U.S. patent number 7,078,493 [Application Number 09/526,437] was granted by the patent office on 2006-07-18 for antibodies to human tumor necrosis factor receptor-like genes.
This patent grant is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Robert D. Fleischmann, John M. Greene, Jian Ni.
United States Patent |
7,078,493 |
Greene , et al. |
July 18, 2006 |
Antibodies to human tumor necrosis factor receptor-like genes
Abstract
The present inventors have discovered novel receptors in the
Tumor Necrosis Factor (TNF) receptor family. In particular,
receptors having homology to the type 2 TNF receptor (TNF-RII) are
provided. Isolated nucleic acid molecules are also provided
encoding the novel receptors of the present invention. Receptor
polypeptides are further provided as are vectors, host cells and
recombinant methods for producing the same.
Inventors: |
Greene; John M. (Gaithersburg,
MD), Fleischmann; Robert D. (Gaithersburg, MD), Ni;
Jian (Rockville, MD) |
Assignee: |
Human Genome Sciences, Inc.
(Rockville, MD)
|
Family
ID: |
36659085 |
Appl.
No.: |
09/526,437 |
Filed: |
March 15, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
08718737 |
Sep 18, 1996 |
|
|
|
|
08469637 |
Jun 6, 1995 |
|
|
|
|
PCT/US95/03216 |
Mar 15, 1995 |
|
|
|
|
60136248 |
May 26, 1999 |
|
|
|
|
60124489 |
Mar 15, 1999 |
|
|
|
|
Current U.S.
Class: |
530/389.2;
530/388.1; 530/389.1; 530/388.15; 530/387.1; 435/7.1 |
Current CPC
Class: |
G01N
33/566 (20130101); G01N 33/564 (20130101); G01N
33/6893 (20130101); C07K 16/2878 (20130101); G01N
33/574 (20130101); Y02A 50/58 (20180101); Y02A
50/30 (20180101); G01N 2800/32 (20130101) |
Current International
Class: |
C07K
16/00 (20060101); G01N 33/53 (20060101) |
Field of
Search: |
;530/350,351,387.1,387.3,387.9,388.1,388.15,389.1,389.2 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 585 939 |
|
Mar 1994 |
|
EP |
|
0 816 380 |
|
Jan 1998 |
|
EP |
|
0 816 380 |
|
Jan 1998 |
|
EP |
|
0 897 114 |
|
Feb 1999 |
|
EP |
|
WO 91/09045 |
|
Jun 1991 |
|
WO |
|
WO 94/09137 |
|
Apr 1994 |
|
WO |
|
WO 94/13808 |
|
Jun 1994 |
|
WO |
|
WO 96/26217 |
|
Aug 1996 |
|
WO |
|
WO 96/26217 |
|
Aug 1996 |
|
WO |
|
WO 96/28546 |
|
Sep 1996 |
|
WO |
|
WO 96/28546 |
|
Sep 1996 |
|
WO |
|
WO 98/48051 |
|
Oct 1998 |
|
WO |
|
Other References
Kohno, T. et al., "A second tumor necrosis factor receptor gene
product can shed a naturally occurring tumor necrosis factor
inhibitor," Proc. Natl. Acad. Sci. USA 87:8331-8335 (1990). cited
by other .
Schall, T.J. et al., "Molecular Cloning and Expression of a
Receptor for Human Tumor Necrosis Factor," Cell 61:361-370 (1990).
cited by other .
Aruffo, A.A. et al., Database A-Geneseq24 on MASPAR, Accession No.
R38859 (1993). cited by other .
Aggarwal, B. B. and K. Natarajan, "Tumor necrosis factors:
Developments during the last decade," Eur. Cytokine Netw.
7(2):93-124 (Apr.-Jun. 1996). cited by other .
Aslanidis, C., Database EMBL-new3 on MASPAR, Accession No. X75491
(Mar. 1994). cited by other .
Beutler, B. et al., "Unraveling function in the TNF ligand and
receptor families," Science 264:667-668 (1994). cited by other
.
Bowie, J.U. et al., "Deciphering the message in protein sequences:
tolerance to amino acid substitutions," Science 247:1306-1310
(1990). cited by other .
Camerini, D. et al., "The T Cell Activation Antigen CD27 Is a
Member of the Nerve Growth Factor/Tumor Necrosis Factor Receptor
Gene Family," J. Immunol. 147(9):3165-3169 (1991). cited by other
.
Chinnaiyan, A.M. et al., "Signal Transduction by DR3, a Death
Domain-Containing Receptor Related to TNFR-1 and CD95," Science
274:990-992 (1996). cited by other .
Crowe, P.D. et al., "A lymphotoxin-beta-specific receptor," Science
264:707-710 (1994). cited by other .
Durkop, H. et al., "Molecular Cloning and Expression of a New
Member of the Nerve Growth Factor Receptor Family That Is
Characteristic for Hodgkin's Disease," Cell 68:421-427 (1992).
cited by other .
Engelmann, H. et al., "Two Tumor Necrosis Factor-Binding Proteins
Purified from Human Urine. Evidence for Immunological
Cross-Reactivity with Cell Surface Tumor Necrosis Factor
Receptors," J. Biol. Chem. 265(3):1531-1536 (1990). cited by other
.
Feinstein, E. et al., "The death domain: a module shared by
proteins with diverse cellular functions," TIBS 20:342-344 (Sep.
1995). cited by other .
Genexpress, Database EMBL/GenBank/DDBJ on MASPAR, Accession No.
Z38433 (Oct. 1994). cited by other .
George, et al., in Macromolecular Sequencing and Synthesis,
Schlessinger, D.H., ed., Alan R. Liss, Inc., New York, pp. 127-149
(1988). cited by other .
Glasgow, E. and Schechter, N., Database EMBL-new3 on MASPAR,
Accession No. L23876 (1993). cited by other .
Hillier, L. et al., Database EST-STS on MASPAR, Accession No.
H14106 (Jul. 1995). cited by other .
Himmler, A. et al., "Molecular Cloning and Expression of Human and
Rat Tumor Necrosis Factor Receptor Chain (p60) and Its Soluble
Derivative, Tumor Necrosis Factor-Binding Protein," DNA and Cell
Biol. 9(10):705-715 (1990). cited by other .
Hohmann, H.-P. et al., "Two Different Cell Types Have Different
Major Receptors for Human Tumor Necrosis Factor (TNF.alpha.)" J.
Biol. Chem. 264(25):14927-14934 (1989). cited by other .
Hsu, K. C. and M. V. Chao, "Differential Expression and Ligand
Binding Properties of Tumor Necrosis Factor Receptor Chimeric
Mutants," J. Biol. Chem. 268(22):16430-16436 (1993). cited by other
.
Hudson, T., Database EST-STS on MASPAR, Accession No. G11923 (Oct.
1995). cited by other .
Itoh, N. et al., "The Polypeptide Encoded by the cDNA for Human
Cell Surface Antigen Fas Can Mediate Apoptosis," Cell 66:233-243
(1991). cited by other .
Johnson, D. et al., "Expression and Structure of the Human NGF
Receptor," Cell 47:545-554 (1986). cited by other .
Lewis, M. et al., "Cloning and expression of cDNAs for two distinct
murine tumor necrosis factor receptors demonstrate one receptor is
species specific," Proc. Natl. Acad. Sci. USA 88:2830-2834 (1991).
cited by other .
Loetscher, H. et al., "Molecular Cloning and Expression of the
Human 55 kd Tumor Necrosis Factor Receptor," Cell 61:351-359
(1990). cited by other .
Mallett, S. et al., "Characterization of the MRC 0X40 antigen of
activated CD4 positive T lymphocytes--a molecule related to nerve
growth factor receptor ," EMBO J. 9(4):1063-1068 (1990). cited by
other .
Muzio, M. et al., "FLICE, A Novel FADD-Homologous ICE/CED-3-like
Protease, Is Recruited to the CD95 (Fas/APO-1) Death-Inducing
Signaling Complex," Cell 85:817-827 (1996). cited by other .
NCBI Entrez, GenBank Report, Accession No. D62967, from Fujiwara,
T. et al. (Aug. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. D63118, from Fujiwara,
T. et al. (Aug. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. D63125, from Fujiwara,
T. et al. (Aug. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. D63126, from Fujiwara,
T. et al. (Aug. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA296905, from Adams,
MD. et al. (Sep. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA296908, from Adams,
M.D. et al. (Sep. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. 298429, from Adams, M.D.
et al. (Sep. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. H88769, from Hillier, L.
et al. (Nov. 1995). cited by other .
NCBI Entrez, GenBank Report, Accession No. C02463, from Okubo, K.
et al. (Jul. 1996). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA037313, from Hillier,
L. et al. (Nov. 1996). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA195113, from Hillier,
L. et al. (May 1997). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA233719, from Hillier,
L. et al. (Aug. 1997). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA706996, from Hillier,
L. et al. (Dec. 1997). cited by other .
NCBI Entrez, GenBank Report, Accession No. AA599841, from Jia, L.
et al. (Mar. 1998). cited by other .
Nophar, Y. et al., "Soluble forms of tumor necrosis factor
receptors (TNF-Rs). The cDNA for the type I TNF-R, cloned using
amino acid sequence data of its soluble form, encodes both the cell
surface and a soluble form of the receptor," EMBO J.
9(10):3269-3278 (1990). cited by other .
Pfeffer, K. et al., "Mice Deficient for the 55 kd Tumor Necrosis
Factor Receptor Are Resistant to Endotoxic Shock, yet Succumb to L.
monocytogenes Infection," Cell 73:457-467 (1993). cited by other
.
Piguet, P. F. et al., "Evolution of collagen arthritis in mice is
arrested by treatment with anti-tumour necrosis factor (TNF)
antibody or a recombinant soluble TNF receptor," Immunol.
77:510-514 (1992). cited by other .
Radeke, M. J. et al., "Gene transfer and molecular cloning of the
rat nerve growth factor receptor," Nature 325:593-597 (1987). cited
by other .
Salgaller, M.L. et al., "Generation of specific anti-melanoma
reactivity by stimulation of human tumor-infiltrating lymphocytes
with MAGE-1 synthetic peptide," Cancer Immunol. Immunother.
39:105-116 (1994). cited by other .
Smith, C.A. et al., "A receptor for tumor necrosis factor defines
an unusual family of cellular and viral proteins," Science
248:1019-1023 (1990). cited by other .
Smith, C. A. et al., "T2 Open Reading Frame from the Shope Fibroma
Virus Encodes a Soluble Form of the TNF Receptor," Biochem.
Biophys. Res. Comm. 176(1):335-342 (1991). cited by other .
Stamenkovic, I. et al., "A B-lymphocyte activation molecule related
to the nerve growth factor receptor and induced by cytokines in
carcinomas," EMBO J. 8(5):1403-1410 (1989). cited by other .
Van Ostade, X. et al., "Human tumor necrosis factor mutants with
preferential binding to and activity on either the R55 or R75
receptor," Eur. J. Biochem. 220(3):771-779 (Mar. 1994). cited by
other .
Zauner, W. et al., Database EMBL-new3 on MASPAR, Accession No.
X60370, X60371, X60550 (1992). cited by other .
International Search Report issued by the International Searching
Authority for Appl. No. PCT/US96/15003, mailed Jan. 21, 1997. cited
by other .
International Search Report issued by the International Searching
Authority for Appl. No. PCT/US96/16849, mailed Mar. 26, 1997. cited
by other .
International Search Report issued by the International Searching
Authority for Appl. No. PCT/US96/18540, mailed Mar. 18, 1997. cited
by other .
Dialog File 351, WPI Accession No. 96-402320, Derwent WPI English
Language Abstract for WO 96/26217. cited by other .
Kwon et al. "TR1, a new member of the tumor necrosis factor
receptor superfamily, induces fibroblast proliferation and inhibits
osteoclastogenesis and bone resorption" FASEB Journal
12(10):845-854 (1998). cited by other .
Simonet et al. "Osteoprotegerin: A novel secreted protein involved
in the regulation of bone density" Cell 89(2):309-319 (1997). cited
by other .
Tsuda et al. "Isolation of a novel cytokine from human fibroblasts
that specifically inhibits osteoclastogenesis" Biochemical and
Biophysical Res. Comms. 234(1):137-142 (1997). cited by other .
Supplementary Partial European Search Report, Application No. 96 93
5862, dated Jan. 13, 2003. cited by other.
|
Primary Examiner: Landsman; Robert S.
Assistant Examiner: Jegatheesan; Seharaseyon
Attorney, Agent or Firm: Human Genome Sciences, Inc.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application
No. 60/136,248, filed May 26, 1999 and U.S. Provisional Application
No. 60/124,489, filed Mar. 15, 1999. This application is also a
continuation-in-part of U.S. patent application Ser. No.
08/718,737, filed Sep. 18, 1996, which was a continuation-in-part
of U.S. patent application Ser. No. 08/469,637, filed Jun. 6, 1995,
which was a continuation of PCT/US95/03216, filed Mar. 15, 1995.
The content of all the aforesaid applications are relied upon and
incorporated by reference in their entirety.
Claims
What is claimed is:
1. An isolated antibody, which specifically binds a protein
selected from the group consisting of: (a) a protein whose sequence
consists of the amino acid sequence of SEQ ID NO:2; (b) a protein
whose sequence consists of amino acids 1 to 380 of SEQ ID NO:2.
2. The antibody of claim 1, which specifically binds a protein
whose sequence consists of the amino acid sequence of SEQ ID
NO:2.
3. The antibody of claim 1, which specifically binds a protein
whose sequence consists of amino acids 1 to 380 of SEQ ID NO:2.
4. The antibody of claim 1, wherein said antibody is
polyclonal.
5. The antibody of claim 1, wherein said antibody is
monoclonal.
6. The antibody of claim 5, wherein said antibody is produced by a
method selected from the group consisting of the hybridoma
technique, the trioma technique, the human B-cell hybridoma
technique, and the EBV-hybridoma technique.
7. The antibody of claim 1, wherein said antibody is chimeric.
8. The antibody of claim 1, wherein said antibody is humanized.
9. A composition comprising the antibody of claim 1 and a
carrier.
10. An isolated antibody fragment, which specifically binds a
protein selected from the group consisting of: (a) a protein whose
sequence consists of the amino acid sequence of SEQ ID NO:2; (b) a
protein whose sequence consists of amino acids 1 to 380 of SEQ ID
NO: 2.
11. The antibody fragment of claim 10, which specifically binds a
protein whose sequence consists of the amino acid sequence of SEQ
ID NO:2.
12. The antibody fragment of claim 10, which specifically binds a
protein whose sequence consists of amino acids 1 to 380 of SEQ ID
NO:2.
13. The antibody fragment of claim 10, wherein said antibody
fragment comprises a Fab fragment.
14. The antibody fragment of claim 10, wherein said antibody
fragment comprises a single chain antibody.
15. The antibody fragment of claim 10, wherein said antibody
fragment is chimeric.
16. The antibody fragment of claim 10, wherein said antibody
fragment is humanized.
17. The antibody fragment of claim 10, wherein said antibody
fragment is the product of an Fab expression library.
18. A composition comprising the antibody fragment of claim 10 and
a carrier.
19. An isolated antibody, which specifically binds a protein
selected from the group consisting of: (a) a protein whose sequence
consists of the amino acid sequence encoded by ATCC Deposit No.
75899.
20. The isolated antibody of claim 19, which specifically binds the
protein whose sequence consists of the amino acid sequence encoded
by ATCC Deposit No. 75899.
21. The antibody of claim 19, wherein said antibody is
polyclonal.
22. The antibody of claim 19, wherein said antibody is
monoclonal.
23. The antibody of claim 19, wherein said antibody is
chimeric.
24. The antibody of claim 19, wherein said antibody is
humanized.
25. A composition comprising the antibody of claim 19 and a
carrier.
26. An isolated antibody fragment, which specifically binds a
protein selected from the group consisting of: (a) a protein whose
sequence consists of the amino acid sequence encoded by ATCC
Deposit No. 75899.
27. The isolated antibody fragment of claim 26, which specifically
binds the protein whose sequence consists of the amino acid
sequence encoded by ATCC Deposit No. 75899.
28. The antibody fragment of claim 26, wherein said antibody
fragment comprises a Fab fragment.
29. The antibody fragment of claim 26, wherein said antibody
fragment comprises a single chain antibody.
30. The antibody fragment of claim 26, wherein said antibody
fragment is chimeric.
31. The antibody fragment of claim 26, wherein said antibody
fragment is humanized.
32. A composition comprising the antibody fragment of claim 26 and
a carrier.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present inventors have discovered novel receptors in the Tumor
Necrosis Factor (TNF) receptor family. In particular, receptors
having homology to the type 2 TNF receptor (TNF-RII) are provided.
Isolated nucleic acid molecules are also provided encoding the
novel receptors of the present invention. Receptor polypeptides are
further provided, as are vectors, host cells, and recombinant
methods for producing the same.
2. Related Art
Human tumor necrosis factors .alpha. (TNF-.alpha.) and .beta.
(TNF-.beta. or lymphotoxin) are related members of a broad class of
polypeptide mediators, which includes the interferons, interleukins
and growth factors, collectively called cytokines (Beutler, B. and
Cerami, A., Annu. Rev. Immunol. 7:625 655 (1989)).
Tumor necrosis factor (TNF-.alpha. and TNF-.beta.) was originally
discovered as a result of its anti-tumor activity, however, now it
is recognized as a pleiotropic cytokine playing important roles in
a host of biological processes and pathologies. To date, there are
ten known members of the TNF-related cytokine family, TNF-.alpha.,
TNF-.beta. (lymphotoxin-.alpha.), LT-.beta., TRAIL and ligands for
the Fas receptor, CD30, CD27, CD40, OX40 and 4-1BB receptors. These
proteins have conserved C-terminal sequences and variable
N-terminal sequences which are often used as membrane anchors, with
the exception of TNF-.beta.. Both TNF-.alpha. and TNF-.beta.
function as homotrimers when they bind to TNF receptors.
TNF is produced by a number of cell types, including monocytes,
fibroblasts, T-cells, natural killer (NK) cells and predominately
by activated macrophages. TNF-.alpha. has been reported to have a
role in the rapid necrosis of tumors, immunostimulation, autoimmune
disease, graft rejection, producing an anti-viral response, septic
shock, cerebral malaria, cytotoxicity, protection against
deleterious effects of ionizing radiation produced during a course
of chemotherapy, such as denaturation of enzymes, lipid
peroxidation and DNA damage (Nata et al., J. Immunol. 136:2483
(1987)), growth regulation, vascular endothelium effects and
metabolic effects. TNF-.alpha. also triggers endothelial cells to
secrete various factors, including PAI-1, IL-1, GM-CSF and IL-6 to
promote cell proliferation. In addition, TNF-.alpha. up-regulates
various cell adhesion molecules such as E-Selectin, ICAM-1 and
VCAM-1. TNF-.alpha. and the Fas ligand have also been shown to
induce programmed cell death.
TNF-.beta. has many activities, including induction of an antiviral
state and tumor necrosis, activation of polymorphonuclear
leukocytes, induction of class I major histocompatibility complex
antigens on endothelial cells, induction of adhesion molecules on
endothelium and growth hormone stimulation (Ruddle, N. and Homer,
R., Prog. Allergy, 40:162 182 (1988)).
Recent studies with "knockout" mice have shown that mice deficient
in TNF-.beta. production show abnormal development of the
peripheral lymphoid organs and morphological changes in spleen
architecture (reviewed in Aggarwal et al., Eur Cytokine Netw,
7(2):93 124 (1996)). With respect to the lymphoid organs, the
popliteal, inguinal, para-aortic, mesenteric, axillary and cervical
lymph nodes failed to develop in TNF-.beta.-/-mice. In addition,
peripheral blood from TNF-.beta.-/-mice contained a three fold
reduction in white blood cells as compared to normal mice.
Peripheral blood from TNF-.beta.-/-mice, however, contained four
fold more B cells as compared to their normal counterparts.
Further, TNF-.beta., in contrast to TNF-.alpha. has been shown to
induce proliferation of EBV-infected B cells. These results
indicate that TNF-.beta. is involved in lymphocyte development.
The first step in the induction of the various cellular responses
mediated by TNF or LT is their binding to specific cell surface or
soluble receptors. Two distinct TNF receptors of approximately
55-KDa (TNF-RI) and 75-KDa (TNF-RII) have been identified (Hohman
et al., J. Biol. Chem., 264:14927 14934 (1989)), and human and
mouse cDNAs corresponding to both receptor types have been isolated
and characterized (Loetscher et al., Cell, 61:351 (1990)). Both
TNF-Rs share the typical structure of cell surface receptors
including extracellular, transmembrane and intracellular
regions.
These molecules exist not only in cell bound forms, but also in
soluble forms, consisting of the cleaved extra-cellular domains of
the intact receptors (Nophar et al., EMBO. Journal, 9 (10):3269 76
(1990)) and otherwise intact receptors wherein the transmembrane
domain is lacking. The extracellular domains of TNF-RI and TNF-RII
share 28% identity and are characterized by four repeated
cysteine-rich motifs with significant intersubunit sequence
homology. The majority of cell types and tissues appear to express
both TNF receptors and both receptors are active in signal
transduction, however, they are able to mediate distinct cellular
responses. Further, TNF-RII was shown to exclusively mediate human
T-cell proliferation by TNF as shown in PCT WO 94/09137.
TNF-RI dependent responses include accumulation of C-FOS, IL-6, and
manganese superoxide dismutase mRNA, prostaglandin E2 synthesis,
IL-2 receptor and MHC class I and II cell surface antigen
expression, growth inhibition, and cytotoxicity. TNF-RI also
triggers second messenger systems such as phospholipase A.sub.2,
protein kinase C, phosphatidylcholine-specific phospholipase C and
sphingomyelinase (Pfeffer, K et al., Cell, 73:457 467 (1993)).
Several interferons and other agents have been shown to regulate
the expression of TNF-Rs. Retinoic acid, for example, has been
shown to induce the production of TNF receptors in some cells type
while down regulating production in other cells. In addition,
TNF-.alpha. has been shown affect the localization of both types of
receptor. TNF-.alpha. induces internalization of TNF-RI and
secretion of TNF-RII (reviewed in Aggarwal et al., supra). Thus,
the production and localization of both TNF-Rs are regulated by a
variety of agents.
The yeast two hybrid system has been used to identify ligands which
associate with both types of the TNF-Rs (reviewed in Aggarwal et
al., supra). Several proteins have been identified which interact
with the cytoplasmic domain of a murine TNF-R. Two of these
proteins appear to be related to the baculovirus inhibitor of
apoptosis, suggesting a direct role for TNF-R in the regulation of
programmed cell death.
SUMMARY OF THE INVENTION
The novel Tumor Necrosis Factor (TNF) family receptors of the
present invention are referred to herein as "TR1 receptors." Thus,
in accordance with one aspect of the present invention, there are
provided isolated nucleic acid molecules encoding the TR1
polypeptides of the present invention, including mRNAs, DNAs,
cDNAs, genomic DNA as well as antisense analogs thereof and
biologically active and diagnostically or therapeutically useful
fragments thereof.
The isolated nucleic acid molecules of the present invention
comprise, or alternatively consist of, polynucleotide molecules
encoding the native TR1 receptor polypeptide having the amino acid
sequence shown in FIG. 1 (SEQ ID NO:2) or the amino acid sequence
encoded by the cDNA clone deposited in a bacterial host as ATCC
Deposit Number 75899 on Sep. 29, 1994. The nucleotide sequence
determined by sequencing the deposited native TR1 receptor clone,
which is shown in FIG. 1 (SEQ ID NO: 1), contains an open reading
frame encoding a polypeptide of 401 amino acid residues, including
an initiation codon at positions 46 48 in FIG. 1, with a leader
sequence of about 21 amino acid residues, and a predicted molecular
weight of about 46 kDa for the whole protein and about 44 kDa for
the non-glycosylated mature protein. The amino acid sequence of the
predicted mature native TR1 receptor protein is shown in FIG. 1,
amino acid residues about 22 to about 401 (SEQ ID NO:2).
Also included in the present invention are isolated nucleic acid
molecules comprising, or alternatively consisting of, a
polynucleotide encoding a carboxy terminus modified TR1 receptor
polypeptide having the amino acid sequence shown in FIG. 2 (SEQ ID
NO:4). The nucleotide sequence encoding a carboxy terminus modified
TR1 receptor polypeptide, shown in FIG. 2 (SEQ ID NO:3), contains
an open reading frame encoding a polypeptide of 395 amino acid
residues, including an initiation codon at positions 1 3 in FIG. 2,
with a leader sequence of about 21 amino acid residues, and a
predicted molecular weight of about 43 kDa for the non-glycosylated
mature protein. The amino acid sequence of the mature carboxy
terminus modified TR1 receptor protein is shown in FIG. 2, amino
acid residues from about 22 to about 395 (SEQ ID NO:4).
In a further aspect, the invention provides an isolated nucleic
acid molecule comprising, or alternatively consisting of, a
polynucleotide having a nucleotide sequence selected from the group
consisting of: (a) a nucleotide sequence encoding a TR1 receptor
polypeptide having the complete amino acid sequence in FIG. 1 (SEQ
ID NO:2) or FIG. 2 (SEQ ID NO:4); (b) a nucleotide sequence
encoding the predicted mature native TR1 receptor polypeptide
having the amino acid sequence at about position 22 to about
position 401 in FIG. 1 (SEQ ID NO:2) or the predicted mature
carboxy terminus modified TR1 receptor polypeptide having the amino
acid sequence at about position 22 to about position 395 in FIG. 2
(SEQ ID NO:4); (c) a nucleotide sequence encoding the native TR1
receptor polypeptide having the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 75899; (d)
a nucleotide sequence encoding the mature native TR1 receptor
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 75899; and (e) a nucleotide
sequence complementary to any of the nucleotide sequences in (a),
(b), (c) or (d) above.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise, or alternatively consist of, a
polynucleotide having a nucleotide sequence at least 80%, 85%, 90%,
or 92% identical, and more preferably at least 95%, 96%, 97%, 98%
or 99% identical, to any of the nucleotide sequences in (a), (b),
(c), (d), or (e), above, or a polynucleotide which hybridizes under
stringent hybridization conditions to a polynucleotide in (a), (b),
(c), (d), or (e), above. This polynucleotide which hybridizes does
not hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A
residues or of only T residues.
An additional nucleic acid embodiment of the invention relates to
an isolated nucleic acid molecule comprising, or alternatively
consisting of, a polynucleotide which encodes the amino acid
sequence of an epitope-bearing portion of a TR1 receptor
polypeptide having an amino acid sequence in (a), (b), (c), or (d),
above.
In accordance with another aspect of the present invention, there
are provided novel mature polypeptides which are TR1 receptors, as
well as fragments, analogs and derivatives thereof. The
polypeptides of the present invention are of human origin and have
amino acid sequences selected from the group consisting of: (a) the
amino acid sequence of the native TR1 receptor polypeptide having
the complete 401 amino acid sequence, including the leader
sequence, shown in FIG. 1 (SEQ ID NO:2), or the amino acid sequence
of the carboxy terminus modified TR1 receptor polypeptide having
the complete 395 amino acid sequence, including the leader
sequence, shown in FIG. 2 (SEQ ID NO:4); (b) the amino acid
sequence of the predicted mature native TR1 receptor polypeptide
(without the leader) having the amino acid sequence at about
position 22 to about position 401 in FIG. 1 (SEQ ID NO:2) or the
amino acid sequence of the predicted mature carboxy terminus
modified TR1 receptor polypeptide (without the leader) having the
amino acid sequence at about position 22 to about position 395 in
FIG. 2 (SEQ ID NO:4); (c) the amino acid sequence of the native TR1
receptor polypeptide having the complete amino acid sequence,
including the leader, encoded by the cDNA clone contained in ATCC
Deposit No. 75899; and (d) the amino acid sequence of the mature
native TR1 receptor polypeptide having the amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 75899. The
polypeptides of the present invention also include polypeptides
having an amino acid sequence with at least 90% similarity, and
more preferably at least 95% similarity to those described in (a),
(b), (c) or (d) above, as well as polypeptides having an amino acid
sequence at least 80% identical, at least 85% identical, more
preferably at least 90% or 92% identical, and still more preferably
95%, 96%, 97%, 98% or 99% identical to those above.
The above-described soluble TR1 receptor polypeptides are believed
not to include amino acids comprising a transmembrane domain. Thus,
in a further aspect, the present invention provides TR1 receptor
polypeptides that include such a transmembrane domain-containing
amino acid sequence. Such polypeptides may be native or constructed
from the TR1 receptors described herein.
An additional embodiment of this aspect of the invention relates to
a peptide or polypeptide which has the amino acid sequence of an
epitope-bearing portion of a TR1 receptor polypeptide having an
amino acid sequence described in (a), (b), (c) or (d), above.
Peptides or polypeptides having the amino acid sequence of an
epitope-bearing portion of a TR1 receptor polypeptide of the
invention include portions of such polypeptides with at least six
or seven, preferably at least nine, and more preferably at least
about 30 amino acids to about 50 amino acids, although
epitope-bearing polypeptides of any length up to and including the
entire amino acid sequence of a polypeptide of the invention
described above also are included in the invention. In another
embodiment, the invention provides an isolated antibody that binds
specifically to a TR1 receptor polypeptide having an amino acid
sequence described in (a), (b), (c), or (d) above.
The invention also provides functional domains of the soluble TR1
receptor polypeptides of the present invention. These domains
include amino acid residues from about 22 to about 261 in FIG. 1
(SEQ ID NO:2) and FIG. 2 (SEQ ID NO:4). The inventors have
discovered that amino acid residues from about 22 to about 261 in
FIGS. 1 and 2 are homologous to the extracellular domain of a
publically known TNF-RII (FIG. 3). Further included are amino acid
residues from about 262 to about 401 in FIG. 1 (SEQ ID NO:2) and
amino acid residues from about 262 to about 395 in FIG. 2 (SEQ ID
NO:4), which the present inventors have discovered are homologous
to the intracellular domain of the publically known TNF-RII (FIG.
3).
The invention further provides methods for isolating antibodies
that bind specifically to a TR1 receptor polypeptide having an
amino acid sequence as described herein. Such antibodies are useful
diagnostically or therapeutically as described below.
In accordance with yet a further aspect of the present invention,
there is provided a process for producing such polypeptides by
recombinant techniques which comprises culturing recombinant
prokaryotic and/or eukaryotic host cells, containing a nucleic acid
sequence encoding a polypeptide of the present invention, under
conditions promoting expression of said protein and subsequent
recovery of said protein. Thus, the present invention also relates
to methods of making such vectors and host cells and for using them
for production of TR1 receptor polypeptides or peptides by
recombinant techniques.
In accordance with yet a further aspect of the present invention,
there is provided a process for utilizing such polypeptides, or
polynucleotide encoding such polypeptides to screen for receptor
antagonists and/or agonists and/or receptor ligands. Such a
screening method for identifying compounds capable of enhancing or
inhibiting a cellular response induced by the TR1 receptor involves
contacting cells which express the TR1 receptor with the candidate
compound, assaying a cellular response, and comparing the cellular
response to a standard cellular response, the standard being
assayed when contact is made in absence of the candidate compound;
whereby, an increased cellular response over the standard indicates
that the compound is an agonist and a decreased cellular response
over the standard indicates that the compound is an antagonist.
In accordance with yet a further aspect of the present invention,
there are provided nucleic acid probes comprising nucleic acid
molecules of sufficient length to specifically hybridize to the
polypeptide of the present invention.
In another aspect, screening assays for agonists and antagonists
are provided which involve determining the effect a candidate
compound has on the binding of cellular ligands capable of either
eliciting or inhibiting a TR1 receptor mediated response. In
particular, the methods involve contacting a TR1 receptor
polypeptide with a candidate compound and determining whether TR1
receptor polypeptide binding to the cellular ligand is increased or
decreased due to the presence of the candidate compound. Further,
if binding to the TR1 receptor by the cellular ligand is altered,
the effect on TR1 receptor activity is then determined. In
addition, such assays may be used to identify compound which
directly elicit a TR1 receptor mediated response.
In accordance with still another aspect of the present invention,
there is provided a process of using such agonists for treating
conditions related to insufficient TR1 receptor activity, for
example, to inhibit tumor growth, to stimulate human cellular
proliferation, e.g., T-cell proliferation, to regulate the immune
response and antiviral responses, to protect against the effects of
ionizing radiation, to protect against chlamydia infection, to
regulate growth and to treat immunodeficiencies such as is found in
HIV.
In accordance with another aspect of the present invention, there
is provided a process of using such antagonists for treating
conditions associated with over-expression of the TR1 receptor, for
example, for treating T-cell mediated autoimmune diseases such as
AIDS, septic shock, cerebral malaria, graft rejection,
cytotoxicity, cachexia, apoptosis and inflammation.
The present inventors have discovered that TR1 receptor is
expressed in pulmonary tissue, hippocampus, adult heart, kidney,
liver, placenta, smooth muscle, thymus, prostate, ovary, small
intestine and osteoblastoma and fibroblast cell lines. Further, the
inventors have shown that a detectable quantity of TR1 receptor
mRNA is not present in fetal brain, synovium, synovial sarcoma,
T-cells, endothlial cells, activated macrophages, lymph nodes,
thymus, neutrophils, and activated neutrophils. For a number of
disorders, it is believed that significantly higher or lower levels
of one or both of the TR1 receptor gene expressions can be detected
in certain tissues (e.g., cancer, apoptosis, and inflammation) or
bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal
fluid) taken from an individual having such a disorder, relative to
a "standard" TR1 receptor gene expression level, i.e., the TR1
receptor expression level in tissue or bodily fluids from an
individual not having one of the disorders associated with aberrant
TR1 receptor function. Thus, the invention provides a diagnostic
method useful during diagnosis of a disorder associated with
aberrant TR1 receptor function, which involves: (a) assaying TR1
receptor gene expression level in cells or body fluid of an
individual; (b) comparing the TR1 receptor gene expression level
with a standard TR1 receptor gene expression level, whereby an
increase or decrease in the assayed TR1 receptor gene expression
level compared to the standard expression level is indicative of a
disorder associated with aberrant TR1 receptor function.
BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1(A B) shows the cDNA sequence (SEQ ID NO: 1) and
corresponding deduced amino acid sequence (SEQ ID NO:2) of the
native TR1 receptor polypeptide of the present invention which is
believed to lack a transmembrane domain. The initial 21 amino acids
represent the putative leader sequence and are underlined. The
standard one-letter abbreviations for amino acids are used.
Sequencing was performed using a 373 automated DNA sequencer
(Applied Biosystems, Inc.). Sequencing accuracy is predicted to be
greater than 97% accurate.
FIGS. 2(A B) shows the cDNA sequence (SEQ ID NO:3) and
corresponding deduced amino acid sequence (SEQ ID NO:4) of the
carboxy terminus modified TR1 receptor polypeptide of the present
invention. As above, the initial 21 amino acids represent the
putative leader sequence and are underlined. Sequencing and
abbreviations are as in FIG. 1.
FIG. 3 illustrates an amino acid sequence alignment of the native
TR1 receptor polypeptide of the present invention (upper line) and
the publically known human type 2 TNF receptor (human TNF-RII,
shown on the lower line).
FIG. 4 shows an analysis of the native TR1 receptor amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown. In the "Antigenic
Index--Jameson-Wolf" graph, amino acid residues 20 52, 66 203, 229
279, 297 378 in FIG. 1 correspond to the shown highly antigenic
regions of the native TR1 receptor protein.
FIG. 5 shows a binding assay of polyclonal antibodies specific for
human TNF-RI and TNF-RII and the native TR1 receptor of the present
invention. Purified native TR1 receptor (HSABH13 protein) was added
to well in a 96-well plate (100 .mu.l/well), and incubated for 2
hours. After incubation, the plate was washed three times and
phosphatase-labeled goat polyclonal antibody to human TNF-RI and
TNF-RII (200 .mu.l) was added to each well. After a further 2 hour
incubation, the receptor-antibody conjugate was washed three times
and 200 .mu.l of substrate solution was added to each well. The
plate was incubated further for 1 hr. The O.D. of the resulting
solution was then measured using a ELISA reader (test wavelength
450 nm, correction wavelength 590 nm). All reagents were from R
& D System (Minneapolis, Minn. 55413) and were used according
to the manufacturer's instructions.
FIG. 6 shows a binding assay of the native TR1 receptor to
monoclonal antibodies specific for type I and II TNF receptors.
Purified native TR1 receptor (HSABH13 protein) (100 ul/well) was
added to a 96-well plate provided by R&D system which was
coated with mAbs to sTNFRI or sTNFRII, and incubated for 2 hr.
After wasing three times with washing buffer, phosphatase-labeled
polyclonal antibody to sTNF RI or sTNF RII (200 ml) was added.
After a 2 hour incubation and three times wash, 200 ml of substrate
solution was added to each well and the plate was incubated for 1
hr. The OD was measured using a ELISA reader (test wavelength 450
nm, correction wavelength 590 nm). All reagents were from R & D
System.
FIG. 7 shows a competitive binding assay between the native TR1
receptor of the present invention and a novel TNF ligand-like
protein (HUVEO19) for TNF-.alpha. or TNF-.beta.. Purified native
TR1 receptor protein (100 .mu.l well) was added to wells of a
96-well plate, and incubated for 2 hours. After incubation, the
plate was washed three times, 10 ng of either TNF-.alpha. or
TNF-.beta. was added to the wells and the plate was incubated for
an additional 2 hours followed by an additional three washes. In a
duplicate plate, 10 ng of a novel. TNF ligand-like protein
(HUVEO19) was incubated first with native TR1 receptor and after
the initial three washes, 10 ng of either TNF-.alpha. or TNF-.beta.
was added to the wells for the second incubation. For each plate,
the wells were washed three times and phosphatase-labeled
polyclonal antibody specific for either TNF-.alpha. or TNF-.beta.
(200 .mu.l) was added. After a further 2 hour incubation, the wells
were washed three times wash times and 200 .mu.l of substrate
solution was added to each well. The plates were then incubated for
1 hr and the O.D. was measured using a ELISA reader (test
wavelength 450 nm, correction wavelength 590 nm). All reagents were
obtained from R & D System, as above.
FIG. 8 shows a competitive binding assay between the native TR1
receptor of the present invention and human TNF-RI and TNF-RII for
TNF-.alpha. and the novel TNF ligand-like protein described above.
Purified native TR1 receptor protein (100 .mu.l/well) was added to
wells of a 96-well plate which was precoated with TNF-.alpha. or
novel TNF ligand-like protein (HUVEO19), and incubated for 2 hours.
After incubation, the plate was washed three times, 10 ng of either
human TNF-RI or TNF-RII was added to the plate. The plate was then
incubated for an additional 2 hr. After the 2 hour incubation, the
wells were washed three times. In a duplicate plate, native TR1
receptor was omitted and 10 ng of either human TNF-RI or TNF-RII
was added. After the second 2 hour incubation the plates were
washed three times and phosphatase-labeled polygonal antibody to
human TNF-RI or TNF-RII (200 .mu.l) was added to each well. After
an additional 2 hour incubation, the plates were washed three times
wash, 200 .mu.l of substrate solution was added to each well, and
plate was incubated for 1 hour. The O.D. was then measured using a
ELISA reader (test wavelength 450 nm, correction wavelength 590
nm). All reagents were obtained from R & D System, as
above.
FIGS. 9(A B) shows a screening assay (ELISA) of polyclonal rabbit
anti-TR1 antibodies. Polyclonal rabbit anti-TR1 antibodies were
prepared by Pocono Rabbit Farm & Laboratory, Inc. (Canadensis,
Pa. 18325) according to standard protocol. The rabbit serum was
tested by ELISA. In particular, the plates were coated with TR1
(labeled as TNFr batch HG02900-1-B) for 2 hours at room temperature
or overnight at 4.degree. C. After washing with PBS, they were
blocked with PBS with 1% BSA and 0.5% sodium azide at 4.degree. C.
overnight. The PBS-BSA was flicked out of the well and test
supernatants were added and incubated for 1 hour at room
temperature. After 3 washes with PBS, 50 ml of anti-rabbit IgG
horseradish peroxidase conjugate (1:1000 dilution in PBS with 1%
BSA) was added and incubated at room temperature for 0.5 1 hr.
After 3 washes with PBS, the substrate solution for IgG horseradish
peroxidase was added to the plate and incubated at room temperature
for 10 30 minutes. The reaction was stopped by adding 50 ml of 0.1
M EDTA. The absorbance was read at 450 nm.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated
DNA sequencer (such as the Model 373 from Applied Biosystems,
Inc.), and all amino acid sequences of polypeptides encoded by DNA
molecules determined herein were predicted by translation of a DNA
sequence determined as above. Therefore, as is known in the art for
any DNA sequence determined by this automated approach, any
nucleotide sequence determined herein may contain some errors.
Nucleotide sequences determined by automation are typically at
least about 90% identical, more typically at least about 95% to at
least about 99.9% identical to the actual nucleotide sequence of
the sequenced DNA molecule. The actual sequence can be more
precisely determined by other approaches including manual DNA
sequencing methods well known in the art. As is also known in the
art, a single insertion or deletion in a determined nucleotide
sequence compared to the actual sequence will cause a frame shift
in translation of the nucleotide sequence such that the predicted
amino acid sequence encoded by a determined nucleotide sequence
will be completely different from the amino acid sequence actually
encoded by the sequenced DNA molecule, beginning at the point of
such an insertion or deletion.
Unless otherwise indicated, each "nucleotide sequence" set forth
herein is presented as a sequence of deoxyribonucleotides
(abbreviated A, G, C and T). However, by "nucleotide sequence" of a
nucleic acid molecule or polynucleotide is intended, for a DNA
molecule or polynucleotide, a sequence of deoxyribonucleotides, and
for an RNA molecule or polynucleotide, the corresponding sequence
of ribonucleotides (A, G, C and U), where each thymidine
deoxyribonucleotide (T) in the specified deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U). For
instance, reference to an RNA molecule having the sequence of SEQ
ID NO:1 set forth using deoxyribonucleotide abbreviations is
intended to indicate an RNA molecule having a sequence in which
each deoxyribonucleotide A, G or C of SEQ ID NO:1 has been replaced
by the corresponding ribonucleotide A, G or C, and each
deoxyribonucleotide T has been replaced by a ribonucleotide U.
The term "gene" or "cistron" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
In accordance with an aspect of the present invention, there is
provided an isolated nucleic acid molecule comprising, or
alternatively consisting of, a polynucleotide encoding the
predicted mature native TR1 receptor polypeptide having the deduced
amino acid sequence of FIG. 1 (SEQ ID NO:2) or for the mature
native TR1 receptor polypeptide encoded by the cDNA of the clone
which was deposited on Sep. 29, 1994 at the American Type Culture
Collection, Patent Depository, 10801 University Boulevard,
Manassas, Va. 20110-2209, and given accession number 75899. The
nucleotide sequence shown in FIG. 1 (SEQ ID NO:1) was obtained by
sequencing the HSABH13 clone deposited with the ATCC. The deposited
clone is contained in the pBluescript SK(-) plasmid (Stratagene,
LaJolla, Calif.).
Also provided is an isolated nucleic acid molecule comprising, or
alternatively consisting of, a polynucleotide encoding the mature
carboxy terminus modified TR1 receptor polypeptide having the
deduced amino acid sequence of FIG. 2 (SEQ ID NO:4), which includes
a frame shift at a carboxy terminal amino acid residue shown in
FIG. 1 (SEQ ID NO:2). Due to the location of this frame shift, the
inventors, as one skilled in the art would recognize, predict that
a functional TR1 receptor with a modified carboxy terminus is
encoded by FIG. 2 (SEQ ID NO:3). This conclusion is based on the
fact that the remainder of the sequence remains substantially
unaltered.
One skilled in the art would be able to produce such a carboxy
terminus modified TR1 receptor as shown in FIG. 2 (SEQ ID NO:4)
from the cDNA clone contained in ATCC Deposit No. 75899 or from an
isolated naturally occurring polynucleotide using standard
recombinant DNA techniques, which are described in numerous sources
including in Molecular Cloning, A Laboratory Manual, 2nd. edition,
Sambrook, J., Fritsch, E. F. and Maniatis, T., eds., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
Using the information provided herein, such as the nucleotide
sequence in FIG. 1 (SEQ ID NO:1) or FIG. 2 (SEQ ID NO:3), a cDNA
molecule comprising a polynucleotide encoding a polypeptide of the
present invention may be obtained from numerous human tissues,
including pulmonary tissue, hippocampus, adult heart, kidney,
liver, placenta, smooth muscle, thymus, prostate, ovary, small
intestinal tissue and osteoblastoma and fibroblast cell lines. The
present inventors have discovered that the native TR1 receptor of
the present invention is expressed in each of the above tissues and
cell types.
The cDNA contained in ATCC Deposit No. 75899 was isolated from a
cDNA library derived from human early passage fibroblasts (HSA 172
cells) and is structurally related to a prior art human TNF-RII
receptor. See FIG. 3 (SEQ ID NO:5). The determined nucleotide
sequence of the TR1 receptor cDNA of FIG. 1 (SEQ ID NO: 1) contains
an initiation codon at positions 46 48 of the nucleotide sequence
in FIG. 1 (SEQ ID NO: 1) and contains an open reading frame
encoding a protein of 401 amino acid residues of which
approximately the first 21 amino acids residues are the putative
leader sequence such that the mature protein comprises about 380
amino acids. The protein exhibits the highest degree of homology to
human TNF-R2 with about 27% identity and about 43% similarity over
the entire length of the proteins. Six conserved cyteines present
in modules of 40 residues in all TNF receptors are conserved in
this receptor.
As indicated, the present invention also provides the mature
form(s) of the TR1 receptor proteins of the present invention.
According to the signal hypothesis, proteins secreted by mammalian
cells have a signal or secretory leader sequence which is cleaved
from the mature protein once export of the growing protein chain
across the rough endoplasmic reticulum has been initiated. Most
mammalian cells and even insect cells cleave secreted proteins with
the same specificity. However, in some cases, cleavage of a
secreted protein is not entirely uniform, which results in two or
more mature species on the protein. Further, it has long been known
that the cleavage specificity of a secreted protein is ultimately
determined by the primary structure of the complete protein, that
is, it is inherent in the amino acid sequence of the polypeptide.
Therefore, the present invention provides a nucleotide sequence
encoding the mature TR1 receptor polypeptides having the amino acid
sequence encoded by the cDNA clone contained in the host identified
as ATCC Deposit No. 75899 and as shown in FIG. 1 (SEQ ID NO:2) and
FIG. 2 (SEQ ID NO:4). By the mature TR1 receptor having the amino
acid sequence encoded by the cDNA clone contained in the host
identified as ATCC Deposit No. 75899 is meant the mature form(s) of
the TR1 receptor protein produced by expression in a mammalian cell
(e.g., COS cells, as described below) of the complete open reading
frame encoded by the human DNA sequence of the clone contained in
the vector in the deposited host. As indicated below, the mature
TR1 receptor having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 75899 may or may not differ
from the predicted "mature" TR1 receptor protein shown in FIG. 1
(amino acids from about 22 to about 401) depending on the accuracy
of the predicted cleavage site based on computer analysis.
Methods for predicting whether a protein has a secretory leader as
well as the cleavage point for that leader sequence are available
because it is known that much of the cleavage specificity for a
secretory protein resides in certain amino acid residues within the
signal sequence and the N-terminus of the mature protein,
particularly residues immediately surrounding the cleavage site.
For instance, the method of McGeoch (Virus Res. 3:271 286 (1985))
uses the information from a short N-terminal charged region and a
subsequent uncharged region of the complete (uncleaved) protein.
The method of von Heinje (Nucleic Acids Res. 14:4683 4690 (1986))
uses the information from the residues surrounding the cleavage
site, typically residues -13 to +2 where +1 indicates the amino
acid terminus of the mature protein. The accuracy of predicting the
cleavage points of known mammalian secretory proteins for each of
these methods is in the range of 75 80%. von Heinje, supra.
However, the two methods do not always produce the same predicted
cleavage point(s) for a given protein.
In the present case, the predicted amino acid sequence of the
complete TR1 receptor polypeptides of the present invention were
analyzed by a computer program ("PSORT"). This program is available
from Dr. Kenta Nakai of the Institute for Chemical Research, Kyoto
University (see, K. Nakai and M. Kanehisa, Genomics 14:897 911
(1992)), which is an expert system for predicting the cellular
location of a protein based on the amino acid sequence. As part of
this computational prediction of localization, the methods of
McGeoch and von Heinje are incorporated. The analysis by the PSORT
program predicted the cleavage sites between amino acids 21 and 22
in FIG. 1 (SEQ ID NO:2) and FIG. 2 (SEQ ID NO:4). Thereafter, the
complete amino acid sequences were further analyzed by visual
inspection, applying a simple form of the (-1,-3) rule of von
Heine. von Heinje, supra. Thus, the leader sequence for the native
TR1 receptor protein is predicted to consist of amino acid residues
1 21 in FIG. 1 (SEQ ID NO:2), while the predicted mature native TR1
receptor protein consists of residues 22 401, and the leader
sequence for the carboxy terminus modified TR1 receptor protein is
predicted to consist of amino acid residues 1 21 in FIG. 2 (SEQ ID
NO:4), while the predicted mature native TR1 receptor protein
consists of residues 22 395 in FIG. 2 (SEQ ID NO:4).
Thus, in view of above, as one of ordinary skill would appreciate,
the actual leader sequence of the TR1 receptor proteins of the
present invention are predicted to be about 21 amino acids in
length, but may be anywhere in the range of about 16 to about 27
amino acids. The TR1 receptors of the present invention are soluble
receptors and are secreted. However, they may also exist as
membrane bound receptors having a transmembrane region and intra-
and extracellular regions. The polypeptides of the present
invention may bind TNF and lymphotoxin ligands or other TNF ligand
family members.
In accordance with an aspect of the present invention there are
provided polynucleotides which may be in the form of RNA or in the
form of DNA, which DNA includes cDNA, genomic DNA, and synthetic
DNA. The DNA may be double-stranded or single-stranded, and if
single stranded may be the coding strand or non-coding (anti-sense)
strand. The coding sequence which encodes the mature polypeptide
may be identical to the coding sequence shown in FIG. 1 (SEQ ID
NO:1), FIG. 2 (SEQ ID NO:3) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO: 1), FIG. 2
(SEQ ID NO:3) or the deposited cDNA.
The polynucleotide which encodes for the mature polypeptide of FIG.
1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4) or for the mature polypeptide
encoded by the deposited cDNA may include: only the coding sequence
for the mature polypeptide; the coding sequence for the mature
polypeptide and additional coding sequence such as a leader or
secretory sequence or a proprotein sequence; the coding sequence
for the mature polypeptide (and optionally additional coding
sequence) and non-coding sequence, such as introns or non-coding
sequence 5' and/or 3' of the coding sequence for the mature
polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses
a polynucleotide which includes only coding sequence for the
polypeptide as well as a polynucleotide which includes additional
coding and/or non-coding sequence.
The present invention further relates to polynucleotides
comprising, or alternatively consisting of, variants of the
hereinabove described polynucleotides, which encode fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4), or the
polypeptide encoded by the cDNA of the deposited clone. The
variants of the polynucleotides may be naturally occurring allelic
variants of the polynucleotides or non-naturally occurring variants
of those polynucleotides.
In one aspect of this embodiment, the present invention is directed
to fragments of the isolated nucleic acid molecules described
herein. By a fragment of an isolated nucleic acid molecule having
the nucleotide sequence of the deposited cDNA or the nucleotide
sequence shown in FIG. 1 (SEQ ID NO:1) or FIG. 2 (SEQ ID NO:4) is
intended fragments at least about 15 nt, and more preferably at
least about 20 nt, still more preferably at least about 30 nt, and
even more preferably, at least about 40 nt in length which are
useful as diagnostic probes and primers as discussed herein. In
this context, "about" includes the particularly recited values and
values larger or smaller by several (5, 4, 3, 2, and 1)
nucleotides. Of course, larger fragments, 50, 75, 100, 125, 150,
175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475,
500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800,
825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100,
1125, 1150, or 1200 nt in length are also useful according to the
present invention as are fragments corresponding to most, if not
all, of the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1),
FIG. 2 (SEQ ID NO:3), of the deposited cDNA. By a fragment at least
20 nt in length, for example, is intended fragments which include
20 or more contiguous bases from the nucleotide sequence of the
deposited cDNA or the nucleotide sequence as shown in FIG. 1 (SEQ
ID NO:1) or FIG. 2 (SEQ ID NO:3).
The present invention is further directed to polynucleotides
comprising, or alternatively consisting of, fragments of isolated
nucleic acid molecules which encode subportions of TR1 receptor
domains. In particular, the invention provides polynucleotides
comprising, or alternatively consisting of, the nucleotide
sequences of a member selected from the group consisting of
nucleotides 46 105, 106 165, 166 225, 226 285, 286 345, 346 405,
406 465, 466 525, 526 585, 586 645, 646 705, 706 765, 766 825, 826
885, 886 945, 946 1005, 1006 1065, 1066 1125, 1126 1185, 1186 1245,
or 1186 1248 of SEQ ID NO:1, or the complementary strand
thereto.
The invention also provides polynucleotides comprising, or
alternatively consisting of, the nucleotide sequences of a member
selected from the group consisting of nucleotides 1 60, 11 70, 64
123, 124 183, 184 243, 244 303, 304 363, 364 423, 424 483, 484 543,
544 603, 604 663, 664 723, 724 783, 784 843, 844 903, 904 963, 964
1023, 1024 1083, 1084 1143, or 1129 1188 of SEQ ID NO:3, or the
complementary strand thereto.
The present invention is further directed to polynucleotides
comprising, or alternatively consisting of, isolated nucleic acid
molecules which encode domains of the TR1 receptor. In one aspect,
the invention provides polynucleotides comprising, or alternatively
consisting of, nucleic acid molecules which encode beta-sheet
regions of the TR1 receptor set out in Table 2. Representative
examples of such polynucleotides comprise, or alternatively consist
of, nucleic acid molecules which encode a polypeptide having an
amino acid sequence selected from the group consisting of amino
acid residues from about 16 to about 22, amino acid residues from
about 57 to about 63, amino acid residues from about 129 to about
134, amino acid residues from about 139 to about 143, amino acid
residues from about 167 to about 174, amino acid residues from
about 197 to about 203, amino acid residues from about 205 to about
214, amino acid residues from about 220 to about 225, amino acid
residues from about 265 to about 275, amino acid residues from
about 281 to about 285, amino acid residues from about 325 to about
335, amino acid residues from about 366 to about 401, and amino
acid residues from about 396 to about 401 of SEQ ID NO:2. The
invention is further directed to isolated polypeptides comprising,
or alternatively consisting of, an amino acid sequence selected
from the group consisting of amino acid residues from about 16 to
about 22, amino acid residues from about 57 to about 63, amino acid
residues from about 129 to about 134, amino acid residues from
about 139 to about 143, amino acid residues from about 167 to about
174, amino acid residues from about 197 to about 203, amino acid
residues from about 205 to about 214, amino acid residues from
about 220 to about 225, amino acid residues from about 265 to about
275, amino acid residues from about 281 to about 285, amino acid
residues from about 325 to about 335, amino acid residues from
about 366 to about 401, and amino acid residues from about 396 to
about 401 of SEQ ID NO:2. In this context "about" includes the
particularly recited value and values larger or smaller by several
(5, 4, 3, 2, or 1) amino acids.
Nucleic acid fragments of the present invention include nucleic
acid molecules encoding beta-sheet regions of the the TR1 receptor
protein, as well as isolated nucleic acid molecules comprising, or
alternatively consisting of, a polynucleotide having a nucleotide
sequence at least 80% identical, and more preferably at least 85%,
90%, 92%, 95%, 96%, 97%, 98% or 99% identical to nucleic acid
molecules encoding beta-sheet regions of the the TR1 receptor
protein. Polynucleotides encoding polypeptides at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to beta-sheet
regions are also with the scope of the invention, as are the
polypeptides encoded by these polynucleotides.
Since the gene has been deposited and the nucleotide sequence shown
in FIG. 1 (SEQ ID NO: 1) and FIG. 2 (SEQ ID NO:3) are provided,
generating such DNA fragments would be routine to the skilled
artisan. For example, restriction endonuclease cleavage or shearing
by sonication could easily be used to generate fragments of various
sizes. Alternatively, such fragments could be generated
synthetically.
Preferred nucleic acid fragments of the present invention include
nucleic acid molecules encoding epitope-bearing portions of the TR1
receptor protein. In particular, such nucleic acid fragments of the
present invention include nucleic acid molecules encoding: a
polypeptide comprising, or alternatively consisting of, amino acid
residues from about 20 to about 52 in FIG. 1 (SEQ ID NO:2) or FIG.
2 (SEQ ID NO:4); a polypeptide comprising, or alternatively
consisting of, amino acid residues from about 66 to about 203 in
FIG. 1 (SEQ ID NO:2) or FIG. 2 (SEQ ID NO:4); a polypeptide
comprising, or alternatively consisting of, amino acid residues
from about 229 to about 279 in FIG. 1 (SEQ ID NO:2) or FIG. 2 (SEQ
ID NO:4); and a polypeptide comprising, or alternatively consisting
of, amino acid residues from about 297 to about 378 in FIG. 1 (SEQ
ID NO:2). In this context, "about" includes the particularly
recited values and values larger or smaller by several (5, 4, 3, 2,
and 1) nucleotides. Using the Jameson-Wolf graph shown in FIG. 4,
the inventors have determined that the above polypeptide fragments
are antigenic regions of the TR1 receptor protein.
Thus, the present invention includes polynucleotides encoding the
same mature polypeptide as shown in FIG. 1 (SEQ ID NO:2) or the
same mature polypeptide encoded by the cDNA of the deposited clone
as well as variants of such polynucleotides which variants encode
for a fragment, derivative or analog of the polypeptide of FIG. 1
(SEQ ID NO:2) or the polypeptide encoded by the cDNA of the
deposited clone. Such nucleotide variants include deletion
variants, substitution variants and addition or insertion
variants.
As hereinabove indicated, the polynucleotide may have a coding
sequence which is a naturally occurring allelic variant of the
coding sequence shown in FIG. 1 (SEQ ID NO: 1), FIG. 2 (SEQ ID
NO:3), or of the coding sequence of the deposited clone. As
indicated, one particularly preferred variant is a TR1 receptor
containing a transmembrane domain inserted after amino acid residue
about 260 or 261 in FIG. 1 or FIG. 2. As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide. Variants may occur naturally, such as a
natural allelic variant. By an "allelic variant" is intended one of
several alternate forms of a gene occupying a given locus on a
chromosome of an organism. Genes II, Lewin, B., ed., John Wiley
& Sons, New York (1985). Non-naturally occurring variants may
be produced using art-known mutagenesis techniques, which include,
but are not limited to, oligonucleotide mediated mutagenesis,
alanine scanning, PCR mutagenesis, site-directed mutagenesis (see,
e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and Zoller et
al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis (see,
e.g., Wells et al., Gene 34:315 (1985)), restriction selection
mutagenesis (see, e.g., Wells et al., Philos. Trans. R. Soc. London
Ser A 317:415 (1986)).
Such variants include those produced by nucleotide substitutions,
deletions or additions. The substitutions, deletions or additions
may involve one or more nucleotides. The variants may be altered in
coding regions, non-coding regions, or both. Alterations in the
coding regions may produce conservative or non-conservative amino
acid substitutions, deletions or additions. Especially preferred
among these are silent substitutions, additions and deletions,
which do not alter the properties and activities of the TR1
receptor proteins or portions thereof. Also especially preferred in
this regard are conservative substitutions. Most highly preferred
are nucleic acid molecules encoding the mature native TR1 receptor
protein having the amino acid sequence shown in FIG. 1 (SEQ ID
NO:2), the mature native TR1 receptor amino acid sequence encoded
by the deposited cDNA clone, or the mature carboxy terminus
modified TR1 receptor protein having the amino acid sequence shown
in FIG. 2 (SEQ ID NO:4).
The present invention also includes polynucleotides, wherein the
coding sequence for the mature polypeptide may be fused in the same
reading frame to a polynucleotide sequence which aids in expression
and secretion of a polypeptide from a host cell, for example, a
leader sequence which functions as a secretory sequence for
controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains. Such
isolated molecules, particularly DNA molecules, are useful as
probes for gene mapping, by in situ hybridization with chromosomes,
and for detecting expression of the TR1 receptor genes in human
tissue, for instance, by Northern blot analysis.
Thus, for example, the polynucleotide of the present invention may
encode for a mature protein, or for a protein having a prosequence
or for a protein having both a prosequence and a presequence
(leader sequence).
By "isolated" nucleic acid molecule(s) is intended a nucleic acid
molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically.
However, a nucleic acid contained in a clone that is a member of a
library (e.g., a genomic or cDNA library) that has not been
isolated from other members of the library (e.g., in the form of a
homogeneous solution containing the clone and other members of the
library) or a chromosome isolated or removed from a cell or a cell
lysate (e.g., a "chromosome spread," as in a karyotype), is not
"isolated" for the purposes of the invention. As discussed further
herein, isolated nucleic acid molecules according to the present
invention may be produced naturally, recombinantly, or
synthetically.
The polynucleotides of the present invention may also have the
coding sequence fused in frame to a marker sequence which allows
for purification of the polypeptide of the present invention. The
marker sequence may be a hexa-histidine tag supplied by a pQE-9
vector to provide for purification of the mature polypeptide fused
to the marker in the case of a bacterial host, or, for example, the
marker sequence may be a hemagglutinin (HA) tag when a mammalian
host, e.g. COS-7 cells, is used. The HA tag corresponds to an
epitope derived from the influenza hemagglutinin protein (Wilson et
al., Cell, 37:767 (1984)). The coding sequence may also be fused to
a sequence which codes for a fusion protein such as an IgG Fc
fusion protein.
The term "gene" means the segment of DNA involved in producing a
polypeptide chain; it includes regions preceding and following the
coding region (leader and trailer) as well as intervening sequences
(introns) between individual coding segments (exons).
Fragments of the full length gene of the present invention may be
used as a hybridization probe for a cDNA library to isolate the
full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which
hybridize to the hereinabove-described sequences if there is at
least 80%, preferably at least 90% or 92%, and more preferably at
least 95%, 96%, 97%, 98% or 99% identity between the sequences. The
present invention particularly relates to polynucleotides which
hybridize under stringent conditions to the hereinabove-described
polynucleotides, for instance, the cDNA contained in ATCC Deposit
75899. By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times. SSC (750 mM NaCl, 75 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times. SSC at about
65.degree. C.
Alternatively, the polynucleotide may have at least 20 bases,
preferably 30 bases, and more preferably at least 50 bases which
hybridize to a polynucleotide of the present invention and which
has an identity thereto, as hereinabove described, and which may or
may not retain activity. For example, such polynucleotides may be
employed as probes for the polynucleotide of SEQ ID NO:1, for
example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
Of course, polynucleotides hybridizing to a larger portion of the
reference polynucleotide (e.g., the deposited cDNA clone), for
instance, a portion 50 750 nt in length, or even to the entire
length of the reference polynucleotide, are also useful as probes
according to the present invention, as are polynucleotides
corresponding to most, if not all, of the nucleotide sequence of
the deposited cDNA or the nucleotide sequence as shown in FIG. 1
(SEQ ID NO: 1) or FIG. 2 (SEQ ID NO:3). By a portion of a
polynucleotide of "at least 20 nt in length," for example, is
intended 20 or more contiguous nucleotides from the nucleotide
sequence of the reference polynucleotide (e.g., the deposited cDNA
or the nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1) or
FIG. 2 (SEQ ID NO:3)). As indicated, such portions are useful
diagnostically either as a probe according to conventional DNA
hybridization techniques or as primers for amplification of a
target sequence by the polymerase chain reaction (PCR), as
described, for instance, in Molecular Cloning, A Laboratory Manual,
2nd. edition, Sambrook, J., Fritsch, E. F. and Maniatis, T., eds.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989), the entire disclosure of which is hereby incorporated
herein by reference.
Since a TR1 receptor cDNA clone has been deposited and its
determined nucleotide sequence is provided in FIG. 1 (SEQ ID NO:
1), generating polynucleotides which hybridize to a portion of the
TR1 receptor cDNA molecule would be routine to the skilled artisan.
For example, restriction endonuclease cleavage or shearing by
sonication of the TR1 receptor cDNA clone could easily be used to
generate DNA portions of various sizes which are polynucleotides
that hybridize to a portion of the TR1 receptor cDNA molecule.
Alternatively, the hybridizing polynucleotides of the present
invention could be generated synthetically according to known
techniques. Of course, a polynucleotide which hybridizes only to a
poly A sequence (such as the 3' terminal poly(A) tract of the TR1
receptor cDNA shown in FIG. 1 (SEQ ID NO: 1), or to a complementary
stretch of T (or U) resides, would not be included in a
polynucleotide of the invention used to hybridize to a portion of a
nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone generated from an oligo-dT primed cDNA
library).
Further embodiments of the invention include isolated nucleic acid
molecules comprising a polynucleotide having a nucleotide sequence
at least 80%, 85%, 90%, or 92% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide
sequence encoding the full-length native TR1 receptor polypeptide
having the complete amino acid sequence in FIG. 1 (SEQ ID NO:2) or
a nucleotide sequence encoding the full-length carboxy terminus
modified TR1 receptor polypeptide having the complete amino acid
sequence in FIG. 2 (SEQ ID NO:4), including the predicted leader
sequences; (b) a nucleotide sequence encoding the mature native TR1
receptor polypeptide (full-length polypeptide with the leader
removed) having the amino acid sequence at positions about 22 to
about 401 in FIG. 1 (SEQ ID NO:2) or a nucleotide sequence encoding
the mature carboxy terminus modified TR1 receptor polypeptide
(full-length polypeptide with the leader removed) having the amino
acid sequence at positions about 22 to about 395 in FIG. 2 (SEQ ID
NO:4); (c) a nucleotide sequence encoding the full-length native
TR1 receptor polypeptide having the complete amino acid sequence
including the leader encoded by the cDNA clone contained in ATCC
Deposit No. 75899; (d) a nucleotide sequence encoding the mature
native TR1 receptor polypeptide having the amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 75899; or
(e) a nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), or (d).
By a polynucleotide having a nucleotide sequence at least, for
example, 95% "identical" to a reference nucleotide sequence
encoding a TR1 receptor polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five point mutations, or mismatches, per each 100 nucleotides of
the reference nucleotide sequence encoding the TR1 receptor
polypeptide. In other words, to obtain a polynucleotide having a
nucleotide sequence at least 95% identical to a reference
nucleotide sequence, up to 5% of the nucleotides in the reference
sequence may be deleted or substituted with another nucleotide, or
a number of nucleotides up to 5% of the total nucleotides in the
reference sequence may be inserted into the reference sequence.
These mutations, or mismatches, of the reference sequence may occur
at the 5' or 3' terminal positions of the reference nucleotide
sequence or anywhere between those terminal positions, interspersed
either individually among nucleotides in the reference sequence or
in one or more contiguous groups within the reference sequence.
The reference (query) sequence may be the entire TR1 encoding
nucleotide sequence shown in FIG. 1 (SEQ ID NO:2), FIG. 2 (SEQ ID
NO:4) or any TR1 polynucleotide fragment as described herein.
As a practical matter, whether any particular nucleic acid molecule
is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the nucleotide sequence shown in FIG. 1, FIG. 2 or to the
nucleotide sequence of the deposited cDNA clone can be determined
conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711. Bestfit uses the local homology
algorithm of Smith and Waterman, Advances in Applied Mathematics 2:
482 489 (1981), to find the best segment of homology between two
sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference nucleotide sequence and that gaps in homology of up to 5%
of the total number of nucleotides in the reference sequence are
allowed.
As a practical matter, whether any particular nucleic acid molecule
is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the encoding nucleotide sequence shown in FIG. 1 (SEQ ID
NO:2), FIG. 2 (SEQ ID NO:4) or to the nucleotide sequence of the
deposited cDNA clone, can be determined conventionally using known
computer programs such as the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711)
to find the best segment of homology, as described above.
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject
sequence, also referred to as a global sequence alignment, is
determined using the FASTDB computer program based on the algorithm
of Brutlag et al. (Comp. App. Biosci. 6:237 245 (1990)). Preferred
parameters used in a FASTDB alignment of DNA sequences to calculate
percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=,
Joining Penalty=30, Randomization Group Length=0, CutoffScore=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length
of the subject nucleotide sequence, whichever is shorter.
According to this embodiment, if the subject sequence is shorter
than the query sequence because of 5' or 3' deletions, not because
of internal deletions, a manual correction is made to the results
to take into consideration the fact that the FASTDB program does
not account for 5' and 3' truncations of the subject sequence when
calculating percent identity. For subject sequences truncated at
the 5' or 3' ends relative to the query sequence, the percent
identity is corrected by calculating the number of bases of the
query sequence that are 5' and 3' of the subject sequence, which
are not matched/aligned, as a percent of the total bases of the
query sequence. A determination of whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of this
embodiment.
Only bases outside the 5' and 3' bases of the subject sequence, as
displayed by the FASTDB alignment, which are not matched/aligned
with the query sequence, are calculated for the purposes of
manually adjusting the percent identity score. For example, a 90
base subject sequence is aligned to a 100 base query sequence to
determine percent identity. The deletions occur at the 5' end of
the subject sequence and therefore, the FASTDB alignment does not
show a match/alignment of the first 10 bases at 5' end. The 10
unpaired bases represent 10% of the sequence (number of bases at
the 5' and 3' ends not matched/total number of bases in the query
sequence) so 10% is subtracted from the percent identity score
calculated by the FASTDB program. If the remaining 90 bases were
perfectly matched the final percent identity would be 90%.
In another example, a 90 base subject sequence is compared with a
100 base query sequence. This time the deletions are internal
deletions so that there are no bases on the 5' or 3' ends of the
subject sequence which are not matched/aligned with the query
sequence. In this case the percent identity calculated by FASTDB is
not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are made for the purposes of this embodiment.
Preferred, however, are nucleic acid molecules having sequences at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to
the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1), FIG. 2
(SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNA
which do, in fact, encode a polypeptide having TR1 receptor protein
activity. By "a polypeptide having TR1 receptor activity" is
intended polypeptides exhibiting activity similar, but not
necessarily identical, to an activity of the TR1 receptor protein
of the invention (either the full-length protein or, preferably,
the mature protein), as measured in a particular biological assay.
For example, TR1 receptor protein activity can be measured using
the binding affinity for a TR1-.beta. ligand or other molecule
shown to bind to the native TR1 receptor protein. For example, the
competitive binding assays shown in FIG. 7 can be used to determine
whether a candidate polypeptide has a binding affinity similar to
that of the native TR1 receptor described herein.
Thus, "a polypeptide having TR1 receptor protein activity" includes
polypeptides that exhibit TR1 receptor binding activity in the
above-described assays. Although the degree of binding activity
need not be identical to that of the TR1 receptor protein,
preferably, "a polypeptide having TR1 receptor protein activity"
will exhibit substantially similar activity as compared to the
native TR1 receptor protein.
The present application is directed to nucleic acid molecules at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to
the nucleic acid sequences (i.e., polynucleotides) disclosed
herein, irrespective of whether they encode a polypeptide having
TR1 functional activity. This is because even where a particular
nucleic acid molecule does not encode a polypeptide having TR1
functional activity, one of skill in the art would still know how
to use the nucleic acid molecule, for instance, as a hybridization
probe or a polymerase chain reaction (PCR) primer. Uses of the
nucleic acid molecules of the present invention that do not encode
a polypeptide having TR1 functional activity include, but are not
limited to, inter alia, (1) isolating a TR1 gene or allelic or
splice variants thereof in a cDNA library; (2) in situ
hybridization (e.g., "FISH") to metaphase chromosomal spreads to
provide precise chromosomal location of a TR1 gene, as described in
Verma et al., Human Chromosomes: A Manual of Basic Techniques,
Pergamon Press, New York (1988); and (3) Northern Blot analysis for
detecting TR1 mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to
the nucleic acid sequences disclosed herein, which do, in fact,
encode a polypeptide having TR1 functional activity. By "a
polypeptide having TR1 functional activity" is intended
polypeptides exhibiting activity similar, but not necessarily
identical, to an activity of the TR1 receptors of the present
invention (either the full-length polypeptide, or the splice
variants), as measured, for example, in a particular immunoassay or
biological assay. For example, TR1 activity can be measured by
determining the ability of a TR1 polypeptide to bind a TR1 ligand
(e.g., TRANCE (Anderson et al., Nature 390:175 179 (1997); TRAIL
(Wiley, S. R., et al., Immunity 3:673 682(1995); and OPGL (Kong, Y.
Y., et al., Nature 397:315 323 (1999)).
Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid
sequence of the deposited cDNA, the nucleic acid sequence shown in
FIG. 1 (SEQ ID NO: 1) or FIG. 2 (SEQ ID NO:3), or fragments
thereof, will encode polypeptides "having TR1 functional activity."
In fact, since degenerate variants of any of these nucleotide
sequences all encode the same polypeptide, in many instances, this
will be clear to the skilled artisan even without performing the
above described comparison assay. It will be further recognized in
the art that, for such nucleic acid molecules that are not
degenerate variants, a reasonable number will also encode a
polypeptide having TR1 functional activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are
either less likely or not likely to significantly affect protein
function (e.g., replacing one aliphatic amino acid with a second
aliphatic amino acid).
For example, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie et al., "Deciphering
the Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247:1306 1310 (1990), wherein the authors
indicate that there are two main approaches for studying the
tolerance of an amino acid sequence to change. The first method
relies on the process of evolution, in which mutations are either
accepted or rejected by natural selection. The second approach uses
genetic engineering to introduce amino acid changes at specific
positions of a cloned gene and selections or screens to identify
sequences that maintain functionality. As the authors state, these
studies have revealed that proteins are surprisingly tolerant of
amino acid substitutions. The authors further indicate which amino
acid changes are likely to be permissive at a certain position of
the protein. For example, most buried amino acid residues require
nonpolar side chains, whereas few features of surface side chains
are generally conserved. Other such phenotypically silent
substitutions are described in Bowie et al., Science 247:1306 1310
(1990) (indicating that proteins are surprisingly tolerant of amino
acid substitutions), and the references cited therein.
Preferably, the polynucleotide fragments of the invention encode a
polypeptide which demonstrates a TR1 functional activity. By a
polypeptide demonstrating "functional activity" is meant, a
polypeptide capable of displaying one or more known functional
activities associated with a full-length TR1 polypeptide. Such
functional activities include, but are not limited to, biological
activity (e.g., inhibition of osteoclastogenesis; stimulation of
increased bone density; enhancement of B and T cell growth,
proliferation and/or differentiation; regulation of dendritic cell
function), antigenicity (ability to bind (or to compete with a TR1
polypeptide for binding) to an anti-TR1 antibody), immunogenicity
(ability to generate antibody which binds to a TR1 polypeptide),
and ability to bind to a receptor or ligand for a TR1 polypeptide
(e.g., TRANCE (Anderson et al., Nature 390:175 179 (1997); TRAIL
(Wiley, S. R., et al., Immunity 3:673 682(1995); and OPGL (Kong, Y.
Y., et al., Nature 397:315 323 (1999)).
The functional activity of TR1 polypeptides, and fragments,
variants derivatives, and analogs thereof, can be assayed by
various methods.
For example, in one embodiment where one is assaying for the
ability to bind or compete with full-length TR1 polypeptide for
binding to anti-TR1 antibody, various immunoassays known in the art
can be used, including but not limited to, competitive and
non-competitive assay systems using techniques such as
radioimmunoassays, ELISA (enzyme linked immunosorbent assay),
"sandwich" immunoassays, immunoradiometric assays, gel diffusion
precipitation reactions, immunodiffusion assays, in situ
immunoassays (using colloidal gold, enzyme or radioisotope labels,
for example), western blots, precipitation reactions, agglutination
assays (e.g., gel agglutination assays, hemagglutination assays),
complement fixation assays, immunofluorescence assays, protein A
assays, and immunoelectrophoresis assays, etc. In one embodiment,
antibody binding is detected by a labeled primary antibody. In
another embodiment, the primary antibody is detected by binding of
a secondary antibody or reagent to the primary antibody. In a
further embodiment, the secondary antibody is labeled. Many means
are known in the art for detecting binding in an immunoassay and
are within the scope of the present invention.
In another embodiment, where a TR1 ligand is identified (e.g.,
TRANCE (Anderson et al., Nature 390:175 179 (1997); TRAIL (Wiley,
S. R., et al., Immunity 3:673 682(1995); OPGL (Kong, Y. Y., et al.,
Nature 397:315 323 (1999)), or the ability of a polypeptide
fragment, variant or derivative of the invention to multimerize is
being evaluated, binding can be assayed by means well-known in the
art, such as: reducing and non-reducting gel chromatography,
protein affinity chromatography, and affinity blotting, for
example. See generally, Phizicky, E., et al., 1995, Microbiol. Rev.
59:94 123. In another embodiment, physiological correlates of TR1
binding to its substrates (signal transduction) can be assayed. In
addition, assays known in the art may routinely be applied to
measure the ability of TR1 polypeptides and fragments, variants
derivatives and analogs thereof to elicit TR1 related biological
activity in vitro or in vivo (e.g., inhibition of
osteoclastogenesis; stimulation of increased bone density;
enhancement of B and T cell growth, proliferation and/or
differentiation; regulation of dendritic cell function). Other
methods will be known to the skilled artisan and are within the
scope of the invention.
The deposit(s) referred to herein will be maintained under the
terms of the Budapest Treaty on the International Recognition of
the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn. 112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
TR1 Receptor Polypeptides and Fragments
The present invention further relates to a polypeptide which has
the deduced amino acid sequence of FIG. 1 (SEQ ID NO:2), FIG. 2
(SEQ ID NO:4), or which has the amino acid sequence encoded by the
deposited cDNA, as well as fragments, analogs and derivatives of
such a polypeptide.
The terms "fragment," "derivative" and "analog" when referring to
the polypeptide of FIG. 1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4), or
that encoded by the deposited cDNA, means a polypeptide which
retains essentially the same biological function or activity as
such a polypeptide. Thus, an analog includes a proprotein which can
be activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
The polypeptides of the present invention may be recombinant
polypeptides, natural polypeptides or synthetic polypeptides,
preferably recombinant polypeptides.
It will be recognized in the art that some amino acid sequences of
the TR1 receptor polypeptide can be varied without significant
effect on the structure or function of the protein. If such
differences in sequence are contemplated, it should be remembered
that there will be critical areas on the protein which determine
activity. In general, it is possible to replace residues which form
the tertiary structure, provided that residues performing a similar
function are used. In other instances, the type of residue may be
completely unimportant if the alteration occurs at a non-critical
region of the protein.
Thus, the invention further includes variations of the TR1 receptor
polypeptide which show substantial TR1 receptor polypeptide
activity or which include regions of TR1 receptor protein such as
the protein portions discussed below. Such mutants include
deletions, insertions, inversions, repeats, and type substitutions
(for example, substituting one hydrophilic residue for another, but
not substituting a strongly hydrophilic one for a strongly
hydrophobic one as a rule). Small changes or such "neutral" amino
acid substitutions will generally have little effect on
activity.
Typically seen as conservative substitutions are the replacements,
one for another, among the aliphatic amino acids Ala, Val, Leu and
Ile; interchange of the hydroxyl residues Ser and Thr, exchange of
the acidic residues Asp and Glu, substitution between the amide
residues Asn and Gin, exchange of the basic residues Lys and Arg
and replacements among the aromatic residues Phe, Tyr.
As indicated in detail above, further guidance concerning which
amino acid changes are likely to be phenotypically silent (i.e.,
are not likely to have a significant deleterious effect on a
function) can be found in Bowie et al, supra.
Thus, the fragment, derivative or analog of the polypeptide of FIG.
1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4), or that encoded by the
deposited cDNA may be (i) one in which one or more of the amino
acid residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid residue) and
such substituted amino acid residue may or may not be one encoded
by the genetic code, or (ii) one in which one or more of the amino
acid residues includes a substituent group, or (iii) one in which
the mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as an IgG Fc fusion
region peptide or leader or secretory sequence or a sequence which
is employed for purification of the mature polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein. Polynucleotides encoding these fragments,
derivatives or analogs are also encompassed by the invention.
Of particular interest are substitutions of charged amino acids
with another charged amino acid and with neutral or negatively
charged amino acids. The latter results in proteins with reduced
positive charge to improve the characteristics of the TR1 receptor
proteins. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they can be immunogenic. (Pinckard et al., Clin Exp.
Immunol. 2:331 340 (1967); Robbins et al., Diabetes 36:838 845
(1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307 377 (1993)).
The replacement of amino acids can also change the selectivity of
binding to cell surface receptors. Ostade et al., Nature 361:266
268 (1993) describes certain mutations resulting in selective
binding of TNF-.alpha. to only one of the two known types of TNF
receptors. Thus, the TR1 receptors of the present invention may
include one or more amino acid substitutions, deletions or
additions, either from natural mutations or human manipulation.
Changes are preferably of a minor nature, such as conservative
amino acid substitutions that do not significantly affect the
folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
Amino acids in the TR1 receptors of the present invention that are
essential for function can be identified by methods known in the
art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081 1085 (1989)).
The latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as receptor binding in vitro,
or in vitro proliferative activity. Sites that are critical for
ligand-receptor binding can also be determined by structural
analysis such as crystallization, nuclear magnetic resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899 904
(1992) and de Vos et al., Science 255:306 312 (1992)).
The polypeptides and polynucleotides of the present invention are
preferably provided in an isolated form, and preferably are
purified to homogeneity. A recombinantly produced version of the
TR1 receptor polypeptide can be substantially purified by the
one-step method described in Smith and Johnson, Gene 67:31 40
(1988).
The polypeptides of the present invention include the polypeptide
encoded by the deposited cDNA including the leader, the mature
polypeptide encoded by the deposited cDNA minus the leader (i.e.,
the mature protein), the polypeptide of FIG. 1 (SEQ ID NO:2) or
FIG. 2 (SEQ ID NO:4) including the leader, the polypeptide of FIG.
1 (SEQ ID NO:2) or FIG. 2 (SEQ ID NO:4) minus the leader, as well
as polypeptides which have at least 90% similarity, more preferably
at least 95% similarity, and still more preferably at least 96%,
97%, 98% or 99% similarity to those described above. Further
polypeptides of the present invention include polypeptides at least
80% identical or 85% identical, more preferably at least 90% or 92%
identical, still more preferably at least 95%, 96%, 97%, 98% or 99%
identical to the polypeptide encoded by the deposited cDNA, to the
polypeptide of FIG. 1 (SEQ ID NO:2), the polypeptide of FIG. 2 (SEQ
ID NO:4), and also include portions of such polypeptides with at
least 30 amino acids and more preferably at least 50 amino acids.
Such portions may include an additional N-terminal methionine
residue.
As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide. By "% similarity" for two polypeptides is
intended a similarity score produced by comparing the amino acid
sequences of the two polypeptides using the Bestfit program
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer Group, University Research Park, 575 Science Drive,
Madison, Wis. 53711) and the default settings for determining
similarity. Bestfit uses the local homology algorithm of Smith and
Waterman (Advances in Applied Mathematics 2:482 489, 1981) to find
the best segment of similarity between two sequences.
By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
TR1 receptor polypeptide is intended that the amino acid sequence
of the polypeptide is identical to the reference sequence except
that the polypeptide sequence may include up to five amino acid
alterations per each 100 amino acids of the reference sequence of
the TR1 receptor polypeptides of the present invention. In other
words, to obtain a polypeptide having an amino acid sequence at
least 95% identical to a reference amino acid sequence, up to 5% of
the amino acid residues in the reference sequence may be deleted or
substituted with another amino acid, or a number of amino acids up
to 5% of the total amino acid residues in the reference sequence
may be inserted into the reference sequence. These alterations of
the reference sequence may occur at the amino or carboxy terminal
positions of the reference amino acid sequence or anywhere between
those terminal positions, interspersed either individually among
residues in the reference sequence or in one or more contiguous
groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the amino acid sequence shown in FIG. 1 (SEQ ID
NO:2), FIG. 2 (SEQ ID NO:4), or the amino acid sequence encoded by
deposited cDNA clone can be determined conventionally using known
computer programs such as the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
When using Bestfit or any other sequence alignment program to
determine whether a particular sequence is, for instance, 95%
identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed.
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject
sequence, also referred to as a global sequence alignment, is
determined using the FASTDB computer program based on the algorithm
of Brutlag et al. (Comp. App. Biosci. 6:237 245 (1990)). Preferred
parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0,
k-tuple=2, Mismatch Penalty=1, Joining Penalty=20, Randomization
Group Length=0, Cutoff Score=1, Window Size=sequence length, Gap
Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of
the subject amino acid sequence, whichever is shorter.
According to this embodiment, if the subject sequence is shorter
than the query sequence due to N- or C-terminal deletions, not
because of internal deletions, a manual correction is made to the
results to take into consideration the fact that the FASTDB program
does not account for N- and C-terminal truncations of the subject
sequence when calculating global percent identity. For subject
sequences truncated at the N- and C-termini, relative to the query
sequence, the percent identity is corrected by calculating the
number of residues of the query sequence that are N- and C-terminal
of the subject sequence, which are not matched/aligned with a
corresponding subject residue, as a percent of the total bases of
the query sequence. A determination of whether a residue is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This final percent identity score is what is used for the purposes
of this embodiment.
Only residues to the N- and C-termini of the subject sequence,
which are not matched/aligned with the query sequence, are
considered for the purposes of manually adjusting the percent
identity score. That is, only query residue positions outside the
farthest N- and C-terminal residues of the subject sequence. For
example, a 90 amino acid residue subject sequence is aligned with a
100 residue query sequence to determine percent identity. The
deletion occurs at the N-terminus of the subject sequence and
therefore, the FASTDB alignment does not show a match/alignment of
the first 10 residues at the N-terminus. The 10 unpaired residues
represent 10% of the sequence (number of residues at the N- and
C-termini not matched/total number of residues in the query
sequence) so 10% is subtracted from the percent identity score
calculated by the FASTDB program. If the remaining 90 residues were
perfectly matched the final percent identity would be 90%.
In another example, a 90 amino acid residue subject sequence is
aligned with a 100 residue query sequence. This time the deletions
are internal deletions so there are no residues at the N- or
C-termini of the subject sequence which are not matched/aligned
with the query. In this case the percent identity calculated by
FASTDB is not manually corrected. Once again, only residue
positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
The polypeptides of the present invention have uses that include,
but are not limited to, as sources for generating antibodies that
bind the polypeptides of the invention, and as molecular weight
markers on SDS-PAGE gels or on molecular sieve gel filtration
columns using methods well known to those of skill in the art.
As described in detail below, the polypeptides of the present
invention can also be used to raise polyclonal and monoclonal
antibodies, which are useful in assays for detecting TR1 receptor
protein expression as described below or as agonists and
antagonists capable of enhancing or inhibiting TR1 receptor protein
function. Further, such polypeptides can be used in the yeast
two-hybrid system to "capture" TR1 receptor protein binding
proteins which are also candidate agonist and antagonist according
to the present invention. The yeast two hybrid system is described
in Fields and Song, Nature 340:245 246 (1989).
As indicated, the above described TR1 receptor polypeptides are
believed not to include a transmembrane domain. Thus, in an
additional embodiment, the present invention relates to the TR1
receptor polypeptides of the present invention having an amino acid
sequence further comprising a transmembrane domain. Such receptor
polypeptides may be native or constructed from the TR1 receptors
described herein according to recombinant techniques. Methods for
isolating a nucleotide sequence encoding a TR1 receptor that
contains a transmembrane domain include hybridizing nucleotide
probes constructed from the sequence provided in FIG. 1 (SEQ ID NO:
1) or FIG. 2 (SEQ ID NO:3) with a cDNA library obtained from one or
more of the above described tissue sources.
If produced recombinantly or synthetically, suitable sites for the
insertion of a transmembrane domain spanning amino acid sequence
will be apparent to one skilled in the art. The present inventors
have discovered that amino acid residues from about 22 to about
261, shown in FIG. 1 (SEQ ID NO:2), have considerable homology to
the extracellular domain of human TR1-RII (FIG. 3; SEQ ID NO:5).
Further, amino acid residues from about 262 to about 401, shown in
FIG. 1 (SEQ ID NO:2), have considerable homology to the
intracellular domain of human TR1-RII (FIG. 3; SEQ ID NO:5). Thus,
one skilled in the art would appreciate that between amino acid
residues 261 and 262 in either FIG. 1 (SEQ ID NO:2) or FIG. 2 (SEQ
ID NO:4) (or a site proximal--within about 1 10 amino
acids--thereto) would be a suitable site for the insertion of an
amino acid sequence comprising a transmembrane domain.
Polynucleotides encoding an amino acid sequence comprising a
transmembrane domain may be isolated from (or constructed from the
nucleotide sequence of) other TR1 receptor genes and inserted into
an appropriate site of the deposited clone by recombinant
techniques. Further, such domains may be synthetically constructed
and inserted into the soluble TR1 receptors of the present
invention. Insertion of such amino acid residues comprising a
transmembrane domain into a TR1 receptor of the present invention
would likely result in a non-soluble receptor that would integrate
into membranes. A specific example of a transmembrane domain useful
according to the present invention is the TNF-R2 transmembrane
domain shown at amino acid residues from about 258 to about 287 in
FIG. 3 (bottom sequence) (SEQ ID NO:5). Other such TR1 receptor
transmembrane domains will be apparent to the those skilled in the
art.
Epitopic Polypeptide Fragments
The present invention also encompasses polypeptides comprising, or
alternatively consisting of, an epitope of the polypeptide having
an amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4, or an epitope
of the polypeptide sequence encoded by a polynucleotide sequence
contained in deposited clone identified as ATCC Accession No.
75899, or encoded by a polynucleotide that hybridizes to the
complement of the sequence of SEQ ID NO: 1 or SEQ ID NO:3 or
contained in the deposited clone identified as ATCC Accession No.
75899 under stringent hybridization conditions or lower stringency
hybridization conditions as defined supra. The present invention
further encompasses polynucleotide sequences encoding an epitope of
a polypeptide sequence of the invention (such as, for e.g., the
sequence disclosed in SEQ ID NOS:1 and 3), polynucleotide sequences
of the complementary strand of a polynucleotide sequence encoding
an epitope of the invention, and polynucleotide sequences which
hybridize to the complementary strand under stringent hybridization
conditions or lower stringency hybridization conditions defined
supra.
The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl Acad. Sci. USA 81:3998 4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
Fragments that function as epitopes may be produced by any
conventional means known in the art (See, e.g., Houghten, Proc.
Natl Acad. Sci. USA 82:5131 5135 (1985), and further description in
U.S. Pat. No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a
sequence of at least 4, at least 5, at least 6, at least 7, more
preferably at least 8, at least 9, at least 10, at least 15, at
least 20, at least 25, and, most preferably, between about 15 to
about 30 amino acids. Preferred polypeptides comprising immunogenic
or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues
in length. Antigenic epitopes are useful, for example, to raise
antibodies, including monoclonal antibodies, that specifically bind
the epitope. Antigenic epitopes can be used as the target molecules
in immunoassays. See, for instance, Wilson et al., Cell 37:767 778
(1984); Sutcliffe et al., Science 219:660 666 (1983).
Similarly, immunogenic epitopes can be used, for example, to induce
antibodies according to methods well known in the art. (See, for
instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et
al., Proc. Natl Acad. Sci. USA 82:910 914 (1985); and Bittle et
al., J. Gen. Virol. 66:2347 2354 (1985)). A preferred immunogenic
epitope includes the secreted protein. The polypeptides comprising
one or more immunogenic epitopes may be presented for eliciting an
antibody response together with a carrier protein, such as an
albumin, to an animal system (such as, for example, rabbit or
mouse), or, if the polypeptide is of sufficient length (at least
about 25 amino acids), the polypeptide may be presented without a
carrier. However, immunogenic epitopes comprising as few as 8 to 10
amino acids have been shown to be sufficient to raise antibodies
capable of binding to, at the very least, linear epitopes in a
denatured polypeptide (e.g., in Western blotting).
Epitope-bearing polypeptides of the present invention may be used
to induce antibodies according to methods well known in the art
including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347 2354 (1985). If in vivo immunization is used,
animals may be immunized with free peptide; however, anti-peptide
antibody titer may be boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine residues
may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde. Animals such as, for example,
rabbits, rats, and mice are immunized with either free or
carrier-coupled peptides, for instance, by intraperitoneal and/or
intradermal injection of emulsions containing about 100 micrograms
of peptide or carrier protein and Freund's adjuvant or any other
adjuvant known for stimulating an immune response. Several booster
injections may be needed, for instance, at intervals of about two
weeks, to provide a useful titer of anti-peptide antibody that can
be detected, for example, by ELISA assay using free peptide
adsorbed to a solid surface. The titer of anti-peptide antibodies
in serum from an immunized animal may be increased by selection of
anti-peptide antibodies, for instance, by adsorption to the peptide
on a solid support and elution of the selected antibodies according
to methods well known in the art.
As one of skill in the art will appreciate, and as discussed above,
the polypeptides of the present invention comprising an immunogenic
or antigenic epitope can be fused to other polypeptide sequences.
For example, the polypeptides of the present invention may be fused
with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM),
or portions thereof (CH1, CH2, CH3, or any combination thereof and
portions thereof) resulting in chimeric polypeptides. Such fusion
proteins may facilitate purification and may increase half-life in
vivo. This has been shown for chimeric proteins consisting of the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins. See, e.g., EP 394,827; Traunecker et al., Nature,
331:84 86 (1988). IgG Fusion proteins that have a disulfide-linked
dimeric structure due to the IgG portion disulfide bonds have also
been found to be more efficient in binding and neutralizing other
molecules than monomeric polypeptides or fragments thereof alone.
See, e.g., Fountoulakis et al., J. Biochem., 270:3958 3964 (1995).
Nucleic acids encoding the above epitopes can also be recombined
with a gene of interest as an epitope tag (e.g., the hemagglutinin
("HA") tag or flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system described by Janknecht
et al. allows for the ready purification of non-denatured fusion
proteins expressed in human cell lines (Janknecht, R. et al., Proc.
Natl. Acad. Sci. USA 88:8972 8976 (1991). In this system, the gene
of interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag consisting of six histidine residues. The tag
serves as a matrix-binding domain for the fusion protein. Extracts
from cells infected with the recombinant vaccinia virus are loaded
onto Ni.sup.2+ nitriloacetic acid-agarose column and
histidine-tagged proteins can be selectively eluted with
imidazole-containing buffers.
Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Pattent et al., Curr. Opinion Biotechnol. 8:724 733
(1997); Harayama, Trends Biotechnol. 16:76 82 (1998); Hansson et
al., J. Mol. Biol. 287:265 276 (1999); and Lorenzo and Blasco,
Biotechniques 24:308 313 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety).
In one embodiment, alteration of polynucleotides corresponding to
SEQ ID NO:1 and the polypeptides encoded by these polynucleotides
may be achieved by DNA shuffling. DNA shuffling involves the
assembly of two or more DNA segments by homologous or site-specific
recombination to generate variation in the polynucleotide sequence.
In another embodiment, polynucleotides of the invention, or the
encoded polypeptides, may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or
other methods prior to recombination. In another embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc.,
of a polynucleotide coding a polypeptide of the invention may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules.
Non-limiting examples of antigenic polypeptides or peptides that
can be used to generate TR1 receptor-specific antibodies include: a
polypeptide comprising amino acid residues from about 20 to about
52 in FIG. 1 (SEQ ID NO:2) or FIG. 2 (SEQ ID NO:4); a polypeptide
comprising amino acid residues from about 66 to about 203 in FIG. 1
(SEQ ID NO:2) or FIG. 2 (SEQ ID NO:4); a polypeptide comprising
amino acid residues from about 229 to about 279 in FIG. 1 (SEQ ID
NO:2) or FIG. 2 (SEQ ID NO:4); a polypeptide comprising amino acid
residues from about 297 to about 378 in FIG. 1 (SEQ ID NO:2). As
indicated above, the inventors have determined that the above
polypeptide fragments are antigenic regions of the TR1 receptor
protein.
Immunogenic epitope-bearing peptides of the invention, i.e., those
parts of a protein that elicit an antibody response when the whole
protein is the immunogen, are identified according to methods known
in the art. For instance, Geysen et al., supra, discloses a
procedure for rapid concurrent synthesis on solid supports of
hundreds of peptides of sufficient purity to react in an
enzyme-linked immunosorbent assay. Interaction of synthesized
peptides with antibodies is then easily detected without removing
them from the support. In this manner a peptide bearing an
immunogenic epitope of a desired protein may be identified
routinely by one of ordinary skill in the art. For instance, the
immunologically important epitope in the coat protein of
foot-and-mouth disease virus was located by Geysen et al. with a
resolution of seven amino acids by synthesis of an overlapping set
of all 208 possible hexapeptides covering the entire 213 amino acid
sequence of the protein. Then, a complete replacement set of
peptides in which all 20 amino acids were substituted in turn at
every position within the epitope were synthesized, and the
particular amino acids conferring specificity for the reaction with
antibody were determined. Thus, peptide analogs of the
epitope-bearing peptides of the invention can be made routinely by
this method. U.S. Pat. No. 4,708,781 to Geysen (1987) further
describes this method of identifying a peptide bearing an
immunogenic epitope of a desired protein.
Further still, U.S. Pat. No. 5,194,392 to Geysen (1990) describes a
general method of detecting or determining the sequence of monomers
(amino acids or other compounds) which is a topological equivalent
of the epitope (i.e., a "mimotope") which is complementary to a
particular paratope (antigen binding site) of an antibody of
interest. More generally, U.S. Pat. No. 4,433,092 to Geysen (1989)
describes a method of detecting or determining a sequence of
monomers which is a topographical equivalent of a ligand which is
complementary to the ligand binding site of a particular receptor
of interest. Similarly, U.S. Pat. No. 5,480,971 to Houghten. et al.
(1996) on Peralkylated Oligopeptide Mixtures discloses linear
C.sub.1 C.sub.7-alkyl peralkylated oligopeptides and sets and
libraries of such peptides, as well as methods for using such
oligopeptide sets and libraries for determining the sequence of a
peralkylated oligopeptide that preferentially binds to an acceptor
molecule of interest. Thus, non-peptide analogs of the
epitope-bearing peptides of the invention also can be made
routinely by these methods.
Fragments or portions of the polypeptides of the present invention
may be employed for producing the corresponding full-length
polypeptide by peptide synthesis; therefore, the fragments may be
employed as intermediates for producing the full-length
polypeptides. Fragments or portions of the polynucleotides of the
present invention may be used to synthesize full-length
polynucleotides of the present invention.
The present invention is further directed to isolated polypeptides
comprising, or alternatively consisting of, fragments of TR1. In
particular, the invention provides isolated polypeptides
comprising, or alternatively consisting of, the amino acid
sequences of a member selected from the group consisting of amino
acids 1 60, 11 70, 21 80, 31 90, 41 100, 51 110, 61 120, 71 130, 81
140, 91 150, 101 160, 111 170, 121 180, 131 190, 141 200, 151 210,
161 220, 171 230, 181 240, 191 250, 201 260, 211 270, 221 280, 231
290, 241 300, 251 310, 261 320, 271 330, 281 340, 291 350, 301 360,
311 370, 321 380, 331 390, 341 400, and 351 401 of SEQ ID NO:2 or
SEQ ID NO:4, as well as isolated polynucleotides which encode these
polypeptides.
Among the especially preferred fragments of the invention are
fragments characterized by structural or functional attributes of
TR1. Such fragments include amino acid residues that comprise, or
alternatively consist of, one, two, three, four, or more of the
following functional domains: alpha-helix and alpha-helix forming
regions ("alpha-regions"), beta-sheet and beta-sheet-forming
regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"),
hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, surface forming regions, and
high antigenic index regions (i.e., containing four or more
contiguous amino acids having an antigenic index of greater than or
equal to 1.5, as identified using the default parameters of the
Jameson-Wolf program) of full-length TR1 (SEQ ID NO:2). Certain
preferred regions are those set out in FIG. 4 and include, but are
not limited to, regions of the aforementioned types identified by
analysis of the amino acid sequence depicted in FIG. 1 (SEQ ID
NO:2), such preferred regions include; Garnier-Robson predicted
alpha-regions, beta-regions, turn-regions, and coil-regions;
Chou-Fasman predicted alpha-regions, beta-regions, turn-regions,
and coil-regions; Kyte-Doolittle predicted hydrophilic and
hydrophobic regions; Eisenberg alpha and beta amphipathic regions;
Emini surface-forming regions; and Jameson-Wolf high antigenic
index regions, as predicted using the default parameters of these
computer programs. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
The data representing the structural or functional attributes of
TR1 set forth in FIG. 4 and/or Table 2, as described above, was
generated using the various identified modules and algorithms of
the DNA*STAR set on default parameters. In a preferred embodiment,
the data presented in columns VIII, IX, XIII, and XIV of Table 2
can be used to determine regions of TR1 which exhibit a high degree
of potential for antigenicity. Regions of high antigenicity are
determined from the data presented in columns VIII, IX, XIII,
and/or IV by choosing values which represent regions of the
polypeptide which are likely to be exposed on the surface of the
polypeptide in an environment in which antigen recognition may
occur in the process of initiation of an immune response.
Certain preferred regions in these regards are set out in FIG. 4,
but may, as shown in Table 2, respectively, be represented or
identified by using tabular representations of the data presented
in FIG. 4. The DNA*STAR computer algorithm used to generate FIG. 4
(set on the original default parameters) was used to present the
data in FIG. 4 in a tabular format (See Table 2). The tabular
format of the data in FIG. 4 may be used to easily determine
specific boundaries of a preferred region.
The above-mentioned preferred regions set out in FIG. 4 and in
Table 2 include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIG. 1. As set out in FIG. 4 and in Table 2,
such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions; Chou-Fasman
alpha-regions, beta-regions, and coil-regions; Kyte-Doolittle
hydrophilic regions and hydrophobic regions; Eisenberg alpha- and
beta-amphipathic regions; Karplus-Schulz flexible regions; Emini
surface-forming regions; and Jameson-Wolf regions of high antigenic
index.
The above-mentioned preferred regions set out in FIG. 4 and in
Table 2 include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIG. 1. As set out in FIG. 4 and in Table 2,
such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions (columns I, III, V,
and VII in Table 2), Chou-Fasman alpha-regions, beta-regions, and
turn-regions (columns I, II, IV, and VI in Table 2), Kyte-Doolittle
hydrophilic regions (column VIII in Table 2), Hopp-Woods
hydrophobic regions (column IX in Table 2), Eisenberg alpha- and
beta-amphipathic regions (columns X and XI in Table 2),
Karplus-Schulz flexible regions (column XII in Table 2),
Jameson-Wolf regions of high antigenic index (column XIII in Table
2), and Emini surface-forming regions (column XIV in Table 2).
The polypeptides of the present invention have uses that include,
but are not limited to: use as a molecular weight marker on
SDS-PAGE gels or on molecular sieve gel filtration columns using
methods well-known to those of skill in the art.
As mentioned above, even if deletion of one or more amino acids
from the N-terminus of a protein results in modification or loss of
one or more biological functions of the protein, other biological
activities may still be retained. Thus, the ability of shortened
TR1 muteins to induce and/or bind to antibodies which recognize the
complete or mature forms of the polypeptides generally will be
retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the N-terminus.
Whether a particular polypeptide lacking N-terminal residues of a
complete polypeptide retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an TR1 mutein
with a large number of deleted N-terminal amino acid residues may
retain some biological or immunogenic activities. In fact, peptides
composed of as few as six TR1 amino acid residues may often evoke
an immune response.
Accordingly, the present invention further provides polypeptides
having one or more residues deleted from the amino terminus of the
TR1 amino acid sequence shown in FIGS. 1 and 2 (i.e., SEQ ID NO:2
and 4, respectively), up to the valine residue at position number
396 and polynucleotides encoding such polypeptides. In particular,
the present invention provides polypeptides comprising the amino
acid sequence of residues n-401 of FIG. 1 (SEQ ID NO:2), where n is
an integer in the range of 2 to 396. The polypeptides having
N-terminal deletions may also include an N-terminal methionine
residue. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of a member selected from the group consisting of,
residues of N-2 to L-401; K-3 to L-401; L-4 to L-401; L-5 to L-401;
C-6 to L-401; C-7 to L-401; A-8 to L-401; L-9 to L-401; V-10 to
L-401; F-11 to L-401; L-12 to L-401; D-13 to L-401; L-14 to L-401;
S-15 to L-401; L-16 to L-401; K-17 to L-401; W-18 to L-401; T-19 to
L-401; T-20 to L-401; Q-21 to L-401; E-22 to L-401; T-23 to L-401;
F-24 to L-401; P-25 to L-401; P-26 to L-401; K-27 to L-401; Y-28 to
L-401; L-29 to L-401; H-30 to L-401; Y-31 to L-401; D-32 to L-401;
E-33 to L-401; E-34 to L-401; T-35 to L-401; S-36 to L-401; H-37 to
L-401; Q-38 to L-401; L-39 to L-401; L-40 to L-401; C-41 to L-401;
D-42 to L-401; K-43 to L-401; C-44 to L-401; P-45 to L-401; P-46 to
L-401; G-47 to L-401; T-48 to L-401; Y-49 to L-401; L-50 to L-401;
K-51 to L-401; Q-52 to L-401; H-53 to L-401; C-54 to L-401; T-55 to
L-401; A-56 to L-401; K-57 to L-401; W-58 to L-401; K-59 to L-401;
T-60 to L-401; V-61 to L-401; C-62 to L-401; A-63 to L-401; P-64 to
L-401; C-65 to L-401; P-66 to L-401; D-67 to L-401; H-68 to L-401;
Y-69 to L-401; Y-70 to L-401; T-71 to L-401; D-72 to L-401; S-73 to
L-401; W-74 to L-401; H-75 to L-401; T-76 to L-401; S-77 to L-401;
D-78 to L-401; E-79 to L-401; C-80 to L-401; L-81 to L-401; Y-82 to
L-401; C-83 to L-401; S-84 to L-401; P-85 to L-401; V-86 to L-401;
C-87 to L-401; K-88 to L-401; E-89 to L-401; L-90 to L-401; Q-91 to
L-401; Y-92 to L-401; V-93 to L-401; K-94 to L-401; Q-95 to L-401;
E-96 to L-401; C-97 to L-401; N-98 to L-401; R-99 to L-401; T-100
to L-401; H-101 to L-401; N-102 to L-401; R-103 to L-401; V-104 to
L-401; C-105 to L-401; E-106 to L-401; C-107 to L-401; K-108 to
L-401; E-109 to L-401; G-110 to L-401; R-111 to L-401; Y-112 to
L-401; L-113 to L-401; E-114 to L-401; I-115 to L-401; E-116 to
L-401; F-117 to L-401; C-118 to L-401; L-119 to L-401; K-120 to
L-401; H-121 to L-401; R-122 to L-401; S-123 to L-401; C-124 to
L-401; P-125 to L-401; P-126 to L-401; G-127 to L-401; F-128 to
L-401; G-129 to L-401; V-130 to L-401; V-131 to L-401; Q-132 to
L-401; A-133 to L-401; G-134 to L-401; T-135 to L-401; P-136 to
L-401; E-137 to L-401; R-138 to L-401; N-139 to L-401; T-140 to
L-401; V-141 to L-401; C-142 to L-401; K-143 to L-401; R-144 to
L-401; C-145 to L-401; P-146 to L-401; D-147 to L-401; G-148 to
L-401; F-149 to L-401; F-150 to L-401; S-151 to L-401; N-152 to
L-401; E-153 to L-401; T-154 to L-401; S-155 to L-401; S-156 to
L-401; K-157 to L-401; A-158 to L-401; P-159 to L-401; C-160 to
L-401; R-161 to L-401; K-162 to L-401; H-163 to L-401; T-164 to
L-401; N-165 to L-401; C-166 to L-401; S-167 to L-401; V-168 to
L-401; F-169 to L-401; G-170 to L-401; L-171 to L-401; L-172 to
L-401; L-173 to L-401; T-174 to L-401; Q-175 to L-401; K-176 to
L-401; G-177 to L-401; N-178 to L-401; A-179 to L-401; T-180 to
L-401; H-181 to L-401; D-182 to L-401; N-183 to L-401; I-184 to
L-401; C-185 to L-401; S-186 to L-401; G-187 to L-401; N-188 to
L-401; S-189 to L-401; E-190 to L-401; S-191 to L-401; T-192 to
L-401; Q-193 to L-401; K-194 to L-401; C-195 to L-401; G-196 to
L-401; L-197 to L-401; D-198 to L-401; V-199 to L-401; T-200 to
L-401; L-201 to L-401; C-202 to L-401; E-203 to L-401; E-204 to
L-401; A-205 to L-401; F-206 to L-401; F-207 to L-401; R-208 to
L-401; F-209 to L-401; A-210 to L-401; V-211 to L-401; P-212 to
L-401; T-213 to L-401; K-214 to L-401; F-215 to L-401; T-216 to
L-401; P-217 to L-401; N-218 to L-401; W-219 to L-401; L-220 to
L-401; S-221 to L-401; V-222 to L-401; L-223 to L-401; V-224 to
L-401; D-225 to L-401; N-226 to L-401; L-227 to L-401; P-228 to
L-401; G-229 to L-401; T-230 to L-401; K-231 to L-401; V-232 to
L-401; N-233 to L-401; A-234 to L-401; E-235 to L-401; S-236 to
L-401; V-237 to L-401; E-238 to L-401; R-239 to L-401; L-240 to
L-401; K-241 to L-401; R-242 to L-401; Q-243 to L-401; H-244 to
L-401; S-245 to L-401; S-246 to L-401; Q-247 to L-401; E-248 to
L-401; Q-249 to L-401; T-250 to L-401; F-251 to L-401; Q-252 to
L-401; L-253 to L-401; L-254 to L-401; K-255 to L-401; L-256 to
L-401; W-257 to L-401; K-258 to L-401; H-259 to L-401; Q-260 to
L-401; N-261 to L-401; K-262 to L-401; D-263 to L-401; Q-264 to
L-401; D-265 to L-401; L-266 to L-401; V-267 to L-401; K-268 to
L-401; K-269 to L-401; L-270 to L-401; L-271 to L-401; Q-272 to
L-401; D-273 to L-401; L-274 to L-401; D-275 to L-401; L-276 to
L-401; C-277 to L-401; E-278 to L-401; N-279 to L-401; S-280 to
L-401; V-281 to L-401; Q-282 to L-401; R-283 to L-401; H-284 to
L-401; L-285 to L-401; G-286 to L-401; H-287 to L-401; A-288 to
L-401; N-289 to L-401; L-290 to L-401; T-291 to L-401; F-292 to
L-401; E-293 to L-401; Q-294 to L-401; L-295 to L-401; R-296 to
L-401; S-297 to L-401; L-298 to L-401; M-299 to L-401; E-300 to
L-401; S-301 to L-401; L-302 to L-401; P-303 to L-401; G-304 to
L-401; K-305 to L-401; K-306 to L-401; V-307 to L-401; G-308 to
L-401; A-309 to L-401; E-310 to L-401; D-311 to L-401; L-312 to
L-401; E-313 to L-401; K-314 to L-401; T-315 to L-401; I-316 to
L-401; K-317 to L-401; A-318 to L-401; C-319 to L-401; K-320 to
L-401; P-321 to L-401; S-322 to L-401; D-323 to L-401; Q-324 to
L-401; L-325 to L-401; L-326 to L-401; K-327 to L-401; L-328 to
L-401; L-329 to L-401; S-330 to L-401; L-331 to L-401; W-332 to
L-401; R-333 to L-401; L-334 to L-401; K-335 to L-401; N-336 to
L-401; G-337 to L-401; D-338 to L-401; Q-339 to L-401; D-340 to
L-401; T-341 to L-401; L-342 to L-401; K-343 to L-401; G-344 to
L-401; L-345 to L-401; M-346 to L-401; H-347 to L-401; A-348 to
L-401; L-349 to L-401; K-350 to L-401; H-351 to L-401; S-352 to
L-401; K-353 to L-401; T-354 to L-401; Y-355 to L-401; H-356 to
L-401; F-357 to L-401; P-358 to L-401; K-359 to L-401; T-360 to
L-401; V-361 to L-401; T-362 to L-401; Q-363 to L-401; S-364 to
L-401; L-365 to L-401; K-366 to L-401; K-367 to L-401; T-368 to
L-401; L-369 to L-401; R-370 to L-401; F-371 to L-401; L-372 to
L-401; H-373 to L-401; S-374 to L-401; F-375 to L-401; T-376 to
L-401; M-377 to L-401; Y-378 to L-401; K-379 to L-401; L-380 to
L-401; Y-381 to L-401; Q-382 to L-401; K-383 to L-401; L-384 to
L-401; F-385 to L-401; L-386 to L-401; E-387 to L-401; M-388 to
L-401; L-389 to L-401; G-390 to L-401; N-391 to L-401; Q-392 to
L-401; V-393 to L-401; Q-394 to L-401; S-395 to L-401; and V-396 to
L-401 of the TR1 sequence shown in FIG. 1 (which is identical to
the sequence shown as SEQ ID NO:2, with the exception that the
amino acid residues in FIG. 1 are numbered consecutively from 1
through 401 from the N-terminus to the C-terminus, while the amino
acid residues in SEQ ID NO:2 are numbered consecutively from -21
through 380 to reflect the position of the predicted signal
peptide). The polypeptides having N-terminal deletions may also
include an N-terminal methionine residue.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide
sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%
identical to the polynucleotide sequences encoding the polypeptides
described above. The present invention also encompasses the above
polynucleotide sequences fused to a heterologous polynucleotide
sequence. Polypeptides encoded by these polynucleotide sequences
are also encompassed by the invention.
In a preferred embodiment, polypeptides of the invention include
TR1 polypeptides having a deletion of amino acids M-1 to Q-21 in
FIG. 1. In other words, polypeptides of the invention include
fragments having the amino acid sequence of E-22 to m, where m is
an an integer in the range of 28 to 401. Fragments beginning at
E-22 may also include an N-terminal methionine, thus having the
sequence METFPPK- to 401.
Also as mentioned above, even if deletion of one or more amino
acids from the C-terminus of a protein results in modification or
loss of one or more biological functions of the protein, other
biological activities may still be retained. Thus, the ability of
the shortened TR1 mutein to induce and/or bind to antibodies which
recognize the complete or mature forms of the polypeptide generally
will be retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the C-terminus.
Whether a particular polypeptide lacking C-terminal residues of a
complete polypeptide retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an TR1 mutein
with a large number of deleted C-terminal amino acid residues may
retain some biological or immunogenic activities. In fact, peptides
composed of as few as six TR1 amino acid residues may often evoke
an immune response.
Accordingly, the present invention further provides polypeptides
having one or more residues deleted from the carboxy terminus of
the amino acid sequence of the TR1 polypeptide shown in FIG. 1 (SEQ
ID NO:2), up to the cysteine residue at position number 6, and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising the amino acid
sequence of residues 1-m of FIG. 1 (i.e., SEQ ID NO:2), where m is
an integer in the range of 6 to 400.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of a member selected from the group consisting of
residues M-1 to C-400; M-1 to S-399; M-1 to I-398; M-1 to K-397;
M-1 to V-396; M-1 to S-395; M-1 to Q-394; M-1 to V-393; M-1 to
Q-392; M-1 to N-391; M-1 to G-390; M-1 to I-389; M-1 to M-388; M-1
to E-387; M-1 to L-386; M-1 to F-385; M-1 to L-384; M-1 to K-383;
M-1 to Q-382; M-1 to Y-381; M-1 to L-380; M-1 to K-379; M-1 to
Y-378; M-1 to M-377; M-1 to T-376; M-1 to F-375; M-1 to S-374; M-1
to H-373; M-1 to L-372; M-1 to F-371; M-1 to R-370; M-1 to I-369;
M-1 to T-368; M-1 to K-367; M-1 to K-366; M-1 to L-365; M-1 to
S-364; M-1 to Q-363; M-1 to T-362; M-1 to V-361; M-1 to T-360; M-1
to K-359; M-1 to P-358; M-1 to F-357; M-1 to H-356; M-1 to Y-355;
M-1 to T-354; M-1 to K-353; M-1 to S-352; M-1 to H-351; M-1 to
K-350; M-1 to L-349; M-1 to A-348; M-1 to H-347; M-1 to M-346; M-1
to L-345; M-1 to G-344; M-1 to K-343; M-1 to L-342; M-1 to T-341;
M-1 to D-340; M-1 to Q-339; M-1 to D-338; M-1 to G-337; M-1 to
N-336; M-1 to K-335; M-1 to I-334; M-1 to R-333; M-1 to W-332; M-1
to L-331; M-1 to S-330; M-1 to L-329; M-1 to L-328; M-1 to K-327;
M-1 to L-326; M-1 to I-325; M-1 to Q-324; M-1 to D-323; M-1 to
S-322; M-1 to P-321; M-1 to K-320; M-1 to C-319; M-1 to A-318; M-1
to K-317; M-1 to I-316; M-1 to T-315; M-1 to K-314; M-1 to E-313;
M-1 to I-312; M-1 to D-311; M-1 to E-310; M-1 to A-309; M-1 to
G-308; M-1 to V-307; M-1 to K-306; M-1 to K-305; M-1 to G-304; M-1
to P-303; M-1 to L-302; M-1 to S-301; M-1 to E-300; M-1 to M-299;
M-1 to L-298; M-1 to S-297; M-1 to R-296; M-1 to L-295; M-1 to
Q-294; M-1 to E-293; M-1 to F-292; M-1 to T-291; M-1 to L-290; M-1
to N-289; M-1 to A-288; M-1 to H-287; M-1 to G-286; M-1 to I-285;
M-1 to H-284; M-1 to R-283; M-1 to Q-282; M-1 to V-281; M-1 to
S-280; M-1 to N-279; M-1 to E-278; M-1 to C-277; M-1 to L-276; M-1
to D-275; M-1 to I-274; M-1 to D-273; M-1 to Q-272; M-1 to I-271;
M-1 to I-270; M-1 to K-269; M-1 to K-268; M-1 to V-267; M-1 to
I-266; M-1 to D-265; M-1 to Q-264; M-1 to D-263; M-1 to K-262; M-1
to N-261; M-1 to Q-260; M-1 to H-259; M-1 to K-258; M-1 to W-257;
M-1 to L-256; M-1 to K-255; M-1 to L-254; M-1 to L-253; M-1 to
Q-252; M-1 to F-251; M-1 to T-250; M-1 to Q-249; M-1 to E-248; M-1
to Q-247; M-1 to S-246; M-1 to S-245; M-1 to H-244; M-1 to Q-243;
M-1 to R-242; M-1 to K-241; M-1 to I-240; M-1 to R-239; M-1 to
E-238; M-1 to V-237; M-1 to S-236; M-1 to E-235; M-1 to A-234; M-1
to N-233; M-1 to V-232; M-1 to K-231; M-1 to T-230; M-1 to G-229;
M-1 to P-228; M-1 to L-227; M-1 to N-226; M-1 to D-225; M-1 to
V-224; M-1 to L-223; M-1 to V-222; M-1 to S-221; M-1 to L-220; M-1
to W-219; M-1 to N-218; M-1 to P-217; M-1 to T-216; M-1 to F-215;
M-1 to K-214; M-1 to T-213; M-1 to P-212; M-1 to V-211; M-1 to
A-210; M-1 to F-209; M-1 to R-208; M-1 to F-207; M-1 to F-206; M-1
to A-205; M-1 to E-204; M-1 to E-203; M-1 to C-202; M-1 to L-201;
M-1 to T-200; M-1 to V-199; M-1 to D-198; M-1 to I-197; M-1 to
G-196; M-1 to C-195; M-1 to K-194; M-1 to Q-193; M-1 to T-192; M-1
to S-[91; M-1 to E-190; M-1 to S-189; M-1 to N-188; M-1 to G-187;
M-1 to S-186; M-1 to C-185; M-1 to I-184; M-1 to N-183; M-1 to
D-182; M-1 to H-181; M-1 to T-180; M-1 to A-179; M-1 to N-178; M-1
to G-177; M-1 to K-176; M-1 to Q-175; M-1 to T-174; M-1 to L-173;
M-1 to L-172; M-1 to L-171; M-1 to G-170; M-1 to F-169; M-1 to
V-168; M-1 to S-167; M-1 to C-166; M-1 to N-165; M-1 to T-164; M-1
to H-163; M-1 to K-162; M-1 to R-161; M-1 to C-160; M-1 to P-159;
M-1 to A-158; M-1 to K-157; M-1 to S-156; M-1 to S-155; M-1 to
T-154; M-1 to E-153; M-1 to N-152; M-1 to S-151; M-1 to F-150; M-1
to F-149; M-1 to G-]48; M-1 to D-147; M-1 to P-146; M-1 to C-145;
M-1 to R-144; M-1 to K-143; M-1 to C-142; M-1 to V-141; M-1 to
T-140; M-1 to N-139; M-1 to R-138; M-1 to E-137; M-1 to P-136; M-1
to T-135; M-1 to G-134; M-1 to A-133; M-1 to Q-132; M-1 to V-131;
M-1 to V-130; M-1 to G-129; M-1 to F-128; M-1 to G-127; M-1 to
P-126; M-1 to P-125; M-1 to C-124; M-1 to S-123; M-1 to R-122; M-1
to H-121; M-1 to K-120; M-1 to L-119; M-1 to C-118; M-1 to F-117;
M-1 to E-116; M-1 to I-115; M-1 to E-114; M-1 to L-113; M-1 to
Y-112; M-1 to R-111; M-1 to G-110; M-1 to E-109; M-1 to K-108; M-1
to C-107; M-1 to E-106; M-1 to C-105; M-1 to V-104; M-1 to R-103;
M-1 to N-102; M-1 to H-101; M-1 to T-100; M-1 to R-99; M-1 to N-98;
M-1 to C-97; M-1 to E-96; M-1 to Q-95; M-1 to K-94; M-1 to V-93;
M-1 to Y-92; M-1 to Q-91; M-1 to L-90; M-1 to E-89; M-1 to K-88;
M-1 to C-87; M-1 to V-86; M-1 to P-85; M-1 to S-84; M-1 to C-83;
M-1 to Y-82; M-1 to L-81; M-1 to C-80; M-1 to E-79; M-1 to D-78;
M-1 to S-77; M-1 to T-76; M-1 to H-75; M-1 to W-74; M-1 to S-73;
M-1 to D-72; M-1 to T-71; M-1 to Y-70; M-1 to Y-69; M-1 to H-68;
M-1 to D-67; M-1 to P-66; M-1 to C-65; M-1 to P-64; M-1 to A-63;
M-1 to C-62; M-1 to V-61; M-1 to T-60; M-1 to K-59; M-1 to W-58;
M-1 to K-57; M-1 to A-56; M-1 to T-55; M-1 to C-54; M-1 to H-53;
M-1 to Q-52; M-1 to K-51; M-1 to L-50; M-1 to Y-49; M-1 to T-48;
M-1 to G-47; M-1 to P-46; M-1 to P-45; M-1 to C-44; M-1 to K-43;
M-1 to D-42; M-1 to C-41; M-1 to L-40; M-1 to L-39; M-1 to Q-38;
M-1 to H-37; M-1 to S-36; M-1 to T-35; M-1 to E-34; M-1 to E-33;
M-1 to D-32; M-1 to Y-31; M-1 to H-30; M-1 to L-29; M-1 to Y-28;
M-1 to K-27; M-1 to P-26; M-1 to P-25; M-1 to F-24; M-1 to T-23;
M-1 to E-22; M-1 to Q-21; M-1 to T-20; M-1 to T-19; M-1 to W-18;
M-1 to K-17; M-1 to I-16; M-1 to S-15; M-1 to I-14; M-1 to D-13;
M-1 to L-12; M-1 to F-11; M-1 to V-10; M-1 to L-9; M-1 to A-8; M-1
to C-7; and M-1 to C-6 of the sequence of the TR1 sequence shown in
FIG. 1 (which is identical to the sequence shown as SEQ ID NO:2,
with the exception that the amino acid residues in FIG. 1 are
numbered consecutively from 1 through 401 from the N-terminus to
the C-terminus, while the amino acid residues in SEQ ID NO:2 are
numbered consecutively from -21 through 380 to reflect the position
of the predicted signal peptide).
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide
sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%
identical to the polynucleotide sequences encoding the polypeptides
described above. The present invention also encompasses the above
polynucleotide sequences fused to a heterologous polynucleotide
sequence. Polypeptides encoded by these polynucleotide sequences
are also encompassed by the invention.
The invention also provides polypeptides having one or more amino
acids deleted from both the amino and the carboxyl termini of an
TR1 polypeptide, which may be described generally as having
residues n-m of FIG. 1 (i.e., SEQ ID NO:2), where n and m are
integers as described above. The polypeptides having N- and
C-terminal deletions may also include an N-terminal methionine
residue.
In certain preferred embodiments, TR1 polypeptides of the invention
comprise fusion proteins as described above wherein the TR1
polypeptides are those described as n-m herein. In preferred
embodiments, the application is directed to nucleic acid molecules
at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic
acid sequences encoding polypeptides having the amino acid sequence
of the specific N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
The TR1 polypeptides of the invention may be in monomers or
multimers (i.e., dimers, trimers, tetramers and higher multimers).
Accordingly, the present invention relates to monomers and
multimers of the TR1 polypeptides of the invention, their
preparation, and compositions (preferably pharmaceutical
compositions) containing them. In specific embodiments, the
polypeptides of the invention are monomers, dimers, trimers or
tetramers. In additional embodiments, the multimers of the
invention are at least dimers, at least trimers, or at least
tetramers.
Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only TR1 polypeptides of the invention (including TR1
fragments, variants, and fusion proteins, as described herein).
These homomers may contain TR1 polypeptides having identical or
different amino acid sequences. In a specific embodiment, a homomer
of the invention is a multimer containing only TR1 polypeptides
having an identical amino acid sequence. In another specific
embodiment, a homomer of the invention is a multimer containing TR1
polypeptides having different amino acid sequences. In specific
embodiments, the multimer of the invention is a homodimer (e.g.,
containing TR1 polypeptides having identical or different amino
acid sequences) or a homotrimer (e.g., containing TR1 polypeptides
having identical or different amino acid sequences). In additional
embodiments, the homomeric multimer of the invention is at least a
homodimer, at least a homotrimer, or at least a homotetramer.
As used herein, the term heteromer refers to a multimer containing
heterologous polypeptides (i.e., polypeptides of a different
protein) in addition to the TR1 polypeptides of the invention. In a
specific embodiment, the multimer of the invention is a
heterodimer, a heterotrimer, or a heterotetramer. In additional
embodiments, the heteromeric multimer of the invention is at least
a heterodimer, at least a heterotrimer, or at least a
heterotetramer.
Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, for example, by liposome formation. Thus, in one
embodiment, multimers of the invention such as, for example,
homodimers or homotrimers, are formed when polypeptides of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention such as, for example,
heterotrimers or heterotetramers, are formed when polypeptides of
the invention contact antibodies to the polypeptides of the
invention (including antibodies to the heterologous polypeptide
sequence in a fusion protein of the invention) in solution. In
other embodiments, multimers of the invention are formed by
covalent associations with and/or between the TR1 polypeptides of
the invention. Such covalent associations may involve one or more
amino acid residues contained in the polypeptide sequence (e.g.,
that recited in SEQ If) NO:2 or SEQ ID NO:4, or that encoded by the
deposited clone). In one instance, the covalent associations are
cross-links between cysteine residues which interact in the native
(i.e., naturally occurring) polypeptide. In another instance, the
covalent associations are the consequence of chemical or
recombinant manipulation. Alternatively, such covalent associations
may involve one or more amino acid residues contained in the
heterologous polypeptide sequence in a TR1 fusion protein. In one
example, covalent associations are between the heterologous
sequence contained in a fusion protein of the invention (see, e.g.,
U.S. Pat. No. 5,478,925). In a specific example, the covalent
associations are between the heterologous sequence contained in a
TR1-Fc fusion protein of the invention (as described herein). In
another specific example, covalent associations of fusion proteins
of the invention are between heterologous polypeptide sequence from
another TNF family ligand/receptor member that is capable of
forming covalently associated multimers, such as for example,
oseteoprotegerin (see, e.g., International Publication No. WO
98/49305, the contents of which are herein incorporated by
reference in its entirety).
The multimers of the invention may be generated using chemical
techniques known in the art. For example, polypeptides desired to
be contained in the multimers of the invention may be chemically
cross-linked using linker molecules and linker molecule length
optimization techniques known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the sequence of the polypeptides desired to be contained in
the multimer (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Further, polypeptides
of the invention may be routinely modified by the addition of
cysteine or biotin to the C-terminus or N-terminus of the
polypeptide and techniques known in the art may be applied to
generate multimers containing one or more of these modified
polypeptides (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the polypeptide components desired to be contained in
the multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
Alternatively, multimers of the invention may be generated using
genetic engineering techniques known in the art. In one embodiment,
polypeptides contained in multimers of the invention are produced
recombinantly using fusion protein technology described herein or
otherwise known in the art (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety). In a
specific embodiment, polynucleotides coding for a homodimer of the
invention are generated by ligating a polynucleotide sequence
encoding a polypeptide of the invention to a sequence encoding a
linker polypeptide and then further to a synthetic polynucleotide
encoding the translated product of the polypeptide in the reverse
orientation from the original C-terminus to the N-terminus (lacking
the leader sequence) (see, e.g., U.S. Pat. No. 5,478,925, which is
herein incorporated by reference in its entirety). In another
embodiment, recombinant techniques described herein or otherwise
known in the art are applied to generate recombinant polypeptides
of the invention which contain a transmembrane domain and which can
be incorporated by membrane reconstitution techniques into
liposomes (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety).
In addition, polypeptides of the invention can be chemically
synthesized using techniques known in the art (e.g., see,
Creighton, 1983, Proteins: Structures and Molecular Principles,
W.H. Freeman & Co., N.Y.; and Hunkapiller, M., et al., 1984,
Nature 310:105 111). For example, a peptide corresponding to a
fragment of the TR1 polypeptides of the invention can be
synthesized by use of a peptide synthesizer. Furthermore, if
desired, nonclassical amino acids or chemical amino acid analogs
can be introduced as a substitution or addition into the TR1
polynucleotide sequence. Non-classical amino acids include, but are
not limited to, the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
The invention encompasses TR1 polypeptides which are differentially
modified during or after translation, e.g., by glycosylation,
acetylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to an
antibody molecule or other cellular ligand, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including but not limited, to specific chemical cleavage by
cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease,
NaBH.sub.4; acetylation, formylation, oxidation, reduction;
metabolic synthesis in the presence of tunicamycin; etc.
Additional post-translational modifications encompassed by the
invention include, for example, N-linked or O-linked carbohydrate
chains, processing of N- or C-termini, attachment of chemical
moieties to the amino acid backbone, chemical modifications of
N-linked or O-linked carbohydrate chains, and addition or deletion
of an N-terminal methionine residue as a result of procaryotic host
cell expression. The polypeptides may also be modified with a
detectable label, such as an enzymatic, fluorescent, isotopic or
affinity label, to allow for detection and isolation of the
protein.
Also provided by the invention are chemically modified derivatives
of TR1 which may provide additional advantages such as increased
solubility, stability and circulating time of the polypeptide, or
decreased immunogenicity (see U.S. Pat. No. 4,179,337). The
chemical moieties for derivitization may be selected from water
soluble polymers such as polyethylene glycol, ethylene
glycol/propylene glycol copolymers, carboxymethylcellulose,
dextran, polyvinyl alcohol and the like. The polypeptides may be
modified at random positions within the molecule, or at
predetermined positions within the molecule and may include one,
two, three or more attached chemical moieties.
The polymer may be of any molecular weight, and may be branched or
unbranched. For polyethylene glycol, the preferred molecular weight
is between about 1 kDa and about 100 kDa (the term "about"
indicating that in preparations of polyethylene glycol, some
molecules will weigh more, some less, than the stated molecular
weight) for ease in handling and manufacturing. Other sizes may be
used, depending on the desired therapeutic profile (e.g., the
duration of sustained release desired, the effects, if any on
biological activity, the ease in handling, the degree or lack of
antigenicity and other known effects of polyethylene glycol to a
therapeutic protein or analog). For example, the polyethylene
glycol may have an average molecular weight of about 200, 500,
1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000,
6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000,
11,500, 12,000,12,500, 13,000, 13,500, 14,000, 14,500, 15,000,
15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000,
19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000,
60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or
100,000 kDa.
As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol. 56:59 72 (1996); Vorobjev et al., Nucleosides
Nucleotides 18:2745 2750 (1999); and Caliceti et al., Bioconjug.
Chem. 10:638 646 (1999), the disclosures of each of which are
incorporated herein by reference.
The polyethylene glycol molecules (or other chemical moieties)
should be attached to the protein with consideration of effects on
functional or antigenic domains of the protein. There are a number
of attachment methods available to those skilled in the art. See,
e.g., EP 0 401 384, (coupling PEG to G-CSF) (herein incorporated by
reference); Malik et al., Exp. Hematol. 20:1028 1035 (1992)
(reporting pegylation of GM-CSF using tresyl chloride). For
example, polyethylene glycol may be covalently bound to amino acid
residues via a reactive group, such as, a free amino or carboxyl
group. Reactive groups are those to which an activated polyethylene
glycol molecule may be bound. The amino acid residues having a free
amino group may include lysine residues and the N-terminal amino
acid residues; those having a free carboxyl group may include
aspartic acid residues, glutamic acid residues and the C-terminal
amino acid residue. Sulfhydryl groups may also be used as a
reactive group for attaching polyethylene glycol molecules.
Preferred for therapeutic purposes is attachment at an amino group,
such as attachment at the N-terminus or at a lysine group.
As suggested above, polyethylene glycol may be attached to proteins
via linkage to any of a number of amino acid residues. For example,
polyethylene glycol can be linked to a proteins via covalent bonds
to lysine, histidine, aspartic acid, glutamic acid, or cysteine
residues. One or more reaction chemistries may be employed to
attach polyethylene glycol to specific amino acid residues (e.g.,
lysine, histidine, aspartic acid, glutamic acid, or cysteine) of
the protein or to more than one type of amino acid residue (e.g.,
lysine, histidine, aspartic acid, glutamic acid, cysteine and
combinations thereof) of the protein.
One may specifically desire proteins chemically modified at the
N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecule types (by molecular weight, branching, etc.), a
range of proportions of polyethylene glycol molecules to protein
(or peptide) molecules in the reaction mix, types of pegylation
reactions, and methods of obtaining the desired N-terminally
pegylated protein. The method of obtaining the N-terminally
pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if necessary) may be by purification of the
N-terminally pegylated material from a population of pegylated
protein molecules. N-terminal modification may be accomplished by
reductive alkylation which exploits differential reactivity of
different types of primary amino groups (on lysine versus at the
N-terminus) available for derivatization in a particular protein.
Under the appropriate reaction conditions, substantially selective
derivatization at the N-terminus with a carbonyl group-containing
polymer is achieved.
As indicated above, pegylation of the proteins of the invention may
be accomplished by any number of means. For example, polyethylene
glycol may be attached to the protein either directly or by an
intervening linker. Linkerless systems for attaching polyethylene
glycol to proteins are described in Delgado et al., Crit. Rev.
Thera. Drug Carrier Sys. 9:249 304 (1992); Francis et al., Intern.
J. of Hematol 68:1 18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat.
No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of
each of which are incorporated herein by reference.
One system for attaching polyethylene glycol directly to amino acid
residues of proteins without an intervening linker employs
tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the protein. Thus, the invention includes
protein-polyethylene glycol conjugates produced by reacting
proteins of the invention with a polyethylene glycol molecule
having a 2,2,2-trifluoreothane sulphonyl group.
Polyethylene glycol can also be attached to proteins using a number
of different intervening linkers. For example, U.S. Pat. No.
5,612,460, the entire disclosure of which is incorporated herein by
reference, discloses urethane linkers for connecting polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein
the polyethylene glycol is attached to the protein by a linker can
also be produced by reaction of proteins with compounds such as
MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of
which is incorporated herein by reference. Pegylated protein
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
The number of polyethylene glycol moieties attached to each protein
of the invention (i.e., the degree of substitution) may also vary.
For example, the pegylated proteins of the invention may be linked,
on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or
more polyethylene glycol molecules. Similarly, the average degree
of substitution within ranges such as 1 3, 2 4, 3 5, 4 6, 5 7, 6 8,
7 9, 8 10, 9 11, 10 12, 11 13, 12 14, 13 15, 14 16, 15 17, 16 18,
17 19, or 18 20 polyethylene glycol moieties per protein molecule.
Methods for determining the degree of substitution are discussed,
for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys.
9:249 304 (1992).
The entire disclosure of each document cited in this section on
"TR1 Receptor Polypeptides and Fragments" is hereby incorporated
herein by reference.
Vectors and Host Cells
The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
Host cells are genetically engineered (transduced, transformed or
transfected) with the vectors of this invention which may be, for
example, a cloning vector or an expression vector. The vector may
be, for example, in the form of a plasmid, a viral particle, a
phage, etc. The engineered host cells can be cultured in
conventional nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the nucleic acid
sequences of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for
producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a
variety of procedures. In general, the DNA sequence is inserted
into an appropriate restriction endonuclease site(s) by procedures
known in the art. Such procedures and others are deemed to be
within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to
an appropriate expression control sequence(s) (promoter) to direct
mRNA synthesis. As representative examples of such promoters, there
may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp,
the phage lambda P.sub.L promoter and other promoters known to
control expression of genes in prokaryotic or eukaryotic cells or
their viruses. The expression vector also contains a ribosome
binding site for translation initiation and a transcription
terminator. The vector may also include appropriate sequences for
amplifying expression.
In addition, the expression vectors preferably contain one or more
selectable marker genes to provide a phenotypic trait for selection
of transformed host cells such as dihydrofolate reductase or
neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove
described, as well as an appropriate promoter or control sequence,
may be employed to transform an appropriate host to permit the host
to express the protein.
As representative examples of appropriate hosts, there may be
mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant
constructs comprising one or more of the sequences as broadly
described above. The constructs comprise a vector, such as a
plasmid or viral vector, into which a sequence of the invention has
been inserted, in a forward or reverse orientation. In a preferred
aspect of this embodiment, the construct further comprises
regulatory sequences, including, for example, a promoter, operably
linked to the sequence. Large numbers of suitable vectors and
promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pHE4, pBS,
pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a,
pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540,
pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lac, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-1. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
In a further embodiment, the present invention relates to host
cells containing the above-described constructs. The host cell can
be a higher eukaryotic cell, such as a mammalian cell, or a lower
eukaryotic cell, such as a yeast cell, or the host cell can be a
prokaryotic cell, such as a bacterial cell. Introduction of the
construct into the host cell can be effected by calcium phosphate
transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional manner
to produce the gene product encoded by the recombinant sequence.
Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present
invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
Generally, recombinant expression vectors will include origins of
replication and selectable markers permitting transformation of the
host cell, e.g., the ampicillin resistance gene of E. coli and S.
cerevisiae TRP1 gene, and a promoter derived from a
highly-expressed gene to direct transcription of a downstream
structural sequence. Such promoters can be derived from operons
encoding glycolytic enzymes such as 3-phosphoglycerate kinase
(PGK), .alpha.-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by
inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression
vectors for bacterial use can comprise a selectable marker and
bacterial origin of replication derived from commercially available
plasmids comprising genetic elements of the well known cloning
vector pBR322 (ATCC 37017). Such commercial vectors include, for
example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and
GEM1 (Promega Biotec, Madison, Wis., USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and growth of
the host strain to an appropriate cell density, the selected
promoter is induced by appropriate means (e.g., temperature shift
or chemical induction) and cells are cultured for an additional
period.
Cells are typically harvested by centrifugation, disrupted by
physical or chemical means, and the resulting crude extract
retained for further purification.
Microbial cells employed in expression of proteins can be disrupted
by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
Various mammalian cell culture systems can also be employed to
express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
The polypeptide of the present invention can be recovered and
purified from recombinant cell cultures by methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
For secretion of the translated protein into the lumen of the
endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. The signals may be
endogenous to the polypeptide or they may be heterologous
signals.
The polypeptide may be expressed in a modified form, such as a
fusion protein, and may include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
may be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine
techniques in the art. A preferred fusion protein comprises a
heterologous region from immunoglobulin that is useful to
solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in a fusion protein is thoroughly advantageous for use in therapy
and diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, hIL5- has been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, Bennett et al., Journal of Molecular Recognition, 8:52 58
(1995) and Johanson et al., The Journal of Biological Chemistry,
270:9459 9471 (1995).
The TR1 receptor protein can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Polypeptides of the present invention
include naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., TR1 coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with TR1
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous TR1 polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous TR1 polynucleotide sequences via homologous
recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication No. WO 96/29411, published Sep. 26,
1996; International Publication No. WO 94/12650, published Aug. 4,
1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932 8935
(1989); and Zijlstra et al., Nature 342:435 438 (1989), the
disclosures of each of which are incorporated by reference in their
entireties).
TR1 Receptor: Use for Detection of Disease States
The inventors have shown that the TR1 receptor of the present
invention binds both TNF-.alpha. and TNF-.beta. but has a higher
affinity for TNF-.beta.. See FIG. 7. TNF-.beta., a potent ligand of
the TNF receptor proteins, is known to be involved in a number of
biological processes including lymphocyte development, tumor
necrosis, induction of an antiviral state, activation of
polymorphonuclear leukocytes, induction of class I major
histocompatibility complex antigens on endothelial cells, induction
of adhesion molecules on endothelium and growth hormone stimulation
(Ruddle and Homer, Prog. Allergy, 40:162 182 (1988)). TNF-.alpha.,
also a ligand of the TR1 receptors of the present invention, has
been reported to have a role in the rapid necrosis of tumors,
immunostimulation, autoimmune disease, graft rejection, producing
an anti-viral response, septic shock, cerebral malaria,
cytotoxicity, protection against deleterious effects of ionizing
radiation produced during a course of chemotherapy, such as
denaturation of enzymes, lipid peroxidation and DNA damage (Nata et
al., J. Immunol. 136(7):2483 (1987)), growth regulation, vascular
endothelium effects and metabolic effects. TNF-.alpha. also
triggers endothelial cells to secrete various factors, including
PAI-1, IL-1, GM-CSF and IL-6 to promote cell proliferation. In
addition, TNF-.alpha. up-regulates various cell adhesion molecules
such as E-Selectin, ICAM-1 and VCAM-1. TNF-.alpha. and the Fas
ligand have also been shown to induce programmed cell death.
It is believed that certain tissues in mammals with specific
cancers express significantly altered levels of the TR1 receptor
protein and mRNA encoding the TR1 receptor protein when compared to
a corresponding "standard" mammal, i.e., a mammal of the same
species not having the cancer. For example, the inventors have
found that osteosarcoma, ovarian carcinoma, monocyte leukemia, and
lung emphysemia cells express the TR1 receptor protein of the
present invention. Further, since this protein is secreted, it is
believed that enhanced levels of the TR1 receptor protein can be
detected in certain body fluids (e.g., sera, plasma, urine, and
spinal fluid) from mammals with cancer when compared to sera from
mammals of the same species not having the cancer. Thus, the
invention provides a diagnostic method useful during tumor
diagnosis and possibly other disease states, which involves
assaying the expression level of the gene encoding the TR1 receptor
protein in mammalian cells or body fluid and comparing the gene
expression level with a standard TR1 receptor gene expression
level, whereby an increase or decrease in the gene expression level
over the standard is indicative of certain tumors.
Where a tumor diagnosis has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting significantly
enhanced TR1 receptor gene expression will experience a worse
clinical outcome relative to patients expressing the gene at a
lower level.
By "assaying the expression level of the gene encoding the TR1
receptor protein" is intended qualitatively or quantitatively
measuring or estimating the level of the TR1 receptor protein or
the level of the mRNA encoding the TR1 receptor protein in a first
biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the TR1 receptor protein level or mRNA level
in a second biological sample).
Preferably, the TR1 receptor protein level or mRNA level in the
first biological sample is measured or estimated and compared to a
standard TR1 receptor protein level or mRNA level, the standard
being taken from a second biological sample obtained from an
individual not having the cancer. As will be appreciated in the
art, once a standard TR1 receptor protein level or mRNA level is
known, it can be used repeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained
from an individual, cell line, tissue culture, or other source
which contains TR1 receptor protein or mRNA. Biological samples
include mammalian body fluids (such as sera, plasma, urine,
synovial fluid and spinal fluid) which contain secreted mature TR1
receptor protein, and thymus, prostate, heart, placenta, muscle,
liver, spleen, lung, kidney and umbilical tissue. Methods for
obtaining tissue biopsies and body fluids from mammals are well
known in the art. Where the biological sample is to include mRNA, a
tissue biopsy is the preferred source.
The present invention is useful for detecting cancer and other
disease states in mammals. In particular the invention is useful
during diagnosis of cancer resulting from the proliferation of
osteoblastoma cells. As described in Example 7, Northern blot
analysis has shown that osteoblastoma cells, in addition to a
number of normal tissues, have been found to express the TR1
receptor of the present invention. This result, when coupled with
the fact that synovial sarcoma cells do not produce detectable
levels of TR1 receptor mRNA, indicates that the molecules provided
by the present invention may be useful for both detecting certain
disease states as well as providing a treatment for such states.
Preferred mammals include monkeys, apes, cats, dogs, cows, pigs,
horses, rabbits and humans. Particularly preferred are humans.
Total cellular RNA can be isolated from a biological sample using
any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156 159 (1987). Levels
of mRNA encoding the TR1 receptor protein are then assayed using
any appropriate method. These include Northern blot analysis, S1
nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
Northern blot analysis can be performed as described in Example 7
below and in Harada et al., Cell 63:303 312 (1990). Briefly, total
RNA is prepared from a biological sample as described above. For
the Northern blot, the RNA is denatured in an appropriate buffer
(such as, glyoxal/dimethyl sulfoxide/sodium phosphate buffer),
subjected to agarose gel electrophoresis, and transferred onto a
nitrocellulose filter. After the RNAs have been linked to the
filter by a UV linker, the filter is prehybridized in a solution
containing formamide, SSC, Denhardt's solution, denatured salmon
sperm, SDS, and sodium phosphate buffer. TR1 receptor protein cDNA
labeled according to any appropriate method (such as the
.sup.32P-multiprimed DNA labeling system (Amersham)) is used as
probe. After hybridization overnight, the filter is washed and
exposed to x-ray film. cDNA for use as probe according to the
present invention is described in the sections above and will
preferably at least 15 bp in length.
S1 mapping can be performed as described in Fujita et al., Cell
49:357 367 (1987). To prepare probe DNA for use in S1 mapping, the
sense strand of above-described cDNA is used as a template to
synthesize labeled anti sense DNA. The antisense DNA can then be
digested using an appropriate restriction endonuclease to generate
further DNA probes of a desired length. Such antisense probes are
useful for visualizing protected bands corresponding to the target
mRNA (i.e., mRNA encoding the TR1 receptor protein). Northern blot
analysis can be performed as described above.
Preferably, levels of mRNA encoding the TR1 receptor protein are
assayed using the RT-PCR method described in Makino et al.,
Technique 2:295 301 (1990). By this method, the radio activities of
the "amplicons" in the polyacrylamide gel bands are linearly
related to the initial concentration of the target mRNA. Briefly,
this method involves adding total RNA isolated from a biological
sample in a reaction mixture containing a RT primer and appropriate
buffer. After incubating for primer annealing, the mixture can be
supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and
reverse transcriptase. After incubation to achieve reverse
transcription of the RNA, the RT products are then subject to PCR
using labeled primers. Alternatively, rather than labeling the
primers, a labeled dNTP can be included in the PCR reaction
mixture. PCR amplification can be performed in a DNA thermal cycler
according to conventional techniques. After a suitable number of
rounds to achieve amplification, the PCR reaction mixture is
electrophoresed on a polyacrylamide gel. After drying the gel, the
radioactivity of the appropriate bands (corresponding to the mRNA
encoding the TR1 receptor protein)) is quantified using an imaging
analyzer. RT and PCR reaction ingredients and conditions, reagent
and gel concentrations, and labeling methods are well known in the
art. Variations on the RT-PCR method will be apparent to the
skilled artisan.
Any set of oligonucleotide primers which will amplify reverse
transcribed target mRNA can be used and can be designed as
described in the sections above.
Assaying TR1 receptor protein levels in a biological sample can
occur using any art-known method. Preferred for assaying TR1
receptor protein levels in a biological sample are antibody-based
techniques. For example, TR1 receptor protein expression in tissues
can be studied with classical immunohistological methods. In these,
the specific recognition is provided by the primary antibody
(polygonal or monoclonal) but the secondary detection system can
utilize fluorescent, enzyme, or other conjugated secondary
antibodies. As a result, an immunohistological staining of tissue
section for pathological examination is obtained. Tissues can also
be extracted, e.g., with urea and neutral detergent, for the
liberation of TR1 receptor protein for Western-blot or dot/slot
assay (Jalkanen., et al., J. Cell. Biol. 101:976 985 (1985);
Jalkanen, et al., J. Cell. Biol. 105:3087 3096 (1987)). In this
technique, which is based on the use of cationic solid phases,
quantitation of TR1 receptor protein can be accomplished using
isolated TR1 receptor protein as a standard. This technique can
also be applied to body fluids. With these samples, a molar
concentration of TR1 receptor protein will aid to set standard
values of TR1 receptor protein content for different body fluids,
like serum, plasma, urine, spinal fluid, etc. The normal appearance
of TR1 receptor protein amounts can then be set using values from
healthy individuals, which can be compared to those obtained from a
test subject.
Thus, from the above, the present invention further relates to a
diagnostic assay which detects an altered level of a soluble form
of the polypeptide of the present invention where an elevated level
in a sample derived from a host is indicative of certain
diseases.
Assays available to detect levels of soluble receptors are well
known to those of skill in the art, for example, radioimmunoassays,
competitive-binding assays, Western blot analysis, and preferably
an ELISA assay may be employed.
An ELISA assay initially comprises preparing an antibody specific
to an antigen to the polypeptide of the present invention,
preferably a monoclonal antibody. In addition a reporter antibody
is prepared against the monoclonal antibody. To the reporter
antibody is attached a detectable reagent such as radioactivity,
fluorescence or in this example a horseradish peroxidase enzyme. A
sample is now removed from a host and incubated on a solid support,
e.g., a polystyrene dish, that binds the proteins in the sample.
Any free protein binding sites on the dish are then covered by
incubating with a non-specific protein such as bovine serum
albumen. Next, the monoclonal antibody is incubated in the dish
during which time the monoclonal antibodies attach to any proteins
of the present invention which are attached to the polystyrene
dish. All unbound monoclonal antibody is washed out with buffer.
The reporter antibody linked to horseradish peroxidase is now
placed in the dish resulting in binding of the reporter antibody to
any monoclonal antibody bound to the polypeptide of the present
invention. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of the protein of interest present in a given volume of
patient sample when compared against a standard curve.
A competition assay may be employed wherein antibodies specific to
the polypeptides of the present invention are attached to a solid
support. Labeled TR1 receptor polypeptides, and a sample derived
from the host are passed over the solid support and the amount of
label detected attached to the solid support can be correlated to a
quantity in the sample. The soluble form of the receptor may also
be employed to identify agonists and antagonists.
Suitable enzyme labels include, for example, those from the oxidase
group, which catalyze the production of hydrogen peroxide by
reacting with substrate. Glucose oxidase is particularly preferred
as it has good stability and its substrate (glucose) is readily
available. Activity of an oxidase label may be assayed by measuring
the concentration of hydrogen peroxide formed by the enzyme-labeled
antibody/substrate reaction. Besides enzymes, other suitable labels
include radioisotopes, such as iodine (.sup.125I, .sup.121I),
carbon (.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.112In), and technetium (.sup.99mTc), and fluorescent labels,
such as fluorescein and rhodamine, and biotin.
In addition to assaying TR1 receptor protein levels in a biological
sample obtained from an individual, TR1 receptor protein can also
be detected in vivo by imaging. Antibody labels or markers for in
vivo imaging of TR1 receptor protein include those detectable by
X-radiography, NMR or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or cesium, which emit
detectable radiation but are not overtly harmful to the subject.
Suitable markers for NMR and ESR include those with a detectable
characteristic spin, such as deuterium, which may be incorporated
into the antibody by labeling of nutrients for the relevant
hybridoma.
A TR1 receptor protein-specific antibody or antibody fragment which
has been labeled with an appropriate detectable imaging moiety,
such as a radioisotope (for example, .sup.131I, .sup.112I,
.sup.99mTc), a radio-opaque substance, or a material detectable by
nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal
to be examined for cancer. It will be understood in the art that
the size of the subject and the imaging system used will determine
the quantity of imaging moiety needed to produce diagnostic images.
In the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which contain TR1 receptor protein. In vivo tumor imaging is
described in S. W. Burchiel et al., "Immunopharmacokinetics of
Radiolabelled Antibodies and Their Fragments" (Chapter 13 in Tumor
Imaging. The Radiochemical Defection of Cancer, S. W. Burchiel and
B. A. Rhodes, eds., Masson Publishing Inc. (1982)).
TR1 receptor-protein specific antibodies for use in the present
invention can be raised against the intact TR1 receptor protein or
an antigenic polypeptide fragment thereof, which may presented
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse) or, if it is long enough (at least
about 25 amino acids), without a carrier.
As used herein, the term "antibody" (Ab) or "monoclonal antibody"
(Mab) is meant to include intact molecules as well as antibody
fragments (such as, for example, Fab and F(ab').sub.2 fragments)
which are capable of specifically binding to TR1 receptor protein.
Fab and F(ab').sub.2 fragments lack the Fc fragment of intact
antibody, clear more rapidly from the circulation, and may have
less non-specific tissue binding of an intact antibody (Wahl et
al., J. Nucl. Med. 24:316 325 (1983)). Thus, these fragments are
preferred.
The antibodies of the present invention may be prepared by any of a
variety of methods. For example, cells expressing the TR1 receptor
protein or an antigenic fragment thereof can be administered to an
animal in order to induce the production of sera containing
polyclonal antibodies. In a preferred method, a preparation of TR1
receptor protein is prepared and purified to render it
substantially free of natural contaminants. Such a preparation is
then introduced into an animal in order to produce polyclonal
antisera of greater specific activity.
In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or TR1 receptor protein
binding fragments thereof). Such monoclonal antibodies can be
prepared using hybridoma technology (Kohler et al., Nature 256:495
(1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et
al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., In:
Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., (1981)
pp. 563 681). In general, such procedures involve immunizing an
animal (preferably a mouse) with a TR1 receptor protein antigen or,
more preferably, with a TR1 receptor protein-expressing cell.
Suitable cells can be recognized by their capacity to bind anti-TR1
receptor protein antibody. Such cells may be cultured in any
suitable tissue culture medium; however, it is preferable to
culture cells in Earle's modified Eagle's medium supplemented with
10% fetal bovine serum (inactivated at about 56.degree. C.), and
supplemented with about 10 g/l of nonessential amino acids, about
1,000 U/ml of penicillin, and about 100 .mu.g/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP.sub.2O),
available from the American Type Culture Collection, Manassas, Va.
After fusion, the resulting hybridoma cells are selectively
maintained in HAT medium, and then cloned by limiting dilution as
described by Wands et al. (Gastroenterology 80:225 232 (1981)). The
hybridoma cells obtained through such a selection are then assayed
to identify clones which secrete antibodies capable of binding the
TR1 receptor protein antigen.
Techniques described for the production of single chain antibodies
(U.S. Pat. No. 4,946,778) can be adapted to produce single chain
antibodies to immunogenic polypeptide products of this invention.
Also, transgenic mice may be used to express humanized antibodies
to immunogenic polypeptide products of this invention.
Alternatively, additional antibodies capable of binding to the TR1
receptor protein antigen may be produced in a two-step procedure
through the use of anti-idiotypic antibodies. Such a method makes
use of the fact that antibodies are themselves antigens, and that,
therefore, it is possible to obtain an antibody which binds to a
second antibody. In accordance with this method, TR1
receptor-protein specific antibodies are used to immunize an
animal, preferably a mouse. The splenocytes of such an animal are
then used to produce hybridoma cells, and the hybridoma cells are
screened to identify clones which produce an antibody whose ability
to bind to the TR1 receptor protein-specific antibody can be
blocked by the TR1 receptor protein antigen. Such antibodies
comprise anti-idiotypic antibodies to the TR1 receptor
protein-specific antibody and can be used to immunize an animal to
induce formation of further TR1 receptor protein-specific
antibodies.
It will be appreciated that Fab and F(ab').sub.2 and other
fragments of the antibodies of the present invention may be used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce
F(ab').sub.2 fragments). Alternatively, TR1 receptor
protein-binding fragments can be produced through the application
of recombinant DNA technology or through synthetic chemistry.
Where in vivo imaging is used to detect enhanced levels of TR1
receptor protein for tumor diagnosis in humans, it may be
preferable to use "humanized" chimeric monoclonal antibodies. Such
antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described
above. Methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229.1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).
Further suitable labels for the TR1 receptor protein-specific
antibodies of the present invention are provided below. Examples of
suitable enzyme labels include malate dehydrogenase, staphylococcal
nuclease, delta-5-steroid isomerase, yeast-alcohol dehydrogenase,
alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase,
peroxidase, alkaline phosphatase, asparaginase, glucose oxidase,
beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine
esterase.
Examples of suitable radioisotopic labels include .sup.3H,
.sup.111In, .sup.125I, .sup.131I, .sup.32P, .sup.35S, .sup.14C,
.sup.51Cr, .sup.57To, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu,
.sup.90Y, .sup.67Cu, .sup.217Ci, .sup.211At, .sup.212Pb, .sup.47SC,
.sup.109Pd, etc. .sup.111In is a preferred isotope where in vivo
imaging is used since its avoids the problem of dehalogenation of
the .sup.125I or .sup.131I-labeled monoclonal antibody by the
liver. In addition, this radionucleotide has a more favorable gamma
emission energy for imaging (Perkins et al., Eur. J. Nucl Med.
10:296 301 (1985); Carasquillo et al., J. Nucl. Med. 28:281 287
(1987)). For example, .sup.111In coupled to monoclonal antibodies
with 1-(P-isothiocyanatobenzyl)-DPTA has shown little uptake in
non-tumorous tissues, particularly the liver, and therefore
enhances specificity of tumor localization (Esteban et al., J.
Nucl. Med 28:861 870 (1987)).
Examples of suitable non-radioactive isotopic labels include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Tr, and .sup.56Fe.
Examples of suitable fluorescent labels include an .sup.152Eu
label, a fluorescein label, an isothiocyanate label, a rhodamine
label, a phycoerythrin label, a phycocyanin label, an
allophycocyanin label, an o-phthaldehyde label, and a fluorescamine
label.
Examples of suitable toxin labels include diphtheria toxin, ricin,
and cholera toxin.
Examples of chemiluminescent labels include a luminal label, an
isoluminal label, an aromatic acridinium ester label, an imidazole
label, an acridinium salt label, an oxalate ester label, a
luciferin label, a luciferase label, and an aequorin label.
Examples of nuclear magnetic resonance contrasting agents include
heavy metal nuclei such as Gd, Mn, and iron.
Typical techniques for binding the above-described labels to
antibodies are provided by Kennedy et al., Clin. Chim. Acta 70:1 31
(1976), and Schurs et al., Clin. Chim. Acta 81:1 40 (1977).
Coupling techniques mentioned in the latter are the glutaraldehyde
method, the periodate method, the dimaleimide method, the
m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of which
methods are incorporated by reference herein.
TR1 Receptor Antibodies
The present invention further relates to antibodies and T-cell
antigen receptors (TCR) which immunospecifically bind a
polypeptide, preferably an epitope, of the present invention (as
determined by immunoassays well known in the art for assaying
specific antibody-antigen binding). Antibodies of the invention
include, but are not limited to, polyclonal, monoclonal,
multispecific, human, humanized or chimeric antibodies, single
chain antibodies, Fab fragments, F(ab') fragments, fragments
produced by a Fab expression library, anti-idiotypic (anti-Id)
antibodies (including, e.g., anti-Id antibodies to antibodies of
the invention), and epitope-binding fragments of any of the above.
The term "antibody," as used herein, refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain an antigen binding site
that immunospecifically binds an antigen. The immunoglobulin
molecules of the invention can be of any type (e.g., IgG, IgE, IgM,
IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and
IgA2) or subclass of immunoglobulin molecule.
Most preferably the antibodies are human antigen-binding antibody
fragments of the present invention and include, but are not limited
to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine, donkey, ship rabbit,
goat, guinea pig, camel, horse, or chicken. As used herein, "human"
antibodies include antibodies having the amino acid sequence of a
human immunoglobulin and include antibodies isolated from human
immunoglobulin libraries or from animals transgenic for one or more
human immunoglobulin and that do not express endogenous
immunoglobulins, as described infra and, for example in, U.S. Pat.
No. 5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt et al., J. Immunol. 147:60
69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547 1553
(1992).
Antibodies of the present invention may be described or specified
in terms of the epitope(s) or portion(s) of a polypeptide of the
present invention that they recognize or specifically bind. The
epitope(s) or polypeptide portion(s) may be specified as described
herein, e.g., by N-terminal and C-terminal positions, by size in
contiguous amino acid residues, or listed in the Tables and
Figures. Antibodies that specifically bind any epitope or
polypeptide of the present invention may also be excluded.
Therefore, the present invention includes antibodies that
specifically bind polypeptides of the present invention, and allows
for the exclusion of the same.
Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
Antibodies that do not bind polypeptides with less than 95%, less
than 90%, less than 85%, less than 80%, less than 75%, less than
70%, less than 65%, less than 60%, less than 55%, and less than 50%
identity (as calculated using methods known in the art and
described herein) to a polypeptide of the present invention are
also included in the present invention. Further included in the
present invention are antibodies that bind polypeptides encoded by
polynucleotides which hybridize to a polynucleotide of the present
invention under stringent hybridization conditions (as described
herein). Antibodies of the present invention may also be described
or specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-2M,
10.sup.-2M, 5.times.10.sup.-3M, 10.sup.-3M, 5.times.10.sup.-4M,
10.sup.-4M, 5.times.10.sup.-5M, 10.sup.-5M, 5.times.10.sup.-6M,
10.sup.-6M, 5.times.10.sup.-7M, 10.sup.-7M, 5.times.10.sup.-8M,
10.sup.-8M, 5.times.10.sup.-9M, 10.sup.-9M, 5.times.10.sup.-10M,
10.sup.-10M, 5.times.10.sup.-11M, 10.sup.-11M, 5.times.10.sup.-12M,
10.sup.-12M, 5.times.10.sup.-13M, 10.sup.-13M, 5.times.10.sup.-14M,
10.sup.-14M, 5.times.10.sup.-15M, and 10.sup.-15M.
The invention also provides antibodies that competitively inhibit
binding of an antibody to an epitope of the invention as determined
by any method known in the art for determining competitive binding,
for example, the immunoassays described herein. In preferred
embodiments, the antibody competitively inhibits binding to the
epitope by at least 90%, at least 80%, at least 70%, at least 60%,
or at least 50%.
Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. The invention features both
receptor-specific antibodies and ligand-specific antibodies. The
invention also features receptor-specific antibodies which do not
prevent ligand binding but prevent receptor activation. Receptor
activation (i.e., signaling) may be determined by techniques
described herein or otherwise known in the art. For example,
receptor activation can be determined by detecting the
phosphorylation (e.g., tyrosine or serine/threonine) of the
receptor or its substrate by immunoprecipitation followed by
western blot analysis (for example, as described supra). In
specific embodiments, antibodies are provided that inhibit ligand
or receptor activity by at least 90%, at least 80%, at least 70%,
at least 60%, or at least 50% of the activity in absence of the
antibody.
The invention also features receptor-specific antibodies which both
prevent ligand binding and receptor activation as well as
antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation. The antibodies may be
specified as agonists, antagonists or inverse agonists for
biological activities comprising the specific biological activities
of the peptides of the invention disclosed herein. Thus, the
invention further relates to antibodies which act as agonists or
antagonists of the polypeptides of the present invention. The above
antibody agonists can be made using methods known in the art. See,
e.g., PCT publication WO 96/40281; U.S. Pat. No. 5,811,097; Deng et
al., Blood 92(6):1981 1988 (1998); Chen et al., Cancer Res.
58(16):3668 3678 (1998); Harrop et al., J. Immunol. 161(4):1786
1794 (1998); Zhu et al., Cancer Res. 58(15):3209 3214 (1998); Yoon
et al., J. Immunol 160(7):3170 3179 (1998); Prat et al., J. Cell.
Sci. 111(Pt2):237 247 (1998); Pitard et al., J. Immunol. Methods
205(2): 177 190 (1997); Liautard et al., Cytokine 9(4):233 241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295 11301 (1997);
Taryman et al., Neuron 14(4):755 762 (1995); Muller et al.,
Structure 6(9):1153 1167 (1998); Bartunek et al., Cytokine 8(1):14
20 (1996) (which are all incorporated by reference herein in their
entireties).
Antibodies of the present invention may be used, for example, but
not limited to, to purify, detect, and target the polypeptides of
the present invention, including both in vitro and in vivo
diagnostic and therapeutic methods. For example, the antibodies
have use in immunoassays for qualitatively and quantitatively
measuring levels of the polypeptides of the present invention in
biological samples. See, e.g., Harlow et al., Antibodies: A
Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed.
1988) (incorporated by reference herein in its entirety).
As discussed in more detail below, the antibodies of the present
invention may be used either alone or in combination with other
compositions. The antibodies may further be recombinantly fused to
a heterologous polypeptide at the N- or C-terminus or chemically
conjugated (including covalently and non-covalently conjugations)
to polypeptides or other compositions. For example, antibodies of
the present invention may be recombinantly fused or conjugated to
molecules useful as labels in detection assays and effector
molecules such as heterologous polypeptides, drugs, or toxins. See,
e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S.
Pat. No. 5,314,995; and EP 396,387.
The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphorylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
The antibodies of the present invention may be generated by any
suitable method known in the art. Polyclonal antibodies to an
antigen of interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Such adjuvants are also well known in the art.
Monoclonal antibodies can be prepared using a wide variety of
techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563 681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced. Thus,
the term "monoclonal antibody" is not limited to antibodies
produced through hybridoma technology. Monoclonal antibodies can be
prepared using a wide variety of techniques known in the art
including the use of hybridoma and recombinant and phage display
technology.
Methods for producing and screening for specific antibodies using
hybridoma technology are routine and well-known in the art and are
discussed in detail in Example 8. Briefly, mice can be immunized
with a polypeptide of the invention or a cell expressing such
peptide. Once an immune response is detected, e.g., antibodies
specific for the antigen are detected in the mouse serum, the mouse
spleen is harvested and splenocytes isolated. The splenocytes are
then fused by well-known techniques to any suitable myeloma cells,
for example cells from cell line SP20 available from the ATCC.
Hybridomas are selected and cloned by limited dilution. The
hybridoma clones are then assayed by methods known in the art for
cells that secrete antibodies capable of binding a polypeptide of
the invention. Ascites fluid, which generally contains high levels
of antibodies, can be generated by immunizing mice with positive
hybridoma clones.
Accordingly, the present invention provides methods of generating
monoclonal antibodies as well as antibodies produced by the method
comprising culturing a hybridoma cell secreting an antibody of the
invention wherein, preferably, the hybridoma is generated by fusing
splenocytes isolated from a mouse immunized with an antigen of the
invention with myeloma cells and then screening the hybridomas
resulting from the fusion for hybridoma clones that secrete an
antibody able to bind a polypeptide of the invention.
Antibody fragments that recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
For example, the antibodies of the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular, such phage can be
utilized to display antigen-binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured to a solid
surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinkman et al., J. Immunol. Methods 182:41 50 (1995); Ames et al.,
J. Immunol. Methods 184: 177 186 (1995); Kettleborough et al., Eur.
J. Immunol 24:952 958 (1994); Persic et al., Gene 187:9 18 (1997);
Burton et al., Advances in Immunology 57: 191 280 (1994); PCT
application No. PCT/GB91/01134; PCT publications WO 90/02809; WO
91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
As described in the above references, after phage selection, the
antibody coding regions from the phage can be isolated and used to
generate whole antibodies, including human antibodies, or any other
desired antigen binding fragment, and expressed in any desired
host, including mammalian cells, insect cells, plant cells, yeast,
and bacteria, e.g., as described in detail below. For example,
techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments
can also be employed using methods known in the art such as those
disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12(6):864 869 (1992); and Sawai et al., AJRI 34:26 34
(1995); and Better et al, Science 240:1041 1043 (1988) (said
references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain
Fvs and antibodies include those described in U.S. Pat. Nos.
4,946,778 and 5,258,498; Huston et al., Methods in Enzymology
203:46 88 (1991); Shu et al., PNAS 90:7995 7999 (1993); and Skerra
et al., Science 240:1038 1040 (1988). For some uses, including in
vivo use of antibodies in humans and in vitro detection assays, it
may be preferable to use chimeric, humanized, or human antibodies.
A chimeric antibody is a molecule in which different portions of
the antibody are derived from different animal species, such as
antibodies having a variable region derived from a murine
monoclonal antibody and a human immunoglobulin constant region.
Methods for producing chimeric antibodies are known in the art.
See, e.g., Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Gillies et al., (1989) J. Immunol
Methods 125:191 202; U.S. Pat. Nos. 5,807,715; 4,816,567; and
4,816,397, which are incorporated herein by reference in their
entireties. Humanized antibodies are antibody molecules from
non-human species antibody that binds the desired antigen having
one or more complementarity determining regions (CDRs) from the
non-human species and framework regions from a human immunoglobulin
molecule. Often, framework residues in the human framework regions
will be substituted with the corresponding residue from the CDR
donor antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which
are incorporated herein by reference in their entireties.)
Antibodies can be humanized using a variety of techniques known in
the art including, for example, CDR-grafting (EP 239,400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089), veneering or resurfacing (EP 592,106; EP 519,596;
Padlan, Molecular Immunology 28(4/5):489 498 (1991); Studnicka et
al., Protein Engineering 7(6):805 814 (1994); Roguska. et al., PNAS
91:969 973 (1994)), and chain shuffling (U.S. Pat. No.
5,565,332).
Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
Human antibodies can also be produced using transgenic mice which
are incapable of expressing functional endogenous immunoglobulins,
but which can express human immunoglobulin genes. For example, the
human heavy and light chain immunoglobulin gene complexes may be
introduced randomly or by homologous recombination into mouse
embryonic stem cells. Alternatively, the human variable region,
constant region, and diversity region may be introduced into mouse
embryonic stem cells in addition to the human heavy and light chain
genes. The mouse heavy and light chain immunoglobulin genes may be
rendered non-functional separately or simultaneously with the
introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring that express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar
(1995, Int. Rev. Immunol. 13:65 93). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 96/34096; WO 96/33735; U.S. Pat.
Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016;
5,545,806; 5,814,318; and 5,939,598, which are incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and GenPharm (San Jose, Calif.)
can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described
above.
Completely human antibodies which recognize a selected epitope can
be generated using a technique referred to as "guided selection."
In this approach a selected non-human monoclonal antibody, e.g., a
mouse antibody, is used to guide the selection of a completely
human antibody recognizing the same epitope. (Jespers et al.,
Bio/technology 12:899 903 (1988)).
Further, antibodies to the polypeptides of the invention can, in
turn, be utilized to generate anti-idiotype antibodies that "mimic"
polypeptides of the invention using techniques well known to those
skilled in the art. (See, e.g., Greenspan & Bona, FASEB J.
7(5):437 444 (1989) and Nissinoff, J. Immunol. 147(8):2429 2438
(1991)). For example, antibodies which bind to and competitively
inhibit polypeptide multimerization and/or binding of a polypeptide
of the invention to a ligand can be used to generate anti-idiotypes
that "mimic" the polypeptide multimerization and/or binding domain
and, as a consequence, bind to and neutralize polypeptide and/or
its ligand. Such neutralizing anti-idiotypes or Fab fragments of
such anti-idiotypes can be used in therapeutic regimens to
neutralize polypeptide ligand. For example, such anti-idiotypic
antibodies can be used to bind a polypeptide of the invention
and/or to bind its ligands/receptors, and thereby block its
biological activity.
A. Polynucleotides Encoding Antibodies
The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined supra, to polynucleotides that encode
an antibody, preferably, that specifically binds to a polypeptide
of the invention, preferably, an antibody that binds to a
polypeptide having the amino acid sequence of SEQ ID NO:2 or SEQ ID
NO:4.
The polynucleotides may be obtained, and the nucleotide sequence of
the polynucleotides determined, by any method known in the art. For
example, if the nucleotide sequence of the antibody is known, a
polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligation of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be obtained from a
suitable source (e.g., an antibody cDNA library, or a cDNA library
generated from, or nucleic acid, preferably poly A+ RNA, isolated
from, any tissue or cells expressing the antibody, such as
hybridoma cells selected to express an antibody of the invention)
by PCR amplification using synthetic primers hybridizable to the 3'
and 5' ends of the sequence or by cloning using an oligonucleotide
probe specific for the particular gene sequence to identify, e.g.,
a cDNA clone from a cDNA library that encodes the antibody.
Amplified nucleic acids generated by PCR may then be cloned into
replicable cloning vectors using any method well known in the
art.
Once the nucleotide sequence and corresponding amino acid sequence
of the antibody is determined, the nucleotide sequence of the
antibody may be manipulated using methods well known in the art for
the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, N.Y., which are both incorporated by reference herein in
their entireties), to generate antibodies having a different amino
acid sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy
and/or light chain variable domains may be inspected to identify
the sequences of the complementarity determining regions (CDRs) by
methods that are well know in the art, e.g., by comparison to known
amino acid sequences of other heavy and light chain variable
regions to determine the regions of sequence hypervariability.
Using routine recombinant DNA techniques, one or more of the CDRs
may be inserted within framework regions, e.g., into human
framework regions to humanize a non-human antibody, as described
supra. The framework regions may be naturally occurring or
consensus framework regions, and preferably human framework regions
(see, e.g., Chothia et al., J. Mol. Biol. 278:457 479 (1998) for a
listing of human framework regions). Preferably, the polynucleotide
generated by the combination of the framework regions and CDRs
encodes an antibody that specifically binds a polypeptide of the
invention. Preferably, as discussed supra, one or more amino acid
substitutions may be made within the framework regions, and,
preferably, the amino acid substitutions improve binding of the
antibody to its antigen. Additionally, such methods may be used to
make amino acid substitutions or deletions of one or more variable
region cysteine residues participating in an intrachain disulfide
bond to generate antibody molecules lacking one or more intrachain
disulfide bonds. Other alterations to the polynucleotide are
encompassed by the present invention and within the skill of the
art.
In addition, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851
855; Neuberger et al., 1984, Nature 312:604 608; Takeda et al.,
1985, Nature 314:452 454) by splicing genes from a mouse antibody
molecule of appropriate antigen specificity together with genes
from a human antibody molecule of appropriate biological activity
can be used. As described supra, a chimeric antibody is a molecule
in which different portions are derived from different animal
species, such as those having a variable region derived from a
murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
Alternatively, techniques described for the production of single
chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988, Science
242:423 42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879
5883; and Ward et al, 1989, Nature 334:544 54) can be adapted to
produce single chain antibodies. Single chain antibodies are formed
by linking the heavy and light chain fragments of the Fv region via
an amino acid bridge, resulting in a single chain polypeptide.
Techniques for the assembly of functional Fv fragments in E. coli
may also be used (Skerra et al., 1988, Science 242:1038 1041).
B. Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known
in the art for the synthesis of antibodies, in particular, by
chemical synthesis or preferably, by recombinant expression
techniques.
Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, e.g., a heavy or light
chain of an antibody of the invention, requires construction of an
expression vector containing a polynucleotide that encodes the
antibody. Once a polynucleotide encoding an antibody molecule or a
heavy or light chain of an antibody, or portion thereof (preferably
containing the heavy or light chain variable domain), of the
invention has been obtained, the vector for the production of the
antibody molecule may be produced by recombinant DNA technology
using techniques well known in the art. Thus, methods for preparing
a protein by expressing a polynucleotide containing an antibody
encoding nucleotide sequence are described herein. Methods which
are well known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
The expression vector is transferred to a host cell by conventional
techniques and the transfected cells are then cultured by
conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double-chained antibodies,
vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to
express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al, 1986, Gene 45:101; Cockett et al.,
1990, Bio/Technology 8:2).
In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., 1983, EMBO J. 2:1791), in which the antibody coding
sequence may be ligated individually into the vector in frame with
the lac Z coding region so that a fusion protein is produced; pIN
vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101
3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503 5509);
and the like. pGEX vectors may also be used to express foreign
polypeptides as fusion proteins with glutathione S-transferase
(GST). In general, such fusion proteins are soluble and can easily
be purified from lysed cells by adsorption and binding to a matrix
glutathione-agarose beads followed by elution in the presence of
free glutathione. The pGEX vectors are designed to include thrombin
or factor Xa protease cleavage sites so that the cloned target gene
product can be released from the GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis
virus (AcNPV) is used as a vector to express foreign genes. The
virus grows in Spodoptera frugiperda cells. The antibody coding
sequence may be cloned individually into non-essential regions (for
example the polyhedrin gene) of the virus and placed under control
of an AcNPV promoter (for example the polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems
may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355 359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., Methods in Enzymol. 153 51
544 (1987)).
In addition, a host cell strain may be chosen which modulates the
expression of the inserted sequences, or modifies and processes the
gene product in the specific fashion desired. Such modifications
(e.g., glycosylation) and processing (e.g., cleavage) of protein
products may be important for the function of the protein.
Different host cells have characteristic and specific mechanisms
for the post-translational processing and modification of proteins
and gene products. Appropriate cell lines or host systems can be
chosen to ensure the correct modification and processing of the
foreign protein expressed. To this end, eukaryotic host cells which
possess the cellular machinery for proper processing of the primary
transcript, glycosylation, and phosphorylation of the gene product
may be used. Such mammalian host cells include but are not limited
to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in
particular, breast cancer cell lines such as, for example, BT483,
Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line
such as, for example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins,
stable expression is preferred. For example, cell lines which
stably express the antibody molecule may be engineered. Rather than
using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1 2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc.
Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:817) genes can be employed in tk-,
hgprt- or aprt-cells, respectively. Also, antimetabolite resistance
can be used as the basis of selection for the following genes:
dhfr, which confers resistance to methotrexate (Wigler et al, 1980,
Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad.
Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA
78:2072); neo, which confers resistance to the aminoglycoside G-418
Clinical Pharmacy 12:488 505; Wu and Wu, 1991, Biotherapy 3:87 95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573 596;
Mulligan, 1993, Science 260:926 932; and Morgan and Anderson, 1993,
Ann. Rev. Biochem. 62:191 217; May, 1993, TIB TECH 11(5):155 215);
and hygro, which confers resistance to hygromycin (Santerre et al.,
1984, Gene 30:147). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular
Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer
and Expression, A Laboratory Manual, Stockton Press, NY; and in
Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols
in Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et
al., J. Mol. Biol. 150:1 (1981), which are incorporated by
reference herein in their entireties.
The expression levels of an antibody molecule can be increased by
vector amplification (for a review, see Bebbington and Hentschel,
The use of vectors based on gene amplification for the expression
of cloned genes in mammalian cells in DNA cloning, Vol. 3.
(Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., 1983, Mol Cell. Biol. 3:257).
The host cell may be co-transfected with two expression vectors of
the invention, the first vector encoding a heavy chain derived
polypeptide and the second vector encoding a light chain derived
polypeptide. The two vectors may contain identical selectable
markers which enable equal expression of heavy and light chain
polypeptides. Alternatively, a single vector may be used which
encodes both heavy and light chain polypeptides. In such
situations, the light chain should be placed before the heavy chain
to avoid an excess of toxic free heavy chain (Proudfoot, Nature
322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980).
The coding sequences for the heavy and light chains may comprise
cDNA or genomic DNA.
Once an antibody molecule of the invention has been recombinantly
expressed, it may be purified by any method known in the art for
purification of an immunoglobulin molecule, for example, by
chromatography (e.g., ion exchange, affinity, particularly by
affinity for the specific antigen after Protein A, and sizing
column chromatography), centrifugation, differential solubility, or
by any other standard technique for the purification of
proteins.
C. Antibody Conjugates
The present invention encompasses antibodies recombinantly fused or
chemically conjugated (including both covalently and non-covalently
conjugations) to a polypeptide (or portion thereof, preferably at
least 10, 20 or 50 amino acids of the polypeptide) of the present
invention to generate fusion proteins. The fusion does not
necessarily need to be direct, but may occur through linker
sequences. The antibodies may be specific for antigens other than
polypeptides (or portion thereof, preferably at least 10, 20 or 50
amino acids of the polypeptide) of the present invention. For
example, antibodies may be used to target the polypeptides of the
present invention to particular cell types, either in vitro or in
vivo, by fusing or conjugating the polypeptides of the present
invention to antibodies specific for particular cell surface
receptors. Antibodies fused or conjugated to the polypeptides of
the present invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91 99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428 1432 (1992); Fell et al.,
J. Immunol. 146:2446 2452 (1991), which are incorporated by
reference in their entireties.
The present invention further includes compositions comprising the
polypeptides of the present invention fused or conjugated to
antibody domains other than the variable regions. For example, the
polypeptides of the present invention may be fused or conjugated to
an antibody Fc region, or portion thereof. The antibody portion
fused to a polypeptide of the present invention may comprise the
constant region, hinge region, CH1 domain, CH2 domain, and CH3
domain or any combination of whole domains or portions thereof. The
polypeptides may also be fused or conjugated to the above antibody
portions to form multimers. For example, Fc portions fused to the
polypeptides of the present invention can form dimers through
disulfide bonding between the Fc portions. Higher multimeric forms
can be made by fusing the polypeptides to portions of IgA and IgM.
Methods for fusing or conjugating the polypeptides of the present
invention to antibody portions are known in the art. See, e.g.,
U.S. Pat. Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053;
5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO
96/04388; WO 91/06570; Ashkenazi et al., Proc. Natl. Acad. Sci. USA
88:10535 10539 (1991); Zheng et al., J. Immunol. 154:5590 5600
(1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11337
11341(1992) (said references incorporated by reference in their
entireties).
As discussed, supra, the polypeptides of the present invention may
be fused or conjugated to the above antibody portions to increase
the in vivo half life of the polypeptides or for use in
immunoassays using methods known in the art. Further, the
polypeptides of the present invention may be fused or conjugated to
the above antibody portions to facilitate purification. One
reported example describes chimeric proteins consisting of the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins. (EP 394,827; Traunecker et al., Nature 331:84 86
(1988). The polypeptides of the present invention fused or
conjugated to an antibody having disulfide-linked dimeric
structures (due to the IgG) may also be more efficient in binding
and neutralizing other molecules, than the monomeric secreted
protein or protein fragment alone. (Fountoulakis et al., J.
Biochem. 270:3958 3964 (1995)). In many cases, the Fc part in a
fusion protein is beneficial in therapy and diagnosis, and thus can
result in, for example, improved pharmacokinetic properties. (EP A
232,262). Alternatively, deleting the Fc part after the fusion
protein has been expressed, detected, and purified, would be
desired. For example, the Fc portion may hinder therapy and
diagnosis if the fusion protein is used as an antigen for
immunizations. In drug discovery, for example, human proteins, such
as hIL-5 receptor, have been fused with Fc portions for the purpose
of high-throughput screening assays to identify antagonists of
hIL-5. (See, D. Bennett et al., J. Molecular Recognition 8:52 58
(1995); K. Johanson et al., J. Biol. Chem. 270:9459 9471
(1995).
Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitates their purification. In preferred embodiments, the
marker amino acid sequence is a hexa-histidine peptide, such as the
tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA 86:821 824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. Other
peptide tags useful for purification include, but are not limited
to, the "HA" tag, which corresponds to an epitope derived from the
influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984))
and the "flag" tag.
The present invention further encompasses antibodies or fragments
thereof conjugated to a diagnostic or therapeutic agent. The
antibodies can be used diagnostically to, for example, monitor the
development or progression of a tumor as part of a clinical testing
procedure to, e.g., determine the efficacy of a given treatment
regimen. Detection can be facilitated by coupling the antibody to a
detectable substance. Examples of detectable substances include
various enzymes, prosthetic groups, fluorescent materials,
luminescent materials, bioluminescent materials, radioactive
materials, positron emitting metals using various positron emission
tomographies, and nonradioactive paramagnetic metal ions. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.111In or .sup.99Tc.
Further, an antibody or fragment thereof may be conjugated to a
therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion. A
cytotoxin or cytotoxic agent includes any agent that is detrimental
to cells. Examples include paclitaxol, cytochalasin B, gramicidin
D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin
D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
The conjugates of the invention can be used for modifying a given
biological response, the therapeutic agent or drug moiety is not to
be construed as limited to classical chemical therapeutic agents.
For example, the drug moiety may be a protein or polypeptide
possessing a desired biological activity. Such proteins may
include, for example, a toxin such as abrin, ricin A, pseudomonas
exotoxin, or diphtheria toxin; a protein such as tumor necrosis
factor, a-interferon, interferon, nerve growth factor, platelet
derived growth factor, tissue plasminogen activator, a thrombotic
agent or an anti-angiogenic agent, e.g., angiostatin or endostatin;
or, biological response modifiers such as, for example,
lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"),
interleukin-6 ("IL-6"), granulocyte macrophase colony stimulating
factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"),
or other growth factors.
Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies
are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For
Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal
Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243 56
(Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug
Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al.
(eds.), pp. 623 53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody
Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in
Monoclonal Antibodies '84: Biological And Clinical Applications,
Pinchera et al. (eds.), pp. 475 506 (1985); "Analysis, Results, And
Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody
In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection
And Therapy, Baldwin et al. (eds.), pp. 303 16 (Academic Press
1985), and Thorpe et al., "The Preparation And Cytotoxic Properties
Of Antibody-Toxin Conjugates", Immunol. Rev. 62:119 58 (1982).
Alternatively, an antibody can be conjugated to a second antibody
to form an antibody heteroconjugate as described by Segal in U.S.
Pat. No. 4,676,980, which is incorporated herein by reference in
its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered alone or in combination with cytotoxic factor(s)
and/or cytokine(s) can be used as a therapeutic.
D. Assays For Antibody Binding
The antibodies of the invention may be assayed for immunospecific
binding by any method known in the art. The immunoassays which can
be used include but are not limited to competitive and
non-competitive assay systems using techniques such as western
blots, radioimmunoassays, ELISA (enzyme linked immunosorbent
assay), "sandwich" immunoassays, immunoprecipitation assays,
precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art (see, e.g., Ausubel et al., eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, which is incorporated by reference herein in its
entirety). Exemplary immunoassays are described briefly below (but
are not intended by way of limitation).
Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1 4 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York
at 10.16.1.
Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8% 20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer; blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
.sup.32P or .sup.125I) diluted in blocking buffer, washing the
membrane in wash buffer, and detecting the presence of the antigen.
One of skill in the art would be knowledgeable as to the parameters
that can be modified to increase the signal detected and to reduce
the background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York
at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well
microtiter plate with the antigen, adding the antibody of interest
conjugated to a detectable compound such as an enzymatic substrate
(e.g., horseradish peroxidase or alkaline phosphatase) to the well
and incubating for a period of time, and detecting the presence of
the antigen. In ELISAs the antibody of interest does not have to be
conjugated to a detectable compound; instead, a second antibody
(which recognizes the antibody of interest) conjugated to a
detectable compound may be added to the well. Further, instead of
coating the well with the antigen, the antibody may be coated to
the well. In this case, a second antibody conjugated to a
detectable compound may be added following the addition of the
antigen of interest to the coated well. One of skill in the art
would be knowledgeable as to the parameters that can be modified to
increase the signal detected as well as other variations of ELISAs
known in the art. For further discussion regarding ELISAs see,
e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular
Biology, Vol. 1, John Wiley & Sons, Inc., New York at
11.2.1.
The binding affinity of an antibody to an antigen and the off-rate
of an antibody-antigen interaction can be determined by competitive
binding assays. One example of a competitive binding assay is a
radioimmunoassay comprising the incubation of labeled antigen
(e.g., .sup.3H or .sup.125I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is
incubated with antibody of interest is conjugated to a labeled
compound (e.g., .sup.3H or .sup.125I) in the presence of increasing
amounts of an unlabeled second antibody.
TR1 Receptor: Therapeutic Uses
The Tumor Necrosis Factor (TNF) family ligands are known to be
among the most pleiotropic cytokines, inducing a large number of
cellular responses, including cytotoxicity, anti-viral activity,
immunoregulatory activities, and the transcriptional regulation of
several genes (Goeddel, D. V. et al., "Tumor Necrosis Factors: Gene
Structure and Biological Activities," Symp. Quant. Biol. 51:597 609
(1986), Cold Spring Harbor; Beutler, B., and Cerami, A., Annu. Rev.
Biochem. 57:505 518 (1988); Old, L. J., Sci. Am. 258:59 75 (1988);
Fiers, W., FEBS Lett. 285:199 224 (1991)). The TNF-family ligands
induce such various cellular responses by binding to TNF-family
receptors.
TR1 receptor polynucleotides, polypeptides, agonists or antagonists
of the invention may be used in developing treatments for any
disorder mediated (directly or indirectly) by defective, or
insufficient amounts of TR1 receptor. TR1 receptor polypeptides,
agonists or antagonists may be administered to a patient (e.g.,
mammal, preferably human) afflicted with such a disorder.
Alternatively, a gene therapy approach may be applied to treat such
disorders. Disclosure herein of TR1 receptor nucleotide sequences
permits the detection of defective TR1 receptor genes, and the
replacement thereof with normal TR1 receptor-encoding genes.
Defective genes may be detected in in vitro diagnostic assays, and
by comparison of the TR1 receptor nucleotide sequence disclosed
herein with that of a TR1 receptor gene derived from a patient
suspected of harboring a defect in this gene.
In another embodiment, the polypeptides of the present invention
are used as a research tool for studying the biological effects
that result from inhibiting OPGL/TR1 receptor and/or TRAIL/TR1
receptor interactions on different cell types. TR1 receptor
polypeptides also may be employed in in vitro assays for detecting
TRAIL, OPGL or TR1 receptor or the interactions thereof.
In another embodiment, a purified TR1 receptor polypeptide or
antagonist is used to inhibit binding of detecting TRAIL or OPGL to
endogenous cell surface detecting TRAIL and/or OPGL receptors.
Certain ligands of the TNF family (of which detecting TRAIL and
OPGL are members) have been reported to bind to more than one
distinct cell surface receptor protein. TRAIL likewise has been
shown to bind multiple cell surface proteins. By binding TRAIL
and/or OPGL, soluble TR1 receptor polypeptides of the present
invention may be employed to inhibit the binding of TRAIL and/or
OPGL not only to cell surface TR1 receptor, but also to TRAIL
and/or OPGL receptor proteins that are distinct from TR1 receptor.
Thus, in another embodiment, TR1 receptor polynucleotides,
polypeptides, agonists or antagonists is used to inhibit a
biological activity of TRAIL and/or OPGL, in in vitro or in vivo
procedures. By inhibiting binding TRAIL and/or OPGL to cell surface
receptors, TR1 receptor polynucleotides, polypeptides, agonists or
antagonists also inhibit biological effects that result from the
binding of TRAIL and/or OPGL to endogenous receptors. Various forms
of TR1 receptor may be employed, including, for example, the
above-described TR1 receptor fragments, derivatives, and variants
that are capable of binding TRAIL and/or OPGL. In one preferred
embodiment, a soluble TR1 receptor polypeptide is employed to
inhibit a biological activity of TRAIL, e.g., to inhibit
TRAIL-mediated apoptosis of cells susceptible to such apoptosis. In
another preferred embodiment, a soluble TR1 receptor polypeptide is
employed to inhibit a biological activity of OPGL (e.g.,
stimulation of osteoclast differentiation, and lymphocyte
activation).
In a further embodiment, a TR1 receptor polynucleotide,
polypeptide, agonist or antagonist is administered to a mammal
(e.g., a human) to treat a TRAIL-mediated and/or OPGL mediated
disorder. Such TRAIL-mediated and/or OPGL mediated disorders
include conditions caused (directly or indirectly) or exacerbated
by TRAIL and/or OPGL.
Diseases associated with increased cell survival, or the inhibition
of apoptosis, include cancers (such as follicular lymphomas,
carcinomas with p53 mutations, and hormone-dependent tumors,
including, but not limited to colon cancer, cardiac tumors,
pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung
cancer, intestinal cancer, testicular cancer, stomach cancer,
neuroblastoma, myxoma, myoma, lymphoma, endothelioma,
osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma,
adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and
ovarian cancer); autoimmune disorders (such as, multiple sclerosis,
Sjogren's syndrome, Grave's disease, Hashimoto's thyroiditis,
autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's
disease, polymyositis, systemic lupus erythematosus and
immune-related glomerulonephritis, autoimmune gastritis, autoimmune
thrombocytopenic purpura, and rheumatoid arthritis) and viral
infections (such as herpes viruses, pox viruses and adenoviruses),
inflammation, graft vs. host disease (acute and/or chronic), acute
graft rejection, and chronic graft rejection. In preferred
embodiments, TR1 receptor polynucleotides, polypeptides, agonists,
or antagonists of the invention are used to inhibit growth,
progression, and/or metastasis of cancers, in particular those
listed above or in the paragraph that follows.
Additional diseases or conditions associated with increased cell
survival include, but are not limited to, progression, and/or
metastases of malignancies and related disorders such as leukemia
(including acute leukemias (e.g., acute lymphocytic leukemia, acute
myelocytic leukemia (including myeloblastic, promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and
chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g.,
Hodgkin's disease and non-Hodgkin's disease), multiple myeloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid
tumors including, but not limited to, sarcomas and carcinomas such
as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma,
osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer,
prostate cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
Diseases associated with increased apoptosis include AIDS;
neurodegenerative disorders (such as Alzheimer's disease,
Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis
pigmentosa, Cerebellar degeneration and brain tumor or prior
associated disease); autoimmune disorders (such as, multiple
sclerosis, Sjogren's syndrome, Grave's disease Hashimoto's
thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's
disease, Crohn's disease, polymyositis, systemic lupus
erythematosus, immune-related glomerulonephritis, autoimmune
gastritis, thrombocytopenic purpura, and rheumatoid arthritis)
myelodysplastic syndromes (such as aplastic anemia), graft vs. host
disease (acute and/or chronic), ischemic injury (such as that
caused by myocardial infarction, stroke and reperfusion injury),
liver injury or disease (e.g., hepatitis related liver injury,
cirrhosis, ischemia/reperfusion injury, cholestosis (bile duct
injury) and liver cancer); toxin-induced liver disease (such as
that caused by alcohol), septic shock, ulcerative colitis, cachexia
and anorexia. In preferred embodiments, TR1 receptor
polynucleotides, polypeptides, agonists, and/or antagonists are
used to treat the diseases and disorders listed above.
HIV
Many of the pathologies associated with HIV are mediated by
apoptosis, including HIV-induced nephropathy and HIV encephalitis.
Thus, in additional preferred embodiments, TR1 receptor
polynucleotides, polypeptides, agonists, or antagonists of the
invention are used to treat AIDS and pathologies associated with
AIDS.
Another embodiment of the present invention is directed to the use
of TR1 receptor polynucleotides, polypeptides, agonists or
antagonists to reduce TRAIL-mediated death of T cells in
HIV-infected patients. The role of T cell apoptosis in the
development of AIDS has been the subject of a number of studies
(see, for example, Meyaard et al., Science 257:217 219 (1992);
Groux et al., J. Exp. Med., 175:331 (1992); and Oyaizu et al., in
Cell Activation and Apoptosis in HIV infection, Andrieu and Lu,
Eds., Plenum Press, New York (1995), pp. 101 114). Fas-mediated
apoptosis has been implicated in the loss of T cells in HIV
individuals (Katsikis et al., J. Exp. Med 181:2029 2036, 1995). It
is also likely that T cell apoptosis occurs through multiple
mechanisms. For example, at least some of the T cell death seen in
HIV patients is likely to be mediated by TRAIL.
Activated human T cells are induced to undergo programmed cell
death (apoptosis) upon triggering through the CD3/T cell receptor
complex, a process termed activated-induced cell death (AICD). AICD
of CD4 T cells isolated from HIV-Infected asymptomatic individuals
has been reported (Groux et al., supra). Thus, AICD may play a role
in the depletion of CD4+ T cells and the progression to AIDS in
HIV-infected individuals. Thus, the present invention provides a
method of inhibiting TRAIL-mediated T cell death in HIV patients,
comprising administering a TR1 receptor polynucleotides,
polypeptides, agonists or antagonists of the invention (preferably,
a soluble TR1 receptor polypeptide) to the patients. In one
embodiment, the patient is asymptomatic when treatment with TR1
receptor polynucleotides, polypeptides, agonists or antagonists
commences. If desired, prior to treatment, peripheral blood T cells
may be extracted from an HIV patient, and tested for susceptibility
to TRAIL-mediated cell death by procedures known in the art. In one
embodiment, a patient's blood or plasma is contacted with TR1
receptor polypeptides of the invention ex vivo. The TR1 receptor
polypeptides may be bound to a suitable chromatography matrix by
procedures known in the art. The patient's blood or plasma flows
through a chromatography column containing TR1 receptor polypeptide
bound to the matrix, before being returned to the patient. The
immobilized TR1 receptor polypeptide binds TRAIL, thus removing
TRAIL protein from the patient's blood.
In additional embodiments a TR1 receptor polynucleotide,
polypeptide, agonist or antagonist of the invention is administered
in combination with other inhibitors of T cell apoptosis. For
example, as discussed above, Fas-mediated apoptosis also has been
implicated in loss of T cells in HIV individuals (Katsikis et al.,
J. Exp. Med. 181:2029 2036 (1995)). Thus, a patient susceptible to
both Fas ligand mediated and TRAIL mediated T cell death may be
treated with both an agent that blocks TRAIL/TRAIL receptor
interactions and an agent that blocks Fas-ligand/Fas interactions.
Suitable agents for blocking binding of Fas-ligand to Fas include,
but are not limited to, soluble Fas polypeptides; mulitmeric forms
of soluble Fas polypeptides (e.g., dimers of sFas/Fc); anti-Fas
antibodies that bind Fas without transducing the biological signal
that results in apoptosis; anti-Fas-ligand antibodies that block
binding of Fas-ligand to Fas; and muteins of Fas-ligand that bind
Fas but do not transduce the biological signal that results in
apoptosis. Preferably, the antibodies employed according to this
method are monoclonal antibodies. Examples of suitable agents for
blocking Fas-ligand/Fas interactions, including blocking anti-Fas
monoclonal antibodies, are described in International application
publication number WO 95/10540, hereby incorporated by
reference.
In another example, agents, which block binding of TRAIL to a TRAIL
receptor, are administered with the TR1 receptor polynucleotides,
polypeptides, agonists, or antagonists of the invention. Such
agents include, but are not limited to, soluble TRAIL receptor
polypeptides (e.g., DR4 (International application publication
number WO 98/32856); TR5 (International application publication
number WO 98/30693); DR5 (International application publication
number WO 98/41629); and TR10 (International application
publication number WO 98/54202)); multimeric forms of soluble TRAIL
receptor polypeptides; and TRAIL receptor antibodies that bind the
TRAIL receptor without transducing the biological signal that
results in apoptosis, anti-TRAIL antibodies that block binding of
TRAIL to one or more TRAIL receptors, and muteins of TRAIL that
bind TRAIL receptors but do not transduce the biological signal
that results in apoptosis. Preferably, the antibodies employed
according to this method are monoclonal antibodies.
Cardiovascular Disorders
TR1 receptor polynucleotides, polypeptides, agonists, or
antagonists of the invention may be used to treat cardiovascular
disorders, including peripheral artery disease, such as limb
ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such
as arterio-arterial fistula, arteriovenous fistula, cerebral
arteriovenous malformations, congenital heart defects, pulmonary
atresia, and Scimitar Syndrome. Congenital heart defects include
aortic coarctation, cor triatriatum, coronary vessel anomalies,
crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's
anomaly, Eisenmenger complex, hypoplastic left heart syndrome,
levocardia, tetralogy of fallot, transposition of great vessels,
double outlet right ventricle, tricuspid atresia, persistent
truncus arteriosus, and heart septal defects, such as
aortopulmonary septal defect, endocardial cushion defects,
Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal
defects.
Cardiovascular disorders also include heart disease, such as
arrhythmias, carcinoid heart disease, high cardiac output, low
cardiac output, cardiac tamponade, endocarditis (including
bacterial), heart aneurysm, cardiac arrest, congestive heart
failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac
edema, heart hypertrophy, congestive cardiomyopathy, left
ventricular hypertrophy, right ventricular hypertrophy,
post-infarction heart rupture, ventricular septal rupture, heart
valve diseases, myocardial diseases, myocardial ischemia,
pericardial effusion, pericarditis (including constrictive and
tuberculous), pneumopericardium, postpericardiotomy syndrome,
pulmonary heart disease, rheumatic heart disease, ventricular
dysfunction, hyperemia, cardiovascular pregnancy complications,
Scimitar Syndrome, cardiovascular syphilis, and cardiovascular
tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial
flutter, bradycardia, extrasystole, Adams-Stokes Syndrome,
bundle-branch block, sinoatrial block, long QT syndrome,
parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type
pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus
syndrome, tachycardias, and ventricular fibrillation. Tachycardias
include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia, ectopic atrial tachycardia, ectopic junctional
tachycardia, sinoatrial nodal reentry tachycardia, sinus
tachycardia, Torsades de Pointes, and ventricular tachycardia.
Heart valve disease include aortic valve insufficiency, aortic
valve stenosis, hear murmurs, aortic valve prolapse, mitral valve
prolapse, tricuspid valve prolapse, mitral valve insufficiency,
mitral valve stenosis, pulmonary atresia, pulmonary valve
insufficiency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular
stenosis, pulmonary subvalvular stenosis, restrictive
cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion
injury, and myocarditis.
Myocardial ischemias include coronary disease, such as angina
pectoris, coronary aneurysm, coronary arteriosclerosis, coronary
thrombosis, coronary vasospasm, myocardial infarction and
myocardial stunning.
Cardiovascular diseases also include vascular diseases such as
aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular disorders, diabetic angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids,
hepatic veno-occlusive disease, hypertension, hypotension,
ischemia, peripheral vascular diseases, phlebitis, pulmonary
veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein occlusion, Scimitar syndrome, superior vena cava syndrome,
telangiectasia, atacia telangiectasia, hereditary hemorrhagic
telangiectasia, varicocele, varicose veins, varicose ulcer,
vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected
aneurysms, ruptured aneurysms, aortic aneurysms, cerebral
aneurysms, coronary aneurysms, heart aneurysms, and iliac
aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid stenosis, fibromuscular dysplasias,
mesenteric vascular occlusion, Moyamoya disease, renal artery
obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
Cerebrovascular disorders include carotid artery diseases, cerebral
amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral
arteriosclerosis, cerebral arteriovenous malformation, cerebral
artery diseases, cerebral embolism and thrombosis, carotid artery
thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral
hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid
hemorrhage, cerebral infarction, cerebral ischemia (including
transient), subclavian steal syndrome, periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms,
cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary
embolisms, and thromoboembolisms. Thrombosis include coronary
thrombosis, hepatic vein thrombosis, retinal vein occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
and thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment
syndromes, anterior compartment syndrome, myocardial ischemia,
reperfusion injuries, and peripheral limb ischemia. Vasculitis
includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss
Syndrome, mucocutaneous lymph node syndrome, thromboangiitis
obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura,
allergic cutaneous vasculitis, and Wegener's granulomatosis.
In one embodiment, a TR1 receptor polynucleotide, polypeptide,
agonist, or antagonist of the invention is used to treat thrombotic
microangiopathies. One such disorder is thrombotic thrombocytopenic
purpura (TTP) (Kwaan, H. C., Semin. Hematol 24:71 (1987); Thompson
et al., Blood 80:1890 (1992)). Increasing TTP-associated mortality
rates have been reported by the U.S. Centers for Disease Control
(Torok et al., Am. J. Hematol. 50:84 (1995)). Plasma from patients
afflicted with TTP (including HIV+ and HIV- patients) induces
apoptosis of human endothelial cells of dermal microvascular
origin, but not large vessel origin (Laurence et al., Blood 87:3245
(1996)). Plasma of TTP patients thus is thought to contain one or
more factors that directly or indirectly induce apoptosis. Another
thrombotic microangiopathy is hemolytic-uremic syndrome (HUS)
(Moake, J. L., Lancet, 343:393, 1994; Melnyk et al., (Arch. Intern.
Med, 155:2077, 1995; Thompson et al., supra). Thus, in one
embodiment, the invention is directed to use of TR1 receptor to
treat the condition that is often referred to as "adult HUS" (even
though it can strike children as well). A disorder known as
childhood/diarrhea-associated HUS differs in etiology from adult
HUS. In another embodiment, conditions characterized by clotting of
small blood vessels may be treated using TR1 receptor. Such
conditions include, but are not limited to, those described herein.
For example, cardiac problems seen in about 5 10% of pediatric AIDS
patients are believed to involve clotting of small blood vessels.
Breakdown of the microvasculature in the heart has been reported in
multiple sclerosis patients. As a further example, treatment of
systemic lupus erythematosus (SLE) is contemplated. In one
embodiment, a patient's blood or plasma is contacted with TR1
receptor polypeptides of the invention ex vivo. The TR1 receptor
polypeptides of the invention may be bound to a suitable
chromatography matrix by procedures known in the art. According to
this embodiment, the patient's blood or plasma flows through a
chromatography column containing TR1 receptor polynucleotides
and/or polypeptides of the invention bound to the matrix, before
being returned to the patient. The immobilized TR1 receptor binds
TRAIL, thus removing TRAIL protein from the patient's blood.
Alternatively, TR1 receptor polynucleotides, polypeptides, agonists
or antagonists of the invention may be administered in vivo to a
patient afflicted with a thrombotic microangiopathy. In one
embodiment, a soluble form of TR1 receptor polypeptide of the
invention is administered to the patient. Thus, the present
invention provides a method for treating a thrombotic
microangiopathy, involving use of an effective amount of TR1
receptor polynucleotide, polypeptide, agoniss or antagonist. A TR1
receptor polypeptide may be employed in in vivo or ex vivo
procedures, to inhibit TRAIL-mediated damage to (e.g., apoptosis
of) microvascular endothelial cells.
TR1 receptor polynucleotides, polypeptides, agonists or antagonists
of the invention may be employed in combination with other agents
useful in treating a particular disorder. For example, in an in
vitro study reported by Laurence et al. (Blood 87:3245 (1996)),
some reduction of TTP plasma-mediated apoptosis of microvascular
endothelial cells was achieved by using an anti-Fas blocking
antibody, aurintricarboxylic acid, or normal plasma depleted of
cryoprecipitate. Thus, a patient may be treated with a
polynucleotide and/or polypeptide of the invention in combination
with an agent that inhibits Fas-ligand-mediated apoptosis of
endothelial cells, such as, for example, an agent described above.
In one embodiment, a TR1 receptor polynucleotide, polypeptide,
agonist or antagonist, and an anti-FAS blocking antibody are both
administered to a patient afflicted with a disorder characterized
by thrombotic microanglopathy, such as TTP or HUS. Examples of
blocking monoclonal antibodies directed against Fas antigen (CD95)
are described in International patent application publication
number WO 95/10540, hereby incorporated by reference.
The naturally occurring balance between endogenous stimulators and
inhibitors of angiogenesis is one in which inhibitory influences
predominate. Rastinejad et al., Cell 56:345 355 (1989). In those
rare instances in which neovascularization occurs under normal
physiological conditions, such as wound healing, organ
regeneration, embryonic development, and female reproductive
processes, angiogenesis is stringently regulated and spatially and
temporally delimited. Under conditions of pathological angiogenesis
such as that characterizing solid tumor growth, these regulatory
controls fail. Unregulated angiogenesis becomes pathologic and
sustains progression of many neoplastic and non-neoplastic
diseases. A number of serious diseases are dominated by abnormal
neovascularization including solid tumor growth and metastases,
arthritis, some types of eye disorders, and psoriasis. See, e.g.,
reviews by Moses et al., Biotech. 9:630 634 (1991); Folkman et al.,
N. Engl. J. Med., 333:1757 1763 (1995); Auerbach et al., J.
Microvasc. Res. 29:401 411 (1985); Folkman, Advances in Cancer
Research, eds. Klein and Weinhouse, Academic Press, New York, pp.
175 203 (1985); Patz, Am. J. Opthalmol. 94:715 743 (1982); and
Folkman et al, Science 221:719 725 (1983). In a number of
pathological conditions, the process of angiogenesis contributes to
the disease state. For example, significant data have accumulated
which suggest that the growth of solid tumors is dependent on
angiogenesis. Folkman and Klagsbrun, Science 235:442 447
(1987).
The present invention provides for treatment of diseases or
disorders associated with neovascularization by administration of
the TR1 receptor polynucleotides and/or polypeptides of the
invention (including TR1 receptor agonists and/or antagonists).
Malignant and metastatic conditions which can be treated with the
polynucleotides and polypeptides of the invention include, but are
not limited to those malignancies, solid tumors, and cancers
described herein and otherwise known in the art (for a review of
such disorders, see Fishman et al., Medicine, 2d Ed., J. B.
Lippincott Co., Philadelphia (1985)).
Additionally, ocular disorders associated with neovascularization
which can be treated with the TR1 receptor polynucleotides and
polypeptides of the present invention (including TR1 receptor
agonists and TR1 receptor antagonists) include, but are not limited
to: neovascular glaucoma, diabetic retinopathy, retinoblastoma,
retrolental fibroplasia, uveitis, retinopathy of prematurity
macular degeneration, corneal graft neovascularization, as well as
other eye inflammatory diseases, ocular tumors and diseases
associated with choroidal or iris neovascularization. See, e.g.,
reviews by Waltman et al., Am. J. Ophthal. 85:704 710 (1978) and
Gartner et al., Surv. Ophthal. 22:291 312 (1978).
Additionally, disorders which can be treated with the TR1 receptor
polynucleotides and polypeptides of the present invention
(including TR1 receptor agonists and TR1 receptor antagonists)
include, but are not limited to, hemangioma, arthritis, psoriasis,
angiofibroma, atherosclerotic plaques, delayed wound healing,
granulations, hemophilic joints, hypertrophic scars, nonunion
fractures, Osler-Weber syndrome, pyogenic granuloma, scleroderma,
trachoma, and vascular adhesions.
TR1 receptor: Use in Diagnosis, Prognosis, Treatment, or
Prevention
Polynucleotides and/or polypeptides of the invention, and/or
agonists and/or antagonists thereof, are useful in the diagnosis,
prognosis, treatment or prevention of a wide range of diseases
and/or conditions. Such diseases and conditions include, but are
not limited to, cancer (e.g., immune cell related cancers, breast
cancer, prostate cancer, ovarian cancer, follicular lymphoma,
glioblastoma, cancer associated with mutation or alteration of p53,
brain tumor, bladder cancer, uterocervical cancer, colon cancer,
colorectal cancer, non-small cell carcinoma of the lung, small cell
carcinoma of the lung, stomach cancer, etc.), lymphoproliferative
disorders (e.g., lymphadenopathy and lymphomas (e.g., EBVinduced
lymphoproliferations and Hodgkin's disease), microbial (e.g.,
viral, bacterial, etc.) infection (e.g., HIV-1 infection, HIV-2
infection, herpesvirus infection (including, but not limited to,
HSV-1, HSV-2, CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection,
poxvirus infection, human papilloma virus infection, hepatitis
infection (e.g., HAV, HBV, HCV, etc.), Helicobacter pylori
infection, invasive Staphylococcia, etc.), parasitic infection,
nephritis, bone disease (e.g., osteoporosis), atherosclerosis,
pain, cardiovascular disorders (e.g., neovascularization,
hypovascularization or reduced circulation (e.g., ischemic disease
(e.g., myocardial infarction, stroke, etc.)), AIDS, allergy,
inflammation, neurodegenerative disease (e.g., Alzheimer's disease,
Parkinson's disease, amyotrophic lateral sclerosis, pigmentary
retinitis, cerebellar degeneration, etc.), graft rejection (acute
and chronic), graft vs. host disease, diseases due to
osteomyelodysplasia (e.g., aplastic anemia, etc.), joint tissue
destruction in rheumatism, liver disease (e.g., acute and chronic
hepatitis, liver injury, and cirrhosis), autoimmune disease (e.g.,
multiple sclerosis, myasthenia gravis, rheumatoid arthritis,
systemic lupus erythematosus, immune complex glomerulonephritis,
autoimmune diabetes, autoimmune thrombocytopenic purpura, Grave's
disease, Hashimoto's thyroiditis, inflammatory autoimmune diseases,
etc.), cardiomyopathy (e.g., dilated cardiomyopathy), diabetes,
diabetic complications (e.g., diabetic nephropathy, diabetic
neuropathy, diabetic retinopathy), influenza, asthma, psoriasis,
glomerulonephritis, septic shock, and ulcerative colitis.
Polynucleotides and/or polypeptides of the invention and/or
agonists and/or antagonists thereof are useful in promoting
angiogenesis, wound healing (e.g., wounds, burns, and bone
fractures), and regulating bone formation and treating
osteoporosis.
Polynucleotides and/or polypeptides of the invention and/or
agonists and/or antagonists thereof are also useful as an adjuvant
to enhance immune responsiveness to specific antigen and/or
anti-viral immune responses.
More generally, polynucleotides and/or polypeptides of the
invention and/or agonists and/or antagonists thereof are useful in
regulating (i.e., elevating or reducing) immune response. For
example, polynucleotides and/or polypeptides of the invention may
be useful in preparation or recovery from surgery, trauma,
radiation therapy, chemotherapy, and transplantation, or may be
used to boost immune response and/or recovery in the elderly and
immunocompromised individuals. Alternatively, polynucleotides
and/or polypeptides of the invention and/or agonists and/or
antagonists thereof are useful as immunosuppressive agents, for
example in the treatment or prevention of autoimmune disorders or
in the prevention of transplant rejection. In specific embodiments,
polynucleotides and/or polypeptides of the invention are used to
treat or prevent chronic inflammatory, allergic or autoimmune
conditions, such as those described herein or are otherwise known
in the art.
TR1 Receptor: Use for Screening for Agonists and Antagonists of TR1
Receptor Function
In one aspect, the present invention is directed to a method for
enhancing an activity (e.g., cell proliferation, hematopoietic
development, apoptosis) of a TR1 receptor of the present invention,
which involves administering to a cell which expresses a TR1
receptor polypeptide an effective amount of an agonist capable of
increasing TR1 receptor mediated signaling. Preferably, TR1
receptor mediated signaling is increased to treat a disease.
In a further aspect, the present invention is directed to a method
for inhibiting an activity of a TR1 receptor of the present
invention, which involves administering to a cell which expresses
the TR1 receptor polypeptide an effective amount of an antagonist
capable of decreasing TR1 receptor mediated signaling. Preferably,
TR1 receptor mediated signaling is decreased to also treat a
disease.
By "agonist" is intended naturally occurring and synthetic
compounds capable of enhancing or potentiating an activity of a TR1
receptor of the present invention. By "antagonist" is intended
naturally occurring and synthetic compounds capable of inhibiting
an activity of a TR1 receptor. Whether any candidate "agonist" or
"antagonist" of the present invention can enhance or inhibit an
activity can be determined using art-known TR1-family
ligand/receptor cellular response assays, including those described
in more detail below.
Another method involves screening for compounds which inhibit
activation of the receptor polypeptide of the present invention by
determining inhibition of binding of labeled ligand to cells which
have the receptor on the surface thereof. Such a method would be
especially useful for a TR1 receptor of the present invention which
includes a transmembrane spanning amino acid sequence and involves
transfecting a eukaryotic cell with DNA encoding the receptor such
that the cell expresses the receptor on its surface and contacting
the cell with a compound in the presence of a labeled form of a
known ligand. The ligand can be labeled, e.g., by radioactivity.
The amount of labeled ligand bound to the receptors is measured,
e.g., by measuring radioactivity of the receptors. If the compound
binds to the receptor as determined by a reduction of labeled
ligand which binds to the receptors, the binding of labeled ligand
to the receptor is inhibited.
Further screening assays for agonist and antagonist of the present
invention are described in Tartaglia and Goeddel, J. Biol. Chem.
267:4304 4307(1992)).
Thus, in a further aspect, a screening method is provided for
determining whether a candidate agonist or antagonist is capable of
enhancing or inhibiting a cellular response to a TR1 receptor
ligand. The method involves contacting cells which express the TR1
receptor polypeptide with a candidate compound and a ligand,
assaying a cellular response, and comparing the cellular response
to a standard cellular response, the standard being assayed when
contact is made with the ligand in absence of the candidate
compound, whereby an increased cellular response over the standard
indicates that the candidate compound is an agonist of the
ligand/receptor signaling pathway and a decreased cellular response
compared to the standard indicates that the candidate compound is
an antagonist of the ligand/receptor signaling pathway. By
"assaying a cellular response" is intended qualitatively or
quantitatively measuring a cellular response to a candidate
compound and/or a TR1 receptor ligand (e.g., determining or
estimating an increase or decrease in T-cell proliferation or
tritiated thymidine labeling). By the invention, a cell expressing
the TR1 receptor polypeptide can be contacted with either an
endogenous or exogenously administered receptor ligand.
Agonists according to the present invention include naturally
occurring and synthetic compounds such as, for example, TNF family
ligand peptide fragments, transforming growth factor .beta.,
neurotransmitters (such as glutamate, dopamine,
N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T-cells
and antimetabolites. Preferred agonists include chemotherapeutic
drugs such as, for example, cisplatin, doxorubicin, bleomycin,
cytosine arabinoside, nitrogen mustard, methotrexate and
vincristine. Others include ethanol and .beta.-amyloid peptide
(Science 267:1457 1458 (1995)). Further preferred agonists include
polygonal and monoclonal antibodies raised against the TR1 receptor
polypeptide, or a fragment thereof. Such agonist antibodies raised
against a TNF-family receptors are disclosed in Tartaglia et al.,
Proc. Natl. Acad. Sci. USA 88:9292 9296(1991); and Tartaglia and
Goeddel, J. Biol. Chem. 267(7):4304 4307(1992) See, also, PCT
Application WO 94/09137.
Antagonist according to the present invention include naturally
occurring and synthetic compounds such as, for example, the CD40
ligand, neutral amino acids, zinc, estrogen, androgens, viral genes
(such as Adenovirus E1B, Baculovirus p35 and IAP, Cowpox virus
crmA, Epstein-Barr virus BHRF1, LMP-1, African swine fever virus
LMW5-HL, and Herpesvirus .gamma.1 34.5), calpain inhibitors,
cysteine protease inhibitors, and tumor promoters (such as PMA,
Phenobarbital, and .alpha.-Hexachlorocyclohexane). Other
antagonists include polyclonal and monoclonal antagonist antibodies
raised against the TR1 receptor polypeptides or a fragment thereof.
Such antagonist antibodies raised against a TNF-family receptor are
described in Tartaglia and Goeddel, J. Biol. Chem. 267(7):4304
4307(1992)); and Tartaglia et al., Cell 73:213 216 (1993). See,
also, PCT Application WO 94/09137.
Other potential antagonists include antisense molecules. Antisense
technology can be used to control gene expression through antisense
DNA or RNA or through triple-helix formation. Antisense techniques
are discussed, for example, in Okano, J. Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1360 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes
the mature polypeptide of the present invention may be used to
design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide. The oligonucleotides described above can also be
delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of the receptor.
In specific embodiments, antagonists according to the present
invention are nucleic acids corresponding to the sequences
contained in TR1, or the complementary strand thereof, and/or to
nucleotide sequences contained in the deposited clone. In one
embodiment, antisense sequence is generated internally by the
organism, in another embodiment, the antisense sequence is
separately administered (see, for example, O'Connor, J., Neurochem.
56:560 (1991). Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988). Antisense
technology can be used to control gene expression through antisense
DNA or RNA, or through triple-helix formation. Antisense techniques
are discussed for example, in Okano, J. Neurochem. 56:560 (1991),
"Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,"
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance, Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1300 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes
the mature polypeptide of the present invention may be used to
design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
In one embodiment, the TR1 antisense nucleic acid of the invention
is produced intracellularly by transcription from an exogenous
sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the TR1
antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by standard recombinant DNA technology methods. Vectors can be
plasmid, viral, or others known in the art, which used for
replication and expression in vertebrate cells. Expression of the
sequence encoding TR1, or fragments thereof, can be by any promoter
known to act in vertebrate, preferably human cells. Such promoters
can be inducible or constitutive. Such promoters include, but are
not limited to, the SV40 early promoter region (Bernoist and
Chambon, Nature 29:304 310 (1981), the promoter contained in the 3'
long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell
22:787 797 (1980), the herpes thymidine kinase promoter (Wagner et.
al., Proc. Natl. Acad. Sci. U.S.A. 78:1 441 1445 (1981), the
regulatory sequences of the metallothionein gene (Brinster, et al.,
Nature 296:39 42 (1982)), etc.
The antisense nucleic acids of the invention comprise a sequence
complementary to at least a portion of an RNA transcript of a TR1
gene. However, absolute complementarity, although preferred, is not
required. A sequence "complementary to at least a portion of an
RNA," referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex; in the case of double stranded TR1 antisense nucleic
acids, a single strand of the duplex DNA may thus be tested, or
triplex formation may be assayed. The ability to hybridize will
depend on both the degree of complementarity and the length of the
antisense nucleic acid. Generally, the larger the hybridizing
nucleic acid, the more base mismatches with a TR1 RNA it may
contain and still form a stable duplex (or triplex as the case may
be). One skilled in the art can ascertain a tolerable degree of
mismatch by determining the melting point of the hybridized complex
using standard procedures.
Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333 335. Thus, oligonucleotides complementary to
either the 5'- or 3'-untranslated regions of the TR1 shown in FIG.
1 (SEQ ID NO:2) or FIG. 2 (SEQ ID NO:4) could be used in an
antisense approach to inhibit translation of endogenous TR1 mRNA.
Oligonucleotides complementary to the 5' untranslated region of the
mRNA should include the complement of the AUG start codon.
Antisense oligonucleotides complementary to protein coding regions
are less efficient inhibitors of translation but could be used in
accordance with the invention. Whether designed to hybridize to the
5'-, 3'- or protein coding region of TR1 mRNA, antisense nucleic
acids should be at least six nucleotides in length, and preferably
range from 6 to about 50 nucleotides in length. In specific aspects
the oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50 nucleotides
long.
The polynucleotides of the invention can be DNA, RNA or chimeric
mixtures, or derivatives or modified versions thereof, and can be
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo); agents
facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553 6556;
Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648 652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988); hybridization-triggered cleavage agents
(see, e.g., Krol et al., 1988, BioTechniques 6:958 976); or
intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539 549).
To this end, the oligonucleotide may be conjugated to another
molecule, (e.g., a peptide, hybridization triggered cross-linking
agent, transport agent, hybridization-triggered cleavage agent,
etc.).
The antisense oligonucleotide may comprise at least one modified
base moiety which is selected from the group including, but not
limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose and hexose.
In yet another embodiment, the antisense oligonucleotide comprises
at least one modified phosphate backbone selected from the group
including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an
.alpha.-anomeric oligonucleotide. An .alpha.-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids
Res. 15:6625 6641 (1987)). The oligonucleotide is a
2'-O-methylribonucleotide (Inoue et al., Nucl. Acids Res. 15:6131
6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al., FEBS
Lett. 215:327 330 (1987)).
Polynucleotides of the invention may be synthesized by standard
methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(Nucl. Acids Res. 16:3209 (1988)), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A.
85:7448 7451 (1988)), etc.
While antisense nucleotides complementary to the TR1 coding region
sequence could be used, those complementary to the transcribed
untranslated region are most preferred.
Potential antagonists according to the invention also include
catalytic RNA or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, published Oct. 4, 1990; Sarver et al.,
Science 247:1222 1225 (1990)). While ribozymes that cleave mRNA at
site specific recognition sequences can be used to destroy TR1
mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead
ribozymes cleave mRNAs at locations dictated by flanking regions
that form complementary base pairs with the target mRNA. The sole
requirement is that the target mRNA have the following sequence of
two bases: 5'-UG-3'. The construction and production of hammerhead
ribozymes is well known in the art and is described more fully in
Haseloff and Gerlach, Nature 334:585 591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of TR1 (FIG. 1 and FIG. 2). Preferably, the ribozyme is
engineered so that the cleavage recognition site is located near
the 5' end of the TR1 mRNA; i.e., to increase efficiency and
minimize the intracellular accumulation of non-functional mRNA
transcripts.
As in the antisense approach, the ribozymes of the invention can be
composed of modified oligonucleotides (e.g., for improved
stability, targeting, etc.) and should be delivered to cells which
express TR1 in vivo. DNA constructs encoding the ribozyme may be
introduced into the cell in the same manner as described above for
the introduction of antisense encoding DNA. A preferred method of
delivery involves using a DNA construct encoding the ribozyme under
the control of a strong constitutive promoter, (for example, pol
III or pol II promoter), so that transfected cells will produce
sufficient quantities of the ribozyme to destroy endogenous TR1
messages and inhibit translation. Since ribozymes, unlike antisense
molecules, are catalytic, a lower intracellular concentration is
required for efficiency.
Endogenous gene expression can also be reduced by inactivating or
"knocking out" the TR1 gene and/or its promoter using targeted
homologous recombination. (see, e.g., Smithies et al., Nature
317:230 234 (1985); Thomas & Capecchi, Cell 51:503 512(1987);
Thompson et al., Cell 5:313 321 (1989), each of which is
incorporated by reference herein in its entirety). For example, a
mutant, non-functional polynucleotide of the invention (or a
completely unrelated DNA sequence) flanked by DNA homologous to the
endogenous TR1 polynucleotide sequence (either the coding regions
or regulatory regions of the gene) can be used, with or without a
selectable marker and/or a negative selectable marker, to transfect
cells that express polypeptides of the invention in vivo. In
another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agriculture where modifications to embryonic stem cells can be used
to generate animal offspring with an inactive targeted gene (see,
e.g., Thomas & Capecchi 1987 and Thompson 1989, supra). However
this approach can be routinely adapted for use in humans provided
the recombinant DNA constructs are targeted to the required site in
vivo using appropriate viral vectors as will be apparent to those
of skill in the art. The contents of each of the documents recited
in this paragraph is herein incorporated by reference in its
entirety.
In other embodiments, antagonists according to the present
invention include soluble forms of TR1 (e.g., fragments of the TR1
shown in FIGS. 1 and 2 that include the ligand binding domain of
TR1). Such soluble forms of TR1, which may be naturally occurring
or synthetic, antagonize TR1 mediated signaling by competing with
the cell surface forms of the TR1 receptor for binding to
TNF-family ligands. Antagonists of the present invention also
include antibodies specific for TNF-family ligands and TR1-Fc
fusion proteins.
By a "TNF-family ligand" is intended naturally occurring,
recombinant, and synthetic ligands that are capable of binding to a
member of the TNF receptor family and inducing and/or blocking the
ligand/receptor signaling pathway. Members of the TNF ligand family
include, but are not limited to, TNF-.alpha., lymphotoxin-.alpha.
(LT-.alpha., also known as TNF-.beta.), LT-.beta. (found in complex
heterotrimer LT-.alpha.2-.beta.), FasL, CD40L, CD27L, CD30L,
4-1BBL, OX40L and nerve growth factor (NGF).
Further antagonist according to the present invention include
soluble TR1 receptor fragments, e.g., TR1 receptor fragments that
include the ligand binding domain from the extracellular region of
the full length receptor. Such soluble forms of the receptor, which
may be naturally occurring or synthetic, antagonize TR1 receptor
mediated signaling by competing with the cell surface forms of the
TR1 receptor for binding to TNF-family ligands. Thus, such
antagonists include soluble forms of the receptor that contain the
ligand binding domains of the polypeptides of the present
invention.
The invention further relates to antibodies which act as agonists
or antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
receptor/ligand interactions of the polypeptides of the invention
either partially or fully. Included are both receptor-specific
antibodies and ligand-specific antibodies. Included are
receptor-specific antibodies which do not prevent ligand binding
but which prevent receptor activation. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. Also included are receptor-specific
antibodies which prevent both ligand binding and receptor
activation. Likewise included are neutralizing antibodies which
bind the ligand and prevent ligand-receptor binding, as well as
antibodies which bind the ligand and thereby prevent receptor
activation, but which do not prevent ligand-receptor binding.
Further included are antibodies which activate the receptor. These
antibodies may act as agonists for either all or fewer than all of
the biological activities affected by ligand-mediated receptor
activation. The antibodies may be specified as agonists or
antagonists for biological activities comprising specific
activities disclosed herein. The above antibody agonists can be
made using methods known in the art. See, e.g., WO 96/40281; U.S.
Pat. No. 5,811,097; Deng, B. et al., Blood 92:1981 1988 (1998);
Chen, Z. et al., Cancer Res. 58:3668 3678 (1998); Harrop, J. A. et
al., J. Immunol. 161:1786 1794 (1998); Zhu, Z. et al., Cancer Rev.
58:3209 3214 (1998); Yoon, D. Y. et al., J. Immunol 160:3170 3179
(1998); Prat, M. et al., J. Cell. Sci. 111(Pt2):237 247 (1998);
Pitard, V. et al., J. Immunol Methods 205:177 190(1997); Liautard,
J. et al., Cytokine 9(4):233 241 (1997); Carlson, N. G. et al., J.
Biol. Chem. 272:11295 11301 (1997); Taryman, R. E. et al., Neuron
14:755 762 (1995); Muller, Y. A. et al., Structure 6:1153 1167
(1998); Bartunek, P. et al., Cytokine 8:14 20 (1996)(said
references incorporated by reference in their entireties).
Antibodies according to the present invention may be prepared by
any of a variety of standard methods using TR1 receptor immunogens
of the present invention. Such TR1 receptor immunogens include the
TR1 receptor protein shown in FIG. 1 (SEQ ID NO:2) and FIG. 2 (SEQ
ID NO:4) (which may or may not include a leader sequence) and
polypeptide fragments of the receptor comprising the ligand binding
domain.
Polyclonal and monoclonal antibody agonists or antagonists
according to the present invention can be raised according to the
methods disclosed herein and and/or known in the art, such as, for
example, those methods described in Tartaglia and Goeddel, J. Biol.
Chem. 267:4304 4307(1992)); Tartaglia et al., Cell 73:213 216
(1993)), and PCT Application WO 94/09137 (the contents of each of
these three applications are herein incorporated by reference in
their entireties), and are preferably specific to polypeptides of
the invention having the amino acid sequence of SEQ ID NOS: 2
and/or 4.
As indicated polyclonal and monoclonal antibody agonists or
antagonists according to the present invention can be raised
according to the methods disclosed in Tartaglia and Goeddel, J.
Biol. Chem. 267:4304 4307(1992)); Tartaglia et al., Cell 73:213 216
(1993)), and PCT Application WO 94/09137. The term "antibody" (Ab)
or "monoclonal antibody" (mAb) as used herein is meant to include
intact molecules as well as fragments thereof (such as, for
example, Fab and F(ab').sub.2 fragments) which are capable of
binding an antigen. Fab and F(ab').sub.2 fragments lack the Fc
fragment of intact antibody, clear more rapidly from the
circulation, and may have less non-specific tissue binding of an
intact antibody (Wahl et al., J. Nucl. Med. 24:316 325 (1983)).
Antibodies according to the present invention may be prepared by
any of a variety of methods using TR1 receptor immunogens of the
present invention. As indicated, such TR1 receptor immunogens
include the full length TR1 receptor polypeptide (which may or may
not include the leader sequence) and TR1 receptor polypeptide
fragments such as the ligand binding domain, the extracellular
domain and the intracellular domain.
In a preferred method, antibodies according to the present
invention are mAbs. Such mAbs can be prepared using hybridoma
technology (Kohler and Millstein, Nature 256:495 497 (1975) and
U.S. Pat. No. 4,376,110; Harlow et al., Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 1988; Monoclonal Antibodies and hybridomas: A New Dimension
in Biological Analyses, Plenum Press, New York, N.Y., 1980;
Campbell, "Monoclonal Antibody Technology," In: Laboratory
Techniques in Biochemistry and Molecular Biology, Volume 13 (Burdon
et al., eds.), Elsevier, Amsterdam (1984)).
Thymocytes, which have been shown to express the TR1 receptor of
the present invention, can be used in a proliferation assay to
identify both ligands and potential agonists and antagonists to the
polypeptide of the present invention. For example, thymus cells are
disaggregated from tissue and grown in culture medium.
Incorporation of DNA precursors such as .sup.3H-thymidine or
5-bromo-2'-deoxyuridine (BrdU) is monitored as a parameter for DNA
synthesis and cellular proliferation. Cells which have incorporated
BrdU into DNA can be detected using a monoclonal antibody against
BrdU and measured by an enzyme or fluorochrome-conjugated second
antibody. The reaction is quantitated by fluorimetry or by
spectrophotometry. Two control wells and an experimental well are
set up. TNF-.beta. is added to all wells, while soluble receptors
of the present invention are added to the experimental well. Also
added to the experimental well is a compound to be screened. The
ability of the compound to be screened to inhibit the interaction
of TNF-.beta. with the receptor polypeptides of the present
invention may then be quantified. In the case of the agonists, the
ability of the compound to enhance this interaction is
quantified.
A determination may be made whether a ligand not known to be
capable of binding to the polypeptide of the present invention can
bind thereto comprising contacting a mammalian cell comprising an
isolated molecule encoding a polypeptide of the present invention
with a ligand under conditions permitting binding of ligands known
to bind thereto, detecting the presence of any bound ligand, and
thereby determining whether such ligands bind to a polypeptide of
the present invention. Also, a soluble form of the receptor may
utilized in the above assay where it is secreted in to the
extra-cellular medium and contacted with ligands to determine which
will bind to the soluble form of the receptor.
Other agonist and antagonist screening procedures involve providing
appropriate cells which express the receptor on the surface
thereof. In particular, a polynucleotide encoding a polypeptide of
the present invention is employed to transfect cells to thereby
express the polypeptide. Such transfection may be accomplished by
procedures as hereinabove described.
Thus, for example, such assay may be employed for screening for a
receptor antagonist by contacting the cells which encode the
polypeptide of the present invention with both the receptor ligand
and a compound to be screened. Inhibition of the signal generated
by the ligand indicates that a compound is a potential antagonist
for the receptor, i.e., inhibits activation of the receptor.
Proteins and other compounds which bind the TR1 receptor domains
are also candidate agonist and antagonist according to the present
invention. Such binding compounds can be "captured" using the yeast
two-hybrid system (Fields and Song, Nature 340:245 246 (1989). A
modified version of the yeast two-hybrid system has been described
by Roger Brent and his colleagues (Gyuris, et al., Cell 75:791 803
(1993), Zervos, et al., Cell 72:223 232 (1993)). Briefly, a domain
of the TR1 receptor polypeptide is used as bait for binding
compounds. Positives are then selected by their ability to grow on
plates lacking leucine, and then further tested for their ability
to turn blue on plates with X-gal, as previously described in great
detail (Gyuris, et al., supra). Preferably, the yeast two-hybrid
system is used according to the present invention to capture
compounds which bind to either the TR1 receptor ligand binding
domain or to the TR1 receptor intracellular domain. Such compounds
are good candidate agonist and antagonist of the present invention.
This system has been used previously to isolate proteins which bind
to the intracellular domain of the p55 and p75 TNF receptors (WO
95/31544). Once amino acid sequences are identified which bind to
the TR1 receptor, these sequences can be screened for agonist or
antagonist activity using, for example, the thymocyte proliferation
assay described above.
Another assay which can be performed to identify agonists and
antagonists of the TR1 receptors of the present invention involves
the use of combinatorial chemistry to produce random peptides which
then can be screened for both binding affinity the TR1 receptors
and agonistic or antagonistic effects. One such assay has recently
been performed using random peptides expressed on the surface of a
bacteriophage. Wu, Nature Biotechnology 14:429 431. In this
instance, a phage display library was produced which displayed a
vast array of peptides on the surface of the phage. The phage of
this library were then injected into mice and phage expressing
peptides which bound to various organs were then identified. The
DNA contained in the phage bound to the organs was then sequenced
to identify peptide motifs which are capable of interacting with
the surfaces of cells in each organ. One skilled in the art would
recognize that such a random peptide library could also be screened
for motifs which bind to the surface of the TR1 receptors of the
present invention. After such motifs are identified, these peptides
can then be screened for agonistic or antagonistic activity using
the assays described herein.
Other screening techniques include the use of cells which express
the polypeptide of the present invention (for example, transfected
CHO cells) in a system which measures extracellular pH changes
caused by receptor activation, for example, as described in
Science, 246:181 296 (1989). In another example, potential agonists
or antagonists may be contacted with a cell which expresses the
polypeptide of the present invention and a second messenger
response, e.g., signal transduction may be measured to determine
whether the potential antagonist or agonist is effective.
TR1 receptor antagonists also include a small molecule which binds
to and occupies the TR1 receptor thereby making the receptor
inaccessible to ligands which bind thereto such that normal
biological activity is prevented. Examples of small molecules
include but are not limited to small peptides or peptide-like
molecules.
The TR1 receptor agonists may be employed to stimulate ligand
activities, such as inhibition of tumor growth and necrosis of
certain transplantable tumors. The agonists may also be employed to
stimulate cellular differentiation, for example, T-cell,
fibroblasts and haemopoietic cell differentiation. Agonists to the
TR1 receptor may also augment TR1's role in the host's defense
against microorganisms and prevent related diseases (infections
such as that from L. monocytogenes) and Chlamidiae. The agonists
may also be employed to protect against the deleterious effects of
ionizing radiation produced during a course of radiotherapy, such
as denaturation of enzymes, lipid peroxidation, and DNA damage.
The agonists may also be employed to mediate an anti-viral
response, to regulate growth, to mediate the immune response and to
treat immunodeficiencies related to diseases such as HIV.
Antagonists to the TR1 receptor may be employed to treat autoimmune
diseases, for example, graft versus host rejection and allograft
rejection, and T-cell mediated autoimmune diseases. It has been
shown that T-cell proliferation is stimulated via a type 2 TNF
receptor. Accordingly, antagonizing the receptor may prevent the
proliferation of T-cells and treat T-cell mediated autoimmune
diseases.
The antagonists may also be employed to prevent apoptosis, which is
the basis for diseases such as viral infection, rheumatoid
arthritis, systemic lupus erythematosus, insulin-dependent diabetes
mellitus, and graft rejection. Similarly, the antagonists may be
employed to prevent cytotoxicity.
The antagonists to the TR1 receptor may also be employed to treat B
cell cancers which are stimulated by TR1.
Antagonists to the TR1 receptor may also be employed to treat
and/or prevent septic shock, which remains a critical clinical
condition. Septic shock results from an exaggerated host response,
mediated by protein factors such as TNF and IL-1, rather than from
a pathogen directly. For example, lipopolysaccharides have been
shown to elicit the release of TNF leading to a strong and
transient increase of its serum concentration. TNF causes shock and
tissue injury when administered in excessive amounts. Accordingly,
it is believed that antagonists to the TR1 receptor will block the
actions of TNF and treat/prevent septic shock. These antagonists
may also be employed to treat meningococcemia in children which
correlates with high serum levels of TNF.
Among other disorders which may be treated by the antagonists to
TR1 receptors, there are included, inflammation which is mediated
by TNF receptor ligands, and the bacterial infections cachexia and
cerebral malaria. The TR1 receptor antagonists may also be employed
to treat inflammation mediated by ligands to the receptor such as
TNF. In addition, TR1 receptors may also be useful for providing
treatment for AIDS in that TNF-.beta. is involved in the
development of lymphocytes.
Therapeutics: Modes of Administration
The soluble TR1 receptor and agonists and antagonists may be
employed in combination with a suitable pharmaceutical carrier.
Such compositions comprise a therapeutically effective amount of
the soluble receptor or agonist or antagonist, and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising
one or more containers filled with one or more of the ingredients
of the pharmaceutical compositions of the invention. Associated
with such container(s) can be a notice in the form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects
approval by the agency of manufacture, use or sale for human
administration. In addition, the soluble form of the receptor and
agonists and antagonists of the present invention may also be
employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient
manner such as by the oral, topical, intravenous, intraperitoneal,
intramuscular, subcutaneous, intranasal or intradermal routes. The
pharmaceutical compositions are administered in an amount which is
effective for treating and/or prophylaxis of the specific
indication. In general, they are administered in an amount of at
least about 10 .mu.g/kg body weight and in most cases they will be
administered in an amount not in excess of about 8 mg/kg body
weight per day. In most cases, the dosage is from about 10 .mu.g/kg
to about 1 mg/kg body weight daily, taking into account the routes
of administration, symptoms, etc.
The TR1 receptor polypeptide is also suitably administered by
sustained-release systems. Suitable examples of sustained-release
compositions include semi-permeable polymer matrices in the form of
shaped articles, e.g., films, or mirocapsules. Sustained-release
matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman.
et al., Biopolymers 22:547 556 (1983)), poly (2-hydroxyethyl
methacrylate) (Langer et al., J. Biomed. Mater. Res. 15:167 277
(1981), and Langer, Chem. Tech. 12:98 105 (1982)), ethylene vinyl
acetate (Langer et al., Id.) or poly-D-(-)-3-hydroxybutyric acid
(EP 133,988). Sustained-release TR1 receptor polypeptide
compositions also include liposomally entrapped TR1 receptor
polypeptide. Liposomes containing TR1 receptor polypeptide are
prepared by methods known per se: DE 3,218,121; Epstein et al.,
Proc. Natl Acad. Sci. (USA) 82:3688 3692 (1985); Hwang et al.,
Proc. Natl Acad. Sci. (USA) 77:4030 4034 (1980); EP 52,322; EP
36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl.
83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
Ordinarily, the liposomes are of the small (about 200 800
Angstroms) unilamellar type in which the lipid content is greater
than about 30 mol. percent cholesterol, the selected proportion
being adjusted for the optimal TR1 receptor polypeptide
therapy.
For parenteral administration, in one embodiment, the TR1 receptor
polypeptide is formulated generally by mixing it at the desired
degree of purity, in a unit dosage injectable form (solution,
suspension, or emulsion), with a pharmaceutically acceptable
carrier, i.e., one that is non-toxic to recipients at the dosages
and concentrations employed and is compatible with other
ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to polypeptides.
Generally, the formulations are prepared by contacting the TR1
receptor polypeptide uniformly and intimately with liquid carriers
or finely divided solid carriers or both. Then, if necessary, the
product is shaped into the desired formulation. Preferably the
carrier is a parenteral carrier, more preferably a solution that is
isotonic with the blood of the recipient. Examples of such carrier
vehicles include water, saline, Ringer's solution, and dextrose
solution. Non-aqueous vehicles such as fixed oils and ethyl oleate
are also useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as
substances that enhance isotonicity and chemical stability. Such
materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
The TR1 receptor polypeptide is typically formulated in such
vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml,
preferably 1 10 mg/ml, at a pH of about 3 to 8. It will be
understood that the use of certain of the foregoing excipients,
carriers, or stabilizers will result in the formation of TR1
receptor polypeptide salts.
TR1 receptor polypeptide to be used for therapeutic administration
must be sterile. Sterility is readily accomplished by filtration
through sterile filtration membranes (e.g., 0.2 micron membranes).
Therapeutic TR1 receptor polypeptide compositions generally are
placed into a container having a sterile access port, for example,
an intravenous solution bag or vial having a stopper pierceable by
a hypodermic injection needle.
TR1 receptor polypeptide ordinarily will be stored in unit or
multi-dose containers, for example, sealed ampules or vials, as an
aqueous solution or as a lyophilized formulation for
reconstitution. As an example of a lyophilized formulation, 10-ml
vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous TR1
receptor polypeptide solution, and the resulting mixture is
lyophilized. The infusion solution is prepared by reconstituting
the lyophilized TR1 receptor polypeptide using bacteriostatic
Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising
one or more containers filled with one or more of the ingredients
of the pharmaceutical compositions of the invention. Associated
with such container(s) can be a notice in the form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects
approval by the agency of manufacture, use or sale for human
administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic
compounds.
The TR1 receptor and agonists and antagonists which are
polypeptides may also be employed in accordance with the present
invention by expression of such polypeptides in vivo, which is
often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a
polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with
the engineered cells then being provided to a patient to be treated
with the polypeptide. Such methods are well-known in the art. For
example, cells may be engineered by procedures known in the art by
use of a retroviral particle containing RNA encoding a polypeptide
of the present invention.
Similarly, cells may be engineered in vivo for expression of a
polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
Retroviruses from which the retroviral plasmid vectors hereinabove
mentioned may be derived include, but are not limited to, Moloney
Murine Leukemia Virus, spleen necrosis virus, retroviruses such as
Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus,
gibbon ape leukemia virus, human immunodeficiency virus,
adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor
virus. In one embodiment, the retroviral plasmid vector is derived
from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which
may be employed include, but are not limited to, the retroviral
LTR; the SV40 promoter; and the human cytomegalovirus (CMV)
promoter described in Miller et al., Biotechniques, 7:980 990
(1989), or any other promoter (e.g., cellular promoters such as
eukaryotic cellular promoters including, but not limited to, the
histone, pol III, and .beta.-actin promoters). Other viral
promoters which may be employed include, but are not limited to,
adenovirus promoters, thymidine kinase (TK) promoters, and B19
parvovirus promoters. The selection of a suitable promoter will be
apparent to those skilled in the art from the teachings contained
herein.
The nucleic acid sequence encoding the polypeptide of the present
invention is under the control of a suitable promoter. Suitable
promoters which may be employed include, but are not limited to,
adenoviral promoters, such as the adenoviral major late promoter;
or hetorologous promoters, such as the cytomegalovirus (CMV)
promoter; the respiratory syncytial virus (RSV) promoter; inducible
promoters, such as the MMT promoter, the metallothionein promoter;
heat shock promoters; the albumin promoter; the ApoAI promoter;
human globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase promoter; retroviral LTRs
(including the modified retroviral LTRs hereinabove described); the
.beta.-actin promoter; and human growth hormone promoters. The
promoter also may be the native promoter which controls the gene
encoding the polypeptide.
The retroviral plasmid vector is employed to transduce packaging
cell lines to form producer cell lines. Examples of packaging cells
which may be transfected include, but are not limited to, the
PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X, VT-19-17-H2,
.psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell lines as
described in Miller, Human Gene Therapy 1:5 14 (1990), which is
incorporated herein by reference in its entirety. The vector may
transduce the packaging cells through any means known in the art.
Such means include, but are not limited to, electroporation, the
use of liposomes, and CaPO.sub.4 precipitation. In one alternative,
the retroviral plasmid vector may be encapsulated into a liposome,
or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector
particles which include nucleic acid sequences encoding the
polypeptides. Such retroviral vector particles then may be
employed, to transduce eukaryotic cells, either in vitro or in
vivo. The transduced eukaryotic cells will express the nucleic acid
sequence(s) encoding the polypeptide. Eukaryotic cells which may be
transduced include, but are not limited to, embryonic stem cells,
embryonic carcinoma cells, as well as hematopoietic stem cells,
hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial
cells, and bronchial epithelial cells.
The polypeptides of the invention can also be expressed in
transgenic animals. Animals of any species, including but not
limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates (e.g.,
baboons, monkeys and chimpanzees) may be used to generate
transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
Any technique known in the art may be used to introduce the
transgene (i.e., polynucleotides of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol Biotechnol. 40:691 698 (1994);
Carver et al., Biotechnology (NY) 11:1263 1270 (1993); Wright et
al., Biotechnology (NY) 9:830 834 (1991); and Hoppe et al, U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci. USA
82:6148 6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313 321 (1989));
electroporation of cells or embryos (Lo, Mol Cell. Biol. 3:1803
1814 (1983)); introduction of the polynucleotides of the invention
using a gene gun (see, e.g., Ulmer et al., Science 259:1745 (1993);
introducing nucleic acid constructs into embryonic pleuripotent
stem cells and transferring the stem cells back into the
blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717 723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171 229 (1989),
which is incorporated by reference herein in its entirety. Further,
the contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
Any technique known in the art may be used to produce transgenic
clones containing polynucleotides of the invention, for example,
transfer into enucleated oocytes of nuclei from cultured embryonic,
fetal, or adult cells induced to quiescence (Campell et al., Nature
380:64 66 (1996)); Wilmut et al., Nature 385:810 813 (1997)), each
of which is herein incorporated by reference in its entirety).
The present invention provides for transgenic animals that carry
the transgene in all their cells, as well as animals which carry
the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric animals. The transgene may be integrated as a
single transgene or as multiple copies, such as concatamers, e.g.,
head-to-head tandems or head-to-tail tandems. The transgene may
also be selectively introduced into and activated in a particular
cell type using, for example, the teaching of Lasko et al (Lasko et
al., Proc. Natl. Acad. Sci. USA 89:6232 6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed to integrate into and disrupt, via
homologous recombination with chromosomal sequences, the function
of the endogenous gene. The transgene may also be introduced
selectively into a particular cell type, thus inactivating the
endogenous gene in only that cell type, using, for example, the
teaching of Gu et al. (Gu et al., Science 265:103 106 (1994)). The
regulatory sequences required for such a cell-type specific
inactivation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. The contents of
each of the documents recited in this paragraph is herein
incorporated by reference in its entirety.
Once transgenic animals have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques.
Initial screening of animal tissues may be accomplished by Southern
blot analysis or PCR techniques to verify that integration of the
transgene has taken place. The level of mRNA expression of the
transgene in the tissues of the transgenic animals may also be
assessed using techniques which include, but are not limited to,
Northern blot analysis of tissue samples, in situ hybridization
analysis, and reverse transcriptase-PCR (rt-PCR). Samples of
transgenic gene-expressing tissue may also be evaluated
immunocytochemically or immunohistochemically using antibodies
specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred,
outbred, or crossbred to produce colonies of the particular animal.
Examples of such breeding strategies include, but are not limited
to: outbreeding of founder animals having more than one integration
site in order to establish separate lines; inbreeding of separate
lines to produce compound transgenics that express the transgene at
higher levels because of the additive effect of expression of
multiple transgenes; crossing of heterozygous transgenic animals to
produce animals homozygous for a given integration site in order to
both augment expression and eliminate the need for screening of
animals by DNA analysis; crossing of separate homozygous lines to
produce compound heterozygous or homozygous lines; and breeding to
place the transgene on a distinct background that is appropriate
for a particular experimental model.
Transgenic and "knock-out" animals of the invention have uses as
model systems for, including but not limited to, elaborating the
biological function of TR1 polypeptides, studying conditions and/or
disorders associated with aberrant TR1 expression, and screening
for compounds effective in ameliorating such conditions and/or
disorders.
In further embodiments of the invention, cells that are genetically
engineered to express the polypeptides of the invention, or
alternatively, that are genetically engineered not to express the
polypeptides of the invention (e.g., knockouts) are administered to
a patient in vivo. Such cells may be obtained from the patient
(i.e., animal, including human) or an MHC compatible donor and can
include, but are not limited to fibroblasts, bone marrow cells,
blood cells (e.g., lymphocytes), adipocytes, muscle cells,
endothelial cells etc. The cells are genetically engineered in
vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
promoter or inducible promoter or a promoter/enhancer to achieve
expression, and preferably secretion, of the polypeptides of the
invention. The engineered cells which express and preferably
secrete the polypeptides of the invention can be introduced into
the patient systemically (e.g., in the circulation), or
intraperitoneally. Alternatively, the cells can be incorporated
into a matrix and implanted in the body, e.g., genetically
engineered fibroblasts can be implanted as part of a skin graft;
genetically engineered endothelial cells can be implanted as part
of a lymphatic or vascular graft. (See, for example, Anderson et
al. U.S. Pat. No. 5,399,349; and Mulligan & Wilson, U.S. Pat.
No. 5,460,959, each of which is incorporated by reference herein in
its entirety).
When the cells to be administered are non-autologous or non-MHC
compatible cells, they can be administered using well-known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form, which allows for an exchange of
components with the immediate extracellular environment, but does
not allow the introduced cells to be recognized by the host immune
system.
Therapeutics: Combinatorial Formulations
The compositions of the invention may be administered alone or in
combination with other therapeutic agents. Therapeutic agents that
may be administered in combination with the compositions of the
invention, include but not limited to, other members of the TNF
family, chemotherapeutic agents, antibiotics, steroidal and
non-steroidal anti-inflammatories, conventional immunotherapeutic
agents, cytokines and/or growth factors. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
In one embodiment, the compositions of the invention are
administered in combination with other members of the TNF family.
TNF, TNF-related or TNF-like molecules that may be administered
with the compositions of the invention include, but are not limited
to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also
known as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I
(International Publication No. WO 97/33899), endokine-alpha
(International Publication No. WO 98/07880), TR6 (International
Publication No. WO 98/30694), OPG, and neutrokine-alpha
(International Publication No. WO 98/18921, OX40, and nerve growth
factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB,
TR2 (International Publication No. WO 96/34095), DR3 (International
Publication No. WO 97/33904), DR4 (International Publication No. WO
98/32856), TR5 (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International
Publication No. WO 98/41629), TRANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO 98/54202),
312C2 (International Publication No. WO 98/06842), and TR12, and
soluble forms CD154, CD70, and CD153.
Conventional nonspecific immunosuppressive agents, that may be
administered in combination with the compositions of the invention
include, but are not limited to, steroids, cyclosporine,
cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
In a further embodiment, the compositions of the invention are
administered in combination with an agent that regulates bone
and/or tissue growth. Bone growth and/or tissue growth regulators
that may be administered with the compositions of the invention
include, but are not limited to, tetracycline, metronidazole,
amoxicillin, beta-lactamases, aminoglycosides, macrolides,
quinolones, fluoroquinolones, cephalosporins, erythromycin,
ciprofloxacin, and streptomycin.
Certain BMPs which are known to be osteogenic can also induce
neuronal cell differentiation. Embryonic mouse cells treated with
BMP-2 or OP-1 (BMP-7) differentiate into astrocyte-like (glial)
cells, and peripheral nerve regeneration using BMP-2 has been
recently reported (Wang et al., WO 95/05846). In addition, BMP-4,
BMP-5 and OP-1 (BMP-7) are expressed in epidermal edtoderm flanking
the neural plate. Ectopic recombinant BMP-4 and OP-1 (BMP-7)
proteins are capable of inducing neural plate cells to initiate
dorsal neural cell fate differentiation (Liem et al., Cell 82: 969
979 (1995)). At the spinal cord level, OP-1 and other BMPs, which
should include the BMPs of the present invention, can induce neural
crest cell differentiation. It is suggested that OP-1 and these
BMPs can induce many or all dorsal neural cell types, including
roof plate cells, neural crest cells, and commissural neurons,
depending on localized positional cues. Therefore, additionally,
morphogenic devices of this invention may also be implanted in or
surrounding a joint for use in cartilage and soft tissue repair, or
in or surrounding nervous system-associated tissue for use in
neural regeneration and repair.
The tissue specificity of the particular morphogenic protein--or
combination of morphogenic proteins with other biological
factors--will determine the cell types or tissues that will be
amenable to such treatments and can be selected by one skilled in
the art. The ability to enhance other morphogenic protein-induced
tissue regeneration by co-administering a BMP according to the
present invention is thus not believed to be limited to any
particular cell-type or tissue. It is envisioned that the invention
as disclosed herein can be practiced to enhance the activities of
new morphogenic proteins and to enhance new tissue inductive
functions as they are discovered in the future.
The BMP compositions and devices comprising BMP will permit the
physician to obtain predictable bone and/or cartilage formation.
The BMP compositions and devices of this invention may be used to
treat more efficiently and/or effectively all of the injuries,
anomalies and disorders that have been described in the prior art
of osteogenic devices. These include, for example, forming local
bone in fractures, non-union fractures, fusions and bony voids such
as those created in tumor resections or those resulting from cysts;
treating acquired and congenital craniofacial and other skeletal or
dental anomalies (see e.g., Glowacki et al., Lancet 1:959 963
(1981)); performing dental and periodontal reconstructions where
lost bone replacement or bone augmentation is required such as in a
jaw bone; and supplementing alveolar bone loss resulting from
periodontal disease to delay or prevent tooth loss (see e.g.,
Sigurdsson et al., J. Periodontol., 66:511 521 (1995)).
An osteogenic device of this invention which comprises a matrix
comprising allogenic bone and a BMP may also be implanted at a site
in need of bone replacement to accelerate allograft repair and
incorporation in a mammal. Another potential clinical application
of the improved osteogenic devices of this invention is in
cartilage repair, for example, following joint injury or in the
treatment of osteoarthritis. The ability to enhance the
cartilage-inducing activity of other morphogenic proteins by
co-administering a BMP may permit faster or more extensive tissue
repair and replacement using the same or lower levels of
morphogenic proteins.
The BMP compositions and devices of this invention will be useful
in treating certain congenital diseases and developmental
abnormalities of cartilage, bone and other tissues. For example,
homozygous OP-1 (BMP-7)-deficient mice die within 24 hours after
birth due to kidney failure (Luo et al., J. Bone Min. Res. 10
(Supp. 1):S163 (1995)). Kidney failure in these mice is associated
with the failure to form renal glomeruli due to lack of mesenchymal
tissue condensation. OP-1-deficient mice also have various skeletal
abnormalities associated with their hindlimbs, rib cage and skull,
are polydactyl, and exhibit aberrant retinal development. These
results, in combination with those discussed above concerning the
ability of OP-1 to induce differentiation into dorsal neural cell
fates, indicate that OP-1 plays an important role in
epithelialmesenchymal interactions during development. It is
anticipated that the compositions, devices and methods of this
invention may be useful in the future for ameliorating these and
other developmental abnormalities.
Developmental abnormalities of the bone may affect isolated or
multiple regions of the skeleton or of a particular supportive or
connective tissue type. These abnormalities often require
complicated bone transplantation procedures and orthopedic devices.
The tissue repair and regeneration required after such procedures
may occur more quickly and completely with the use of the BMPs of
the present invention or the use of other morphogenic proteins used
in combination with the BMPs of the present invention.
In a further embodiment, the compositions of the invention are
administered in combination with an antibiotic agent. Antibiotic
agents that may be administered with the compositions of the
invention include, but are not limited to, tetracycline,
metronidazole, amoxicillin, beta-lactamases, aminoglycosides,
macrolides, quinolones, fluoroquinolones, cephalosporins,
erythromycin, ciprofloxacin, and streptomycin.
In an additional embodiment, the compositions of the invention are
administered alone or in combination with an anti-inflammatory
agent. Anti-inflammatory agents that may be administered with the
compositions of the invention include, but are not limited to,
glucocorticoids and the nonsteroidal anti-inflammatories,
aminoarylcarboxylic acid derivatives, arylacetic acid derivatives,
arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives, thiazinecarboxamides, e-acetamidocaproic acid,
S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine,
bendazac, benzydamine, bucolome, difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein,
oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and tenidap.
In another embodiment, compostions of the invention are
administered in combination with a chemotherapeutic agent.
Chemotherapeutic agents that may be administered with the
compositions of the invention include, but are not limited to,
antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin,
and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites
(e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and
6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan,
cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and
testolactone); nitrogen mustard derivatives (e.g., mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate);
and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
In an additional embodiment, the compositions of the invention are
administered in combination with cytokines. Cytokines that may be
administered with the compositions of the invention include, but
are not limited to, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13,
IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha.
In an additional embodiment, the compositions of the invention are
administered in combination with angiogenic proteins. Angiogenic
proteins that may be administered with the compositions of the
invention include, but are not limited to, Glioma Derived Growth
Factor (GDGF), as disclosed in European Patent Number EP-399816;
Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European
Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B),
as disclosed in European Patent Number EP-282317; Placental Growth
Factor (PIGF), as disclosed in International Publication Number WO
92/06194; Placental Growth Factor-2 (PIGF-2), as disclosed in
Hauser et al., Gorwth Factors, 4:259 268 (1993); Vascular
Endothelial Growth Factor (VEGF), as disclosed in International
Publication Number WO 90/13649; Vascular Endothelial Growth
Factor-A (VEGF-A), as disclosed in European Patent Number
EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2), as
disclosed in International Publication Number WO 96/39515; Vascular
Endothelial Growth Factor .alpha.-186 (VEGF-B186), as disclosed in
International Publication Number WO 96/26736; Vascular Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication
Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D),
as disclosed in International Publication Number WO 98/07832; and
Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in
German Patent Number DE19639601. The above mentioned references are
incorporated herein by reference.
In an additional embodiment, the compositions of the invention are
administered in combination with Fibroblast Growth Factors.
Fibroblast Growth Factors that may be administered with the
compositions of the invention include, but are not limited to,
FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9,
FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
In additional embodiments, the compositions of the invention are
administered in combination with other therapeutic or prophylactic
regimens, such as, for example, radiation therapy.
Chromosome Assays
The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR
primers (preferably 15 25 bp) from the cDNA. Computer analysis of
the 3' untranslated region is used to rapidly select primers that
do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
Fluorescence in situ hybridization (FISH) of a cDNA clone to a
metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: A Manual of Basic Techniques,
Pergamon Press, New York (1988).
For example, the present inventors have mapped the native TR1 gene
at the chromosomal region 8q23 24.1.
Once a sequence has been mapped to a precise chromosomal location,
the physical position of the sequence on the chromosome can be
correlated with genetic map data. Such data are found, for example,
in V. McKusick, Mendelian Inheritance in Man (available on line
through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or
genomic sequence between affected and unaffected individuals. If a
mutation is observed in some or all of the affected individuals but
not in any normal individuals, then the mutation is likely to be
the causative agent of the disease.
With current resolution of physical mapping and genetic mapping
techniques, a cDNA precisely localized to a chromosomal region
associated with the disease could be one of between 50 and 500
potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
The present invention will be further described with reference to
the following examples; however, it is to be understood that the
present invention is not limited to such examples. All parts or
amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples
certain frequently occurring methods and/or terms will be
described.
"Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a
restriction enzyme that acts only at certain sequences in the DNA.
The various restriction enzymes used herein are commercially
available and their reaction conditions, cofactors and other
requirements were used as would be known to the ordinarily skilled
artisan. For analytical purposes, typically 1 .mu.g of plasmid or
DNA fragment is used with about 2 units of enzyme in about 20 .mu.l
of buffer solution. For the purpose of isolating DNA fragments for
plasmid construction, typically 5 to 50 .mu.g of DNA are digested
with 20 to 250 units of enzyme in a larger volume. Appropriate
buffers and substrate amounts for particular restriction enzymes
are specified by the manufacturer. Incubation times of about 1 hour
at 37.degree. C. are ordinarily used, but may vary in accordance
with the supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate the
desired fragment.
Size separation of the cleaved fragments is performed using 8
percent polyacrylamide gel described by Goeddel, et al., Nucleic
Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds
between two double stranded nucleic acid fragments. Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units of T4 DNA ligase ("ligase")
per 0.5 .mu.g of approximately equimolar amounts of the DNA
fragments to be ligated.
Unless otherwise stated, transformation was performed as described
in the method of Graham and Van der, Virology, 52:456 457
(1973).
EXAMPLE 1
Bacterial Expression and Purification of TR1 Receptor
The DNA sequence encoding TR1 receptor, ATCC Accession No. 75899,
is initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed TR1
receptor nucleic acid sequence (minus the signal peptide sequence).
Additional nucleotides corresponding to TR1 receptor gene are added
to the 5' and 3' end sequences respectively. The 5' oligonucleotide
primer has the sequence 5' GCCAGAGGATCCGAAACGTTTCCTCCAAAGTAC 3'
(SEQ ID NO:6) and contains a BamHI restriction enzyme site (bold).
The 3' sequence 5' CGGCTTCTAGAATTACCTATCATTTCTAAAAAT 3' (SEQ ID
NO:7) contains complementary sequences to a Hind III site (bold)
and is followed by 18 nucleotides of TR1 receptor (FIG. 2). The
restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 is then digested with BamHI and
XbaI. The amplified sequences are ligated into pQE-9 and are
inserted in frame with the sequence encoding for the histidine tag
and the RBS. The ligation mixture is then used to transform E. coli
strain M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989). M15/rep4 contains multiple copies
of the plasmid pREP4, which expresses the lacI repressor and also
confers kanamycin resistance (Kan.sup.r). Transformants are
identified by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies are selected. Plasmid DNA
is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100
.mu.g/ml) and Kan (25 .mu.g/ml). The O/N culture is used to
inoculate a large culture at a ratio of 1:100 to 1:250. The cells
are grown to an optical density 600 (O.D..sup.600) of between 0.4
and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then
added to a final concentration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells are grown an extra 3 to 4 hours.
Cells are then harvested by centrifugation. The cell pellet is
solubilized in the chaotropic agent 6 molar Guanidine HCl. After
clarification, solubilized TR1 receptor is purified from this
solution by chromatography on a Nickel-Chelate column under
conditions that allow for tight binding by proteins containing the
6-His tag (Hochuli et al., J. Chromatography 411:177 184 (1984)).
TR1 receptor (90% pure) is eluted from the column in 6 molar
guanidine HCl pH 5.0 and for the purpose of renaturation adjusted
to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 mM
glutathione (reduced) and 2 mM glutathione (oxidized). After
incubation in this solution for 12 hours the protein is dialyzed to
10 mmolar sodium phosphate.
In addition to the above expression vector, the present invention
further includes an expression vector, pHE4a (ATCC Accession Number
209645, deposited Feb. 25, 1998.), comprising phage operator and
promoter elements. This vector contains: 1) a neomycin
phosphotransferase gene as a selectable marker, 2) an E. coli
origin of replication, 3) a T5 phage promoter sequence, 4) two lac
operator sequences, 5) a Shine-Delgarno sequence, and 6) the
lactose operon repressor gene (lacI.sup.q). The origin of
replication (oriC) is derived from pUC19 (LT1, Gaithersburg, Md.).
The promoter sequence and operator sequences are made
synthetically.
Useful restriction sites in pHE4a include NdeI and KpnI, BamHI,
XhoI, or Asp718. The DNA insert is generated according to the PCR
protocol described in Example 1, using PCR primers having
restriction sites for NdeI (5' primer) and XbaI, BamHI, XhoI, or
Asp718 (3' primer).
EXAMPLE 2
Cloning and Expression of the Native and the Carboxy Terminal
Modified TR1 Receptor Using the Baculovirus Expression System
The DNA sequence encoding the full-length native TR1 receptor
protein, ATCC Accession No. 75899, is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene. The 5' primer has the sequence 5' CGC GGA TCC GCCATC
ATGAACAAGTTGCTGTG 3' (SEQ ID NO: 8) and contains a BamHI
restriction site followed by the first 17 base pairs of the native
TR1 receptor coding sequence in FIG. 1.
The 3' primer has the sequence 5' CGC GGT ACC CAATTGTGAGGAAACAG3'
(SEQ ID NO:9) and contains a Asp718 restriction site and, in
reverse orientation, a sequence complementary to nucleotides 1270
to 1286 in FIG. 1.
For the carboxy terminal modified TR1 receptor, the 5' primer has
the sequence 5' GCGCGGATCCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID NO: 10)
and contains a BamHI restriction enzyme site (in bold) and which is
just behind the first 21 nucleotides of the modified TR1 receptor
gene (the initiation codon for translation "ATG" is underlined)
shown in FIG. 2.
The 3' primer has the sequence 5'
GCGCTCTAGATTACCTATCATTTCTAAAAATAAC 3' (SEQ ID NO:11) and contains
the cleavage site for the restriction endonuclease XbaI and 21
nucleotides complementary to the 3' sequence of the modified TR1
receptor gene shown in FIG. 2.
The amplified modified TR1 receptor sequences were isolated from a
1% agarose gel using a commercially available kit ("Geneclean", BIO
101 Inc., La Jolla, Calif.). The fragments were then digested with
the endonucleases BamHI and XbaI and then purified again on a 1%
agarose gel. This fragment is designated F2.
The vector pRG1 (modification of pVL941 vector, discussed below)
was used for the expression of the TR1 receptor proteins using the
baculovirus expression system (for review see: Summers and Smith, A
Manual of Methods for Baculovirus Vectors and Insect Cell Culture
Procedures, Texas Agricultural Experimental Station Bulletin No.
1555 (1987)). This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by the recognition sites for the restriction
endonucleases BamHI and XbaI. The polyadenylation site of the
simian virus (SV40) was used for efficient polyadenylation. For an
easy selection of recombinant viruses the beta-galactosidase gene
from E. coli was inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the polyhedrin
gene. The polyhedrin sequences were flanked at both sides by viral
sequences for the cell-mediated homologous recombination of
cotransfected wild-type viral DNA. Many other baculovirus vectors
could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1
(Luckow and Summers, Virology 170:31 39).
The plasmid was digested with the restriction enzymes BamHI and
XbaI. The DNA was then isolated from a 1% agarose gel using the
commercially available kit ("Geneclean" BIO 101 Inc., La Jolla,
Calif.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with
T4 DNA ligase. E. coli HB101 cells were then transformed and cells
identified that contained the plasmid (pBac TR1 receptor) with the
TR1 receptor genes using the enzymes BamHI and XbaI. The sequence
of the cloned fragment was confirmed by DNA sequencing.
5 .mu.g of the plasmid pBac TR1 receptor was cotransfected with 1.0
.mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al., Proc. Natl. Acad.
Sci. USA, 84:7413 7417 (1987)).
One .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the plasmid
pBac TR1 receptors were mixed in a sterile well of a microtiter
plate containing 50 .mu.l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
After four days the supernatant was collected and a plaque assay
performed similar as described by Summers and Smith (supra). As a
modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg, Md.) was used which allows an easy isolation of
blue stained plaques. (A detailed description of a "plaque assay"
can also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
Md., page 9 10).
Four days after the serial dilution, the viruses were added to the
cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses were
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculoviruses was used
to infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-TR1 receptor at a multiplicity of infection (MOI) of
2. Six hours later the medium was removed and replaced with SF900
II medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). Forty-two hours later 5 .mu.Ci of
.sup.35S-methionine and 5 .mu.Ci .sup.35S cysteine (Amersham) were
added. The cells are further incubated for 16 hours before they are
harvested by centrifugation and the labelled proteins visualized by
SDS-PAGE and autoradiography.
EXAMPLE 3
Cloning and Expression in Mammalian Cells
Most of the vectors used for the transient expression of the TR1
receptor protein gene sequences in mammalian cells should carry the
SV40 origin of replication. This allows the replication of the
vector to high copy numbers in cells (e.g., COS cells) which
express the T antigen required for the initiation of viral DNA
synthesis. Any other mammalian cell line can also be utilized for
this purpose.
A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of trancription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g., human actin promoter). Suitable expression
vectors for use in practicing the present invention include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala,
Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI
(ATCC 67109). Mammalian host cells that could be used include,
human Hela, 283, H9 and Jurkart cells, mouse NIH3T3 and C127 cells,
Cos 1, Cos 7 and CV1, African green monkey cells, quail QC1 3
cells, mouse L cells and Chinese hamster ovary cells.
Alternatively, the gene can be expressed in stable cell lines that
contain the gene integrated into a chromosome. The co-transfection
with a selectable marker such as dhfr, gpt, neomycin, hygromycin
allows the identification and isolation of the transfected
cells.
The transfected gene can also be amplified to express large amounts
of the encoded protein. The DHFR (dihydrofolate reductase) is a
useful marker to develop cell lines that carry several hundred or
even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 22 7:277 279 (1991); Bebbington et al.,
Bio/Technology 10:169 175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
The expression vectors pC1 and pC4 contain the strong promoter
(LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and
Cellular Biology, 438 447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521 530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
EXAMPLE 3(a)
Expression of Recombinant Native TR1 Receptor in COS Cells
The expression of plasmid, TR1 receptor HA is derived from a vector
pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication,
2) ampicillin resistance gene, 3) E. coli replication origin, 4)
CMV promoter followed by a polylinker region, a SV40 intron and
polyadenylation site. A DNA fragment encoding the entire TR1
receptor precursor and a HA tag fused in frame to its 3' end is
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (Wilson et al., Cell
37:767 (1984)). The infusion of HA tag to the target protein allows
easy detection of the recombinant protein with an antibody that
recognizes the HA epitope.
For the native TR1 receptor (FIG. 1), the plasmid construction
strategy is described as follows:
The DNA sequence encoding native TR1 receptor, ATCC Accesion No.
75899, is constructed by PCR using two primers: The 5' primer has
the sequence 5'CGCGGATCCGCCATC ATGAACAAGTTGCTGTG 3' (SEQ ID NO:8)
and contains a BamHI restriction site followed by the first 17 base
pairs of the native TR1 receptor coding sequence in FIG. 1.
The 3' primer has the sequence 5' CGCGGTACCCAATTGTGAGGAAACAG 3'
(SEQ ID NO:9) and contains a Asp718 restriction site and, in
reverse orientation, a sequence complementary to nucleotides 1270
to 1286 in FIG. 1.
Therefore, the PCR product contains a BamHI site, a TR1 receptor
coding sequence followed by HA tag fused in frame, a translation
termination stop codon next to the HA tag, and an Asp718 site. The
PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested
with BamHI and Asp718 restriction enzymes and ligated. The ligation
mixture is transformed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, Calif.) the transformed culture is plated on
ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and examined by
restriction analysis for the presence of the correct fragment. For
expression of the recombinant TR1 receptors, COS cells are
transfected with the expression vector by DEAE-DEXTRAN method (J.
Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory
Manual, Cold Spring Laboratory Press, (1989)). The expression of
the TR1 receptor HA protein is detected by radiolabelling and
immunoprecipitation method (Harlow and Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)).
Cells are labeled for 8 hours with .sup.35S-cysteine two days post
transfection. Culture media are then collected and cells are lysed
with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1%
NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson et al., supra). Both
cell lysate and culture media are precipitated with a HA specific
monoclonal antibody. Proteins precipitated are analyzed on 15%
SDS-PAGE gels.
EXAMPLE 3(b)
Cloning and Expression of the Native Receptor in CHO Cells
The vector pC1 is used for the expression of native TR1 receptor
protein. Plasmid pC1 is a derivative of the plasmid pSV2-dhfr [ATCC
Accession No. 37146]. Both plasmids contain the mouse DHFR gene
under control of the SV40 early promoter. Chinese hamster ovary- or
other cells lacking dihydrofolate activity that are transfected
with these plasmids can be selected by growing the cells in a
selective medium (alpha minus MEM, Life Technologies) supplemented
with the chemotherapeutic agent methotrexate. The amplification of
the DHFR genes in cells resistant to methotrexate (MTX) has been
well documented (see, e.g., Alt, F. W., Kellems, R. M., Bertino, J.
R., and Schimke, R. T., 1978, J. Biol. Chem. 253:1357 1370, Hamlin,
J. L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107 143,
Page, M. J. and Sydenham, M. A., Biotechnology 9:64 68 (1991)).
Cells grown in increasing concentrations of MTX develop resistance
to the drug by overproducing the target enzyme, DHFR, as a result
of amplification of the DHFR gene. If a second gene is linked to
the DHFR gene it is usually co-amplified and over-expressed. It is
state of the art to develop cell lines carrying more than 1,000
copies of the genes. Subsequently, when the methotrexate is
withdrawn, cell lines contain the amplified gene integrated into
the chromosome(s).
Plasmid pC1 contains for the expression of the gene of interest a
strong promoter of the long terminal repeat (LTR) of the Rouse
Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology,
March 1985:438 4470) plus a fragment isolated from the enhancer of
the immediate early gene of human cytomegalovirus (CMV) (Boshart et
al., Cell 41:521 530, 1985). Downstream of the promoter are the
following single restriction enzyme cleavage sites that allow the
integration of the genes: BamHI, Pvull, and Nrul. Behind these
cloning sites the plasmid contains translational stop codons in all
three reading frames followed by the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other high
efficient promoters can also be used for the expression, e.g., the
human .beta.-actin promoter, the SV40 early or late promoters or
the long terminal repeats from other retroviruses, e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g.,
from the human growth hormone or globin genes can be used as
well.
Stable cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a
selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
The plasmid pC1 is digested with the restriction enzyme BamHI and
then dephosphorylated using calf intestinal phosphates by
procedures known in the art. The vector is then isolated from a 1%
agarose gel.
The DNA sequence encoding the native TR1 receptor, ATCC 75899, is
amplified using PCR oligonucleotide primers corresponding to the 5'
and 3' sequences of the gene:
The 5' primer has the sequence 5' CGCGGATCCGCCATC ATGAACAAGTTGCTGTG
3' (SEQ ID NO:8) and contains a BamHI restriction site followed by
the first 17 base pairs of the native TR1 receptor coding sequence
in FIG. 1.
The 3' primer has the sequence 5' CGCGGTACC CAATTGTGAGGAAACAG 3'
(SEQ ID NO: 9) and contains a Asp718 restriction site and, in
reverse orientation, a sequence complementary to nucleotides 1270
to 1286 in FIG. 1.
Inserted into an expression vector, as described below, the 5' end
of the amplified fragment encoding human TR1 receptor provides an
efficient signal peptide. An efficient signal for initiation of
translation in eukaryotic cells, as described by Kozak, Mol. Biol.
196:947 950 (1987) is appropriately located in the vector portion
of the construct.
The amplified fragments are isolated from a 1% agarose gel as
described above and then digested with the endonucleases BamHI and
Asp718 and then purified again on a 1% agarose gel.
The isolated fragment and the dephosphorylated vector are then
ligated with T4 DNA ligase. E. coli HB101 cells are then
transformed and bacteria identified that contained the plasmid pC1
inserted in the correct orientation using the restriction enzyme
BamHI. The sequence of the inserted gene is confirmed by DNA
sequencing.
Transfection of CHO-DHFR-cells
Chinese hamster ovary cells lacking an active DHFR enzyme are used
for transfection. 5 .mu.g of the expression plasmid C1 are
cotransfected with 0.5 .mu.g of the plasmid pSV-neo using the
lipofecting method (Felgner et al., supra). The plasmid pSV2-neo
contains a dominant selectable marker, the gene neo from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) and cultivated from 10 14 days. After this period, single
clones are trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200
nM, 400 nM). Clones growing at the highest concentrations of
methotrexate are then transferred to new 6-well plates containing
even higher concentrations of methotrexate (500 nM, 1 .mu.M, 2
.mu.M, 5 .mu.M). The same procedure is repeated until clones grow
at a concentration of 100 .mu.M.
The expression of the desired gene product is analyzed by Western
blot analysis and SDS-PAGE.
EXAMPLE 4
Purification of Soluble Native TR1 Receptor
Analysis of the amino acid sequence of native TR1 receptor shows a
relatively high theoretical pI. A chromatography procedure was
developed based on this feature to capture this protein to cation
exchange column (poros 50 HS) at pH 7.0 at which most of other
proteins do not bind to the column. This single-step purification
yields 80 90% pure protein from recombinant baculovirus infected
Sf-9 cell supernatant. The purified protein was confirmed to be the
TNF-receptor homolog by N-terminus amino acid sequence analysis.
The TR1-receptor can be further purified to >95% purity through
heparin binding chromatography.
Seventeen mg of purified soluble TR1-receptor was prepared from 2
liters of baculovirus supernatant. Two mg of protein was used for
antibody production. See, FIGS. 5 8.
EXAMPLE 5
Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
pMV-7 (Kirschmeier et al., DNA, 7:219 25 (1988)) flanked by the
long terminal repeats of the Moloney murine sarcoma virus, is
digested with EcoRI and HindIII and subsequently treated with calf
intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform E. coli strain HB101, which are then plated
onto agar-containing kanamycin for the purpose of confirming that
the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+am12 packaging cells are grown in
tissue culture to confluent density in Dulbecco's Modified Eagles
Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either
alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
EXAMPLE 6
Osteogenic Cell Proliferation Assay for TR1 Receptor Activity
An assay for proliferatory effect of candidate agonists and
antagonists of TR1 receptor function was performed using osteobast
cell line HG63 as follows: A two-fold serial dilution of purified
native TR1 receptor protein starting from 1000 ng/ml was made in
RPMI 1640 medium with 0.5 to 10% FBS. Adherent target cells were
prepared from confluent cultures by trypsinization in PBS, and
non-adherent target cells were harvested from stationary cultures
and washed once with fresh medium. Target cells were suspended at
1.times.10.sup.5 cells/ml in medium containing 0.5% FBS and 0.1 ml
aliquots were dispensed into 96-well flat-bottomed microtiter
plates containing 0.1 ml serially diluted test samples. Incubation
was continued for 70 hr. The activity was quantified using an MTS
[3(4,5-dimethyl-thiazoyl-2-yl) 5
(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] Assay
or any other assay for cell numbers and/or activity. The MTS assay
was performed by the addition of 20 .mu.l of MTS and phenazine
methosulfate (PMS) solution to 96 well plates (Stock solution was
prepared as described by Promega Technical Bulletin No. 169).
During a 3 hour incubation, living cells convert the MTS into a the
aqueous soluble formazan product. Wells with medium only (no cells)
were processed in exactly the same manner as the rest of the wells
and were used for blank controls. Wells with medium and cells were
used as baseline controls. The absorbence at 490 nm was recorded
using an ELISA reader and is proportional to the number of viable
cells in the wells. Cell growth promotion (positive percentage) or
inhibition (negative percentage), as a percentage compared to
baseline control wells (variation between three baseline control
well is less than 5%), calculated for each sample concentration, by
the formula: O.D. experimental/O.D. baseline control X 100--100.
All determinations were made in triplicate. Mean and SD were
calculated by Microsoft Excel.
EXAMPLE 7
Northern Blot Analysis
Northern blot analysis is carried out to examine TR1 receptor gene
expression in human tissues. A cDNA probe containing the sequence
shown in FIG. 1 was labeled with .sup.32P using the rediprime DNA
labelling system from Amersham Life Science, according to
manufacturer's instructions. Unincorporated nucleotide was removed
from labled probe using CHROMA SPIN-100 (Clontech). Two human
Multiple Tissue Northern (MTN) blots (one labaled as H for human
tissue, the other labaled as H.sub.2 for human immune system)
containing approximately 2 mg of poly (A)+ RNA per lane from
various human tissues were purchased from Clontech. Also used were
two Cellline blots containing 20 ng total RNA from different cell
lines. Northern blotting was performed with the Expresshyb
Hybridization Solution (PT 1190-1) from Clontech according to the
manufacture's manual.
Gene expression was detected in heart, placenta, lung, liver, and
kidney tissue. Lower levels of the mRNA was detected in thymus,
prostate, testis, ovary, and small intestine. Expression was also
detected in osteoblastoma, smooth muscle, fibroblasts, ovarian
cancer, venous endothelial cells, monocyte lukemia cells, liver
cells, and lung emphysemia cells. Expression can also be detected
in the following cell types: human hippocampus, kidney medulla,
macrophage, osteoblasts, human pancreas tumor, fetal cochlea, and
adult pulmonary.
EXAMPLE 8
Isolation of Antibody Fragments Directed Against Polypeptides of
the Present Invention From a Library of scFvs
Naturally occuring V-genes isolated from human PBLs are constructed
into a large library of antibody fragments which contain
reactivities against polypeptides of the present invention to which
the donor may or may not have been exposed (see, e.g., U.S. Pat.
No. 5,885,793 incorporated herein in its entirety by
reference).
Rescue of the Library
A library of scFvs is constructed from the RNA of human PBLs as
described in WO92/01047. To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harbouring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 ug/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an O.D.
of 0.8 with shaking. Five ml of this culture is used to innoculate
50 ml of 2.times.TY-AMP-GLU, 2.times.10.sup.8 TU of delta gene 3
helper phage (M13 delta gene III, see WO92/01047) are added and the
culture incubated at 37.degree. C. for 45 minutes without shaking
and then at 37.degree. C. for 45 minutes with shaking. The culture
is centrifuged at 4000 r.p.m. for 10 minutes and the pellet
resuspended in 2 liters of 2.times.TY containing 100 ug/ml
ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are
prepared as described in WO92/01047.
M13 delta gene III is prepared as follows: M13 delta gene III
helper phage does not encode gene III protein, hence the phage(mid)
displaying antibody fragments have a greater avidity of binding to
antigen. Infectious M13 delta gene III particles are made by
growing the helper phage in cells harboring a pUC19 derivative
supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are pelleted (IEC-Centra 8, 4000 revs/min for 10
min), resuspended in 300 ml 2.times.TY broth containing 100 ug
ampicillin/ml and 25 ug kanamycin/ml (2.times.TY-AMP-KAN) and grown
overnight, shaking at 37.degree. C. Phage particles are purified
and concentrated from the culture medium by two PEG-precipitations
(Sambrook et al., 1990), resuspended in 2 ml PBS and passed through
a 0.45 um filter (Minisart NML; Sartorius) to give a final
concentration of approximately 1013 transducing units/ml
(ampicillin-resistant clones).
Panning of the Library
Immunotubes (Nunc) are coated overnight in PBS with 4 ml of either
100 mg/ml or 10 mg/ml of a polypeptide of the present invention.
Tubes are blocked with 2% Marvel-PBS for 2 hours at 37.degree. C.
and then washed 3 times in PBS. Approximately 10.sup.13 TU of phage
are applied to the tube and incubated for 30 minutes at room
temperature tumbling on an over and under turntable and then left
to stand for another 1.5 hours. Tubes are washed 10 times with PBS
0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1
ml of 100 mM triethylamine and rotating 15 minutes on an under and
over turntable after which the solution is immediately neutralized
with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect
10 ml of mid-log E. coli TG1 by incubating eluted phage with
bacteria for 30 minutes at 37.degree. C. The E. coli are then
plated on TYE plates containing 1% glucose and 100 ug/ml
ampicillin. The resulting bacterial library is then rescued with
delta gene 3 helper phage as described above to prepare phage for a
subsequent round of selection. This process is then repeated for a
total of 4 rounds of affinity purification with tube-washing
increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS
for rounds 3 and 4.
Characterization of Binders
Eluted phage from the 3rd and 4th rounds of selection are used to
infect E. Coli HB 2151 and soluble scFv is produced (Marks, et al.,
1991) from single colonies for assay. ELISAs are performed with
microtitre plates coated with either 10 pg/ml of the polypeptide of
the present invention in 50 mM bicarbonate pH 9.6. Clones positive
in ELISA are further characterized by PCR fingerprinting (see e.g.,
WO92/01047) and then by sequencing.
EXAMPLE 9
Method of Determining Alterations in the TR1 Receptor Gene
RNA is isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease). cDNA
is then generated from these RNA samples using protocols known in
the art. (See, Sambrook.) The cDNA is then used as a template for
PCR, employing primers surrounding regions of interest in SEQ ID
NO: 1. Suggested PCR conditions consist of 35 cycles at 95.degree.
C. for 30 seconds; 60 120 seconds at 52 58.degree. C.; and 60 120
seconds at 70.degree. C., using buffer solutions described in
Sidransky, D., et al., Science 252:706 (1991).
PCR products are then sequenced using primers labeled at their 5'
end with T4 polynucleotide kinase, employing SequiTherm Polymerase.
(Epicentre Technologies). The intron-exon borders of selected exons
of TR1 receptor are also determined and genomic PCR products
analyzed to confirm the results. PCR products harboring suspected
mutations in TR1 receptor are then cloned and sequenced to validate
the results of the direct sequencing.
PCR products of the TR1 receptor are cloned into T-tailed vectors
as described in Holton, T. A. and Graham, M. W., Nucleic Acids
Research, 19:1156 (1991) and sequenced with T7 polymerase (United
States Biochemical). Affected individuals are identified by
mutations in TR1 receptor not present in unaffected
individuals.
Genomic rearrangements are also observed as a method of determining
alterations in the TR1 receptor gene. Genomic clones isolated using
techniques known in the art are nick-translated with
digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and
FISH performed as described in Johnson, Cg. et al., Methods Cell
Biol. 35:73 99 (1991). Hybridization with the labeled probe is
carried out using a vast excess of human cot-1 DNA for specific
hybridization to the TR1 receptor genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium iodide, producing a combination of C- and R-bands.
Aligned images for precise mapping are obtained using a triple-band
filter set (Chroma Technology, Brattleboro, Vt.) in combination
with a cooled charge-coupled device camera (Photometrics, Tucson,
Ariz.) and variable excitation wavelength filters. (Johnson, Cv. et
al., Genet. Anal. Tech. Appl., 8:75 (1991).) Image collection,
analysis and chromosomal fractional length measurements are
performed using the ISee Graphical Program System. (Inovision
Corporation, Durham, N.C.) Chromosome alterations of the genomic
region of TR1 receptor (hybridized by the probe) are identified as
insertions, deletions, and translocations. These TR1 receptor
alterations are used as a diagnostic marker for an associated
disease.
EXAMPLE 10
Method of Detecting Abnormal Levels of TR1 receptor in a Biological
Sample
TR1 receptor polypeptides can be detected in a biological sample,
and if an increased or decreased level of TR1 receptor is detected,
this polypeptide is a marker for a particular phenotype. Methods of
detection are numerous, and thus, it is understood that one skilled
in the art can modify the following assay to fit their particular
needs.
For example, antibody-sandwich ELISAs are used to detect TR1
receptor in a sample, preferably a biological sample. Wells of a
microtiter plate are coated with specific antibodies to TR1
receptor, at a final concentration of 0.2 to 10 .mu.g/ml. The
antibodies are either monoclonal or polyclonal and are produced
using technique known in the art. The wells are blocked so that
non-specific binding of TR1 receptor to the well is reduced.
The coated wells are then incubated for >2 hours at room
temperature with a sample containing TR1 receptor. Preferably,
serial dilutions of the sample should be used to validate results.
The plates are then washed three times with deionized or distilled
water to remove unbounded TR1 receptor.
Next, 50 .mu.l of specific antibody-alkaline phosphatase conjugate,
at a concentration of 25 400 ng, is added and incubated for 2 hours
at room temperature. The plates are again washed three times with
deionized or distilled water to remove unbounded conjugate.
75 .mu.l of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl
phosphate (NPP) substrate solution is then added to each well and
incubated 1 hour at room temperature to allow cleavage of the
substrate and flourescence. The flourescence is measured by a
microtiter plate reader. A standard curve is preparded using the
experimental results from serial dilutions of a control sample with
the sample concentration plotted on the X-axis (log scale) and
fluorescence or absorbance on the Y-axis (linear scale). The TR1
receptor polypeptide concentration in a sample is then interpolated
using the standard curve based on the measured flourescence of that
sample.
EXAMPLE 11
Method of Treating Decreased Levels of TR1 Receptor
The present invention relates to a method for treating an
individual in need of a decreased level of TR1 receptor biological
activity in the body comprising, administering to such an
individual a composition comprising a therapeutically effective
amount of TR1 receptor antagonist. Preferred antagonists for use in
the present invention are TR1 receptor-specific antibodies.
Moreover, it will be appreciated that conditions caused by a
decrease in the standard or normal expression level of the TR1
receptor in an individual can be treated by administering TR1
receptor, preferably in a soluble and/or secreted form. Thus, the
invention also provides a method of treatment of an individual in
need of an increased level of TR1 receptor polypeptide comprising
administering to such an individual a pharmaceutical composition
comprising an amount of TR1 receptor to increase the biological
activity level of TR1 receptor in such an individual.
For example, a patient with decreased levels of TR1 receptor
polypeptide receives a daily dose 0.1 100 .mu.g/kg of the
polypeptide for six consecutive days. Preferably, the polypeptide
is in a soluble and/or secreted form.
EXAMPLE 12
Method of Treating Increased Levels of TR1 Receptor
The present invention also relates to a method for treating an
individual in need of an increased level of TR1 receptor biological
activity in the body comprising administering to such an individual
a composition comprising a therapeutically effective amount of TR1
receptor or an agonist thereof.
Antisense technology is used to inhibit production of TR1 receptor.
This technology is one example of a method of decreasing levels of
TR1 receptor polypeptide, preferably a soluble and/or secreted
form, due to a variety of etiologies, such as cancer.
For example, a patient diagnosed with abnormally increased levels
of TR1 receptor is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21
days. This treatment is repeated after a 7-day rest period if the
is determined to be well tolerated.
EXAMPLE 13
Method of Treatment Using Gene Therapy--Ex Vivo
One method of gene therapy transplants fibroblasts, which are
capable of expressing soluble and/or mature TR1 receptor
polypeptides, onto a patient. Generally, fibroblasts are obtained
from a subject by skin biopsy. The resulting tissue is placed in
tissue-culture medium and separated into small pieces. Small chunks
of the tissue are placed on a wet surface of a tissue culture
flask, approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room temperature
over night. After 24 hours at room temperature, the flask is
inverted and the chunks of tissue remain fixed to the bottom of the
flask and fresh media (e.g., Ham's F12 media, with 10% FBS,
penicillin and streptomycin) is added. The flasks are then
incubated at 37.degree. C. for approximately one week.
At this time, fresh media is added and subsequently changed every
several days. After an additional two weeks in culture, a monolayer
of fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219 225 (1988)), flanked
by the long terminal repeats of the Moloney murine sarcoma virus,
is digested with EcoRI and HindIII and subsequently treated with
calf intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads.
The cDNA encoding the TR1 receptor can be amplified using PCR
primers which correspond to the 5' and 3' end encoding sequences
respectively. Preferably, the 5' primer contains an EcoRI site and
the 3' primer includes a HindIII site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is then used to transform E. coli HB101, which are then plated onto
agar containing kanamycin for the purpose of confirming that the
vector contains properly inserted TR1 receptor.
The amphotropic pA317 or GP+am12 packaging cells are grown in
tissue culture to confluent density in Dulbecco's Modified Eagles
Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the TR1 receptor gene is
then added to the media and the packaging cells transduced with the
vector. The packaging cells now produce infectious viral particles
containing the TR1 receptor gene (the packaging cells are now
referred to as producer cells).
Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether TR1 receptor protein is produced.
The engineered fibroblasts are then transplanted onto the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads.
EXAMPLE 14
Method of Treatment Using Gene Therapy--In Vivo
Another aspect of the present invention is using in vivo gene
therapy methods to treat disorders, diseases and conditions. The
gene therapy method relates to the introduction of naked nucleic
acid (DNA, RNA, and antisense DNA or RNA) TR1 receptor sequences
into an animal to increase or decrease the expression of the TR1
receptor polypeptide. The TR1 receptor polynucleotide may be
operatively linked to a promoter or any other genetic elements
necessary for the expression of the TR1 receptor polypeptide by the
target tissue. Such gene therapy and delivery techniques and
methods are known in the art, see, for example, WO90/11092,
WO98/11779; U.S. Pat. Nos. 5,693,622, 5,705,151, 5,580,859; Tabata
H. et al., Cardiovasc. Res. 35:470 479 (1997); Chao J. et al.,
Pharmacol Res. 35:517 522 (1997); Wolff J. A. Neuromuscul. Disord.
7:314 318 (1997); Schwartz B. et al., Gene Ther. 3:405 411 (1996);
Tsurumi Y. et al., Circulation 94:3281 3290 (1996) (incorporated
herein by reference).
The TR1 receptor polynucleotide constructs may be delivered by any
method that delivers injectable materials to the cells of an
animal, such as, injection into the interstitial space of tissues
(heart, muscle, skin, lung, liver, intestine and the like). The TR1
receptor polynucleotide constructs can be delivered in a
pharmaceutically acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences
that are free from any delivery vehicle that acts to assist,
promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, lipofectin or
precipitating agents and the like. However, the TR1 receptor
polynucleotides may also be delivered in liposome formulations
(such as those taught in Felgner P. L. et al. Ann. NY Acad. Sci.
772:126 139 (1995), and Abdallah B. et al. Biol. Cell 85:1 7
(1995)) which can be prepared by methods well known to those
skilled in the art.
The TR1 receptor polynucleotide vector constructs used in the gene
therapy method are preferably constructs that will not integrate
into the host genome nor will they contain sequences that allow for
replication. Any strong promoter known to those skilled in the art
can be used for driving the expression of DNA. Unlike other gene
therapy techniques, one major advantage of introducing naked
nucleic acid sequences into target cells is the transitory nature
of the polynucleotide synthesis in the cells. Studies have shown
that non-replicating DNA sequences can be introduced into cells to
provide production of the desired polypeptide for periods of up to
six months.
The TR1 receptor polynucleotide construct can be delivered to the
interstitial space of tissues within an animal, including of
muscle, skin, brain, lung, liver, spleen, bone marrow, thymus,
heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye, gland, and connective tissue. Interstitial space of
the tissues comprises the intercellular fluid, mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers
in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or that same matrix within connective tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space
occupied by the plasma of the circulation and the lymph fluid of
the lymphatic channels. Delivery to the interstitial space of
muscle tissue is preferred for the reasons discussed below. They
may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and
expressed in persistent, non-dividing cells which are
differentiated, although delivery and expression may be achieved in
non-differentiated or less completely differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle cells are particularly competent in their ability to take up
and express polynucleotides.
For the naked TR1 receptor polynucleotide injection, an effective
dosage amount of DNA or RNA will be in the range of from about 0.05
g/kg body weight to about 50 mg/kg body weight. Preferably the
dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration. The
preferred route of administration is by the parenteral route of
injection into the interstitial space of tissues. However, other
parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
TR1 receptor polynucleotide constructs can be delivered to arteries
during angioplasty by the catheter used in the procedure.
The dose response effects of injected TR1 receptor polynucleotide
in muscle in vivo are determined as follows. Suitable TR1 receptor
template DNA for production of mRNA coding for TR1 receptor
polypeptide is prepared in accordance with a standard recombinant
DNA methodology. The template DNA, which may be either circular or
linear, is either used as naked DNA or complexed with liposomes.
The quadriceps muscles of mice are then injected with various
amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized
by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm
incision is made on the anterior thigh, and the quadriceps muscle
is directly visualized. The TR1 receptor template DNA is injected
in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle
over one minute, approximately 0.5 cm from the distal insertion
site of the muscle into the knee and about 0.2 cm deep. A suture is
placed over the injection site for future localization, and the
skin is closed with stainless steel clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts
are prepared by excising the entire quadriceps. Every fifth 15
.mu.m cross-section of the individual quadriceps muscles is
histochemically stained for TR1 receptor protein expression. A time
course for TR1 receptor protein expression may be done in a similar
fashion except that quadriceps from different mice are harvested at
different times. Persistence of TR1 receptor DNA in muscle
following injection may be determined by Southern blot analysis
after preparing total cellular DNA and HIRT supernatants from
injected and control mice. The results of the above experimentation
in mice can be use to extrapolate proper dosages and other
treatment parameters in humans and other animals using TR1 receptor
naked DNA.
EXAMPLE 15
Gene Therapy Using the Endogenous TR1 Receptor Gene
Another method of gene therapy according to the present invention
involves operably associating the endogenous TR1 receptor sequence
with a promoter via homologous recombination as described, for
example, in U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication Number WO 96/29411, published Sep. 26,
1996; International Publication Number WO 94/12650, published Aug.
4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932 8935
(1989); and Zijlstra et al., Nature 342:435 438 (1989). This method
involves the activation of a gene which is present in the target
cells, but which is not expressed in the cells, or is expressed at
a lower level than desired. Polynucleotide constructs are made
which contain a promoter and targeting sequences, which are
homologous to the 5' non-coding sequence of endogenous TR1
receptor, flanking the promoter. The targeting sequence will be
sufficiently near the 5' end of TR1 receptor so the promoter will
be operably linked to the endogenous sequence upon homologous
recombination. The promoter and the targeting sequences can be
amplified using PCR. Preferably, the amplified promoter contains
distinct restriction enzyme sites on the 5' and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the
same restriction enzyme site as the 5' end of the amplified
promoter and the 5' end of the second targeting sequence contains
the same restriction site as the 3' end of the amplified
promoter.
The amplified promoter and the amplified targeting sequences are
digested with the appropriate restriction enzymes and subsequently
treated with calf intestinal phosphatase. The digested promoter and
digested targeting sequences are added together in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The construct is
size fractionated on an agarose gel then purified by phenol
extraction and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as
naked polynucleotides via electroporation. However, the
polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
Once the cells are transfected, homologous recombination will take
place which results in the promoter being operably linked to the
endogenous TR1 receptor sequence. This results in the expression of
TR1 receptor in the cell. Expression may be detected by
immunological staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation
buffer containing 1 mg/ml acetylated bovine serum albumin. The
final cell suspension contains approximately 3.times.10.sup.6
cells/ml. Electroporation should be performed immediately following
resuspension.
Plasmid DNA is prepared according to standard techniques. For
example, to construct a plasmid for targeting to the TR1 receptor
locus, plasmid pUC18 (MBI Fermentas, Amherst, N.Y.) is digested
with HindIII. The CMV promoter is amplified by PCR with an XbaI
site on the 5' end and a BamfHI site on the 3' end. Two TR1
receptor non-coding sequences are amplified via PCR: one TR1
receptor non-coding sequence (TR1 receptor fragment 1) is amplified
with a HindIII site at the 5' end and an Xba site at the 3'end; the
other TR1 receptor non-coding sequence (TR1 receptor fragment 2) is
amplified with a BamHI site at the 5' end and a HindIII site at the
3' end. The CMV promoter and TR1 receptor fragments are digested
with the appropriate enzymes (CMV promoter--XbaI and BamHI; TR1
receptor fragment 1-XbaI; TR1 receptor fragment 2-BamHI) and
ligated together. The resulting ligation product is digested with
HindIII, and ligated with the HindIII-digested pUC18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode
gap (Bio-Rad). The final DNA concentration is generally at least
120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5.times.10.sup.6 cells) is then added to of the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250 300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14 20 mSec should
be observed.
Electroporated cells are maintained at room temperature for
approximately 5 minutes, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37.degree. C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16 24 hours.
The engineered fibroblasts are then injected into the host, either
alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
The entire disclosure of all publications cited herein are hereby
incorporated by reference.
TABLE-US-00002 TABLE 2 Res Position I II III IV V VI VII VIII IX X
XI XII XIII XIV Met 1 A A . . . . . -0.23 -0.01 * . . 0.30 0.98 Asn
2 A A . . . . . -0.51 0.24 * . . -0.30 0.63 Lys 3 A A . . . . .
-0.79 0.39 * . . -0.30 0.27 Leu 4 A A . . . . . -0.99 0.53 * . .
-0.60 0.14 Leu 5 A A . . . . . -1.41 0.41 . . . -0.60 0.09 Cys 6 A
A . . . . . -1.67 0.70 * . . -0.60 0.04 Cys 7 A A . . . . . -2.37
1.34 * . . -0.60 0.03 Ala 8 A A . . . . . -3.22 1.44 * . . -0.60
0.04 Leu 9 A A . . . . . -2.41 1.44 . . . -0.60 0.05 Val 10 A A . .
. . . -2.49 0.87 . * . -0.60 0.17 Phe 11 A A . . . . . -2.12 0.99 .
* . -0.60 0.12 Leu 12 A A . . . . . -2.34 0.87 . * . -0.60 0.19 Asp
13 A A . . . . . -1.71 0.87 . * . -0.60 0.18 Ile 14 A A . . . . .
-1.19 0.23 . * . -0.30 0.42 Ser 15 A A . . . . . -0.64 0.36 . * .
-0.30 0.53 Ile 16 . . . B . . C -0.26 0.16 * * . -0.10 0.46 Lys 17
. . . B T . . 0.56 0.64 . * F -0.05 0.94 Trp 18 . . . B . . C 0.56
0.36 . * F 0.20 1.22 Thr 19 . . . B . . C 1.13 -0.03 . * F 0.80
3.01 Thr 20 . . . B . . C 0.73 -0.23 . * F 0.80 2.17 Gln 21 . . . B
T . . 1.41 0.56 . * F 0.34 1.79 Glu 22 . . . B T . . 1.16 0.07 . *
F 0.88 1.92 Thr 23 . . . . T . . 1.49 0.01 . * F 1.32 2.05 Phe 24 .
. . . . . C 1.56 -0.47 . . F 1.96 2.37 Pro 25 . . . . . T C 1.06
-0.11 . . F 2.40 2.15 Pro 26 . . . . T T . 1.02 0.57 . . F 1.46
1.23 Lys 27 . . . . T T . 0.78 0.59 . . F 1.22 1.93 Tyr 28 . . . .
. T C 1.09 0.56 . . . 0.63 1.95 Leu 29 . A . . . . C 1.79 0.13 . .
. 0.29 2.11 His 30 . A . . . . C 2.00 -0.30 . . . 0.65 1.83 Tyr 31
A A . . . . . 1.90 -0.30 . . . 0.45 2.02 Asp 32 A A . . . . . 1.56
-0.57 . . F 0.90 3.53 Glu 33 A A . . . . . 1.77 -0.87 . . F 0.90
3.48 Glu 34 A A . . . . . 2.58 -0.87 . * F 0.90 3.02 Thr 35 A . . .
. T . 1.80 -1.23 . . F 1.30 3.13 Ser 36 A . . . . T . 1.23 -0.54 .
. F 1.30 1.49 His 37 A . . . . T . 0.57 0.14 . . . 0.10 0.71 Gln 38
A . . . . T . 0.57 0.71 . . . -0.20 0.26 Leu 39 A . . . . . . 0.61
0.23 . . . -0.10 0.33 Leu 40 . . . . T . . 0.26 -0.16 . . . 1.17
0.48 Cys 41 . . . . T T . 0.34 -0.09 . . . 1.64 0.15 Asp 42 . . . .
T T . 0.17 -0.06 . . F 2.06 0.28 Lys 43 . . . . T T . -0.18 -0.31 .
. F 2.33 0.53 Cys 44 . . . . . T C 0.32 -0.57 . . F 2.70 0.97 Pro
45 . . . . . T C 0.89 -0.66 . . F 2.43 0.84 Pro 46 . . . . T T .
0.74 0.10 . . F 1.46 0.66 Gly 47 . . . . T T . 0.79 0.79 . . F 1.04
1.01 Thr 48 . . . . T T . 0.74 0.21 . . F 1.07 1.31 Tyr 49 A . . .
. . . 1.38 0.19 . . F 0.20 1.47 Leu 50 A . . . . . . 0.92 0.26 . .
F 0.20 2.01 Lys 51 A . . . . . . 0.82 0.40 . . . -0.40 0.75 Gln 52
A . . . . . . 0.58 0.40 . * . -0.40 0.69 His 53 A . . . . . . 0.93
0.14 . * . -0.10 0.84 Cys 54 A . . . . . . 0.89 -0.54 . * . 0.80
0.84 Thr 55 A . . . . . . 1.74 0.37 . * . -0.10 0.51 Ala 56 A . . .
. . . 1.39 -0.03 . * . 0.50 0.75 Lys 57 . . . B T . . 0.53 -0.04 .
* F 1.00 2.03 Trp 58 . . . B T . . -0.10 0.03 . * F 0.40 1.04 Lys
59 . . . B T . . -0.02 0.11 . * F 0.25 0.55 Thr 60 . . . B T . .
0.08 0.11 . * . 0.10 0.28 Val 61 . . . B T . . -0.00 0.54 . * .
-0.10 0.41 Cys 62 . . . B T . . -0.26 0.20 . * . 0.30 0.11 Ala 63 .
. B B . . . 0.03 0.63 . . . -0.30 0.12 Pro 64 . . . . T . . -0.04
0.14 . . . 0.70 0.27 Cys 65 . . . . T T . 0.02 0.00 . . . 1.00 0.67
Pro 66 . . . . T T . 0.63 0.19 . . F 1.20 1.05 Asp 67 . . . . T T .
0.99 0.44 . . . 0.65 1.06 His 68 . . . . T T . 1.58 0.50 . . . 0.55
2.85 Tyr 69 . . . . T . . 1.49 -0.07 . . . 1.15 3.08 Tyr 70 . . . .
T . . 1.87 -0.11 . . . 1.05 2.47 Thr 71 . . . . T T . 2.04 0.80 . .
. 0.35 1.91 Asp 72 . . . . T T . 1.73 0.80 . . . 0.63 1.66 Ser 73 .
. . . T T . 1.47 0.53 . . F 1.06 1.53 Trp 74 . . . . T T . 1.71
0.16 . . F 1.64 1.42 His 75 . . . . . T C 1.96 -0.33 . . F 2.32
1.42 Thr 76 . . . . T T . 1.60 -0.33 * . F 2.80 1.83 Ser 77 . . . .
T T . 0.79 -0.14 . . F 2.37 0.94 Asp 78 . . . . T T . 0.84 -0.37 .
. F 2.09 0.57 Glu 79 . . . . T . . 0.47 -0.11 . . . 1.46 0.62 Cys
80 . . . . T . . 0.20 -0.03 . . . 1.18 0.25 Leu 81 . . . . T . .
0.30 -0.03 . . . 0.90 0.20 Tyr 82 . . . . T . . -0.26 0.40 . . .
0.00 0.18 Cys 83 . . . . T . . -0.92 1.04 . . . 0.00 0.24 Ser 84 .
. . . . T C -0.88 1.04 . . . 0.00 0.16 Pro 85 . . . . T T . -0.21
0.36 . . . 0.50 0.20 Val 86 . . . . T T . -0.21 -0.40 * . . 1.10
0.65 Cys 87 A . . . . T . 0.03 -0.29 * . . 0.70 0.40 Lys 88 A A . .
. . . 0.46 -0.27 * . . 0.30 0.45 Glu 89 A A . . . . . -0.10 0.06 *
. . -0.30 0.95 Leu 90 A A . . . . . 0.16 0.06 * . . -0.15 1.32 Gln
91 A A . . . . . 1.01 -0.51 * . . 0.75 1.32 Tyr 92 A A . . . . .
1.68 -0.11 * . . 0.45 1.32 Val 93 A A . . . . . 0.97 -0.11 * . .
0.45 2.77 Lys 94 A A . . . . . 0.97 -0.23 * . F 0.79 0.86 Gln 95 A
A . . . . . 1.89 -0.23 * . F 1.13 0.88 Glu 96 A A . . . . . 1.58
-0.99 * . F 1.92 2.32 Cys 97 . . . . T T . 1.79 -1.14 * . F 3.06
1.68 Asn 98 . . . . T T . 2.64 -0.64 * * F 3.40 1.32 Arg 99 . . . .
T T . 2.71 -0.64 * * F 3.06 1.22 Thr 100 . . . . T T . 1.86 -0.64 *
* F 2.72 4.47 His 101 . . . . T . . 1.19 -0.57 * * F 2.18 2.06 Asn
102 . . . . T . . 1.86 -0.40 * * . 1.24 0.56 Arg 103 . A . . T . .
1.19 -0.40 * * . 0.70 0.68 Val 104 A A . . . . . 1.12 -0.31 * * .
0.30 0.27 Cys 105 . A . . T . . 1.43 -0.81 . . . 1.00 0.33 Glu 106
A A . . . . . 1.12 -1.21 . * . 0.60 0.29 Cys 107 A . . . . T . 1.23
-0.79 . * . 1.00 0.39 Lys 108 A . . . . T . 0.88 -1.43 . * F 1.30
1.43 Glu 109 A . . . . T . 0.92 -1.24 . . F 1.30 1.29 Gly 110 A . .
. . T . 1.59 -0.56 . . F 1.30 1.99 Arg 111 A A . . . . . 0.70 -1.13
. . F 0.90 1.72 Tyr 112 A A . . . . . 1.37 -0.44 * * . 0.30 0.70
Leu 113 A A . . . . . 0.62 -0.44 * * . 0.45 1.22 Glu 114 A A . . .
. . -0.04 -0.09 . * . 0.30 0.54 Ile 115 A A . . . . . -0.51 0.49 .
* . -0.60 0.18 Glu 116 A A . . . . . -0.58 0.41 . * . -0.60 0.18
Phe 117 A A . . . . . -0.37 -0.27 . * . 0.30 0.21 Cys 118 A A . . .
. . 0.56 0.23 . * . -0.30 0.41 Leu 119 A A . . . . . 0.26 -0.46 . *
. 0.64 0.47 Lys 120 . A . . T . . 0.48 -0.07 . * . 1.38 0.72 His
121 . . . . T T . 0.27 -0.29 . * F 2.27 0.72 Arg 122 . . . . T T .
0.76 -0.43 . * F 2.76 1.36 Ser 123 . . . . T T . 1.08 -0.69 . * F
3.40 1.05 Cys 124 . . . . . T C 1.19 -0.26 . * F 2.41 0.76 Pro 125
. . . . . T C 0.80 0.03 . * F 1.47 0.34 Pro 126 . . . . T T . -0.02
0.46 * . F 1.03 0.25 Gly 127 . . . . T T . -0.99 0.71 * . F 0.69
0.34 Phe 128 . . . . T T . -0.69 0.79 . . . 0.20 0.17 Gly 129 . . B
B . . . -0.61 0.76 . . . -0.60 0.19 Val 130 . . B B . . . -0.74
0.83 . . . -0.60 0.19 Val 131 . . B B . . . -0.84 0.83 . . . -0.60
0.22 Gln 132 . . B B . . . -0.71 0.53 . . . -0.60 0.32 Ala 133 . .
. B . . C -0.01 0.53 . . . -0.06 0.66 Gly 134 . . . B . . C 0.44
-0.11 . . F 1.48 1.53 Thr 135 . . . . . T C 1.30 -0.76 . . F 2.52
1.73 Pro 136 . . . . . T C 1.84 -0.76 . * F 2.86 2.76 Glu 137 . . .
. T T . 0.99 -0.77 . . F 3.40 4.03 Arg 138 . . . . T T . 0.91 -0.56
. . F 3.06 2.07 Asn 139 . . . B T . . 1.30 -0.47 . . F 1.87 0.72
Thr 140 . . . B T . . 1.72 -0.90 . * F 1.83 0.83 Val 141 . . . B T
. . 1.27 -0.90 . * . 1.34 0.83 Cys 142 . . . B T . . 1.06 -0.33 . .
. 1.01 0.28 Lys 143 . . . B T . . 0.94 -0.30 . * . 1.32 0.30 Arg
144 . . . . T . . 0.60 -0.79 * . F 2.28 0.67 Cys 145 . . B . . T .
0.21 -1.00 * . F 2.54 1.23 Pro 146 . . . . T T . 0.37 -0.79 * . F
3.10 0.53 Asp 147 . . . . T T . 0.73 0.00 * . F 1.89 0.24 Gly 148 .
. . . T T . 0.69 0.39 * . F 1.58 0.59 Phe 149 . . . . . . C 0.58
0.21 * . . 0.72 0.61 Phe 150 . . . . . T C 0.93 -0.21 . . . 1.55
0.63 Ser 151 . . . . . T C 0.84 0.27 . . F 1.13 0.93 Asn 152 . . .
. T T . 0.54 0.23 . . F 1.82 1.43 Glu 153 . . . . T T . 0.93 -0.17
. . F 2.76 2.22 Thr 154 . . . . T T . 1.04 -0.96 . . F 3.40 3.31
Ser 155 . . . . T T . 1.53 -0.84 . * F 3.06 2.08 Ser 156 . . . . T
T . 1.17 -0.81 * * F 3.06 1.86 Lys 157 A . . . . T . 1.28 -0.24 . *
F 2.21 0.69 Ala 158 A . . . . T . 1.32 -0.73 . * F 2.66 1.01 Pro
159 A . . . . T . 1.60 -1.11 . * F 2.66 1.50 Cys 160 . . . . T T .
1.59 -1.00 * * F 3.40 1.02 Arg 161 . . . . T T . 1.89 -0.51 * * F
3.06 1.46 Lys 162 . . . . T . . 1.18 -0.61 * * F 2.56 1.52 His 163
. . . . T T . 1.47 -0.47 . * F 2.16 1.52 Thr 164 . . . . T T . 0.82
-0.66 . * F 2.16 1.04 Asn 165 . . . . T T . 0.79 -0.01 . * . 1.26
0.39 Cys 166 . . . . T T . 0.33 0.77 . * . 0.40 0.25 Ser 167 . . .
B T . . -0.52 0.70 . . . -0.04 0.17 Val 168 . . . B T . . -1.30
0.90 . . . -0.08 0.09 Phe 169 A . . B . . . -1.80 1.19 . . . -0.52
0.13 Gly 170 A . . B . . . -2.11 1.30 . . . -0.56 0.08 Leu 171 A .
. B . . . -1.44 1.40 . . . -0.60 0.16 Leu 172 A . . B . . . -1.10
1.16 . . . -0.60 0.32 Leu 173 A . . B . . . -0.59 0.37 . * F 0.13
0.64 Thr 174 A . . B . . . 0.11 0.37 . * F 0.41 0.77 Gln 175 A . .
. . T . -0.13 0.09 . * F 1.24 1.50 Lys 176 . . . . T T . 0.37 -0.10
. * F 2.52 1.84 Gly 177 . . . . T T . 1.14 -0.30 . * F 2.80 1.84
Asn 178 . . . . T T . 1.96 -0.29 . * F 2.52 1.45 Ala 179 . . . . .
. C 2.27 -0.69 . . F 2.14 1.21 Thr 180 . . . . . . C 1.38 -0.29 * .
F 1.56 1.96 His 181 . . . . T T . 0.67 -0.03 . * . 1.38 0.86 Asp
182 . . . . T T . 0.71 0.14 . . . 0.50 0.45 Asn 183 . . . . T T .
0.37 0.03 . . . 0.50 0.42 Ile 184 . . . . T T . 0.96 -0.03 . . .
1.10 0.31 Cys 185 . . . . T T . 0.97 -0.13 . . . 1.10 0.30 Ser 186
. . . . T T . 1.00 0.26 . . F 0.95 0.25 Gly 187 . . . . T T . 0.70
-0.14 . . F 1.85 0.61 Asn 188 . . . . T T . 0.39 -0.44 . . F 2.30
1.52 Ser 189 . . . . . . C 1.28 -0.53 . . F 2.50 1.64 Glu 190 . . .
. T . . 1.99 -0.51 . . F 3.00 2.87 Ser 191 . . . . T . . 1.62 -0.94
. . F 2.70 3.56 Thr 192 . . . . T . . 1.62 -0.77 . * F 2.62 1.43
Gln 193 . . . . T T . 0.73 -0.73 . * F 2.59 0.81 Lys 194 . . . . T
T . 1.03 -0.04 . * F 2.21 0.43 Cys 195 . . . . T T . 0.18 -0.43 * *
F 2.13 0.49 Gly 196 . . . . T T . 0.17 -0.27 . * . 2.20 0.21 Ile
197 . . . B T . . -0.33 -0.19 . * . 1.58 0.15 Asp 198 . A B B . . .
-1.00 0.50 . * . 0.06 0.23 Val 199 . A B B . . . -1.04 0.50 . * .
-0.16 0.13 Thr 200 A A . B . . . -0.38 0.07 . * . -0.08 0.31 Leu
201 A A . B . . . -0.62 -0.61 . * . 0.60 0.33 Cys 202 A A . B . . .
-0.43 -0.11 . * . 0.30 0.44 Glu 203 A A . B . . . -1.13 0.03 * * .
-0.30 0.27 Glu 204 A A . . . . . -0.17 0.33 * * . -0.30 0.28 Ala
205 A A . B . . . -0.56 -0.36 * * . 0.45 1.02 Phe 206 A A . B . . .
-0.33 -0.14 . * . 0.30 0.51 Phe 207 A A . B . . . -0.52 0.36 * * .
-0.30 0.30 Arg 208 A A . B . . . -0.73 1.00 * * . -0.60 0.22 Phe
209 A A . B . . . -1.04 0.93 * * . -0.60 0.39 Ala 210 A A . B . . .
-0.41 0.63 . * . -0.60 0.65 Val 211 . A . B . . C -0.41 -0.16 . * .
0.50 0.66 Pro 212 . A . B . . C -0.02 0.63 . * F -0.25 0.66 Thr 213
. . . B T . . -0.34 0.33 . * F 0.25 0.95 Lys 214 . . . B T . . 0.36
0.26 . * F 0.40 1.98 Phe 215 . . . . . . C 0.66 0.01 . * F 0.40
2.06 Thr 216 . . . . . T C 0.70 0.50 * * F 0.30 1.50 Pro 217 . . .
. . T C 0.61 0.70 * * F 0.15 0.62 Asn 218 . . . . T T . 0.07 1.09 *
* . 0.20 0.96 Trp 219 . . . . T T . -0.79 0.94 * * . 0.20 0.49 Leu
220 . . . B . . C -0.94 1.14 * * . -0.40 0.26 Ser 221 . . B B . . .
-0.63 1.36 * . . -0.60 0.12 Val 222 . . B B . . . -0.42 0.96 * . .
-0.60 0.19 Leu 223 . . B B . . . -1.23 0.44 * . . -0.60 0.37 Val
224 . . B B . . . -1.16 0.44 * . . -0.60 0.23 Asp 225 . . . B T . .
-0.69 0.49 * . . -0.20 0.48 Asn 226 . . . . . . C -0.70 0.27 . . F
0.25 0.58 Leu 227 . . . . . T C 0.20 0.07 . . F 0.60 1.12 Pro 228 .
. . . T T . 0.16 -0.57 . . F 1.70 1.34 Gly 229 . . . . T T . 1.01
0.07 . * F 0.65 0.62 Thr 230 . . . . . T C 0.42 0.07 . * F 0.60
1.21 Lys 231 . . . . . . C 0.42 -0.11 . * F 0.85 0.79 Val 232 A . .
. . . . 0.93 -0.54 . * F 1.10 1.38 Asn 233 A . . . . T . 0.29 -0.59
. * F 1.30 1.28 Ala 234 A . . . . T . 0.63 -0.43 * * F 0.85 0.48
Glu 235 A . . . . T . 1.06 -0.43 * * F 1.00 1.11 Ser 236 A . . . .
T . 0.12 -1.07 * * F 1.30 1.35 Val 237 A A . . . . . 1.02 -0.79 * *
F 0.75 0.94 Glu 238 A A . . . . . 1.13 -1.29 * * F 0.90 1.08 Arg
239 A A . . . . . 1.72 -1.29 * * F 0.90 1.58 Ile 240 A A . . . . .
1.69 -1.27 * . F 1.20 3.70 Lys 241 A A . . . . . 1.69 -1.41 * . F
1.50 2.91 Arg 242 A A . . . . . 2.24 -1.03 * . F 1.80 1.99 Gln 243
. A . . . . C 2.24 -0.64 * * F 2.30 3.80 His 244 . . . . . T C 2.13
-0.93 * * F 3.00 3.29 Ser 245 . . . . . T C 3.02 -0.93 * . F 2.70
2.91
Ser 246 . . . . . T C 2.67 -0.53 . . F 2.40 2.91 Gln 247 . . . . .
T C 1.86 -0.44 * . F 1.80 3.09 Glu 248 . A . . T . . 1.86 -0.16 . *
F 1.30 1.99 Gln 249 A A . . . . . 1.08 -0.14 . . F 0.60 2.58 Thr
250 A A . . . . . 0.57 0.16 * . F 0.00 1.23 Phe 251 A A . . . . .
0.91 0.44 . . . -0.60 0.58 Gln 252 A A . . . . . 0.10 0.44 * . .
-0.60 0.67 Leu 253 A A . . . . . -0.19 0.73 * . . -0.60 0.39 Leu
254 A A . . . . . -0.14 1.16 * . . -0.60 0.47 Lys 255 A A . . . . .
0.13 0.37 * . . -0.30 0.54 Leu 256 A A . . . . . 0.83 0.47 * . .
-0.60 0.89 Trp 257 A A . . . . . 0.83 0.19 * . . -0.15 1.87 Lys 258
A A . . . . . 1.69 -0.10 * . F 0.60 1.51 His 259 A A . . . . . 2.50
-0.10 * . F 0.60 3.65 Gln 260 A A . . . . . 2.46 -0.79 * . F 0.90
5.80 Asn 261 . . . . T T . 3.27 -1.30 . . F 1.70 5.02 Lys 262 A . .
. . T . 2.67 -1.30 . . F 1.30 6.17 Asp 263 A . . . . T . 1.77 -1.11
* . F 1.30 2.50 Gln 264 A . . . . T . 1.84 -0.87 * . F 1.30 1.15
Asp 265 A . . B . . . 1.89 -1.27 * . F 0.90 1.15 Ile 266 A . . B .
. . 1.00 -1.27 * . F 0.90 1.38 Val 267 A . . B . . . 0.07 -0.59 * .
F 0.75 0.56 Lys 268 A . . B . . . 0.07 -0.30 * . . 0.30 0.23 Lys
269 A . . B . . . 0.07 0.10 * . . -0.30 0.58 Ile 270 A . . B . . .
-0.82 -0.59 * . . 0.75 1.30 Ile 271 A . . B . . . 0.07 -0.54 * * .
0.60 0.46 Gln 272 A . . B . . . 0.11 -0.54 * * . 0.60 0.38 Asp 273
. . B B . . . -0.60 0.14 * * . -0.30 0.45 Ile 274 A . . B . . .
-0.64 0.03 * * . -0.30 0.34 Asp 275 A . . B . . . 0.24 -0.66 * * .
0.60 0.34 Leu 276 . . . . T . . 0.83 -0.66 * . . 1.20 0.33 Cys 277
. . . . T T . -0.02 -0.27 * * . 1.10 0.63 Glu 278 A . . . . T .
-0.02 -0.31 * * F 0.85 0.28 Asn 279 A . . . . T . 0.98 0.09 * . F
0.25 0.59 Ser 280 A . . . . T . 0.94 -0.60 * . F 1.30 2.15 Val 281
A . . B . . . 0.87 -0.67 * . F 0.90 1.69 Gln 282 A . . B . . . 1.19
0.01 * . F -0.15 0.74 Arg 283 A . . B . . . 1.16 0.04 * . . -0.30
0.54 His 284 A . . B . . . 0.57 0.16 * . . -0.30 1.00 Ile 285 . . .
B . . C 0.87 0.01 * * . -0.10 0.58 Gly 286 . . . . . . C 0.91 0.01
* * . 0.10 0.48 His 287 . . . . . . C 0.60 0.70 * * . -0.20 0.29
Ala 288 . . . . . . C -0.21 0.69 * * . -0.20 0.60 Asn 289 . . . . .
. C -0.18 0.79 . * . -0.20 0.52 Leu 290 . A . . . . C 0.71 0.36 * *
. -0.10 0.66 Thr 291 A A . . . . . 0.24 0.26 . * . -0.15 1.14 Phe
292 A A . . . . . 0.39 0.44 * * . -0.60 0.58 Glu 293 A A . . . . .
0.68 0.04 * * . -0.15 1.39 Gln 294 A A . . . . . -0.13 -0.26 * * F
0.60 1.29 Leu 295 A A . . . . . 0.08 -0.06 * * F 0.60 1.23 Arg 296
A A . . . . . 0.39 -0.23 * * F 0.45 0.70 Ser 297 A A . . . . . 0.79
-0.23 * . . 0.30 0.70 Leu 298 A A . . . . . -0.02 -0.24 * * . 0.45
1.14 Met 299 A A . . . . . -0.23 -0.24 * * . 0.30 0.48 Glu 300 A A
. . . . . 0.23 0.19 * * . -0.30 0.55 Ser 301 A . . . . . . 0.17
0.23 . . F 0.05 0.66 Leu 302 A . . . . T . 0.51 -0.46 . . F 1.00
1.34 Pro 303 A . . . . T . 0.47 -1.07 . . F 1.30 1.55 Gly 304 . . .
. T T . 0.72 -0.43 . . F 1.25 0.86 Lys 305 A . . . . T . 0.13 -0.39
. . F 1.00 1.03 Lys 306 A A . . . . . 0.43 -0.57 . . F 0.75 0.67
Val 307 A A . . . . . 1.24 -1.00 . . F 0.90 1.18 Gly 308 A A . . .
. . 0.57 -1.43 * . F 0.75 0.98 Ala 309 A A . . . . . 0.91 -0.74 * .
F 0.75 0.34 Glu 310 A A . . . . . 0.91 -0.74 * . F 0.75 0.80 Asp
311 A A . . . . . 0.56 -1.39 * * F 0.90 1.63 Ile 312 A A . . . . .
0.52 -1.33 * * F 0.90 2.32 Glu 313 A A . . . . . 0.91 -1.14 * * F
0.75 0.94 Lys 314 A A . . . . . 0.91 -1.14 * * F 0.90 1.13 Thr 315
A A . . . . . 0.24 -0.64 * * F 0.90 1.62 Ile 316 A A . . . . . 0.29
-0.76 * * F 0.75 0.50 Lys 317 A A . . . . . 0.97 -0.76 * * F 0.75
0.50 Ala 318 A A . . T . . 0.67 -0.33 * . . 0.70 0.54 Cys 319 . A .
. T . . 0.62 -0.43 * . . 0.85 1.03 Lys 320 A A . . . . . 0.93 -1.11
* * F 0.75 0.86 Pro 321 A . . . . T . 0.93 -0.71 * . F 1.30 1.47
Ser 322 A . . . . T . 0.08 -0.53 * . F 1.30 1.93 Asp 323 A . . . .
T . 0.71 -0.41 * . F 0.85 0.79 Gln 324 A . . . . T . 0.57 -0.41 * .
F 1.00 1.03 Ile 325 A . . B . . . -0.29 -0.16 * . . 0.30 0.63 Leu
326 A . . B . . . -0.38 0.14 * . . -0.30 0.31 Lys 327 A . . B . . .
-0.89 0.53 * . . -0.60 0.24 Leu 328 A . . B . . . -1.18 0.81 * * .
-0.60 0.28 Leu 329 A . . B . . . -1.07 1.04 . * . -0.60 0.36 Ser
330 A . . B . . . -1.07 0.36 . * . -0.30 0.35 Leu 331 A . . B . . .
-0.21 1.04 . * . -0.60 0.30 Trp 332 A . . B . . . -0.26 0.36 . * .
0.04 0.73 Arg 333 A . . B . . . 0.21 0.07 . * . 0.38 0.88 Ile 334 .
. . B T . . 1.02 0.11 . * F 1.42 1.05 Lys 335 . . . B T . . 1.32
-0.57 * * F 2.66 1.67 Asn 336 . . . . T T . 2.13 -1.09 * * F 3.40
1.48 Gly 337 . . . . T T . 2.11 -1.09 * * F 3.06 3.52 Asp 338 . . .
. T T . 1.19 -1.29 * * F 2.72 2.54 Gln 339 . . . . . T C 2.12 -0.60
* . F 2.18 1.30 Asp 340 A . . . . . . 1.73 -1.00 * . F 1.44 2.64
Thr 341 A . . . . . . 0.92 -1.00 * . F 1.10 1.56 Leu 342 A A . . .
. . 0.67 -0.31 * . F 0.45 0.74 Lys 343 A A . . . . . 0.63 -0.10 * *
F 0.45 0.44 Gly 344 A A . . . . . 0.04 0.40 * * . -0.30 0.42 Leu
345 A A . . . . . -0.77 0.41 * . . -0.60 0.51 Met 346 A A . . . . .
-0.41 0.41 * * . -0.60 0.21 His 347 A A . . . . . 0.37 0.41 * * .
-0.60 0.42 Ala 348 A A . . . . . 0.02 0.49 * . . -0.60 0.70 Leu 349
A A . . . . . 0.41 0.19 * . . -0.30 0.95 Lys 350 A A . . . . . 0.91
-0.43 * . . 0.45 1.39 His 351 A A . . . . . 1.27 -0.44 . . F 0.60
1.99 Ser 352 A . . . . T . 1.27 -0.19 . . F 1.00 3.78 Lys 353 A . .
. . T . 1.16 -0.37 . . F 1.00 2.57 Thr 354 . . . . T T . 1.76 0.41
. . F 0.50 1.64 Tyr 355 . . . . T T . 1.76 0.34 . . . 0.65 1.89 His
356 . . . . . . C 1.48 -0.04 * . . 0.85 1.89 Phe 357 . .. . . . T C
0.92 0.44 * . . 0.15 1.89 Pro 358 . . . . T T . 0.57 0.60 * . F
0.35 0.89 Lys 359 . . . . T T . 0.88 0.33 * . F 0.65 0.95 Thr 360 A
. . . . T . 0.82 0.23 * . F 0.40 1.90 Val 361 A . . B . . . 0.04
-0.17 * . F 0.60 1.64 Thr 362 A . . B . . . 0.79 0.09 * . F -0.15
0.68 Gln 363 A . . B . . . 1.04 0.09 * . F -0.15 0.94 Ser 364 A . .
B . . . 0.69 -0.40 * . F 0.60 2.53 Leu 365 A A . . . . . 0.11 -0.56
* * F 0.90 2.53 Lys 366 A A . B . . . 1.08 -0.36 * * F 0.60 1.03
Lys 367 A A . B . . . 0.69 -0.76 * * F 0.90 1.50 Thr 368 A A . B .
. . -0.12 -0.36 * * F 0.60 1.57 Ile 369 A . . B . . . 0.14 -0.36 *
* . 0.30 0.65 Arg 370 A . . B . . . 0.66 0.14 * * . -0.30 0.44 Phe
371 A . . B . . . -0.09 0.53 * * . -0.60 0.41 Leu 372 A . . B . . .
-0.44 0.83 * * . -0.60 0.51 His 373 A . . B . . . -0.73 0.63 * * .
-0.60 0.37 Ser 374 . . . B . . C -0.09 1.24 . * . -0.40 0.43 Phe
375 A . . B . . . -0.16 1.21 . * . -0.60 0.81 Thr 376 A . . B . . .
-0.27 0.53 . . . -0.45 1.19 Met 377 A . . B . . . 0.30 0.71 . . .
-0.60 0.73 Tyr 378 A . . B . . . 0.33 1.09 . . . -0.45 1.33 Lys 379
A A . B . . . 0.68 0.70 * * . -0.45 1.59 Leu 380 A A . B . . . 0.57
0.21 * . . -0.15 3.21 Tyr 381 A A . B . . . 0.18 0.29 * * . -0.15
1.69 Gln 382 A A . B . . . -0.03 0.31 * * . -0.30 0.73 Lys 383 A A
. B . . . 0.21 1.00 * * . -0.60 0.73 Leu 384 A A . B . . . -0.43
0.31 * * . -0.30 0.81 Phe 385 A A . B . . . -0.51 0.17 . * . -0.30
0.46 Leu 386 A A . B . . . -0.61 0.46 * . . -0.60 0.16 Glu 387 A A
. B . . . -0.61 0.89 . . . -0.60 0.19 Met 388 A A . B . . . -0.66
0.60 * * . -0.60 0.36 Ile 389 A A . B . . . -0.70 0.21 * . . -0.30
0.76 Gly 390 A A . B . . . 0.00 0.17 * . . -0.30 0.33 Asn 391 A . .
B . . . 0.51 0.57 * . F -0.45 0.57 Gln 392 A . . B . . . -0.34 0.34
* . F 0.00 1.09 Val 393 A . . B . . . 0.30 0.30 . * F -0.15 0.82
Gln 394 A . . B . . . 0.30 -0.13 . * F 0.60 1.02 Ser 395 . . . B T
. . 0.34 0.16 . * F 0.25 0.41 Val 396 . . B B . . . -0.32 0.14 . .
F -0.15 0.74 Lys 397 . . B B . . . -1.13 0.07 . . F -0.15 0.23 Ile
398 . . B B . . . -0.67 0.36 . . . -0.30 0.14 Ser 399 . . B B . . .
-1.06 0.40 . * . -0.30 0.24 Cys 400 . . B B . . . -1.14 0.19 . * .
-0.30 0.16 Leu 401 . . B B . . . -0.68 0.61 . * . -0.60 0.28
SEQUENCE LISTINGS
1
1111527DNAHomo
sapienssig_peptide(46)..(106)mat_peptide(109)..(1248)CDS(46)..(1248)
1cgcccagccg ccgcctccaa gcccctgagg tttccgggga ccaca atg aac aag ttg
57 Met Asn Lys Leu -20ctg tgc tgc gcg ctc gtg ttt ctg gac atc tcc
att aag tgg acc acc 105Leu Cys Cys Ala Leu Val Phe Leu Asp Ile Ser
Ile Lys Trp Thr Thr -15 -10 -5cag gaa acg ttt cct cca aag tac ctt
cat tat gac gaa gaa acc tct 153Gln Glu Thr Phe Pro Pro Lys Tyr Leu
His Tyr Asp Glu Glu Thr Ser -1 1 5 10 15cat cag ctg ttg tgt gac aaa
tgt cct cct ggt acc tac cta aaa caa 201His Gln Leu Leu Cys Asp Lys
Cys Pro Pro Gly Thr Tyr Leu Lys Gln 20 25 30cac tgt aca gca aag tgg
aag acc gtg tgc gcc cct tgc cct gac cac 249His Cys Thr Ala Lys Trp
Lys Thr Val Cys Ala Pro Cys Pro Asp His 35 40 45tac tac aca gac agc
tgg cac acc agt gac gag tgt cta tac tgc agc 297Tyr Tyr Thr Asp Ser
Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser 50 55 60ccc gtg tgc aag
gag ctg cag tac gtc aag cag gag tgc aat cgc acc 345Pro Val Cys Lys
Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr 65 70 75cac aac cgc
gtg tgc gaa tgc aag gaa ggg cgc tac ctt gag ata gag 393His Asn Arg
Val Cys Glu Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu 80 85 90 95ttc
tgc ttg aaa cat agg agc tgc cct cct gga ttt gga gtg gtg caa 441Phe
Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln 100 105
110gct gga acc cca gag cga aat aca gtt tgc aaa aga tgt cca gat ggg
489Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly
115 120 125ttc ttc tca aat gag acg tca tct aaa gca ccc tgt aga aaa
cac aca 537Phe Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys
His Thr 130 135 140aat tgc agt gtc ttt ggt ctc ctg cta act cag aaa
gga aat gca aca 585Asn Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys
Gly Asn Ala Thr 145 150 155cac gac aac ata tgt tcc gga aac agt gaa
tca act caa aaa tgt gga 633His Asp Asn Ile Cys Ser Gly Asn Ser Glu
Ser Thr Gln Lys Cys Gly160 165 170 175ata gat gtt acc ctg tgt gag
gag gca ttc ttc agg ttt gct gtt cct 681Ile Asp Val Thr Leu Cys Glu
Glu Ala Phe Phe Arg Phe Ala Val Pro 180 185 190aca aag ttt acg cct
aac tgg ctt agt gtc ttg gta gac aat ttg cct 729Thr Lys Phe Thr Pro
Asn Trp Leu Ser Val Leu Val Asp Asn Leu Pro 195 200 205ggc acc aaa
gta aac gca gag agt gta gag agg ata aaa cgg caa cac 777Gly Thr Lys
Val Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Gln His 210 215 220agc
tca caa gaa cag act ttc cag ctg ctg aag tta tgg aaa cat caa 825Ser
Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln 225 230
235aac aaa gac caa gat ata gtc aag aag atc atc caa gat att gac ctc
873Asn Lys Asp Gln Asp Ile Val Lys Lys Ile Ile Gln Asp Ile Asp
Leu240 245 250 255tgt gaa aac agc gtg cag cgg cac att gga cat gct
aac ctc acc ttc 921Cys Glu Asn Ser Val Gln Arg His Ile Gly His Ala
Asn Leu Thr Phe 260 265 270gag cag ctt cgt agc ttg atg gaa agc tta
ccg gga aag aaa gtg gga 969Glu Gln Leu Arg Ser Leu Met Glu Ser Leu
Pro Gly Lys Lys Val Gly 275 280 285gca gaa gac att gaa aaa aca ata
aag gca tgc aaa ccc agt gac cag 1017Ala Glu Asp Ile Glu Lys Thr Ile
Lys Ala Cys Lys Pro Ser Asp Gln 290 295 300atc ctg aag ctg ctc agt
ttg tgg cga ata aaa aat ggc gac caa gac 1065Ile Leu Lys Leu Leu Ser
Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp 305 310 315acc ttg aag ggc
cta atg cac gca cta aag cac tca aag acg tac cac 1113Thr Leu Lys Gly
Leu Met His Ala Leu Lys His Ser Lys Thr Tyr His320 325 330 335ttt
ccc aaa act gtc act cag agt cta aag aag acc atc agg ttc ctt 1161Phe
Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr Ile Arg Phe Leu 340 345
350cac agc ttc aca atg tac aaa ttg tat cag aag tta ttt tta gaa atg
1209His Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu Phe Leu Glu Met
355 360 365ata ggt aac cag gtc caa tca gta aaa ata agc tgc tta
taactggaaa 1258Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys Leu
370 375 380tggccattga gctgtttcct cacaattggc gagatcccat ggatgagtaa
actgtttctc 1318aggcacttga ggctttcagt gatatctttc tcattaccag
tgactaattt tgccacaggg 1378tactaaaaga aactatgatg tggagaaagg
actaacatct cctccaataa accccaaatg 1438gttaatccaa ctgtcagatc
tggatcgtta tctactgact atattttccc ttattactgc 1498ttgcagtaat
tcaactggaa aaaaaaaaa 15272401PRTHomo sapiens 2Met Asn Lys Leu Leu
Cys Cys Ala Leu Val Phe Leu Asp Ile Ser Ile -20 -15 -10Lys Trp Thr
Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp -5 -1 1 5 10Glu
Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr 15 20
25Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys Ala Pro
30 35 40Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His Thr Ser Asp Glu
Cys 45 50 55Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Tyr Val Lys
Gln Glu 60 65 70 75Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Lys
Glu Gly Arg Tyr 80 85 90Leu Glu Ile Glu Phe Cys Leu Lys His Arg Ser
Cys Pro Pro Gly Phe 95 100 105Gly Val Val Gln Ala Gly Thr Pro Glu
Arg Asn Thr Val Cys Lys Arg 110 115 120Cys Pro Asp Gly Phe Phe Ser
Asn Glu Thr Ser Ser Lys Ala Pro Cys 125 130 135Arg Lys His Thr Asn
Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys140 145 150 155Gly Asn
Ala Thr His Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr 160 165
170Gln Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg
175 180 185Phe Ala Val Pro Thr Lys Phe Thr Pro Asn Trp Leu Ser Val
Leu Val 190 195 200Asp Asn Leu Pro Gly Thr Lys Val Asn Ala Glu Ser
Val Glu Arg Ile 205 210 215Lys Arg Gln His Ser Ser Gln Glu Gln Thr
Phe Gln Leu Leu Lys Leu220 225 230 235Trp Lys His Gln Asn Lys Asp
Gln Asp Ile Val Lys Lys Ile Ile Gln 240 245 250Asp Ile Asp Leu Cys
Glu Asn Ser Val Gln Arg His Ile Gly His Ala 255 260 265Asn Leu Thr
Phe Glu Gln Leu Arg Ser Leu Met Glu Ser Leu Pro Gly 270 275 280Lys
Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys 285 290
295Pro Ser Asp Gln Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys
Asn300 305 310 315Gly Asp Gln Asp Thr Leu Lys Gly Leu Met His Ala
Leu Lys His Ser 320 325 330Lys Thr Tyr His Phe Pro Lys Thr Val Thr
Gln Ser Leu Lys Lys Thr 335 340 345Ile Arg Phe Leu His Ser Phe Thr
Met Tyr Lys Leu Tyr Gln Lys Leu 350 355 360Phe Leu Glu Met Ile Gly
Asn Gln Val Gln Ser Val Lys Ile Ser Cys 365 370
375Leu38031188DNAHomo
sapienssig_peptide(1)..(61)mat_peptide(64)..(1185)CDS(1)..(1185)
3atg aac aag ttg ctg tgc tgc gcg ctc gtg ttt ctg gac atc tcc att
48Met Asn Lys Leu Leu Cys Cys Ala Leu Val Phe Leu Asp Ile Ser Ile
-20 -15 -10aag tgg acc acc cag gaa acg ttt cct cca aag tac ctt cat
tat gac 96Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His
Tyr Asp -5 -1 1 5 10gaa gaa acc tct cat cag ctg ttg tgt gac aaa tgt
cct cct ggt acc 144Glu Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys
Pro Pro Gly Thr 15 20 25tac cta aaa caa cac tgt aca gca aag tgg aag
acc gtg tgc gcc cct 192Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys
Thr Val Cys Ala Pro 30 35 40tgc cct gac cac tac tac aca gac agc tgg
cac acc agt gac gag tgt 240Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp
His Thr Ser Asp Glu Cys 45 50 55cta tac tgc agc ccc gtg tgc aag gag
ctg cag tac gtc aag cag gag 288Leu Tyr Cys Ser Pro Val Cys Lys Glu
Leu Gln Tyr Val Lys Gln Glu 60 65 70 75tgc aat cgc acc cac aac cgc
gtg tgc gaa tgc aag gaa ggg cgc tac 336Cys Asn Arg Thr His Asn Arg
Val Cys Glu Cys Lys Glu Gly Arg Tyr 80 85 90ctt gag ata gag ttc tgc
ttg aaa cat agg agc tgc cct cct gga ttt 384Leu Glu Ile Glu Phe Cys
Leu Lys His Arg Ser Cys Pro Pro Gly Phe 95 100 105gga gtg gtg caa
gct gga acc cca gag cga aat aca gtt tgc aaa aga 432Gly Val Val Gln
Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg 110 115 120tgt cca
gat ggg ttc ttc tca aat gag acg tca tct aaa gca ccc tgt 480Cys Pro
Asp Gly Phe Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys 125 130
135aga aaa cac aca aat tgc agt gtc ttt ggt ctc ctg cta act cag aaa
528Arg Lys His Thr Asn Cys Ser Val Phe Gly Leu Leu Leu Thr Gln
Lys140 145 150 155gga aat gca aca cac gac aac ata tgt tcc gga aac
agt gaa tca act 576Gly Asn Ala Thr His Asp Asn Ile Cys Ser Gly Asn
Ser Glu Ser Thr 160 165 170caa aaa tgt gga ata gat gtt acc ctg tgt
gag gag gca ttc ttc agg 624Gln Lys Cys Gly Ile Asp Val Thr Leu Cys
Glu Glu Ala Phe Phe Arg 175 180 185ttt gct gtt cct aca aag ttt acg
cct aac tgg ctt agt gtc ttg gta 672Phe Ala Val Pro Thr Lys Phe Thr
Pro Asn Trp Leu Ser Val Leu Val 190 195 200gac aat ttg cct ggc acc
aaa gta aac gca gag agt gta gag agg ata 720Asp Asn Leu Pro Gly Thr
Lys Val Asn Ala Glu Ser Val Glu Arg Ile 205 210 215aaa cgg caa cac
agc tca caa gaa cag act ttc cag ctg ctg aag tta 768Lys Arg Gln His
Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu220 225 230 235tgg
aaa cat caa aac aaa gac caa gat ata gtc aag aag atc atc caa 816Trp
Lys His Gln Asn Lys Asp Gln Asp Ile Val Lys Lys Ile Ile Gln 240 245
250gat att gac ctc tgt gaa aac agc gtg cag cgg cac att gga cat gct
864Asp Ile Asp Leu Cys Glu Asn Ser Val Gln Arg His Ile Gly His Ala
255 260 265aac ctc acc ttc gag cag ctt cgt agc ttg atg gaa agc tta
ccg gga 912Asn Leu Thr Phe Glu Gln Leu Arg Ser Leu Met Glu Ser Leu
Pro Gly 270 275 280aag aaa gtg gga gca gaa gac att gaa aaa aca ata
aag gca tgc aaa 960Lys Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile
Lys Ala Cys Lys 285 290 295ccc agt gac cag atc ctg aag ctg ctc agt
ttg tgg cga ata aaa aat 1008Pro Ser Asp Gln Ile Leu Lys Leu Leu Ser
Leu Trp Arg Ile Lys Asn300 305 310 315ggc gac caa gac acc ttg aag
ggc cta atg cac gca cta aag cac tca 1056Gly Asp Gln Asp Thr Leu Lys
Gly Leu Met His Ala Leu Lys His Ser 320 325 330aag acg tac cac ttt
ccc aaa act gtc act cag agt cta aag aag acc 1104Lys Thr Tyr His Phe
Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr 335 340 345atc agg ttc
ctt cac agc ttc aca atg tac aaa ttg tat cag aag tta 1152Ile Arg Phe
Leu His Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu 350 355 360ttt
tta gaa atg ata ggt aat cta gaa aag atc taa 1188Phe Leu Glu Met Ile
Gly Asn Leu Glu Lys Ile 365 3704395PRTHomo sapiens 4Met Asn Lys Leu
Leu Cys Cys Ala Leu Val Phe Leu Asp Ile Ser Ile -20 -15 -10Lys Trp
Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp -5 -1 1 5
10Glu Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr
15 20 25Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys Ala
Pro 30 35 40Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His Thr Ser Asp
Glu Cys 45 50 55Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Tyr Val
Lys Gln Glu 60 65 70 75Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys
Lys Glu Gly Arg Tyr 80 85 90Leu Glu Ile Glu Phe Cys Leu Lys His Arg
Ser Cys Pro Pro Gly Phe 95 100 105Gly Val Val Gln Ala Gly Thr Pro
Glu Arg Asn Thr Val Cys Lys Arg 110 115 120Cys Pro Asp Gly Phe Phe
Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys 125 130 135Arg Lys His Thr
Asn Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys140 145 150 155Gly
Asn Ala Thr His Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr 160 165
170Gln Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg
175 180 185Phe Ala Val Pro Thr Lys Phe Thr Pro Asn Trp Leu Ser Val
Leu Val 190 195 200Asp Asn Leu Pro Gly Thr Lys Val Asn Ala Glu Ser
Val Glu Arg Ile 205 210 215Lys Arg Gln His Ser Ser Gln Glu Gln Thr
Phe Gln Leu Leu Lys Leu220 225 230 235Trp Lys His Gln Asn Lys Asp
Gln Asp Ile Val Lys Lys Ile Ile Gln 240 245 250Asp Ile Asp Leu Cys
Glu Asn Ser Val Gln Arg His Ile Gly His Ala 255 260 265Asn Leu Thr
Phe Glu Gln Leu Arg Ser Leu Met Glu Ser Leu Pro Gly 270 275 280Lys
Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys 285 290
295Pro Ser Asp Gln Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys
Asn300 305 310 315Gly Asp Gln Asp Thr Leu Lys Gly Leu Met His Ala
Leu Lys His Ser 320 325 330Lys Thr Tyr His Phe Pro Lys Thr Val Thr
Gln Ser Leu Lys Lys Thr 335 340 345Ile Arg Phe Leu His Ser Phe Thr
Met Tyr Lys Leu Tyr Gln Lys Leu 350 355 360Phe Leu Glu Met Ile Gly
Asn Leu Glu Lys Ile 365 3705461PRTHomo sapiens 5Met Ala Pro Val Ala
Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu 1 5 10 15Trp Ala Ala
Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro
Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr
Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55
60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp
65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu
Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala
Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly
Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys
Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg
Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys
Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile
Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185
190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser
195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr
Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala
Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro
Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Phe Ala Leu Pro Val Gly
Leu Ile Val Gly Val Thr Ala Leu Gly 260 265 270Leu Leu Ile Ile Gly
Val Val Asn Cys Val Ile Met Thr Gln Val Lys 275 280 285Lys Lys Pro
Leu Cys Leu Gln
Arg Glu Ala Lys Val Pro His Leu Pro 290 295 300Ala Asp Lys Ala Arg
Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu305 310 315 320Ile Thr
Ala Pro Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser 325 330
335Ala Leu Asp Arg Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly
340 345 350Val Glu Ala Ser Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly
Ser Ser 355 360 365Asp Ser Ser Pro Gly Gly His Gly Thr Gln Val Asn
Val Thr Cys Ile 370 375 380Val Asn Val Cys Ser Ser Ser Asp His Ser
Ser Gln Cys Ser Ser Gln385 390 395 400Ala Ser Ser Thr Met Gly Asp
Thr Asp Ser Ser Pro Ser Glu Ser Pro 405 410 415Lys Asp Glu Gln Val
Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser 420 425 430Gln Leu Glu
Thr Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro 435 440 445Leu
Pro Leu Gly Val Pro Asp Ala Gly Met Lys Pro Ser 450 455
460633DNAHomo sapiens 6gccagaggat ccgaaacgtt tcctccaaag tac
33733DNAHomo sapiens 7cggcttctag aattacctat catttctaaa aat
33832DNAHomo sapiens 8cgcggatccg ccatcatgaa caagttgctg tg
32926DNAHomo sapiens 9cgcggtaccc aattgtgagg aaacag 261031DNAHomo
sapiens 10gcgcggatcc atgaacaagt tgctgtgctg c 311134DNAHomo sapiens
11gcgctctaga ttacctatca tttctaaaaa taac 34
* * * * *