U.S. patent number 6,475,796 [Application Number 09/574,708] was granted by the patent office on 2002-11-05 for vascular endothelial growth factor variants.
This patent grant is currently assigned to Scios, Inc.. Invention is credited to Judith A. Abraham, N. Stephen Pollitt.
United States Patent |
6,475,796 |
Pollitt , et al. |
November 5, 2002 |
Vascular endothelial growth factor variants
Abstract
The invention is directed to a method of enhancing the
biological activity of vascular endothelial growth factors (VEGF).
The invention further concerns certain VEGF variants having
enhanced biological activity, methods and means for preparing these
variants, and pharmaceutical compositions comprising them. In a
further aspect, the invention concerns methods of treatment using,
and articles of manufacture containing such VEGF variants.
Inventors: |
Pollitt; N. Stephen (Los Altos,
CA), Abraham; Judith A. (San Jose, CA) |
Assignee: |
Scios, Inc. (Sunnyvale,
CA)
|
Family
ID: |
22467519 |
Appl.
No.: |
09/574,708 |
Filed: |
May 18, 2000 |
Current U.S.
Class: |
435/455;
424/198.1; 530/350; 514/8.1 |
Current CPC
Class: |
A61P
9/14 (20180101); C07K 14/52 (20130101); A61P
9/12 (20180101); A61P 43/00 (20180101); A61P
7/02 (20180101); A61P 9/10 (20180101); A61P
7/00 (20180101); A61P 9/00 (20180101); A61K
38/00 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/52 (20060101); A61K
38/00 (20060101); C12N 015/87 (); C07K 017/00 ();
A61K 039/00 (); A61K 038/00 () |
Field of
Search: |
;530/350 ;514/2
;424/198.1 ;435/455 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0370989 |
|
Nov 1989 |
|
EP |
|
B0484401 |
|
Jul 1990 |
|
EP |
|
0484401 |
|
Sep 1996 |
|
EP |
|
0484401 |
|
Sep 1996 |
|
EP |
|
WO91/02058 |
|
Feb 1991 |
|
WO |
|
WO98/10071 |
|
Mar 1998 |
|
WO |
|
WO98/24811 |
|
Jun 1998 |
|
WO |
|
Other References
Proudfoot et al., J. Biol. Chem., 1996, vol. 271, pp. 2599-2603.*
.
Kruse et al., EMBO J., 1993, vol. 12, pp. 5121-5129.* .
Achen et al., "Vascular endothelial growth factor D (VEGF-D) is a
ligand for the tyrosine kinases VEGF receptor 2(Flk1) and VEGF
receptor 3(Flt4)" Proc. Natl. Aca. Sci. 95:548-553 (1998). .
Altschul et al., "Gapped BLAST and PSI-BLAST: a new generation of
protein database programs", Nucleic Acids Res. 25:3389-3402 (1997).
.
Ausubel et al., "Current Protocols in Molecular Biology" eds.
(1987). .
Beach and Nurse, "High-frequency transformation of the fission
yeast Schizosaccharomyces pombe" Nature 290:140 (1981). .
C. Anthony, "The Biochemistry of Methylotrophs" Department of
Biochemistry University of Southampton, England 269 (1982). .
Cohen et al. "High Levels of Biologically Active Vascular
Endothelial Growth Factor (VEGF) are Produced by the Baculovirus
Expression System", Growth Factors 7:131-138 (1993). .
Cohen et al. "VEGF121, a Vascular Endothelial Growth Factor (VEGF)
Isoform Lacking Heparin Binding Ability, Requires Cell-surface
Heparan Sulfates for Efficient Binding to VEGF Receptors of Human
Melanoma Cells", J. Biol. Chem. 270:11322-11326 [1995]. .
Conn et al., "Purification of glycoprotein vascular endothelial
cell mitogen from a rat glioma-derived cell line"PNAS USA
87:1323-1327 (1990). .
Connolly et al., "Human Vascular Permeability Factor" J. Biol Chem.
264:20017-20024 [1989]. .
Connolly et al., "Tumot Vascular Permeability Factor Stimualtes
Endothelial Cell Growth and Angiogenesis" J. Clin. Invest. 84:
1470-1478 (1989). .
Cregg et al. in, "High-Level Expression and Efficient Assembly of
Hepatitis B Surface Antigen in: The Methylotrophic Yeast, Pichia
Pastoris, Bio/Technology" 5:479-485 (1987). .
D. Gospodarowicz et al., "Isolation and Characterization of a
Vascular Endothelial Cell Mitogen Produced by Pituitary-Derived
Folliculo Stellate Cells" PNAS USA 86:7311-7215 (1989). .
Dvorak et al. "Distribution of Vascular Permeability Factor
(Vascular Endothelial Growth Factor) in Tumors: Concentration in
Tumor Blood Vessels" J. Exp. Med. 174:1275-1278 (1991). .
Ferrara and Henzel, "Pituitary Follicular Cells Secrete a Novel
Heparin-Binding Growth Factor Specific for Vascular Endothelial
Cells" Biochem. Biophys. Res. Comm. 161:851-858 (1988). .
Fiebich et al., :Synthesis and assembly of functionally active
human vascular endothelial growth factor homodimers in insect cells
Eur. J. Biochem 211:19-26 (1993). .
Fiers et al., "Complete nucleotide sequence of SV40 DNA" Nature
273:113 [1978]. .
Freshney, "Animal Cell Culture" ed. IRL Press (1987). .
Gait, "Oligonucleotide Synthesis" ed. IRL Press (1984). .
Gitay-Goren et al. "Selective Binding of VEGF121 to One the Three
Vascualr Endothelial Growth Factor Receptors of Vascular
Endothelial Cells", J. Biol. Chem. 271:5519-5523 [1996]). .
Goeddel et al., "Direct expression in Escherichia coli of a DNA
sequence coding for human growth hormone" Nature 281:544 [1979].
.
Goto et al., "Synergistic Effects of Vascular Endothelial Growth
Factor and Basic Fibroblast Growth factor on the Proliferation and
Cord Formation of Bovine Capillary Enndothelial Cells Within
Collagen Gels" Lab. Invest. 69:508-517 (1993). .
Graham et al, "Characteristics of Human Cell Line Transformed by
DNA from Human Adenovirus Type 5" J. Gen. Virol. 36:59 [1977].
.
Hinnen, et al., "Transformation of Yeast" Proc. Natl. Acad, Sci.
USA 75:1929-1933 [1978]. .
Hitzeman, et al., "Isolation and Characterization of the Yeast
3-Phosphoglycerokinase Gene (PGK) by an Immunological Screening
Technique" J. Biol. Chem. 255:2073 [1980]. .
Holland et al., "Isolation and Identification of Yeast Messenger
Ribonucleic Acids Coding for Enolase, Glucerldehyde-3-phosphate
Dehydrogenase and Phosphoglycerate Kinase" Biochemistry 17:4900
(1978). .
Houck et al., "Dual Regulation of Vascualr Endothelial Growth
Factor Bioavailability by Genentic and Proteolytic Mechanisms" J.
Biol. Chem. 267:26031-26037 [1992]. .
Houck et al., "The Vascular Endothelial Growth Factor Family:
Identification of a Fourth Molecular Species and Characterization
of Altyernative Splicing of RNA" Mol. Endo. 5:1806-1814 [1991].
.
Keck et al., "Disulfide Structure of the Heparin Binding Domain in
Vascular Endothelial Growth Factor: Caharacterization of
Posttranswlational Modifications" Arch Biochem. Biophys.
344:103-113 (1997). .
Keck et al., "Vascular Permeability Factor, an Endothelial Cell
Mitogen Related to PDGH" Science 246:1309-1312 (1989). .
Kelly and Hynes, "Trasformation of Aspergillus niger by the amdS
gene of Aspergillus nidularis" EMBO J. 4:475-479 [1985]. .
Kendall and Thomas, "Inhibition of vascular endothelial cell growth
factor activity by an endogenously encoded soluble receptor" PNAS
USA 90:10705-10709 (1993). .
Keyt et al., "The Carboxyl-terminal Domain (111-165) of Vascular
Endothelial Growth Factor Is Critical for Its Mitogenic Potency" J.
Biol. Chem. 271:7788-7795 [1996]. .
Kim et al., "Inhibition of vascular endothelial growth
factor-induced angiogenesis suppresses tumour growth in vivo"
Nature 362:841-844 (1993). .
Kondo et al., "The shortest isoform of human vascular endothelial
growth factor/vascular permeability factor (VEGF/VPF121) produced
by Saccharomyces cerevisiae promotes both angiogeness and vascualr
premeabiliyt" Biochim. Biophys. Acta 1243:195-202 [1995]. .
Koolwijk et al., "Cooperative Effect of TNF.alpha., Bfgf, and vegf
on the Formation of Tubular Sturctures of Human Microvascular
Endothelial Cells in a Fibrin Matrix. Rile of Urokinase Activity"
J. Cell Biol. 132: 1177-1188 (1996). .
Korz et al. "Simple fed-batch technique for high cell density
cultivation of Escherichia coli", J. Bacteriol. 39:59-65, (1995).
.
Leung et al., "Vascular Endothelial Growth Factor Is A Secreted
Angiogenic Mitogen" Science 246:1306-1309 (1989). .
Miller & Calos, "Gene Transfer Vectors for Mammalian Cells" ed.
Current Communications in Molecular Biology (1987). .
Mohanraj et al., "A Novel Method to Purify Recombinant Vascular
Endothelial Grwoth Factor (VEGF121) Expressed in Yeast" Biochem.
Biophys. Res. Comm. 215:750-756 [1995]. .
Muller, et al., "Vascular endothelial growth factor:Crystal
structure and functional mapping of the kinase domain receptor
binding site" PNAS USA 94:7192-7197 [1997]. .
Mullis et al., "PCR: The Polymerase Chain Reaction" ed. Birkhauser
(1994). .
Pepper et al., "Potent Synergism Between Vascular Endothelial
Growth Factor and Basic Fibroblast Growth Factor in the Induction
of Angiogenesis In Vitro" Biochem. Biophys. Res. Commun.
189:824-831 (1992). .
Phillips et al., "Vascular Endothelial Growth Factor (rhVEGF165)
Stimulates Direct Angiogenesis in the Rabbit Cornea" In Vivo
8:961-965 (1995). .
Plate et al., "Vascular endothelial growth factor is a potential
tumour angiogenesis factor in human gliomas in vivo" Nature
359:845-848 (1992). .
Plouet et al., "Isolation and characterization of a newly
identified endothelial cell mitogen produced by AtT-20 cells" EMBO.
J. 8: 3801-3806 (1989). .
Sambrook et al., "Molecular Cloning:A Laboratory Manual", Second
Edition, Sections 1.82, 16.32-16.37 1988. .
Siemeister et al. "The .alpha.-Helical Domain Near the Amino
Terminus is Essential for Dimerization of Vascular Endothelial
Growth Factor" J. Biol. Chem. 273:11115-11120 [1998]. .
Siemeister et al., "Expression of Biologically Active Isoforms of
the Tumor Angiogenesis Factor VEGF in Escherichia coli", Biochem,
Biophys. Res. Comm. 222:249-255 (1996). .
Soker et al., "Neuropilin-1 Is Expressed by Endothelial and Tumor
Cells as an Isoform-Specific Receptor for Vascular Endothelial
Growth Factor" Cell 92;735-745 [1998]. .
Soker et al., "Characterization of Novel Vascular Endothelial
Growth Factor (VEGF) Receptors on Tumor Cells That Bind VEGF 165
via Its Exon 7-encoded Domain" J. Biol.Chem. 271:5761-5767 (1996).
.
Tisher et al., "The Human Gene for Vascular Endothelial Growth
Factor" J. Biol. Chem. 266:11947-11954 (1991). .
Urlaub and Chasin, "Isolation of Chinese Hamster Cell Mutants
Deficient in Dihydrofolate Reductase Activity" Proc. Natl. Acad.
Sci. USA 77:4216 [1980]. .
Vincenti et al., "Assignment of the Vascular Endothelial Growth
Factor Genes to Human Chromosome 6p21.3" Circulation 93:1493-1495
(1996). .
Wagner and Hynes, "Domain Structure of Fibronectin and Its Relation
to Function" J. Biol. Chem. 254:6746-6754 [1979]. .
Waltenberger et al., "Different Signal Transduction Properties of
KDR and Flt1, Two Receptors for Vascualr Endothelial Growth Factor"
J. Biol. Chem. 269:26988-26995 (1994). .
Wang and Hanson "Parenteral Formulations of Proteins and Peptides:
Stability and Stabilizers", Journal of Parenteral Science and
Technology, Technical Report No. 10, Supp. 42-2S (1988). .
Yang et al., "Substantially Attenuated Hemodynamic Responses to
Escherichia coli-Derived Vascular Endothelial Growth Factor Given
by Intravenous Infusion Compared with Bolus Injection" J.
Pharmacol. Experimental Therpeutics 284: 103-110 (1998). .
Proudfoot et al., J. Biol. Chem., 1996, vol. 271, pp. 2599-2603.*
.
Kruse et al., EMBO J., 1993, vol. 12, pp. 5121-5129..
|
Primary Examiner: Eyler; Yvonne
Assistant Examiner: Andres; Janet L.
Attorney, Agent or Firm: Knobbe, Martens Olson & Bear
LLP
Parent Case Text
This application claims the benefit of provisional application No.
60/135,312 filed on May 20, 1999.
Claims
What is claimed is:
1. A method of enhancing the biological activity of a vascular
endothelial growth factor (VEGF) originally having a cysteine (C)
residue at a position corresponding to amino acid position 116 of
the 121 amino acids long native mature human VEGF (hVEGF.sub.121)
(position 142 of SEQ ID NO: 2) and an N-linked glycosylation site
at a position corresponding to amino acid positions 75-77 of
hVEGF.sub.121 (positions 101-103 of SEQ ID NO: 2), comprising (a)
eliminating said cysteine (C) residue and removing said N-linked
glycosylation site by site-directed mutagenesis of the encoding
nucleic acid sequence to produce a VEGF variant, said variant
having at least 85% sequence identity with the native mature
hVEGF.sub.121 polypeptide (amino acids 27-147 of SEQ ID NO: 2), and
(b) determining the biological activity of said VEGF variant
relative to the said hVEGF121 to confirm the enhancement of
biological activity.
2. The method of claim 1 wherein said cysteine (C) residue is
substituted by the residue of another amino acid.
3. The method of claim 2 wherein said other amino acid is serine
(S).
4. The method of claim 2 wherein, apart from the substitution at
position 116 and the removal of the glycosylation site at positions
75-77, said VEGF variant retains the amino acid sequence of mature
hVEGF.sub.121 (amino acids 27-147 of SEQ ID NO: 2).
5. The method of claim 1 wherein said glycosylation site is removed
by amino acid substitution for at least one residue in the
asparagine-isoleucine-threonine (N-I-T) glycosylation site at
positions 75-77 of hVEGF.sub.121 (positions 101-103 of SEQ ID NO:
2).
6. The method of claim 5 wherein asparagine (N) at position 75 is
substituted by another amino acid.
7. The method of claim 6 wherein said other amino acid is glutamine
(Q).
8. The method of claim 7 wherein said VEGF variant has asparagine
(N) at position 75 substituted by glutamine (Q) and cysteine (C) at
position 116 substituted by serine (S), but otherwise retains the
amino acid sequence of hVEGF121 (amino acids 27-147 of SEQ ID NO:
2).
9. A variant of a native vascular endothelial growth factor (VEGF)
having a cysteine (C) residue at amino acid position 116 and a
glycosylation site at amino acid positions 75-77, comprising the
substitution of said cysteine (C) by another amino acid and having
said glycosylation site removed, wherein the amino acid numbering
follows the numbering of the 121 amino acids long native human VEGF
(hVEGF121) (amino acids 27-147 of SEQ ID NO: 2), and wherein said
variant has at least 85% sequence identity with a mature hVEGF121
polypeptide (amino acids 27-147 of SEQ ID NO: 2), and has enhanced
biological activity compared to mature hVEGF121 (amino acids 27-147
of SEQ ID NO: 2).
10. The variant of claim 9 wherein said cysteine (C) is substituted
by serine (S).
11. The variant of claim 9 wherein said glycosylation site is
removed by amino acid substitution for at least one residue in the
asparagine-isoleucine-threonine (N-I-T-) glycosylation site at
positions 75-77 of mature hVEGF121 (positions 101-103 of SEQ ID NO:
2).
12. The variant of claim 11 wherein asparagine (N) at amino acid
position 75 is substituted by glutamine (Q).
13. A composition comprising a VEGF variant of claim 9 in admixture
with a pharmaceutically acceptable excipient.
14. The composition of claim 13 wherein in said VEGF variant
asparagine (N) at amino acid position 75 is substituted by
glutamine (Q).
15. An article of manufacture comprising a VEGF variant (a) having
a cysteine (C) residue at amino acid position 116 substituted by
another amino acid, and a glycosylation site at amino acid
positions 75-77 removed by site-directed mutagenesis of the
encoding nucleic acid, where the amino acid numbering follows the
numbering of the 121 amino acids long native human VEGF (hVEGF121)
(amino acids 27-147 of SEQ ID NO: 2), (b) having at least 85%
sequence identity with the mature hVEGF121 polypeptide (amino acids
27-147 of SEQ ID NO: 2), and (c) having enhanced biological
activity relative to said mature hVEGF121 (amino acids 27-147 of
SEQ ID NO: 2); a container; and a label or package insert
comprising instructions for administration of said VEGF
variant.
16. The article of manufacture of claim 15 wherein said
instructions concern the treatment of coronary artery disease.
17. The article of manufacture of claim 16 wherein said
instructions concern the treatment of peripheral arterial disease.
Description
BACKGROUND OF THE INVENTION
I. Field of the Invention
This invention is directed to a method of enhancing the biological
activity of vascular endothelial growth factors (VEGF). The
invention further concerns certain VEGF variants having enhanced
biological activity. The invention also concerns methods and means
for preparing these variants, and pharmaceutical compositions
comprising them. The invention further concerns methods of
treatment using, and articles of manufacture containing such VEGF
variants.
II. Description of Background and Related Art
Vascular endothelial growth factor (VEGF), also referred to as
vascular permeability factor (VPF), is a secreted protein generally
occurring as a homodimer and having multiple-biological functions.
The native human VEGF monomer occurs as one of five known isoforms,
consisting of 121, 145, 165, 189, and 206 amino acid residues in
length after removal of the signal peptide. The corresponding
homodimer isoforms are generally referred to as hVEGF.sub.121,
hVEGF.sub.145, hVEGF.sub.165, hVEGF.sub.189, and hVEGF.sub.206,
respectively. The known isoforms are generated by alternative
splicing of the RNA encoded by a single human VEGF gene that is
organized in eight exons, separated by seven introns, and has been
assigned to chromosome 6p21:3 (Vincenti et al., Circulation
93:1493-1495 [1996]). A schematic representation of the various
forms of VEGF generated by alternative splicing of VEGF mRNA is
shown in FIG. 1, where the protein sequences encoded by each of the
eight exons of the VEGF gene are represented by numbered boxes.
VEGF.sub.165 lacks the residues encoded by exon 6, while
VEGF.sub.121 lacks the residues encoded by exons 6 and 7. With the
exception of hVEGF.sub.121, all VEGF isoforms bind heparin. The
lack of a heparin-binding region in hVEGF.sub.121 is believed to
have a profound effect on its biochemical properties. In addition,
proteolytic cleavage of hVEGF produces a 110-amino acid species
(hVEGF.sub.110).
hVEGF.sub.121 and hVEGF.sub.165 are the most abundant of the five
known isoforms. They both bind to the receptors KDR/Flk-1 and Flt-1
but hVEGF.sub.165 -additionally binds to a more recently discovered
receptor (VEGF.sub.165 R) (Soker et al., J. Biol. Chem.
271:5761-5767 [1996]). VEGF.sub.165 R has been recently cloned by
Soker et al., and shown to be equivalent to a previously-defined
protein known as neuropilin-1 (Cell 92:735-745 [1998]). The binding
of hVEGF.sub.165 to the latter receptor is mediated by the
exon-7encoded domain, which is not present in hVEGF.sub.121.
VEGF is a potent mitogen for micro- and macrovascular endothelial
cells derived from arteries, veins, and lymphatics, but shows
significant mitogenic activity for virtually no other normal cell
types. The denomination of VEGF reflects this narrow target cell
specificity. VEGF has been shown to promote angiogenesis in various
in vivo models, including, for example, the chick chorioallantoic
membrane (Leung et al., Science 246:1306-1309 [1989]; Plouet et
al., EMBO J 8:3801-3806 [1989]); the rabbit cornea (Phillips et
al., In Vivo 8:961-965 [1995]); the primate iris (Tolentino et al.,
Arch Opthalmol 114:964-970 [1996]); and the rabbit bone (Connolly
et al., J. Clin. Invest. 84:1470-1478 [1989]). As a result of its
pivotal role in angiogenesis (spouting of new blood vessels) and
vascular remodeling (enlargement of preexisting vessels), VEGF is a
promising candidate for the treatment of coronary artery disease
and peripheral vascular disease. High levels of VEGF are expressed
in various types of tumors in response to tumor-induced hypoxia
(Dvorak et al., J. Exp. Med. 174:1275-1278 [1991]; Plate et al.,
Nature 359:845-848 [1992]), and tumor growth has been inhibited by
anti-VEGF antibodies and soluble VEGF receptors (Kim et al., Nature
362:841-844 [1993]; Kendall and Thomas, PNAS USA 90:10705-10709
[1993]).
The biologically active form of hVEGF.sub.121 is a homodimer (in
which the two chains are oriented anti-parallel) containing one
N-linked glycosylation site per monomer chain at amino acid
position 75 (Asn-75), which corresponds to a similar glycosylation
site at position 75 of hVEGF.sub.165. If the N-linked glycosylation
structures are removed, the biologically active molecule has a
molecular weight of about 28 kDa with a calculated pI of 6.1. Each
monomer chain in the hVEGF.sub.121, homodimer has a total of nine
cysteines, of which six are involved in the formation of three
intra-chain disulfides stabilizing the monomeric structure, two are
involved in two inter-chain disulfide bonds stabilizing the dimeric
structure, while until recently one cysteine (Cys-116) has been
believed to remain unpaired. Recently, a Cys(116)--Cys(l 16)
inter-chain disulfide bond has been reported in E. coli derived
recombinant hVEGF.sub.121 (Keck et al., Arch. Biochem. Biophys.
344:103-113 [1997]), and there are data indicating that
VEGF.sub.121, as produced in nature, also occurs in the form of
homodimers that have the cysteines at positions 116
disulfide-bonded with each other. EP 0 484 401 describes the
substitution of one or more cysteine residues, including Cys-116,
within the native VEGF molecule by another amino acid, to render
the molecule more stable.
SUMMARY OF THE INVENTION
The present invention concerns methods and means for enhancing the
biological activity of vascular endothelial growth factor (VEGF),
new VEGF variants with enhanced biological activity, and various
uses of such new variants.
In a specific aspect, the invention concerns a method of enhancing
the biological activity of a VEGF originally having a cysteine (C)
residue at a position corresponding to amino acid position 116 of
the 121 amino acids long native mature human VEGF (hVEGF).sub.21)
by removing such cysteine (C) residue to produce a VEGF variant.
The variant preferably comprises a glycosylation site at a position
corresponding to amino acid positions 75-77 of hVEGF.sub.121, which
is altered or removed, preferably by amino acid substitution within
the glycosylation site to which the glycosylation would normally
attach, so that glycosylation can no longer occur.
In another aspect, the invention concerns a variant of a native
VEGF that originally has a cysteine (C) residue at amino acid
position 116 and a glycosylation site at amino acid positions
75-77, comprising the substitution of said cysteine (C) by another
amino acid and having the glycosylation site altered or removed,
wherein the amino acid numbering follows the numbering of the 121
amino acids long native human VEGF (hVEGF.sub.121), and wherein the
variant has enhanced biological activity compared to hVEGF.sub.121.
The invention also concerns nucleic acid encoding such VEGF
variants, a vector comprising the nucleic acid, cells transformed
with such vector, and method for making the novel VEGF
variants.
In yet another aspect, the invention concerns a composition
comprising a VEGF variant having a cysteine (C) residue at amino
acid position 116 substituted by another amino acid, and a
glycosylation site at amino acid positions 75-77 altered or
removed, wherein the amino acid numbering follows the numbering of
the 121 amino acids long native human VEGF (hVEGF.sub.121).
In a further aspect, the invention concerns a method of inducing
angiogenesis and/or vascular remodeling by administering to a
patient in need a VEGF variant having a cysteine (C) residue at
amino acid position 116 substituted by another amino acid, and a
glycosylation site at amino acid positions 75-77 altered or
removed, wherein the amino acid numbering follows the numbering of
the 121 amino acids long native human VEGF (hVEGF.sub.121). In a
particular embodiment, this method concerns the treatment of
coronary artery disease or peripheral vascular disease.
In a still further aspect, the invention concerns a method for the
prevention or repair of injury to blood vessels by administering an
effective amount of a VEGF variant having a cysteine (C) residue at
amino acid position 116 substituted by another amino acid, and a
glycosylation site at amino acid positions 75-77 altered or
removed, wherein the amino acid numbering follows the numbering of
the 121 amino acids long native human VEGF (hVEGF.sub.121). In a
particular embodiment, the injury is associated with microvascular
angiopathy, such as thrombotic microangiopathy (TMA). In a further
embodiment, the invention concerns the treatment of microvascular
angiopathy, e.g. TMA of the kidney, heart, or lungs. In a
particularly preferred embodiment, the invention concerns the
prevention or repair of injury to blood vessels in association with
hemolytic uremic syndrome (HUS), including thrombotic
thrombocytopenic purpura (TTP).
In another aspect, the invention concerns a method for the
treatment of essential hypertension by administering an effective
amount of a VEGF variant having a cysteine (C) residue at amino
acid position 116 substituted by another amino acid, and a
glycosylation site at amino acid positions 75-77 removed, wherein
the amino acid numbering follows the numbering of the 121 amino
acids long native human VEGF (hVEGF.sub.121).
In a different aspect, the invention concerns an article of
manufacture comprising a VEGF variant as hereinbefore defined, a
container, and a label or package insert with instructions for
administration.
In all embodiments, the VEGF variant preferably is N75Q,C116S
hVEGF.sub.121.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic representation of the various forms of VEGF
that can be encoded by alternative splicing of VEGF mRNA. The
protein sequences encoded by each of the eight exons of the VEGF
gene are represented by numbered boxes. The sequences encoded by
exons 6 and 7 are rich in basic amino acid residues and confer the
ability to interact with heparin and heparin-like molecules.
Asterisks indicate N-linked glycosylation sites. Exon 1 and the
first part of exon 2 (depicted by a narrower bar) encode the
secretion signal sequence for the protein.
FIG. 2 shows a nucleotide sequence encoding native human
VEGF.sub.121 (SEQ ID NO: 1).
FIG. 3 shows the amino acid sequence of native human VEGF.sub.121
(SEQ ID NO: 2).
FIG. 4 shows a nucleotide sequence encoding native human
VEGF.sub.145 (SEQ ID NO: 3).
FIG. 5 shows the amino acid sequence of native human VEGF.sub.145
(SEQ ID NO: 4).
FIG. 6 shows a nucleotide sequence encoding native human
VEGF.sub.165 (SEQ ID NO: 5).
FIG. 7 shows the amino acid sequence of native human VEGF.sub.165
(SEQ ID NO: 6).
FIG. 8 shows a nucleotide sequence encoding native human
VEGF.sub.189 (SEQ ID NO: 7).
FIG. 9 shows the amino acid sequence of native human VEGF.sub.189
(SEQ ID NO: 8).
FIG. 10 shows a nucleotide sequence of native human VEGF.sub.206
(SEQ ID NO: 9).
FIG. 11 shows the amino acid sequence of native human VEGF.sub.206
(SEQ ID NO: 10).
FIG. 12 shows the amino acid sequence of native human VEGF.sub.110
(SEQ ID NO: 11).
FIGS. 13 and 14 show the results from two separate tests in the
HUVEC proliferationi assay. The graphs depict the amount of DNA
synthesis that was stimulated in response to serial dilutions of
Pichia-derived N75QVEGF.sub.121 vs. N75QC116SVEGF.sub.121. The X
axis of each graph represents the final concentration of added
growth factor in the assay wells, expressed as ng/ml. The y axis
represents the optical density recorded in each well after use of
the BrdU kit (Boehringer Mannheim) to detect incorporated
bromodeoxyuridine at the end of the assay.
FIG. 15 shows the structure of expression plasmid pAN93.
FIG. 16 shows the structure of expression plasmid pAN102.
FIG. 17 shows the structure of expression plasmid pAN104.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
The term "vascular endothelial growth factor" or "VEGF" as used
herein refers to an naturally occurring (native) forms of a VEGF
polypeptide (also known as "vascular permeability factor" or "VPF")
from any animal species, including humans and other mammalian
species, such as murine, rat, bovine, equine, porcine, ovine,
canine, or feline, and functional derivatives thereof. "Native
human VEGF" consists of two polypeptide chains generally occurring
as homodimers. Each monomer occurs as one of five known isoforms,
consisting of 121, 145, 165, 189, and 206 amino acid residues in
length. The homodimers produced from these isoforms will be
hereinafter referred to as hVEGF.sub.121, hVEGF145, hVEGF.sub.165,
hVEGF.sub.189, and hVEGF.sub.206, respectively. Similarly to the
human VEGF, "native murine VEGF" and "native bovine VEGF" are also
known to exist in several isoforms, usually occurring as
homodimers, with the monomer subunits extending 120, 164, and 188
amino acids in length. With the exception of hVEGF.sub.121, all
native human VEGF polypeptides are basic, heparin-binding
molecules. hVEGF.sub.121 is a weakly acidic polypeptide that does
not bind to heparin. The term "VEGF" specifically includes VEGF-B,
VEGF-C (also known as VRP), and VEGF-D (also known as zvegf2), all
of which contain a cysteine corresponding to Cys116 of VEGF.sub.121
(see, for example, Achen et al., Proc. Natl. Acad. Sci. 95:548-553
[1998], FIG. 1; and PCT Publication No. WO 98/24811). These and
similar native forms, whether known or hereinafter discovered are
all included in the definition of "native VEGF" or "native sequence
VEGF", regardless of their mode of preparation, whether isolated
from nature, synthesized, produced by methods of recombinant DNA
technology, or any combination of these and other techniques. The
term "vascular endothelial growth factor" or "VEGF" includes VEGF
polypeptides in monomeric, homodimeric and heterodimeric forms. The
definition of "VEGF" also includes a 110 amino acids long human
VEGF species (hVEGF.sub.110), and its homologues in other mammalian
species, such as murine, rat, bovine, equine, porcine, ovine,
canine, or feline, and functional derivatives thereof. In addition,
the term "VEGF" covers chimeric, dimeric proteins, in which a
portion of the primary amino acid structure corresponds to a
portion of either the A-chain subunit or the B-chain subunit of
platelet-derived growth factor, and a portion of the primary amino
acid structure corresponds to a portion of vascular endothelial
growth factor. In a particular embodiment, a chimeric molecule is
provided consisting of one chain comprising at least a portion of
the A- or B-chain subunit of a platelet-derived growth factor,
disulfide linked to a second chain comprising at least a portion of
a VEGF molecule. More details of such dimers are provided, for
example, in U.S. Pat. Nos. 5,194,596 and 5,219,739 and in European
Patent EP-B 0 484 401, the disclosures of which are hereby
expressly incorporated by reference. The nucleotide and amino acid
sequences of hVEGF.sub.121 and bovine VEGF.sub.120 are disclosed,
for example, in U.S. Pat. Nos. 5,194,596 and 5,219,739, and in EP 0
484 401. hVEGF.sub.145 is described in PCT Publication No. WO
98/10071; hVEGF.sub.165 is described in U.S. Pat. No. 5,332,671;
hVEGF.sub.189 is described in U.S. Pat. No. 5,240,848; and
hVEGF.sub.206 is described in Houck et al. Mol. Endocrinol.
5:1806-1814 (1991). For the disclosure of the nucleotide and amino
acid sequences of various human VEGF isoforms see also Leung et
al., Science 246:1306-1309 (1989); Keck et al., Science
246:1309-1312 (1989); Tisher et al., J. Biol. Chem. 266:11947-11954
(1991); EP 0 370 989; and PCT publication WO 98/10071. Forms of
VEGF are shown schematically in FIG. 1. FIGS. 2-12 (SEQ ID NOs:
1-11) show the nucleotide and amino acid sequences of various VEGF
species.
A "functional derivative" of a native polypeptide is a compound
having a qualitative biological activity in common with the native
polypeptide. A functional derivative of a VEGF is a compound that
has a qualitative biological activity in common with a native
sequence (human or non-human) VEGF molecule as hereinabove defined.
"Functional derivatives" include, but are not limited to, fragments
of native polypeptides from any animal species (including humans),
and derivatives of native (human and non-human) polypeptides and
their fragments, provided that they have a biological activity in
common with a corresponding native polypeptide. "Fragments"
comprise regions within the sequence of a mature native VEGF
polypeptide.
The term "derivative" is used to define amino acid sequence and
glycosylation variants, and covalent modifications of a native
polypeptide, whereas the term "variant" refers to amino acid
sequence and glycosylation variants within this definition.
In general, the term "amino acid sequence variant" refers to
molecules with some differences in their amino acid sequences as
compared to a reference (e.g. native sequence) polypeptide. The
amino acid alterations may be substitutions, insertions, deletions
or any desired combinations of such changes in a native amino acid
sequence.
Substitutional variants are those that have at least one amino acid
residue in a native sequence removed and a different amino acid
inserted in its place at the same position. The substitutions may
be single, where only one amino acid in the molecule has been
substituted, or they may be multiple, where two or more amino acids
have been substituted in the same molecule.
Insertional variants are those with one or more amino acids
inserted immediately adjacent to an amino acid at a particular
position in a native amino acid sequence. Immediately adjacent to
an amino acid means connected to either the .alpha.-carboxy or
.alpha.-amino functional group of the amino acid.
Deletional variants are those with one or more amino acids in the
native amino acid sequence removed. Ordinarily, deletional variants
will have one or two amino acids deleted in a particular region of
the molecule.
In addition to the alterations at amino acid positions 116 and/or
75, the VEGF variants of the present invention may contain further
amino acid alterations, including substitutions and/or insertions
and/or deletions in any other region of the VEGF molecule,
including the N- and C-terminal regions. The amino acid sequence
variants of the present invention show at least about 75%, more
preferably at least about 85%, even more preferably at least about
90%, most preferably at least about 95% amino, acid sequence
identity with a native, sequence VEGF polypeptide.
"Sequence identity", is defined as the percentage of amino acid
residues in a candidate sequence that are identical with the amino
acid residues in a native polypeptide sequence, after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity, and not considering any
conservative substitutions as part of the sequence identity. The %
sequence identity values are generated by the NCBI BLAST2.0
software as defined by Altschul et al., (1997), "Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs",
Nucleic Acids Res., 25:3389-3402. The parameters are set to default
values, with the exception of the Penalty for mismatch, which is
set to -1.
The term "glycosylation variant" is used to refer to a polypeptide
having a glycosylation profile different from that of a
corresponding native polypeptide. Glycosylation of polypeptides is
typically either N-linked or O-linked. N-linked refers to the
attachment of the carbohydrate moiety to the side of an asparagine
residue. The tripeptide sequences, asparagine-X-serine and
asparagine-X-threonine, wherein X is any amino acid except proline,
are recognition sequences for enzymatic attachment of the
carbohydrate moiety to the asparagine side chain. O-linked,
glycosylation refers to the attachment of one of the sugars
N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid,
most commonly serine or threonine, although 5-hydroxyproline or
5-hydroxylysine may also be involved in O-linked glycosylation. Any
difference in the location and/or nature of the carbohydrate
moieties present in a variant or fragment as compared to its native
counterpart is within the scope herein.
The glycosylation pattern of native polypeptides can be determined
by well known techniques of analytical chemistry, including HPAE
chromatography (Hardy, M. R. et al., Anal. Biochem. 170:54-62
[1988]), methylation analysis to determine glycosyl-linkage
composition (Lindberg, B., Meth. Enzymol. 28:178-195 [1972];
Waeghe, T. J. et al., Carbohydr. Res. 123:281-304 [1983]), NMR
spectroscopy, mas spectrometry, etc.
"Covalent derivatives" include modifications of a native
polypeptide or a fragment thereof with an organic proteinaceous or
non-proteinaceous derivatizing agent, and post-translational
modifications. Covalent modifications are traditionally introduced
by reacting targeted amino acid residues with an organic
derivatizing agent that is capable of reacting with selected sides
or terminal residues, or by harnessing mechanisms of
post-translational modifications that function in selected
recombinant host cells. Certain post-translational modifications
are the result of the action of recombinant host cells on the
expressed polypeptide. Glutaminyl and asparaginyl residues are
frequently post-translationally deamidated to the corresponding
glutamyl and aspartyl residues. Alternatively, these residues are
deamidated under mildly acidic conditions. Either form of these
residues may be present in the trk receptor polypeptides of the
present invention. Other post-translational modifications include
hydroxylation of proline and lysine, phosphorylation of hydroxyl
groups of seryl, tyrosine or threonyl residues, methylation of the
.alpha.-amino groups of lysine, arginine, and histidine side chains
(T. E. Creighton, Proteins: Structure and Molecular Properties, W.
H. Freeman & Co., San Francisco, pp. 79-86 [1983]).
The term "glycosylation site" is used to refer to an N-linked
glycosylation that requires a tripeptidyl sequence of the formula
Asp-X-Ser or Asp-X-Thr, wherein X is any amino acid other than
proline (Pro), which prevents glycosylation.
The terms "biological activity" and "activity" in connection with
the VEGF variants of the present invention mean mitogenic activity
as determined in any in vitro assay of endothelial cell
proliferation. Activity is preferably determined in a human
umbilical vein endothelial (HUVE) cell-based assay, as described,
for example, in any of the following publications: Gospodarowicz et
al., PNAS USA 86, 7311-7315 (1989); Ferrara and Henzel, Biochem.
Biophys. Res. Comm. 161:851-858 (1989); Conn et al., PNAS USA
87:1323-1327 (1990); Soker et al., Cell 92:735-745 (1998);
Waltenberger et al., J. Biol. Chem. 269:26988-26995 (1994);
Siemeister et al., Biochem. Biophys. Res. Comm. 222:249-255 (1996);
Fiebich et al., Eur. J. Biochem. 211:19-26 [1993]; Cohen et al.,
Growth Factors 7:131-138 (1993). A particular HUVE cell (HUVEC)
assay is described in the examples below.
The terms "vector", "polynucleotide vector", "construct" and
"polynucleotide construct" are used interchangeably herein. A
polynucleotide vector of this invention may be in any of several
forms, including, but not limited to, RNA, DNA, RNA encapsulated in
a retroviral coat, DNA encapsulated in an adenovirus coat, DNA
packaged in another viral or viral-like form (such as herpes
simplex, and adeno-associated virus (AAV)), DNA encapsulated in
liposomes, DNA complexed with polylysine, complexed with synthetic
polycationic molecules, conjugated with transferring, complexed
with compounds such as polyethylene glycol (PEG) to immunologically
"mask" the molecule and/or increase half-life, or conjugated to a
non-viral protein. Preferably, the polynucleotide is DNA. As used
herein, "DNA" includes not only bases A, T, C, and G, but also
includes any of their analogs or modified forms of these bases,
such as methylated nucleotides, internucleotide modifications such
as uncharged linkages and thioates, use of sugar analogs, and
modified and/or alternative backbone structures, such as
polyamides.
"Under transcriptional control" is a term well-understood in the
art and indicates that transcription of a polynucleotide sequence,
usually a DNA. sequence, depends on its being operably
(operatively) linked to an element which contributes to or promotes
transcription.
A "host cell" includes an individual cell or cell culture which can
be or has been a recipient of any vector of this invention. Host
cells include progeny of a single host cell, and the progeny may
not necessarily be completely identical (in morphology or in total
DNA complement) to the original parent cell due to natural,
accidental, or deliberate mutation and/or change. A host cell
includes cells transfected or infected in vivo with a vector
comprising a polynucleotide encoding an angiogenic factor.
An "individual" is a vertebrate, preferably a mammal, more
preferably a human.
"Mammal" for purposes of treatment refers to any animal classified
as a mammal, including humans, domestic and farm animals, and zoo,
sports, or pet animals, such as dogs, cats, cattle, horses, sheep,
pigs, etc. Preferably, the mammal is human.
An "effective amount" is an amount sufficient to effect beneficial
or desired clinical results. An effective amount can be
administered in one or more administrations. For purposes of this
invention, an effective amount of a VEGF variant is an amount that
is sufficient to palliate, ameliorate, stabilize, reverse, slow or
delay the progression of the disease state. In a preferred
embodiment of the invention, the "effective amount" is defined as
an amount capable of stimulating the growth and/or remodeling of
collateral blood vessels. In another preferred embodiment, the
"effective amount" is defined as an amount capable of preventing,
reducing or reversing endothelial cell injury or injury to the
surrounding tissues.
"Repair" of injury includes complete and partial repair, such as
reduction of the injury that has already occurred, or partial
reinstatement of the functionality of a tissue of organ.
As used herein, "treatment" is an approach for obtaining beneficial
or desired clinical results. For purposes of this invention,
beneficial or desired clinical results include, but are not limited
to, alleviation of symptoms, diminishment of extent of disease,
stabilized (i.e., not worsening) state of disease, delay or slowing
of disease progression, amelioration or palliation of the disease
state, and remission (whether partial or total), whether detectable
or undetectable. "Treatment" can also mean prolonging survival as
compared to expected survival if not receiving treatment
"Treatment" refers to both therapeutic treatment and prophylactic
or preventative measures. Those in need of treatment include those
already with the disorder as well as those in which the disorder is
to be prevented. "Palliating" a disease means that the extent
and/or undesirable clinical manifestations of a disease state are
lessened and/or the time course of the progression is slowed or
lengthened, as compared to a situation without treatment.
Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
"Angiogenesis" is defined the promotion of the growth of new blood
capillary vessels from existing endothelium, while "therapeutic
angiogenesis" is defined as the promotion of the growth or new
blood vessels and/or demodeling of old blood vessels, for example,
to increase blood supply to an ischemic region.
The term "peripheral arterial disease" also known as "peripheral
vascular disease", is defined as the narrowing or obstruction of
the blood vessels supplying the extremities. It is a common
manifestation of atherosclerosis, and most often affects the blood
vessels of the leg. Two major types of peripheral arterial disease
are intermittent claudication, in which the blood supply to one or
more limbs has been reduced to the point where exercise cannot be
sustained without the rapid development of cramping pain; and
critical leg ischemia, in which the blood supply is no longer
sufficient to completely support the metabolic needs of even the
resting limb.
"Coronary artery disease" is defined as the narrowing or
obstruction of one or more of the arteries that supply blood to the
muscle tissue of the heart. This disease is also a common
manifestation of atherosclerosis.
The term "microvascular angiopathy" is used to describe acute
injuries to smaller blood vessels and subsequent dysfunction of the
tissue in which the injured blood vessels are located.
Microvascular angiopathies are a common feature of the pathology of
a variety of diseases of various organs, such as kidney, heart, and
lungs. The injury is often associated with endothelial cell injury
or death and the presence of products of coagulation or thrombosis.
The agent of injury may, for example, be a toxin, an immune factor,
an infectious agent, a metabolic or physiological stress, or a
component of the humoral or cellular immune system, or may be as of
yet unidentified. A subgroup of such diseases is unified by the
presence of thrombotic microangiopathies (TMA), and is
characterized clinically by non-immune hemolytic anemia,
thrombocytopenia, and/or renal failure. The most common cause of
TMA is the hemolytic uremic syndrome (HUS), a disease that is
particularly frequent in childhood, where it is the most common
cause of acute renal failure. The majority of these cases are
associated with enteric infection with the verotoxin producing
strain, E. coli O157. Some HUS patients, especially adults, may
have a relative lack of renal involvement and are sometimes
classified as having thrombotic thrombocytopenic purpura (TTP).
However, thrombotic microangiopathies may also occur as a
complication of pregnancy (eclampsia), with malignant hypertension
following radiation to the kidney, after transplantation (often
secondary to cyclosporine or FK506 treatment), with cancer
chemotherapies (especially mitomycin C), with certain infections
(e.g., Shigella or HIV), in association with systemic lupus or the
antiphospholipid syndrome, or may be idiopathic or familial.
Experimental data suggest that endothelial cell injury is a common
feature in the pathogenesis of HUS/TTP. See, e.g. Kaplan et al.,
Pediatr. Nephrol. 4:276 (1990). Endothelial cell injury triggers a
cascade of subsequent events, including local intravascular
coagulation, fibrin deposition, and platelet activation and
aggregation. The mechanisms that mediate these events are not well
understood. In the case of verotoxin-mediated HUS, injury to the
endothelium leads to detachment and death, with local platelet
activation and consumption, fibrin deposition and microangiopathic
hemolysis.
The phrase "hemolytic-uremic syndrome" or "HUS" is used in the
broadest sense, and includes all diseases and conditions
characterized by thrombotic microangiopathic hemolytic anemia and
variable organ impairment, irrespective of whether renal failure is
the predominant feature. Although, as mentioned before, the disease
is particularly frequent in childhood, the term "HUS" specifically
covers a syndrome, typically observed in adults, that is also
referred to as thrombotic thrombocytopenic purpura (TTP) and is
generally characterized by the predominance of thrombocytopenia and
neurologic impairment, but has thrombotic microangiopathy as the
underlying pathologic lesion.
The terms "amino acid" and "amino acids" refer to all naturally
occurring L-.alpha.-amino acids. This definition is meant to
include norleucine, ornithine, and homocysteine. The amino acids
are identified by either the single-letter or three-letter
designations, as follows: Asp (D) aspartic acid Thr (T) threonine
Ser (S) serine Glu (E) glutamic acid Pro (P) proline Gly (G)
glycine Ala (A) alanine Cys (C) cysteine Val (V) valine Met (M)
methionine Ile (I) isoleucine Leu (L) leucine Tyr (Y) tyrosine Phe
(F) phenylalanine His (H) histidine Lys (K) lysine Arg (R) arginine
Trp (W) tryptophan Gln (Q) glutamine Asn (N) asparagine
The notations throughout this application describe VEGF amino acid
sequence variants, where the location of a particular amino acid
residue in the polypeptide chain of VEGF is identified by a number,
following the amino acid numbering of hVEGF.sub.121. In the present
application, similarly positioned residues in the VEGF variants are
designated by these numbers, even though the actual residue is not
so numbered due to deletions or insertions in the molecule. This
will occur, for example, in the case of variants which, in addition
to the specified amino acid substitutions, contain further
deletion(s) and/or insertion(s). Substituted VEGF variants are
designated by identifying the native (wild-type) amino acid on the
left side of the number denoting the position where the
substitution takes place, and identifying the substituted amino
acid on the right side of the number. For example, replacement of
the amino acid asparagine (N) with a glutamine (Q) at position 75
of hVEGF.sub.121 is designated N75Q hVEGF.sub.121. The double
mutant, additionally having cysteine (C) at position 116 replaced
by serine (S) is designated N75Q, C116S hVEGF.sub.121.
"Carriers" as used herein include pharmaceutically acceptable
carriers, excipients, or stabilizers which are nontoxic to the cell
or mammal being exposed thereto at the dosages and concentrations
employed. Often the pharmaceutically acceptable carrier is an
aqueous pH buffered solution. Examples of pharmaceutically
acceptable carriers include buffers such as phosphate, citrate, and
other organic acids; antioxidants including ascorbic acid; low
molecular weight (less than about 10 residues) polypeptide;
proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids such
as glycine, glutamine, asparagine, arginine or lysine;
monosaccharides, disaccharides, and other carbohydrates including
glucose, mannose, or dextrins; chelating agents such as EDTA; sugar
alcohols such as mannitol or sorbitol; salt-forming counterions
such as sodium; and/or nonionic surfactants such as TWEEN.RTM.,
polyethylene glycol (PEG), and PLURONICS.RTM..
"Chronic" administration refers to administration of the agent(s)
in a continuous mode as opposed to an acute mode, so as to maintain
the initial therapeutic effect (activity) for an extended period of
time.
"Intermittent" administration is treatment that is not
consecutively done without interruption, but rather is cyclic in
nature.
II. General Methods
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques of molecular biology (including
recombinant techniques), microbiology, cell biology, biochemistry
and immunology, which are within the skill of the art. Such
techniques are explained fully in the literature, such as,
"Molecular Cloning: A Laboratory Manual", second edition (Sambrook
et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984);
"Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in
Enzymology" (Academic Press, Inc.); "Handbook of Experimental
Immunology" (D. M. Weir & C. C. Blackwell, eds.); "Gene
Transfer Vectors for Mammalian Cells" (J. M. Miller & M. P.
Calos, eds., 1987); "Current Protocols in Molecular Biology" (F. M.
Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction",
(Mullis et al., eds., 1994); and "Current Protocols in Immunology"
(J. E. Coligan et al., eds., 1991).
The methods of the present invention concern variants of a native
sequence VEGF molecule ordinarily having a free cysteine (C)
residue at a position corresponding to amino acid position 116 of
the 121 amino acids long native mature human VEGF (hVEGF.sub.121).
It has been found that the elimination of this cysteine (C) residue
produces VEGF variants that have an enhanced biological activity
compared to native mature hVEGF.sub.121. The cysteine residue is
preferably replaced by another amino acid. Preferred amino acids
used for substitution are serine, glycine, alanine, valine,
leucine, isoleucine, threonine or methionine, more preferably
serine, glycine or alanine, most preferably serine. Substitution is
preferably performed by site-directed mutagenesis of the nucleic
acid sequence encoding the unmodified variant, having a cysteine
(C) at position 116. Particularly preferred is site-directed
mutagenesis using polymerase chain reaction (PCR) amplification
(see, for example, U.S. Pat. No. 4,683,195 issued Jul. 28, 1987;
and Current Protocols In Molecular Biology, Chapter 15 (Ausubel et
al., ed., 1991). Other site-directed mutagenesis techniques are
also well known in the art and are described, for example, in the
following publications: Current Protocols In Molecular Biology,
supra, Chapter 8; Molecular Cloning: A Laboratory Manual., 2.sup.nd
edition (Sambrook et al., 1989); Zoller et al., Methods Enzymol.
100:468-500 (1983); Zoller & Smith, DNA 3:479-488 (1984);
Zoller et al., Nucl. Acids Res., 10:6487 (1987); Brake et al.,
Proc. Natl. Acad. Sci. USA 81:4642-4646(1984); Botstein et al.,
Science 229:1193 (1985); Kunkel et al., Methods Enzymol. 154:367-82
(1987), Adelman et al., DNA 2:183 (1983); and Carter et al., Nucl.
Acids Res., 13:4331 (1986). Cassette mutagenesis (Wells et al.,
Gene, 34:315 [1985]), and restriction selection mutagenesis (Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 [1986]) may
also be used.
VEGF variants with more than one amino acid substitution may be
generated in one of several ways. If the amino acids are located
close together in the polypeptide chain, they may be mutated
simultaneously, using one oligonucleotide that codes for all of the
desired amino acid substitutions. If, however, the amino acids are
located some distance from one another (e.g. separated by more than
ten amino acids), it is more difficult to generate a single
oligonucleotide that encodes all of the desired changes. Instead,
one of two alternative methods may be employed. In the first
method, a separate oligonucleotide is generated for each amino acid
to be substituted. The oligonucleotides are then annealed to the
single-stranded template DNA simultaneously, and the second strand
of DNA that is synthesized from the template will encode all of the
desired amino acid substitutions. The alternative method involves
two or more rounds of mutagenesis to produce the desired
mutant.
In a preferred embodiment, the present invention involves the
generation of VEGF variants that, in addition to the elimination of
a free (unpaired) cysteine at position 116, have an N-linked
glycosylation site removed at amino acid position 75. An N-linked
glycosylation site may be a tripeptidyl sequence of the formula
Asn-X-Ser or Asn-X-Thr, wherein Asn is the acceptor and X is any of
the twenty genetically encoded amino acids except Pro, which is
known to prevent glycosylation. In native hVEGF.sub.121, an
Asn-Ile-Thr (NIT) glycosylation site is present at amino acid
positions 75-77. The removal of this glycosylation site is
preferably achieved by amino acid substitution for at least one
residue of the glycosylation signal. In a particularly preferred
variant, Asn (N) at position 75 is replaced by Glu (Q). The
substitution may be performed by any of the mutagenesis techniques
discussed above.
DNA encoding the VEGF variants of the present invention may also be
prepared by chemical synthesis. Methods of chemically synthesizing
DNA having a specific sequence are well known in the art. Such
techniques include the phosphoramidite method (Beaucage and
Caruthers, Tetrahedron Letters 22:1859 [1981]; Matteucci and
Caruthers, Tetrahedron Letters 21:719 [1980]; and Matteucci and
Caruthers, J. Amer. Chem. Soc. 103: 3185 [1981]), and the
phosphotriester approach (Ito et al., Nucleic Acids Res.
10:1755-1769 [1982]).
In addition to removing the underlying glycosylation site, the
N-linked glycosylation at amino acid position 75 can be
substantially removed by using an endoglycosidase, such as
Endoglycosidase H (Endo-H), which is capable of (partial) removal
of high mannose and hybrid oligosaccharides. Endo-H treatment is
accomplished via techniques known per se, as described, for
example, in Tarentino et al., J. Biol. Chem. 249: 811 (1974);
Trimble et al., Anal. Biochem. 141:515 (1984); and Little et al.,
Biochem. 23:6191 (1984).
The cDNA encoding the desired VEGF variant of the present invention
is inserted into a replicable vector for cloning and expression.
Suitable vectors are prepared using standard techniques of
recombinant DNA technology, and are, for example, described in the
textbooks cited above. Isolated plasmids and DNA fragments are
cleaved, tailored, and ligated together in a specific order to
generate the desired vectors. After ligation, the vector containing
the gene to be expressed is transformed into a suitable host
cell.
Host cells can be any eukaryotic or prokaryotic hosts known for
expression of heterologous proteins.
The VEGF variants of the present invention can be expressed in
eukaryotic hosts, such as eukaryotic microbes (yeast), cells
isolated from multicellular organisms (mammalian cell cultures),
plants and insect cells.
While prokaryotic host provide a convenient means to synthesize
eukaryotic proteins, when made this fashion, proteins usually lack
many of the immunogenic properties, three-dimensional conformation,
glycosylation, and other features exhibited by authentic eukaryotic
proteins. Eukaryotic expression systems overcome these
limitations.
Yeasts are particularly attractive as expression hosts for a number
of reasons. They can be rapidly growth on inexpensive (minimal)
media, the recombinant can be easily selected by complementation,
expressed proteins can be specifically engineered for cytoplasmic
localization or for extracellular export, and are well suited for
large-scale fermentation.
Saccharomyces cerevisiae (common baker's yeast) is the most
commonly used among lower eukaryotic hosts. However, a number of
other genera, species, and strains are also available and useful
herein, such as Pichia pastoris (EP 183,070; Sreekrishna et al., J.
Basic Microbiol. 28:165-278 [1988]). The expression of
hVEGF.sub.121 in Saccharomyces cerevisiae is disclosed, for
example, by Kondo et al., Biochim. Biophys. Acta 1243:195-202
(1995), the entire disclosure of which is hereby expressly
incorporated by reference. The variants of the present invention
may be expressed in an analogous fashion. Expression of
hVEGF.sub.121 in Pichia pastoris has been described by Mohanraj et
al., Biochem. Biophys. Res. Commun. 215 :750-756 (1995), while
similar expression of the hVEGF.sub.165 molecule was described by
Mohanraj et al., Growth Factors 12:17-27 (1995). The yeast
expression system was purchased from Invitrogen (San Diego,
Calif.). The disclosures of these references are hereby expressly
incorporated by reference. Other yeasts suitable for VEGF
expression include, without limitation, Kluyveromyces hosts (U.S.
Pat. No. 4,943,529), e.g. Kluyveromyces lactis; Schizosaccharomyces
pombe (Beach and Nurse, Nature 290:140 (1981); Aspergillus hosts,
e.g. A. niger (Kelly and Hynes, EMBO J. 4:475-479 [1985]) and A.
nidulans (Ballance et al., Biochem. Biophys. Res. Commun:
112:284-289 [1983]), and Hansenula hosts, e.g. Hansenula
polymorpha.
Preferably a methylotrophic yeast is used as a host in performing
the methods of the present invention. Suitable methylotrophic
yeasts include, but are not limited to, yeast capable of growth on
methanol selected from the group consisting of the genera Pichia
and Hansenula. A list of specific species which are exemplary of
this class of yeasts may be found, for example, in C. Anthony, The
Biochemistry of Methylotrophs, 269 (1982). Presently preferred are
methylotrophic yeasts of the genus Pichia such as the auxotrophic
Pichia pastoris GS115 (NRRL Y-15851); Pichia pastoris GS 190 (NRRL
Y-18014) disclosed in U.S. Pat. No. 4,818,700; and Pichia pastoris
PPFI (NRRL Y-18017) disclosed in U.S. Pat. No. 4,812,405.
Auxotrophic Pichia pastoris strains are also advantageous to the
practice of this invention for their ease of selection. It is
recognized that wild type Pichia pastoris strains (such as NRRL
Y-11430 and NRRL Y-11431) may be employed with equal success if a
suitable transforming marker gene is selected, such as the use of
SUC2 to transform Pichia pastoris to a strain capable of growth on
sucrose, or if an antibiotic resistance marker is employed, such as
resistance to G418. Pichia pastoris linear plasmids are disclosed,
for example, in U.S. Pat. No. 5,665,600.
Suitable promoters used in yeast vectors include the promoters for
3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255:2073
[1980]); and other glycolytic enzymes (Hess et al., J. Adv. Enzyme
Res. 7:149 [1968]; Holland et al., Biochemistry 17:4900 [1978]),
e.g., enolase, glyceraldehyde-3-phosphate dehydrogenase,
hexokinase, pyvurate decarboxylase, phosphofructokinase,
glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate
kinase, triosephosphate somerase, phosphoglucose isomerase, and
glucokinase. In the constructions of suitable expression plasmids,
the termination sequences associated with these genes are also
ligated into the expression vector 3' of the sequence desired to be
expressed to provide polyadenylation of the mRNA and termination.
Other promoters that have the additional advantage of transcription
controlled by growth conditions are the promoter regions for
alcohol oxidase I (AOX1, particularly preferred for expression in
Pichia), alcohol dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen
metabolism, and the aforementioned glyceraldehyde-3-phosphate
dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Any plasmid vector containing a yeast-compatible
promoter and termination sequences, with or without an origin of
replication, is suitable. Yeast expression systems are commercially
available, for example, from Clontech Laboratories, Inc. (Palo
Alto, Calif., e.g. pYEX 4T family of vectors for S. cerevisiae),
Invitrogen (Carlsbad, Calif., e.g. pPICZ series Easy Select Pichia
Expression Kit) and Stratagene (La Jolla, Calif., e.g. ESP.TM.
Yeast Protein Expression and Purification System for S. pombe and
pESC vectors for S. cerevisiae). The production of N75Q, C116S
hVEGF121 in P. pastoris is described in detail in the Examples
below. Other VEGF variants can be expressed in an analogous
fashion.
Cell cultures derived from multicellular organisms may also be used
as hosts to practice the present invention. While both invertebrate
and vertebrate cell cultures are acceptable, vertebrate cell
cultures, particularly mammalian cells, are preferable. Examples of
suitable cell lines include monkey kidney CV1 cell line transformed
by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney cell line
293S (Graham et al, J. Gen. Virol. 36:59 [1977]); baby hamster
kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary (CHO) cells
(Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216 [1980];
monkey kidney cells (CVI-76, ATCC CCL 70); African green monkey
cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells
(HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); human
lung cells (W138, ATCC CCL 75); and human liver cells (Hep G2, HB
8065).
Suitable promoters used in mammalian expression vectors are often
of viral origin. These viral promoters are commonly derived from
cytomeagolavirus (CMV), polyoma virus, Adenovirus2, and Simian
Virus 40 (SV40). The SV40 virus contains two promoters that are
termed the early and late promoters. They are both easily obtained
from the virus as one DNA fragment that also contains the viral
origin of replication (Fiers et al., Nature 273:113 [1978]).
Smaller or larger SV40 DNA fragments may also be used, provided
they contain the approximately 250-bp sequence extending from the
HindIII site toward the BglI site located in the viral origin of
replication. An origin of replication may be obtained from an
exogenous source, such as SV40 or other virus, and inserted into
the cloning vector. Alternatively, the host cell chromosomal
mechanism may provide the origin of replication. If the vector
containing the foreign gene is integrated into the host cell
chromosome, the latter is often sufficient.
Eukaryotic expression systems employing insect cell hosts may rely
on either plasmid or baculoviral expression systems. The typical
insect host cells are derived from the fall army worm (Spodoptera
frugiperda). For expression of a foreign protein these cells are
infected with a recombinant form of the baculovirus Autographa
californica nuclear polyhedrosis virus which has the gene of
interest expressed under the control of the viral polyhedrin
promoter. Other insects infected by this virus include a cell line
known commercially as "High 5" (Invitrogen) which is derived from
the cabbage looper (Trichoplusia ni). Another baculovirus sometimes
used is the Bombyx mori nuclear polyhedorsis virus which infect the
silk worm (Bombyx mori). Numerous baculovirus expression systems
are commercially available, for example, from Invitrogen
(Bac-N-Blue.TM.), Clontech (BacPAK.TM. Baculovirus Expression
System), Life Technologies (BAC-TO-BAC.TM.), Novagen (Bac Vector
System.TM.), Pharmingen and Quantum Biotechnologies). Another
insect cell host is common fruit fly, Drosophila melanogaster, for
which a transient or stable plasmid based transfection kit is
offered commercially by Invitrogen (The DES.TM. System).
Prokaryotes are the preferred hosts for the initial cloning steps,
and are particularly useful for rapid production of large amounts
of DNA, for production of single-stranded DNA templates used for
site-directed mutagenesis, for screening many mutants
simultaneously, and for DNA sequencing of the mutants generated.
Biologically active isoforms of hVEGF have been successfully
expressed in Escherichia coli (E. coli), see, for example
Siemeister et al., Biochem. and Biophys. Res. Comm. 222:249-255
(1996), where E. coli strain BL21 carrying an inducible T7 RNA
polymerase gene (Studier et al., Methods Enzymol. 185:60-98 [1990])
was transformed with the appropriate constructs. Other E. coli
strains suitable for the production of the VEGF variants of the
present invention include, for example, AD494 (DE3); EB105; and CB
(E. coli B) and their derivatives; K12 strain 214 (ATCC 31,446);
W3110 (ATCC 27,325); X1776 (ATCC 31,537); HB101 (ATCC 33,694);
JM101 (ATCC 33,876); NM522 (ATCC 47,000); NM538 (ATCC 35,638);
NM539 (ATCC 35,639), etc. Many other species and genera of
prokaryotes may be used as well. Prokaryotes, e.g. E. coli, produce
the VEGF variants in an unglycosylated form, therefore, there is no
need for the removal of the glycosylation signal at amino acid
position 75.
Vectors used for transformation of prokaryotic host cells usually
have a replication site, marker gene providing for phenotypic
selection in transformed cells, one or more promoters compatible
with the host cells, and a polylinker region containing several
restriction sites for insertion of foreign DNA. Plasmids typically
used for transformation of E. coli include pBR322, pUC18, pUC19,
pUC118, pUC119, and Bluescript M13, all of which are commercially
available and described in Sections 1.12-1.20 of Sambrook et al.,
supra. The promoters commonly used in vectors for the
transformation of prokaryotes are the T7 promoter (Studier et al.,
supra); the tryptophan (trp) promoter (Goeddel et al., Nature
281:544 [1979]); the alkaline phosphatase promoter (phoA); and the
.beta.-lactamase and lactose (lac) promoter systems.
In E. coli, the VEGF variants typically accumulate in the form of
inclusion bodies, and need to be solubilized, purified, refolded
and dimerized. Methods for the recovery and refolding of VEGF
isoforms from E. coli are described, for example, in Siemeister et
al., supra.
Many eukaryotic proteins, including VEGF, contain an endogenous
signal sequence as part of the primary translation product. This
sequence targets the protein for export from the cell via the
endoplasmic reticulum and Golgi apparatus. The signal sequence is
typically located at the amino terminus of the protein, and ranges
in length from about 13 to about 36 amino acids. Although the
actual sequence varies among proteins, all known eukaryotic signal
sequences contain at least one positively charged residue and a
highly hydrophobic stretch of 10-15 amino acids (usually rich in
the amino acids leucine, isoleucine, valine and phenylalanine) near
the center of the signal sequence. The signal sequence is normally
absent from the secreted form of the protein, as it is cleaved by a
signal peptidase located on the endoplasmic reticulum during
translocation of the protein into the endoplasmic reticulum. The
protein with its signal sequence still attached is often referred
to as the pre-protein, or the immature form of the protein, in
contrast to the protein from which the signal sequence has been
cleaved off, which is usually referred to as the mature protein.
Proteins may also be targeted for secretion by linking a
heterologous signal sequence to the protein. This is readily
accomplished by ligating DNA encoding a signal sequence to the 5'
end of the DNA encoding the protein, and expressing the fusion
protein in an appropriate host cell. Prokaryotic and eukaryotic
(yeast and mammalian) signal sequences may be used, depending on
the type of the host cell. The DNA encoding the signal sequence is
usually excised from a gene encoding a protein with a signal
sequence, and then ligated to the DNA encoding the protein to be
secreted, e.g. VEGF. Alternatively, the signal sequence can be
chemically synthesized. The signal must be functional, i.e.
recognized by the host cell signal peptidase such that the signal
sequence is cleaved and the protein is secreted. A large variety of
eukaryotic and prokaryotic signal sequences is known in the art,
and can be used in performing the process of the present invention.
Yeast signal sequences include, for example, acid phosphatase,
alpha factor, alkaline phosphatase and invertase signal sequences.
Prokaryotic signal sequences include, for example LamB, OmpA, OmpB
and OmpF, MalE, PhoA, and .beta.lactamase.
Mammalian cells are usually transformed with the appropriate
expression vector using a version of the calcium phosphate method
(Graham et al., Virology 52:546 [1978]; Sambrook et al., supra,
sections 16.32-16.37), or, more recently, lipofection. However,
other methods, e.g. protoplast fusion, electroporation, direct
microinjection, etc. are also suitable.
Yeast hosts are generally transformed by the polyethylene glycol
method (Hinnen, Proc. Natl. Acad. Sci. USA 75:1929 [1978]). Yeast,
e.g. Pichia pastoris, can also be transformed by other
methodologies, e.g. electroporation, as described in the
Examples.
Prokaryotic host cells can, for example, be transformed using the
calcium chloride method (Sambrook et al., supra, section 1.82), or
electroporation.
If the host is Pichia pastoris, transformed cells can be selected
for by using appropriate techniques including, but not limited to,
culturing previously auxotrophic cells after transformation in the
absence of the biochemical product required (due to the cell's
auxotrophy), selection for and detection of a new phenotype, or
culturing in the presence of an antibiotic which is toxic to the
yeast in the absence of a resistance gene contained in the
transformant. Isolated transformed Pichia pastoris cells are
cultured by appropriate fermentation techniques such as shake flask
fermentation, high density fermentation or the technique disclosed
by Cregg et al. in, High-Level h112Expression and Efficient
Assembly of Hepatitis B Surface Antigen in: the Methylotrophic
Yeast, Pichia Pastoris, Bio/Technology 5:479-485 (1987). Isolates
may be screened by assaying for VEGF production to identify those
isolates with the highest production level.
Transformed strains, that are of the desired phenotype and
genotype, are grown in fermentors. For the large-scale production
of recombinant DNA-based products in methylotrophic yeast, a three
stage, high cell-density fed-batch fermentation system is normally
the preferred fermentation protocol employed. In the first, or
growth stage, expression hosts are cultured in defmed minimal
medium with an excess of a non-inducing carbon source (e.g.
glycerol). When grown on such carbon sources, heterologous gene
h114expression is completely repressed, which allows the generation
of cell mass in the absence of heterologous protein h115expression.
It is presently preferred, during this growth stage, that the pH of
the medium be maintained at about 4.5-5. Next, a short period of
non-inducing carbon source limitation growth is allowed to further
increase cell mass and derepress the methanol responsive promoter.
The pH of the medium during this limitation growth period is
adjusted to the pH value to be maintained during the production
phase, which is generally carried out at about pH 5 to about pH 6,
preferably either about pH 5.0 or about pH 6.0. Subsequent to the
period of growth under limiting conditions, methanol alone
("limited methanol fed-batch mode") or a limiting amount of
non-inducing carbon source plus methanol (referred to herein as
"mixed-feed fed-batch mode") is added in the fermentor, inducing
the expression of the heterologous gene driven by a methanol
responsive promoter. This third stage is the so-called production
stage. Fermentation can also be conducted in shake flasks,
essentially as described in the Examples.
More recently, techniques have been developed for the expression of
heterologous proteins in the milk of non-human transgenic animals.
For example, Krimpenfort et al:, Biotechnology 9:844-847 (1991)
describes microinjection of fertilized bovine oocytes with genes
encoding human proteins and development of the resulting embryos in
surrogate mothers. The human genes were fused to the bovine
.alpha.S.sub.1 casein regulatory elements. This general technology
is also described in PCT Application WO91/08216 published Jun. 13,
1991. PCT application WO88/00239, published Jan. 14, 1988,
describes procedures for obtaining suitable regulatory DNA
sequences for the products of the mammary glands of sheep,
including beta lactoglobulin, and the construction of transgenic
sheep modified so as to secrete foreign proteins in milk. PCT
publication WO88/01648, published Mar. 10, 1988, generally
describes construction of transgenic animals which secrete foreign
proteins into milk under control of the regulatory sequences of
bovine alpha lactalbumin gene. PCT application WO88/10118,
published Dec. 29, 1988, describes construction of transgenic mice
and larger mammals for the production of various recombinant human
proteins in milk. Thus, techniques for construction of appropriate
host vectors containing regulatory sequences effective to produce
foreign proteins in mammary glands and cause the secretion of said
protein into milk are known in the art.
Among the milk-specific protein promoters are the casein promoters
and the beta lactoglobulin promoter. The casein promoters may, for
example, be selected from an alpha casein promoter, a beta casein
promoter or a kappa casein promoter. Preferably, the casein
promoter is of bovine origin and is an alpha S-1 casein promoter.
Among the promoters that are specifically activated in mammary is
the long terminal repeat (LTR) promoter of the mouse mammary tumor
virus (MMTV). The milk-specific protein promoter or the promoters
that are specifically activated in mammary tissue may be derived
from either cDNA or genomic sequences. Preferably, they are genomic
in origin.
Signal peptides that are useful in expressing heterologous proteins
in the milk of transgenic mammals include milk-specific signal
peptides or other signal peptides useful in the secretion and
maturation of eukaryotic and prokaryotic proteins. Preferably, the
signal peptide is selected from milk-specific signal peptides or
the signal peptide of the desired recombinant protein product, if
any. Most preferably, the milk-specific signal peptide is related
to the milk-specific promoter used in the expression system of this
invention.
III. Pharmaceutical Compositions
Pharmaceutical compositions of the present invention can comprise a
polynucleotide encoding a VEGF variant herein, or, alternatively,
pharmaceutical compositions can comprise the VEGF variant
itself
Suitable forms, in part, depend upon the use or the route of entry,
for example oral, transdermal, inhalation, or by injection. Such
forms should allow the agent or composition to reach a target cell
whether the target cell is present in a multicellular host or in
culture. For example, pharmacological agents or compositions
injected into the blood stream should be soluble. Other factors are
known in the art, and include considerations such as toxicity and
forms that prevent the agent or composition from exerting its
effect.
Compositions comprising a VEGF variant or a polynucleotide encoding
a VEGF variant can also be formulated as pharmaceutically
acceptable salts (e.g., acid addition salts) and/or complexes
thereof. Pharmaceutically acceptable salts are non-toxic at the
concentration at which they are administered. Pharmaceutically
acceptable salts include acid addition salts such as those
containing sulfate, hydrochloride, phosphate, sulfonate, sulfamate,
sulfate, acetate, citrate, lactate, tartrate, methanesulfonate,
ethanesulfonate, benzenesulfonate, p-toluenesulfonate,
cyclohexylsulfonyl, cyclohexylsulfamate and quinate.
Pharmaceutically acceptable salts can be obtained from acids such
as hydrochloric acid, sulfuric acid, phosphoric acid, sulfonic
acid, sulfamic acid, acetic acid, citric acid, lactic acid,
tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic
acid, benzenesulfonic acid, p-toluenesulfonic acid,
cyclohexylsulfonic acid, cyclohexylsulfamic acid, and quinic acid.
Such salts may be prepared by, for example, reacting the free acid
or base forms of the product with one or more equivalents of the
appropriate base or acid in a solvent or medium in which the salt
is insoluble, or in a solvent such as water which is then removed
in vacuo or by freeze-drying or by exchanging the ions of an
existing salt for another ion on a suitable ion exchange resin.
Carriers or excipients can also be used to facilitate
administration of the compound. Examples of carriers and excipients
include calcium carbonate, calcium phosphate, various sugars such
as lactose, glucose, or sucrose, or types of starch, cellulose
derivatives, gelatin, vegetable oils, polyethylene glycols and
physiologically compatible solvents. The compositions or
pharmaceutical composition can be administered by different routes
including, but not limited to, intravenous, intra-arterial,
intraperitoneal, intrapericardial, intracoronary, subcutaneous, and
intramuscular, oral, topical, or transmucosal.
The desired isotonicity of the compositions can be accomplished
using sodium chloride or other pharmaceutically acceptable agents
such as dextrose, boric acid, sodium tartrate, propylene glycol,
polyols (such as mannitol and sorbitol), or other inorganic or
organic solutes.
Pharmaceutical compositions comprising a VEGF variant or a
polynucleotide encoding a VEGF variant can be formulated for a
variety of modes of administration, including systemic and topical
or localized administration. Techniques and formulations generally
may be found in Remington's Pharmaceutical Sciences, 18th Edition,
Mack Publishing Co., Easton, Pa. 1990. See, also, Wang and Hanson
"Parenteral Formulations of Proteins and Peptides: Stability and
Stabilizers", Journal of Parenteral Science and Technology,
Technical Report No. 10, Supp. 42-2S (1988). A suitable
administration format can best be determined by a medical
practitioner for each patient individually.
For systemic administration, injection is preferred, e.g.,
intramuscular, intravenous, intra-arterial, intracoronary,
intrapericardial, intraperitoneal, subcutaneous, intrathecal, or
intracerebrovascular. For injection, the compounds of the invention
are formulated in liquid solutions, preferably in physiologically
compatible buffers such as Hank's solution or Ringer's solution.
Alternatively, the compounds of the invention are formulated in one
or more excipients (e.g., propylene glycol) that are generally
accepted as safe as defined by USP standards. They can, for
example, be suspended in an inert oil, suitably a vegetable oil
such as sesame, peanut, olive oil, or other acceptable carrier.
Preferably, they are suspended in an aqueous carrier, for example,
in an isotonic buffer solution at pHof about 5.6 to 7.4. These
compositions can be sterilized by conventional sterilization
techniques, or can be sterile filtered. The compositions can
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
buffering agents. Useful buffers include for example, sodium
acetate/acetic acid buffers. A form of repository or "depot" slow
release preparation can be used so that therapeutically effective
amounts of the preparation are delivered into the bloodstream over
many hours or days following transdermal injection or delivery. In
addition, the compounds can be formulated in solid form and
redissolved or suspended immediately prior to use. Lyophilized
forms are also included.
The VEGF variants of the present invention can also be introduced
directly into the heart, by using a catheter inserted directly into
a coronary artery, as described, for example, in U.S. Pat. No.
5,244,460.
Alternatively, the compounds can be administered orally. For oral
administration, the compounds are formulated into conventional oral
dosage forms such as capsules, tablets and tonics.
Systemic administration can also be by transmucosal or transdermal.
For transmucosal or transdermal administration, penetrants
appropriate to the barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art, and
include, for example, for transmucosal administration, bile salts
and fusidic acid derivatives. In addition, detergents can be used
to facilitate permeation. Transmucosal administration can be, for
example, through nasal sprays or using suppositories.
For administration by inhalation, usually inhalable dry power
compositions or aerosol compositions are used, where the size of
the particles or droplets is selected to ensure deposition of the
active ingredient in the desired part of the respiratory tract,
e.g. throat, upper respiratory tract or lungs. Inhalable
compositions and devices for their administration are well known in
the art. For example, devices for the delivery of aerosol
medications for inspiration are known. One such device is a metered
dose inhaler that delivers the same dosage of medication to the
patient upon each actuation of the device. Metered dose inhalers
typically include a canister containing a reservoir of medication
and propellant under pressure and a fixed volume metered dose
chamber. The canister is inserted into a receptacle in a body or
base having a mouthpiece or nosepiece for delivering medication to
the patient. The patient uses the device by manually pressing the
canister into the body to close a filling valve and capture a
metered dose of medication inside the chamber and to open a release
valve which releases the captured, fixed volume of medication in
the dose chamber to the atmosphere as an aerosol mist.
Simultaneously, the patient inhales through the mouthpiece to
entrain the mist into the airway. The patient then releases the
canister so that the release valve closes and the filling valve
opens to refill the dose chamber for the next administration of
medication. See, for example, U.S. Pat. No. 4,896,832 and a product
available from 3M Healthcare known as Aerosol Sheathed Actuator and
Cap.
Another device is the breath actuated metered dose inhaler that
operates to provide automatically a metered dose in response to the
patient's inspiratory effort. One style of breath actuated device
releases a dose when the inspiratory effort moves a mechanical
lever to trigger the release valve. Another style releases the dose
when the detected flow rises above a preset threshold, as detected
by a hot wire anemometer. See, for example, U.S. Pat. Nos.
3,187,748; 3,565,070; 3,814,297; 3,826,413; 4,592,348; 4,648,393;
4,803,978.
Devices also exist to deliver dry powdered drugs to the patient's
airways (see, e.g. U.S. Pat. No. 4,527,769) and to deliver an
aerosol by heating a solid aerosol precursor material (see, e.g.
U.S. Pat. No. 4,922,901). These devices typically operate to
deliver the drug during the early stages of the patient's
inspiration by relying on the patient's inspiratory flow to draw
the drug out of the reservoir into the airway or to actuate a
heating element to vaporize the solid aerosol precursor.
Devices for controlling particle size of an aerosol are also known,
see, for example, U.S. Pat. Nos. 4,790,305;. 4,926,852; 4,677,975;
and 3,658,059.
For topical administration, the compounds of the invention are
formulated into ointments, salves, gels, or creams, as is generally
known in the art.
If desired, solutions of the above compositions can be thickened
with a thickening agent such as methyl cellulose. They can be
prepared in emulsified form, either water in oil or oil in water.
Any of a wide variety of pharmaceutically acceptable emulsifying
agents can be employed including, for example, acacia powder, a
non-ionic surfactant (such as a Tween), or an ionic surfactant
(such as alkali polyether alcohol sulfates or sulfonates, e.g., a
Triton).
Compositions useful in the invention are prepared by mixing the
ingredients following generally accepted procedures. For example,
the selected components can be mixed simply in a blender or other
standard device to produce a concentrated mixture which can then be
adjusted to the final concentration and viscosity by the addition
of water or thickening agent and possibly a buffer to control pH or
an additional solute to control tonicity.
The amounts of various compounds for use in the methods of the
invention to be administered can be determined by standard
procedures. Generally, a therapeutically effective amount is
between about 100 mg/kg and 10.sup.-12 mg/kg depending on the age
and size of the patient, and the disease or disorder associated
with the patient. Generally, it is an amount between about 0.05 and
50 mg/kg, preferably 0.05 and 20 mg/kg, most preferably 0.05 and 2
mg/kg of the individual to be treated.
For use by the physician, the compositions are provided in dosage
unit form containing an amount of a VEGF variant herein.
IV. Therapeutic Targets
The VEGF variants of the present invention are promising candidates
for the same indications as native sequence VEGF molecules.
Accordingly, the VEGF variants herein can be used to induce
angiogenesis and/or vascular remodeling, and therefore may find
utility in the treatment of coronary artery disease and/or
peripheral vascular disease. The VEGF variants of the present
invention can be used, for example, to foster myocardial blood
vessel growth and to improve blood flow to the heart (see, e.g.
U.S. Pat. No. 5,244,460).
One of the main therapeutic targets of the present invention is the
treatment of peripheral arterial disease and/or coronary artery
disease. Both peripheral arterial disease and coronary artery
disease can often be treated successfully with either
angioplasty/endarterectomy approaches (to open up the blockage
caused by atherosclerotic plaque growth) or surgical bypass (to
create a conduit around the blockage). In a significant number of
cases, however, patients are deemed to be poor risks to be helped
by either of these types of approaches. It is this group of
so-called "no option" patients that are expected to be the primary
beneficiaries of the treatments provided by the present invention.
It is foreseen that the new blood vessels, or newly-enlarged
vessels, created in response to the treatment by the VEGF variants
of the present invention, will create a natural bypass around the
blocked vessels, without significant side-effects. As a result, the
long-term hope is that this therapy will be used to replace
angioplasty/endarterectomy/surgical bypass in the coronary artery
disease patient population in general, or at least in some
cases.
The present invention is further directed to the treatment
(including prevention) of injury to blood vessels and to the
treatment (including prevention) of injury to tissues containing
such blood vessels, in conditions where the endothelial cell injury
is mediated by known or unknown toxins, such as occurs in hemolytic
uremic syndrome (HUS), toxic shock syndrome, exposure to venomis,
or exposure to chemical or medicinal toxins, and in conditions
where the endothelial cell injury is mediated by hypertension.
The invention further concerns the treatment (including prevention)
of kidney diseases associated with injury to, or atrophy of, the
vasculature of the glomerulus and interstitium.
The invention also concerns the treatment (including prevention) of
injury to the endothelium of blood vessels, and for the treatment
(including prevention) of injury to tissues containing such injured
blood vessels in diseases associated with hypercoagulable states,
platelet activation or aggregation, thrombosis, or activation of
proteins of the clotting cascade, or in activation of coagulation
or platelet aggregation such as preeclampsia, thrombotic
thombocytopenic purpura (TTP), disseminated intravascular
coagulation, sepsis, pancreatis.
The invention also provides methods for the treatment (including
prevention) of injury to blood vessels or injury to the surrounding
tissue adjacent to injured blood vessels arising as a result of
diminished blood flow due to decreased blood pressure, or full or
partial occlusion of the blood vessel, due to atherosclerosis,
thrombosis, mechanical trauma, vascular wall dissection, surgical
dissection, or any other impediment to normal blood flow or
pressure. Specifically, the invention provides methods for the
treatment (including prevention) of acute renal failure, myocardial
infarction with or without accompanying thrombolytic therapy,
ischemic bowel disease, transient ischemic attacks, and stroke.
The invention also provides methods for the treatment (including
prevention) of hypoxia or hypercapnia or fibrosis arising from
injury to the endothelium of the lungs occasioned by injurious
immune stimuli, toxin, exposure, infection, or ischemia, including
but not limited to acute respiratory distress syndrome, toxic
alveolar injury, as occurs in smoke inhalation, pneumonia,
including viral and bacterial infections, and pulmonary emboli.
The invention further provides methods and means for the treatment
(including prevention) of pulmonary dysfunction arising from injury
to the pulmonary endothelium, including disorders arising from
birth prematurity, and primary and secondary causes of pulmonary
hypertension.
The methods disclosed herein can also be used for the treatment of
wounds arising from any injurious breach of the dermis with
associated vascular injury.
The invention also provides methods for the treatment (including
prevention) or injury to the endothelium and blood vessels, and for
the treatment (including prevention) of injury to tissues
containing injured blood vessels, due to injurious immune stimuli,
such as immune cytokines, immune complexes, proteins of the
complement cascade, including but not restricted to diseases such
as vasculitis of all types, allergic reactions, diseases of
immediate and delayed hypersensitivity, autoimmune diseases.
The methods of the present invention further useful in the
preservation or enhancement of function of organ allografts,
including but not restricted to transplants of kidney, heart,
liver, lung, pancreas, skin, bone, intestine, and xenografts.
Specific kidney diseases that may be treatable by using the methods
of the present invention include HUS, focal glomerulosclerosis,
amyloidosis, glomerulonephritis, diabetes, SLE, and chronic
hypoxia/atrophy.
The VEGF variants of the present invention can also be used for
treating hypertension. Effectiveness of the treatment is determined
by decreased blood pressure particularly in response to salt
loading.
The VEGF variants of the present invention can also be useful in
treating disorders relating to abnormal transport of solutes across
endothelial cells. Such disorders include (1) the treatment or
prevention of kidney disease associated with impaired filtration or
excretion of solutes; (2) the treatment or prevention of diseases
of the central nervous system associated with alterations in
cerebrospinal fluid synthesis, composition, or circulation,
including stroke, meningitis, tumor, infections, and disorders of
bone growth; (3) the treatment or prevention of hypoxia or
hypercapnia or fibrosis arising from accumulation of fluid
secretions in the lungs or impediments to their removal, including
but not restricted to acute respiratory distress syndrome, toxic
alveolar injury, as occurs in smoke inhalation, pneumonia,
including viral and bacterial infections, surgical intervention,
cystic fibrosis, and other inherited or acquired disease of the
lung associated with fluid accumulation in the pulmonary air space;
(4) the treatment or prevention of pulmonary dysfunction arising
from injury to the pulmonary endothelium, including disorders
arising from birth prematurity, and primary and secondary causes of
pulmonary hypertension; (5) the treatment or prevention of disease
arising from disordered transport of fluid and solutes across the
intestinal epithelium, including but not restricted to inflammatory
bowel disease, infectious diarrhea, and surgical intervention; (6)
the treatment or prevention of ascites accumulation in the
peritoneum as occurs in failure of the heart, liver, or kidney, or
in infectious or tumor states; (7) the enhancement of efficacy of
solute flux as it can be needed for peritoneal dialysis in the
treatment of kidney failure or installation of therapeutics or
nutrition into the peritoneum; (8) the preservation or enhancement
of function of organ allografts, including but not restricted to
transplants of kidney, heart, liver, lung, pancreas, skin, bone,
intestine,land xenografts; and (9) the treatment of cardiac valve
disease.
V. Gene Therapy
The present invention also provides delivery vehicles suitable for
delivery of a polynucleotide encoding a VEGF variant into cells
(whether in vivo, ex vivo, or in vitro). Generally, a
polynucleotide encoding a VEGF variant will be operably linked to a
promoter and a heterologous polynucleotide. A polynucleotide
encoding a VEGF variant can be contained within a cloning or
expression vector, using methods well known in the art, or within a
viral vector. These vectors (especially expression vectors) can in
turn be manipulated to assume any of a number of forms, which may,
for example, facilitate delivery to and/or entry into a target
cell. Delivery of the polynucleotide constructs of the invention to
eukaryotic cells, particularly to mammalian cells, more
particularly to distal tubule cells of the kidney, can be
accomplished by any suitable art-known method. Delivery can be
accomplished in vivo, ex vivo, or in vitro.
The invention provides methods and compositions for transferring
such expression constructs into cells, especially in vivo for
performing the methods of the present invention. It is also an
object of the invention to provide compositions for the treatment
(including prevention) of the conditions listed above by providing
for the prevention or repair of the underlying vascular injury
and/or the associated damage to non-vascular tissues.
Delivery vehicles suitable for incorporation of a polynucleotide
encoding a VEGF variant of the present invention for introduction
into a host cell include non-viral vehicles and viral vectors.
Verma and Somia (1997) Nature 389:239-242.
A wide variety of non-viral vehicles for delivery of a
polynucleotide encoding a VEGF variant are known in the art and are
encompassed in the present invention. A polynucleotide encoding a
VEGF variant can be delivered to a cell as naked DNA (U.S. Pat. No.
5,692,622; WO 97/40163). Alternatively, a polynucleotide encoding a
VEGF variant can be delivered to a cell associated in a variety of
ways with a variety of substances (forms of delivery) including,
but not limited to cationic lipids; biocompatible polymers,
including natural polymers and synthetic polymers; lipoproteins;
polypeptides; polysaccharides; lipopolysaccharides; artificial
viral envelopes; metal particles; and bacteria. A delivery vehicle
can be a microparticle. Mixtures or conjugates of these various
substances can also be used as delivery vehicles. A polynucleotide
encoding a VEGF variant can be associated non-covalently or
covalently with these various forms of delivery. Liposomes can be
targeted to a particular cell type, e.g., to a glomerular
epithelial cell.
Viral vectors include, but are not limited to, DNA viral vectors
such as those based on adenoviruses, herpes simplex virus,
poxviruses such as vaccinia virus, and parvoviruses, including
adeno-associated virus; and RNA viral vectors, including, but not
limited to, the retroviral vectors. Retroviral vectors include
murine leukemia virus, and lentiviruses such as human
immunodeficiency virus. Naldini et al. (1996) Science
272:263-267.
Non-viral delivery vehicles comprising a polynucleotide encoding a
VEGF variant can be introduced into host cells and/or target cells
by any method known in the art, such as transfection by the calcium
phosphate coprecipitation technique; electroporation;
electropermeabilization; liposome-mediated transfection; ballistic
transfection; biolistic processes including microparticle
bombardment, jet injection, and needle and syringe injection; or by
microinjection. Numerous methods of transfection are known to the
skilled worker in the field.
Viral delivery vehicles can be introduced into cells by infection.
Alternatively, viral vehicles can be incorporated into any of the
non-viral delivery vehicles described above for delivery into
cells. For example, viral vectors can be mixed with cationic lipids
(Hodgson and Solaiman (1996) Nature Biotechnol. 14:339-342); or
lamellar liposomes (Wilson et al. (1977) Proc. Natl. Acad. Sci. USA
74:3471; and Faller et al. (1984) J. Virol. 49:269). For in vivo
delivery, the delivery vehicle(s) can be introduced into an
individual by any of a number of methods, each of which is familiar
in the art.
Further details of the present invention will be apparent from the
following non-limiting Examples. All references cited throughout
the specification, including the Examples, are hereby expressly
incorporated by reference.
EXAMPLES
Example 1
Construction of Pichia pastoris Expression Plasmids for the C116S
variant
Since the codon for Cys116 is near the 3' end of the VEGF.sub.121
gene, the C116S mutation can be introduced by incorporating the
mutation (TGT-Cys to TCT-Ser) in a reverse PCR primer that contains
the AvrII cloning site. Oligonucleotide primers were constructed
with the following sequences: Forward primer Oligo 1612:
GGGGGGGAATTCGATGAGATTTCCTTCAATTTTACTGCA (SEQ ID NO: 12) Reverse
primer Oligo 2524:
GGGGGGTCCTAGGTCACCGCCTCGGCTTGTCAGATTTTTTCTTGTCTTG (SEQ ID NO:
13)
where the position of the mutation in the reverse primer is
underlined. PCR amplification of the VEGF.sub.121 coding sequences
fused at the amino terminus to the alpha factor leader was
conducted using as template DNA plasmids pAN93 (wild type
VEGF.sub.121) and pAN102 (N75Q VEGF.sub.121) (FIGS. 15 and 16).
Reaction mixtures consisted of the following in a 50 .mu.l final
volume: 1 .mu.l [0.1 .mu.g] of template DNA, 5 .mu.l of a 10 .mu.M
solution of each of the primers, 5 .mu.l of a 2.5 mM
dideoxynucleotide solution, 1 .mu.l VENT polymerase (New England
Biolabs, Beverly, Mass.), and 5 .mu.l reaction buffer supplied by
the enzyme manufacturer. The temperature program (94 C., 1 min.;
70.degree. C., 1 min.) was repeated for 30 cycles. Five 1 .mu.l of
the resulting mixture was examined by electrophoresis and ethidium
bromide staining on a 1% agarose gel and a band corresponding to
the expected size of 647 bp was observed. The PCR product in each
vector was recovered by use of a Spin Gene Clean Kit (Bio101, Vista
Calif.) and eluted in a 18 .mu.l final volume. Both PCR fragments
as well as the recipient plasmid vector, pAN104 (FIG. 17) were
digested with EcoRI and AvrII at 37.degree. C. for 2 hours. DNA was
recovered from the reaction using Spin Gene Clean, and purified on
a 1% agarose gel and the single visible band was excised from each
lane. DNA was purified from the gel slices using Spin Gene Clean.
The PCR fragments were each ligated to the pAN104 EcoRI/AvrII
vector fragment at 16.degree. C. overnight and 5 .mu.l of each
reaction mixture was transformed into E. coli TOP10F' cells and
plated on selective media containing 50 .mu.g/ml zeocin
(Invitrogen, Carlsbad, Calif.). Eight colonies from either the wild
type or N75Q mutant transformations were grown up for plasmid DNA
preparation. These DNA preparations were digested with EcoRI and
AvrII restriction enzymes and the resulting fragment sizes
estimated using agarose gel electrophoresis. The expected 647 bp
band was present in all but two of these digests and two of the
correct DNA preparations were chosen for further work. The correct
DNA sequence was confirmed using dideoxy chain termination
sequencing. These plasmids were named pAN105 (C116S mutant) and
pAN106 (N75Q, C116S mutant).
Example 2
Expression of C116S VEGF121 and N75Q, C116S VEGF121 in Pichia
pastoris
Plasmids pAN105 and pAN106 were digested with SalI to give linear
DNA and transformed by electroporation into Pichia pastoris strain
GS115. Cells were selected for acquisition of histidine prototrophy
by plating on RDB plates and incubating at 30.degree. C. The
resulting colonies were also checked for zeocin resistance by
streaking on YEPD plates containing 100 .mu.g/ml zeocin. Zeocin
resistant transformants were screened for secretion of VEGF.sub.121
into the media by first inoculating into 2 ml BMGY medium and
shaking at 30.degree. C. overnight. Cells were then spun down and
resuspended in BMMY medium and incubated in a 30.degree. C. shaker
for 48 hours to allow for induction of VEGF.sub.121 expression. For
analysis of VEGF.sub.121 expression, either 10 or 100 .mu.l of cell
supernate was applied to a nitrocellulose membrane by filtration
through a 96-well dot blot apparatus. Anti-human VEGF antibody
(R&D Systems, Minneapolis, Minn.) was used to detect expression
as per manufacturer's specifications. Each of two colonies tested
for both pAN105 and pAN106 gave strong positive signals. These new
strains were designated ABL191 & ABL192 (pAN105 transformants)
and ABL193 and ABL194 (pAN106 transformants). For ABL91 and ABL193,
the dot blots were repeated with serial 2-fold dilutions of the
conditioned media. Anti-VEGF reactivity was detectable down to an
equivalent of 0.025 .mu.l supernatant.
Example 3
Fed-batch fermentation process
Materials
The compositions of the media and other materials used in the
fed-batch fermentation process are shown in Tables 1-7.
Method
As described in Example 2, N75Q, C116S VEGF121 was expressed in
Pichia pastoris strain GS115 transformed with the expression
construct pAN106 (strains ABL193 and ABL194). The host strain is
methanol utilization proficient (mut.sup.+), capable of growth on
methanol as a sole carbon and energy source. The expression
construct directs the cell to secrete the VEGF variant into the
culture medium in response to the inducer methanol.
Colonies of P. pastoris strain GS115 transformed with pAN106 were
maintained at 4.degree. C. on YPDS+zeocin plates. A streak plate
from a colony was used to generate the inoculum for the
fermentation. The inoculum was grown in a baffled, 500-ml shake
flask containing 50 ml of YYG medium. The flask was inoculated with
a single colony and grown overnight at 30.degree. C. with shaking.
The optical density (OD.sub.590 nm) of the resulting culture was
27. This culture was used to inoculate a 10-L fermentor containing
6.0 L of Pichia Fermentation Tank Medium. The temperature of the
fermentation was controlled at 30.degree. C. The culture was
agitated using an impeller rotation rate of 1000 rpm. The culture
was aerated at 16.7 L/min. The pH of the culture was maintained
with 2M phosphoric acid and 14.8 M ammonium hydroxide. During the
initial batch phase of the fermentation the culture pH was
maintained at 4.5. After approximately 17 hours of batch growth,
the initial charge of glycerol had been exhausted as evidenced by a
rapid rise in the dissolved oxygen (DO) level. The optical density
at this time was approximately 60.
The rise in dissolved oxygen level triggered the initiation of the
pre-induction phase of the culture, in which the glycerol feed was
added at a controlled rate to maintain the DO level at 25% of
saturation. The glycerol feed was continued for 4 hours. The
induction phase was then initiated.
Initiation of the induction phase entailed terminating the glycerol
feed, starting the methanol feed, and adjusting the culture pH. The
maximum methanol feed rate was initially 20 ml/min. It was
increased to 60 ml/min after 3 hours and increased to 120 ml/min
after an additional 1 hour. The maximum methanol feed rate remained
at 120 ml/min until harvest. The feed control was programmed to
feed at less than the maximal rate if the DO level dropped below
25%. The pH was adjusted (over 1 hour) from 4.5 to 6.0 by addition
of 14.8 M ammonium hydroxide. The optical density of the culture,
when the methanol feed was initiated, was approximately 120.
Samples were taken from the fermentor every 2 to 4 hours during the
day and early evening. Samples were plated to evaluate culture
uniformity and viability. The culture pH of samples was measured to
gauge whether the in-line pH probe had drifted. The optical density
of the samples was measured. As part of sampling during the
induction phase, the methanol feed was turned off briefly and the
time was measured for the DO to increase by 10%. This DO response
time was used to gauge whether methanol was accumulating in the
fermentor. Times greater than 2 minutes indicate overfeeding of
methanol to a degree which may be toxic to the cells. All response
times were 90 seconds or less.
Ninety hours after inoculation the fermentor was harvested. At
harvest, the culture temperature was reduced to 25.degree. C. and
the culture pH adjusted to 4.0 by addition of 2M phosphoric acid.
The final optical density of the culture was 410.
C116S VEGF.sub.121 was fermented in an analogous fashion.
The fermentation broth was then clarified by centrifugation and the
supernatant was filtered. Product in the filtered supernatant was
then continuously processed by cation exchange chromatography
(SP-Streamline, Pharmacia). The material captured was further
purified by reverse-phase HPLC (C4, YMC). The fraction were
collected, and concentration of the VEGF variant was determined.
For further details of purification see, e.g. Muller et al., Proc.
Natl. Acad. Sci. USA 94:7192-7197 (1997).
TABLE 1 YYG Medium Ingredient Amount Yeast Extract 10.0 g Yeast
Nitrogen Base 13.4 g Biotin 0.4 mg Glycerin 20 mL 1 M Potassium
Phosphate Buffer (see below) 250 mL H.sub.2 O Up to 1 L pH is
approximately 6.0 without adjustment Sterilize with autoclave
TABLE 2 1 M Potassium Phosphate Buffer KH.sub.2 PO.sub.4 118 g
K.sub.2 HPO.sub.4 23.0 g H.sub.2 O Up to 1 L Adjust pH to 6.0 with
NaOH Sterilize by filtration
TABLE 3 YPDS + Zeocin Plates Ingredient Amount Yeast Extract 10.0 g
Sorbitol 182.2 g Peptone 20.0 g Agar 20.0 g H.sub.2 O 900 mL
Glucose* 40 g 100 mg/ml Zeocin** 1.0 mL *Sterilized separately with
autoclave **Sterilized separately by filtration
TABLE 4 PTM1 Trace Minerals with Biotin Ingredient Amount
CuSO.sub.4 5H.sub.2 O 6.00 g NaI 0.08 g MnSO.sub.4 H.sub.2 O 3.00 g
Na.sub.2 MoO.sub.4 2H.sub.2 O 0.20 g H.sub.3 BO.sub.3 0.02 g
CoCl.sub.2 6H.sub.2 O 0.91 g ZnCl.sub.2 20.00 g FeCl.sub.3 6H.sub.2
O 20.78 g H.sub.2 SO.sub.4 5.00 mL Biotin 0.2 g H.sub.2 O Up to
1.00 L
TABLE 5 Pichia Fermentation Tank Medium Ingredient Amount 85%
H.sub.3 PO.sub.4 8.4 mL CaCl.sub.2 2H.sub.2 O 1.08 g K.sub.2
SO.sub.4 8.60 g MgSO.sub.4 7.02 g KOH 1.95 g Peptone 10.0 g Adjust
pH to 4.5 (with NaOH) then add Glycerol 22.5 g Sterilize in
fermentor then add PTM1 Trace Minerals with Biotin (see below) 4.0
mL 0.20 g/L Biotin 8.0 mL
TABLE 6 Glycerol Feed Ingredient Amount Glycerol 500 mL Water Up to
1000 mL Sterilize in autoclave and then add PTM1 Trace Minerals
with Biotin 12.0 mL
TABLE 7 Methanol Feed Ingredient Amount Methanol 1 L Filter
sterilize and then add PTM1 Trace Minerals with Biotin 12.0 mL
Example 4
HUVE cell proliferation assay--BrdU ELISA
Assay
96-well plates were coated with human fibronectin (Sigma; 1
.mu.g/100 .mu.l/well) in phosphate-buffered saline (PBS). The
plates were incubated at room temperature for 45 minutes, the
fibronectin solution was aspirated, and the plates were dried for
20-30 minutes open to air. Cells (HUVEC, Clonetics) were then
plated at 10000 cells/100 .mu.l/well in serum free medium) human
endothelial cell serum free medium; (Gibco)+2% fetal bovine serum
(FBS), leaving the first column cell-free to act as a blank. The
cells were incubated at 37.degree. C., 5% CO.sub.2 overnight (18-24
hours). The medium was changed to 100 .mu.l/well serum free medium
+1% FBS, and the plates were incubated at 37.degree. C., 5%
CO.sub.2 for 24 hours to allow the cells to quiesce.
VEGF.sub.121 standards and the samples to be tested were diluted
serially 1:3 in serum-free medium+0.1% human serum albumin: (HSA,
Sigma). 10 .mu.l of the dilutions were added to the wells, which
were incubated at 37.degree. C., 5% CO.sub.2 for 24 hours. BrdU
solution from the Cell Proliferation USA kit (Boehringer Mannheim)
was diluted 1:100 with Gibco serum-free medium, and 12 .mu.l of
this solution was added to each well. The plates were then
incubated at 37.degree. C., 5% CO.sub.2 for 4-5 hours. BrdU was
omitted for the wells used as background control.
After the 4-5 hours incubation, the medium was aspirated, 200 .mu.l
FixDeNat solution was added to each well, and the plates were
incubated at room temperature for 30 minutes. FixDeNat was
thoroughly aspirated, 100 .mu.l anti-BrdU-POD
(anti-BrdU-peroxidase) antibody solution were added to each well
(1:100 dilution of anti-BrdU-POD into PBS+0.05% Tween20+0.5% HSA),
and the plates were incubated at room temperature for 90 minutes.
Wells were washed three times with 300 .mu.l/well of PBS+0.05%
Tween20, and 100 .mu.l TMB substrate was added. This was followed
by incubation for 20-30 minutes until the color was sufficient for
colorimetric reading, whereupon 50 .mu.l sulfuric acid (SN) was
added, and colorimetric reading was performed at an absorbance of
450 nm.
Results
The results are shown in FIGS. 13 and 14. The graphs depict the
amount of DNA synthesis that was stimulated in response to serial
dilutions of Pichia-derived N75Q VEGF.sub.121 vs. N75Q,C116S
VEGF.sub.121. The X axis of each graph represents the final
concentration of added growth factor in the assay wells, expressed
as ng/ml. The y axis represents the optical density recorded in
each well after use of the BrdU kit (Boehringer Mannheim) to detect
incorporated bromodeoxyuridine at the end of the assay.
In the case of the experiment shown in FIG. 13, the ED.sub.50
(effective dose of growth factor needed to achieve a half-maximal
proliferation response) for N17Q, C116S VEGF.sub.121 was 1.72
ng/ml, while N75Q VEGF.sub.121 showed an ED.sub.50 of 3.09 ng/ml.
In the experiment shown in FIG. 14, the ED.sub.50 's for N75Q,
C116S VEGF.sub.121 and N75Q VEGF.sub.121 were 2.86 and 8.02 ng/ml,
respectively. Thus, in each case, the N75Q, C116S VEGF.sub.121
variant was significantly more potent than N75Q VEGF.sub.121 in
promoting DNA synthesis (by 1.7 to 2.8-fold).
SEQUENCE LISTING <100> GENERAL INFORMATION: <160>
NUMBER OF SEQ ID NOS: 11 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 1 <211> LENGTH: 444 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)...(441)
<400> SEQUENCE: 1 atg aac ttt ctg ctg tct tgg gtg cat tgg agc
ctt gcc ttg ctg ctc 48 tac ctc cac cat gcc aag tgg tcc cag gct gca
ccc atg gca gaa gga 96 gga ggg cag aat cat cac gaa gtg gtg aag ttc
atg gat gtc tat cag 144 cgc agc tac tgc cat cca atc gag acc ctg gtg
gac atc ttc cag gag 192 tac cct gat gag atc gag tac atc ttc aag cca
tcc tgt gtg ccc ctg 240 atg cga tgc ggg ggc tgc tgc aat gac gag ggc
ctg gag tgt gtg ccc 288 act gag gag tcc aac atc acc atg cag att atg
cgg atc aaa cct cac 336 caa ggc cag cac ata gga gag atg agc ttc cta
cag cac aac aaa tgt 384 gaa tgc aga cca aag aaa gat aga gca aga caa
gaa aaa tgt gac aag 432 ccg agg cgg tga 444 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 2 <211> LENGTH: 147
<212> TYPE: PRT <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 2 Met Asn Phe Leu Leu Ser Trp Val His Trp Ser
Leu Ala Leu Leu Leu 1 5 10 15 Tyr Leu His His Ala Lys Trp Ser Gln
Ala Ala Pro Met Ala Glu Gly 20 25 30 Gly Gly Gln Asn His His Glu
Val Val Lys Phe Met Asp Val Tyr Gln 35 40 45 Arg Ser Tyr Cys His
Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu 50 55 60 Tyr Pro Asp
Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu 65 70 75 80 Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro 85 90
95 Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His
100 105 110 Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn
Lys Cys 115 120 125 Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu
Lys Cys Asp Lys 130 135 140 Pro Arg Arg 145 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 3 <211> LENGTH: 516
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)...(513) <400> SEQUENCE: 3 atg aac ttt ctg ctg
tct tgg gtg gat tgg agc ctt gcc ttg ctg ctc 48 tac ctc cac cat gcc
aag tgg tcc cag gct gca ccc atg gca gaa gga 96 gga ggg cag aat cat
cac gaa gtg gtg aag ttc atg gat gtc tat cag 144 cgc agc tac tgc cat
cca atc gag acc ctg gtg gac atc ttc cag gag 192 tac cct gat gag atc
gag tac atc ttc aag cca tcc tgt gtg ccc ctg 240 atg cga tgc ggg ggc
tgc tgc aat gac gag ggc ctg gag tgt gtg ccc 288 act gag gag tcc aac
atc acc atg cag att atg cgg atc aaa cct cac 336 caa ggc cag cac ata
gga gag atg agc ttc cta cag cac aac aaa tgt 384 gaa tgc aga cca aag
aaa gat aga gca aga caa gaa aaa aaa tca gtt 432 cga gga aag gga aag
ggg caa aaa cga aag cgc aag aaa tcc cgg tat 480 aag tcc tgg agc gta
tgt gac aag ccg agg cgg tga 516 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 4 <211> LENGTH: 145
<212> TYPE: PRT <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 4 Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His
His Glu Val Val Lys 1 5 10 15 Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30 Val Asp Ile Phe Gln Glu Tyr
Pro Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45 Pro Ser Cys Val Pro
Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60 Gly Leu Glu
Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile 65 70 75 80 Met
Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90
95 Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg
100 105 110 Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys
Arg Lys 115 120 125 Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Cys
Asp Lys Pro Arg 130 135 140 Arg 145 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 5 <211> LENGTH: 576
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)...(573) <400> SEQUENCE: 5 atg aac ttt ctg ctg
tct tgg gtg cat tgg agc ctc gcc ttg ctg ctc 48 tac ctc cac cat gcc
aag tgg tcc cag gct gca ccc atg gca gaa gga 96 gga ggg cag aat cat
cac gaa gtg gtg aag ttc atg gat gtc tat cag 144 cgc agc tac tgc cat
cca atc gag acc ctg gtg gac atc ttc cag gag 192 tac cct gat gag atc
gag tac atc ttc aag cca tcc tgt gtg ccc ctg 240 atg cga tgc ggg ggc
tgc tgc aat gac gag ggc ctg gag tgt gtg ccc 288 act gag gag tcc aac
atc acc atg cag att atg cgg atc aaa cct cac 336 caa ggc cag cac ata
gga gag atg agc ttc cta cag cac aac aaa tgt 384 gaa tgc aga cca aag
aaa gat aga gca aga caa gaa aat ccc tgt ggg 432 cct tgc tca gag cgg
aga aag cat ttg ttt gta caa gat ccg cag acg 480 tgt aaa tgt tcc tgc
aaa aac aca gac tcg cgt tgc aag gcg agg cag 528 ctt gag tta aac gaa
cgt act tgc aga tgt gac aag ccg agg cgg tga 576 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 6 <211>
LENGTH: 191 <212> TYPE: PRT <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 6 Met Asn Phe Leu Leu Ser Trp Val His
Trp Ser Leu Ala Leu Leu Leu 1 5 10 15 Tyr Leu His His Ala Lys Trp
Ser Gln Ala Ala Pro Met Ala Glu Gly 20 25 30 Gly Gly Gln Asn His
His Glu Val Val Lys Phe Met Asp Val Tyr Gln 35 40 45 Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu 50 55 60 Tyr
Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu 65 70
75 80 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val
Pro 85 90 95 Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile
Lys Pro His 100 105 110 Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu
Gln His Asn Lys Cys 115 120 125 Glu Cys Arg Pro Lys Lys Asp Arg Ala
Arg Gln Glu Asn Pro Cys Gly 130 135 140 Pro Cys Ser Glu Arg Arg Lys
His Leu Phe Val Gln Asp Pro Gln Thr 145 150 155 160 Cys Lys Cys Ser
Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg Gln 165 170 175 Leu Glu
Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg 180 185 190
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 7
<211> LENGTH: 642 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS
<222> LOCATION: (1)...(639) <400> SEQUENCE: 7 atg aac
ttt ctg ctg tct tgg gtg cat tgg agc ctc gcc ttg ctg ctc 48 tac ctc
cac cat gcc aag tgg tcc cag gct gca ccc atg gca gaa gga 96 gga ggg
cag aat cat cac gaa gtg gtg aag ttc atg gat gtc tat cag 144 cgc agc
tac tgc cat cca atc gag acc ctg gtg gac atc ttc cag gag 192 tac cct
gat gag atc gag tac atc ttc aag cca tcc tgt gtg ccc ctg 240 atg cga
tgc ggg ggc tgc tgc aat gac gag ggc ctg gag tgt gtg ccc 288 act gag
gag tcc aac atc acc atg cag att atg cgg atc aaa cct cac 336 caa ggc
cag cac ata gga gag atg agc ttc cta cag cac aac aaa tgt 384 gaa tgc
aga cca aag aaa gat aga gca aga caa gaa aaa aaa tca gtt 432 cga gga
aag gga aag ggg caa aaa cga aag cgc aag aaa tcc cgg tat 480 aag tcc
tgg agc gtg ggg cct tgc tca gag cgg aga aag cat ttg ttt 528 gta caa
gat ccg cag acg tgt aaa tgt tcc tgc aaa aac aca gac tcg 576 cgt tgc
aag gcg agg cag ctt gag tta aac gaa cgt act tgc aga tgt 624 gac aag
ccg agg cgg tga 642 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 8 <211> LENGTH: 213 <212> TYPE:
PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 8 Met
Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu 1 5 10
15 Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly
20 25 30 Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val
Tyr Gln 35 40 45 Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp
Ile Phe Gln Glu 50 55 60 Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys
Pro Ser Cys Val Pro Leu 65 70 75 80 Met Arg Cys Gly Gly Cys Cys Asn
Asp Glu Gly Leu Glu Cys Val Pro 85 90 95 Thr Glu Glu Ser Asn Ile
Thr Met Gln Ile Met Arg Ile Lys Pro His 100 105 110 Gln Gly Gln His
Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys 115 120 125 Glu Cys
Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Lys Lys Ser Val 130 135 140
Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Tyr 145
150 155 160 Lys Ser Trp Ser Val Gly Pro Cys Ser Glu Arg Arg Lys His
Leu Phe 165 170 175 Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys
Asn Thr Asp Ser 180 185 190 Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn
Glu Arg Thr Cys Arg Cys 195 200 205 Asp Lys Pro Arg Arg 210
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 9
<211> LENGTH: 699 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS
<222> LOCATION: (1)...(696) <400> SEQUENCE: 9 atg aac
ttt ctg ctg tct tgg gtg cat tgg agc ctc gcc ttg ctg ctc 48 tac ctc
cac cat gcc aag tgg tcc cag gct gca ccc atg gca gaa gga 96 gga ggg
cag aat cat cac gaa gtg gtg aag ttc atg gat gtc tat cag 144 cgc agc
tac tgc cat cca atc gag acc ctg gtg gac atc ttc cag gag 192 tac cct
gat gag atc gag tac atc ttc aag cca tcc tgt gtg ccc ctg 240 atg cga
tgc ggg ggc tgc tgc aat gac gag ggc ctg gag tgt gtg ccc 288 act gag
gag tcc aac atc acc atg cag att atg cgg atc aaa cct cac 336 caa ggc
cag cac ata gga gag atg agc ttc cta cag cac aac aaa tgt 384 gaa tgc
aga cca aag aaa gat aga gca aga caa gaa aaa aaa tca gtt 432 cga gga
aag gga aag ggg caa aaa cga aag cgc aag aaa tcc cgg tat 480 aag tcc
tgg agc gtg tac gtt ggt gcc cgc tgc tgt cta atg ccc tgg 528 agc ctc
cct ggc ccc cat ccc tgt ggg cct tgc tca gag cgg aga aag 576 cat ttg
ttt gta caa gat ccg cag acg tgt aaa tgt tcc tgc aaa aac 624 aca gac
tcg cgt tgc aag gcg agg cag ctt gag tta aac gaa cgt act 672 tgc aga
tgt gac aag ccg agg cgg tga 699 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 10 <211> LENGTH: 232
<212> TYPE: PRT <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 10 Met Asn Phe Leu Leu Ser Trp Val His Trp
Ser Leu Ala Leu Leu Leu 1 5 10 15 Tyr Leu His His Ala Lys Trp Ser
Gln Ala Ala Pro Met Ala Glu Gly 20 25 30 Gly Gly Gln Asn His His
Glu Val Val Lys Phe Met Asp Val Tyr Gln 35 40 45 Arg Ser Tyr Cys
His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu 50 55 60 Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu 65 70 75 80
Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro 85
90 95 Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro
His 100 105 110 Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His
Asn Lys Cys 115 120 125 Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln
Glu Lys Lys Ser Val 130 135 140 Arg Gly Lys Gly Lys Gly Gln Lys Arg
Lys Arg Lys Lys Ser Arg Tyr
145 150 155 160 Lys Ser Trp Ser Val Tyr Val Gly Ala Arg Cys Cys Leu
Met Pro Trp 165 170 175 Ser Leu Pro Gly Pro His Pro Cys Gly Pro Cys
Ser Glu Arg Arg Lys 180 185 190 His Leu Phe Val Gln Asp Pro Gln Thr
Cys Lys Cys Ser Cys Lys Asn 195 200 205 Thr Asp Ser Arg Cys Lys Ala
Arg Gln Leu Glu Leu Asn Glu Arg Thr 210 215 220 Cys Arg Cys Asp Lys
Pro Arg Arg 225 230 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 11 <211> LENGTH: 110 <212> TYPE:
PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 11 Ala
Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys 1 5 10
15 Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu
20 25 30 Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile
Phe Lys 35 40 45 Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys
Cys Asn Asp Glu 50 55 60 Gly Leu Glu Cys Val Pro Thr Glu Glu Ser
Asn Ile Thr Met Gln Ile 65 70 75 80 Met Arg Ile Lys Pro His Gln Gly
Gln His Ile Gly Glu Met Ser Phe 85 90 95 Leu Gln His Asn Lys Cys
Glu Cys Arg Pro Lys Lys Asp Arg 100 105 110
* * * * *