U.S. patent number 7,208,274 [Application Number 10/376,770] was granted by the patent office on 2007-04-24 for rapid analysis of variations in a genome.
This patent grant is currently assigned to Ravgen, Inc.. Invention is credited to Ravinder S. Dhallan.
United States Patent |
7,208,274 |
Dhallan |
April 24, 2007 |
Rapid analysis of variations in a genome
Abstract
The invention provides a method useful for determining the
sequence of large numbers of loci of interest on a single or
multiple chromosomes. The method utilizes an oligonucleotide primer
that contains a recognition site for a restriction enzyme such that
digestion with the restriction enzyme generates a 5' overhang
containing the locus of interest. The 5' overhang is used as a
template to incorporate nucleotides, which can be detected. The
method is especially amenable to the analysis of large numbers of
sequences, such as single nucleotide polymorphisms, from one sample
of nucleic acid.
Inventors: |
Dhallan; Ravinder S. (Bethesda,
MD) |
Assignee: |
Ravgen, Inc. (Columbia,
MD)
|
Family
ID: |
27792098 |
Appl.
No.: |
10/376,770 |
Filed: |
February 28, 2003 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20040106102 A1 |
Jun 3, 2004 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
10093618 |
Mar 11, 2002 |
6977162 |
|
|
|
60378354 |
May 8, 2002 |
|
|
|
|
60360232 |
Mar 1, 2002 |
|
|
|
|
Current U.S.
Class: |
435/6.12; 506/14;
536/23.1; 536/24.3 |
Current CPC
Class: |
C12Q
1/683 (20130101); C12Q 1/6858 (20130101); C12Q
1/683 (20130101); C12Q 1/6858 (20130101); C12Q
1/683 (20130101); C12Q 1/683 (20130101); C12Q
2533/101 (20130101); C12Q 2525/131 (20130101); C12Q
2521/313 (20130101); C12Q 2533/101 (20130101); C12Q
2525/131 (20130101); C12Q 2521/313 (20130101); C12Q
2535/125 (20130101); C12Q 2525/131 (20130101); C12Q
2545/114 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C07H 21/02 (20060101); C07H
21/04 (20060101) |
Field of
Search: |
;435/6
;536/23.1,24.3 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 994 963 |
|
Apr 2000 |
|
EP |
|
2 299 166 |
|
Sep 1996 |
|
GB |
|
WO 91/08304 |
|
Jun 1991 |
|
WO |
|
WO 95/06137 |
|
Mar 1995 |
|
WO |
|
WO-98/12355 |
|
Mar 1998 |
|
WO |
|
WO 98/39474 |
|
Sep 1998 |
|
WO |
|
WO 02/04672 |
|
Jan 2002 |
|
WO |
|
WO 02/083839 |
|
Oct 2002 |
|
WO |
|
WO 03/074723 |
|
Sep 2003 |
|
WO |
|
WO 03/74740 |
|
Sep 2003 |
|
WO |
|
WO 03/106642 |
|
Dec 2003 |
|
WO |
|
WO 2004/078994 |
|
Sep 2004 |
|
WO |
|
WO 2004/079011 |
|
Sep 2004 |
|
WO |
|
Other References
Foreman, K. E. et al. (Jun. 1997). "In Situ Polymerase Chain
Reaction-Based Localization Studies Support Role of Human
Herpesvirus-8 as the Cause of Two AIDS-related Neoplasms: Kaposi's
Sarcoma and Body Cavity Lymphoma," J. Clinical Inves .
99(12):2971-2978. cited by other .
International Search Report mailed on Jun. 14, 2005 for PCT patent
Application No. PCT/US04/06337 filed Mar. 1, 2004, 5 pages. cited
by other .
Kawasaki, E. S. (1990). "Sample Preparation From Blood, Cells and
Other Fluids," Chapter 18 In PCR Protocols: A Guide to Methods and
Applications. Innis, M. A. et al., eds., Academic Press, Inc, pp.
146-152. cited by other .
Lee, M. S. et al. (Jun. 1989). "Detection of Two Alternative
bcr/abl mRNA Junctions and Minimal Residual Disease in Philadelphia
Chromosome Positive Chronic Myelogenous Leukemia by Polymerase
Chain Reaction, " Blood 73(8):2165-2170. cited by other .
Written Opinion mailed on Jun. 14, 2005 for PCT patent application
No. PCT/US04/06337 filed Mar. 1, 2004, 6 pages. cited by other
.
Witten Opinion mailed on May 23, 2005 for PCT patent application
No. PCT/US03/06198 filed Feb. 28, 2003, 8 pages. cited by other
.
Written Opinion mailed on Mar. 10, 2005 for PCT patent application
No. PCT/US03/06376 filed on Feb. 28, 2003, 3 pages. cited by other
.
U.S. Appl. No. 10/093,618, filed Mar. 11, 2002, Dhallan. cited by
other .
Ahlquist, D. A. et al. (2000). "Colorectal Cancer Screening by
Detection of Altered Human DNA in Stool: Feasibility of A
Multitarget Assay Panel," Gastroenterology 119:1219-1227. cited by
other .
Bianchi, D. W. et al. (1990). "Isolation of Fetal DNA From
Nucleated Erythrocytes in Maternal Blood,"Proc. Nalt. Acad. Sci USA
87:3279-3283. cited by other .
Bianchi, D. W. et al. (1996). "Male Fetal Progenitor Cells Persist
in Maternal blood for as Longas 27 Years Postpartum," Proc. Natl.
Acad. Sci. USA 93:705-708. cited by other .
Bianchi, D. W. et al. (1997). "PCR Quantitation of Fetal Cells in
Maternal Blood in Normal and Aneuploid Pregnancies," Am. J. Hum.
Genet. 61:822-829. cited by other .
Blanchard, A.P. and L. Hood (1996). "Sequence to Array: Probing the
Genome's Secrets," Nature Biotechnology149:1649. cited by other
.
Brenner, S. et al. (2000). "Gene Expression Analysis by Massively
Parallel Signature Sequencing (MPSS) on Microbead Arrays," Nature
Biotechnology 18:630-634. cited by other .
Broude, N. et al. (2001). "High-Level Multiplex DNA Amplification,"
Antisense & Nucleic Acid Drug Development 11:327-332. cited by
other .
Brown, E. L. et al. (1979). "Chemical Synthesis and Cloning of a
Tyrosine tRNA Gene," Methods in Enzymology 68:109-151. cited by
other .
Bruch, J. F. et al., (1991). "Trophoblast-Like Cells Sorted From
Peripheral Maternal BloodUsing Flow Cytometry: A Multiparametric
Study Involving Transmission Electro Microsopy and Fetal DNA
Amplification," Prenatal Disgnosis 11:787-798. cited by other .
Cairns, P. et al. (2001). "Molecular Detection of Prostate Cancer
in Urine by GSTP1 Hypermethylation," Clin. Can. Res. 7:2727-2730.
cited by other .
Center for Medical Genetics. (1998-2003). Human Insertion/Deletion
Polymorphisms http://research. marshfieldclinicorg/genetics/. Last
visited on Apr. 14, 2003. 3 pages cited by other .
Chen, J. et al. (2000). "A Microsphere-Based Assay for Multiplexed
Single Nucleotide Polymorphism Analysis Using Single Base Chain
Extension," Genome Research 10:549-557. cited by other .
Chicurel, M. (2001). "Faster, Better, Cheaper Genotyping," Nature
412:580-582. cited by other .
Collins, F. S. and Mansoura, M. K. (2001). "The Human Genome
Project: Revealing the Shared Inheritance of All Humankind,"
7.sup.th Biennial Symposium on Minorities, the Medically
Underserved and Cancer 91(1):221-225. cited by other .
Cooper, D. N. and Krawczak, M. eds.(1993). "Human Gene Mutation,"
In Duchenne Muscular Dystrophy, Alzheimer's Disease, Cystic
Fibrosis, and Huntington's Disease. BIOS Scientific Publishers
Limited. (Table of Contents only). cited by other .
Cutler, D. J. et al. (2001). "High-Throughput Variation Detection
and Genotyping Using Microarrays," Genome Research 11:1913-1925.
cited by other .
Drabek, J. (2001). "A Commented Dictionary of Techniques for
Genotyping," Electrophoresis 22:1024-1045. cited by other .
Durant, J. et al. (1999). "Drug-Resistance Genotyping in HIV-1
Therapy," The Lancet 354:1120-1122. cited by other .
Durant, J. et al. (1999). "Drug-Resistance Genotyping in HIV-1
Therapy: The Virad APT Randomised Controlled Trial," The Lancet
353:2195-2199. cited by other .
Egholm, M. et al. (1992). "Peptide Nucleic Acids (PNA).
Oligonucleotide Analogues with an Achiral Peptide Backbone," J. Am.
Chem. Soc. 114(5):1895-1897. cited by other .
El-Naggar, A. K. et al. (2001). "Genetic Heterogeneity in Saliva
from Patients with ORal Squamos Carcinomas: Implications in
Molecular Diagnosis and Screening," J. Mol. Diag. 3(4):164-170.
cited by other .
Erlich, H. A. ed. (1989). PCR Technology: Principals and
Applications of DNA Amplification, Stockton Press. pp. ix-x. (Table
of Contents only). cited by other .
Field, F. et al. (1999). "Genetic Alterations in Bronchial Lavage
as a Potential Marker for Individuals with a High Risk of
Developing Lung Cancer," Cancer Research 59:2690-2695. cited by
other .
Ganshert-Ahert, D. et al. (1992). "Magnetic Cell Sorting and
Transferrin Receptor as Potential Means of Prenatal Diagnosis form
Materanl Blood," Am. J. Obstet. Gynecol. 166:1350-1355. cited by
other .
Gerhold, D. et al. (1999). "DNA Chips: Promising Toys have Become
Powerful Tools," TIBS 24:168-173. cited by other .
Green, A. et al. (1990). "Direct Single Stranded Sequencing from
Agarose of Polymerase Chain Reaction Products," Nucleic Acids Res.
18(20):6163-6164. cited by other .
Grosch, S. et al. (2001). "A Rapid Screening Method for a Single
Nucleotide Polymorphism (SNP) in the Human MOR Gene," Br. J. Clin
Pharmacol 52:711-714. cited by other .
Hedenfalk, I.et al. (2001). "Gene-Expression Profiles in Hereditary
Breast Cancer," New Engl. Jnl. Med. 344(8):539-548. cited by other
.
Herzenberg , L. A. et al. (1979). "Fetal Cells in the Blood of
Pregnant Women: Detection ad Engrichment by Fluroescence-Activated
Cell Sorting," Proc. Natl. Acad. Sci. USA 76:1453-1455. cited by
other .
Hogervorst, F.B.L. et al. (1995). "Rapid Detection of BRCA1
Mutations by the Protein Truncation Test," Nature Genetics
10:208-212. cited by other .
HSU, T. M. et al. (2001). "Genotyping Single-Nucleotide
Polymorphisms by the Invader Assay with Dual-Color Fluorescence
Polarization Detection," Clinical Chemistry 47(8):1373-1377. cited
by other .
Huber, M. et al. (2001). "Detection of Single Base Alterations in
Genomic DNA by Solid Phase Polymerase Chain Reaction on
Oligonucleotide Microarrays," Analytical Biochemistry 299:34-30.
cited by other .
Human Gene Mutation Database (HGMD). (2003).
http:archive.uwcm.ac.uk/uwcm/mg/hgmd0.html. Last visited on Oct. 2,
2003. 3 pages total. cited by other .
Innis, M. A. ed., (1990). PCR Protocols: A Guide to Methods and
Applications. Academic Press, Inc. pp. v-x. (Table of Contents
only). cited by other .
James, P. et al. (1994). "Protein Identification in DNA Databases
by Peptide Mass Fingerprinting," Protein Science 3:1347-1350. cited
by other .
Kandpal, R.P. et al. (1990). "Selective Enrichment of a Large Size
Genomic DNA Fragment by Affinity Capture: An Approach for Genome
Mapping," Nucleic Acids Res. 18(7):1789-1795. cited by other .
Kaneoka, H. et al. (1991). "Solid-Phase Direct DNA Sequencing of
Allele-Specific Polymerase Chain Reaction-Amplified HLA-DR Genes,"
Biotechniques 10(1):30, 32 and 34 only. cited by other .
Kinzler, K. W. et al. (1991). "Indentification of FAP Locus Genes
from Chromosome 5q21," Science 253:661-665. cited by other .
Kwok, P-Y. (2001). "Methods for Genotyping Single Nucleotide
Polymorphisms," Annual Review of Genomics and Human. Genetics
2:235-258. cited by other .
Lander, E. S. et al. (2001). "Initial Sequencing and Analysis of
the Human Genome," Nature 409:860-921. cited by other .
Li, J. et al. (1999). "Single Nucleotide Polymorphism Determination
using Primer Extension and Time-of-Flight Mass Spectrometry,"
Electrophoresis 20:1258-1265. cited by other .
Liloglou,T. et al. (2001). "Cancer-Specific Genomic Instablilty in
Bronchial Lavage: A Molecular Tool for Lung Cancer Detection,"
Cancer Research 61:1624-1628. cited by other .
Lockhart, D. J. and Winzeler, E. A. ( 2000). "Genomics, Gene
Expression and DNA Arrays," Nature 405:827-836. cited by other
.
Lo, Y-M. D. et al. (1989). "Prenatal Sex Determination by DNA
Amplification From Maternal Peripheral Blood," The Lancet
2:1363-1365. cited by other .
Lo, Y.M.D. et al. (1996). "Two-Way Cell Traffic Between Mother and
Fetus: Biologic and Clinical Implications," Blood 88:4390-4395.
cited by other .
Lo, Y.M.D. et al. (1997). "Presence of Fetal DNA in Maternal Plasma
and Serum," Lancet 350:485-487. cited by other .
Lo, Y.M.D. et al. (1998). "Quantitative Anaylysis of Fetal DNA in
Maternal Plasma and Serum: Implications for Noninvasive Prenatal
Diagnosis," Am. J. Hum. Genet. 62:768-775. cited by other .
Mao, L. et al. (1996). "Molecular Detection of Primary Bladder
Cancer by Microsatellite Analysis," Science 271:659-662. cited by
other .
Maxam, A. M. and Gilbert, W. (1977). "A New Method for Sequencing
DNA," Proc. Natl. Acad. Sci. 74(2):560-564. cited by other .
McPherson, M. J. et al. eds., (1991). PCR: A Practical Approach,
IRL Press at Oxford University Press. Total pp. 6. (Table of
Contents). cited by other .
Munoz, N. et al. (2003). "Epidemiologic Classification of Human
Papillomavirus Types Associated with Cervical Cancer," New England
Jnl. Med. 348:518-527. cited by other .
Mueller et al. (1990). "Isolation of Fetal Trophoblast Cells From
Peripheral Blood of Pregnant Women," Lancet 336:197-200. cited by
other .
Narang, S. A. et al. (1979). "Improved Phosphotriester Method for
the Synthesis of Gene Fragments," Methods in Enzymology 68:90-98.
cited by other .
Newman, L. (2002). "Ductal Lavage for Breast Cancer Risk
Assessment," Cancer Control 9(6):473-479. cited by other .
Nielsen, P.E. et al. (1991). "Sequence-Selective Recognition of DNA
by Strand Displacement with a Thymine-Substituited Polyamide,"
Science 254:1497-1500. cited by other .
Orban, T. et al. (2000). "Sequence Alterations Can Mask Eash
Other's Presence during Screening with SSCP or Heterodulplex
Analysis: BRCA Genes as Examples," BioTechniques 29(1):94-98. cited
by other .
Pertl, B. MD, and Bianchi, D. W. MD, (2001). "Fetal DNA in Maternal
Plasma: Emerging Clinical Applications," Obstetrics and Gynecology
98(3):483:490. cited by other .
Poch, M. T. et al. (1997). "Sth132I, A Novel Class-IIS Restriction
Endonuclease of Streptococcus thermophilus ST132," Gene
195:201-206. cited by other .
Riordan, J. R. et al. (1989). "Identification of the Cystic
Fibrosis Gene: Cloning and Characterization of Complementary DNA,"
Science 245 (4922):1066-1073. cited by other .
Roest, P.A.M. et al. (1993). "Protein Truncation Test (PTT) for
Rapid Detection of Translation-Terminating Mutations," Human
Molecular Genetics 2(10):1719-1721. cited by other .
Rommens, J. M. et al. (1989). "Identification of the Cystic
Fibrosis Gene: Chromosome Walking and Jumping," Science
245:1059-1065. cited by other .
Ryan, B. M. et al. (2003). "A Prospective Study of Circulationg
Mutant KRAS2 in the Serum of Patients with Colorectal Neoplasia:
Strong Prognostic Indicator in Postoperative Follow Up," Gut.
52:101-108. cited by other .
Sambrook, J. and Russell, D. W. eds., (2001). Molecular Cloning
Laboratory Manual. vol. 2 Third Edition, Cold Spring Harbor
Laboratory Press. pp. v-xx. (Table of Contents only). cited by
other .
Sanger, F. et al. (1977). "DNA Sequencing with Chain-Terminating
Inhibitors," PNAS USA 74(12):5463-5467. cited by other .
Shah, J. S. et al. (1995). "Q-Beta Replicase-Amplified Assay for
Detection of Mycobacterium tuberculosis Directly from Clinical
Specimens," Journal of Clinical Microbiology. 33(6):1435-1441.
cited by other .
Shapero, M. H. et al. (2001). "SNP Genotyping by Multiplexed
Solid-Phase Amplification and Fluorescent Minisequencing," Genome
Research 11:1926-1934. cited by other .
Shi, M. M. (2001). "Enabling Large-Scale Pharmacogenetic Studies by
High-Throughput Mutation Detection and Genotyping Technologies,"
Clinical Chemistry 47(2):164-172. cited by other .
Sibson, D. R. et al. (2001). "Molecular Indexing of Human Genomic
DNA," Nucleic Acids Research 29(19):1-10. cited by other .
Small, K. M. et al. (2002). "Synergistic Polymorphisms of
.beta..sub.1- and .alpha..sub.2c-Adrenergic Receptors and The Risk
of Congestive Heart Failure," New Eng. Jnl Med. 347(15):1135-1142.
cited by other .
SNP Report for TSC 0034767. (Jan. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0087315. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Apr. 14, 2003.
2 pages. cited by other .
SNP Report for TSC 0095512. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Apr. 14, 2003.
2 pages. cited by other .
SNP Report for TSC 0115603. (Mar. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0195492. (Jun. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0197279. (Jun. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0198557. (Jun. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0214366. (Jun. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0264580. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Apr. 14, 2003.
2 pages. cited by other .
SNP Report for TSC 0413944. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Apr. 14, 2003.
2 pages. cited by other .
SNP Report for TSC 0597888. (Jun. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0813773. (Oct. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 0837969. (Dec. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report for TSC 1130902. (May 2001).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003.
2 pages. cited by other .
SNP Report TSC 0309610. (Jul. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Sep. 10, 2003.
cited by other .
SNP Report TSC 0607185 (Oct. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Sep. 11, 2003.
2 pages. cited by other .
SNP TSC 0200347. (Jun. 2000). http://snp.cshl.org/snpsearch.shtml.
Last visited on Sep. 10, 2003. 2 pages. cited by other .
Spafford, M. F. et al. (2001). "Detection of Head and Neck Squamos
Cell Carcinoma Among Exfoliated Oral Mucosal Cells by
Microsatellite Analysis," Clinical Cancer Research 7:607-612. cited
by other .
Subramanian, G. et al. (2001) "Implications of the Human Genome for
Understanding Human Biology and Medicine," JAMA 286(18):2296-2307.
cited by other .
Syvanen, A-C. (1999). "From Gels to Chips: "Minisequencing" Primer
Extension for Analysis of Point Mutations and Single Nucleotide
Polymorphisms," Human Mutation 13:1-10. cited by other .
Szybalski, W. et al. (1991). "Class-IIS Restriction Enzymes--A
Review," Gene 100:13-16. cited by other .
Taton, T.A. et al. (2000). "Scanometric DNA Array Detection with
Nanoparticle Probes," Science 289:1757-1760. cited by other .
Tockman, M. MD, PhD. (2000). "Advances in Sputum Analysis for
Screening and Early Detection of Lung Cancer," Cancer Control
7(1):19-24. cited by other .
Traverso, G. et al. (2002). "Detection of APC Mutations in Fecal
DNA from Patients With Colorectal Tumors," New England Journal of
Medicine 346(5):311-320. cited by other .
Tsao, J. and Shibata, D. (1994). "Further Evident That One of the
Earliest Alterations in Colorectal Carcinogenesis Involves APC,"
Am. J. Pathol. 145(3):531-534. cited by other .
Tsongalis, G. J. et al. (2001). "READIT: A Novel Technology Used in
the Interrogation of Nucleic Acid Sequences for Single-Nucleotide
Polymorphisms," Experimental and Molecular Pathology 71:222-225.
cited by other .
Utting, M. et al. (2002). "Micorsatellite Analysis of Free Tumor
DNA in Urine, Serum, and Plasma of Patients: A Minimally Invasive
Method for the Detection of Bladder Cancer," Clinical Cancer Res.
8:35-40. cited by other .
van der Luijt, R. et al. (1994). "Rapid Detection of
Translation-Terminating Mutations at the Ademomatous Polyposis Coli
(APC) Gene by Direct Protein Truncation Test," Genomics 20:1-4.
cited by other .
van Rhijin, Bas, W. G. et al. (2003). "Combined Microsatellite and
FGFR3 Mutation analysis Enables a Highly Sensitive Detection of
Urothelial Cell Carcinoma in Voided Urine," Clinical Cancer Res.
9:257-263. cited by other .
Venter, J.C. et al. (2001). "The Sequence of the Human Genome,"
Science 291:1304-1351. (Erratum attached, 1 page Jun. 2001). cited
by other .
Walknowska, J. et al. (1969). "Practical and Theoretical
Implicationsof Fetal/Maternal Lymphocyte Transfer," The Lancet
1:1119-1122. cited by other .
Wallace, R.W. (1997). "DNA on a Chip: Serving Up the Genome for
Diagnostics and Research," Molecular Medicine Today 3:384-389.
cited by other .
Wang, D. G. et al. (1998). "Large-Scale Identification, Mapping,
and Genotyping of Single-Nucleotide Polymorphisms in the Human
Genome," Science 280:1077-1082. cited by other .
Waterston, R.H. and McPherson, J.D. (2001). "A Map of Human Genome
Sequence Variation Containing 1.42 Million Single Nucleotide
Polymorphisms," Nature 409:928-933. cited by other .
Welsh K. and Bunce, M. (1999). "Molecular Typing for the MHC and
PCR-SSP," Reviews in Immunogenetics 1:157-176. cited by other .
Westin, L. et al. (2000). "Anchored Multiplex Amplification on a
Microelectronic Chip Array," Nature Biotechnology 18:199-204. cited
by other .
Wilson, K. S. et al. (2002). "Differential Gene Expression Patterns
in HER2/neu-Positive and--Negative Breast Cancer Cell Lines and
Tissues," Am. J. Pathol. 161 (4):1171-1185. cited by other .
Xie, D. et al. (2000). "Population-Based, Case-Control Study of
HER2 Genetic Polymorphism and Breast Cancer Risk," J. Natl. Cancer
Institute 92(5):412-417. cited by other .
Zhou, G-H. et al. (2001). "Quantitative Detection of Single
Nucleotide Polymorphisms for a Pooled Sample by a Bioluminometric
Assay Coupled with Modified Primer Extension Reactions (BAMPER),"
Nucleic Acids Research 29(19):1-11. cited by other .
Saito, H. et al. (Sep. 30, 2000). "Prenatal DNA Diagnosis of a
Single-Gene Disorder from Maternal Plasma," The Lancet 356:1170.
cited by other .
U.S. Appl. No. 60/360,232, filed Mar. 1, 2002, Dhallan. cited by
other .
U.S. Appl. No. 60/378,354, filed May 8, 2002, Dhallan. cited by
other .
Amicucci, P. et al. (2000). "Prenatal Diagnosis of Myotonic
Dystrophy Using Fetal DNA Obtained from Maternal Plasma," Clinical
Chemistry 46(2):301-302. cited by other .
Angert, R.M. et al. (Jan. 2003). "Fetal Cell-Free Plasma DNA
Concentrations in Maternal Blood Are Stable 24 Hours after
Collection: Analysis of First- and Third-Trimester Samples,"
Clinical Chemistry 49(1):195-198. cited by other .
Anker, P. et al. eds. (Apr. 2000). "Circulating Nucleic Acids in
Plasma or Serum," Table of Contents from the First International
Symposium on Circulating Nucleic Acids in Plasma/Serum: Implication
in Cancer Diagnosis, Prognosis, or Follow-up and in Prenatal
Diagnosis, Apr. 18-20, 1999 in Menthon Saint-Bernard, France,
located at
<http://www.unige.ch/LABPV/symposium/cnaps/cnaps.sub.--book.html>
last visited on Mar. 27, 2001, four pages. cited by other .
Anonymous. (Dec. 16, 1996). "Birth Defects: Maternal Blood Gets Put
to the Test," Physician's Weekly Clinical Updates located at:
<http://www.physweekly.com/archive/96/12.sub.--16.sub..noteq.19/cu4.ht-
ml> last visited on Mar. 27, 2001, one page. cited by other
.
Anonymous. (Dec. 17, 1998). "Strategies for the Rapid Prenatal
Detection of Down's Syndrome," CMGS located at
<http://www.ich.ucl/ac/uk/cmgs/downs98.html> last visited on
Mar. 27, 2001, four pages. cited by other .
Anonymous. (Feb. 5, 2001). "Methods of Ultrasensitive Bioanalysis:
DNA Sequencing and Indexing" Union Bay Ultrasensitive Bioanalysis
Team located at
<http://faculty.washington.edu/dovichi/research/application/DNA/DNASeq-
uencing.html> last visited Apr. 16, 2001, four pages. cited by
other .
Anonymous. (2001). "Molecular Indexing (MI) Home Page," Helix
Research Institute located at <http://www.hri.co.jp/MI> last
visited Apr. 16, 2001, four pages. cited by other .
Barnett, E.V. (Jun. 1968). "Detection of Nuclear Antigens (DNA) in
Normal and Pathologic Human Fluids by Quantitative Complement
Fixation," Arthritis and Rheumatism 11(3):407-417. cited by other
.
Bauer, M. et al. (Jan. 2002). "Detection of Maternal
Deoxyribonucleic Acid in Umbilical Cord Plasma by Using Fluorescent
Polymerase Chain Reaction Amplification of Short Tandem Repeat
Sequences," Am. J. Obstet. Gynecol. 186:117-120. cited by other
.
Beer, A.E. et al. (Sep. 7, 1994). "The Biological Basis of Passage
of Fetal Celular Material into the Maternal Circulation," Annals
New York Academy of Sciences 731:21-35. cited by other .
Bennett, P.R. et al. (Aug. 26, 1993). "Prenatal Determination of
Fetal RhD Type of DNA Amplification," The New England Journal of
Medicine 329(9):607-610. cited by other .
Bianchi, D.W. (Dec. 1995). "Prenatal Diagnosis by Analysis of Fetal
Cells in Maternal Blood," The Journal of Pediatrics 127(6):847-856.
cited by other .
Bianchi, D.W. (1998). "Current Knowledge About Fetal Blood Cells in
the Maternal Circulation," J. Perinat. Med. 26:175-185. cited by
other .
Bianchi, D.W. (1998). "Fetal DNA in Maternal Plasma: The Plot
Thickens and the Placental Barrier Thins," Am. J. Hum. Genet.
62:763-764. cited by other .
Bianchi, D.W. (2000). "A Guest Editorial: State of Fetal Cells in
Maternal Blood: Diagnosis or Dilemma," Obstetrical and
Gynecological Survey 55(11):665-667. cited by other .
Bianchi, D.W. (Sep. 2000). "Fetal Cells in the Mother: From Genetic
Diagnosis to Diseases Associated with Fetal Cell Microchimerism,"
European Journal of Obstetrics & Gynecology and Reproductive
Biology 92:103-108. cited by other .
Bianchi, D.W. (May 2002). "Prenatal Exclusion of Recessively
Inherited Disorders: Should Maternal Plasma Analysis Precede
Invasive Techniques?" Clinical Chemistry 48(5):689-670. cited by
other .
Bianchi, D.W. et al. (2001). "Longitudinal Fetal DNA Quantitation
Studies in Maternal Cells and Plasma over a 24 Hour Period,"
Program Nr: 2377 located at
<http://www.faseb.org/genetics/ashg00/f2377.html> last
visited on Mar. 27, 2001, one page. cited by other .
Bianchi, D.W. et al. (May 12-13, 2001). "Thoughts on the Origin of
Fetal DNA in the Pregnant Woman," Abstract 3.4 In Chapter 3
"Clinical Applications of Fetal DNA in Maternal Plasma," In
Abstracts, 12th Fetal Cell Workshop, Fetal Diagn. Ther. 16:450.
cited by other .
Bianchi, D.W. et al. (Jul. 2002). "Fetal Gender and Aneuploidy
Detection Using Fetal Cells in Maternal Blood: Analysis of NIFTY I
Data," Prenatal Diagnosis 22:609-615. cited by other .
Brambati, B. (Sep. 7, 1994). "Prenatal Diagnosis by Isolating and
Analyzing Fetal Nucleated Red Cells: Dream or Reality?" Annals New
York Academy of Sciences 731:248-252. cited by other .
Byrne, B.M. et al. (Jul. 1, 2003). "Fetal DNA Quantitation in
Peripheral Blood Is Not Useful as a Marker of Disease Severity in
Women with Preeclampsia," Hypertens Pregnancy 22(2):157-164. cited
by other .
Camaschella, C. et al. (Jun. 1, 1990). "Prenatal Diagnosis of Fetal
Hemoglobin Lepore-Boston Disease on Maternal Peripheral Blood,"
Blood 75(11):2102-2106. cited by other .
Chen, X.Q. et al. (Sep. 1996). "Microsatellite Alterations in
Plasma DNA of Small Cell Lung Cancer Patients," Nature Medicine
2(9):1033-1035. cited by other .
Cohen, J. (Oct. 2002). "Fetal Fortunes," Technology Review 54-61.
cited by other .
Cox, R.A. et al. (Feb. 1977). "DNA Concentrations in Serum Mand
Plasma," Clinical Chemistry 23(2):297. cited by other .
Cunningham, J. et al. (Oct. 1999). "Non-Invasive RNA-Based
Determination of Fetal Rhesus D Type: A Prospective Study Based on
96 Pregnancies," British J. of Ob-Gyn 106:1023-1028. cited by other
.
Davis, G.L. et al. (Jan.-Feb. 1973). "Detection of Circulating DNA
by Counterimmuno-electrophoresis (CIE)," Arthritis and Rheumatism
16(1):52-58. cited by other .
Dhallan, R. et al. (Mar. 3, 2004). "Methods to Increase the
Percentage of Free Fetal DNA Recovered From the Maternal
Circulation," JAMA 291(9):1114-1119. cited by other .
Ding, C. et al. (Jul. 20, 2004). "MS Analysis of Single-Nucleotide
Differences in Circulating Nucleic Acids: Application to
Noninvasive Prenatal Diagnosis," PNAS 101(29):10762-10767. cited by
other .
Douglas, G.W. et al. (Nov. 1959). "Trophoblast in the Circulating
Blood During Pregnancy," American Journal of Obstetrics and
Gynecology 78(5):960-973. cited by other .
Emanuel, S.L. et al. (1993). "Amplification of Specific Gene
Products from Human Serum," GATA 10(6):144-146. cited by other
.
Farnia, A. et al. (1998). "Fetal Cells in Maternal Blood as a
Second Non-Invasive Step for Fetal Down Syndrome Screening,"
Prenat. Diagn. 18:983-986. cited by other .
Fournie, G.J. et al. (1993). "Plasma DNA as Cell Death Marker in
Elderly Patients," Gerontology 39:215-221. cited by other .
Fowke, K.R. et al. (1995). "Genetic Analysis of Human DNA Recovered
From Minute Amounts of Serum or Plasma," Journal of Immunological
Methods 180:45-51. cited by other .
Hahn, S. et al. (May 12-13, 2001). "An Examination of Fetal Cells,
Free Fetal DNA and Fetal Cell Culture: The Basel Experience,"
Abstract 3.2 In Chapter 3 "Clinical Applications of Fetal DNA in
Maternal Plasma," In Abstracts, 12th Fetal Cell Workshop, Fetal
Diagn. Ther. 16:449. cited by other .
Hahn, S. et al. (Sep. 2002). "Prenatal Diagnosis Using Fetal Cells
and Cell-Free Fetal DNA in Maternal Blood: What is Currently
Feasible?" Clinical Obstetrics and Gynecology 45(3):649-656. cited
by other .
Heinemann, J.A. et al. (Apr. 2000). "New Hypotheses on the Material
Nature of Horizontally Mobile Genes," Annals New York Academy of
Sciences 906:169-186. cited by other .
Holzgreve, W. et al. (2000). "Fetal Cells in Cervical Mucus and
Maternal Blood," Bailliere's Clinical Obstetrics and Gynaecology
14(4):709-722. cited by other .
Holzgreve, W. et al. (Jun. 2001). "Prenatal Diagnosis Using Fetal
Cells and Free Fetal DNA in Maternal Blood," Clinical Perinatology
28(2):353-365. cited by other .
Human Gene Mutation Database (HGMD). (Date Unknown). Located at
<http:archive.uwcm.ac.uk/uwcm/mg/hgmd0.html> last visited on
Sep. 20, 2004. 3 pages total. cited by other .
International Search Report mailed on Jul. 17, 2003, for PCT Patent
Application No. PCT/US03/06376 filed on Feb. 28, 2003, 4 pages.
cited by other .
International Search Report mailed on Sep. 2, 2003, for PCT patent
application No. PCT/US03/06198 filed on Feb. 28, 2003, 9 pages.
cited by other .
International Search Report mailed on Jul. 20, 2004 for PCT patent
application No. PCT/US03/27308 filed Aug. 29, 2003, 8 pages. cited
by other .
Kamm, R.C. et al. (1972). "Nucleic Acid Concentrations in Normal
Human Plasma," Clinical Chemistry 18(6):519-522. cited by other
.
Kamm, R.C. et al. (1975). "Plasma Deoxyribonucleic Acid
Concentrations of Women in Labor and Umbilical Cords," American
Journal of Obstetrics and Gynecology 121(1):29-31. cited by other
.
Kang, A. et al. (1999). "Fetal Cells in Maternal Blood: Their Role
in Non-Invasive Prenatal Diagnosis and in the Etiology of Certain
Diseases," ("Fetale Zellen im mutterlichen Blut--ihre Bedeutung fur
eine nicht-invasive pranatale Diagnostik und bei der Atiologic
bestimmter Erkrankungen,") Schweiz Med. Wochenschr 129:1470-1743.
English Translation and original language article. cited by other
.
Kuo, P-L. (1999). "Fetal Cell Isolation From Maternal
Blood--Clinical and Biological Implications," Adv. Obstet.
Perinatol. 10(1):15-24. cited by other .
Kwak, J.Y.H. et al. (Sep. 7, 1994). "Biological Basis of
Fetoplacental Antigenic Determinants in the Induction of the
Antiphospholipid Antibody Syndrome and Recurrent Pregnancy Loss,"
Annals New York Academy of Sciences 731:242-245. cited by other
.
Lagona, F. et al. (Apr. 2000). "Fetal DNA Analysis from Maternal
Plasma and Nucleated Blood Cells," Annals New York Academy of
Sciences 906:156-160. cited by other .
Lee, T. et al. (Nov. 2002). "Down Syndrome and Cell-Free Fetal DNA
in Archived Maternal Serum," Am. J. Obstet. Gynecol. 187:1217-1221.
cited by other .
Leon, S.A. et al. (1977). "Free DNA in the Serum of Rheumatoid
Arthritis Patients," Journal of Rheumatology 4(2):139-143. cited by
other .
Lo, Y.M.D. (Sep. 7, 1994). "An Improved PCR-Based System for
Prenatal Sex Determination from Maternal Peripheral Blood," Annals
New York Academy of Sciences 731:214-216. cited by other .
Lo, Y.M.D. et al. (Sep. 7, 1994). "Strategies for the Detection of
Autosomal Fetal DNA Sequence from Maternal Peripheral Blood,"
Annals New York Academy of Sciences 731:204-213. cited by other
.
Lo, Y.M.D. (Sep. 7, 1994). "Prenatal Determination of Fetal Rhesus
D Status by DNA Amplification of Peripheral Blood of
Rhesus-Negative Mothers," Annals New York Academy of Sciences, 731:
229-236. cited by other .
Lo, Y.M.D. (Dec. 1994) "Non-Invasive Prenatal Diagnosis Using Fetal
Cells in Maternal Blood," Journal of Clinical Pathology
47(12):1060-1065. cited by other .
Lo, Y.M.D. (1999). "Fetal RhD Genotyping From Maternal Plasma,"
Annals of Medicine 31(5):308-312. cited by other .
Lo, Y.M.D. (1999). "Rapid Clearance of Fetal DNA from Maternal
Plasma," Am. J. Hum. Genet. 64:218-224. cited by other .
Lo, Y.M.D. (Apr. 2000). "Fetal DNA in Maternal Plasma," Annals of
New York Academy of Sciences 906:141-147. cited by other .
Lo, Y.M.D. (Dec. 2000). "Fetal DNA in Maternal Plasma: Biology and
Diagnostic Applications," Clinical Chemistry 46(12):1903-1906.
cited by other .
Lo, Y.M.D. (May 12-13, 2001). "Fetal DNA in Maternal Plasma,"
Abstract 3.1 In Chapter 3 "Clinical Applications of Fetal DNA in
Maternal Plasma," In Abstracts, 12th Fetal Cell Workshop, Fetal
Diagn. Ther., 16:448-449. cited by other .
Lo, Y.M.D. (Jun. 2001). "Fetal DNA in Maternal Plasma: Application
to Non-Invasive Blood Group Genotyping of the Fetus," Transfus.
Clin. Biol. 8(3):306-310. cited by other .
Lo, Y.M.D. (Jan. 2003). "Fetal DNA in Maternal Plasma/Serum: The
First 5 Years," Pediatric Research 53(1):16-17. cited by other
.
Lo, Y.M.D. et al. (Jun. 16, 1990). "Detection of Single-Copy Fetal
DNA Sequence From Maternal Blood," The Lancet 335:1463-1464. cited
by other .
Lo, Y.M.D. et al. (1994). "Detection of Fetal RhD Sequence From
Peripheral Blood of Sensitized RhD-Negative Women," British Journal
of Hematology 87:658-660. cited by other .
Lo, Y.M.D. et al. (1999). "Increased Fetal DNA Concentrations in
the Plasma of Pregnant Women Carrying Fetuses with Trisomy 21,"
Clinical Chemistry 45(10):1747-1751. cited by other .
Longo, M.C. et al. (1990). "Use of Uracil DNA Glycosylase to
Control Carry-Over Contamination in Polymerase Chain Reactions,"
Gene 93:125-128. cited by other .
Martin, M. et al. (Feb. 1992). "A Method for Using Serum or Plasma
as a Source of DNA for HLA Typing," Human Immunology 33(2):108-113.
cited by other .
Miller, D. ed. (Aug. 16, 1996). "Notes on Fifth Fetal Cell
Workshop," Amsterdam, May 3, 1996, published and located at
<http://iubio.bio.indiana.edu> last visited on Mar. 27, 2001,
four pages. cited by other .
Mulcahy, H.E. et al. (Sep. 7, 1996). "Cancer and Mutant DNA in
Blood Plasma," The Lancet 348(9028):628. cited by other .
Muller, F. et al. (Mar. 2000). "Parental Origin of the Extra
Chromosome in Prenatally Diagnosed Fetal Trisomy 21," Hum. Genet.
106:340-344. cited by other .
Nawroz, H. et al. (Sep. 1996). "Microsatelite Alterations in Serum
DNA of Head and Neck Cancer Patients," Nature Medicine
2(9):1035-1037. cited by other .
Oliphant, A. et al. (Jun. 2002). "BeadArray.TM. Technology:
Enabling An Accurate, Cost-Effective Approach to High-Throughput
Genotyping," Biotechniques 32(Suppl):S56-S61. cited by other .
Pertl, B. et al. (May 14, 1994). "Rapid Molecular Method for
Prenatal Detection of Down's Syndrome," The Lancet 343:1197-1198.
cited by other .
Pertl, B. et al. (Oct. 1999). "First Trimester Prenatal Diagnosis:
Fetal Cells in the Maternal Circulation," Seminars in Perinatology
23(5):393-402. cited by other .
Pertl, B. et al. (Jan. 6, 2000). "Detection of Male and Female
Fetal DNA in Maternal Plasma by Multiplex Fluorescent Polymerase
Chain Reaction Amplification of Short Tandem Repeats," Hum. Genet.
106:45-49. cited by other .
Pertl, B. et al. (Mar. 27, 2001). "Detection of Male and Female
Fetal DNA in Maternal Plasma by Multiplex Fluorescent Polymerase
Chain Reaction Amplification of Short Tandem Repeats," located at
<http://link.springer.de/link/service/journals/00439/contents/99/00166-
/s004399900166ch002.html> last visited on Mar. 27, 2001, one
page. cited by other .
Pertl, B. et al. (Mar. 27, 2001). "Detection of Male and Female
Fetal DNA in Maternal Plasma by Multiplex Fluorescent Polymerase
Chain Reaction Amplification of Short Tandem Repeats (STRs),"
Program Nr: 410 located at
<http://www.faseb.org.genetics/ashg99/f410.html> last visited
Mar. 27, 2001, one page. cited by other .
Poon, L.L.M. (2000). "Presence of Fetal RNA in Maternal Plasma,"
Clin. Chem. 46(11):1832-1834. cited by other .
Poon, L.L.M. et al. (Nov. 25, 2000). "Prenatal Detection of Fetal
Down's Syndrome from Maternal Plasma," The Lancet 356:1819-1820.
cited by other .
Poon, L.L.M. et al. (Nov. 2001). "Circulating Fetal DNA in Maternal
Plasma," Clinica Chimmica Acta 313:151-155. cited by other .
Promega, Inc. (Dec. 1999). "Wizard.RTM. DNA Clean-Up System,"
Promega Corp. Technical Bulletin TB141:1-4. cited by other .
Ramster, B. (Jul. 2, 2001). "IVF Screening for Down's Syndrome
Flawed, Say Experts," BioMedNet located at
<http://news.bmn,com/news/story?day=010703&story> last
visited Jul. 3, 2001, one page. cited by other .
Raptis, L. et al. (Dec. 1980). "Quantitation and Characterization
of Plasma DNA in Normals and Patients with Systemic Lupis
Erythematosus," Journal of Clinical Investigation 66:1391-1399.
cited by other .
Samura, O. et al. (Jul. 2000). "Female Fetal Cells in Maternal
Blood: Use of DNA Polymorphisms to Prove Origin," Hum. Genet.
107:28-32. cited by other .
Samura, O. et al. (Sep. 2001). "Diagnosis of Trisomy 21 in Fetal
Nucleated Erythrocytes from Maternal Blood by Use of Short Tandem
Repeat Sequences," Clinical Chemistry 47(9):1622-1626. cited by
other .
Shapiro, B. et al. (1983). "Determination of Circulating DNA Levels
in Patients with Benign or Malignant Gastrointestinal Disease,"
Cancer 51:2116-2120. cited by other .
Sidransky, D. (Apr. 2000). "Circulating DNA: What We Know and What
We Need to Learn," In Circulating Nucleic Acids in Plasma or Serum,
Annals New York Academy of Sciences 906:1-4. cited by other .
Simpson, J.L. et al. (1994). "Isolating Fetal Cells in Maternal
Circulation for Prenatal Diagnosis," Prenatal Diagnosis
14:1229-1242. cited by other .
Simpson, J.L. et al. (Sep. 7, 1994). "Fetal Cells in Maternal
Blood. Overview and Historical Perspective," Annals New York
Academy of Sciences 731:1-8. cited by other .
Simpson, J.L. et al. (Mar. 3, 2004). "Cell-Free Fetal DNA in
Maternal Blood," JAMA 291(9):1135-1137. cited by other .
Smid, M. et al. (1999). "Evaluation of Different Approaches for
Fetal DNA Analysis from Maternal Plasma and Nucleated Blood Cells,"
Clinical Chemistry 45(8):1570-1572. cited by other .
Smid, M. et al. (2001). "Quantitative Analysis of Fetal DNA in
Maternal Plasma in Pregnancies Affected by Insulin-Dependent
Diabetes mellitus (IDDM)," Abstract 3.3 In Chapter 3 "Clinical
Applications of Fetal DNA in Maternal Plasma," In Abstracts, 12th
Fetal Cell Workshop, Fetal Diagn. Ther., 16:449-450. cited by other
.
SNP Entry Report for HC21S00007. (Date Unknown). located at
<http//:csnp.unige.ch/cgi-bin/csnp.sub.--fetch?entry=HC21S00007>
last visited on Sep. 27, 2004, one page. cited by other .
SNP Entry Report for HC21S00027. (Date Unknown). located at
<http//:csnp.unige.ch/cgi-bin/csnp.sub.--fetch?db+csnp&format=html&ent-
ry=HC21S00027> last visited on Sep. 27, 2004, one page. cited by
other .
SNP Entry Report for HC21S00131. (Date Unknown). located at
<http//:csnp.unige.ch/cgi-bin/csnp.sub.--fetch?db+csnp&format=html&ent-
ry=HC21S00131> last visited on Sep. 27, 2004, one page. cited by
other .
SNP Entry Report for HC21S00340. (Date Unknown). located at
<http//:csnp.unige.ch/cgi-bin/csnp.sub.--fetch?entry=HC21S00340>
last visited on Sep. 27, 2004, 2 pages. cited by other .
SNP Report for TSC 0200347. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Sep. 10, 2003,
2 pages. cited by other .
SNP Report for TSC 0214366. (Oct. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003,
2 pages. cited by other .
SNP Report for TSC 0214366. (Oct. 2000).
(http://snp.cshl.org/snpsearch.shtml. Last visited on Dec. 30,
2003, 2 pages. cited by other .
SNP Report for TSC 0309610. (Aug. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Sep. 10, 2003,
2 pages. cited by other .
SNP Report for TSC 0607185. (Oct. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Sep. 11, 2003,
2 pages. cited by other .
SNP Report for TSC 0813773. (Oct. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003,
2 pages. cited by other .
SNP Report for TSC 0837969. (Dec. 2000).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003,
2 pages. cited by other .
SNP Report for TSC 1130902. (May 2001).
http://snp.cshl.org/snpsearch.shtml. Last visited on Aug. 12, 2003,
2 pages. cited by other .
Steele, C.D. et al. (Dec. 1996). "Prenatal Diagnosis Using Fetal
Cells Isolated From Maternal Peripheral Blood: A Review," Clinical
Obstetrics and Gynecology 39(4):801-813. cited by other .
Stroun, M. et al. (Apr. 2000). "The Origin and Mechanism of
Circulating DNA," Annals New York Academy of Sciences 906:161-168.
cited by other .
Tan, E.M. et al. (1966). "Deoxyribonucleic Acid (DNA) and
Antibodies to DNA in the Serum of Patients with Systemic Lupis
Erythematosus," Journal of Clinical Investigation 45(11):1732-1740.
cited by other .
Tang, N.L.S. et al. (1999). "Detection of Fetal-Derived Paternally
Inherited X-Chromosome Polymorphisms in Maternal Plasma," Clinical
Chemistry 45(11):2033-2035. cited by other .
Thomas, M.R. et al. (Sep. 7, 1994). "The Time of Appearance, and
Quantitation, of Fetal DNA in the Maternal Circulation," Annals New
York Academy of Sciences 731:217-225. cited by other .
Ugozzoli, L. et al. (1992). "Detection of Specific Alleles by Using
Allele-Specific Primer Extension Followed by Capture on Solid
Support," GATA 9(4):107-112. cited by other .
Uitto, J. et al. (Aug. 2003). "Probing the Fetal Genome: Progress
in Non-Invasive Prenatal Diagnosis," Trends in Molecular Medicine
9(8):239-243. cited by other .
van Wijk, I.J. et al. (2000). "Detection of Apoptotic Fetal Cells
in Plasma of Pregnant Women," Clinical Chemistry 46(5):729-731.
cited by other .
Velculescu, V.E. et al. (Oct. 2000). "Analysing Uncharted
Transcriptomes with SAGE," TIG 16(10): 423-425. cited by other
.
Verma, L. et al. (Jul. 4, 1998). "Rapid and Simple Prenatal DNA
Diagnosis of Down's Syndrome," The Lancet 352:9-11. cited by other
.
Wataganara, T. et al. (Jan. 2003). "Maternal Serum Cell-Free Fetal
DNA Levels are Increased in Cases of Trisomy 13 but not Trisomy
18," Hum. Genet. 112(1):204-208. cited by other .
Yamamoto et al. (Mar. 1994). "Anti-ssDNA and dsDNA Antibodies in
Preeclampsia," Asia Oceania J. Obstet Gynaecol. 20(1):93-99. cited
by other .
Zhang, L. et al. (Jul. 1992). "Whole Genome Amplification From a
Single Cell: Implications for Genetic Analysis," Proc. Nat. Acad.
Sci. 89:5847-5851. cited by other .
Zhen, D.K. et al. (1998). "Poly-Fish: A Technique of Repeated
Hybridizations That Improves Cytogenetic Analysis of Fetal Cells in
Maternal Blood," Prenat. Diagn. 18:1181-1185. cited by other .
Zhong, X.Y. et al. (2000). "Fetal DNA in Maternal Plasma is
Elevated in Pregnancies with Aneuploid Fetuses," Prenatal Diagnosis
20:795-798. cited by other .
Stratagene Corporation. (1988). "Gene Characterization Kits," The
Stratagene Catalog, p. 39. cited by other .
Supplementary European Search Report mailed on Jul. 4, 2006 for EP
Application No. 03 74 3737.3, three pages. cited by other.
|
Primary Examiner: Whisenant; Ethan
Attorney, Agent or Firm: Morrison & Foerster LLP
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. patent
application Ser. No. 10/093,618, filed Mar. 11, 2002, now U.S. Pat.
No. 6,977,162, which claims benefit of provisional U.S. Patent
Application No. 60/360,232, filed Mar. 1, 2002. This application
also claims benefit of provisional U.S. Patent Application No.
60/378,354, filed May 8, 2002. The contents of these applications
are hereby incorporated by reference in their entirety herein.
Claims
What is claimed is:
1. A method for determining a sequence of alleles of a locus of
interest, said method comprising: (a) amplifying a locus of
interest on a template DNA using a first and second primers,
wherein the second primer contains a recognition site for a
restriction enzyme that cuts DNA at a distance from the recognition
site and digestion with the restriction enzyme generates a 5'
overhang containing the locus of interest, and wherein the first
primer contains a recognition site for a restriction enzyme that is
different from the recognition site for the restriction enzyme on
the second primer and contains a tag at the 5' end; (b) digesting
the amplified DNA with the restriction enzyme that recognizes the
recognition site on the second primer; (c) incorporating
nucleotides into the digested DNA of (b), wherein; (i) a labeled
nucleotide that terminates elongation, and is complementary to the
locus of interest of an allele, is incorporated into the 5'
overhang of said allele, and (ii) a nucleotide complementary to the
locus of interest of a different allele is incorporated into the 5'
overhang of said different allele, and said terminating nucleotide,
which is complementary to a nucleotide in the 5' overhang of said
different allele, is incorporated into the 5' overhang of said
different allele; (d) digesting the DNA of (c) with the restriction
enzyme that recognizes the recognition site on the first primer;
and (e) determining the sequence of the alleles of the locus of
interest by determining the sequence of the digested DNA of (d)
containing the labeled nucleotide.
2. The method of claim 1, wherein the template DNA is obtained from
a source selected from the group consisting of a bacterium, fungus,
virus, protozoan, plant, animal and human.
3. The method of claim 1, wherein the template DNA is obtained from
a human source.
4. The method of claim 1, wherein the template DNA is obtained from
a sample selected from the group consisting of a cell, tissue,
blood, serum, plasma, urine, spinal fluid, lymphatic fluid, semen,
vaginal secretion, ascitic fluid, saliva, mucosa secretion,
peritoneal fluid, fecal matter, and body exudates.
5. The method of claim 1, wherein the amplification in (a)
comprises polymerase chain reaction (PCR).
6. The method of claim 1, wherein a 5' region of the second primer
does not anneal to the template DNA.
7. The method of claim 1, wherein a 5' region of the first primer
does not anneal to the template DNA.
8. The method of claim 6, wherein an annealing length of the 3'
region of the second primer is selected from the group consisting
of 25 20, 20 15, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, and less
than 4 bases.
9. The method of claim 1, wherein an annealing temperature for
cycle 1 of PCR is about the melting temperature of the portion of
the 3' region of the second primer that anneals to the template
DNA.
10. The method of claim 9, wherein an annealing temperature for
cycle 2 of PCR is about the melting temperature of the portion of
the 3' region of the first primer that anneals to the template
DNA.
11. The method of claim 10, wherein an annealing temperature for
the remaining cycles of PCR is at about the melting temperature of
the entire second primer.
12. The method of claim 1, wherein the 3' end of the second primer
is adjacent to the locus of interest.
13. The method of claim 1, wherein the recognition site on the
second primer is for a Type IIS restriction enzyme.
14. The method of claim 13, wherein the Type IIS restriction enzyme
is selected from the group consisting of: Alw I, Alw26 I, Bbs I,
Bbv I, BceA I, Bmr I, Bsa I, Bst71 I, BsmA I, BsmB I, BsmF I, BspM
I, Ear I, Fau I, Fok I, Hga I, Ple I, Sap I, SSfaN I, and Sthi32
I.
15. The method of claim 13, wherein the Type IIS restriction enzyme
is BceA I.
16. The method of claim 13, wherein the Type IIS restriction enzyme
is BsmF I.
17. The method of claim 1, wherein the tag is used to separate the
amplified DNA from the template DNA.
18. The method of claim 17, wherein the tag is used to separate the
amplified DNA containing the incorporated nucleotide from the
amplified DNA that does not contain the incorporated
nucleotide.
19. The method of claim 1, wherein the tag is selected from the
group consisting of: radioisotope, fluorescent reporter molecule,
chemiluminescent reporter molecule, antibody, antibody fragment,
hapten, biotin, derivative of biotin, photobiotin, iminobiotin,
digoxigenin, avidin, enzyme, acridinium, sugar, enzyme, apoenzyme,
homopolymeric oligonucleotide, hormone, ferromagnetic moiety,
paramagnetic moiety, diamagnetic moiety, phosphorescent moiety,
luminescent moiety, electrochemiluminescent moiety, chromatic
moiety, moiety having a detectable electron spin resonance,
electrical capacitance, dielectric constant or electrical
conductivity, and combinations thereof.
20. The method of claim 1, wherein the tag is biotin.
21. The method of claim 20, wherein the biotin tag is used to
separate amplified DNA from the template DNA using a streptavidin
matrix.
22. The method of claim 21, wherein the streptavidin matrix is
coated on wells of a microtiter plate.
23. The method of claim 1, wherein the incorporation of a
nucleotide in (c) is by a DNA polymerase selected from the group
consisting of E. coli DNA polymerase, Klenow fragment of E. coli
DNA polymerase I, T7 DNA polymerase, T4 DNA polymerase, Taq
polymerase, Pfu DNA polymerase, Vent DNA polymerase and
sequenase.
24. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(i) comprises incorporation of a labeled
nucleotide.
25. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(i) comprises incorporation of a
dideoxynucleotide.
26. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(i) further comprises incorporation of a
deoxynucleotide and a dideoxynucleotide.
27. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(i) further comprises using a mixture of labeled
and unlabeled nucleotides.
28. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(ii) comprises incorporation of a labeled
nucleotide.
29. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(ii) comprises incorporation of a
deoxynucleotide.
30. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(ii) further comprises incorporation of a
deoxynucleotide and a dideoxynucleotide.
31. The method of claim 1, wherein the incorporation of a
nucleotide in (c)(ii) further comprises using a mixture of labeled
and unlabeled nucleotides.
32. The method of claim 24, wherein the labeled nucleotide is a
dideoxynucleotide.
33. The method of claim 24, wherein the labeled nucleotide is
labeled with a molecule selected from the group consisting of
radioactive molecule, fluorescent molecule, antibody, antibody
fragment, hapten, carbohydrate, biotin, derivative of biotin,
phosphorescent moiety, luminescent moiety, electrochemiluminescent
moiety, chromatic moiety, and moiety having a detectable electron
spin resonance, electrical capacitance, dielectric constant and
electrical conductivity.
34. The method of claim 24, wherein the labeled nucleotide is
labeled with a fluorescent molecule.
35. The method of claim 34, wherein the incorporation of a
nucleotide in (c)(i) further comprises incorporation of an
unlabeled nucleotide.
36. The method of claim 1, wherein the determination of the
sequence of the locus of interest in (e) comprises detecting a
nucleotide.
37. The method of claim 24, wherein the determination of the
sequence of the locus of interest in (e) comprises detecting a
labeled nucleotide.
38. The method of claim 37, wherein the detection is by a method
selected from the group consisting of gel electrophoresis,
polyacrylamide gel electrophoresis, fluorescence detection system,
sequencing, ELISA, mass spectrometry, fluorometry, hybridization,
microarray, and Southern Blot.
39. The method of claim 37, wherein the detection method is DNA
sequencing.
40. The method of claim 37, wherein the detection method is
fluorescence detection.
41. The method of claim 1, wherein the alleles of a locus of
interest are suspected of containing a single nucleotide
polymorphism or mutation.
42. The method of claim 1, wherein the method is used for
determining sequences of multiple loci of interest
concurrently.
43. The method of claim 42, wherein the template DNA comprises
multiple loci from a single chromosome.
44. The method of claim 42, wherein the template DNA comprises
multiple loci from different chromosomes.
45. The method of claim 42, wherein the loci of interest on
template DNA are amplified in one reaction.
46. The method of claim 42, wherein each of the loci of interest on
template DNA is amplified in a separate reaction.
47. The method of claim 46, wherein the amplified DNA are pooled
together prior to digestion of the amplified DNA.
48. The method of claim 42, wherein each of the labeled DNA in (c)
containing a locus of interest is separated prior to (e).
49. The method of claim 42, wherein at least one of the loci of
interest is suspected of containing a single nucleotide
polymorphism or a mutation.
50. A method for determining a sequence of alleles of a locus of
interest, said method comprising: (a) amplifying a locus of
interest on a template DNA using a first and second primers,
wherein the second primer contains a recognition site for a
restriction enzyme that cuts DNA at a distance from the recognition
site and digestion with the restriction enzyme generates a 5'
overhang containing the locus of interest, wherein the first primer
contains a recognition site for a restriction enzyme that is
different from the recognition site for the restriction enzyme on
the second primer, and contains a tag at the 5' end, and wherein
the annealing temperature for cycle 1 of PCR is at about the
melting temperature of the portion of 3' region of the second
primer that anneals to the template DNA, the annealing temperature
for cycle 2 of PCR is at about the melting temperature of the
portion of the 3' region of the first primer that anneals to the
template DNA, and the annealing temperature for the remaining
cycles is at about the melting temperature of the entire second
primer; (b) digesting the amplified DNA with the restriction enzyme
that recognizes the recognition site on the second primer; (c)
incorporating nucleotides into the digested DNA of (b), wherein;
(i) a labeled nucleotide that terminates elongation, and is
complementary to the locus of interest of an allele, is
incorporated into the 5' overhang of said allele, and (ii) a
nucleotide complementary to the locus of interest of a different
allele is incorporated into the 5' overhang of said different
allele, and said terminating nucleotide, which is complementary to
a nucleotide in the 5' overhang of said different allele, is
incorporated into the 5' overhang of said different allele; (d)
digesting the DNA of (c) with the restriction enzyme that
recognizes the recognition site on the first primer; and (e)
determining the sequence of the alleles of the locus of interest by
determining the sequence of the digested DNA of (d) containing the
labeled nucleotide.
51. The method of claim 50, wherein the tag is used to separate the
amplified DNA from the template DNA.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention is directed to a rapid method for determining
the sequence of nucleic acid. The method is especially useful for
genotyping, and for the detection of one to tens to hundreds to
thousands of single nucleotide polymorphisms (SNPs) or mutations on
single or on multiple chromosomes, and for the detection of
chromosomal abnormalities, such as truncations, transversions,
trisomies, and monosomies.
2. Background
Sequence variation among individuals comprises a continuum from
deleterious disease mutations to neutral polymorphisms. There are
more than three thousand genetic diseases currently known including
Duchenne Muscular Dystrophy, Alzheimer's Disease, Cystic Fibrosis,
and Huntington's Disease (D. N. Cooper and M. Krawczak, "Human
Genome Mutations," BIOS Scientific Publishers, Oxford (1993)).
Also, particular DNA sequences may predispose individuals to a
variety of diseases such as obesity, arteriosclerosis, and various
types of cancer, including breast, prostate, and colon. In
addition, chromosomal abnormalities, such as trisomy 21, which
results in Down's Syndrome, trisomy 18, which results in Edward's
Syndrome, trisomy 13, which results in Patau Syndrome, monosomy X,
which results in Turner's Syndrome, and other sex aneuploidies,
account for a significant portion of the genetic defects in
liveborn human beings. Knowledge of gene mutations, chromosomal
abnormalities, and variations in gene sequences, such as single
nucleotide polymorphisms (SNPs), will help to understand, diagnose,
prevent, and treat diseases.
Most frequently, sequence variation is seen in differences in the
lengths of repeated sequence elements, such as minisatellites and
microsatellites, as small insertions or deletions, and as
substitutions of the individual bases. Single nucleotide
polymorphisms (SNPs) represent the most common form of sequence
variation; three million common SNPs with a population frequency of
over 5% have been estimated to be present in the human genome.
Small deletions or insertions, which usually cause frameshift
mutations, occur on average, once in every 12 kilobases of genomic
DNA (Wang, D. G. et al., Science 280: 1077 1082 (1998)). A genetic
map using these polymorphisms as a guide is being developed
(http://research.marshfieldclinic.org/genetics/; internet address
as of Jan. 10, 2002).
The nucleic acid sequence of the human genome was published in
February, 2001, and provides a genetic map of unprecedented
resolution, containing several hundred thousand SNP markers, and a
potential wealth of information on human diseases (Venter et al.,
Science 291:1304 1351 (2001); International Human Genome Sequencing
Consortium, Nature 409:860 921 (2001)). However, the length of DNA
contained within the human chromosomes totals over 3 billion base
pairs so sequencing the genome of every individual is impractical.
Thus, it is imperative to develop high throughput methods for
rapidly determining the presence of allelic variants of SNPs and
point mutations, which predispose to or cause disease phenotypes.
Efficient methods to characterize functional polymorphisms that
affect an individual's physiology, psychology, audiology,
opthamology, neurology, response to drugs, drug metabolism, and
drug interactions also are needed.
Several techniques are widely used for analyzing and detecting
genetic variations, such as DNA sequencing, restriction fragment
length polymorphisms (RFLP), DNA hybridization assays, including
DNA microarrays and peptide nucleic acid analysis, and the Protein
Truncation Test (PTT), all of which have limitations. Although DNA
sequencing is the most definitive method, it is also the most time
consuming and expensive. Often, the entire coding sequence of a
gene is analyzed even though only a small fraction of the coding
sequence is of interest. In most instances, a limited number of
mutations in any particular gene account for the majority of the
disease phenotypes.
For example, the cystic fibrosis transmembrane conductance
regulator (CFTR) gene is composed of 24 exons spanning over 250,000
base pairs (Rommens et al., Science 245:1059 1065 (1989); Riordan
et al., Science 245:1066 73 (1989)). Currently, there are
approximately 200 mutations in the CFTR gene that are associated
with a disease state of Cystic Fibrosis. Therefore, only a very
small percentage of the reading frame for the CFTR gene needs to be
analyzed. Furthermore, a total of 10 mutations make up 75.1% of all
known disease cases. The deletion of a single phenylalanine
residue, F508, accounts for 66% of all Cystic Fibrosis cases in
Caucasians.
Hybridization techniques, including Southern Blots, Slot Blots, Dot
Blots, and DNA microarrays, are commonly used to detect genetic
variations (Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Third Edition (2001). In a typical
hybridization assay, an unknown nucleotide sequence ("the target")
is analyzed based on its affinity for another fragment with a known
nucleotide sequence ("the probe"). If the two fragments hybridize
under "stringent conditions," the sequences are thought to be
complementary, and the sequence of the target fragment may be
inferred from "the probe" sequence.
However, the results from a typical hybridization assay often are
difficult to interpret. The absence or presence of a hybridization
signal is dependent upon the definition of "stringent conditions."
Any number of variables may be used to raise or lower stringency
conditions such as salt concentration, the presence or absence of
competitor nucleotide fragments, the number of washes performed to
remove non-specific binding and the time and temperature at which
the hybridizations are performed. Commonly, hybridization
conditions must be optimized for each "target" nucleotide fragment,
which is time-consuming, and inconsistent with a high throughput
method. A high degree of variability is often seen in hybridization
assays, as well as a high proportion of false positives. Typically,
hybridization assays function as a screen for likely candidates but
a positive confirmation requires DNA sequencing analysis.
Several techniques for the detection of mutations have evolved
based on the principal of hybridization analysis. For example, in
the primer extension assay, the DNA region spanning the nucleotide
of interest is amplified by PCR, or any other suitable
amplification technique. After amplification, a primer is
hybridized to a target nucleic acid sequence, wherein the last
nucleotide of the 3' end of the primer anneals immediately 5' to
the nucleotide position on the target sequence that is to be
analyzed. The annealed primer is extended by a single, labeled
nucleotide triphosphate. The incorporated nucleotide is then
detected.
There are several limitations to the primer extension assay. First,
the region of interest must be amplified prior to primer extension,
which increases the time and expense of the assay. Second, PCR
primers and dNTPs must be completely removed before primer
extension, and residual contaminants can interfere with the proper
analysis of the results. Third, and the most restrictive aspect of
the assay, is that the primer is hybridized to the DNA template,
which requires optimization of conditions for each primer, and for
each sequence that is analyzed. Hybridization assays have a low
degree of reproducibility, and a high degree of
non-specificity.
The Peptide Nucleic Acid (PNA) affinity assay is a derivative of
traditional hybridization assays (Nielsen et al., Science 254:1497
1500 (1991); Egholm et al., J. Am. Chem. Soc. 114:1895 1897 (1992);
James et al., Protein Science 3:1347 1350 (1994)). PNAs are
structural DNA mimics that follow Watson-Crick base pairing rules,
and are used in standard DNA hybridization assays. PNAs display
greater specificity in hybridization assays because a PNA/DNA
mismatch is more destabilizing than a DNA/DNA mismatch and
complementary PNA/DNA strands form stronger bonds than
complementary DNA/DNA strands. However, genetic analysis using PNAs
still requires a laborious hybridization step, and as such, is
subject to a high degree of non-specificity and difficulty with
reproducibility.
Recently, DNA microarrays have been developed to detect genetic
variations and polymorphisms (Taton et al., Science 289:1757 60,
2000; Lockhart et al., Nature 405:827 836 (2000); Gerhold et al.,
Trends in Biochemical Sciences 24:168 73 (1999); Wallace, R. W.,
Molecular Medicine Today 3:384 89 (1997); Blanchard and Hood,
Nature Biotechnology 149:1649 (1996)). DNA microarrays are
fabricated by high-speed robotics, on glass or nylon substrates,
and contain DNA fragments with known identities ("the probe"). The
microarrays are used for matching known and unknown DNA fragments
("the target") based on traditional base-pairing rules. The
advantage of DNA microarrays is that one DNA chip may provide
information on thousands of genes simultaneously. However, DNA
microarrays are still based on the principle of hybridization, and
as such, are subject to the disadvantages discussed above.
The Protein Truncation Test (PTT) is also commonly used to detect
genetic polymorphisms (Roest et al., Human Molecular Genetics
2:1719 1721, (1993); Van Der Luit et al., Genomics 20:1 4 (1994);
Hogervorst et al., Nature Genetics 10: 208 212 (1995)). Typically,
in the PTT, the gene of interest is PCR amplified, subjected to in
vitro transcription/translation, purified, and analyzed by
polyacrylamide gel electrophoresis. The PTT is useful for screening
large portions of coding sequence and detecting mutations that
produce stop codons, which significantly diminish the size of the
expected protein. However, the PTT is not designed to detect
mutations that do not significantly alter the size of the
protein.
Thus, a need still exists for a rapid method of analyzing DNA,
especially genomic DNA suspected of having one or more single
nucleotide polymorphisms or mutations.
BRIEF SUMMARY OF THE INVENTION
The invention is directed to a method for determining a sequence of
a locus of interest, the method comprising: (a) amplifying a locus
of interest on a template DNA using a first and second primers,
wherein the second primer contains a recognition site for a
restriction enzyme such that digestion with the restriction enzyme
generates a 5' overhang containing the locus of interest; (b)
digesting the amplified DNA with the restriction enzyme that
recognizes the recognition site on the second primer; (c)
incorporating a nucleotide into the digested DNA of (b) by using
the 5' overhang containing the locus of interest as a template; and
(d) determining the sequence of the locus of interest by
determining the sequence of the DNA of (c).
The invention is also directed to a method for determining a
sequence of a locus of interest, said method comprising: (a)
amplifying a locus of interest on a template DNA using a first and
second primers, wherein the second primer contains a portion of a
recognition site for a restriction enzyme, wherein a full
recognition site for the restriction enzyme is generated upon
amplification of the template DNA such that digestion with the
restriction enzyme generates a 5' overhang containing the locus of
interest; (b) digesting the amplified DNA with the restriction
enzyme that recognizes the full recognition site generated by the
second primer and the template DNA; (c) incorporating a nucleotide
into the digested DNA of (b) by using the 5' overhang containing
the locus of interest as a template; and determining the sequence
of the locus of interest by determining the sequence of the DNA of
(c).
The invention also is directed to a method for determining a
sequence of a locus of interest, said method comprising (a)
replicating a region of DNA comprising a locus of interest from a
template polynucleotide by using a first and a second primer,
wherein the second primer contains a sequence that generates a
recognition site for a restriction enzyme such that digestion with
the restriction enzyme generates a 5' overhang containing the locus
of interest; (b) digesting the DNA with the restriction enzyme that
recognizes the recognition site generated by the second primer to
create a DNA fragment; (c) incorporating a nucleotide into the
digested DNA of (b) by using the 5' overhang containing the locus
of interest as a template; and (d) determining the sequence of the
locus of interest by determining the sequence of the DNA of
(c).
The invention also is directed to a DNA fragment containing a locus
of interest to be sequenced and a recognition site for a
restriction enzyme, wherein digestion with the restriction enzyme
creates a 5' overhang on the DNA fragment, and wherein the locus of
interest and the restriction enzyme recognition site are in
relationship to each other such that digestion with the restriction
enzyme generates a 5' overhang containing the locus of
interest.
The template DNA can be obtained from any source including
synthetic nucleic acid, preferably from a bacterium, fungus, virus,
plant, protozoan, animal or human source. In one embodiment, the
template DNA is obtained from a human source. In another
embodiment, the template DNA is obtained from a cell, tissue, blood
sample, serum sample, plasma sample, urine sample, spinal fluid,
lymphatic fluid, semen, vaginal secretion, ascitic fluid, saliva,
mucosa secretion, peritoneal fluid, fecal sample, or body
exudates.
The 3' region of the first and/or second primer can contain a
mismatch with the template DNA. The mismatch can occur at but is
not limited to the last 1, 2, or 3 bases at the 3' end.
The restriction enzyme used in the invention can cut DNA at the
recognition site. The restriction enzyme can be but is not limited
to PflF I, Sau96 I, ScrF I, BsaJ I, Bssk I, Dde I, EcoN I, Fnu4H I,
Hinf I, or Tth111 I. Alternatively, the restriction enzyme used in
the invention can cut DNA at a distance from its recognition
site.
In another embodiment, the first primer contains a recognition site
for a restriction enzyme. In a preferred embodiment, the
restriction enzyme recognition site is different from the
restriction enzyme recognition site on the second primer. The
invention includes digesting the amplified DNA with a restriction
enzyme that recognizes the recognition site on the first
primer.
Preferably, the recognition site on the second primer is for a
restriction enzyme that cuts DNA at a distance from its recognition
site and generates a 5' overhang, containing the locus of interest.
In a preferred embodiment, the recognition site on the second
primer is for a Type IIS restriction enzyme. The Type IIS
restriction enzyme, e.g., is selected from the group consisting of:
Alw I, Alw26 I, Bbs I, Bbv I, BceA I, Bmr I, Bsa I, Bst71 I, BsmA
I, BsmB I, BsmF I, BspM I, Ear I, Fau I, Fok I, Hga I, Ple I, Sap
I, SSfaN I, and Sthi32 I, and more preferably BceA I and BsmF
I.
In one embodiment, the 5' region of the second primer does not
anneal to the template DNA and/or the 5' region of the first primer
does not anneal to the template DNA. The annealing length of the 3'
region of the first or second primer can be 25 20, 20 15, 15, 14,
13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or less than 4 bases.
In one embodiment, the amplification can comprise polymerase chain
reaction (PCR). In a further embodiment, the annealing temperature
for cycle 1 of PCR can be at about the melting temperature of the
3' region of the second primer that anneals to the template DNA. In
another embodiment, the annealing temperature for cycle 2 of PCR
can be about the melting temperature of the 3' region of the first
primer that anneals to the template DNA. In another embodiment, the
annealing temperature for the remaining cycles can be about the
melting temperature of the entire sequence of the second
primer.
In one embodiment, the 3' end of the second primer is adjacent to
the locus of interest.
The first and/or second primer can contain a tag at the 5'
terminus. Preferably, the first primer contains a tag at the 5'
terminus. The tag can be used to separate the amplified DNA from
the template DNA. The tag can be used to separate the amplified DNA
containing the labeled nucleotide from the amplified DNA that does
not contain the labeled nucleotide. The tag can be but is not
limited to a radioisotope, fluorescent reporter molecule,
chemiluminescent reporter molecule, antibody, antibody fragment,
hapten, biotin, derivative of biotin, photobiotin, iminobiotin,
digoxigenin, avidin, enzyme, acridinium, sugar, enzyme, apoenzyme,
homopolymeric oligonucleotide, hormone, ferromagnetic moiety,
paramagnetic moiety, diamagnetic moiety, phosphorescent moiety,
luminescent moiety, electrochemiluminescent moiety, chromatic
moiety, moiety having a detectable electron spin resonance,
electrical capacitance, dielectric constant or electrical
conductivity, or combinations thereof. Preferably, the tag is
biotin. The biotin tag is used to separate amplified DNA from the
template DNA using a streptavidin matrix. The streptavidin matrix
is coated on wells of a microtiter plate.
The incorporation of a nucleotide in the method of the invention is
by a DNA polymerase including but not limited to E. coli DNA
polymerase, Klenow fragment of E. coli DNA polymerase I, T5 DNA
polymerase, T7 DNA polymerase, T4 DNA polymerase, Taq polymerase,
Pfu DNA polymerase, Vent DNA polymerase, bacteriophage 29,
REDTaq.TM. Genomic DNA polymerase, and sequenase.
The incorporation of a nucleotide can further comprise using a
mixture of labeled and unlabeled nucleotides. One nucleotide, two
nucleotides, three nucleotides, four nucleotides, five nucleotides,
or more than five nucleotides may be incorporated. A combination of
labeled and unlabeled nucleotides can be incorporated. The labeled
nucleotide can be but is not limited to a dideoxynucleotide
triphosphate and deoxynucleotide triphosphate. The unlabeled
nucleotide can be but is not limited to a dideoxynucleotide
triphosphate and deoxynucleotide triphosphate. The labeled
nucleotide is labeled with a molecule such as but not limited to a
radioactive molecule, fluorescent molecule, antibody, antibody
fragment, hapten, carbohydrate, biotin, and derivative of biotin,
phosphorescent moiety, luminescent moiety, electrochemiluminescent
moiety, chromatic moiety, or moiety having a detectable electron
spin resonance, electrical capacitance, dielectric constant or
electrical conductivity. Preferably, the labeled nucleotide is
labeled with a fluorescent molecule. The incorporation of a
fluorescent labeled nucleotide further includes using a mixture of
fluorescent and unlabeled nucleotides.
In one embodiment, the determination of the sequence of the locus
of interest comprises detecting the incorporated nucleotide. In one
embodiment, the detection is by a method such as but not limited to
gel electrophoresis, capillary electrophoresis, microchannel
electrophoresis, polyacrylamide gel electrophoresis, fluorescence
detection, sequencing, ELISA, mass spectrometry, time of flight
mass spectrometry, quadrupole mass spectrometry, magnetic sector
mass spectrometry, electric sector mass spectrometry, fluorometry,
infrared spectrometry, ultraviolet spectrometry, palentiostatic
amperometry, hybridization, such as Southern Blot, or microarray.
In a preferred embodiment, the detection is by fluorescence
detection.
In a preferred embodiment, the locus of interest is suspected of
containing a single nucleotide polymorphism or mutation. The method
can be used for determining sequences of multiple loci of interest
concurrently. The template DNA can comprise multiple loci from a
single chromosome. The template DNA can comprise multiple loci from
different chromosomes. The loci of interest on template DNA can be
amplified in one reaction. Alternatively, each of the loci of
interest on template DNA can be amplified in a separate reaction.
The amplified DNA can be pooled together prior to digestion of the
amplified DNA. Each of the labeled DNA containing a locus of
interest can be separated prior to determining the sequence of the
locus of interest. In one embodiment, at least one of the loci of
interest is suspected of containing a single nucleotide
polymorphism or a mutation.
In another embodiment, the method of the invention can be used for
determining the sequences of multiple loci of interest from a
single individual or from multiple individuals. Also, the method of
the invention can be used to determine the sequence of a single
locus of interest from multiple individuals.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1A. A Schematic diagram depicting a double stranded DNA
molecule. A pair of primers, depicted as bent arrows, flank the
locus of interest, depicted as a triangle symbol at base N14. The
locus of interest can be a single nucleotide polymorphism, point
mutation, insertion, deletion, translocation, etc. Each primer
contains a restriction enzyme recognition site about 10 bp from the
5' terminus depicted as region "a" in the first primer and as
region "d" in the second primer. Restriction recognition site "a"
can be for any type of restriction enzyme but recognition site "d"
is for a restriction enzyme, which cuts "n" nucleotides away from
its recognition site and leaves a 5' overhang and a recessed 3'
end. Examples of such enzymes include but are not limited to BceA I
and BsmF I. The 5' overhang serves as a template for incorporation
of a nucleotide into the 3' recessed end.
The first primer is shown modified with biotin at the 5' end to aid
in purification. The sequence of the 3' end of the primers is such
that the primers anneal at a desired distance upstream and
downstream of the locus of interest. The second primer anneals
close to the locus of interest; the annealing site, which is
depicted as region "c," is designed such that the 3' end of the
second primer anneals one base away from the locus of interest. The
second primer can anneal any distance from the locus of interest
provided that digestion with the restriction enzyme, which
recognizes the region "d" on this primer, generates a 5' overhang
that contains the locus of interest.
The first primer annealing site, which is depicted as region "b',"
is about 20 bases.
FIG. 1B. A schematic diagram depicting the annealing and extension
steps of the first cycle of amplification by PCR. The first cycle
of amplification is performed at about the melting temperature of
the 3' region, which anneals to the template DNA, of the second
primer, depicted as region "c," and is 13 base pairs in this
example. At this temperature, both the first and second primers
anneal to their respective complementary strands and begin
extension, depicted by dotted lines. In this first cycle, the
second primer extends and copies the region b where the first
primer can anneal in the next cycle.
FIG. 1C. A schematic diagram depicting the annealing and extension
steps following denaturation in the second cycle of amplification
of PCR. The second cycle of amplification is performed at a higher
annealing temperature (TM2), which is about the melting temperature
of the 20 bp of the 3' region of the first primer that anneals to
the template DNA, depicted as region "b." Therefore at TM2, the
first primer, which is complementary to region b, can bind to the
DNA that was copied in the first cycle of the reaction. However, at
TM2 the second primer cannot anneal to the original template DNA or
to DNA that was copied in the first cycle of the reaction because
the annealing temperature is too high. The second primer can anneal
to 13 bases in the original template DNA but TM2 is calculated at
about the melting temperature of 20 bases.
FIG. 1D. A schematic diagram depicting the annealing and extension
reactions after denaturation during the third cycle of
amplification. In this cycle, the annealing temperature, TM3, is
about the melting temperature of the entire second primer,
including regions "c" and "d." The length of regions "c"+"d" is
about 27 33 bp long, and thus TM3 is significantly higher than TM1
and TM2. At this higher TM the second primer, which contain region
c and d, anneals to the copied DNA generated in cycle 2.
FIG. 1E. A schematic diagram depicting the annealing and extension
reactions for the remaining cycles of amplification. The annealing
temperature for the remaining cycles is TM3, which is about the
melting temperature of the entire second primer. At TM3, the second
primer binds to templates that contain regions c' and d' and the
first primer binds to templates that contain regions a' and b. By
raising the annealing temperature successively in each cycle for
the first three cycles, from TM1 to TM2 to TM3, nonspecific
amplification is significantly reduced.
FIG. 1F. A schematic diagram depicting the amplified locus of
interest bound to a solid matrix.
FIG. 1G. A schematic diagram depicting the bound, amplified DNA
after digestion with a restriction enzyme that recognizes "d." The
"downstream" end is released into the supernatant, and can be
removed by washing with any suitable buffer. The upstream end
containing the locus of interest remains bound to the solid
matrix.
FIG. 1H. A schematic diagram depicting the bound amplified DNA,
after "filling in" with a labeled ddNTP. A DNA polymerase is used
to "fill in" the base (N'.sub.14) that is complementary to the
locus of interest (N.sub.14). In this example, only ddNTPs are
present in this reaction, such that only the locus of interest or
SNP of interest is filled in.
FIG. 1I. A schematic diagram depicting the labeled, bound DNA after
digestion with restriction enzyme "a." The labeled DNA is released
into the supernatant, which can be collected to identify the base
that was incorporated.
FIG. 2. A schematic diagram depicting double stranded DNA templates
with "N" number of loci of interest and "n" number of primer pairs,
x.sub.1, y.sub.1 to X.sub.n, y.sub.n, specifically annealed such
that a primer flanks each locus of interest. The first primers are
biotinylated at the 5' end, depicted by .cndot., and contain a
restriction enzyme recognition site, "a", which is recognized by
any type of restriction enzyme. The second primers contain a
restriction enzyme recognition site, "d," where "d" is a
recognition site for a restriction enzyme that cuts DNA at a
distance from its recognition site, and generates a 5' overhang
containing the locus of interest and a recessed 3' end. The second
primers anneal adjacent to the respective loci of interest. The
exact position of the restriction enzyme site "d" in the second
primers is designed such that digesting the PCR product of each
locus of interest with restriction enzyme "d" generates a 5'
overhang containing the locus of interest and a 3' recessed end.
The annealing sites of the first primers are about 20 bases long
and are selected such that each successive first primer is further
away from its respective second primer. For example, if at locus 1
the 3' ends of the first and second primers are Z base pairs apart,
then at locus 2, the 3' ends of the first and second primers are
Z+K base pairs apart, where K=1, 2, 3 or more than three bases.
Primers for locus N are Z.sub.N-1+K base pairs apart. The purpose
of making each successive first primer further apart from their
respective second primers is such that the "filled in" restriction
fragments (generated after amplification, purification, digestion
and labeling as described in FIGS. 1B 1I) differ in size and can be
resolved, for example by electrophoresis, to allow detection of
each individual locus of interest.
FIG. 3A. Photograph of a gel demonstrating PCR amplification of the
4 DNA fragments containing different SNPs using the low stringency
annealing temperature protocol.
FIG. 3B. Photograph of a gel demonstrating PCR amplification of the
4 DNA fragments containing different SNPs using the medium
stringency annealing temperature protocol.
FIG. 3C. Photograph of a gel demonstrating PCR amplification of the
4 DNA fragments containing different SNPs using the high stringency
annealing temperature protocol.
For FIGS. 3A 3C, the following conditions apply: A sample
containing genomic DNA templates from thirty-six human volunteers
was analyzed for the following four SNPs: SNP HC21S00340 (lane 1),
identification number as assigned in the Human Chromosome 21 cSNP
Database, located on chromosome 21; SNP TSC 0095512 (lane 2),
located on chromosome 1; SNP TSC 0214366 (lane 3), located on
chromosome 1; and SNP TSC 0087315 (lane 4), located on chromosome
1. Each DNA fragment containing a SNP was amplified by PCR using
three different annealing temperature protocols, herein referred to
as the low stringency annealing temperature; medium stringency
annealing temperature; and high stringency annealing temperature.
Regardless of the annealing temperature protocol, each DNA fragment
containing a SNP was amplified for 40 cycles of PCR. The
denaturation step for each PCR reaction was performed for 30
seconds at 95.degree. C.
FIG. 4A. A depiction of the DNA sequence of SNP HC21S00027 (SEQ ID
NOS:27 & 28), assigned by the Human Chromosome 21 cSNP
database, located on chromosome 21. A first primer (SEQ ID NO:17)
and a second primer (SEQ ID NO:18) are indicated above and below,
respectively, the sequence of HC21S00027. The first primer is
biotinylated and contains the restriction enzyme recognition site
for EcoRI. The second primer contains the restriction enzyme
recognition site for BsmF I and contains 13 bases that anneal to
the DNA sequence. The SNP is indicated by R (A/G) and r (T/C;
complementary to R).
FIG. 4B. A depiction of the DNA sequence of SNP HC21S00027 (SEQ ID
NOS:27 & 28), as assigned by the Human Chromosome 21 cSNP
database, located on chromosome 21. A first primer (SEQ ID NO:17)
and a second primer (SEQ ID NO:19) are indicated above and below,
respectively, the sequence of HC21S00027. The first primer is
biotinylated and contains the restriction enzyme recognition site
for EcoRI. The second primer contains the restriction enzyme
recognition site for BceA I and has 13 bases that anneal to the DNA
sequence. The SNP is indicated by R (A/G) and r (T/C; complementary
to R).
FIG. 4C. A depiction of the DNA sequence of SNP TSC0095512 (SEQ ID
NOS:29 & 30) from chromosome 1. The first primer (SEQ ID NO:11)
and the second primer (SEQ ID NO:20) are indicated above and below,
respectively, the sequence of TSC0095512. The first primer is
biotinylated and contains the restriction enzyme recognition site
for EcoRI. The second primer contains the restriction enzyme
recognition site for BsmF I and has 13 bases that anneal to the DNA
sequence. The SNP is indicated by S (G/C) and s (C/G; complementary
to S).
FIG. 4D. A depiction of the DNA sequence of SNP TSC0095512 (SEQ ID
NOS:29 & 30) from chromosome 1. The first primer (SEQ ID NO:11)
and the second primer (SEQ ID NO:12) are indicated above and below,
respectively, the sequence of TSC0095512. The first primer is
biotinylated and contains the restriction enzyme recognition site
for EcoRI. The second primer contains the restriction enzyme
recognition site for BceA I and has 13 bases that anneal to the DNA
sequence. The SNP is indicated by S (G/C) and s (C/G; complementary
to S).
FIGS. 5A 5D. A schematic diagram depicting the nucleotide sequences
of SNP HC21S00027 (FIG. 5A (SEQ ID NOS:31 & 32) and FIG. 5B
(SEQ ID NOS:31 & 33)), and SNP TSC0095512 (FIG. 5C (SEQ ID
NOS:34 & 35) and FIG. 5D (SEQ ID NOS:34 & 36)) after
amplification with the primers described in FIGS. 4A 4D.
Restriction sites in the primer sequence are indicated in bold.
FIGS. 6A 6D. A schematic diagram depicting the nucleotide sequences
of each amplified DNA fragment containing a SNP after digestion
with the appropriate Type IIS restriction enzyme. FIG. 6A (SEQ ID
NOS:31 & 32) and FIG. 6B (SEQ ID NOS:31 & 33) depict
fragments of a DNA sequence containing SNP HC21S00027 digested with
the Type IIS restriction enzymes BsmF I and BceA I, respectively.
FIG. 6C (SEQ ID NOS:34 & 35) and FIG. 6D (SEQ ID NOS:34 &
36) depict fragments of a DNA sequence containing SNP TSC0095512
digested with the Type IIS restriction enzymes BsmF I and BceA I,
respectively.
FIGS. 7A 7D. A schematic diagram depicting the incorporation of a
fluorescently labeled nucleotide using the 5' overhang of the
digested SNP site as a template to "fill in" the 3' recessed end.
FIG. 7A (SEQ ID NOS:31, 37 & 41) and FIG. 7B (SEQ ID NOS:31, 37
& 39) depict the digested SNP HC21S00027 locus with an
incorporated labeled ddNTP (*R.sup.-dd=fluorescent dideoxy
nucleotide). FIG. 7C (SEQ ID NOS:34 & 38) and FIG. 7D (SEQ ID
NO:34) depict the digested SNP TSC0095512 locus with an
incorporated labeled ddNTP (*S.sup.-dd=fluorescent dideoxy
nucleotide). The use of ddNTPs ensures that the 3' recessed end is
extended by one nucleotide, which is complementary to the
nucleotide of interest or SNP site present in the 5' overhang.
FIG. 7E. A schematic diagram depicting the incorporation of dNTPs
and a ddNTP into the 5' overhang containing the SNP site. The DNA
fragment containing SNP HC21S00007 was digested with BsmF I, which
generates a four base 5' overhang. The use of a mixture of dNTPs
and ddNTPs allows the 3' recessed end to be extended one nucleotide
(a ddNTP is incorporated first) (SEQ ID NOS:31, 37 & 41); two
nucleotides (a dNTP is incorporated followed by a ddNTP) (SEQ ID
NOS:31, 39 & 41); three nucleotides (two dNTPs are
incorporated, followed by a ddNTP) (SEQ ID NOS:31, 40 & 41); or
four nucleotides (three dNTPs are incorporated, followed by a
ddNTP) (SEQ ID NOS:31 & 41). All four products can be separated
by size, and the incorporated nucleotide detected
(*R.sup.-dd=fluorescent dideoxy nucleotide). Detection of the first
nucleotide, which corresponds to the SNP or locus site, and the
next three nucleotides provides an additional level of quality
assurance. The SNP is indicated by R (A/G) and r (T/C)
(complementary to R).
FIGS. 8A 8D. Release of the "filled in" SNP from the solid support
matrix, i.e. streptavidin coated well. SNP HC21S00027 is shown in
FIG. 8A (SEQ ID NOS:31, 37 & 41) and FIG. 8B (SEQ ID NOS:31, 37
& 39), while SNP TSC0095512 is shown in FIG. 8C (SEQ ID NOS:34
& 38) and FIG. 8D (SEQ ID NO:34). The "filled in" SNP is free
in solution, and can be detected.
FIG. 9A. Sequence analysis of a DNA fragment containing SNP
HC21S00027 digested with BceAI. Four "fill in" reactions are shown;
each reaction contained one fluorescently labeled nucleotide,
ddGTP, ddATP, ddTTP, or ddCTP, and unlabeled ddNTPs. The 5'
overhang generated by digestion with BceA I and the expected
nucleotides at this SNP site are indicated.
FIG. 9B. Sequence analysis of SNP TSC0095512. SNP TSC0095512 was
amplified with a second primer that contained the recognition site
for BceA I, and in a separate reaction, with a second primer that
contained the recognition site for BsmF I. Four fill in reactions
are shown for each PCR product; each reaction contained one
fluorescently labeled nucleotide, ddGTP, ddATP, ddTTP, or ddCTP,
and unlabeled ddNTPs. The 5' overhang generated by digestion with
BceA I and with BsmF I and the expected nucleotides are
indicated.
FIG. 9C. Sequence analysis of SNP TSC0264580 after amplification
with a second primer that contained the recognition site for BsmF
I. Four "fill in" reactions are shown; each reaction contained one
fluorescently labeled nucleotide, which was ddGTP, ddATP, ddTTP, or
ddCTP and unlabeled ddNTPs. Two different 5' overhangs are
depicted: one represents the DNA molecules that were cut 11
nucleotides away on the sense strand and 15 nucleotides away on the
antisense strand and the other represents the DNA molecules that
were cut 10 nucleotides away on the sense strand and 14 nucleotides
away on the antisense strand. The expected nucleotides also are
indicated.
FIG. 9D. Sequence analysis of SNP HC21S00027 amplified with a
second primer that contained the recognition site for BsmF I. A
mixture of labeled ddNTPs and unlabeled dNTPs was used to fill in
the 5' overhang generated by digestion with BsmF I. Two different
5' overhangs are depicted: one represents the DNA molecules that
were cut 11 nucleotides away on the sense strand and 15 nucleotides
away on the antisense strand and the other represents the DNA
molecules that were cut 10 nucleotides away on the sense strand and
14 nucleotides away on the antisense strand. The nucleotide
upstream of the SNP, the nucleotide at the SNP site (the sample
contained DNA templates from 36 individuals; both nucleotides would
be expected to be represented in the sample), and the three
nucleotides downstream of the SNP are indicated.
FIG. 10. Sequence analysis of multiple SNPs. SNPs HC21S00131, and
HC21S00027, which are located on chromosome 21, and SNPs
TSC0087315, SNP TSC0214366, SNP TSC0413944, and SNP TSC0095512,
which are on chromosome 1, were amplified in separate PCR reactions
with second primers that contained a recognition site for BsmF I.
The primers were designed so that each amplified locus of interest
was of a different size. After amplification, the reactions were
pooled into a single sample, and all subsequent steps of the method
performed (as described for FIGS. 1F 1I) on that sample. Each SNP
and the nucleotide found at each SNP are indicated.
FIG. 11. Sequence determination of both alleles of SNPs TSC0837969,
TSC0034767, TSC1130902, TSC0597888, TSC0195492, TSC0607185 using
one fluorescently labeled nucleotide. Labeled ddGTP was used in the
presence of unlabeled dATP, dCTP, dTTP to fill-in the overhang
generated by digestion with BsmF I. The nucleotide preceding the
variable site on the strand that was filled-in was not guanine, and
the nucleotide after the variable site on the strand that was
filled in was not guanine. The nucleotide two bases after the
variable site on the strand that was filled-in was guanine. Alleles
that contain guanine at variable site are filled in with labeled
ddGTP. Alleles that do not contain guanine are filled in with
unlabeled dATP, dCTP, or dTTP, and the polymerase continues to
incorporate nucleotides until labeled ddGTP is filled in at
position 3 complementary to the overhang.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a novel method for rapidly
determining the sequence of DNA, especially at a locus of interest
or multiple loci of interest. The sequences of any number of DNA
targets, from one to hundreds or thousands or more of loci of
interest in any template DNA or sample of nucleic acid can be
determined efficiently, accurately, and economically. The method is
especially useful for the rapid sequencing of one to tens of
thousands or more of genes, regions of genes, fragments of genes,
single nucleotide polymorphisms, and mutations on a single
chromosome or on multiple chromosomes.
The invention is directed to a method for determining a sequence of
a locus of interest, the method comprising: (a) amplifying a locus
of interest on a template DNA using a first and second primers,
wherein the second primer contains a recognition site for a
restriction enzyme such that digestion with the restriction enzyme
generates a 5' overhang containing the locus of interest; (b)
digesting the amplified DNA with the restriction enzyme that
recognizes the recognition site on the second primer; (c)
incorporating a nucleotide into the digested DNA of (b) by using
the 5' overhang containing the locus of interest as a template; and
(d) determining the sequence of the locus of interest by
determining the sequence of the DNA of (c).
The invention is also directed to a method for determining a
sequence of a locus of interest, said method comprising: (a)
amplifying a locus of interest on a template DNA using a first and
second primers, wherein the first and/or second primer contains a
portion of a recognition site for a restriction enzyme, wherein a
full recognition site for the restriction enzyme is generated upon
amplification of the template DNA such that digestion with the
restriction enzyme generates a 5' overhang containing the locus of
interest; (b) digesting the amplified DNA with the restriction
enzyme that recognizes the full recognition site generated by the
second primer and the template DNA; (c) incorporating a nucleotide
into the digested DNA of (b) by using the 5' overhang containing
the locus of interest as a template; and determining the sequence
of the locus of interest by determining the sequence of the DNA of
(c).
DNA Template
By a "locus of interest" is intended a selected region of nucleic
acid that is within a larger region of nucleic acid. A locus of
interest can include but is not limited to 1 100, 1 50, 1 20, or 1
10 nucleotides, preferably 1 6, 1 5, 1 4, 1 3, 1 2, or 1
nucleotide(s).
As used herein, an "allele" is one of several alternate forms of a
gene or non-coding regions of DNA that occupy the same position on
a chromosome. The term allele can be used to describe DNA from any
organism including but not limited to bacteria, viruses, fungi,
protozoa, molds, yeasts, plants, humans, non-humans, animals, and
archaebacteria.
As used herein with respect to individuals, "mutant alleles" refers
to variant alleles that are associated with a disease state.
For example, bacteria typically have one large strand of DNA. The
term allele with respect to bacterial DNA refers to the form of a
gene found in one cell as compared to the form of the same gene in
a different bacterial cell of the same species.
Alleles can have the identical sequence or can vary by a single
nucleotide or more than one nucleotide. With regard to organisms
that have two copies of each chromosome, if both chromosomes have
the same allele, the condition is referred to as homozygous. If the
alleles at the two chromosomes are different, the condition is
referred to as heterozygous. For example, if the locus of interest
is SNP X on chromosome 1, and the maternal chromosome contains an
adenine at SNP X (A allele) and the paternal chromosome contains a
guanine at SNP X (G allele), the individual is heterozygous at SNP
X.
As used herein, "sequence" means the identity of, or to determine
the identity of (depending on whether used as a noun or a verb,
respectively), one nucleotide or more than one contiguous
nucleotides in a polynucleotide. In the case of a single
nucleotide, e.g., a SNP, "sequence" is used as a noun
interchangeably with "identity" herein, and "sequence" is used
interchangeably as a verb with "identify" herein.
The term "template" refers to any nucleic acid molecule that can be
used for amplification in the invention. RNA or DNA that is not
naturally double stranded can be made into double stranded DNA so
as to be used as template DNA. Any double stranded DNA or
preparation containing multiple, different double stranded DNA
molecules can be used as template DNA to amplify a locus or loci of
interest contained in the template DNA.
The source of the nucleic acid for obtaining the template DNA can
be from any appropriate source including but not limited to nucleic
acid from any organism, e.g., human or nonhuman, e.g., bacterium,
virus, yeast, fungus, plant, protozoan, animal, nucleic
acid-containing samples of tissues, bodily fluids (for example,
blood, serum, plasma, saliva, urine, tears, semen, vaginal
secretions, lymph fluid, cerebrospinal fluid or mucosa secretions),
fecal matter, individual cells or extracts of the such sources that
contain the nucleic acid of the same, and subcellular structures
such as mitochondria or chloroplasts, using protocols well
established within the art. Nucleic acid can also be obtained from
forensic, food, archeological, or inorganic samples onto which
nucleic acid has been deposited or extracted. In a preferred
embodiment, the nucleic acid has been obtained from a human or
animal to be screened for the presence of one or more genetic
sequences that can be diagnostic for, or predispose the subject to,
a medical condition or disease.
The nucleic acid that is to be analyzed can be any nucleic acid,
e.g., genomic, plasmid, cosmid, yeast artificial chromosomes,
artificial or man-made DNA, including unique DNA sequences, and
also DNA that has been reverse transcribed from an RNA sample, such
as cDNA. The sequence of RNA can be determined according to the
invention if it is capable of being made into a double stranded DNA
form to be used as template DNA.
The terms "primer" and "oligonucleotide primer" are interchangeable
when used to discuss an oligonucleotide that anneals to a template
and can be used to prime the synthesis of a copy of that
template.
"Amplified" DNA is DNA that has been "copied" once or multiple
times, e.g. by polymerase chain reaction. When a large amount of
DNA is available to assay, such that a sufficient number of copies
of the locus of interest are already present in the sample to be
assayed, it may not be necessary to "amplify" the DNA of the locus
of interest into an even larger number of replicate copies. Rather,
simply "copying" the template DNA once using a set of appropriate
primers, such as those containing hairpin structures that allow the
restriction enzyme recognition sites to be double stranded, can
suffice.
"Copy" as in "copied DNA" refers to DNA that has been copied once,
or DNA that has been amplified into more than one copy.
In one embodiment, the nucleic acid is amplified directly in the
original sample containing the source of nucleic acid. It is not
essential that the nucleic acid be extracted, purified or isolated;
it only needs to be provided in a form that is capable of being
amplified. A hybridization step of the nucleic acid with the
primers, prior to amplification, is not required. For example,
amplification can be performed in a cell or sample lysate using
standard protocols well known in the art. DNA that is on a solid
support, in a fixed biological preparation, or otherwise in a
composition that contains non-DNA substances and that can be
amplified without first being extracted from the solid support or
fixed preparation or non-DNA substances in the composition can be
used directly, without further purification, as long as the DNA can
anneal with appropriate primers, and be copied, especially
amplified, and the copied or amplified products can be recovered
and utilized as described herein.
In a preferred embodiment, the nucleic acid is extracted, purified
or isolated from non-nucleic acid materials that are in the
original sample using methods known in the art prior to
amplification.
In another embodiment, the nucleic acid is extracted, purified or
isolated from the original sample containing the source of nucleic
acid and prior to amplification, the nucleic acid is fragmented
using any number of methods well known in the art including but not
limited to enzymatic digestion, manual shearing, and sonication.
For example, the DNA can be digested with one or more restriction
enzymes that have a recognition site, and especially an eight base
or six base pair recognition site, which is not present in the loci
of interest. Typically, DNA can be fragmented to any desired
length, including 50, 100, 250, 500, 1,000, 5,000, 10,000, 50,000
and 100,000 base pairs long. In another embodiment, the DNA is
fragmented to an average length of about 1000 to 2000 base pairs.
However, it is not necessary that the DNA be fragmented.
Fragments of DNA that contain the loci of interest can be purified
from the fragments of DNA that do not contain the loci of interest
before amplification. The purification can be done by using primers
that will be used in the amplification (see "Primer Design" section
below) as hooks to retrieve the fragments containing the loci of
interest, based on the ability of such primers to anneal to the
loci of interest. In a preferred embodiment, tag-modified primers
are used, such as e.g. biotinylated primers. See also the
"Purification of Amplified DNA" section for additional tags.
By purifying the DNA fragments containing the loci of interest, the
specificity of the amplification reaction can be improved. This
will minimize amplification of nonspecific regions of the template
DNA. Purification of the DNA fragments can also allow multiplex PCR
(Polymerase Chain Reaction) or amplification of multiple loci of
interest with improved specificity.
In one embodiment, the nucleic acid sample is obtained with a
desired purpose in mind such as to determine the sequence at a
predetermined locus or loci of interest using the method of the
invention. For example, the nucleic acid is obtained for the
purpose of identifying one or more conditions or diseases to which
the subject can be predisposed or is in need of treatment for, or
the presence of certain single nucleotide polymorphisms. In an
alternative embodiment, the sample is obtained to screen for the
presence or absence of one or more DNA sequence markers, the
presence of which would identify that DNA as being from a specific
bacterial or fungal microorganism, or individual.
The loci of interest that are to be sequenced can be selected based
upon sequence alone. In humans, over 1.42 million single nucleotide
polymorphisms (SNPs) have been described (Nature 409:928 933
(2001); The SNP Consortium LTD). On the average, there is one SNP
every 1.9 kb of human genome. However, the distance between loci of
interest need not be considered when selecting the loci of interest
to be sequenced according to the invention. If more than one locus
of interest on genomic DNA is being analyzed, the selected loci of
interest can be on the same chromosome or on different
chromosomes.
In a preferred embodiment, the length of sequence that is amplified
is preferably different for each locus of interest so that the loci
of interest can be separated by size.
In fact, it is an advantage of the invention that primers that copy
an entire gene sequence need not be utilized. Rather, the copied
locus of interest is preferably only a small part of the total
gene. There is no advantage to sequencing the entire gene as this
can increase cost and delay results. Sequencing only the desired
bases or loci of interest within the gene maximizes the overall
efficiency of the method because it allows for the maximum number
of loci of interest to be determined in the fastest amount of time
and with minimal cost.
Because a large number of sequences can be analyzed together, the
method of the invention is especially amenable to the large-scale
screening of a number of individual samples.
Any number of loci of interest can be analyzed and processed,
especially concurrently, using the method of the invention. The
sample(s) can be analyzed to determine the sequence at one locus of
interest or at multiple loci of interest concurrently. For example,
the 10 or 20 most frequently occurring mutation sites in a disease
associated gene can be sequenced to detect the majority of the
disease carriers.
Alternatively, 2, 3, 4, 5, 6, 7, 8, 9, 10 20, 20 25, 25 30, 30 35,
35 40, 40 45, 45 50, 50 100, 100 250, 250 500, 500 1,000, 1,000
2,000, 2,000 3,000, 3,000 5,000, 5,000 10,000, 10,000 50,000 or
more than 50,000 loci of interest can be analyzed at the same time
when a global genetic screening is desired. Such a global genetic
screening might be desired when using the method of the invention
to provide a genetic fingerprint to identify a certain
microorganism or individual or for SNP genotyping.
The multiple loci of interest can be targets from different
organisms. For example, a plant, animal or human subject in need of
treatment can have symptoms of infection by one or more pathogens.
A nucleic acid sample taken from such a plant, animal or human
subject can be analyzed for the presence of multiple suspected or
possible pathogens at the same time by determining the sequence of
loci of interest which, if present, would be diagnostic for that
pathogen. Not only would the finding of such a diagnostic sequence
in the subject rapidly pinpoint the cause of the condition, but
also it would rule out other pathogens that were not detected. Such
screening can be used to assess the degree to which a pathogen has
spread throughout an organism or environment. In a similar manner,
nucleic acid from an individual suspected of having a disease that
is the result of a genetic abnormality can be analyzed for some or
all of the known mutations that result in the disease, or one or
more of the more common mutations.
The method of the invention can be used to monitor the integrity of
the genetic nature of an organism. For example, samples of yeast
can be taken at various times and from various batches in the
brewing process, and their presence or identity compared to that of
a desired strain by the rapid analysis of their genomic sequences
as provided herein.
The locus of interest that is to be copied can be within a coding
sequence or outside of a coding sequence. Preferably, one or more
loci of interest that are to be copied are within a gene. In a
preferred embodiment, the template DNA that is copied is a locus or
loci of interest that is within a genomic coding sequence, either
intron or exon. In a highly preferred embodiment, exon DNA
sequences are copied. The loci of interest can be sites where
mutations are known to cause disease or predispose to a disease
state. The loci of interest can be sites of single nucleotide
polymorphisms. Alternatively, the loci of interest that are to be
copied can be outside of the coding sequence, for example, in a
transcriptional regulatory region, and especially a promoter,
enhancer, or repressor sequence.
Primer Design
Published sequences, including consensus sequences, can be used to
design or select primers for use in amplification of template DNA.
The selection of sequences to be used for the construction of
primers that flank a locus of interest can be made by examination
of the sequence of the loci of interest, or immediately thereto.
The recently published sequence of the human genome provides a
source of useful consensus sequence information from which to
design primers to flank a desired human gene locus of interest.
By "flanking" a locus of interest is meant that the sequences of
the primers are such that at least a portion of the 3' region of
one primer is complementary to the antisense strand of the template
DNA and upstream of the locus of interest (forward primer), and at
least a portion of the 3' region of the other primer is
complementary to the sense strand of the template DNA and
downstream of the locus of interest (reverse primer). A "primer
pair" is intended to specify a pair of forward and reverse primers.
Both primers of a primer pair anneal in a manner that allows
extension of the primers, such that the extension results in
amplifying the template DNA in the region of the locus of
interest.
Primers can be prepared by a variety of methods including but not
limited to cloning of appropriate sequences and direct chemical
synthesis using methods well known in the art (Narang et al.,
Methods Enzymol. 68:90 (1979); Brown et al., Methods Enzymol.
68:109 (1979)). Primers can also be obtained from commercial
sources such as Operon Technologies, Amersham Pharmacia Biotech,
Sigma, and Life Technologies. The primers of a primer pair can have
the same length. Alternatively, one of the primers of the primer
pair can be longer than the other primer of the primer pair. The
primers can have an identical melting temperature. The lengths of
the primers can be extended or shortened at the 5' end or the 3'
end to produce primers with desired melting temperatures. In a
preferred embodiment, the 3' annealing lengths of the primers,
within a primer pair, differ. Also, the annealing position of each
primer pair can be designed such that the sequence and length of
the primer pairs yield the desired melting temperature. The
simplest equation for determining the melting temperature of
primers smaller than 25 base pairs is the Wallace Rule
(Td=2(A+T)+4(G+C)). Computer programs can also be used to design
primers, including but not limited to Array Designer Software
(Arrayit Inc.), Oligonucleotide Probe Sequence Design Software for
Genetic Analysis (Olympus Optical Co.), NetPrimer, and DNAsis from
Hitachi Software Engineering. The TM (melting or annealing
temperature) of each primer is calculated using software programs
such as Net Primer (free web based program at
http://premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html
(internet address as of Feb. 13, 2002).
In another embodiment, the annealing temperature of the primers can
be recalculated and increased after any cycle of amplification,
including but not limited to cycle 1, 2, 3, 4, 5, cycles 6 10,
cycles 10 15, cycles 15 20, cycles 20 25, cycles 25 30, cycles 30
35, or cycles 35 40. After the initial cycles of amplification, the
5' half of the primers is incorporated into the products from each
loci of interest, thus the TM can be recalculated based on both the
sequences of the 5' half and the 3' half of each primer.
For example, in FIG. 11B, the first cycle of amplification is
performed at about the melting temperature of the 3' region of the
second primer (region "c") that anneals to the template DNA, which
is 13 bases. After the first cycle, the annealing temperature can
be raised to TM2, which is about the melting temperature of the 3'
region of the first primer (region "b'") that anneals to the
template DNA. The second primer cannot bind to the original
template DNA because it only anneals to 13 bases in the original
DNA template, and TM2 is about the melting temperature of
approximately 20 bases, which is the 3' annealing region of the
first primer (FIG. 1C). However, the first primer can bind to the
DNA that was copied in the first cycle of the reaction. In the
third cycle, the annealing temperature is raised to TM3, which is
about the melting temperature of the entire sequence of the second
primer ("c" and "d"). The template DNA produced from the second
cycle of PCR contains both regions c' and d', and therefore, the
second primer can anneal and extend at TM3 (FIG. 1D). The remaining
cycles are performed at TM3. The entire sequence of the first
primer (a+b') can anneal to the template from the third cycle of
PCR, and extend (FIG. 1E). Increasing the annealing temperature
will decrease non-specific binding and increase the specificity of
the reaction, which is especially useful if amplifying a locus of
interest from human genomic DNA, which contains 3.times.10.sup.9
base pairs.
As used herein, the term "about" with regard to annealing
temperatures is used to encompass temperatures within 10 degrees
Celsius of the stated temperatures.
In one embodiment, one primer pair is used for each locus of
interest. However, multiple primer pairs can be used for each locus
of interest.
In one embodiment, primers are designed such that one or both
primers of the primer pair contain sequence in the 5' region for
one or more restriction endonucleases (restriction enzyme).
As used herein, with regard to the position at which restriction
enzymes digest DNA, the "sense" strand is the strand reading 5' to
3' in the direction in which the restriction enzyme cuts. For
example, BsmF I recognizes the following sequence:
TABLE-US-00001 5'GGGAC(N).sub.10.sup..dwnarw.3' (SEQ ID NO:1) or
3'CCCTG(N).sub.14.uparw.5' 5'.sup..dwnarw.(N).sub.14GTCCC3' (SEQ ID
NO:2) 3'.sub..uparw.(N).sub.10CAGGG5'
Thus, the sense strand is the strand containing the "GGGAC"
sequence as it reads 5' to 3' in the direction that the restriction
enzyme cuts.
As used herein, with regard to the position at which restriction
enzymes digest DNA, the "antisense" strand is the strand reading 3'
to 5' in the direction in which the restriction enzyme cuts. Thus,
the antisense strand is the strand that contains the "ccctg"
sequence as it reads 3' to 5'.
In the invention, one of the primers in a primer pair can be
designed such that it contains a restriction enzyme recognition
site for a restriction enzyme such that digestion with the
restriction enzyme produces a recessed 3' end and a 5' overhang
that contains the locus of interest (herein referred to as a
"second primer"). For example, the second primer of a primer pair
can contain a recognition site for a restriction enzyme that does
not cut DNA at the recognition site but cuts "n" nucleotides away
from the recognition site. "N" is a distance from the recognition
site to the site of the cut by the restriction enzyme. If the
recognition sequence is for the restriction enzyme BceA I, the
enzyme will cut ten (10) nucleotides from the recognition site on
the sense strand, and twelve (12) nucleotides away from the
recognition site on the antisense strand.
The 3' region and preferably the 3' half of the primers is designed
to anneal to a sequence that flanks the loci of interest (FIG. 1A).
The second primer may anneal any distance from the locus of
interest provided that digestion with the restriction enzyme that
recognizes the restriction enzyme recognition site on this primer
generates a 5' overhang that contains the locus of interest. The 5'
overhang can be of any size, including but not limited to 1, 2, 3,
4, 5, 6, 7, 8, and more than 8 bases.
In a preferred embodiment, the 3' end of the second primer can
anneal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more than
14 bases from the locus of interest or at the locus of
interest.
In a preferred embodiment, the second primer is designed to anneal
closer to the locus of interest than the other primer of a primer
pair (the other primer is herein referred to as a "first primer").
The second primer can be a forward or reverse primer and the first
primer can be a reverse or forward primer, respectively. Whether
the first or second primer should be the forward or reverse primer
can be determined by which design will provide better sequencing
results.
For example, the primer that anneals closer to the locus of
interest can contain a recognition site for the restriction enzyme
BsmF I, which cuts ten (10) nucleotides from the recognition site
on the sense strand, and fourteen (14) nucleotides from the
recognition site on the antisense strand. In this case, the primer
can be designed so that the restriction enzyme recognition site is
13 bases, 12 bases, 10 bases or 11 bases from the locus of
interest. If the recognition site is 13 bases from the locus of
interest, digestion with BsmF I will generate a 5' overhang (RXXX),
wherein the locus of interest (R) is the first nucleotide in the
overhang (reading 3' to 5'), and X is any nucleotide. If the
recognition site is 12 bases from the locus of interest, digestion
with BsmF I will generate a 5' overhang (XRXX), wherein the locus
of interest (R) is the second nucleotide in the overhang (reading
3' to 5'). If the recognition site is 11 bases from the locus of
interest, digestion with BsmF I will generate a 5' overhang (XXRX),
wherein the locus of interest (R) is the third nucleotide in the
overhang (reading 3' to 5'). The distance between the restriction
enzyme recognition site and the locus of interest should be
designed so that digestion with the restriction enzyme generates a
5' overhang, which contains the locus of interest. The effective
distance between the recognition site and the locus of interest
will vary depending on the choice of restriction enzyme.
In another embodiment, the second primer, which can anneal closer
to the locus of interest relative to the first primer, can be
designed so that the restriction enzyme that generates the 5'
overhang, which contains the locus of interest, will see the same
sequence at the cut site, independent of the nucleotide at the
locus of interest. For example, if the primer that anneals closer
to the locus of interest is designed so that the recognition site
for the restriction enzyme BsmF I (5' GGGAC 3') is thirteen bases
from the locus of interest, the restriction enzyme will cut the
antisense strand one base upstream of the locus of interest. The
nucleotide at the locus of interest is adjacent to the cut site,
and may vary from DNA molecule to DNA molecule. If it is desired
that the nucleotides adjacent to the cut site be identical, the
primer can be designed so that the restriction enzyme recognition
site for BsmF I is twelve bases away from the locus of interest.
Digestion with BsmF I will generate a 5' overhang, wherein the
locus of interest is in the second position of the overhang
(reading 3' to 5') and is no longer adjacent to the cut site.
Designing the primer so that the restriction enzyme recognition
site is twelve (12) bases from the locus of interest allows the
nucleotides adjacent to the cut site to be the same, independent of
the nucleotide at the locus of interest. Also, primers that have
been designed so that the restriction enzyme recognition site is
eleven (11) or ten (10) bases from the locus of interest will allow
the nucleotides adjacent to the cut site to be the same,
independent of the nucleotide at the locus of interest.
The 3' end of the first primer (either the forward or the reverse)
can be designed to anneal at a chosen distance from the locus of
interest. Preferably, for example, this distance is between 10 25,
25 50, 50 75, 75 100, 100 150, 150 200, 200 250, 250 300, 300 350,
350 400, 400 450, 450 500, 500 550, 550 600, 600 650, 650 700, 700
750, 750 800, 800 850, 850 900, 900 950, 950 1000 and greater than
1000 bases away from the locus of interest. The annealing sites of
the first primers are chosen such that each successive upstream
primer is further and further away from its respective downstream
primer.
For example, if at locus of interest 1 the 3' ends of the first and
second primers are Z bases apart, then at locus of interest 2, the
3' ends of the upstream and downstream primers are Z+K bases apart,
where K=1, 2, 3, 4, 5 10, 10 20, 20 30, 30 40, 40 50, 50 60, 60 70,
70 80, 80 90, 90 100, 100 200, 200 300, 300 400, 400 500, 500 600,
600 700, 700 800, 800 900, 900 1000, or greater than 1000 bases
(FIG. 2). The purpose of making the upstream primers further and
further apart from their respective downstream primers is so that
the PCR products of all the loci of interest differ in size and can
be separated, e.g., on a sequencing gel. This allows for
multiplexing by pooling the PCR products in later steps.
In one embodiment, the 5' region of the first primer can have a
recognition site for any type of restriction enzyme. In a preferred
embodiment, the first primer has at least one restriction enzyme
recognition site that is different from the restriction enzyme
recognition site in the second primer. In another preferred
embodiment, the first primer anneals further away from the locus of
interest than the second primer.
In a preferred embodiment, the second primer contains a restriction
enzyme recognition sequence for a Type IIS restriction enzyme
including but not limited to BceA I and BsmF I, which produce a two
base 5' overhang and a four base 5' overhang, respectively.
Restriction enzymes that are Type IIS are preferred because they
recognize asymmetric base sequences (not palindromic like the
orthodox Type II enzymes). Type IIS restriction enzymes cleave DNA
at a specified position that is outside of the recognition site,
typically up to 20 base pairs outside of the recognition site.
These properties make Type IIS restriction enzymes, and the
recognition sites thereof, especially useful in the method of the
invention. Preferably, the Type IIS restriction enzymes used in
this method leave a 5' overhang and a recessed 3' end.
A wide variety of Type IIS restriction enzymes are known and such
enzymes have been isolated from bacteria, phage, archaebacteria and
viruses of eukaryotic algae and are commercially available
(Promega, Madison Wis.; New England Biolabs, Beverly, Mass.;
Szybalski W. et al., Gene 100:13 16, (1991)). Examples of Type IIS
restriction enzymes that would be useful in the method of the
invention include, but are not limited to enzymes such as those
listed in Table I.
TABLE-US-00002 TABLE I TYPE IIS RESTRICTION ENZYMES THAT GENERATE A
5' OVERHANG AND A RECESSED 3' END. Recognition/ Enzyme-Source
Cleavage Site Supplier Alw I - Acinetobacter lwoffii GGATC(4/5) NE
Biolabs Alw26 I - Acinetobacter lwoffi GTCTC(1/5) Promega Bbs I -
Bacillus laterosporus GAAGAC(2/6) NE Biolabs Bbv I - Bacillus
brevis GCAGC(8/12) NE Biolabs BceA I - Bacillus cereus 1315
ACGGC(12/14) NE Biolabs Bmr I - Bacillus megaterium ACTGGG(5/4) NE
Biolabs Bsa I - Bacillus stearothermophilus 6-55 GGTCTC(1/5) NE
Biolabs Bst71 I - Bacillus stearothermophilus 71 GCAGC(8/12)
Promega BsmA I - Bacillus stearothermophilus A664 GTCTC(1/5) NE
Biolabs BsmB I - Bacillus stearothermophilus B61 CGTCTC(1/5) NE
Biolabs BsmF I - Bacillus stearothermophilus F GGGAC(10/14) NE
Biolabs BspM I - Bacillus species M ACCTGC(4/8) NE Biolabs Ear I -
Enterobacter aerogenes CTCTTC(1/4) NE Biolabs Fau I -
Flavobacterium aquatile CCCGC(4/6) NE Biolabs Fok I -
Flavobacterium okeonokoites GGATG(9/13) NE Biolabs Hga I -
Haemophilus gallinarum GACGC(5/10) NE Biolabs Ple I - Pseudomonas
lemoignei GAGTC(4/5) NE Biolabs Sap I - Saccharopolyspora species
GCTCTTC(1/4) NE Biolabs SfaN I - Streptococcus faecalis ND547
GCATC(5/9) NE Biolabs Sth132 I - Streptococcus thermophilus ST132
CCCG(4/8) No commercial supplier (Gene 195:201 206 (1997))
In one embodiment, a primer pair has sequence at the 5' region of
each of the primers that provides a restriction enzyme recognition
site that is unique for one restriction enzyme.
In another embodiment, a primer pair has sequence at the 5' region
of each of the primers that provide a restriction site that is
recognized by more than one restriction enzyme, and especially for
more than one Type IIS restriction enzyme. For example, certain
consensus sequences can be recognized by more than one enzyme. For
example, BsgI, Eco571 and BpmI all recognize the consensus 5'
(G/C)TgnAG 3' and cleave 16 bp away on the antisense strand and 14
bp away on the sense strand. A primer that provides such a
consensus sequence would result in a product that has a site that
can be recognized by any of the restriction enzymes BsgI, Eco57I
and BpmI.
Other restriction enzymes that cut DNA at a distance from the
recognition site, and produce a recessed 3' end and a 5' overhang
include Type III restriction enzymes. For example, the restriction
enzyme EcoP15I recognizes the sequence 5'CAGCAG 3' and cleaves 25
bases downstream on the sense strand and 27 bases on the antisense
strand. It will be further appreciated by a person of ordinary
skill in the art that new restriction enzymes are continually being
discovered and may readily be adopted for use in the subject
invention.
In another embodiment, the second primer can contain a portion of
the recognition sequence for a restriction enzyme, wherein the full
recognition site for the restriction enzyme is generated upon
amplification of the template DNA such that digestion with the
restriction enzyme generates a 5' overhang containing the locus of
interest. For example, the recognition site for BsmF I is 5'
GGGACN.sub.10.sup..dwnarw.3' (SEQ ID NO: 1). The 3' region, which
anneals to the template DNA, of the second primer can end with the
nucleotides "GGG," which do not have to be complementary with the
template DNA. If the 3' annealing region is about 10 20 bases, even
if the last three bases do not anneal, the primer will extend and,
generate a BsmF I site.
TABLE-US-00003 Second 5'GGAAATTCCATGATGCGTGGG.fwdarw. (SEQ ID
primer: NO:3) Template
3'CCTTTAAGGTACTACGCAN.sub.1'N.sub.2'N.sub.3'TG5' DNA:
5'GGAAATTCCATGATGCGTN.sub.1N.sub.2N.sub.3AC3' (SEQ ID NO:4)
The second primer can be designed to anneal to the template DNA,
wherein the next two bases of the template DNA are thymidine and
guanine, such that an adenosine and cytosine are incorporated into
the primer forming a recognition site for BsmF I, 5'
GGGACN.sub.10.sup..dwnarw.3' (SEQ ID NO: 1). The second primer can
be designed to anneal in such a manner that digestion with BsmF I
generates a 5' overhang containing the locus of interest.
In another embodiment, the second primer can contain an entire or
full recognition site for a restriction enzyme or a portion of a
recognition site, which generates a full recognition site upon
amplification of the template DNA such that digestion with a
restriction enzyme that cuts at the recognition site generates a 5'
overhang that contains the locus of interest. For example, the
restriction enzyme BsaJ I binds the following recognition site: 5'
C.sup..dwnarw.CN.sub.1N.sub.2GG 3'. The second primer can be
designed such that the 3' region of the primer ends with "CC." The
SNP of interest is represented by "N.sub.1'", and the template
sequence downstream of the SNP is "N.sub.2'CC."
TABLE-US-00004 Second primer 5' GGAAATTCCATGATGCGTACC.fwdarw. (SEQ
ID NO:5) Template DNA 3' CCTTTAAGGTACTACTACGCATGGN.sub.1,N.sub.2,CC
5' (SEQ ID NO:28) 5' GGAAATTCCATGATGCGTACCN.sub.1N.sub.2GG 3' (SEQ
ID NO:6)
After digestion with BsaJ I, a 5' overhang of the following
sequence would be generated:
TABLE-US-00005 5' C 3' 3' GGN.sub.1.cndot.N.sub.2.cndot.C 5'
If the nucleotide guanine is not reported at the locus of interest,
the 3' recessed end can be filled in with unlabeled cytosine, which
is complementary to the first nucleotide in the overhang. After
removing the excess cytosine, labeled ddNTPs can be used to fill in
the next nucleotide, N.sub.1', which represents the locus of
interest. Alternatively if guanine is reported to be a potential
nucleotide at the locus of interest, labeled nucleotides can be
used to detect a nucleotide 3' of the locus of interest. Unlabeled
dCTP can be used to "fill in" followed by a fill in with a labeled
nucleotide other that cytosine. Cytosine will be incorporated until
it reaches a base that is not complementary. If the locus of
interest contained a guanine, it would be filled in with the dCTP,
which would allow incorporation of the labeled nucleotide. However,
if the locus of interest did not contain a guanine, the labeled
nucleotide would not be incorporated. Other restriction enzymes can
be used including but not limited to BssK I (5' .sup..dwnarw.CCNGG
3'), Dde I (5' C.sup..dwnarw.TNAG 3'), EcoN I (5'
CCTNN.sup..dwnarw.NNNAGG 3') (SEQ ID NO:7), Fnu4H I (5'
GC.sup..dwnarw.NGC 3'), Hinf I (5' G.sup..dwnarw.ANTC 3'), PflF I
(5' GACN.sup..dwnarw.NNGTC 3'), Sau96 I (5' G.sup..dwnarw.GNCC 3'),
ScrF I (5' CC.sup..dwnarw.NGG 3'), and Tth111 I (5'
GACN.sup..dwnarw.NNGTC 3').
It is not necessary that the 3' region, which anneals to the
template DNA, of the second primer be 100% complementary to the
template DNA. For example, the last 1, 2, or 3 nucleotides of the
3' end of the second primer can be mismatches with the template
DNA. The region of the primer that anneals to the template DNA will
target the primer, and allow the primer to extend. Even if, for
example, the last two nucleotides are not complementary to the
template DNA, the primer will extend and generate a restriction
enzyme recognition site.
TABLE-US-00006 Second 5'GGAAATTCCATGATGCGTACC.fwdarw. (SEQ pri- ID
mer: NO:5) Tem-
3'CCTTTAAGGTACTACGCATN.sub.a'N.sub.b'N.sub.1'N.sub.2'CC5' plate
DNA: 5'GGAAATTCCATGATGCGTAN.sub.aN.sub.bN.sub.1N.sub.2GG3' (SEQ ID
NO:8)
After digestion with BsaJ I, a 5' overhang of the following
sequence would be generated:
TABLE-US-00007 5'C3' 3'GGN.sub.1'N.sub.2'C5'
If the nucleotide cytosine is not reported at the locus of
interest, the 5' overhang can be filled in with unlabeled cytosine.
The excess cytosine can be rinsed away, and filled in with labeled
ddNTPs. The first nucleotide incorporated (N.sub.1) corresponds to
the locus of interest.
Alternatively, it is possible to create the full restriction enzyme
recognition sequence using the first and second primers. The
recognition site for any restriction enzyme can be generated, as
long as the recognition site contains at least one variable
nucleotide. Restriction enzymes that recognize sites that contain
at least one variable nucleotide include but are not limited to
BssK I (5'.sup..dwnarw.CCNGG 3'), Dde I (5'C.sup..dwnarw.TNAG 3'),
Econ I (5'CCTNN.sup..dwnarw.NNNAGG 3') (SEQ ID NO:7), Fnu4H I
(5'GC.sup..dwnarw.NGC 3'), Hinf I (5'G.sup..dwnarw.ANTC 3') PflF I
(5' GACN.sup..dwnarw.NNGTC 3'), Sau96 I (5' G.sup..dwnarw.GNCC 3'),
ScrF I (5' CC.sup..dwnarw.NGG 3'), and Tth111 I (5'
GACN.sup..dwnarw.NNGTC 3'). In this embodiment, the first or second
primer may anneal closer to the locus of interest or the first or
second primer may anneal at an equal distance from the locus of
interest. The first and second primers can be designed to contain
mismatches to the template DNA at the 3' region; these mismatches
create the restriction enzyme recognition site. The number of
mismatches that can be tolerated at the 3' end depends on the
length of the primer, and includes but is not limited to 1, 2, or
more than 2 mismatches. For example, if the locus of interest is
represented by N.sub.1', a first primer can be designed to be
complementary to the template DNA, depicted below as region "a."
The 3' region of the first primer ends with "CC," which is not
complementary to the template DNA. The second primer is designed to
be complementary to the template DNA, which is depicted below as
region "b'". The 3' region of the second primer ends with "CC,"
which is not complementary to the template DNA.
TABLE-US-00008 First primer 5' a CC.fwdarw. Template DNA 3' a'
AAN.sub.1'N.sub.2'TT b' 5' 5' a TTN.sub.1N.sub.2AA b 3' .rarw.CC b'
5' Second Primer
After one round of amplification the following products would be
generated:
TABLE-US-00009 5' a CCN.sub.1N.sub.2AA b 3' and 5' b'
CCN.sub.2'N.sub.1'AA a' 3'.
In cycle two, the primers can anneal to the templates that were
generated from the first cycle of PCR:
TABLE-US-00010 5' a CCN.sub.1N.sub.2AA b 3' .rarw.CC b' 5' .rarw.CC
a 5' 5' b' CCN.sub.2'N.sub.1'AA a' 3'
After cycle two of PCR, the following products would be
generated:
TABLE-US-00011 5' a CCN.sub.1N.sub.2GG b 3' 3' a'
GGN.sub.1'N.sub.2'CC b' 5'
The restriction enzyme recognition site for BsaJ I is generated,
and after digestion with BsaJ I, a 5' overhang containing the locus
of interest is generated. The locus of interest can be detected as
described in detail below. Alternatively, the 3' region of the
first and second primers can contain 1, 2, 3, or more than 3
mismatches followed by a nucleotide that is complementary to the
template DNA. For example, the first and second primers can be used
to create a recognition site for the restriction enzyme EcoN I,
which binds the following DNA sequence: 5' CCTNN.sup..dwnarw.NNNAGG
3' (SEQ ID NO: 7). The last nucleotides of each primer would be
"CCTN.sub.1 or CCTN.sub.1N.sub.2." The nucleotides "CCT" may or may
not be complementary to the template DNA; however, N.sub.1 and
N.sub.2 are nucleotides complementary to the template DNA. This
allows the primers to anneal to the template DNA after the
potential mismatches, which are used to create the restriction
enzyme recognition site.
In another embodiment, a primer pair has sequence at the 5' region
of each of the primers that provides two or more restriction sites
that are recognized by two or more restriction enzymes.
In a most preferred embodiment, a primer pair has different
restriction enzyme recognition sites at the 5' regions, especially
5' ends, such that a different restriction enzyme is required to
cleave away any undesired sequences. For example, the first primer
for locus of interest "A" can contain sequence recognized by a
restriction enzyme, "X," which can be any type of restriction
enzyme, and the second primer for locus of interest "A," which
anneals closer to the locus of interest, can contain sequence for a
restriction enzyme, "Y," which is a Type IIS restriction enzyme
that cuts "n" nucleotides away and leaves a 5' overhang and a
recessed 3' end. The 5' overhang contains the locus of interest.
After binding the amplified DNA to streptavidin coated wells, one
can digest with enzyme "Y," rinse, then fill in with labeled
nucleotides and rinse, and then digest with restriction enzyme "X,"
which will release the DNA fragment containing the locus of
interest from the solid matrix. The locus of interest can be
analyzed by detecting the labeled nucleotide that was "filled in"
at the locus of interest, e.g. SNP site.
In another embodiment, the second primers for the different loci of
interest that are being amplified according to the invention
contain recognition sequence in the 5' regions for the same
restriction enzyme and likewise all the first primers also contain
the same restriction enzyme recognition site, which is a different
enzyme from the enzyme that recognizes the second primers. The
primer (either the forward or reverse primer) that anneals closer
to the locus of interest contains a recognition site for, e.g., a
Type IIs restriction enzyme.
In another embodiment, the second primers for the multiple loci of
interest that are being amplified according to the invention
contain restriction enzyme recognition sequences in the 5' regions
for different restriction enzymes.
In another embodiment, the first primers for the multiple loci of
interest that are being amplified according to the invention
contain restriction enzyme recognition sequences in the 5' regions
for different restriction enzymes.
Multiple restriction enzyme sequences provide an opportunity to
influence the order in which pooled loci of interest are released
from the solid support. For example, if 50 loci of interest are
amplified, the first primers can have a tag at the extreme 5' end
to aid in purification and a restriction enzyme recognition site,
and the second primers can contain a recognition site for a type
IIS restriction enzyme. For example, several of the first primers
can have a restriction enzyme recognition site for EcoR I, other
first primers can have a recognition site for Pst I, and still
other first primers can have a recognition site for BamH I. After
amplification, the loci of interest can be bound to a solid support
with the aid of the tag on the first primers. By performing the
restriction digests one restriction enzyme at a time, one can
serially release the amplified loci of interest. If the first
digest is performed with EcoRI, the loci of interest amplified with
the first primers containing the recognition site for EcoR I will
be released, and collected while the other loci of interest remain
bound to the solid support. The amplified loci of interest can be
selectively released from the solid support by digesting with one
restriction enzyme at a time. The use of different restriction
enzyme recognition sites in the first primers allows a larger
number of loci of interest to be amplified in a single reaction
tube.
In a preferred embodiment, any region 5' of the restriction enzyme
digestion site of each primer can be modified with a functional
group that provides for fragment manipulation, processing,
identification, and/or purification. Examples of such functional
groups, or tags, include but are not limited to biotin, derivatives
of biotin, carbohydrates, haptens, dyes, radioactive molecules,
antibodies, and fragments of antibodies, peptides, and immunogenic
molecules.
In another embodiment, the template DNA can be replicated once,
without being amplified beyond a single round of replication. This
is useful when there is a large amount of the DNA available for
analysis such that a large number of copies of the loci of interest
are already present in the sample, and further copies are not
needed. In this embodiment, the primers are preferably designed to
contain a "hairpin" structure in the 5' region, such that the
sequence doubles back and anneals to a sequence internal to itself
in a complementary manner. When the template DNA is replicated only
once, the DNA sequence comprising the recognition site would be
single-stranded if not for the "hairpin" structure. However, in the
presence of the hairpin structure, that region is effectively
double stranded, thus providing a double stranded substrate for
activity by restriction enzymes.
To the extent that the reaction conditions are compatible, all the
primer pairs to analyze a locus or loci of interest of DNA can be
mixed together for use in the method of the invention. In a
preferred embodiment, all primer pairs are mixed with the template
DNA in a single reaction vessel. Such a reaction vessel can be, for
example, a reaction tube, or a well of a microtiter plate.
Alternatively, to avoid competition for nucleotides and to minimize
primer dimers and difficulties with annealing temperatures for
primers, each locus of interest or small groups of loci of interest
can be amplified in separate reaction tubes or wells, and the
products later pooled if desired. For example, the separate
reactions can be pooled into a single reaction vessel before
digestion with the restriction enzyme that generates a 5' overhang,
which contains the locus of interest or SNP site, and a 3' recessed
end. Preferably, the primers of each primer pair are provided in
equimolar amounts. Also, especially preferably, each of the
different primer pairs is provided in equimolar amounts relative to
the other pairs that are being used.
In another embodiment, combinations of primer pairs that allow
efficient amplification of their respective loci of interest can be
used (see e.g. FIG. 2). Such combinations can be determined prior
to use in the method of the invention. Multi-well plates and PCR
machines can be used to select primer pairs that work efficiently
with one another. For example, gradient PCR machines, such as the
Eppendorf Mastercycler.RTM. gradient PCR machine, can be used to
select the optimal annealing temperature for each primer pair.
Primer pairs that have similar properties can be used together in a
single reaction tube.
In another embodiment, a multi-sample container including but not
limited to a 96-well or more plate can be used to amplify a single
locus of interest with the same primer pairs from multiple template
DNA samples with optimal PCR conditions for that locus of interest.
Alternatively, a separate multi-sample container can be used for
amplification of each locus of interest and the products for each
template DNA sample later pooled. For example, gene A from 96
different DNA samples can be amplified in microtiter plate 1, gene
B from 96 different DNA samples can be amplified in microtiter
plate 2, etc., and then the amplification products can be
pooled.
The result of amplifying multiple loci of interest is a preparation
that contains representative PCR products having the sequence of
each locus of interest. For example, if DNA from only one
individual is used as the template DNA and if hundreds of
disease-related loci of interest were amplified from the template
DNA, the amplified DNA would be a mixture of small, PCR products
from each of the loci of interest. Such a preparation could be
further analyzed at that time to determine the sequence at each
locus of interest or at only some of loci of interest.
Additionally, the preparation could be stored in a manner that
preserves the DNA and can be analyzed at a later time. Information
contained in the amplified DNA can be revealed by any suitable
method including but not limited to fluorescence detection,
sequencing, gel electrophoresis, and mass spectrometry (see
"Detection of Incorporated Nucleotide" section below).
Amplification of Loci of Interest
The template DNA can be amplified using any suitable method known
in the art including but not limited to PCR (polymerase chain
reaction), 3SR (self-sustained sequence reaction), LCR (ligase
chain reaction), RACE-PCR (rapid amplification of cDNA ends), PLCR
(a combination of polymerase chain reaction and ligase chain
reaction), Q-beta phage amplification (Shah et al., J. Medical
Micro. 33: 1435 41 (1995)), SDA (strand displacement
amplification), SOE-PCR (splice overlap extension PCR), and the
like. These methods can be used to design variations of the
releasable primer mediated cyclic amplification reaction explicitly
described in this application. In the most preferred embodiment,
the template DNA is amplified using PCR (PCR: A Practical Approach,
M. J. McPherson, et al., IRL Press (1991); PCR Protocols: A Guide
to Methods and Applications, Innis, et al., Academic Press (1990);
and PCR Technology: Principals and Applications of DNA
Amplification, H. A. Erlich, Stockton Press (1989)). PCR is also
described in numerous U.S. patents, including U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; 4,965,188; 4,889,818; 5,075,216;
5,079,352; 5,104,792, 5,023,171; 5,091,310; and 5,066,584.
The components of a typical PCR reaction include but are not
limited to a template DNA, primers, a reaction buffer (dependent on
choice of polymerase), dNTPs (dATP, dTTP, dGTP, and dCTP) and a DNA
polymerase. Suitable PCR primers can be designed and prepared as
discussed above (see "Primer Design" section above). Briefly, the
reaction is heated to 95.degree. C. for 2 min. to separate the
strands of the template DNA, the reaction is cooled to an
appropriate temperature (determined by calculating the annealing
temperature of designed primers) to allow primers to anneal to the
template DNA, and heated to 72.degree. C. for two minutes to allow
extension.
In a preferred embodiment, the annealing temperature is increased
in each of the first three cycles of amplification to reduce
non-specific amplification. See also Example 1, below. The TM1 of
the first cycle of PCR is about the melting temperature of the 3'
region of the second primer that anneals to the template DNA. The
annealing temperature can be raised in cycles 2 10, preferably in
cycle 2, to TM2, which is about the melting temperature of the 3'
region, which anneals to the template DNA, of the first primer. If
the annealing temperature is raised in cycle 2, the annealing
temperature remains about the same until the next increase in
annealing temperature. Finally, in any cycle subsequent to the
cycle in which the annealing temperature was increased to TM2,
preferably cycle 3, the annealing temperature is raised to TM3,
which is about the melting temperature of the entire second primer.
After the third cycle, the annealing temperature for the remaining
cycles may be at about TM3 or may be further increased. In this
example, the annealing temperature is increased in cycles 2 and 3.
However, the annealing temperature can be increased from a low
annealing temperature in cycle 1 to a high annealing temperature in
cycle 2 without any further increases in temperature or the
annealing temperature can progressively change from a low annealing
temperature to a high annealing temperature in any number of
incremental steps. For example, the annealing temperature can be
changed in cycles 2, 3, 4, 5, 6, etc.
After annealing, the temperature in each cycle is increased to an
"extension" temperature to allow the primers to "extend" and then
following extension the temperature in each cycle is increased to
the denaturization temperature. For PCR products less than 500 base
pairs in size, one can eliminate the extension step in each cycle
and just have denaturization and annealing steps. A typical PCR
reaction consists of 25 45 cycles of denaturation, annealing and
extension as described above. However, as previously noted, even
only one cycle of amplification (one copy) can be sufficient for
practicing the invention.
Any DNA polymerase that catalyzes primer extension can be used
including but not limited to E. coli DNA polymerase, Klenow
fragment of E. coli DNA polymerase I, T7 DNA polymerase, T4 DNA
polymerase, Taq polymerase, Pfu DNA polymerase, Vent DNA
polymerase, bacteriophage 29, and REDTaq.TM. Genomic DNA
polymerase, or sequenase. Preferably, a thermostable DNA polymerase
is used. A "hot start" PCR can also be performed wherein the
reaction is heated to 95.degree. C. for two minutes prior to
addition of the polymerase or the polymerase can be kept inactive
until the first heating step in cycle 1. "Hot start" PCR can be
used to minimize nonspecific amplification. Any number of PCR
cycles can be used to amplify the DNA, including but not limited to
2, 5, 10, 15, 20, 25, 30, 35, 40, or 45 cycles. In a most preferred
embodiment, the number of PCR cycles performed is such that
equimolar amounts of each loci of interest are produced.
Purification of Amplified DNA
Purification of the amplified DNA is not necessary for practicing
the invention. However, in one embodiment, if purification is
preferred, the 5' end of the primer (first or second primer) can be
modified with a tag that facilitates purification of the PCR
products. In a preferred embodiment, the first primer is modified
with a tag that facilitates purification of the PCR products. The
modification is preferably the same for all primers, although
different modifications can be used if it is desired to separate
the PCR products into different groups.
The tag can be a radioisotope, fluorescent reporter molecule,
chemiluminescent reporter molecule, antibody, antibody fragment,
hapten, biotin, derivative of biotin, photobiotin, iminobiotin,
digoxigenin, avidin, enzyme, acridinium, sugar, enzyme, apoenzyme,
homopolymeric oligonucleotide, hormone, ferromagnetic moiety,
paramagnetic moiety, diamagnetic moiety, phosphorescent moiety,
luminescent moiety, electrochemiluminescent moiety, chromatic
moiety, moiety having a detectable electron spin resonance,
electrical capacitance, dielectric constant or electrical
conductivity, or combinations thereof.
In a preferred embodiment, the 5' ends of the primers can be
biotinylated (Kandpal et al., Nucleic Acids Res. 18:1789 1795
(1990); Kaneoka et al., Biotechniques 10:30 34 (1991); Green et
al., Nucleic Acids Res. 18:6163 6164 (1990)). The biotin provides
an affinity tag that can be used to purify the copied DNA from the
genomic DNA or any other DNA molecules that are not of interest.
Biotinylated molecules can be purified using a streptavidin coated
matrix as shown in FIG. 1F, including but not limited to
Streptawell, transparent, High-Bind plates from Roche Molecular
Biochemicals (catalog number 1 645 692, as listed in Roche
Molecular Biochemicals, 2001 Biochemicals Catalog).
The PCR product of each locus of interest is placed into separate
wells of a Streptavidin coated plate. Alternatively, the PCR
products of the loci of interest can be pooled and placed into a
streptavidin coated matrix, including but not limited to the
Streptawell, transparent, High-Bind plates from Roche Molecular
Biochemicals (catalog number 1 645 692, as listed in Roche
Molecular Biochemicals, 2001 Biochemicals Catalog).
The amplified DNA can also be separated from the template DNA using
non-affinity methods known in the art, for example, by
polyacrylamide gel electrophoresis using standard protocols.
Digestion of Amplified DNA
The amplified DNA can be digested with a restriction enzyme that
recognizes a sequence that had been provided on the first or second
primer using standard protocols known within the art (FIGS. 6A 6D).
The enzyme used depends on the restriction recognition site
generated with the first or second primer. See "Primer Design"
section, above, for details on restriction recognition sites
generated on primers.
Type IIS restriction enzymes are extremely useful in that they cut
approximately 10 20 base pairs outside of the recognition site.
Preferably, the Type IIS restriction enzymes used are those that
generate a 5' overhang and a recessed 3' end, including but not
limited to BceA I and BsmF I (see e.g. Table I). In a most
preferred embodiment, the second primer (either forward or
reverse), which anneals close to the locus of interest, contains a
restriction enzyme recognition sequence for BsmF I or BceA I. The
Type IIS restriction enzyme BsmF I recognizes the nucleic acid
sequence GGGAC, and cuts 14 nucleotides from the recognition site
on the antisense strand and 10 nucleotides from the recognition
site on the sense strand. Digestion with BsmF I generates a 5'
overhang of four (4) bases.
For example, if the second primer is designed so that after
amplification the restriction enzyme recognition site is 13 bases
from the locus of interest, then after digestion, the locus of
interest is the first base in the 5' overhang (reading 3' to 5'),
and the recessed 3' end is one base upstream of the locus of
interest. The 3' recessed end can be filled in with a nucleotide
that is complementary to the locus of interest. One base of the
overhang can be filled in using dideoxynucleotides. However, 1, 2,
3, or all 4 bases of the overhang can be filled in using
deoxynucleotides or a mixture of dideoxynucleotides and
deoxynucleotides.
The restriction enzyme BsmF I cuts DNA ten (10) nucleotides from
the recognition site on the sense strand and fourteen (14)
nucleotides from the recognition site on the antisense strand.
However, in a sequence dependent manner, the restriction enzyme
BsmF I also cuts eleven (11) nucleotides from the recognition site
on the sense strand and fifteen (15) nucleotides from the
recognition site on the antisense strand. Thus, two populations of
DNA molecules exist after digestion: DNA molecules cut at 10/14 and
DNA molecules cut at 11/15. If the recognition site for BsmF I is
13 bases from the locus of interest in the amplified product, then
DNA molecules cut at the 11/15 position will generate a 5' overhang
that contains the locus of interest in the second position of the
overhang (reading 3' to 5'). The 3' recessed end of the DNA
molecules can be filled in with labeled nucleotides. For example,
if labeled dideoxynucleotides are used, the 3' recessed end of the
molecules cut at 11/15 would be filled in with one base, which
corresponds to the base upstream of the locus of interest, and the
3' recessed end of molecules cut at 10/14 would be filled in with
one base, which corresponds to the locus of interest. The DNA
molecules that have been cut at the 10/14 position and the DNA
molecules that have been cut at the 11/15 position can be separated
by size, and the incorporated nucleotides detected. This allows
detection of both the nucleotide before the locus of interest,
detection of the locus of interest, and potentially the three bases
pairs after the locus of interest.
Alternatively, if the base upstream of the locus of interest and
the locus of interest are different nucleotides, then the 3'
recessed end of the molecules cut at 11/15 can be filled in with
deoxynucleotide that is complementary to the upstream base. The
remaining deoxynucleotide is washed away, and the locus of interest
site can be filled in with either labeled deoxynucleotides,
unlabeled deoxynucleotides, labeled dideoxynucleotides, or
unlabeled dideoxynucleotides. After the fill in reaction, the
nucleotide can be detected by any suitable method. Thus, after the
first fill in reaction with dNTP, the 3' recessed end of the
molecules cut at 10/14 and 11/15 is upstream of the locus of
interest. The 3' recessed end can now be filled in one base, which
corresponds to the locus of interest, two bases, three bases or
four bases.
Alternatively, if the base upstream of the locus of interest and
the base downstream of the locus of interest are reported to be the
same, the 3' recessed end of the molecules cut at 11/15 can be
"filled in" with unlabeled deoxynucleotide, followed by a "fill in"
with labeled dideoxynucleotide. For example, if the nucleotide
upstream of the locus of interest is a cytosine, and a cytosine is
a potential nucleotide at the locus of interest, and an adenosine
is the first nucleotide 3' of the locus of interest, a "fill in"
reaction can be performed with unlabeled deoxyguanine triphosphate
(dGTP), followed by a fill in with labeled dideoxythymidine
triphosphate. If the locus of interest contains a cytosine, the
ddTTP will be incorporated and detected. However, if the locus of
interest does not contain a cytosine, the dGTP will not be
incorporated, which prevents incorporation of the ddTTP.
The restriction enzyme BceA I recognizes the nucleic acid sequence
ACGGC and cuts 12 (twelve) nucleotides from the recognition site on
the sense strand and 14 (fourteen) nucleotides from the recognition
site on the antisense strand. If the distance from the recognition
site for BceA I on the second primer is designed to be thirteen
(13) bases from the locus of interest (see FIGS. 4A 4D), digestion
with BceA I will generate a 5' overhang of two bases, which
contains the locus of interest, and a recessed 3' end that is
upstream of the locus of interest. The locus of interest is the
first nucleotide in the 5' overhang (reading 3' to 5').
Alternative cutting is also seen with the restriction enzyme BceA
I, although at a much lower frequency than is seen with BsmF I. The
restriction enzyme BceA I can cut thirteen (13) nucleotides from
the recognition site on the sense strand and fifteen (15)
nucleotides from the recognition site on the antisense strand.
Thus, two populations of DNA molecules exist: DNA molecules cut at
12/14 and DNA molecules cut at 13/15. If the restriction enzyme
recognition site is 13 bases from the locus of interest in the
amplified product, DNA molecules cut at the 13/15 position yield a
5' overhang, which contains the locus of interest in the second
position of the overhang (reading 3' to 5'). Labeled
dideoxynucleotides can be used to fill in the 3' recessed end of
the DNA molecules. The DNA molecules cut at 13/15 will have the
base upstream of the locus of interest filled in, and the DNA
molecules cut at 12/14 will have the locus of interest site filled
in. The DNA molecules cut at 13/15 and those cut at 12/14 can be
separated by size, and the incorporated nucleotide detected. Thus,
the alternative cutting can be used to obtain additional sequence
information.
Alternatively, if the two bases in the 5' overhang are different,
the 3' recessed end of the DNA molecules, which were cut at 13/15,
can be filled in with the deoxynucleotide complementary to the
first base in the overhang, and excess deoxynucleotide washed away.
After filling in, the 3' recessed end of the DNA molecules that
were cut at 12/14 and the DNA molecules that were cut at 13/15 are
upstream of the locus of interest. The 3' recessed ends can be
filled with either labeled dideoxynucleotides, unlabeled
dideoxynucleotides, labeled deoxynucleotides, or unlabeled
deoxynucleotides.
If the primers provide different restriction sites for certain of
the loci of interest that were copied, all the necessary
restriction enzymes can be added together to digest the copied DNA
simultaneously. Alternatively, the different restriction digests
can be made in sequence, for example, using one restriction enzyme
at a time, so that only the product that is specific for that
restriction enzyme is digested.
Incorporation of Labeled Nucleotides
Digestion with the restriction enzyme that recognizes the sequence
on the second primer generates a recessed 3' end and a 5' overhang,
which contains the locus of interest (FIG. 1G). The recessed 3' end
can be filled in using the 5' overhang as a template in the
presence of unlabeled or labeled nucleotides or a combination of
both unlabeled and labeled nucleotides. The nucleotides can be
labeled with any type of chemical group or moiety that allows for
detection including but not limited to radioactive molecules,
fluorescent molecules, antibodies, antibody fragments, haptens,
carbohydrates, biotin, derivatives of biotin, phosphorescent
moieties, luminescent moieties, electrochemiluminescent moieties,
chromatic moieties, and moieties having a detectable electron spin
resonance, electrical capacitance, dielectric constant or
electrical conductivity. The nucleotides can be labeled with one or
more than one type of chemical group or moiety. Each nucleotide can
be labeled with the same chemical group or moiety. Alternatively,
each different nucleotide can be labeled with a different chemical
group or moiety. The labeled nucleotides can be dNTPs, ddNTPs, or a
mixture of both dNTPs and ddNTPs. The unlabeled nucleotides can be
dNTPs, ddNTPs or a mixture of both dNTPs and ddNTPs.
Any combination of nucleotides can be used to incorporate
nucleotides including but not limited to unlabeled
deoxynucleotides, labeled deoxynucleotides, unlabeled
dideoxynucleotides, labeled dideoxynucleotides, a mixture of
labeled and unlabeled deoxynucleotides, a mixture of labeled and
unlabeled dideoxynucleotides, a mixture of labeled deoxynucleotides
and labeled dideoxynucleotides, a mixture of labeled
deoxynucleotides and unlabeled dideoxynucleotides, a mixture of
unlabeled deoxynucleotides and unlabeled dideoxynucleotides, a
mixture of unlabeled deoxynucleotides and labeled
dideoxynucleotides, dideoxynucleotide analogues, deoxynucleotide
analogues, a mixture of dideoxynucleotide analogues and
deoxynucleotide analogues, phosphorylated nucleoside analogues,
2-deoxynucleoside-5' triphosphates and modified 2'-deoxynucleoside
triphosphates.
For example, as shown in FIG. 1H, in the presence of a polymerase,
the 3' recessed end can be filled in with fluorescent ddNTP using
the 5' overhang as a template. The incorporated ddNTP can be
detected using any suitable method including but not limited to
fluorescence detection.
All four nucleotides can be labeled with different fluorescent
groups, which will allow one reaction to be performed in the
presence of all four labeled nucleotides. Alternatively, five
separate "fill in" reactions can be performed for each locus of
interest; each of the four reactions will contain a different
labeled nucleotide (e.g. ddATP*, ddTTP*, ddUTP*, ddGTP*, or ddCTP*,
where * indicates a labeled nucleotide). Each nucleotide can be
labeled with different chemical groups or the same chemical groups.
The labeled nucleotides can be dideoxynucleotides or
deoxynucleotides.
In another embodiment, nucleotides can be labeled with fluorescent
dyes including but not limited to fluorescein, pyrene,
7-methoxycoumarin, Cascade Blue.TM., Alexa Flur 350, Alexa Flur
430, Alexa Flur 488, Alexa Flur 532, Alexa Flur 546, Alexa Flur
568, Alexa Flur 594, Alexa Flur 633, Alexa Flur 647, Alexa Flur
660, Alexa Flur 680, AMCA-X, dialkylaminocoumarin, Pacific Blue,
Marina Blue, BODIPY 493/503, BODIPY FI-X, DTAF, Oregon Green 500,
Dansyl-X, 6-FAM, Oregon Green 488, Oregon Green 514, Rhodamine
Green-X, Rhodol Green, Calcein, Eosin, ethidium bromide, NBD, TET,
2', 4', 5', 7' tetrabromosulfonefluorescien, BODIPY-R6G, BODIPY-FI
BR2, BODIPY 530/550, HEX, BODIPY 558/568, BODIPY-TMR-X., PyMPO,
BODIPY 564/570, TAMRA, BODIPY 576/589, Cy3, Rhodamine Red-x, BODIPY
581/591, carboxyXrhodamine, Texas Red-X, BODIPY-TR-X., Cy5,
SpectrumAqua, SpectrumGreen #1, SpectrumGreen #2, SpectrumOrange,
SpectrumRed, or naphthofluorescein.
In another embodiment, the "fill in" reaction can be performed with
fluorescently labeled dNTPs, wherein the nucleotides are labeled
with different fluorescent groups. The incorporated nucleotides can
be detected by any suitable method including but not limited to
Fluorescence Resonance Energy Transfer (FRET).
In another embodiment, a mixture of both labeled ddNTPs and
unlabeled dNTPs can be used for filling in the recessed 3' end of
the DNA sequence containing the SNP or locus of interest.
Preferably, the 5' overhang consists of more than one base,
including but not limited to 2, 3, 4, 5, 6 or more than 6 bases.
For example, if the 5' overhang consists of the sequence "XGAA,"
wherein X is the locus of interest, e.g. SNP, then filling in with
a mixture of labeled ddNTPs and unlabeled dNTPs will produce
several different DNA fragments. If a labeled ddNTP is incorporated
at position "X," the reaction will terminate and a single labeled
base will be incorporated. If however, an unlabeled dNTP is
incorporated, the polymerase continues to incorporate other bases
until a labeled ddNTP is incorporated. If the first two nucleotides
incorporated are dNTPs, and the third is a ddNTP, the 3' recessed
end will be extended by three bases. This DNA fragment can be
separated from the other DNA fragments that were extended by 1, 2,
or 4 bases by size. A mixture of labeled ddNTPs and unlabeled dNTPs
will allow all bases of the overhang to be filled in, and provides
additional sequence information about the locus of interest, e.g.
SNP (see FIGS. 7E and 9D).
After incorporation of the labeled nucleotide, the amplified DNA
can be digested with a restriction enzyme that recognizes the
sequence provided by the first primer. For example, in FIG. 1I, the
amplified DNA is digested with a restriction enzyme that binds to
region "a," which releases the DNA fragment containing the
incorporated nucleotide from the streptavidin matrix.
Alternatively, one primer of each primer pair for each locus of
interest can be attached to a solid support matrix including but
not limited to a well of a microtiter plate. For example,
streptavidin-coated microtiter plates can be used for the
amplification reaction with a primer pair, wherein one primer is
biotinylated. First, biotinylated primers are bound to the
streptavidin-coated microtiter plates. Then, the plates are used as
the reaction vessel for PCR amplification of the loci of interest.
After the amplification reaction is complete, the excess primers,
salts, and template DNA can be removed by washing. The amplified
DNA remains attached to the microtiter plate. The amplified DNA can
be digested with a restriction enzyme that recognizes a sequence on
the second primer and generates a 5' overhang, which contains the
locus of interest. The digested fragments can be removed by
washing. After digestion, the SNP site or locus of interest is
exposed in the 5' overhang. The recessed 3' end is filled in with a
labeled nucleotide, including but not limited to, fluorescent ddNTP
in the presence of a polymerase. The labeled DNA can be released
into the supernatant in the microtiter plate by digesting with a
restriction enzyme that recognizes a sequence in the 5' region of
the first primer.
Analysis of the Locus of Interest
The labeled loci of interest can be analyzed by a variety of
methods including but not limited to fluorescence detection, DNA
sequencing gel, capillary electrophoresis on an automated DNA
sequencing machine, microchannel electrophoresis, and other methods
of sequencing, mass spectrometry, time of flight mass spectrometry,
quadrupole mass spectrometry, magnetic sector mass spectrometry,
electric sector mass spectrometry infrared spectrometry,
ultraviolet spectrometry, palentiostatic amperometry or by DNA
hybridization techniques including Southern Blots, Slot Blots, Dot
Blots, and DNA microarrays, wherein DNA fragments would be useful
as both "probes" and "targets," ELISA, fluorimetry, and
Fluorescence Resonance Energy Transfer (FRET).
The loci of interest can be analyzed using gel electrophoresis
followed by fluorescence detection of the incorporated nucleotide.
Another method to analyze or read the loci of interest is to use a
fluorescent plate reader or fluorimeter directly on the 96-well
streptavidin coated plates. The plate can be placed onto a
fluorescent plate reader or scanner such as the Pharmacia 9200
Typhoon to read each locus of interest.
Alternatively, the PCR products of the loci of interest can be
pooled and after "filling in," (FIG. 10) the products can be
separated by size, using any method appropriate for the same, and
then analyzed using a variety of techniques including but not
limited to fluorescence detection, DNA sequencing gel, capillary
electrophoresis on an automated DNA sequencing machine,
microchannel electrophoresis, other methods of sequencing, DNA
hybridization techniques including Southern Blots, Slot Blots, Dot
Blots, and DNA microarrays, mass spectrometry, time of flight mass
spectrometry, quadrupole mass spectrometry, magnetic sector mass
spectrometry, electric sector mass spectrometry infrared
spectrometry, ultraviolet spectrometry, palentiostatic amperometry.
For example, polyacrylamide gel electrophoresis can be used to
separate DNA by size and the gel can be scanned to determine the
color of fluorescence in each band (using e.g. ABI 377 DNA
sequencing machine or a Pharmacia Typhoon 9200).
In another embodiment, one nucleotide can be used to determine the
sequence of multiple alleles of a gene. A nucleotide that
terminates the elongation reaction can be used to determine the
sequence of multiple alleles of a gene. At one allele, the
terminating nucleotide is complementary to the locus of interest in
the 5' overhang of said allele. The nucleotide is incorporated and
terminates the reaction. At a different allele, the terminating
nucleotide is not complementary to the locus of interest, which
allows a non-terminating nucleotide to be incorporated at the locus
of interest of the different allele. However, the terminating
nucleotide is complementary to a nucleotide downstream from the
locus of interest in the 5' overhang of said different allele. The
sequence of the alleles can be determined by analyzing the patterns
of incorporation of the terminating nucleotide. The terminating
nucleotide can be labeled or unlabeled.
In a another embodiment, the terminating nucleotide is a nucleotide
that terminates or hinders the elongation reaction including but
not limited to a dideoxynucleotide, a dideoxynucleotide derivative,
a dideoxynucleotide analog, a dideoxynucleotide homolog, a
dideoxynucleotide with a sulfur chemical group, a deoxynucleotide,
a deoxynucleotide derivative, a deoxynucleotide homolog, a
deoxynucleotide analog, and a deoxynucleotide with a sulfur
chemical group, arabinoside triphosphate, an arabinoside
triphosphate analog, a arabinoside triphosphate homolog, or an
arabinoside derivative.
In another embodiment, a terminating nucleotide labeled with one
signal generating moiety tag, including but not limited to a
fluorescent dye, can be used to determine the sequence of the
alleles of a locus of interest. The use of a single nucleotide
labeled with one signal generating moiety tag eliminates any
difficulties that can arise when using different fluorescent
moieties. In addition, using one nucleotide labeled with one signal
generating moiety tag to determine the sequence of alleles of a
locus of interest reduces the number of reactions, and eliminates
pipetting errors.
For example, if the second primer contains the restriction enzyme
recognition site for BsmFI, digestion will generate a 5' overhang
of 4 bases. The second primer can be designed such that the locus
of interest is located in the first position of the overhang. A
representative overhang is depicted below, where R represents the
locus of interest:
TABLE-US-00012 5'CAC 3'GTG R T G G Overhang position 1 2 3 4
One nucleotide with one signal generating moiety tag can be used to
determine whether the variable site is homozygous or heterozygous.
For example, if the variable site is adenine (A) or guanine (G),
then either adenine or guanine can be used to determine the
sequence of the alleles of the locus of interest, provided that
there is an adenine or guanine in the overhang at position 2, 3, or
4.
For example, if the nucleotide in position 2 of the overhang is
thymidine, which is complementary to adenine, then labeled ddATP,
unlabeled dCTP, dGTP, and dTTP can be used to determine the
sequence of the alleles of the locus of interest. The ddATP can be
labeled with any signal generating moiety including but not limited
to a fluorescent dye. If the template DNA is homozygous for
adenine, then labeled ddATP* will be incorporated at position 1
complementary to the overhang at the alleles, and no nucleotide
incorporation will be seen at position 2, 3 or 4 complementary to
the overhang.
TABLE-US-00013 Allele 1 5'CCC A* 3'GGG T T G G Overhang position 1
2 3 4 Allele 2 5'CCC A* 3'GGG T T G G Overhang position 1 2 3 4
One signal will be seen corresponding to incorporation of labeled
ddATP at position 1 complementary to the overhang, which indicates
that the individual is homozygous for adenine at this position.
This method of labeling eliminates any difficulties that may arise
from using different dyes that have different quantum
coefficients.
Homozygous Guanine:
If the template DNA is homozygous for guanine, then no ddATP will
be incorporated at position 1 complementary to the overhang, but
ddATP will be incorporated at the first available position, which
in this case is position 2 complementary to the overhang. For
example, if the second position in the overhang corresponds to a
thymidine, then:
TABLE-US-00014 Allele 1 5'CCC G A* 3'GGG C T G G Overhang position
1 2 3 4 Allele 2 5'CCC G A* 3'GGG C T G G Overhang position 1 2 3
4
One signal will be seen corresponding to incorporation of ddATP at
position 2 complementary to the overhang, which indicates that the
individual is homozygous for guanine. The molecules that are filled
in at position 2 complementary to the overhang will have a
different molecular weight than the molecules filled in at position
1 complementary to the overhang.
Heterozygous Condition:
TABLE-US-00015 Allele 1 5'CCC A* 3'GGG T T G G Overhang position 1
2 3 4 Allele 2 5'CCC G A* 3'GGG C T G G Overhang position 1 2 3
4
Two signals will be seen; the first signal corresponds to the ddATP
filled in at position one complementary to the overhang and the
second signal corresponds to the ddATP filled in at position 2
complementary to the overhang. The two signals can be separated
based on molecular weight; allele 1 and allele 2 will be separated
by a single base pair, which allows easy detection and quantitation
of the signals. Molecules filled in at position one can be
distinguished from molecules filled in at position two using any
method that discriminates based on molecular weight including but
not limited to gel electrophoresis, capillary gel electrophoresis,
DNA sequencing, and mass spectrometry. It is not necessary that the
nucleotide be labeled with a chemical moiety; the DNA molecules
corresponding to the different alleles can be separated based on
molecular weight.
If position 2 of the overhang is not complementary to adenine, it
is possible that positions 3 or 4 may be complementary to adenine.
For example, position 3 of the overhang may be complementary to the
nucleotide adenine, in which case labeled ddATP may be used to
determine the sequence of both alleles.
Homozygous for Adenine:
TABLE-US-00016 Allele 1 5'CCC A* 3'GGG T G T G Overhang position 1
2 3 4 Allele 2 5'CCC A* 3'GGG T G T G Overhang position 1 2 3 4
Homozygous for Guanine:
TABLE-US-00017 Allele 1 5'CCC G C A* 3'GGG C G T G Overhang
position 1 2 3 4 Allele 2 5'CCC G C A* 3'GGG C G T G Overhang
position 1 2 3 4
Heterozygous:
TABLE-US-00018 Allele 1 5'CCC A* 3'GGG T G T G Overhang position 1
2 3 4 Allele 2 5'CCC G C A* 3'GGG C G T G Overhang position 1 2 3
4
Two signals will be seen; the first signal corresponds to the ddATP
filled in at position 1 complementary to the overhang and the
second signal corresponds to the ddATP filled in at position 3
complementary to the overhang. The two signals can be separated
based on molecular weight; allele 1 and allele 2 will be separated
by two bases, which can be detected using any method that
discriminates based on molecular weight.
Alternatively, if positions 2 and 3 are not complementary to
adenine (i.e. positions 2 and 3 of the overhang correspond to
guanine, cytosine, or adenine) but position 4 is complementary to
adenine, labeled ddATP can be used to determine the sequence of
both alleles.
Homozygous for Adenine:
TABLE-US-00019 Allele 1 5'CCC A* 3'GGG T G G T Overhang position 1
2 3 4 Allele 2 5'CCC A* 3'GGG T G G T Overhang position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of
molecules filled in with ddATP at position one complementary to the
overhang, which indicates that the individual is homozygous for
adenine at the variable site.
Homozygous for Guanine:
TABLE-US-00020 Allele 1 5'CCC G C C A* 3'GGG C G G T Overhang
position 1 2 3 4 Allele 2 5'CCC G C C A* 3'GGG C G G T Overhang
position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of
molecules filled in at position 4 complementary to the overhang,
which indicates that the individual is homozygous for guanine.
Heterozygous:
TABLE-US-00021 Allele 1 5' CCC A* 3' GGG T G G T Overhang position
1 2 3 4 Allele 2 5' CCC G C C A* 3' GGG C G G T Overhang position 1
2 3 4
Two signals will be seen; the first signal corresponds to the ddATP
filled in at position one complementary to the overhang and the
second signal corresponds to the ddATP filled in at position 4
complementary to the overhang. The two signals can be separated
based on molecular weight; allele 1 and allele 2 will be separated
by three bases, which allows detection and quantitation of the
signals. The molecules filled in at position 1 and those filled in
at position 4 can be distinguished based on molecular weight.
As discussed above, if the variable site contains either adenine or
guanine, either labeled adenine or labeled guanine can be used to
determine the sequence of both alleles. If positions 2, 3, or 4 of
the overhang are not complementary to adenine but one of the
positions is complementary to a guanine, then labeled ddGTP can be
used to determine whether the template DNA is homozygous or
heterozygous for adenine or guanine. For example, if position 3 in
the overhang corresponds to a cytosine then the following signals
will be expected if the template DNA is homozygous for guanine,
homozygous for adenine, or heterozygous:
Homozygous for Guanine:
TABLE-US-00022 Allele 1 5' CCC G* 3' GGG C T C T Overhang position
1 2 3 4 Allele 2 5' CCC G* 3' GGG C T C T Overhang position 1 2 3
4
One signal will be seen that corresponds to the molecular weight of
molecules filled in with ddGTP at position one complementary to the
overhang, which indicates that the individual is homozygous for
guanine.
Homozygous for Adenine:
TABLE-US-00023 Allele 1 5' CCC A A G* 3' GGG T T C T Overhang
position 1 2 3 4 Allele 2 5' CCC A A G* 3' GGG T T C T Overhang
position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of
molecules filled in at position 3 complementary to the overhang,
which indicates that the individual is homozygous for adenine at
the variable site.
Heterozygous:
TABLE-US-00024 Allele 1 5' CCC G* 3' GGG C T C T Overhang position
1 2 3 4 Allele 2 5' CCC A A G* 3' GGG T T C T Overhang position 1 2
3 4
Two signals will be seen; the first signal corresponds to the ddGTP
filled in at position one complementary to the overhang and the
second signal corresponds to the ddGTP filled in at position 3
complementary to the overhang. The two signals can be separated
based on molecular weight; allele 1 and allele 2 will be separated
by two bases, which allows easy detection and quantitation of the
signals.
Some type IIS restriction enzymes also display alternative cutting
as discussed above. For example, BsmFI will cut at 10/14 and 11/15
from the recognition site. However, the cutting patterns are not
mutually exclusive; if the 11/15 cutting pattern is seen at a
particular sequence, 10/14 cutting is also seen. If the restriction
enzyme BsmF I cuts at 10/14 from the recognition site, the 5'
overhang will be X.sub.1X.sub.2X.sub.3X.sub.4. If BsmF I cuts 11/15
from the recognition site, the 5' overhang will be
X.sub.0X.sub.1X.sub.2X.sub.3. If position X.sub.0 of the overhang
is complementary to the labeled nucleotide, the labeled nucleotide
will be incorporated at position X.sub.0 and provides an additional
level of quality assurance. It provides additional sequence
information.
For example, if the variable site is adenine or guanine, and
position 3 in the overhang is complementary to adenine, labeled
ddATP can be used to determine the genotype at the variable site.
If position 0 of the 11/15 overhang contains the nucleotide
complementary to adenine, ddATP will be filled in and an additional
signal will be seen.
Heterozygous:
TABLE-US-00025 10/14 Allele 1 5' CCA A* 3' GGT T G T G Overhang
position 1 2 3 4 10/14 Allele 2 5' CCA G C A* 3' GGT C G T G
Overhang position 1 2 3 4 11/15 Allele 1 5' CC A* 3' GG T T G T
Overhang position 0 1 2 3 11/15 Allele 2 5' CC A* 3' GG T C G T
Overhang position 0 1 2 3
Three signals are seen; one corresponding to the ddATP incorporated
at position 0 complementary to the overhang, one corresponding to
the ddATP incorporated at position 1 complementary to the overhang,
and one corresponding to the ddATP incorporated at position 3
complementary to the overhang. The molecules filled in at position
0, 1, and 3 complementary to the overhang differ in molecular
weight and can be separated using any technique that discriminates
based on molecular weight including but not limited to gel
electrophoresis, and mass spectrometry.
For quantitating the ratio of one allele to another allele or when
determining the relative amount of a mutant DNA sequence in the
presence of wild type DNA sequence, an accurate and highly
sensitive method of detection must be used. The alternate cutting
displayed by type IIS restriction enzymes may increase the
difficulty of determining ratios of one allele to another allele
because the restriction enzyme may not display the alternate
cutting (11/15) pattern on the two alleles equally. For example,
allele 1 may be cut at 10/14 80% of the time, and 11/15 20% of the
time. However, because the two alleles may differ in sequence,
allele 2 may be cut at 10/14 90% of the time, and 11/15 20% of the
time.
For purposes of quantitation, the alternate cutting problem can be
eliminated when the nucleotide at position 0 of the overhang is not
complementary to the labeled nucleotide. For example, if the
variable site corresponds to adenine or guanine, and position 3 of
the overhang is complementary to adenine (i.e., a thymidine is
located at position 3 of the overhang), labeled ddATP can be used
to determine the genotype of the variable site. If position 0 of
the overhang generated by the 11/15 cutting properties is not
complementary to adenine, (i.e., position 0 of the overhang
corresponds to guanine, cytosine, or adenine) no additional signal
will be seen from the fragments that were cut 11/15 from the
recognition site. Position 0 complementary to the overhang can be
filled in with unlabeled nucleotide, eliminating any complexity
seen from the alternate cutting pattern of restriction enzymes.
This method provides a highly accurate method for quantitating the
ratio of a variable site including but not limited to a mutation,
or a single nucleotide polymorphism.
For instance, if SNP X can be adenine or guanine, this method of
labeling allows quantitation of the alleles that correspond to
adenine and the alleles that correspond to guanine, without
determining if the restriction enzyme displays any differences
between the alleles with regard to alternate cutting patterns.
Heterozygous:
TABLE-US-00026 10/14 Allele 1 5' CCG A* 3' GGC T G T G Overhang
position 1 2 3 4 10/14 Allele 2 5' CCG G C A* 3' GGC C G T G
Overhang position 1 2 3 4
The overhang generated by the alternate cutting properties of BsmF
I is depicted below:
TABLE-US-00027 11/15 Allele 1 5' CC 3' GG C T G T Overhang position
0 1 2 3 11/15 Allele 2 5' CC 3' GG C C G T Overhang position 0 1 2
3
After filling in with labeled ddATP and unlabeled dGTP, dCTP, dTTP,
the following molecules would be generated:
TABLE-US-00028 11/15 Allele 1 5' CC G A* 3' GG C T G T Overhang
position 0 1 2 3 11/15 Allele 2 5' CC G G C A* 3' GG C C G T
Overhang position 0 1 2 3
Two signals are seen; one corresponding to the molecules filled in
with ddATP at position one complementary to the overhang and one
corresponding to the molecules filled in with ddATP at position 3
complementary to the overhang. Position 0 of the 11/15 overhang is
filled in with unlabeled nucleotide, which eliminates any
difficulty in quantitating a ratio for the nucleotide at the
variable site on allele 1 and the nucleotide at the variable site
on allele 2.
Any nucleotide can be used including adenine, adenine derivatives,
adenine homologues, guanine, guanine derivatives, guanine
homologues, cytosine, cytosine derivatives, cytosine homologues,
thymidine, thymidine derivatives, or thymidine homologues, or any
combinations of adenine, adenine derivatives, adenine homologues,
guanine, guanine derivatives, guanine homologues, cytosine,
cytosine derivatives, cytosine homologues, thymidine, thymidine
derivatives, or thymidine homologues.
The nucleotide can be labeled with any chemical group or moiety,
including but not limited to radioactive molecules, fluorescent
molecules, antibodies, antibody fragments, haptens, carbohydrates,
biotin, derivatives of biotin, phosphorescent moieties, luminescent
moieties, electrochemiluminescent moieties, chromatic moieties, and
moieties having a detectable electron spin resonance, electrical
capacitance, dielectric constant or electrical conductivity. The
nucleotide can be labeled with one or more than one type of
chemical group or moiety.
In another embodiment, labeled and unlabeled nucleotides can be
used. Any combination of deoxynucleotides and dideoxynucleotides
can be used including but not limited to labeled dideoxynucleotides
and labeled deoxynucleotides; labeled dideoxynucleotides and
unlabeled deoxynucleotides; unlabeled dideoxynucleotides and
unlabeled deoxynucleotides; and unlabeled dideoxynucleotides and
labeled deoxynucleotides.
In another embodiment, nucleotides labeled with a chemical moiety
can be used in the PCR reaction. Unlabeled nucleotides then are
used to fill-in the 5' overhangs generated after digestion with the
restriction enzyme. An unlabeled terminating nucleotide can be used
to in the presence of unlabeled nucleotides to determine the
sequence of the alleles of a locus of interest.
For example, if labeled dTTP was used in the PCR reaction, the
following 5' overhang would be generated after digestion with BsmF
I:
TABLE-US-00029 10/14 Allele 1 5' CT*G A 3' GAC T G T G Overhang
position 1 2 3 4 10/14 Allele 2 5' CT*G G C A 3' GAC C G T G
Overhang position 1 2 3 4
Unlabeled ddATP, unlabeled dCTP, unlabeled dGTP, and unlabeled dTTP
can be used to fill-in the 5' overhang. Two signals will be
generated; one signal corresponds to the DNA molecules filled in
with unlabeled ddATP at position 1 complementary to the overhang
and the second signal corresponds to DNA molecules filled in with
unlabeled ddATP at position 3 complementary to the overhang. The
DNA molecules can be separated based on molecular weight and can be
detected by the fluorescence of the dTTP, which was incorporated
during the PCR reaction.
The labeled DNA loci of interest sites can be analyzed by a variety
of methods including but not limited to fluorescence detection, DNA
sequencing gel, capillary electrophoresis on an automated DNA
sequencing machine, microchannel electrophoresis, and other methods
of sequencing, mass spectrometry, time of flight mass spectrometry,
quadrupole mass spectrometry, magnetic sector mass spectrometry,
electric sector mass spectrometry infrared spectrometry,
ultraviolet spectrometry, palentiostatic amperometry or by DNA
hybridization techniques including Southern Blots, Slot Blots, Dot
Blots, and DNA microarrays, wherein DNA fragments would be useful
as both "probes" and "targets," ELISA, fluorimetry, and
Fluorescence Resonance Energy Transfer (FRET).
This method of labeling is extremely sensitive and allows the
detection of alleles of a locus of interest that are in various
ratios including but not limited to 1:1, 1:2, 1:3, 1:4, 1:5, 1:6
1:10, 1:11 1:20, 1:21 1:30, 1:31 1:40, 1:41 1:50, 1:51 1:60, 1:61
1:70, 1:71 1:80, 1:81 1:90, 1:91:1:100, 1:101 1:200, 1:250, 1:251
1:300, 1:301 1:400, 1:401 1:500, 1:501 1:600, 1:601 1:700, 1:701
1:800, 1:801 1:900, 1:901 1:1000, 1:1001 1:2000, 1:2001 1:3000,
1:3001 1:4000, 1:4001 1:5000, 1:5001 1:6000, 1:6001 1:7000, 1:7001
1:8000, 1:8001 1:9000, 1:9001 1:10,000; 1:10,001 1:20,000,
1:20,001:1:30,000, 1:30,001 1:40,000, 1:40,001 1:50,000, and
greater than 1:50,000.
For example, this method of labeling allows one nucleotide labeled
with one signal generating moiety to be used to determine the
sequence of alleles at a SNP locus, or detect a mutant allele
amongst a population of normal alleles, or detect an allele
encoding antibiotic resistance from a bacterial cell amongst
alleles from antibiotic sensitive bacteria, or detect an allele
from a drug resistant virus amongst alleles from drug-sensitive
virus, or detect an allele from a non-pathogenic bacterial strain
amongst alleles from a pathogenic bacterial strain.
As shown above, a single nucleotide can be used to determine the
sequence of the alleles at a particular locus of interest. This
method is especially useful for determining if an individual is
homozygous or heterozygous for a particular mutation or to
determine the sequence of the alleles at a particular SNP site.
This method of labeling eliminates any errors caused by the quantum
coefficients of various dyes. It also allows the reaction to
proceed in a single reaction vessel including but not limited to a
well of a microtiter plate, or a single eppendorf tube.
This method of labeling is especially useful for the detection of
multiple genetic signals in the same sample. For example, this
method is useful for the detection of fetal DNA in the blood,
serum, or plasma of a pregnant female, which contains both maternal
DNA and fetal DNA. The maternal DNA and fetal DNA may be present in
the blood, serum or plasma at ratios such as 97:3; however, the
above-described method can be used to detect the fetal DNA. This
method of labeling can be used to detect two, three, or four
different genetic signals in the sample population
This method of labeling is especially useful for the detection of a
mutant allele that is among a large population of wild type
alleles. Furthermore, this method of labeling allows the detection
of a single mutant cell in a large population of wild type cells.
For example, this method of labeling can be used to detect a single
cancerous cell among a large population of normal cells. Typically,
cancerous cells have mutations in the DNA sequence. The mutant DNA
sequence can be identified even if there is a large background of
wild type DNA sequence. This method of labeling can be used to
screen, detect, or diagnosis any type of cancer including but not
limited to colon, renal, breast, bladder, liver, kidney, brain,
lung, prostate, and cancers of the blood including leukemia.
This labeling method can also be used to detect pathogenic
organisms, including but not limited to bacteria, fungi, viruses,
protozoa, and mycobacteria. It can also be used to discriminate
between pathogenic strains of microorganism and non-pathogenic
strains of microorganisms including but not limited to bacteria,
fungi, viruses, protozoa, and mycobacteria.
For example, there are several strains of Escherichia coli (E.
coli), and most are non-pathogenic. However, several strains, such
as E. coli 0157 are pathogenic. There are genetic differences
between non-pathogenic E. coli strains and pathogenic E. coli. The
above described method of labeling can be used to detect pathogenic
microorganisms in a large population of non-pathogenic organisms,
which are sometimes associated with the normal flora of an
individual.
In another embodiment, the sequence of the locus of interest can be
determined by detecting the incorporation of a nucleotide that is
3' to the locus of interest, wherein said nucleotide is a different
nucleotide from the possible nucleotides at the locus of interest.
This embodiment is especially useful for the sequencing and
detection of SNPs. The efficiency and rate at which DNA polymerases
incorporate nucleotides varies for each nucleotide.
According to the data from the Human Genome Project, 99% of all
SNPs are binary. The sequence of the human genome can be used to
determine the nucleotide that is 3' to the SNP of interest. When
the nucleotide that is 3' to the SNP site differs from the possible
nucleotides at the SNP site, a nucleotide that is one or more than
one base 3' to the SNP can be used to determine the identity of the
SNP.
For example, suppose the identity of SNP X on chromosome 13 is to
be determined. The sequence of the human genome indicates that SNP
X can either be adenosine or guanine and that a nucleotide 3' to
the locus of interest is a thymidine. A primer that contains a
restriction enzyme recognition site for BsmF I, which is designed
to be 13 bases from the locus of interest after amplification, is
used to amplify a DNA fragment containing SNP X. Digestion with the
restriction enzyme BsmF I generates a 5' overhang that contains the
locus of interest, which can either be adenosine or guanine. The
digestion products can be split into two "fill in" reactions: one
contains dTTP, and the other reaction contains dCTP. If the locus
of interest is homozygous for guanine, only the DNA molecules that
were mixed with dCTP will be filled in. If the locus of interest is
homozygous for adenosine, only the DNA molecules that were mixed
with dTTP will be filled in. If the locus of interest is
heterozygous, the DNA molecules that were mixed with dCTP will be
filled in as well as the DNA molecules that were mixed with dTTP.
After washing to remove the excess dNTP, the samples are filled in
with labeled ddATP, which is complementary to the nucleotide
(thymidine) that is 3' to the locus of interest. The DNA molecules
that were filled in by the previous reaction will be filled in with
labeled ddATP. If the individual is homozygous for adenosine, the
DNA molecules that were mixed with dTTP subsequently will be filled
in with the labeled ddATP. However, the DNA molecules that were
mixed with dCTP, would not have incorporated that nucleotide, and
therefore, could not incorporate the ddATP. Detection of labeled
ddATP only in the molecules that were mixed with dTTP indicates
that the identity of the nucleotide at SNP X on chromosome 13 is
adenosine.
In another embodiment, large scale screening for the presence or
absence of single nucleotide mutations can be performed. One to
tens to hundreds to thousands of loci of interest on a single
chromosome or on multiple chromosomes can be amplified with primers
as described above in the "Primer Design" section. The primers can
be designed so that each amplified loci of interest is of a
different size (FIG. 2). The amplified loci of interest that are
predicted, based on the published wild type sequences, to have the
same nucleotide at the locus of interest can be pooled together,
bound to a solid support, including wells of a microtiter plate
coated with streptavidin, and digested with the restriction enzyme
that will bind the recognition site on the second primer. After
digestion, the 3' recessed end can be filled in with a mixture of
labeled ddATP, ddTTP, ddGTP, ddCTP, where each nucleotide is
labeled with a different group. After washing to remove the excess
nucleotide, the fluorescence spectra can be detected using a plate
reader or fluorimeter directly on the streptavidin coated plates.
If all 50 loci of interest contain the wild type nucleotide, only
one fluorescence spectra will be seen. However, if one or more than
one of the 50 loci of interest contain a mutation, a different
nucleotide will be incorporated and other fluorescence pattern(s)
will be seen. The nucleotides can be released from the solid
matrix, and analyzed on a sequencing gel to determine the loci of
interest that contained the mutations. As each of the 50 loci of
interest are of different size, they will separate on a sequencing
gel.
The multiple loci of interest can be of a DNA sample from one
individual representing multiple loci of interest on a single
chromosome, multiple chromosomes, multiple genes, a single gene, or
any combination thereof. The multiple loci of interest also can
represent the same locus of interest but from multiple individuals.
For example, 50 DNA samples from 50 different individuals can be
pooled and analyzed to determine a particular nucleotide of
interest at gene "X."
When human data is being analyzed, the known sequence can be a
specific sequence that has been determined from one individual
(including e.g. the individual whose DNA is currently being
analyzed), or it can be a consensus sequence such as that published
as part of the human genome.
Kits
The methods of the invention are most conveniently practiced by
providing the reagents used in the methods in the form of kits. A
kit preferably contains one or more of the following components:
written instructions for the use of the kit, appropriate buffers,
salts, DNA extraction detergents, primers, nucleotides, labeled
nucleotides, 5' end modification materials, and if desired, water
of the appropriate purity, confined in separate containers or
packages, such components allowing the user of the kit to extract
the appropriate nucleic acid sample, and analyze the same according
to the methods of the invention. The primers that are provided with
the kit will vary, depending upon the purpose of the kit and the
DNA that is desired to be tested using the kit. In preferred
embodiments the kits contain a primer that allows the generation of
a recognition site for a restriction enzyme such that digestion
with the enzyme generates in the DNA fragment generated during the
sequencing method, a 5' overhang containing the locus of
interest.
A kit can also be designed to detect a desired or variety of single
nucleotide polymorphisms, especially those associated with an
undesired condition or disease. For example, one kit can comprise,
among other components, a set or sets of primers to amplify one or
more loci of interest associated with breast cancer. Another kit
can comprise, among other components, a set or sets of primers for
genes associated with a predisposition to develop type I or type II
diabetes. Still, another kit can comprise, among other components,
a set or sets of primers for genes associated with a predisposition
to develop heart disease. Details of utilities for such kits are
provided in the "Utilities" section below.
Utilities
The methods of the invention can be used whenever it is desired to
know the sequence of a certain nucleic acid, locus of interest or
loci of interest therein. The method of the invention is especially
useful when applied to genomic DNA. When DNA from an
organism-specific or species-specific locus or loci of interest is
amplified, the method of the invention can be used in genotyping
for identification of the source of the DNA, and thus confirm or
provide the identity of the organism or species from which the DNA
sample was derived. The organism can be any nucleic acid containing
organism, for example, virus, bacterium, yeast, plant, animal or
human.
Within any population of organisms, the method of the invention is
useful to identify differences between the sequence of the sample
nucleic acid and that of a known nucleic acid. Such differences can
include, for example, allelic variations, mutations, polymorphisms
and especially single nucleotide polymorphisms.
In a preferred embodiment, the method of the invention provides a
method for identification of single nucleotide polymorphisms.
In a preferred embodiment, the method of the invention provides a
method for identification of the presence of a disease, especially
a genetic disease that arises as a result of the presence of a
genomic sequence, or other biological condition that it is desired
to identify in an individual for which it is desired to know the
same. The identification of such sequence in the subject based on
the presence of such genomic sequence can be used, for example, to
determine if the subject is a carrier or to assess if the subject
is predisposed to developing a certain genetic trait, condition or
disease. The method of the invention is especially useful in
prenatal genetic testing of parents and child. Examples of some of
the diseases that can be diagnosed by this invention are listed in
Table II.
TABLE-US-00030 TABLE II Achondroplasia Adrenoleukodystrophy,
X-Linked Agammaglobulinemia, X-Linked Alagille Syndrome
Alpha-Thalassemia X-Linked Mental Retardation Syndrome Alzheimer
Disease Alzheimer Disease, Early-Onset Familial Amyotrophic Lateral
Sclerosis Overview Androgen Insensitivity Syndrome Angelman
Syndrome Ataxia Overview, Hereditary Ataxia-Telangiectasia Becker
Muscular Dystrophy (also The Dystrophinopathies) Beckwith-Wiedemann
Syndrome Beta-Thalassemia Biotinidase Deficiency Branchiootorenal
Syndrome BRCA1 and BRCA2 Hereditary Breast/Ovarian Cancer Breast
Cancer CADASIL Canavan Disease Cancer Charcot-Marie-Tooth
Hereditary Neuropathy Charcot-Marie-Tooth Neuropathy Type 1
Charcot-Marie-Tooth Neuropathy Type 2 Charcot-Marie-Tooth
Neuropathy Type 4 Charcot-Marie-Tooth Neuropathy Type X Cockayne
Syndrome Colon Cancer Contractural Arachnodactyly, Congenital
Craniosynostosis Syndromes (FGFR-Related) Cystic Fibrosis
Cystinosis Deafness and Hereditary Hearing Loss DRPLA
(Dentatorubral-Pallidoluysian Atrophy) DiGeorge Syndrome (also
22q11 Deletion Syndrome) Dilated Cardiomyopathy, X-Linked Down
Syndrome (Trisomy 21) Duchenne Muscular Dystrophy (also The
Dystrophinopathies) Dystonia, Early-Onset Primary (DYT1)
Dystrophinopathies, The Ehlers-Danlos Syndrome, Kyphoscoliotic Form
Ehlers-Danlos Syndrome, Vascular Type Epidermolysis Bullosa Simplex
Exostoses, Hereditary Multiple Facioscapulohumeral Muscular
Dystrophy Factor V Leiden Thrombophilia Familial Adenomatous
Polyposis (FAP) Familial Mediterranean Fever Fragile X Syndrome
Friedreich Ataxia Frontotemporal Dementia with Parkinsonism-17
Galactosemia Gaucher Disease Hemochromatosis, Hereditary Hemophilia
A Hemophilia B Hemorrhagic Telangiectasia, Hereditary Hearing Loss
and Deafness, Nonsyndromic, DFNA3 (Connexin 26) Hearing Loss and
Deafness, Nonsyndromic, DFNB1 (Connexin 26) Hereditary Spastic
Paraplegia Hermansky-Pudlak Syndrome Hexosaminidase A Deficiency
(also Tay-Sachs) Huntington Disease Hypochondroplasia Ichthyosis,
Congenital, Autosomal Recessive Incontinentia Pigmenti Kennedy
Disease (also Spinal and Bulbar Muscular Atrophy) Krabbe Disease
Leber Hereditary Optic Neuropathy Lesch-Nyhan Syndrome Leukemias
Li-Fraumeni Syndrome Limb-Girdle Muscular Dystrophy Lipoprotein
Lipase Deficiency, Familial Lissencephaly Marfan Syndrome MELAS
(Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-Like
Episodes) Monosomies Multiple Endocrine Neoplasia Type 2 Multiple
Exostoses, Hereditary Muscular Dystrophy, Congenital Myotonic
Dystrophy Nephrogenic Diabetes Insipidus Neurofibromatosis 1
Neurofibromatosis 2 Neuropathy with Liability to Pressure Palsies,
Hereditary Niemann-Pick Disease Type C Nijmegen Breakage Syndrome
Norrie Disease Oculocutaneous Albinism Type 1 Oculopharyngeal
Muscular Dystrophy Ovarian Cancer Pallister-Hall Syndrome Parkin
Type of Juvenile Parkinson Disease Pelizaeus-Merzbacher Disease
Pendred Syndrome Peutz-Jeghers Syndrome Phenylalanine Hydroxylase
Deficiency Prader-Willi Syndrome PROP1-Related Combined Pituitary
Hormone Deficiency (CPHD) Prostate Cancer Retinitis Pigmentosa
Retinoblastoma Rothmund-Thomson Syndrome Smith-Lemli-Opitz Syndrome
Spastic Paraplegia, Hereditary Spinal and Bulbar Muscular Atrophy
(also Kennedy Disease) Spinal Muscular Atrophy Spinocerebellar
Ataxia Type 1 Spinocerebellar Ataxia Type 2 Spinocerebellar Ataxia
Type 3 Spinocerebellar Ataxia Type 6 Spinocerebellar Ataxia Type 7
Stickler Syndrome (Hereditary Arthroophthalmopathy) Tay-Sachs (also
GM2 Gangliosidoses) Trisomies Tuberous Sclerosis Complex Usher
Syndrome Type I Usher Syndrome Type II Velocardiofacial Syndrome
(also 22q11 Deletion Syndrome) Von Hippel-Lindau Syndrome Williams
Syndrome Wilson Disease X-Linked Adrenoleukodystrophy X-Linked
Agammaglobulinemia X-Linked Dilated Cardiomyopathy (also The
Dystrophinopathies) X-Linked Hypotonic Facies Mental Retardation
Syndrome
The method of the invention is useful for screening an individual
at multiple loci of interest, such as tens, hundreds, or even
thousands of loci of interest associated with a genetic trait or
genetic disease by sequencing the loci of interest that are
associated with the trait or disease state, especially those most
frequently associated with such trait or condition. The invention
is useful for analyzing a particular set of diseases including but
not limited to heart disease, cancer, endocrine disorders, immune
disorders, neurological disorders, musculoskeletal disorders,
ophthalmologic disorders, genetic abnormalities, trisomies,
monosomies, transversions, translocations, skin disorders, and
familial diseases.
The method of the invention can be used to genotype microorganisms
so as to rapidly identify the presence of a specific microorganism
in a substance, for example, a food substance. In that regard, the
method of the invention provides a rapid way to analyze food,
liquids or air samples for the presence of an undesired biological
contamination, for example, microbiological, fungal or animal waste
material. The invention is useful for detecting a variety of
organisms, including but not limited to bacteria, viruses, fungi,
protozoa, molds, yeasts, plants, animals, and archaebacteria. The
invention is useful for detecting organisms collected from a
variety of sources including but not limited to water, air, hotels,
conference rooms, swimming pools, bathrooms, aircraft, spacecraft,
trains, buses, cars, offices, homes, businesses, churches, parks,
beaches, athletic facilities, amusement parks, theaters, and any
other facility that is a meeting place for the public.
The method of the invention can be used to test for the presence of
many types of bacteria or viruses in blood cultures from human or
animal blood samples.
The method of the invention can also be used to confirm or identify
the presence of a desired or undesired yeast strain, or certain
traits thereof, in fermentation products, e.g. wine, beer, and
other alcohols or to identify the absence thereof.
The method of the invention can also be used to confirm or identify
the relationship of a DNA of unknown sequence to a DNA of known
origin or sequence, for example, for use in criminology, forensic
science, maternity or paternity testing, archeological analysis,
and the like.
The method the invention can also be used to determine the
genotypes of plants, trees and bushes, and hybrid plants, trees and
bushes, including plants, trees and bushes that produce fruits and
vegetables and other crops, including but not limited to wheat,
barley, corn, tobacco, alfalfa, apples, apricots, bananas, oranges,
pears, nectarines, figs, dates, raisins, plums, peaches, apricots,
blueberries, strawberries, cranberries, berries, cherries, kiwis,
limes, lemons, melons, pineapples, plantains, guavas, prunes,
passion fruit, tangerines, grapefruit, grapes, watermelon,
cantaloupe, honeydew melons, pomegranates, persimmons, nuts,
artichokes, bean sprouts, beets, cardoon, chayote, endive, leeks,
okra, green onions, scallions, shallots, parsnips, sweet potatoes,
yams, asparagus, avocados, kohlrabi, rutabaga, eggplant, squash,
turnips, pumpkins, tomatoes, potatoes, cucumbers, carrots, cabbage,
celery, broccoli, cauliflower, radishes, peppers, spinach,
mushrooms, zucchini, onions, peas, beans, and other legumes.
Especially, the method of the invention is useful to screen a
mixture of nucleic acid samples that contain many different loci of
interest and/or a mixture of nucleic acid samples from different
sources that are to be analyzed for a locus of interest. Examples
of large scale screening include taking samples of nucleic acid
from herds of farm animals, or crops of food plants such as, for
example, corn or wheat, pooling the same, and then later analyzing
the pooled samples for the presence of an undesired genetic marker,
with individual samples only being analyzed at a later date if the
pooled sample indicates the presence of such undesired genetic
sequence. An example of an undesired genetic sequence would be the
detection of viral or bacterial nucleic acid sequence in the
nucleic acid samples taken from the farm animals, for example,
mycobacterium or hoof and mouth disease virus sequences or fungal
or bacterial pathogen of plants.
Another example where pools of nucleic acid can be used is to test
for the presence of a pathogen or gene mutation in samples from one
or more tissues from an animal or human subject, living or dead,
especially a subject who can be in need of treatment if the
pathogen or mutation is detected. For example, numerous samples can
be taken from an animal or human subject to be screened for the
presence of a pathogen or otherwise undesired genetic mutation, the
loci of interest from each biological sample amplified
individually, and then samples of the amplified DNA combined for
the restriction digestion, "filling in," and detection. This would
be useful as an initial screening for the assay of the presence or
absence of nucleic acid sequences that would be diagnostic of the
presence of a pathogen or mutation. Then, if the undesired nucleic
acid sequence of the pathogen or mutation was detected, the
individual samples could be separately analyzed to determine the
distribution of the undesired sequence. Such an analysis is
especially cost effective when there are large numbers of samples
to be assayed. Samples of pathogens include the mycobacteria,
especially those that cause tuberculosis or paratuberculosis,
bacteria, especially bacterial pathogens used in biological
warfare, including Bacillus anthracis, and virulent bacteria
capable of causing food poisoning, viruses, especially the
influenza and AIDS virus, and mutations known to be associated with
malignant cells. Such an analysis would also be advantageous for
the large scale screening of food products for pathogenic
bacteria.
Conversely, the method of the invention can be used to detect the
presence and distribution of a desired genetic sequence at various
locations in a plant, animal or human subject, or in a population
of subjects, e.g. by screening of a combined sample followed by
screening of individual samples, as necessary.
The method of the invention is useful for analyzing genetic
variations of an individual that have an effect on drug metabolism,
drug interactions, and the responsiveness to a drug or to multiple
drugs. The method of the invention is especially useful in
pharmacogenomics.
Having now generally described the invention, the same will become
better understood by reference to certain specific examples which
are included herein for purposes of illustration only and are not
intended to be limiting unless other wise specified.
EXAMPLES
The following examples are illustrative only and are not intended
to limit the scope of the invention as defined by the claims.
Example 1
DNA sequences were amplified by PCR, wherein the annealing step in
cycle 1 was performed at a specified temperature, and then
increased in cycle 2, and further increased in cycle 3 for the
purpose of reducing non-specific amplification. The TM1 of cycle 1
of PCR was determined by calculating the melting temperature of the
3' region, which anneals to the template DNA, of the second primer.
For example, in FIG. 1B, the TM1 can be about the melting
temperature of region "c." The annealing temperature was raised in
cycle 2, to TM2, which was about the melting temperature of the 3'
region, which anneals to the template DNA, of the first primer. For
example, in FIG. 1C, the annealing temperature (TM2) corresponds to
the melting temperature of region "b'". In cycle 3, the annealing
temperature was raised to TM3, which was about the melting
temperature of the entire sequence of the second primer For
example, in FIG. 1D, the annealing temperature (TM3) corresponds to
the melting temperature of region "c"+region "d". The remaining
cycles of amplification were performed at TM3.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained
by venipuncture from a human volunteer with informed consent. Blood
was collected from 36 volunteers. Template DNA was isolated from
each blood sample using QIAamp DNA Blood Midi Kit supplied by
QIAGEN (Catalog number 51183). Following isolation, the template
DNA from each of the 36 volunteers was pooled for further
analysis.
Design of Primers
The following four single nucleotide polymorphisms were analyzed:
SNP HC21S00340, identification number as assigned by Human
Chromosome 21 cSNP Database, (FIG. 3, lane 1) located on chromosome
21; SNP TSC 0095512 (FIG. 3, lane 2) located on chromosome 1, SNP
TSC 0214366 (FIG. 3, lane 3) located on chromosome 1; and SNP TSC
0087315 (FIG. 3, lane 4) located on chromosome 1. The SNP
Consortium Ltd database can be accessed at http://snp.cshl.org/,
website address effective as of Feb. 14, 2002.
TABLE-US-00031 SNP HC21S00340 was amplified using the following
primers: First primer: 5' TAGAATAGCACTGAATTCAGGAATACAATCATTGTCAC 3'
(SEQ ID NO:9) Second primer: 5' ATCACGATAAACGGCCAAACTCAGGTTA 3'
(SEQ ID NO:10) SNP T5C0095512 was amplified using the following
primers: First primer: 5' AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG 3'
(SEQ ID NO:11) Second primer: 5' TCTCCAACTAACGGCTCATCGAGTAAAG 3'
(SEQ ID NO:12) SNP TSC0214366 was amplified using the following
primers: First primer: 5' ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA 3'
(SEQ ID NO:13) Second primer: 5' GAGAATTAGAACGGCCCAAATCCCACTC 3'
(SEQ ID NO:14) SNP TSC 0087315 was amplified using the following
primers: First primer: 5' TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC 3'
(SEQ ID NO:15) Second primer: 5' TGGACCATAAACGGCCAAAAACTGTAAG 3'
(SEQ ID NO:16)
All primers were designed such that the 3' region was complementary
to either the upstream or downstream sequence flanking each locus
of interest and the 5' region contained a restriction enzyme
recognition site. The first primer contained a biotin tag at the 5'
end and a recognition site for the restriction enzyme EcoRI. The
second primer contained the recognition site for the restriction
enzyme BceA I.
PCR Reaction
All four loci of interest were amplified from the template genomic
DNA using PCR (U.S. Pat. Nos. 4,683,195 and 4,683,202). The
components of the PCR reaction were as follows: 40 ng of template
DNA, 5 .mu.M first primer, 5 .mu.M second primer, 1.times.
HotStarTaq Master Mix as obtained from QIAGEN (Catalog No. 203443).
The HotStarTaq Master Mix contained DNA polymerase, PCR buffer, 200
.mu.M of each dNTP, and 1.5 mM MgCl.sub.2.
Amplification of each template DNA that contained the SNP of
interest was performed using three different series of annealing
temperatures, herein referred to as low stringency annealing
temperature, medium stringency annealing temperature, and high
stringency annealing temperature. Regardless of the annealing
temperature protocol, each PCR reaction consisted of 40 cycles of
amplification. PCR reactions were performed using the HotStarTaq
Master Mix Kit supplied by QIAGEN. As instructed by the
manufacturer, the reactions were incubated at 95.degree. C. for 15
min. prior to the first cycle of PCR. The denaturation step after
each extension step was performed at 95.degree. C. for 30 sec. The
annealing reaction was performed at a temperature that permitted
efficient extension without any increase in temperature.
The low stringency annealing reaction comprised three different
annealing temperatures in each of the first three cycles. The
annealing temperature for the first cycle was 37.degree. C. for 30
sec.; the annealing temperature for the second cycle was 57.degree.
C. for 30 sec.; the annealing temperature for the third cycle was
64.degree. C. for 30 sec. Annealing was performed at 64.degree. C.
for subsequent cycles until completion.
As shown in the photograph of the gel (FIG. 3A), multiple bands
were observed after amplification of the DNA template containing
SNP TSC 0087315 (lane 4). Amplification of the DNA templates
containing SNP HC21S00340 (lane 1), SNP TSC0095512 (lane 2), and
SNP TSC0214366 (lane 3) generated a single band of high intensity
and one band of faint intensity, which was of higher molecular
weight. When the low annealing temperature conditions were used,
the correct size product was generated and this was the predominant
product in each reaction.
The medium stringency annealing reaction comprised three different
annealing temperatures in each of the first three cycles. The
annealing temperature for the first cycle was 40.degree. C. for 30
seconds; the annealing temperature for the second cycle was
60.degree. C. for 30 seconds; and the annealing temperature for the
third cycle was 67.degree. C. for 30 seconds. Annealing was
performed at 67.degree. C. for subsequent cycles until completion.
Similar to what was observed under low stringency annealing
conditions, amplification of the DNA template containing SNP
TSC0087315 (FIG. 3B, lane 4) generated multiple bands under
conditions of medium stringency. Amplification of the other three
DNA fragments containing SNPs (lanes 1 3) produced a single band.
These results demonstrate that variable annealing temperatures can
be used to cleanly amplify loci of interest from genomic DNA with a
primer that has an annealing length of 13 bases.
The high stringency annealing reaction was comprised of three
different annealing temperatures in each of the first three cycles.
The annealing temperature of the first cycle was 46.degree. C. for
30 seconds; the annealing temperature of the second cycle was
65.degree. C. for 30 seconds; and the annealing temperature for the
third cycle was 72.degree. C. for 30 seconds. Annealing was
performed at 72.degree. C. for subsequent cycles until completion.
As shown in the photograph of the gel (FIG. 3C), amplification of
the DNA template containing SNP TSC0087315 (lane 4) using the high
stringency annealing temperatures generated a single band of the
correct molecular weight. By raising the annealing temperatures for
each of the first three cycles, non-specific amplification was
eliminated. Amplification of the DNA fragment containing SNP
TSC0095512 (lane 2) generated a single band. DNA fragments
containing SNPs HC21S00340 (lane 1), and TSC0214366 (lane 3) failed
to amplify at the high stringency annealing temperatures, however,
at the medium stringency annealing temperatures, these DNA
fragments containing SNPs amplified as a single band. These results
demonstrate that variable annealing temperatures can be used to
reduce non-specific PCR products, as demonstrated for the DNA
fragment containing SNP TSC0087315 (FIG. 3, lane 4).
Example 2
SNPs on chromosomes 1 (TSC0095512), 13 (TSC0264580), and 21
(HC21S00027) were analyzed. SNP TSC0095512 was analyzed using two
different sets of primers, and SNP HC21S00027 was analyzed using
two types of reactions for the incorporation of nucleotides.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained
by venipuncture from a human volunteer with informed consent.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit
supplied by QIAGEN (Catalog number 51183). The template DNA was
isolated as per instructions included in the kit. Following
isolation, template DNA from thirty-six human volunteers were
pooled together and cut with the restriction enzyme EcoRI. The
restriction enzyme digestion was performed as per manufacturer's
instructions.
Design of Primers
SNP HC21S00027 was amplified by PCR using the following primer
set:
TABLE-US-00032 First primer: 5'
ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3' (SEQ ID NO:17) Second
primer: 5' CTTAAATCAGGGGACTAGGTAAACTTCA 3' (SEQ ID NO:18)
The first primer contained a biotin tag at the extreme 5' end, and
the nucleotide sequence for the restriction enzyme EcoRI. The
second primer contained the nucleotide sequence for the restriction
enzyme BsmF I (FIG. 4A).
Also, SNP HC21S00027 was amplified by PCR using the same first
primer but a different second primer with the following sequence:
Second primer: 5' CTTAAATCAGACGGCTAGGTAAACTTCA 3' (SEQ ID
NO:19)
This second primer contained the recognition site for the
restriction enzyme BceA I (FIG. 4B).
SNP TSC0095512 was amplified by PCR using the following primers:
First primer: 5' AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG 3' (SEQ ID
NO:11) Second primer: 5' TCTCCAACTAGGGACTCATCGAGTAAAG 3' (SEQ ID
NO:20)
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The second primer
contained a restriction enzyme recognition site for BsmF I (FIG.
4C).
Also, SNP TSC0095512 was amplified using the same first primer and
a different second primer with the following sequence: Second
primer: 5' TCTCCAACTAACGGCTCATCGAGTAAAG 3' (SEQ ID NO: 12)
This second primer contained the recognition site for the
restriction enzyme BceA I (FIG. 4D).
SNP TSC0264580, which is located on chromosome 13, was amplified
with the following primers: First primer: 5'
AACGCCGGGCGAGAATTCAGTTTTTCAACTTGCAAGG 3' (SEQ ID NO:21) Second
primer: 5' CTACACATATCTGGGACGTTGGCCATCC 3' (SEQ ID NO:22)
The first primer contained a biotin tag at the extreme 5' end and
had a restriction enzyme recognition site for EcoRI. The second
primer contained a restriction enzyme recognition site for BsmF
I.
PCR Reaction
All loci of interest were amplified from the template genomic DNA
using the polymerase chain reaction (PCR, U.S. Pat. Nos. 4,683,195
and 4,683,202, incorporated herein by reference). In this example,
the loci of interest were amplified in separate reaction tubes but
they could also be amplified together in a single PCR reaction. For
increased specificity, a "hot-start" PCR was used. PCR reactions
were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog number 203443). The amount of template DNA and
primer per reaction can be optimized for each locus of interest but
in this example, 40 ng of template human genomic DNA and 5 .mu.M of
each primer were used. Forty cycles of PCR were performed. The
following PCR conditions were used: (1) 95.degree. C. for 15
minutes and 15 seconds; (2) 37.degree. C. for 30 seconds; (3)
95.degree. C. for 30 seconds; (4) 57.degree. C. for 30 seconds; (5)
95.degree. C. for 30 seconds; (6) 64.degree. C. for 30 seconds; (7)
95.degree. C. for 30 seconds; (8) Repeat steps 6 and 7 thirty nine
(39) times; (9) 72.degree. C. for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the
melting temperature of the 3' annealing region of the second
primers, which was 37.degree. C. The annealing temperature in the
second cycle of PCR was about the melting temperature of the 3'
region, which anneals to the template DNA, of the first primer,
which was 57.degree. C. The annealing temperature in the third
cycle of PCR was about the melting temperature of the entire
sequence of the second primer, which was 64.degree. C. The
annealing temperature for the remaining cycles was 64.degree. C.
Escalating the annealing temperature from TM1 to TM2 to TM3 in the
first three cycles of PCR greatly improves specificity. These
annealing temperatures are representative, and the skilled artisan
will understand the annealing temperatures for each cycle are
dependent on the specific primers used.
The temperatures and times for denaturing, annealing, and
extension, can be optimized by trying various settings and using
the parameters that yield the best results. Schematics of the PCR
products for SNP HC21S00027 and SNP TSC095512 are shown in FIGS. 5A
5D.
Purification of Fragment Containing Locus of Interest
The PCR products were separated from the genomic template DNA. Each
PCR product was divided into four separate reaction wells of a
Streptawell, transparent, High-Bind plate from Roche Diagnostics
GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001 Biochemicals Catalog). The first primers
contained a 5' biotin tag so the PCR products bound to the
Streptavidin coated wells while the genomic template DNA did not.
The streptavidin binding reaction was performed using a Thermomixer
(Eppendorf) at 1000 rpm for 20 min. at 37.degree. C. Each well was
aspirated to remove unbound material, and washed three times with
1.times. PBS, with gentle mixing (Kandpal et al., Nucl. Acids Res.
18:1789 1795 (1990); Kaneoka et al., Biotechniques 10:30 34 (1991);
Green et al., Nucl. Acids Res. 18:6163 6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments Containing Loci
of Interest
The purified PCR products were digested with the restriction enzyme
that bound the recognition site incorporated into the PCR products
from the second primer. DNA templates containing SNP HC21S00027
(FIGS. 6A and 6B) and SNP TSC0095512 (FIGS. 6C and 6D) were
amplified in separate reactions using two different second primers.
FIG. 6A (SNP HC21S00027) and FIG. 6C (SNP TSC0095512) depict the
PCR products after digestion with the restriction enzyme BsmF I
(New England Biolabs catalog number R0572S). FIG. 6B (SNP
HC21S00027) and FIG. 6D (SNP TSC0095512) depict the PCR products
after digestion with the restriction enzyme BceA I (New England
Biolabs, catalog number R0623S). The digests were performed in the
Streptawells following the instructions supplied with the
restriction enzyme. The DNA fragment containing SNP TSC0264580 was
digested with BsmF I. After digestion with the appropriate
restriction enzyme, the wells were washed three times with PBS to
remove the cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest described above yielded a DNA
fragment with a 5' overhang, which contained the SNP site or locus
of interest and a 3' recessed end. The 5' overhang functioned as a
template allowing incorporation of a nucleotide or nucleotides in
the presence of a DNA polymerase.
For each SNP, four separate fill in reactions were performed; each
of the four reactions contained a different fluorescently labeled
ddNTP (ddATP, ddTTP, ddGTP, or ddCTP). The following components
were added to each fill in reaction: 1 .mu.l of a fluorescently
labeled ddNTP, 0.5 .mu.l of unlabeled ddNTPs (40 .mu.M), which
contained all nucleotides except the nucleotide that was
fluorescently labeled, 2 .mu.l of 10.times. sequenase buffer, 0.25
.mu.l of Sequenase, and water as needed for a 20 .mu.l reaction.
All of the fill in reactions were performed at 40.degree. C. for 10
min. Non-fluorescently labeled ddNTP was purchased from Fermentas
Inc. (Hanover, Md.). All other labeling reagents were obtained from
Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing Core
Kit, US 79565). In the presence of fluorescently labeled ddNTPs,
the 3' recessed end was extended by one base, which corresponds to
the SNP or locus of interest (FIGS. 7A 7D).
A mixture of labeled ddNTPs and unlabeled dNTPs also was used for
the "fill in" reaction for SNP HC21S00027. The "fill in" conditions
were as described above except that a mixture containing 40 .mu.M
unlabeled dNTPs, 1 .mu.l fluorescently labeled ddATP, 1 .mu.l
fluorescently labeled ddTTP, 1 .mu.l fluorescently labeled ddCTP,
and 1 .mu.l ddGTP was used. The fluorescent ddNTPs were obtained
from Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing
Core Kit, US 79565; Amersham did not publish the concentrations of
the fluorescent nucleotides). The DNA fragment containing SNP
HC21S00027 was digested with the restriction enzyme BsmF I, which
generated a 5' overhang of four bases. As shown in FIG. 7E, if the
first nucleotide incorporated is a labeled ddNTP, the 3' recessed
end is filled in by one base, allowing detection of the SNP or
locus of interest. However, if the first nucleotide incorporated is
a dNTP, the polymerase continues to incorporate nucleotides until a
ddNTP is filled in. For example, the first two nucleotides may be
filled in with dNTPs, and the third nucleotide with a ddNTP,
allowing detection of the third nucleotide in the overhang. Thus,
the sequence of the entire 5' overhang may be determined, which
increases the information obtained from each SNP or locus of
interest.
After labeling, each Streptawell was rinsed with 1.times. PBS (100
.mu.l) three times. The "filled in" DNA fragments were then
released from the Streptawells by digestion with the restriction
enzyme EcoRI, according to the manufacturer's instructions that
were supplied with the enzyme (FIGS. 8A 8D). Digestion was
performed for 1 hour at 37.degree. C. with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, 2 3 .mu.l of the 10
.mu.l sample was loaded in a 48 well membrane tray (The Gel
Company, catalog number TAM48-01). The sample in the tray was
absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog
number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel
(BioWhittaker Molecular Applications, Long Ranger Run Gel Packs,
catalog number 50691).
The sample was electrophoresed into the gel at 3000 volts for 3
min. The membrane comb was removed, and the gel was run for 3 hours
on an ABI 377 Automated Sequencing Machine. The incorporated
labeled nucleotide was detected by fluorescence.
As shown in FIG. 9A, from a sample of thirty six (36) individuals,
one of two nucleotides, either adenosine or guanine, was detected
at SNP HC21S00027. These are the two nucleotides reported to exist
at SNP HC21S00027 (www.snp.schl.org/snpsearch.shtml). One of two
nucleotides, either guanine or cytosine, was detected at SNP
TSC0095512 (FIG. 9B). The same results were obtained whether the
locus of interest was amplified with a second primer that contained
a recognition site for BceA I or the second primer contained a
recognition site for BsmF I.
As shown in FIG. 9C, one of two nucleotides was detected at SNP
TSC0264580, which was either adenosine or cytosine. These are the
two nucleotides reported for this SNP site
(www.snp.schl.org/snpsearch.shtml). In addition, a thymidine was
detected one base upstream of the locus of interest. In a sequence
dependent manner, BsmF I cuts some DNA molecules at the 10/14
position and other DNA molecules, which have the same sequence, at
the 11/15 position. When the restriction enzyme BsmF I cuts 11
nucleotides away on the sense strand and 15 nucleotides away on the
antisense strand, the 3' recessed end is one base upstream of the
SNP site. The sequence of SNP TSC0264580 indicated that the base
immediately preceding the SNP site was a thymidine. The
incorporation of a labeled ddNTP into this position generated a
fragment one base smaller than the fragment that was cut at the
10/14 position. Thus, the DNA molecules cut at the 11/15 position
provided identity information about the base immediately preceding
the SNP site, and the DNA molecules cut at the 10/14 position
provided identity information about the SNP site.
SNP HC21S00027 was amplified using a second primer that contained
the recognition site for BsmF I. A mixture of labeled ddNTPs and
unlabeled dNTPs was used to fill in the 5' overhang generated by
digestion with BsmF I. If a dNTP was incorporated, the polymerase
continued to incorporate nucleotides until a ddNTP was
incorporated. A population of DNA fragments, each differing by one
base, was generated, which allowed the full sequence of the
overhang to be determined.
As seen in FIG. 9D, an adenosine was detected, which was
complementary to the nucleotide (a thymidine) immediately preceding
the SNP or locus of interest. This nucleotide was detected because
of the 11/15 cutting property of BsmF I, which is described in
detail above. A guanine and an adenosine were detected at the SNP
site, which are the two nucleotides reported for this SNP site
(FIG. 9A). The two nucleotides were detected at the SNP site
because the molecular weights of the dyes differ, which allowed
separation of the two nucleotides. The next nucleotide detected was
a thymidine, which is complementary to the nucleotide immediately
downstream of the SNP site. The next nucleotide detected was a
guanine, which was complementary to the nucleotide two bases
downstream of the SNP site. Finally, an adenosine was detected,
which was complementary to the third nucleotide downstream of the
SNP site. Sequence information was obtained not only for the SNP
site but for the nucleotide immediately preceding the SNP site and
the next three nucleotides.
None of the loci of interest contained a mutation. However, if one
of the loci of interest harbored a mutation including but not
limited to a point mutation, insertion, deletion, translocation or
any combination of said mutations, it could be identified by
comparison to the consensus or published sequence. Comparison of
the sequences attributed to each of the loci of interest to the
native, non-disease related sequence of the gene at each locus of
interest determines the presence or absence of a mutation in that
sequence. The finding of a mutation in the sequence is then
interpreted as the presence of the indicated disease, or a
predisposition to develop the same, as appropriate, in that
individual. The relative amounts of the mutated vs. normal or
non-mutated sequence can be assessed to determine if the subject
has one or two alleles of the mutated sequence, and thus whether
the subject is a carrier, or whether the indicated mutation results
in a dominant or recessive condition.
Example 3
Four loci of interest from chromosome I and two loci of interest
from chromosome 21 were amplified in separate PCR reactions, pooled
together, and analyzed. The primers were designed so that each
amplified locus of interest was a different size, which allowed
detection of the loci of interest.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained
by venipuncture from a human volunteer with informed consent.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit
supplied by QIAGEN (Catalog number 51183). The template DNA was
isolated as per instructions included in the kit. Template DNA was
isolated from thirty-six human volunteers, and then pooled into a
single sample for further analysis.
Design of Primers
TABLE-US-00033 SNP TSC 0087315 was amplified using the following
primers: First primer: 5' TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC 3'
(SEQ ID NO:15) Second primer: 5' TGGACCATAAACGGCCAAAAACTGTAAG 3'
(SEQ ID NO:16) SNP TSC0214366 was amplified using the following
primers: First primer: 5' ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA 3'
(SEQ ID NO:13) Second primer: 5' GAGAATTAGAACGGCCCAAATCCCACTC 3'
(SEQ ID NO:14) SNP TSC 0413944 was amplified with the following
primers: First primer: 5' TACCTTTTGATCGAATTCAAGGCCAAAAATATTAAGTT 3'
(SEQ ID NO:23) Second primer: 5' TCGAACTTTAACGGCCTTAGAGTAGAGA 3'
(SEQ ID NO:24) SNP TSC0095512 was amplified using the following
primers: First primer: 5' AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG 3'
(SEQ ID NO:11) Second primer: 5' TCTCCAACTAACGGCTCATCGAGTAAAG 3'
(SEQ ID NO:12) SNP HC21S00131 was amplified with the following
primers: First primer: 5' CGATTTCGATAAGAATTCAAAAGCAGTTCTTAGTTCAG 3'
(SEQ ID NO:25) Second primer: 5' TGCGAATCTTACGGCTGCATCACATTCA 3'
(SEQ ID NO:26)
SNP HC21S00027 was amplified with the following primers:
TABLE-US-00034 SNP HC21S00027 was amplified with the following
primers: First primer: 5' ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3'
(SEQ ID NO:17) Second primer: 5' CTTAAATCAGACGGCTAGGTAAACTTCA 3'
(SEQ ID NO:19)
For each SNP, the first primer contained a recognition site for the
restriction enzyme EcoRI and had a biotin tag at the extreme 5'
end. The second primer used to amplify each SNP contained a
recognition site for the restriction enzyme BceA I.
PCR Reaction
The PCR reactions were performed as described in Example 2 except
that the following annealing temperatures were used: the annealing
temperature for the first cycle of PCR was 37.degree. C. for 30
seconds, the annealing temperature for the second cycle of PCR was
57.degree. C. for 30 seconds, and the annealing temperature for the
third cycle of PCR was 64.degree. C. for 30 seconds. All subsequent
cycles had an annealing temperature of 64.degree. C. for 30
seconds. Thirty seven (37) cycles of PCR were performed. After PCR,
1/4 of the volume was removed from each reaction, and combined into
a single tube.
Purification of Fragment Containing Locus of Interest
The PCR products (now combined into one sample, and referred to as
"the sample") were separated from the genomic template DNA as
described in Example 2 except that the sample was bound to a single
well of a Streptawell microtiter plate.
Restriction Enzyme Digestion of Isolated Fragments Containing Loci
of Interest
The sample was digested with the restriction enzyme BceA I, which
bound the recognition site in the second primer. The restriction
enzyme digestions were performed following the instructions
supplied with the enzyme. After the restriction enzyme digest, the
wells were washed three times with 1.times. PBS.
Incorporation of Nucleotides
The restriction enzyme digest described above yielded DNA molecules
with a 5' overhang, which contained the SNP site or locus of
interest and a 3' recessed end. The 5' overhang functioned as a
template allowing incorporation of a nucleotide in the presence of
a DNA polymerase.
The following components were used for the fill in reaction: 1
.mu.l of fluorescently labeled ddATP; 1 .mu.l of fluorescently
labeled ddTTP; 1 .mu.l of fluorescently labeled ddGTP; 1 .mu.l of
fluorescently labeled ddCTP; 2 .mu.l of 10.times. sequenase buffer,
0.25 .mu.l of Sequenase, and water as needed for a 20 .mu.l
reaction. The fill in reaction was performed at 40.degree. C. for
10 min. All labeling reagents were obtained from Amersham (Thermo
Sequenase Dye Terminator Cycle Sequencing Core Kit (US 79565); the
concentration of the ddNTPS provided in the kit is proprietary and
not published by Amersham). In the presence of fluorescently
labeled ddNTPs, the 3' recessed end was filled in by one base,
which corresponds to the SNP or locus of interest.
After the incorporation of nucleotide, the Streptawell was rinsed
with 1.times. PBS (100 .mu.l) three times. The "filled in" DNA
fragments were then released from the Streptawell by digestion with
the restriction enzyme EcoRI following the manufacturer's
instructions. Digestion was performed for 1 hour at 37.degree. C.
with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, 2 3 .mu.l of the 10
.mu.l sample was loaded in a 48 well membrane tray (The Gel
Company, catalog number TAM48-01). The sample in the tray was
absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog
number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel
(BioWhittaker Molecular Applications, Long Ranger Run Gel Packs,
catalog number 50691).
The sample was electrophoresed into the gel at 3000 volts for 3
min. The membrane comb was removed, and the gel was run for 3 hours
on an ABI 377 Automated Sequencing Machine. The incorporated
nucleotide was detected by fluorescence.
The primers were designed so that each amplified locus of interest
differed in size. As shown in FIG. 10, each amplified loci of
interest differed by about 5 10 nucleotides, which allowed the loci
of interest to be separated from one another by gel
electrophoresis. Two nucleotides were detected for SNP TSC0087315,
which were guanine and cytosine. These are the two nucleotides
reported to exist at SNP TSC0087315
(www.snp.schl.org/snpsearch.shtml). The sample comprised template
DNA from 36 individuals and because the DNA molecules that
incorporated a guanine differed in molecular weight from those that
incorporated a cytosine, distinct bands were seen for each
nucleotide.
Two nucleotides were detected at SNP HC21S00027, which were guanine
and adenosine (FIG. 10). The two nucleotides reported for this SNP
site are guanine and adenosine (www.snp.schl.org/snpsearch.shtml).
As discussed above, the sample contained template DNA from
thirty-six individuals, and one would expect both nucleotides to be
represented in the sample. The molecular weight of the DNA
fragments that incorporated a guanine was distinct from the DNA
fragments that incorporated an adenosine, which allowed both
nucleotides to be detected.
The nucleotide cytosine was detected at SNP TSC0214366 (FIG. 10).
The two nucleotides reported to exist at this SNP position are
thymidine and cytosine.
The nucleotide guanine was detected at SNP TSC0413944 (FIG. 10).
The two nucleotides reported for this SNP are guanine and cytosine
(http://snp.cshl.org/snpsearch.shtml).
The nucleotide cytosine was detected at SNP TSC0095512 (FIG. 10).
The two nucleotides reported for this SNP site are guanine and
cytosine (www.snp.schl.org/snpsearch.shtml).
The nucleotide detected at SNP HC21S00131 was guanine. The two
nucleotides reported for this SNP site are guanine and adenosine
(www.snp.schl.org/snpsearch.shtml).
As discussed above, the sample was comprised of DNA templates from
thirty-six individuals and one would expect both nucleotides at the
SNP sites to be represented. For SNP TSC0413944, TSC0095512,
TSC0214366 and HC21S00131, one of the two nucleotides was detected.
It is likely that both nucleotides reported for these SNP sites are
present in the sample but that one fluorescent dye overwhelms the
other. The molecular weight of the DNA molecules that incorporated
one nucleotide did not allow efficient separation of the DNA
molecules that incorporated the other nucleotide. However, the SNPs
were readily separated from one another, and for each SNP, a proper
nucleotide was incorporated. The sequences of multiple loci of
interest from multiple chromosomes, which were treated as a single
sample after PCR, were determined.
A single reaction containing fluorescently labeled ddNTPs was
performed with the sample that contained multiple loci of interest.
Alternatively, four separate fill in reactions can be performed
where each reaction contains one fluorescently labeled nucleotide
(ddATP, ddTTP, ddGTP, or ddCTP) and unlabeled ddNTPs (see Example
2, FIGS. 7A 7D and FIGS. 9A C). Four separate "fill in" reactions
will allow detection of any nucleotide that is present at the loci
of interest. For example, if analyzing a sample that contains
multiple loci of interest from a single individual, and said
individual is heterozygous at one or more than one loci of
interest, four separate "fill in" reactions can be used to
determine the nucleotides at the heterozygous loci of interest.
Also, when analyzing a sample that contains templates from multiple
individuals, four separate "fill in" reactions will allow detection
of nucleotides present in the sample, independent of how frequent
the nucleotide is found at the locus of interest. For example, if a
sample contains DNA templates from 50 individuals, and 49 of the
individuals have a thymidine at the locus of interest, and one
individual has a guanine, the performance of four separate "fill
in" reactions, wherein each "fill in" reaction is run in a separate
lane of a gel, such as in FIGS. 9A 9C, will allow detection of the
guanine. When analyzing a sample comprised of multiple DNA
templates, multiple "fill in" reactions will alleviate the need to
distinguish multiple nucleotides at a single site of interest by
differences in mass.
In this example, multiple single nucleotide polymorphisms were
analyzed. It is also possible to determine the presence or absence
of mutations, including point mutations, transitions,
transversions, translocations, insertions, and deletions from
multiple loci of interest. The multiple loci of interest can be
from a single chromosome or from multiple chromosomes. The multiple
loci of interest can be from a single gene or from multiple
genes.
The sequence of multiple loci of interest that cause or predispose
to a disease phenotype can be determined. For example, one could
amplify one to tens to hundreds to thousands of genes implicated in
cancer or any other disease. The primers can be designed so that
each amplified loci of interest differs in size. After PCR, the
amplified loci of interest can be combined and treated as a single
sample. Alternatively, the multiple loci of interest can be
amplified in one PCR reaction or the total number of loci of
interest, for example 100, can be divided into samples, for example
10 loci of interest per PCR reaction, and then later pooled. As
demonstrated herein, the sequence of multiple loci of interest can
be determined. Thus, in one reaction, the sequence of one to ten to
hundreds to thousands of genes that predispose or cause a disease
phenotype can be determined.
Example 4
Genomic DNA was obtained from four individuals after informed
consent was obtained. Six SNPs on chromosome 13 (TSC0837969,
TSC0034767, TSC1130902, TSC0597888, TSC0195492, TSC0607185) were
analyzed using the template DNA. Information regarding these SNPs
can be found at the following website
(www.snp.schl.org/snpsearch.shtml) website active as of Feb. 11,
2003).
A single nucleotide labeled with one fluorescent dye was used to
genotype the individuals at the six selected SNP sites. The primers
were designed to allow the six SNPs to be analyzed in a single
reaction.
Preparation of Template DNA
The template DNA was prepared from a 9 ml sample of blood obtained
by venipuncture from a human volunteer with informed consent.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit
supplied by QIAGEN (Catalog number 51183). The template DNA was
isolated as per instructions included in the kit.
Design of Primers
TABLE-US-00035 SNP TSC0837969 was amplified using the following
primer set: First primer: (SEQ ID NO: 30) 5'
GGGCTAGTCTCCGAATTCCACCTATCCTACCAAATGTC 3' Second primer: (SEQ ID
NO: 31) 5' TAGCTGTAGTTAGGGACTGTTCTGAGCAC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 44 bases from of the locus of interest. The
second primer contained a restriction enzyme recognition site for
BsmF I.
TABLE-US-00036 SNP TSC0034767 was amplified using the following
primer set: First primer: (SEQ ID NO: 32) 5'
CGAATGCAAGGCGAATTCGTTAGTAATAACACAGTGCA 3' Second primer: (SEQ ID
NO: 33) 5' AAGACTGGATCCGGGACCATGTAGAATAC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 50 bases from the locus of interest. The second
primer contained a restriction enzyme recognition site for BsmF
I.
TABLE-US-00037 SNP TSC1130902 was amplified using the following
primer set: First primer: (SEQ ID NO: 34) 5'
TCTAACCATTGCGAATTCAGGGCAAGGGGGGTGAGATC 3' Second primer: (SEQ ID
NO: 35) 5' TGACTTGGATCCGGGACAACGACTCATCC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 60 bases from the locus of interest. The second
primer contained a restriction enzyme recognition site for BsmF
I.
TABLE-US-00038 SNP TSC0597888 was amplified using the following
primer set: First primer: (SEQ ID NO: 36) 5'
ACCCAGGCGCCAGAATTCTTTAGATAAAGCTGAAGGGA 3' Second primer: (SEQ ID
NO: 37) 5' GTTACGGGATCCGGGACTCCATATTGATC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 70 bases from the locus of interest. The second
primer contained a restriction enzyme recognition site for BsmF
I.
TABLE-US-00039 SNP TSC0195492 was amplified using the following
primer set: First primer: (SEQ ID NO: 38) 5'
CGTTGGCTTGAGGAATTCGACCAAAAGAGCCAAGAGAA Second primer: (SEQ ID NO:
39) 5' AAAAAGGGATCCGGGACCTTGACTAGGAC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 80 bases from the locus of interest. The second
primer contained a restriction enzyme recognition site for BsmF
I.
TABLE-US-00040 SNP TSC0607185 was amplified using the following
primer set: First primer: (SEQ ID NO: 40) 5'
ACTTGATTCCGTGAATTCGTTATCAATAAATCTTACAT 3' Second primer: (SEQ ID
NO: 41) 5' CAAGTTGGATCCGGGACCCAGGGCTAACC 3'
The first primer had a biotin tag at the 5' end and contained a
restriction enzyme recognition site for EcoRI. The first primer was
designed to anneal 90 bases from the locus of interest. The second
primer contained a restriction enzyme recognition site for BsmF
I.
All loci of interest were amplified from the template genomic DNA
using the polymerase chain reaction (PCR, U.S. Pat. Nos. 4,683,195
and 4,683,202, incorporated herein by reference). In this example,
the loci of interest were amplified in separate reaction tubes but
they could also be amplified together in a single PCR reaction. For
increased specificity, a "hot-start" PCR was used. PCR reactions
were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog number 203443). The amount of template DNA and
primer per reaction can be optimized for each locus of interest but
in this example, 40 ng of template human genomic DNA and 5 .mu.M of
each primer were used. Forty cycles of PCR were performed. The
following PCR conditions were used: (1) 95.degree. C. for 15
minutes and 15 seconds; (2) 37.degree. C. for 30 seconds; (3)
95.degree. C. for 30 seconds; (4) 57.degree. C. for 30 seconds; (5)
95.degree. C. for 30 seconds; (6) 64.degree. C. for 30 seconds; (7)
95.degree. C. for 30 seconds; (8) Repeat steps 6 and 7 thirty nine
(39) times; (9) 72.degree. C. for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the
melting temperature of the 3' annealing region of the second
primers, which was 37.degree. C. The annealing temperature in the
second cycle of PCR was about the melting temperature of the 3'
region, which anneals to the template DNA, of the first primer,
which was 57.degree. C. The annealing temperature in the third
cycle of PCR was about the melting temperature of the entire
sequence of the second primer, which was 64.degree. C. The
annealing temperature for the remaining cycles was 64.degree. C.
Escalating the annealing temperature from TM1 to TM2 to TM3 in the
first three cycles of PCR greatly improves specificity. These
annealing temperatures are representative, and the skilled artisan
will understand the annealing temperatures for each cycle are
dependent on the specific primers used.
The temperatures and times for denaturing, annealing, and
extension, can be optimized by trying various settings and using
the parameters that yield the best results. In this example, the
first primer was designed to anneal at various distances from the
locus of interest. The skilled artisan understands that the
annealing location of the first primer can be 5 10, 11 15, 16 20,
21 25, 26 30, 31 35, 36 40, 41 45, 46 50, 51 55, 56 60, 61 65, 66
70, 71 75, 76 80, 81 85, 86 90, 91 95, 96 100, 101 105, 106 110,
111 115, 116 120, 121 125, 126 130, 131 140, 141 160, 161 180, 181
200, 201 220, 221 240, 241 260, 261 280, 281 300, 301 350, 351 400,
401 450, 451 500, or greater than 500 bases from the locus of
interest.
Purification of Fragment Containing Locus of Interest
The PCR products were separated from the genomic template DNA.
After the PCR reaction, 1/4 of the volume of each PCR reaction from
one individual was mixed together in a well of a Streptawell,
transparent, High-Bind plate from Roche Diagnostics GmbH (catalog
number 1 645 692, as listed in Roche Molecular Biochemicals, 2001
Biochemicals Catalog). The first primers contained a 5' biotin tag
so the PCR products bound to the Streptavidin coated wells while
the genomic template DNA did not. The streptavidin binding reaction
was performed using a Thermomixer (Eppendorf) at 1000 rpm for 20
min. at 37.degree. C. Each well was aspirated to remove unbound
material, and washed three times with 1.times. PBS, with gentle
mixing (Kandpal et al., Nucl. Acids Res. 18:1789 1795 (1990);
Kaneoka et al., Biotechniques 10:30 34 (1991); Green et al., Nucl.
Acids Res. 18:6163 6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments Containing Loci
of Interest
The purified PCR products were digested with the restriction enzyme
BsmF I, which binds to the recognition site incorporated into the
PCR products from the second primer. The digests were performed in
the Streptawells following the instructions supplied with the
restriction enzyme. After digestion, the wells were washed three
times with PBS to remove the cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment
with a 5' overhang, which contained the SNP site or locus of
interest and a 3' recessed end. The 5' overhang functioned as a
template allowing incorporation of a nucleotide or nucleotides in
the presence of a DNA polymerase.
Below, a schematic of the 5' overhang for SNP TSC0837969 is shown.
The entire DNA sequence is not reproduced, only the portion to
demonstrate the overhang (where R indicates the variable site).
TABLE-US-00041 5' TTAA 3' AATT R A C A Overhang position 1 2 3
4
The observed nucleotides for TSC0837969 on the 5' sense strand
(here depicted as the top strand) are adenine and guanine. The
third position in the overhang on the antisense strand corresponds
to cytosine, which is complementary to guanine. As this variable
site can be adenine or guanine, fluorescently labeled ddGTP in the
presence of unlabeled dCTP, dTTP, and dATP was used to determine
the sequence of both alleles. The fill-in reactions for an
individual homozygous for guanine, homozygous for adenine or
heterozygous are diagrammed below.
Homozygous for guanine at TSC 0837969:
TABLE-US-00042 Allele 1 5'TTAA G* 3'AATT C A C A Overhang position
1 2 3 4 Allele 2 5'TTAA G* 3'AATT C A C A Overhang position 1 2 3
4
Labeled ddGTP is incorporated into the first position of the
overhang. Only one signal is seen, which corresponds to the
molecules filled in with labeled ddGTP at the first position of the
overhang.
Homozygous for adenine at TSC 0837969:
TABLE-US-00043 Allele 1 5'TTAA A T G* 3'AATT T A C A Overhang
position 1 2 3 4 Allele 2 5'TTAA A T G* 3'AATT T A C A Overhang
position 1 2 3 4
Unlabeled dATP is incorporated at position one of the overhang, and
unlabeled dTTP is incorporated at position two of the overhang.
Labeled ddGTP is incorporated at position three of the overhang.
Only one signal will be seen; the molecules filled in with ddGTP at
position 3 will have a different molecular weight from molecules
filled in at position one, which allows easy identification of
individuals homozygous for adenine or guanine.
Heterozygous at TSC0837969:
TABLE-US-00044 Allele 1 5'TTAA G* 3'AATT C A C A Overhang position
1 2 3 4 Allele 2 5'TTAA A T G* 3'AATT T A C A Overhang position 1 2
3 4
Two signals will be seen; one signal corresponds to the DNA
molecules filled in with ddGTP at position 1, and a second signal
corresponding to molecules filled in at position 3 of the overhang.
The two signals can be separated using any technique that separates
based on molecular weight including but not limited to gel
electrophoresis.
Below, a schematic of the 5' overhang for SNP TSC0034767 is shown.
The entire DNA sequence is not reproduced, only the portion to
demonstrate the overhang (where R indicates the variable site).
TABLE-US-00045 A C A R GTGT3' CACA5' 4 3 2 1 Overhang Position
The observed nucleotides for TSC0034767 on the 5' sense strand
(here depicted as the top strand) are cytosine and guanine. The
second position in the overhang corresponds to adenine, which is
complementary to thymidine. The third position in the overhang
corresponds to cytosine, which is complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP,
dTTP, and dATP is used to determine the sequence of both
alleles.
In this case, the second primer anneals upstream of the locus of
interest, and thus the fill-in reaction occurs on the anti-sense
strand (here depicted as the bottom strand). Either the sense
strand or the antisense strand can be filled in depending on
whether the second primer, which contains the type IIS restriction
enzyme recognition site, anneals upstream or downstream of the
locus of interest.
Below, a schematic of the 5' overhang for SNP TSC1130902 is shown.
The entire DNA sequence is not reproduced, only a portion to
demonstrate the overhang (where R indicates the variable site).
TABLE-US-00046 5'TTCAT 3'AAGTA R T C C Overhang position 1 2 3
4
The observed nucleotides for TSC1130902 on the 5' sense strand are
adenine and guanine. The second position in the overhang
corresponds to a thymidine, and the third position in the overhang
corresponds to cytosine, which is complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP,
dTTP, and dATP is used to determine the sequence of both
alleles.
Below, a schematic of the 5' overhang for SNP TSC0597888 is shown.
The entire DNA sequence is not reproduced, only the portion to
demonstrate the overhang (where R indicates the variable site).
TABLE-US-00047 T C T R ATTC3' TAAG5' 4 3 2 1 Overhang position
The observed nucleotides for TSC0597888 on the 5' sense strand
(here depicted as the top strand) are cytosine and guanine. The
third position in the overhang corresponds to cytosine, which is
complementary to guanine. Fluorescently labeled ddGTP in the
presence of unlabeled dCTP, dTTP, and dATP is used to determine the
sequence of both alleles.
Below, a schematic of the 5' overhang for SNP TSC0607185 is shown.
The entire DNA sequence is not reproduced, only the portion to
demonstrate the overhang (where R indicates the variable site).
TABLE-US-00048 C C T R TGTC3' ACAG5' 4 3 2 1 Overhang position
The observed nucleotides for TSC0607185 on the 5' sense strand
(here depicted as the top strand) are cytosine and thymidine. In
this case, the second primer anneals upstream of the locus of
interest, which allows the anti-sense strand to be filled in. The
anti-sense strand (here depicted as the bottom strand) will be
filled in with guanine or adenine.
The second position in the 5' overhang is thymidine, which is
complementary to adenine, and the third position in the overhang
corresponds to cytosine, which is complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP,
dTTP, and dATP is used to determine the sequence of both
alleles.
Below, a schematic of the 5' overhang for SNP TSC0195492 is shown.
The entire DNA sequence is not reproduced, only the portion to
demonstrate the overhang.
TABLE-US-00049 5'ATCT 3'TAGA R A C A Overhang position 1 2 3 4
The observed nucleotides at this site are cytosine and guanine on
the sense strand (here depicted as the top strand). The second
position in the 5' overhang is adenine, which is complementary to
thymidine, and the third position in the overhang corresponds to
cytosine, which is complementary to guanine. Fluorescently labeled
ddGTP in the presence of unlabeled dCTP, dTTP, and dATP was used to
determine the sequence of both alleles.
As demonstrated above, the sequence of both alleles of the six SNPs
can be determined by labeling with ddGTP in the presence of
unlabeled dATP, dTTP, and dCTP. The following components were added
to each fill in reaction: 1 .mu.l of fluorescently labeled ddGTP,
0.5 .mu.l of unlabeled ddNTPs (40 .mu.M), which contained all
nucleotides except guanine, 2 .mu.l of 10.times. sequenase buffer,
0.25 .mu.l of Sequenase, and water as needed for a 20 .mu.l
reaction. The fill in reaction was performed at 40.degree. C. for
10 min. Non-fluorescently labeled ddNTP was purchased from
Fermentas Inc. (Hanover, Md.). All other labeling reagents were
obtained from Amersham (Thermo Sequenase Dye Terminator Cycle
Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1.times. PBS (100
.mu.l) three times. The "filled in" DNA fragments were then
released from the Streptawells by digestion with the restriction
enzyme EcoRI, according to the manufacturer's instructions that
were supplied with the enzyme. Digestion was performed for 1 hour
at 37.degree. C. with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample was loaded
into a lane of a 36 cm 5% acrylamide (urea) gel (BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number
50691). The sample was electrophoresed into the gel at 3000 volts
for 3 min. The gel was run for 3 hours on a sequencing apparatus
(Hoefer SQ3 Sequencer). The gel was removed from the apparatus and
scanned on the Typhoon 9400 Variable Mode Imager. The incorporated
labeled nucleotide was detected by fluorescence.
As shown in FIG. 11, the template DNA in lanes 1 and 2 for SNP
TSC0837969 is homozygous for adenine. The following fill-in
reaction was expected to occur if the individual was homozygous for
adenine:
Homozygous for adenine at TSC 0837969:
TABLE-US-00050 5'TTAA A T G* 3'AATT T A C A Overhang position 1 2 3
4
Unlabeled dATP was incorporated in the first position complementary
to the overhang. Unlabeled dTTP was incorporated in the second
position complementary to the overhang. Labeled ddGTP was
incorporated in the third position complementary to the overhang.
Only one band was seen, which migrated at about position 46 of the
acrylamide gel. This indicated that adenine was the nucleotide
filled in at position one. If the nucleotide guanine had been
filled in, a band would be expected at position 44.
However, the template DNA in lanes 3 and 4 for SNP TSC0837969 was
heterozygous. The following fill-in reactions were expected if the
individual was heterozygous:
Heterozygous at TSC0837969:
TABLE-US-00051 Allele 1 5'TTAA G* 3'AATT C A C A Overhang position
1 2 3 4 Allele 2 5'TTAA A T G* 3'AATT T A C A Overhang position 1 2
3 4
Two distinct bands were seen; one band corresponds to the molecules
filled in with ddGTP at position 1 complementary to the overhang
(the G allele), and the second band corresponds to molecules filled
in with ddGTP at position 3 complementary to the overhang (the A
allele). The two bands were separated based on the differences in
molecular weight using gel electrophoresis. One fluorescently
labeled nucleotide ddGTP was used to determine that an individual
was heterozygous at a SNP site. This is the first use of a single
nucleotide to effectively detect the presence of two different
alleles.
For SNP TSC0034767, the template DNA in lanes 1 and 3 is
heterozygous for cytosine and guanine, as evidenced by the two
distinct bands. The lower band corresponds to ddGTP filled in at
position 1 complementary to the overhang. The second band of
slightly higher molecular weight corresponds to ddGTP filled in at
position 3, indicating that the first position in the overhang was
filled in with unlabeled dCTP, which allowed the polymerase to
continue to incorporate nucleotides until it incorporated ddGTP at
position 3 complementary to the overhang. The template DNA in lanes
2 and 4 was homozygous for guanine, as evidenced by a single band
of higher molecular weight than if ddGTP had been filled in at the
first position complementary to the overhang.
For SNP TSC1130902, the template DNA in lanes 1, 2, and 4 is
homozygous for adenine at the variable site, as evidenced by a
single higher molecular weight band migrating at about position 62
on the gel. The template DNA in lane 3 is heterozygous at the
variable site, as indicated by the presence of two distinct bands.
The lower band corresponded to molecules filled in with ddGTP at
position 1 complementary to the overhang (the guanine allele). The
higher molecular weight band corresponded to molecules filled in
with ddGTP at position 3 complementary to the overhang (the adenine
allele).
For SNP TSC0597888, the template DNA in lanes 1 and 4 was
homozygous for cytosine at the variable site; the template DNA in
lane 2 was heterozygous at the variable site, and the template DNA
in lane 3 was homozygous for guanine. The expected fill-in
reactions are diagrammed below:
Homozygous for Cytosine:
TABLE-US-00052 Allele 1 T C T G ATTC 3' G* A C TAAG 5' 4 3 2 1
Overhang position Allele 2 T C T G ATTC 3' G* A C TAAG 5' 4 3 2 1
Overhang position
Homozygous for Guanine:
TABLE-US-00053 Allele 1 T C T C ATTC 3' G* TAAG 5' 4 3 2 1 Overhang
position Allele 2 T C T C ATTC 3' G* TAAG 5' 4 3 2 1 Overhang
position
Heterozygous for Guanine/Cytosine:
TABLE-US-00054 Allele 1 T C T G ATTC 3' G* A C TAAG 5' 4 3 2 1
Overhang position Allele 2 T C T C ATTC 3' G* TAAG 5' 4 3 2 1
Overhang position
Template DNA homozygous for guanine at the variable site displayed
a single band, which corresponded to the DNA molecules filled in
with ddGTP at position 1 complementary to the overhang. These DNA
molecules were of lower molecular weight compared to the DNA
molecules filled in with ddGTP at position 3 of the overhang (see
lane 3 for SNP TSC0597888). The DNA molecules differed by two bases
in molecular weight.
Template DNA homozygous for cytosine at the variable site displayed
a single band, which corresponds to the DNA molecules filled in
with ddGTP at position 3 complementary to the overhang. These DNA
molecules migrated at a higher molecular weight than DNA molecules
filled in with ddGTP at position 1 (see lanes 1 and 4 for SNP
TSC0597888).
Template DNA heterozygous at the variable site displayed two bands;
one band corresponded to the DNA molecules filled in with ddGTP at
position 1 complementary to the overhang and was of lower molecular
weight, and the second band corresponded to DNA molecules filled in
with ddGTP at position 3 complementary to the overhang, and was of
higher molecular weight (see lane 3 for SNP TSC0597888).
For SNP TSC0195492, the template DNA in lanes 1 and 3 was
heterozygous at the variable site, which was demonstrated by the
presence of two distinct bands. The template DNA in lane 2 was
homozygous for guanine at the variable site. The template DNA in
lane 4 was homozygous for cytosine. Only one band was seen in lane
4 for this SNP, and it had a higher molecular weight than the DNA
molecules filled in with ddGTP at position 1 complementary to the
overhang (compare lanes 2, 3 and 4).
The observed alleles for SNP TSC0607185 are reported as cytosine or
thymidine. For consistency, the SNP consortium denotes the observed
alleles as they appear in the sense strand
(www.snp.schl.org/snpsearch.shtml); website active as of Feb. 11,
2003). For this SNP, the second primer annealed upstream of the
locus of interest, which allowed the fill-in reaction to occur on
the antisense strand after digestion with BsmF I.
The template DNA in lanes 1 and 3 was heterozygous; the template
DNA in lane 2 was homozygous for thymidine, and the template DNA in
lane 4 was homozygous for cytosine. The antisense strand was filled
in with ddGTP, so the nucleotide on the sense strand corresponded
to cytosine.
Molecular weight markers can be used to identify the positions of
the expected bands. Alternatively, for each SNP analyzed, a known
heterozygous sample can be used, which will identify precisely the
position of the two expected bands.
As demonstrated in FIG. 11, one nucleotide labeled with one
fluorescent dye can be used to determine the identity of a variable
site including but not limited to SNPs and single nucleotide
mutations. Typically, to determine if an individual is homozygous
or heterozygous at a SNP site, multiple reactions are performed
using one nucleotide labeled with one dye and a second nucleotide
labeled with a second dye. However, this introduces problems in
comparing results because the two dyes have different quantum
coefficients. Even if different nucleotides are labeled with the
same dye, the quantum coefficients are different. The use of a
single nucleotide labeled with one dye eliminates any errors from
the quantum coefficients of different dyes.
In this example, fluorescently labeled ddGTP was used. However, the
method is applicable for a nucleotide tagged with any signal
generating moiety including but not limited to radioactive
molecule, fluorescent molecule, antibody, antibody fragment,
hapten, carbohydrate, biotin, derivative of biotin, phosphorescent
moiety, luminescent moiety, electrochemiluminescent moiety,
chromatic moiety, and moiety having a detectable electron spin
resonance, electrical capacitance, dielectric constant or
electrical conductivity. In addition, labeled ddATP, ddTTP, or
ddCTP can be used.
The above example used the third position complementary to the
overhang as an indicator of the second allele. However, the second
or fourth position of the overhang can be used as well (see Section
on Incorporation of Nucleotides). Furthermore, the overhang was
generated with the type IIS enzyme BsmF I; however any enzyme that
cuts DNA at a distance from its binding site can be used including
but not limited to the enzymes listed in Table I.
Also, in the above example, the nucleotide immediately preceding
the SNP site was not a guanine on the strand that was filled in.
This eliminated any effects of the alternative cutting properties
of the type IIS restriction enzyme to be removed. For example, at
SNP TSC0837969, the nucleotide upstream of the SNP site on the
sense strand was an adenine. If BsmF I displayed alternate cutting
properties, the following overhangs would be generated for the
adenine allele and the guanine allele:
TABLE-US-00055 G allele - 11/15 Cut 5' TTA 3' AAT T C A C Overhang
position 0 1 2 3 G allele after fill-in 5' TTA A G* 3' AAT T C A C
Overhang position 0 1 2 3 A allele 11/15 Cut 5' TTA 3' AAT T T A C
Overhang position 0 1 2 3 A allele after fill-in 5' TTA A A T G* 3'
AAT T T A C Overhang position 0 1 2 3
For the guanine allele, the first position in the overhang would be
filled in with dATP, which would allow the polymerase to
incorporate ddGTP at position 2 complementary to the overhang.
There would be no detectable difference between molecules cut at
the 10/14 position or molecules cut at the 11/15 position.
For the adenine allele, the first position complementary to the
overhang would be filled in with dATP, the second position would be
filled in with dATP, the third position would be filled in with
dTTP, and the fourth position would be filled in with ddGTP. There
would be no difference in the molecular weights between molecules
cut at 10/14 or molecules cut at 11/15. The only differences would
correspond to whether the DNA molecules contained an adenine at the
variable site or a guanine at the variable site.
As seen in FIG. 11, positioning the annealing region of the first
primer allows multiple SNPs to be analyzed in a single lane of a
gel. Also, when using the same nucleotide with the same dye, a
single fill-in reaction can be performed. In this example, 6 SNPs
were analyzed in one lane. However, any number of SNPs including
but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30
40, 41 50, 51 60, 61 70, 71 80, 81 100, 101 120, 121 140, 141 160,
161 180, 181 200, and greater than 200 can be analyzed in a single
reaction.
Furthermore, one labeled nucleotide used to detect both alleles can
be mixed with a second labeled nucleotide used to detect a
different set of SNPs provided that neither of the nucleotides that
are labeled occur immediately before the variable site
(complementary to nucleotide at position 0 of the 11/15 cut). For
example, suppose SNP X can be guanine or thymidine at the variable
site and has the following 5' overhang generated after digestion
with BsmF I:
TABLE-US-00056 SNP X 10/14 5' TTGAC G allele 3' AACTG C A C T
Overhang position 1 2 3 4 SNP X 11/15 5' TTGA G allele 3' AACT G C
A C Overhang position 0 1 2 3 SNP X 10/14 5' TTGAC T allele 3'
AACTG A A C T Overhang position 1 2 3 4 SNP X 11/15 5' TTGA T
allele 3' AACT G A A C Overhang position 0 1 2 3
After the fill-in reaction with labeled ddGTP, unlabeled dATP,
dCTP, and dTTP, the following molecules would be generated:
TABLE-US-00057 SNP X 10/14 5' TTGAC G* G allele 3' AACTG C A C T
Overhang position 1 2 3 4 SNP X 11/15 5' TTGA C G* G allele 3' AACT
G C A C Overhang position 0 1 2 3 SNP X 10/14 5' TTGAC T T G* T
allele 3' AACTG A A C T Overhang position 1 2 3 4 SNP X 11/15 5'
TTGA C T T G* T allele 3' AACT G A A C Overhang position 0 1 2
3
Now suppose SNP Y can be adenine or thymidine and has the following
5' overhangs generated after digestion with BsmF I.
TABLE-US-00058 SNP Y 10/14 5' GTTT A allele 3' CAAA T G T A
Overhang position 1 2 3 4 SNP Y 11/15 5' GTT A allele 3' CAA A T G
T Overhang position 0 1 2 3 SNP Y 10/14 5' GTTT T allele 3' CAAA A
G T A Overhang position 1 2 3 4 SNP Y 11/15 5' GTT T allele 3' CAA
A A G T Overhang position 0 1 2 3
After fill-in with labeled ddATP and unlabeled dCTP, dGTP, and
dTTP, the following molecules would be generated:
TABLE-US-00059 SNP Y 10/14 5' GTTT A* A allele 3' CAAA T G T A
Overhang position 1 2 3 4 SNP Y 11/15 5' GTT T A* A allele 3' CAA A
T G T Overhang position 0 1 2 3 SNP Y 10/14 5' GTTT T C A* T allele
3' CAAA A G T A Overhang position 1 2 3 4 SNP Y 11/15 5' GTT T T C
A* T allele 3' CAA A A G T Overhang position 0 1 2 3
In this example, labeled ddGTP and labeled ddATP are used to
determine the identity of both alleles of SNP X and SNP Y
respectively. The nucleotide immediately preceding (the
complementary nucleotide to position 0 of the overhang from the
11/15 cut SNP X is not guanine or adenine on the strand that is
filled-in. Likewise, the nucleotide immediately preceding SNPY is
not guanine or adenine on the strand that is filled-in. This allows
the fill-in reaction for both SNPs to occur in a single reaction
with labeled ddGTP, labeled ddATP, and unlabeled dCTP and dTTP.
This reduces the number of reactions that need to be performed and
increases the number of SNPs that can be analyzed in one
reaction.
The first primers for each SNP can be designed to anneal at
different distances from the locus of interest, which allows the
SNPs to migrate at different positions on the gel. For example, the
first primer used to amplify SNP X can anneal at 30 bases from the
locus of interest, and the first primer used to amplify SNP Y can
anneal at 35 bases from the locus of interest. Also, the
nucleotides can be labeled with fluorescent dyes that emit at
spectrums that do not overlap. After running the gel, the gel can
be scanned at one wavelength specific for one dye. Only those
molecules labeled with that dye will emit a signal. The gel then
can be scanned at the wavelength for the second dye. Only those
molecules labeled with that dye will emit a signal. This method
allows maximum compression for the number of SNPs that can be
analyzed in a single reaction.
In this example, the nucleotide preceding the variable site on the
strand that was filled-in is not be adenine or guanine. This method
can work with any combination of labeled nucleotides, and the
skilled artisan would understand which labeling reactions can be
mixed and those that can not. For instance, if one SNP is labeled
with thymidine and a second SNP is labeled with cytosine, the SNPs
can be labeled in a single reaction if the nucleotide immediately
preceding each variable site is not thymidine or cytosine on the
sense strand and the nucleotide immediately after the variable site
is not thymidine or cytosine on the sense strand.
This method allows the signals from one allele to be compared to
the signal from a second allele without the added complexity of
determining the degree of alternate cutting, or having to correct
for the quantum coefficients of the dyes. This method is especially
useful when trying to quantitate a ratio for one allele to another.
For example, this method is useful for detecting chromosomal
abnormalities. The ratio of alleles at a heterozygous site is
expected to be about 1:1 (one A allele and one G allele). However,
if an extra chromosome is present the ratio is expected to be about
1:2 (one A allele and 2 G alleles or 2 A alleles and 1 G allele).
This method is especially useful when trying to detect fetal DNA in
the presence of maternal DNA.
In addition, this method is useful for detecting two genetic
signals in one sample. For example, this method can detect mutant
cells in the presence of wild type cells (see Example 5). If a
mutant cell contains a mutation in the DNA sequence of a particular
gene, this method can be used to detect both the mutant signal and
the wild type signal. This method can be used to detect the mutant
DNA sequence in the presence of the wild type DNA sequence. The
ratio of mutant DNA to wild type DNA can be quantitated because a
single nucleotide labeled with one signal generating moiety is
used.
Example 5
Non-invasive methods for the detection of various types of cancer
have the potential to reduce morbidity and mortality from the
disease. Several techniques for the early detection of colorectal
tumors have been developed including colonoscopy, barium enemas,
and sigmoidoscopy but are limited in use because the techniques are
invasive, which causes a low rate of patient compliance.
Non-invasive genetic tests may be useful in identifying early stage
colorectal tumors.
In 1991, researchers identified the Adenomatous Polyposis Coli gene
(APC), which plays a critical role in the formation of colorectal
tumors (Kinzler et al., Science 253:661 665, 1991). The APC gene
resides on chromosome 5q21-22 and a total of 15 exons code for an
RNA molecule of 8529 nucleotides, which produces a 300 Kd APC
protein. The protein is expressed in numerous cell types and is
essential for cell adhesion.
Mutations in the APC gene generally initiate colorectal neoplasia
(Tsao, J. et al., Am, J. Pathol. 145:531 534, 1994). Approximately
95% of the mutations in the APC gene result in nonsense/frameshift
mutations. The most common mutations occur at codons 1061 and 1309;
mutations at these codons account for 1/3 of all germline
mutations. With regard to somatic mutations, 60% occur within
codons 1286 1513, which is about 10% of the coding sequence. This
region is termed the mutation Cluster Region (MCR). Numerous types
of mutations have been identified in the APC gene including
nucleotide substitutions (see Table III), splicing errors (see
Table IV), small deletions (see Table V), small insertions (see
Table VI), small insertions/deletions (see Table VII), gross
deletions (see Table VIII), gross insertions (see Table IX), and
complex rearrangements (see Table X).
Researchers have attempted to identify cells harboring mutations in
the APC gene in stool samples (Traverso, G. et al., New England
Journal of Medicine, Vol 346:311 320, 2002). While APC mutations
are found in nearly all tumors, about 1 in 250 cells in the stool
sample has a mutation in the APC gene; most of the cells are normal
cells that have been shed into the feces. Furthermore, human DNA
represents about one-billionth of the total DNA found in stool
samples; the majority of DNA is bacterial. The technique employed
by Traverso et al. only detects mutations that result in a
truncated protein.
As discussed above, numerous mutations in the APC gene have been
implicated in the formation of colorectal tumors. Thus, there still
exists a need for a highly sensitive, non-invasive technique for
the detection of colorectal tumors. Below, methods are described
for detection of two mutations in the APC gene. However, any number
of mutations can be analyzed using the methods described
herein.
Preparation of Template DNA
The template DNA is purified from a sample containing colon cells
including but not limited to a stool sample. The template DNA is
purified using the procedures described by Ahlquist et al.
(Gastroenterology, 119:1219 1227, 2000). If stool samples are
frozen, the samples are thawed at room temperature, and homogenized
with an Exactor stool shaker (Exact Laboratories, Maynard, Mass.)
Following homogenization, a 4 gram stool equivalent of each sample
is centrifuged at 2536.times.g for 5 minutes. The samples are
centrifuged a second time at 16, 500.times.g for 10 minutes.
Supernatants are incubated with 20 .mu.l of RNase (0.5 mg per
milliliter) for 1 hour at 37.degree. C. DNA is precipitated with
1/10 volume of 3 mol of sodium acetate per liter and an equal
volume of isopropanol. The DNA is dissolved in 5 ml of TRIS-EDTA
(0.01 mol of Tris per liter (pH 7.4) and 0.001 mole of EDTA per
liter.
Design of Primers
To determine if a mutation resides at codon 1370, the following
primers are used:
TABLE-US-00060 First primer: (SEQ ID NO: 42) 5'
GTGCAAAGGCCTGAATTCCCAGGCACAAAGCTGTTGAA 3' Second primer: (SEQ ID
NO: 43) 5' TGAAGCGAACTAGGGACTCAGGTGGACTT
The first primer contains a biotin tag at the extreme 5' end, and
the nucleotide sequence for the restriction enzyme EcoRI. The
second primer contains the nucleotide sequence for the restriction
enzyme BsmF I.
To determine if a small deletion exists at codon 1302, the
following primers are used:
TABLE-US-00061 First primer: (SEQ ID NO: 44) 5'
GATTCCGTAAACGAATTCAGTTCATTATCATCTTTGTC 3' Second primer: (SEQ ID
NO: 45) 5' CCATTGTTAAGCGGGACTTCTGCTATTTG 3'
The first primer has a biotin tag at the 5' end and contains a
restriction enzyme recognition site for EcoRI. The second primer
contains a restriction enzyme recognition site for BsmF I.
PCR Reaction
The loci of interest are amplified from the template genomic DNA
using the polymerase chain reaction (PCR, U.S. Pat. Nos. 4,683,195
and 4,683,202, incorporated herein by reference). The loci of
interest are amplified in separate reaction tubes; they can also be
amplified together in a single PCR reaction. For increased
specificity, a "hot-start" PCR reaction is used, e.g. by using the
HotStarTaq Master Mix Kit supplied by QIAGEN (catalog number
203443). The amount of template DNA and primer per reaction are
optimized for each locus of interest but in this example, 40 ng of
template human genomic DNA and 5 .mu.M of each primer are used.
Forty cycles of PCR are performed. The following PCR conditions are
used: (1) 95.degree. C. for 15 minutes and 15 seconds; (2)
37.degree. C. for 30 seconds; (3) 95.degree. C. for 30 seconds; (4)
57.degree. C. for 30 seconds; (5) 95.degree. C. for 30 seconds; (6)
64.degree. C. for 30 seconds; (7) 95.degree. C. for 30 seconds; (8)
Repeat steps 6 and 7 thirty nine (39) times; (9) 72.degree. C. for
5 minutes.
In the first cycle of PCR, the annealing temperature is about the
melting temperature of the 3' annealing region of the second
primers, which is 37.degree. C. The annealing temperature in the
second cycle of PCR is about the melting temperature of the 3'
region, which anneals to the template DNA, of the first primer,
which is 57.degree. C. The annealing temperature in the third cycle
of PCR is about the melting temperature of the entire sequence of
the second primer, which is 64.degree. C. The annealing temperature
for the remaining cycles is 64.degree. C. Escalating the annealing
temperature from TM1 to TM2 to TM3 in the first three cycles of PCR
greatly improves specificity. These annealing temperatures are
representative, and the skilled artisan understands that the
annealing temperatures for each cycle are dependent on the specific
primers used.
The temperatures and times for denaturing, annealing, and
extension, are optimized by trying various settings and using the
parameters that yield the best results.
Purification of Fragment Containing Locus of Interest
The PCR products are separated from the genomic template DNA. Each
PCR product is divided into four separate reaction wells of a
Streptawell, transparent, High-Bind plate from Roche Diagnostics
GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001 Biochemicals Catalog). The first primers contain
a 5' biotin tag so the PCR products bound to the Streptavidin
coated wells while the genomic template DNA does not. The
streptavidin binding reaction is performed using a Thermomixer
(Eppendorf) at 1000 rpm for 20 min. at 37.degree. C. Each well is
aspirated to remove unbound material, and washed three times with
1.times. PBS, with gentle mixing (Kandpal et al., Nucl. Acids Res.
18:1789 1795 (1990); Kaneoka et al., Biotechniques 10:30 34 (1991);
Green et al., Nucl. Acids Res. 18:6163 6164 (1990)).
Alternatively, the PCR products are placed into a single well of a
streptavidin plate to perform the nucleotide incorporation reaction
in a single well.
Restriction Enzyme Digestion of Isolated Fragments Containing Loci
of Interest
The purified PCR products are digested with the restriction enzyme
BsmF I (New England Biolabs catalog number R0572S), which binds to
the recognition site incorporated into the PCR products from the
second primer. The digests are performed in the Streptawells
following the instructions supplied with the restriction enzyme.
After digestion with the appropriate restriction enzyme, the wells
are washed three times with PBS to remove the cleaved
fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest described above yields a DNA fragment
with a 5' overhang, which contains the locus of interest and a 3'
recessed end. The 5' overhang functions as a template allowing
incorporation of a nucleotide or nucleotides in the presence of a
DNA polymerase.
For each locus of interest, four separate fill in reactions are
performed; each of the four reactions contains a different
fluorescently labeled ddNTP (ddATP, ddTTP, ddGTP, or ddCTP). The
following components are added to each fill in reaction: 1 .mu.l of
a fluorescently labeled ddNTP, 0.5 .mu.l of unlabeled ddNTPs (40
EM), which contains all nucleotides except the nucleotide that is
fluorescently labeled, 2 .mu.l of 10.times. sequenase buffer, 0.25
.mu.l of Sequenase, and water as needed for a 20 .mu.l reaction.
The fill are performed in reactions at 40.degree. C. for 10 min.
Non-fluorescently labeled ddNTP are purchased from Fermentas Inc.
(Hanover, Md.). All other labeling reagents are obtained from
Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing Core
Kit, US 79565). In the presence of fluorescently labeled ddNTPs,
the 3' recessed end is extended by one base, which corresponds to
the locus of interest.
A mixture of labeled ddNTPs and unlabeled dNTPs also can be used
for the fill-in reaction. The "fill in" conditions are as described
above except that a mixture containing 40 .mu.M unlabeled dNTPs, 1
.mu.l fluorescently labeled ddATP, 1 .mu.l fluorescently labeled
ddTTP, 1 .mu.l fluorescently labeled ddCTP, and 1 .mu.l ddGTP are
used. The fluorescent ddNTPs are obtained from Amersham (Thermo
Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565;
Amersham does not publish the concentrations of the fluorescent
nucleotides). The locus of interest is digested with the
restriction enzyme BsmF I, which generates a 5' overhang of four
bases. If the first nucleotide incorporated is a labeled ddNTP, the
3' recessed end is filled in by one base, allowing detection of the
locus of interest. However, if the first nucleotide incorporated is
a dNTP, the polymerase continues to incorporate nucleotides until a
ddNTP is filled in. For example, the first two nucleotides may be
filled in with dNTPs, and the third nucleotide with a ddNTP,
allowing detection of the third nucleotide in the overhang. Thus,
the sequence of the entire 5' overhang is determined, which
increases the information obtained from each SNP or locus of
interest. This type of fill in reaction is especially useful when
detecting the presence of insertions, deletions, insertions and
deletions, rearrangements, and translocations.
Alternatively, one nucleotide labeled with a single dye is used to
determine the sequence of the locus of interest. See Example 4.
This method eliminates any potential errors when using different
dyes, which have different quantum coefficients.
After labeling, each Streptawell is rinsed with 1.times. PBS (100
.mu.l) three times. The "filled in" DNA fragments are released from
the Streptawells by digesting with the restriction enzyme EcoRI,
according to the manufacturer's instructions that are supplied with
the enzyme. The digestion is performed for 1 hour at 37.degree. C.
with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample is loaded
into a lane of a 36 cm 5% acrylamide (urea) gel (BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number
50691). The sample is electrophoresed into the gel at 3000 volts
for 3 min. The gel is run for 3 hours using a sequencing apparatus
(Hoefer SQ3 Sequencer). The incorporated labeled nucleotide is
detected by fluorescence.
To determine if any cells contain mutations at codon 1370 of the
APC gene when separate fill-in reactions are performed, the lanes
of the gel that correspond to the fill-in reaction for ddATP and
ddTTP are analyzed. If only normal cells are present, the lane
corresponding to the fill in reaction with ddATP is a bright
signal. No signal is detected for the "fill-in" reaction with
ddTTP. However, if the patient sample contains cells with mutations
at codon 1370 of the APC gene, the lane corresponding to the fill
in reaction with ddATP is a bright signal, and a signal is detected
from the lane corresponding to the fill in reaction with ddTTP. The
intensity of the signal from the lane corresponding to the fill in
reaction with ddTTP is indicative of the number of mutant cells in
the sample.
Alternatively, one labeled nucleotide is used to determine the
sequence of the alleles at codon 1370 of the APC gene. At codon
1370, the normal sequence is AAA, which codes for the amino acid
lysine. However, a nucleotide substitution has been identified at
codon 1370, which is associated with colorectal tumors.
Specifically, a change from A to T (AAA-TAA) typically is found at
codon 1370, which results in a stop codon. A single fill-in
reaction is performed using labeled ddATP, and unlabeled dTTP,
dCTP, and dGTP. A single nucleotide labeled with one fluorescent
dye is used to determine the presence of both the normal and mutant
DNA sequence that codes for codon 1370. The relevant DNA sequence
is depicted below with the sequence corresponding to codon 1370 in
bold:
TABLE-US-00062 5' CCCAAAAGTCCACCTGA (SEQ ID NO: 46) 3'
GGGTTTTCAGGTGGACT (SEQ ID NO: 47)
After digest with BsmF I, the following overhang is produced:
TABLE-US-00063 5' CCC 3' GGG T T T T Overhang position 1 2 3 4
If the patient sample has no cells harboring a mutation at codon
1370, one signal is seen corresponding to incorporation of labeled
ddATP.
TABLE-US-00064 5' CCC A* 3' GGG T T T T Overhang position 1 2 3
4
However, if the patient sample has cells with mutations at codon
1370 of the APC gene, one signal is seen, which corresponds to the
normal sequence at codon 1370, and a second signal is seen, which
corresponds to the mutant sequence at codon 1370. The signals
clearly are identified as they differ in molecular weight.
TABLE-US-00065 Overhang of normal DNA sequence: CCC GGG T T T T
Overhang position 1 2 3 4 Normal DNA sequence after fill-in: CCC A*
GGG T T T T Overhang position 1 2 3 4 Overhang of mutant DNA
sequence: CCC GGG A T T T Overhang position 1 2 3 4 Mutant DNA
sequence after fill-in: CCC T A* GGG A T T T Overhang position 1 2
3 4
Two signals are seen when the mutant allele is present. The mutant
DNA molecules are filled in one base after the wild type DNA
molecules. The two signals are separated using any method that
discriminates based on molecular weight. One labeled nucleotide
(ddATP) is used to detect the presence of both the wild type DNA
sequence and the mutant DNA sequence. This method of labeling
reduces the number of reactions that need to be performed and
allows accurate quantitation for the number of mutant cells in the
patient sample. The number of mutant cells in the sample is used to
determine patient prognosis, the degree and the severity of the
disease. This method of labeling eliminates the complications
associated with using different dyes, which have distinct quantum
coefficients. This method of labeling also eliminates errors
associated with pipetting reactions.
To determine if any cells contain mutations at codon 1302 of the
APC gene when separate fill-in reactions are performed, the lanes
of the gel that correspond to the fill-in reaction for ddTTP and
ddCTP are analyzed. The normal DNA sequence is depicted below with
sequence coding for codon 1302 in bold type-face.
TABLE-US-00066 Normal Sequence: 5' ACCCTGCAAATAGCAGAA (SEQ ID NO:
48) 3' TGGGACGTTTATCGTCTT (SEQ ID NO: 49)
After digest, the following 5' overhang is produced:
TABLE-US-00067 5' ACCC 3' TGGG A C G T Overhang position 1 2 3
4
After the fill-in reaction, labeled ddTTP is incorporated.
TABLE-US-00068 5' ACCC T* 3' TGGG A C G T Overhang position 1 2 3
4
A deletion of a single base of the APC sequence, which typically
codes for codon 1302, has been associated with colorectal tumors.
The mutant DNA sequence is depicted below with the relevant
sequence in bold:
TABLE-US-00069 Mutant Sequence: 5' ACCCGCAAATAGCAGAA (SEQ ID NO:
50) 3' TGGGCGTTTATCGTCTT (SEQ ID NO: 51) After digest: 5' ACC 3'
TGG G C G T Overhang position 1 2 3 4 After fill-in: 5' ACC C* 3'
TGG G C G T Overhang position 1 2 3 4
If there are no mutations in the APC gene, signal is not detected
for the fill in reaction with ddCTP*, but a bright signal is
detected for the fill-in reaction with ddTTP*. However, if there
are cells in the patient sample that have mutations in the APC
gene, signals are seen for the fill-in reactions with ddCTP* and
ddTTP*.
Alternatively, a single fill-in reaction is performed using a
mixture containing unlabeled dNTPs, fluorescently labeled ddATP,
fluorescently labeled ddTTP, fluorescently labeled ddCTP, and
fluorescently labeled ddGTP. If there is no deletion, labeled ddTTP
is incorporated.
TABLE-US-00070 5' ACCC T* 3' TGGG A C G T Overhang position 1 2 3
4
However, if the T has been deleted, labeled ddCTP* is
incorporated.
TABLE-US-00071 5' ACC C* 3' TGG G C G T Overhang position 1 2 3
4
The two signals are separated by molecular weight because of the
deletion of the thymidine nucleotide. If mutant cells are present,
two signals are generated in the same lane but are separated by a
single base pair (this principle is demonstrated in FIG. 9D). The
deletion causes a change in the molecular weight of the DNA
fragments, which allows a single fill in reaction to be used to
detect the presence of both normal and mutant cells.
In the above example, methods for the detection of a nucleotide
substitution and a small deletion are described. However, the
methods are used for the detection of any type of mutation
including but not limited to nucleotide substitutions (see Table
III), splicing errors (see Table IV), small deletions (see Table
V), small insertions (see Table VI), small insertions/deletions
(see Table VII), gross deletions (see Table VIII), gross insertions
(see Table IX), and complex rearrangements (see Table X).
In addition, the above-described methods are used for the detection
of any type of disease including but not limited to those listed in
Table II. Furthermore, any type of mutant gene is detected using
the inventions described herein including but not limited to the
genes associated with the diseases listed in Table II, BRCA1,
BRCA2, MSH6, MSH2, MLH1, RET, PTEN, ATM, H-RAS, p53, ELAC2, CDH1,
APC, AR, PMS2, MLH3, CYP1A1, GSTP1, GSTM1, AXIN2, CYP19, MET, NAT1,
CDKN2A, NQ01, trc8, RAD51, PMS1, TGFBR2, VHL, MC4R, POMC, NROB2,
UCP2, PCSK1, PPARG, ADRB2, UCP3, glur1, cart, SORBS1, LEP, LEPR,
SIM1, TNF, IL-6, IL-1, IL-2, IL-3, IL1A, TAP2, THPO, THRB, NBS1,
RBM15, LIF, MPL, RUNX1, Her-2, glucocorticoid receptor, estrogen
receptor, thyroid receptor, p21, p27, K-RAS, N-RAS, retinoblastoma
protein, Wiskott-Aldrich (WAS) gene, Factor V Leiden, Factor II
(prothrombin), methylene tetrahydrofolate reductase, cystic
fibrosis, LDL receptor, HDL receptor, superoxide dismutase gene,
SHOX gene, genes involved in nitric oxide regulation, genes
involved in cell cycle regulation, tumor suppressor genes,
oncogenes, genes associated with neurodegeneration, genes
associated with obesity. Abbreviations correspond to the proteins
as listed on the Human Gene Mutation Database, which is
incorporated herein by reference (www.archive.uwcm.ac.uk/uwcm)
website address active as of Feb. 12, 2003).
The above-example demonstrates the detection of mutant cells and
mutant alleles from a fecal sample. However, the methods described
herein are used for detection of mutant cells from any biological
sample including but not limited to blood sample, serum sample,
plasma sample, urine sample, spinal fluid, lymphatic fluid, semen,
vaginal secretion, ascitic fluid, saliva, mucosa secretion,
peritoneal fluid, fecal sample, body exudates, breast fluid, lung
aspirates, cells, tissues, individual cells or extracts of the such
sources that contain the nucleic acid of the same, and subcellular
structures such as mitochondria or chloroplasts. In addition, the
methods described herein are used for the detection of mutant cells
and mutated DNA from any number of nucleic acid containing sources
including but not limited to forensic, food, archeological,
agricultural or inorganic samples.
The above example is directed to detection of mutations in the APC
gene. However, the inventions described herein are used for the
detection of mutations in any gene that is associated with or
predisposes to disease (see Table XI).
For example, hypermethylation of the glutathione S-transferase P1
(GSTP1) promoter is the most common DNA alteration in prostrate
cancer. The methylation state of the promoter is determined using
sodium bisulfite and the methods described herein.
Treatment with sodium bisulfite converts unmethylated cytosine
residues into uracil, and leaving the methylated cytosines
unchanged. Using the methods described herein, a first and second
primer are designed to amplify the regions of the GSTP1 promoter
that are often methylated. Below, a region of the GSTP1 promoter is
shown prior to sodium bisulfite treatment:
Before Sodium Bisulfite treatment: 5' ACCGCTACA 3' TGGCGATCA
Below, a region of the GSTP1 promoter is shown after sodium
bisulfite treatment, PCR amplification, and digestion with the type
IIS restriction enzyme BsmF I:
TABLE-US-00072 Unmethylated 5'ACC 3'TGG U G A T Overhang position 1
2 3 4 Methylated 5'ACC 3'TGG C G A T Overhang position 1 2 3 4
Labeled ddATP, unlabeled dCTP, dGTP, and dTTP are used to fill-in
the 5' overhangs. The following molecules are generated:
TABLE-US-00073 Unmethylated 5'ACC A* 3'TGG U G A T Overhang
position 1 2 3 4 Methylated 5'ACC G C T A* 3'TGG C G A T Overhang
position 1 2 3 4
Two signals are seen; one corresponds to DNA molecules filled in
with ddATP at position one complementary to the overhang
(unmethylated), and the other corresponds to the DNA molecules
filled in with ddATP at position 4 complementary to the overhang
(methylated). The two signals are separated based on molecular
weight. Alternatively, the fill-in reactions are performed in
separate reactions using labeled ddGTP in one reaction and labeled
ddATP in another reaction.
The methods described herein are used to screen for prostate cancer
and also to monitor the progression and severity of the disease.
The use of a single nucleotide to detect both the methylated and
unmethylated sequences allows accurate quantitation and provides a
high level of sensitivity for the methylated sequences, which is a
useful tool for earlier detection of the disease.
The information contained in Tables III X was obtained from the
Human Gene Mutation Database. With the information provided herein,
the skilled artisan will understand how to apply these methods for
determining the sequence of the alleles for any gene. A large
number of genes and their associated mutations can be found at the
following website: www.archive.uwcm.ac.uk./uwcm.
TABLE-US-00074 TABLE III NUCLEOTLDE SUBSTITUTIONS Nucleo- Amino
Codon tide acid Phenotype 99 CGG-TGG Arg-Trp Adenomatous polyposis
coli 121 AGA-TGA Arg-Term Adenomatous polyposis coli 157 TGG-TAG
Trp-Term Adenomatous polyposis coli 159 TAC-TAG Tyr-Term
Adenomatous polyposis coli 163 CAG-TAG Gln-Term Adenomatous
polyposis coli 168 AGA-TGA Arg-Term Adenomatous polyposis coli 171
AGT-ATT Ser-Ile Adenomatous polyposis coli 181 CAA-TAA Gln-Term
Adenomatous polyposis coli 190 GAA-TAA Glu-Term Adenomatous
polyposis coli 202 GAA-TAA Glu-Term Adenomatous polyposis coli 208
CAG-CGG Gln-Arg Adenomatous polyposis coli 208 CAG-TAG Gln-Term
Adenomatous polyposis coli 213 CGA-TGA Arg-Term Adenomatous
polyposis coli 215 CAG-TAG Gln-Term Adenomatous polyposis coli 216
CGA-TGA Arg-Term Adenomatous polyposis coli 232 CGA-TGA Arg-Term
Adenomatous polyposis coli 233 CAG-TAG Gln-Term Adenomatous
polyposis coli 247 CAG-TAG Gln-Term Adenomatous polyposis coli 267
GGA-TGA Gly-Term Adenomatous polyposis coli 278 CAG-TAG Gln-Term
Adenomatous polyposis coli 280 TCA-TGA Ser-Term Adenomatous
polyposis coli 280 TCA-TAA Ser-Term Adenomatous polyposis coli 283
CGA-TGA Arg-Term Adenomatous polyposis coli 302 CGA-TGA Arg-Term
Adenomatous polyposis coli 332 CGA-TGA Arg-Term Adenomatous
polyposis coli 358 CAG-TAG Gln-Term Adenomatous polyposis coli 405
CGA-TGA Arg-Term Adenomatous polyposis coli 414 CGC-TGC Arg-Cys
Adenomatous polyposis coli 422 GAG-TAG Glu-Term Adenomatous
polyposis coli 423 TGG-TAG Trp-Term Adenomatous polyposis coli 424
CAG-TAG Gln-Term Adenomatous polyposis coli 433 CAG-TAG Gln-Term
Adenomatous polyposis coli 443 GAA-TAA Glu-Term Adenomatous
polyposis coli 457 TCA-TAA Ser-Term Adenomatous polyposis coli 473
CAG-TAG Gln-Term Adenomatous polyposis coli 486 TAC-TAG Tyr-Term
Adenomatous polyposis coli 499 CGA-TGA Arg-Term Adenomatous
polyposis coli 500 TAT-TAG Tyr-Term Adenomatous polyposis coli 541
CAG-TAG Gln-Term Adenomatous polyposis coli 553 TGG-TAG Trp-Term
Adenomatous polyposis coli 554 CGA-TGA Arg-Term Adenomatous
polyposis coli 564 CGA-TGA Arg-Term Adenomatous polyposis coli 577
TTA-TAA Leu-Term Adenomatous polyposis coli 586 AAA-TAA Lys-Term
Adenomatous polyposis coli 592 TTA-TGA Leu-Term Adenomatous
polyposis coli 593 TGG-TAG Trp-Term Adenomatous polyposis coli 593
TGG-TGA Trp-Term Adenomatous polyposis coli 622 TAC-TAA Tyr-Term
Adenomatous polyposis coli 625 CAG-TAG Gln-Term Adenomatous
polyposis coli 629 TTA-TAA Leu-Term Adenomatous polyposis coli 650
GAG-TAG Glu-Term Adenomatous polyposis coli 684 TTG-TAG Leu-Term
Adenomatous polyposis coli 685 TGG-TGA Trp-Term Adenomatous
polyposis coli 695 CAG-TAG Gln-Term Adenomatous polyposis coli 699
TGG-TGA Trp-Term Adenomatous polyposis coli 699 TGG-TAG Trp-Term
Adenomatous polyposis coli 713 TCA-TGA Ser-Term Adenomatous
polyposis coli 722 AGT-GGT Ser-Gly Adenomatous polyposis coli 747
TCA-TGA Ser-Term Adenomatous polyposis coli 764 TTA-TAA Leu-Term
Adenomatous polyposis coli 784 TCT-ACT Ser-Thr Adenomatous
polyposis coli 805 CGA-TGA Arg-Term Adenomatous polyposis coli 811
TCA-TGA Ser-Term Adenomatous polyposis coli 848 AAA-TAA Lys-Term
Adenomatous polyposis coli 876 CGA-TGA Arg-Term Adenomatous
polyposis coli 879 CAG-TAG Gln-Term Adenomatous polyposis coli 893
GAA-TAA Glu-Term Adenomatous polyposis coli 932 TCA-TAA Ser-Term
Adenomatous polyposis coli 932 TCA-TGA Ser-Term Adenomatous
polyposis coli 935 TAC-TAG Tyr-Term Adenomatous polyposis coli 935
TAC-TAA Tyr-Term Adenomatous polyposis coli 995 TGC-TGA Gys-Term
Adenomatous polyposis coli 997 TAT-TAG Tyr-Term Adenomatous
polyposis coli 999 CAA-TAA Gln-Term Adenomatous polyposis coli 1000
TAC-TAA Tyr-Term Adenomatous polyposis coli 1020 GAA-TAA Glu-Term
Adenomatous polyposis coli 1032 TCA-TAA Ser-Term Adenomatous
polyposis coli 1041 CAA-TAA Gln-Term Adenomatous polyposis coli
1044 TCA-TAA Ser-Term Adenomatous polyposis coli 1045 CAG-TAG
Gln-Term Adenomatous polyposis coli 1049 TGG-TGA Trp-Term
Adenomatous polyposis coli 1067 CAA-TAA Gln-Term Adenomatous
polyposis coli 1071 CAA-TAA Gln-Term Adenomatous polyposis coli
1075 TAT-TAA Tyr-Term Adenomatous polyposis coli 1075 TAT-TAG
Tyr-Term Adenomatous polyposis coli 1102 TAC-TAG Tyr-Term
Adenomatous polyposis coli 1110 TCA-TGA Ser-Term Adenomatous
polyposis coli 1114 CGA-TGA Arg-Term Adenomatous polyposis coli
1123 CAA-TAA Gln-Term Adenomatous polyposis coli 1135 TAT-TAG
Tyr-Term Adenomatous polyposis coli 1152 CAG-TAG Gln-Term
Adenomatous polyposis coli 1155 GAA-TAA Glu-Term Adenomatous
polyposis coli 1168 GAA-TAA Glu-Term Adenomatous polyposis coli
1175 CAG-TAG Gln-Term Adenomatous polyposis coli 1176 CCT-CTT
Pro-Leu Adenomatous polyposis coli 1184 GCC-CCC Ala-Pro Adenomatous
polyposis coli 1193 CAG-TAG Gln-Term Adenomatous polyposis coli
1194 TCA-TGA Ser-Term Adenomatous polyposis coli 1198 TCA-TGA
Ser-Term Adenomatous polyposis coli 1201 TCA-TGA Ser-Term
Adenomatous polyposis coli 1228 CAG-TAG Gln-Term Adenomatous
polyposis coli 1230 CAG-TAG Gln-Term Adenomatous polyposis coli
1244 CAA-TAA Gln-Term Adenomatous polyposis coli 1249 TGC-TGA
Cys-Term Adenomatous polyposis coli 1256 CAA-TAA Gln-Term
Adenomatous polyposis coli 1262 TAT-TAA Tyr-Term Adenomatous
polyposis coli 1270 TGT-TGA Cys-Term Adenomatous polyposis coli
1276 TCA-TGA Ser-Term Adenomatous polyposis coli 1278 TCA-TAA
Ser-Term Adenomatous polyposis coli 1286 GAA-TAA Glu-Term
Adenomatous polyposis coli 1289 TGT-TGA Cys-Term Adenomatous
polyposis coli 1294 CAG-TAG Gln-Term Adenomatous polyposis coli
1307 ATA-AAA Ile-Lys Colorectal cancer, predis- position to,
association 1309 GAA-TAA Glu-Term Adenomatous polyposis coli 1317
GAA-CAA Glu-Gln Colorectal cancer, predis- position to 1328 CAG-TAG
Gln-Term Adenomatous polyposis coli 1338 CAG-TAG Gln-Term
Adenomatous polyposis coli 1342 TTA-TAA Leu-Term Adenomatous
polyposis coli 1342 TTA-TGA Leu-Term Adenomatous polyposis coli
1348 AGG-TGG Arg-Trp Adenomatous polyposis coli 1357 GGA-TGA
Gly-Term Adenomatous polyposis coli
1367 CAG-TAG Gln-Term Adenomatous polyposis coli 1370 AAA-TAA
Lys-Term Adenomatous polyposis coli 1392 TCA-TAA Ser-Term
Adenomatous polyposis coli 1392 TCA-TGA Ser-Term Adenomatous
polyposis coli 1397 GAG-TAG Glu-Term Adenomatous polyposis coli
1449 AAG-TAG Lys-Term Adenomatous polyposis coli 1450 CGA-TGA
Arg-Term Adenomatous polyposis coli 1451 GAA-TAA Glu-Term
Adenomatous polyposis coli 1503 TCA-TAA Ser-Term Adenomatous
polyposis coli 1517 CAG-TAG Gln-Term Adenomatous polyposis coli
1529 CAG-TAG Gln-Term Adenomatous polyposis coli 1539 TCA-TAA
Ser-Term Adenomatous polyposis coli 1541 CAG-TAG Gln-Term
Adenomatous polyposis coli 1564 TTA-TAA Leu-Term Adenomatous
polyposis coli 1567 TCA-TGA Ser-Term Adenomatous polyposis coli
1640 CGG-TGG Arg-Trp Adenomatous polyposis coli 1693 GAA-TAA
Glu-Term Adenomatous polyposis coli 1822 GAC-GTC Asp-Val
Adenomatous polyposis coli association with ? 2038 CTG-GTG Leu-Val
Adenomatous polyposis coli 2040 CAG-TAG Gln-Term Adenomatous
polyposis coli 2566 AGA-AAA Arg-Lys Adenomatous polyposis coli 2621
TCT-TGT Ser-Cys Adenomatous polyposis coli 2839 CTT-TTT Leu-Phe
Adenomatous polyposis coli
TABLE-US-00075 TABLE IV NUCLEOTIDE SUBSTITUTIONS Donor/ Relative
Substi- Acceptor location tution Phenotype ds - 1 G-C Adenomatous
polyposis coli as -1 G-A Adenomatous polyposis coli as -1 G-C
Adenomatous polyposis coli ds +2 T-A Adenomatous polyposis coli as
-1 G-C Adenomatous polyposis coli as -1 G-T Adenomatous polyposis
coli as -1 G-A Adenomatous polyposis coli as -2 A-C Adenomatous
polyposis coli as -5 A-G Adenomatous polyposis coli ds +3 A-C
Adenomatous polyposis coli as -1 G-A Adenomatous polyposis coli ds
+1 G-A Adenomatous polyposis coli as -1 G-T Adenomatous polyposis
coli ds +1 G-A Adenomatous polyposis coli as -1 G-A Adenomatous
polyposis coli ds +1 G-A Adenomatous polyposis coli ds +3 A-G
Adenomatous polyposis coli ds +5 G-T Adenomatous polyposis coli as
-1 G-A Adenomatous polyposis coli as -6 A-G Adenomatous polyposis
coli as -5 A-G Adenomatous polyposis coli as -2 A-G Adenomatous
polyposis coli ds +2 T-C Adenomatous polyposis coli as -2 A-G
Adenomatous polyposis coli ds +1 G-A Adenomatous polyposis coli ds
+1 G-T Adenomatous polyposis coli ds +2 T-G Adenomatous polyposis
coli
TABLE-US-00076 TABLE V APC SMALL DELETIONS Location/ codon Deletion
Phenotype 77 TTAgataGCAGTAATTT Adenomatous polyposis coli 97
GGAAGccgggaagGATCTGTATC Adenomatous polyposis coli 138
GAGAaAGAGAG_E3I3_GTAA Adenomatous polyposis coli 139
AAAGAgag_E3I3_Gtaacttttct Thyroid cancer 139
AAAGagag_E3I3_GTAACTTTTC Adenomatous polyposis coli 142
TTTTAAAAAAaAAAAATAG_I3E4_GTCA Adenomatous polyposis coli 144
AAAATAG_13E4_GTCatTGCTTCTTGC Adenomatous polyposis coli 149
GACAaaGAAGAAAAGG Adenomatous polyposis coli 149 GACAAagaaGAAAAGGAAA
Adenomatous polyposis coli 155
AGGAA.sup..LAMBDA.AAAGActggtATTACGCTCA Adenomatous polyposis coli
169 AAAAGA.sup..LAMBDA.ATAGatagTCTTCCTTTA Adenomatous polyposis
coli 172 AGATAGT.sup..LAMBDA.CTTcCTTTAAGTGA Adenomatous polyposis
coli 179 TCCTTacaaACAGATATGA Adenomatous polyposis coli 185
ACCaGAAGGCAATT Adenomatous polyposis coli 196 ATCAGagTTGCGATGGA
Adenomatous polyposis coli 213 CGAGCaCAG_E515_GTAAGTT Adenomatous
polyposis coli 298 CACtcTGCACCTCGA Adenomatous polyposis coli 329
GATaTGTCGCGAAC Adenomatous polyposis coli 365 AAAGActCTGTATTGTT
Adenomatous polyposis coli 397 GACaaGAGAGGCAGG Adenomatous
polyposis coli 427 CATGAacCAGGCATGGA Adenomatous polyposis coli 428
GAACCaGGCATGGACC Adenomatous polyposis coli 436
AATCCaa_E919_gTATGTTCTCT Adenomatous polyposis coli 440
GCTCCtGTTGAACATC Adenomatous polyposis coli 455 AAACTtTCATTTGATG
Adenomatous polyposis coli 455 AAACtttcaTTTGATGAAG Adenomatous
polyposis coli 472 CTAcAGGCCATTGC Adenomatous polyposis coli 472
TAAATTAG_I10E11_GGgGACTACAGGC Adenomatous polyposis coli 478
TTATtGCAAGTGGAC Adenomatous polyposis coli 486 TACGgGCTTACTAAT
Adenomatous polyposis coli 494 AGTATtACACTAAGAC Adenomatous
polyposis coli 495 ATTACacTAAGACGATA Adenomatous polyposis coli 497
CTAaGACGATATGC Adenomatous polyposis coli 520 TGCTCtaTGAAAGGCTG
Adenomatous polyposis coli 526 ATGAGagcacttgtgGCCCAACTAA
Adenomatous polyposis coli 539 GACTTaCAGCAG_E12I12_GTAC Adenomatous
polyposis coli 560 AAAAAgaCGTTGCGAGA Adenomatous polyposis coli 566
GTTGgaagtGTGAAAGCAT Adenomatous polyposis coli 570 AAAGCaTTGATGGAAT
Adenomatous polyposis coli 577 TTAGaagtTAAAAAG_E13I13_GTA
Adenomatous polyposis coli 584 ACCCTcAAAAGCGTAT Adenomatous
polyposis coli 591 GCCTtATGGAATTTG Adenomatous polyposis coli 608
GCTgTAGATGGTGC Adenomatous polyposis coli 617
GTTggcactcttacttaccGGAGCCAGAC Adenomatous polyposis coli 620
CTTACttacCGGAGCCAGA Adenomatous polyposis coli 621 ACTTaCCGGAGCCAG
Adenomatous polyposis coli 624 AGCcaGACAAACACT Adenomatous
polyposis coli 624 AGCCagacAAACACTTTA Adenomatous polyposis coli
626 ACAaacaCTTTAGCCAT Adenomatous polyposis coli 629
TTAGCcATTATTGAAA Adenomatous polyposis coli 635 GGAGgTGGGATATTA
Adenomatous polyposis coli 638 ATATtACGGAATGTG Adenomatous
polyposis coli 639 TTACGgAATGTGTCCA Adenomatous polyposis coli 657
AGAgaGAACAACTGT Adenomatous polyposis coli 659
TATTTCAG_I14E15_GCaaatcctaagagagAACA Adenomatous polyposis coli
ACTGTC 660 AACTgtCTACAAACTT Adenomatous polyposis coli 665
TTAttACAACACTTA Adenomatous polyposis coli 668 CACttAAAATCTCAT
Adenomatous polyposis coli 673 AGTttgacaatagtCAGTAATGCA Adenomatous
polyposis coli 768 CACTTaTCAGAAACTT Adenomatous polyposis coli 769
TTATcAGAAACTTTT Adenomatous polyposis coli 770 TCAGAaACTTTTGACA
Adenomatous polyposis coli 780 AGTGcCAAGGCATCT Adenomatous
polyposis coli 792 AAGCaAAGTCTCTAT Adenomatous polyposis coli 792
AAGCAaaGTCTCTATGG Adenomatous polyposis coli 793 CAAAgTGTCTATGGT
Adenomatous polyposis coli 798 GATTatGTTTTTGACA Adenomatous
polyposis coli 802 GACACcaatcgacatGATGATAATA Adenomatous polyposis
coli 805 CGACatGATGATAATA Adenomatous polyposis coli 811
TCAGacaaTTTTAATACT Adenomatous polyposis coli 825 TATtTGAATACTAC
Adenomatous polyposis coli 827 AATAcTACAGTGTTA Adenomatous
polyposis coli 830 GTGTTacccagctcctctTCATCAAGAG Adenomatous
polyposis coli 833 AGCTCcTCTTCATCAA Adenomatous polyposis coli 836
TCATcAAGAGGAAGC Adenomatous polyposis coli 848 AAAGAtaGAAGTTTGGA
Adenomatous polyposis coli 848 AAAGatagaagTTTGGAGAGA Adenomatous
polyposis coli 855 GAACgCGGAATTGGT Adenomatous polyposis coli 856
CGCGgaattGGTCTAGGCA Adenomatous polyposis coli 856 CGCGgAATTGGTCTA
Adenomatous polyposis coli 879 CAGaTCTCCACCAC Adenomatous polyposis
coli 902 GAAGAcagaAGTTCTGGGT Adenomatous polyposis coli 907
GGGTcTACCACTGAA Adenomatous polyposis coli 915 GTGACaGATGAGAGAA
Adenomatous polyposis coli 929 CATACacatTCAAACACTT Adenomatous
polyposis coli 930 ACACAttcaAACACTTACA Adenomatous polyposis coli
931 CATtCAAACACTTA Adenomatous polyposis coli 931 CATTcAAACACTTAC
Adenomatous polyposis coli 933 AACacttACAATTTCAC Adenomatous
polyposis coli 935 TACAatttcactAAGTCGGAAA Adenomatous polyposis
coli 937 TTCActaaGTCGGAAAAT Adenomatous polyposis coli 939
AAGtcggAAAATTGAAA Adenomatous polyposis coli 946 ACATgTTCTATGCCT
Adenomatous polyposis coli 954 TTAGaaTACAAGAGAT Adenomatous
polyposis coli 961 AATgATAGTTTAAA Adenomatous polyposis coli 963
AGTTTaAATAGTGTCA Adenomatous polyposis coli 964 TTAaataGTGTCAGTAG
Adenomatous polyposis coli 973 TATGgTAAAAGAGGT Adenomatous
polyposis coli 974 GGTAAaAGAGGTCAAA Adenomatous polyposis coli 975
AAAAgaGGTGAAATGA Thyroid cancer 992 AGTAAgTTTTGCAGTT Thyroid cancer
993 AAGttttgcagttaTGGTCAATAC Adenomatous polyposis coli 999
CAAtacccagCCGACCTAGC Adenomatous polyposis coli 1023
ACACcAATAAATTAT Adenomatous polyposis coli 1030 AAAtaTTCAGATGA
Adenomatous polyposis coli 1032 TCAGatgagCAGTTGAACT Adenomatous
polyposis coli 1033 GATGaGCAGTTGAAC Adenomatous polyposis coli 1049
TGGGcAAGACCCAAA Adenomatous polyposis coli 1054 CACAtaataGAAGATGAAA
Adenomatous polyposis coli 1055 ATAAtagaaGATGAAATAA Adenomatous
polyposis coli 1056 ATAGAaGATGAAATAA Adenomatous polyposis coli
1060 ATAAAacaaaGTGAGCAAAG Adenomatous polyposis coli 1061
AAAcaaaGTGAGCAAAG Adenomatous polyposis coli 1061 AAACaaAGTGAGCAAA
Adenomatous polyposis coli 1062 CAAAgtgaGCAAAGACAA Adenomatous
polyposis coli 1065 CAAAGacAATCAAGGAA Adenomatous polyposis coli
1067 CAAtcaaGGAATCAAAG Adenomatous polyposis coli 1071
CAAAgtACAACTTATC Adenomatous polyposis coli 1079 ACTGagAGCACTGATG
Adenomatous polyposis coli 1082 ACTGAtgATAAACACCT Adenomatous
polyposis coli 1084 GATaaacACCTCAAGTT Adenomatous polyposis coli
1086 CACCtcAAGTTCCAAC Adenomatous polyposis coli
1093 TTTGgACAGCAGGAA Adenomatous polyposis coli 1098
TGTgtTTCTCCATAC Adenomatous polyposis coli 1105 CGGgGAGCCAATGG
Thyroid cancer 1110 TCAGAaACAAATCGAG Adenomatous polyposis coli
1121 ATTAAtcaaAATGTAAGCC Adenomatous polyposis coli 1131
CAAgAAGATGACTA Adenomatous polyposis coli 1134 GACTAtGAAGATGATA
Adenomatous polyposis coli 1137 GATgataaGCCTACCAAT Adenomatous
polyposis coli 1146 CGTTAcTCTGAAGAAG Adenomatous polyposis coli
1154 GAAGaagaaGAGAGACCAA Adenomatous polyposis coli 1155
GAAGaagaGAGACCAACA Adenomatous polyposis coli 1156
GAAgagaGACCAACAAA Adenomatous polyposis coli 1168
GAAgagaaACGTCATGTG Adenomatous polyposis coli 1178
GATTAtagtttaAAATATGCCA Adenomatous polyposis coli 1181
TTAAaATATGCCACA Adenomatous polyposis coli 1184 GCCacagaTATTCCTTCA
Adenomatous polyposis coli 1185 ACAgaTATTCCTTCA Adenomatous
polyposis coli 1190 TCACAgAAACAGTCAT Adenomatous polyposis coli
1192 AAAcaGTCATTTTCA Adenomatous polyposis coli 1198
TCAaaGAGTTCATCT Adenomatous polyposis coli 1207 AAAAcCGAACATATG
Adenomatous polyposis coli 1208 ACCgaacATATGTCTTC Adenomatous
polyposis coli 1210 CATatGTCTTCAAGC Adenomatous polyposis coli 1233
CCAAGtTCTGCACAGA Adenomatous polyposis coli 1249 TGCAaaGTTTCTTCTA
Adenomatous polyposis coli 1259 ATAcaGACTTATTGT Adenomatous
polyposis coli 1260 CAGACttATTGTGTAGA Adenomatous polyposis coli
1268 CCAaTATGTTTTTC Adenomatous polyposis coli 1275 AGTtCATTATCATC
Adenomatous polyposis coli 1294 CAGGAaGCAGATTCTG Adenomatous
polyposis coli 1301 ACCCtGCAAATAGCA Adenomatous polyposis coli 1306
GAAAtaaaAGAAAAGATT Adenomatous polyposis coli 1307 ATAaAAGAAAAGAT
Adenomatous polyposis coli 1308 AAAgaaaAGATTGGAAC Adenomatous
polyposis coli 1308 AAAGAaaagaTTGGAACTAG Adenomatous polyposis coli
1318 GATCcTGTGAGCGAA Adenomatous polyposis coli 1320
GTGAGcGAAGTTCCAG Adenomatous polyposis coli 1323 GTTCcAGCAGTGTCA
Adenomatous polyposis coli 1329 CACCctagaaccAAATCCAGCA Adenomatous
polyposis coli 1336 AGACtgCAGGGTTCTA Adenomatous polyposis coli
1338 CAGgGTTCTAGTTT Adenomatous polyposis coli 1340 TCTAgTTTATCTTCA
Adenomatous polyposis coli 1342 TTATcTTCAGAATCA Adenomatous
polyposis coli 1352 GTTgAATTTTCTTC Adenomatous polyposis coli 1361
CCCTcCAAAAGTGGT Adenomatous polyposis coli 1364 AGTggtgCTCAGACACC
Adenomatous polyposis coli 1371 AGTCCacCTGAACACTA Adenomatous
polyposis coli 1372 CCACCtGAACACTATG Adenomatous polyposis coli
1376 TATGttCAGGAGACCC Adenomatous polyposis coli 1394
GATAgtTTTGAGAGTC Adenomatous polyposis coli 1401 ATTGCcAGCTCCGTTC
Adenomatous polyposis coli 1415 AGTGGcATTATAAGCC Adenomatous
polyposis coli 1426 AGCCcTGGACAAACC Adenomatous polyposis coli 1427
CCTGGaCAAACCATGC Adenomatous polyposis coli 1431 ATGCcACCAAGCAGA
Adenomatous polyposis coli 1454 AAAAAtAAAGCACCTA Adenomatous
polyposis coli 1461 GAAaAGAGAGAGAG Adenomatous polyposis coli 1463
AGAgagaGTGGACCTAA Adenomatous polyposis coli 1464 GAGAgTGGACCTAAG
Adenomatous polyposis coli 1464 GAGAgtGGACCTAAGC Adenomatous
polyposis coli 1464 GAGagTGGACCTAAG Adenomatous polyposis coli 1492
GCCaCGGAAAGTAC Adenomatous polyposis coli 1493 ACGGAaAGTACTCCAG
Adenomatous polyposis coli 1497 CCAgATGGATTTTC Adenomatous
polyposis coli 1503 TCAtccaGCCTGAGTGC Adenomatous polyposis coli
1522 TTAagaataaTGCCTCCAGT Adenomatous polyposis coli 1536
GAAACagAATCAGAGCA Adenomatous polyposis coli 1545
TCAAAtgaaaACCAAGAGAA Adenomatous polyposis coli 1547 GAAaACCAAGAGAA
Adenomatous polyposis coli 1550 GAGAaagaGGCAGAAAAA Adenomatous
polyposis coli 1577 GAATgtATTATTTCTG Adenomatous polyposis coli
1594 CCAGCcCAGACTGCTT Adenomatous polyposis coli 1596
CAGACtGCTTCAAAAT Adenomatous polyposis coli 1823 TTCAaTGATAAGCTC
Adenomatous polyposis coli 1859 AATGAttctTTGAGTTCTC Adenomatous
polyposis coli 1941 CCAGAcagaGGGGCAGCAA Desmoid tumours 1957
GAAaATACTCCAGT Adenomatous polyposis coli 1980 AACaATAAAGAAAA
Adenomatous polyposis coli 1985 GAACCtATCAAAGAGA Adenomatous
polyposis coli 1986 CCTaTCAAAGAGAC Adenomatous polyposis coli 1998
GAACcAAGTAAACCT Adenomatous polyposis coli 2044 AGCTCcGCAATGCCAA
Adenomatous polyposis coli 2556 TCATCccttcctcGAGTAAGCAC Adenomatous
polyposis coli 2643 CTAATttatCAAATGGCAC Adenomatous polyposis coli
Bold letters indicate the codon. Undercase letters represent the
deletion. Where deletions extend beyond the coding region, other
positional information is provided. For example, the abbreviation
5'UTR represents 5' untranslated region, and the abbreviation E616
denotes exon 6/intron 6 boundary.
TABLE-US-00077 TABLE VI SMALL INSERTIONS Codon Insertion Phenotype
157 T Adenomatous polyposis coli 170 AGAT Adenomatous polyposis
coli 172 T Adenomatous polyposis coli 199 G Adenomatous polyposis
coli 243 AG Adenomatous polyposis coli 266 T Adenomatous polyposis
coli 357 A Adenomatous polyposis coli 405 C Adenomatous polyposis
coli 413 T Adenomatous polyposis coli 416 A Adenomatous polyposis
coli 457 G Adenomatous polyposis coli 473 A Adenomatous polyposis
coli 503 ATTC Adenomatous polyposis coli 519 C Adenomatous
polyposis coli 528 A Adenomatous polyposis coli 561 A Adenomatous
polyposis coli 608 A Adenomatous polyposis coli 620 CT Adenomatous
polyposis coli 621 A Adenomatous polyposis coli 623 TTAC
Adenomatous polyposis coli 627 A Adenomatous polyposis coli 629 A
Adenomatous polyposis coli 636 GT Adenomatous polyposis coli 639 A
Adenomatous polyposis coli 704 T Adenomatous polyposis coli 740
ATGC Adenomatous polyposis coli 764 T Adenomatous polyposis coli
779 TT Adenomatous polyposis coli 807 AT Adenomatous polyposis coli
827 AT Adenomatous polyposis coli 831 A Adenomatous polyposis coli
841 CTTA Adenomatous polyposis coli 865 CT Adenomatous polyposis
coli 865 AT Adenomatous polyposis coli 900 TG Adenomatous polyposis
coli 921 G Adenomatous polyposis coli 927 A Adenomatous polyposis
coli 935 A Adenomatous polyposis coli 936 C Adenomatous polyposis
coli 975 A Adenomatous polyposis coli 985 T Adenomatous polyposis
coli 997 A Adenomatous polyposis coil 1010 TA Adenomatous polyposis
coli 1085 C Adenomatous polyposis coli 1085 AT Adenomatous
polyposis coli 1095 A Adenomatous polyposis coli 1100 GTTT
Adenomatous polyposis coli 1107 GGAG Adenomatous polyposis coli
1120 G Adenomatous polyposis coli 1166 A Adenomatous polyposis coli
1179 T Adenomatous polyposis coli 1187 A Adenomatous polyposis coli
1211 T Adenomatous polyposis coli 1256 A Adenomatous polyposis coli
1265 T Adenomatous polyposis coli 1267 GATA Adenomatous polyposis
coli 1268 T Adenomatous polyposis coli 1301 A Adenomatous polyposis
coli 1301 C Adenomatous polyposis coli 1323 A Adenomatous polyposis
coli 1342 T Adenomatous polyposis coli 1382 T Adenomatous polyposis
coli 1458 GTAG Adenomatous polyposis coli 1463 AG Adenomatous
polyposis coli 1488 T Adenomatous polyposis coli 1531 A Adenomatous
polyposis coli 1533 T Adenomatous polyposis coli 1554 A Adenomatous
polyposis coli 1555 A Adenomatous polyposis coli 1556 T Adenomatous
polyposis coli 1563 GACCT Adenomatous polyposis coli 1924 AA
Desmoid tumours
TABLE-US-00078 TABLE VII SMALL INSERTIONS/DELETIONS Location/ codon
Deletion Insertion Phenotype 538 GAAGAcTTACAGCAGG gaa Adenomatous
polyposis coli 620 CTTACttaCCGGAGCCAG ct Adenomatous polyposis coli
728 AATctcatGGCAAATAGG Ttgcagctttaa Adenomatous polyposis coli 971
GATGgtTATGGTAAAA taa Adenomatous polyposis coli
TABLE-US-00079 TABLE VIII GROSS DELETIONS 2 kb including ex. 11
Adenomatous polyposis coli 3 kb I10E11-1.5 kb to I12E13-170 bp
Adenomatous polyposis coil 335 bp nt. 1409 1743 ex. 11 13
Adenomatous polyposis coli 6 kb incl. ex. 14 Adenomatous polyposis
coil 817 bp I13E14-679 to I13E14+138 Adenomatous polyposis coli ex.
11 15M Adenomatous polyposis coli ex. 11-3'UTR Adenomatous
polyposis coil ex. 15A ex. 15F Adenomatous polyposis coil ex. 4
Adenomatous polyposis coli ex. 7, 8 and 9 Adenomatous polyposis
coli ex. 8 to beyond ex. 15F Adenomatous polyposis coil ex. 8 ex.
15F Adenomatous polyposis coli ex. 9 Adenomatous polyposis coil
>10 mb (del 5q22) Adenomatous polyposis coil
TABLE-US-00080 TABLE IX ROSS INSERTIONS AND DUPLICATIONS
Description Phenotype Insertion of 14 bp nt. 3816 Adenomatous
polyposis coli Insertion of 22 bp nt. 4022 Adenomatous polyposis
coli Duplication of 43 bp cd. 1295 Adenomatous polyposis coli
Insertion of 337 bp of Alu I Desmoid tumours sequence cd. 1526
TABLE-US-00081 TABLE X COMPLEX REARRANGEMENTS (INCLUDING
INVERSIONS) A-T nt. 4893 Q1625H, Del C nt. 4897 Adenomatous
polyposis coli cd. 1627 Del 1099 bp I13E14 - 728 to E14I14 +
Adenomatous polyposis coli 156, ins 126 bp Del 1601 bp E14I14 + 27
to E14I14 + Adenomatous polyposis coli 1627, ins 180 bp Del 310 bp,
ins. 15 bp nt. 4394, cd 1464 Adenomatous polyposis coli Del A and T
cd. 1395 Adenomatous polyposis coli Del TC nt. 4145, Del TGT nt.
4148 Adenomatous polyposis coli Del. T, nt. 983, Del. 70 bp, nt.
985 Adenomatous polyposis coli Del. nt. 3892 3903, ins ATTT
Adenomatous polyposis coli
TABLE-US-00082 TABLE XI Cancer Type Marker Application Reference
DIAGNOSTIC APPLICATIONS Breast Her2/Neu Using methods described
herein, D. Xie et al., Detection - design second primer such that
after J. Natl. polymorphism PCR, and digestion with restriction
Cancer at codon 655 enzyme, a 5' overhang containing Institute, 92,
(GTC/valine to DNA sequence for codon 655 of 412 (2000)
ATC/isoleucine Her2/Neu is generated. K. S. Wilson [Val(655)Ile])
Her2/Neu can be detected and et al., Am. J. quantified as a
possible marker for Pathol., 161, 1171 breast cancer. Methods
described (2002) herein can detect both mutant allele L. Newman,
and normal allele, even when mutant Cancer allele is small fraction
of total DNA. Control, 9, Herceptin therapy for breast cancer 473
(2002) is based upon screening for Her2. The earlier the mutant
allele can be detected, the faster therapy can be provided.
Breast/Ovarian Hypermethylation Methods described herein can be M.
Esteller et of BRCA1 used to differentiate between tumors al., New
resulting from inherited BRCA1 England Jnl mutations and those from
non- Med., 344, inherited abnormal methylation of 539 (2001) the
gene Bladder Microsatellite Methods described herein can be W. G.
Bas et analysis of free applied to microsatellite analysis and al.,
Clinical tumor DNA in FGFR3 mutation analysis for Cancer Urine,
Serum detection of bladder cancer. Res., 9,257 and Plasma Methods
described herein provide a (2003) non-invasive method for detection
of M. Utting et bladder cancer. al., Clincal Cancer Res., 8,35
(2002) L. Mao, D. Sidransky et al., Science, 271, 669 (1996) Lung
Microsatellite Methods described herein can be T. Liloglou et
analysis of used to detect mutations in sputum al., Cancer DNA from
samples, and can markedly boost Research, 61, sputum the accuracy
of preclinical lung 1624, (2001) cancer screening M. Tockman et
al., Cancer Control, 7, 19 (2000) Field et al., Cancer Research,
59, 2690 (1999) Cervical Analysis of Methods described herein can
be N. Munoz et HPV genotype used to detect HPV genotype from a al.,
New cervical smear preparation. England Jnl Med., 348, 518 (2003)
Head and Tumor specific Methods described herein can be M. Spafford
Neck alterations in used to detect any of 23 et al. Clinical
exfoliated oral microsatellite markers, which are Cancer mucosal
cells associated with Head and Neck Research, 17, (microsatellite
Squamous Cell Carcinoma 607 (2001) markers) (HNSCC). A. El-Naggar
et al., J. Mol. Diag., 3,164 (2001) Colorectal Screening for
Methods described herein can be B. Ryan et al. mutation in K- used
to detect K-ras 2 mutations, Gut, 52, 101 ras2 and APC which can be
used as a prognostic (2003) genes. indicator for colorectal cancer.
APC (see Example 5). Prostate GSTP1 Methods described herein can be
P. Cairns et Hypermethylation used to detect GSTP1 al. Clin. Can.
hypermethylation in urine from Res., 7,2727 patients with prostate
cancer; this (2001) can be a more accurate indicator than PSA. HIV
Antiretroviral Screening Methods described herein can be used J.
Durant et resistance individuals for for detection of mutations in
the HIV al. The mutations in virus. Treatment outcomes are Lancet,
353, HIV virus - e.g. improved in individuals receiving anti 2195
(1999) 154V mutation retroviral therapy based upon resistance or
CCR5 .DELTA. 32 screening. allele. CARDIOLOGY Congestive
Synergistic Methods described herein can be K. Small et al. Heart
Failure polymorphisms used to genotype these loci and may New Eng.
Jnl. of beta1 and help identify people who are at a Med., alpha2c
higher risk of heart failure. 347,1135 adrenergic (2002)
receptors
Having now fully described the invention, it will be understood by
those of skill in the art that the invention can be performed with
a wide and equivalent range of conditions, parameters, and the
like, without affecting the spirit or scope of the invention or any
embodiment thereof.
All documents, e.g., scientific publications, patents and patent
publications recited herein are hereby incorporated by reference in
their entirety to the same extent as if each individual document
was specifically and individually indicated to be incorporated by
reference in its entirety. Where the document cited only provides
the first page of the document, the entire document is intended,
including the remaining pages of the document.
SEQUENCE LISTINGS
1
262 1 15 DNA Unknown misc_feature (6)...(15) n = A,T,C or G 1
gggacnnnnn nnnnn 15 2 19 DNA Unknown misc_feature (1)...(14) n =
A,T,C or G 2 nnnnnnnnnn nnnngtccc 19 3 21 DNA Artificial Sequence
Primer 3 ggaaattcca tgatgcgtgg g 21 4 23 DNA Homo sapiens
misc_feature (19)...(21) n = A,T,C or G 4 ggaaattcca tgatgcgtnn nac
23 5 21 DNA Artificial Sequence Primer 5 ggaaattcca tgatgcgtac c 21
6 25 DNA Homo sapiens misc_feature (22)...(23) n = A,T,C or G 6
ggaaattcca tgatgcgtac cnngg 25 7 11 DNA Unknown misc_feature
(4)...(8) n = A,T,C or G 7 cctnnnnnag g 11 8 25 DNA Homo sapiens
misc_feature (20)...(23) n = A,T,C or G 8 ggaaattcca tgatgcgtan
nnngg 25 9 38 DNA Artificial Sequence Primer 9 tagaatagca
ctgaattcag gaatacaatc attgtcac 38 10 28 DNA Artificial Sequence
Primer 10 atcacgataa acggccaaac tcaggtta 28 11 38 DNA Artificial
Sequence Primer 11 aagtttagat cagaattcgt gaaagcagaa gttgtctg 38 12
28 DNA Artificial Sequence Primer 12 tctccaacta acggctcatc gagtaaag
28 13 38 DNA Artificial Sequence Primer 13 atgactagct atgaattcgt
tcaaggtaga aaatggaa 38 14 28 DNA Artificial Sequence Primer 14
gagaattaga acggcccaaa tcccactc 28 15 37 DNA Artificial Sequence
Primer 15 ttacaatgca tgaattcatc ttggtctctc aaagtgc 37 16 28 DNA
Artificial Sequence Primer 16 tggaccataa acggccaaaa actgtaag 28 17
38 DNA Artificial Sequence Primer 17 ataaccgtat gcgaattcta
taattttcct gataaagg 38 18 28 DNA Artificial Sequence Primer 18
cttaaatcag gggactaggt aaacttca 28 19 28 DNA Artificial Sequence
Primer 19 cttaaatcag acggctaggt aaacttca 28 20 28 DNA Artificial
Sequence Primer 20 tctccaacta gggactcatc gagtaaag 28 21 37 DNA
Artificial Sequence Primer 21 aacgccgggc gagaattcag tttttcaact
tgcaagg 37 22 28 DNA Artificial Sequence Primer 22 ctacacatat
ctgggacgtt ggccatcc 28 23 38 DNA Artificial Sequence Primer 23
taccttttga tcgaattcaa ggccaaaaat attaagtt 38 24 28 DNA Artificial
Sequence Primer 24 tcgaacttta acggccttag agtagaga 28 25 38 DNA
Artificial Sequence Primer 25 cgatttcgat aagaattcaa aagcagttct
tagttcag 38 26 28 DNA Artificial Sequence Primer 26 tgcgaatctt
acggctgcat cacattca 28 27 23 DNA Homo sapiens misc_feature
(3)...(5) n = A,T,C or G 27 gtnnnacgca tcatggaatt tcc 23 28 25 DNA
Homo sapiens misc_feature (3)...(4) n = A,T,C or G 28 ccnnggtacg
catcatggaa tttcc 25 29 25 DNA Homo sapiens misc_feature (3)...(6) n
= A,T,C or G 29 ccnnnntacg catcatggaa tttcc 25 30 38 DNA Artificial
Sequence Primer 30 gggctagtct ccgaattcca cctatcctac caaatgtc 38 31
29 DNA Artificial Sequence Primer 31 tagctgtagt tagggactgt
tctgagcac 29 32 38 DNA Artificial Sequence Primer 32 cgaatgcaag
gcgaattcgt tagtaataac acagtgca 38 33 29 DNA Artificial Sequence
Primer 33 aagactggat ccgggaccat gtagaatac 29 34 38 DNA Artificial
Sequence Primer 34 tctaaccatt gcgaattcag ggcaaggggg gtgagatc 38 35
29 DNA Artificial Sequence Primer 35 tgacttggat ccgggacaac
gactcatcc 29 36 38 DNA Artificial Sequence Primer 36 acccaggcgc
cagaattctt tagataaagc tgaaggga 38 37 29 DNA Artificial Sequence
Primer 37 gttacgggat ccgggactcc atattgatc 29 38 38 DNA Artificial
Sequence Primer 38 cgttggcttg aggaattcga ccaaaagagc caagagaa 38 39
29 DNA Artificial Sequence Primer 39 aaaaagggat ccgggacctt
gactaggac 29 40 38 DNA Artificial Sequence Primer 40 acttgattcc
gtgaattcgt tatcaataaa tcttacat 38 41 29 DNA Artificial Sequence
Primer 41 caagttggat ccgggaccca gggctaacc 29 42 38 DNA Artificial
Sequence Primer 42 gtgcaaaggc ctgaattccc aggcacaaag ctgttgaa 38 43
29 DNA Artificial Sequence Primer 43 tgaagcgaac tagggactca
ggtggactt 29 44 38 DNA Artificial Sequence Primer 44 gattccgtaa
acgaattcag ttcattatca tctttgtc 38 45 29 DNA Artificial Sequence
Primer 45 ccattgttaa gcgggacttc tgctatttg 29 46 17 DNA Homo sapiens
46 cccaaaagtc cacctga 17 47 17 DNA Homo sapiens 47 tcaggtggac
ttttggg 17 48 18 DNA Homo sapiens 48 accctgcaaa tagcagaa 18 49 18
DNA Homo sapiens 49 ttctgctatt tgcagggt 18 50 17 DNA Homo sapiens
50 acccgcaaat agcagaa 17 51 17 DNA Homo sapiens 51 ttctgctatt
tgcgggt 17 52 17 DNA Homo sapiens misc_feature 4, 5, 6, 7 These
nucleotides may be absent 52 ttagatagca gtaattt 17 53 23 DNA Homo
sapiens misc_feature (6)...(13) These nucleotides may be absent 53
ggaagccggg aaggatctgt atc 23 54 15 DNA Homo sapiens misc_feature 5
This nucleotide may be absent 54 gagaaagaga ggtaa 15 55 19 DNA Homo
sapiens misc_feature 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19 These nucleotides may be absent 55 aaagagaggt aacttttct 19 56 18
DNA Homo sapiens misc_feature 5, 6, 7, 8 These nucleotides may be
absent 56 aaagagaggt aacttttc 18 57 23 DNA Homo sapiens
misc_feature 11 This nucleotide may be absent 57 ttttaaaaaa
aaaaaatagg tca 23 58 22 DNA Homo sapiens misc_feature 11, 12 These
nucleotides may be absent 58 aaaataggtc attgcttctt gc 22 59 16 DNA
Homo sapiens misc_feature 5, 6 These nucleotides may be absent 59
gacaaagaag aaaagg 16 60 19 DNA Homo sapiens misc_feature 6, 7, 8, 9
These nucleotides may be absent 60 gacaaagaag aaaaggaaa 19 61 25
DNA Homo sapiens misc_feature 11, 12, 13, 14, 15 These nucleotides
may be absent 61 aggaaaaaga ctggtattac gctca 25 62 24 DNA Homo
sapiens misc_feature 11, 12, 13, 14 These nucleotides may be absent
62 aaaagaatag atagtcttcc ttta 24 63 21 DNA Homo sapiens
misc_feature 11 This nucleotide may be absent 63 agatagtctt
cctttaactg a 21 64 19 DNA Homo sapiens misc_feature 6, 7, 8, 9
These nucleotides may be absent 64 tccttacaaa cagatatga 19 65 14
DNA Homo sapiens misc_feature 4 This nucleotide may be absent 65
accagaaggc aatt 14 66 17 DNA Homo sapiens misc_feature 6, 7 These
nucleotides may be absent 66 atcagagttg cgatgga 17 67 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 67 cgagcacagg
taagtt 16 68 15 DNA Homo sapiens misc_feature 4, 5 These
nucleotides may be absent 68 cactctgcac ctcga 15 69 14 DNA Homo
sapiens misc_feature 4 This nucleotide may be absent 69 gatatgtcgc
gaac 14 70 17 DNA Homo sapiens misc_feature 6, 7 These nucleotides
may be absent 70 aaagactctg tattgtt 17 71 15 DNA Homo sapiens
misc_feature 4, 5 These nucleotides may be absent 71 gacaagagag
gcagg 15 72 17 DNA Homo sapiens misc_feature 6, 7 These nucleotides
may be absent 72 catgaaccag gcatgga 17 73 16 DNA Homo sapiens
misc_feature 6 This nucleotide may be absent 73 gaaccaggca tggacc
16 74 18 DNA Homo sapiens misc_feature 6, 7, 8 These nucleotides
may be absent 74 aatccaagta tgttctct 18 75 16 DNA Homo sapiens
misc_feature 6 This nucleotide may be absent 75 gctcctgttg aacatc
16 76 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 76 aaactttcat ttgatg 16 77 19 DNA Homo sapiens misc_feature
5, 6, 7, 8, 9 These nucleotides may be absent 77 aaactttcat
ttgatgaag 19 78 14 DNA Homo sapiens misc_feature 4 This nucleotide
may be absent 78 ctacaggcca ttgc 14 79 21 DNA Homo sapiens
misc_feature 11 This nucleotide may be absent 79 taaattaggg
ggactacagg c 21 80 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 80 ttattgcaag tggac 15 81 15 DNA Homo
sapiens misc_feature 5 This nucleotide may be absent 81 tacgggctta
ctaat 15 82 16 DNA Homo sapiens misc_feature 6 This nucleotide may
be absent 82 agtattacac taagac 16 83 17 DNA Homo sapiens
misc_feature 6, 7 These nucleotides may be absent 83 attacactaa
gacgata 17 84 14 DNA Homo sapiens misc_feature 4 This nucleotide
may be absent 84 ctaagacgat atgc 14 85 17 DNA Homo sapiens
misc_feature 6, 7 These nucleotides may be absent 85 tgctctatga
aaggctg 17 86 25 DNA Homo sapiens misc_feature 6, 7, 8, 9, 10, 11,
12, 13, 14, 15 These nucleotides may be absent 86 atgagagcac
ttgtggccca actaa 25 87 16 DNA Homo sapiens misc_feature 6 This
nucleotide may be absent 87 gacttacagc aggtac 16 88 17 DNA Homo
sapiens misc_feature 6, 7 These nucleotides may be absent 88
aaaaagacgt tgcgaga 17 89 19 DNA Homo sapiens misc_feature 5, 6, 7,
8, 9 These nucleotides may be absent 89 gttggaagtg tgaaagcat 19 90
16 DNA Homo sapiens misc_feature 6 This nucleotide may be absent 90
aaagcattga tggaat 16 91 18 DNA Homo sapiens misc_feature 5, 6, 7, 8
These nucleotides may be absent 91 ttagaagtta aaaaggta 18 92 16 DNA
Homo sapiens misc_feature 6 This nucleotide may be absent 92
accctcaaaa gcgtat 16 93 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 93 gccttatgga atttg 15 94 14 DNA Homo
sapiens misc_feature 4 This nucleotide may be absent 94 gctgtagatg
gtgc 14 95 29 DNA Homo sapiens misc_feature (4)...(19) These
nucleotides may be absent 95 gttggcactc ttacttaccg gagccagac 29 96
19 DNA Homo sapiens misc_feature 6, 7, 8, 9 These nucleotides may
be absent 96 cttacttacc ggagccaga 19 97 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 97 acttaccgga gccag 15
98 15 DNA Homo sapiens misc_feature 4, 5 These nucleotides may be
absent 98 agccagacaa acact 15 99 18 DNA Homo sapiens misc_feature
5, 6, 7, 8 These nucleotides may be absent 99 agccagacaa acacttta
18 100 17 DNA Homo sapiens misc_feature 4, 5, 6, 7 These
nucleotides may be absent 100 acaaacactt tagccat 17 101 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 101 ttagccatta
ttgaaa 16 102 15 DNA Homo sapiens misc_feature 5 This nucleotide
may be absent 102 ggaggtggga tatta 15 103 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 103 atattacgga atgtg
15 104 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 104 ttacggaatg tgtcca 16 105 15 DNA Homo sapiens
misc_feature 4, 5 These nucleotides may be absent 105 agagagaaca
actgt 15 106 34 DNA Homo sapiens misc_feature (11)...(24) These
nucleotides may be absent 106 tatttcaggc aaatcctaag agagaacaac tgtc
34 107 16 DNA Homo sapiens misc_feature 5, 6 These nucleotides may
be absent 107 aactgtctac aaactt 16 108 15 DNA Homo sapiens
misc_feature 4, 5 These nucleotides may be absent 108 ttattacaac
actta 15 109 15 DNA Homo sapiens misc_feature 4, 5 These
nucleotides may be absent 109 cacttaaaat ctcat 15 110 24 DNA Homo
sapiens misc_feature (4)...(14) These nucleotides may be absent 110
agtttgacaa tagtcagtaa tgca 24 111 16 DNA Homo sapiens misc_feature
6 This nucleotide may be absent 111 cacttatcag aaactt 16 112 15 DNA
Homo sapiens misc_feature 5 This nucleotide may be absent 112
ttatcagaaa ctttt 15 113 16 DNA Homo sapiens misc_feature 6 This
nucleotide may be absent 113 tcagaaactt ttgaca 16 114 15 DNA Homo
sapiens misc_feature 5 This nucleotide may be absent 114 agtcccaagg
catct 15 115 15 DNA Homo sapiens misc_feature 5 This nucleotide may
be absent 115 aagcaaagtc tctat 15 116 17 DNA Homo sapiens
misc_feature 6, 7 These nucleotides may be absent 116 aagcaaagtc
tctatgg 17 117 15 DNA Homo sapiens misc_feature 5 This nucleotide
may be absent 117 caaagtctct atggt 15 118 16 DNA Homo sapiens
misc_feature 5, 6 These nucleotides may be absent 118 gattatgttt
ttgaca 16 119 25 DNA Homo sapiens misc_feature (6)...(15) These
nucleotides may be absent 119 gacaccaatc gacatgatga taata 25 120 16
DNA Homo sapiens misc_feature 5, 6 These nucleotides may be absent
120 cgacatgatg ataata 16 121 18 DNA Homo sapiens misc_feature 5, 6,
7, 8 These nucleotides may be absent 121 tcagacaatt ttaatact 18 122
14 DNA Homo sapiens misc_feature 4 This nucleotide may be absent
122 tatttgaata ctac 14 123 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 123 aatactacag tgtta 15 124 28 DNA Homo
sapiens misc_feature (6)...(18) These nucleotides may be absent 124
gtgttaccca gctcctcttc atcaagag 28 125 16 DNA Homo sapiens
misc_feature 6 This nucleotide may be absent 125 agctcctctt catcaa
16 126 15 DNA Homo sapiens misc_feature 5 This nucleotide may be
absent 126 tcatcaagag gaagc 15 127 17 DNA Homo sapiens misc_feature
6, 7 These nucleotides may be absent 127 aaagatagaa gtttgga 17 128
21 DNA Homo sapiens misc_feature 5, 6, 7, 8, 9, 10, 11 These
nucleotides may be absent 128 aaagatagaa gtttggagag a 21 129 15 DNA
Homo sapiens misc_feature 5 This nucleotide may be absent 129
gaacgcggaa ttggt 15 130 19 DNA Homo sapiens misc_feature (5)...(9)
These nucleotides may be absent 130 cgcggaattg gtctaggca 19 131 15
DNA Homo sapiens misc_feature 5 This nucleotide may be absent 131
cgcggaattg gtcta 15 132 14 DNA Homo sapiens misc_feature 4 This
nucleotide may be absent 132 cagatctcca ccac 14 133 19 DNA Homo
sapiens misc_feature (6)...(9) These nucleotides may be
absent 133 gaagacagaa gttctgggt 19 134 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 134 gggtctacca ctgaa
15 135 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 135 gtgacagatg agagaa 16 136 19 DNA Homo sapiens
misc_feature (6)...(9) These nucleotides may be absent 136
catacacatt caaacactt 19 137 19 DNA Homo sapiens misc_feature
(6)...(9) These nucleotides may be absent 137 acacattcaa acacttaca
19 138 14 DNA Homo sapiens misc_feature 4 This nucleotide may be
absent 138 cattcaaaca ctta 14 139 15 DNA Homo sapiens misc_feature
5 This nucleotide may be absent 139 cattcaaaca cttac 15 140 17 DNA
Homo sapiens misc_feature (4)...(7) These nucleotides may be absent
140 aacacttaca atttcac 17 141 22 DNA Homo sapiens misc_feature
(5)...(12) These nucleotides may be absent 141 tacaatttca
ctaagtcgga aa 22 142 18 DNA Homo sapiens misc_feature (5)...(8)
These nucleotides may be absent 142 ttcactaagt cggaaaat 18 143 17
DNA Homo sapiens misc_feature (4)...(7) These nucleotides may be
absent 143 aagtcggaaa attcaaa 17 144 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 144 acatgttcta tgcct
15 145 16 DNA Homo sapiens misc_feature 5, 6 These nucleotides may
be absent 145 ttagaataca agagat 16 146 14 DNA Homo sapiens
misc_feature 4 This nucleotide may be absent 146 aatgatagtt taaa 14
147 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 147 agtttaaata gtgtca 16 148 17 DNA Homo sapiens
misc_feature 4, 5, 6, 7 These nucleotides may be absent 148
ttaaatagtg tcagtag 17 149 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 149 tatggtaaaa gaggt 15 150 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 150 ggtaaaagag
gtcaaa 16 151 16 DNA Homo sapiens misc_feature 5, 6 These
nucleotides may be absent 151 aaaagaggtc aaatga 16 152 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 152 agtaagtttt
gcagtt 16 153 24 DNA Homo sapiens misc_feature (4)...(14) These
nucleotides may be absent 153 aagttttgca gttatggtca atac 24 154 20
DNA Homo sapiens misc_feature (4)...(10) These nucleotides may be
absent 154 caatacccag ccgacctagc 20 155 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 155 acaccaataa attat
15 156 14 DNA Homo sapiens misc_feature 4 This nucleotide may be
absent 156 aaatattcag atga 14 157 19 DNA Homo sapiens misc_feature
(5)...(9) These nucleotides may be absent 157 tcagatgagc agttgaact
19 158 15 DNA Homo sapiens misc_feature 5 This nucleotide may be
absent 158 gatgagcagt tgaac 15 159 15 DNA Homo sapiens misc_feature
5 This nucleotide may be absent 159 tgggcaagac ccaaa 15 160 19 DNA
Homo sapiens misc_feature (5)...(9) These nucleotides may be absent
160 cacataatag aagatgaaa 19 161 19 DNA Homo sapiens misc_feature
(5)...(9) These nucleotides may be absent 161 ataatagaag atgaaataa
19 162 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 162 atagaagatg aaataa 16 163 20 DNA Homo sapiens
misc_feature (6)...(10) These nucleotides may be absent 163
ataaaacaaa gtgagcaaag 20 164 17 DNA Homo sapiens misc_feature
(4)...(7) These nucleotides may be absent 164 aaacaaagtg agcaaag 17
165 16 DNA Homo sapiens misc_feature 5, 6 These nucleotides may be
absent 165 aaacaaagtg agcaaa 16 166 18 DNA Homo sapiens
misc_feature (5)...(8) These nucleotides may be absent 166
caaagtgagc aaagacaa 18 167 17 DNA Homo sapiens misc_feature 6, 7
These nucleotides may be absent 167 caaagacaat caaggaa 17 168 17
DNA Homo sapiens misc_feature (4)...(7) These nucleotides may be
absent 168 caatcaagga atcaaag 17 169 16 DNA Homo sapiens
misc_feature 5, 6 These nucleotides may be absent 169 caaagtacaa
cttatc 16 170 16 DNA Homo sapiens misc_feature 5, 6 These
nucleotides may be absent 170 actgagagca ctgatg 16 171 17 DNA Homo
sapiens misc_feature 6, 7 These nucleotides may be absent 171
actgatgata aacacct 17 172 17 DNA Homo sapiens misc_feature
(4)...(7) These nucleotides may be absent 172 gataaacacc tcaagtt 17
173 16 DNA Homo sapiens misc_feature 5, 6 These nucleotides may be
absent 173 cacctcaagt tccaac 16 174 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 174 tttggacagc aggaa
15 175 15 DNA Homo sapiens misc_feature 4, 5 These nucleotides may
be absent 175 tgtgtttctc catac 15 176 14 DNA Homo sapiens
misc_feature 4 This nucleotide may be absent 176 cggggagcca atgg 14
177 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 177 tcagaaacaa atcgag 16 178 19 DNA Homo sapiens
misc_feature (6)...(9) These nucleotides may be absent 178
attaatcaaa atgtaagcc 19 179 14 DNA Homo sapiens misc_feature 4 This
nucleotide may be absent 179 caagaagatg acta 14 180 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 180 gactatgaag
atgata 16 181 18 DNA Homo sapiens misc_feature (4)...(8) These
nucleotides may be absent 181 gatgataagc ctaccaat 18 182 16 DNA
Homo sapiens misc_feature 6 This nucleotide may be absent 182
cgttactctg aagaag 16 183 19 DNA Homo sapiens misc_feature (5)...(9)
These nucleotides may be absent 183 gaagaagaag agagaccaa 19 184 18
DNA Homo sapiens misc_feature 5, 6, 7, 8 These nucleotides may be
absent 184 gaagaagaga gaccaaca 18 185 17 DNA Homo sapiens
misc_feature 5, 6, 7, 8 These nucleotides may be absent 185
gaagagagac caacaaa 17 186 18 DNA Homo sapiens misc_feature
(4)...(8) These nucleotides may be absent 186 gaagagaaac gtcatgtg
18 187 22 DNA Homo sapiens misc_feature (6)...(12) These
nucleotides may be absent 187 gattatagtt taaaatatgc ca 22 188 15
DNA Homo sapiens misc_feature 5 This nucleotide may be absent 188
ttaaaatatg ccaca 15 189 18 DNA Homo sapiens misc_feature (4)...(8)
These nucleotides may be absent 189 gccacagata ttccttca 18 190 15
DNA Homo sapiens misc_feature 4, 5 These nucleotides may be absent
190 acagatattc cttca 15 191 16 DNA Homo sapiens misc_feature 6 This
nucleotide may be absent 191 tcacagaaac agtcat 16 192 15 DNA Homo
sapiens misc_feature 4, 5 These nucleotides may be absent 192
aaacagtcat tttca 15 193 15 DNA Homo sapiens misc_feature 4, 5 These
nucleotides may be absent 193 tcaaagagtt catct 15 194 15 DNA Homo
sapiens misc_feature 5 This nucleotide may be absent 194 aaaaccgaac
atatg 15 195 17 DNA Homo sapiens misc_feature (4)...(7) These
nucleotides may be absent 195 accgaacata tgtcttc 17 196 15 DNA Homo
sapiens misc_feature 4, 5 These nucleotides may be absent 196
catatgtctt caagc 15 197 16 DNA Homo sapiens misc_feature 6 This
nucleotide may be absent 197 ccaagttctg cacaga 16 198 16 DNA Homo
sapiens misc_feature 5, 6 These nucleotides may be absent 198
tgcaaagttt cttcta 16 199 15 DNA Homo sapiens misc_feature 4, 5
These nucleotides may be absent 199 atacagactt attgt 15 200 17 DNA
Homo sapiens misc_feature 6, 7 These nucleotides may be absent 200
cagacttatt gtgtaga 17 201 14 DNA Homo sapiens misc_feature 4 This
nucleotide may be absent 201 ccaatatgtt tttc 14 202 14 DNA Homo
sapiens misc_feature 4 This nucleotide may be absent 202 agttcattat
catc 14 203 16 DNA Homo sapiens misc_feature 6 This nucleotide may
be absent 203 caggaagcag attctg 16 204 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 204 accctgcaaa tagca
15 205 18 DNA Homo sapiens misc_feature (5)...(8) These nucleotides
may be absent 205 gaaataaaag aaaagatt 18 206 14 DNA Homo sapiens
misc_feature 4 This nucleotide may be absent 206 ataaaagaaa agat 14
207 17 DNA Homo sapiens misc_feature (4)...(7) These nucleotides
may be absent 207 aaagaaaaga ttggaac 17 208 20 DNA Homo sapiens
misc_feature (6)...(10) These nucleotides may be absent 208
aaagaaaaga ttggaactag 20 209 15 DNA Homo sapiens misc_feature 5
This nucleotide may be absent 209 gatcctgtga gcgaa 15 210 16 DNA
Homo sapiens misc_feature 6 This nucleotide may be absent 210
gtgagcgaag ttccag 16 211 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 211 gttccagcag tgtca 15 212 22 DNA Homo
sapiens misc_feature (5)...(13) These nucleotides may be absent 212
caccctagaa ccaaatccag ca 22 213 16 DNA Homo sapiens misc_feature 5,
6 These nucleotides may be absent 213 agactgcagg gttcta 16 214 14
DNA Homo sapiens misc_feature 4 This nucleotide may be absent 214
cagggttcta gttt 14 215 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 215 tctagtttat cttca 15 216 15 DNA Homo
sapiens misc_feature 5 This nucleotide may be absent 216 ttatcttcag
aatca 15 217 14 DNA Homo sapiens misc_feature 4 This nucleotide may
be absent 217 gttgaatttt cttc 14 218 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 218 ccctccaaaa gtggt
15 219 17 DNA Homo sapiens misc_feature (4)...(7) These nucleotides
may be absent 219 agtggtgctc agacacc 17 220 17 DNA Homo sapiens
misc_feature 6, 7 These nucleotides may be absent 220 agtccacctg
aacacta 17 221 16 DNA Homo sapiens misc_feature 6 This nucleotide
may be absent 221 ccacctgaac actatg 16 222 16 DNA Homo sapiens
misc_feature 5, 6 These nucleotides may be absent 222 tatgttcagg
agaccc 16 223 16 DNA Homo sapiens misc_feature 5, 6 These
nucleotides may be absent 223 gatagttttg agagtc 16 224 16 DNA Homo
sapiens misc_feature 6 This nucleotide may be absent 224 attgccagct
ccgttc 16 225 16 DNA Homo sapiens misc_feature 6 This nucleotide
may be absent 225 agtggcatta taagcc 16 226 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 226 agccctggac aaacc
15 227 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 227 cctggacaaa ccatgc 16 228 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 228 atgccaccaa gcaga
15 229 16 DNA Homo sapiens misc_feature 6 This nucleotide may be
absent 229 aaaaataaag caccta 16 230 14 DNA Homo sapiens
misc_feature 4 This nucleotide may be absent 230 gaaaagagag agag 14
231 17 DNA Homo sapiens misc_feature (4)...(7) These nucleotides
may be absent 231 agagagagtg gacctaa 17 232 15 DNA Homo sapiens
misc_feature 5 This nucleotide may be absent 232 gagagtggac ctaag
15 233 16 DNA Homo sapiens misc_feature 5, 6 These nucleotides may
be absent 233 gagagtggac ctaagc 16 234 15 DNA Homo sapiens
misc_feature 4, 5 These nucleotides may be absent 234 gagagtggac
ctaag 15 235 14 DNA Homo sapiens misc_feature 4 This nucleotide may
be absent 235 gccacggaaa gtac 14 236 16 DNA Homo sapiens
misc_feature 6 This nucleotide may be absent 236 acggaaagta ctccag
16 237 14 DNA Homo sapiens misc_feature 4 This nucleotide may be
absent 237 ccagatggat tttc 14 238 17 DNA Homo sapiens misc_feature
(4)...(7) These nucleotides may be absent 238 tcatccagcc tgagtgc 17
239 20 DNA Homo sapiens misc_feature (4)...(10) These nucleotides
may be absent 239 ttaagaataa tgcctccagt 20 240 17 DNA Homo sapiens
misc_feature 6, 7 These nucleotides may be absent 240 gaaacagaat
cagagca 17 241 20 DNA Homo sapiens misc_feature (6)...(10) These
nucleotides may be absent 241 tcaaatgaaa accaagagaa 20 242 14 DNA
Homo sapiens misc_feature 4 This nucleotide may be absent 242
gaaaaccaag agaa 14 243 18 DNA Homo sapiens misc_feature (5)...(8)
These nucleotides may be absent 243 gagaaagagg cagaaaaa 18 244 16
DNA Homo sapiens misc_feature 5, 6 These nucleotides may be absent
244 gaatgtatta tttctg 16 245 16 DNA Homo sapiens misc_feature 6
This nucleotide may be absent 245 ccagcccaga ctgctt 16 246 16 DNA
Homo sapiens misc_feature 6 This nucleotide may be absent 246
cagactgctt caaaat 16 247 15 DNA Homo sapiens misc_feature 5 This
nucleotide may be absent 247 ttcaatgata agctc 15 248 19 DNA Homo
sapiens misc_feature (6)...(9) These nucleotides may be absent 248
aatgattctt tgagttctc 19 249 19 DNA Homo sapiens misc_feature
(6)...(9) These nucleotides may be absent 249 ccagacagag gggcagcaa
19 250 14 DNA Homo sapiens misc_feature 4 This nucleotide may be
absent 250 gaaaatactc cagt 14 251 14 DNA Homo sapiens misc_feature
4 This nucleotide may be absent 251 aacaataaag aaaa 14 252 16 DNA
Homo sapiens misc_feature 6 This nucleotide may be absent 252
gaacctatca aagaga 16 253 14 DNA Homo sapiens misc_feature 4 This
nucleotide may be absent 253 cctatcaaag agac 14 254 15 DNA
Homo sapiens misc_feature 5 This nucleotide may be absent 254
gaaccaagta aacct 15 255 16 DNA Homo sapiens misc_feature 6 This
nucleotide may be absent 255 agctccgcaa tgccaa 16 256 23 DNA Homo
sapiens misc_feature (6)...(13) These nucleotides may be absent 256
tcatcccttc ctcgagtaag cac 23 257 19 DNA Homo sapiens misc_feature
(6)...(9) These nucleotides may be absent 257 ctaatttatc aaatggcac
19 258 18 DNA Homo sapiens misc_feature 6 n = C or G 258 gaagannntt
acagcagg 18 259 18 DNA Homo sapiens misc_feature 6 n = T or C 259
cttacnnncc ggagccag 18 260 25 DNA Homo sapiens misc_feature 4 n = C
or T 260 aatnnnnnnn nnnnnggcaa atagg 25 261 12 DNA Homo sapiens 261
ttgcagcttt aa 12 262 17 DNA Homo sapiens misc_feature 5 n = G or T
262 gatgnnntat ggtaaaa 17
* * * * *
References