U.S. patent number 7,238,480 [Application Number 10/798,844] was granted by the patent office on 2007-07-03 for pyrophosphorolysis activated polymerization (pap).
This patent grant is currently assigned to City of Hope. Invention is credited to Qiang Liu, Arthur D. Riggs, Steve S. Sommer.
United States Patent |
7,238,480 |
Liu , et al. |
July 3, 2007 |
**Please see images for:
( Certificate of Correction ) ** |
Pyrophosphorolysis activated polymerization (PAP)
Abstract
A novel method of pyrophosphorolysis activated polymerization
(PAP) has been developed. In PAP, pyrophosphorolysis and
polymerization by DNA polymerase are coupled serially for each
amplification by using an activatable oligonucleotide P* that has a
non-extendible 3'-deoxynucleotide at its 3' terminus. PAP can be
applied for exponential amplification or for linear amplification.
PAP can be applied to amplification of a rare allele in admixture
with one or more wild-type alleles by using an activatable
oligonucleotide P* that is an exact match at its 3' end for the
rare allele but has a mismatch at or near its 3' terminus for the
wild-type allele. PAP is inhibited by a mismatch in the 3' specific
sequence as far as 16 nucleotides away from the 3' terminus. PAP
can greatly increase the specificity of detection of an extremely
rare mutant allele in the presence of the wild-type allele.
Specificity results from both pyrophosphorolysis and polymerization
since significant nonspecific amplification requires the
combination of mismatch pyrophosphorolysis and misincorporation by
the DNA polymerase, an extremely rare event. Using genetically
engineered DNA polymerases greatly improves the efficiency of
PAP.
Inventors: |
Liu; Qiang (Arcadia, CA),
Sommer; Steve S. (Duarte, CA), Riggs; Arthur D. (La
Verne, CA) |
Assignee: |
City of Hope (Duarte,
CA)
|
Family
ID: |
30119495 |
Appl.
No.: |
10/798,844 |
Filed: |
March 12, 2004 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20050095608 A1 |
May 5, 2005 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
10434369 |
May 9, 2003 |
7033763 |
|
|
|
10269879 |
Oct 15, 2002 |
7105298 |
|
|
|
09789556 |
Feb 22, 2001 |
6534269 |
|
|
|
60379092 |
May 10, 2002 |
|
|
|
|
60237180 |
Oct 3, 2000 |
|
|
|
|
60187035 |
Mar 6, 2000 |
|
|
|
|
60184315 |
Feb 23, 2000 |
|
|
|
|
Current U.S.
Class: |
435/6.11;
435/6.12; 435/91.1; 435/91.2 |
Current CPC
Class: |
C12Q
1/6827 (20130101); C12Q 1/6858 (20130101); C12Q
1/6827 (20130101); C12Q 1/6858 (20130101); C12Q
1/6858 (20130101); C12Q 1/6858 (20130101); C12Q
1/6827 (20130101); C12Q 1/6858 (20130101); C12Q
2525/186 (20130101); C12Q 2521/319 (20130101); C12Q
2535/125 (20130101); C12Q 2565/301 (20130101); C12Q
2535/125 (20130101); C12Q 2525/186 (20130101); C12Q
2521/319 (20130101); C12Q 2535/131 (20130101); C12Q
2525/186 (20130101); C12Q 2521/319 (20130101); C12Q
2535/125 (20130101); C12Q 2565/301 (20130101); C12Q
2535/125 (20130101); C12Q 2525/186 (20130101); C12Q
2565/301 (20130101); C12Q 2535/125 (20130101); C12Q
2525/186 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12P 19/34 (20060101) |
Field of
Search: |
;435/6 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 892 058 |
|
Jan 1999 |
|
EP |
|
0 892 058 |
|
Jan 1999 |
|
EP |
|
Other References
Bi, W. and Stambrook, P.J., "Detection of known mutation by
proof-reading PCR," Nucleic Acids Res, 1998, 26:3073-3075. cited by
other .
Meyer, P.R. et al., "Unblocking of chain-terminated primer by HIV-1
reverse transcriptase through a nucleotide-dependent mechanism,"
Proc Natl Acad Sci USA, 1998, 95:13471-13476. cited by other .
Liu, Q. et al., "Pyrophosphorolysis-Activated Polymerization (PAP):
Application to Allele-Specific Amplification," Biotechniques
29:1072-1083, 2000. cited by other .
Sommer, S.S., et al., "PCR Amplification of Specific Alles (PASA)
is a General Method for Rapidly Detecting Known Single-Base
Changes," Biotechniques 12(1):82-87, 1992. cited by other .
Tabor, S., et al., "DNA Sequence Analysis with a Modified
Bacteriophage T7 DNA Polymerase," The Journal of Biological
Chemistry 265(14):8322-8328, May 15, 1990. cited by other.
|
Primary Examiner: Horlick; Kenneth R.
Attorney, Agent or Firm: Rothwell, Figg, Ernst & Manbeck
p.c.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application is a continuation of U.S. patent
application Ser. No. 10/434,369 filed 9 May 2003, now U.S. Pat. No.
7,033,763, which in turn is a continuation-in-part of U.S. patent
application Ser. No. 10/269,879 filed on 15 Oct. 2002, now U.S.
Pat. No. 7,105,298, which in turn is a division of U.S. patent
application Ser. No. 09/789,556 filed on 22 Feb. 2001, now U.S.
Pat. No. 6,534,269. Ser. No. 09/789,556 is further related to and
claims priority under 35 USC .sctn.119(e) to U.S. provisional
patent application Ser. Nos. 60/184,315 filed on 23 Feb. 2000, and
60/187,035 filed on 6 Mar. 2000, 60/237,180 filed on 3 Oct. 2000.
Ser. No. 10/434,369 is further related to and claims priority under
35 USC .sctn. 119(e) to U.S. provisional patent application Ser.
No. 60/379,092 filed on 10 May 2002. Each of these applications is
incorporated herein by reference.
Claims
What is claimed is:
1. A method for determining the presence or absence of a nucleic
acid hybrid in a sample comprising the following steps: (a)
providing a reaction mixture comprising (i) a sample that may
contain a nucleic acid hybrid wherein one strand of the hybrid
comprises an activatable oligonucleotide having a non-extendible
3'-terminus, (ii) pyrophosphate, (iii) an enzyme that catalyzes the
release of a nucleotide from a nucleic acid hybrid, by
pyrophosphorolysis of the non-extendible 3'-terminus of a strand of
the nucleic acid hybrid in the presence of pyrophosphate, and (iv)
a suitable nucleotide that can be incorporated in the place of said
released nucleotide; (b) maintaining said reaction mixture for a
time period and under conditions that permit (i) pyrophosphorolysis
of the non-extendible 3'-terminus of a strand of a nucleic acid
hybrid to produce a released nucleotide and a modified 3'-terminus
as well as (ii) the incorporation of said suitable nucleotide into
the modified 3'-terminus of the nucleic acid hybrid to produce an
incorporated modified 3'-terminus, thereby forming a treated
sample; and (c) assaying the treated sample to determine whether
incorporation of said suitable nucleotide into the hybrid occurred
and thereby determining the presence or absence of a nucleic acid
hybrid in said sample.
2. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 1 wherein the nucleotide suitable
for incorporation into the modified 3'-terminus of the nucleic acid
hybrid includes a label.
3. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 1 wherein the method of assaying
whether incorporation of a suitable nucleotide occurred comprises
determining whether the label is associated with the nucleic acid
hybrid.
4. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 2 wherein the label is a fluorescent
label.
5. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 1 wherein said nucleic acid hybrid
is formed between a target nucleic acid strand and a probe nucleic
acid strand.
6. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 1 wherein said nucleic acid hybrid
comprises a label.
7. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 2 wherein said nucleotide suitable
for incorporation into the modified 3'-terminus of the nucleic acid
hybrid is a chain terminating or other polymerization-blocking
nucleotide.
8. The method of detecting the presence or absence of a nucleic
acid hybrid according to claim 5 wherein assaying to determine
whether incorporation of said suitable nucleotide occurred is
carried out by detecting an increase in the length of said
probe.
9. A method for determining the presence or absence of a nucleic
acid target in a sample comprising the following steps: (a)
providing a reaction mixture comprising (i) a sample that may
contain a nucleic acid target, (ii) a nucleic acid probe
corresponding to said nucleic acid target, wherein the nucleic acid
probe comprises an activatable oligonucleotide having a
non-extendible 3' terminus, (iii) pyrophosphate, (iv) an enzyme
that catalyzes the release of a nucleotide from a nucleic acid
hybrid, wherein one strand of the hybrid comprises an activatable
oligonucleotide having a non-extendible 3'-terminus, by
pyrophosphorolysis of the non-extendible 3'-terminus of a strand of
the nucleic acid hybrid in the presence of pyrophosphate, and (v) a
suitable nucleotide that can be incorporated in the place of said
released nucleotide; (b) maintaining said reaction mixture for a
time period and under conditions that permit (i) hybridization of
the nucleic acid target with the nucleic acid probe to form a
nucleic acid hybrid that comprises a non-extendible 3'-terminus,
(ii) pyrophosphorolysis of the non-extendible 3'-terminus of a
strand of a nucleic acid hybrid to produce a released nucleotide
and a modified 3'-terminus as well as (iii) the incorporation of
said suitable nucleotide into the modified 3'-terminus of the
nucleic acid hybrid to produce an incorporated modified
3'-terminus, thereby forming a treated sample; and (c) assaying the
treated sample to determine whether incorporation of said suitable
nucleotide occurred and thereby determining the presence or absence
of the nucleic acid target in said sample.
10. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 9 wherein said reaction
mixture may comprise a plurality of nucleic acid targets and their
corresponding nucleic acid probes.
11. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 10 wherein said nucleic
acid probes are distinguishable from one another on the basis of
length, thereby permitting the determination of the presence or
absence of a plurality of nucleic acid targets.
12. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 10 wherein the suitable
nucleotides incorporated to form the incorporated modified
3'-terminus permit distinction between the probes, thereby
permitting the determination of the presence or absence of a
plurality of nucleic acid targets.
13. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 12 wherein the nucleic
acid probes having incorporated modified 3'-termini are
distinguishable from one another on the basis of the suitable
nucleotide incorporated or on the basis of length, thereby
permitting the determination of the presence or absence of a
plurality of nucleic acid targets.
14. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 9 wherein said reaction
mixture may comprise a plurality of nucleic acid targets that
differ from one another by a single base.
15. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 14 wherein said
plurality of nucleic acid targets differ from one another by a
single base at an interrogation position.
16. The method for determining the presence or absence of a nucleic
acid target in a sample according to claim 15 wherein the
penultimate 3'-terminal residue of the corresponding nucleic acid
probe base pairs with the interrogation position of the nucleic
acid target.
17. A method for determining the presence or absence of a specific
nucleic acid base at an interrogation position of a nucleic acid
target in a sample comprising the following steps: (a) providing a
reaction mixture comprising (i) a sample that may contain a nucleic
acid target having a nucleic acid residue at an interrogation
position, (ii) a nucleic acid probe comprising a nucleic acid
residue in its 3'-terminus that base pairs with the interrogation
position of the nucleic acid target when the nucleic acid target
and the nucleic acid probe are hybridized to form a nucleic acid
hybrid, wherein the nucleic acid probe comprises an activatable
oligonucleotide having a non-extendible 3' terminus, (ii)
pyrophosphate, (iii) an enzyme that catalyzes the release of a
nucleotide from a nucleic acid hybrid, a wherein one strand of the
hybrid comprises an activatable oligonucleotide having a
non-extendible 3'-terminus, by pyrophosphorolysis of the
non-extendible 3'-terminus of a strand of the nucleic acid hybrid
in the presence of pyrophosphate, and (iv) a suitable nucleotide
that can be incorporated in the place of said released nucleotide;
(b) maintaining said reaction mixture for a time period and under
conditions that permit (i) formation of a nucleic acid hybrid
between the nucleic acid probe and the nucleic acid target, (ii)
pyrophosphorolysis of the non-extendible 3'-terminus of a strand of
a nucleic acid hybrid to produce a released nucleotide and a
modified 3'-terminus and (iii) the incorporation of said suitable
nucleotide into the modified 3'-terminus of the nucleic acid hybrid
to produce an incorporated modified 3'-terminus, thereby forming a
treated sample; and (c) assaying the treated sample to determine
whether incorporation of said suitable nucleotide occurred and
thereby determining the presence or absence of a specific nucleic
acid base at an interrogation position of a nucleic acid target in
said sample.
18. The method for determining the presence or absence of a
specific nucleic acid base at an interrogation position of a
nucleic acid target in a sample according to claim 17 wherein the
nucleic acid residue of the nucleic acid probe that corresponds
with the interrogation position of the nucleic acid target is the
3'-terminal residue.
19. The method for determining the presence or absence of a
specific nucleic acid base at an interrogation position of a
nucleic acid target in a sample according to claim 17 wherein the
nucleic acid residue of the nucleic acid probe that corresponds
with the interrogation position of the nucleic acid target is the
penultimate 3'-terminal residue.
20. The method for determining the presence or absence of a nucleic
acid hybrid in a sample according to claim 1 wherein said nucleic
acid hybrid is affixed to a solid support.
21. The method for determining the presence or absence of a nucleic
acid hybrid in a sample according to claim 20 wherein said nucleic
acid hybrid is affixed to a solid support through attachment of a
strand of the nucleic acid hybrid to said solid support.
22. A method of determining a nucleotide sequence of a nucleic acid
hybrid that comprises the following steps: (a) providing a reaction
mixture comprising (i) a sample that contains a nucleic acid hybrid
wherein one strand of the hybrid comprises an activatable
oligonucleotide having a non-extendible 3'-terminus, (ii)
pyrophosphate, (iii) an enzyme that catalyzes the release of a
nucleotide from a nucleic acid hybrid, by pyrophosphorolysis of the
non-extendible 3'-terminus of a strand of the nucleic acid hybrid
in the presence of pyrophosphate, and (iv) a suitable nucleotide
that can be incorporated in the place of said released nucleotide;
(b) maintaining said reaction mixture for a time period and under
conditions that permit (i) pyrophosphorolysis of the non-extendible
3'-terminus of a strand of a nucleic acid hybrid to produce a
released nucleotide and a modified 3'-terminus as well as (ii) the
incorporation of said suitable nucleotide into the modified
3'-terminus of the nucleic acid hybrid to produce an incorporated
modified 3'-terminus, thereby forming a treated sample; and (c)
assaying the treated sample to determine where incorporation of
said suitable nucleotide into the hybrid occurred and thereby
determining nucleotide sequence of the nucleic acid hybrid.
23. The method of determining a nucleotide sequence of a nucleic
acid hybrid according to claim 22 wherein said nucleic acid hybrid
is formed by a combination of a nucleic acid probe with a nucleic
acid target.
Description
BACKGROUND OF THE INVENTION
This invention relates to nucleic acid polymerization and
amplification. In particular, it relates to a novel and general
method for nucleic acid amplification, in which pyrophosphorolysis
and polymerization are serially-coupled. The method has been
adapted for allele-specific amplification and can greatly increase
the specificity to detect an extremely rare allele in the presence
of wild-type alleles. We refer to the method as pyrophosphorolysis
activated polymerization (PAP).
The publications and other materials used herein to illuminate the
background of the invention or provide additional details
respecting the practice, are incorporated by reference, and for
convenience are respectively grouped in the appended
Bibliography.
Multiple methods for detecting mutations present in less than 10%
of cells (i.e. rare alleles) have been developed, including PCR
amplification of specific alleles (PASA), peptide nucleic acid
(PNA) clamping blocker PCR, allele-specific competitive blocker
PCR, mismatch amplification mutation assay (MAMA), restriction
fragment-length polymorphism (RFLP)/PCR (Parsons and Heflich, 1997)
and QE-PCR (Ronai and Minamoto, 1997). These methods: i) amplify
the rare allele selectively, ii) destroy the abundant wild-type
allele, or iii) spatially separate the rare allele from the
wild-type allele. The specificity achievable under typical
research/clinical conditions is 10.sup.-3 (Parsons and Heflich,
1997), although a few publications reported higher specificity of
detection (Pourzand and Cerutti, 1993; Knoll et al., 1996). These
methods either do not generally achieve the higher specificity or
are not suitable for routine analysis.
A robust method of detecting one mutant allele in 10.sup.4-10.sup.9
wild-type alleles would be advantageous for many applications
including detecting minimal residual disease (recurrence after
remission or rare remaining cancer cells in lymph nodes and other
neighboring tissues) and measurement of mutation load (the
frequency and pattern of somatic mutations present in normal
tissues). Individuals with a high mutation load may be at increased
risk for cancer due to either environmental exposure or endogenous
defects in any of hundreds of genes necessary to maintain the
integrity of the genome. For those individuals found to have a high
mutation load, clues to etiology can be obtained by defining the
mutation pattern.
There are many DNA sequencing methods and their variants, such as
the Sanger sequencing using dideoxy termination and denaturing gel
electrophoresis (Sanger et al., 1977), Maxam-Gilbert sequencing
using chemical cleavage and denaturing gel electrophoresis (Maxam
and Gilbert, 1977), pyro-sequencing detecting pyrophosphate
(PP.sub.i) released during the DNA polymerase reaction (Ronaghi et
al., 1998), and sequencing by hybridization (SBH) using
oligonucleotides (Lysov et al., 1988; Bains and Smith, 1988;
Drmanac et al., 1989; Khrapko et al., 1989; Pevzner et al., 1989;
Southern et al., 1992).
There are multiple gel-based methods for scanning for unknown
mutations including single stranded conformation polymorphism
(SSCP) and the SSCP-hybrid methods of dideoxy fingerprinting (ddF),
restriction endonuclease fingerprinting (REF), and Detection Of
Virtually All Mutations-SSCP (DOV AM-S), denaturing gradient gel
electrophoresis (DGGE), denaturing HPLC (dHPLC) chemical or
enzymatic cleavage (Sarkar et al., 1992; Liu and Sommer, 1995; Liu
et al., 1999; Myers et al., 1985; Cotton et al., 1988; Liu et al.,
1999; Buzin et al., 2000; Spiegelman et al., 2000). DOVAM-S and
chemical cleavage reactions have been shown in blinded analyses to
identify essentially all mutations (Buzin et al., 2000). dHPLC,
which is based on reverse phase chromatography, also may identify
essentially all mutations under appropriate conditions (O'Donovan
et al., 1998; Oefner and Underhill, 1998; Spiegelman et al., 2000).
Efforts are under way to develop general scanning methods with
higher throughput.
Sequencing by hybridization (SBH) is being adapted to scanning or
resequencing for unknown mutations on microarrays (Southern, 1996).
This continues to be a promising area of intense study. However it
is not possible as yet to detect most microinsertions and deletions
with this approach and the signal to noise ratio for single base
changes precludes detection of 5-10% of single nucleotide changes
(Hacia, 1999). Alternative approaches warrant exploration.
It is becoming increasingly apparent that in vivo chromatin
structure is crucial for mammalian gene regulation and development.
Stable changes in chromatin structure often involve changes in
methylation and/or changes in histone acetylation. Somatically
heritable changes in chromatin structure are commonly called
epigenetic changes (Russo and Riggs, 1996) and it is now clear that
epigenetic "mistakes" or epimutations are frequently an important
contributing factor to the development of cancer (Jones and Laird,
1999).
One of the few methods for assaying in vivo chromatin structure,
and the only method with resolution at the single nucleotide level,
is ligation-mediated PCR (LM-PCR) (Mueller and Wold, 1989; Pfeifer
et al., 1989) and its variant of terminal transferase-mediated PCR
(TD-PCR) (Komura and Riggs, 1998). Many aspects of chromatin
structure can be determined by LM-PCR, such as the location of
methylated cytosine residues, bound transcription factors, or
positioned nucleosomes. It is readily apparent that LM-PCR works
better with some primer sets than with others. Thus, it is desired
to develop a more robust method of measuring chromatin
structure.
Thus, it is an object of the present invention to develop
alternative methods for amplification of DNA, for sequencing DNA
and for analysis of chromatin structure. This object is
accomplished by the use of the novel pyrophosphorolysis activated
polymerization (PAP) as described herein. PAP has the potential to
enhance dramatically the specificity of the amplification of
specific alleles, for resequencing DNA and for chromatin structure
analysis.
SUMMARY OF THE INVENTION
The invention is a pyrophosphorolysis activated polymerization
(PAP) method of synthesizing a desired nucleic acid strand on a
nucleic acid template strand. The method comprises the following
steps carried out serially.
(a) Annealing to the template strand a complementary activatable
oligonucleotide P*. This activatable oligonucleotide has a
non-extendible 3' terminus that is activatable by
pyrophosphorolysis (hereinafter referred to as a non-extendible 3'
terminus or a 3' non-extendible end or a non-extendible 3' end).
The non-extendible 3' terminus (or end) is a nucleotide or
nucleotide analog which has the capacity to form a Watson-Crick
base bair with a complementary nucleotide and which lacks a 3' OH
capable of being extended by a nucleic acid polymerase. In one
embodiment, the non-extendible 3' terminus may be a non-extendible
3' deoxynucleotide, such as a dideoxynucleotide. In a second
embodiment, the non-estendible 3' terminus may be a chemically
modified nucleotide lacking the 3' hydroxyl group, such as an
acyclonucleotide. Acyclonucleotides substitute a
2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar
normally present in dNMPs. In other embodiments, the non-extendible
3' terminus may be other blockers as described herein. In one
embodiment, the activatable oligonucleotide P* has no nucleotides
at or near its 3' terminus that mismatch the corresponding
nucleotides on the template strand. In a second embodiment, the
activatable oligonucleotide P* has a mismatch at or within 16
nucleotides of its 3' terminus with respect to a corresponding
nucleotide on the template strand. The terminal 3'-deoxynucleotide
is hybridized to the template strand when the oligonucleotide P* is
annealed.
(b) Pyrophosphorolyzing the annealed activatable oligonucleotide P*
with pyrophosphate and an enzyme that has pyrophosphorolysis
activity. This activates the oligonucleotide P* by removal of the
hybridized non-extendible 3' terminus.
(c) Polymerizing by extending the activated oligonucleotide P* on
the template strand in presence of four nucleoside triphosphates of
their analogs and a nucleic acid polymerase to synthesize the
desired nucleic acid strand.
The PAP method can be applied to amplify a desired nucleic acid
strand by the following additional steps.
(d) Separating the desired nucleic acid strand of step (c) from the
template strand, and
(e) Repeating steps (a)-(d) until a desired level of amplification
of the desired nucleic acid strand is achieved.
In a preferred aspect, the PAP method as described above is applied
to allele-specific amplification (PAP-A). In this application, the
nucleic acid template strand is a sense or antisense strand of one
allele and is present in admixture with the corresponding (sense or
antisense) nucleic acid strand of the second allele (the allelelic
strand). The activatable oligonucleotide P* has at least one
nucleotide or analog at or near its 3' terminus, e.g., within 16
nucleotides of the 3' terminus, that mismatches the corresponding
nucleotide of the allelic strand. Because of the mismatch, in step
(a) of the PAP method the non-extendible 3' terminus of
oligonucleotide P* is not substantially hybridized to the allelelic
strand. In step (b) the pyrophosphorolysis does not substantially
remove the non-hybridized non-extendible 3' terminus from the
activatable oligonucleotide P* annealed to the allelic strand. In
step (c) the oligonucleotide P* is not substantially extended by
polymerization on the allelic strand. As a result, the desired
nucleic acid strand synthesized on the template strand is amplified
preferentially over any nucleic acid strand synthesized on the
allelelic strand.
In a second preferred aspect, the PAP-A method described above can
be performed bidirectionally (Bi-PAP-A). Bidirectional-PAP (Bi-PAP)
is a novel design that preferably uses two opposing
pyrophosphorolysis activatable oligonucleotides (P*) with one
nucleotide overlap at their 3' termini. Thus, in Bi-PAP, PAP-A is
performed with a pair of opposing activatable oligonucleotide P*s.
Both the downstream and upstream P*s are specific for the
nucleotide of interest at the 3' termini (e.g., an A:T base pair).
In the initial round of amplification from genomic DNA, segments of
undefined size are generated. In subsequent rounds, a segment equal
to the combined lengths of the oligonucleotides minus one is
amplified exponentially. Nonspecific amplification occurs at lower
frequencies because this design eliminates misincorporation error
from an unblocked upstream. The P*s may be 30-60 nucleotides for
most efficient amplification.
The PAP method can be used to amplify either RNA or DNA. When used
to amplify DNA, the activatable oligonucleotide P* may be a
2'-deoxyoligonucleotide, the non-extendible 3' terminus may be,
e.g., a 2',3'-dideoxynucleotide or an acyclonucleotide or other
blockers as described herein, the four nucleoside triphosphates are
2'-deoxynucleoside triphosphates or their analogs, and the nucleic
acid polymerase is a DNA polymerase. The DNA polymerase used in
step (c) can also be the enzyme having pyrophosphorolysis activity
used in step (b). Preferred DNA polymerases having
pyrophosphorolysis activity are thermostable Tfl, Taq, and
genetically engineered DNA polymerases, such as AmpliTaqFs and
ThermoSequenase.TM.. These genetically engineered DNA polymerases
have the mutation F667Y or an equivalent mutation in their active
sites. The use of genetically engineered DNA polymerases, such as
AmpliTaqFs and ThermoSequenase.TM., greatly improves the efficiency
of PAP. These Family I DNA polymerases can be used when the
activatable oligonucleotide P* is a 3' dideoxynucleotide or an
acyclonucleotide. When the activatable oligonucleotide P* is an
acyclonucleotide, Family II archaeon DNA polymerases can also be
used. Examples of such polymerases include, but are not limited to,
Vent (exo-) and Pfu (exo-). These polymerases efficiently amplify
3' acyclonucleotide blocked P*. Two or more polymerases can also be
used in one reaction. If the template is RNA, the nucleic acid
polymerase may be RNA polymerase, reverse transcriptase, or their
variants. The activatable oligonucleotide P* may be a
ribonucleotide or a 2'-deoxynucleotide. The non-extendible 3'
terminus may be a 3' deoxyribonucleotide or an acyclonucleotide.
The four nucleoside triphosphates may be ribonucleoside
triphosphates, 2' deoxynucleoside triphosphates or their analogs.
For convenience, the description that follows uses DNA as the
template. However, RNA is also included, such as described for the
present aspect.
Amplification by the PAP method can be linear or exponential.
Linear amplification is obtained when the activatable
oligonucleotide P* is the only complementary oligonucleotide used.
Exponential amplification is obtained when a second opposing
oligonucleotide, which may be a P*, is present that is
complementary to the desired nucleic acid strand. The activatable
oligonucleotide P* and the second oligonucleotide flank the region
that is targeted for amplification. In step (a) the second
oligonucleotide anneals to the separated desired nucleic acid
strand product of step (d). In step (c) polymerization extends the
second oligonucleotide on the desired nucleic acid strand to
synthesize a copy of the nucleic acid template strand. In step (d)
the synthesized nucleic acid template strand is separated from the
desired nucleic acid strand. Steps (a) through (d) are repeated
until the desired level exponential amplification has been
achieved.
In the PAP method, a mismatch between the activatable
oligonucleotide P* and the template strand results in no
substantial amplification, if the mismatch occurs in the 3'
specific subsequence of P* at the 3' terminus of P* or within 16
nucleotides of the 3' terminus of P*. This lack of amplification
for such mismatches in the 3' specific subsequence of P* provides
four billion different and specific oligonucleotides with one base
substitution resolution.
In a preferred aspect, the PAP method is used for exponential
amplification of a rare, mutant allele in a mixture containing one
or more wild-type alleles. Strands of the alleles are separated to
provide single-stranded nucleic acid, and then the following steps
are carried out serially.
(a) Annealing to the sense or antisense strands of each allele a
complementary activatable 2'-deoxyoligonucleotide P* that has a
non-extendible 3' terminus. The non-extendible 3' terminus may be,
e.g., a non-extendible 2',3'-dideoxynucleotide or an
acyclonucleotide. P* has no 2'-deoxynucleotides at or near its 3'
terminus that mismatch the corresponding 2'-deoxynucleotides on the
mutant strand, but has at least one 2'-deoxynucleotide at or near
its 3' terminus that mismatches the corresponding
2'-deoxynucleotide on the wild-type stand. Consequently, the
non-extendible 3' terminus is hybridized to the mutant strand but
not to the wild-type strand when the oligonucleotide P* is
annealed. Simultaneously, a second 2'-deoxyoligonucleotide that is
complementary to the anti-parallel strands of each allele is
annealed to the anti-parallel strands. The activatable
2'-deoxyoligonucleotide P* and the second 2'-deoxyoligonucleotide
flank the region of the gene to be amplified.
(b) Pyrophosphorolyzing the activatable 2'-deoxyoligonucleotide P*
that is annealed to a mutant strand with pyrophosphate and an
enzyme that has pyrophosphorolysis activity. This activates the
2'-deoxyoligonucleotide P* that is annealed to the mutant strand by
removal of the hybridized non-extendible 3' terminus. It does not
substantially activate the 2'-deoxyoligonucleotide P* when it is
annealed to the mutant strand because the non-hybridized
non-extendible 3' terminus is not substantially removed by the
pyrophosphorolysis.
(c) Polymerizing by extending the activated oligonucleotide P* on
the mutant strand in presence of four nucleoside triphosphates or
their analogs and a DNA polymerase and extending the second
2'-deoxyoligonucleotide on both mutant and wild-type anti-parallel
strands.
(d) Separating the extension products of step (c);
(e) Repeating steps (a)-(d) until the desired level of
amplification of the mutant allele has been achieved.
The activatable 2'-deoxyoligonucleotide P* is annealed to the
antisense strands of the alleles and the second
2'-deoxyoligonucleotide is annealed to the sense strands, or vice
versa.
Steps (a) to (c) of PAP can be conducted sequentially as two or
more temperature stages on a thermocycler, or they can be conducted
as one temperature stage on a thermocycler.
Nucleoside triphosphates and 2'-deoxynucleoside triphosphates or
their chemically modified versions may be used as substrates for
multiple-nucleotide extension by PAP, i.e., when one nucleotide is
incorporated the extending strand can be further extended.
2',3'-dideoxynucleoside triphosphates, their chemically modified
versions, acyclonucleotides or other blocked nucleotides which are
terminators for further extension may be used for single-nucleotide
extension. 2',3'-dideoxynucleoside triphosphates may be labeled
with radioactivity or dye for differentiation from the 3' terminal
dideoxynucleotide, if present, of oligonucleotide P*. Mixtures of
nucleoside triphosphates or 2'-deoxynucleotide triphosphates or
their analogs, and 2',3'-dideoxynucleoside triphosphates or their
analogs may also be used.
PAP can be used in a novel method of DNA sequence determination. In
PAP, pyrophosphorolysis and polymerization by DNA polymerase are
coupled serially by using P*, an oligonucleotide containing a
non-extendible 3' terminus. The non-extendible 3' terminus may be,
e.g., a non-extendible 3'-deoxynucleotide or an acyclonucleotide.
This principle is based on the specificity of PAP and in turn on
the base pairing specificity of the 3' specific subsequence. This
property of the 3' specific subsequence can be applied to scan or
resequence for unknown sequence variants, to determine de novo DNA
sequence, to compare two DNA sequences, and to monitor gene
expression profiling in large scale. A P* array is possible in
these methods. That is, each of the P*s can be immobilized at an
individual dot or a solid support, thus allowing all the PAP
reactions to be processed in parallel.
Thus in one aspect, the PAP method is used for scanning or
resequencing unknown sequence variants within a predetermined
sequence by carrying out the following steps serially.
(a) Mixing under hybridization conditions a template strand of the
nucleic acid with multiple sets of four activatable
oligonucleotides P* which are sufficiently complementary to the
template strand to hybridize therewith. Within each set the
oligonucleotides P* differ, from each other in having a different
non-extendible 3' terminus, so that the non-extendible 3' terminus
is hybridized to the template strand if the template strand is
complementary to the non-extendible 3' terminus. The number of sets
corresponds to the number of nucleotides in the sequence. The
non-extendible 3' terminus may be, e.g., a non-extendible
3'-deoxynucleotide or an acyclonucleotide.
(b) Treating the resulting duplexed P*s with pyrophosphate and an
enzyme that has pyrophosphorolysis activity to activate by
pyrophosphorolysis only those oligonucleotides P* which have a
non-extendible 3' terminus that is hybridized to the template
strand.
(c) Polymerizing by extending the activated oligonucleotides P* on
the template strand in presence of four nucleoside triphosphates or
their analogs and a nucleic acid polymerase.
(d) Separating the nucleic acid strands synthesized in step (c)
from the template strand.
(e) Repeating steps (a)-(d) until a desired level of amplification
is achieved, and
(f) Arranging the nucleic acid sequence in order by analyzing
overlaps of oligonuclotides P* that produced amplifications.
In a second aspect, the PAP method is used for determining de novo
the sequence of a nucleic acid by carrying out the following steps
serially.
(a) Mixing under hybridization conditions a template strand of the
nucleic acid with multiple activatable oligonucleotides P*. All of
the oligonucleotides P* have the same number n of nucleotides as
the template and constitute collectively all possible sequences
having n nucleotides. All of the oligonucleotides P* have a
non-extendible 3' terminus. The non-extendible 3' terminus may be,
e.g., a non-extendible 3'-deoxynucleotide or an acyclonucleotide.
Any oligonucleotides P* that are sufficiently complementary will
hybridize to the template strand. The non-extendible 3' terminus
will hybridize to the template strand only if the template strand
is complementary at the position corresponding to the 3'
terminus.
(b) Treating the resulting duplexed P*s with pyrophosphate and an
enzyme that has pyrophosphorolysis activity to activate only those
hybridized oligonucleotides P* which have a non-extendible 3'
terminus that is hybridized to the template strand, by
pyrophosphorolysis of those hybridized non-extendible 3'
termini.
(c) Polymerizing by extending the activated oligonucleotides P* on
the template strand in presence of four nucleoside triphosphates or
their analogs and a nucleic acid polymerase.
(d) Separating the nucleic acid strands synthesized in step (c)
from the template strand.
(e) Repeating steps (a)-(d) until a desired level of amplification
has been achieved, and
(f) Determining the sequence of oligonucleotides P* that produced
amplifications, then arranging the nucleic acid sequence in order
by analyzing overlaps of these oligonucleotides.
PAP can also be used to study chromatin structure analogously to
ligation-mediated PCR (LM-PCR) by carrying out the following steps
serially. LM-PAP has been used for the determination of primary
nucleotide sequence, cytosine methylation patterns, DNA lesion
formation and repair and in vivo protein-DNA footprints (Dai et
al., 2000; Mueller and Wold, 1989; Pfeifer et al., 1989; Pfeifer et
al., 1999; Becker and Grossman, 1993). Ligation-mediated PAP
(LM-PAP) involves cleavage, primer extension, linker ligation and
PAP that can be applied for analysis of in vivo chromatin
structure, such as, methylated state of chromosomes, and for other
nucleic acid analysis as for LM-PCR.
The nature of LM-PAP is that the template is synthesized before
PAP, such as by ligation reaction or by extension using terminal
transferase. PAP may be any type of PAP: with only one P*, with two
opposing oligonucleotides where at least one is P*, Bi-PAP, matched
PAP, mismatched PAP, and so on. Thus, at its simplest, LM-PAP is
the application of PAP to a presynthesized template. LM-PAP may be
performed by steps (i), (ii), (iii), (iv) and (v), by steps (i),
(ii), (iii) and (vi), by steps (ii), (iii), (iv) and (v) or by
steps (ii), (iii) and (vi), where the steps are as follows.
(i) The cleavage occurs chemically, enzymatically or naturally to
"breakdown" nucleic acid strands. The nucleic acid usually is
genomic DNA that may have lesions or nicks produced in vivo.
(ii) The oligonucleotide P1 is gene-specific and its extension
includes: 1) annealing to the template strand a substantially
complementary oligonucleotide; 2) extending the oligonucleotide on
the template strand in the presence of nucleoside triphosphates or
their analogs and a nucleic acid polymerase, the extension "runs
off" at the cleavage site on the template strand. Steps 1) and 2)
may be repeated.
The primer extension may be replaced by a P* extension, in which
the above PAP is performed with only one activatable
oligonucleotide P*.
(iii) The linker ligation step includes ligation of a linker to the
3' terminus of the synthesized nucleic acid strand. The linker
ligation step may be replaced by a terminal transferase extension
that is non-template dependent polymerization and an extra nucleic
acid sequence is added to the 3' terminus of the synthesized
nucleic acid strand.
(iv) PCR is performed with a second gene-specific oligonucleotide
(P2) together with an oligonucleotide specific for the linker or
the added sequence by terminal transferase.
(v) A third gene-specific P* (P3) is used to detect the PCR
generated fragments. PAP method is applied with only one
activatable oligonucleotide P*. The extension of the activated
oligonucleotide P* "runs off" at the end of the template strand
generated in IV. The PAP method may be applied in an
allele-specific manner. The activatable oligonucleotide P* may
contain one or more nucleotides that are not complementary to the
template strand. The uncomplimentary nucleotide(s) of P* may locate
at the 3' terminus of P*.
(vi) Instead of steps (iv) and (v), PAP method can be applied with
two opposing oligonucleotides of which at least one is the
activatable oligonucleotide P*. The activatable oligonucleotide
P*(P3) is gene-specific. The second oligonucleotide is specific for
the linker or the added sequence by terminal transferase. The
second oligonucleotide may be another activatable oligonucleotide
P* or a regular oligonucleotide. The PAP method may be applied in
an allele-specific manner. The activatable oligonucleotide P* (P3)
may contain one or more nucleotides that are not complementary to
the template strand. The uncomplimentary nucleotide(s) of P* may
locate at the 3' terminus of P* (P3).
The third gene-specific oligonucleotide (P3) is then usually used
to label and allow visualization of the PCR generated fragments. P3
is labeled at the 5' terminus with .sup.32P or, more recently, with
near infrared fluorochromes such as IRD 700 or IRD 800 (Li-Cor
Inc.) (Dai et al., 2000).
PAP can be used to detect a target nucleic acid. In one embodiment
this method involves the following steps:
(a) adding to a nucleic acid containing sample an oligonucleotide
P*, wherein the oligonucleotide P* has a non-extendible 3'
terminus, wherein the 3' terminal residue of oligonucleotide P* is
removable by pyrophosphorolysis, and wherein the oligonucleotide P*
anneals to a substantially complementary strand of the target
nucleic acid present in the sample;
(b) removing the 3' non-extendible terminus of the oligonucleotide
P* annealed to the substantially complementary strand of the target
nucleic acid by pyrophosphorolysis to unblock the oligonucleotide
P* to produce an unblocked oligonucleotide; and
(c) detecting the presence of the target nucleic acid, wherein the
sequence of the target nucleic acid is substantially complementary
to the sequence of the oligonucleotide P*.
The method of the first embodiment may further include before the
detection step the step: (b1) extending the unblocked
oligonucleotide using a nucleic acid polymerase to produce an
extended oligonucleotide. The method may also include the addition
of a second oligonucleotide which may or may not have a 3'
non-extendible terminus. The second oligonucleotide may anneal to
the substantially complementary strand of the target nucleic acid
or it may anneal to the complement of the substantially
complementarty strand of the target nucleci acid.
In a second embodiment for detecting a nucleic acid the method
involves the following steps:
(a) adding to a nucleic acid containing sample two oligonucleotide
P*s, wherein each oligonucleotide P* has a non-extendable 3'
terminus, wherein the 3' terminal residue of each oligonucleotide
P* is removable by pyrophosphorolysis, wherein one oligonucleotide
P* overlaps with the other oligonucleotide P* by at least one
nucleotide at their respective 3' ends, and wherein one
oligonucleotide P* anneals to a substantially complementary strand
of the target nucleic acid present in the sample and the other
oligonucleotide P* anneals to a complement of the substantially
complementary strand of the target nucleic acid;
(b) removing the 3' non-extendable terminus of the oligonucleotide
P*s annealed to the target nucleic acid by pyrophosphorolysis to
unblock the oligonucleotide P*s to produce unblocked
oligonucleotides; and
(c) detecting the presence of the target nucleic acid, wherein the
sequence of the target nucleic acid is substantially complementary
to the sequence of the oligonucleotide P*s.
The method of the second embodiment may further include before the
detection step the step: (b1) extending the unblocked
oligonucleotide using a nucleic acid polymerase to produce an
extended oligonucleotide.
In one embodiment, the detection of the nucleic acid in step (c) is
performed by detecting the unblocking of oligonucleotide P*. In one
aspect, the unblocking is detected by loss of a label contained in
the 3' terminal residue of oligonucleotide P*. In a second aspect,
the unblocking is detected by detecting the presence of a 3' OH on
the 3' terminal residue that is capable of extension or ligation.
In this aspect, the detection is determined by extending the
unblocked oligonucleotide or by ligating the unblocked
oligonucleotide to an oligonucleotide. In a second embodiment, the
detection of the nucleic acid in step (c) is performed by detecting
the extended oligonucleotide. In one aspect, the extended
oligonucleotide is detected by the presence of a label in the
extended oligonucleotide. The label is part of a nucleotide or
nucleotide analog used in the extension step. In a second aspect,
the extended oligonucleotide is detected by gel electrophoresis. In
a third aspect, the extended oligonucleotide is detected by the
binding or incorporation of a dye or spectral material.
The P* oligonucleotides are selected to be "substantially"
complementary" to the different strands of each specific sequence
to be amplified. Therefore, the P* oligonucleotide sequence need
not reflect the exact sequence of the template. For example, a
non-complementary nucleotide segment may be attached to the 5'-end
of the P* oligonucleotide, with the remainder of the P*
oligonucleotide sequence being complementary to the strand.
Alternatively, non-complementary bases or longer sequences can be
interspersed into the P* oligonucleotide, provided that the P*
oligonucleotide sequence has sufficient complementarity with the
sequence of the strand to be amplified to hybridize therewith and
form a template for synthesis of the extension product of the other
P* oligonucleotide. The ability to detect nucleic acid sequences
which are substantially complementary to oligonucleotide P* is
particularly useful for the detection of multiple mutations, such
as seen in high viral load, where the detection of the presence of
the virus is important and not necessarily the exact nucleic acid
sequence of the virus. This method is also capable of detecting
nucleic acids that are completely complementary.
The present invention also includes other modifications of PAP. The
activatable oligonucleotide P* may contain blocked nucleotides at
other positions in addition to the 3' terminus. The introduction of
internal blocking nucleotides results in an interface between
amplification and PAP which would permit PAP to amplify in a
non-exponential manner (e.g., quadratic or geometric) with higher
fidelity, i.e., errors made by the polymerase would not be
propagatable. The activatable oligonucleotide P* may contain
modified nucleotides that are extendible as well as the 3' blocked
nucleotide. Thus, anywhere 5' to the 3' terminus, there may be
either blocking or non-blocking modified nucleotides. A polymerase
that pyrophosphorolyzes the mismatched primer rather than the
matched primer could be used to detect rare mutations in which the
P* that mismatched at the 3' terminus is activated and extended.
The detection of a rare mutation is based on no mismatch anywhere
along the length of the oligonucleotide because a mismatch inhibits
the activation of P*s. Activation may occur by another mechanism,
such as a 3' exonuclease. The 3' exonuclease may have specificity
for the matched primer or the mismatched primer so that it
discriminates as to whether there is a mismatch at the 3' end. The
3' exonuclease can be used either way. If it prefers a mismatch, it
can be used as described above, but its ability to detect uncommon
mutations would depend on some specificity for activation, although
that specificity may come partly from internal mismatches. The
extension reaction can be performed by a DNA polymerase, an RNA
polymerase or a reverse transcriptase, the template may be a DNA or
an RNA, and the oligonucleotide P* may be a DNA, an RNA, or a
DNA/RNA heteromer. Pyrophosphorolysis and the extension can be
performed by different polymerases. For example, the P* may include
a penultimate modified oligonucleotide that could not be extended
by pyrophosphorolyzing polymerase but could be extended by another
polymerase. One example is a 3' dideoxy that could be
pyrophosphorolyzed by a DNA polymerase, but the presence of a
ribonucleotide in the penultimate position would require extension
by an RNA polymerase. PAP can be generalized as an inactive
oligonucleotide that is activated by a nucleic acid metabolizing
enzyme, such as helicases, topoisomerases, telomerases, RNAH or
restriction enzymes. Methylases would detect the presence or
absence of a methyl group in genomic DNA. Methylases could be
coupled with truncating amplification which forces the polymerase
back to the template. A P* in which the 3' end is a dideoxy and
penultimate few nucleotides are ribos can be used as a tool for
differentially making a protein product derived from a specific
mutation that was desired, or for making a protein product whose
expression is linked to the presence of a particular sequence.
Pyrophosphorolysis would activate the P* if there was a precise
match to the mutation at the 3' end. The activated oligonucleotide
is then a substrate for the generation of RNA by an RNA polymerase.
The RNA could then be translated in vitro to produce the protein
product. PAP (PAP, Bi-PAP, matched or mismatched PAP, simplex PAP,
multiplex PAP and others) can be used for quantification. The yield
of the amplification products is quantitatively associated with the
amount of input template. The association may be proportional or
otherwise. In PAP, product may accumulate linearly, exponentially
or otherwise.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows a schematic of the detection of a rare mutation by
allele-specific PAP (PAP-A).
FIG. 2 shows a schematic of bidirectional PAP-A (Bi-PAP-A).
FIG. 3 shows a schematic of PAP-based resequencing (PAP-R)
performed on a microarray with programmable photochemical
oligonucleotide.
FIG. 4 shows a schematic of microarray-based resequencing to detect
a G to A mutation.
FIG. 5 shows a schematic of ligation-mediated PCR (LM-PCR).
FIGS. 6A and 6B are a schematic illustrating use of PAP to detect
the G allele at nucleotide 229 of the D.sub.1 dopamine receptor
gene. The procedure is described in detail in Example 1 below.
FIG. 6C is an autoradiogram of PAP from the G/G, A/A and G/A
genotypes of the human dopamine receptor gene.
FIGS. 7A and 7B are diagrams illustrating enhanced specificity of
PAP relative to PASA.
FIGS. 8A and 8B are autoradiograms showing the results of
electrophoresis of samples obtained in Example 1 below.
FIG. 9 is an autoradiogram showing the results of electrophoresis
of samples obtained in Example 1 below.
FIG. 10 is an autoradiogram showing the results of electrophoresis
of samples obtained in Example 1 below.
FIG. 11A is a schematic illustrating enhancement of PAP
efficiency.
FIG. 11B is an autoradiogram of PAP from the G/G, A/A and G/A
genotypes of the human dopamine receptor gene.
FIGS. 12A-12E are autoradiograms showing the results of
electrophoresis of samples obtained in Example 2 below.
FIG. 13 is an autoradiogram showing the results of electrophoresis
of samples obtained in Example 2 below.
FIG. 14 is an autoradiogram showing the results of electrophoresis
of samples obtained in Example 2 below.
FIG. 15 is an autoradiogram showing the results of electrophoresis
of samples obtained in Example 3 below.
FIGS. 16A-16B show UV footprinting by LM-PAP. FIG. 16A shows
allele-specific LM-PAP versus allele-specific LM-PCR for the
dopamine D.sub.1 receptor gene. FIG. 16B shows LM-PAP for the pgk
gene.
FIGS. 17A-17B show PAP amplification directly from human (FIG. 17A)
and mouse (FIG. 17B) genomic DNA using PAP and Bi-PAP,
respectively.
FIGS. 18A-18E show PAP amplification using 3' terminal
acyclonucleotide blocked P*. FIG. 18A: Model: A duplexed DNA
template of the lacI gene is shown. The mutated template contains a
G at the nucleotide position 369, while the wild-type template
contains a T at the nucleotide position 369 of the lacI gene.
P*=pyrophosphorolysis activatable oligonucleotide. The P* has an
acycloNMP or a ddNMP at the 3' terminus. The P* is specific to the
mutated template but mismatches to the wild-type template at the 3'
terminus (Table 6). O=oligodeoxynucleotide. PAP was performed with
P*1 and O1, P*2 and O2, or P*1 and P*2, respectively. FIG. 18B: PAP
with 30 mer P*s: The P*s are specific for the mutated template but
mismatch the wild-type template at their 3' terminus. In lanes 1-8
are 3' terminal acyclonucleotide blocked P*s. In lanes 9-16 are 3'
terminal dideoxynucleotide blocked P*s for comparison. In lanes 1-4
and 9-12, the mutated template is used. In lanes 5-8 and 13-16, the
wild-type template is used. The PAP product and P* are indicated
with their sizes. Lane M is 120 ng of .phi.X174-PUC19/HaeIII DNA
marker. FIG. 18C: PAP with 35-mer P*s: The experiment is the same
as in FIG. 18B except with 35-mer P*s that are 3' co-terminal with
the 30-mer P*s and five nucleotides longer at their 5' termini.
FIG. 18D: PAP with Vent (exo-) polymerase. The experiment is the
same as in FIG. 18B except that Vent (exo-) was used. FIG. 18E: PAP
with Pfu (exo-) polymerase. The experiment is the same as in FIG.
19B except that Pfu (exo-) was used.
FIG. 19 shows that PAP has high selectivity to detect rare
mutations in the abundance of the wild-type template. In the
example of nucleotide position 190, the mutation-specific P*
matches the mutated A template but mismatches the wild-type T
template at the 3' terminus. Specific and efficient amplification
is indicated by thick arrows. When hybridized to the mutated A
template, the P* cannot extend directly from the 3' terminal
dideoxynucleotide, the 3' terminal ddTMP must be removed by
pyrophosphorolysis and the activated oligonucleotide is then
extended efficiently. Two types of nonspecific amplification from
the T template are indicated as Types I and II. The nonspecific
amplification occurs rarely when mismatch pyrophosphorolysis occurs
to generate a wild-type product that will not support efficient
amplification as template for subsequent cycles (Type I) (the error
is indicated by thin arrow and estimated frequency of as low as
10.sup.-5). When both mismatch pyrophosphorolysis and
misincorporation occur extremely rarely to generate a mutated
product (Type II) (the errors are indicated by thin arrows and
estimated coupled frequency of 3.3.times.10.sup.-11). Once the
errors occur, the mutated product can be amplified exponentially in
subsequent cycles and so it determines the selectivity.
FIGS. 20A-20B show Bi-PAP amplification. FIG. 20A: Schematic of
Bi-PAP to detection a rare mutation. The mutation-specific assay
with two mutated P* for nucleotide 190 is shown. The downstream and
upstream P*s contain a dideoxy T and a dideoxy A at their 3'
termini, respectively. They are specific for the T:A allele at
nucleotide 190 (on the right), but are mismatched to the A:T
wild-type allele at their 3' termini (on the left). The P*s are 40
nucleotides long and overlap at their 3' termini by one nucleotide.
On the left, no substantial product is generated from the wild-type
template because of the mismatch. On the right, the mutated product
is generated efficiently from the mutated template. FIG. 20B:
Bi-PAP amplification directly from .lamda. DNA. Each of the
wild-type and mutation-specific Bi-PAP assays at nucleotide 190 was
used to amplify a 79-bp segment of the lacI gene from .lamda. DNAs.
For the wild-type assay in lanes 1-3, the two wild-type P*s have 3'
terminal ddA and ddT, respectively. For the mutation-specific assay
in lanes 4-6 and lanes 7-9, the two mutated P*s are with ddT and
ddA at their 3' termini, respectively. In lanes 1, 4 and 7, 2000
copies of the wild-type template were added to each reaction. In
lanes 2, 5 and 8, 2000 copies of the mutated template were added to
each reaction. In lanes 3, 6 and 9, no template was added. In lanes
7-9, 200 ng of human genomic DNA was added as carrier. The product
and P* are indicated. Lane M is 120 ng of .phi.X174-PUC19/HaeIII
DNA marker.
FIGS. 21A-21C show titration of template for sensitivity and
selectivity of Bi-PAP. With the mutated P*s, the wild-type template
was amplified to generate the mutated product in Experiment I. The
mutated template was amplified to generate the mutated product in
Experiments II, III and IV. FIG. 21A: The mutation-specific Bi-PAP
assay for A190T. In Experiment I, the copies of the wild-type
.lamda. DNA are indicated in lanes 1-5. Lane 6 is a negative
control with no DNA. In Experiment II, the copies of the mutated
.lamda. DNA are indicated in lane 7-11. Lane 11 (0.2 copy) is a
negative control to support the dilution accuracy of copy number.
Lane 12 is a negative control with no DNA. In Experiment III, the
copies of the mutated .lamda. DNA in the presence of
2.times.10.sup.9 copies of the wild-type .lamda. DNA are indicated
in lane 13-17. Lane 18 is a negative control with only the
wild-type .lamda. DNA. In Experiment IV, the copies of the mutated
.lamda. DNA in the presence of 100 ng of human genomic DNA are
indicated in lanes 19-23. Lane 24 is negative control only with the
human genomic DNA. Lane "C WT" is the wild-type product control in
which the wild-type P*s were used to amplify 2000 copies of the
wild-type .lamda. DNA. Lane "C Mut" is the mutated product control
in which the mutated P*s were used to amplify 2000 copies of the
mutated .lamda. DNA. The wild-type and mutated products with unique
mobilities are indicated. FIG. 21B: The mutation-specific Bi-PAP
assay for T369G. FIG. 21C: The mutation-specific Bi-PAP assay for
T369C.
FIG. 22 shows a design of P* microarray for Bi-PAP resequencing.
Bi-PAP can be used for resequencing to detect unknown mutations in
a known region on a microarray. The P*s are designed according to
the wild-type template. The two opposing P*s for each Bi-PAP are
anchored in a microarray spot. Each pair of arrows represents four
Bi-PAPs for one nucleotide position. A mutation is indicated on the
template, and it spans six overlapped P*s. On the microarray, many
Bi-PAPs can be processed in a parallel way.
FIGS. 23A-23B show a schematic of Bi-PAP resequencing. FIG. 23A:
Detection of the wild-type sequence. This is a close look at the
microarray. The P*s are designed according to the wild-type
sequence. On the position of nucleotide A, four Bi-PAPs are
synthesized with four pairs of P*s. The four downstream P*s have
identical sequence, except that at the 3' terminus either ddAMP,
ddTMP, ddGMP or ddCMP, corresponds to the wild-type sequence and
the three possible single base substitutions. The four
corresponding upstream P*s have identical sequence, except that at
the 3' terminus either ddTMP, ddAMP, ddCMP or ddGMP. Each pair of
P*s have one nucleotide overlap at their 3' termini. On the next
nucleotide C, another four pairs of P*s are synthesized (not
shown). If the wild-type sample is added, only the wild-type
Bi-PAPs generates the specific product that is labeled by
fluorescence. In this way, to scan a 1 kb region, you need 8000
P*s. FIG. 23B: Detection of an A to T mutation. On the mutated
nucleotide T, the mutation-specific Bi-PAP generates the mutated
product. On the next nucleotide G, no product of Bi-PAP is
generated because each pair of P* contains one or two mismatches
(not shown).
FIGS. 24A-24B show Bi-PAP resequencing microarray. FIG. 24A:
Detection of the wild-type sequence. Four pairs of P*s are designed
for each nucleotide position according to the wild-type sequence.
Each pair of P*s are downstream and upstream directed, and have one
overlap and complementary nucleotide at their 3' termini. The
wild-type P* pair are specifically amplified on each nucleotide
position. If all of the wild-type P* pairs specifically amplified,
the wild-type sequence can be determined. FIG. 24B: Detection of
the A to T mutation. With the mutated template, the
mutation-specific Bi-PAP is amplified. There is a window of no
Bi-PAP signals centered by the mutation-specific Bi-PAP and three
successive nucleotides on each side. The paired specific
subsequence is supposed to be seven nucleotides long. Any unknown
single-base substitution can be determined, even if it is a
heterozygous mutation. Also, small deletions and insertions can be
detected and localized.
FIG. 25 shows PAP de novo sequencing on microarray. PAP can also be
used for de novo DNA sequencing of an unknown region. The paired
specific subsequence is supposed to fifteen nucleotides long. P*
pairs of a complete set of the paired specific subsequence are on a
microarray with known addresses. After the unknown DNA sample is
added, Bi-PAP is performed. All the amplified B-PAP products are
collected and then the paired specific subsequences of the
amplified P* pairs are assembled by one-nucleotide overlapping.
Thus, the unknown complementary sequence is reconstructed.
FIGS. 26A-26C show the detection of somatic mutations. FIG. 26A:
Eighteen genomic DNA samples of the lac.sup.+ transgenic mice were
chosen. 2 .mu.g genomic DNA of each sample was amplified with the
assay B to detect the T369G mutation two times. Samples 1-10 are
from livers of 25-month old mice. Samples 11-14 are from hearts
(samples 11, 13 and 14) and adipose (sample 12) of 6-month old
mice. Samples 15-18 are from brains of 10-day old mice. P=positive
control that amplified the mutated .lamda. DNA, N=negative control
with no DNA, +=amplified product, -=no product. FIG. 26B: The assay
B was performed. In lanes 11-12, 13-16 and 17-20, 2 .mu.g, 0.5
.mu.g and 0.125 .mu.g of the lacI.sup.+ mouse genomic DNA of sample
mutated .lamda. DNA per reaction was reconstructed by two-fold
serial dilutions. In lanes 1-10 and 13-20, each reaction also
contained 1 .mu.g of the lacI.sup.- mouse genomic DNA carrier.
ss=single-stranded, ds=double-stranded. FIG. 26C: The assay B was
performed. In lanes 11-14, 2 .mu.g of the lacI.sup.+ mouse genomic
DNA of sample 3 was used in each reaction. In lanes 15-18, 2 .mu.g
of the lacI.sup.+ mouse genomic DNA of sample 9 was used in each
reaction. Lanes 1-10 are controls; the copy number of the mutated
.lamda. DNA per reaction is indicated. Each control reaction also
contained 1 .mu.g of the lacI.sup.- mouse genomic DNA carrier.
DETAILED DESCRIPTION OF THE INVENTION
The following terminology is used herein.
Pyrophosphorolysis: removal of the 3' nucleotide from a nucleotide
strand chain by DNA polymerase in the presence of pyrophosphate
(PP.sub.i) to generate the nucleotide triphosphate. This is the
reverse of the polymerization reaction.
PAP: Pyrophosphorolysis activated polymerization. PAP can use one
P* or can use two opposing oligonucleotides in which at least one
is P*.
P*: an oligonucleotide with a non-extendible 3' terminus (or end)
that is activatable by pyrophosphorolysis.
PAP-A: PAP-based allele-specific amplification that can be used for
detection of rare mutations (FIG. 1).
Bi-PAP-A: PAP-A performed with a pair of opposing P*, i.e.,
bidirectional (FIG. 2) with at least one nucleotide overlap at
their 3' termini.
PAP-R: PAP-based resequencing for detection of unknown mutations
within a known sequence (FIGS. 3 and 4).
LM-PAP: ligation-mediated PAP. The nature of LM-PAP is that the
template is synthesized before PAP, such as by ligation reaction or
by extension using terminal transferase.
LM-PCR: ligation-mediated PCR (FIG. 5).
G.sup.v or A.sup.v alleles: alleles of the common polymorphism of
the dopamine D.sub.1 receptor gene that was used as a model system
herein (also referred to herein as G.sup.0 or A.sup.0 alleles).
Linear PAP: PAP with only one P* for linear product
accumulation.
Exponential PAP: PAP with two opposing oligonucleotides for
exponential product accumulation, and at least one is P*.
Noise rate (%): the relative yield of the mismatched product to the
matched product. A specific signal for PAP is defined as a noise
rate of less than 10%.
PCR amplification of specific alleles (also known as
allele-specific PCR or ARMS).
Resequencing: scanning for unknown mutations and determining the
precise sequence changes within a known sequence. Resequencing is
distinguished from de novo sequencing.
Mutation load: the frequency and pattern of somatic mutations
within a tissue.
Minimal residual disease: e.g., rare remaining cancer cells in
lymph nodes and other neighboring tissues or early recurrence after
remission.
Non-extendible 3' terminus (or end): a nucleotide or nucleotide
analog at the 3' terminus (or end) of oligonucleotide P* that is
non-extendible but that is activatable by pyrophosphorolysis.
Examples of a non-extendible 3' termini (or ends) include, but are
not limited to, a 2',3'-dideoxynucleotide, an acyclonucleotide,
3'-deoxyadenosine (cordycepin), 3'azido-3-deoxythymidine (AZT),
2,3'-dideoxyinosine (ddI), 2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T).
Simplex PAP: one PAP (PAP, Bi-PAP, matched or mismatched PAP, and
others) in one reaction tube or on a solid support.
Multiplex PAP: more than one PAP (PAP, Bi-PAP, matched or
mismatched PAP, and others) in one reaction tube or on a solid
support, e.g., microarray.
Matched PAP: PAP having a match between P* and its template.
Mismatched PAP: PAP having a mismatch between P* and its
template.
Nested PAP: PAP using two or more pairs of P* in which one pair is
located inside a second pair on a template nucleic acid.
Hotstart PAP: PAP in which an essential reaction component is
withheld until denaturation temperatures are approached (Charo et
al., 1992; Kellogg et al., 1994; Mullis,
D'Aquila et al., 1991). Essential reaction components can be
withheld by, e.g., a neutralizing antibody bound to the polymerase,
sequestering a component, such as the polymers or MgCl.sub.2 in
wax, chemically modifying the polymerase to prevent activation
until high temperature incubation or separating components by
wax.
Truncated Amplification: an amplification method which amplifies
non-exponentially, e.g., in a quadratic or geometric manner, with
over two chimeric oligonucleotides and produces truncated terminal
products that are no more than three rounds of replication from the
original template. (Liu et al., 2002).
Reactive `3 OH: is a 3` OH that is capable of being extended by a
nucleic acid polymerase or ligated to an oligonucleotide.
DNA polymerases, which are critical to nucleic acid amplification,
catalyze some or all of the following reactions: i) polymerization
of deoxynucleotide triphosphates or their analogs; ii)
pyrophosphorolysis of duplexed DNA in the presence of pyrophosphate
(PP), [dNMP].sub.n+x[PPi] . . . [dNMP].sub.n-x+x[dNTP]; iii)
3'-5'exonuclease activity (which does not require PPi), and iv)
5'-3' exonuclease activity (Duetcher and Kornberg, 1969; Kornberg
and Baker, 1992). For Taq and Tfl DNA polymerases, polymerization
and 5'-3' exonuclease activity have been reported (Chien et al.,
1976; Kaledin et al., 1981; Longley et al., 1990). For T7
Sequenase.TM. and Thermo Sequenase.TM. DNA polymerases,
pyrophosphorolysis can lead to the degradation of specific
dideoxynucleotide-terminated segments in Sanger sequencing reaction
(Tabor and Richardson, 1990; Vander Horn et al., 1997).
Pyrophosphorolysis is generally of very minor significance because
PP.sub.i is degraded by pyrophosphatase under normal physiological
conditions. However, in the presence of high in vitro
concentrations of PP.sub.i, pyrophosphorolysis can be substantial.
For oligonucleotides with a 3' terminal dideoxy nucleotide, only
pyrophosphorolysis is possible. Once the dideoxy nucleotide is
removed, the activated oligonucleotide can be extended by
polymerization.
Pyrophosphorolysis activated polymerization (PAP) offers a novel
approach for retrieving a diversity of information from nucleic
acids. The exceptional specificity of PAP derives from the serial
coupling of two reactions. PAP involves the activation by
pyrophosphorolysis of a 3' terminal blocked oligonucleotide (P*)
followed by extension of the activated oligonucleotide by DNA
polymerization. Operationally, PAP involves the use of an
activatable oligonucleotide (P*) in place of a normal
oligonucleotide that can be directly extended. Examples of P*
include an inactive dideoxy terminated oligonucleotide P* or an
inactive chemically modified nucleotide lacking a 3' hydroxyl
group, such as an acyclonucleotide, or having a non-extendible
nucleotide terminated oligonucleotide P*. Acycloclonucleotides
(acycloNTPs) in which the sugar ring is absent are known to act as
chain terminators in DNA sequencing (Sanger et al., 1977; Trainor,
1996; Gardner and Jack, 2002). The activation of P* is inhibited by
mismatches throughout the length of the oligonucleotide. Mismatches
even two nucleotides from the 5' terminus inhibit PAP
amplification.
Activation of a P* by pyrophosphorolysis offers extraordinary
specificity throughout the length of P*. The enhanced specificity
can be used to detect rare known mutations, to elucidate unknown
mutations by resequencing, to determine unknown sequence by de novo
sequencing, to measure gene expression levels, to compare two
sequences, and to increase the specificity of in vivo analysis of
chromatin structure. Microarray-based programmable photochemical
oligonucleotide synthesis and PAP are synergistic technologies.
Thus, the enhanced specificity can be used for rapid,
microarray-based resequencing, de novo sequencing, gene expression
profiling and SNP detection.
A number of methods for enzymatic nucleic acid amplification in
vitro have been developed and can be adapted to detect known
sequence variants. These include polymerase chain reaction (PCR)
(Saiki et al., 1985; Saiki et al., 1988), ligase chain reaction
(LCR) (Landegren, 1998; Barany, 1991) and rolling circle
amplification (RCA) (Baner et al., 1998; Lizardi et al., 1998).
Herein, we describe pyrophosphorolysis activated polymerization
(PAP), an approach that has the potential to enhance dramatically
the specificity of PCR allele-specific amplification (Sommer et
al., 1989). PAP differs from corrections with PCR in multiple ways:
i) the P* oligonucleotide is blocked at the 3' terminus and must be
activated by pyrophosphorolysis, ii) pyrophosphorolysis and
polymerization are serially coupled for each amplification, iii)
PAP may be performed with one P* for linear amplification or with
two oligonucleotides for exponential amplification, iv) PP.sub.i,
is necessary for the amplification, v) significant nonspecific
amplification would require the serial coupling of errors of both
mismatch pyrophosphorolysis and misincorporation.
The enhanced specificity of PAP relative to PASA is provided by
serially coupling pyrophosphorolysis and polymerization.
Significant nonspecific amplification requires mismatch
pyrophosphorolysis and misincorporation by DNA polymerase, an
extremely rare event. For example as described herein, DNA
polymerase was utilized to detect the G allele at nucleotide 229 of
the D.sub.1 dopamine receptor gene. P* was synthesized either with
ddA, ddT, ddG or ddC at the 3' terminus. The 3' terminal
dideoxynucleotide inhibits direct extension by polymerization, but
can be removed by pyrophosphorolysis in the presence of
pyrophosphate (PP.sub.i) when the P* is specifically hybridized
with the complementary strand of the G allele. The activated
oligonucleotide can be extended by polymerization in the 5'-3'
direction.
Evidence is presented that pyrophosphorolysis followed by
polymerization can be used to increase the specificity of PASA.
Significant nonspecific amplification with PAP requires the serial
coupling of the two types of errors, i.e., mismatched
pyrophosphorolysis and misincorporation (FIG. 1). The rate of
mismatched pyrophosphorolysis is expressed as the relative rates of
removal of a 3' mismatch deoxynucleotide relative to the correct 3'
deoxynucleotide. The rate of mismatch pyrophosphorolysis is less
than 10.sup.-5 for T7 DNA polymerase (Kornberg and Baker, 1992;
Wong et al., 1991). The misincorporation rate to create a
substitution mutation by polymerization, expressed as the
incorporation rate of an incorrect versus a correct dNMP, was
reported to be 10.sup.-5 for T7 DNA polymerase and to be 10.sup.-4
for E. coli DNA polymerase I (Kornberg and Baker, 1992; Wong et
al., 1991; Bebenek et al., 1990). Similar results were reported for
Taq DNA polymerase, 3'-5' exonuclease-deficient mutants of T7 DNA
polymerase and E. coli DNA polymerase I (Kornberg and Baker, 1992;
Wong et al., 1991; Bebenek et al., 1990; Eckert and Kunkel,
1990).
PAP is a method of synthesizing a desired nucleic acid strand on a
nucleotide acid template strand. In PAP, pyrophosphorolysis and
polymerization are serially coupled for nucleic acid amplification
using pyrophosphorolysis activatable oligonucleotides (P*). P* is
an oligonucleotide that is composed of N nucleotides or their
analogs and has a non-extendible nucleotide or its analog at the 3'
terminus, such as 3',5' dideoxynucleotide. When substantially
hybridized on its template strand, P* could not be extended
directly from the 3' terminal nucleotide or its analog by DNA
polymerase, the 3' terminal nucleotide or its analog of the P* can
be removed by pyrophosphorolysis and then the activated
oligonucleotide (<N) can be extended on the template.
The method comprises the following steps carried out serially.
Annealing to the template strand a substantially complementary
activatable oligonucleotide P*. This activatable oligonucleotide P*
has a non-extendible nucleotide or its analog at the 3'
terminus.
(b) Pyrophosphorolyzing the annealed activatable oligonucleotide P*
with pyrophosphate and an enzyme that has pyrophosphorolysis
activity. This activates oligonucleotide P* by removal of the 3'
terminal non-extendible nucleotide or its analog.
(c) Polymerizing by extending the activated oligonucleotide P* on
the template strand in the presence of nucleoside triphosphates or
their analogs and a nucleic acid polymerase to synthesize the
desired nucleic acid strand.
The PAP method can be applied to amplify a desired nucleic acid
strand by the following additional steps.
(d) Separating the desired nucleic acid strand of step (C) from the
template strand, and
(e) Repeating steps (A)-(D) until a desired level of amplification
of the desired nucleic acid strand is achieved.
The above PAP method can be applied to allele-specific
amplification. The activatable oligonucleotide P* has one or more
nucleotides that are not complementary to the template strand. The
uncomplimentary nucleotide(s) of P* may locate at the 3' terminus
of P*. The above step of (A), (B) or (C) could not occur
substantially. As the result, the desired nucleic acid strand is
synthesized substantially less.
The above PAP method can be applied with only one activatable
oligonucleotide P*. (e) Repeating steps (a)-(d), a desired level of
amplification of the desired nucleic acid strand may be achieved
linearly. The targeted nucleic acid region outside the annealing
region may be of different sizes or of different sequence contexts,
so the synthesized nucleic acid strands are of different sizes or
of different sequence contexts.
The above PAP method can be applied with two opposing
oligonucleotides of which at least one is the activatable
oligonucleotide P*. The activatable oligonucleotide P* and the
second oligonucleotide are targeted for amplification of a nucleic
acid region. Steps (a)-(c) occur to the activatable oligonucleotide
P*. The second oligonucleotide is substantially complementary to
the other template strand. If the second oligonucleotide is another
activatable oligonucleotide P*, steps (a)-(c) occur. If the second
oligonucleotide is a regular extendible oligonucleotide, steps (a)
and (c) occur: (modified a) annealing to its template strand,
followed by (modified c) polymerizing by extending the
oligonucleotide on its template strand in the presence of
nucleoside triphosphates or their analogs and a nucleic acid
polymerase to synthesize the desired nucleic acid strand. (e)
Repeating steps (a)-(d), or steps (a), (c) and (d), a desired level
of amplification of the desired nucleic acid strand may be
achieved, e.g., exponentially. The targeted nucleic acid region
between the two annealing regions of the two opposing
oligonucleotides may be of different sizes or of different sequence
contexts, so the synthesized nucleic acid strands are of different
sizes or of different sequence contexts.
LM-PAP involves cleavage, primer extension, linker ligation and PAP
that can be applied for analysis of in vivo chromatin structure,
such as, methylated state of chromosomes.
LM-PAP may be performed by steps (i), (ii), (iii), (iv) and (v), by
steps (i), (ii), (iii) and (vi), by steps (ii), (iii), (iv) and (v)
or by steps (ii), (iii) and (vi), where the steps are as
follows.
The cleavage occurs chemically, enzymatically or naturally to
"breakdown" nucleic acid strands. The nucleic acid usually is
genomic DNA that may have lesions or nicks produced in vivo.
(ii) The primer of P1 is gene-specific and its extension includes:
1) annealing to the template strand a substantially complementary
primer; 2) extending the primer on the template strand in the
presence of nucleoside triphosphates or their analogs and a nucleic
acid polymerase, the extension "runs off" at the cleavage site on
the template strand. Steps 1) and 2) may be repeated.
The primer extension may be replaced by a P* extension (The above
PAP with only one activatable oligonucleotide P*).
(iii) The linker ligation step includes ligation of a linker to the
3' terminus of the synthesized nucleic acid strand. The linker
ligation step may be replaced by a terminal transferase extension
that is non-template dependent polymerization and an extra nucleic
acid sequence is added to the 3' terminus of the synthesized
nucleic acid strand.
(iv) PCR is performed with a second gene-specific primer (P2)
together with a primer specific for the linker or the added
sequence by terminal transferase.
(v) A third gene-specific P* (P3) is used to detect the PCR
generated fragments. PAP method is applied with only one
activatable oligonucleotide P*. The extension of the activated
oligonucleotide P* "runs off" at the end of the template strand
generated in step (iv). The PAP method may be applied in
allele-specific manners. The activatable oligonucleotide P* may
contain one or more nucleotides that are not complementary to the
template strand. The uncomplimentary nucleotide(s) of P* may locate
at the 3' terminus of P*.
(vi) Instead of steps (iv) and (v), PAP method can be applied with
two opposing oligonucleotides of which at least one is the
activatable oligonucleotide P*. The activatable oligonucleotide
P*(P3) is gene-specific. The second oligonucleotide is specific for
the linker or the added sequence by terminal transferase. The
second oligonucleotide may be another activatable oligonucleotide
P* or a regular primer. The PAP method may be applied in
allele-specific manners. The activatable oligonucleotide P* (P3)
may contain one or more nucleotides that are not complementary to
the template strand. The uncomplimentary nucleotide(s) of P* may
locate at the 3' terminus of P* (P3).
FIG. 1 shows detection of a rare mutation by allele-specific PAP
(PAP-A). PAP-A can detect a rare allele with extremely high
specificity because an allele-specific oligonucleotide with a 3'
dideoxy terminus (P*) permits the serial coupling of
pyrophosphorolysis and polymerization. For example, if an
allele-specific oligonucleotide has a 3' dideoxy terminus (P*) that
matches a rare "T" allele, activation occurs by pyrophosphorolytic
removal of the dideoxy nucleotide and is followed by polymerization
(Situation A). Activation by pyrophosphorolysis does not normally
occur with a mismatch at the 3' terminus as with the wild-type "C"
allele (Situation B). Rarely, pyrophosphorolysis does occur at a
mismatch (estimated frequency 10.sup.-5), but the activated
oligonucleotide is extended to produce wild-type sequence
(Situation C). A product that supports efficient amplification is
generated when mismatch pyrophosphorolysis occurs, a polymerase
error that inserts A opposite C in template DNA (Situation D). The
frequency of mismatch pyrophosphorolysis coupled with the
polymerase mutation is estimated at
10.sup.5.times.3.times.10.sup.-6=3.times.10.sup.-11.
PAP has a potential specificity of 3.times.10.sup.-11. Approaching
this potential requires a design that eliminates confounding
sources of error. For example, extension errors from non-blocked
upstream oligonucleotides can generate a product with the mutation
of interest. If the misincorporation rate for TaqFS is about
10.sup.-5 per nucleotide and only one of the three
misincorporations generates the mutation of interest, the error
rate is about 3.3.times.10.sup.-6. Polymerases that contain a
proofreading function might have an error rate per specific
mutation of 3.times.10.sup.-7. Polymerases or polymerase complexes
with lower error rates would improve specificity further.
One approach utilizes linear PAP. Linear PAP-A may be performed for
40 cycles with only P* in the presence of a fluorescent or
radiolabeled ddNTP. A labeled terminated product of defined size
will be generated when P* is activated. Linear PAP-A has the
advantage of utilizing only the original genomic DNA and
eliminating error due to misincorporation from extension of an
unblocked upstream primer. However, the sensitivity of detection is
limited because the level of amplification is not greater than the
number of cycles. For a simple genome like lambda phage, a
detection specificity of 10.sup.-6 is possible. The specificity of
linear PAP-A depends critically on the absence of unblocked,
extendible oligonucleotides. To achieve a robust specificity of
10.sup.-6, unblocked extendible oligonucleotides should be present
at 10.sup.-7. This may be achieved by treating gel purified P*
(about 99.99% pure with our present protocol) with a 3' to 5'
exonuclease to degrade unblocked molecules followed by
repurification by gel electrophoresis.
A second approach is bidirectional PAP-A (Bi-PAP-A; FIG. 2). In
Bi-PAP-A, both the downstream and upstream oligonucleotides are P*s
that are specific for the nucleotide of interest. The P*s overlap
at their 3' termini by one nucleotide. This design eliminates
extension error from a non-blocked upstream oligonucleotide. This
design should not be limited by small amounts of active
contaminating oligonucleotide to which the dideoxy terminus has not
been added (about 0.01% with our current protocol) because the
product generated will be that of a control and will not be a
substrate for efficient amplification in subsequent cycles.
Bi-PAP-A generates a product that is the size of a primer dimer.
However, it is not a primer dimer in the conventional sense, in
that template DNA with a mutation of interest is an intermediate
required to generate a product that is an efficient substrate for
amplification in subsequent cycles. Bidirectional PAP-A eliminates
important bottlenecks to specificity and has the potential to reach
a specificity of 10.sup.-9.
As shown in FIG. 2, both the downstream and the upstream P*s are
specific for the nucleotide of interest at the 3' termini (an A:T
base pair in this example). In the initial round of amplification
from genomic DNA, segments of undefined size will be generated. In
subsequent rounds, a segment equal to the combined lengths of the
oligonucleotide minus one will be amplified exponentially.
Nonspecific amplification occurs at lower frequencies because this
design eliminates misincorporation error from an unblocked upstream
oligonucleotide that can generate the A:T template from a G:C
wild-type template with an error rate of 3.times.10.sup.-6. The P*s
may be 30-60 nucleotides for most efficient amplification.
Situation A shows that a template with a rare A:T allele will be
amplified efficiently. Both the upstream and the downstream P*s are
amplified efficiently. Situation B shows that if the DNA template
contains the wild-type G:C sequence, neither the downstream nor the
upstream P* will be activated substantially.
Rapid resequencing will facilitate elucidation of genes that
predispose to cancer and other complex diseases. The specificity of
PAP lends itself to resequencing. P*s may be photochemically
synthesized on microarrays using flexible digital micromirror
arrays.
Microarrays of immobilized DNA or oligonucleotides can be
fabricated either by in situ light-directed combinational synthesis
or by conventional synthesis (reviewed by Ramsay, 1998; Marshall
and Hodgson, 1998). Massively parallel analysis can be performed.
Photochemical synthesis of oligonucleotides is a powerful means for
combinatorial parallel synthesis of addressable oligonucleotide
microarrays (Singh-Gasson et al., 1999; LeProust et al., 2000).
This flexible alternative to a large number of photolithographic
masks for each chip utilizes a maskless array synthesizer with
virtual masks generated on a computer. These virtual masks are
relayed to a digital micromirror array. An ultraviolet image of the
virtual mask is produced on the active surface of the glass
substrate by a 1:1 reflective imaging system. The glass substrate
is mounted in a flow cell reaction chamber connected to a DNA
synthesizer. Cycles of programmed chemical coupling occur after
light exposure. By repeating the procedure with additional virtual
masks, it is possible to synthesize oligonucleotide microarrays
with any desired sequence. The prototype developed by Singh-Gasson,
et al. synthesized oligonucleotide microarrays containing more than
76,000 features measuring 16 square microns.
By combining programmable photochemical oligonucleotide synthesis
with digital mirrors and oligonucleotide extension of P*, a high
throughput and automated method of resequencing is possible. PAP-R
may detect virtually 100% of single base substitutions and other
small sequence variants because of its high redundancy; the
mismatch spanned by the several overlapping P* oligonucleotides
will prevent activation of a cluster of overlapping P*s. One
strategy for resequencing is shown in FIGS. 3 and 4. FIG. 3 shows a
schematic of PAP-R performed on a microarray with programmable
photochemical oligonucleotide: PAP can be used for resequencing to
detect unknown mutations. On this microarray, the wild-type
template is indicated. The P*s are designed according to the
wild-type template. The P*s that overlap with the mutation generate
little or no signal indicated as "Low" PAP signal.
FIG. 4 shows an example of solid support-based, e.g.,
microarray-based, resequencing to detect a G to A mutation. Linear
PAP is performed with four different dye-labeled ddNTPs as
substrates for single-base extensions. P*s have a specific region
of 16 nucleotides within the 3' region of the oligonucleotide.
Homozygous or hemizygous DNA template is utilized in the example.
Sets of four P*s, with identical sequence except for the four
ddNMPs at the 3' terminus, are synthesized for each nucleotide
position on the sense strand of the wild-type sequence. The P* with
a ddA at the 3' terminus generates a PAP signal at the site of the
G-A mutation. The mutation also creates a 15 base "gap" of no PAP
signal for the subsequent overlapping 15 sets of P*s. For
heterozygous mutation, the P*s with ddA and ddG provide PAP
signals. The heterozygous mutation also generates the 15-base "gap"
of 50% signal intensity (which is flanked by signals of 100%
intensity). For added redundancy with heterozygotes samples,
antisense P*s can be utilized (not shown). An unknown single-base
substitution can be determined by combination of the two sets of
P*s. Small deletions and insertions can be detected and
localized.
With 100,000 oligonucleotides per microarray, about 12 kb can be
resequenced from downstream and upstream directions. The detection
of virtually all mutations requires supplementation of the standard
Geniom.RTM. instrument software. For wild-type sequence, the signal
intensities may vary. Certain oligonucleotides will generate a
weaker signal due to secondary structure and other factors. The
pattern of signal from wild-type samples should be distinguished
reliably from the pattern generated by a given sequence change. The
preliminary data suggest that almost all mismatches will inhibit
activation dramatically. Because of the redundancy, mutations may
be reliably distinguished from the wild-type even if a significant
minority of single base mismatches does not inhibit activation
substantially.
It is becoming increasingly apparent that in vivo chromatin
structure is crucial for mammalian gene regulation and development.
Stable changes in chromatin structure often involve changes in
methylation and/or changes in histone acetylation. Somatically
heritable changes in chromatin structure are commonly called
epigenetic changes (Russo and Riggs, 1996) and it is now clear that
epigenetic "mistakes" or epimutations are frequently an important
contributing factor to the development of cancer (Jones and Laird,
1999).
One of the few methods for assaying in vivo chromatin structure,
and the only method with resolution at the single nucleotide level,
is ligation-mediated PCR (LM-PCR) (Mueller and Wold, 1989; Pfeifer
et al., 1989). LM-PCR has been used to assess chromatin structure,
methylation and damaged DNA. FIG. 5 shows a schematic of LM-PCR in
which a DNA lesion in the starting DNA is indicated by a small
diamond. LM-PCR involves cleavage, primer extension, linker
ligation and PCR amplification. LM-PAP is similar to LM-PCR except
that activatable oligonucleotide P*s are used.
LM-PCR has proven to be an important technique, now having been
used in over 100 published studies (Pfeifer et al., 1999). Many
aspects of chromatin structure can be determined by LM-PCR, such as
the location of methylated cytosine residues, bound transcription
factors, or positioned nucleosomes. Importantly, the structure is
determined in cells that are intact and have been minimally
perturbed. UV photo-footprinting, for example, is performed by UV
irradiating tissue culture cells in a Petri dish, immediately
extracting the DNA, and performing LM-PCR to determine the location
of thymidine dimers, the formation of which is affected by bound
transcription factors.
Allele-specific LM-PAP can be applied to quantitatively determine
the level of in vivo methylation. The background of LM-PCR
currently limits reliable estimation of the level of methylation.
It is generally considered that 0%, 50% and 100% methylation can be
determined, but distinguishing finer gradations is not reliable.
With a marked reduction in background in LM-PAP, 0%, 20%, 40%, 60%,
80%, and 100% methylation standards may be distinguished reliably.
It will be of particular interest to utilize allele-specific LM-PAP
to examine the level of methylation in imprinted regions, or in
active verses inactive X-chromosomal genes in females. It is
anticipated that LM-PAP will decrease the skill and experience
needed to examine chromatin structure, thereby facilitating
analysis of chromatin structure by more laboratories.
LM-PAP has a diversity of applications. It will be of particular
interest to utilize allele-specific PAP to examine differential
methylation and chromatin structure in imprinted genes or in active
versus inactive X chromosomal genes in females. In addition, the
relationship between mutagens, DNA damage, and mutagenesis can be
examined.
In PAP, as described above and illustrated herein,
pyrophosphorolysis and polymerization by DNA polymerase are coupled
serially by using pyrophosphorolysis activatable oligonucleotide.
In PAP sequencing, the principle is based on the specificity of PAP
and in turn on the base pairing specificity of the 3' specific
subsequence. This property of the 3' specific subsequence can be
applied to scan for unknown sequence variants, to determine de novo
DNA sequence, to compare two DNA sequences and to monitor gene
expression profiling.
PAP is highly sensitive to mismatches along the length of P* in PAP
with one P* and one opposing unclocked oligonucleotide. The
specificity of PAP is also affected by P* length and mismatch. If
the allele-specific nucleotide of P* is at the 3' terminus, only
the specific allele is amplified and the specificity is not
associated with P* length. If the allele-specific nucleotide is not
at the 3' terminus of P*, the specificity is associated with P*
length. 26 mer P* has a 3' specific subsequence of
three-nucleotides within this region any mismatch inhibit the
amplification. 18-mer has a 3' specific subsequence of 16
nucleotides.
Bi-PAP is a form of PAP. In Bi-PAP with two opposing P*s, each P*
has its own 3' subsequence, i.e., within this region any mismatch
inhibit the amplification of Bi-PAP. For example, when the
allele-specific nucleotide of the P* pair is at their 3' termini,
only the specific allele was amplified, no matter what the lengths
of the P*s are 40, 35 or 30 nucleotides. The length of the paired
specific subsequence is addition of the P* pair minus one.
The length of the paired specific subsequence may be affected by
the sequence context and size of each P*, the type of the 3'
terminal non-extendible nucleotide, the template sequence, the DNA
polymerase, other components like ions, and cycling conditions.
When the template contains repeated sequences or homogenous polymer
runs longer than the length of the P* pair, P* may lose specificity
for anchoring.
Resequencing is the sequencing of a known region to detect unknown
mutations. The property of the paired specific subsequence of
Bi-PAP can be applied to scanning for unknown sequence variants or
re-sequencing of predetermined sequences in a parallel way.
A Bi-PAP resequencing is shown in FIGS. 22, 23A, 23B, 24A and 23B.
Briefly, the wild-type sequence can be determined, and any single
base substitution can be determined with the type and position. An
unknown small deletion and insertion can be detected and localized.
In order to identify a specific type of deletion or insertion, it
is possible to add corresponding Bi-PAPs. For fingerprinting, which
can provide information regarding mutation position, fewer numbers
of Bi-PAPs can be used.
The concept of Bi-PAP de novo DNA sequencing makes use of the
complete set of paired specific subsequence of the P* pair to
identify the presence of the paired specific subsequence in the de
novo sequence.
Bi-PAP de novo DNA sequencing on microarray is shown in FIG. 25.
Briefly, the procedure first collects all the Bi-PAP amplifications
with their P* pairs and then reconstructs the unknown DNA sequence
from this collection by ordering the paired specific
subsequences.
For comparison of two DNA sequences to see if they are the same or
different, there is a simple way to reduce the number of P* pairs
by using an incomplete set of the specific subsequences of the P*
pair. By arranging them in a particular order, it is possible to
identify the chromosomal locations as well as the sequences.
To monitor gene expression profiling, where up to 6.times.10.sup.4
to 10.sup.5 transcripts are expressed and details of the precise
sequence are unnecessary, Bi-PAP can be applied. A set of P* pairs
which can specifically amplify unique motifs in genes can be
designed for Bi-PAP.
This property of the base pairing specificity of Bi-PAP can be
applied to scan for unknown sequence variants, to determine de novo
DNA sequence, to compare two DNA sequences and to monitor gene
expression profiling. A Bi-PAP array is possible. Each pair of two
opposing P*s can be immobilized at an individual spot on a solid
support, e.g., microarray, thus allowing all the Bi-PAP reactions
to be processed in parallel.
For PAP, the activatable oligonucleotide has a non-extendible 3'
terminus that is activatable by pyrophosphorolysis (hereinafter
referred to as a non-extendible 3' terminus). Any 3' terminal
non-extendible oligonucleotide can be used, if it can hybridize
with the template strand, the 3' terminal nucleofide can be removed
by pyrophosphorolysis, and the activated oligonucleotide can be
extended. Examples of non-extendible 3' terminus include, but are
not limited to, a non-extendible 3' deoxynucleotide, such as a
dideoxynucleotide, or a chemically modified nucleotide lacking the
3' hydroxyl group, such as an acyclonucleotide. Acyclonucleotides
substitute a 2-hydroxyethoxymethyl group for the
2'-deoxyribofuranosyl sugar normally present in dNMPs.
Alternative blocking agents may increase the selectivity of
pyrophosphoroloysis for a complete match, thereby further enhancing
the selectivity of PAP for detecting rare mutations. Finally,
alternative blocking agents may be less expensive or more readily
automatable, thereby improving the cost-effectiveness of PAP and
facilitating PAP microarray-based resequencing.
In addition, P*s not blocked with dideoxynucleotides extends the
selection of DNA polymerases which can be used for PAP. As
demonstrated herein, Family I polymerases may be used for PAP when
the 3' terminal non-extendible oligonucleotide contains a
dideoxynucleotide or an acyclonucleotide. Family II polymerases may
be used for PAP when the 3' terminal non-extendible oligonucleotide
contains an acyclonucleotide.
EXAMPLES
The invention can be understood from the following Examples, which
illustrate that PAP can be used to identify a known mutation in a
polymorphic site within the human D.sub.1 dopamine receptor gene.
The effects of the dideoxyoligonucleotide sequences,
acyclonucleotide sequences, DNA polymerases, PP.sub.i
concentrations, allele-specific templates, pH, and dNTP
concentrations were examined. The experiments reported in the
Examples were conducted for proof of principle. The following
examples are offered by way of illustration and are not intended to
limit the invention in any manner. Standard techniques well known
in the art or the techniques specifically described therein were
utilized.
Example 1
Preparation of Template by PCR
A 640-bp region of the human D.sub.1 dopamine receptor gene was
amplified by PCR with two primers (T=5' GAC CTG CAG CAA GGG AGT CAG
AAG 3' (SEQ ID NO:1) and U=5' TCA TAC CGG AAA GGG CTG GAG ATA 3'
(SEQ ID NO:2)) (FIG. 6A). The TU:UT duplexed product spans
nucleotides 33 to 672 in GenBank X55760 and the G+C content is
55.3%. A common A to G polymorphism is located at nucleotide 229,
resulting in three genotypes of G/G, A/A and G/A (Liu et al.,
1995). The PCR mixture contains a volume of 50 .mu.l: 50 mM KCl, 10
mM Tris/HCl, pH 8.3, 1.5 mM MgCl.sub.2, 200 .mu.M each of the four
dNTPs (Boehringer Mannheim), 10 .mu.M of each primer, 2% DMSO, 1 U
of Taq DNA polymerase (Boehringer Mannheim) and 250 ng of genomic
DNA from G/G homozygote, A/A homozygote or G/A heterozygotes.
Cycling conditions included: denaturation at 95.degree. C. for 15
seconds, annealing at 55.degree. C. for 30 seconds, and elongation
at 72.degree. C. for one minute, for a total of 35 cycles
(Perkin-Elmer GeneAmp PCR system 9600). The PCR product was
purified from primers and other small molecules by approximately
10,000-fold by three times of retention on a Centricon.RTM. 100
microconcentrator (Amicon). The amount of recovered PCR product was
determined by UV absorbance at 260 nm.
Synthesis of P* by Adding a 3'-dideoxynucleotide
The deoxynucleotide oligonucleotide was synthesized by Perseptive
Biosystems 8909 Synthesizer (Framinsham) and purified by oligopure
cartridges (Hamilton) in the City of Hope DNA/RNA Chemistry
Laboratory. The 3' terminal dideoxynucleotide was added by terminal
transferase. The mixture contained a total volume of 40 .mu.l: 200
mM potassium cacodylate, 25 mM Tris/HCl (pH 6.6 at 25.degree. C.),
2.5 mM CoCl.sub.2, 0.25 mg/ml of BSA, 4000 pM of the
oligonucleotide, 2.5 mM 2',3'-ddNTP (the molar ratio of the 3'-OH
terminus to ddNTP was 1:25) Boehringer Mannheim), 125 U of terminal
transferase (Boehringer Mannheim). The reaction was incubated at
37.degree. C. for 1 hour and then stopped by adding EDTA at 5 mM
final concentration. After desalting by using butanol, the
dideoxyoligonucleotide was purified by preparative 7M urea/20%
polyacrylamide gel electrophoresis in TBE buffer (90 mM
Tris/borate, 1 mM EDTA, pH 8.3) (Maniatis et al., 1982). The amount
of the recovered P* was determined by UV absorbance at 260 nm.
Since small amounts of unterminated oligonucleotide would result in
non-specificity of pyrophosphorolysis, each dideoxyoligonucleotide
was .sup.32P-labeled at the 5' terminus by T4 polynucleotide kinase
and then was electrophoresed through a 7M urea/20% polyacrylamide
gel. Only P* products were visible even when the gel was
overexposed (data not shown). It is estimated that more than 99.99%
of P* contained a dideoxynucleotide at the 3' terminus.
Pyrophosphorolysis Activated Polymerization
A 469-bp region within the TU:UT duplexed template was amplified by
PAP with oligonucleotides P* and U, or with only one P* (Table 1
and FIG. 6A). The PU:UP duplexed product corresponds to nucleotides
204 to 672 in GenBank X55760 and the G+C content is 55.6%. Unless
stated, the PAP reaction mixture contained a total volume of 25
.mu.l for Tfl DNA polymerase: 75 mM KCl, 20 mM Tris/HCl (pH 7.4),
1.5 mM MgCl.sub.2, 40 .mu.M each of the four DNTPs (dATP, dTTP,
dGTP and dCTP), 0.2 .mu.M P*, 0.05 .mu.M U oligonucleotide, 300
.mu.M Na.sub.4PP.sub.i (the 20 MM stock solution was adjusted by
HCl to pH 8.0), 1 .mu.Ci of [.alpha.-.sup.32P]-dCTP (3000 Ci/nmole,
Amersham), 1 U of Tfl DNA polymerase (Promega) and 2 ng of TU:UT.
For Taq DNA polymerase, the reaction mixture was the same except
for 50 mM KCl, 10 mM Tris/HCl (pH 7.4), 2.0 mM MgCl.sub.2 and 1 U
of Taq DNA polymerase (Boehringer Mannheim). The mixtures of PCR
and other controls were the same except for the primers added.
Cycling conditions included: 94.degree. C. for 15 seconds,
55.degree. C. for one minute, ramping to 72.degree. C. for one
minute and 72.degree. C. for two minutes, for a total of 15
cycles.
TABLE-US-00001 TABLE 1 Oligonucleotides used in PAP Tem- G plate
5'...AATCTGACTGACCCCTATTCCCTGCTT GGAAC...3' (SEQ ID NO:3) A Name
Oligonucleotide sequence 5' 3' (SEQ ID NO:) Purpose D.sub.1
ACTGACCCCTATTCCCTGCTT.sup.b (4) Control D.sub.1G*.sup.a
ACTGACCCCTATTCCCTGCTTG*.sup.b (5) 3' ddG and G allele specificity
co-localized D.sub.2G* ACTGACCCCTATTCCCTGCTTGG* (6) G allele
specificity 5' to ddG D.sub.3G* ACTGACCCCTATTCCCTGCTTGGG* (7) G
allele specificity 5' to ddG D.sub.4G* ACTGACCCCTATTCCCTGCTTGGGG*
(8) 3' ddG mismatches template D.sub.5G*
TCTGACTGACCCCTATTCCCTGCTTG* (9) D.sub.1G*, with 5' extended bases
D.sub.6A* TGACTGACCCCTATTCCCTGCTTA* (10) 3' ddA and A
allele-specificity co-localized U TCATACCGGAAAGGGCTGGAGATA (11)
Upstream oligonucleotide Allele-specific 3' terminal
nucleotide.sup.d nucleotide.sup.c From 3' Size T.sub.m
Amplification.sup.f Name Type Match Type terminus (bp) (base)
(.degree. C.).sup.e G allele A allele D.sub.1 dT Yes -- +1 21 64
Yes Yes D.sub.1G* ddG Yes G 0 22 68 No No D.sub.2G* ddG Yes G -1 23
72 No No D.sub.3G* ddG Yes G -2 24 76 Yes No D.sub.4G* ddG No G -3
25 80 No No D.sub.5A* ddG Yes G 0 26 80 Yes No D.sub.6A* ddA Yes A
0 24 72 No No U dA Yes -- -- 24 72 Yes Yes .sup.aD.sub.1G* was
produced by adding a G dideoxynucleotide to the 3' terminus of the
D.sub.1, * = a dideoxynucleotide at the 3' terminus. .sup.bThe T
means the 3' terminus is T deoxynucleotide and G* means the 3'
terminus is G dideoxynucleotide. The bold capital G and A are the G
and A bases corresponding to G and A alleles, respectively. The
first base at the 5' terminus corresponds to nucleotide 208 in
GenBank X55760. .sup.cThe 3' terminal base is a deoxynucleotide or
dideoxynucleotide, and creates a match (Yes) or a mismatch (No)
with the corresponding base on the complementary strand of the
template. .sup.dThe allele-specific nucleotide is G or A and its
distance to the 3' terminus is assigned: 0 = at the 3' terminus +1
= one base downstream from the 3' terminus, -1 = one base upstream
from the 3' terminus, -2 = two bases upstream from the 3' terminus,
and -3 = three bases upstream from the 3' terminus. .sup.eThe
T.sub.m for oligonucleotides was estimated to be 4.degree. C.
.times. (G + C) + 2.degree. C. .times. (T + A) at 1 M NaCl (Miyada
and Wallace, 1987). .sup.fThe amplification with U and one P* or
with only one P*.
The reaction was electrophoresed through a standard 2% agarose gel.
The gel was stained with ethidium bromide for UV photography by a
CCD camera (Bio-Rad Gel Doc 1000), dried and subjected to Kodak
X-OMAT.TM. AR film for autoradiography.
Restriction Digestion
Each of the three restriction endonucleases of AciI
(5'CCGC3'/3'GGC.tangle-solidup.G5') EaeI
(5'PyGGCCPu3'/3'PuCCGG.tangle-solidup.Py5') and Eco0109I
(5'PuGGNCCPy3'/3'PyCCNG.tangle-solidup.GPu5') has a restriction
site within the PU:UP duplex. The G/G alleles were amplified by PAP
with D.sub.5G* and U; PCR amplification with D.sub.1 and U was used
as the control. 40 .mu.l of the PAP reaction and 2 .mu.l of the PCR
reaction were purified and concentrated with a Centricon.RTM. 100
microconcentrator, and the products digested by the restriction
endonuclease: 2.5 U of AciI in 1.times.NE buffer 3; or 3 U of EaeI
in 1.times.NE buffer 1; or 30 U of Eco0109I in NE buffer 4 with BSA
(all of the above enzymes and buffers from New England BioLabs). 10
.mu.l of the reaction was incubated at 37.degree. C. for 2 hours.
The digestion reaction was electrophoresed through a standard 2%
agarose gel as described above.
Principle of PAP
Tfl and Taq DNA polymerases were shown to contain
pyrophosphorolysis activity. Tfl DNA polymerase was utilized to
detect the G allele at nucleotide 229 of the D.sub.1 dopamine
receptor gene (Liu et al., 1995) (FIG. 6A). P* was synthesized with
either ddG or ddA at the 3'terminus (see Table 1). The 3'terminal
dideoxynucleotide inhibits direct extension by polymerization, but
can be removed by pyrophosphorolysis in the presence of
pyrophosphate (PP.sub.i) when the P* is specifically hybridized
with the complementary strand of the G allele. The degraded
oligonucleotide can be extended by polymerization in 5'-3'direction
(FIGS. 6B and 6C).
The enhanced specificity of PAP relative to PASA is provided by
serially coupling pyrophosphorolysis and polymerization.
Significant nonspecific amplification requires mismatch
pyrophosphorolysis and misincorporation by DNA polymerase, an
extremely rare event (FIG. 7).
Specific Amplification with D.sub.5G* and D.sub.3G*
PAP was performed with two oligonucleotides (P* and U), Tfl DNA
polymerase and DNA template of the G/G and A/A alleles. Multiple P*
were tested (Table 1). D.sub.5G* (the allele-specific nucleotide
and dideoxynucleotide are co-localized to the 3' terminus and
D.sub.3G* (the allele-specific nucleotide is two bases from the 3'
terminus) specifically amplified the G allele in the presence of
PP.sub.i (FIG. 8A). Without added PP.sub.i, no specific product was
observed with D.sub.5G*, indicating that added PP.sub.i was an
essential component for PAP (FIG. 8B, lanes 6 and 15). Faint
products with D.sub.3G* in lane 4 and with D.sub.4G* in lane 5 were
observed (FIG. 8B) (see below).
Effects of pH, [PP.sub.i] and [dNTP] and Enzyme
Each of the above parameters was examined. PAP was most efficient
at pH between 7.4 and 7.7, at [PP.sub.i] between 200 .mu.M and 400
.mu.M, and at [dNTPs] between 25 .mu.M and 50 .mu.M (Table 2). Taq
DNA polymerase can substitute for Tfl with similar efficiencies
(Table 2).
TABLE-US-00002 TABLE 2 Parameters affecting PAP PAP
efficiency.sup.b Parameter D.sub.5G*-U D.sub.3G*-U pH.sup.a 8.1 - -
7.9 - - 7.7 ++ +++ 7.5 ++ +++ 7.4 ++ +++ 7.15 + + PP.sub.i.sup.a
1000 - - (.mu.M) 800 - .+-. 600 - ++ 400 ++ +++ 200 ++ +++ 0 - .+-.
All dNTPs 200 - .+-. changed.sup.a 100 - .+-. (.mu.M) 50 ++ +++ 25
++ ++++ dGTP 100 .+-. ++ changed.sup.a,c 50 .+-. ++ 25 .+-. ++ dATP
100 - + changed.sup.a,c 50 - + 25 - ++ Taq DNA G allele and
PP.sub.i ++ +++ polymerase A allele and PP.sub.i - - G allele and
no PP.sub.i - .+-. .sup.aTfl DNA polymerase was used to amplify the
G/G alleles under the conditions in Materials and Methods, except
for the factors indicated .sup.bThe PAP efficiency is indicated as:
-, no specific product(s); .+-., very weak specific product(s); +,
weak specific product(s); ++, moderate specific product(s); +++,
strong specific product(s); ++++, very strong specific product(s).
.sup.cThe indicated concentration was changed but the others were
kept at 200 .mu.M.
Identity of Specific Products
In order to confirm the identity of the specific products,
restriction endonuclease digestion was performed (FIG. 9). Each of
the three restriction endonucleases of AciI, EaeI and Eco0109 has a
restriction site with the PU:UP duplex. The expected restriction
fragments were found. Similar results were observed with D.sub.3G*
and U.
The specific products of PAP with D.sub.5G* and U revealed two
specific bands on the agarose gel, i.e., PU:UP and UP; because U
was more efficient than D.sub.5G*, under our amplification
conditions. In order to confirm this, the G/G alleles were
amplified by PAP using Tfl DNA polymerase with D.sub.5G* and U as
previously. The products were denatured and electrophoresed through
a denaturing polyacrylamide gel. Only one specific band in
single-stranded form was observed, indicating that the specific PAP
products contain the duplexed and single stranded segments. The
same result was observed with D.sub.3G* and U.
Linear PAP
PAP was performed for linear amplification with only one P* from
the G/G and A/A alleles in the presence of PP.sub.i. The specific
products of PAP were obtained with D.sub.3G* and with D.sub.5G*,
but not with the other P* (FIG. 10, lanes 4 and 6). The efficiency
of P* was affected by the oligonucleotide size, the 3'-terminal
dideoxynucleotide and the position of the allele-specific
nucleotide.
FIGS. 6A-6C show schematic of PAP. FIG. 6A. A duplexed DNA template
TU:UT is amplified with two oligonucleotides P* and U, Tfl DNA
polymerase, dNTPs, pyrophosphate and [.alpha.-.sup.32P]-dCTP.
P*=pyrophosphorolysis activatable oligonucleotide. In this example
P* is D.sub.5G* and TU:UT is a 640-bp segment of the dopamine
D.sub.1 receptor gene. FIG. 6B. D.sub.5G* has a G dideoxynucleotide
at the 3' terminus, and it is specific to the complementary strand
of the G allele, but mismatches the A allele at the 3' terminus
(Table 1). Removal of the dideoxy G by pyrophosphorolysis is
followed by polymerization for each amplification. FIG. 6C.
Autoradiogram of PAP from the G/G, A/A and G/A genotypes. When the
G allele is present, the radioactively labeled specific products of
469 bases (duplex PU:UP and excess antisense strand UP) are
produced, since the low rate of pyrophosphorolysis by Tfl
polymerase implies that oligonucleotide U has a much higher
efficiency than oligonucleotide P*. Electrophoresis for a longer
period separates PU:UP from UP. Other products of UT and UT:TU are
indicated. Note that TU:UT derives from annealing of excess
radioactively labeled UT with non-radioactively labeled TU original
template. PAP was also performed with D.sub.3G* and U from the G/G,
A/A and G/A genotypes, and similar results were obtained.
FIGS. 7A-7B show enhanced specificity of PAP with D.sub.5G*. The
specificity of PAP is compared with that of PASA to exponentially
amplify a template pool of G and A alleles. FIG. 7A. The specific
amplification of PASA derives from the high efficiency of primer
extension when the primer matches the G allele. The nonspecific
amplification results from mismatch extension from the A allele.
When this occurs, it results in an efficiency substrate for further
amplification. The thickness and position of the arrow represent
the amplification efficiency in each cycle. FIG. 7B. The specific
amplification of PAP from the G allele occurs at high efficiency.
Two types of nonspecific amplifications originate from the A
allele: (i) nonspecific amplification can occur at low efficiency
by mismatch pyrophosphorolysis resulting in a A:T homo-duplex PU:UP
product, which is not an efficient template for subsequent
amplification; (ii) nonspecific amplification can occur at
extremely low efficiency by both mismatch pyrophosphorolysis and
misincorporation to produce a G:T hetero-duplex PU:UP product, but
once it occurs, it provides an efficiency template for subsequent
amplification. A similar tendency of nonspecific amplifications is
suggested for linear amplification by PAP with only D.sub.5G*. It
should be noted that allele-specific nucleotide of P*, such as
D.sub.3G*, may be near but not at the 3' terminus. In that case
nonspecific amplification of PAP requires both mismatch
pyrophosphorolysis and mismatch extension. While both variations of
PAP should have higher specificity than PASA, the highest
specificity is predicted when the 3' terminal dideoxy nucleotide is
also the allele-specific nucleotide.
FIGS. 8A-8B show specific amplification with D.sub.5G* and
D.sub.3G*. PAP was performed in the presence (FIG. 8A) or absence
(FIG. 8B) of added PP.sub.i with two oligonucleotides for
exponential amplification. The oligonucleotides are listed in Table
1. Extension controls with only U identify the positions of TU:UT
and UT. Extension controls with D.sub.1 identify the position of
PU. PCR controls of D.sub.1 and U identify the positions of PU:UP
and PU:UT. Only 20% of the extension reaction with D.sub.1 and the
PCR reaction were loaded relative to other lanes.
FIG. 9 shows restriction endonuclease digestion. To show
specificity of PAP, samples from the experiment shown in FIG. 8
were digested with AciI, EaeI and Eco0109I restriction
endonucleases. Each enzyme has a restriction site within PU:UP. PAP
amplified the G/G alleles with D.sub.5G* and U, and 5% of PCR
reaction with D.sub.1 and U were taken as control. AciI produces a
236 bp and a 233 bp fragments from PU:UP and a 407 bp and a 233 bp
fragments from TU:UT. EaeI produces a 289 bp and a 180 bp fragments
from PU:UP and a 460 bp and a 180 bp fragments from TU:UT. Eco0109I
produces a 348 bp and a 121 bp fragments from PU:UP and a 107 bp, a
412 bp and a 121 bp fragments from TU:UT. The arrows indicate the
digestion products expected from PU:UP.
FIG. 10 shows linear PAP. PAP was performed with only one P* in the
presence of added PP.sub.i. 20% of the reaction with D.sub.1 was
loaded relative to other lanes (lanes 1 and 10). No=no
oligonucleotide added.
Enhanced Specificity of PAP with D.sub.5G*
Example 1 provides evidence that pyrophosphorolysis followed by
polymerization may be used to increase the specificity of PASA.
Significant nonspecific amplification requires the serial coupling
of the two types of errors (FIG. 7). The mismatch
pyrophosphorolysis rate to remove a mismatch deoxynucleotide at the
3' terminus, expressed as the removal rate of an incorrect versus a
correct dNMP, was reported at less than 10.sup.-5 for T7 DNA
polymerase (Kornberg and Baker, 1992; Wong et al., 1991). The
misincorporation rate to create a substitution mutation by
polymerization, expressed as the incorporation rate of an incorrect
versus a correct dNMP, was reported as to be 10.sup.-5 for T7 DNA
polymerase and to be 10.sup.-4 for E.coli DNA polymerase I
(Kornberg and Baker, 1992; Wong et al., 1991; Bebenek et al.,
1990). Similar results were reported for Taq DNA polymerase and for
3'-5' exonuclease-deficient mutants of T7 DNA polymerase and E.
coli DNA polymerase I (Kornberg and Baker, 1992; Wong et al., 1991;
Eckert and Kunkel, 1990). The specificity due to the (i)
nonspecific amplification in PAP with D.sub.5G* is estimated to be
10.sup.-5 per cycle, if the mismatch pyrophosphorolysis rate of a
ddNMP is the same as dNMP. The specificity due to the (ii)
nonspecific amplification is estimated to be 3.3.times.10.sup.-11,
if the mismatch pyrophosphorolysis and the misincorporation are
serially coupled.
Essential Components of PAP
Each P* was tested by utilizing Tfl or Taq DNA polymerases to
amplify the G/G and A/A alleles. The specific amplification
requires the presence of PP.sub.i and allele-specific template. In
addition, the amplification efficiency is affected by the
oligonucleotide size, the 3' terminal dideoxynucleotide, the
position of the allele-specific nucleotide relative to the 3'
terminus of P*.
It is not clear why D.sub.1G* and D.sub.2G* did not generate the
specific signals, but it may be related to a threshold stability of
duplex between P* and the template. D.sub.6A*, which contains A
dideoxynucleotide at the 3' terminus, did not generate the specific
signal, which may be associated with different incorporation
efficiencies of ddNTPs by polymerization. Klenow fragment of E.
coli DNA polymerase I, Taq DNA polymerase and .DELTA.Taq DNA
polymerase incorporate ddGTP more efficiently than other ddNTPs
(Sanger et al., 1977; Tabor and Richardson, 1995; Vander Horn et
al., 1997). The rate of ddNTP incorporation also varies depending
on the template sequence and can be 10-fold higher at some bases
relative to others (Sanger et al., 1977). Another possibility is
that D.sub.6A* is shorter in size with a lower T.sub.m.
In PAP without added PP.sub.i, very faint false signals were
generated with D.sub.3G* and with D.sub.4G* (FIG. 8B). One
possibility is that oligonucleotide dimers can form and trigger
nonspecific pyrophosphorolysis of P* in later cycles after "endo-"
PP.sub.i is released from the by-polymerization to generate UT.
3'terminal degraded D.sub.3G* and D.sub.4G* can be hybridized and
extended as false signal. Oligonucleotide dimers were observed with
D.sub.3G* and D.sub.4G*. Another possibility with D.sub.3G* is that
the specific pyrophosphorolysis can occur in later cycles after
"endo-" PP.sub.i is released. A third possibility is that D.sub.3G*
and D.sub.4G* were contaminated by minimal D.sub.3 and D.sub.4
which were not fully added by G dideoxynucleotide at 3'
termini.
Comparison with Other Technologies
A number of methods for enzymatic nucleic acid amplification in
vitro have been developed and can be adapted to detect known
sequence variants. These include polymerase chain reaction (PCR)
(Saiki et al., 1985; Saiki et al., 1988), ligase chain reaction
(LCR) (Landegren et al., 1988; Barany, 1991) and rolling circle
amplification (RCA) (Lizardi et al., 1998; Baner et al., 1998). PAP
is different in many ways: i) pyrophosphorolysis and polymerization
are serially coupled for each amplification, ii) there is at least
one dideoxyoligonucleotide for PAP. Other chemically modified
nucleotides lacking the 3'-hydroxyl group at the 3' terminus, such
as acyclonucleotides can serve the same function (see Example 12
below), iii) one format is for linear amplification and the other
is for exponential amplification, iv) PP.sub.i is necessary for the
amplification, v) significant nonspecific amplification requires
both mismatch pyrophosphorolysis and misincorporation, vi) PAP can
detect known point mutations and greatly increase the specificity
to detect an extremely rare mutant allele from the wild-type
allele.
The mechanistic basis is that two or more reactions are serially
coupled for amplification with increased specificity. The key
component of PAP is a pyrophosphorolysis activatable
oligonucleotide. The blocked 3' terminus in these experiments is a
dideoxy nucleotide, but any non-extendible nucleotide susceptible
to pyrophosphorolysis could in principle be substituted. Indeed,
any enzyme that cleaves an oligonucleotide 5' to a mismatch could
serve the same function as pyrophosphorolysis activation. For
example, a blocked oligonucleotide including the methylated
recognition sequence (such as G.sup.mATC) is annealed to its target
with the unmethylated recognition sequence, then restriction
endonuclease (such as DpnI) can only cleave the methylated site and
so activate the oligonucleotide for extension. If a mismatch is
located 5' to the cleavage site, significant nonspecific
amplification requires the serial coupling of mismatch cleavage and
a misincorporation, which is a rare event. Activatable
oligonucleotides may also be combined with "minisequencing" primer
extension. This may provide a more specific assay for detection of
single base changes that might be particularly amenable to chip
technology in which specificity can be a problem (Syvanen, 1999).
Demonstration that PAP can occur in the linear format (FIG. 10)
supports the feasibility of this approach.
Nucleoside triphosphates and 2'-deoxynucleoside triphosphates or
their chemically modified versions may be used as substrates for
multiple-nucleotide extension by PAP, i.e., when one nucleotide is
incorporated the extending strand can be further extended.
2',3'-dideoxynucleoside triphosphates or their chemically modified
versions that are terminators for further extension may be used for
single-nucleotide extension. 2',3'-dideoxynucleoside triphosphates
may be labeled with radioactivity or fluorescence dye for
differentiation from the 3' terminal dideoxynucleotide of
oligonucleotide P*. Mixtures of nucleoside triphosphates or
2'-deoxynucleotide triphosphates and 2',3'-dideoxynucleoside
triphosphates may also be used.
In PAP, specific nucleic acid sequence is produced by using the
nucleic acid containing that sequence as a template. If the nucleic
acid contains two strands, it is necessary to separate the strands
of the nucleic acid before it can be used as the template, either
as a separate step or simultaneously. The strand separation can
also be accomplished by any other suitable method including
physical, chemical or enzymatic means.
When it is desired to produce more than one specific product from
the original nucleic acid or mixture of nucleic acids, the
appropriate number of different oligonucleotides are utilized. For
example, if two different specific products are to be produced
exponentially, four oligonucleotides are utilized. Two of the
oligonucleotides (P*.gtoreq.1) are specific for one of the specific
nucleic acid sequences and the other two oligonucleotides
(P*.gtoreq.1) are specific for the second specific nucleic acid
sequence. In this manner, each of the two different specific
sequences can be produced exponentially by the present process.
The DNA or RNA may be single- or double-stranded, may be a
relatively pure species or a component of a mixture of nucleic
acids, and may be linear or circular. The nucleic acid or acids may
be obtained from any source, for example, from plasmid, from cloned
DNA or RNA, or from natural DNA or RNA from any source, including
bacteria, yeast, viruses, and higher organisms such as plants or
animals. DNA or RNA may be extracted from blood, tissue material
such as chorionic villi or amniotic cells by a variety of
techniques such as that described by Maniatis et al. (1982).
The P* oligonucleotides are selected to be "substantially"
complementary" to the different strands of each specific sequence
to be amplified. Therefore, the P* oligonucleotide sequence need
not reflect the exact sequence of the template. For example, a
non-complementary nucleotide segment may be attached to the 5'-end
of the P* oligonucleotide, with the remainder of the P*
oligonucleotide sequence being complementary to the strand.
Alternatively, non-complementary bases or longer sequences can be
interspersed into the P* oligonucleotide, provided that the P*
oligonucleotide sequence has sufficient complementarity with the
sequence of the strand to be amplified to hybridize therewith and
form a template for synthesis of the extension product of the other
P* oligonucleotide. As used in the claims, the term "complementary"
should be understood to mean "substantially complementary," as
discussed herein.
Any specific nucleic acid sequence can be produced by the present
process. It is only necessary that a sufficient number of bases at
both ends of the sequence be known in sufficient detail so that two
oligonucleotides can hybridize to different strands of the desired
sequence at relative positions along the sequence. The greater the
knowledge about the bases at both ends of the sequence, the greater
can be the specificity of the oligonucleotides for the target
nucleic acid sequence, and thus the greater the efficiency of the
process. It will be understood that the word oligonucleotide as
used hereinafter may refer to more than one oligonucleotide,
particularly in the case where there is some ambiguity in the
information regarding the terminal sequence(s) of the segment to be
amplified.
The present invention can be performed in a step-wise fashion where
after each step new reagents are added, or simultaneously, where
all reagents are added at the initial step, or partially step-wise
and partially simultaneous, where fresh reagent is added after a
given number of steps. The simultaneous method may be utilized when
an enzymatic means is used for the strand separation step. In the
simultaneous procedure, the reaction mixture may contain the
strand-separating enzyme (e.g., helicase), an appropriate energy
source for the strand-separating enzyme, such as ATP. Additional
materials may be added as necessary.
The nucleic acid polymerase may be any compound or system that will
function to accomplish the amplification. Suitable enzymes for this
purpose include, for example, Tfl DNA polymerase, Taq DNA
polymerase, E. coli DNA polymerase I, Klenow fragment of E. coli
DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, other
available DNA polymerases, RNA polymerases or their variants,
reverse transcriptase or its variants, and other genetic engineered
versions. It is predicted on the basis of the relationship between
reverse and forward reactions that a DNA polymerase will have high
and even pyrophosphorolysis activity for the P* activatable
oligonucleotide, if it incorporates ddNTPs efficiently (compared
with dNTPs) and evenly (compared among the four ddNTPs). Of all the
DNA polymerases, the genetic engineered version may be the best in
the future, such as ThermoSequenase (Vander Horn et al., 1997).
Generally, the synthesis will be initiated at the 3' end of each
oligonucleotide and proceed in the 5' direction on the template
strand. However, inducing agents which initiate synthesis at the 5'
end and proceed in the other direction can also be used in the PAP
method as described above.
Example 2
Preparation of Template by PCR
A 640-bp region of the human D.sub.1 dopamine receptor gene was
amplified by PCR with two primers (T=5' GAC CTG CAG CAA GGG AGT CAG
AAG 3' (SEQ ID NO:1) and U=5' TCA TAC CGG AAA GGG CTG GAG ATA 3'
(SEQ ID NO:2)). The TU:UT duplexed product spans nucleotides 33 to
672 in GenBank X55760 and the G+C content of the product is 55%. A
common A to G polymorphism is located at nucleotide 229, resulting
in three genotypes of G/G, A/A and G/A. The PCR volume is 50 .mu.l:
50 mM KCl, 10 mM Tris/HCl, pH 8.3, 1.5 mM MgCl.sub.2, 200 .mu.M
each of the four dNTPs, 0.1 .mu.M of each primer, 2% DMSO, 1 U of
Taq DNA polymerase (Boehringer Mannheim) and 250 ng of genomic DNA
from G/G homozygote, A/A homozygote or G/A heterozygotes. Cycling
conditions included: denaturation at 94.degree. C. for 15 sec.,
annealing at 55.degree. C. for 30 sec., and elongation at
72.degree. C. for one min., for a total of 35 cycles with a GeneAmp
PCR System 9600 (Perkin-Elmer Applied Biosystems). The PCR product
was purified from primers and other small molecules by
approximately 10,000-fold by three times of retention on a
Centricons 100 microconcentrator (Amicon). The amount of recovered
PCR product was determined by UV absorbance at 260 nm.
Synthesis of P* by Adding a 3' Dideoxynucleotide
The deoxynucleotide oligonucleotide was synthesized by Perseptive
Biosystems 8909 Synthesizer (Framinsham) and purified by oligopure
cartridges (Hamilton) in the City of Hope DNA/RNA Chemistry
Laboratory. The 3' terminal dideoxynucleotide was added by terminal
transferase. The mixture contained a total volume of 30 .mu.l: 100
mM potassium cacodylate (pH 7.2), 2.0 mM CoCl.sub.2, 0.2 mM DTT,
2500 pM of the oligonucleotide, 2 mM 2',3'-ddNTP (the molar ratio
of the 3'-OH terminus to ddNTP was 1:24)(Boehringer Mannheim), 100
U of terminal transferase (GIBCO BRL). The reaction was incubated
at 37.degree. C. for 4 hr and then stopped by adding EDTA at 5 mM
final concentration. After desalting using a Centri-spin.TM. column
(Princeton Separations), P* was purified by preparative 7 M
urea/20% polyacrylamide gel electrophoresis in TBE buffer (90 mM
Tris/borate, 1 mM EDTA, pH 8.3) (Maniatis et al., 1982). The amount
of the recovered P* was determined by UV absorbance at 260 nm.
Since small amounts of unterminated oligonucleotide would result in
nonspecificity of pyrophosphorolysis, each P* was .sup.32P-labeled
at the 5' terminus by T4 polynucleotide kinase and then was
electrophoresed through a 7 M urea/20% polyacrylamide gel. Only P*
products were visible even when the gel was overexposed. It is
estimated that more than 99.99% of P* contained a dideoxynucleotide
at the 3' terminus. The purity of P* was supported by the absence
of PCR product or PAP product at pH 8.3.
Pyrophosphorolysis Activated Polymerization
Regions from 445 to 469 bp within the TU:UT duplexed template were
amplified by PAP with oligonucleotides P* and U, or with only P*.
The PU:UP duplexed product corresponds to nucleotides 204-228 to
672 in GenBank X55760 and its G+C content is 56%. The PAP reaction
mixture contained a total volume of 25 .mu.l: 50 mM KCl, 10 mM
Tris/HCl (pH 7.6), 1.5 mM MgCl.sub.2, 100 .mu.M each of the four
dNTPs (dATP, dTTP, dGTP and dCTP), 0.1 .mu.M P*, 0.1 .mu.M U
oligonucleotide (TCATACCGGAAAGGGCTGGAGATA (SEQ ID NO:2)), 300 .mu.M
Na.sub.4PP.sub.i, 2% DMSO, 1 .mu.Ci of [.alpha.-.sup.32P] dCTP
(3000 Ci/mmole, Amersham), 1 U of AmpliTaqFS DNA polymerase (PE
Applied Biosystems) or 0.5 U of each of AmpliTaqFS and Taq DNA
polymerases, and 10 ng of TU:UT. ThermoSequenase (Amersham
Pharmacia) was also tested under the same conditions except for 8U
ThermoSequenase or 4U ThermoSequenase plus 0.5U Taq and 2.5 mM
MgCl.sub.2. The cycling conditions included: denaturation at
94.degree. C. for 10 sec., annealing at 60.degree. C. for 1 min.
(at 55.degree. C. for ThermoSequenase), and elongation at
72.degree. C. for 2 min., for a total of 15 cycles.
The product was electrophoresed through a standard 2% agarose gel.
The gel was stained with ethidium bromide for UV photography by a
CCD camera (Bio-Rad Gel Doc 1000) and Multi-Analyst.RTM. software,
dried and subjected to Kodak X-OMAT.TM. AR film for
autoradiography. The PAP yield was quantitated with a
PhosphorImager with ImageQuant software (Molecular Dynamics) as the
total number of pixels in the PCR band minus the background,
indicated as a random unit.
Enhanced PAP Efficiency
In Example 1, only the P* with ddG at the 3' terminus was amplified
using native Tfl or Taq DNA polymerase. AmpliTaqFS and
ThermoSequenase DNA polymerases were found to achieve much higher
PAP efficiency with much less discrimination against any kind of
dideoxynucleotide (ddAMP, ddTMP, ddGMP or ddCMP) at the 3' terminus
of P*. For example, P*(212)18G.sup.0 and P*(212)18A.sup.0, which
are 18-mers of the dopamine D.sub.1 receptor gene but have ddGMP
and ddAMP at the 3' termini (Table 3), specifically amplified the G
and A alleles, respectively. Their yield ratio was 1.4 (compare
lanes 9 with 11 in FIG. 11B), and so P*(212)18G.sup.0 is estimated
to be 4% more efficient per cycle than P*(212)18A.sup.0. Another
P*(228)26A.sup.-24=5' TAGGAACTTGGGGGGTGTCAGAGCCC* 3' (SEQ ID
NO:12), which is a 26-mer with ddCMP at the 3' terminus, was
amplified as efficiently as a primer without ddCMP at the 3'
terminus, and the yield was estimated to be increased 1,000 fold
compared with that by using Tfl or Taq. Moreover, PAP amplified
segments directly from human genomic DNA.
TABLE-US-00003 TABLE 3 PAP specificity affected by P* length and
mismatch Mismatch Noise base T.sub.m ratio Name Sequence (SEQ ID
NO:) Type Distance.sup.c (.degree. C.).sup.d (%).sup.e Template
Strand G 5'...AATCTGACTGACCCCTATTCCCTGCTT GGAAC...3' (3) A
P*(204)26G.sup.0a 5'tctgactgACCCCTATTCCCTGCTTG*.sup.b (13) G 0 80
0.0 P*(208)22G.sup.0 5'actgACCCCTATTCCCTGCTTG* (14) G 0 68 0.5
P*(210)20G.sup.0 5'tgACCCCTATTCCCTGCTTG* (15) G 0 62 0.1
P*(212)18G.sup.0 5'ACCCCTATTCCCTGCTTG* (16) G 0 56 0.3
P*(216)26G.sup.-12 5'ctattcccTGCTTGGGAACTTGAGGG* (17) G -12 80
107.1 P*(220)22G.sup.-12 5'tcccTGCTTGGGAACTTGAGGG* (18) G -12 70
95.5 P*(222)20G.sup.-12 5'ccTGCTTGGGAACTTGAGGG* (19) G -12 64 75.8
P*(224)18G.sup.-12 5'TGCTTGGGAACTTGAGGG* (20) G -12 56 7.0
P*(206)26A.sup.-2 5'tgactgaCCCCTATTCCCTGCTTAGG* (21) A -2 80 30.4
P*(210)22A.sup.-2 5'tgacCCCTATTCCCTGCTTAGG* (22) A -2 68 3.3
P*(212)20A.sup.-2 5'acCCCTATTCCCTGCTTAGG* (23) A -2 62 2.0
P*(214)18A.sup.-2 5'CCCTATTCCCTGCTTAGG* (24) A -2 56 0.0
P*(206)26G.sup.-9 5'tgactgacCCCTATTCGCTGCTTAGG* (25) C.fwdarw.G -9
80 95.0 P*(210)22G.sup.-9 5'tgacCCCTATTCGCTGCTTAGG* (26) C.fwdarw.G
-9 68 88.1 P*(212)20G.sup.-9 5'acCCCTATTCGCTGCTTAGG* (27)
C.fwdarw.G -9 62 49.5 P*(214)18G.sup.-9 5'CCCTATTCGCTGCTTAGG* (28)
C.fwdarw.G -9 56 4.7 P*(206)26T.sup.-15
5'tgactgacCCTTATTCCCTGCTTAGG* (29) C.fwdarw.T -15 78 89.0
P*(210)22T.sup.-15 5'tgacCCTTATTCCCTGCTTAGG* (30) C.fwdarw.T -15 66
47.8 P*(212)20T.sup.-15 5'acCCTTATTCCCTGCTTAGG* (31) C.fwdarw.T -15
60 3.4 P*(214)18T.sup.-15 5'CCTTATTCCCTGCTTAGG* (32) C.fwdarw.T -15
54 0.0 .sup.aP*(204)26G.sup.0 is a P* with a G dideoxynucleotide at
the 3' terminus. "0" means the allele-specific base is at the 3'
terminus. The first base at 5' terminus corresponds to nucleotide
204 in GenBank X55760. Its length is 26 bases. .sup.bThe bold G or
A are the G or A allele specific base and the underlined base is
designed mismatch. .sup.cThe distance from the 3' terminus to the
allele-specific base: "0" = at the 3' terminus, -3 = three bases
from the 3' terminus. .sup.dThe Tm for oligonucleotide was
estimated to be 4.degree. C. .times. (G + C) + 2.degree. C. .times.
(T + A) under condition of 1 M NaCl. The length of each P* is 18
bases. .sup.eThe noise rate of PAP (%) is defined as the relative
yield of non-specific allele product to specific allele product by
the same P*, or as the relative yield of the designated mutated P*
to its native form by using the same template. A specific signal is
denoted as <10% noise rate.
AmpliTaqFS has two mutations compared with native Taq. One mutation
in the 5' nuclease domain eliminates 5'-3' exonuclease activity and
the second mutation F667Y in the active site (Innis and Gelfand,
1999). ThermoSequenase has the same mutation F667Y in the active
site but a deletion of the 5'-3' exonuclease domain (Tabor and
Richardson, 1995; Van der Horn et al., 1997). They do not
distinguish between dNTP and ddNTP for incorporation. The
pyrophosphorolysis of ddNMPs, which is the reverse reaction, is
supposed to be much higher and less discriminated by these enzymes.
Although either AmpliTaqFS or ThermoSequenase DNA polymerases used
was formulated to contain a thermostable pyrophosphatase
(manufacturers' instructions) that can hydrolyze PP.sub.i in the
reaction so as to decrease PAP efficiency, PAP was still amplified
under our conditions. AmpliTaqFS and ThermoSequenase DNA
polymerases will work better in their pure form without the
contaminated pyrophosphatase.
The 3' Specific Subsequence of P*
Various P*s were examined with different lengths and mismatches
using AmpliTaqFS (Table 3). The effect of length and mismatch on
PAP efficiency is expressed as the relative yield (%) between two
P*s of different lengths from the same template (FIG. 12), which
varied from 0.0% to 201.5% with each two to four less bases in
length. The specificity of PAP is also affected by P* length and
mismatch (Table 3). The noise rate (%) is defined as the relative
yield of the mismatch product to the match product, and a specific
signal is scored with <10% noise rate. If the allele-specific
base of P* was at the 3' terminus, only the specific allele was
amplified and the specificity was not associated with P* length
(FIG. 12A). If the allele-specific base was not at the 3' terminus
of P*, the specificity was associated with P* length. Any
non-3'-terminal mismatch in the 18-mer P*, which was up to 15 bases
from the 3' terminus, caused no amplification (FIGS. 12B-12E), but
even two such mismatches in the 26-mer P* caused non-specific
amplification.
The 18-mers were further examined using "stacked" P*s, which span
the allele-specific base at different positions (FIG. 13 and Table
4). The noise rate (%) varied from 0.0% to 7.1%. The length of the
3' specific subsequence was .gtoreq.13 bases.
TABLE-US-00004 TABLE 4 PAP specificity with differently positioned
P*s Name Sequence (SEQ ID NO:) Template G
5'GACTGACCCCTATTCCCTGCTT-GGAACTTGAGGGGTGTC . . . 3' (33) A
P*(212)18G.sup.0 5'ACCCCTATTCCCTGCTTG* (16) P*(212)18A.sup.0
5'ACCCCTATTCCCTGCTTA* (34) P*(214)18A.sup.-2 5'CCCTATTCCCTGCTTAGG*
(24) P*(218)18G.sup.-6 5'TTCCCTGCTTGGGAACT* (35) P*(221)18G.sup.-9
5'CCCTGCTTGGGAACTTGA* (36) P*(224)18G.sup.-12 5'TGCTTGGGAACTTGAGGG*
(37) Allele-specific base Noise rate (%).sup.a 3' terminal Dis-
Exponential Name dideoxy Type tance Tm (.degree. C.) PAP Linear PAP
template P*(212)18G.sup.0 ddG G 0 56 2.7 0.0 P*(212)18A.sup.0 ddA A
0 54 3.8 1.1 P*(214)18A.sup.-2 ddG A -2 56 4.7 0.0
P*(218)18G.sup.-6 ddT G -6 54 0.0 0.0 P*(221)18G.sup.-9 ddA G -9 56
1.7 1.7 P*(224)18G.sup.-12 ddG G -12 56 7.1 0.6 .sup.aThe
amplification from the G and A templates by PAP with two
oligonucleotides or linear PAP with one P*. The noise rate of PAP
(%) is the relative yield of the non-specific allele product to the
specific allele product.
Similar results were obtained by using P*s which match and mismatch
the G allele at different positions (Table 5). The noise rate with
one mismatch was various from 0.8% to 5.6%. The length of the 3'
specific subsequence was .gtoreq.16 bases. The noise rate with two
mismatches was 0% (compare lane 2 with lanes 10-15 in FIG. 14).
TABLE-US-00005 TABLE 5 PAP specificity with differently mismatched
P*s Noise rate (%).sup.b The 3' terminal Mismatch.sup.a Exponential
Linear Name Sequence (SEQ ID NO:) dideoxy Type Distance T.sub.m
(.degree. C.) PAP PAP P*(212)18G.sup.0 5'ACCCCTATTCCCTGCTTG* (16)
DdG 56 1.0 0.0 P*(212)18A.sup.-3 5'ACCCCTATTCCCTGATTG* (38) DdG
C.fwdarw.A -3 54 1.3 0.0 P*(212)18G.sup.-6 5'ACCCCTATTCCGTGCTTG*
(39) DdG C.fwdarw.G -6 56 0.8 0.6 P*(212)18C.sup.-9
5'ACCCCTATCCCCTGCTTG* (40) DdG T.fwdarw.C -9 58 1.8 0.4
P*(212)18G.sup.-12 5'ACCCCGATTCCCTGCTTG* (41) DdG T.fwdarw.G -12 58
5.6 1.- 7 P*(212)18T.sup.-15 5'ACTCCTATTCCCTGCTTG* (42) DdG
C.fwdarw.T -15 54 3.3 1.- 2 .sup.amatch or mismatch with the G
allele. .sup.bnoise rate (%) is the relative yield between a
mismatched P* and P*(212)18G.sup.0 with the G allele-specific
template.
Linear PAP was examined using only 18 mer P*s and higher
specificity was observed with lower noise rate (Tables 4 and 5).
Linear PAP takes a different mechanistic pathway in which every
non-specific product is generated from the starting template which
requires mismatched pyrophosphorolysis with the 3' terminal
mismatched P*, or both mismatched pyrophosphorolysis and mismatched
extension with the non-3' terminal mismatched P*.
PASA was performed with 17-mer primers without adding a ddNMP at
the 3' terminus (see Tables 4 and 5). A mismatched 17-mer primer
strongly amplified a nonspecific product with 30% noise rate when
the mismatch was as near as 6 bases to 3' terminus, showing a much
shorter 3' specific subsequence. Similar results were reported
elsewhere previously (Sarkar et al., 1990).
In summary, P* (1-length) has two subsequences: a 3' specific
subsequence (n=the number of bases of the 3' specific subsequence
.ltoreq.1) determines the specificity, i.e., within this region any
mismatch to its complementary strand of the template results in no
substantial amplification; and a 5' enhancer subsequence (m=the
number of bases of 5' enhancer subsequence .gtoreq.0) enhances the
amplification efficiency. PAP specificity is co-determined by the
base pairing specificity of the 3' specific subsequence, the
pyrophosphorolysis specificity and the polymerization specificity.
Thus, the base pairing specificity of the 3' specific subsequence
is a minimum requirement of the PAP specificity.
The length of the 3' specific subsequence of P* may be affected by
the sequence context and size of the P*, the type of the 3'
terminal dideoxynucleotide, the template sequence, the DNA
polymerase, other components like ion, and cycling conditions. When
the template contains repeated sequences >1 or homogeneous
polymer runs >1, P* loses specificity for anchoring. The length
of the 3' specific subsequence of P* may be affected by the
sequence context and size of the P*, the type of the 3' terminal
dideoxynucleotide, the template sequence, the DNA polymerase, other
components like ion, and cycling conditions. When the template
contains repeated sequences >1 or homogeneous polymer runs
>1, P* loses specificity for anchoring.
Scanning or Resequencing for Unknown Sequence Variants
The property of the 3' specific subsequence of P* can be applied to
scanning for unknown sequence variants or re-sequencing of
predetermined sequences in a parallel way. Each nucleotide on the
complementary strand of the predetermined sequence is queried by
four downstream P*s, such as 18-mers (FIG. 11), which have
identical sequence except that at the 3' terminus, either ddAMP,
ddTMP, ddGMP or ddCMP corresponds to the wild-type sequence and the
three possible single base substitutions. The number of P*s
scanning the complementary strand of X bases is multiplication of 4
and X, which is suitable for either exponential or linear PAP. The
four downstream P*s can even be immobilized on a single dot when
ddAMP, ddTMP, ddGMP and ddCMP at the 3' termini are labeled
differently for differentiation, such as by four fluorescence dyes.
The amplification signal can thus be represented by intensity
decrease of each dye when ddNMP is removed from P* by
pyrophosphorolysis. One advantage of linear PAP is that the four
ddNTPs can be used as substrates for single base extensions, with
are labeled with different dyes for differentiation.
Briefly, if only all the P*s corresponding the wild-type sequence
are specifically amplified, the wild-type sequence can be arranged
in order by analyzing overlaps. A P* with a single base
substitution at the 3' terminus is amplified at the position of
hemi- or homo-point mutations. The mutation also creates a "gap" of
no PAP signal, which spans a region of several successive
nucleotides. For single base substitution, the gap size
(bases)+1=the length of the 3' specific subsequence.
Furthermore, we can also scan the sense strand by designing a
second set of upstream P*s. An unknown single base substitution can
be determined by combination of the two sets of P*s, even in
heterozygotes. An unknown small deletion and insertion can be
detected and localized. In order to identify a specific type of
deletion or insertion, it is possible to add corresponding P*s. For
fingerprinting, which can provide information of mutation position,
there is a simple stacking way that the stacked region of each two
successive P*s< the 3' specific subsequence on the array to
reduce the number of P*s by up to n fold.
Determination of de novo DNA Sequence
The concept of de novo DNA sequencing by PAP makes use of all the
possible 3' specific subsequences of P* to identify the presence of
the 3' specific subsequence in de novo sequence. A complete set of
the 3' specific subsequences of P* is 4.sup.n. Each of the 3'
specific subsequence has a complete subset of the 5' enhancer
subsequence of 4.sup.m. For example, a complete set of 16-mer as
the 3' specific subsequence and 2-mer as the 5' enhancer
subsequence can be indicated as (A, T, G, C)(A, T, G, C)
N.sub.16=4.sup.18.
Briefly, the procedure first determines the list of all the
specific PAP amplifications and then reconstructs the unknown DNA
complementary sequence from this list by ordering the 3' specific
subsequences with the given length by using the Watson-Crick
pairing rules.
The assembly process is interrupted wherever a given 3' specific
subsequence of P* is encountered two or more times. One of the
factors influencing the maximum sequencing length is the length of
the 3' specific subsequence. The length of a random sequence that
can be reconstructed unambiguously by a complete set of the 3'
specific subsequence with the given length is approximately the
square root of the number of the 3' specific sequence in the
complete set with .gtoreq.50% possibility that any given 3'
specific subsequence is not encountered two or more times. Octamers
of the 3' specific subsequence, of which there are 65,536, may be
useful in the range up to 200 bases. Decanucleotides, of which
there are more than a million, may analyze up to a kilobase de novo
sequence. 18 mer P*s containing 16 mer as the 3' specific
subsequence, which complete set is 4.sup.18 of P*s, may sequence
maximum 77,332 bases.
When there is neighbored known sequence to design an opposite
oligonucleotide for PAP with two oligonucleotides. The maximum
sequencing length is mainly limited to the opposite
oligonucleotide, but not to the length of the 3' specific
subsequence of P*, termed Conditional de novo DNA Sequencing.
Other Applications for PAP
For fingerprinting which compares two DNA sequences to see if they
are the same or different, there is a simple way to reduce the
number of P*s by using an incomplete set of the 3' specific
subsequences. By arranging them in a particular order, it is
possible to identify the chromosomal locations as well as
sequences. Considering the 3.times.10.sup.9 bp DNA in human genome,
PAP with two oligonucleotides is preferred over PAP with only one
P* to increase the specificity.
To monitor gene expression profiling, where up to 6.times.10.sup.4
to 10.sup.5 transcripts are expressed and details of the precise
sequence are unnecessary, PAP with only one P* can be applied and a
set of P* which identify unique motifs in genes can be designed
with a total length of up to 22-mer. Between each two P*s, there is
at least a sequence difference at the 3' terminus or .gtoreq.2
sequence differences at the non-3' terminus.
Comparison with Sequence by Hybridization
In SBH by using oligonucleotide, the DNA sequence is determined by
the hybridization and assembly of positively hybridizing probes
through overlapping portions. It has been known for a long time
that a single oligonucleotide hybridization on a immobilized sample
can be very specific in optimal hybridization and washing
conditions (Wallace et al., 1979), thus it is possible to
discriminate perfect hybrids from ones containing a single internal
mismatch. The oligonucleotides in array are 11-20 nucleotides in
length and have 7-9 bases specific region in the middle, the
non-specific signal is generated by mismatched hybridization. Under
standard hybridization and washing conditions, the duplex stability
between match and mismatch is also affected by the terminal
mismatch and the flanking sequence (Drmanac et al., 1989; Khrapko
et al., 1989; Ginot, 1997).
SHB can be modified with enzymes in several ways (Miyada and
Wallace, 1987; Southern, 1996). Primer extension by DNA polymerase
incorporates bases one at a time only if they match the complement
strand. Ligase has similar requirements: two oligonucleotides can
be joined enzymatically provided they both are complementary to the
template at the position of joining.
FIGS. 11A-11B show the enhancement of PAP efficiency. FIG. 11A. PAP
is amplified with two oligonucleotides P* and U from duplex TU:UT
template. Each of the four P*s has a ddA, ddT, ddG and ddC at the
3' terminus. The 3' terminal base is either specific to the
complementary strand of the G or A alleles, or not matched. FIG.
11B. Autoradiogram of PAP from the G/G, A/A and G/A genotypes of
the human dopamine receptor gene. The radioactively labeled
specific products of 461 bases (duplex PU:UP and excess antisense
strand UP) are produced. Other side products UT and UT:TU are
indicated. Note that TU:UT derives from annealing of excess
radioactively labeled UT with non-radioactively labeled TU original
template.
FIGS. 12A-12E show the effect of P* length and mismatch on PAP
efficiency. PAP was amplified with P* and U oligonucleotide (see
Table 3). In each of FIGS. 12A-12E, P*s have the sample 3' termini
but are different in length. FIG. 12A. In lanes 1-4, the P*s
matched and amplified the G allele. In lanes 5-8, the P*s
mismatched at the 3' termini but amplified the A allele. FIG. 12B.
In lanes 9-12, the P*s matched and amplified the G allele. In lanes
13-16, the P*s mismatched at -12 bases to the 3' termini but
amplified the A allele. FIG. 12C. In lanes 17-20, the P*s matched
and amplified the A allele. In lanes 21-24, the P*s mismatched at
-2 bases to the 3' termini but amplified the G allele. FIG. 12D. In
lanes 25-28, the P*s mismatched at -9 bases to the 3' termini but
amplified the A allele. FIG. 12E. In lanes 29-32, the P*s
mismatched at -15 bases to the 3' termini but amplified the A
allele. The length effect is indicated as the yield ratio in one
lane (L.sub.n) to the previous lane (L.sub.n-1). The length effect
was not shown in lanes 5-8 because the signals are at or close to
the background.
FIG. 13 shows PAP specificity with differently positioned P*s. PAP
was amplified with a P* and U oligonucleotide (see Table 4). The P*
matched to and amplified the G allele in lanes 2-7, but mismatched
to and amplified the A allele in lanes 9-15. Lanes 1 and 9 were PCR
control with D.sub.1(212)17 mer and U. Lanes 8 and 16 were
extension control with only U.
FIG. 14 shows PAP specificity with differently mismatched P*s. PAP
was amplified with a P* and U oligonucleotide (see Table 5). In
lanes 2-7, the P* amplified the G allele with match or one
mismatch. In lanes 9-15, the P* amplified the A with one or two
mismatches. Lanes 1 and 9 were PCR control with D.sub.1(212)17 mer
and U. Lanes 8 and 16 were extension control with only U.
Example 3
PAP Amplification from Genomic DNA
This example illustrates PAP amplification directly from genomic
DNA. The oligonucleotides used in this example are listed below.
Lane numbers refer to lanes in FIG. 15.
The downstream oligonucleotides in 0.1 .mu.M concentration are:
TABLE-US-00006 Lane 1: D.sub.1(204)25D 5' TCTGACTGACCCCTATTCCCTGCTT
3' (SEQ ID NO:43) Lane 2: P*(206)24A.sup.0 5'
TGACTGACCCCTATTCCCTGCTTA* 3' (A allele specific; SEQ ID NO:44) Lane
3: P*(204)26G.sup.0 5' TCTGACTGACCCCTATTCCCTGCTTG* 3' (G allele
specific; SEQ ID NO:45) Lane 4: P*(206)24G.sup.-2 5'
ACTGACCCCTATTCCCTGCTTGGG* 3' (G allele specific; SEQ ID NO:46) Lane
5: P*(228)26A.sup.-24 5' TAGGAACTTGGGGGGTGTCAGAGCCC* 3' (A allele
specific; SEQ ID NO:47)
The opposite upstream oligonucleotide in 0.1 .mu.M concentration
is: D.sub.1(420)24U 5' ACGGCAGCACAGACCAGCGTGTTC 3' (SEQ ID NO:48),
which was paired with each downstream oligonucleotide. See
Footnotes of Table 3 for details.
The other components were the same as in Example 2, except for the
following: 0.5 U of each of AmpliTaqFS and Taq DNA polymerases, and
100 ng of heterozygous G/A allelic genomic DNA were used per 25
.mu.l reaction by using 30 cycles.
The PAP product size range from 193 bp to 218 bp. One double
stranded and one single stranded product was observed on the gel,
indicating the exhaust of PP.sub.i hydrolyzed by the contaminated
thermostable pyrophosphatase.
Example 4
Comparison of Specificity of LM-PCR and LM-PAP
The LM-PCR protocol includes primer extension, linker ligation, PCR
amplification, and directed labeling in the human dopamine D.sub.1
receptor gene model system (FIG. 16). LM-PCR was performed with the
addition by terminal deoxynucleotidyl transferase (TdT) (this
protocol is known as TD-PCR) on UV-treated genomic DNA samples
essentially as described (Pfeifer et al., 1999), except that
Vent.sub.R (exo-) DNA polymerase was used in the first 10 cycles of
primer extension (P1 primer=5' TTGCCACTCAAGCGGTCCTCTCAT 3' (SEQ ID
NO:49)). Temperature cycles were 1 min at 95.degree. C., 3 min. at
63.degree. C., and 3 min at 72.degree. C. To enhance the signal,
terminal transferase was added to the protocol, and this variation
of LM-PCR is called TD-PCR. Dynabeads were used to enrich target
DNA molecules before terminal deoxynucleotidyl transferase (TdT)
tailing. PCR was performed using Expand Long Template PCR System 3
(BMB) as described by the manufacturer (P2 primer=5' GAAGCAATCTGGCT
GTGCAAAGTC 3' (SEQ ID NO:50)). The PCR products were purified using
QIAquick PCR Purification Kit (QIAGEN) before performing the direct
labeling. A portion of the cleaned PCR product was used for direct
labeling with AmpliTaq DNA Polymerase (Perkin-Elmer) with .sup.32P
labeled primers:
TABLE-US-00007 P3A: (5' TCTGACTGACCCCTATTCCCTGCTTA 3' (SEQ ID
NO:51; the 3' terminal deoxynucleotide is A allele specific) and
P3G: (5' TCTGACTGACCCCTATTCCCTGCTTG 3'. (SEQ ID NO:52; the 3'
terminal deoxynucleotide is G allele specific)
LM-PAP was performed as allele-specific PCR except for the direct
labeling step by PAP (FIG. 16A). The purified PCR product was used
for direct labeling with .sup.32P labeled primers:
TABLE-US-00008 P3A: 5' TCTGACTGACCCCTATTCCCTGCTTA* 3' (SEQ ID
NO:53; the 3' terminal deoxynucleotide is A allele specific) and
P3G: 5' TCTGACTGACCCCTATTCCCTGCTTG* 3' (SEQ ID NO:54; the 3'
terminal deoxynucleotide is G allele specific)
using PAP reaction conditions in a 10 .mu.l volume (50 mM KCl, 10
mM Tris/HCl (pH 7.6), 1.5 mM MgCl.sub.2, 100 .mu.M of each dNTP,
0.1 .mu.M P*, 300 .mu.M Na.sub.4PP.sub.1, 2% DMSO, 0.25U each of
AmpliTaqFS and AmpliTaq DNA Polymerases (Perkin-Elmer). The cycling
conditions were 94.degree. C., 10 sec.; 60.degree. C., 1 min. and
72.degree. C., 2 min. for a total of 8 or 16 cycles. LM-PAP was
dramatically more specific than LM-PCR. The initial data with the
dopamine D1 gene shows a lower background with LM-PAP than with the
identical unblocked oligonucleotide with LM-PCR. Also, LM-PAP can
be performed with the PGK gene, a gene with a very high GC rich
region (70%) (FIG. 16B).
FIG. 16A shows a UV footprinting of the dopamine D1 receptor gene
with a comparison of allele-specific LM-PAP and allele-specific
LM-PCR. A direct comparison of LM-PAP with a P* and LM-PCR with an
unblocked primer of identical sequence shows that two alleles can
be distinguished with LM-PAP, but not with LM-PCR. Both methods
were performed on HF-16 DNA that was untreated (C), in vitro
treated (T) or in vivo treated (V) with UV. The direct labeling
reaction using PAP conditions (lanes 7-18) with .sup.32P labeled
primers P3A* (lanes 7-9 and 13-15) and P3G* (lanes 10-12 and 16-18)
was done with AmpliTaqFS and AmpliTaq for 8 and 16 cycles. For
LM-PCR the direct labeling reaction was done with AmpliTaq (lanes
1-6) and .sup.32P-labeled primers P3A (lanes 1-3) and P3G (lanes
4-6) for 8 cycles Allelic primers P*s, P3A* and P3G* for LM-PAP
clearly distinguish the two alleles, while unblocked allelic
primers of identical sequence, P3A and P3G, were unable to
distinguish the alleles by LM-PCR.
FIG. 16B shows a UV footprinting of the pgK gene. The LM-PAP
procedure for PGK was essentially the same as for the dopamine D1
receptor except that Pfu Turbo DNA polymerase was used in the
primer extension, as well as 7-deaza-dGTP/dGTP in a 3:1 ratio.
Temperature cycles were 95.degree. 1 min., 60.degree. 2 min., and
76.degree. 3 min. The PCR step was performed using Vent (exo-) DNA
Polymerase at 97.degree. 1 min., 60.degree. 2 min., 76.degree. 3
min. also with deaza dGTP. The purified PCR products were used for
direct labeling with the .sup.32P P3G* and P3C* primers using PAP
reaction conditions in a 25 .mu.l volume (50 mM KCL, 20 mM Hepes,
pH 6.95, 10 mM (NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2, 40
.mu.M dNTP, 150 .mu.M Na.sub.4PPi, 4% DMSO, and 1 unit of AmpliTaq
FS DNA Polymerase. The conditions for cycling were 94.degree. 15
sec., 60.degree. 30 sec., and 72.degree. 1 min. for 10 cycles.
Example 5
Optimization of PAP-A to Detect a Mutation in 1 of
10.sup.4-10.sup.5 Templates
One .mu.g of lambda phage DNA contains 2.times.10.sup.10 copies of
template. The specificity of PAP is determined by mixing one part
mutant lacI templates with 10.sup.4 to 10.sup.5 parts control DNA
templates, e.g., wild-type lacI. The specificity of PAP-A is a
function of the error rate of the polymerase, the purity of P*
(<2.times.10.sup.-4 by current purification protocol) and the
potential for damage of the DNA template in the extraction process.
The yield and specificity of PAP is optimized by testing enzyme
type and concentration and the concentrations of other components,
such as dNTP, PP.sub.i, Mg.sup.++ or Mn.sup.++. Hotstart PAP using
antibody-activated enzyme, such as DNA polymerase, at room
temperature can be used to eliminate spurious amplifications.
Wild-type and mutant lambda phage DNA, which are used in the
laboratory as a model system to study spontaneous mutation in
mammals, are prepared from infected E. coli SCS-8 cells (Nishino et
al., 1996). The lambda phage is grown under high fidelity
conditions and DNA is isolated with care under conditions with low
rates of DNA damage (Stratagene manual) (Nishino et al., 1996; Hill
et al., 1999).
The mutants include one example of each of the two types of
transitions, the four types of transversions and a one-base
nucleotide deletion. P*s specific for each of the mutations is
synthesized. These DNA templates are used for reconstruction
experiments in which mutated DNA is serially diluted into wild-type
DNA. The spiked samples are used to optimize PAP-A. The most robust
polymerases are chosen based on yield and specificity using TaqFS,
ThermoSequenase, and SequiTherm Excel II (Epicentre). Other
components of the reaction are optimized systematically, including
thermocycling parameters, oligonucleotide length, and reagent
concentrations of PP.sub.i, dNTP and Mg.sup.++ or Mn.sup.++.
Quantitative detection of the yield of PAP product is achieved with
autoradiography or fluorescence on a SSCP gel. These data aids in
the optimization of PAP-R and LM-PAP (below). The optimization of
these various parameters result in a specificity of 1 part in
10.sup.4-10.sup.5.
The optimized conditions are also tested for detecting mutations in
the human factor IX gene by mixing human mutant genomic DNA
templates with up to 10.sup.4 wild-type templates. As with the
lambda experiment, exponential PAP is performed with appropriately
designed oligonucleotides (using Oligo5 software) for 40 cycles and
strong signal is achieved by autoradiography or by fluorescence
detection.
Example 6
Optimization of PAP-R
In a model system, mismatches along the length of P* inhibited
activation, even when the mismatch is two nucleotides from the 5'
end (FIG. 14). An additional set of 18 mers of P*s, whose 5'
termini were displaced 2, 6, 9, and 12 nucleotides downstream, also
showed inhibition of activation (FIG. 13). In addition, 20 and 22
mers also show inhibition with single nucleotide mismatches (FIG.
12). To extend these findings and to lay the foundation for a
robust method of resequencing, the relationship between the
location of single base mismatches and activation of P*s is
analyzed further.
The factor IX gene is used as a model system because more than
1,000 DNA samples from hemophilia patients and family members have
been ascertained from previous work on the molecular epidemiology
of germline mutations in humans (Sommer, 1995; Ketterling et al.,
1999). Two 20-nucleotide regions of exon B and exon H in the human
factor IX gene are used as model systems. The region of exon B is
designed from nucleotides 6460 to 6479 (5' CGAGAAGTTTTTGAAAACAC 3'
(SEQ ID NO:55; Yoshitake et al., 1985), within which eight
different single base mutations are available. The region of exon H
is from nucleotides 30845 to 30864 (5' GAACATACAGAGCAAAAGCG 3' (SEQ
ID NO:56), within which seven mutations at different positions are
available. P*s identical to wild-type regions B and H will be
synthesized. Identical P*s are synthesized, with the exception of a
single nucleotide mismatch.
The wild-type factor IX sequence is used in the initial studies. A
few P*s that match the wild-type sequence or that mismatch at
selected sites within the 5' third of the oligonucleotide sequence
are helpful in performing pilot experiments to assess the optimal
length of the oligonucleotide. The effects of polymerases and
reaction conditions can be assessed.
From preliminary data, it appears that 18 mers or larger may be an
optimal size. It is also possible that 25 mers or even 30 mers may
be optimal. For the present example, it is assumed that 20 mers are
an optimal size. Wild type P* and twenty P*s with one of the
possible single base mismatches at each nucleotide of the position
region of exon B are synthesized. Eight of these P* are a perfect
match to a mutation in a patient with hemophilia B. As positive
controls, it is shown that these P*s activate efficiently when the
appropriate mutated DNA sample is used. Exponential PAP and linear
PAP are performed and the noise rate is determined. The noise rate
for linear PAP is generally lower and is used.
To confirm preliminary data in another sequence context, a similar
experiment is performed in exon H. The seven mutations in that
region of exon H are analyzed in a blinded manner to determine if
the precise match is detected. The effects of the position of the
mismatch or the type of mismatch on P* activation is determined.
The effects of different polymerases, reaction temperature, and
other reaction conditions can also be determined. Another set of 20
P*s provides additional data from mismatches 12-20 nucleotides from
the 3' terminus.
Example 8
Optimization of LM-PAP
The human dopamine D.sub.1 receptor gene and the mouse Pgkl gene
are used as model systems to compare the analysis of chromatin
structure when LM-PAP or LM-PCR is utilized. The dopamine D.sub.1
receptor gene has been described above. X chromosome inactivation
occurs at an early embryonic stage. Since the two alleles in female
cells maintain a different expression status, this is an
advantageous system for studies of gene regulation. Pgkl is an
X-linked housekeeping gene encoding phosphoglycerate kinase (PGK).
PGK is an important enzyme in glycolysis and the gene is expected
to be active all the time except in the inactive X chromosome (Xi)
of female somatic cells and in male germ cells.
The preliminary data shows a dramatic enhancement of specificity
with LM-PAP relative to LM-PCR in the dopamine D.sub.1 receptor
gene, a gene not previously analyzed for chromatin structure (FIG.
16A). In this example, LM-PAP and LM-PCR are performed. Three sets
of oligonucleotides that generated LM-PCR profiles and seven sets
of primers that generated LM-PCR profiles with unacceptable
background in the Pgkl (and other X-chromosomal genes) are used to
compare LM-PAP with LM-PCR. Deoxy-terminating and
dideoxy-terminating oligonucleotides of identical sequence are
utilized to perform LM-PAP and LM-PCR, respectively. The level of
signal relative to background is also quantitated by a
PhosphoImager. The average signal-to-noise ratio is determined.
Optimization data derived from analyses with PAP-A and PAP-R are
also useful in the LM-PAP protocol. LM-PAP is optimized for the two
regions to determine if the signal-to-noise ratio can be reduced
further.
Example 8
Optimization of Allele-Specific LM-PAP
Polymorphic sites of pgkla and lb gene in both coding and
non-coding regions have been reported (Boer et al., 1990). These
are used to design the allele-specific P*. One allele-specific
oligonucleotide is chosen prospectively from the Pgkl gene and one
is chosen prospectively from the dopamine D.sub.1 receptor gene.
Blocked and unblocked oligonucleotides of identical sequence are
synthesized and allele-specific LM-PAP and LM-PCR are performed,
respectively. The signal to noise ratio is quantitated and
compared.
Example 9
PAP-R on a Microarray
The initial experiment will focus on the two 20 nucleotide regions
of exons B and H as described above. The experimental design of
PAP-R is similar to the experiments described above, except for
digital light-direct synthesis of P* oligonucleotides on a
microarray, e.g., with the Geniom.RTM. instrument. A total of 160
oligonucleotides are synthesized complementary to wild-type and to
all the single base mismatches for 20 bp regions of exons B and H
of the factor IX gene. As a positive control, 160 oligonucleotides,
each out of registered by one nucleotide, are synthesized to match
exactly an adjacent 160 bp region of the factor IX gene. Genomic
DNA from wild-type and mutant samples is amplified, annealed to the
oligonucleotides and primer extension will be performed with a
fluorescent dideoxy terminator. The protocol is optimized for the
solid support. Adjustment of primer length, enzyme utilized and
reaction conditions is performed such that most, if not all, of the
oligonucleotides that mismatch the two 20 bp nucleotide regions of
factor IX generate little if any signal, while most of the 160
control oligonucleotides generate a strong signal.
J One strategy for resequencing is shown in FIGS. 3 and 4. Each
nucleotide in the complementary strand of the predetermined
sequence is queried by four downstream P*s, such as 20 mers, which
have identical sequence except for the 3' terminus, which is either
ddA, ddT, ddG or ddC. For a 1 kb segment, 4,000 P*s are needed in
the downstream direction. In the second set of experiments, exons B
and H of the factor IX gene are resequenced. Samples from more than
200 patients with different mutations in these regions are
available for analysis. False positives and false negatives are
assessed by blinded analysis. Heterozygous female samples are
available for many of the mutations. For the remaining male patient
samples one to one mixing experiments with wild-type or a second
mutated sample generates the equivalent of heterozygotes or
compound heterozygotes, respectively. Subsequently, all the regions
of likely functional significance (the putative promoter region,
the coding regions, and the splice junctions) are resequenced (2.2
kb). Since more than 600 independent mutations are available, it is
possible to determine whether more than 99% of all sequence changes
are identified (the sequence changes in these samples have been
determined by direct sequencing over the course of a decade).
A P* with a single base substitution at the 3' terminus generates a
signal at the position of hemizygous or homozygous point mutations.
The mutation also creates a "gap" of no PAP signal, which spans a
region of several successive nucleotides. When a single base
substitution occurs, the gap size (nucleotides)+1=the length of the
3' specific subsequence (FIGS. 3 and 4).
To analyze samples with higher G+C content (55%), mutations in the
lacI gene are utilized. These mutations from the Big Blue.RTM.
Transgenic Mouse Mutation Detection System, have the potential to
facilitate the definition of a strategy that detects more than
99.9% of mutations, since more than 6,000 mutations are available
in this system. The relevant regions are analyzed with the help of
robotic devices. In addition, hundreds of mutations or
polymorphisms are available for analysis in other genes with G+C
contents of 30-75%. The dystrophin gene is particularly amenable to
testing performance under conditions in which megabases of sequence
require scanning. In this gene in which 90 segments are amplified
by a robotic device, virtually all sequence variants have been
defined by DOVAM-S followed by DNA sequencing. This is advantageous
because many molecular epidemiological and molecular diagnostic
applications benefit from resequencing that detects virtually 100%
of the mutations.
Example 10
PAP Amplification Directly from Human and Mouse Genomic DNAs
PAP was performed with each of two P*s, P1* (SEQ ID NO:45, G allele
specific)) or P2* (SEQ ID NO:47, A allele specific) and an upstream
unblocked primer (U; (SEQ ID NO:48) to amplify 180-bp segments of
the D.sub.1 dopamine gene. The P* are 26-mers with ddC and ddG at
the 3' termini. 100 ng of human genomic DNA was amplified for 35
cycles followed by 2% gel electrophoresis. The PAP reaction mixture
contained a total volume of 25 .mu.l: 50 mM KCl, 20 mM HEPES/NaOH
(pH 6.9 at 25.degree. C.), 10 mM (NH.sub.4).sub.2SO.sub.4, 1.5 mM
MgCl.sub.2, 40 .mu.M each of the four dNTPs (dATP, dTTP, dGTP,
dCTP), 0.1 .mu.M U, 150 .mu.M Na.sub.4Pp.sub.i, 2% DMSO, 0.5 U of
AmpliTaqFS polymerase (PE Applied Biosystems), 0.5 U Taq polymerase
and 100 ng of human genomic DNA. The cycling conditions were
94.degree. C. for 15 sec, 65.degree. C. for 30 sec and 72.degree.
C. for 1 min. FIG. 17A shows the results for PAP amplification of
the D.sub.1 dopamine gene. In lanes 2 and 5, P1* is specific for
the A allele template at 24 nucleotides from the 3' terminus, so
there is little or no discrimination between the G/G and A/A
genotypes. In lanes 3 and 6, P2* is specific for the A allele
template at 2 nucleotides from the 3' terminus, so there is
specific amplification of the A/A genotype. Lanes 1 and 5 are PCR
controls. Lanes 4 and 8 are negative controls without P*. Lane M is
120 ng cpx DNA/HAEIV marker.
Three Bi-PAP assays were tested directly from mouse genomic DNA.
Bi-PAP was performed with two P*s containing a dideoxynucleotide
blocker at the 3' terminus to amplify an 80-bp segment of the lacI
gene. The P*s are specific to the wild-type template and are 40-42
nucleotides long. In each of the three Bi-PAP assays, two opposite
P* with one nucleotide overlap at their 3' termini were used to
amplify 400 copies of the lacI gene using 35 cycles. The sequences
of the P*s are as follows:
TABLE-US-00009 5' GAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT* 3' (SEQ
ID NO:67) and 5' GCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAA* 3'
(SEQ ID NO:68) in lanes 1 and 2; 5'
GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAA* 3' (SEQ ID NO:69 and 5'
GGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGT* (SEQ ID NO:70) in lanes 3
and 4; and 5' TACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAAC* 3' (SEQ ID
NO:71) and 5' GGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTG* 3' (SEQ ID
NO:72) in lanes 5 and 6.
The PAP reaction mixture contained a total volume of 25 .mu.l: 50
mM KCl, 20 mM HEPES/NaOH (pH 6.9 at 25.degree. C.), 10 mM
(NH.sub.4).sub.2SOH.sub.4, 1.5 mM MgCl.sub.2, 40 .mu.M each of the
four dNTPs (dATP, dTTP, dGTP, dCTP), 0.1 .mu.M U, 150 .mu.M
Na.sub.4Pp.sub.i, 4% DMSO, 1.0 U of AmpliTaqFS polymerase (PE
Applied Biosystems) and 400 copies of mouse genomic DNA. The
cycling conditions were 94.degree. C. for 15 sec, 65.degree. C. for
30 sec and 72.degree. C. for 1 min. The unincorporated P*s were
separated well from the Bi-PAP product on 2% agarose gel. No dimer
was seen. FIG. 17B shows the results for these Bi-PAP assays. In
lanes 1, 3 and 5, the wild-type templates are amplified. Lanes 2, 4
and 6 are negative controls without mouse genomic DNA.
Three PAP assays directly amplified 180-bp segments of the D1
receptor gene from human genomic DNA with strong signals of PAP
products. The allele-specificity of 26-mer P* remains when the
mismatch is at 2 nucleotides from the 3' terminus, but the
allele-specificity is lost when the mismatch is at 24 nucleotides
from the 3' terminus. Three Bi-PAP assays directly amplified as low
as four hundred copies of the lacI gene from mouse genomic DNA. The
P* oligonucleotides have different deoxynucleotides blocked at the
3' terminus and all can be efficiently activated. Addition of extra
human DNA did not affect the amplification of the lacI gene in
mouse genomic DNA. The product of Bi-PAP was easily distinguished
from unincorporated P*s. P* does not form dimmers because P* needs
long and perfectly matched regions at the 3' terminus for
activation.
Example 11
PAP with Acyclonucleotides and Various Polymerases
.lamda. Phage DNA Template
The wild-type .lamda. phage DNA template that contains an inserted
wild-type lacI gene of E. coli (Kohler et al., 1991) was purchased
from Stratagene. The mutant .lamda. phage DNA template was prepared
from .lamda. phage plaques transformed into SCS-8 E. coli cells
according to Maniatis, et al. (1982). It contained a T to G
mutation at nucleotide 369 in the lacI gene. The amount of .lamda.
phage DNA was determined by UV absorbance at 260 nm.
Synthesis of P* by Adding Acyclonucleotide or a Dideoxynucleotide
at the 3' Terminus
The 3' terminal acyclonucleotide or 3' terminal dideoxynucleotide
was added to a deoxynucleotide oligonucleotide by terminal
transferase. The mixture contained a total volume of 25 .mu.l: 100
mM potassium cacodylate (pH 7.2), 2.0 mM CoCl.sub.2, 0.2 mM DTT, 2
nM of the oligonucleotide, 2.4 mM acycloNTP (the molar ratio of the
3'-OH terminus to acycloNTP was 1:30) (New England BioLabs), or 2.4
mM 2',3'-ddNTP (the molar ratio of the 3'-OH terminus to ddNTP was
1:30)(Roche), 100 U of terminal transferase (Invitrogen). The
reaction was incubated at 37.degree. C. for 6 hr and then stopped
by adding EDTA to a 5 mM final concentration. After desalting using
a Centri-spin.sup.-20 column (Princeton Separations), P* was
purified by preparative 7 M urea/18% polyacrylamide gel
electrophoresis with 30 mM triethanolamine/tricine buffer (pH 7.9
at 25.degree. C.) (Maniatis, et al., 1982; Liu, et al., 1999b). The
amount of recovered P* was determined by UV absorbance at 260
nm.
Since small amounts of unterminated oligonucleotide would result in
unexpected PCR amplification, the purity of P* was tested by the
absence of PCR product at pH 8.3 in which pyrophosphorolysis is
inhibited. It is estimated that more than 99.99% of P* contained an
acyclonucleotide or a dideoxynucleotide at the 3' terminus.
PAP Amplification
PAP was examined with P*1 and O1, with P*2 and O2, and with P*1 and
P2* respectively (FIG. 18A and Table 6). The P*s were 30 or 35
nucleotide long and contained an acyclonucleotide or a
dideoxynucleotide at the 3' terminus.
TABLE-US-00010 TABLE 6 List of Oligonucleotides PAP Amplification
(allele) Desig. Name.sup.a Sequence (ID NO:) 3' Terminal G:C T:A
P*1 P*(340)30D CGAAGCCTGTAAAGCGGCGGTGCACAATCG* (57) acycloGMP Yes
No or ddGMP O1 O(502)25U ACTGTTGATGGGTGTCTGGTCAGAG (58) dGMP P*2
P*(398)30U TGATCAGCCCACTGACGCGTTGCGCGAGAC* (59) acycloCMP Yes No or
ddCMP O2 O(190)21D ACAACTGGCGGGCAAACAGTC (60) dCMP .sup.aThe
position of the first nucleotide of the transcript in the lacI gene
of E. coli is assigned the nucleotide position 1 (Farabaugh, 1978).
As an example for P*1, P* = pyrophosphorolysis activatable
oligonucleotide, it may be a 3' terminal acyclonucleotide blocked
P* or a 3' terminal dideoxynucleotide blocked P*. (340)30D = 5'end
of the P* begins at 340, the length is 30 nucleotides and the
direction is downstream (i.e., in the direction of
transcription).The precise sizes and Locations of the amplified
fragment can be obtained from the informative names. The 30-mer P*s
are indicated above. The 35-mer P*s are 3' co-terminal with the
30-mer P*s and 5 nucleotides longer at their 5' termini.
The PAP reaction mixture with AmpliTaqFS DNA polymerase contained a
total volume of 25 .mu.l : 50 mM KCl, 20 mM HEPES/NaOH (pH 6.9 at
25.degree. C.), 10 mM (NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2,
50 .mu.M each of the four dNTPs (dATP, dTTP, dGTP and dCTP), 0.1
.mu.M of each oligonucleotide, 150 .mu.M Na.sub.4PP.sub.i, 4% DMSO,
1 U of AmpliTaqFS DNA polymerase (PE Applied Biosystems), 0.1 ng of
the .lamda. phage DNA template. The cycling conditions were
92.degree. C. for 10 sec, 65.degree. C. for 30 sec, and 72.degree.
C. for 1 min for a total of 30 cycles. A denaturing step 92.degree.
C. for 1 min was added before the first cycle.
The PAP reaction mixture with Vent (exo-) or Pfu (exo-) contained a
total volume of 25 .mu.l: 10 mM KCl, 20 mM HEPES/NaOH (pH 7.19 at
25.degree. C.), 10 mM (NH.sub.4).sub.2SO.sub.3, 1.2 mM MgCl.sub.2,
50 .mu.M each of the four dNTPs (dATP, dTTP, dGTP and dCTP), 0.1
.mu.M of each oligonucleotide, 150 .mu.M Na.sub.4PP.sub.i, 4% DMSO,
1 U of Vent (exo-) DNA polymerase (New England BioLabs) or Pfu
(exo-) DNA polymerase (Stratagene), 0.1 ng of the .lamda. phage DNA
template. The cycling conditions were 94.degree. C. for 15 sec,
60.degree. C. for 30 sec, and 72.degree. C. for 1 min for a total
of 30 cycles. A denaturing step of 94.degree. C. for 1 min was
added before the first cycle.
The product was electrophoresed through a standard 2% agarose gel.
The gel was stained with ethidium bromide for UV photography by a
CCD camera (Bio-Rad Gel Doc 1000).
As shown above, TaqFS, a genetically engineered DNA polymerase
(Innis and Gelfand, 1999), greatly improved the efficiency of PAP.
3' terminal dideoxynucleotide blocked P*s can be activated by
pyrophosphorolysis to remove the 3' terminal dideoxynucleotide in
the presence of pyrophosphate (PP.sub.i) and the complementary
strand of the allelic template. Then the activated P* can be
extended by DNA polymerization.
PAP was performed with 3' acyclonucleotide blocked P*s by using
.lamda. phage DNA containing the lacI gene as model system. P*1 and
P*2 are downstream and upstream blocked oligonucleotides,
respectively, for the same mutation (FIG. 18A and Table 6). The P*1
and P*2 have an acycloGMP and acycloCMP at their 3' termini,
respectively. Amplification products were absent without
pyrophosphate added at pH 8.3 where pyrophosphorolysis is
inhibited, showing that P*1 and P*2 were not directly
extendible.
P*1 and P*2 are specific to the mutated template but mismatch to
the wild-type template at their 3' termini. The mutated template
was amplified efficiently by PAP with one acyclonucleotide blocked
P* and one opposing unblocked oligonucleotide and by PAP with two
opposing 3' terminal acyclonucleotide blocked P*s (lanes 1 and 2 in
FIG. 18B), with two opposing acyclonucleotide blocked P*s (a
special form of PAP where the two opposing P*s are overlapped at
their 3' termini by one nucleotide) (Land 3 in FIG. 18B). However,
no product was generated from the wild-type template because of the
mismatch at the 3' terminus, showing the specificity (lanes 5-7 in
FIG. 18B). PAP with the 3' dideoxynucleotide blocked P* showed
similar results (lanes 9-16 in FIG. 18B). Direct sequencing
analysis confirmed the correct sequence of the amplified product.
The effect of P* length was also tested. Similar results were
obtained with 35-mer P*s that are co-terminal with the 30-mer P*s
and five nucleotides longer at their 5' termini (FIG. 18C). Other
P*s specific for the wild-type sequence at the 3' terminus (with
acycloTMP and ddTMP) were also tested with similar results.
Family II DNA polymerases Vent (exo-) and Pfu (exo-) were tested
using the above model system. With the acyclonucleotide blocker and
perfect match at the 3' terminus, the mutated template was
amplified efficiently by PAP with one P* (lanes 1 and 2 in FIGS.
18D and 18E) and one opposing unblocked oligonucleotide and by PAP
with two opposing P*s of P*1 and P*2 (a special form of PAP where
the two opposing P*s are overlapped at their 3' termini by one
nucleotide) (lane 3 in FIGS. 18D and 18E). However, no product was
generated from the wild-type template because P*1 and P*2 mismatch
the wild-type template at their 3' termini, showing the specificity
(lanes 5-7 in FIGS. 18D and 18E). Vent (exo-) and Pfu (exo-)
polymerases could not amplify with the 3' dideoxynucleotide blocked
P* (lanes 9-16 in FIGS. 18D and 18E). Direct sequencing analysis
confirmed the correct sequence of the P*1/O1 and P*2/O 2 products.
Similar results were obtained with AcycloPol (Perkin-Elmer), a
genetically engineered Family II archeon DNA polymerase. It is not
clear why PAP with Vent (exo-) and Pfu (exo-) DNA polymerases
discriminates against 3' dideoxyribonucleotide blockers.
Other Blockers
These results demonstrate that two terminators used in Sanger
sequencing can be used as blockers in PAP. Terminators have also
been described as therapies of viral illnesses, such as AIDS, and
for cancer therapy, such as, 3'-deoxyadenosine (cordycepin),
3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxyinosine (ddI),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T). DNA polymerase can
incorporate their triphosphate form into the synthesizing strand,
and the incorporation cause termination of the extension (Gardner
and Jack, 1999; Cheng et al., 1987; St. Clair et al., 1987; Ueno
and Mitsuya, 1997). The monophosphate nucleotides of
3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxy-3'-thiacytidine
(3TC) and 2',3'-didehydro-2',3'-dideoxythymidine (d4T), when
located at the 3' termini of oligonucleotides, can be removed by
pyrophosphorolysis by HIV reverse transcriptase or its variants
(Arion et al., 1998; Gotte et al., 2000; Meyer et al., 2000; Urban
et al., 2001). These results indicate the application of PAP for
various types of blockers and for RNA templates.
In summary, PAP amplification occurred efficiently and specifically
with 3' acyclonucleotide and 3' dideoxynucleotide blockers using
TaqFS DNA polymerase, and only with acyclonucleotide blockers using
Vent (exo-) and Pfu (exo-) DNA polymerases. Other 3' terminal
nonextendible oligonucleotides and other DNA polymerases can be
used, if the 3' terminal nucleotide can be removed by
pyrophosphorolysis, and the activated oligonucleotide can be
extended.
Example 12
Detection of Extremely Rare Alleles by Bi-PAP
.lamda. Phage DNA Template
The wild-type .lamda. phage DNA template that contains an inserted
wild-type lacI gene of E. coli (Kohler et al., 1991) was purchased
from Stratagene. Three mutated .lamda. phage DNA templates were
prepared from .lamda. phage plaques transformed into SCS-8 E. coli
cells according to Maniatis et al (1982). They contain an A to T
mutation at nucleotide position 190, a T to G mutation at
nucleotide 369 and a T to C mutation at nucleotide 369 in the lacI
gene, respectively. The amount of .lamda. phage DNA was determined
by UV absorbance at 260 nm.
Synthesis of P* by Adding a 3' Dideoxynucleotide
The 3' terminal dideoxynucleotide was added to an
oligodeoxynucleotide by terminal transferase. The mixture contained
a total volume of 25 .mu.l: 100 mM potassium cacodylate (pH 7.2),
2.0 mM CoCl.sub.2, 0.2 mM DTT, 2 nM of the oligonucleotide, 2.4 mM
2',3'-ddNTP (the molar ratio of the 3'-OH terminus to ddNTP was
1:30)(Roche), 100 U of terminal transferase (Invitrogen). The
reaction was incubated at 37.degree. C. for 6 hr and then stopped
by adding EDTA to a 5 mM final concentration. After desalting using
a Centri-spin.sup.-20 column (Princeton Separations), P* was
purified by preparative 7 M urea/16% polyacrylamide gel
electrophoresis with 30 mM Triethanolamine/Tricine buffer (pH 7.9
at 25.degree. C.) (Maniatis et al., 1982, Liu et al., 1999b). The
amount of recovered P* was determined by UV absorbance at 260
nm.
Since small amounts of unterminated oligonucleotide would result in
unexpected PCR amplification, P* was .sup.32P-labeled at the 5'
terminus by T4 polynucleotide kinase and then was electrophoresed
through a 7 M urea/20% polyacrylamide gel. Only P* products were
visible even when the gel was overexposed. It is estimated that
more than 99.99% of P* contained a dideoxynucleotide at the 3'
terminus. The purity of P* was supported by the absence of PCR
product at pH 8.3 in which pyrophosphorolysis is inhibited.
PAP Amplification
Bi-PAP assays for nucleotide 190 and nucleotide 369 of the lacI
gene were examined. The P*s were 40 nucleotides long except that
the upstream P*s for position 369 are 42 nucleotides. Each P*
contained the sequence-specific nucleotide at the 3' terminus. The
PAP reaction mixture contained a total volume of 25 .mu.l: 50 mM
KCl, 20 mM_HEPES/NaOH (pH 6.9 at 25.degree. C.), 10 mM
(NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2, 40 .mu.M each of the
four dNTPs (dATP, dTTP, dGTP and dCTP), 0.1 .mu.M each P*, 150
.mu.M Na.sub.4PP.sub.i, 4% DMSO, 1 .mu.Ci of
[.alpha.-.sup.32P]-dCTP (3000 Ci/mmole, Amersham), 1 U of
AmpliTaqFS DNA polymerase (PE Applied Biosystems), 2,000 copies of
the .lamda. phage DNA template or stated elsewhere. The cycling
conditions were 92.degree. C. for 6 sec, 68.degree. C. for 20 sec,
and 72.degree. C. for 20 sec for a total of 35 cycles. A denaturing
step of 92.degree. C. for 1 min was added before the first
cycle.
The product was electrophoresed through a standard 2.5% agarose
gel, and the gel was stained with ethidium bromide for UV
photography by a CCD camera (Bio-Rad Gel Doc 1000).
In order to differentiate the mutated product from the wild-type
product of the same size, non-denaturing SSCP gel electrophoresis
was performed (Orita et al., 1989). The reaction was mixed with
two-fold volume of loading buffer (7M urea and 50% formamide),
boiled and rapidly cooled on ice. The product in 10 .mu.l of the
mixed reaction was electrophoresed through an 8% non-denaturing
PAGE-PLUS (Amresco) gel with 30 mM Ethanolamine/Capsco buffer (pH
9.6) (Liu et al., 1999b) at 4.degree. C. The gel was dried and
exposed to Kodak X-OMAT.TM. AR film for autoradiography. Three or
four bands from each amplified product were seen on a gel. The
upper one or two bands were double strained DNA due to
hybridization of de-natured single-stranded segments during the
electrophoresis as a result of the substantial amounts of amplified
product present. Increasing the concentration of the amplified
product further increase the intensity of the upper bands.
Highly Efficient PAP Amplification
TaqFS, a genetically engineered DNA polymerase greatly improved the
efficiency of PAP. The conditions of PAP were further optimized for
dramatically higher efficiencies allowing PAP to amplify directly
from a few copies of .lamda. phage DNA or human genomic DNA
template. The reaction components and the thermocycling regime were
optimized, including: i) decreased concentrations of PPi in that
keeping the PPi to dNTP ratio essentially constant, ii) use of low
pH HEPES buffer (pH 6.9 at 25.degree. C.), iii) addition of
(NH.sub.4).sub.2SO.sub.3, iv) increased amount of TaqFS, and v)
higher annealing temperature.
Bi-PAP
PAP has a potential selectivity of 3.3.times.10.sup.11:1 (FIG. 19).
Approaching this potential requires a design that eliminates
confounding sources of error. The A190T mutation of the lacI gene
of .lamda. DNA is used as a model system. In PAP with one
downstream P* and one upstream unblocked oligonucleotide, extension
errors from the non-blocked upstream oligonucleotide can produce
the rare mutation of interest, thus reducing the selectivity. If
the misincorporation rate of TaqFS is 10.sup.-4 per incorporated
nucleotide and one of the three possible misincorporations
generates the A.fwdarw.RT mutation on the newly synthesized
upstream strand, the selectivity decreases to 3.3.times.10.sup.-5
due to the side effect. In order to remove this limitation, Bi-PAP
was developed (FIG. 20A). In Bi-PAP, both the downstream and
upstream oligonucleotides are P*s that are specific for the
nucleotide of interest at their 3' termini. The P*s overlap at
their 3' termini by one nucleotide.
Bi-PAP amplified efficiently and specifically at nucleotide
position 190 using .lamda. phage DNA containing the lacI gene as
template (FIG. 20B). Addition of human genomic DNA did not affect
the amplification. The 79-bp product of Bi-PAP was easily
distinguished from unincorporated P*s. P* did not form dimers
because P* needs a perfectly matched region at the 3' terminus for
activation. Similar results were observed at nucleotide position
369. Direct sequencing analysis confirmed the correct sequence of
the amplified product.
Sensitivity and Selectivity of Bi-PAP
In order to demonstrate the extremely high selectivity of Bi-PAP,
more than 10.sup.10 copies of DNA template was used for a Bi-PAP
reaction. .lamda. DNA containing the lacI gene of E.coli was chosen
as the model system because 1 .mu.g of .lamda. DNA contains
2.times.10.sup.10 vector genomes, while 1 .mu.g of human genomic
DNA only contains 3.3.times.10.sup.5 genomes. In order to avoid
potential contamination of the wild-type .lamda. DNA in this
laboratory, mutation-specific Bi-PAP assays with mutated P*s were
chosen to amplify the wild-type .lamda. DNA. The relative frequency
of a spontaneous mutation of the lacI gene in the wild-type .lamda.
DNA is estimated to be less than 10.sup.-9 by examining .lamda.
phage plaques infecting E. coli.
The sensitivity and selectivity of Bi-PAP were examined using three
mutation-specific Bi-PAP assays with their corresponding mutated
.lamda. DNA (see Table 7 footnotes for definitions). Four titration
experiments were performed for each mutation-specific Bi-PAP assay
(FIGS. 21A-21C). Experiment I tested how much the mutated P* can
"tolerate" the wild-type DNA template (i.e., the maximum copies of
the wild-type template without a detectable mutated product). The
wild-type .lamda. DNA was titrated from 2.times.10.sup.10 copies to
2.times.10.sup.6 copies. The maximum tolerances were
2.times.10.sup.9 to 2.times.10.sup.10, 2.times.10.sup.7 to
2.times.10.sup.8, and 2.times.10.sup.7 to 2.times.10.sup.8,
respectively, for the three mutation specific Bi-PAP assays,
respectively (FIGS. 21A-21C). Experiment II tested the sensitivity
of Bi-PAP. The mutated .lamda. DNA was titrated from
2.times.10.sup.3 to 0 copies. The ratio of the maximum tolerance
(Experiment I) to the sensitivity is the selectivity. Experiment II
was repeated in the presence of large amount of wild-type template
(Experiment III) or large amounts of human genomic DNA (Experiment
IV) without effects (FIG. 21A; data not shown for T369G and T369C).
A dose response with template copy number was observed.
TABLE-US-00011 TABLE 7 Summary of the three mutation-specific
Bi-PAP assays.sup.a Sensi- Assay Position.sup.b Type.sup.b
tivity.sup.c Selectivitity.sup.d A 190 A:T.fwdarw.T:A 2 10.sup.9:1
to 10.sup.10:1 B 369 T:A.fwdarw.G:C 2 10.sup.7:1 to 10.sup.8:1 C
369 T:A.fwdarw.C:G 2 10.sup.7:1 to 10.sup.8:1 .sup.aIn each of the
three mutation-specific Bi-PAP assays, two opposite P*s with one
nucleotide overlap at their 3' termini were used. The P*s are 40 42
nucleotides long. They are 5'
GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAT* (SEQ ID NO:61) and 5'
GGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGA* (SEQ ID NO:62) in Assay
A; 5' GAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCG* (SEQ ID NO:63)
and5' GCGGATAGTTAATGATCAGCCCAC TGACGCGTTGCGCGAGAC* (SEQ ID NO:64)
in Assay B; 5' GAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCC* (SEQ ID
NO:65) and 5' GCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAG AG* (SEQ ID
NO:66) in Assay C. .sup.bThe position of the first nucleotide of
transcript in the lacI gene is assigned the nucleotide position 1
(Farabaugh, 1978). The 3' nucleotide of the P* is located at the
indicated position and is complementary to the corresponding
mutation. .sup.cThe sensitivity is defined as the minimum copies of
the mutated template from which a detectable mutated product is
generated when a mutation-specific Bi-PAP assay is used. It was
determined by Experiment II (FIGS. 21A 21C). .sup.dThe selectivity
is the ratio of the maximum copies of the wild-type template with
undetectable product the minimum copies of the mutated template
with detectable product to, when a mutation-specific Bi-PAP assay
is used.
The approximately 100-fold difference in selectivity between the
nucleotide positions 190 and 369 may derive from: i) the presence
of spontaneous mutations at the position 360 at a frequency of
10.sup.-7 to 10.sup.-8 in the wild-type .lamda. DNA, ii) impurity
of P* oligonucleotides, iii) specificity of pyrophosphorolysis for
a perfect match at the 3' terminus and fidelity of DNA polymerase
to incorporate a correct nucleotide may be associated with sequence
context such that the Type II non-specific amplification occurs at
a frequency of 10.sup.-7 to 10.sup.-8. In the latter case, a
100-fold difference in selectivity could arise from a 10-fold
difference in pyrophosphorolysis specificity and a 10-fold
difference in DNA polymerase fidelity with sequence context.
The rate of a spontaneous mutation of .lamda. phage in E. coli
varies from locus to locus, on the average from 10.sup.-9 to
10.sup.-11 per incorporated nucleotide. The amplified signal seen
in Experiment I might be caused by rare spontaneous mutations.
There is a possible side reaction due to the impurity of P*
contamination of unblocked oligonucleotide where the dideoxy
terminus has not been added, although no unblocked oligonucleotide
was detected in the P*. However, this selectivity may not be
limited severely by small amounts of unblocked oligonucleotide
because the product generated would be much more likely to be the
wild-type rather than the specific mutation
(3.3.times.10.sup.5:1).
In summary, Bi-PAP has extremely high sensitivity and selectivity.
Bi-PAP can selectively detect two copies of rare mutated allele
with a single base substitution from up to 2.times.10.sup.9 copies
of the wild-type allele. Bi-PAP is a simple, rapid, automatable
method for detecting any rare allele of interest.
Example 13
Measurement of Mutation Load in Mouse Tissues by Bi-PAP
Materials and Methods
Liver, heart, adipose tissue, cerebrum and cerebellum from 10-day
to 25-month old mice were snap frozen and stored under liquid
nitrogen until used. DNA was extracted according to the Big Blue
protocol (Stratagene instruction manual). In brief, tissues were
homogenized and digested with proteinase K. The genomic DNA was
extracted with phenol/chloroform and precipitated with ethanol. The
DNA was dissolved in TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8.0)
and stored at 4.degree. C. The amount of the mouse genomic DNA was
determined by UV absorbance at 260 nm.
The mutation-specific Bi-PAP assay for T369G (Assay B: the two
opposite P*s are dideoxynucleotide blocked with one nucleotide
overlap at their 3' termini are:
TABLE-US-00012 5'GAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCA (SEQ ID NO:63)
CAATCG*3' and 5'GCGGATAGTTAATGATCAGCCCACTGACGCGTTG (SEQ ID NO:64)
CGCGAGAC*3'
of the lacI gene was performed as above except that i) the reaction
contained 2 .mu.g of the mouse genomic DNA (.about.20 kb in size),
unless otherwise stated; ii) mouse DNA in 20 .mu.l
(1.25.times.HEPES buffer, 5% DMSO without MgCl.sub.2) was heated at
100.degree. C. for 2 min and quickly cooled on ice, before the
other components added; iii) a denaturing step at 95.degree. C. for
1 min was added before the first cycle; iv) the denaturing step was
95.degree. C. for 10 sec.
10 .mu.l of the 25 .mu.l reaction was mixed with 10 .mu.l of the
denaturing loading buffer, boiled and rapidly cooled on ice. The
product was electrophoresed through a 8% 7M urea/PAGE gel with 90
mM TBE buffer at room temperature. The gel was dried and exposed to
Kodak X-OMAT.TM. AR film for autoradiography.
Results and Discussion
Transgenic mouse mutation detection systems permit determination of
the frequency and pattern of spontaneous or induced mutations in
vivo. The Big Blue.RTM. system uses transgenic mice harboring
chromosomally-integrated .lamda. phage DNA containing the E. coli
lacI gene as the mutational target (Grossen and Vijg, 1993; Gossen
et al., 1989; Kohler et al., 1990. The lacI gene is integrated
within each mouse diploid genome in 40 tandemly repeated .lamda.
DNAs.
The Big Blue.RTM. mutation detection system assay is performed by
isolating genomic DNA from transgenic mouse tissues and mixing it
with .lamda. packaging extracts. The packaged .lamda. phage can
infect E. coli. In the presence of X-gal substrate, lacI mutants
give rise to blue plaques on a background of colorless wild-type
plaques. Observed mutants derive overwhelmingly from the mouse
(Hill et al., 1999). The mutant frequency is determined by dividing
the number of circular blue plaques by the total number of plaques.
Of 5000 sequenced mutant plaques, 31 T369G mutants have been found
in a total of 149.times.10.sup.6 plaques screened from various
ages, genders and treatments in this laboratory
(frequency=2.1.times.10.sup.-7).
To assess the utility of Bi-PAP for measuring ultra-rare mutations
in mammalian cells, the T369G mutation was analyzed in genomic DNA
from the Big Blue mice. Two .mu.g of mouse genomic DNA was
amplified in 25 .mu.l reaction containing a total of
1.2.times.10.sup.7 copies of the lacI gene. The mutation-specific
Bi-PAP assay for T369G (Assay B) was performed for 18 samples in
duplicate (FIG. 26A). Three categories of results were defined,
each with similar number of samples: 1) six samples were positive
two times (5, 11-15), 2) seven samples were positive one time (1,
3, 6, 9, 16-18), and 3) five samples were negative two times (2, 4,
7, 8, 10).
Two samples in each category were studied further (FIGS. 26B-26C,
Table 8). In category 1, for the two samples 5 and 12 with the
strongest amplified signals (FIG. 26A), a four-dilution fold
delitionto 0.5 .mu.g and 16-fold dilution to 0.125 .mu.g of mouse
genomic DNA were performed for further quantitation (FIG. 26B). The
T369G mutant frequency for each sample was estimated and varies
370-fold among the six samples (Table 8). The average T369G mutant
frequency of 2.9.times.10.sup.-7 was within 50% of the average
T369G mutant frequency of 2.1.times.10.sup.-7 measured from
4.times.10.sup.7 plaques using the Big Blue.RTM. mutation detection
system and confirmed by direct sequencing.
TABLE-US-00013 TABLE 8 Somatic mutant frequency measured by Bi-PAP
Frequency of Mouse positive amplification.sup.b Estimated genomic
DNA 2 .mu.g of 0.5 .mu.g of 0.125 .mu.g of mutant Sample.sup.a
Tissue Age DNA DNA DNA frequency.sup.d 1 12 Adipose 6 months 8/8
8/8 4/8 (0.69).sup.c 9.25 .times. 10.sup.-7 2 5 Liver 25 months 8/8
7/8 5/8 (0.98) 1.31 .times. 10.sup.-6 3 3 Liver 25 months 8/24
(0.41) 3.38 .times. 10.sup.-8 4 9 Liver 25 months 13/24 (0.78) 6.50
.times. 10.sup.-8 5 7 Liver 25 months 2/24 (0.09) 7.25 .times.
10.sup.-9 6 10 Liver 25 months 1/24 (0.04) 3.52 .times. 10.sup.-9
Average 2.91 .times. 10.sup.-7 .sup.asee FIG. 26A. .sup.bthe ratio
of the number of positive signals for the T369G mutation relative
to the total number of reactions. .sup.cthe average number of T369G
mutants per reaction is estimated using a formula (the frequency of
zero mutants per reaction = e.sup.-x, x is the average number of
mutants per reaction) suppose that the mutant distributes in the
reaction according to a Poisson distribution and that if one or
more mutants are in the reaction, the amplification is positive,
and if zero mutant is in the reaction, it is negative. .sup.dthe
frequency of the T369G mutant of the lacI gene in mouse genome per
reaction is estimated assuming that the mutant distributes in mouse
genomic DNA according to a Poisson distribution and that one or
more mutants are positive in the detection. For each of samples 12
and 5, a total of ~6.0 .times. 10.sup.6, copies of the lacI gene
are used for the estimate, and for each of samples 3, 9, 7 and 10,
~2.9 .times. 10.sup.8 copies are used assuming that 2 .mu.g of the
lacI.sup.+ mouse genomic DNA contains ~1.2 .times. 10.sup.7 copies
of the lacI gene.
The 370-fold variation in mutant frequency was observed in livers
of five mice at 25 months of age. This large variation could be due
to difficulties in amplifying one copy of the template. To address
this issue, each of the analyses was repeated at least two times
with similar results. For example, in sample 9, seven of 14
reactions with 2 .mu.g of DNA were positive in one experiment,
three of four such reactions were positive in another experiment,
and two of four such reactions were positive in a third experiment.
For sample 7, there was one positive in eight and one positive in
14 reactions. The product was sequenced to confirm the T369G
mutation after re-amplification from the positive reaction. In
addition, positive controls (2 .mu.g of the lacI.sup.+ mouse DNA
with .about.10 copies of T369G) and negative controls (mouse
genomic DNA without the lacI target, i.e., the lacI.sup.- mouse
DNA) were performed. As additional positive controls,
reconstruction experiments were performed in that the copy number
of the mutated .lamda. DNA per reaction was serially diluted by
two-fold in the presence of the lacI.sup.- genomic DNA carrier.
Reproducible amplifications from as low as one copy of template
were demonstrated (FIGS. 26B, 26C).
In retrospect, the 370-fold variation in the frequency of T369G
mutant observed among the six mice may not be surprising because
the T369G mutant frequency among mice is over dispersed, implying a
hyper-Poisson distribution (Nishino et al., 1996; Piegorsch et al.,
1994). Among six mice the inter-animal variation in the overall
mutant frequency assayed by the Big Blue.RTM. mutation detection
system might be 3 to 4 fold, with significant founder effects in
one or a few of the mice. The variation might be in the range of
2.times.10.sup.-5 to 8.times.10.sup.-5 which is the sum of more
than 1,000 different mutations. Here, only the T369G mutation is
assayed. It is anticipated that the great majority of the signal
derives from duplex mutated templates (Hill et al., 1999), but it
should be noted that unresolved mismatch intermediates derived
primarily from DNA replication or DNA repair would also generate a
signal. Thus, the physical limit of sensitivity is actually one
half of a duplex DNA molecule per reaction.
In conclusion, we demonstrate that Bi-PAP can analyze ultra-rare
mutations at frequencies as low as 10.sup.-7 to 10.sup.-9,
depending on the assay. It is shown that Bi-PAP can detect single
copies of the somatic mutation directly from mammalian genomic DNA.
The inter-assay variation may reflect locus-specific variability in
the assay sensitivity or in the frequency of the assayed mutants
among the samples. More work is necessary to distinguish between
these possibilities. In mammalian DNA, the number of copies of
template is limited by the enormous genome size. Two .mu.g of
genomic DNA contains only 600,000 mouse haploid genomes, yet the
reaction is viscous. Our analysis of the Big Blue mouse genomic DNA
was facilitated by the 20 copies of the lacI gene per haploid
genome. To measure mutation load in humans, genomic DNA in one
reaction could be increased at least three fold by reducing the
viscosity (e.g., shearing the DNA into small segments by ultrasonic
treatment) and another four fold by expanding the reaction volume
to 100 .mu.l. Mutation load in human genomic DNA might be
facilitated by analyzing segments of virtually identical sequence,
e.g., there are three 9.6 kb segments with 99.sup.+% sequence
identity on human X chromosome involved in a common inversion
mutation in hemophilia A (Lakich et al., 1993). Less complex
genomes including C-elegans, Drosophila, and human mitochondria
genome or chronic viral infections (e.g., hepatitis B) also should
be analyzable with this protocol.
While the invention has been disclosed in this patent application
by reference to the details of preferred embodiments of the
invention, it is to be understood that the disclosure is intended
in an illustrative rather than in a limiting sense, as it is
contemplated that modifications will readily occur to those skilled
in the art, within the spirit of the invention and the scope of the
appended claims.
BIBLIOGRAPHY
Arion, D. et al., Biochemistry 37, 15908-15917 (1998). Bains W. and
Smith G. C., J Theor Biol 135, 303-307(1988). Baner, J. et al.,
Nucleic Acids Res 26, 5073-5078 (1998). Barany, F., Proc Natl Acad
Sci USA 88, 189-193 (1991). Bebenek, K. et al., J Biol Chem 265,
13878-13887 (1990). Becker, M. M. and Grossmann, G., in
Footprinting of nucleic acid-protein complexes (ed. Revzin, A.),
pp. 129-159 (Academic Press, New York, 1993). Boer, P. H. et al.,
Biochem Genet 28, 299-308 (1990). Buzin, C. H. et al.,
BioTechniques 28, 746-753 (2000). Cheng, Y. C. et al., J Biol Chem
262, 2187-2189 (1987). Chien, A. et al., Bacteriol 127, 1550-1557
(1976). Chou, Q. et al., Nucl Acids Res. 20,1717-1723 (1992).
Cotton, R. G. et al., Proc Natl Acad Sci USA 85, 4397-4401 (1988).
Dai, S.-M. et al., Nature Biotechnology 18:1108-1111 (2000).
D'Aquila, R. J. et al., Nucl Acids Res 19, 3749 (1991). Drmanac, R.
et al., Genomics 4, 114-128 (1989). Duetcher, M. P. and Kornberg,
A., J Biol Chem 244, 3019-3028 (1969). Eckert, K. A. and Kunkel, T.
A., Nucleic Acids Res. 18, 3739-3744 (1990). Gardner, A. F. and
Jack, W. E., Nucleic Acids Res 30:605-613 (2002). Gardner, A. F.
and Jack, W. E., Nucleic Acids Res 27:2545-2553 (1999). Ginot, F.,
Hum Mutat 10, 1-10 (1997). Gossen, J. and Vijg, J., Trends Genet 9,
27-31 (1993). Gossen, J. A. et al., Proc Natl Acad Sci USA 86,
7971-7975 (1989). Gotte, M. et al., J Virol 74, 3579-3585 (2000).
Hacia, J. et al., Nat Genet 21, 42-47 (1999). Hill, K. A. et al.,
Mutat Res Mini Reviews 436, 11-19 (1999). Innis, M. A. and Gelfand,
D. H., in PCR APPLICATIONS Protocols for Functional Genomics (eds.
Innis, M. A., Gelfand, D. H. & Sninsky, J. J.), pp. 3-22
(Academic Press, 1999). Jones, P. A. and Laird, P. W., Nat Genet
21, 163-167 (1999). Kaledin, A. S. et al., Biokhimiia 46, 1576-1584
(1981). Kellogg, D. E. et al., Biotechniques 16, 1134-1137 (1994).
Ketterling, R. P. et al., Hum Genet 105, 629-640 (1999). Khrapko,
K. R. et al., FEBS Letts 256. 118-122 (1989). Knoll, A. et al., Hum
Genet 98, 539-545 (1996). Kohler, S. W. et al., Strategies in Mol
Biol 3, 19-21 (1990). Kohler, S. W. et al., Proc Natl Acad Sci USA
88, 7958-7962 (1991). Komura, J. and Riggs, A. D., Nucleic Acids
Res 26, 1807-1811 (1998). Kornberg, A. and Baker, T. A., DNA
Replication, (eds., Second Edition), pp. 113-226 (W.H. Freeman and
Co., New York 1992). Lakich, D. et al., Nature Genet 5, 236-241
(1993). Landegren, U. et al., Science 241, 1077-1080 (1988).
LeProust, E. et al., J Comb Chem 2, 349-354 (2000). Liu, Q. and
Sommer, S., BioTechniques 29, 1072-1083 (2000). Liu, Q. and Sommer,
S., BioTechniques 18, 470-477 (1995). Liu, Q. et al., Am J Med
Genet (Neuropsych Genet) 60, 165-171 (1995). Liu, Q. et al.,
BioTechniques 26, 932-942 (1999). Liu, Q. et al., BioTechniques 33,
129-138 (2002). Liu, Q. et al., Anal Biochem 270, 112-122 (1999b).
Lizardi, P. M. et al., Nature Genetics 19, 225-232 (1998). Longley,
M. J. et al., Nucleic Acids Res 18, 7317-7322 (1990). Lysov, I. et
al., Dokl Akad Nauk SSSR 303, 1508-1511 (1988). Maniatis, T. et
al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor,
N.Y.: Cold Spring Harbor Laboratory, 1982. Marshall, A. and
Hodgson, I., Nat Biotechnol 16, 27-31 (1998) Maxam, A. M. and
Gilbert, W., Proc Natl Acad Sci USA 74, 560-564 (1977). Meyer, P et
al., EMBO J 19, 3520-3529 (2000). Miyada, C. G. and Wallace, R. B.,
Methods in Enzymology 154, 94-107 (1987). Mueller, P. R. and Wold,
B., Science 246, 780-786 (1989). [published erratum, appears in
Science 224, 802(1990).] Mullis, K. B., PCR Methods Appl 1, 11-4
(1991). Myers, R. M. et al., Science 230, 1242-1246 1985. Nishino,
H. et al., Environ Mol Mutagen 28, 299-312 (1996). Nishino, H. et
al., Environ Mol Mutagen 28, 414-417 (1996). O'Donovan, M. C. et
al., Genomics 52, 44-49 (1998). Oefner, P. and Underhill, P.,
Current Protocols in Human Genetics Supplement 19:7.10.1-7.10.12
(1998). Orita, M. et al., Proc Natl Acad Sci USA 86:2766-2770
(1989). Parsons, B. L. and Heflich, R. H., Mutat Res 387, 97-121
(1997). Pevzner P. A., J Biomol Struct Dyn 7, 63-73 (1989).
Pfeifer, G. F. et al., Science 246, 810-813 (1989). Pfeifer, G. P.
et al., Methods Enzymol 304, 548-571 (1999). Piegorsch, W. W. et
al., Environ Mol Mutagen 23, 17-31 (1994). Pourzand, C. and
Cerutti, P., Mutat Res 288, 113-121 (1993). Ramsay, G., Nat
Biotechnol 16, 40-44 (1998). Ronaghi, M. et al., Science 281, 363,
365 (1998). Ronai, Z. and Minamoto, T., Hum Mutat 10, 322-325
(1997). Russo, E. and Riggs, A. D., Epigenetics mechanics of gene
regulation. In: Anonymous 1996 Saiki, R. K. et al., Science 230,
1350-1354 (1985). Saiki, R. K. et al., Science 239, 487-491 (1988).
Sanger, F. et al., Proc Natl Acad Sci USA 74, 5463-5467 (1977).
Sarkar, G. et al., Anal Biochem 186, 64-68 (1990). Sarkar, G. et
al., Nucleic Acids Res 20, 871-878 (1992). Singh-Gasson, S. et al.,
Nat Biotechnol 17, 974-978 (1999). Sommer, S. S., Trends Genet 11,
141-147 (1995). Sommer, S. S. et al., Mayo Clinic Prac. 64,
1361-1372 (1989). Southern, E. M. et al., Genomics 13, 1008-1017
(1992). Southern, E. M., Trends Genet 12, 110-115 (1996).
Spiegelman, J. I. et al., BioTechniques 29, 1084-1092(2000). St.
Clair, M. H., Antimicrob Agents Chemother 31, 1972-1977 (1987).
Syvanen, A. C., Hum Mutat 13, 1-10 (1999). Tabor, S. and
Richardson, C. C., J Biol Chem 265, 8322-8328 (1990). Tabor, S. and
Richardson, C. C., Proc Natl Acad Sci USA 92, 6339-6343 (1995).
Trainor, G. L., U.S. Pat. No. 5,558,991 (1996). Ueno, T. and
Mitsuya, H., Biochemistry 36, 1092-1099 (1997). Urban, S. et al.,
Proc Natl Acad Scie USA 98, 4984-4989 (2001). Vander Horn, P. B. et
al., BioTechniques 22, 758-762 (1997). Wallace, R. B. et al.,
Nucleic Acids Res 6, 3543-3557 (1979). Wong, I. et al.,
Biochemistry 30, 526-537 (1991). Yoshitake, S. et al., Biochemistry
24, 3736-3750 (1985).
SEQUENCE LISTINGS
1
72 1 24 DNA Artificial Amplification primer 1 gacctgcagc aagggagtca
gaag 24 2 24 DNA Artificial Amplification primer 2 tcataccgga
aagggctgga gata 24 3 33 DNA Homo sapiens 3 aatctgactg acccctattc
cctgcttrgg aac 33 4 21 DNA Artificial Oligonucleotide 4 actgacccct
attccctgct t 21 5 22 DNA Artificial Oligonucleotide 5 actgacccct
attccctgct tg 22 6 23 DNA Artificial Oligonucleotide 6 actgacccct
attccctgct tgg 23 7 24 DNA Artificial Oligonucleotide 7 actgacccct
attccctgct tggg 24 8 25 DNA Artificial Oligonucleotide 8 actgacccct
attccctgct tgggg 25 9 26 DNA Artificial Oligonucleotide 9
tctgactgac ccctattccc tgcttg 26 10 24 DNA Artificial
Oligonucleotide 10 tgactgaccc ctattccctg ctta 24 11 24 DNA
Artificial Oligonucleotide 11 tcataccgga aagggctgga gata 24 12 26
DNA Artificial Oligonucleotide 12 taggaacttg gggggtgtca gagccc 26
13 26 DNA Artificial Oligonucleotide 13 tctgactgac ccctattccc
tgcttg 26 14 22 DNA Artificial Oligonucleotide 14 actgacccct
attccctgct tg 22 15 20 DNA Artificial Oligonucleotide 15 tgacccctat
tccctgcttg 20 16 18 DNA Artificial Oligonucleotide 16 acccctattc
cctgcttg 18 17 26 DNA Artificial Oligonucleotide 17 ctattccctg
cttgggaact tgaggg 26 18 22 DNA Artificial Oligonucleotide 18
tccctgcttg ggaacttgag gg 22 19 20 DNA Artificial Oligonucleotide 19
cctgcttggg aacttgaggg 20 20 18 DNA Artificial Oligonucleotide 20
tgcttgggaa cttgaggg 18 21 26 DNA Artificial Oligonucleotide 21
tgactgaccc ctattccctg cttagg 26 22 22 DNA Artificial
Oligonucleotide 22 tgacccctat tccctgctta gg 22 23 20 DNA Artificial
Oligonucleotide 23 acccctattc cctgcttagg 20 24 18 DNA Artificial
Oligonucleotide 24 ccctattccc tgcttagg 18 25 26 DNA Artificial
Oligonucleotide 25 tgactgaccc ctattcgctg cttagg 26 26 22 DNA
Artificial Oligonucleotide 26 tgacccctat tcgctgctta gg 22 27 20 DNA
Artificial Oligonucleotide 27 acccctattc gctgcttagg 20 28 18 DNA
Artificial Oligonucleotide 28 ccctattcgc tgcttagg 18 29 26 DNA
Artificial Oligonucleotide 29 tgactgaccc ttattccctg cttagg 26 30 22
DNA Artificial Oligonucleotide 30 tgacccttat tccctgctta gg 22 31 20
DNA Artificial Oligonucleotide 31 acccttattc cctgcttagg 20 32 18
DNA Artificial Oligonucleotide 32 ccttattccc tgcttagg 18 33 40 DNA
Homo sapiens 33 gactgacccc tattccctgc ttrggaactt gaggggtgtc 40 34
18 DNA Artificial Oligonucleotide 34 acccctattc cctgctta 18 35 17
DNA Artificial Oligonucleotide 35 ttccctgctt gggaact 17 36 18 DNA
Artificial Oligonucleotide 36 ccctgcttgg gaacttga 18 37 18 DNA
Artificial Oligonucleotide 37 tgcttgggaa cttgaggg 18 38 18 DNA
Artificial Oligonucleotide 38 acccctattc cctgattg 18 39 18 DNA
Artificial Oligonucleotide 39 acccctattc cgtgcttg 18 40 18 DNA
Artificial Oligonucleotide 40 acccctatcc cctgcttg 18 41 18 DNA
Artificial Oligonucleotide 41 accccgattc cctgcttg 18 42 18 DNA
Artificial Oligonucleotide 42 actcctattc cctgcttg 18 43 25 DNA Homo
sapiens 43 tctgactgac ccctattccc tgctt 25 44 24 DNA Artificial
Oligonucleotide 44 tgactgaccc ctattccctg ctta 24 45 26 DNA
Artificial Oligonucleotide 45 tctgactgac ccctattccc tgcttg 26 46 24
DNA Artificial Oligonucleotide 46 actgacccct attccctgct tggg 24 47
26 DNA Artificial Oligonucleotide 47 taggaacttg gggggtgtca gagccc
26 48 24 DNA Artificial Oligonucleotide 48 acggcagcac agaccagcgt
gttc 24 49 24 DNA Artificial Oligonucleotide 49 ttgccactca
agcggtcctc tcat 24 50 24 DNA Artificial Oligonucleotide 50
gaagcaatct ggctgtgcaa agtg 24 51 26 DNA Artificial Oligonucleotide
51 tctgactgac ccctattccc tgctta 26 52 26 DNA Artificial
Oligonucleotide 52 tctgactgac ccctattccc tgcttg 26 53 26 DNA
Artificial Oligonucleotide 53 tctgactgac ccctattccc tgctta 26 54 26
DNA Artificial Oligonucleotide 54 tctgactgac ccctattccc tgcttg 26
55 20 DNA Homo sapiens 55 cgagaagttt ttgaaaacac 20 56 20 DNA Homo
sapiens 56 gaacatacag agcaaaagcg 20 57 30 DNA Artificial
Oligonucleotide 57 cgaagcctgt aaagcggcgg tgcacaatcg 30 58 25 DNA
Artificial Oligonucleotide 58 actgttgatg ggtgtctggt cagag 25 59 30
DNA Artificial Oligonucleotide 59 tgatcagccc actgacgcgt tgcgcgagac
30 60 21 DNA Artificial Oligonucleotide 60 acaactggcg ggcaaacagt c
21 61 40 DNA Artificial Oligonucleotide 61 gatggcggag ctgaattaca
ttcccaaccg cgtggcacat 40 62 40 DNA Artificial Oligonucleotide 62
ggcaacgcca atcagcaacg actgtttgcc cgccagttga 40 63 40 DNA Artificial
Oligonucleotide 63 gaagcggcgt cgaagcctgt aaagcggcgg tgcacaatcg 40
64 42 DNA Artificial Oligonucleotide 64 gcggatagtt aatgatcagc
ccactgacgc gttgcgcgag ac 42 65 40 DNA Artificial Oligonucleotide 65
gaagcggcgt cgaagcctgt aaagcggcgg tgcacaatcc 40 66 42 DNA Artificial
Oligonucleotide 66 gcggatagtt aatgatcagc ccactgacgc gttgcgcgag ag
42 67 40 DNA Artificial Oligonucleotide 67 gaagcggcct cgaagcctgt
aaagcggcgg tgcacaatct 40 68 42 DNA Artificial Oligonucleotide 68
gcggatagtt aatgatcagc ccactgacgc gttgcgcgag aa 42 69 40 DNA
Artificial Oligonucleotide 69 gatggcggag ctgaattaca ttcccaaccg
cgtggcacaa 40 70 40 DNA Artificial Oligonucleotide 70 ggcaacgcca
atcagcaacg actgtttgcc cgcctattgt 40 71 40 DNA Artificial
Oligonucleotide 71 tacattccca accgcgtggc acaacaactg gcgggcaaac 40
72 40 DNA Artificial Oligonucleotide 72 gggccagact ggaggtggca
acgccaatca gcaacgactg 40
* * * * *