U.S. patent number 7,473,682 [Application Number 10/577,679] was granted by the patent office on 2009-01-06 for angiogenic peptides and uses thereof.
This patent grant is currently assigned to Ramot at Tel Aviv University Ltd.. Invention is credited to Alexander Battler, Britta Hardy, Ran Kornowski, Annat Raiter, Chana Weiss.
United States Patent |
7,473,682 |
Hardy , et al. |
January 6, 2009 |
Angiogenic peptides and uses thereof
Abstract
A peptide comprising an amino acid sequence as set forth in SEQ
ID NO: 2, 4, 6, 8, 10 or 12 is provided. The peptide being at least
6 and no more than 50 amino acid residues in length. Also provided
are therapeutic applications using such peptides.
Inventors: |
Hardy; Britta (Tel Aviv,
IL), Battler; Alexander (Ramat-HaSharon,
IL), Raiter; Annat (Kfar Saba, IL),
Kornowski; Ran (Ramat-HaSharon, IL), Weiss; Chana
(Givat Shmuel, IL) |
Assignee: |
Ramot at Tel Aviv University
Ltd. (Tel-Aviv, IL)
|
Family
ID: |
34527062 |
Appl.
No.: |
10/577,679 |
Filed: |
October 28, 2004 |
PCT
Filed: |
October 28, 2004 |
PCT No.: |
PCT/IL2004/000992 |
371(c)(1),(2),(4) Date: |
April 28, 2006 |
PCT
Pub. No.: |
WO2005/039616 |
PCT
Pub. Date: |
May 06, 2005 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20070082849 A1 |
Apr 12, 2007 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60558558 |
Apr 2, 2004 |
|
|
|
|
60514895 |
Oct 29, 2003 |
|
|
|
|
Current U.S.
Class: |
514/1.1;
514/21.1; 514/13.3; 514/15.1; 514/6.9; 514/13.5 |
Current CPC
Class: |
A61P
9/00 (20180101); A61K 47/64 (20170801); G01N
33/5064 (20130101); G01N 33/6896 (20130101); A61P
9/10 (20180101); A61K 38/08 (20130101); A61P
17/02 (20180101); A61P 43/00 (20180101); A61K
38/10 (20130101); C07K 14/52 (20130101); G01N
2333/4709 (20130101) |
Current International
Class: |
A61K
38/10 (20060101); A61K 38/16 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
1136082 |
|
Sep 2001 |
|
EP |
|
WO 02/02593 |
|
Jan 2002 |
|
WO |
|
WO 03/037172 |
|
Aug 2003 |
|
WO |
|
Other References
Zhang et al., Cancer Letters, 2001, v171, 153-164. cited by
examiner .
Balian, WO 03/072593, 2003, pp. 1-22 with 1-9 of figures/drawings.
cited by examiner .
Puzas "Human TRAP Peptide SEQ ID No. 24", Database Geneseq
'Online!, Database Accession No. ABR44764, 2003. Abstract. cited by
other .
Bainbridge et al. "A Peptide Encoded by Exon 6 of VEGF (EG3306)
Inhibits VEGF-IncludedAngiogenesis In Vitro and Ischaemic Retinal
Neovascularisation In Vivo", Biochemidal and Biophysical Research
Communications, 302: 793-799, 2003. cited by other .
Conway et al. "Molecular Mechanisms of Blood Vessel Growth",
Cardiovascular Research, 49: 507-521, 2001. cited by other .
Giordano et al. "Biopanning and Rapid Analysis of Selective
Interactive Ligands",Nature Medicine, 11(7), 1249-1253, 2001. cited
by other .
Hetian et al.. "A Novel Peptide Isolated from a Phage Display
Library Inhibits Tumor Growth and Metastasis by Blocking the
Binding of Vascular Endothelial Growth Factor to its Kinase Domain
Receptor", The Journal of Biological Chemistry, 277(45):
43137-43142, 200 2. cited by other .
Liu et al. "Combinataorial Peptide Library Methods for
Immunobiology Research", Experimental Hematology, 31: 11-30, 2003.
cited by other .
Puzas "Human TRAP Peptide SEQ ID No. 24", Database Geneseq
'Online!, Database Accession No. ABR44764, 2003. Abstract. cited by
other .
Ramarao "Human Sperm Activator Peptide (Husap), Sperm 5 Pro.",
Database Geneseq 'Online!, Database Accession No. AAE32981, 2003.
Abstract. cited by other .
Binetruy-Tournaire et al. "Identification of A Peptide Blocking
Vascular Endothelial Growth Factor (VEGF)-Mediated Angiogenesis",
The EMBO Journal, 19(7): 1525-1533, 2000. cited by other.
|
Primary Examiner: Gupta; Anish
Assistant Examiner: Niebauer; Ronald T
Claims
What is claimed is:
1. An isolated peptide comprising the amino acid sequence set forth
in SEQ ID NO:6 or 10, the peptide being no more than 50 amino acids
in length.
2. An isolated peptide consisting of the amino acid sequence set
forth in SEQ ID NO:6 or 10.
3. The isolated peptide of claim 1, wherein the peptide is a cyclic
peptide.
4. The isolated peptide of claim 1, wherein the peptide is a linear
peptide.
5. A composition-of-matter comprising a peptide which comprises the
amino acid sequence set forth in SEQ ID NO:6, wherein said peptide
is no more than 50 amino acids in length, and an additional peptide
which comprises the amino acid sequence set forth in SEQ ID NO:10,
wherein said additional peptide is no more than 50 amino acids in
length.
6. A composition-of-matter comprising a peptide which consists of
the amino acid sequence set forth in SEQ ID NO: 6 and an additional
peptide which consists of the amino acid sequence set forth in SEQ
ID NO: 10.
7. A pharmaceutical composition comprising as an active ingredient
the peptide of claim 1 and a pharmaceutically acceptable carrier or
diluent.
8. The pharmaceutical composition of claim 7, wherein the peptide
is a linear peptide.
9. The pharmaceutical composition of claim 7, wherein the peptide
is a cyclic peptide.
10. A pharmaceutical composition comprising as an active ingredient
the peptide of claim 2, and a pharmaceutically acceptable carrier
or diluent.
11. A composition for targeting a drug to endothelial cells, the
composition comprising the drug fused to a peptide consisting of
the amino acid sequence set forth in SEQ ID NO:6 or 10.
12. A composition for targeting a drug to endothelial cells, the
composition comprising the drug fused to the peptide of claim 1.
Description
RELATED APPLICATIONS
This application is a National Phase Application of PCT Patent
Application No. PCT/IL2004/000992 having International Filing Date
of Oct. 28, 2004, which claims the benefit of U.S. Provisional
Patent Application No. 60/514,895 filed on Oct. 29, 2003 and U.S.
Provisional Patent Application No. 60/558,558 filed on Apr. 2,
2004. The contents of the above Applications are all incorporated
herein by reference.
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to peptides that are capable of
promoting angiogenesis and to the use thereof in the treatment of
angiogenesis-dependent diseases, such as ischemic vascular
diseases.
Angiogenesis is the process of generating new capillary blood
vessels and involves an interplay between cells and soluble factors
(1). In brief, activated endothelial cells migrate and proliferate
to form new vessels, which are surrounded by layers of
periendothelial cells; small blood vessels are surrounded by
pericytes and large blood vessels are surrounded by smooth muscle
cells.
Numerous factors regulate the angiogenic process. These include
soluble factors and tissue oxygen. In the past two decades, a
number of angiogenic molecules which positively regulate the
angiogenic process were elucidated. These include Vascular
Endothelium Growth Factor (VEGF), basic Fibroblast Growth Factor
(bFGF), acidic FGF/FGF-1, hypoxia-inducible factor-1.alpha.
(HIF-1.alpha.), and others (2). As mentioned, oxygen conditions
also have important implications for the physiological and
pathological angiogenic process (3). Under hypoxic conditions, VEGF
gene expression is induced both in endothelial cells and pericytes
to produce secretory forms of VEGF. VEGF, in turn, may bind to VEGF
receptor-2 (Kdr) or VEGF receptor-1 (VEGFR-1; Flt-1) expressed on
endothelial cells in an autocrine or paracrine manner, thereby
causing proliferation of endothelial cells, which may lead to
angiogenesis. Basal amounts of vascular VEGF synthesized under
normoxia promote the maintenance of microvascular homeostasis (5).
Expression of VEGF receptor 1 mRNA (Flt-1) was found to be
up-regulated in peri-ischemic endothelial cells and in the
infracted core of endothelial cells and periphery, with peak
expression of VEGFR-1 in endothelial cells. Gene expression of
VEGFR-1 is directly inducible by hypoxia, as in the case of VEGF.
Twenty-four hours following hypoxia-induced VEGF gene expression,
concurrent with the expression of the VEGFR-1 and 2 (Kdr) genes,
endothelial cells begin to proliferate (6, 7).
Hypoxia-inducible gene products that participate in these cellular
responses include erytropoietin, VEGF, and glycolytic enzymes (8).
Hypoxia can directly enhance the expression of bFGF mRNA in
pericytes. Increased expression of bFGF may play an important role
in pericyte proliferation and in differentiation of pericytes and
smooth muscle cells (9).
Angiogenesis-dependent diseases result when the angiogenic process
is disregulated, resulting in excessive amounts of new blood
vessels or an insufficient number of blood vessels. Insufficient
angiogenesis is related to a large number of diseases and
conditions, such as coronary artery diseases and delayed wound
healing. To date, cardiovascular diseases are the leading cause of
mortality in the United States, Europe, and Israel. In the United
States, approximately one million deaths per year are attributed to
cardiac causes, fifty percent of which are attributed to Coronary
Artery Disease (CAD). The major morbidity from CAD is a result of
obstructive coronary artery narrowing and the resultant myocardial
ischemia CAD affects more than 13 million people, and its annual
economic burden is in excess of sixty billion U.S. Dollars.
Mechanical revascularization of obstructive coronary stenoses by
percutaneous techniques, including percutaneous transluminal
angioplasty and stent implantation, is used to restore normal
coronary artery blood flow. In addition, coronary artery occlusion
bypass surgery is performed using arterial and venous conduits as
grafts onto the coronary arterial tree. These treatment modalities
have significant limitations in individuals with diffuse
atherosclerotic disease or severe small vessel coronary artery
disease, in diabetic patients, as well as in individuals who have
already undergone surgical or percutaneous procedures.
For these reasons, therapeutic angiogenesis, aimed at stimulating
new blood vessel growth, is highly desirable. The therapeutic
concept of angiogenesis therapy is based on the premise that the
existing potential for vascular growth inherent to vascular tissue
can be utilized to promote the development of new blood vessels
under the influence of the appropriate angiogenic molecules.
Therapeutic angiogenesis defines the intervention used to treat
local hypovascularity by stimulating or inducing neovascularization
for the treatment of ischemic vascular disease.
Animal studies have proven the feasibility of enhancing collateral
perfusion and function via angiogenic compounds. Those experiments
proved that exogenous administration of angiogenic growth factors
or their genetic constructs could promote collateral vessel growth
in experimental models of chronic ischemia. Although such studies
demonstrated proof of concept, additional studies raise issues that
still have not been resolved, such as the duration of exposure of
the vessels to angiogenic factors and the brief half-lives of such
proteins (10).
Synthetic peptides encompassing portions of proteins have become
supportive tools for understanding the molecular mechanisms
associated with protein biological functions. The use of short
peptides constructed from specific regions of human FGF and VEGF
that have the potential to efficiently agonize or antagonize the
biological functions of the growth factor family members has been
described (11). Several groups have reported the use of intact
cells to screen a phage display peptide library to identify cell
surface-binding peptides (12). A peptide-based ligand receptor map
of the VEGF family was constructed by screening human endothelial
cells stimulated with VEGF with a peptide library (13). Another
study has described the screening of a 12-mer phage display peptide
library on VEGF-2 receptor protein (14).
While reducing the present invention to practice, the present
inventors used a 12-mer phage display peptide library to uncover
peptides which are able to bind the cell-surface of endothelial
cells incubated under normoxic or hypoxic conditions. Such peptides
were shown to trigger angiogenic processes including endothelial
cell-proliferation and vascularization. As such, these peptides can
be used to treat various angiogenesis-dependent diseases, such as
ischemic vascular diseases. Furthermore, characterization of the
nature of endothelial cell signaling by these peptides will provide
the basis for the development of targeted angiogenic therapy for
morbidities, such as cardiovascular disease.
SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided
peptide selected from the group consisting of SEQ ID NOs: 2, 4, 6,
8, 10, and 12.
According to another aspect of the present invention there is
provided a peptide comprising an amino acid sequence selected from
the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 12, the
peptide being no more than 50 amino acid residues in length.
According to yet another aspect of the present invention there is
provided a peptide comprising an amino acid sequence as set forth
in SEQ ID NO:13, 27, or 32, the peptide being at least 6 and no
more than 50 amino acid residues in length.
According to still another aspect of the present invention there is
provided a composition-of-matter comprising at least two peptides,
each independently selected from the group consisting of SEQ ID
NOs: 2, 4, 6, 8, 10, and 12.
According to an additional aspect of the present invention there is
provided a pharmaceutical composition comprising a therapeutically
effective amount of a peptide having an amino acid sequence as set
forth in SEQ ID NO:13, 27, or 32, the peptide being at least 6 and
no more than 50 amino acid residues in length, and a
pharmaceutically acceptable carrier or diluent.
According to yet an additional aspect of the present invention
there is provided a pharmaceutical composition comprising a
therapeutically effective amount of a peptide selected from the
group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 12 and a
pharmaceutically acceptable carrier or diluent.
According to still an additional aspect of the present invention
there is provided a pharmaceutical composition comprising a
therapeutically effective amount of a peptide having an amino acid
sequence selected from thee group consisting of SEQ ID NOs: 2, 4,
6, 8, 10, and 12, the peptide being no more than 50 amino acid
residues in length, and a pharmaceutically acceptable carrier or
diluent.
According to a further aspect of the present invention there is
provided a method of promoting angiogenesis in a tissue of a
subject, the method comprising providing to the subject a
therapeutically effective amount of a peptide having an amino acid
sequence as set forth in SEQ ID NO:13, 27, 32 the peptide being at
least 6 and no more than 50 amino acid residues in length, to
thereby promote angiogenesis in the subject.
According to further features in preferred embodiments of the
invention described below, the peptide is selected from the group
consisting of SEQ ID NOs:2, 6, and 12.
According to still further features in the described preferred
embodiments the amino acid sequence is selected from the group
consisting of SEQ ID NOs:2, 6, and 12.
According to still further features in the described preferred
embodiments the peptide is a linear peptide or a cyclic
peptide.
According to yet a further aspect of the present invention there is
provided a method of promoting angiogenesis in a tissue of a
subject, the method comprising providing to the subject a
therapeutically effective amount of a peptide selected from the
group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 12, to thereby
promote angiogenesis in the subject.
According to still a further aspect of the present invention there
is provided a method of promoting angiogenesis in a tissue of a
subject, the method comprising providing to the subject a
therapeutically effective amount of a peptide having an amino acid
sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6,
8, 10, and 12, the peptide being no more than 50 amino acid
residues in length, to thereby promote angiogenesis in the
subject.
According to still further features in the described preferred
embodiments the subject suffers from arteriosclerosis, retinopathy,
remodeling disorder, von Hippel-Lindau syndrome, diabetes, and/or
hereditary hemorrhagic telengiectasia.
According to still a further aspect of the present invention there
is provided a nucleic acid construct comprising a polynucleotide
sequence encoding the peptide of the present invention.
According to still further features in the described preferred
embodiments the nucleic acid construct further comprises a
promoter.
According to still a further aspect of the present invention there
is provided a composition for targeting a drug to endothelial
cells, the composition comprising the drug fused to a peptide
having an amino acid sequence as set forth in SEQ ID NO:13, 27, or
32, the peptide being at least 6 and no more than 50 amino acid
residues in length.
According to still further features in the described preferred
embodiments the drug is selected from the group consisting of a
toxin, a chemotherapeutic agent, and a radioisotope.
According to still a further aspect of the present invention there
is provided a composition for targeting a drug to endothelial
cells, the composition comprising the drug fused to a peptide
selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10,
and 12.
According to still a further aspect of the present invention there
is provided a composition for targeting a drug to endothelial
cells, the composition comprising the drug fused to a peptide
having an amino acid sequence selected from the group consisting of
SEQ ID NOs: 2, 4, 6, 8, 10, and 12, the peptide being no more than
50 amino acid residues in length.
According to still a further aspect of the present invention there
is provided a method of identifying putative angiogenic molecules,
the method comprising: (a) providing endothelial cells having
peptides bound thereto, each of the peptides having an amino acid
sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6,
8, 10, and 12, the peptide being no more than 50 amino acid
residues in length; and (b) identifying a molecule capable of
displacing the peptides from the endothelial cells to thereby
identify putative angiogenic molecules.
The present invention successfully addresses the shortcomings of
the presently known configurations by providing peptides which are
capable of promoting angiogenesis and as such can be used to treat
angiogenesis-dependent diseases, such as ischemic vascular
diseases.
Unless otherwise defined, all technical and scientific terms used
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. In
case of conflict, the patent specification, including definitions,
will control. In addition, the materials, methods, and examples are
illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
The file of this patent contains at least one drawing executed in
color photograph. Copies of this patent with color photograph(s)
will be provided by the Patent and Trademark Office upon request
and payment of necessary fee.
The invention is herein described, by way of example only, with
reference to the accompanying drawings. With specific reference now
to the drawings in detail, it is stressed that the particulars
shown are by way of example and for purposes of illustrative
discussion of the preferred embodiments of the present invention
only, and are presented in the cause of providing what is believed
to be the most useful and readily understood description of the
principles and conceptual aspects of the invention. In this regard,
no attempt is made to show structural details of the invention in
more detail than is necessary for a fundamental understanding of
the invention, the description taken with the drawings making
apparent to those skilled in the art how the several forms of the
invention may be embodied in practice.
In the drawings:
FIGS. 1a-b are bar graphs depicting the binding of
peptide-presenting phages at a concentration of 10.sup.9 (FIG. 1a)
or 10.sup.10 (FIG. 1b) phage per well, to ECs under normoxic
conditions and following 3, 6, and 24 hours of hypoxia. The bars
represent the binding to ECs of 15 different peptide-presenting
phage (VL, LP, TR, ST, QF, NS, SP, YR, LT, HR, HY, SV, TP, NR, and
SA) and the control (NO, unmodified M13 phage) following a 2-hour
incubation. Absorbance at 450 nm, produced by anti-M13 HRP
antibody, which detects peptide-presenting phages attached to ECs
in the presence of tetramethyl benzidine liquid substrate, was
measured using an ELISA reader.
FIG. 2 is a bar graph depicting the effect of peptide-presenting
phages on ECs proliferation. Six peptide-presenting phages (VL, TR,
YR, QF, LT, SP) each at a concentration of 10.sup.6 were incubated
with ECs in serum free media for 24 hours. Data was obtained by
measuring radioactive [.sup.3H]-Thymidine uptake into ECs (cpm/min)
in the last 6 hours of incubation, and presented as a percent above
ECs proliferation induced by control phages (NO, unmodified M13
phages).
FIGS. 3a-b are bar graphs depicting the effect of direct activation
of peptide-presenting phages on ECs migration. The migration of ECs
was assayed in the presence of 10.sup.5 (FIG. 3a) or 10.sup.6 (FIG.
3b) peptide-presenting phages per well and was compared to negative
(ECs, or ECs in the presence of NO phages--unmodified M13 phages)
or positive (the angiogenic molecule--VEGF) control. The bars
compare ECs migration induced by 12 peptide-presenting phages (VL,
LP, QF, SP, TR, NS, SV, LA, LT, YR, TP and SA) following 5 hours of
incubation in migration chambers. Data was obtained by measuring
the fluorescent enhancement of the CyQuant GR dye molecular probe
bound to cellular nucleic acid of lysed migratory cells using the
Fluorescent ELISA reader at 480/520 nm and is expressed as Relative
Fluorescence Units (RFU).
FIGS. 4a-b are bar graphs depicting chemo-attraction of ECs by
peptide-presenting phages added to the feeder tray of the migration
chamber. Peptide-presenting phages were used at a concentration of
10.sup.5 (FIG. 4a) or 10.sup.6 (FIG. 4b) phages per well and were
compared to negative controls (ECs or ECs in the presence of NO
phages--unmodified M13 phages). The bars compare ECs
chemo-attraction induced by 12 peptide-presenting phages (VL, LP,
QF, SP, TR, NS, SV, LA, LT, YR, TP and SA) following 5 hours of
incubation in migration chamber. Data was obtained and presented as
described for FIGS. 3a-b, hereinabove.
FIG. 5 is a bar graph depicting the proliferation of ECs in
arterial rings in the presence of peptide-presenting phages
(10.sup.6) as compared with negative control (NO phage, unmodified
M13 phages) and positive control (the angiogenic molecule-FGF). The
bars compare ECs proliferation induced by six peptide-presenting
phages (SP, LT, YR, TR, VL, and QF) following 7 days incubation in
DMEM containing 10% FCS (37.degree. C. with 5% CO.sub.2). Data was
obtained by an XTT assay (O.D. 450 nm).
FIGS. 6a-i are graphs depicting the specific binding of synthetic
peptides to Peripheral Blood Lymphocytes (PBL, FIG. 6a) or ECs
(FIG. 6b-i). The graphs represent flow cytometry analysis of
100,000 cells incubated for 2 hours with 4 or 6 .mu.g of synthetic
peptides. FIGS. 6a-b are the results of flow cytometry analysis
presenting the gates chosen either for (FIG. 6a) peripheral blood
lymphocytes or for (FIG. 6b) endothelial cells analysis. The dots
represent the dispersion of FITC labeled cells, according to their
size (horizontal axis) versus their granulation (vertical axis).
FIGS. 6c-i are the results of flow cytometry analysis presenting
the percent binding to ECs and mean fluorescence of synthetic
peptides: FIG. 6c--no peptide; FIG. 6d--SP; FIG. 6e--QF; FIG.
6f--LT; FIG. 6g--YR; FIG. 6h--TR; FIG. 6i--VL. The graphs represent
flow cytometry analysis of 10.sup.6 ECs incubated for 2 hours with
4 .mu.g of synthetic peptides (green line), 6 .mu.g of synthetic
peptides (red line), or isotype control (black line).
FIG. 7 is a bar graph demonstrating binding of synthetic peptides
to PBL and ECs. The graph represents flow cytometry analysis of 5
.mu.g FITC labeled synthetic peptide (SP, YR, LT, VL, QF and TR)
bound to 100,000 PBLs and ECs. The bars compare mean fluorescence
(emitted by the labeled synthetic peptides following 2 hours
incubation with PBLs or ECs. Data was collected using FACS.
FIGS. 8a-b are graphs depicting the effect of synthetic peptides on
cells proliferation. FIG. 8a illustrates the proliferation of ECs
induced by LP, ST, TR, and VL at concentrations of 0.05, 0.1, 1,
10, and 100 ng/ml, following 24 hours incubation in EBM-2. FIG. 8b
illustrates the proliferation of MVECs induced by LT SP, or YR at
concentrations of 0.1, 1, 10, and 100 ng/ml following 24 hours
incubation in EBM-MV. Results are expressed as [.sup.3H]-Thymidine
uptake by cells incubated with peptides minus control (cells
incubated in EBM-2 and EBM-MV, respectively). Data was obtained by
measuring radioactive [.sup.3H]-Thymidine uptake into cells in a
scintillation .beta. counter by cpm/min in the last 6 hours of
incubation.
FIGS. 9a-c are graphs depicting the effect of the synthetic
peptides on ECs migration. FIG. 9a-c are graphs illustrating the
migration of ECs induced by LT (FIG. 9a), SP (FIG. 9b), or VL and
TR (FIG. 9c) at concentrations of 5, 10, 20 and 50 ng/ml following
5 hours of incubation in migration chamber. Data was obtained and
presented as described for FIGS. 3a-b, hereinabove.
FIG. 10 is a graph depicting the time dependent effect of peptide
incubation on ECs migration. The figure presents the migration of
ECs as induced by 1 ng/ml synthetic peptide (LT, QF, SP, TR, VL and
YR) following 5 and 15 hours of incubation in migration chamber.
Data was obtained and presented as described for FIGS. 3a-b,
hereinabove.
FIGS. 11a-b are graphs depicting effect of the synthetic peptides
on MVECs migration. The graphs are illustrating the migration of
MVECs (FIG. 11a) and migration activation of MVECs (FIG. 11b)
induced by LT, SP, YR, TR, VL, QF and FGF at concentrations of 1
and 10 ng/ml, following 5 hours of incubation in migration chamber.
Data was obtained and presented as described for FIGS. 3a-b,
hereinabove.
FIG. 12 is a graph depicting the effect of synthetic peptides on
arterial ring sprouting. The graph presents the proliferation of
ECs in arterial rings induced by four synthetic peptides (i.e., QF,
YR, LT and VL) at concentrations 1, 10, 100 and 1000 ng/ml
following 7 days incubation in DMEM containing 10% FCS (37.degree.
C. with 5% CO.sub.2). Data was obtained by estimation of cell
proliferation by an XTT assay (O.D. 450 mm).
FIGS. 13a-j are photomicrographs depicting the effect of the
peptides on cells tube formation. FIGS. 13a-e demonstrate MVEC tube
formation induced by 8 hours incubation of VEGF (FIG. 13b), YR
(FIG. 13c), QF (FIG. 13d), VL (FIG. 13e), as compared to untreated
control (FIG. 13a). Photos were taken after 8 incubation;
Magnification.times.100. FIGS. 13f-j demonstrate EC tube formation
induced by 20 hours incubation of FGF (FIG. 13g), YR (FIG. 13h), QF
(FIG. 13i), VL (FIG. 13j), as compared to untreated control (FIG.
13f).
FIGS. 14a-e are bar graphs depicting the effect of synthetic
peptides on gene expression of the following genes in MVECs: FIG.
14a--VEGF-A; FIG. 14b--VEGF-C; FIG. 14c--FLT-1; FIG. 14d--KDR; FIG.
14e--HEF-1.alpha.. The synthetic peptides (LT, QF, SP, TR, YR and
VL at concentration of 1 ng/ml) or VEGF (at concentration of 10
ng/ml) were added to the cells and gene expression was determined
using real-time PCR 1.5 and 6 hours following the peptide or VEGF
addition. Results are presented as net expression ratio of treated
cells as compared to untreated controls.
FIG. 15 is a bar graph demonstrating the intensity of synthetic
peptides binding to ECs exposed to the effect of hypoxia treatment
Flow cytometry analysis was effected on the binding of 6 .mu.g FITC
labeled synthetic peptide (LT, QF, SP, TR, VL and YR) to 10.sup.5
untreated ECs or ECs after hypoxia. The bars compare mean
fluorescence (488 nm) obtained after 2 hours incubation of the FITC
labeled synthetic peptides with ECs. Data was collected using
FACS.
FIGS. 16a-b are graphs depicting the intensity of synthetic
peptides binding to ECs exposed to the effect of hypoxia. The
graphs present flow cytometry analysis of 6 .mu.g FITC labeled SP
peptide (FIG. 16a) or LT peptide (FIG. 16b) to 10.sup.5 ECs
following 2 hours incubation. Red line--ECs without hypoxia; green
line--ECs after hypoxia; black line--isotype control.
FIGS. 17a-f are graphs depicting the effect of synthetic peptides
on cells proliferation. FIGS. 17a-c illustrate the proliferation of
HLUVECs induced by LT (FIG. 17a), SP (FIG. 17b), or QF (FIG. 17c)
at concentrations of 0.01, 1, 10, and 100 ng/ml, following 24 hours
incubation in EBM-2. FIGS. 10d-f illustrate the proliferation of
MVECs induced by LT (FIG. 17d), SP (FIG. 17e), or QF (FIG. 17f) at
concentrations of 0.01, 1, 10, and 100 ng/ml following 24 hours
incubation in EBM-MV. The plots compare the proliferation of cells
under normal conditions (control), under hypoxic conditions or
after hypoxic conditions. Data was obtained by measuring
radioactive [.sup.3H]-Thymidine uptake into cells in a
scintillation .beta. counter by cpm/min in the last 6 hours of
incubation.
FIGS. 18a-e are photomicrographs depicting the effect of SP on
HUVEC (FIGS. 18a-c) and MVEC (FIGS. 18d-e) tube formation under
hypoxic conditions. FIGS. 18a-c demonstrate EC tube formation
induced by 18 hours incubation with FGF (FIG. 18b), or SP (FIG.
18c) as compared to control (FIG. 18a). FIGS. 18d-e demonstrate
MVEC tube formation induced by 18 hours incubation with FGF (FIG.
18d), or SP (FIG. 18e). Photos were taken after 18 hours
incubation. Magnification.times.100.
FIGS. 19a-e are photomicrographs depicting the effect of synthetic
peptides on vascularization of mouse ears. The figures demonstrate
the vascularization as induced by subcutaneous injection of VEGF
(100 ng/mouse ear, FIG. 19a), LT (10 .mu.g/ear; FIG. 19b), YR (10
.mu.g/ear; FIG. 19c), QF (.mu.g/ear; FIG. 19d), or SP (FIG. 19e,
0.1 .mu.g/ear). Each injection was carried out in a final volume of
10 .mu.l, i.e., 10 .mu.g/10 .mu.l PBS, 0.1 .mu.g/10 .mu.l PBS or 10
.mu.l PBS (Control). Photos were taken 2 days following
injection.
FIGS. 20a-b are photomicrographs depicting the effect of TR peptide
on vascularization of mouse ear. Shown are histology sections
demonstrating vascularization and neo-vascularization induced by 10
.mu.g TR (FIG. 20b) as compared to control (FIG. 20a). Note,
injection of TR peptide reveals large blood vessel formation and
neovascularization as demonstrated by capillary blood vessels with
single erytbrocyte cell.
FIG. 21 is a bar graph depicting median flux of ischemic hind
limb/control in a rat ischemic hind limb model. The Figure presents
the ischemic hind limb blood flow measured at days 4, 7, 9 and 13.
Results are the mean of 4, 7 9, and 13 days after peptide
inoculation after 600 .mu.g of VL, LT, QF, TR, SP, YR, FGF or PBS
injection to the ischemic leg as compared to the other leg. Results
are expressed as OP/control .times.100 median flux (Percent median
flux of the operated leg versus non operated control leg). Data was
obtained at days 4, 7, 9, 13 using a Laser Doppler Blood Flow
analyzer.
FIGS. 22a-c illustrate the uncovering a conserved sequence motif
which is shared by the peptides of the present invention and the
mouse VEGF-B (Swiss-Prot Accession: VEGB_MOUSE). FIG. 22a--the
amino acid sequences of the peptides of the present invention; FIG.
22b--alignment of the amino acid sequences of VL, QF, YR and TR and
scanning by e-Motif uncovers a conserved motif "pw[il][de].y"; FIG.
22c--alignment of the amino acid sequences of VL, QF, YR and TR
with mouse VEGF-B.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of peptides, which can be used for
promoting tissue angiogenesis. Specifically, the present invention
can be used to treat angiogenesis-dependent diseases, such as
ischemic vascular diseases.
The principles and operation of the present invention may be better
understood with reference to the drawings and accompanying
descriptions.
Before explaining at least one embodiment of the invention in
detail, it is to be understood that the invention is not limited in
its application to the details set forth in the following
description or exemplified by the Examples. The invention is
capable of other embodiments or of being practiced or carried out
in various ways. Also, it is to be understood that the phraseology
and terminology employed herein is for the purpose of description
and should not be regarded as limiting.
Angiogenesis is the process of generating new capillary blood
vessels involving an interplay between cells and soluble factors
(1). The process is characterized by the migration of activated
endothelial cells that proliferate to form new vessels, which are
surrounded by layers of periendothelial cells, including pericytes
for small blood vessels and smooth muscle cells for large blood
vessels.
Angiogenesis-dependent diseases are a consequence of an imbalanced
angiogenic process resulting in an excessive amount of new blood
vessels or insufficient number of blood vessels. Insufficient
angigenesis is related to a large number of diseases and
conditions, such as coronary artery diseases and delayed wound
healing.
Therapeutic angiogenesis is aimed at stimulating new blood vessel
growth. The concept of such a therapy is based on the premise that
the inherent potential of vascularization in a vascular tissue can
be utilized to promote the development of new blood vessels under
the influence of the appropriate angiogenic molecules.
While reducing the present invention to practice, the present
inventors used a 12-mer phage display peptide library to uncover
peptides that are able to bind the cell-surface of endothelial
cells incubated under normoxic or hypoxic conditions.
As is illustrated in the Examples section which follows, the
peptides of the present invention triggered angiogenic reactions
including, endothelial cell-proliferation and migration, aortic
ring sprouting, tube formation and in-vivo vascularization. These
findings suggest that the peptides of the present invention can be
used in the treatment of various angiogenesis-dependent diseases,
such as ischemic-vascular diseases. Furthermore, characterization
of the nature of endothelial cell signaling by these peptides will
provide the basis for the development of targeted angiogenic
therapy for diseases, such as cardiovascular disease.
Thus, according to one aspect of the present invention there is
provided a peptide including an amino acid sequence as set forth in
SEQ ID NO: 2, 4, 6, 8, 10 or 12, the peptide is at least 6, at
least 7, at least 8, at least 9, at least 10, at least 11, at least
12, at least 13, at least 14, at least 15, at least 16, at least
17, at least 18, at least 19, at least 20, at least 21, at least
22, at least 23, at least 24, at least 25, at least 26, at least
27, at least 28, at least 29, at least 30, at least 31, at least
32, at least 33, at least 34, at least 35, at least 36, at least
37, at least 38, at least 39, at least 40, at least 41, at least
42, at least 43, at least 44, at least 45, at least 46, at least
47, at least 48, at least 49, and no more than 50 amino acid
residues in length.
According to another aspect of the present invention there is
provided a peptide including an amino acid sequence selected from
the group consisting of SEQ ID NOs: NO:13, 27 or 32, the peptide is
at least 6, at least 7, at least 8, at least 9, at least 10, at
least 11, at least 12, at least 13, at least 14, at least 15, at
least 16, at least 17, at least 18, at least 19, at least 20, at
least 21, at least 22, at least 23, at least 24, at least 25, at
least 26, at least 27, at least 28, at least 29, at least 30, at
least 31, at least 32, at least 33, at least 34, at least 35, at
least 36, at least 37, at least 38, at least 39, at least 40, at
least 41, at least 42, at least 43, at least 44, at least 45, at
least 46, at least 47, at least 48, at least 49, and no more than
50 amino acid residues in length.
As is shown in Example 6 of the Examples section, the peptides of
this aspect of the present invention share a conserved amino acid
sequence (SEQ ID NO:13, 27 or 32) with mammalian vascular
endothelial growth factor B (VEGF-B, SwissProt/TrEMBL Accession:
VEGB_MOUSE), thereby substantiating the angiogenic function
attributed to the peptides of this aspect of the present
invention.
Preferably, the peptide of the present invention includes the
sequence set forth by SEQ ID NO: 2, 6, 8 or 12, more preferably the
peptide of the present invention includes the sequence set forth by
SEQ ID NO:6 or 8.
According to another preferred embodiment of this aspect of the
present invention the amino acid sequence is as set forth in SEQ ID
NO: 2, 6, 8, or 12, preferably the amino acid sequence is as set
forth in SEQ ID NO:6 or 8.
The present invention also envisages the use of peptides containing
more than one consensus sequence as provided in SEQ ID NO:14.
According to yet another aspect of the present invention there is
provided a peptide including an amino acid sequence as set forth in
SEQ ID NO: 14, the peptide is at least 6, at least 7, at least 8,
at least 9, at least 10, at least 11, at least 12, at least 13, at
least 14, at least 15, at least 16, at least 17, at least 18, at
least 19, at least 20, at least 21, at least 22, at least 23, at
least 24, at least 25, at least 26, at least 27, at least 28, at
least 29, at least 30, at least 31, at least 32, at least 33, at
least 34, at least 35, at least 36, at least 37, at least 38, at
least 39, at least 40, at least 41, at least 42, at least 43, at
least 44, at least 45, at least 46, at least 47, at least 48, at
least 49, and no more than 50 amino acid residues in length.
The term "peptide" as used herein encompasses native peptides
(either degradation products, synthetically synthesized peptides or
recombinant peptides) and peptidomimetics (typically, synthetically
synthesized peptides), as well as peptoids and semipeptoids which
are peptide analogs, which may have, for example, modifications
rendering the peptides more stable while in a body or more capable
of penetrating into cells. Such modifications include, but are not
limited to N terminus modification, C terminus modification,
peptide bond modification, including, but not limited to, CH2--NH,
CH2--S, CH2--S.dbd.O, O.dbd.C--NH, CH2--O, CH2--CH2, S.dbd.C--NH,
CH.dbd.CH or CF.dbd.CH, backbone modifications, and residue
modification. Methods for preparing peptidomnimetic compounds are
well known in the art and are specified, for example, in
Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F.
Choplin Pergamon Press (1992), which is incorporated by reference
as if fully set forth herein.
Further details in this respect are provided hereinunder. Peptide
bonds (--CO--NH--) within the peptide may be substituted, for
example, by N-methylated bonds (--N(CH.sub.3)--CO--), ester bonds
(--C(R)H--C--O--O--C(R)--N--), ketomethylen bonds (--CO--CH2--),
.alpha.-aza bonds (--NH--N(R)--CO--), wherein R is any alkyl, e.g.,
methyl, carba bonds (--CH2--NH--), hydroxyethylene bonds
(--CH(OH)--CH2--), thioamide bonds (--CS--NH--), olefinic double
bonds (--CH.dbd.CH--), retro amide bonds (--NH--CO--), peptide
derivatives (--N(R)--CH2--CO--), wherein R is the "normal" side
chain, naturally presented on the carbon atom.
These modifications can occur at any of the bonds along the peptide
chain and even at several (2-3) at the same time.
Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted
for synthetic non-natural acid, such as Phenylglycine, TIC,
naphthylelanine (Nol), ring-methylated derivatives of Phe,
halogenated derivatives of Phe or o-methyl-Tyr.
In addition to the above, the peptides of the present invention may
also include one or more modified amino acids or one or more
non-amino acid monomers (e.g. fatty acids, complex carbohydrates
etc).
As used herein in the specification and in the claims section below
the term "amino acid" or "amino acids" is understood to include the
20 naturally occurring amino acids; those amino acids often
modified post-translationally in vivo, including, for example,
hydroxyproline, phosphoserine and phosphothreonine; and other
unusual amino acids including, but not limited to, 2-aminoadipic
acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and
ornithine. Furthermore, the term "amino acid" includes both D- and
L-amino acids.
Tables 1 and 2 below list naturally occurring amino acids (Table 1)
and non-conventional or modified amino acids (e.g., synthetic,
Table 2) which can be used with the present invention.
TABLE-US-00001 TABLE 1 Three-Letter One-letter Amino Acid
Abbreviation Symbol alanine Ala A Arginine Arg R Asparagine Asn N
Aspartic acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic Acid
Glu E glycine Gly G Histidine His H isoleucine Iie I leucine Leu L
Lysine Lys K Methionine Met M phenylalanine Phe F Proline Pro P
Serine Ser S Threonine Thr T tryptophan Trp W tyrosine Tyr Y Valine
Val V Any amino acid as above Xaa X
TABLE-US-00002 TABLE 2 Non-conventional amino acid Code
.alpha.-aminobutyric acid Abu .alpha.-amino-.alpha.-methylbutyrate
Mgabu aminocyclopropane- Cpro carboxylate aminoisobutyric acid Aib
aminonorbornyl- Norb carboxylate cyclohexylalanine Chexa
cyclopentylalanine Cpen D-alanine Dal D-arginine Darg D-aspartic
acid Dasp D-cysteine Dcys D-glutamine Dgln D-glutamic acid Dglu
D-histidine Dhis D-isoleucine Dile D-leucine Dleu D-lysine Dlys
D-methionine Dmet D-ornithine Dorn D-phenylalanine Dphe D-proline
Dpro D-serine Dser D-threonine Dthr D-tryptophan Dtrp D-tyrosine
Dtyr D-valine Dval D-.alpha.-methylalanine Dmala
D-.alpha.-methylarginine Dmarg D-.alpha.-methylasparagine Dmasn
D-.alpha.-methylaspartate Dmasp D-.alpha.-methylcysteine Dmcys
D-.alpha.-methylglutamine Dmgln D-.alpha.-methylhistidine Dmhis
D-.alpha.-methylisoleucine Dmile D-.alpha.-methylleucine Dmleu
D-.alpha.-methyllysine Dmlys D-.alpha.-methylmethionine Dmmet
D-.alpha.-methylornithine Dmorn D-.alpha.-methylphenylalanine Dmphe
D-.alpha.-methylproline Dmpro D-.alpha.-methylserine Dmser
D-.alpha.-methylthreonine Dmthr D-.alpha.-methyltryptophan Dmtrp
D-.alpha.-methyltyrosine Dmty D-.alpha.-methylvaline Dmval
D-.alpha.-methylalnine Dnmala D-.alpha.-methylarginine Dnmarg
D-.alpha.-methylasparagine Dnmasn D-.alpha.-methylasparatate Dnmasp
D-.alpha.-methylcysteine Dnmcys D-N-methylleucine Dnmleu
D-N-methyllysine Dnmlys N-methylcyclohexylalanine Nmchexa
D-N-methylornithine Dnmorn N-methylglycine Nala
N-methylaminoisobutyrate Nmaib N-(1-methylpropyl)glycine Nile
N-(2-methylpropyl)glycine Nile N-(2-methylpropyl)glycine Nleu
D-N-methyltryptophan Dnmtrp D-N-methyltyrosine Dnmtyr
D-N-methylvaline Dnmval .gamma.-aminobutyric acid Gabu
L-t-butylglycine Tbug L-ethylglycine Etg L-homophenylalanine Hphe
L-.alpha.-methylarginine Marg L-.alpha.-methylaspartate Masp
L-.alpha.-methylcysteine Mcys L-.alpha.-methylglutamine Mgln
L-.alpha.-methylhistidine Mhis L-.alpha.-methylisoleucine Mile
D-N-methylglutamine Dnmgln D-N-methylglutamate Dnmglu
D-N-methylhistidine Dnmhis D-N-methylisoleucine Dnmile
D-N-methylleucine Dnmleu D-N-methyllysine Dnmlys
N-methylcyclohexylalanine Nmchexa D-N-methylornithine Dnmorn
N-methylglycine Nala N-methylaminoisobutyrate Nmaib
N-(1-methylpropyl)glycine Nile N-(2-methylpropyl)glycine Nleu
D-N-methyltryptophan Dnmtrp D-N-methyltyrosine Dnmtyr
D-N-methylvaline Dnmval .gamma.-aminobutyric acid Gabu
L-t-butylglycine Tbug L-ethylglycine Etg L-homophenylalanine Hphe
L-.alpha.-methylarginine Marg L-.alpha.-methylaspartate Masp
L-.alpha.-methylcysteine Mcys L-.alpha.-methylglutamine Mgln
L-.alpha.-methylhistidine Mhis L-.alpha.-methylisoleucine Mile
L-.alpha.-methylleucine Mleu L-.alpha.-methylmethionine Mmet
L-.alpha.-methylnorvaline Mnva L-.alpha.-methylphenylalanine Mphe
L-.alpha.-methylserine mser L-.alpha.-methylvaline Mtrp
L-.alpha.-methylleucine Mval Nnbhm N-(N-(2,2-diphenylethyl)
carbamylmethyl-glycine Nnbhm 1-carboxy-1-(2,2-diphenyl Nmbc
ethylamino)cyclopropane L-N-methylalanine Nmala L-N-methylarginine
Nmarg L-N-methylasparagine Nmasn L-N-methylaspartic acid Nmasp
L-N-methylcysteine Nmcys L-N-methylglutamine Nmgin
L-N-methylglutamic acid Nmglu L-N-methylhistidine Nmhis
L-N-methylisolleucine Nmile L-N-methylleucine Nmleu
L-N-methyllysine Nmlys L-N-methylmethionine Nmmet
L-N-methylnorleucine Nmnle L-N-methylnorvaline Nmnva
L-N-methylornithine Nmorn L-N-methylphenylalanine Nmphe
L-N-methylproline Nmpro L-N-methylserine Nmser L-N-methylthreonine
Nmthr L-N-methyltryptophan Nmtrp L-N-methyltyrosine Nmtyr
L-N-methylvaline Nmval L-N-methylethylglycine Nmetg
L-N-methyl-t-butylglycine Nmtbug L-norleucine Nle L-norvaline Nva
.alpha.-methyl-aminoisobutyrate Maib
.alpha.-methyl-.gamma.-aminobutyrate Mgabu
.alpha.-methylcyclohexylalanine Mchexa
.alpha.-methylcyclopentylalanine Mcpen
.alpha.-methyl-.alpha.-napthylalanine Manap
.alpha.-methylpenicillamine Mpen N-(4-aminobutyl)glycine Nglu
N-(2-aminoethyl)glycine Naeg N-(3-aminopropyl)glycine Norn
N-amino-.alpha.-methylbutyrate Nmaabu .alpha.-napthylalanine Anap
N-benzylglycine Nphe N-(2-carbamylethyl)glycine Ngln
N-(carbamylmethyl)glycine Nasn N-(2-carboxyethyl)glycine Nglu
N-(carboxymethyl)glycine Nasp N-cyclobutylglycine Ncbut
N-cycloheptylglycine Nchep N-cyclohexylglycine Nchex
N-cyclodecylglycine Ncdec N-cyclododeclglycine Ncdod
N-cyclooctylglycine Ncoct N-cyclopropylglycine Ncpro
N-cycloundecylglycine Ncund N-(2,2-diphenylethyl)glycine Nbhm
N-(3,3-diphenylpropyl)glycine Nbhe N-(3-indolylyethyl) glycine
Nhtrp N-methyl-.gamma.-aminobutyrate Nmgabu D-N-methylmethionine
Dnmmet N-methylcyclopentylalanine Nmcpen D-N-methylphenylalanine
Dnmphe D-N-methylproline Dnmpro D-N-methylserine Dnmser
D-N-methylserine Dnmser D-N-methylthreonine Dnmthr
N-(1-methylethyl)glycine Nva N-methyla-napthylalanine Nmanap
N-methylpenicillamine Nmpen N-(p-hydroxyphenyl)glycine Nhtyr
N-(thiomethyl)glycine Ncys penicillamine Pen
L-.alpha.-methylalanine Mala L-.alpha.-methylasparagine Masn
L-.alpha.-methyl-t-butylglycine Mtbug L-methylethylglycine Metg
L-.alpha.-methylglutamate Mglu L-.alpha.-methylhomo phenylalanine
Mhphe N-(2-methylthioethyl)glycine Nmet
N-(3-guanidinopropyl)glycine Narg N-(1-hydroxyethyl)glycine Nthr
N-(hydroxyethyl)glycine Nser N-(imidazolylethyl)glycine Nhis
N-(3-indolylyethyl)glycine Nhtrp N-methyl-.gamma.-aminobutyrate
Nmgabu D-N-methylmethionine Dnmmet N-methylcyclopentylalanine
Nmcpen D-N-methylphenylalanine Dnmphe D-N-methylproline Dnmpro
D-N-methylserine Dnmser D-N-methylthreonine Dnmthr
N-(1-methylethyl)glycine Nval N-methyla-napthylalanine Nmanap
N-methylpenicillamine Nmpen N-(p-hydroxyphenyl)glycine Nhtyr
N-(thiomethyl)glycine Ncys penicillamine Pen
L-.alpha.-methylalanine Mala L-.alpha.-methylasparagine Masn
L-.alpha.-methyl-t-butylglycine Mtbug L-methylethylglycine Metg
L-.alpha.-methylglutamate Mglu L-.alpha.-methylhomophenylalanine
Mhphe N-(2-methylthioethyl)glycine Nmet L-.alpha.-methyllysine Mlys
L-.alpha.-methylnorleucine Mnle L-.alpha.-methylornithine Morn
L-.alpha.-methylproline Mpro L-.alpha.-methylthreonine Mthr
L-.alpha.-methyltyrosine Mtyr L-N-methylhomophenylalanine Nmhphe
N-(N-(3,3-diphenylpropyl) carbamylmethyl(1)glycine Nnbhe
The peptides of the present invention are preferably utilized in a
linear form although it will be appreciated that in cases where
cyclization does not severely interfere with peptide
characteristics, cyclic forms of the peptide can also be utilized.
Cyclic peptides can either be synthesized in a cyclic form or
configured so as to assume a cyclic form under desired conditions
(e.g., physiological conditions).
It will be appreciated that since one of the main obstacles in
using short peptide fragments in therapy is their proteolytic
degradation by stereospecific cellular proteases, the peptides of
the present invention are preferably synthesized from D-isomers of
natural amino acids [i.e., inverso peptide analogues, Tjernberg
(1997) J. Biol. Chem. 272; 12601-5, Gazit (2002) Curr. Med. Chem.
9:1667-1675].
Additionally, the peptides of the present invention include retro,
inverso, and retro-inverso analogues thereof. It will be
appreciated that complete or extended partial retro-inverso
analogues of hormones have generally been found to retain or
enhance biological activity. Retro-inversion has also found
application in the area of rational design of enzyme inhibitors
(see U.S. Pat. No. 6,261,569).
As used herein a "retro peptide" refers to peptides that are made
up of L-amino acid residues which are assembled in opposite
direction to the native peptide sequence.
Retro-inverso modification of naturally occurring polypeptides
involves the synthetic assembly of amino acids with .alpha.-carbon
stereochemistry opposite to that of the corresponding L-amino
acids, i.e., D- or D-allo-amino acids in inverse order to the
native peptide sequence. A rerto inverso analogue, thus, has
reversed termini and reversed direction of peptide bonds, while
essentially maintaining the topology of the side chains as in the
native peptide sequence.
It will be appreciated that incorporation of any of the
above-mentioned amino acid modifications including conserved
changes in amino acid residues of the peptides of the present
invention can be effected, as long as the angiogenic function
(e.g., endothelial cell proliferation, migration, vascular
sprouting, vascularization) of the peptides of the present
invention is retained. To test this, any of the angiogenesis assays
described hereinbelow and in the Examples section which follows can
be effected.
The peptides of present invention can be biochemically synthesized,
such as by using standard solid phase techniques. These methods
include exclusive solid phase synthesis, partial solid phase
synthesis methods, fragment condensation, classical solution
synthesis. These methods are preferably utilized when the peptide
is relatively short (i.e., 10 kDa) and/or when it cannot be
produced by recombinant techniques (i.e., not encoded by a nucleic
acid sequence) and therefore involves different chemistry.
Solid phase peptide synthesis procedures are well known in the art
and further described by John Morrow Stewart and Janis Dillaha
Young, Solid Phase Peptide Syntheses (2nd Ed., Pierce Chemical
Company, 1984).
Synthetic peptides can be purified by preparative high performance
liquid chromatography [Creighton T. (1983); Proteins, structures
and molecular principles. WH Freeman and Co. N.Y.] and the
composition of which can be confirmed via amino acid
sequencing.
Recombinant techniques are preferably used when large amounts of
the peptides are required. Such recombinant techniques are
described by Bitter et al., (1987) Methods in Enzymol. 153:516-544,
Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al.
(1984) Nature 310:511-514, Takamatsu et al. (1987) EMBO J.
6:307-311, Coruzzi et al. (1984) EMBO J. 3:1671-1680 and Brogli et
al., (1984) Science 224:838-843, Gurley et al. (1986) Mol. Cell.
Biol. 6:559-565 and Weissbach & Weissbach, 1988, Methods for
Plant Molecular Biology, Academic Press, NY, Section VIII, pp
421-463.
To produce a peptide of the present invention using recombinant
technology, a polynucleotide encoding a peptide of the present
invention (e.g., SEQ ID NO: 1, 3, 5, 7, 9 or 11) is ligated into a
nucleic acid expression construct, which includes the
polynucleotide sequence under the transcriptional control of a
promoter sequence suitable for directing constitutive tissue
specific or inducible transcription in the host cells, as further
described hereinbelow.
Other then containing the necessary elements for the transcription
and translation of the inserted coding sequence, the expression
construct of the present invention can also include sequences
engineered to enhance stability, production, purification, yield or
toxicity of the expressed polypeptide. Such a fusion protein can be
designed so that the fusion protein can be readily isolated by
affinity chromatography, e.g., by immobilization on a column
specific for the heterologous protein. Where a cleavage site is
engineered between the peptide moiety and the heterologous protein,
the peptide can be released from the chromatographic column by
treatment with an appropriate enzyme or agent that disrupts the
cleavage site [e.g., see Booth et al. (1988) Immunol. Lett
19:65-70; and Gardella et al., (1990) J. Biol. Chem.
265:15854-15859].
A variety of prokaryotic or eukaryotic cells can be used as
host-expression systems to express the peptide coding sequence.
These include, but are not limited to, microorganisms, such as
bacteria transformed with a recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vector containing the peptide coding
sequence; yeast transformed with recombinant yeast expression
vectors containing the peptide coding sequence; plant cell systems
infected with recombinant virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors, such as Ti
plasmid, containing the peptide coding sequence. Mammalian
expression systems can also be used to express the peptides of the
present invention. Bacterial systems are preferably used to produce
recombinant peptides, according to the present invention, thereby
enabling a high production volume at low cost.
Other expression systems, such as insects and mammalian host cell
systems, which are well known in the art, can also be used by the
present invention.
In any case, transformed cells are cultured under effective
conditions, which allow for the expression of high amounts of
recombinant peptides. Effective culture conditions include, but are
not limited to, effective media, bioreactor, temperature, pH and
oxygen conditions that permit protein production. An effective
medium refers to any medium in which a cell is cultured to produce
the recombinant peptides of the present invention. Such a medium
typically includes an aqueous solution having assimilable carbon,
nitrogen and phosphate sources, and appropriate salts, minerals,
metals and other nutrients, such as vitamins. Cells of the present
invention can be cultured in conventional fermentation bioreactors,
shake flasks, test tubes, microtiter dishes, and petri plates.
Culturing can be carried out at a temperature, pH and oxygen
content appropriate for a recombinant cell. Such culturing
conditions are within the expertise of one of ordinary skill in the
art.
Depending on the vector and host system used for production,
resultant proteins of the present invention may either remain
within the recombinant cell; be secreted into the fermentation
medium; be secreted into a space between two cellular membranes,
such as the periplasmic space in E. coli; or be retained on the
outer surface of a cell or viral membrane.
Following a certain time in culture, recovery of the recombinant
protein is effected. The phrase "recovering the recombinant
protein" refers to collecting the whole fermentation medium
containing the protein and need not imply additional steps of
separation or purification. Proteins of the present invention can
be purified using a variety of standard protein purification
techniques, such as, but not limited to, affinity chromatography,
ion exchange chromatography, filtration, electrophoresis,
hydrophobic interaction chromatography, gel filtration
chromatography, reverse phase chromatography, concanavalin A
chromatography, chromatofocusing and differential
solubilization.
The peptides of the present invention are preferably retrieved in
"substantially pure" form. As used herein, "substantially pure"
refers to a purity that allows for the effective use of the protein
in the diverse applications, described herein
As mentioned hereinabove, the peptides of the present invention can
be used to promote angiogenesis (i.e., vascularization) in a tissue
of a subject even under hypoxic conditions.
As used herein the term "subject" refers to a mammal, such as a
canine, a feline, a bovine, a porcine, an equine. Preferably, the
subject of the present invention is human.
The subject of this aspect of the present invention may suffer from
an angiogenesis-dependent disease or disorder. Examples include,
but are not limited to delayed wound-healing, delayed ulcer
healing, reproduction associated disorders, arteriosclerosis,
myocardial ischemia, peripheral ischemia, cerebral ischemia,
retinopathy, remodeling disorder, von Hippel-Lindau syndrome,
diabetes and hereditary hemorrhagic telengiectasia.
It will be appreciated that the peptides of the present invention
can also be expressed from a nucleic acid construct administered to
the subject employing any suitable mode of administration,
described hereinabove (i.e., in-vivo gene therapy). Alternatively,
the nucleic acid construct is introduced into a suitable cell via
an appropriate gene delivery vehicle/method (transfection,
transduction, homologous recombination, etc.) and an expression
system as needed and then the modified cells are expanded in
culture and returned to the individual (i.e., ex-vivo gene
therapy). However, to enable secretion of the peptides of the
present invention the polynucleotides encoding thereof (e.g., SEQ
ID NO: 1, 3, 5, 7, 9 or 11) preferably further include a
polynucleotide sequence which encodes an in-frame signal peptide
(e.g., the signal peptide of human VEGF-B Swiss-Prot/TrEMBL
Accession VEGB_HUMAN).
To enable cellular expression of the peptides of the present
invention, the nucleic acid construct of the present invention
further includes at least one cis acting regulatory element As used
herein, the pbrase "cis acting regulatory element" refers to a
polynucleotide sequence, preferably a promoter, which binds a trans
acting regulator and regulates the transcription of a coding
sequence located downstream thereto.
Any available promoter can be used by the present methodology. In a
preferred embodiment of the present invention, the promoter
utilized by the nucleic acid construct of the present invention is
active in the specific cell population transformed. Examples of
cell type-specific and/or tissue-specific promoters include
promoters, such as albumin that is liver specific [Pinkert et al,
(1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame
et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters
of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and
immunoglobulins; [Baneji et al (1983) Cell 33729-740],
neuron-specific promoters, such as the neurofilament promoter
[Byrne et al (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477],
pancreas-specific promoters [Edlunch et al. (1985) Science
230:912-916] or mammary gland-specific promoters, such as the milk
whey promoter (U.S. Pat. No. 4,873,316 and European Application
Publication No. 264,166). The nucleic acid construct of the present
invention can further include an enhancer, which can be adjacent or
distant to the promoter sequence and can function in up regulating
the transcription therefrom.
The nucleic acid construct of the present methodology preferably
further includes an appropriate selectable marker and/or an origin
of replication. Preferably, the construct utilized is a shuttle
vector, which can propagate both in E. coli (wherein the construct
comprises an appropriate selectable marker and origin of
replication) and be compatible for propagation in cells, or
integration in a gene and a tissue of choice. The construct
according to the present invention can be, for example, a plasmid,
a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial
chromosome.
Currently preferred in vivo nucleic acid transfer techniques
include transfection with viral or non-viral constructs, such as
adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated
virus (AAV) and lipid-based systems. Useful lipids for
lipid-mediated transfer of the gene are, for example, DOTMA, DOPE,
and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1): 54-65
(1996)]. The most preferred constructs for use in gene therapy are
viruses, most preferably adenoviruses, AAV, lentiviruses, or
retrbviruses. A viral construct, such as a retroviral construct
includes at least one transcriptional promoter/enhancer or
locus-defining element(s), or other elements that control gene
expression by other means, such as alternate splicing, nuclear RNA
export, or post-translational modification of messenger. Such
vector constructs also include a packaging signal, long terminal
repeats (LTRs) or portions thereof; and positive and negative
strand primer binding sites appropriate to the virus used, unless
it is already present in the viral construct. In addition, such a
construct typically includes a signal sequence for secretion of the
peptide or antibody from a host cell in which it is placed.
Preferably the signal sequence for this purpose is a mammalian
signal sequence. Optionally, the construct may also include a
signal that directs polyadenylation, as well as one or more
restriction sites and a translation termination sequence. By way of
example, such constructs will typically include a 5' LTR, a tRNA
binding site, a packaging signal, an origin of second-strand DNA
synthesis, and a 3' LTR or a portion thereof. Other vectors can be
used that are non-viral, such as cationic lipids, polylysine, and
dendrimers.
The peptides or the nucleic acid construct encoding same of the
present invention can be provided to an individual per se, or as
part of a pharmaceutical composition where one peptide or more is
mixed with a pharmaceutically acceptable carrier.
As used herein a "pharmaceutical composition" refers to a
preparation of one or more of the active ingredients described
herein with other chemical components, such as physiologically
suitable carriers and excipients. The purpose of a pharmaceutical
composition is to facilitate administration of a compound to an
organisnm.
Herein the term "active ingredient" refers to the peptide
preparation or the nucleic acid construct encoding same, which is
accountable for the biological effect.
Hereinafter, the phrases "physiologically acceptable carrier" and
"pharmaceutically acceptable carrier" which may be interchangeably
used refer to a carrier or a diluent that does not cause
significant irritation to an organism and does not abrogate the
biological activity and properties of the administered compound. An
adjuvant is included under these phrases. One of the ingredients
included in the pharmaceutically acceptable carrier can be for
example polyethylene glycol (PEG), a biocompatlble polymer with a
wide range of solubility in both organic and aqueous media (Mutter
et al. (1979).
Herein the term "excipient" refers to an inert substance added to a
pharmaceutical composition to further facilitate administration of
an active ingredient. Examples, without limitation, of excipients
include calcium carbonate, calcium phosphate, various sugars and
types of starch, cellulose derivatives, gelatin, vegetable oils and
polyethylene glycols.
Techniques for formulation and administration of drugs may be found
in "Remington's Pharmaceutical Sciences," Mack Publishing Co.,
Easton, Pa., latest edition, which is incorporated herein by
reference.
Suitable routes of administration may, for example, include oral,
rectal, transmucosal, especially transnasal, intestinal or
parenteral delivery, including intramuscular, subcutaneous and
intramedulary injections as well as intrathecal, direct
intraventricular, intravenous, inrtaperitoneal, intranasal, or
intraocular injections.
Alternately, one may administer a preparation in a local rather
than systemic manner, for example, via injection of the preparation
directly into a specific region of a patient's body.
Pharmaceutical compositions of the present invention may be
manufactured by processes well known in the art, e.g., by means of
conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or lyophilizing
processes.
Pharmaceutical compositions for use in accordance with the present
invention may be formulated in conventional manner using one or
more physiologically acceptable carriers comprising excipients and
auxiliaries, which facilitate processing of the active ingredients
into preparations which, can be used pharmaceutically. Proper
formulation is dependent upon the route of administration
chosen.
For injection, the active ingredients of the invention may be
formulated in aqueous solutions, preferably in physiologically
compatible buffers, such as Hank's solution, Ringer's solution, or
physiological salt buffer. For transmucosal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the
art.
For oral administration, the compounds can be formulated readily by
combining the active compounds with pharmaceutically acceptable
carriers well known in the art. Such carriers enable the compounds
of the invention to be formulated as tablets, pills, dragees,
capsules, liquids, gels, syrups, slurries, suspensions, and the
like, for oral ingestion by a patient. Pharmacological preparations
for oral use can be made using a solid excipient, optionally
grinding the resulting mixture, and processing the mixture of
granules, after adding suitable auxiliaries if desired, to obtain
tablets or dragee cores. Suitable excipients are, in particular,
fillers, such as sugars, including lactose, sucrose, mannitol, or
sorbitol; cellulose preparations, such as, for example, maize
starch, wheat starch, rice starch, potato starch, gelatin, gum
tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium
carbomethylcellulose; and/or physiologically acceptable polymers,
such as polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as cross-linked polyvinyl pyrrolidone,
agar, or alginic acid or a salt thereof, such as sodium
alginate.
Dragee cores are provided with suitable coatings. For this purpose,
concentrated sugar solutions may be used which may optionally
contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel,
polyethylene glycol, titanium dioxide, lacquer solutions and
suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may be added to the tablets or dragee coatings for
identification or to characterize different combinations of active
compound doses.
Pharmaceutical compositions, which can be used orally, include
push-fit capsules made of gelatin as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules may contain the active ingredients in
admixture with filler, such as lactose, binders, such as starches,
lubricants, such as talc or magnesium stearate and, optionally,
stabilizers. In soft capsules, the active ingredients may be
dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for the chosen route of
administration.
For buccal administration, the compositions may take the form of
tablets or lozenges formulated in conventional manner.
For administration by nasal inhalation, the active ingredients for
use according to the present invention are conveniently delivered
in the form of an aerosol spray presentation from a pressurized
pack or a nebulizer with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane or carbon dioxide. In the case of a
pressurized aerosol, the dosage unit may be determined by providing
a valve to deliver a metered amount. Capsules and cartridges of;
e.g., gelatin for use in a dispenser may be formulated containing a
powder mix of the compound and a suitable powder base, such as
lactose or starch
The preparations described herein may be formulated for parenteral
administration, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multidose containers with optionally, an
added preservative. The compositions may be suspensions, solutions
or emulsions in oily or aqueous vehicles, and may contain
formulatory agents, such as suspending, stabilizing and/or
dispersing agents.
Pharmaceutical compositions for parenteral administration include
aqueous solutions of the active preparation in water-soluble form.
Additionally, suspensions of the active ingredients may be prepared
as appropriate oily or water based injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils, such as sesame
oil, or synthetic fatty acids esters, such as ethyl oleate,
triglycerides or liposomes. Aqueous injection suspensions may
contain substances, which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the active ingredients to
allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for
constitution with a suitable vehicle, e.g., sterile, pyrogen-free
water based solution, before use.
The preparation of the present invention may also be formulated in
rectal compositions, such as suppositories or retention enemas,
using, e.g., conventional suppository bases, such as cocoa butter
or other glycerides.
Pharmaceutical compositions suitable for use in context of the
present invention include compositions wherein the active
ingredients are contained in an amount effective to achieve the
intended purpose. More specifically, a therapeutically effective
amount means an amount of active ingredients effective to prevent,
alleviate or ameliorate symptoms of disease or prolong the survival
of the subject being treated.
Determination of a therapeutically effective amount is well within
the capability of those skilled in the art.
For any preparation used in the methods of the invention, the
therapeutically effective amount or dose can be estimated initially
from in vitro assays. For example, a dose can be formulated in
animal models and such information can be used to more accurately
determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients
described herein can be determined by standard pharmaceutical
procedures in vitro, in cell cultures or experimental animals. The
data obtained from these in vitro and cell culture assays and
animal studies can be used in formulating a range of dosage for use
in human. The dosage may vary depending upon the dosage form
employed and the route of administration utilized. The exact
formulation, route of administration and dosage can be chosen by
the individual physician in view of the patient's condition. [See
e.g., Fingl, et al., (1975) "The Pharmacological Basis of
Therapeutics", Ch. 1 p.1].
Depending on the severity and responsiveness of the condition to be
treated, dosing can be of a single or a plurality of
administrations, with course of treatment lasting from several days
to several weeks or until cure is effected or diminution of the
disease state is achieved.
The amount of a composition to be administered will, of course, be
dependent on the subject being treated, the severity of the
affliction, the manner of administration, the judgment of the
prescribing physician, etc.
Compositions including the preparation of the present invention
formulated in a compatible pharmaceutical carrier may also be
prepared, placed in an appropriate container, and labeled for
treatment of an indicated condition.
Compositions of the present invention may, if desired, be presented
in a pack or dispenser device, such as an FDA approved kit, which
may contain one or more unit dosage forms containing the active
ingredient. The pack may, for example, comprise metal or plastic
foil, such as a blister pack. The pack or dispenser device may be
accompanied by instructions for administration. The pack or
dispenser may also be accommodated by a notice associated with the
container in a form prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceuticals, which notice is
reflective of approval by the agency of the form of the
compositions or human or veterinary administration. Such notice,
for example, may be of labeling approved by the U.S. Food and Drug
Administration for prescription drugs or of an approved product
insert.
Due to their selective binding to endothelial cells, the peptides
of the present invention can be used to target agents fused thereto
to ECs and thus can also be used for treating, i.e., curing,
preventing or substantially reducing symptoms of
angiogenesis-dependent diseases which are characterized by
hyper-vascularization. For example, such fusions which include
drugs can be used to inhibit tumor growth by destruction of the
tumor vasculature.
Examples of drugs which can be included in such compositions
include, but are not limited to, toxins, such as enzymatically
active toxins of bacterial, fungal, plant, or animal origin, or
fragments thereof [e.g., diphteria toxin, exotoxin A chain of
Pseudomonas aeruginosa, ricin A chain, abrin A chain, modeccin A
chain, .alpha.-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin, and the tricothecenes], radioisotopes (e.g.,
.sup.125I, .sup.131I, .sup.90Y, .sup.212Bi .sup.198Re) and
chemotherapeutic agents (e.g., alkylating agents, folic acid
antagonists, anti-metabolites of nucleic acid metabolism,
antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine
nucleosides, amines, amino acids, triazol nucleosides, or
corticosteroids. Specific examples include, Adriamycin,
Doxorubicin, 5-Fluorouracil, Cytosine arabinoside (i.e., Ara-C),
Cyclophosphamide, Thiotepa, Busulfan, Cytoxin, Taxol, Toxotere,
Methotrexate, Cisplatin, Melphalan, Vinblastine, Bleomycin,
Etoposide, Ifosfamide, Mitomycin C, Mitoxantrone, Vincreistine,
Vinorelbine, Carboplatin, Teniposide, Daunomycin, Carminomycin,
Aminopterin, Dactinomycin, Mitomycins, Esperamicins (see U.S. Pat.
No. 4,675,187), Melphalan, and other related nitrogen mustards.
Also included in this definition are hormonal agents that act to
regulate or inhibit hormone action on tumors, such as tamoxifen and
onapristone.
Fusions between the peptides of the present invention and drugs can
be generated using a variety of bifunctional protein-coupling
agents, such as N-succinimidyl-3-(2-pyridyldithiol) propionate
(SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters
(such as dimethyl adipimidate HCL), active esters (such as
disuccinimidyl suberate), aldehydes (such as glutareldehyde),
bisazido compounds (such as bis-(p-azidobenzoyl)hexanediamine),
bis-diazonium derivatives (such as
bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as
tolyene 2,6-diisocyanate), and bis-active fluorine compounds (such
as 1,5-difiuoro-2,4-dinitrobenzene). For example, a ricin fusion
can be prepared as described in Vitetta et al., Science, 238: 1098
(1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene
triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent
for conjugation of radionucleotide to the peptide. See WO94/11026;
U.S. Pat. No. 6,426,400; Laske, D. W., Youle, R. J., and Oldfield,
E. H. (1997) Tumor regression with regional distribution of the
targeted toxin TF-CRM107 in patients with malignant brain tumors.
Nature Medicine 3:1362-1368.
A growing body of evidence indicates that angiogenesis is essential
to the progression of cancer. In fact, the extent of neovascularity
is strongly correlated with metastases in primary breast carcinoma,
bladder cancer, prostrate cancer, non-small cell lung cancer,
cutaneous melanomas, and uterine cervix carcinoma [Ferrar N.,
Breast Cancer Research and Treatment 36: 127-137 (1995)]. Thus,
assessing the angiogenic phenotype of tumors will provide a strong
indication to disease outcome. Other diseases or conditions which
are characterized by hypervascularization or hypovascularization
include, but are not limited to, retinal neovascularization,
neovascularization in atherosclerotic plaques, hemangiomas,
arthritis, and psoriasis, as well as the diseases described
hereinabove. See Folknan, J. New England J. of Med. 333:1757-63
(1995).
Thus, the ability of the peptides of the present invention to bind
specifically to the cell-surface of endothelial cells, suggests the
use thereof as potent detectors of vascularization. This may be
important for detecting the presence of; assessing predisposition
to, or monitoring progression of an angiogenesis-dependent
diseases.
Thus, the present invention also envisages a method of detecting a
presence or an absence of endothelial cells in a biological
sample.
The method is effected by incubating the biological sample with a
peptide of the present invention capable of binding to the
cell-surface of endothelial cells and detecting the peptide, to
thereby detect the presence or the absence of endothelial cells in
the biological sample.
The biological sample utilized for detection is preferably a tissue
sample such as a biopsy specimen. Methods of obtaining tissue
biopsies from mammals are well known in the art (see Hypertext
Transfer Protocol://World Wide Web dothealthatoz
dotcom/healthatoz/Atoz/default dothtml).
At least one peptide of the present invention is contacted with the
biological sample under conditions suitable for complex formation
(i.e., buffer, temperature, incubation time etc.); suitable
conditions are described in Example 1 of the Examples section.
Peptide-cell complexes within a biological sample can be detected
via any one of several methods known in the art, which methods can
employ biochemical and/or optical detection schemes.
To facilitate complex detection, the peptides of the present
invention are highlighted preferably by a tag or an antibody. It
will be appreciated that highlighting can be effected prior to,
concomitant with or following complex formation, depending on the
highlighting method. As used herein the term "tag" refers to a
molecule, which exhibits a quantifiable activity or characteristic.
A tag can be a fluorescent molecule including chemical fluorescers,
such as fluorescein or polypeptide fluorescers, such as the green
fluorescent protein (GFP) or related proteins (World Wide
Webdotclontechdotcom). In such case, the tag can be quantified via
its fluorescence, which is generated upon the application of a
suitable excitatory light. Alternatively, a tag can be an epitope
tag, a fairly unique polypeptide sequence to which a specific
antibody can bind without substantially cross reacting with other
cellular epitopes. Such epitope tags include a Myc tag, a Flag tag,
a His tag, a leucine tag, an IgG tag, a streptavidin tag and the
like.
It will be appreciated that the peptides of the present invention
may also be used as potent detectors of endothelial cells in vivo.
A designed peptide capable of binding endothelial cells, labeled
non-radioactively or with a radio-isotope, as is well known in the
art can be administered to an individual to diagnose the onset or
presence of angiogenesis-dependent disease, discussed hereinabove.
The binding of such a labeled peptide after administration to
endothelial cells can be detected by in vivo imaging techniques
known in the art.
It will be appreciated that such a detection method can also be
utilized in an assay for uncovering potential drugs useful in
inhibition or promotion of angiogenesis. For example, the present
invention may be used for high throughput screening of test
compounds (i.e., putative angiogenic molecules). Typically, the
peptides of the present invention are radiolabeled, to reduce assay
volume. The peptides are allowed to bind endothelial cells prior
to, concomitant with or following binding of the test compound. A
competition assay is then effected by monitoring displacement of
the label by a test compound [Han (1996) J. Am. Chem. Soc.
118:4506-7 and Esler (1996) Chem. 271:8545-8].
Once a putative angiogenic molecule is identified it is further
evaluated using angiogenesis assays which are well known in the
art. Examples include, but are not limited to, the chick
chorioallantoic membrane, rabbit cornea assay, sponge implant
models, matrigel and tumor models (see also the assays described in
the Examples section which follows).
The peptides of the present invention can be included in a
diagnostic or therapeutic kilt For example, the peptides can be
packaged in a one or more containers with appropriate buffers and
preservatives and used for diagnosis or for directing therapeutic
treatment. Thus, the peptides, for example, can be each mixed in a
single container or placed in individual containers. Preferably,
the containers include a label. Suitable containers include, for
example, bottles, vials, syringes, and test tubes. The containers
may be formed from a variety of materials, such as glass or
plastic.
In addition, other additives, such as stabilizers, buffers,
blockers and the like may also be added.
The peptides of such kits can also be attached to a solid support,
such as beads, array substrate (e.g., chips) and the like and used
for diagnostic purposes.
Peptides included in kits or immobilized to substrates may be
conjugated to a detectable label, such as described
hereinabove.
The kit can also include instructions for determining if the tested
subject is suffering from, or is at risk of developing, a
condition, disorder, or disease associated with disregulated
angiogenesis.
Additional objects, advantages, and novel features of the present
invention will become apparent to one ordinarily skilled in the art
upon examination of the following examples, which are not intended
to be limiting. Additionally, each of the various embodiments and
aspects of the present invention as delineated hereinabove and as
claimed in the claims section below finds experimental support in
the following examples.
EXAMPLES
Reference is now made to the following examples, which together
with the above descriptions, illustrate the invention in a non
limiting fashion.
Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan
J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn.
(1994); Mishell and Shiigi (eds), "Selected Methods in Cellular
Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;
3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219;
5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J.,
ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins
S. J., eds. (1985); "Transcription and Translation" Hames, B. D.,
and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R.
I., ed. (1986); "immobilized Cells and Enzymes" IRL Press, (1986);
"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
Example 1
Selection of Novel Potential Angiogenesis-Inducing Phage Display
Peptides
Novel peptides that potentially induce angiogenesis were identified
by positive affinity selection (i.e., biopanning) of a random phage
display peptide library using human umbilical vein endothelial
cells [HUVECs, ECs (the two abbreviations are used interchangeably
throughout the document)], followed by Enzyme-Linked Immunosorbent
Assay (ELISA) of positive phage clones to ECs.
Materials and Experimental Methods
Phage Display Peptide Library--The Random Phage Display Peptide
Library employed in this study was purchased from New England
Biolabs (NEB), Inc. (Beverly, Mass., USA). The phage display
library is based on a combinatorial library of random peptide
12-mers fused to a minor coat protein (pIII) of M13 phage. The
displayed 12-mer peptides are expressed at the N-terminus of pIII.
The library consists of about 2.7.times.10.sup.9 electroporated
sequences amplified once to yield 20 copies of each sequence in 10
.mu.l of phage suspension.
The phage display peptide library was screened by five rounds of
positive affinity selection (biopanning) using
differentially-treated ECs: a) ECs without treatment (under
normoxia), b) ECs following 3 hours of hypoxia treatment, and c)
ECs following 24 hours of hypoxia treatment. Each positive
selection was preceded by a negative selection using human
Peripheral Blood Lymphocytes (PBLs). Each round of biopanning was
effected by elution of the bound phage with 0.2 M glycine-HCl and
incubation of the unbound phages on the second EC plate. This
procedure was executed three times. Phages of the three elution
steps were pooled for the second round of biopanning and so on.
After the fifth round of biopanning, 40 individual clones from each
group of cells screened were isolated so that, in all, 120
individual clones were obtained.
Human Umbilical Vein Endothelial Cells (HUVECs)--HUVECs (ECs), were
isolated by Collagenase digestion as previously described [Jaffe et
al., J. Clin. Invest., 52(11):2757-64, 1973]. ECs were cultured
with M199 supplemented with 20% FCS, 10.sup.4 units of penicillin,
10 mg/ml of streptomycin sulfate, 10 mg/ml of neomycin sulfate
(Biological Industries, Kibbutz Beit Haemek, Israel), 25 .mu.g/ml
of EC growth supplement (Biomedical Technologies, Inc., Stoughton,
Mass., USA), and 5 U/ml of Heparin (SIGMA, Rehovot, Israel). HUVECs
were harvested with Trypsin (0.25%), EDTA (0.05%, Biological
Industries, Kibbutz Beit Haemek, Israel) and incubated on 60 mm
petri dishes coated with 1% gelatin for 24 hours. Following
incubation, cells were washed and incubated with M199 supplemented
with 10% FCS. ECs were subjected to four different treatments: a)
no treatment, b) 3 hours of hypoxia, c) 6 hours of hypoxia, or d)
24 hours of hypoxia. Subsequently, monolayers were washed with PBS
and dried overnight. Cells were rehydrated with PBS containing 5%
FCS and 0.1% sodium azide and maintained at 4.degree. C. until
biopanning.
Hypoxia treatment--ECs were subjected to hypoxia for 3, 6, or 24
hours in a gas mixture containing 94% N.sub.2, 5% CO.sub.2, and 1%
O.sub.2 in a hypoxia chamber (Billups-Rothenberg, Delmar, Calif.,
USA).
Screening of positive clones by ELISA--The binding of positive
clones from each group was re-evaluated by ELISA. For this purpose,
ECs under normoxic conditions, ECs following 3, 6, or 24 hours of
hypoxia, or human PBL (as controls) were plated at
20.times.10.sup.3 cells/well on 96 well plates. Plates were
re-hydrated by overnight incubation at 4.degree. C. in PBS
supplemented with 3% BSA, followed by three washes with PBS. Phage
from each of the 120 clones isolated were dispersed on the ELISA
plates at concentrations of 10.sup.10, 10.sup.9, or 10.sup.8 phage
per well and incubated for two hours at room temperature. Plates
were then washed three times with PBS containing 0.05% Tween,
followed by three washes with double distilled water (DDW). After
washing, an anti-M13 HRP antibody (Amersham Pharmacia Biotech UK
Limited, Buckinghamshire, UK) at a 1:5,000 dilution was added and
incubated for 2 hours at room temperature .degree. C., following
which the plates were washed 5 times in the presence of PBS and
0.05% Tween-20. The BRP reaction was carried out using 100 .mu.l of
tetramethyl benzidine liquid substrate (DAKO TMB substrate
chromogen, DAKO Corporation, Carpinteria, Calif., USA) for a 15
minute-incubation following which the reaction was terminated by
the addition of 50 .mu.l of 1 M HCl. Plates were read at 450 nm in
an ELISA reader (SLT 400ATC, SLT LAB Instruments, Austria).
Statistical and graphical methods--Statistical analysis was
effected by analysis of variance (ANOVA) with appropriate post-hoc
tests, generally Dunnett's, for a comparison to a control or
Tukey-Kramer HSD for multiple comparisons. Results were considered
statistically significant at P<0.05.
Results
EC-binding peptides were selected using phage display peptide
library--A phage display peptide library was subjected to five
rounds of positive affinity selections (biopanning) using ECs under
physiological conditions (i.e., normoxia) or following hypoxia. The
second step of selection of peptide-presenting phage was effected
by ELISA using ECs and lymphocyte-coated plates as controls.
Fifteen different peptide-presenting phages at a concentration of
10.sup.9 (FIG. 1a) and 10.sup.10 (FIG. 1b) phages per well were
screened by ELISA on four different EC preparations (ECs at
normoxic conditions and ECs following 3, 6, and 24 hours of
hypoxia). FIG. 1a and Table 3 hereinbelow, illustrate selected
peptides which exhibited statistically significant differences
(p<0.05) between binding of NO phage (i.e., unmodified M13
phage) and binding of certain peptide-presenting phages as
determined using ANOVA analysis of 10.sup.9 selected phage
indicated
TABLE-US-00003 TABLE 3 Peptide-presenting phage Peptide Cells SP EC
SP H3 TR EC TR H3 TR H6 TR H24 VL EC VL H3 VL H6 VL H24 YR EC YR H3
YR H6 YR H24 Table 3: Peptide-presenting phage selected from EC
(ECs at normoxic conditions), H3 (ECs following 3 hours of
hypoxia), H6 (ECs following 6 hours of hypoxia), and H24 (ECs
following 24 hours of hypoxia). P < 0.05.
Similarly, statistically significant peptides which were selected
using ANOVA analysis performed on 10.sup.10 phages (p<0.05) are
shown in FIG. 1b.
Altogether, these findings demonstrate the identification of
specific peptide-presenting phages which are capable of
specifically binding ECs under either normoxia or hypoxia
Example 2
Selected Peptide-Presenting Phages are Capable of Inducing
Angiogenesis In Vitro
The ability of selected peptide-presenting phages to induce
angiogenesis in vitro was evaluated by inducing EC proliferation,
migration or sprouting of aortic rings.
Materials and Experimental Methods
Identification of DNA sequences from selected peptide-presenting
phages--DNA from all isolated selected clones was purified by
incubation with iodide buffer and ethanol according to the
manufacturer's instructions (NEB, Beverly, Mass., USA). This rapid
procedure produces template of sufficient purity for automated DNA
sequencing with dye-labeled dideoxynucleotides. The 96 gIII (NEB)
sequencing primer was utilized for automated DNA sequencing by the
Sequencing Unit of Tel Aviv University, Tel Aviv, Israel.
ECs and hypoxia treatment--ECs were isolated, cultured, and
subjected to hypoxia treatments as described in Example 1,
hereinabove.
EC proliferation assay--ECs (40.times.10.sup.3 cells/well) were
seeded on 24-well plates coated with 1% gelatin and were further
cultured in the presence of M199 medium supplemented with 20% FCS,
10.sup.4 units of penicillin, 10 mg/ml of streptomycin sulfate, 10
mg/ml of neomycin sulfate (Biological Industries, Kibbutz Beit
Haemek, Israel), 25 .mu.g/ml of endothelial cell growth supplement
(Biomedical Technologies, Inc., Stoughton, Mass., USA) and 5 U/ml
of heparin (SIGMA, Rehovot, Israel). After 24 hours, cells were
washed with serum-free medium (SFM) and incubated with SFM for
another 24 hours at 37.degree. C. Subsequently, 10.sup.6 selected
phages were added per well and plates were incubated for another 24
hours. Abortive phages (those lacking a cloned peptide) were used
as negative controls and were designated NO. Two .mu.Ci/well of
[.sup.3H]-Thymidine (SIGMA, Rehovot, Israel) were added for the
last 6 hours of incubation, following which the cells were fixed
for 16 hours with 10% TCA at 4.degree. C. and washed with absolute
ethanol. For cell lysis, NaOH (300 .mu.l of 0.5 M per well) was
added to the cells for a 15-minute incubation at 37.degree. C.,
following which cell lysates were transferred to scintillation
vials containing 2 ml of scintillation liquid (Ultima Gold, Packard
Bioscience, Meriden, Conn., USA) and counted cpm/min in a .beta.
counter (Scintillation .beta. Counter 1600 TR, Packard A Camberra
Company, Meriden, Conn., USA).
EC migration assay--EC migration was evaluated by the Chemicon QCM
96-well Migration Assay (Chemicon International, Temecula, Calif.,
USA) according to the manufacturer's instructions. Briefly, the
kit's migration chamber comprises an insert membrane with 8 .mu.m
pores and a feeder tray containing the peptides as
chemoattractants. Cell migration was evaluated by placing the cells
in the migration chamber and following their migration to the
bottom of the membrane.
For the migration/chemoattractant assay, ECs from passage 3 were
incubated for 24 hours on gelatin-coated plates in the presence of
the M199 SFM. Following trypsinization, 2.times.10.sup.4 ECs were
incubated for 5 hours in each of the 96 wells of the migration
chamber. The peptide-presenting phages (10.sup.5 or 10.sup.6) were
added to the feeder tray to chemoattractant the cells without being
in physical contact with the cells. Cells which reached the bottom
of the membrane (i.e., migratory cells) were dissociated from the
membrane following the incubation with a cell detachment buffer.
The migratory cells were subsequently lysed and detected by the
molecular probe CyQuant GR dye which exerts green fluorescent
enhancement when bound to cellular nucleic acid.
For activation migration assays, 10.sup.5 or 10.sup.6
peptide-presenting phages were incubated (for 5 hours) with ECs in
the migration chamber. NO phages (unmodified M13 phages) served as
negative control in both migration assays. Results were determined
by a fluorescent ELISA reader at 480/520 nm (Fluostar BMG Lab Teck)
and are presented in net values from which the control values were
subtracted.
Aortic ring formation assay--Adventitia of human mammary or radial
artery was stripped and cut into 1 mm long rings. The bottom of
each well of a sterile 96-well plate was coated with 20 .mu.g of
fibronectin (Biological Industries, Kibbutz Beit Haemek, Israel)
and the rings were positioned in the center of each well containing
150 ml of Dulbecco's modified Eagle's medium (DMEM, Biological
Industries) supplemented with 10% FCS. For aortic ring formation,
10.sup.6 peptide-presenting phages were added to each well and the
plates were incubated for 7 days in the presence of 5% CO.sub.2 at
37.degree. C. Unmodified M13 phages (NO) were used as negative
controls. Arterial rings were removed and the extent of cell
proliferation was estimated using the XTT assay (biological
Industries) according to the manufacturer's instructions.
Experimental Results
Characterization of identical EC-binding peptides from various
EC-treated cells--DNA sequence analysis of the cloned regions of
the positively selected peptide-presenting phages revealed the
presence of identical clones among the various ECs. Moreover, some
peptide-presenting phages (e.g., VL, LP, TR) were common in both
cells grown under normoxia (EC) and cells grown under hypoxia
(H24). Other peptide-presenting phages, e.g., YR or LT, were from
ECs exposed to 3 or 24 hours of hypoxia, respectively. On the other
hand, while SP was common to ECs exposed to 3 and 24 hours of
hypoxia, others (e.g., ST, QF, NS), were from ECs grown under
nomoxia (Table 4, hereinbelow).
TABLE-US-00004 TABLE 4 Number of identical sequences obtained from
positively-selected peptide-presenting phages Peptide EC H3 H24 VL
22 -- 10 LP 2 29 9 TR 2 -- 2 ST 2 -- -- QF 4 -- -- NS 2 -- -- SP --
3 2 YR -- 2 -- LT -- -- 4 HR -- -- 3 HY -- -- 2 TP -- -- -- NR --
-- -- SA -- -- -- Table 4: The number of identical clones present
in positively-selected peptide-presenting phages from EC (ECs under
normoxic conditions), H3 (ECs following 3 hours of hypoxia), or H24
(ECs following 24 hours of hypoxia).
Peptide-presenting phages are capable of inducing EC proliferation
and migration--Six individual clones (VL, LT, QF, SP, YR, and TR)
were tested using the Chemicon QCM 96-well Migration Assay for the
capacity of the presented peptides to induce EC proliferation and
migration. The DNA and protein sequences of the selected peptides
are displayed in Table 5, hereinbelow.
TABLE-US-00005 TABLE 5 Sequences of selected peptides and nucleic
acid encoding same Amino acid sequence PeptideID # Nucleic acid
sequence (SEQ ID) (SEQ ID) VL GTTCCGTGGATGGAGCCGGCTTATCAGAGGTTTCTG
VPWMEPAYQRFL (SEQ ID NO:1) (SEQ ID NO:2) LT
CTGCTTGCGGATACGACGCATCATAGGCCGTGGACT LLADTTHHRPWT (SEQ ID NO:3)
(SEQ ID NO:4) QF CAGCCTTGGTTGGAGCAGGCTTATTATAGTACGTTT QPWLEQAYYSTF
(SEQ ID NO:5) (SEQ ID NO:6) SP TCTGCGCATGGGACGTCTACTGGTGTTCCGTGGCCG
SAHGTSTGVPWP (SEQ ID NO:7) (SEQ ID NO:8) YR
TATCCGCATATTGATTCGCTTGGTCATTGGCGGCGG YPHIDSLGHWRR (SEQ ID NO:9)
(SEQ ID NO:10) TR ACTTTGCCGTGGCTGGAGGAGTCTTATTGGCGTCCT TLPWLEESYWRP
(SEQ ID NO:11) (SEQ ID NO:12) Table 5: Presented are the amino acid
sequences of the selected peptides and the nucleic acid sequences
encoding same.
As is shown in FIG. 2, all six selected peptide-presenting phages
induced (at a concentration of 10.sup.6/well) increased
proliferation of ECs as compared with the unmodified, empty, phages
(NO).
The selected peptide-presenting phages are capable of inducing EC
migration--The ability of the peptide-presenting phages to induce
EC migration of activated ECs was tested by placing the
peptide-presenting phages with the ECs in migration chambers. Two
of the tested peptide-presenting phages. (QF and LT) induced
migration of the activated ECs at a concentration of 10.sup.5 (FIG.
3a) or 10.sup.6 (FIG. 3b) phages per well. On the other hand,
placement of the peptide-presenting phages at two different
concentrations on the feeder tray revealed the ability of YR (of
the six peptide-presenting phages) to induce migration as
chemoattractants at 10.sup.5 phages per well (FIG. 4a), and the
ability of QF, SP, TR and LT to induce migration as
chemoattractants at a concentration of 10.sup.6 phages per well
(FIG. 4b).
Aortic ring sprouting by peptide presenting phages--Aortic rings
were tested for sprouting in the presence of peptide-presenting
phages. FIG. 5 demonstrates proliferation of cells originating from
the aortic rings, induced by peptide presenting phages. ANOVA
analysis comparing the six peptide-presenting phages indicated an
overall clear difference in the proliferation of cells derived from
the aortic rings (P=0.0003). In addition, post-hoc tests indicated
statistically significant differences between the VL
peptide-presenting phage and the S24 empty phage control (i.e.,
NO).
These results demonstrate that the peptide-presenting phages of the
present invention are capable of inducing EC migration and
proliferation, i.e., are capable of inducing angiogenesis in
vitro.
Example 3
Synthetic Peptides are Capable of Inducing Angiogenesis In Vitro
Under Normoxic Conditions
Peptides corresponding to the selected peptide-presenting phages
were synthesized and their potential to induce angiogenesis in
vitro was evaluated, as follows.
Materials and Experimental Methods
Peptide synthesis--Peptides were synthesized by SynPep (Dublin,
Calif., USA). HPLC purity analysis demonstrated that the purity of
each synthetic peptide was higher than 97%. Peptide QF was
dissolved in 50% water/50% acetonitrile. All other peptides were
dissolved in water.
Fluorescein labeling of synthetic peptides--Fluorescein
Isothiocyanate (FTIC, Pierce, Rockford, Ill.) is an amino-reactive
probe that reacts in an alkine environment with primary amines to
form a stable fluorescent derivative. 12.5 .mu.l of FITC (10 mg/ml)
were added per 1 mg of peptide diluted in 0.5 M bicarbonate buffer
(pH 9.5) and agitated in the dark for 2 hours. 0.1 ml of 1.5 M
hydroxilamine was then added per 1 ml of reaction mixture and
agitated for an additional 30 minutes at room temperature. Unbound
FITC was removed by dialysis in the presence of PBS.
Peptide binding to ECs--ECs were cultured in M199 supplemented with
10% FCS. For peptide binding assays, the cells were trypsinized and
10.sup.5 cells were suspended in PBS supplemented with 5% FCS and
0.1% sodium azide. Cells were incubated for 2 hours (on ice, in the
dark) in the presence of 1-6 .mu.g of FITC-labeled peptides,
following which the stained cells were washed twice with PBS.
Samples were analyzed by FACS (FACScan, Becton Dickinson, San Jose,
Calif., USA). For control, 0.5.times.10.sup.6 of PBLs were
utilized.
Proliferation of ECs in the presence of synthetic peptides--ECs
were incubated in the presence of EBM-2 medium containing
supplements (Cambrex BioWhittaker Cell Biology Products,
Walkersville, USA). Cells were passaged every 3 days by harvesting
cells with 0.25% Trypsin/0.05% (Biological Industries) and
re-plating the cells at a concentration of 10.sup.4 cells per a 25
cm.sup.2 flask. ECs from passage 3 were used for proliferation
experiments.
ECs (12.times.10.sup.3 cells/well) were seeded on 24-well plates in
EBM-2 medium containing supplements. Following a 24-hours
incubation, cells were subjected to 24 hours of starvation in
supplements-free medium (SFM). Synthetic peptides (SP, LT, TR, and
VL) were each added at concentrations of 0.05, 0.1, 1, 10, or 100
ng/ml for 24 hours. For a proliferation assay, 2 .mu.Ci/well of
[.sup.3H]-Thymidine (SIGMA, Rehovot, Israel) were added for a
6-hour incubation, following which the plates were washed 3 times
with PBS. For cell lysis, the plates were incubated for 15 minutes
at 37.degree. C. with 300 .mu.l/well of 0.5 M NaOH. Subsequently,
cell lysates were transferred to scintillation vials containing 2
ml of scintillation liquid (Ultima Gold, Packard Bioscience,
Meriden, Conn., USA) and counted (cpm/min) in a .beta. counter
(Scintillation .beta. Counter 1600 TR, Packard A Camberra Company,
Meriden, Conn., USA).
Proliferation of dermal microvascular endothelial cells (MVECs) in
the presence of synthetic peptides--MVECs were incubated with
synthetic peptides (LT, SP, and YR) as described above for HUVECs
(ECs), except that the MVECs were seeded in EBM-MV medium
containing supplements (Cambrex BioWhittaker Cell Biology Products)
and MVECs from passage 4 (rather than 3) were used for
proliferation experiments.
Migration assays in the presence of synthetic peptides--EC
migration was evaluated as described in Example 2, hereinabove.
Following typsinization, ECs (25.times.10.sup.3) were incubated in
migration chambers. For the chemoattactant migration assay,
synthetic peptides were added to the feeder tray at 5, 10, 20, and
50 ng/ml and incubated with the cells for 5 or 15 hours. For
migration activation assays, synthetic peptides at 0.1, 1, and 10
ng/ml were incubated with the cells in the migration chamber for 5
or 15 hours.
MVEC migration was evaluated as described above except that MVECs
from passage 3 were incubated in EBM-MV SFM. Synthetic peptides
were added at 10 ng/ml to the feeder tray for chemoattractant
migration assay as well as for activation of migration assays. The
presence of migratory cells was detected using the fluorescent
ELISA reader at 480/520 nm (Fluostar BMG Lab Teck) as described in
Example 2, hereinabove.
Sprouting of aortic rings by synthetic peptides--Human mammary or
radial artery was prepared in a 96-well plate as described in
Example 2, hereinabove. Peptides were added in increasing
concentrations (1, 10, 100, and 1,000 ng/ml) to each well
containing the aortic ring. Plates were incubated at 37.degree. C.
in the presence of 5% CO.sub.2 for 7 days. Arterial rings were
removed and cell proliferation was assessed using the XTT assay
(Biological Industries) according to the manufacturer's
instructions.
Tube formation assay--ECs from passage 3 or MVECs from passage 4
were harvested with trypsin and incubated for 24 hours in SFM.
Twenty-four--well plates were pre-coated with 250 .mu.l of Cultrex
Basement Membrane Extract with reduced growth factors (R&D
Systems, Minneapolis, Minn., USA). Five hundred microliters of
medium containing 10.sup.6 cells were transferred to the coated
wells. Synthetic peptides, FGF, YR, QF, or VL were added to ECs,
and VEGF, YR, QF, or VL were added to MVECs at 10 ng/ml. Plates
were incubated for 24 hours at 37.degree. C. in the presence of 5%
CO.sub.2. HUVECs and MVECs were photographed under a light
microscope at 20 hours and 8 hours, respectively.
Real Time PCR--MVECs from passage 3 were incubated for 24 hours in
EBM-MV supplement-free medium (starving media). Following
starvation, 1 ng/ml of synthetic peptides LT, QF, SP, TR, YR, and
VL and 10 ng/ml of VEGF were added to the plates. Following 1.5 or
6 hours of incubation, total RNA was extracted using TRIsol reagent
(Invitrogen Life Technologies, Carlsbad Calif., USA) and 0.8 .mu.g
of the extracted RNA was used as a template for reverse
transcription (Invitrogen) using random primers (SuperScript III
First-Strand Synthesis System for RT-PCR (hvitrogen, Carlsbad
Calif., USA) according to the manufacturer's instructions.
Resulting cDNAs were subjected to real time PCR amplification using
the ABI prism 7000 Sequence Detection System (Applied Biosystems,
Foster City, Calif., USA). Oligonucleotide primers were designed
using Primer Express Software (Applied Biosystems, Foster City,
Calif., USA) according the translated region of VEGF-A (Accession
No:NM.sub.--003376), VEGF-C (Accession No:NM.sub.--005429), KDR
(Accession No:NM.sub.--002253), FLT-1 (Accession
No:NM.sub.--002019), HIF-.alpha. (Accession No:HSU22431), and GAPDH
(Accession No:NM.sub.--002046) and are listed in Table 6,
hereinbelow. Briefly, a reaction mixture of 20 .mu.l consisting of
DDW, oligonucleotide primers (500 nM), cDNA (3 .mu.l), and SYBR
Green PCR master kit (Applied Biosystems, Foster City, Calif., USA)
was subjected to an amplification program of 15 seconds at
95.degree. C., and 60 seconds at 60.degree. C. for 40 cycles.
Results were analyzed using the Sequence Detector Software Version
1 (Applied Biosystenis).
TABLE-US-00006 TABLE 6 Oligonucleotide primers for amplification of
selected genes cDNA Gene name Sense primer (SEQ ID) Anti-sense
primer (SEQ ID) VEGF-A CTACCTCCACCATGCCAAGTG TGCGCTGATAGACATCCATGA
(SEQ ID NO:15) (SEQ ID NO:16) VEGF-C TTCCTGCCGATGCATGTGTA
TGTTCGCTGCCTGACACTGT (SEQ ID NO:17) (SEQ ID NO:18) KDR
TCAGGCAGCTCACAGTCCTAGAG ACTTGTCGTCTGATTCTCCAGGTT (SEQ ID NO:19)
(SEQ ID NO:20) FLT-1 TCAGCGCATGGCAATAATAGA ACCAAGGTGCTAGCCATCTTATTC
(SEQ ID NO:21) (SEQ ID NO:22) HIF-.alpha. AGTGTACCCTAACTAGCCGAGGAA
GCCTGTGCAGTGCAATACCTT (SEQ ID NO:23) (SEQ ID NO:24) GAPDH
GTCGGAGTCAACGGATTTGG GGCAACAATATCCACTTTACCAGAGT (SEQ ID NO:25) (SEQ
ID NO:26)
Statstcal and graphical methods--See Example 1, hereinabove.
Experimental Results
Synthetic peptides bind ECs in vitro--Six synthetic peptides LT,
QF, SP, TR, VL, and YR (displayed in Table 5) were synthesized in
order to evaluate their ability to induce angiogenesis in vitro and
in vivo. Specific binding of the above-described synthetic peptides
to ECs was tested. The peptides were FITC-labeled and binding to
ECs was analyzed by FACS. As is shown in FIGS. 6a-i and FIG. 7, the
synthetic peptides bound specifically to ECs but not to lymphocytes
(PBLs). Increasing concentrations of peptides (FIGS. 6c-i, red
lines) resulted in increased binding to ECs (94-96% binding)
relative to a lower concentration (FIGS. 6c-i, green lines).
Synthetic peptides are capable of inducing proliferation under
normoxia--Synthetic peptides were assayed for their effect on
proliferation of HUVECs under normoxic conditions. ECs were seeded
on 24 well plates in SFM for 24 hours and then synthetic peptides
were added at increasing concentrations for an additional 24 hours.
A significant dose-dependent increase in [.sup.3H]-Thymidine uptake
was observed in ECs incubated with the LT, SP, TR, and VL peptides
(FIG. 8a). Peptides LT, TR, and SP, at 10 ng/ml each, induced the
highest proliferative response, leading to 1.7, 1.8, and 1.6-fold
increases, respectively. On the other hand, VL, at 1 ng/ml, induced
the highest proliferative response leading to a 1.8 fold
increase.
A significant increase in [.sup.3H]-Thymidine uptake was also
demonstrated for MVECs incubated with LT, SP or YR (FIG. 8b). The
increase was in a dose dependent manner with the highest
proliferation response in a concentration of 1 ng/ml for all three
peptides. At this concentration, LT YR and SP increased MVECs
proliferation response by 1.8, 1.7 and 1.4 fold, respectively (FIG.
8b).
Cells migration by synthetic peptides--To test the effect of the
synthetic peptides on EC cell migration, synthetic peptides at
concentrations of 5, 10, 20, and 50 ng/ml were added to the feeder
tray. A dose-dependent induced migration was observed for LT (FIG.
9a) and SP (FIG. 9b). The effect appears to reach a plateau at high
concentrations, which would be predicted based on pharmacokinetics.
The exact pharmacologic profile of this attraction requires further
study. A smaller effect of induced migration was noted for VL and
TR when used as chemoattractants (FIG. 9c).
The synthetic peptides are capable of activating migration of EC
cells--To further test the effectiveness of the synthetic peptides
in activating migration, the synthetic peptides were incubated with
the ECs in the migration chambers. FIG. 10 illustrates that each of
these peptides, within a 5 hours span, induces statistically
significantly more ECs migration than control ECs without the
peptide present. By 15 hours, however, the migration of cells has
been reduced, so that no statistical difference is seen between any
peptide-treated cells and control epithelial cells (FIG. 10).
MVECs were also shown to migrate due to synthetic peptides
induction. The experiment performed with the test peptides
demonstrated their effectiveness as chemoattractants to induce
migration of MVECs in a dose dependent manner. FIG. 11a illustrates
that each of the test peptides, within a 5 hours span, induced more
cell migration than control endothelial cells without the peptide
present (results are in net values from which the control values
were subtracted). At 10 ng/ml, LT, QF, YR SP, TR and VL induced a
3.5, 2.4, 2.4, 2, 2, and 2-fold increase in MVECs migration
respectively.
MVECs were also directly activated. by the synthetic peptides. TR,
SP, QF, and YR were all shown to induce MVECs migration (by 2.6,
2.1, 2.3 and 1.8 folds, respectively), at 1 ng/ml (FIG. 11b).
Aortic rings sprouting by synthetic peptides--As described before
for the peptide-presenting phages, aortic rings induced sprouting
was evaluated by addition to the cultured aortic rings purified
synthetic peptides at different concentrations. Four peptides (QF,
YR, LT, and VL) were compared for their ability to induce cell
proliferation in aortic rings. Clear differences between the
peptides (after correction for control optical density) were
observed at the noted peptide concentrations (FIG. 12).
Tube Formation--ECs and MVECs were incubated on matrigel in the
presence of peptides and array formation was analyzed. Peptides
(YR, QF and VL) added to MVECs at concentration of 10 ng/ml,
resulted in a significant increase in tube formation (FIGS. 13c-e)
as compared to untreated cells (FIG. 13a). This increase was
similar to the effect of VEGF on these cells (FIG. 13b). The same
effect of increased tube formation was induced by these peptides
when added to ECs (FIG. 13h-j) as compared to untreated cells (FIG.
13f). This increase was similar to the effect of FGF on ECs (FIG.
13g).
As described for the peptide-presenting phages, the synthetic
peptides produced, could-induce in vitro angiogenic effects in ECs.
In all angiogenic effects tested, at least one (while in most cases
more) of the synthetic peptides tested showed significant effect
over control. These results indicate that these peptides may be
also capable of in vivo angiogenesis.
Peptides effect on gene expression in MVECs--The effect of the
synthetic peptides on the expression in MVECs of selected genes
(VEGF-A, VEGF-C, KDR, FLT-1 and HIF-1.alpha.) related to the VEGF
pathway (a major pathway that participated in angiogenic process)
was tested. Synthetic peptides were added at 1 ng/ml for 1.5 and 6
hours. After incubation with peptide, RNA was extracted from MVECs
and Real Time PCR was performed. Gene expression was calculated as
peptide/control (cells without peptide treatment) ratio.
The different peptides exhibited varying effects on the expression
of the genes tested as demonstrated in FIGS. 14a-e and summarized
in Table 7, hereinbelow.
TABLE-US-00007 TABLE 7 The effect of the different peptides on gene
expression Expression Expression Synthetic after 1.5 Synthetic
after 6 Gene peptide hours peptide hours VEGF-A QF, TR, YR, VL, +
VL + (FIG. 14a) LT, SP QF, TR, YR - VEGF-C QF, TR, VL, + QF, TR,
VL, + (FIG. 14b) LT, SP LT, SP FLT-1 QF, TR, YR, VL, + QF, YR -
(FIG. 14c) LT, SP KDR QF, SP, YR + TR, VL + (FIG. 14d) LT - YR -
HIF QF, TR, VL + TR, VL + (FIG. 14e) LT, YR - LT, QF - Table 7: The
increased (+) or non-increased (-)gene expression is presented for
the noted genes as a result of incubation with the noted synthetic
peptides.
As is shown in Table 7 hereinabove, all 6 peptides tested were
shown to induce the expression of some of the genes tested. These
results may lead to the molecular mechanism by which these peptides
induce angiogenesis.
Example 4
The Effect of Hypoxia on In Vitro Induced Angiogenesis by Synthetic
Peptides
The ability of selected peptides to induce angiogenesis was
evaluated by induction of cell binding, proliferation, migration
and tube formation assays under hypoxic condition.
Materials and Experimental Methods
Peptides synthesis and Fluorescein labeling--See Example 3,
hereinabove.
ECs and hypoxia conditions--ECs were isolated, cultured, and
subjected to hypoxia conditions as described in Example 1,
hereinabove.
FACS analysis of peptide binding to ECs with and without hypoxia
treatment--ECs were exposed to hypoxia conditions and then prepared
for FACS analysis as described in Example 3, hereinabove. Cells
were stained with 6 .mu.g of SP or LT labeled peptide. Samples were
analyzed by Fluorescence Activated Cell Sorter (FACScan Beckton
Dickinson, Calif., USA).
Synthetic peptides induced proliferation or migration after and
under hypoxia treatment--Cell proliferation or migration assays
were performed as described in Example 3, hereinabove, except that
cells were divided to 3 groups: control cells, cells after exposure
to hypoxia conditions or cells proliferating under hypoxia
conditions. For cell proliferation assays, ECs were incubated with
QF, LT and SP and MVECs were incubated with LT, SP, and YR. For
cell migration assays, ECs were incubated with EBM-2 and MVECs were
incubated with EBM-MV media.
Tube formation assay after and under hypoxia treatment--Tube
formation assay was performed as described in Example 3,
hereinabove, except that the cells were divided to 3 groups:
control cells, cells after exposure to hypoxia conditions, and
cells on matrigel basement that form tubes under hypoxia
treatment.
Statistical and graphical methods--was performed as described in
Example 1, hereinabove.
Experimental Results
Synthetic peptides bind to ECs after hypoxia treatment--Peptide
binding assays were performed on ECs grown under normoxia or ECs
following hypoxia. As is shown in FIGS. 15 and 16a-b, while LT and
SP exhibited increased binding to ECs exposed to hypoxia, the other
peptides (i.e., QF, TR, VL and YR) exhibited similar intensity of
binding to ECs under both conditions.
Synthetic peptides induced proliferation under and following
hypoxia treatment--The effect of synthetic peptides (QF, LT and SP)
on proliferation of ECs was tested under and following hypoxia
treatment as compared to control. ECs were seeded on 24 well plates
in serum free media for 24 hours, following which synthetic
peptides were added to cells in various concentrations for
additional 24 hours.
FIGS. 17a-b demonstrate a significant dose-dependent increase in
[.sup.3H]-Thymidine uptake in ECs incubated with the LT and SP
peptides under and following hypoxia. As is shown in FIG. 17a,
while LT (at a concentration of 10 ng/ml) resulted in a 3.5-fold
increase of cell proliferation after hypoxia, LT at 1 ng/ml
resulted in a 1.7-fold increase in cell proliferation under
hypoxia. Similarly, SP (at a concentration of 10 ng/ml) increased
cell proliferation after hypoxia in 2 fold (FIG. 17b). On the other
hand, QF did not show increase in proliferation of endothelial
cells after or under hypoxia treatment (FIG. 17c).
The effect of these synthetic peptides (QF, LT and SP) on the
proliferation of MVECs under the same conditions was also tested.
FIGS. 17d-e demonstrate a significant dose-dependent increase in
[.sup.3H]-Thymidine uptake in MVECs which were incubated with the
peptides LT and SP after and under hypoxia. LT increased 1.7 fold
MVECs proliferation after hypoxia at 1 ng/ml and at 10 ng/ml under
hypoxia conditions (FIG. 17d). SP increased MVECs proliferation
after hypoxia in 1.5 fold at 10 ng/ml and 1.9 fold under hypoxia
conditions at 1 ng/ml (FIG. 17e). QF did not show increase
proliferation of MVECs under hypoxic conditions compared to
normoxic conditions (FIG. 17f).
Table 8, hereinbelow, summarizes the set of experiments testing the
effect of the synthetic peptides of the present invention on HUVEC
or MVEC cell proliferation under normoxia, following hypoxia or
under hypoxia.
TABLE-US-00008 TABLE 8 The effect of synthetic peptides on cell
proliferation PROLIFERATION Normal After hypoxia Under hypoxia
HUVEC MVEC HUVEC MVEC HUVEC MVEC YR ++ ++ - - + + LT - ++ ++ ++ ++
++ SP - - ++ ++ ++ ++ QF + + + - - - TR ++ ++ - - - - VL ++ - - - +
+ FGF ++ ++ ++ + + +
Table 9, hereinbelow, summarizes the set of experiments testing the
effect of the synthetic peptides of the present invention on HUVEC
or MVEC cell migration.
TABLE-US-00009 TABLE 9 The effect of synthetic peptides on cell
migration MIGRATION Normal conditions Under hypoxia HUVEC MVEC
HUVEC MVEC None - - - - YR + + + + LT +++ +++ - - SP - + + ++ QF ++
++ + ++ TR ++ + + ++ VL + + ++ + FGF ++ ++ + +
Tube formation assay after and under hypoxia treatment--The effect
of synthetic peptides of the present invention on tube formation of
ECs and MVECs was tested by their incubation on matrigel in the
presence of LT, SP and QF peptides.
Addition of 10 ng/ml peptides QF under normoxic conditions, similar
to the effect of VEGF or bFGF, resulted in a significant increase
in tube formation in comparison to untreated ECs (FIGS. 13d and i).
SP and LT under normoxic conditions did not induce tube formation
(Data not shown). Peptide SP however, was effective only in tube
formation under hypoxia conditions (FIG. 18a-e).
Table 10, hereinbelow, summarizes the set of experiments testing
the effect of the synthetic peptides of the present invention on
tube formation.
TABLE-US-00010 TABLE 10 The effect of synthetic peptides on tube
formation TUBE FORMATION Normal conditions After hypoxia Under
hypoxia HUVEC MVEC HUVEC MVEC HUVEC MVEC None - - - - - - YR ++ ++
- - ++ ++ LT - - - - - - SP - - - - ++ ++ QF ++ ++ + + - - TR - - -
- - - VL ++ ++ - - - - FGF ++ ++ ++ ++ - -
EXAMPLE 5
Peptide-Induced In Vivo Angiogenesis
The synthetic peptides of the present invention were used to induce
in vivo angiogenesis in a mouse ear model and rat or mice ischemic
hind-limb models.
Materials and Experimental Methods
In Wivo angiogenesis in a mouse-ear model--Ear angiogenesis studies
were a modification of an approach described previously
(Pettersson, 2000). Synthetic peptides in a concentration of 1, 10
and 20 .mu.g/15 .mu.l per mouse were injected subcutaneously into
the ears of nude mice and Balb/C mice. Contralateral ears were
injected only with PBS. Digital photographs were obtained 2, 4, 6,
and 20 days after injection. Two days after peptide inoculation,
angiogenic effect of peptides could be observed.
Histological sections--Histological sections of the mouse-ears
injected with the angiogenic peptides were performed by fixing
tissues in 4% buffered formalin. Sections were embedded in paraffin
blocks sectioned in 4 .mu.m thick layers and stained with
hematoxolin-eosin.
Rat ischemic hind-limb model and laser-Doppler imager analysis--A
rat ischeric hind limb model was used for evaluation of the in vivo
potential of angiogenesis induced by the selected synthetic
peptides. Ischemia was created in the rat left hind limb by
ligation the femoral artery. The right hind limb served as a
control. A day after the operation each of the peptides was
injected into two sites close to the ligation and one site distal
to the ligation. Each rat was treated with each of the peptides in
a total amount of 600 .mu.g.
The blood flow was measured using a Laser Doppler Blood Flow
analyzer (MoorLDI, Moor Instrument, Wilmington, Del.) at 2, 6, 9
and 13 days after peptides injections. The average perfusion of
each limb was computed and blood flow was expressed as the ischemic
(left)/control (right) blood flow ratio.
Mouse ischemic hind limb model--Ischemia was created in the mouse
left hind limb by ligation of the femoral artery. The right hind
limb served as control. A day after the operation each of the
peptides was injected into one site close to the ligation and one
site distal to the ligation. Each mouse was treated with each of
the peptides in a total amount of 10 .mu.g.
Physiological observations--Ischemic mice were evaluated for their
ability to climb a ladder on day 1, 4, 7, and 10-post operation.
The scoring system was as follows: 1--walk and climb; 2--walk and
climb with some difficulty, 3--walk and cannot climb the ladder;
4--walk with difficulties and cannot climb the ladder.
Blood perfusion in ischemic mice--The percent of blood perfusion
was measured using a Laser Doppler Imager (PeriMed, Sweden) at 14
and 19 days after peptides injections. The average percent
perfusion of each limb was computed and expressed as the ischemic
(left)/control (right) blood perfusion ratio.
Statistical and graphical methods--were performed as described in
Example 1, hereinabove.
Experimental Results
In vivo angiogenesis in a mouse-ear model--Injection of the
synthetic peptides or VEGF into the ears of nude mice and Balb/C
mice resulted in increased number of blood vessels in the ears of
mice injected with 10 .mu.g of LT, YR, QF and SP (FIGS. 19b-e) or
VEGF (FIG. 19a). Histological examination of stained sections of
the ears revealed an increase in the number of blood vessels and
the appearance of neo-vascularizations in peptide injected ears
(FIGS. 20a-b, Table 11, hereinbelow).
TABLE-US-00011 TABLE 11 Blood vessels induced by peptide injection
Number of blood Peptide Concentration Days after inoculation
vessels FGF 3 ng/ear 5 11 control -- 5 7 VEGF 10 ng/ear 5 17
control -- 5 10 LT 10 .mu.g/ear 5 18 control -- 5 13 SP 10
.mu.g/ear 5 15 control -- 5 9 YR 10 .mu.g/ear 5 11 control -- 5 12
TR 10 .mu.g/ear 5 15 control -- 5 9 QF 10 .mu.g/ear 5 21 control --
5 15 VL 10 .mu.g/ear 5 14 control -- 5 12
Table 12, hereinbelow, summarizes the data obtained from a set of
experiments testing the effect of the peptides of the present
invention on in vivo ear angiogenesis.
TABLE-US-00012 TABLE 12 In vivo ear angiogenesis induced by
AngioPeptides No. of mice PBS Injected Peptide/PBS PBS 10 11.1 0.8
LT 10 11.3 3 SP 10 10 1 YR 8 12.1 7.6 TR 10 9.5 5.5 VL 10 9.8 5.6
QF 10 12.2 0.9 FGF 10 11.42 2.08 Table 12: Synthetic peptides or
PBS were injected to mice ears as described under Materials and
Experimental Methods and the number of blood vessels were counted
in PBS injected or the peptide injected ear. Peptide/PBS = the
ratio between the No. of blood vessels in the peptide-injected ear
and the No. of blood vessels in the PBS-injected ear.
Laser-Doppler analysis in a rat ischemic hind-limb model--The blood
flow of ischemic hind limb was measured after 600 .mu.g peptide
injection using a Laser Doppler Blood Flow analyzer (MoorLDI, Moor
Instrument) at 4 time points (at days 2, 6, 9 and 13). The percent
of median flux of the operated leg/control leg of rats treated with
peptides was calculated for each peptide injected. Treatment of
rats with the peptides QF and YR showed 112.5 and 108.2 percent
increase of median flux of the ischemic leg/control leg,
respectively (FIG. 21).
Physiological evaluation of the ability of the ischemic mice to
climb a ladder were followed on day 1, 4, 7, and 10-post operation
and the results are summarized in Table 13, hereinbelow.
TABLE-US-00013 TABLE 13 Physiological evaluation of ischemic mice
following peptide injection Injection Day 1 Day 4 Day 7 Day 10 PBS
3.07 3 2 2 FGF 2.57 2 1 1 YR 2.75 2.5 1.4 1 TR 3.05 2.5 1.6 1.4 QF
2.83 2 1.6 1.2 LT 3.07 2.25 1.6 1.2 VL 2.75 2 1.6 1.4 SP 2.85 2.25
1.75 1.6 Table 13: Physiological score of mice with hind limb
ischemia as determined by the ability to clime a ladder. Shown are
the mean scores of 10 mice in each group. The scoring system was as
following: 1 - walk and climb; 2 - walk and climb with some
difficulty; 3 - walk and cannot climb the ladder; 4 - walk with
difficulties and cannot climb the ladder.
The results presented in Table 13, hereinabove, demonstrate the
ability of the peptides of the present invention to prevent at
least some of the physiological difficulties present in ischemic
mice (e.g., climbing a ladder).
Injection of the synthetic peptides of the present invention
increases blood perfusion in ischemic mice--To further test the
potential of the synthetic peptides of the present invention to
induce angiogenesis in vivo, the percent of blood perfusion was
measured in ischemic mice using a Laser Doppler Imager (PeriMed,
Sweden) at 14 and 19 days following peptides injections. The
average percent perfusion of each limb was computed and expressed
as the ischemic (left)/control (right) blood perfusion ratio.
Significant differences were observed between the peptides
(P=0.0102). As is shown in Table 14, hereinbelow, a significant
increase in the percent of blood perfusion ratio was observed in
mice injected with QF and YR.
TABLE-US-00014 TABLE 14 The blood perfusion ratio (in percentages)
of the ischemic vs. control limbs Level Number Mean Std Dev Std Err
Mean FGF 4 93.438 8.3423 4.171 LT 4 78.275 11.0320 5.516 PBS 9
82.436 7.2285 2.410 QF 4 112.222 22.4931 11.247 SP 8 84.478 15.2471
5.391 TR 8 86.006 16.4668 5.822 VL 8 95.560 12.2757 4.340 YR 4
104.349 22.0348 11.017
Altogether, these results strongly suggest the use of the synthetic
peptides of the present invention, and especially, the QF and YR as
angiogenic, anti-ischemic agents.
Example 6
A Conserved Sequence Motif (SEQ ID NO: 13) Supports the Angiogenic
Function Attributed to the Peptides of the Present Invention
Sequence analysis of the isolated peptides revealed a conserved
amino acid sequence (SEQ ID NO: 27 or 32) which is shared by 3-4 of
the peptides VL; QF, TR and possibly YR (see FIGS. 22a-c).
This sequence was found by the eMOTIF scan software (Biochemistry,
Stanford University, Hypertext Transfer
Protocol://dnadotstanforddotedu/emotif/emotif-scandothtml) to be
shared with mouse vascular endothelial growth factor B precursor
(Swiss-Prot Accession: VEGB_MOUSE), which has a very similar human
homologue. The following peptide sequences YR (shared); LT and SP
may belong to a different group. Interestingly these two groups of
peptide were isolated under two different test conditions, while
the first (VL, QF and TR) were isolated under normoxic conditions
the second groups of peptides (YR, LT and SP) were selected under
hypoxic conditions, suggesting that these two groups bind to
different cellular determinants or with different affinities.
It is appreciated that certain features of the invention, which
are, for clarity, described in the context of separate embodiments,
may also be provided in combination in a single embodiment.
Conversely, various features of the invention, which are, for
brevity, described in the context of a single embodiment, may also
be provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with
specific embodiments thereof, it is evident that many alternatives,
modifications and variations will be apparent to those skilled in
the art. Accordingly, it is intended to embrace all such
alternatives, modifications and variations that fall within the
spirit and broad scope of the appended claims. All publications,
patents and patent applications mentioned in this specification are
herein incorporated in their entirety by reference into the
specification, to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporated herein by reference. In
addition, citation or identification of any reference in this
application shall not be construed as an admission that such
reference is available as prior art to the present invention.
REFERENCES CITED
(Additional References are Cited in the Text)
1. Liekens S, De Clerk E, Netts J. Angiogenesis: regulators and
clinical applications. Biochemical Pharmacology 61:253-270,
2001.
2. Lewis B, Flugelman M, Weisz A, Keren-Tal I, Schaper W.
Angiogenesis by gene therapy: a new horizon for myocardial
revascularization? Cardiovascular Research. 35:490-497, 1997.
3. Risau W. What if anything, is an angiogenic factor? Cancer
Metastasis Review 15:149-151, 1996.
4. Monacci W T, Merill M J, Oldflield E H. Expression of vascular
permeability factor/vascular endothelial growth factor in normal
rat tissues. Am. J. Physiology 264:C1362-C1002, 1993.
5. Nomura M, Yamagishi S, Harada S, Hayashi Y, Yamashima T,
Yamashita J and Yamamoto H. Possible participation of autocrine and
paracrine vascular endothelial growth factors in hypoxia induced
proliferation of endothelial cell and pericytes. J. Biological
Chemistry 47:28316-28324, 1995.
6. Ikeda E, Achen M G, Breier G, Risau W. Hypoxia induced
transcriptional activation and increased mRNA stability of vascular
endothelial growth factor in C6 glioma cells. J. Biol. Chem.
270:19761-19766, 1995.
7. Shweiki D, Itin A, Soller D, Keshet E. Vascular endothelial
growth factor induced by hypoxia may mediate hypoxia initiated
angiogenesis. Nature, 359:843-845, 1992.
8. Wang G L, Jiang B, Rue E, Semenza G. Hypoxia inducible factor 1
is a basic helix loop helix pas heterodimer regulated by cellular
oxygen tension. Proc. Natl. Acad. Sci. USA 92:5510-5514, 1995
9. Wang L, Xiong M, Che D, Liu S, Hao C, Zheng X The effect of
hypoxia on expression of basic fibroblast growth factor in
pulmonary vascular pericytes. J. Tongji Med Univ. 20:265-267,
2000.
10. Bainbridge J, Haiyan J, Bagherzadeh A, Selwood D, Ali R,
Zachery L Introduction of a chemical constraint in a short peptide
derived from human aFGF elicits mitogenic structural determinants.
Biochemical and Biophysical Research Communications 302: 793-799,
2003.
11. Liu R, Enstrom A, Lam K. Combinatorial peptide library for
immunobiology research. Experimental Hematology 31:11-30, 2003.
12. Giordano R., Cardo-Vila J., Lahdenrata, Pasqualini R, Arap W.
Biopanning and rapid analysis of selective interactive ligands.
Nature Medicine 7:1249-1253, 2001.
13. Hetian L, Ping A, Shumei S, Xiaoing L, Luowen H, Jian W, Lin M,
Meisheng L, Junshan Y, Chengchao S. A novel peptide isolated from a
phage display library inhibits tumor growth and metastasis by
blocking the binding of vascular endothelial growth factor to its
kinase domain receptor. J Biol Chem.277:43137-43142, 2002.
14. Conway E, Collen D, Carmeliet P. Molecular mechanisms of blood
vessels growth. Cardiovascular Research. 40:507-521, 2001.
SEQUENCE LISTINGS
1
32 1 36 DNA Artificial sequence Phage displayed peptide DNA
sequence 1 gttccgtgga tggagccggc ttatcagagg tttctg 36 2 12 PRT
Artificial sequence Phage displayed peptide 2 Val Pro Trp Met Glu
Pro Ala Tyr Gln Arg Phe Leu 1 5 10 3 36 DNA Artificial sequence
Phage displayed peptide DNA sequence 3 ctgcttgcgg atacgacgca
tcataggccg tggact 36 4 12 PRT Artificial sequence Phage displayed
peptide 4 Leu Leu Ala Asp Thr Thr His His Arg Pro Trp Thr 1 5 10 5
36 DNA Artificial sequence Phage displayed peptide DNA sequence 5
cagccttggt tggagcaggc ttattatagt acgttt 36 6 12 PRT Artificial
sequence Phage displayed peptide 6 Gln Pro Trp Leu Glu Gln Ala Tyr
Tyr Ser Thr Phe 1 5 10 7 36 DNA Artificial sequence Phage displayed
peptide DNA sequence 7 tctgcgcatg ggacgtctac tggtgttccg tggccg 36 8
12 PRT Artificial sequence Phage displayed peptide 8 Ser Ala His
Gly Thr Ser Thr Gly Val Pro Trp Pro 1 5 10 9 36 DNA Artificial
sequence Phage displayed peptide DNA sequence 9 tatccgcata
ttgattcgct tggtcattgg cggcgg 36 10 12 PRT Artificial sequence Phage
displayed peptide 10 Tyr Pro His Ile Asp Ser Leu Gly His Trp Arg
Arg 1 5 10 11 36 DNA Artificial sequence Phage displayed peptide
DNA sequence 11 actttgccgt ggctggagga gtcttattgg cgtcct 36 12 12
PRT Artificial sequence Phage displayed peptide 12 Thr Leu Pro Trp
Leu Glu Glu Ser Tyr Trp Arg Pro 1 5 10 13 6 PRT Artificial sequence
Consensus motif derived from integration of biologically active
phage displayed peptides 13 Pro Trp Xaa Xaa Xaa Tyr 1 5 14 5 PRT
Artificial sequence Synthetic peptide 14 Val Pro Trp Leu Glu 1 5 15
21 DNA Artificial sequence Single strand DNA oligonucleotide 15
ctacctccac catgccaagt g 21 16 21 DNA Artificial sequence Single
strand DNA oligonucleotide 16 tgcgctgata gacatccatg a 21 17 20 DNA
Artificial sequence Single strand DNA oligonucleotide 17 ttcctgccga
tgcatgtcta 20 18 20 DNA Artificial sequence Single strand DNA
oligonucleotide 18 tgttcgctgc ctgacactgt 20 19 23 DNA Artificial
sequence Single strand DNA oligonucleotide 19 tcaggcagct cacagtccta
gag 23 20 24 DNA Artificial sequence Single strand DNA
oligonucleotide 20 acttgtcgtc tgattctcca ggtt 24 21 21 DNA
Artificial sequence Single strand DNA oligonucleotide 21 tcagcgcatg
gcaataatag a 21 22 24 DNA Artificial sequence Single strand DNA
oligonucleotide 22 accaaggtgc tagccatctt attc 24 23 24 DNA
Artificial sequence Single strand DNA oligonucleotide 23 agtgtaccct
aactagccga ggaa 24 24 21 DNA Artificial sequence Single strand DNA
oligonucleotide 24 gcctgtgcag tgcaatacct t 21 25 20 DNA Artificial
sequence Single strand DNA oligonucleotide 25 gtcggagtca acggatttgg
20 26 26 DNA Artificial sequence Single strand DNA oligonucleotide
26 ggcaacaata tccactttac cagagt 26 27 7 PRT Artificial sequence
Consensus motif derived from integration of biologically active
phage displayed peptides 27 Pro Trp Xaa Xaa Xaa Xaa Tyr 1 5 28 207
PRT Mus musculus 28 Met Ser Pro Leu Leu Arg Arg Leu Leu Leu Val Ala
Leu Leu Gln Leu 1 5 10 15 Ala Arg Thr Gln Ala Pro Val Ser Gln Phe
Asp Gly Pro Ser His Gln 20 25 30 Lys Lys Val Val Pro Trp Ile Asp
Val Tyr Ala Arg Ala Thr Cys Gln 35 40 45 Pro Arg Glu Val Val Val
Pro Leu Ser Met Glu Leu Met Gly Asn Val 50 55 60 Val Lys Gln Leu
Val Pro Ser Cys Val Thr Val Gln Arg Cys Gly Gly 65 70 75 80 Cys Cys
Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gln His Gln 85 90 95
Val Arg Met Gln Ile Leu Met Ile Gln Tyr Pro Ser Ser Gln Leu Gly 100
105 110 Glu Met Ser Leu Glu Glu His Ser Gln Cys Glu Cys Arg Pro Lys
Lys 115 120 125 Lys Glu Ser Ala Val Lys Pro Asp Arg Val Ala Ile Pro
His His Arg 130 135 140 Pro Gln Pro Arg Ser Val Pro Gly Trp Asp Ser
Thr Pro Gly Ala Ser 145 150 155 160 Ser Pro Ala Asp Ile Ile His Pro
Thr Pro Ala Pro Gly Ser Ser Ala 165 170 175 Arg Leu Ala Pro Ser Ala
Val Asn Ala Leu Thr Pro Gly Pro Ala Ala 180 185 190 Ala Ala Ala Asp
Ala Ala Ala Ser Ser Ile Ala Lys Gly Gly Ala 195 200 205 29 35 PRT
Mus musculus 29 Pro Val Ser Gln Phe Asp Gly Pro Ser His Gln Lys Lys
Val Val Pro 1 5 10 15 Trp Ile Asp Val Tyr Ala Arg Ala Thr Cys Gln
Pro Arg Glu Val Val 20 25 30 Val Pro Leu 35 30 35 PRT Homo sapiens
30 Pro Val Ser Gln Pro Asp Ala Pro Gly His Gln Arg Lys Val Val Ser
1 5 10 15 Trp Ile Asp Val Tyr Thr Arg Ala Thr Cys Gln Pro Arg Glu
Val Val 20 25 30 Val Pro Leu 35 31 6 PRT Mus musculus 31 Pro Trp
Ile Asp Val Tyr 1 5 32 7 PRT Artificial sequence Consensus motif
derived from integration of biologically active phage displayed
peptides 32 Pro Trp Xaa Xaa Xaa Xaa Tyr 1 5
* * * * *