silenced genes associated with
cancer
Abstract
A method of identifying epigenetically silenced genes, e.g.,
methylation silenced genes, in cancer cells is provided. In
addition, methods of identifying a cancer by detecting epigenetic
silencing of gene expression are provided, as are methods of
treating a subject having such a cancer, for example, a colorectal
cancer and/or gastric cancer. Reagents for practicing such methods
also are provided.
Inventors: |
Baylin; Stephen B. (Baltimore,
MD), Herman; James (Baltimore, MD), Suzuki; Hiromu
(Sapporo, JP), Sidransky; David (Baltimore, MD) |
Assignee: |
The Johns Hopkins University School
of Medicine (Baltimore, MD)
|
Family
ID: |
27805174 |
Appl.
No.: |
10/384,491 |
Filed: |
March 7, 2003 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20030224040 A1 |
Dec 4, 2003 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60362422 |
Mar 7, 2002 |
|
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
A61P
35/00 (20180101); C12Q 1/6809 (20130101); C12Q
1/6886 (20130101); C12Q 1/6809 (20130101); C12Q
2537/164 (20130101); C12Q 2600/154 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101) |
Field of
Search: |
;435/6,91.1,91.2 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 01/77377 |
|
Oct 2001 |
|
WO |
|
WO 02/00927 |
|
Jan 2002 |
|
WO |
|
WO 0200927 |
|
Jan 2002 |
|
WO |
|
Other References
Eads et al., "Epigenetic Patterns in the Progression of Esophageal
Adenocarcinoma," Cancer Research, Apr. 15, 2001, vol. 61, pp.
3410-3418. cited by examiner .
Shi et al., "Oligonucleotide-Based Microarray for DNA Methylation
Analysis: Principles and Applications," Journal of Cellular
Biochmistry, 2003, vol. 88, pp. 138-143. cited by examiner .
Yang et al., "Transcriptional Activation of Estrogen Receptor I in
Human Brest Cancer Cells by Histone Deacetylase Inhibition," Cancer
Research, Dec. 2000, vol. 60, pp. 6890-6894. cited by examiner
.
Liang et al., "Analysis of Gene Induction in Human Fibroblasts and
Bladder Cancer Cells Exposed to the Methylation Inhibitor
5-Aza-2'-deoxycytidine," Cancer Research, Feb. 15, 2002, vol. 62,
pp. 961-966. cited by examiner .
Toyota et al., "Inactivation of CACNA1G, a T-Type Calcium Channel
Gene, by Aberrant Methylation of Its 5' CpG Island in Human
Tumors," Cancer Research, Sep. 15, 1999, vol. 59, pp. 4535-4541.
cited by examiner .
Nephew et al., "Epigenetic gene silencing in cancer initiation and
progression," Cancer Letters, 2003, vol. 190, pp. 125-133. cited by
examiner .
Cameron et al., "Synergy of demethylation and histone deacetylase
inhibition in the re-expression of genes silenced in cancer,"
Nature Genetics, Jan. 1999, vol. 21, pp. 103-107. cited by examiner
.
Bachman et al., "Methylation-associated Silencing of the Tissue
Inhibitor of Metallaoproteinase-3 Gene Suggests a Suppressor in
Kidney, Brain, and Other Human Cancers.sup.1" Cancer Research,
59:798-802 (1999). cited by other .
Baylin et al., "Abnormal Patterns of DNA Methylation in Human
Neoplasia: Potential Consequences for Tumor Progression," Cancer
Cells, 3 (10):383-390 (1991). cited by other .
Baylin, Stephen B., "DNA hypermethylation in tumorigenesis,
epigenetics joins genetics," TIG 16 (4):168-174 (2000). cited by
other .
Cameron et al., "Synergy of demethylation and histone deacetylase
inhibition in the re-expression of genes silenced in cancer,"
Nature Genetics, 21:103-107. cited by other .
Chetcuti et al., "Loss of Annexin II Heavy and Light Chains in
Prostate Cancer and Its Precursors.sup.1" Cancer Research,
61:6331-6334 (2001). cited by other .
Esteller et al., "A Gene Hypermethylation Profile of Human
Cancer,.sup.1" Cancer Research, 61:3225-3229 (2001). cited by other
.
Graff et al., "E-Cadherin Expression Is Silenced by DNA
Hypermethylation in Human Breast and Prosate Carcinomas.sup.1"
Cancer Research, 55:5195-5199 (1995). cited by other .
Herman et al., "Distinct Patterns of Inactivation of p15.sup.INK4B
and p16.sup.INK4A"Cancer Research, 57:837-841 (1997). cited by
other .
Herman et al., "Hypermethylation-associated Inactivation Indicates
a Tumor Suppressor Role for p15.sup.INK4B1" Cancer Research,
56:722-727 (1996). cited by other .
Herman et al., "Inactivation of the CDKN2/p16/MTS1 Gene Is
Frequently Associated with Aberrant DNA Methylation in All Common
Human Cancers.sup.1" Cancer Research, 55:4525-4530 (1995). cited by
other .
Herman et al., "Incidence and functional consequences of hMLH1
promoter hypermethylation in colorectal carcinoma," Proc. Natl.
Acad. Sci. USA, 95:6870-6875 (1998). cited by other .
Herman et al., "Methylation-specific PCR: A novel PCR assay for
methylation status of CpG islands," Proc. Natl. Acad. Sci. USA,
93:9821-9826 (1996). cited by other .
Herman et al., "Silencing of the VHL tumor-suppressor gene by DNA
methylation in renal carcinoma," Proc. Natl. Acad. Sci. USA,
91:9700-9704 (1994). cited by other .
Katzenellenbogen et al., "Hypermethylation of the DAP-Kinase CpG
Island Is a Common Alteration in B-Cell Malignancies," Blood, 93
(12):4347-4353 (1999). cited by other .
Makos et al., "Regional DNA Hypermethylation at D17S5 Precedes 17p
Structural Changes in the Progression of Renal Tumors.sup.1,"
Cancer Research, 53:2719 (1993). cited by other .
Melkonyan et al., "SARPs: A family of secreted apoptosis-related
proteins," Proc. Natl. Acad. Sci. USA, 94:13636-13641 (1997). cited
by other .
Ng et al., "Frequent Death-associated Protein Kinase Promoter
Hypermethylation in Multiple Myeloma.sup.1," Clinical
CancerResearch, 7:1724-1729 (2001). cited by other .
Ottaviano et al., "Methylation of the Estrogen Receptor Gene CpG
Island Marks Loss of Estrogen Receptor Expression in Human Breast
Cancer Cells.sup.1" Cancer Research, 54:2552-2555 (1994). cited by
other .
Sakai et al., "Allele-specific Hypermethylation of the
Retinoblastoma Tumor-suppressor Gene," Am. J. Hum. Genet,.
48:880-888 (1991). cited by other .
Smiraglia et al., "Excessive CpG island hypermethylation in cancer
cell lines versus primary human malignancies," Human Molecular
Genetics, 10 (3):1413-1419 (2001). cited by other .
Soengas et al., "Inactivation of the apoptosis effector Apaf-1 in
malignant melanoma," Nature, 409:207-211 (2001). cited by other
.
Sutcliffe et al., "Deletions of a differentially methylated CpG
island at the SNRPN gene define a putative imprinting control
region," Nature Genetics, 8:52-58 (1994). cited by other .
Suzuki et al., "A genomic screen for genes upregulated by
demethylation and histone deacetylase inhibition in human
colorectal cancer," nature genetics, 31:141-149 (2002). cited by
other .
Toyota et al., "Aberrant Methylation of the Cyclooxygenase 2 CpG
Island in Colorectal Tumors.sup.1" Cancer Research, 60:4044-4048
(2000). cited by other .
Toyota et al., "CpG island methylator phenotype in colorectal
cancer," Proc. Natl. Acad. Sci. USA, 96:8681-8686 (1999). cited by
other .
Ugolini et al., "Differential expression assay of chromosome arm 8p
genes identifies Frizzled-related (FRP1/FRZB) and Fibroblast Growth
Factor Receptor 1 (FGFR1) as candidate breast cancer genes,"
Oncogene, 18:1903-1910 (1999). cited by other .
Ugolini et al., "WNT pathway and mammary carcinogenesis: Loss of
expression of candidate tumor suppressor gene SFRP1 in most
invasive carcinomas except of the medullary type," Oncogene,
20:5810-5817 (2001). cited by other .
Xiong et al., "COBRA: a sensitive and quantitative DNA methylation
assay," Nucleic Acids Research, 25 (12):2532-2534 (1997). cited by
other .
Yoshikawa et al., "SOCS-1, a negative regulator of the JAK/STAT
pathway, is silenced by methylation in human hepatocellular
carcinoma and shows growth-suppression activity," nature genetics
28:29-35 (2001). cited by other .
Eads, et al., "Epigenetic Patterns in the Progression of Esophageal
Adenocarcinoma", Can Res. 61:3410-3418, (Apr. 15, 2001). cited by
other .
Shi, et al., "Oligonucleotide-Based Microarray for DNA Methylation
Analysis: Princeiples and Applications", Jour. Cell. Biochem.
88:138-143 (2003). cited by other .
Yang, et al., "Transcriptional Activation of Estrogen Receptor I in
Human Breat Cancer Cells by Histone Deacetylase Inhibition", Can
Res. 60:6890-6894 (Dec. 2000). cited by other .
Baylin et al., "Aberrant patterns of DNA methylation, chromatin
formation and gene expression in cancer," Human Molecular Genetics,
10 (7):687-692 (2001). cited by other .
Feinberg, Andrew P., "Methylation meets genomics," nature genetics,
27:9-10 (2001). cited by other .
Howard et al., "Identification of receptors for neuromedin U and
its role in feeding," Nature 406:70-74 (2000). cited by other .
Merlo et al., "5' CpG island methylation is associated with
transcriptional silencing of tumour suppressor p16/CDKN2/MTS1 in
human cancers," Nature Medicine, 1 (7):686-692 (1995). cited by
other .
Sasaki et al., "Colorectal carcinomas in mice lacking the catalytic
subunit of PI(3)KK," Nature, 406:897-902 (2000). cited by other
.
Shi et al., "Expressed CpG Island Sequence Tag Microarray for Dual
Screening of DNA Hypermethylation and Gene Silencing in Cancer
Cells.sup.1," Cancer Research, 62:3214-3220 (2002). cited by other
.
Steenman et al., "Loss of imprinting of IGF2 is linked to reduced
expression and abnormal methylation of H19 in Wilms' tumour,"
Nature Genetics, 7:433 (1994). cited by other .
Velcich et al., "Colorectal Cancer in Mice Genetically Deficient in
the Mucin Muc2," Science, 295:1726-1729 (2002) and Supplementary
Material pp. 1-8. cited by other .
Xu et al., "Artificial Neural Networks and Gene Filtering
Distinguish Between Global Gene Expression Profiles of Barrett's
Esophagus and Esophageal Cancer," Cancer Research, 62:3493-3497
(2002). cited by other .
Yamashita et al., "Pharmacologic unmasking of epigenetically
silenced tumor suppressor genes in esophageal squamous cell
carcinoma," Cancer Cell 2:485-495 (2002). cited by other .
Mariadason et al., "Genetic Reprogramming in Pathways of Colonic
Cell Maturation Induced by Short Chain Fatty Acids: Comparison with
Trichostatin A, Sulindac, and Curcumin and Implications for
Chemoprevention of Colon Cancer", Cancer Research, 60:4561-4575
(2000). cited by other .
Song et al., "Transcriptional Silencing of Cyclooxygenase-2 by
Hyper-Methylation of the 5' CpG Island in Human Gastric Carcinoma
Cells", Cancer Research, 61:4628-4635 (2001). cited by
other.
|
Primary Examiner: Kim; Young J
Attorney, Agent or Firm: DLA Piper LLP (US)
Government Interests
This invention was made in part with government support under Grant
No. CA54396 awarded by the National Cancer Institute. The United
States government may have certain rights in this invention.
Parent Case Text
This application claims the benefit of priority under 35 U.S.C.
.sctn.119(e)(1) of U.S. Ser. No. 60/362,422, filed Mar. 7, 2002,
the entire content of which is incorporated herein by reference.
Claims
What is claimed is:
1. A method of identifying at least one methylation silenced gene
associated with cancer, comprising: a) contacting an array of
nucleotide sequences representative of a genome with nucleic acid
subtraction products, wherein the nucleic acid subtraction products
are nucleic acid molecules corresponding to RNA expressed in cancer
cells that have been treated with a demethylating agent and an
inhibitor of histone deacetylase, under conditions suitable for
selective hybridization of the nucleic acid subtraction products to
complementary nucleotide sequences of the array; and b) detecting
selective hybridization of the nucleic acid subtraction products to
a subpopulation of nucleotide sequences of the array, wherein the
subpopulation of nucleotide sequences are not re-expressed in the
presence of the histone deacetylase inhibitor alone and only
re-expressed in the presence of the combination of at least one
demethylating agent and at least one histone deacetylase inhibitor,
wherein the detected subpopulation of nucleic acid sequences
represents silenced genes consisting of methylation silenced genes
comprising 5' CpG methylated islands of the cancer cells, thereby
identifying at least one methylation silenced gene associated with
cancer, wherein the at least one methylation silenced gene
comprises SFRP2.
2. The method of claim 1, wherein the nucleic acid molecules
corresponding to RNA comprise cDNA.
3. The method of claim 1, wherein the demethylating agent comprises
5-aza-2'-deoxycytidine.
4. The method of claim 1, wherein the at least one methylation
silenced gene is associated with one type of cancer.
5. The method of claim 1, wherein the at least one methylation
silenced gene further comprises PTGS2, CDKN2A, TIMP3, S100A10,
SFRP1, SFRP4, SFRP5, CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1,
SNRPN, or a combination thereof.
6. The method of claim 5, wherein the at least one methylation
silenced gene is associated with at least two types of cancer.
7. The method of claim 1, wherein the at least one methylation
silenced gene further comprises HOXA1, GRO3, DLX7, or a combination
thereof.
8. The method of claim 1, wherein the cancer is a carcinoma or a
sarcoma.
9. The method of claim 8, wherein the cancer is colorectal cancer,
gastric cancer, or colorectal cancer and gastric cancer.
10. The method of claim 1, wherein the at least one methylation
silenced gene further comprises SFRP1, SFRP4, SFRP5, or a
combination thereof.
11. The method of claim 1, wherein the at least one methylation
silenced gene is epigenetically silenced.
12. The method of claim 1, wherein the at least one methylation
silenced gene further comprises PTGS2, CDKN2A, TIMP3, S100A10,
SFRP1, SFRP4, SFRP5, CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1,
SNRPN, HOXA1, GRO3, DLX7, or a combination thereof.
13. The method of claim 1, wherein the at least one epigenetically
silenced gene further comprises POR1, MBNL, TRADD, PDIP, RAD23B,
RPL13, GNAI2, PPP1R21A, FPGT, TRIM32, or a combination thereof.
14. The method of claim 11, wherein the cancer is a carcinoma or a
sarcoma.
15. The method of claim 14, wherein the cancer is a colorectal
cancer, a gastric cancer, or a colorectal cancer and a gastric
cancer.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The invention relates generally to methods of detecting genes that
are epigenetically silenced in cancer cells, and more specifically
to a genomic screen useful for identifying colorectal cancer cells
and gastric cancer cells.
2. Background Information
Although cancers generally are considered to be due to genetic
changes such as mutations of a gene, it has become clear that
epigenetic mechanisms, which do not result in mutations of the DNA
sequence, also can result in cancers. The most commonly observed
epigenetic change involves silencing of gene expression due to
methylation of the gene sequence, particularly the 5' upstream gene
regulatory sequences. Methylation of cytosine residues located 5'
to guanosine in CpG dinucleotides, particularly in CpG-rich regions
(CpG islands), often is involved in the normal regulation of gene
expression in higher eukaryotes. For example, extensive methylation
of CpG islands is associated with transcriptional inactivation of
selected imprinted genes, as well as the genes on the inactivated X
chromosome in females. Aberrant methylation of normally
unmethylated CpG islands also has been found in immortalized and
transformed cells, and has been associated with transcriptional
inactivation of defined tumor suppressor genes in human
cancers.
Changes to genes that are associated with cancer, including
mutations that result in loss of expression of gene or expression
of a defective gene product, and epigenetic mechanisms such as
methylation-silencing of gene transcription, provide markers useful
for determining whether a cell is susceptible to loss of normal
growth control and, therefore, potentially a cancer cell. For
example, a mutation of the BRCA1 gene has been associated with
breast cancer. As such, diagnostic tests can be performed using
cells, for example, from a woman with a family history of breast
cancer to determine whether the woman has the BRCA1 mutation that
is a marker for breast cancer. The prostate specific antigen (PSA)
is another example of a marker, in this case for prostate cancer.
Although neither the defect resulting in expression of the PSA nor
the normal function of PSA in the body is known, PSA nevertheless
provides a valuable cancer marker because it allows the
identification of men predisposed to prostate cancer or at a very
early stage of the disease such that effective therapy can be
implemented. More recently, methylation-silenced transcription of a
suppressor of cytokine signaling/cytokine-inducible SH2 protein
family member, the SOCS-1 gene was found in various cancers,
including hepatocellular carcinoma, multiple myeloma, and acute
leukemias. As such, screening assays directed to detecting the
methylation status of the SOCS-1 gene can provide diagnostic
information relating to such cancer.
As cancer often is a silent disease that does not present clinical
signs or symptoms until the disease is well advanced, the
availability and use of markers that allow the identification of
individuals susceptible to a cancer, or even that allow detection
of a cancer at an early stage, can be of great benefit.
Unfortunately, such markers are not available for most cancers. As
such, many cancer patients do not seek medical assistance until the
cancer is at a stage that requires radical therapy, or is
untreatable. Thus, a need exists for markers that can be used to
detect cancer cells. The present invention satisfies this need and
provides additional advantages.
SUMMARY OF THE INVENTION
The present invention relates to methods of identifying
epigenetically silenced genes, for example, methylation silenced
genes, that are associated with a cancer. In one embodiment, the
present invention relates to a method of identifying at least one
epigenetically silenced gene associated with at least one cancer.
Such a method can be performed, for example, by contacting an array
of nucleotide sequences representative of a genome with nucleic
acid subtraction products, which comprise nucleic acid molecules
corresponding to RNA expressed in cancer cells contacted with at
least one agent that reactivates expression of epigenetically
silenced genes but not RNA expressed in normal cells corresponding
to the cancer cells, under conditions suitable for selective
hybridization of nucleic acid subtraction products to complementary
nucleotide sequences of the array; and detecting selective
hybridization of nucleic acid subtraction products to a
subpopulation of nucleotide sequences of the array, wherein nucleic
acid molecules corresponding to RNA expressed in the normal cells
corresponding the cancer cells do not hybridize to the
subpopulation of nucleotide sequences under such conditions
suitable for selective hybridization, whereby the nucleic acid
subtraction products that selectively hybridize to the
subpopulation of nucleotide sequences of the array represent
epigenetically silenced genes of the cancer cells, thereby
identifying at least one epigenetically silenced genes associated
with at least one cancer.
The agent that reactivates expression of epigenetically silenced
genes can be any such agent, for example, a methyltransferase
inhibitor (e.g., 5-aza-2'-deoxycytidine; DAC), a histone
deacetylase inhibitor (e.g., trichostatin A; TSA), or a combination
of agents such as a combination of DAC and TSA. Accordingly, in one
aspect of the present embodiment, the nucleic acid subtraction
products include nucleic acid molecules corresponding to RNA
expressed in cancer cells contacted with DAC or with TSA. In
another aspect, the nucleic acid subtraction products include
nucleic acid molecules corresponding to RNA expressed in cancer
cells contacted with DAC and TSA.
Epigenetically silenced genes associated with a cancer are
exemplified herein by the genes listed in Table 1. For example,
epigenetically silenced genes that can be reactivated due to
contact of cancer cells with DAC, i.e., methylation silenced genes,
are exemplified by PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, SFRP2,
SFRP4, SFRP5, CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN,
HOXA1, GRO3, DLX7. Similarly, epigenetically silenced genes that
can be reactivated due to contact of cancer cells with DAC and TSA
are exemplified by POR1, MBNL, TRADD, PDIP, RAD23B, RPL13, GNAI2,
PPP1R21A, FPGT, TRIM32, or a combination thereof.
A method of the invention can identify epigenetically silenced
genes associated with one or more cancers, including, for example,
one or more carcinomas and/or sarcomas. Such a method is
exemplified herein by identifying epigenetically silenced genes
associated with a colorectal cancer, with a gastric cancer, and
with a colorectal cancer and a gastric cancer.
In another embodiment, the present invention relates to a method of
identifying at least one methylation silenced gene associated with
at least one cancer. Such a method can be performed, for example,
by contacting an array of nucleotide sequences representative of a
genome with nucleic acid subtraction products, which comprise
nucleic acid molecules corresponding to RNA expressed in cancer
cells contacted with a demethylating agent but not nucleic acid
molecules corresponding to RNA expressed in normal cells
corresponding to the cancer cells, under conditions suitable for
selective hybridization of nucleic acid subtraction products to
complementary nucleotide sequences of the array; and detecting
selective hybridization of nucleic acid subtraction products to a
subpopulation of nucleotide sequences of the array, wherein nucleic
acid molecules corresponding to RNA expressed in the normal cells
corresponding the cancer cells do not hybridize to the
subpopulation of nucleotide sequences under said conditions
suitable for selective hybridization, whereby the nucleic acid
subtraction products that selectively hybridize to the
subpopulation of nucleotide sequences of the array represent
methylation silenced genes of the cancer cells, thereby identifying
at least one methylation silenced genes associated with at least
one cancer.
The nucleic acid molecules corresponding to RNA of a cancer cell
can be DNA (e.g., cDNA) or RNA (e.g., cRNA). Generally, the nucleic
acid molecules corresponding to RNA of a cell are detectably
labeled, for example, with a radioisotope, a paramagnetic isotope,
a luminescent compound, a chemiluminescent compound, a fluorescent
compound, a metal chelate, an enzyme, a substrate for an enzyme, a
receptor, or a ligand for a receptor; or are capable of being
detected, for example, using a detectably labeled probe, such that
hybridization of the nucleic acid molecules to nucleotide sequences
of the array can be detected.
According to a method of the invention, at least one (e.g., 1, 2,
3, 4, 5, or more) methylation silenced gene can be associated with
at least one (e.g. 1, 2, 3, or more) cancer. The cancer can be, for
example, a carcinoma or a sarcoma, including one or more specific
types of cancer, e.g., an alimentary/gastrointestinal tract cancer,
a liver cancer, a skin cancer, a breast cancer, an ovarian cancer,
a prostate cancer, a lymphoma, a leukemia, a kidney cancer, a lung
cancer, a muscle cancer, a bone cancer, or a brain cancer. In one
example, methylation silenced PTGS2, CDKN2A, TIMP3, S100A10, SFRP1,
CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3,
and DLX7 genes, alone or in combination, were identified as being
associated with colorectal cancer, gastric cancer, or both
colorectal cancer and gastric cancer. In another example, members
of a family of genes, including SFRP1, SFRP2, SFRP4, SFRP5, alone
or in combination, were identified as methylation silenced genes
associated with colorectal cancer and/or gastric cancer.
The present invention also relates to a method for identifying a
cell that exhibits or is predisposed to exhibiting unregulated
growth. Such a method can be performed, for example, by detecting,
in a test cell, epigenetic silencing of at least one gene as set
forth in Table 1, or a combination thereof, thereby identifying the
test cell as a cell that exhibits or is predisposed to exhibiting
unregulated growth. For example, the epigenetic silenced gene can
be a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, SFRP2, SFRP4, SFRP5,
CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3,
DLX7, POR1, MBNL, TRADD, PDIP, RAD23B, RPL13, GNAI2, PPP1R21A,
FPGT, or TRIM32 gene, or a combination of such genes. The cell
exhibiting, or predisposed to exhibiting unregulated growth, can be
a neoplastic cell, which can be, for example, a premalignant cell
such as a cell of a gastrointestinal polyp, or can be a cancer
cell, for example, a carcinoma cell such as a colorectal cancer
cell or a gastric cancer cell, or a sarcoma cell.
In one embodiment, the epigenetic silencing is methylation
silencing, and the method for identifying a cell that exhibits or
is predisposed to exhibiting unregulated growth is performed by
detecting methylation silencing. Methylation silencing can be
detected, for example, by contacting a region comprising a 5'
regulatory region of the nucleic acid molecule comprising the gene
with a methylation sensitive restriction endonuclease, which
cleaves a recognition site in the 5' regulatory region comprising a
methylated cytosine residue of a CpG dinucleotide, whereby cleavage
of the nucleic acid molecule is indicative of methylation silencing
of the gene of the test cell. For example, the methylation
sensitive restriction endonuclease is Acc III, Ban I, BstN I, Msp
I, or Xma I. Alternatively, or in addition, methylation silencing
can be detected by contacting a region comprising a 5' regulatory
region of the nucleic acid molecule comprising the gene with a
methylation sensitive restriction endonuclease, which cleaves a
recognition site in the 5' regulatory region comprising a
methylated cytosine residue of a CpG dinucleotide, provided the
cytosine residue of the CpG dinucleotide is unmethylated, whereby a
lack of cleavage of the nucleic acid molecule is indicative of
methylation silencing of the gene of the test cell. For example,
the methylation sensitive restriction endonuclease is Acc II, Ava
I, BssH II, BstU I, Hpa II, or Not I.
Methylation silencing of a gene also can be detected by contacting
a 5' regulatory region of the nucleic acid molecule comprising the
gene of the test cell with a chemical reagent that selectively
modifies either an unmethylated cytosine residue or a methylated
cytosine residue, and detecting a product generated due to said
contacting, wherein the product is indicative of methylation of a
cytosine residue in a CpG dinucleotide of the gene, thereby
detecting methylation silencing of the gene of the test cell. For
example, the product can be detected using an electrophoresis
method, a chromatography method, a mass spectrometry method, or a
combination of such methods.
In one aspect of the present method, the chemical reagent is
hydrazine, thereby producing a hydrazine treated 5' regulatory
region of the gene. Such a method can further include contacting
the hydrazine treated 5' regulatory region with a reagent that
cleaves hydrazine modified cytosine residues to generate a product
comprising fragments of the nucleic acid molecule comprising the
gene; separating the fragments according to molecular weight; and
detecting a gap at a position known to contain a cytosine residue
in the 5' regulatory region of the gene, wherein the gap is
indicative of methylation of a cytosine residue in the CpG
dinucleotide in the gene, thereby detecting methylation silencing
of the gene of the test cell. The reagent that cleaves the
hydrazine modified cytosine residue can be, for example,
piperidine.
In another aspect of the present method, the chemical reagent
comprises bisulfite ions, whereby unmethylated cytosine residues in
the 5' regulatory region of the gene are converted to bisulfite
modified cytosine residues. Such a method can further include
exposing the bisulfite ion treated gene to alkaline conditions,
whereby bisulfite modified cytosine residues are converted to
uracil residues; and detecting an amount or distribution of uracil
residues in the 5' regulatory region of the bisulfite ion treated
gene of the test cell, wherein a decrease in the amount or
distribution of uracil residues in the 5' regulatory region of gene
from the test cell, as compared to the amount or distribution of
uracil residues in a corresponding bisulfite ion treated
unmethylated gene following exposure to alkaline conditions, is
indicative of methylation of cytosine residues in CpG dinucleotides
in the 5' regulatory region of the gene, thereby detecting
methylation silencing of the gene of the test cell. The amount or
distribution of uracil residues can be detected, for example, by
determining the nucleotide sequence of the bisulfite modified 5'
regulatory region of the gene following exposure to alkaline
conditions. Alternatively, or in addition, the amount or
distribution of uracil residues can be detected by contacting the
bisulfite ion treated gene sequence, following exposure to alkaline
conditions, with an oligonucleotide that selectively hybridizes to
the 5' region regulatory of the gene containing uracil residues,
and detecting selective hybridization of the oligonucleotide.
An oligonucleotide useful in such a method can be, for example, an
oligonucleotide having a nucleotide sequence as set forth in SEQ ID
NO: 23, 24, 111, 112, 115, 116, 119, 120, 125, 126, 129, 130, 133,
134, 139, 140, 143, or 144. To facilitate detection, in one aspect
the oligonucleotide can include a detectable label, thus providing
a means to detect selective hybridization by detecting the label.
The detectable label can be any label that is conveniently
detectable, including, for example, is a radioisotope, a
paramagnetic isotope, a luminescent compound, a chemiluminescent
compound, a fluorescent compound, a metal chelate, an enzyme, a
substrate for an enzyme, a receptor, or a ligand for a receptor. In
another aspect, the oligonucleotide can be a substrate for a primer
extension reaction, wherein detecting selective hybridization
comprises detecting a product of the primer extension reaction. For
example, the oligonucleotide (primer) can be a methylation specific
primer such as an oligonucleotide having a nucleotide sequence as
set forth in SEQ ID NO: 23, 24, 111, 112, 115, 116, 119, 120, 125,
126, 129, 130, 133, 134, 139, 140, 143, or 144, which can
selectively hybridize to and allow extension of nucleotide sequence
comprising a methylated region of an SFRP1, SFRP2, SFRP4, or SFRP5
gene.
An amount or distribution of uracil residues also can be detected,
for example, by contacting the 5' regulatory region of a gene with
an amplification primer pair comprising a forward primer and a
reverse primer under conditions suitable for amplification, wherein
at least one primer of the primer pair comprises an oligonucleotide
that selectively hybridizes to a nucleotide sequence of the 5'
regulatory region containing uracil residues, whereby generation of
an amplification product is indicative of methylation of cytosine
residues in CpG dinucleotides in the 5' regulatory region of the
gene, thereby detecting methylation silencing of the gene of the
test cell. Amplification primer pairs useful for such a method are
exemplified in Tables 2 and 3, and include, for example, a primer
pair as set forth in SEQ ID NO: 23 and 24, SEQ ID NOS: 111 and 112,
SEQ ID NOS: 115 and 116, SEQ ID NOS: 119 and 120, SEQ ID NOS: 125
and 126, SEQ ID NOS: 129 and 130, SEQ ID NOS: 133 and 134, SEQ ID
NOS: 139 and 140, or SEQ ID NOS: 143 and 144, which are methylation
specific primers useful for detecting methylation of an SFRP1,
SFRP2, SFRP4, or SFRP5 gene 5' regulatory region.
In addition, the amount or distribution of uracil residues can be
detected by contacting the 5' regulatory region of the gene with an
amplification primer pair comprising a forward primer and a reverse
primer under conditions suitable for amplification, wherein both
primers of the primer pair selectively hybridize to a nucleotide
sequence of the 5' regulatory region containing cytosine residues,
but not to a corresponding nucleotide sequence of the 5' regulatory
region containing uracil residues, and whereby generation of an
amplification product is indicative of a lack of methylation of
cytosine residues in CpG dinucleotides in the 5' regulatory region
of the gene, thereby detecting methylation silencing of the gene of
the test cell. Amplification primer pair useful for such a method
are exemplified in Tables 2 and 3, and include, for example, a
primer pair as set forth in SEQ ID NOS: 25 and 26, SEQ ID NOS: 113
and 114, SEQ ID NOS: 117 and 118, SEQ ID NOS: 121 and 122, SEQ ID
NOS: 127 and 128, SEQ ID NOS: 131 and 132, SEQ ID NOS: 135 and 136,
SEQ ID NOS: 141 and 142, or SEQ ID NOS: 145 and 146, which are
unmethylation specific primers useful for detecting a lack of
methylation of an SFRP1, SFRP2, SFRP4, or SFRP5 gene 5' regulatory
region.
The amount or distribution of uracil residues also can be detected
by contacting the 5' regulatory region of the gene with a first
amplification primer pair and a second amplification primer pair
under conditions suitable for amplification, wherein the first
amplification primer pair comprises a forward primer and a reverse
primer, wherein at least one primer of the first primer pair
comprises an oligonucleotide that selectively hybridizes to a
nucleotide sequence of the 5' regulatory region of the gene
containing uracil residues, and wherein the second amplification
primer pair comprises a forward primer and a reverse primer,
wherein both primers of the second primer pair selectively
hybridize to a nucleotide sequence of the 5' regulatory region of
the gene containing cytosine residues, but not to a corresponding
nucleotide sequence of the 5' regulatory region of the gene
containing uracil residues, and wherein an amplification product,
if any, generated by the first primer pair has a first length, and
wherein an amplification product, if any, generated by the second
primer pair has a second length, which is different from the first
length, whereby the length of the amplification products is
indicative of uracil residues and, therefore, methylation of
cytosine residues in CpG dinucleotides in the 5' regulatory region
of the gene, thereby detecting methylation silencing of the gene of
the test cell.
Methylation silencing of a gene associated with a cancer also can
be identified by contacting a test cell with a demethylating agent,
and detecting increased expression of an RNA encoded by the gene as
compared to a level of expression of the RNA in a test cell not
contacted with a demethylating agent. Such a method can further
include detecting methylation, if any, of cytosine residues in a
CpG dinucleotide in a CpG island of the 5' regulatory region of the
gene in a corresponding cell exhibiting regulated growth, or an
extract of the corresponding cell The demethylating agent can be a
methyltransferase inhibitor such as 5-aza-2'-deoxycytidine.
Increased expression of an RNA can be detected using any method for
detecting RNA, including, for example, northern blot analysis, a
reverse transcription-polymerase chain reaction assay, or selective
hybridization to an array of nucleotide sequences as disclosed
herein. Accordingly, the methods of the invention can be performed
in a high throughput format, wherein the test cell, or extract of
the test cell, comprises one of a plurality of test cells, or
extracts of the test cells, or a combination thereof, and each of
the test cells, or extracts of the test cells, of the plurality is
the same or different, or a combination thereof. According to a
high throughput method of practicing the present invention, the
test cells, or extracts of the test cell, can be arranged in an
array, which can be an addressable array, on a solid support such
as a microchip, a glass slide, or a bead.
A test cell examined according to a method of the invention can be
a cell from a cell culture, e.g., an established cell line, or
primary cells placed in culture, or can comprise a sample obtained
from a subject, for example, a human subject. As such, the sample
can be an organ sample, a tissue sample, or a cell sample, for
example, an alimentary/gastrointestinal tract tissue sample, a
liver sample, a skin sample, a lymph node sample, a kidney sample,
a lung sample, a muscle sample, a bone sample, or a brain sample.
For example, a gastrointestinal tract sample can include a stomach
sample, a small intestine sample, a colon sample, a rectal sample,
or a combination thereof. A sample also can comprise a biological
fluid sample, for example, a bone marrow, blood, serum, lymph,
cerebrospinal fluid, saliva, sputum, stool, urine, or ejaculate
sample, which can contain cells therein or products of cells,
particularly nucleic acid molecules.
The present invention also relates to a method of reducing or
inhibiting unregulated growth of a cell exhibiting epigenetic
silenced transcription of at least one gene associated with a
cancer. Such a method can be practiced, for example, by restoring
expression of a polypeptide encoded by the epigenetic silenced gene
in the cell, thereby reducing or inhibiting unregulated growth of
the cell. Such expression can be restored, for example, by
contacting the cell with a demethylating agent (e.g, a
methyltransferase inhibitor), a histone deacetylase inhibitor, or a
combination thereof.
In one embodiment, the epigenetic silenced gene is a methylation
silenced gene, and the method includes contacting the cell with at
least one demethylating agent, for example, DAC. In one aspect, the
cell can be contacted with the demethylating agent in vitro, e.g.,
in a culture medium or other medium conducive to survival of the
cell. If desired, the cell contacted with the demethylating agent
further can be administered to a subject. In another aspect, the
agent can be administered to subject such that the cell exhibiting
unregulated growth is contacted with the agent.
In another embodiment, the method includes introducing a
polynucleotide encoding the polypeptide into the cell, whereby the
polypeptide is expressed from the polynucleotide, thereby restoring
expression of the polypeptide in the cell. The polynucleotide can,
but need not, be contained in a vector, e.g., a viral vector,
and/or can be formulated in a matrix that facilitates introduction
of the polynucleotide into a cell, e.g., liposomes or microbubbles.
The polynucleotide can be introduced into a cell by contacting the
cell with the polynucleotide ex vivo, in which case the cell
containing the polynucleotide can, but need not, be administered to
a subject. The polynucleotide also can be introduced into a cell by
contacting the cell with the polynucleotide in vivo.
The epigenetic silenced gene can be any gene identified using a
method as disclosed herein, and examining a particular cell type
such as a particular cancer cell type. Epigenetic silenced genes in
colorectal cancer cells are exemplified herein by the genes listed
in Table 1, for which GenBank Accession Nos. Polynucleotide
sequences encompassing portions of the genes of Table 1 can be
obtained, for example, by RT-PCR of nucleic acid molecules obtained
from colorectal cancer cells using amplification primer pairs as
set forth in Table 3 (SEQ ID NOS: 149 to 296; e.g., SEQ ID NOS: 149
and 150, or SEQ ID NOS: 151 and 152, etc.). Epigenetic silenced
genes in colorectal cancer cells and/or gastric cancer cells are
exemplified by PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L,
KIAA0786, TIMP2, PCDH8, FOLH1, and SNRPN, which do not exhibit
detectable basal expression, and are re-expressed upon treatment
with DAC, but not with TSA; HOXA1, GRO3, and DLX7, which exhibit a
basal level of expression that is increased upon treatment with
DAC, but not TSA; and POR1, MBNL, TRADD, PDIP, RAD23B, RPL13,
GNAI2, PPP1R21A, FPGT, and TRIM32, which are up-regulated by TSA
alone, whereas their basal expression and up-regulation with DAC
vary among genes.
The present invention further relates to a method for treating a
cancer patient, wherein cancer cells in the patient exhibit
epigenetic silenced expression of at least one gene. Such a method
can be performed, for example, by restoring expression of one or
more epigenetic silenced genes in cancer cells in the patient. For
example, where at least one epigenetic silenced gene is a
methylation silenced gene, the patient can be treated by
administering a demethylating agent to the subject in an amount
sufficient to restore expression of the methylation silenced
gene(s) in cancer cells in the subject. Alternatively, or in
addition, the patient can be treated by administering at least one
polynucleotide encoding at least one polypeptide encoded by one or
more of the epigenetic silenced genes to the subject under
conditions sufficient for expression of the at least one
polypeptide in cancer cells in the subject. Where a polynucleotide
is administered to the patient, the polynucleotide can be contained
in a vector (e.g., a viral vector) preferably an expression vector,
and/or can be formulated in a matrix that facilitates uptake of the
polynucleotide by a target cancer cell (e.g., in a liposome).
The cancer to be treated according to a method of the invention can
be any type of cancer, including, for example, a carcinoma or a
sarcoma. For example, wherein the cancer is a colorectal cancer, a
gastric cancer, or colorectal cancer and gastric cancer, a patient
can be treated by restoring expression of one or more epigenetic
silenced genes, including, PTGS2, CDKN2A, TIMP3, S100A10, SFRP1,
CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3,
DLX7, POR1, MBNL, TRADD, PDIP, RAD23B, RPL13, GNAI2, PPP1R21A,
FPGT, TRIM32, a family member thereof, or a combination thereof.
The SFRP genes, including SFRP1, SFRP2, SFRP4, and SFRP5, provide
an example of a family of genes in which one or more is
epigenetically silenced in colorectal cancer cells, gastric cancer
cells, or both.
The present invention also relates to a method for selecting a
therapeutic strategy for treating a cancer patient. Such a method
can be performed, for example, by identifying at least one
methylation silenced gene associated with the cancer, according to
a method as disclosed herein (i.e., by contacting an array of
nucleotide sequences representative of a genome with nucleic acid
subtraction products and detecting selective hybridization of
nucleic acid subtraction products to a subpopulation of nucleotide
sequences of the array; and selecting an agent useful for restoring
expression of one or more of the identified methylation silenced
gene in cancer cells of the patient. For example, the selected
agent can be a polynucleotide encoding an identified methylation
silenced gene, for example, a polynucleotide encoding a polypeptide
encoded by a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L,
KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3, or DLX7 gene, a
family member of such a gene, or a combination of such genes. The
selected agent for restoring expression of a methylation silenced
gene also can be a demethylating agent such as DAC.
Accordingly, the present invention further relates to a method of
treating a subject suffering from a colorectal cancer, a gastric
cancer, or both, wherein cells associated with the cancer contain
at least one methylation silenced gene. Such a method can be
performed, for example, by administering an amount of an agent that
restores expression of the at least one methylation silenced gene
to the subject sufficient to restore expression of the methylation
silenced gene in cells associated with the cancer. The agent can be
a polynucleotide encoding the at least one methylation silenced
gene, for example, a polynucleotide encoding a polypeptide encoded
by a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L, KIAA0786,
TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3, and/or DLX7 gene, a family
member thereof, or a combination thereof; or can be a demethylating
agent such as DAC. An agent useful for treating a subject suffering
from a colorectal cancer, a gastric cancer, or both, can be
contacted with cells of the cancer ex vivo, after which the cells
can be administered back into the patient; or the agent can be
administer to a site of the cancer cells in the patient.
The present invention further relates to an isolated
oligonucleotide, which has a nucleotide sequence as set forth in
any one of SEQ ID NOS: 1 to 296, as well as to a plurality of
isolated oligonucleotides, which includes at least two of the
isolated oligonucleotides as set forth in SEQ ID NOS: 1 to 296. In
addition, the invention relates to an amplification primer pair,
which includes a forward primer and a reverse primer as set forth
in SEQ ID NOS: 1 to 296 (e.g., SEQ ID NOS: 1 and 2, SEQ ID NOS: 3
and 4, SEQ ID NOS: 5 and 6, etc.), wherein the amplification primer
pair can amplify a nucleotide sequence of a gene as listed in Table
1. In one aspect, an amplification primer pair of the invention can
be used to specifically amplify a methylated 5' regulatory region
of the nucleic acid molecule, such amplification primer pairs being
exemplified by SEQ ID NOS: 23 and 24, SEQ ID NOS: 111 and 112, SEQ
ID NOS: 115 and 116, SEQ ID NOS: 119 and 120, SEQ ID NOS: 125 and
126, SEQ ID NOS: 129 and 130, SEQ ID NOS: 133 and 134, SEQ ID NOS:
139 and 140 or SEQ ID NOS: 143 and 144, which can amplify SFRP
family members having a methylated 5' regulatory region. In another
aspect, an amplification primer pair of the invention can be used
to specifically amplify an unmethylated 5' regulatory region of the
nucleic acid molecule, such amplification primer pairs being
exemplified by SEQ ID NOS: 25 and 26, SEQ ID NOS: 113 and 114, SEQ
ID NOS: 117 and 118, SEQ ID NOS: 121 and 122, SEQ ID NOS: 127 and
128, SEQ ID NOS: 131 and 132, SEQ ID NOS: 135 and 136, SEQ ID NOS:
141 and 142 or SEQ ID NOS: 145 and 146, which can amplify SFRP
family members having an unmethylated 5' regulatory region.
The present invention also relates to a kit, which contains at
least one isolated oligonucleotide of the invention, including, for
example, a plurality of such isolated oligonucleotides. In one
embodiment, a plurality of isolated oligonucleotides of a kit of
the invention includes at least one amplification primer pair
(i.e., a forward primer and a reverse primer), and can include a
plurality of amplification primer pairs, including, for example,
amplification primer pairs as set forth in Table 2, Table 3, and/or
Table 4. As such, a kit of the invention can contain, for example,
one or a plurality of methylation specific amplification primer
pairs, unmethylation specific amplification primer pairs, or a
combination of methylation specific amplification primer pairs and
unmethylation specific amplification primer pair, including
methylation specific primer pairs and unmethylation specific primer
pairs useful for amplifying a methylated form or an unmethylated
form of a particular gene that is known to be or suspected of being
methylation silenced in one or more types of cancer cells.
A kit of the invention can further include additional reagents,
which can be useful, for example, for a purpose for which the
oligonucleotides of the kit are useful. For example, where a kit
contains one or a plurality of methylation specific and/or
unmethylation specific amplification primers, the kit can further
contain, for example, control polynucleotides, which can be
methylated or unmethylated; one or more reagents that modify
methylated cytosine residues, and/or one or more reagents for
performing an amplification reaction. Where the kit contains one or
plurality of oligonucleotides that selectively hybridize to a
methylated or to an unmethylated gene sequence, the kit can further
contain, for example, a methylation sensitive restriction
endonuclease.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 provides a summary of methylation specific PCR (MSP)
analyses of 6 genes from Group 1a (see Table 1) in a series of
human cancer cell lines from various origins. Gene names are
indicated on the top, and cell line names are indicated on the
left. Black boxes indicate full methylation, gray boxes and open
boxes indicate partial methylation and no methylation,
respectively. "ND" indicates not determined (because of lack of
amplification in MSP).
FIG. 2 provides a summary of MSP analyses of the SFRP genes in 124
primary CRC samples (see Example 1). Gene names are indicated at
the top. Each row represents a primary CRC tumor. Gray boxes and
open boxes indicate methylation and no methylation,
respectively.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based on the development of a method for
identifying epigenetically silenced genes in a cell genome, for
example, a cancer cell genome. The method is exemplified by the
identification of 74 genes that are epigenetically silenced in
colorectal carcinoma (CRC) cells, including genes that are silenced
due to methylation and/or histone deacetylation. As disclosed
herein, a pattern of tumor profiling was revealed, as exemplified
by the identification of methylation silencing of SFRP1, SEZ6L,
LPPH1 and CXX1 genes in CRC and gastric carcinoma (GC). Such tumor
profiling extended to related family members of the SFRP1 gene,
wherein, in CRC and GC, hypermethylation of SFRP2, SFRP4, and SFRP5
also was detected (SFRP3 lacks CpG islands in the 5' regulatory
region). Accordingly, the present invention provides a method for
identifying epigenetically silenced genes associated with a cancer,
and further provides methods of detecting a cancer associated with
epigenetic silencing of gene expression, methods of treating a
patient having such a cancer, and compositions useful for
practicing such methods.
Aberrant hypermethylation of gene promoters is recognized as a
major mechanism associated with inactivation of tumor suppressor
genes in cancer. Transcriptional silencing can be mediated by
methylation and/or histone deacetylase (HDAC) activity, with the
methylation being dominant. As disclosed herein, a cDNA microarray
based analysis was used to screen for genes that are epigenetically
silenced in human CRC. A screen of over 10,000 genes identified a
substantial number of epigenetically silenced genes, including
several exhibiting promoter hypermethylation (i.e., methylation
silenced) and others with unmethylated promoters, for which
increased expression was produced by HDAC inhibition (see Example
1). Validity of the disclosed method is provided by determining
that many of the hypermethylated genes have high potential for
roles in tumorigenesis by virtue of their predicted function or
chromosome position. A group of genes was identified that are
preferentially hypermethylated in CRC and GC, including the SFRP1,
gene, which belongs to a gene family that, as disclosed herein,
also were frequently hypermethylated in CRC. In addition to
suggesting a mechanism for loss of tumor suppressor gene function,
the present results provide a molecular marker panel that can
detect essentially all CRC (see FIG. 2).
Cancer progression is fostered not only by genetically, but also by
epigenetically, determined alterations in gene function. The latter
involve aberrantly hypermethylated CpG islands in gene promoters
with loss of transcription of the genes. Recognition of this
promoter hypermethylation has developed a growing effort to
randomly screen the cancer genome to identify such loci. These
search strategies, including identification of CpG island
hypermethylation in regions of high frequency loss of
heterozygosity (LOH) and throughout the genome, have all proven to
have utilities for identification of tumor specifically
hypermethylated CpG islands. However, each suffers from either
identifying some sites not associated with gene promoters,
potential bias of utilized methylation sensitive restriction sites
for CpG island subsets or lack of the site in numerous islands,
and/or the need to laboriously search for nearby genes once the
altered locus is identified.
The presently disclosed microarray based strategy obviates the
disadvantages of previous methods by coupling gene expression
status to epigenetic regulation. Furthermore, the approach exploits
the observation that silencing of hypermethylated genes in cancer
can be dependent on both dense CpG island methylation and HDAC
activity (Cameron et al., Nature Genet. 21:103-107, 1999, which is
incorporated herein by reference). As exemplified using colon
cancer cells, the disclosed method robustly identifies new genes
for which transcriptional repression can have a key role in
tumorigenesis. Remarkably, the disclosed genomic screening method
allowed an identification of gene hypermethylation events that
cluster to specific tumor types, and can simultaneously involve
multiple members of a single gene family (Example 1).
Accordingly, methods are provided for identifying epigenetically
silenced genes, for example, methylation silenced genes, that are
associated with a cancer. In one embodiment, the invention provides
a method of identifying at least one epigenetically silenced gene
associated with at least one cancer. As used herein, the term "at
least one" means 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. For
example, the disclosed microarray method identified 74 genes that
were epigenetically silenced in colorectal cancer cells.
Furthermore, it was determined that several of the genes that were
identified as epigenetically silenced in CRC also were
epigenetically silenced in gastric cancer cells. As such, the
method identified epigenetically silenced genes associated with CRC
and/or GC.
The term "epigenetically silenced" or "epigenetic silenced", when
used in reference to a gene, means that the gene is not being
transcribed, or is being transcribed at a level that is decreased
with respect to the level of transcription of the gene in a
corresponding control cell (e.g., a normal cell), due to a
mechanism other than a genetic change. Epigenetic mechanisms of
gene silencing are well known and include, for example,
hypermethylation of CpG dinucleotides in a CpG island of the 5'
regulatory region of a gene, and structural changes in chromatin
due, for example, to histone acetylation, such that gene
transcription is reduced or inhibited. Methods for detecting
epigenetic silencing of a gene are disclosed herein and include,
for example, detecting re-expression (reactivation) of the gene
following contact of a cell with an agent that relieves the
epigenetic silencing, for example, with a demethylating agent where
the silencing is due to hypermethylation.
As used herein, the term "methylation" or "hypermethylation", when
used in reference to a gene, means that cytosine residues of CpG
dinucleotides in a CpG island associated with the gene are
methylated at the 5'-position, i.e., 5'-methylcytosine. The term
"methylation status" is used herein to refer to a relative
abundance, including the presence or absence, of methylated
cytosine residues of CpG dinucleotides in a CpG island. In general,
the cytosine residues in a CpG island are not methylated in a
transcriptionally active gene and, therefore, the detection of
methylated cytosine residues in a CpG island indicates that
expression of the gene is reduced or inhibited. Accordingly, as
discussed above, reference herein to a "methylation silenced" gene
means that the gene is not being transcribed, or is being
transcribed at a level that is decreased with respect to the level
of transcription of the gene in a corresponding control cell
(generally a normal cell) due to hypermethylation of CpG
dinucleotides in a CpG island of the 5' regulatory region of the
gene. A consequence of methylation silenced gene expression is that
a cell containing the gene has reduced levels of, or completely
lacks, a polypeptide encoded by the gene (i.e., the gene product)
such that any function normally attributed to the gene product in
the cell is reduced or absent.
A method of identifying an epigenetically silenced gene associated
with a cancer can be performed, for example, by contacting an array
of nucleotide sequences representative of a genome with nucleic
acid subtraction products (i.e., nucleic acid molecules
corresponding to RNA expressed in cancer cells contacted with at
least one agent that reactivates expression of epigenetically
silenced genes, but not RNA expressed in normal cells corresponding
to the cancer cells) under conditions suitable for selective
hybridization of nucleic acid subtraction products to complementary
nucleotide sequences of the array; and detecting selective
hybridization of nucleic acid subtraction products to a
subpopulation of nucleotide sequences of the array, wherein nucleic
acid molecules corresponding to RNA expressed in the normal cells
corresponding the cancer cells do not hybridize to the
subpopulation of nucleotide sequences under such conditions
suitable for selective hybridization, whereby the nucleic acid
subtraction products that selectively hybridize to the
subpopulation of nucleotide sequences of the array represent
epigenetically silenced genes of the cancer cells (see Example 1).
Reference to "nucleic acid molecules corresponding to RNA" of a
cell means RNA such as mRNA or polyA+ RNA, cDNA generated using RNA
from the cell as a template, or cRNA generated using RNA or cDNA as
a template. For practicing a method of the invention, the nucleic
acid molecules corresponding to RNA of a cell generally are
detectably labeled, for example, with a radioisotope, a
paramagnetic isotope, a luminescent compound, a chemiluminescent
compound, a fluorescent compound, a metal chelate, an enzyme, a
substrate for an enzyme, a receptor, or a ligand for a receptor; or
are capable of being detected, for example, using a detectably
labeled probe, such that hybridization of the nucleic acid
molecules to nucleotide sequences of the array can be detected.
As used herein, the term "array of nucleotide sequences
representative of a genome" means an organized group of nucleotide
sequences that are linked to a solid support, for example, a
microchip or a glass slide, wherein the sequences can hybridize
specifically and selectively to nucleic acid molecules expressed in
a cell. The array is selected based on the organism from which the
cells to be examined are derived and/or on a tissue or tissues that
are to be examined. Generally, the array is representative of the
genome of a eukaryotic cell or cell type, particularly a mammalian
cell or cell type, and preferably a human cell, including a cell of
one or more tissues, as desired (e.g., colorectal epithelial
cells). In general, an array of probes that is "representative" of
a genome will identify at least about 10% of the expressed nucleic
acid molecules in a cell, generally at least about 20% or 40%,
usually about 50% to 70%, typically at least about 80% or 90%, and
particularly 95% to 99% or more of the expressed nucleic acid
molecules of a cell or organism. It should be recognized that the
greater the representation, the more likely that a method of the
invention can identify all genes that are epigenetically silenced
in a cancer. Arrays containing nucleotide sequences representative
of specified genomes can be prepared using well known methods, or
obtained from a commercial source (e.g., Invitrogen Corp.;
Affymetrix), as exemplified by a Human GeneFilters.TM. Microarray,
Release II, array (Research Genetics; now a subsidiary of
Invitrogen Corp.) used in the present studies (Example 1).
The agent that reactivates expression of epigenetically silenced
genes can be a methyltransferase inhibitor (e.g.,
5-aza-2'-deoxycytidine; DAC), a histone deacetylase inhibitor
(e.g., trichostatin A; TSA), or a combination of agents such as a
combination of DAC and TSA. RNA can be isolated from cells such as
cancer cells treated with such an agent or agent, and the RNA, or a
cDNA product of the RNA can be contacted with RNA molecules from
corresponding cells (e.g., cancer cells) that were not treated with
the agent(s) under conditions such that RNA (or cDNA) expressed
only in the treated cells can be isolated, thus obtaining nucleic
acid subtraction products. Methods for performing a nucleic acid
subtraction reaction are well known (Hedrick et al., Nature
308:149-155, 1984, which is incorporated herein by reference), and
kits for performing such methods are available from commercial
sources (e.g., Gibco/BRL; see Example 1).
According to a method of the invention, at least one (e.g., 1, 2,
3, 4, 5, or more) epigenetically silenced gene can be associated
with at least one (e.g. 1, 2, 3, or more) cancer. The cancer can
be, for example, a carcinoma or a sarcoma, including one or more
specific types of cancer, e.g., an alimentary/gastrointestinal
tract cancer, a liver cancer, a skin cancer, a breast cancer, an
ovarian cancer, a prostate cancer, a lymphoma, a leukemia, a kidney
cancer, a lung cancer, a muscle cancer, a bone cancer, or a brain
cancer. Epigenetically silenced genes associated with a cancer are
exemplified herein by the genes listed in Table 1 (and for which
GenBank Accession numbers are provided; see, for example, world
wide web, at the URL "ncbi.nlm.nih.gov"), which are associated with
CRC and/or GC. With reference to Table 1, epigenetically silenced
genes in CRC cells that can be reactivated due to contact of the
cells with DAC (i.e., methylation silenced genes) are exemplified
by PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L, KIAA0786,
TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3, and DLX7; and
epigenetically silenced genes that can be reactivated due to
contact of cancer cells with TSA are exemplified by POR1, MBNL,
TRADD, PDIP, RAD23B, RPL13, GNAI2, PPP1R21A, FPGT, and TRIM32.
Furthermore, as disclosed herein, related family members of the
identified epigenetically silenced genes also can be epigenetically
silenced, including, for example, SFRP2, SFRP4, and SFPR5, which
are related to SFRP1, and which, alone or in combination, were
associated with 123 of 124 CRC samples tested (see Example 1; FIG.
2).
The silencing of gene transcription associated with aberrant DNA
methylation of CpG dinucleotides in normally unmethylated gene
promoter regions is the most widely studied epigenetic abnormality
in tumorigenesis. The binding of protein complexes consisting of
methyl-CpG-binding domains, transcriptional co-repressors,
chromatin remodeling proteins and histone deacetylases to
hypermethylated DNA regions results in a transcriptionally
repressed (silenced) chromatin state. In eukaryotic cells,
methylation of cytosine residues that are immediately 5' to a
guanosine residue occurs predominantly in CG poor regions. In
contrast, CpG islands generally remain unmethylated in normal
cells, except during X chromosome inactivation and parental
specific imprinting, where methylation of 5' regulatory regions is
associated with transcriptional repression. De novo methylation of
the retinoblastoma (Rb) gene has been demonstrated in a small
fraction of retinoblastomas (Sakai et al., Am. J. Hum. Genet.
48:880, 1991), and aberrant methylation of the VHL gene was found
in a subset of sporadic renal cell carcinomas (Herman et al., Proc.
Natl. Acad. Sci. USA 91:9700-9704, 1994). Expression of a tumor
suppressor gene can also be abolished by de novo DNA methylation of
a normally unmethylated 5' CpG island (see, for example, Issa et
al., Nature Genet. 7:536, 1994; Merlo et al., Nature Med. 1:686,
1995; Herman et al., Cancer Res. 56:722, 1996).
Aberrant methylation of promoter regions in CpG islands also has
been associated with the development of cancer. In hematopoietic
malignancies, for example, hypermethylation of E-cadherin (Graff et
al., Cancer Res. 55:5195-5199, 1995), DAP-kinase (Katzenellenbogen
et al., Blood 93:4347-4353, 1999), and the cell cycle regulators
p15.sup.INK4B and p16.sup.INK4A, is associated with gene
inactivation (Herman et al., Cancer Res. 57:837-841 1997; Melki et
al., Blood 95:3208-3213, 2000; Ng et al., Clin. Canc. Res.
7:1724-1729, 2001). Transcriptional silencing due to
hypermethylation also has been detected in the CDKN2A gene (Herman
et al., Cancer Res. 55:4525-4530, 1995), MGMT (Esteller et al.,
Cancer Res. 59:793-797, 1999), and MLH1 gene (Herman et al., Proc.
Natl. Acad. Sci. USA 95:6870-6875, 1998).
Hypermethylation of a CpG island at chromosome position 17p13.3 has
been observed in multiple common types of human cancers (Makos et
al., Proc. Natl. Acad. Sci. USA 89:1929, 1992; Makos et al., Cancer
Res. 53:2715, 1993; Makos et al., Cancer Res. 53:2719, 1993), and
coincides with timing and frequency of 17p loss and p53 mutations
in brain, colon, and renal cancers. Silenced gene transcription
associated with hypermethylation of the normally unmethylated
promoter region CpG islands has been implicated as an alternative
mechanism to mutations of coding regions for inactivation of tumor
suppressor genes (Baylin et al., Cancer Cells 3:383, 1991; Jones
and Buckley, Adv. Cancer Res. 54:1-23, 1990). This change also has
been associated with the loss of expression of VHL, a renal cancer
tumor suppressor gene on 3p (Herman et al., supra, 1994), the
estrogen receptor gene on 6q (Ottaviano et al., Cancer Res.
54:2552, 1994), and the H19 gene on 11p (Steenman et al., Nature
Genetics, 7:433, 1994). Methylation-silenced transcription of the
SOCS-1 gene is associated with various cancers, including
hepatocellular carcinoma, multiple myeloma, and acute leukemias
(Yoshikawa et al., Nat. Genet. 28:29-35, 2001, which is
incorporated herein by reference).
Accordingly, the present invention provides a method for
identifying a cell that exhibits or is predisposed to exhibiting
unregulated growth by detecting, in a test cell, epigenetic
silencing of at least one gene as set forth in Table 1, or a
combination thereof. For example, the epigenetic silenced gene can
be a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, SFRP2, SFRP4, SFRP5,
CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3,
DLX7, POR1, MBNL, TRADD, PDIP, RAD23B, RPL13, GNAI2, PPP1R21A,
FPGT, or TRIM32 gene, or a combination of such genes. The cell
exhibiting, or predisposed to exhibiting unregulated growth, can be
a neoplastic cell, which can be, for example, a premalignant cell
such as a cell of a gastrointestinal polyp, or can be a cancer
cell, for example, a carcinoma cell such as a colorectal cancer
cell or a gastric cancer cell, or a sarcoma cell.
In one embodiment, a method of the invention requires, in part, a
comparison of the methylation status of a gene in a test cell or
sample with the methylation status of a corresponding gene in a
corresponding cell exhibiting regulated growth. As used herein, the
term "corresponding" means a reference material, with which a test
material is being compared. Generally, the reference material
provides a control or standard with which the test material is
compared. For example, reference to a corresponding unmethylated
SFRP gene, with respect to an SFRP gene being examined for
methylation status, means that the unmethylated SFRP gene is the
same type of gene as the a SFRP gene being examined for methylation
status, e.g., the test gene and the corresponding unmethylated gene
are both human a SFRP1, genes. Reference to a corresponding cell
exhibiting regulated growth, with respect to a test cell, generally
refers to a normal cell, i.e., a cell that has a cell cycle and
growth pattern characteristic of a population of such cells in a
healthy individual, for example, a normal colon epithelial cell
where the test cell being examined is suspected of being a CRC
cell.
A method of the invention is practiced using a sample comprising a
test cell, or an extract of the test cell that includes nucleic
acid molecules of the cell, particularly genomic DNA, including all
or a portion comprising the CpG island of a 5' regulatory region of
the gene that is to be examined for methylation status. Generally,
the test cell is a cell that is suspected of being a cell that
exhibits unregulated growth, for example, a biopsy sample of
suspicious lesion, or is a cell that is (or was) in proximity to a
premalignant or malignant cell, for example, cell samples taken at
one or few places outside of the region of a suspicious lesion,
such test cell providing an indication, for example, of the extent
to which a surgical procedure should be performed, or a cell sample
taken from a surgical margin, such test cells being useful for
determining whether a cancer has been completely removed, or for
determining whether a cancer has recurred.
A test cell examined according to a method of the invention also
can be a primary cell that has been obtained from a subject and
placed in culture, for example, for the purpose of establishing a
primary cell culture that exhibits substantially the same growth
characteristics as the cells from which the culture was
established, or for the purpose of treating and/or expanding the
cells for readministration to the subject. For example, colon
epithelial cells can be obtained from a cancer patient suffering
from a CRC, wherein the cells exhibit methylation silenced
expression of one or more genes associated with the cancer. The
cells can be treated in culture using one or more agent to be
tested for an ability to restores expression of the silenced
gene(s), thus providing a means to identify an agent that can be
useful for treating the cancer patient, or another patient having a
CRC characterized by methylation silencing of one or more of the
same genes.
A test cell can be obtained from a subject in any way typically
used in clinical setting for obtaining a sample containing the
cells. For example, the test cells (or a sample comprising the test
cells) can be obtained by a biopsy procedure such as needle biopsy
of an organ or tissue containing the cells to be tested. As such,
the test cells can be obtained from a gastrointestinal tract sample
(e.g., a biopsy of a polyp), a liver sample, a bone marrow sample,
a skin sample, a lymph node sample, a kidney sample, a lung sample,
a muscle sample, a bone sample, a brain sample, or the like. The
test cell also can be a component of a biological fluid, for
example, blood, lymph, cerebrospinal fluid, saliva, sputum, stool,
urine, or ejaculate. If appropriate, the test cells also can be
obtained by lavage, for example, for obtaining test cells from the
colon, uterus, abdominal cavity, or the like, or using an
aspiration procedure, for example, for obtaining a bone marrow
sample.
A method of the invention also can be practiced using an extract of
a test cell, wherein the extract includes nucleic acid molecules of
the test cell, particularly genomic DNA, including all or a CpG
island containing portion of the gene or genes to be examined. The
extract can be a crude extract comprising, for example, a
freeze-thawed sample of a tissue containing the test cells; can
comprise partially purified genomic DNA, which can include, for
example, components of the nuclear matrix; or can comprise
substantially purified genomic DNA, which is obtained, for example,
following treatment with a protease and alcohol precipitation. In
certain embodiments, the test cell also can be a component of a
histologic sample that is embedded in paraffin.
Where the epigenetic silencing includes methylation silencing, the
method for identifying a cell that exhibits or is predisposed to
exhibiting unregulated growth is performed by detecting methylation
of one or more target genes in the cell. Methylation of a CpG
dinucleotide in a CpG island of a gene can be detected using any of
various well known methods for detecting CpG methylation of a
nucleic acid molecule. Such methods include contacting the gene
with one or a series of chemical reagents that selectively modify
either unmethylated cytosine residues or methylated cytosine
residues, but not both, such that the presence or absence of the
modification can be detected; contacting the gene sequence with a
methylation sensitive restriction endonuclease, which has a
recognition site that includes a CpG dinucleotide, and that cleaves
a recognition site either having a methylated cytosine residue of
the CpG or lacking a methylated cytosine residue of the CpG, but
not both, such that the presence or absence of cleavage of the
sequence can be detected; or contacting a nucleic acid molecule
comprising the gene with an oligonucleotide probe, primer, or
amplification primer pair that selectively hybridizes to the gene
sequence and allows a determination to made as to whether the CpG
methylation is present. Examples of such methods are provided
herein, and modifications and variations on such methods are well
known in the art.
Methylation of a target gene can be detected, for example, by
contacting a region comprising a 5' regulatory region of a nucleic
acid molecule comprising the gene with a methylation sensitive
restriction endonuclease, which cleaves a recognition site in the
5' regulatory region comprising a methylated cytosine residue of a
CpG dinucleotide, whereby cleavage of the nucleic acid molecule is
indicative of methylation and, therefore, methylation silencing of
the gene of the test cell. Methylation sensitive restriction
endonucleases are well known and include, for example, Acc III, Ban
I, BstN I, Msp I, and Xma I. Alternatively, or in addition,
methylation silencing can be detected by contacting a region
comprising a 5' regulatory region of a nucleic acid molecule
comprising the gene with a methylation sensitive restriction
endonuclease, which cleaves a recognition site in the 5' regulatory
region comprising a methylated cytosine residue of a CpG
dinucleotide, provided the cytosine residue of the CpG dinucleotide
is unmethylated, whereby a lack of cleavage of the nucleic acid
molecule is indicative of methylation silencing of the gene of the
test cell. Such methylation sensitive restriction endonucleases are
exemplified by Acc II, Ava I, BssH II, BstU I, Hpa II, and Not
I.
The presence or absence of cleavage of a nucleic acid molecule
comprising a target gene sequence by a methylation sensitive
restriction endonuclease can be identified using any method useful
for detecting the length or continuity of a polynucleotide
sequence. For example, cleavage of the target gene sequence can be
detected by Southern blot analysis, which allows mapping of the
cleavage site, or using any other electrophoretic method or
chromatographic method that separates nucleic acid molecules on the
basis of relative size, charge, or a combination thereof. Cleavage
of a target gene also can be detected using an oligonucleotide
ligation assay, wherein, following contact with the restriction
endonuclease, a first oligonucleotide that selectively hybridizes
upstream of and adjacent to a restriction endonuclease cleavage
site and a second oligonucleotide that selectively hybridizes
downstream of and adjacent to the cleavage site are contacted with
the target gene sequence, and further contacted with a ligase such
that, in the absence of cleavage the oligonucleotides are adjacent
to each other and can be ligated together, whereas, in the absence
of cleavage, ligation does not occur. By determining the size or
other relevant parameter of the oligonucleotides following the
ligation reaction, ligated oligonucleotides can be distinguished
from unligated oligonucleotides, thereby providing an indication of
restriction endonuclease activity.
Methylation silencing of a gene also can be detected by contacting
a 5' regulatory region of the nucleic acid molecule comprising the
gene of the test cell with a chemical reagent that selectively
modifies either an unmethylated cytosine residue or a methylated
cytosine residue, and detecting a product generated due to said
contacting, wherein the product is indicative of methylation of a
cytosine residue in a CpG dinucleotide of the gene, thereby
detecting methylation silencing of the gene of the test cell. For
example, the product can be detected using an electrophoresis
method, a chromatography method, a mass spectrometry method, or a
combination of such methods.
In one aspect of this embodiment, the gene is contacted with
hydrazine, which modifies cytosine residues, but not methylated
cytosine residues, then the hydrazine treated gene sequence is
contacted with a reagent such as piperidine, which cleaves the
nucleic acid molecule at hydrazine modified cytosine residues,
thereby generating a product comprising fragments. By separating
the fragments according to molecular weight, using, for example, an
electrophoretic, chromatographic, or mass spectrographic method,
and comparing the separation pattern with that of a similarly
treated corresponding unmethylated gene sequence, gaps are apparent
at positions in the test gene contained methylated cytosine
residues. As such, the presence of gaps is indicative of
methylation of a cytosine residue in the CpG dinucleotide in the
target gene of the test cell.
In another aspect, a nucleic acid molecule comprising the target
gene is contacted with a chemical reagent comprising bisulfite
ions, for example, sodium bisulfite, which converts unmethylated
cytosine residues to bisulfite modified cytosine residues, then the
bisulfite ion treated gene sequence is exposed to alkaline
conditions, which convert bisulfite modified cytosine residues to
uracil residues. Sodium bisulfite reacts readily with the
5,6-double bond of cytosine (but poorly with methylated cytosine)
to form a sulfonated cytosine reaction intermediate that is
susceptible to deamination, giving rise to a sulfonated uracil. As
such, the sulfonate group can be removed by exposure to alkaline
conditions, resulting in the formation of uracil. The DNA then can
amplified, for example, by PCR, and sequenced to determine the
methylation status of all CpG sites. Uracil is recognized as a
thymine by Taq polymerase and, upon PCR, the resultant product
contains cytosine only at the position where 5-methylcytosine was
present in the starting template DNA. By comparing the amount or
distribution of uracil residues in the bisulfite ion treated gene
sequence of the test cell with a similarly treated corresponding
unmethylated gene sequence, detection of a decrease in the amount
or distribution of uracil residues in the gene from the test cell
is indicative of methylation of cytosine residues in CpG
dinucleotides in the target gene of the test cell. The amount or
distribution of uracil residues also can be detected by contacting
the bisulfite ion treated target gene sequence, following exposure
to alkaline conditions, with an oligonucleotide that selectively
hybridizes to a nucleotide sequence of the target gene that either
contains uracil residues or that lacks uracil residues, but not
both, and detecting selective hybridization (or the absence
thereof) of the oligonucleotide.
As used herein, the term "selective hybridization" or "selectively
hybridize" or "specific hybridization" refers to an interaction of
two nucleic acid molecules that occurs and is stable under
moderately stringent or highly stringent conditions. As such,
selective hybridization preferentially occurs, for example, between
an oligonucleotide and a target nucleic acid molecule, and not
substantially between the oligonucleotide and a nucleic acid
molecule other than the target nucleic acid molecule, including not
with nucleic acid molecules encoding related but different members
of a gene family. Generally, an oligonucleotide useful as a probe
or primer that selectively hybridizes to a target nucleic acid
molecule is at least about 12 to 15 nucleotides in length,
generally at least about 18 to 20 nucleotides in length, usually at
least about 21 to 25 nucleotides in length, and particularly about
26 to 35 nucleotides in length or. Examples of oligonucleotides
useful in practicing the methods of the invention are disclosed
herein as SEQ ID NOS: 1 to 296 more (see Tables 2, 3 and 4).
Conditions that allow for selective hybridization can be determined
empirically, or can be estimated based, for example, on the
relative GC:AT (or GC:AU) content of the hybridizing
oligonucleotide and the target nucleic acid molecule, the length of
the hybridizing oligonucleotide, and the number, if any, of
mismatches between the oligonucleotide and target sequence to which
it is to hybridize (see, for example, Sambrook et al., "Molecular
Cloning: A laboratory manual (Cold Spring Harbor Laboratory Press
1989)). As such, the conditions used to achieve a particular level
of stringency will vary, depending on the nature of the hybridizing
nucleic acid molecules. An additional consideration is whether one
of the nucleic acids is immobilized, for example, on a filter. An
example of progressively higher stringency conditions is as
follows: 2.times.SSC/0.1% SDS at about room temperature
(hybridization conditions); 0.2.times.SSC/0.1% SDS at about room
temperature (low stringency conditions); 0.2.times.SSC/0.1% SDS at
about 42.degree. C. (moderate stringency conditions); and
0.1.times.SSC at about 62.degree. C. (high stringency conditions).
Hybridization and/or washing can be carried out using only one of
these conditions, for example, high stringency conditions, or each
of the conditions can be used, for example, for 10 to 15 minutes
each, in the order listed above, repeating any or all of the steps
listed.
Selective hybridization of an oligonucleotide with a target gene
(e.g., a gene as listed in Table 1) can be detected, for example,
by performing the method using an oligonucleotide that includes a
detectable label. The detectable label can be any molecule that
conveniently can be linked to the oligonucleotide and detected
using readily available equipment. For example, the detectable
label can be a fluorescent compound such a Cy3, Cy5, Fam,
fluorescein, rhodamine, or a green fluorescent protein or enhanced
or modified form thereof; a radionuclide such as sulfur-35,
technicium-99, phosphorus-32, tritium or iodine-125; a paramagnetic
spin label such as carbon-13, Gd-157, Mn-55, Dy-162, Cr-52, or
Fe-56; a luminescent compound such as an aequorin; a
chemiluminescent compound; a metal chelate; an enzyme such as
luciferase or .beta.-galactosidase, or a substrate for an enzyme;
or a receptor or a ligand for a receptor, for example, biotin. The
means for detecting the detectable label will be selected based on
the characteristics of the label, as will the means for linking the
label to an oligonucleotide (see, for example, Hermanson,
"Bioconjugate Techniques" (Academic Press 1996), which is
incorporated herein by reference).
Selective hybridization also can be detected, for example, by
utilizing the oligonucleotide as a substrate for a primer extension
reaction, further contacting the sample with deoxyribonucleotides
(dNTPs), including, if desired, a detectable dNTP (e.g., a
fluorescently labeled dNTP, a digoxigenin labeled dNTP, or a biotin
labeled dNTP), and a DNA dependent DNA polymerase under conditions
sufficient for the primer extension reaction to proceed, and
detecting a product of the primer extension reaction. Conditions
for performing a primer extension reaction are well known in the
art (see, for example, Sambrook et al., supra, 1989).
The amount or distribution of uracil residues in a bisulfite ion
treated nucleic acid molecule comprising a target gene sequence
following exposure to alkaline conditions also can be detected
using an amplification reaction such as PCR. An amplification
reaction is performed under conditions that allow selective
hybridization of the forward and reverse primers of an
amplification primer pair to the target nucleic acid molecule.
Generally, the reaction is performed in a buffered aqueous
solution, at about pH 7-9, usually about pH 8. In addition, the
reaction generally is performed in a molar excess of primers to
target nucleic acid molecule, for example, at a ratio of about
100:1 primer:genomic DNA. Where the amount of the target nucleic
acid molecule in a sample is not known, for example, in a
diagnostic procedure using a biological sample, a range of primer
amounts can be used in samples run in parallel, although generally
even the addition of a small amount of primers will result in a
sufficient molar excess such that the amplification reaction can
proceed.
The deoxyribonucleoside triphosphates, dATP, dCTP, dGTP, and dTTP,
can be added to the synthesis mixture either separately or as a
mixture, which can further include the primers, in adequate amounts
and the resulting solution is heated to about
90.degree.-100.degree. C. from about 1 to 10 minutes, preferably
from 1 to 4 minutes. After this heating period, the solution is
allowed to cool to room temperature, which is preferable for the
primer hybridization. To the cooled mixture is added an appropriate
agent for effecting the primer extension reaction, generally a
polymerase, and the reaction is allowed to occur under conditions
as disclosed herein (see Example 1) or otherwise known in the art.
Where the polymerase is heat stable, it can be added together with
the other reagents. The polymerase can be any enzyme useful for
directing the synthesis of primer extension products, including,
for example, E. coli DNA polymerase I, Klenow fragment of E. coli
DNA polymerase I, T4 DNA polymerase, other available DNA
polymerases, polymerase muteins, reverse transcriptase, and other
enzymes, including heat-stable enzymes, as are well known in the
art and commercially available. The amplification products can be
identified as methylated or non-methylated by a sequencing method,
oligomer restriction (Saiki et al., BioTechnology 3:1008-1012,
1985), allele-specific oligonucleotide probe analysis (Conner et
al., Proc. Natl. Acad. Sci. USA 80:278, 1983), oligonucleotide
ligation assays (Landegren et al., Science 241:1077, 1988), and the
like (see, also, Landegren et al., Science 242:229-237, 1988).
In one embodiment, the amplification is performed by contacting the
target gene sequence (e.g., a gene as listed in Table 1) with an
amplification primer pair comprising a forward primer and a reverse
primer under conditions suitable for amplification, wherein at
least one primer of the primer pair comprises an oligonucleotide
that selectively hybridizes to a target gene sequence containing
uracil residues, whereby generation of an amplification product is
indicative of methylation of cytosine residues in CpG dinucleotides
in the target gene of the test cell. In another embodiment, the
amplification reaction is performed by contacting the target gene
sequence with an amplification primer pair comprising a forward
primer and a reverse primer under conditions suitable for
amplification, wherein both primers of the primer pair selectively
hybridize to a target gene sequence containing cytosine residues,
but not to a target gene sequence containing uracil residues,
whereby generation of an amplification product is indicative of a
lack of methylation of cytosine residues in CpG dinucleotides in
the target gene of the test cell.
In still another embodiment, a methylation-specific amplification
reaction such as methylation-specific PCR (MSP) is used alone, or
in combination with bisulfite treatment, to detect the methylation
status of a nucleic acid molecule (see U.S. Pat. Nos. 6,265,171;
6,200,756; and 6,017,704, each of which is incorporated herein by
reference; see, also, Example 1). MSP is a particularly sensitive
method that allows detection of low numbers of methylated alleles
and the use of small amounts of a nucleic acid sample, including
paraffin-embedded materials, and also can be conveniently adapted
to a multiplex analysis, including, for example, simultaneous
detection of unmethylated and methylated products in a single
sample, thus providing an internal control.
The amplification primer pairs used in an MSP reaction are designed
to specifically distinguish between bisulfite untreated or
unmodified DNA, and methylated and unmethylated DNA. MSP primer
pairs for unmethylated DNA (unmethylation specific primer pairs)
generally have a thymidine residue in the 3'-CpG pair to
distinguish it from the cytosine residue retained in methylated
DNA, and the complement is designed for the antisense primer. MSP
primer pairs usually contain relatively few cytosine or guanine
residues in the sequence because cytosine is absent in the sense
(forward) primer and the guanine is absent in the antisense
(reverse) primer; cytosine becomes modified to uracil, which is
amplified as thymidine in the amplification product. MSP
unmethylation (MSP(U)) specific primer pairs and MSP methylation
(MSP(M)) specific are exemplified in Tables 2 and 3. For example,
amplification primer pairs useful for such a method include, for
example, a primer pair as set forth in SEQ ID NO: 23 and 24, SEQ ID
NOS: 111 and 112, SEQ ID NOS: 115 and 116, SEQ ID NOS: 119 and 120,
SEQ ID NOS: 125 and 126, SEQ ID NOS: 129 and 130, SEQ ID NOS: 133
and 134, SEQ ID NOS: 139 and 140, or SEQ ID NOS: 143 and 144, which
are methylation specific primers useful for detecting methylation
of an SFRP1, SFRP2, SFRP4, or SFRP5 gene 5' regulatory region; and
a primer pair as set forth in SEQ ID NOS: 25 and 26, SEQ ID NOS:
113 and 114, SEQ ID NOS: 117 and 118, SEQ ID NOS: 121 and 122, SEQ
ID NOS: 127 and 128, SEQ ID NOS: 131 and 132, SEQ ID NOS: 135 and
136, SEQ ID NOS: 141 and 142, or SEQ ID NOS: 145 and 146, which are
unmethylation specific primers useful for detecting a lack of
methylation of an SFRP1, SFRP2, SFRP4, or SFRP5 gene 5' regulatory
region. In view of the exemplified methylation-specific and
unmethylation-specific primer pairs, and the availability of
nucleotide sequences comprising portions of target genes such as
those listed in Table 1, it will be recognized that additional
methylation-specific and unmethylation-specific primer pairs useful
for amplification of a methylated or an unmethylated gene as listed
in Table 1 or other identified target gene, as well as for family
members related to the listed genes such as the SFRP family
members, readily can be made.
Accordingly, in one aspect, MSP is used for detecting the amount or
distribution of uracil residues in a bisulfite ion treated target
genes following alkaline treatment. Such a method can be performed
by contacting the gene sequence with a first amplification primer
pair and a second amplification primer pair under conditions
suitable for amplification, wherein the first amplification primer
pair comprises a forward primer and a reverse primer, and at least
one primer of the first primer pair comprises an oligonucleotide
that selectively hybridizes to a nucleotide sequence of the target
gene that contains uracil residues, and wherein the second
amplification primer pair comprises a forward primer and a reverse
primer, and both primers of the second primer pair selectively
hybridize to a target gene containing cytosine residues, but not to
a target gene sequence containing uracil residues, and wherein an
amplification product, if any, generated by the first primer pair
has a first length, and an amplification product, if any, generated
by the second primer pair has a second length, which is different
from the first length, whereby the length of the amplification
products is indicative of the amount or distribution of uracil
residues and, therefore, of methylation of cytosine residues in CpG
dinucleotides in the target gene of the test cell.
The amount or distribution of uracil residues also can be detected
by contacting the 5' regulatory region of the gene with a first
amplification primer pair and a second amplification primer pair
under conditions suitable for amplification, wherein the first
amplification primer pair comprises a forward primer and a reverse
primer, wherein at least one primer of the first primer pair
comprises an oligonucleotide that selectively hybridizes to a
nucleotide sequence of the 5' regulatory region of the gene
containing uracil residues, and wherein the second amplification
primer pair comprises a forward primer and a reverse primer,
wherein both primers of the second primer pair selectively
hybridize to a nucleotide sequence of the 5' regulatory region of
the gene containing cytosine residues, but not to a corresponding
nucleotide sequence of the 5' regulatory region of the gene
containing uracil residues, and wherein an amplification product,
if any, generated by the first primer pair has a first length, and
wherein an amplification product, if any, generated by the second
primer pair has a second length, which is different from the first
length, whereby the length of the amplification products is
indicative of uracil residues and, therefore, methylation of
cytosine residues in CpG dinucleotides in the 5' regulatory region
of the gene, thereby detecting methylation silencing of the gene of
the test cell.
Methylation silencing of a gene in a cell exhibiting or suspected
of exhibiting unregulated growth (e.g., a gene associated with a
cancer) also can be identified by contacting a test cell with a
demethylating agent, and detecting increased expression of an RNA
encoded by the gene as compared to a level of expression of the RNA
in a test cell not contacted with a demethylating agent. Such a
method can further include detecting methylation, if any, of
cytosine residues in a CpG dinucleotide in a CpG island of the 5'
regulatory region of the gene in a corresponding cell exhibiting
regulated growth, or an extract of the corresponding cell The
demethylating agent can be a methyltransferase inhibitor such as
DAC. Increased expression of an RNA can be detected using any
method for detecting RNA, including, for example, northern blot
analysis, a reverse transcription-polymerase chain reaction assay,
or selective hybridization to an array of nucleotide sequences as
disclosed herein. Accordingly, the methods of the invention can be
performed in a high throughput format, wherein the test cell, or
extract of the test cell, comprises one of a plurality of test
cells, or extracts of the test cells, or a combination thereof, and
each of the test cells, or extracts of the test cells, of the
plurality is the same or different, or a combination thereof.
In adapting the methods of the invention to a high throughput
format, the test cells, or extracts of the test cell, can be
arranged in an array, which can be an addressable array, on a solid
support such as a microchip, a glass slide, or a bead, and the
cells (or extracts) can be contacted serially or in parallel with
an oligonucleotide probe or primer (or primer pair) as disclosed
herein. Samples arranged in an array or other reproducible pattern
can be assigned an address (i.e., a position on the array), thus
facilitating identification of the source of the sample. An
additional advantage of arranging the samples in an array,
particularly an addressable array, is that an automated system can
be used for adding or removing reagents from one or more of the
samples at various times, or for adding different reagents to
particular samples. In addition to the convenience of examining
multiple samples at the same time, such high throughput assays
provide a means for examining duplicate, triplicate, or more
aliquots of a single sample, thus increasing the validity of the
results obtained, and for examining control samples under the same
conditions as the test samples, thus providing an internal standard
for comparing results from different assays. Conveniently, cells or
extracts at a position in the array can be contacted with two or
more oligonucleotide probes or primers (or primer pairs), wherein
the oligonucleotides are differentially labeled or comprise a
reaction that generates distinguishable products, thus providing a
means for performing a multiplex assay. Such assays can allow the
examination of one or more, particularly 2, 3, 4, 5, 10, 15, 20, or
more genes to identify epigenetically silenced genes in a test
cell.
The present invention also provides oligonucleotides, which can be
useful as probes or primers for identifying an epigenetic silenced
gene (or the absence thereof). As used herein, the term
"oligonucleotide", "polynucleotide", or "nucleic acid molecule" is
used broadly to mean a sequence of two or more deoxyribonucleotides
or ribonucleotides that are linked together by a phosphodiester
bond. The term "gene" also is used herein to refer to a
polynucleotide sequence contained in a genome. It should be
recognized, however, that a nucleic acid molecule comprising a
portion of a gene can be isolated from a cell or can be examined as
genomic DNA, for example, by a hybridization reaction or a PCR
reaction. Thus, while in a genome, it may not always be clear as to
a specific nucleotide position where a gene begins or ends, for
purposes of the present invention, a gene is considered to be a
discrete nucleic acid molecule that includes at least the
nucleotide sequence set forth in the GenBank Accession Numbers
shown in Table 1 for various genes identified and or examined
herein.
For convenience of discussion, the term "oligonucleotide" is used
herein to refer to a polynucleotide that is used as a probe or
primer, whereas the term "polynucleotide" or "nucleic acid
molecule" is used more broadly to encompass any sequence of two or
more nucleotides, including an oligonucleotide. In addition, the
term "nucleotide sequence is used to refer to the molecules that
are present on an array. As such, it should be recognized that the
various terms used herein to conveniently distinguish different
nucleic acid molecules. As such, the terms include RNA and DNA,
which can be a gene or a portion thereof, a cDNA, a synthetic
polydeoxyribonucleic acid sequence, or the like. Generally, an
oligonucleotide or polynucleotide can be single stranded or double
stranded, as well as a DNA/RNA hybrid, although it will be
recognized that the strands of a double stranded oligonucleotide
that is to be used as a probe or primer will be separated, for
example, by heating a solution containing the oligonucleotide above
the melting temperature of the particular oligonucleotide.
The terms "oligonucleotide", "polynucleotide", and the like as used
herein include naturally occurring nucleic acid molecules, which
can be isolated from a cell, as well as fragments thereof as
produced, for example, by a restriction endonuclease digestion, and
synthetic molecules, which can be prepared, for example, by methods
of chemical synthesis or by enzymatic methods such as by PCR. In
various embodiments, an oligonucleotide or polynucleotide of the
invention can contain nucleoside or nucleotide analogs, or a
backbone bond other than a phosphodiester bond, for example, a
thiodiester bond, a phosphorothioate bond, a peptide-like bond or
any other bond known to those in the art as useful for linking
nucleotides to produce synthetic polynucleotides (see, for example,
Tam et al., Nucl. Acids Res. 22:977-986, 1994); Ecker and Crooke,
BioTechnology 13:351360, 1995, each of which is incorporated herein
by reference). The incorporation of non-naturally occurring
nucleotide analogs or bonds linking the nucleotides or analogs can
be particularly useful where the polynucleotide is to be exposed to
an environment that can contain a nucleolytic activity, including,
for example, a tissue culture medium, a cell or in a living
subject, since the modified polynucleotides can be designed to be
less (or, if desired, more) susceptible to degradation.
In general, the nucleotides comprising a polynucleotide are
naturally occurring deoxyribonucleotides, such as adenine,
cytosine, guanine or thymine linked to 2'-deoxyribose, or
ribonucleotides such as adenine, cytosine, guanine or uracil linked
to ribose. However, a polynucleotide (or oligonucleotide) also can
contain nucleotide analogs, including non-naturally occurring
synthetic nucleotides or modified naturally occurring nucleotides.
Such nucleotide analogs are well known in the art and commercially
available, as are polynucleotides containing such nucleotide
analogs (Lin et al., Nucl. Acids Res. 22:5220-5234, 1994; Jellinek
et al., Biochemistry 34:11363-11372, 1995; Pagratis et al., Nature
Biotechnol. 15:68-73, 1997, each of which is incorporated herein by
reference).
A polynucleotide comprising naturally occurring nucleotides and
phosphodiester bonds can be chemically synthesized or can be
produced using recombinant DNA methods, using an appropriate
polynucleotide as a template. In comparison, a polynucleotide
comprising nucleotide analogs or covalent bonds other than
phosphodiester bonds generally will be chemically synthesized,
although an enzyme such as T7 polymerase can incorporate certain
types of nucleotide analogs into a polynucleotide and, therefore,
can be used to produce such a polynucleotide recombinantly from an
appropriate template (Jellinek et al., supra, 1995). As such, the
polynucleotide can be prepared using a method such as conventional
phosphotriester and phosphodiester methods, including, for example,
an automated method such as that using diethylphosphoramidites (see
Beaucage et al., Tetrahedron Lett., 22:1859-1862, 1981), or a
method whereby the oligonucleotides are synthesized on a modified
solid support (see U.S. Pat. No. 4,458,066).
An oligonucleotide of the invention, which can selectively
hybridize to a target nucleic acid molecule and can be used as a
reagent for detecting expression and/or methylation (or lack of
methylation; "unmethylation") of a gene, is designed to selectively
hybridize to a nucleotide sequence within about 2000 nucleotides
upstream (5') or downstream (3') of the target gene, and generally
within about 1000 nucleotides of the region comprising the CpG
island that is to be examined for cytosine methylation, usually
within about 500 nucleotides of the site to be examined. In
addition, as indicated above, an oligonucleotide of the invention,
or useful in a method of the invention, is at least about 12
nucleotides in length, generally at least about 14 or 15
nucleotides in length, usually at least about 18 to 20 nucleotides,
and can be about 25, 30, 35 or more nucleotides in length, such
that it can selectively hybridize to a target nucleic acid molecule
(see, for example, Tables 2, 3, and 4). It will be recognized that
the length of the oligonucleotide will depend, in part, on the
target gene. For example, when the target gene is one of a family
of closely related genes having regions of substantial sequence
similarity, a longer oligonucleotide can be used to assure
selective hybridization to the target gene and minimal, if any,
cross-hybridization to the related gene sequence(s).
Oligonucleotides of the invention are designed to be substantially
complementary to at least one strand of a double stranded nucleic
acid molecule corresponding to a genomic locus (or to each of both
strands where an intervening sequence is to be amplified) and,
where they are to be used for differentiating methylated from
unmethylated cytosine residues, will include the appropriate
guanine or cytosine residues, as discussed above. Oligonucleotides
of the invention are exemplified by amplification primer pairs
useful 1) for RT-PCR of a nucleotide sequence of a target gene
(see, for example, Table 4, SEQ ID NOS: 149 to 296); 2) for
methylation specific or unmethylation specific amplification of a
nucleotide sequence of a target gene (see, for example, Table 2,
wherein MSP(M) indicates methylation specific primer pairs (e.g.,
SEQ ID NOS: 3 and 4) and MSP(U) indicates unmethylation specific
primer pairs (e.g., SEQ ID NOS: 5 and 6), see, also, Table 3); or
3) for bisulfite PCR (see, for example, Table 2, SEQ ID NOS: 1 and
2).
Accordingly, the present invention provides an oligonucleotide
selected from any one of SEQ ID NOS: 1 to 296, and further provides
a plurality of such oligonucleotides, which includes at least two
(e.g., 2, 3, 4, 5, or more) of the oligonucleotides set forth as
SEQ ID NOS: 1 to 296, wherein the amplification primer pair can
amplify a nucleotide sequence of a gene as listed in Table 1, in
some cases depending, for example, on whether the target sequence
is methylated or unmethylated. The present invention also provides
an amplification primer pair, which comprises a forward primer and
a reverse primer, particularly a primer pair that includes one, and
particularly two, of the oligonucleotides of SEQ ID NOS: 1 to 296,
which can be a forward primer, a reverse primer or both of a primer
pair as set forth in Tables 2, 3 and 4 (e.g., SEQ ID NOS: 1 and 2,
SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6, etc.).
In one aspect, an amplification primer pair of the invention can be
used to specifically amplify a methylated 5' regulatory region of
the nucleic acid molecule, such amplification primer pairs being
exemplified by SEQ ID NOS: 23 and 24, SEQ ID NOS: 111 and 112, SEQ
ID NOS: 115 and 116, SEQ ID NOS: 119 and 120, SEQ ID NOS: 125 and
126, SEQ ID NOS: 129 and 130, SEQ ID NOS: 133 and 134, SEQ ID NOS:
139 and 140 or SEQ ID NOS: 143 and 144, which can amplify SFRP
family members having a methylated 5' regulatory region (see Tables
2 and 3). In another aspect, an amplification primer pair of the
invention can be used to specifically amplify an unmethylated 5'
regulatory region of the nucleic acid molecule, such amplification
primer pairs being exemplified by SEQ ID NOS: 25 and 26, SEQ ID
NOS: 113 and 114, SEQ ID NOS: 117 and 118, SEQ ID NOS: 121 and 122,
SEQ ID NOS: 127 and 128, SEQ ID NOS: 131 and 132, SEQ ID NOS: 135
and 136, SEQ ID NOS: 141 and 142 or SEQ ID NOS: 145 and 146, which
can amplify SFRP family members having an unmethylated 5'
regulatory region (see Tables 2 and 3).
The present invention also relates to a kit, which contains at
least one isolated oligonucleotide of the invention, including, for
example, a plurality of such isolated oligonucleotides. In one
embodiment, a plurality of isolated oligonucleotides of a kit of
the invention includes at least one amplification primer pair
(i.e., a forward primer and a reverse primer), and can include a
plurality of amplification primer pairs, including, for example,
amplification primer pairs as set forth in Table 2, Table 3, and/or
Table 4. As such, a kit of the invention can contain, for example,
one or a plurality of methylation specific amplification primer
pairs, unmethylation specific amplification primer pairs, or a
combination methylation specific amplification primer pairs and
unmethylation specific amplification primer pair, including
methylation specific primer pairs and unmethylation specific primer
pairs useful for amplifying a methylated form or an unmethylated
form of a particular gene that is known to be or suspected of being
methylation silenced in one or more types of cancer cells.
A kit of the invention can further include additional reagents,
which can be useful, for example, for a purpose for which the
oligonucleotides of the kit are useful. For example, where a kit
contains one or a plurality of methylation specific and/or
unmethylation specific amplification primers, the kit can further
contain, for example, control polynucleotides, which can be
methylated or unmethylated; one or more reagents that modify
methylated cytosine residues, and/or one or more reagents for
performing an amplification reaction. Where the kit contains one or
plurality of oligonucleotides that selectively hybridize to a
methylated or to an unmethylated gene sequence, the kit can further
contain, for example, a methylation sensitive restriction
endonuclease. A kit of the invention also can contain at least a
second primer pair, which can, but need not, be one of the above
listed primer pairs, and can be useful, for example, for a nested
amplification reaction. Such additional primer pairs can be
designed based on the expected sequence of the amplified portion of
the target gene using the sequence information available in the
relevant GenBank Accession No. for the target gene (see Table
1).
In one embodiment, a kit of the invention contains a methylation
specific primer pair and an unmethylation specific primer pair,
which are specific for the same target gene, thus allowing a user
of the kit to determine whether a particular target gene is
methylated or unmethylated. In another embodiment, the kit contains
a plurality of such methylation specific and unmethylation specific
primer pairs, thus allowing a user to determine the methylation of
one or more target genes. For example, such a kit can contain a
primer pair as set forth in SEQ ID NOS: 3 and 4 (see Table 2;
MSP(M)) and a primer pair as set forth in SEQ ID NOS: 5 and 6
(Table 2; MSP(U)), thus providing amplification primer pairs useful
for determining whether the 5' regulatory region of the S100A10
gene (see, also, GenBank Ace. No. AA44051; Table 1) is methylated
or unmethylated. Additional combinations of methylation and/or
unmethylation specific primer pairs can be determined by referring
to Tables 2 and 3, thus providing kits that allow a determination
of the methylation status of different genes and/or of different
members of a gene family such as the SFRP gene family. Such a kit
can further contain a primer pair that includes oligonucleotides
that selectively hybridize to an expected amplification product
generated using the methylation specific or unmethylation specific
primer pair, thus providing reagents useful for performing a nested
amplification procedure.
A kit of the invention also can contain a detectable label that can
be linked to or incorporated into an oligonucleotide of the kit, or
a plurality of different detectable labels such that, depending the
needs of the user, can be selected for a particular use, and, if
desired, reagents for linking or incorporating the detectable label
into the oligonucleotide. Alternatively, or in addition, the kit
can contain one or more reagents useful for performing a
hybridization reaction such that selective hybridization conditions
readily are attained; and/or can contain one or more standard
nucleic acid molecules, for example, a standard target SFRP1,
nucleotide sequence that contains methylated cytosine residues
corresponding the region to which the oligonucleotide is designed
to selectively hybridize, or a standard target SFRP1 nucleotide
sequence that contains unmethylated cytosine residues corresponding
to the target sequence, or a combination thereof. Such standards
provide several advantages, including, for example, allowing a
confirmation that a reaction using a test cell, or extract thereof,
functioned properly, or allowing for comparisons among samples
examined at different times or collected from different
sources.
Where a kit contains one or more oligonucleotides useful for
performing a primer extension (or amplification) reaction, the kit
can further include reagents for performing the selective
hybridization reaction such that the oligonucleotide provides a
substrate for the extension reaction; and/or one or more reagents
for performing the primer extension (or amplification) reaction,
for example, dNTPs, one or more of which can be detectably labeled
or otherwise modified for conveniently linking a detectable label;
one or a selection of polymerases; and/or one or more standard
target nucleic acid molecules. Where a kit of the invention
contains two or more oligonucleotides (or primer pairs) such as
those exemplified herein or otherwise useful for practicing the
methods of the invention, the kit provides a convenient source of
reagents from which the skilled artisan can select one or more
oligonucleotides (or primer pairs), as desired.
The present invention also relates to a method of reducing or
inhibiting unregulated growth of a cell exhibiting epigenetic
silenced transcription of at least one gene associated with a
cancer. Such a method can be practiced, for example, by restoring
expression of a polypeptide encoded by the epigenetic silenced gene
in the cell, thereby reducing or inhibiting unregulated growth of
the cell. Such expression can be restored, for example, by
contacting the cell with a demethylating agent (e.g, a
methyltransferase inhibitor), a histone deacetylase inhibitor, or a
combination thereof.
In one embodiment, the epigenetic silenced gene is a methylation
silenced gene, and the method includes contacting the cell with at
least one demethylating agent, for example, DAC. In one aspect, the
cell can be contacted with the demethylating agent in vitro, e.g.,
in a culture medium or other medium conducive to survival of the
cell. If desired, the cell contacted with the demethylating agent
further can be administered to a subject. In another aspect, the
agent can be administered to subject such that the cell exhibiting
unregulated growth is contacted with the agent.
In another embodiment, the method includes introducing a
polynucleotide encoding the polypeptide into the cell, whereby the
polypeptide is expressed from the polynucleotide, thereby restoring
expression of the polypeptide in the cell. The polynucleotide can,
but need not, be contained in a vector, e.g., a viral vector,
and/or can be formulated in a matrix that facilitates introduction
of the polynucleotide into a cell, e.g., liposomes or microbubbles.
The polynucleotide can be introduced into a cell by contacting the
cell with the polynucleotide ex vivo, in which case the cell
containing the polynucleotide can, but need not, be administered to
a subject. The polynucleotide also can be introduced into a cell by
contacting the cell with the polynucleotide in vivo.
The epigenetic silenced gene can be any gene identified using a
method as disclosed herein, and examining a particular cell type
such as a particular cancer cell type. Epigenetic silenced genes in
colorectal cancer cells are exemplified herein by the genes listed
in Table 1, for which GenBank Accession Nos. Polynucleotide
sequences encompassing portions of the genes of Table 1 can be
obtained, for example, by RT-PCR of nucleic acid molecules obtained
from colorectal cancer cells using amplification primer pairs as
set forth in Table 3 (SEQ ID NOS: 149 to 296). Epigenetic silenced
genes in colorectal cancer cells and/or gastric cancer cells are
exemplified by PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L,
KIAA0786, TIMP2, PCDH8, FOLH1, and SNRPN, which do not exhibit
detectable basal expression, and are re-expressed upon treatment
with DAC, but not with TSA; HOXA1, GRO3, and DLX7, which exhibit a
basal level of expression that is increased upon treatment with
DAC, but not TSA; and POR1, MBNL, TRADD, PDIP, RAD23B, RPL13,
GNAI2, PPP1R21A, FPGT, and TRIM32, which are up-regulated by TSA
alone, whereas their basal expression and up-regulation with DAC
vary among genes.
The present invention also relates to a method for selecting a
therapeutic strategy for treating a cancer patient. Such a method
can be performed, for example, by identifying at least one
methylation silenced gene associated with the cancer, according to
a method as disclosed herein (i.e., by contacting an array of
nucleotide sequences representative of a genome with nucleic acid
subtraction products and detecting selective hybridization of
nucleic acid subtraction products to a subpopulation of nucleotide
sequences of the array; and selecting an agent useful for restoring
expression of one or more of the identified methylation silenced
gene in cancer cells of the patient. For example, the selected
agent can be a polynucleotide encoding an identified methylation
silenced gene, for example, a polynucleotide encoding a polypeptide
encoded by a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L,
KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3, or DLX7 gene, a
family member of such a gene, or a combination of such genes. The
selected agent for restoring expression of a methylation silenced
gene also can be a demethylating agent such as DAC.
Accordingly, the invention provide a method for treating a cancer
patient, wherein cancer cells in the patient exhibit epigenetic
silenced expression of at least one gene. Such a method can be
performed, for example, by restoring expression of one or more
epigenetic silenced genes in cancer cells in the patient. For
example, where at least one epigenetic silenced gene is a
methylation silenced gene, the patient can be treated by
administering a demethylating agent to the subject in an amount
sufficient to restore expression of the methylation silenced
gene(s) in cancer cells in the subject. Alternatively, or in
addition, the patient can be treated by administering at least one
polynucleotide encoding at least one polypeptide encoded by one or
more of the epigenetic silenced genes to the subject under
conditions sufficient for expression of the at least one
polypeptide in cancer cells in the subject. Where a polynucleotide
is administered to the patient, the polynucleotide can be contained
in a vector (e.g., a viral vector) preferably an expression vector,
and/or can be formulated in a matrix that facilitates uptake of the
polynucleotide by a target cancer cell (e.g., in a liposome).
The cancer to be treated according to a method of the invention can
be any type of cancer, including, for example, a carcinoma or a
sarcoma. For example, wherein the cancer is a colorectal cancer, a
gastric cancer, or colorectal cancer and gastric cancer, a patient
can be treated by restoring expression of one or more epigenetic
silenced genes, including, PTGS2, CDKN2A, TIMP3, S100A10, SFRP1,
CXX1, SEZZ6L, KIAA0786, TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3,
DLX7, POR1, MBNL, TRADD, PDIP, RAD23B, RPL13, GNAI2, PPP1R21A,
FPGT, TRIM32, a family member thereof, or a combination thereof.
The SFRP genes, including SFRP1, SFRP2, SFRP4, and SFRP5, provide
an example of a family of genes in which one or more is
epigenetically silenced in colorectal cancer cells, gastric cancer
cells, or both.
In one embodiment, a method is provided for treating a subject
suffering from a colorectal cancer, a gastric cancer, or both,
wherein cells associated with the cancer contain at least one
methylation silenced gene. Such a method can be performed, for
example, by administering an amount of an agent that restores
expression of the at least one methylation silenced gene to the
subject sufficient to restore expression of the methylation
silenced gene in cells associated with the cancer. The agent can be
a polynucleotide encoding the at least one methylation silenced
gene, for example, a polynucleotide encoding a polypeptide encoded
by a PTGS2, CDKN2A, TIMP3, S100A10, SFRP1, CXX1, SEZZ6L, KIAA0786,
TIMP2, PCDH8, FOLH1, SNRPN, HOXA1, GRO3, and/or DLX7 gene, a family
member thereof, or a combination thereof; or can be a demethylating
agent such as DAC. An agent useful for treating a subject suffering
from a colorectal cancer, a gastric cancer, or both, can be
contacted with cells of the cancer ex vivo, after which the cells
can be administered back into the patient; or the agent can be
administer to a site of the cancer cells in the patient.
As a result of methylation silenced transcription of one or more
genes in a cell, the gene product(s) is not present in the cell
and, therefore, there is a loss of function associated with the
absence of the encoded gene product(s). For example, SFRP gene
family members can counter WNT/frizzled signaling (Finch et al.,
Proc. Natl. Acad. Sci., USA 94:6770-6775, 1997; Rattner et al.,
Proc. Natl. Acad. Sci., USA 94:2859-2963, 1997). As such, loss of
function of one or more SFRP genes can abrogate an entire tumor
suppressor pathway. Similarly, the PCDH8 gene encodes a member of a
cell adhesion molecule family, loss of function of which is known
to be important in tumor invasion and metastasis (Strehl et al.,
Genomics 53:81-89, 1998). Accordingly, the methods of the invention
are based on providing a cell that exhibits unregulated growth due
to epigenetic silenced, particularly methylation silenced, gene
expression with the polypeptide encoded by the methylation silenced
gene, thereby restoring regulated growth to the cell. As disclosed
herein, the polypeptide can be provided to the cell directly, can
be expressed from an exogenous polynucleotide that is introduced
into the cell and encodes the polypeptide, or by restoring
expression of the endogenous methylation silenced gene in the cell.
By restoring the polypeptide to a cell exhibiting unregulated
growth, or characteristics generally associated with unregulated
growth, including, for example, the ability to grow in soft agar, a
lack of contact inhibited growth, or refractoriness to programmed
cell death, are alleviated.
Expression of one or more methylation silenced genes such as one or
more genes shown in Table 1 can restored, for example, by
contacting the cells with a demethylating agent such as DAC, which,
when incorporated into the genes during replication of the cell
results in progeny cells containing unmethylated genes, which can
be transcribed. The cells contacted with the demethylating agent
can be cells in culture, wherein the demethylating agent is added
to the cell culture medium in an amount sufficient to result in
demethylation of the target genes, without being toxic to the
cells. The cells in culture can be cells of an established cell
line, or can be cells, which can be a mixed population of cells,
that have been removed from a subject and are being contacted ex
vivo, for example, to determine whether contact with the particular
demethylating agent can restore expression of the target gene(s),
and therefore, can be useful when administered to the subject. Such
ex vivo treatment of the cells also can be useful for restoring
expression of the target gene, after which the cells, which
optionally can be expanded in culture, can be administered back to
the subject. Such a method, as well as any of the methods of
treatment as disclosed herein, can further include treatments
otherwise known in the art as useful for treating a subject having
the particular cancer, or that can be newly useful when used in
combination with the present methods.
Cells exhibiting methylation silenced gene expression also can be
contacted with the demethylating agent in vivo by administering the
agent to a subject. Where convenient, the demethylating agent can
be administered using, for example, a catheterization procedure, at
or near the site of the cells exhibiting unregulated growth in the
subject, or into a blood vessel in which the blood is flowing to
the site of the cells. Similarly, where an organ, or portion
thereof, to be treated can be isolated by a shunt procedure, the
agent can be administered via the shunt, thus substantially
providing the agent to the site containing the cells. The agent
also can be administered systemically or via other routes as
disclosed herein or otherwise known in the art.
A polypeptide, which is reduced or absent due to an epigenetic
silenced gene, also can be provided to a cell by introducing a
polynucleotide encoding the polypeptide into the cell, whereby the
polypeptide is expressed from the polynucleotide in the cell. As
such, the present invention provides methods of gene therapy, which
can be practiced in vivo or ex vivo. For example, where the cell is
characterized by methylation silenced transcription of the SFRP1
gene, a polynucleotide having a nucleotide sequence as set forth in
GenBank Accession No. N32514 (see Table 1) can be introduced into
the target cell.
The polynucleotide can include, in addition to polypeptide coding
sequence, operatively linked transcriptional regulatory elements,
translational regulatory elements, and the like, and can be in the
form of a naked DNA molecule, which can be contained in a vector,
or can be formulated in a matrix such as a liposome or microbubbles
that facilitates entry of the polynucleotide into the particular
cell. As used herein, the term "operatively linked" refers to two
or more molecules that are positioned with respect to each other
such that they act as a single unit and effect a function
attributable to one or both molecules or a combination thereof. For
example, a polynucleotide encoding an SFRP1, polypeptide can be
operatively linked to a second (or more) coding sequence, such that
a chimeric polypeptide can be expressed from the operatively linked
coding sequences. The chimeric polypeptide can be a fusion protein,
in which the two (or more) encoded polypeptides are translated into
a single polypeptide, i.e., are covalently bound through a peptide
bond; or can be translated as two discrete peptides that, upon
translation, can operatively associate with each other to form a
stable complex. Similarly, a polynucleotide sequence encoding a
desired polypeptide can be operatively linked to a regulatory
element, in which case the regulatory element confers its
regulatory effect on the polynucleotide similarly to the way in
which the regulatory element would effect a polynucleotide sequence
with which it normally is associated with in a cell.
A fusion protein generally demonstrates some or all of the
characteristics of each of its polypeptide components, and,
therefore, can be useful for restoring gene expression in the cell
and can further provide additional advantages. For example, the
fusion protein can include a polypeptide, which is otherwise
reduced or absent due to epigenetic silencing of its encoding gene,
operatively linked to a cell compartment localization domain such
that expression of the fusion protein in a cell or loading of the
cell with fusion protein allows translocation of the encoded
polypeptide to the intracellular compartment such as the nucleus,
in which it effects its activity. Cell compartmentalization
domains, for example, are well known and include a plasma membrane
localization domain, a nuclear localization signal, a mitochondrial
membrane localization signal, an endoplasmic reticulum localization
signal, and the like, as well as signal peptides, which can direct
secretion of a polypeptide from a cell (see, for example, Hancock
et al., EMBO J. 10:4033-4039, 1991; Buss et al., Mol. Cell Biol.
8:3960-3963, 1988; U.S. Pat. No. 5,776,689 each of which is
incorporated herein by reference). The fusion protein also can
comprise a desired polypeptide operatively linked to a peptide that
acts as a ligand for a receptor, a peptide useful as a tag for
identifying a cell in which the polypeptide is expressed, or for
isolating the fusion protein, or any other peptide or polypeptide
of interest, providing the fusion protein has the protein activity
of the desired polypeptide, e.g., an SFRP polypeptide activity in
countering WNT/frizzled activity. Peptide tags such as a
polyhistidine tag peptide, e.g., His-6, which can be detected using
a divalent cation such as nickel ion, cobalt ion, or the like; a
FLAG epitope, which can be detected using an anti-FLAG antibody
(see, for example, Hopp et al., BioTechnology 6:1204 (1988); U.S.
Pat. No. 5,011,912, each of which is incorporated herein by
reference); a c-myc epitope, which can be detected using an
antibody specific for the epitope; biotin, which can be detected
using streptavidin or avidin; and glutathione S-transferase, which
can be detected using glutathione, are well known in the art, and
provide a means of detecting the presence of a polypeptide
operatively linked thereto. Such tags provide the additional
advantage that they can facilitate isolation of the operatively
linked polypeptide, for example, where it is desired to obtain the
polypeptide in a substantially purified form, such a polypeptide
also being useful for practicing methods of the invention.
A polynucleotide encoding a polypeptide otherwise encoded by an
epigenetic silenced can be used alone, or can be contained in a
vector, which can facilitate manipulation of the polynucleotide,
including introduction of the polynucleotide into a target cell.
The vector can be a cloning vector, which is useful for maintaining
the polynucleotide, or can be an expression vector, which contains,
in addition to the polynucleotide, regulatory elements useful for
expressing the polynucleotide and encoded polypeptide in a
particular cell. An expression vector can contain the expression
elements necessary to achieve, for example, sustained transcription
of the encoding polynucleotide, or the regulatory elements can be
operatively linked to the polynucleotide prior to its being cloned
into the vector.
An expression vector (or the polynucleotide encoding the desired
polypeptide) generally contains or encodes a promoter sequence,
which can provide constitutive or, if desired, inducible or tissue
specific or developmental stage specific expression of the encoding
polynucleotide, a poly-A recognition sequence, and a ribosome
recognition site or internal ribosome entry site, or other
regulatory elements such as an enhancer, which can be tissue
specific. The vector also can contain elements required for
replication in a prokaryotic or eukaryotic host system or both, as
desired. Such vectors, which include plasmid vectors and viral
vectors such as bacteriophage, baculovirus, retrovirus, lentivirus,
adenovirus, vaccinia virus, semliki forest virus and
adeno-associated virus vectors, are well known and can be purchased
from a commercial source (Promega, Madison Wis.; Stratagene, La
Jolla Calif.; GIBCO/BRL, Gaithersburg Md.) or can be constructed by
one skilled in the art (see, for example, Meth. Enzymol., Vol. 185,
Goeddel, ed. (Academic Press, Inc., 1990); Jolly, Canc. Gene Ther.
1:51-64, 1994; Flotte, J. Bioenerg. Biomemb. 25:37-42, 1993;
Kirshenbaum et al., J. Clin. Invest. 92:381-387, 1993; each of
which is incorporated herein by reference).
A tetracycline (tet) inducible promoter can be particularly useful
for driving expression of a polynucleotide encoding a desired
polypeptide. Upon administration of tetracycline, or a tetracycline
analog, to a subject containing a polynucleotide operatively linked
to a tet inducible promoter, expression of the encoded polypeptide
is induced. The polynucleotide also can be operatively linked to
tissue specific regulatory element, for example, a liver cell
specific regulatory element such as an .alpha.-fetoprotein promoter
(Kanai et al., Cancer Res. 57:461-465, 1997; He et al., J. Exp.
Clin. Cancer Res. 19:183-187, 2000) or an albumin promoter (Power
et al., Biochem. Biophys. Res. Comm. 203:1447-1456, 1994; Kuriyama
et al., Int. J. Cancer 71:470-475, 1997); a muscle cell specific
regulatory element such as a myoglobin promoter (Devlin et al., J.
Biol. Chem. 264:13896-13901, 1989; Yan et al., J. Biol. Chem.
276:17361-17366, 2001); a prostate cell specific regulatory element
such as the PSA promoter (Schuur et al., J. Biol. Chem.
271:7043-7051, 1996; Latham et al., Cancer Res. 60:334-341, 2000);
a pancreatic cell specific regulatory element such as the elastase
promoter (Ornitz et al., Nature 313:600-602, 1985; Swift et al.,
Genes Devel. 3:687-696, 1989); a leukocyte specific regulatory
element such as the leukosialin (CD43) promoter (Shelley et al.,
Biochem. J. 270:569-576, 1990; Kudo and Fukuda, J. Biol. Chem.
270:13298-13302, 1995); or the like, such that expression of the
polypeptide is restricted to particular cell in an individual, or
to particular cells in a mixed population of cells in culture, for
example, an organ culture. Regulatory elements, including tissue
specific regulatory elements, many of which are commercially
available, are well known in the art (see, for example, InvivoGen;
San Diego Calif.).
Viral expression vectors can be particularly useful for introducing
a polynucleotide into a cell, particularly a cell in a subject.
Viral vectors provide the advantage that they can infect host cells
with relatively high efficiency and can infect specific cell types.
For example, a polynucleotide encoding a desired polypeptide can be
cloned into a baculovirus vector, which then can be used to infect
an insect host cell, thereby providing a means to produce large
amounts of the encoded polypeptide. The viral vector also can be
derived from a virus that infects cells of an organism of interest,
for example, vertebrate host cells such as mammalian, avian or
piscine host cells. Viral vectors can be particularly useful for
introducing a polynucleotide useful in performing a method of the
invention into a target cell. Viral vectors have been developed for
use in particular host systems, particularly mammalian systems and
include, for example, retroviral vectors, other lentivirus vectors
such as those based on the human immunodeficiency virus (HIV),
adenovirus vectors, adeno-associated virus vectors, herpesvirus
vectors, hepatitis virus vectors, vaccinia virus vectors, and the
like (see Miller and Rosman, BioTechniques 7:980-990, 1992;
Anderson et al., Nature 392:25-30 Suppl., 1998; Verma and Somia,
Nature 389:239-242, 1997; Wilson, New Engl. J. Med. 334:1185-1187
(1996), each of which is incorporated herein by reference).
A polynucleotide, which can be contained in a vector, can be
introduced into a cell by any of a variety of methods known in the
art (Sambrook et al., supra, 1989; Ausubel et al., Current
Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md.
(1987, and supplements through 1995), each of which is incorporated
herein by reference). Such methods include, for example,
transfection, lipofection, microinjection, electroporation and,
with viral vectors, infection; and can include the use of
liposomes, microemulsions or the like, which can facilitate
introduction of the polynucleotide into the cell and can protect
the polynucleotide from degradation prior to its introduction into
the cell. A particularly useful method comprises incorporating the
polynucleotide into microbubbles, which can be injected into the
circulation. An ultrasound source can be positioned such that
ultrasound is transmitted to the tumor, wherein circulating
microbubbles containing the polynucleotide are disrupted at the
site of the tumor due to the ultrasound, thus providing the
polynucleotide at the site of the cancer. The selection of a
particular method will depend, for example, on the cell into which
the polynucleotide is to be introduced, as well as whether the cell
is isolated in culture, or is in a tissue or organ in culture or in
situ.
Introduction of a polynucleotide into a cell by infection with a
viral vector is particularly advantageous in that it can
efficiently introduce the nucleic acid molecule into a cell ex vivo
or in vivo (see, for example, U.S. Pat. No. 5,399,346, which is
incorporated herein by reference). Moreover, viruses are very
specialized and can be selected as vectors based on an ability to
infect and propagate in one or a few specific cell types. Thus,
their natural specificity can be used to target the nucleic acid
molecule contained in the vector to specific cell types. As such, a
vector based on an HIV can be used to infect T cells, a vector
based on an adenovirus can be used, for example, to infect
respiratory epithelial cells, a vector based on a herpesvirus can
be used to infect neuronal cells, and the like. Other vectors, such
as adeno-associated viruses can have greater host cell range and,
therefore, can be used to infect various cell types, although viral
or non-viral vectors also can be modified with specific receptors
or ligands to alter target specificity through receptor mediated
events. A polynucleotide of the invention, or a vector containing
the polynucleotide can be contained in a cell, for example, a host
cell, which allows propagation of a vector containing the
polynucleotide, or a helper cell, which allows packaging of a viral
vector containing the polynucleotide. The polynucleotide can be
transiently contained in the cell, or can be stably maintained due,
for example, to integration into the cell genome.
A method of the invention also can be practiced by directly
providing desired polypeptide to a cell exhibiting unregulated
growth. The polypeptide can be produced and isolated, and
formulated as desired, using methods as disclosed herein. The
polypeptide can be contacted with the cell in vitro under
conditions that result in sufficient permeability of the cell such
that the polypeptide can cross the cell membrane, or can be
microinjected into the cells. Where the desired polypeptide is
contacted with a cell in situ in an organism, it can comprise a
fusion protein, which includes a peptide or polypeptide component
that facilitates transport across the cell membrane, for example, a
human immunodeficiency virus (HIV) TAT protein transduction domain,
and can further comprise a nuclear localization domain operatively
linked thereto. Alternatively, or in addition, the polypeptide can
be formulated in a matrix that facilitates entry of the polypeptide
into a cell.
For administration to a living subject, an agent such as a
demethylating agent, a polynucleotide, or a polypeptide useful for
practicing a therapeutic method of the invention generally is
formulated in a composition suitable for administration to the
subject. Thus, the invention provides compositions containing an
agent that is useful for restoring regulated growth to a cell
exhibiting unregulated growth due to methylation silenced
transcription of one or more genes. As such, the agents are useful
as medicaments for treating a subject suffering from a pathological
condition associated with such unregulated growth.
Such compositions generally include a carrier that can is
acceptable for formulating and administering the agent to a
subject. Such acceptable carriers are well known in the art and
include, for example, aqueous solutions such as water or
physiologically buffered saline or other solvents or vehicles such
as glycols, glycerol, oils such as olive oil or injectable organic
esters. An acceptable carrier can contain physiologically
acceptable compounds that act, for example, to stabilize or to
increase the absorption of the conjugate. Such physiologically
acceptable compounds include, for example, carbohydrates, such as
glucose, sucrose or dextrans, antioxidants, such as ascorbic acid
or glutathione, chelating agents, low molecular weight proteins or
other stabilizers or excipients. One skilled in the art would know
that the choice of an acceptable carrier, including a
physiologically acceptable compound, depends, for example, on the
physico-chemical characteristics of the therapeutic agent and on
the route of administration of the composition, which can be, for
example, orally or parenterally such as intravenously, and by
injection, intubation, or other such method known in the art. The
pharmaceutical composition also can contain a second reagent such
as a diagnostic reagent, nutritional substance, toxin, or
therapeutic agent, for example, a cancer chemotherapeutic
agent.
The agent can be incorporated within an encapsulating material such
as into an oil-in-water emulsion, a microemulsion, micelle, mixed
micelle, liposome, microsphere or other polymer matrix (see, for
example, Gregoriadis, Liposome Technology, Vol. 1 (CRC Press, Boca
Raton, Fla. 1984); Fraley, et al., Trends Biochem. Sci., 6:77
(1981), each of which is incorporated herein by reference).
Liposomes, for example, which consist of phospholipids or other
lipids, are nontoxic, physiologically acceptable and metabolizable
carriers that are relatively simple to make and administer.
"Stealth" liposomes (see, for example, U.S. Pat. Nos. 5,882,679;
5,395,619; and 5,225,212, each of which is incorporated herein by
reference) are an example of such encapsulating materials
particularly useful for preparing a composition useful in a method
of the invention, and other "masked" liposomes similarly can be
used, such liposomes extending the time that the therapeutic agent
remain in the circulation. Cationic liposomes, for example, also
can be modified with specific receptors or ligands (Morishita et
al., J. Clin. Invest., 91:2580-2585 (1993), which is incorporated
herein by reference). In addition, a polynucleotide agent can be
introduced into a cell using, for example, adenovirus-polylysine
DNA complexes (see, for example, Michael et al., J. Biol. Chem.
268:6866-6869 (1993), which is incorporated herein by
reference).
The route of administration of the composition containing the
therapeutic agent will depend, in part, on the chemical structure
of the molecule. Polypeptides and polynucleotides, for example, are
not particularly useful when administered orally because they can
be degraded in the digestive tract. However, methods for chemically
modifying polypeptides, for example, to render them less
susceptible to degradation by endogenous proteases or more
absorbable through the alimentary tract are disclosed herein or
otherwise known in the art (see, for example, Blondelle et al.,
supra, 1995; Ecker and Crook, supra, 1995). In addition, a
polypeptide agent can be prepared using D-amino acids, or can
contain one or more domains based on peptidomimetics, which are
organic molecules that mimic the structure of a domain; or based on
a peptoid such as a vinylogous peptoid.
A composition as disclosed herein can be administered to an
individual by various routes including, for example, orally or
parenterally, such as intravenously, intramuscularly,
subcutaneously, intraorbitally, intracapsularly, intraperitoneally,
intrarectally, intracistemally or by passive or facilitated
absorption through the skin using, for example, a skin patch or
transdermal iontophoresis, respectively. Furthermore, the
composition can be administered by injection, intubation, orally or
topically, the latter of which can be passive, for example, by
direct application of an ointment, or active, for example, using a
nasal spray or inhalant, in which case one component of the
composition is an appropriate propellant. A pharmaceutical
composition also can be administered to the site of a pathologic
condition, for example, intravenously or intra-arterially into a
blood vessel supplying a tumor.
The total amount of an agent to be administered in practicing a
method of the invention can be administered to a subject as a
single dose, either as a bolus or by infusion over a relatively
short period of time, or can be administered using a fractionated
treatment protocol, in which multiple doses are administered over a
prolonged period of time. One skilled in the art would know that
the amount of the composition to treat a pathologic condition in a
subject depends on many factors including the age and general
health of the subject as well as the route of administration and
the number of treatments to be administered. In view of these
factors, the skilled artisan would adjust the particular dose as
necessary. In general, the formulation of the composition and the
routes and frequency of administration are determined, initially,
using Phase I and Phase II clinical trials.
The composition can be formulated for oral formulation, such as a
tablet, or a solution or suspension form; or can comprise an
admixture with an organic or inorganic carrier or excipient
suitable for enteral or parenteral applications, and can be
compounded, for example, with the usual non-toxic, pharmaceutically
acceptable carriers for tablets, pellets, capsules, suppositories,
solutions, emulsions, suspensions, or other form suitable for use.
The carriers, in addition to those disclosed above, can include
glucose, lactose, mannose, gum acacia, gelatin, mannitol, starch
paste, magnesium trisilicate, talc, corn starch, keratin, colloidal
silica, potato starch, urea, medium chain length triglycerides,
dextrans, and other carriers suitable for use in manufacturing
preparations, in solid, semisolid, or liquid form. In addition
auxiliary, stabilizing, thickening or coloring agents and perfumes
can be used, for example a stabilizing dry agent such as triulose
(see, for example, U.S. Pat. No. 5,314,695).
The following example is intended to illustrate but not limit the
invention.
Example 1
Genomic Screen for Epigenetic Silenced Gene Associated with
Colorectal Cancer
This example provides a method for detecting genes that are
epigenetically down-regulated in cancer cells, and confirms the
validity of the method by identifying genes that are epigenetically
down-regulated in and diagnostic of colorectal cancer cells (see,
also, Suzuki et al., Nature Genet. 31:141-149, 2002, which is
incorporated herein by reference).
Methods
Cell Culture and Tissue Samples
Cell lines were cultured in RPMI 1640 or Minimal Essential Medium
(MEM) supplemented with 10% fetal bovine serum. Tissue samples of
colorectal cancer and normal colon mucosa were from specimens
obtained at the time of clinically indicated surgical
procedures.
DAC and TSA Treatment and RNA Preparation
RKO cells were treated with 5-aza-2'-deoxycytidine (DAC; Sigma)
and/or trichostatin A (TSA; Wako) as described (Cameron et al.,
supra, 1999). Briefly, the treatment consisted of DAC (200 nM) for
48 hr, with drug and medium replaced at the 24 hr time point after
beginning of treatment, followed by addition of TSA to a final
concentration of 300 nM (from a 1.5 mM ethanol dissolved stock) and
incubation for an additional 24 hr. Cells also were treated with
DAC alone or TSA alone, or mock treated, using the same volumes of
PBS and/or ethanol, and/or same amount of the drugs. Some
colorectal cancer (CRC) cell lines also were treated for RT-PCR
analysis to assess more robust levels of gene expression; treatment
was with 5 .mu.M DAC for 72 hr, with drug and medium being replaced
every 24 hr. Total RNA was extracted using the TRIZOL Reagent
(Gibco/BRL), and used for microarray analysis, cDNA subtraction and
RT-PCR.
cDNA Subtraction
Prior to cDNA subtraction, poly A RNA was isolated from total RNA
using the MESSAGE MAKER Reagent Assembly kit (Gibco/BRL). cDNA
subtraction was performed with the combination treated RKO cell
line as the tester, and mock treated cells as the driver by using
the PCR-Select.TM. cDNA subtraction kit (Clontech). Synthesized
cDNA was digested with Rsa I, and tester cDNA was ligated to
adaptors included in the kit. After hybridization, PCR
amplification of the subtracted cDNA was performed using the
ADVANTAGE cDNA PCR kit (Clontech).
Microarray Analysis
Microarray analysis was performed using the Mammalian GeneFilters
Microarrays.TM. system (Research Genetics). Filters were generated
for approximately 5,000 of the genes analyzed in the Johns Hopkins
Comprehensive microarray core, and filters for an additional 5,000
genes were purchased (Human GeneFilters Microarrays.TM. Release II;
Research Genetics). A total of 10,814 genes and ESTs were analyzed.
Hybridization of the filters was performed according to
manufacturer's recommendation. Briefly, 5 .mu.g of total RNA was
reverse transcribed and labeled using oligo (dT).sub.12-18 primer
and .sup.32dCTP with SUPERSCRIPT II reverse transcriptase
(Gibco/BRL). Hybridization of the filters was allowed to proceed
for 12 to 18 hr. Data was analyzed using the PSCAN program
(National Institutes of Health). For subtraction-microarray
analysis, the 2nd PCR product from cDNA subtraction was labeled
with .sup.33P using the MULTIPRIME DNA labeling system (Amersham).
Hybridization and data analysis were performed as described above.
Microarray analysis was repeated independently at least three times
for each condition, and results for probing the arrays with cDNA
for total RNA from mock treated cells were compared to those for
hybridizations with subtraction PCR products.
Semi-Quantitative RT-PCR
DNase I (Ambion) treated total RNA (2 .mu.g) was reverse
transcribed for single stranded cDNA using oligo (dT).sub.12-18
primer with SUPERSCRIPT II reverse transcriptase (Gibco/BRL). PCR
reactions were performed in a volume of 50 .mu.l containing
1.times.PCR buffer (Gibco/BRL), 1.5 mM of MgCl.sub.2, 0.3 mM of
dNTP, 0.25 .mu.M of each primer and 2 U of Taq polymerase
(Gibco/BRL). One hundred ng of cDNA was used for PCR amplification,
and all of the genes were amplified with multiple cycle numbers (20
to 35 cycles) to determine appropriate conditions to obtain
semi-quantitative differences in their expression levels. GAPDH PCR
(25 and 28 cycles) was performed to ensure cDNA quality and loading
accuracy. Amplification primer pairs were as shown in Table 4 (SEQ
ID NOS: 149 to 296.
Methylation Analysis
Bisulfite modification of genomic DNA was performed as described
(Baylin et al., Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996,
which is incorporated herein by reference). Methylation status was
determined by PCR analysis of bisulfite-modified genomic DNA using
two procedures. In the first procedure, all genes investigated were
analyzed by bisulfite-PCR, followed by digestion with multiple
methylated CpG site-specific restriction enzymes (COBRA; Xiong and
Laird, Nucleic Acids Res. 25:2532-2534, 1997, which is incorporated
herein by reference). The second procedure used methylation
specific PCR (MSP) for all genes analyzed in multiple cancer cell
lines and tissue samples (Baylin et al., supra, 1996). All of the
bisulfite PCR and MSP primers were designed according to genomic
sequences around presumed transcription start sites of investigated
genes.
Methylation and Expression Analysis of the SFRP Genes
Methylation analysis of SFRP2 and SFRP4 was performed using three
different MSP primer pairs to cover the 5' CpG islands of each
gene. For SFRP5 methylation analysis, two different MSP primer
pairs were used. For RT-PCR, SFRP2 sense and antisense primers were
designed for exons 2 and 3, respectively; SFRP4 sense and antisense
primers were designed for exons 2 and 5, respectively; and SFRP5
sense and antisense primers were designed for exons 2 and 3,
respectively. For each gene, the MSP primer pair that best assessed
the methylation status of the gene with respect to the expression
data in cell lines was used; these primers also were used for
analysis of primary CRC tissues.
Results
Microarray Analysis and Categorization of Up-Regulated Genes
cDNA microarray technology was used to identify genes up-regulated
RKO CRC cells after treatment with low dose DAC, which minimally
blocks DNA methylation, and/or TSA, which inhibit histone
deacetylase (HDAC) activity. In initial studies, the low dose of
DAC used and the short treatment time for the cells resulted in
only a few gene alleles being demethylated, which may have led to
up-regulation of gene expression (Cameron et al., supra, 1999), and
resulted in insufficient sensitivity as evidenced by a failure to
detect control genes arrayed on the filters that were known to be
synergistically reactivated by the drug combination in RKO cells
(Cameron et al., supra, 1999; Toyota et al., Cancer Res.
60:4044-4048, 2000). Accordingly, the sensitivity of the screen was
increased by performing an initial cDNA subtraction step between
mock treated cells (driver) and DAC and TSA treated cells (tester).
The PCR product after the second round of subtraction was then used
as a probe for microarray hybridization.
Of four control genes that were arrayed on the filters, and known
to be methylated in RKO cells, only hMLH1 re-expression could not
be detected; however, the other three control genes, p16, TIMP3 and
PTGS2 (COX2), were successfully detected, as validated by
subsequent PCR study. For unknown genes, those genes that showed no
expression in the mock filter (i.e., those with the same intensity
as empty spots when probed with non-subtracted cDNA from mock
treated cells), and showed detectable expression after probing with
the subtraction products between mock and treated cells, were
selected for subsequent analysis by semi-quantitative RT-PCR in
cells subjected to mock, DAC alone, TSA alone, or combination drug
treatment.
From a total of 10,814 genes examined by subtraction microarray, 74
were up-regulated by DAC and/or TSA treatment. These 74 genes could
be divided into two groups: Group 1 genes (n=51), which showed no
change in expression with TSA alone, a minimal increase in
expression following low dose DAC alone, but much stronger
induction by the combined DAC and TSA (Table 1); and Group 2 genes
(n=23), which show up-regulation by TSA alone, and have a variable
initial expression or response to DAC alone. In addition, Group 1
genes could be further subdivided into two groups: Group 1a genes
(n=24), which are completely inactivated in mock cells; and Group
1b genes (n=27), which show basal expression detected by
RT-PCR.
Fifty-six of the total non-EST genes (Table 1) had characterized
chromosomal positions; a putative transcription start site was
identified for 46 of the genes by searching all available genome
databases. In addition, 5' CpG islands (GC content>60%, CpG to
GpC>0.6 and minimum length 200 bp) were identified for 27 of the
56 genes (Gardiner-Garden and Frommer, J. Mol. Biol. 20, 261-282,
1987). Failure to find CpG islands in the putative near upstream
regions of the remaining genes could indicate either the absence of
a CpG rich proximal promoter, a CpG island containing control
region located further upstream than could be determined using
available genomic data, or that the region identified is not the
true transcription start site.
Methylation Analysis of 5' CpG Islands in RKO Cells
The methylation status of the identified CpG islands was analyzed
using bisulfite-PCR in combination with methylated CpG
site-specific restriction enzymes (Xiong and Laird, supra, 1997)
and MSP (Herman et al., supra, 1996), and the results were compared
to the expression status. All 12 of the Group 1a genes (including 3
positive control genes) with identifiable 5' CpG islands contained
dense methylation of these regions in RKO cells (Table 1) and
exhibited no basal expression detected by RT-PCR. Of the 5 Group 1b
genes for which 5' CpG islands were identified, three showed
partial methylation (Table 1) that corresponded with their low
basal expression levels; the other two genes did not exhibit any
methylation. In contrast, none of 10 Group 2 genes, independent of
basal expression, showed any 5' CpG island methylation (Table
1).
Methylation and Expression Analysis of Group 1a Genes in CRC
Lines
The Group 1a genes were further examined with respect to their
relevance for cancer. The methylation status and expression of
Group 1a genes was examined in a series of 8 CRC cell lines.
Hypermethylation of the SFRP1, SEZ6L, PCDH8 and FOLH1, genes was
detected in all CRC lines investigated. Five of the 8 cell lines
showed total or predominant methylation of KIAA0786. CXX1 was of
special interest, because it is located on the X chromosome and is
normally inactivated and methylated on one allele and active and
unmethylated on the other in female cells. However, only methylated
or predominantly methylated CXX1 alleles were detected in 5 of the
8 CRC lines, including RKO cells, and all were derived from male
patients except for HT29. SNRPN also is notable in that it is
maternally imprinted in humans and hypermethylated in the promoter
region CpG island of the silenced allele, and, as expected, normal
peripheral blood lymphocytes showed partial methylation in the CpG
island around the transcription start site (Sutcliffe et al.,
Nature Genet. 8:52-58, 1994). In contrast, RKO, HCT116, and SW480
CRC cells showed complete methylation and lacked basal expression.
S100A10 and TIMP2 methylation was observed only in RKO cells.
Importantly, in the methylated cell lines, each of the above genes
lacked basal expression, which was restored by incubation with DAC.
Despite a lack of methylation, KIAA0786 was not basally expressed
in SW480 cells, yet it was reactivated by treatment with DAC.
Methylation Analysis of Group 1a Genes in Primary CRC Tissues
The methylation status of Group 1a genes was examined in primary
colon cancers and corresponding normal colon tissues. SFRP1
methylation was observed in primary CRC samples with a strikingly
high frequency ( 17/20), whereas no methylation was detected in 6
of 17 normal tissues from the same individuals with the tumors, or
in normal tissue of three individuals whose tumors showed no
methylation. In 11 cases, SFRP1 methylation was observed both in
tumors and normal counterparts, but tumors showed stronger
methylation signals. SFRP1, methylation also was examined in normal
colon tissues from two patients without CRC; no methylation was
detected.
SEZ6L and KIAA0786 also showed a very high frequency of
hypermethylation in primary CRC (13 of 20 cases, and 8 of 20 cases,
respectively). Like SFRP1, however, no methylation was detected in
these genes in normal colon from individuals whose tumors harbored
no methylation, or in the normal colon in 11 of 13 (SEZ6L) and 4 of
8 (KIAA0786) individuals whose tumors were methylated. Some
methylation of SEZ6L and KIAA0786 was detected in normal colon from
2 and 4 individuals, respectively, but the tumors showed stronger
methylation signals.
As expected, all tissue samples including normal colon mucosa from
female patients showed partial methylation of CXX1, which is
located on the X-chromosome. However, 3 of 14 male patients showed
CXX1, methylation in a tumor-specific manner. S100A10 and TIMP2
methylation was not observed in any primary CRC sample. FOLH1 and
PCDH8 were equally methylated in every CRC sample and normal
counterpart examined.
Methylation Patterns of Group 1a Genes Link CRC and Gastric
Cancers
The present results indicate that SFRP1, SEZ6L, CXX1, KIAA0786,
S100A10 and TIMP2 are involved in tumor development and/or
progression. As such, these genes were examined in tumor cell lines
of other cancer types. A striking pattern of tumor profiling
emerged in that complete hypermethylation of SFRP1, SEZ6L, LPPH1
and CXX1, was common in CRC and gastric cancers, whereas only
partial or no methylation generally was observed in all other
cancer types studied (FIG. 1). The exceptions to this pattern for
SFRP1, were notable. The proapoptotic activity of the SFRP1, gene
has been demonstrated in MCF7 breast cancer cells, which did not
express this gene in the basal state (Melkonyan et al, Proc. Natl.
Acad. Sci. USA 94:13636-13641, 1997). As disclosed herein, complete
methylation of the CpG island region was detected in MCF7 cells, as
well as in MDA MB231 breast cancer cells, and 2 of 4 prostate
cancer cell lines studied (FIG. 1).
Methylation and Expression Analysis of SFRP Family Members
To further characterize the grouping of hypermethylated genes
discussed above, and the potential role for one of the most
interesting genes, SFPR1, in CRC cells, additional SFRP genes were
examined. Of the five SFRP genes that have been identified, four
were found to have dense CpG islands around their first exons.
SFRP3, which lacked a 5' CpG island, was expressed at a basal level
in each of 7 CRC cell lines tested. However, with a very high
frequency, each of the other three SFRP genes was hypermethylated
in CRC cell lines, and the hypermethylation was associated with a
lack of basal expression, which was restored by DAC treatment.
Methylation analysis of the SFRP genes in primary CRC tissues
(n=124) was of particular interest. The genes were not
hypermethylated in normal colon, except for trace methylation of
SFRP2 in a patient with a colon cancer in which the gene is
hypermethylated. Furthermore, normal colon tissue, and cell lines
derived from other tissues, expressed the genes in the absence of
promoter methylation. However, hypermethylation was observed for
all four genes in primary CRC tumors. The frequencies differed in
this large analysis, which included expanded data for SFRP1,
(SFRP1, 118 of 124, 95.1%; SFRP2, 11 of 124 89.5%; SFRP4, 36 of
124, 29.0%; and SFRP5, 73/124, 58.9%). Strikingly, 24.1% of cases
(30 of 124) showed methylation of all of four SFRP genes with CpG
islands, and at least one of the four was methylated in 123 of 124
tumors (99.2%; FIG. 2).
These results demonstrate that logical mining of the initial
microarray data markedly extended the gene discovery consequences.
The results also reveal an involvement of epigenetic silencing of a
gene family which, in CRC, can abrogate a block to WNT oncogene
activity. This hypermethylation of the SFRP gene family appears to
provide the highest molecular marker coverage yet described for a
common human cancer (see Esteller et al., Cancer Res. 61:3225-3229,
2001).
By exploiting the observation that the transcriptional silencing of
hypermethylated genes in cancer cells depends on a synergy between
the methylation and the activity of HDACs, with the methylation
having the dominant effect (Cameron et al., supra, 1999), a method
of screening cancer cell genomes for such genes has been developed.
The present results validate this concept concerning the nature of
chromatin associated with cancer genes silenced in association with
promoter hypermethylation, and demonstrate that the methods
efficiently identifies genes having a high potential for a role in
tumorigenesis.
From the standpoint of transcriptionally repressive chromatin, the
disclosed strategy has provided important information about the
promoters of genes with various responses to the inhibitors
utilized. The results for Group 1a genes confirmed that densely
methylated genes will not re-express if exposed to HDAC inhibition
alone. In contrast, the results for Group 2 genes revealed that
those genes that do re-express or up-regulate expression following
HDAC inhibition, alone, have a lack of promoter methylation, even
when CpG islands were present in their 5' regions. The present
study discloses genes that were up-regulated after treatment of
cells with the demethylating agent, DAC, even though the promoters
of these genes were unmethylated. Similar findings were previously
reported (Soengas et al., Nature 409, 207-211 (2001). While
methylation of upstream genes, such as transcription factors, could
secondarily result in activation of these genes, another
possibility is that inhibitors of DNA methyltransferases (DNMTs),
such as DAC, affect these proteins other than by blocking their
methylating capacities. Recent studies revealed that DNMTs have the
potential directly, and through interaction with HDACs and other
corepressor proteins, to repress transcription independently of
their methylating activities (Rountree et al., Nature Genet.
25:269-277, 2000; Bachman et al., J. Biol. Chem. 276:32282-32287,
2001; Fuks et al., Nature Genet. 24:88-91, 2000; Fuks et al., EMBO
J. 20:2536-2544, 2001; Robertson et al. Nature Genet. 25:338-342,
2000).
Although the present studies initially used established cell lines,
which could create a bias towards detection of genes that are
altered only in culture or for which promoter hypermethylation is
not tumor specific (see, for example, Smiraglia et al., Hum. Mol.
Genet 10:1413-1419, 2001), careful analysis of paired primary
tumors and normal tissues indicate that the disclosed method is
efficient for identifying genes (11 of 12) for which altered
expression is associated with hypermethylated 5' CpG islands in
primary as well as cultured cells. Seven of the 12 genes detected
by the microarray approach, including p16, COX2, TIMP3, SEZ6L,
SFRP1, KIAA0786 and CXX1, were methylated specifically in primary
tumors or only in regions of normal colon from CRC patients having
methylation of those genes in their CRC tumors. Another gene,
TIMP2, while not methylated in normal colon, primary CRC tumors, or
PBL, was very frequently hypermethylated in malignant lymphomas. A
ninth gene, SNRPN, which is an imprinted gene, exhibited
methylation in the promoter of the silenced allele. Two other genes
were methylated in both normal colon and primary CRC; only S100A10
was not methylated in primary tissues, although analysis of this
gene was not extensive, and it has been reported to be
down-regulated in prostate cancer (Chetcuti et al., Cancer Res.
61:6331-6334, 2001).
The disclosed microarray approach further identified a substantial
number of genes that are hypermethylated in a tumor specific
fashion. For example, some genes such as SFRP1 were methylated in
some, but not all, normal colon mucosa tissues from patients with
CRC, but not subject without CRC. This methylation in the normal
tissues can reflect a "field effect", in which premalignant changes
occur over a broad region of the colon, or can indicate a tendency
for certain CpG islands to become methylated with age in normal
colon, as was found for a group of genes frequently hypermethylated
in CRC (Toyota et al., Proc. Natl. Acad. Sci. USA 96:8681-8686,
1999). A field effect is more likely because the ages of
individuals with no methylation in normal tissues ranged from 53 to
64 years of age, and one 46 year old patient showed methylation in
both normal and tumor tissues.
An advantage of the present approach is that most of the genes that
were identified have known properties or implied functions that are
important for tumorigenesis. For example, most of the Group 1a
genes, and many in the other groups, are located in chromosome
regions that undergo frequent LOH in cancers, e.g., SFRP1, at
chromosome 8p12, SEZ6L at 22q11, and TIMP2 at 17q25 (Table 1). In
addition, many of the genes identified encode components of
pathways involved in cancer. For example, among the Group 1a genes,
SFRP1 antagonizes WNT oncogene signaling (Finch et al., supra,
1997), and breast cancer cells transfected with SFRP1 showed
increased sensitivity to proapoptotic stimuli (Melkonyan et al.,
supra, 1997). SFRP1 under-expression has been observed in the
majority of breast carcinomas (Ugolini et al., Oncogene
18:1903-1910, 1999; Ugolini et al., Oncogene 20:5810-5817, 2001).
Mouse SEZ6 and rat latrophilin expression is limited to brain, but
their human homologues (SEZ6L and KIAA0786) were identified from
frequently deleted regions in lung and breast cancers respectively,
although their functions in humans remain unclear (Nishioka et al.,
Oncogene 19:6251-6260, 2000; White et al., Oncogene 17:3513-3519,
1998). TIMP2 is a member of the tissue inhibitor of matrix
metalloproteinase (TIMP) family, which includes TIMP3, a gene that
frequently is inactivated by hypermethylation in various
malignancies (Bachman et al., Cancer Res. 59:798-802, 1999).
S100A10, also termed annexin II light chain or p11, forms a
heterotetrameric complex with another calcium-binding protein,
annexin II heavy chain (p36; Kube et al., Gene 102:255-259, 1991).
Frequent loss of p36 and p11 protein expression was reported in
prostate cancers, possibly due to methylation silencing of the p36
gene (Chetcuti et al., supra, 2001). CXX1 is a putative prenylated
protein (Frattini et al., Genomics 46:167-169, 1997). SNRPN, which
may be involved in pre-mRNA splicing, is located on 15q11-q13, a
region that is implicated in Prader-Will syndrome and Angelman
syndrome (Nicholls et al., Trends Genet. 14:194-200, 1998).
FOLH1, and PCDH8 also have interesting characteristics. Folate
metabolism affects DNA methylation, and a folate metabolic enzyme,
methylenetetrahydrofolate reductase, may affect susceptibility to
human malignancies (Matsuo et al., Blood 97:3205-3209, 2001; Song
et al., Cancer Res. 61:3272-3275, 2001). FOLH1 is involved in
folate uptake and may have a role in DNA methylation in cancers
(Heston, W. D., Urology 3A Suppl: 104-112, 1997). PCDH8 is a member
of a cell-cell adhesion molecule family (Strehl et al., Genomics
53:81-89, 1998), for which loss of function is important for
invasion and metastasis. However, FOLH1, and PCDH8 did not show
tumor specific or tumor predominant methylation. FOLH1, was
originally characterized as a prostate specific membrane antigen
(PSMA), and is strongly expressed in prostate cancers; it has not
been studied in colorectal tumors. Among normal tissues, PCDH8 is
expressed exclusively in fatal and adult brain. Thus, methylation
of FOLH1 and PCDH8 can be a tissue specific phenomenon related to
gene expression, since these genes are silent in CRC cell lines and
treatment of such cells with DAC leads to re-expression.
The identification of a frequent preference for hypermethylation of
multiple genes in gastrointestinal tumors, including
hypermethylation of a gene family, SFRP, suggests that a common
defect in chromatin constitution can bias multiple genes, which can
include a family of related genes, to epigenetic silencing in
association with promoter hypermethylation. This results suggests
additional methods for identifying genes that are differentially
regulated in cancer cells as compared to normal cells.
From a functional standpoint, all of the SFRP genes are considered
to counter WNT/frizzled signaling (Finch et al., supra, 1997;
Rattner et al., Proc. Natl. Acad. Sci. USA 94:2859-2863, 1997;
Chang et al., Hum. Mol. Genet. 8:575-583, 1999; Abu-Jawdeh et al.,
Lab. Invest. 79:439-447, 1999) As such, loss of function of SFRP
genes can abrogate an entire tumor suppressor pathway. For example,
APC mutations are common in colon cancer, and can lead to
constitutive WNT pathway action (Morin et al., Science
275:1787-1790, 1997; Behrens et al., Science 280:596-599, 1998).
Initial results indicated that APC mutations are frequent
throughout CRC tumors with all combinations of hypermethylation of
the SFRP genes. However, APC has additional functions
(Mimori-Kiyosue and Tsukita, J. Cell Biol. 154:1105-1109, 2001).
Thus, loss of inhibition of WNT activity through other mechanisms
indicates a new functional pathway important to colorectal
tumorigenesis.
The presently disclosed approach provides a means to identify the
entire spectrum of genes silenced by epigenetic mechanisms in
individual cancer types. The finding that the methylation patterns
for the newly identified genes map with the specific cancer type
initially screened, and a related tumor type (see FIG. 1), confirms
the importance of promoter hypermethylation for profiling of human
cancers. Notably, CRC and gastric tumors are among the few tumor
types to manifest the microsatellite instability phenotype due to
losses of mismatch repair function; in each case, the link was a
hypermethylation event involving the promoter of the MLH1 gene
(Baylin and Herman, Trends Genet. 16:168-174, 2000, which is
incorporated herein by reference). Thus, panels of such markers are
useful for examining and manipulating the pathways that regulate
tumorigenesis. Furthermore, the present results demonstrate that a
limited number of hypermethylated genes are sufficient to compose
comprehensive marker panels for sensitive detection of specific
types of human cancer. The above methods provide a means to
identify such gene panels in other disorders.
Although the invention has been described with reference to the
above example, it will be understood that modifications and
variations are encompassed within the spirit and scope of the
invention. Accordingly, the invention is limited only by the
claims, which follow Tables 1 to 4.
TABLE-US-00001 TABLE 1 Genes upregulated by DAC and TSA treatment
in RKO cells Acc no..sup.a Gene name Symbol Location CpG
island.sup.b Methylation.sup.c Group 1a R80217
prostaglandin-endoperoxide synthase 2 PTGS2.sup.d 1q25.2-q25.3 yes
yes (prostaglandin G/H synthase and cyclooxygenase).sup.d AA877595
cyclin-dependent kinase inhibitor 2A CDKN2A.sup.d 9p21 yes yes
(melanoma, p16, inhibits CDK4).sup.d AA099153 tissue inhibitor of
metalloproteinase 3 TIMP3.sup.d 22q12.3 yes yes (Sorsby fundus
dystrophy, pseudoinflammatory).sup.d AA444051 S100 calcium-binding
protein A10 S100A10 1q21 yes yes N32514 secreted frizzled-related
protein 1 SFRP1 8p12-p11.1 yes yes W72596 CAAX box 1 CXX1 Xq26 yes
yes H29013 seizure-related gene 6 (mouse)-like SEZ6L 22q11.2-12.1
yes yes W74533 latrophilin KIAA0786 1p31.1 yes yes AA486280 tissue
inhibitor of metalloproteinase 2 TIMP2 17q25 yes yes H29216
protocadherin 8 PCDH8 13q14.3-q21.1 yes yes N64840 folate hydrolase
(prostate-specific FOLH1 11p11.2 yes yes membrane antigen) 1
AI017332 human SNRPN mRNA, 3' UTR, partial sequence SNRPN 15q12 yes
yes N54793 pregnancy specific .beta.-1-glycoprotein 6 PSG6 19q13.2
no H87471 kynureninase (L-kynurenine hydrolase) KYNU 2p23.3-q14.3
no AA001432 laminin, .alpha.3 (nicein (150 kD), kalinin (165 kD),
LAMA3 18q11.2 no BM600 (150 kD), epilegrin) AA034939 laminin, alpha
2 (merosin, congenital muscular LAMA2 6q22-q23 no dystrophy, LAMA2)
A1298976 small inducible cytokine subfamily C, SCYC1 1q21-q25 no
member 1 (lymphotactin) AA291484 cytochrome P450, subfamily IVB,
polypeptide 1 CYP4B1 1p34-p12 no R62603 Collagen, type VI, .alpha.3
COL6A3 2q37 no T73558 deoxyribonuclease I-like 3 DNASE1L3
3p21.1-3p14.3 no AA404246 Homo sapiens hypothetical protein
MGC13047 10 no AA156424 EST H16554 EST N67972 EST Group 1b AA173290
homeo box A1 HOXA1 7p15.3 yes partial AA935273 GRO3 oncogene GRO3
4q21 yes partial AA256304 distal-less homeobox 7 DLX7 17q21.33 yes
partial H17115 stromal antigen 3 STAG3 7 yes no AA454880
heterogeneous nuclear ribonucleoprotein D HNRPD 4q21.1-q21.2 yes no
(AU-rich element RNA-binding protein 1, 37 kD) AA496149
3-hydroxy-3-methylglutaryl-Coenzyme A synthase HMGCS2 1p13-p12 no 2
(mitochondrial) AA176491 myogenic factor 6 (herculin) MYF6 12q21 no
H16793 chromosome 8 open reading frame 4 C8orf4 8p11.2 no H10079
KIAA0751 gene product 8 no H59614 similar to putative insulin-like
growth factor 11p15.5 uk II associated protein AA457731 SNARE
protein YKT6 6 uk AA419251 interferon induced transmembrane protein
1(9-27) IFITM1 11 uk N48178 KIAA0403 protein 6 uk AA027147
hypothetical protein MGC3040 3 uk H18646 hypothetical protein
FLJ10697 10 uk AA013268 Homo sapiens mRNA containing (CAG)4 repeat,
UK uk clone CZ-CAG-7 AA039857 EST AA101632 EST AA464518 EST
AA427754 EST H16733 EST H88953 EST N90849 EST N22486 EST T62979 EST
R53558 EST R39555 EST Group 2 AA425908 partner of RAC1 (arfaptin 2)
PORT 11p15 yes no AA405717 muscleblind (Drosophila
melanogaster)-like MBNL 3 yes no AA916906 TNFRSF1A-associated via
death domain TRADD 16q22 yes no AA404394 for protein disulfide
isomerase-related PDIP 3 yes no AA489678 RAD23 (S. cerevisiae)
homolog B RAD23B 3p25.1 yes no AA447514 ribosomal protein L13 RPL13
16q24.3 yes no AA071330 guanine nucleotide binding protein (G
protein), GNAI2 3p21 yes no .alpha.-inhibiting activity polypeptide
2 AA669126 protein phosphatase 1, regulatory (inhibitor) PPP1R21A
12q15-q21 yes no subunit 12A R38619 fucose-1-phosphate
guanyltransferase FPGT 1 yes no AA055503 tripartite
motif-containing 32 TRIM32 9q32-q34.11 yes no T66981 egf-like
module containing mucin-like, EMR1 19p13.3 no hormone receptor-like
sequence 1 AA480906 protein kinase C binding protein 1 PRKCBP1
20q12 no N45318 phosphoglycerate mutase 2 (muscle) PGAM2 7p13-p12
no N30096 glutathione S-transferase A3 GSTA3 6p12 no AA427733
advillin ADVIL 12 no N92901 fatty acid binding protein 4, adipocyte
FABP4 8q21 no T60149 hypothetical protein FL13449 13 uk AA453578
human DNA sequence from clone RP11-3J10 on 9p12-p13.3 uk chromosome
9-12-13.3 W81520 Homo sapiens gene from PAC 106H8, 1 uk similar to
Dynamin AA446486 EST AA447992 EST H94605 EST W46439 EST
.sup.aGenBank accession number. .sup.bYes: CpG island was found
around presumed transcription start site or near upstream region;
no: no CpG island was found around presumed transcription start
site or near upstream region; uk: upstream genomic sequence is
unknown. .sup.cYes: fully methylated; partial: partially
methylated; no: no methylation. .sup.dPositive control genes.
TABLE-US-00002 TABLE 2 Primer sequences for methylation study Gene
name Method sense antisense S100A10 bisulfite PCR
TGAAGAGAAGTTTATAAGAAYGTTTTGT* (1)*** CAACAAATCCRAAGCTAAAAACTACCCA**
(2) MSP (M) TCGCGTCGTTTTTTTTTATTTATTCGTC (3)
AAACTCACCTTAACCGAAACGCGACG (4) MSP (U)
GTTTTTGTGTTGTTTTTTTTTATTTATTTGTT (5) AACAAAACTCACCTTAACCAAAAACACA
(6) CXX1 bisulfite PCR GGAGTTTATGAGAGGGTTGGAGTTT (7)
ATCACCCACTACAAAACRAACCCTA** (8) MSP (M) TGGATACGTATTTTCGGCGACGTTTC
CAACGACGCGTCGCPAACCGAATCG MSP (U) TGGTTTTTGTGGATATGTATTTTTGGTGAT
AATTCCTCCAACAACACATCACAAACCA SEZ6L bisulfite PCR
GGGGAATTGGYGTTAAATTTTGTAGGG* AAACAACTTCCRAAACCCCCTAAAC** MSP (M)
TTCGGAAGTTGTTTCGGTTCGC CGAACATCGTAACTACAAAAAACGCG MSP (U)
GGGTTTTGGAAGTTGTTTTGGTTTGT AACCACAAACATCATAACTACAAAAAACACA SFRP1
bisulfite PCR 1 TGGTTTTGTTTTTTAAGGGGTGTTGAGT (19)
ACACTAACTCCRAAAACTACAAAACTAAA** (20) bisulfite PCR 2
TTAGTTTTGTAGTTTTYGGAGTTAGTG* TCCTACCRCAAACTTCCAAAAACCTCC** MSP (M)
TGTAGTTTTCGGAGTTAGTGTCGCGC CCTACGATCGAAAACGAOGCGAACG MSP (U)
GTTTTGTAGTTTTTGGAGTTAGTGTTGTGT CTCAACCTACAATCAAAAACAACACAAACA LPHH1
bisulfite PCR GTTAAAGTTTAGTTGGTTTTAYGTAATTAT*
CTTTTAATTTCCRTAACCCTCCTTTTAT** MSP (M) ATTAATTTTGGAGCGTTTTTCGCGCGTC
TCCACGCACCGMCCAAAAACCCCG MSP (U) ATGTATTAATTTTGGAGTGTTTTTTGTGTGTT
TCTCCACACACCAAACCAAAAACCCCA TIMP2 bisulfite PCR
AGATAAAGAGGAGAGAAAGTTTG CCPACAACAAAAACCRAAC* MSP (M)
ATTCGTAGAAGGTAGCGCGGTCGTC CTCACCTACCCCGCTCGACCGCG MSP (U)
ATATATTTGTAGAAGGTAGTGTGGTTGTT TCCTCACCTACCCCACTCAACCACA SNRPN
bisulfite PCR GTTATYGGTATAGTTGATTTTGT* (39)
CTCCCCCCAAATCATTCCRATAA** (40) FOLH1 bisulfite PCR
GAGGTATTAGTGAGATTGAGAGAGATTT CCCTAAAAWACCMCMCA.AAATCCCA MSP (M)
TTCGTCGTGGTGGTTGGAGGGCGC CAACGCACACCAACGCGAACGACG MSP (U)
TTATTTTGTTGTGGTGGTTGGAGGGTGT CCCCAACACACAACCAACACAAACAACA PCDH8
bisulfite PCR AAGGGATTGTTAGAGGTAGGYGGAG* CACAAAACTCATACCTCCAACCTCA
HOXA1 bisulfite PCR TTATGGAGGAAGTGAGAAAGTTGG
TCTACACCCCCCTACCCACTAAAA GRO3 bisulfite PCR
TAGGAATTTGGGGTAGAAAATGAATATTT ACCCRAACTATATAACTCCCCAAAATC** DLX7
bisulfite PCR GGAGAGTTAGGYGGGTTAGAGTTGA* CTACAAAAAAAATAACCATATCTCC
MPS (M) GATTTTTCGCGGCGGTATCGTAGCGC CAACCCCTTCCTTCGTTAAACAACGCG MSP
(U) GATTAGATTTTTTGTGGTGGTATTGTAGTGT AACAACCCCTTCCTTCATTAAACAACACA
HNRNP bisulfite PCR GAAGGGGGTAGGTTAGGGAGAGG (59)
CCACCATAACTCCCTCCTACTC (60) MSP (M) TGATCGGGACGCGTCGTTTTTTCGTC
CTTCGCCTCCCACTCTCGCGCGACG MSP (U) TTATGTGATTGGGATGTGTTGTTTTTTTGTT
CCCTTCACCTCCCACTCTCACACAACA STAG3 bisulfite PCR
TGGTATTTAGGAGGTTGGTGAAATA ACCCTCAATCTCCTACTCCATTAAA MSP (M)
GCGGGGTTMAGCGGGTCGTTCGC AAAAATATACGAACTAATACGCGCCACG MSP (U)
GGGTGGGGTTAAAGTGGGTTGTTTGT TTAAAAATATACAAACTAATACACACCACA POR1
bisulfite PCR GTAGTTGTTGTTGTTGTTGTTGTTGTTT
AACATCTTACCCTCTAAACAAATTTATAC MSP (M) GTTTCGTTTTTATAATTTGCGACGTGGTC
CTCAAAACGCCAAACCCGAACCGCG MSP (U) GTGATGTTAGTTTTGTTTTTATAATTTGTGAT
TCCCCTCAAAACACCAAACCCAAACCA MBNL bisulfite PCR
GAATTTATTGGTGTGTTTAGTAGTYGG* CCCRAACCACAAAATCRCCTATCAAC** MSP (M)
GGGAGGGCGTTCGGTTTGTACGTTC (79) CATAAACGATCGCCCAACGACGCCG (80) MSP
(U) AGTGGGAGGGTGTTTGGTTTGTATGTTT CAAATCATAAACAATCACCCAACAACACCA
RAD23B bisulfite PCR AGGAGGAAGTTTTAGGAGTTTTTG
CTAACTCACCACAAAATAATAACC MSP (M) TCGTGGTTGGCGTTCGGCGCGTGA
ACCGCCGCGCAACTCGACTACCGA MSP (U) TTGTGGTTGGTGTTTGGTGTGTGA
ATACCACCACACAACTCAACTACC RPL13 bisulfite PCR
GTGTTTTATAAATGTGAATAAATAGAATTT CAATACACTCTAAAATAATAACAAAACC MSP (M)
TTTTAGGGTTGTCGGGAGAGTCGCGG CAACCGAACGAAAAAAAAACGACCCCG MSP (U)
GTGGTTTTAGGGTTGTTGGGAGAGTTGT AAAACAACCAAACAAAAAAAAAACAACCCCA TRADD
bisulfite PCR GGTATTAGAAAATTTTGGTTTTTAGGGGG
ACCCACCCACCTACTACACTAACCTA MSP (M) ACGGGAAGTAGTTATCGGGAGTTCGC
GACGAAACCTAAATTCCCACGCCCG MSP (U) TGGATGGGAAGTAGTTATTGGGAGTTTGT
(99) CTCAACAAAACCTAAATTCCCACACCCA (100) FPGT bisulfite POR
GTTATTTGTTTTTGAGATYGTTGTTAGAG* CTAACAACTACCATAACCCCACCTTC PDIR
bisulfite PCR AGTGGAGAAAGGAGTTAGYGGTGGGTA*
CCTACCTAACATACACRCCCTCATCCC** GNA12 bisulfite PCR
GGTTTAGTTATAGGTTTGGTTYGTTTAGG* CTCACCCAACAACAACAACTTCACCTC MYPT1
bisulfite POR GGGTTATATTYGTTTTTTTTTGGTGGTTTA*
CCTCCCTTCCTACCACAAAAACCCTC HT2A bisulfite PCR
GTTTTTAGAGGAAAGTTTATTTTTGTAGGG (109) ATCCCCAATCCCCAACCCTCCTTCCC
(110) *Y = C or T **R = A or G **SEQ ID NO: - numbered from 1 to
110, from left to right, top to bottom; representative SEQ ID NOS:
shown
TABLE-US-00003 TABLE 3 Primer sequences for the SFRP genes Gene
Method sense antisense SFRP2 MSP1(M)* GGGTCGGAGTTTTTCGGAGTTGCGC
(111)** CCGCTCTCTTCGCTAAATACGACTCG (112) MSP1(U)*
TTTTGGGTTGGAGTTTTTTGGAGTTGTGT AACCCACTCTCTTCACTAAATACAACTCA MSP2(M)
AAAATAAGTTCGGGTTTCGGCGGTAC CAATAAACGAACAAAACGCGAACTACG MSP2(U)
GTAAAATAAGTTTGGGTTTTGGTGGTAT CACAATAAACAAAACAAAACACAAACTACA MSP3(M)
TTAGTATTTGGTCGCGAGGTCGTTC CCCTAAATACCGCCGCTCGCCCG MSP3(U)
TTGTTAGTATTTGGTTGTGAGGTTGTTT CCCCTAAATACCACCACTCACCCA RT-PCR
GATGATGACAACGACATAATGGAAACG GAGTGTGCTTGGGGAACGGGAGCT SFRP4 MSP1(M)
AGTTGTTAAGGGAGCGTTTCGAGTTTAC CTCAACCTTCGAAAACGAAGCCGCCG MSP1(U)
GTAGTTGTTAAGGGAGTGTTTTGAGTTTAT CTCTCAACCTTCAAAAACAAACCCACCA
MSP2(M)* GGGTGATGTTATCGTTTTTGTATCGAC (129)
CCTCCCCTAACGTAAACTCGAAACG (130) MSP2(M)*
GGGGGTGATGTTATTGTTTTTGTATTGAT CACCTCCCCTAACATAAACTCAAAACA MSP3(M)
GGTTGCGTTTGGAGTTGCGGAGTTC TCCAATCGACAACAAAACGAAACGCG MSP3(U)
GTTGGTTGTGTTTTGAGTTGTGGAGTTT AACTCCAATCAACAACAAAACAAAACACA RT-PCR
GGTACAGGAAAGGCCTCTTGATGTTG GGATCTTTTACTAAGCTGATCTCTCC SFRP5
MSP1(M)* AAGATTTGGCGTTGGGCGGGACGTTC ACTCCAACCCGAACCTCGCCGTACG
MSP1(U)* GTAAGATTTGGTGTTGGGTGGGATGTTT AAAACTCCAACCCAAACCTCACCATACA
MSP2(M) CGTTTTGGAGTTGGGGTTAGGCGGTC AAATAAATAACAACCTACGCTACGAACG
MSP2_(U) TTTGTTTTGGAGTTGGGGTTAGGTGGTT
CCAAATAAATAACAACCTACACTACAAACA RT-PCR TGCGCCCAGTGTGAGATGGAGCAC
(147) CCCATCCCTTAGGCCTTGTGCCAGT (148) *Primers shown in FIG. 6 and
used in primary tissue sample analysis **SEQ ID NO: - numbered from
111-148, from left to right, top to bottom; representative SEQ ID
NOS: shown
TABLE-US-00004 TABLE 4 Acc No.a Gene name Symbol RT prmer (sense)
RT prmer (antiense) Group 1a R80217 prostaglandin-endo- PTGS2d
TAAACAGACATTTATTTCCAGAC (149)** GAAAGAAATAGTCAATATGCTTG (150)
peroxide synthase 2 (prostaglandin G/H synthase and cyclo-
oxygenase)d AA877595 cyclin-dependent CDKN2Ad AGCCTTCGGCTGACTGGCTGG
CTGCCCATCATCATGACC- TGGA kinase inhibitor 2A (melanoma, p16,
inhibits CDK4)d AA099153 Tissue inhibitor of TIMP3d
CAGCTGGAGCCTGGGGGACTG CCTTGCGCTGGGAGAGGGTGAG metalloproteinase 3
(Sorsby fundus AA444051 S100 calcium-binding S100A10
TTTCTCTGCTTGTCAAATGAGAGT CTTAACAAAGGAGGACCTGAGAG protein A10 N32514
secreted frizzled- SERP1 TTGTAGTTATCTTAGAAGATAGCATGG
ACGGGAATTACTATTAACATAAGCG related protein 1 W72596 CAAX box 1 CXX1
CTGCTGCCGCCCCTGGGCCTCAC (159) GTAGTGTATTAGAGCAGAGCAGAATG (160)
H29013 seizure related gene SEZ6L CCCAGGAGAATGCCTACCTTTG
AAACTGCCAAACAGCCCAGAAGG 6 (mouse) like W74533 latrophilin LPHH1
CTGTGGTTGATTGCTAGTGGT AAGTGACTGAACCTTGCAGTTCT AA486280 tissue
inhibitor of TIMP2 CCCTCCTCGGCAGTGTGTGGGGTC
GGGATGTCAGAGCTGGACCAGTCGAA metalloproteinase 2 H29216 Protocadherin
8 PCDH8 ATTACTGTGCTTATAAGTGACACG GAAGTTATTGCCAAAGGAACTGT N64840
folate hydrolase FOLH GTTCGAGGAGGGATGGTGTTTGAGC (169)
ATACCACACAAATTCAATACGGATTCT (170) (prostate-specific membrane
antigen) 1 AI017332 Human SNRPN mRNA, 3 SNRPN
AATGACACTCTGAAATCCAGTC CTATTGTGTGATAGGCTCTGT UTR, partial sequence
N54793 Pregnancy specific PSG6 TGAGTGGTAGCAAGGTTTACA
ATTTCAGCCTCTTCCGPATCT beta-1-glycoprotein 6 H87471 kynureninase (L-
KYNU TTANAAAAATCGAATAATACTGAAATAACC GGGGTGCCCAGCCTAACAATAA
kynurenine hydrolase) AA001432 laminin, alpha 3 LAMA3
TCTCTGAAGAAGGAGGTCATGT GGAGGGAGGTGCATTGGGTAAT (nicein (150 kD),
kalinin (165 kD), BM600 (150 kD), epi- legrin) AA034939 laminin,
alpha 2 LAMA2 AAAGCAGTTGGTGGATTCAAAG (179) TTATTAGTTGGCTGGGCATGA
(180) (merosin, congenital muscular dystrophy) (LAMA2) AI298976
small inducible cyto- SCYC1 TTCTTTACACATCAGTCACAAG
GGGTGTTGAGTTACCAGATGA kine subfamily C, member 1 (lympho- tactin)
AA291484 cytochrome P450, sub- CYP4B1 AAAGAAACACATCTCAGTGAAGGG
CAGGAGGCTTGTAGTTTAGAAGG family IVB, poly- peptide 1 R62603
Collagen, type VI, COL6A3 AGTTAGCCACTGCTGGTGTT CCCTCCCTCCAGCACACAAA
alpha 3 T73558 deoxyribonuclease DNASE1L3 CCAGAGACATCCGTTAAGGAGA
TTGGGTCTAGGAGCGTT- TGCT I-like 3 AA404246 Homo sapiens hypo-
MGC13047 TCTTGAGCATTGTGGTGGCCTTA (189) TTCGGGCTTCCTGGAGGGAACA (190)
thetical protein MGC13047 AA156424 EST GCAACATGAAGATTCTGAAGGGT
ACAGCAAACTGCATTTACCATCG H16554 EST TTGGAAAGATCGTCCTGGTGC
AACTTCTGGCCCTCGGAGGAA N67972 EST AACAGCAAGCATGACATATTCA
GCAGAGAGAATGTGAGGAACCTT Group 1b AA173290 homeo box A1 HOXA1
ATGCCTCAGAGGGTAGCCTTG ATTACAGACATCCTAAGACCCG AA935273 GRO3 oncogene
GRO3 TCATCAAACATAGCTCAGTCCT (199) CCAAGGGAAAGAGAAACGCTG (200)
AA256304 distal-less homeobox DLX7 TTTCTCTGGAGGACAAGCAGTTAG
TTTCTCTGCATCTCTTCTACCTCC 7 H17115 stromal antigen 3 STAG3
ACCTGGAGCTGTTCCTGC GTAACAGCTCTTCAAGCTCCT AA454880 Heterogeneous
nuclear HNRPD GGTGGTTATGGAGGATATGAC CCAGTAAGACACTACTACATC
ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37 kD)
AA496149 3-hydroxy-3-methyl- HMGCS2 ATTTGGAGATTCACAGGAACAGC
CCACTCTTAGCTGG- TAAATGAAT glutaryl-Coenzyme A synthase 2 (mito-
chondrial) H10079 KIAA0751 gene product KIAA0751
AACCATCTTGCTTTCCTTAAATTC (209) CCCACCCTTCTTCACCCGCTTT (210)
AA176491 myogenic factor 6 MYF6 TACAATACCAGGATCCTCGCACAT
TTGGAACTGCGAGTGGCTTAG (herculin) H16793 Chromosome 8 open C8ORF4
TATTATTGTTGCATGACATTTGC AAAGTGCACCCACATGGATGTTA reading frame 4
H59614 similar to PUTATIVE GCTTTATTGGGATTGCAAGCGT
GGGCTGCCTGTCTGACCTC INSULIN-LIKE GROWTH FACTOR II ASSOCIATED
PROTEIN AA457731 SNARE protein YKT6 GGGCGGACGCATGATAGCTGTA
GTCTTGTTCTTTGACAGAAGCTC N48178 KIAA04O3 protein KIAA0403
TTCACATAGCACACAAGTGAC (219) GACCTCTACTTCCTTGGAGCTT (220) AA419251
interferon induced IFITM1 CACAAGCACGTGCACTTTATTGAA
TAGTAGCCGCCCATAGCCTGC transmembrane protein 1(9-27) AA027147
hypothetical protein MGC3040 AATGTTTCTCATTAAGTCAGGGT
CCAGCCAATGGCGACTATAGAGA MGC3040 H18646 Hypothetical protein
FLJ10697 CCCACGTTTATTTACATATGA CTTTTGTGTATATATAGATACTTGC FLJ10697
AA013268 Homo sapiens mRNA GCAGAGTTTCACTGTATCAAC
TGAAGATTGTAGGGCTTAGAT containing (CAG)4 repeat, clone CZ- CAG-7
AA039857 EST TATTTGTGGCTCCTTCCCACTT (229) CCTCCTGCCCTCATGCCTGTAA
(230) AA101632 EST CGCGTTGCATCCCTTGGATTGTA CCACGGTTGGTTAATAGTCCCTT
AA464518 EST AAGTACACAAGTGGTAAGTATAG ACTCTTTGATTACAAGCACTGG
AA427754 EST ATGCACACATGTTTAATTGTAG CGTAGGTATACACGTGCCAT H16733 EST
TGCCAAGTGCAATGTTCCAGAAA TTTCGGGAGAACCCAACCTMG H88953 EST
TGCTTAGGATATAGCATGAAA (239) TATCGGCATAGATATATGAGT (240) N90849 EST
AAATGCTTTGGAATCCCTGAGA TGTGCTTAAGTGGCAGGAT N22486 EST
ACAAGTTTMGMGAACAAAGCTG TATGGACATCCAGTTGTTCCAGCA T62979 EST
AGGAGGGAAGGGTPACAACTCAT AGAATGTGGATGACCCCTCGGAAG R53558 EST
GTCAGTCTGCTCACTCCACCGT CGGATGTGGAAACCTTTCAGGA R39555 EST
TATCACAAGCATTTATTGAGTACC (249) TATTCTAGATATTTACTCCTTCG (250) Group
2 AA425908 partner of RAC1 POR1 ACAAAGGATGTACCATGTCCAA
CAGATCAAGGTGATGCACAAG (arfaptin 2) AA405717 Muscleblind MBNL
CATACAGCAAAGTCAACTACTGC ACGCAGTTCMATTTCATGGTTT (Drosophila)-like
AA916906 TNFRSF1A-associated TRADD TTTGGAGAACCTGGATGGCCT
ATCTGCAGCACCCAGGA- TGAA via death domain AA404394 for protein
disulfide PDIR AGAGCCCACGTGGGAAGA CAGGTATCATTCACAGTGTAAT
isomerase-related AA489678 RAD23 (S. cerevisiae) RAD23B
TGCCATGAGATATCTTGATTGT (259) GGGCCAATGGAGAAATGCAGC (260) homolog B
AA447514 ribosomal protein L13 RPL13 TATACAGTCTTCCCACTTCACT
TTCTGCCTGATCATCCCATTGTA AA071330 guanine nucleotide GNAI2
AAGCTACGAGAATGAGCAGGTG GTCTTGTTCTGTGATGAGGGG binding protein (G
protein), alpha inhibiting activity polypeptide 2 AA669126 Myosin
phosphatase, MYPT1 GAAGATCAGTTAATGTCACTCC TGGTAGAAGACAAGATGATTTG
target subunit 1 R38619 FUCOSE-1-PHOSPHATE FPGT
TGAATGACAAAGACATAACATCC CTCAAGTTATGTGTCCCTA- TATT
GUANYLYLTRANSFERASE AA055503 TAT-INTERACTIVE HT2A
TTCCGCTGCATTGCTGGCATGT (269) GCCTTGGAAGTGCCTAATTGCT (270) PROTEIN,
72-KD T66981 egf-like module EMR1 AGTCCCAGACCTCAAGGATCT
GGGTAAATCAGTCAGACAGGC containing, mucin- like, hormone
receptor-like sequence 1 AA480906 protein kinase C PRKCBP1
CAGCTCAGTCACAGGAGAGA TACAGTTCGCATCCTCTTAAC binding protein 1 N45318
Phosphoglycerate PGAM2 CTCACAGGCTTCAACAAGGCA GGGAGGTGCCTTTATTGCCCA
mutase 2 (muscle) N30096 glutathione
S- GSTA3 TAGCATATAATTGGAAAGGGTTC AAGTGTTACAGAGCCATGGACAA
transferase A3 AA427733 advillin AVIL CTTTGACACATTACAGATCTGGG (279)
CATCCTTGCATTCCTTGCTTGTT (280) N92901 fatty acid binding FABP4
TTAACCAACGTAACCATATTGAATAAA AGGATGATAAACTGGTGGTGGAAT protein 4,
adipocyte T60149 Hypothetical protein FLJ13449
GCACATTAAACAGCATACATACC CCCTGTTCCTTGTGGAAACCTAT FLJ13449 AA453578
Human DNA sequence TTGCCCATAACTCACTGTGGCCT AAATCTGGCTGGAACGGGACA
from clone RP11-3J10 on chromosome 9p12- 13.3 W81520 H. sapiens
gene from TGTCTTTAGGAGACGTGAGAAAG CTTCCACGGATTACTGACAGAG PAC 106H8,
similar to Dynamin AA446486 EST AACTTAGCACAATTAACTGCAGC (289)
TGCCTGAAATCCCACTACTTGG (290) AA447992 EST CATTTATCTTGATCAAACCCACC
ATGCTTTCTGAAGAGTGAGCCC H94605 EST CGTGGTACCTAAACATGGACAC
TCTCATTGTAGGTCTCCTAAAG W46439 EST TTTGAAGCACTAAGATCAATAC (295)
TTGCGAACGCGTCTGTGA (296) *Acc No., Genbank accession number. bCpG
island, `Yes`, CpG island was found around presumed transcription
start site or near upstream region; `No`, no CpG island was found
around presumed transcription start site or near upstream region;
`UK`, upstream genomic sequence is unknown. cMethylation, `Yes`,
fully methylated. `Partial`, partially methylated. `No`, no
methylation. dpositive control genes. **SEQ ID NO: - numbered from
149 to 296, from left to right, top to bottom; representative SEQ
ID NO: shown.
SEQUENCE LISTINGS
1
296128DNAArtificial sequenceAmplification primer 1tgaagagaag
tttataagaa ygttttgt 28228DNAArtificial sequenceAmplification primer
2caacaaatcc raacctaaaa actaccca 28328DNAArtificial
sequenceAmplification primer 3tcgcgtcgtt tttttttatt tattcgtc
28426DNAArtificial sequenceAmplification primer 4aaactcacct
taaccgaaac gcgacg 26532DNAArtificial sequenceAmplification primer
5gtttttgtgt tgtttttttt tatttatttg tt 32627DNAArtificial
sequenceAmplification primer 6aacaaaactc accttaacca aaacaca
27725DNAArtificial sequenceAmplification primer 7ggagtttatg
agagggttgg agttt 25825DNAArtificial sequenceAmplification primer
8atcacccact acaaaacraa cccta 25926DNAArtificial
sequenceAmplification primer 9tggatacgta ttttcggcga cgtttc
261025DNAArtificial sequenceAmplification primer 10caacgacgcg
tcgcaaaccg aatcg 251130DNAArtificial sequenceAmplification primer
11tggtttttgt ggatatgtat ttttggtgat 301228DNAArtificial
sequenceAmplification primer 12aattcctcca acaacacatc acaaacca
281327DNAArtificial sequenceAmplification primer 13ggggaattgg
ygttaaattt tgtaggg 271425DNAArtificial sequenceAmplification primer
14aaacaacttc craaaccccc taaac 251522DNAArtificial
sequenceAmplification primer 15ttcggaagtt gtttcggttc gc
221626DNAArtificial sequenceAmplification primer 16cgaacatcgt
aactacaaaa aacgcg 261726DNAArtificial sequenceAmplification primer
17gggttttgga agttgttttg gtttgt 261831DNAArtificial
sequenceAmplification primer 18aaccacaaac atcataacta caaaaaacac a
311928DNAArtificial sequenceAmplification primer 19tggttttgtt
ttttaagggg tgttgagt 282029DNAArtificial sequenceAmplification
primer 20acactaactc craaaactac aaaactaaa 292127DNAArtificial
sequenceAmplification primer 21ttagttttgt agttttygga gttagtg
272227DNAArtificial sequenceAmplification primer 22tcctaccrca
aacttccaaa aacctcc 272326DNAArtificial sequenceAmplification primer
23tgtagttttc ggagttagtg tcgcgc 262425DNAArtificial
sequenceAmplification primer 24cctacgatcg aaaacgacgc gaacg
252530DNAArtificial sequenceAmplification primer 25gttttgtagt
ttttggagtt agtgttgtgt 302630DNAArtificial sequenceAmplification
primer 26ctcaacctac aatcaaaaac aacacaaaca 302730DNAArtificial
sequenceAmplification primer 27gttaaagttt agttggtttt aygtaattat
302828DNAArtificial sequenceAmplification primer 28cttttaattt
ccrtaaccct ccttttat 282928DNAArtificial sequenceAmplification
primer 29attaattttg gagcgttttt cgcgcgtc 283025DNAArtificial
sequenceAmplification primer 30tccacgcacc gaaccaaaaa ccccg
253132DNAArtificial sequenceAmplification primer 31atgtattaat
tttggagtgt tttttgtgtg tt 323227DNAArtificial sequenceAmplification
primer 32tctccacaca ccaaaccaaa aacccca 273323DNAArtificial
sequenceAmplification primer 33agataaagag gagagaaagt ttg
233420DNAArtificial sequenceAmplification primer 34ccaacaacaa
aaaaccraac 203525DNAArtificial sequenceAmplification primer
35attcgtagaa ggtagcgcgg tcgtc 253623DNAArtificial
sequenceAmplification primer 36ctcacctacc ccgctcgacc gcg
233729DNAArtificial sequenceAmplification primer 37atatatttgt
agaaggtagt gtggttgtt 293825DNAArtificial sequenceAmplification
primer 38tcctcaccta ccccactcaa ccaca 253923DNAArtificial
sequenceAmplification primer 39gttatyggta tagttgattt tgt
234023DNAArtificial sequenceAmplification primer 40ctccccccaa
atcattccra taa 234128DNAArtificial sequenceAmplification primer
41gaggtattag tgagattgag agagattt 284229DNAArtificial
sequenceAmplification primer 42ccctaaaaaa aaccaacaac aaaatccca
294324DNAArtificial sequenceAmplification primer 43ttcgtcgtgg
tggttggagg gcgc 244425DNAArtificial sequenceAmplification primer
44caacgcacaa ccaacgcgaa cgacg 254528DNAArtificial
sequenceAmplification primer 45ttattttgtt gtggtggttg gagggtgt
284628DNAArtificial sequenceAmplification primer 46ccccaacaca
caaccaacac aaacaaca 284725DNAArtificial sequenceAmplification
primer 47aagggattgt tagaggtagg yggag 254825DNAArtificial
sequenceAmplification primer 48cacaaaactc atacctccaa cctca
254924DNAArtificial sequenceAmplification primer 49ttatggagga
agtgagaaag ttgg 245024DNAArtificial sequenceAmplification primer
50tctacacccc cctacccact aaaa 245129DNAArtificial
sequenceAmplification primer 51taggaatttg gggtagaaaa tgaatattt
295227DNAArtificial sequenceAmplification primer 52acccraacta
tataactccc caaaatc 275325DNAArtificial sequenceAmplification primer
53ggagagttag gygggttaga gttga 255425DNAArtificial
sequenceAmplification primer 54ctacaaaaaa aataaccata tctcc
255526DNAArtificial sequenceAmplification primer 55gatttttcgc
ggcggtatcg tagcgc 265627DNAArtificial sequenceAmplification primer
56caaccccttc cttcgttaaa caacgcg 275731DNAArtificial
sequenceAmplification primer 57gattagattt tttgtggtgg tattgtagtg t
315829DNAArtificial sequenceAmplification primer 58aacaacccct
tccttcatta aacaacaca 295923DNAArtificial sequenceAmplification
primer 59gaagggggta ggttagggag agg 236022DNAArtificial
sequenceAmplification primer 60ccaccataac tccctcctac tc
226126DNAArtificial sequenceAmplification primer 61tgatcgggac
gcgtcgtttt ttcgtc 266225DNAArtificial sequenceAmplification primer
62cttcgcctcc cactctcgcg cgacg 256331DNAArtificial
sequenceAmplification primer 63ttatgtgatt gggatgtgtt gtttttttgt t
316427DNAArtificial sequenceAmplification primer 64cccttcacct
cccactctca cacaaca 276525DNAArtificial sequenceAmplification primer
65tggtatttag gaggttggtg aaata 256625DNAArtificial
sequenceAmplification primer 66accctcaatc tcctactcca ttaaa
256724DNAArtificial sequenceAmplification primer 67gcggggttaa
agcgggtcgt tcgc 246828DNAArtificial sequenceAmplification primer
68aaaaatatac gaactaatac gcgccacg 286926DNAArtificial
sequenceAmplification primer 69gggtggggtt aaagtgggtt gtttgt
267030DNAArtificial sequenceAmplification primer 70ttaaaaatat
acaaactaat acacaccaca 307128DNAArtificial sequenceAmplification
primer 71gtagttgttg ttgttgttgt tgttgttt 287229DNAArtificial
sequenceAmplification primer 72aacatcttac cctctaaaca aatttatac
297329DNAArtificial sequenceAmplification primer 73gtttcgtttt
tataatttgc gacgtggtc 297425DNAArtificial sequenceAmplification
primer 74ctcaaaacgc caaacccgaa ccgcg 257532DNAArtificial
sequenceAmplification primer 75gtgatgttag ttttgttttt ataatttgtg at
327627DNAArtificial sequenceAmplification primer 76tcccctcaaa
acaccaaacc caaacca 277727DNAArtificial sequenceAmplification primer
77gaatttattg gtgtgtttag tagtygg 277826DNAArtificial
sequenceAmplification primer 78cccraaccac aaaatcrcct atcaac
267925DNAArtificial sequenceAmplification primer 79gggagggcgt
tcggtttgta cgttc 258025DNAArtificial sequenceAmplification primer
80cataaacgat cgcccaacga cgccg 258128DNAArtificial
sequenceAmplification primer 81agtgggaggg tgtttggttt gtatgttt
288230DNAArtificial sequenceAmplification primer 82caaatcataa
acaatcaccc aacaacacca 308324DNAArtificial sequenceAmplification
primer 83aggaggaagt tttaggagtt tttg 248424DNAArtificial
sequenceAmplification primer 84ctaactcacc acaaaataat aacc
248524DNAArtificial sequenceAmplification primer 85tcgtggttgg
cgttcggcgc gtga 248624DNAArtificial sequenceAmplification primer
86accgccgcgc aactcgacta ccga 248724DNAArtificial
sequenceAmplification primer 87ttgtggttgg tgtttggtgt gtga
248824DNAArtificial sequenceAmplification primer 88ataccaccac
acaactcaac tacc 248930DNAArtificial sequenceAmplification primer
89gtgttttata aatgtgaata aatagaattt 309028DNAArtificial
sequenceAmplification primer 90caatacactc taaaataata acaaaacc
289126DNAArtificial sequenceAmplification primer 91ttttagggtt
gtcgggagag tcgcgg 269227DNAArtificial sequenceAmplification primer
92caaccgaacg aaaaaaaaac gaccccg 279328DNAArtificial
sequenceAmplification primer 93gtggttttag ggttgttggg agagttgt
289431DNAArtificial sequenceAmplification primer 94aaaacaacca
aacaaaaaaa aaacaacccc a 319529DNAArtificial sequenceAmplification
primer 95ggtattagaa aattttggtt tttaggggg 299626DNAArtificial
sequenceAmplification primer 96acccacccac ctactacact aaccta
269726DNAArtificial sequenceAmplification primer 97acgggaagta
gttatcggga gttcgc 269825DNAArtificial sequenceAmplification primer
98gacgaaacct aaattcccac gcccg 259929DNAArtificial
sequenceAmplification primer 99tggatgggaa gtagttattg ggagtttgt
2910028DNAArtificial sequenceAmplification primer 100ctcaacaaaa
cctaaattcc cacaccca 2810129DNAArtificial sequenceAmplification
primer 101gttatttgtt tttgagatyg ttgttagag 2910226DNAArtificial
sequenceAmplification primer 102ctaacaacta ccataacccc accttc
2610327DNAArtificial sequenceAmplification primer 103agtggagaaa
ggagttagyg gtgggta 2710427DNAArtificial sequenceAmplification
primer 104cctacctaac atacacrccc tcatccc 2710529DNAArtificial
sequenceAmplification primer 105ggtttagtta taggtttggt tygtttagg
2910627DNAArtificial sequenceAmplification primer 106ctcacccaac
aacaacaact tcacctc 2710730DNAArtificial sequenceAmplification
primer 107gggttatatt ygtttttttt tggtggttta 3010826DNAArtificial
sequenceAmplification primer 108cctcccttcc taccacaaaa accctc
2610930DNAArtificial sequenceAmplification primer 109gtttttagag
gaaagtttat ttttgtaggg 3011026DNAArtificial sequenceAmplification
primer 110atccccaatc cccaaccctc cttccc 2611125DNAArtificial
sequenceAmplification primer 111gggtcggagt ttttcggagt tgcgc
2511226DNAArtificial sequenceAmplification primer 112ccgctctctt
cgctaaatac gactcg 2611329DNAArtificial sequenceAmplification primer
113ttttgggttg gagttttttg gagttgtgt 2911429DNAArtificial
sequenceAmplification primer 114aacccactct cttcactaaa tacaactca
2911526DNAArtificial sequenceAmplification primer 115aaaataagtt
cgggtttcgg cggtac 2611627DNAArtificial sequenceAmplification primer
116caataaacga acaaaacgcg aactacg 2711728DNAArtificial
sequenceAmplification primer 117gtaaaataag tttgggtttt ggtggtat
2811829DNAArtificial sequenceAmplification primer 118cacaataaac
aaacaaaaca caaactaca 2911925DNAArtificial sequenceAmplification
primer 119ttagtatttg gtcgcgaggt cgttc 2512023DNAArtificial
sequenceAmplification primer 120ccctaaatac cgccgctcgc ccg
2312128DNAArtificial sequenceAmplification primer 121ttgttagtat
ttggttgtga ggttgttt 2812224DNAArtificial sequenceAmplification
primer 122cccctaaata ccaccactca ccca 2412327DNAArtificial
sequenceAmplification primer 123gatgatgaca acgacataat ggaaacg
2712424DNAArtificial sequenceAmplification primer 124gagtgtgctt
ggggaacggg agct 2412528DNAArtificial sequenceAmplification primer
125agttgttaag ggagcgtttc gagtttac 2812626DNAArtificial
sequenceAmplification primer 126ctcaaccttc gaaaacgaac ccgccg
2612730DNAArtificial sequenceAmplification primer 127gtagttgtta
agggagtgtt ttgagtttat 3012828DNAArtificial sequenceAmplification
primer 128ctctcaacct tcaaaaacaa acccacca 2812927DNAArtificial
sequenceAmplification primer 129gggtgatgtt atcgtttttg tatcgac
2713025DNAArtificial sequenceAmplification primer 130cctcccctaa
cgtaaactcg aaacg 2513129DNAArtificial sequenceAmplification primer
131gggggtgatg ttattgtttt tgtattgat 2913227DNAArtificial
sequenceAmplification primer 132cacctcccct aacataaact caaaaca
2713325DNAArtificial sequenceAmplification primer 133ggttgcgttt
cgagttgcgg agttc 2513426DNAArtificial sequenceAmplification primer
134tccaatcgac aacaaaacga aacgcg 2613528DNAArtificial
sequenceAmplification primer 135gttggttgtg ttttgagttg tggagttt
2813629DNAArtificial sequenceAmplification primer 136aactccaatc
aacaacaaaa caaaacaca 2913726DNAArtificial sequenceAmplification
primer 137ggtacaggaa aggcctcttg atgttg 2613826DNAArtificial
sequenceAmplification primer 138ggatctttta ctaagctgat ctctcc
2613926DNAArtificial sequenceAmplification primer 139aagatttggc
gttgggcggg acgttc 2614025DNAArtificial sequenceAmplification primer
140actccaaccc gaacctcgcc gtacg 2514128DNAArtificial
sequenceAmplification primer 141gtaagatttg gtgttgggtg ggatgttt
2814228DNAArtificial sequenceAmplification primer 142aaaactccaa
cccaaacctc accataca 2814326DNAArtificial sequenceAmplification
primer 143cgttttggag ttggggttag gcggtc 2614428DNAArtificial
sequenceAmplification primer 144aaataaataa caacctacgc tacgaacg
2814528DNAArtificial sequenceAmplification primer 145tttgttttgg
agttggggtt aggtggtt 2814630DNAArtificial sequenceAmplification
primer 146ccaaataaat aacaacctac actacaaaca 3014724DNAArtificial
sequenceAmplification primer 147tgcgcccagt gtgagatgga gcac
2414825DNAArtificial sequenceAmplification primer 148cccatccctt
aggccttgtg ccagt 2514923DNAArtificial sequenceAmplification primer
149taaacagaca tttatttcca gac 2315023DNAArtificial
sequenceAmplification primer 150gaaagaaata gtcaatatgc ttg
2315121DNAArtificial sequenceAmplification primer 151agccttcggc
tgactggctg g 2115222DNAArtificial sequenceAmplification primer
152ctgcccatca tcatgacctg ga 2215321DNAArtificial
sequenceAmplification primer 153cagctggagc ctgggggact g
2115422DNAArtificial sequenceAmplification primer 154ccttgcgctg
ggagagggtg ag 2215524DNAArtificial sequenceAmplification primer
155tttctctgct tgtcaaatga gagt 2415623DNAArtificial
sequenceAmplification primer 156cttaacaaag gaggacctga gag
2315727DNAArtificial sequenceAmplification primer 157ttgtagttat
cttagaagat agcatgg 2715825DNAArtificial sequenceAmplification
primer 158acgggaatta ctattaacat aagcg 2515923DNAArtificial
sequenceAmplification primer 159ctgctgccgc ccctgggcct cac
2316026DNAArtificial SequenceAmplification primer 160gtagtgtatt
agagcagagc agaatg 2616122DNAArtificial sequenceAmplification primer
161cccaggagaa tgcctacctt tg 2216223DNAArtificial
sequenceAmplification primer 162aaactgccaa acagcccaga agg
2316321DNAArtificial sequenceAmplification primer 163ctgtggttga
ttgctagtgg t 2116423DNAArtificial sequenceAmplification primer
164aagtgactga accttgcagt tct 2316524DNAArtificial
sequenceAmplification primer 165ccctcctcgg cagtgtgtgg ggtc
2416626DNAArtificial sequenceAmplification primer 166gggatgtcag
agctggacca gtcgaa 2616724DNAArtificial sequenceAmplification primer
167attactgtgc ttataagtga cacg 2416823DNAArtificial
sequenceAmplification primer 168gaagttattg ccaaaggaac tgt
2316925DNAArtificial sequenceAmplification primer 169gttcgaggag
ggatggtgtt tgagc 2517027DNAArtificial sequenceAmplification primer
170ataccacaca aattcaatac ggattct 2717122DNAArtificial
sequenceAmplification primer 171aatgacactc tgaaatccag tc
2217221DNAArtificial sequenceAmplification primer 172ctattgtgtg
ataggctctg t 2117321DNAArtificial sequenceAmplification primer
173tgagtggtag caaggtttac a 2117421DNAArtificial
sequenceAmplification primer 174atttcagcct cttccgaatc t
2117528DNAArtificial sequenceAmplification primer 175ttaaaaatcg
aataatactg aaataacc 2817622DNAArtificial sequenceAmplification
primer 176ggggtgccca gcctaacaat aa 2217722DNAArtificial
sequenceAmplification primer 177tctctgaaga aggaggtcat gt
2217822DNAArtificial sequenceAmplification primer 178ggagggaggt
gcattgggta at 2217922DNAArtificial sequenceAmplification primer
179aaagcagttg gtggattcaa ag 2218021DNAArtificial
sequenceAmplification primer 180ttattagttg gctgggcatg a
2118122DNAArtificial sequenceAmplification primer 181ttctttacac
atcagtcaca ag 2218221DNAArtificial sequenceAmplification primer
182gggtgttgag ttaccagatg a 2118324DNAArtificial
sequenceAmplification primer 183aaagaaacac atctcagtga aggg
2418423DNAArtificial sequenceAmplification primer 184caggaggctt
gtagtttaga agg 2318520DNAArtificial sequenceAmplification primer
185agttagccac tgctggtgtt 2018620DNAArtificial sequenceAmplification
primer 186ccctccctcc agcacacaaa 2018722DNAArtificial
sequenceAmplification primer 187ccagagacat ccgttaagga ga
2218821DNAArtificial sequenceAmplification primer 188ttgggtctag
gagcgtttgc t 2118923DNAArtificial sequenceAmplification primer
189tcttgagcat tgtggtggcc tta 2319022DNAArtificial
sequenceAmplification primer 190ttcgggcttc ctggagggaa ca
2219123DNAArtificial sequenceAmplification primer 191gcaacatgaa
gattctgaag ggt 2319223DNAArtificial sequenceAmplification primer
192acagcaaact gcatttacca tcg 2319321DNAArtificial
sequenceAmplification primer 193ttggaaagat cgtcctggtg c
2119421DNAArtificial sequenceAmplification primer 194aacttctggc
cctcggagga a 2119522DNAArtificial sequenceAmplification primer
195aacagcaagc atgacatatt ca 2219623DNAArtificial
sequenceAmplification primer 196gcagagagaa tgtgaggaac ctt
2319721DNAArtificial sequenceAmplification primer 197atgcctcaga
gggtagcctt g 2119822DNAArtificial sequenceAmplification primer
198attacagaca tcctaagacc cg 2219922DNAArtificial
sequenceAmplification primer 199tcatcaaaca tagctcagtc ct
2220021DNAArtificial sequenceAmplification primer 200ccaagggaaa
gagaaacgct g 2120124DNAArtificial sequenceAmplification primer
201tttctctgga ggacaagcag ttag 2420224DNAArtificial
sequenceAmplification primer 202tttctctgca tctcttctac ctcc
2420318DNAArtificial sequenceAmplification primer 203acctggagct
gttcctgc 1820421DNAArtificial sequenceAmplification primer
204gtaacagctc ttcaagctcc t 2120521DNAArtificial
sequenceAmplification primer 205ggtggttatg gaggatatga c
2120621DNAArtificial sequenceAmplification primer 206ccagtaagac
actactacat c 2120723DNAArtificial sequenceAmplification primer
207atttggagat tcacaggaac agc 2320823DNAArtificial
sequenceAmplification primer 208ccactcttag ctggtaaatg aat
2320924DNAArtificial sequenceAmplification primer 209aaccatcttg
ctttccttaa attc 2421022DNAArtificial sequenceAmplification primer
210cccacccttc ttcacccgct tt 2221124DNAArtificial
sequenceAmplification primer 211tacaatacca ggatcctcgc acat
2421221DNAArtificial sequenceAmplification primer 212ttggaactgc
gagtggctta g 2121323DNAArtificial sequenceAmplification primer
213tattattgtt gcatgacatt tgc 2321423DNAArtificial
sequenceAmplification primer 214aaagtgcacc cacatggatg tta
2321522DNAArtificial sequenceAmplification primer 215gctttattgg
gattgcaagc gt 2221619DNAArtificial sequenceAmplification primer
216gggctgcctg tctgacctc 1921722DNAArtificial sequenceAmplification
primer 217gggcggacgc atgatagctg ta 2221823DNAArtificial
sequenceAmplification primer 218gtcttgttct ttgacagaag ctc
2321921DNAArtificial sequenceAmplification primer 219ttcacatagc
acacaagtga c 2122022DNAArtificial sequenceAmplification primer
220gacctctact tccttggagc tt 2222124DNAArtificial
sequenceAmplification primer 221cacaagcacg tgcactttat tgaa
2422221DNAArtificial sequenceAmplification primer 222tagtagccgc
ccatagcctg c 2122323DNAArtificial sequenceAmplification primer
223aatgtttctc attaagtcag ggt 2322423DNAArtificial
sequenceAmplification primer 224ccagccaatg gcgactatag aga
2322521DNAArtificial sequenceAmplification primer 225cccacgttta
tttacatatg a 2122625DNAArtificial sequenceAmplification primer
226cttttgtgta tatatagata cttgc 2522721DNAArtificial
SequenceAmplification primer 227gcagagtttc actgtatcaa c
2122821DNAArtificial sequenceAmplification primer 228tgaagattgt
agggcttaga t 2122922DNAArtificial sequenceAmplification primer
229tatttgtggc tccttcccac tt 2223022DNAArtificial
sequenceAmplification primer 230cctcctgccc tcatgcctgt aa
2223123DNAArtificial sequenceAmplification primer 231cgcgttgcat
cccttggatt gta 2323223DNAArtificial sequenceAmplification primer
232ccacggttgg ttaatagtcc ctt 2323323DNAArtificial
sequenceAmplification primer 233aagtacacaa gtggtaagta tag
2323422DNAArtificial sequenceAmplification primer 234actctttgat
tacaagcact gg 2223522DNAArtificial sequenceAmplification primer
235atgcacacat gtttaattgt ag 2223620DNAArtificial
sequenceAmplification primer 236cgtaggtata cacgtgccat
2023723DNAArtificial sequenceAmplification primer 237tgccaagtgc
aatgttccag aaa 2323822DNAArtificial sequenceAmplification primer
238tttcgggaga acccaaccta ag 2223921DNAArtificial
sequenceAmplification primer 239tgcttaggat atagcatgaa a
2124021DNAArtificial sequenceAmplification primer 240tatcggcata
gatatatgag t 2124122DNAArtificial sequenceAmplification primer
241aaatgctttg gaatccctga ga 2224219DNAArtificial
sequenceAmplification primer 242tgtgcttaag tggcaggat
1924324DNAArtificial sequenceAmplification primer 243acaagtttaa
gaagaacaaa gctg 2424424DNAArtificial sequenceAmplification primer
244tatggacatc cagttgttcc agca 2424523DNAArtificial
sequenceAmplification primer 245aggagggaag ggtaacaact cat
2324624DNAArtificial sequenceAmplification primer 246agaatgtgga
tgacccctcg gaag 2424722DNAArtificial sequenceAmplification primer
247gtcagtctgc tcactccacc gt 2224822DNAArtificial
sequenceAmplification primer 248cggatgtgga aacctttcag ga
2224924DNAArtificial sequenceAmplification primer 249tatcacaagc
atttattgag tacc 2425023DNAArtificial sequenceAmplification primer
250tattctagat atttactcct tcg 2325122DNAArtificial
sequenceAmplification primer 251acaaaggatg taccatgtcc aa
2225221DNAArtificial sequenceAmplification primer 252cagatcaagg
tgatgcacaa g 2125323DNAArtificial sequenceAmplification primer
253catacagcaa agtcaactac tgc 2325423DNAArtificial
sequenceAmplification primer 254acgcagttca aatttcatgg ttt
2325521DNAArtificial sequenceAmplification primer 255tttggagaac
ctggatggcc t 2125621DNAArtificial sequenceAmplification primer
256atctgcagca cccaggatga a 2125718DNAArtificial
sequenceAmplification primer 257agagcccacg tgggaaga
1825822DNAArtificial sequenceAmplification primer 258caggtatcat
tcacagtgta at 2225922DNAArtificial sequenceAmplification primer
259tgccatgaga tatcttgatt gt 2226021DNAArtificial
sequenceAmplification primer 260gggccaatgg agaaatgcag c
2126122DNAArtificial sequenceAmplification primer 261tatacagtct
tcccacttca ct 2226223DNAArtificial sequenceAmplification primer
262ttctgcctga tcatcccatt gta 2326322DNAArtificial
sequenceAmplification primer 263aagctacgag aatgagcagg tg
2226421DNAArtificial sequenceAmplification primer 264gtcttgttct
gtgatgaggg g 2126522DNAArtificial sequenceAmplification primer
265gaagatcagt taatgtcact cc 2226622DNAArtificial
sequenceAmplification primer 266tggtagaaga caagatgatt tg
2226723DNAArtificial sequenceAmplification primer 267tgaatgacaa
agacataaca tcc 2326823DNAArtificial sequenceAmplification primer
268ctcaagttat gtgtccctat att 2326922DNAArtificial
sequenceAmplification primer 269ttccgctgca ttgctggcat gt
2227022DNAArtificial sequenceAmplification primer 270gccttggaag
tgcctaattg ct 2227121DNAArtificial sequenceAmplification primer
271agtcccagac ctcaaggatc t 2127221DNAArtificial
sequenceAmplification primer 272gggtaaatca gtcagacagg c
2127320DNAArtificial sequenceAmplification primer 273cagctcagtc
acaggagaga 2027421DNAArtificial sequenceAmplification primer
274tacagttcgc atcctcttaa c 2127521DNAArtificial
sequenceAmplification primer 275ctcacaggct tcaacaaggc a
2127621DNAArtificial sequenceAmplification primer 276gggaggtgcc
tttattgccc a 2127723DNAArtificial sequenceAmplification primer
277tagcatataa ttggaaaggg ttc 2327823DNAArtificial
sequenceAmplification primer 278aagtgttaca gagccatgga caa
2327923DNAArtificial sequenceAmplification primer 279ctttgacaca
ttacagatct ggg 2328023DNAArtificial sequenceAmplification primer
280catccttgca ttccttgctt gtt 2328127DNAArtificial
sequenceAmplification primer 281ttaaccaacg taaccatatt gaataaa
2728224DNAArtificial sequenceAmplification primer 282aggatgataa
actggtggtg gaat 2428323DNAArtificial sequenceAmplification primer
283gcacattaaa cagcatacat acc 2328423DNAArtificial
sequenceAmplification primer 284ccctgttcct tgtggaaacc tat
2328523DNAArtificial sequenceAmplification primer 285ttgcccataa
ctcactgtgg cct 2328621DNAArtificial sequenceAmplification primer
286aaatctggct ggaacgggac a 2128723DNAArtificial
sequenceAmplification primer 287tgtctttagg agacgtgaga aag
2328822DNAArtificial sequenceAmplification primer 288cttccacgga
ttactgacag ag 2228923DNAArtificial sequenceAmplification primer
289aacttagcac aattaactgc agc 2329022DNAArtificial
sequenceAmplification primer 290tgcctgaaat cccactactt gg
2229123DNAArtificial sequenceAmplification primer 291catttatctt
gatcaaaccc acc 2329222DNAArtificial sequenceAmplification primer
292atgctttctg aagagtgagc cc 2229322DNAArtificial
sequenceAmplification primer 293cgtggtacct aaacatggac ac
2229422DNAArtificial sequenceAmplification primer 294tctcattgta
ggtctcctaa ag 2229522DNAArtificial sequenceAmplification primer
295tttgaagcac taagatcaat ac 2229618DNAArtificial
sequenceAmplification primer 296ttgcgaacgc gtctgtga 18
* * * * *