U.S. patent number 6,399,861 [Application Number 08/447,985] was granted by the patent office on 2002-06-04 for methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof.
This patent grant is currently assigned to Dekalb Genetics Corp.. Invention is credited to Paul C. Anderson, Christopher E. Flick, William J. Gordon-Kamm, Albert P. Kausch, Catherine J. Mackey, Emil M. Orozco, Peter Orr, Michael A. Stephens, David A. Walters, Donald S. Walters.
United States Patent |
6,399,861 |
Anderson , et al. |
June 4, 2002 |
**Please see images for:
( Certificate of Correction ) ** |
Methods and compositions for the production of stably transformed,
fertile monocot plants and cells thereof
Abstract
This invention relates to a reproducible system for the
production of stable, genetically transformed maize cells, and to
methods of selecting cells that have been transformed. One method
of selection disclosed employs the Streptomyces bar gene introduced
by microprojectile bombardment into embryogenic maize cells which
were grown in suspension cultures, followed by exposure to the
herbicide bialaphos. The methods of achieving stable transformation
disclosed herein include tissue culture methods and media, methods
for the bombardment of recipient cells with the desired
transforming DNA, and methods of growing fertile plants from the
transformed cells. This invention also relates to the transformed
cells and seeds and to the fertile plants grown from the
transformed cells and to their pollen.
Inventors: |
Anderson; Paul C. (Stonington,
CT), Flick; Christopher E. (Old Saybrook, CT),
Gordon-Kamm; William J. (Stonington, CT), Kausch; Albert
P. (Stonington, CT), Mackey; Catherine J. (Old Lyme,
CT), Orozco; Emil M. (Groton, CT), Orr; Peter
(Paweatuck, CT), Stephens; Michael A. (East Lyme, CT),
Walters; David A. (Groton, CT), Walters; Donald S.
(Mystic, CT) |
Assignee: |
Dekalb Genetics Corp. (DaKalb,
IL)
|
Family
ID: |
22350146 |
Appl.
No.: |
08/447,985 |
Filed: |
May 23, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
113561 |
Aug 25, 1993 |
|
|
|
|
565844 |
Aug 9, 1990 |
|
|
|
|
513298 |
Apr 17, 1990 |
|
|
|
|
Current U.S.
Class: |
800/320.1;
800/275; 800/288; 800/293; 800/302; 800/303; 800/301 |
Current CPC
Class: |
C12N
15/8241 (20130101); C12N 5/0025 (20130101); A01H
4/001 (20130101); C12N 9/0006 (20130101); C12N
5/04 (20130101); A01H 4/00 (20130101); C12N
9/88 (20130101); C12N 15/8207 (20130101); C12N
15/8209 (20130101); C07K 14/415 (20130101); C12N
15/87 (20130101) |
Current International
Class: |
A01H
4/00 (20060101); C12N 5/00 (20060101); C12N
15/82 (20060101); C07K 14/415 (20060101); C12N
5/04 (20060101); C12N 15/87 (20060101); A01H
005/00 (); C12N 005/04 () |
Field of
Search: |
;800/320.1,301,302,303,293,288,275,260,262,266 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
B-80893/87 |
|
Dec 1988 |
|
AU |
|
2032443 |
|
Dec 1990 |
|
CA |
|
2064761 |
|
Feb 1991 |
|
CA |
|
37 38 874 |
|
Nov 1988 |
|
DE |
|
40 13 099 |
|
Oct 1991 |
|
DE |
|
4 013 099 |
|
Oct 1991 |
|
DE |
|
0 126 537 |
|
Nov 1984 |
|
EP |
|
0 131 623 |
|
Jan 1985 |
|
EP |
|
0 141 373 |
|
May 1985 |
|
EP |
|
0 142 924 |
|
May 1985 |
|
EP |
|
0 154 204 |
|
Sep 1985 |
|
EP |
|
0 160 390 |
|
Nov 1985 |
|
EP |
|
0 174 791 |
|
Mar 1986 |
|
EP |
|
0 189 707 |
|
Aug 1986 |
|
EP |
|
0 193 259 |
|
Sep 1986 |
|
EP |
|
0 202 668 |
|
Nov 1986 |
|
EP |
|
0 204 549 |
|
Dec 1986 |
|
EP |
|
0 242 236 |
|
Oct 1987 |
|
EP |
|
0 242 246 |
|
Oct 1987 |
|
EP |
|
0 299 552 |
|
Jan 1988 |
|
EP |
|
0 257 472 |
|
Mar 1988 |
|
EP |
|
0 262 971 |
|
Apr 1988 |
|
EP |
|
0 269 601 |
|
Jun 1988 |
|
EP |
|
0 270 356 |
|
Jun 1988 |
|
EP |
|
0 271 408 |
|
Jun 1988 |
|
EP |
|
0 275 069 |
|
Jul 1988 |
|
EP |
|
0 280 400 |
|
Aug 1988 |
|
EP |
|
0 282 164 |
|
Sep 1988 |
|
EP |
|
0 289 479 |
|
Nov 1988 |
|
EP |
|
0 290 395 |
|
Nov 1988 |
|
EP |
|
0 292 435 |
|
Nov 1988 |
|
EP |
|
0 301 749 |
|
Feb 1989 |
|
EP |
|
0 331 083 |
|
Sep 1989 |
|
EP |
|
0 331 855 |
|
Sep 1989 |
|
EP |
|
0 334 539 |
|
Sep 1989 |
|
EP |
|
0 335 528 |
|
Oct 1989 |
|
EP |
|
0 348 348 |
|
Dec 1989 |
|
EP |
|
0 353 908 |
|
Feb 1990 |
|
EP |
|
0 359 472 |
|
Mar 1990 |
|
EP |
|
0 359 617 |
|
Mar 1990 |
|
EP |
|
0 360 750 |
|
Mar 1990 |
|
EP |
|
0 408 403 |
|
May 1990 |
|
EP |
|
0 385 962 |
|
Sep 1990 |
|
EP |
|
0 420 358 |
|
Apr 1991 |
|
EP |
|
0 424 047 |
|
Apr 1991 |
|
EP |
|
0 442 174 |
|
Apr 1991 |
|
EP |
|
0 459 643 |
|
May 1991 |
|
EP |
|
0 442 175 |
|
Aug 1991 |
|
EP |
|
0 452 269 |
|
Nov 1991 |
|
EP |
|
0 469 273 |
|
Feb 1992 |
|
EP |
|
0 485 970 |
|
May 1992 |
|
EP |
|
2 661 421 |
|
Oct 1991 |
|
FR |
|
2 159 173 |
|
Nov 1985 |
|
GB |
|
61-134343 |
|
Jun 1986 |
|
JP |
|
8 801 444 |
|
Jan 1990 |
|
NL |
|
85/01856 |
|
May 1985 |
|
WO |
|
85/02972 |
|
Jul 1985 |
|
WO |
|
86/01536 |
|
Mar 1986 |
|
WO |
|
86/03776 |
|
Jul 1986 |
|
WO |
|
87/04181 |
|
Jul 1987 |
|
WO |
|
87/05629 |
|
Sep 1987 |
|
WO |
|
88/08034 |
|
Oct 1988 |
|
WO |
|
89/04371 |
|
May 1989 |
|
WO |
|
89/10396 |
|
Nov 1989 |
|
WO |
|
89/11789 |
|
Dec 1989 |
|
WO |
|
89/12102 |
|
Dec 1989 |
|
WO |
|
90/01551 |
|
Feb 1990 |
|
WO |
|
90/01869 |
|
Mar 1990 |
|
WO |
|
90/02801 |
|
Mar 1990 |
|
WO |
|
90/10691 |
|
Aug 1990 |
|
WO |
|
90/10725 |
|
Sep 1990 |
|
WO |
|
91/02071 |
|
Feb 1991 |
|
WO |
|
WO 91/02071 |
|
Feb 1991 |
|
WO |
|
91/04270 |
|
Apr 1991 |
|
WO |
|
91/04323 |
|
Apr 1991 |
|
WO |
|
91/00183 |
|
May 1991 |
|
WO |
|
91/10725 |
|
Jul 1991 |
|
WO |
|
WO 91/10725 |
|
Jul 1991 |
|
WO |
|
91/16432 |
|
Oct 1991 |
|
WO |
|
92/06205 |
|
Apr 1992 |
|
WO |
|
92/09696 |
|
Jun 1992 |
|
WO |
|
92/12250 |
|
Jul 1992 |
|
WO |
|
92/14822 |
|
Sep 1992 |
|
WO |
|
92/17580 |
|
Oct 1992 |
|
WO |
|
92/19731 |
|
Nov 1992 |
|
WO |
|
93/06220 |
|
Apr 1993 |
|
WO |
|
93/07278 |
|
Apr 1993 |
|
WO |
|
93/08682 |
|
May 1993 |
|
WO |
|
93/09237 |
|
May 1993 |
|
WO |
|
93/14210 |
|
Jul 1993 |
|
WO |
|
Other References
Abstracts, 35th Annual Maize Genetics Conference, In Vitro Cellular
and Devel. Biol., 28 (1993). .
"Biotechnica Applies for Field Test of Genetically Engineered
Corn", Genetic Technology News, 10, 4 (Mar. 1990). .
"Bullets Transform Plant Cells", Agricell Report, 9, 5 (Jul. 1987).
.
Catalog, Handbook of Fine Chemicals, Aldrich Chemical Co., p. 508
(1988). .
"Chipping Away At Old Weed Enemies", Prairie Farmer, 162, 34 (Feb.
20, 1988). .
"Corn Transformers Multiply", Bio/Technol., 8, 490 (Jun. 1990).
.
"Cornell U. Gene Gun Hits Biotech Bullseye", Agriculture
Technology, p. 13. .
"Dalapon", Merck Index, 11th Edition, S. Budavae, (ed.), Merck and
Co., pp. 405-406 (1989). .
"Dekalb Researchers Produce Fertile Corn Plants with Foreign
Genes", ARI Newsletter (Oct.-Nov. 1990). .
Dialog Patent Family Record for Australian Patent AU-B-87/80893.
.
Dialog Search of Japanese Patent No. 61-134,343 (1986). .
"Gene Guns Succeed in Altering Corn", Biotechnology News, p. 2
(Apr. 1990). .
"Genetic Engineering Advance Announced for Corn Plants", Investor's
Daily (Apr. 19, 1990). .
"Genetically Engineered Corn: Breakthrough Brings Market Closer",
Genetic Technology News, 8-11 (Oct. 1990). .
"Herbicide-Resistant Corn", CT Academy of Science and Engineering,
Case Reports, 5, 6 (1990). .
"Keystone Crops", Agriculture Genetics Report (Mar./Apr. 1990).
.
Office Action dated May 30, 1989, Goldman et al., USSN 06/880,271,
filed Jun. 30, 1986. .
Office Action dated Mar. 8, 1990, Goldman et al., USSN 06/880,271,
filed Jun. 30, 1986. .
"Plant Science Research, Inc. Achieves Successful Transformation of
Corn", Genetic Engineering News, 10, 3 (Mar. 1990). .
"Shotgunning DNA into Cells", Genetic Engineering News (Jul.-Aug.
1987). .
"Sticky Ends", Genetic Engineering News, 10, 1 (May 1990). .
"Teams from USDA/Monsanto and DeKalb Genetically Engineer Corn",
Genetic Technology News, 10 (May 1990). .
"Two Teams Succeed in Putting Foreign Genes in Corn Plants",
Genetic Engineering Letter, 10, 3 (Apr. 4, 1990). .
"USDA Approves Field Test for BioTechnica's Genetically Engineered
Corn", Genetic Technology News, 10, 6 (Jul. 1990). .
"USDA Approves More Field Tests", Genetic Technology News, 11, 12
(Jul., 1991). .
Adang, M.J., et al., "Characterized Full-Length and Truncated
Plasmid Clones of the Crystal Protein of Bacillus thuringiensis
subsp. kurstaki HD-73 and Their Toxicity to Manduca sexta", Gene,
36, 289-300 (1985). .
Ahokas, H., "Electrophorectic Transfection of Cereal Grains with
Exogenous Nucleic Acid", Abstracts, Soc. Biochem. Biophys.
Microbio. Fen., Biotieteen Paivat (Bioscience Days), Technical
University of Helsinki, Espoo, Finland, p. 2 (1989). .
Ahokas, H., "Transfection of Germinating Barley Seed
Electrophoretically with Exogenous DNA", Theor. Appl. Genet., 77,
469-472 (1989). .
Akella, V., et al., "Expression in Cowpea Seedlings of Chimeric
Transgenes after Electroporation into Seed-Derived Embryos", Plant
Cell Rep., 12, 110-117 (1993). .
Altenbach, S.B., et al., "Cloning and Sequence Analysis of a cDNA
Encoding a Brazil Nut Protein Exceptionally Rich in Methionine",
Plant Mol. Biol., 8, 239-250 (1987). .
Altenbach, S.B., et al., "Enhancement of the Methionine Content of
Seed Proteins by the Expression of a Chimeric Gene Encoding a
Methionine-Rich Protein in Transgenic Plants", Plant. Mol. Biol.,
13, 513-522 (1989). .
Ampe, C., et al., "The Amino-Acid Sequence of the 2S Sulphur-Rich
from Seed of Brazil Nut (Bertholletia excelsa H.B.K.)", Eur. J.
Biochem., 159, 597-604 (1986). .
Andrews, D.L., et al., "Characterization of the Lipid Acyl
Hydrolase Activity of the Major Potato (Solanum tuberosum) Tuber
Protein, Patatin, by Cloning and Abundant Expression in a
Baculovirus Vector", Biochem. J., 252, 199-206 (1988). .
Armstrong, C.L., et al., "Establishment and Maintenance of Friable,
Embryogenic Maize Callus and the Involvement of L-Proline", Planta,
164, 207-214 (1985). .
Armstrong, C.L., et al., "Genetic and Cytogenetic Variation in
Plants Regenerated from Organogenic and Friable, Embryogenic Tissue
Cultures of Maize," Crop Sci., 28, 363-369 (1988). .
Armstrong, C.L., et al., "Genetic and Cytogenetic Variation in
Plants Regenerated from Organogenic and Friable, Embryogenic Tissue
Cultures of Maize", Biol. Abstracts, 85, Abstract No. 117662, p. 22
(1988). .
Atanassova, R., et al., "A 126 bp Fragment of a Plant Histone Gene
Promoter Confers Preferential Expression in Meristems of Transgenic
Arabidopsis", The Plant Journal, 2, 291-300 (1992). .
Aves, K., et al., "Transformation of an Elite Maize Imbred Through
Microprojectile Bombardment of Regenerable Embryonic Callus", In
Vitro Cell. Develop. Biol., 28A, Abstract No. P-1134, p. 124A
(1992). .
Barker, R.F., et al., "Nucleotide Sequence of the T-DNA Region from
the Agrobacterium tumefaciens Octopine Ti Plasmid pTil5955", Plant
Mol. Biol., 2, 335-350 (1983). .
Beerman, F., et al., "Tyrosinase as a Marker for Transgenic Mice",
Nuc. Acids Res., 19, 958 (1991). .
Belanger, F.C., et al., "Molecular Basis for Allelic Polymorphism
of the Maize Globulin-1 Gene", Genetics, 129, 863-872 (1991). .
Benner, M.S., et al., "Genetic Analysis of Methionine-Rich Storage
Protein Accumulation in Maize", Theor. Appl. Genet., 78, 761-767
(1989). .
Bernasconi, P., et al., "Functional Expression of Arabidopsis
thaliana Anthranilate Synthase Subunit I in Escherichia coli",
Plant Physiol., 106, 353-358 (1994). .
Bevan, M., et al., "A Chimaeric Antibiotic Resistance Gene as a
Selectable Marker for Plant Cell Transformation", Nature, 304,
184-187 (1983). .
Bevan, M., et al., "Structure and Transcription of the Nopaline
Synthase Gene Region of T-DNA", Nuc. Acids Res., 11, 369-385
(1983). .
Binns, A.N., "Agrobacterium-Mediated Gene Delivery and the Biology
of Host Range Limitations", Physiologia Plantarum, 79, 135-139
(1990). .
Bishop, J.E., "Two Teams Place Genes into Corn", The Wall Street
Journal, B1 (Apr. 1990). .
Booy, G., et al., "Attempted Pollen-Mediated Transformation of
Maize", J. Plant Physiol., 135, 319-324 (1989). .
Botterman, J., et al., "Engineering Herbicide Resistance in
Plants", Trends in Genetics, 4, 221-222 (Aug. 1988). .
Boulton, M.I., et al., "Specificity of Agrobacterium-Mediated
Delivery of Maize Streak Virus DNA to Members of the Gramineae",
Plant Mol. Biol., 12, 31-40 (1989). .
Boyer, J.S., "Water Deficits and Photosynthesis", In: Water
Deficits and Plant Growth, vol. IV, Kozlowski, T.T., (ed.),
Academic Press, New York, pp. 153-190 (1976). .
Brignon, P., et al., "Nuclease Sensitivity and Functional Analysis
of a Maize Histone H3 Gene Promoter", Plant Mol. Biol., 22,
1007-1015 (1993). .
Brill, W.J., "Agricultural Microbiology", Scientific American, 245,
199-215 (Sep. 1981). .
Brunke, K.J., et al., "Insect Control with Genetically Engineered
Crops", Trends in Biotechnology, 9, 197-200 (1991). .
Buchanan-Wollaston, V., et al., "Detoxification of the Herbicide
Dalapon by Transformed Plants", J. Cell. Biochem., 13D, Abstract
No. M503, p. 330 (1989). .
Calligiuri, M.G., et al., "Identification of Amino Acid Residues
Involved in Feedback Regulation of the Anthranilate Synthase
Complex from Salmonella typhimurium", J. Biol. Chem., 266,
8328-8335 (1991). .
Callis, J., et al., "Introns Increase Gene Expression in Cultured
Maize Cells", Genes and Development, 1, 1183-1200 (1987). .
Cao, J., et al., "Transformation of Rice and Maize Using the
Biolistic Process", In: Plant Gene Transfer, Lamb, C.J., et al.,
(eds.), Wiley-Liss, Inc., New York, pp. 21-33 (1990). .
Carpita, N.C., "The Biochemistry of "Growing" Cell Walls", In;
Physiology of Cell Expansion During Plant Growth, Cosgrove, D.J. et
al, (eds.), Am. Soc. Plant Physiologist, Rockville, MD, pp. 28-100
(1987). .
Chan, M., et al., "Agrobacterium-Mediated Production of Transgenic
Rice Plants Expressing a Chimeric .alpha.-Amylase
Promoter/.beta.-Glucuronidase Gene", Plant Mol. Biol., 22, 491-506
(1993). .
Chandler, V.L., et al., "Two Regulatory Genes of the Maize
Anthocyanin Pathway are Homologous: Isolation of B Utilizing R
Genomic Sequences", The Plant Cell, 1, 1175-1183 (1989). .
Charest, P.J., et al., "Factors Affecting the Use of
Chloramphenicol Acetyltransferase as a Marker for Brassica Genetic
Transformation", Plant Cell Reports, 7, 628-631 (1989). .
Chasan, R., "Transforming Maize Transformation", The Plant Cell, 4,
1463-1464 (1992). .
Chourey, P.S., et al., "Callus Formation from Protoplasts of a
Maize Cell Culture", Theor. Appl. Genet., 59, 341-344 (1981). .
Christou, P., et al., "Cotransformation Frequencies of Foreign
Genes in Soybean Cell Cultures", Theor. Appl. Genet., 79, 337-341
(1990). .
Christou, P., et al., "Genetic Transformation of Crop Plants Using
Microprojectile Bombardment", The Plant J., 2, 275-281 (1992).
.
Christou, P., et al., "Opine Synthesis in Wild-Type Plant Tissue",
Plant Physiol., 82, 218-221 (1986). .
Christou, P., et al., "Soybean Genetic Engineering--Commercial
Production of Transgenic Plants", Trends in Biotechnology, 8,
145-151 (1990). .
Christou, P., et al., "Stable Transformation of Soybean Callus by
DNA-Coated Gold Particles", Plant Physiol., 87, 671-674 (1988).
.
Chu, C., et al., "Establishment of an Efficient Medium for Another
Culture of Rice Through Comparative Experiments on the Nitrogen
Sources", Scientia Sinica, 18, 659-668 (Sep.-Oct. 1975). .
Clark, B., "Biotech Advance in Corn: Gunslining Researchers Fire
Marker Genes in to Corn", AG Consultant, 46, 12 (Jul. 1990). .
Cocking, F., et al., "Gene Transfer in Cereals", Science, 236,
1259-1262 (1987). .
Coe, E.H., et al., "The Genetics of Corn", In: Corn and Corn
Improvement, 2nd Edition, Sprague, G.F., (ed.), American Society of
Agronomy, Inc., Madison, WI, p. 138 (1977). .
Comai, L., et al., "Expression in Plants of a Mutant aroA Gene from
Salmonella typhimurium Confers Tolerance to Glyphosate", Nature,
217, 741-744 (Oct. 1985). .
Creissen, G., et al., "Agrobacterium- and Microprojectile-Mediated
Viral DNA Delivery into Barley Microspore-Derived Cutures", Plant
Cell Reports, 8, 680-683 (Apr. 1990). .
Crossway, A., et al., "Integration of Foreign DNA Following
Microinjections of Tobacco Mesophyll Protoplasts", Mol. Gen.
Genet., 202, 179-185 (1986). .
Darvill, A., et al., "The Primary Cell Walls of Flowering Plants",
In; The Plant Cell, vol. 1 of "The Biochemistry of Plants" Series,
Tolbert, N.E., (ed.), Acedemic Press, New York, pp. 91-162 (1980).
.
Datta, S.K., et al., "Genetically Engineered Fertile Indica-Rice
Recovered from Protoplasts", Bio/Technology, 8, 736-740 (Aug.
1990). .
Dauce-Le Reverend, B., et al., "Improvement of Escherichia coli
Strains Overproducing Lysine Using Recombinant DNA Techniques",
European J. Appl. Microbiol. Biotechnol., 15, 227-231 (1982). .
De Block, M., et al., "Egineering Herbicide Resistance on Plants by
Expression of a Detoxifying Enzyme", EMBO J., 6, 2513-2518 (1987).
.
De Greef, W., et al., "Evaluation of Herbicide Resistance in
Transgenic Crops under Field Conditions", Bio/Technology, 7, 61-64
(1989). .
Dekeyser, R.A., et al., "Evaluation of Selectable Markers for Rice
Transformation", Plant Physiol., 90, 217-223 (1989). .
Dekeyser, R.A., et al., "Transient Gene Expression in Intact and
Organized Rice Tissues", The Plant Cell, 2, 591-602 (Jul. 1990).
.
DeWald, S.G., et al., "Plant Regeneration from Inbred Maize
Suspensions", Abstracts, VIIth International Congress on Plant
Tissue and Cell Culture, Amsterdam, The Netherlands, Abstract No.
A1-36, p. 12 (Jun. 24-29, 1990). .
DeWet, J.J., et al., "Exogenous Gene Transfer in Maize (Zea mays)
using DNA-treated Pollen", In: The Experimental Manipulation of
Ovule Tissues, Chapman, G.P., et al., (eds.), Longman, New York,
pp. 197-209 (1985). .
DeWet, J.R., et al., "Cloning of Firefly Luciferase cDNA and the
Expression of Active Luciferase in Escherichia coli", Proc. Nat.
Acad. Sci. USA, 82, 7870-7873 (1985). .
D'Halluin, K., et al., "Transgenic Maize Plants by Tissue
Electroportation", The Plant Cell, 4, 1495-1505 (1992). .
Donn, G., et al., "Stable Transformation of Maize with a Chimaeric,
Modified Phosphinothricin-Acetyltransferase Gene from Streptomyces
viridochromogenes", Abstract, VIIth International Congress on Plant
Tissue and Cell Culture, Amsterdam, The Netherlands, Abstract No.
A2-38, p. 53 (Jun. 24-29, 1990). .
Dupuis, I., et al., "Gene Transfer to Maize Male Reproductive
Structure by Particle Bombardment of Tassel Primordia", Plant Cell
Rep., 12, p. 607 (1993). .
Ellis, J.G., et al., "Does the OCS-Element Occur as a Functional
Component of the Promoters of Plant Genes?", The Plant J., 4,
433-443 (1993). .
Evans, D.A., et al., "Somaclonal Variation--Genetic Basis and
Breeding Applications", Trends Genet., 5, 46-50 (1989). .
Fennel, A., et al., "Electroporation and PEG Delivery of DNA into
Maize Microspores", Plant Cell Rep., 11, 567-570 (1992). .
Fitzpatrick, T., "Pleiotrophic Gene Found in Barley Plant", Genetic
Engineering News, 13, 1 (1993). .
Flavell, R., et al., "Prospects for Transforming Monocot Crop
Plants", Nature, 307, 108-109 (Jan. 12, 1984). .
Fransz, P., et al., "Cytodifferentiation During Cells Initiation
and Somatic Embryogenesis in Zea mays L.", Ph.D. Thesis, University
of Wageningen Press, The Netherlands (1988). .
Freeling, J.C., et al., "Developmental Potentials of Maize Tissue
Cultures", Maydica, XXI, 97-112 (Jul. 1977). .
Freiberg, B., "More Researchers Discover Corn Transformation
Technology", AG Biotechnology News, p. 26 (1990). .
Fromm, M.E., et al., "Expression of Genes Transfected into Monocot
and Dicot Plant Cells by Electroportion", Proc. Nat. Acad. Sci.
USA, 82, 5824-5828 (1985). .
Fromm, M.E., et al., "Inheritance and Expression of Chimeric Genes
in the Progeny of Transgenic Maize Plants", Bio/Technology, 8,
833-839 (1990). .
Fromm, M.E., et al., "Stable Transformation of Maize after Gene
Transfer by Electroporation", Nature, 319, 791-793 (1986). .
Fry, S.C., "Introduction to the Growing Cell Wall", In: The Growing
Plant Cell Wall: Chemical and Metabolic Analysis, Longman
Scientific and Technical, New York, pp. 1-5, 102-109 (1988). .
Geiser, M., et al., "The Hypervariable Region on the Genes Coding
for Entomphatogenic Crystal Proteins of Bacillus thuringiensis:
Nucleotide Sequence of the kurhdl gene of subsp. kurstaki HDI",
Gene, 48, 109-118 (1986). .
Goff, S.A., et al., "Plant Regeneration of Anthocyanin Biosynthetic
Genes Following Transfer of B Regulatory Genes into Maize Tissues",
EMBO J., 9, 2517-2522 (1990). .
Goodman, R.M., et al., "Gene Transfer in Crop Improvement",
Science, 236, 48-54 (Apr. 3, 1987). .
Gordon-Kamm, W.J., et al., "Stable Transformation of Embryonic
Maize Cultures by Microprojectile Bombardment", J. Cellular
Biochem., 13D, Absract No. M122, p. 259 (1989). .
Gordon-Kamm, W.J., et al., "Stable Transformation of Maize Cells
and Regeneration of Fertile Transgenic Plants", The Plant Cell, 2,
603-618 (1990). .
Gould, J., et al., "Transformation of the Graminae by Agrobacterium
tumefaciens", Program and Abstracts, The International Society for
Plant Moleclar Biology, Third International Congress, Tucson, AZ,
Abstract No. 1277 (Oct. 6-11, 1991). .
Gould, J., et al., "Transformation of zea mays Using Agrobacterium
tumefaciens and the Shoot Apex", Plant Physiol., 95, 426-434
(1991). .
Gould, O., et al., "Shoot Tip Culture as a Potential Transformation
System", Abstracts, Beltwide Cotton Production Research
Conferences, New Orleans, LA, p. 91 (1988). .
Graves, A., et al., "The Transformation of Zea mays Seedlings with
Agrobacterium tumefaciens", Plant Mol. Biol., 7, 43-50 (1986).
.
Green, C., et al., "Plant Regeneration in Tissue Cultures of
Maize", Crop Sci., 15, 417-421 (1975). .
Green, C., et al., "Plant Regeneration in Tissue Cultures of
Maize", In: Maize for Biological Research, Sheridan, W.F., (ed.),
Plant Molecular Biology Association, Charlottesville, VA, pp.
367-372 (1982). .
Green, C., et al., "Somatic Cell Genetic Systems in Corn", In:
Advances in Gene Technology: Molecular Genetics of Plants and
Animals, Downey, K., (ed.), Academic Press, Inc., New York, pp.
147-157 (1983). .
Grimsley, N., et al., "DNA Transfer from Agrobacterium to Zea mays
or Brassica by Agroinfection is Dependent on Bacterial Virulence
Functions", Mol. Gen. Genet., 217, 309-316 (1989). .
Gritz, L., et al., "Plasmid-Encoded Hygromycin B Resistance: The
Sequence of Hygromycin B Phosphotransferase Gene and Its Expression
in Escherichia coli and Saccharomyces cerevisiae", Gene, 25,
179-188 (1983). .
Guerineau, F., et al., "Sulfonamide Resistance Gene for Plant
Transformation", Plant Molecular Biology, 15, 127-136 (1990). .
Guilley, H., et al., "Transcription of Cauliflower Mosaic Virus
DNA: Detection of Promoter Sequence, and Characterization of
Transcripts", Cell, 30, 763-773 (Oct. 1982). .
Gunset, G., "Corn Farmers See Economic, Environment Gold in
Designer Genes", Chicago Tribune (Jan. 21, 1991). .
Gunset, G., "Genetic Advance May Transform Corn", Chicaco Tribune
(Apr. 19, 1990). .
Hallauer, A.R., et al., "Corn Breeding", In: Corn and Corn
Improvement, 3rd Edition, Sprague, G.F., et al. (eds.), American
Society of Agronomy, Inc., Madison, WI, pp. 463-564 (1988). .
Haughn, G.W., "Transformation with a Mutant Arabidopsis
Acetolactate Synthase Gene Renders Tobacco Resistant to
Sulfonylurea Herbicides", Mol. Gene. Genet., 211, 266-271 (1988).
.
Hauptmann, R.M., et al., "Evaluation of Selectable Markers for
Obtaining Stable Transformants on the Gramineae", Plant Physiol.,
86, 602-606 (1988). .
Herrera-Estrella, L., et al., "Use of Reporter Genes to Study Gene
Expression in Plant Cells", In: Plant Molecular Biology Manual B1,
Kluwer Academic Publishers, Dordrecht, Belgium, pp. 1-22 (1988).
.
Hoffman, L.M., et al., "A Modified Storage Protein in Synthesized,
Processed, and Degraded in the Seeds of Transgenic Plants", Plant
Mol. Biol., 11, 717-729 (1988). .
Hoffman, L.M., et al., "Synthesis and Protein Body Deposition of
Maize 15-kd Zein in Transgenic Tobacco Seeds", EMBO J., 6,
3213-3221 (1987). .
Hofte, H., et al., "Insecticidal Crystal Proteins of Bacillus
thuringiensis", Microbiol. Rev., 53, 242-255 (Jun. 1989). .
Hong, B., et al., "Developmental and Organ-Specific Expression of
an ABA- and Stress-Induced Protein in Barley", Plant Mol. Biol.,
18, 663-674 (1992). .
Hooykaas, P.J.J., "Transformation of Plant Cell via Agrobacterium",
Plant Mol. Biol., 13, 327-336 (1989). .
Hooykaas-Van Slogteren, G.M.S., et al., "Expression of Ti Plasmid
Genes in Monocotylendonous Plants Infected with Agrobacterium
tumefaciens", Nature, 311, 763-764 (Oct. 25, 1984). .
Horn, M., et al., "Transgenic Plants of Orchard Grass (Dactylis
glomerata L.) from Protplasts", Chem. Abstracts, 110, Abstract No.
89869a, p. 208 (1989). .
Horn, M., et al., "Transgenic Plants of Orchardgrass (Dactylis
glomerta L.) from Protoplasts", Plant Cell Reports, 7, 469-472
(1988). .
Howe, A., et al., "Development of Glyphosphate as a Selectable
Marker for the Production of Fertile Transgenic Corn Plants", In
Vitro Cell. Develop. Biol., 28A, 124-A, Abstract No. P-1136
(Jul.-Aug. 1992). .
Huang, Y., et al., "Factors Influencing Stable Transformation of
Maize Protoplasts by Electroporation", Plant Cell, Tissue and Organ
Culture, 18, 281 (1989). .
Imbrie-Milligan, C., et al., "Microcallus Growth from Maize
Protoplasts", Planta, 171, 58-64 (1987). .
International Society for Plant Molecular Biology, Program and
Abstracts, "Molecular Biology of Plant Growth and Development",
Tucson, AZ (Oct. 6-11, 1991). .
Jahne, A., et al., "Regeneration of Fertile Plants from Protoplasts
Derived from Embryogenic Cell Suspensions of Barley (Hordem
vulagare L.)", Plant Cell Rep., 10, 1-6 (1991). .
Jayne, S., et al., "Analysis of Elite Transgenic Maize Plants
Produced by Microprojectile Bombardment", Program and Abstracts,
The International Society for Plant Molecular Biology, Third
International Congress, Tucson, AZ, Abstract No. 338 (Oct. 6-11,
1991). .
Jaynes, J.M., et al., "Plant Protein Improvement by Genetic
Engineering: Use of Synthetic Genes", Trends in Biotechnology, 4,
314-320 (Dec. 1986). .
Jefferson, R.A., "Assaying Chimeric Genes in Plants: The GUS Gene
Fusion System", Plant Mol. Biol. Rep., 5, 387-405 (1987). .
Jefferson, R.A., et al., "Beta-Glucuronidase from Escherichia coli
as a Gene-Fusion Marker", Proc. Nat. Acad. Sci. USA, 83, 8447-8451
(1986). .
Jefferon, R.A., et al., "GUS Fusions: Beta-Glucuronidase as a
Sensitive and Versatile Gene Fusion Marker in Higher Plants", EMBO
J., 6, 3901-3907 (1987). .
Johri, M.M., et al., "Genetic Approaches to Meristem Organization",
In: Maize for Biological Research, Sheridan, W.F., (ed.), Plant
Molecular Biology Association, Charlottesville, VA, pp. 301-310
(1982). .
Jones, H., et al., "Recent Advances in Plant Electroporation",
Oxford Surveys of Plant Molecular and Cell Biology, 4, 347-357
(1987). .
Jones, H., et al., "Transient Gene Expression in Electroporated
Solanum Protoplasts", Plant Mol. Biol., 13, 503-511 (1989). .
Kaeppler, H.F., et al., "Silicon Carbide Fiber-Mediated DNA
Delivery into Plant Cells", Plant Cell Rep., 9, 415-418 (1990).
.
Kamo, K., et al., "Establishment and Characterization of Long-Term
Embryonic Miaze Callus and Cell Suspension Cultures", Plant Sci.,
45, 111-117 (1986). .
Kamo, K., et al., "Regeneration of Zea mays L. from Embryogenic
Callus", Bot. Gaz., 146, 327-334 (1985). .
Kao, K.N., et al., "Nutritional Requirements for Growth of Vicia
hajastana Cells and Protoplasts at a Very Low Population Density in
Liquid Media", Planta, 126, 105-110 (1978). .
Kartha, K., et al., "Transient Expression of Chloramphenicol Acetyl
Transferase (CAT) Gene in Barley Cell Cultures and Immature Embryos
Through Microprojectile Bombardment", Plant Cell. Rep., 8, 429-432
(1989). .
Kay, R., et al., "Duplication of CaMV 35S Promoter Sequences
Creates a Strong Enhancer for Plant Genes", Science, 236, 1299-1302
(Jun. 5, 1987). .
Kirihara, J., et al., "Differential Expression of a Gene for a
Methionine-Rich Storage Protein in Maize", Mol. Gen. Genet., 211,
477-484 (1988). .
Kirihara, J., et al., "Isolation and Sequences of a Gene Encoding a
Methionine-Rich 10-kDa Zein Protein from Maize", Gene, 71, 359-370
(1988). .
Klein, T.M., et al., "Factors Influencing Gene Delivery into Zea
mays Cells by High Velocity Microprojectiles", Bio/Technology, 6,
559-563 (1988). .
Klein, T.M., et al., "Genetic Transformation of Maize Cell by
Particle Bombardment and the Influence of Methylation on Foreign
Gene Expression", In: Gene Manipulation in Plant Improvement II,
Gustafson, J.P., (ed.), Plenum Press, New York, pp. 265-266 (1990).
.
Klein, T.M., et al., "Genetic Tranformation of Maize Cells by
Particle Bombardment", Plant Physiology, 91, 440-444 (1989). .
Klein, T.M., et al., "High-Velocity Microprojectile for Delivering
Nucleic Acids to Living Cells", Nature, 327, 70-73 (1987). .
Klein, T.M., et al., "Regulation of Anthocyanin Biosynthetic Genes
Introduced into Intact Maize Tissues by Microprojectiles", Pro.
Nat. Acad. Sci. USA, 86, 6681-6685 (Sep. 1989). .
Klein, T.M., et al., "Transfer of Foreign Genes into Intact Maize
Cells with High-Velocity Microprojectiles", Proc. Nat. Acad. Sci.
USA, 85, 4305-4309 (1988). .
Kozak, M., "Compilation and Analysis of Sequences from the
Translational Start Site in Eukaryotic mRNAs", Nuc. Acids Res., 12,
857-872 (1984). .
Kozak, M., "Point Mutations Define a Sequence Flanking the AUG
Initiator Codon that Modulates Translation by Eukaryotic
Ribosomes", Cell, 44, 283-292 (1986). .
Koziel, M.G., et al., "Field Performance of Elite Transgenic Maize
Plants Expressing an Insecticidal Protein Derived from Bacillus
thuringiensis", Bio/Technol., 11, 194-200 (1993). .
Kreitlow, B., "Genetic Engineering `Breakthrough` Disputed", Cedar
Rapids Gazette (Apr. 20, 1990). .
Kuhlemeier, C., et al., "Regulation of Gene Expression in Higher
Plants", Ann. Rev. Plant Physiol., 38, 234-239 (1987). .
Langridge, P., et al., "Tranformation of Cereals via Agrobacterium
and the Pollen Pathway: A Critical Assessment", The Plant J., 2,
613-638 (1992). .
Laursen, C.M., et al., "Production of Fertile Transgenic Maize by
Electroporation of Suspension Culture Cells", Plant Mol. Biol., 24,
51-61 (1994). .
Lazzeri, P., et al., "In Vitro Genetic Manipulation of Cereals and
Grasses", Adv. Cell Culture, 6, 291-293 (1988). .
Lee, J.S., et al., "Gene Tranfer into Intact Cells of Tobacco by
Electroporation", Korean J. Genetics, 11, 65-72 (1989). .
Leemans, J., "Genetic Engineering for Fertility Control", Keystone
Symposium--Crop Improvement via Biotechnology: An International
Perspective, Keystone, CO, Abstract No. Y016 (Apr. 10-16, 1992).
.
Lemaux, P.G., et al., "Selection of Stable Transformants from Maize
Suspension Cultures Using the Herbicide Bialaphos," J. Cell.
Biochem. 14e, Abstract No. R230, p. 304 (Mar. 31, 1990). .
Levitt, J., "Growth Regulators", In: Introduction to Plant
Physiology, The C.V. Mosby Company, St. Louis, MO, p. 241 (1969).
.
Li, B.-J., et al., "Introduction of Foreign Genes into the Seed
Embryo Cells of Rice by Electroinjection and the Regeneration of
Transgenic Rice Plants", Science in China, 34, 925-931 (1991).
.
Li, X.-Q., et al., "GUS Expression in Rice Tissue Using
Agrobacterium-Mediated Transformation", Program and Abstracts, The
International Society for Plant Molecular Biology, Third
International Congress, Tucson, AZ, Abstract No. 385 (Oct. 6-11,
1991). .
Lindsey, K., et al., "Electroporation of Cells", Physiol. Plant.,
79, 168-o172 (1990). .
Lindsey, K., et al., "Stable Transformation of Sugarbeet
Protoplasts by Electroporation", Plant Cell Rep., 8, 71-74 (1989).
.
Lindsey, K., et al., "The Permeability of Electroporated Cells and
Protoplasts of Sugar Beet", Planta, 172, 346-355 (1987). .
Lindsey, K., et al., "Transient Gene Expression in Electroporated
Protoplasts and Intact Cells of Sugar Beet", Plant Mol. Biol., 10,
43-52 (1987). .
Looker, D., "Dekalb Claims Success in Effort to Alter Genetic
Makeup of Corn", Des Moines Register (Apr. 19, 1990). .
Lorz, H., et al., "Advances in Tissue Cultures and Progress Towards
Genetic Transformation of Cereals", Plant Breeding, 100, 1-25
(1988). .
Lu, C., et al., "Improved Efficiency of Somatic Embryogenesis and
Plant Regeneration on Tissue Cultures of Maize (Zea mays L.)",
Theor. Appl. Genet., 66, 285-289 (1983). .
Lu, C., et al., "Somatic Embryogenesis in Zea mays L.", Theor.
Appl. Genet, 62, 109-112 (1982). .
Ludwig, S., et al., "A Regulatory Gene as a Novel Visible Marker
for Maize Transformation", Science, 247, 449-450 (1990). .
Ludwig, S., et al., "High Frequency Callus Formation from Maize
Protoplasts", Theor. Appl. Genet., 71, 344-350 (1985). .
Ludwig, S., et al., "Lc, a Member of the Maize R Gene Family
Responsible for Tissue-Specific Anthocyanin Production, Encodes a
Protein Similar to Transcriptional Activators and Contains the
myc-Homology Region", Proc. Nat. Acad. Sci. USA, 86, 7092-7096
(1989). .
Ludwig, S., et al., "Maize R Gene Family: Tissue-Specific
Helix-Loop-Helix Proteins", Cell, 62, 849-851 (1990). .
Lutcke, H., et al., "Selection of AUG Initiation Codons Differs in
Plants and Animals", EMBO J., 6, 43-48 (1987). .
Maas, C., et al., "A Highly Optimized Monocot Expression Cassette:
Application for Barley Transformation and Barley Virus Research",
Program and Abstracts, The International Society for Plant
Molecular Biology, Third International Congress, Tucson, AZ,
Abstract No. 386 (Oct. 6-11, 1991). .
Maddock, S.E., et al., "Expression in Maize Plants of Wheat Germ
Agglutinin, a Novel Source of Insect Resistance", Program and
Abstracts, The International Society for Plant Molecular Biology,
Third International Congress, Tucson, AS, Abstract No. 372 (Oct.
6-11, 1991). .
Mariani, C., et al., "Engineered Male Sterility in Plants",
Symposia of the Society for Experimental Biology, No. XLV,
Proceedings of a Meeting Held at the University of Glasgow,
Scotland, 271-279 (1991). .
Masumura, T., et al., "cDNA Cloning of an mRNA Encoding a
Sulfur-Rich 10 kDa Prolamin Polypeptide in Rice Seeds", Plant Mol.
Biol., 12, 123-130 (1989). .
McCabe, D.E., et al., "Stable Transformation of Soybean (Glycine
max) by Particle Acceleration", Bio/Technology, 6, 923-926 (1988).
.
McCue, K.F., et al., "Drought and Salt Tolerance: Towards
Understanding and Application ", TIBTECH, 8, 358-362 (Dec. 1990).
.
McDaniel, C., et al., "Cell-Lineage Patterns in the Shoot Apical
Meristem of the Germinating Maize Embryo", Planta, 175, 13-22
(1988). .
Meadows, C., et al., "Characterization of Cells and Protoplasts of
the B73 Maize Cell Line", Plant Sci. Lett., 28, 337-348
(1982-1983). .
Mendel, R., et al., "Delivery of Foreign Genes to Intact Barley
Cell by High-Velocity Microprojectiles", Theor. Appl. Genet., 78,
31-34 (1989). .
Messing, J., "Corn Storage Protein: A Molecular Genetic Model",
Division of Energy Biosciences--Summaries of FY 1990 Activities,
U.S. Department of Energy, Washington, D.C., Abstract No. 135, p.
70 (1990). .
Milborrow, B.V., "Abscisic Acid and Other Hormones", In: The
Physiology and Biochemistry of Drought Resistance in Plants, Paleg,
L.G., et al., (eds.), Academic Press, New York, pp. 347-388 (1981).
.
Moffat, A.S., "Corn Transformed", Science, 249, 630 (Aug. 10,
1990). .
Morikawa, H., et al., "Gene Transfer into Intact Plant Cells by
Electroporation Through Cell Walls and Membranes", Gene, 41,
121-124 (1986). .
Morocz, S., et al., "An Improved System to Obtain Fertile
Regenerants via Maize Protoplasts Isolated From a Highly
Embryogenic Suspension Culture", Theor. Appl. Genet., 80, 721-726
(1990). .
Morocz, S., et al, "Two Approaches to Rendering Zea mays L.
Applicable to Tissue Culture Manipulations", IAPTC Abstracts,
Abstract No. 209, p. 190 (1990). .
Murakami, T., et al., "The Bialaphos Biosynthetic Genes of
Streptomyces hygroscopicus: Molecular Cloning and Characterization
of the Gene Cluster", Mol. Gen. Genet., 205, 42-50 (1986). .
Murashige, T., et al., "A Revised Medium for Rapid Growth and Bio
Assays with Tobacco Tissue Cultures", Physiol. Plant., 15, 473-497
(1962). .
Murphy, H.L., "New Dekalb-Pfizer Seed Chief to Harvest R & D
Breakthroughs", Crain's Business Weekly, 38-39 (1990). .
Murray, E.E., et al., "Codon Usage in Plant Genes", Nuc. Acids
Res., 17, 477-498 (1989). .
Murray, L.E., et al., "Transgenic Corn Plants Expressing MDMV
Strain B Coat Protein are Resistant to Mixed Infections of Maize
Dwarf Mosaic Virus and Maize Chlorotic Mottle Virus", Bio/Technol.,
11, 1559-1564 (1993). .
Nelson, R.S., "Virus Tolerance, Plant Growth and Field Performance
of Transgenic Tomato Plants Expressing Coat Protein from Tobacco
Mosaic Virus", Bio/Technology, 6, 403-409 (Apr. 1988). .
Nelson, T., "New Horses for Monocot Gene Jockeys", The Plant Cell,
2, 589 (1990). .
Neuffer, M.G., "Growing Maize for Genetic Purposes", In: Maize for
Biological Research, Sheridan, W.F., (ed.), Plant Molecular Biology
Association, Charlottesville, VA, p. 19-30 (1982). .
Niyogi, K.K., et al., "Suppressors of trp I Fluorescence Identify a
New Arabidopsis Gene, TRP4, Encoding the Anthranilate Synthase
.beta. Subunit", The Plant Cell, 5, 1011-1027 (Sep. 1993). .
Niyogi, K.K., et al., "Two Anthranilate Synthase Genes in
Arabidopsis: Defense-Related Regulation of the Tryptophan Pathway",
The Plant Cell, 4, 721-733 (Jun. 1992). .
Odell, J., et al., "Identification of DNA Sequences Required for
Activity of the Cauliflower Mosaic Virus 35S Promoter", Nature,
313, 810-811 (1985). .
Ohta, Y., et al., "Gene Manifestation of Exogenous DNA Applied to
Self-Propagating Stigma (Gene Action Revealed in the Msuble and
Msub2 Generations from Self-Pollination Applying Exogenous DNA)",
Japn. J. Breed., 30, 184-185 (1980). .
Ohta, Y., et al., "High-Efficiency Genetic Transformation of Maize
by a Mixture of Pollen and Exogenous DNA", Proc. Nat. Acad. Sci.
USA, 83, 715-719 (1986). .
Omirullen, S., et al., "Activity of a Chimeric Promoter with the
Doubled CaMV 35S Enhancer in Protoplast-Derived Cells and
Transgenic Plants in Maize", Plant Mol. Biol., 21, 415-428 (1993).
.
Ozias-Akins, P., et al., "In Vitro Regeneration and Genetic
Manipulation of Grasses", Physiol. Plant., 73, 565-569 (1988).
.
Ozias-Akins, P., et al., "Progress and Limitations in the Culture
of Cereal Protoplasts", Trends in Biotechnology, 2, 119-123 (1984).
.
Park, S.H., et al., "Selection of Maize Transformants from Shoot
Apex Cultures Cocultivated with Agrobacterium Containing the Bar
Gene", In Vitro Cell. Develop. Biol., 29A, p. 85A, Abstract
No.P-1102 (1993). .
Parker, W.B., et al., "Selection and Characterization of
Sethoxydum-Tolerant Maize Tissue Cultures", Plant Physiol., 92,
1220-1225 (1990). .
Paszkowski, J., et al., "Direct Gene Transfer to Plants", The EMBO
Journal, 3, 2717-2722 (1984). .
Pederson, K., et al., "Sequence Analysis and Characterization of a
Maize Gene Encoding a High-Sulfur Zein Protein of Msubr 15,000", J.
Biol. Chem., 261, 6279-6284 (1986). .
Perl, A., et al., "Bacterial Dihydrodipicolinate Synthase and
Desensitized Apsartate Kinase: Two Novel Selectable Markers for
Plant Transformation", Bio/Technol., 11, 715-718 (1993). .
Perlack, F.J., et al., "Modification of the Coding Sequence
Enhances Plant Expression of Insect Control Protein Genes", Proc.
Nat. Acad. Sci. USA, 88, 3324-3328 (1991). .
Phillips, R.L., et al., "Cell/Tissue Culture and In Vitro
Manipulation", In: Corn and Corn Improvement, 3rd Edition, Sprague,
G.F., et al. (eds.), American Society of Agronomy, Inc., Madison,
WI, 345-387 (1988). .
Phillips, R.L., et al., "Elevated Protein-Bound Methionine in Seeds
of a Maize Line Resistant to Lysine Plus Threonine", Cereal Chem.,
62, 213-218 (1985). .
Pioneer HiBred International, Inc., Application for Release in the
Environment Under 7 CFR 340, Corn Plants Genetically Engineered to
Express Wheat Germ Agglutinin (WGA) Genes, in Order to Confer
Resistance to the European Corn Borer (Ostrinia nubilalis) and
Tolerance to Glufosinate Herbicides, 92-022-03, No CBI Copy, p. 11,
(May 4, 1992). .
Pioneer HiBred International, Inc., Release of Genetically
Engineered Corn Plants, Application Under 7 CFR 340, Permit No.
92-174-02, No CBI, p. 8, (Nov. 3, 1992). .
Pioneer HiBred International, Inc., Release of Genetically
Engineered Corn Plants, Application Under 7 CFR 340, Permit No.
92-174-02, CBI Deleted, p 8, (Nov 16, 1992). .
Pioneer HiBred International, Inc., Release of Genetically
Engineered Corn Plants, Application Under 7 CFR 340, Permit No.
92-330-01, CBI-Deleted, p. 13 (Apr. 13, 1993). .
Poehlman, J.M., Breeding Field Crops, 3rd Edition, AVI Publishing
Company, Inc., Westport, CT, 203-206 (1986). .
Poehlman, J.M., Breeding Field Crops, 3rd Edition, AVI Publishing
Company, Inc., Westport, CT, 452 (1986). .
Poehlman, J.M., Breeding Field Crops, 3rd Edition, AVI Publishing
Company, Inc., Westport, CT, 469-470, 477-481 (1986). .
Potrykus, I., "Gene Transfer to Cereals: An Assessment",
Bio/Technology, 8, 535-542 (Jun. 1990). .
Potrykus, I., "Gene Transfer to Cereals: An Assessment", Trends in
Biotechnology, 7, 269-273 (Oct. 1989). .
Potrykus, I., "Gene Transfer to Plants: Assessment and
Perspectives", Physiol. Plant., 79, 125-134 (1990). .
Potrykus, I., et al., "Callus Formation from Cell Culture
Protoplasts of Corn (Zea mays L.)", Theor. Appl. Genet., 54,
209-214 (1979). .
Potrykus, I., et al., "Callus Formation from Stem Protoplasts of
Corn (Zea mays L.)", Mol. Gen. Genet., 156, 347-350 (1977). .
Potrykus, I., et al., "Direct Gene Transfer to Cells of a
Graminaceous Monocot", Mol. Gen. Genet., 199, 183-188 (1985). .
Potter, H., et al., "Enhancer-Dependent Expression of Human Kappa
Immunoglobulin Genes Introduced into Mouse Pre-B Lymphocytes by
Electroporation", Proc. Nat. Acad. Sci. USA, 81, 7161-7165 (1984).
.
Prioli, L.M., et al., "Plant Regeneration and Recovery of Fertile
Plants from Protoplasts of Maize (Zea mays L.)", Bio/Technology, 7,
589-594 (Jun. 1989). .
Puite, K.J., et al., "Electrofusion, a Simple and Reproducible
Technique in Somatic Hybridization of Nicotaina plumbaginifolia
mutants", Plant Cell Rep., 4, 274-276 (1985). .
Ranch, J.P., et al., "Expression of 5-Methyltryptophan Resistance
in Plants Regenerated from Resistant Cell Lines of Datura innoxia",
Plant Physiol., 71, 136-140 (1983). .
Rhodes, C.A., "Corn: From Protoplasts to Fertile Plants",
Bio/Technology, 7, 548 (Jun. 1989). .
Rhodes, C.A., et al., "Genetically Transformed Maize Plants from
Protoplasts", Science, 240, 204-207 (Apr. 1988). .
Rhodes, C.A., et al., "Plant Regeneration from Protoplasts Isolated
from Embryogenic Maize Cell Cultures", Bio/Technology, 6, 56-60
(Jan. 1988). .
Richaud, F., et al., "Chromosomal Location and Nucleotide Sequence
of the Escherichia coli dapA Gene", Biol. Abstracts, 82, Abstract
NO. 3396, p. AB-391 (1986). .
Richaud, F., et al., "Chromosomal Location and Nucleotide Sequence
of the Escherichia coli dapA Gene", Journal of Bacteriology, 166,
297-300 (Apr. 1986). .
Robbins-Roth, C., et al., "They Make it Happen in Biotech",
BioWorld, 30-36 (Nov.-Dec. 1990). .
Robertson, D.S., "Loss of Mu Mutator Activity when Active Mu
Systems are Transferred to Inbred Lines", Maize Genetics Coop.
Newsletter, 60, 10 (1986). .
Ross, M.C., et al., "Transient and Stable Transgenic Cells and
Calli of Tobacco and Maize Following Microprojectile Bombardment",
J. Cell. Biochem., 13D, Abstract No. M149, p. 268 (1989). .
Sahi, S.V., et al., "Metabolites in Maize Which Affect Virulence
Induction in Agrobacterium tumefaciens", Plant Physiol. Supplement,
Abstract No. 514, p. 86 (1989). .
Sanford, J.C., "The Biolistic Process", Trends Biotechnol., 6,
299-302 (1988). .
Sanford, J.C., "Biolistic Plant Transformation", Physiol. Plant.,
79, 206-209 (1990). .
Sanford, J.C., et al., "Attempted Pollen-Mediated Plant
Transformation Employing Genomic Donor DNA", Theor. Appl. Genet.,
69, 571-574 (1985). .
Sanford, J.C., et al., "Delivery of Substances into Cells and
Tissues Using a Particle Bombardment Process", Particulate Sci.
Technol., 5, 27-37 (1987). .
Sass, J.E., "Morphology: Development of the Caryopsis", In: Corn
and Corn Improvement, 2nd Edition, Sprague, G.F., (ed.), American
Society of Agronomy, Inc., Madison, WI, p. 89, 98 (1977). .
Schmidt, A., et al., "Media and Environmental Effects of Phenolics
Production from Tobacco Cell Cultures", Chem. Abstracts., 110,
Abstract No. 230156z, p. 514 (1989). .
Shen, W.H., et al., "Excision of a Transposible Element from a
Viral Vector Introduced into Maize Plants by Agroinfection", The
Plant J., 2, 35-42 (1992). .
Shigekawa, K., et al., "Electroporation of Eukaroytes and
Prokaryotes: A General Approach to the Introduction of
Macromolecules into Cells", BioTechniques, 6, 742-751 (1988). .
Shillito, R.D., et al., "High Efficiency Direct Gene Transfer to
Plants", Bio/Technology, 3, 1099l-1103 (1985). .
Shillito, R.D., et al., "Regeneration of Fertile Plants from
Protoplasts of Elite Inbred Maize", Bio/Technology, 7, 581-587
(Jun. 1989). .
Shimamoto, K., et al., "Fertile Transgenic Rice Plants Regenerated
from Transformed Protoplasts", Nature, 338, 274-278 (1989). .
Shotwell, M.A., et al., "The Biochemistry and Molecular Biology of
Seed Storage Proteins", In: The Biochemistr of Plants, vol. 15,
Marcus A., (ed.), Academic Press, Inc., San Diego, CA, pp. 297-345
(1989). .
Smith, R., et al., "Shoot Apex Explant for Transformation", Plant
Physiol. (Suppl.) 86, Abstract No. 646, p. 108 (1988). .
Soberon, X., et al., "Construction and Characterization of New
Cloning Vehicles. IV. Deletion Derivatives fo pBR322 and pBR325",
Gene, 9, 287-305 (1980). .
Somers, D.A., et al., "Fertile, Transgenic Oat Plants",
Bio/Technology, 10, 1589-1594 (Dec. 1992). .
Songstad, D.D., et al., "Transient Expression of GUS and
Anthocyanin Constructs in Intact Maize Immature Embryos Following
Electroporation," Plant Cell Tissues and Organ Culture, 33, 195-201
(1993). .
Spencer, T.M., et al., "Bialaphos Selection of Stable
Transformations from Maize Cell Culture", Theor. Appl. Genet., 79,
625-631 (May 1990). .
Spencer, T.M., et al., "Fertile Transgenic Maize", Abstracts, 7th
Annual Meeting of the Mid-Atlantic Plant Molecular Biology Society,
Univerisyt of Maryland, College Park MD, p. 30 (Aug. 16-17, 1990).
.
Spencer, T.M., et al., "Segregation of Transgenes in Maize", Plant
Mol. Biol. 18, 201-210 (1992). .
Spencer, T.M., et al., "Selection of Stable Transformants from
Maize Suspension Cultures using the Herbicide Bialaphos", Poster
Presentation, FASEB Plant Gene Expression Conference, Copper
Mountain, CO (Aug. 8, 1989). .
Sprague, G.F., et al., "Corn Breeding", In: Corn and Corn
Improvement, 2nd Edition, Prague, G.F., (ed.), American Society of
Agronomy, Inc., Madison, WI, pp. 305, 320-323 (1977). .
Steimel, D., "Corn Breeders Stalk Perfect Hybrid", Rockford
Register Star, (Aug. 6, 1990). .
Steimel, D., "New Gun Will Custom-Design Corn: Breeding Technique
Expected by End of 90's Will Let Crop Grow Without Pesticides of
Much Water", (Apr. 1990). .
Sugiyama, M., et al., "Use of the Tyrosinase Gene from Streptomyces
to Probe Promoter Sequences for Escherichia coli", Plasmid, 23,
237-241 (1990). .
Suttie, J., et al., "Use of Different Selection Agents to Produce
Maize Transformants of an Elite Geneotype Using Microprojectile
Bombardment", Program and Abstracts, The International Society for
Plant Molecular Biology, Third International Congress, Tucson, AZ,
Abstract No. 426 (Oct. 6-11, 1991). .
Tarczynski, M.C., et al., "Expression of a Bacterial mtlD Gene in
Transgenic Tobacco Leads to Production and Accumulation of
Mannitol", Proc. Natl. Acad. Sci. USA, 89, 2600-2604 (1992). .
Tarczynski, M.C., et al., "Stress Protection of Transgenic Tobacco
by Production of the Osmolyte Mannitol", Science, 259, 508-510
(1993). .
Thompson, C., et al., "Characterization of the Herbicide-Resistance
Gene bar from Streptomyces hygroscopicus", EMBO J., 6, 2519-2523
(1987). .
Tomes, D.T., et al., Specification of U.S. Patent Application,
Serial No. 07/205,155, entitled "Stable Transformation of Plant
Cells," 1-29 (Jun. 10, 1988). .
Tomes, D.T., "Status of Corn Transformation", 26th Annual Corn
Breeders School, Meeting Proceedings, University of Illinois,
Chapaign, IL, p. 7-8 (Feb. 26-27, 1990). .
Tomes, D.T., et al., "Transgenic Tobacco Leaves", Plant Mol. Biol.,
14, 261-268 (Feb. 1990). .
Twell, D., et al., "Transient Expression of Chimeric Genes
Delivered into Pollen by Microprojectile Bombardment", Plant
Physiol., 91, 1271-1274 (1989). .
Ulian, E., et al., "Transformation of Plants via the Shoot Apex",
In Vitro Cell. Dev. Biol., 9, 951-954 (1988). .
Usami, S., et al., "Absense in Monocotyledonous Plants of the
Diffusable Plant Factors including T-DNA Circulation and vir Gene
Expression in Agrobacterium", Mol. Gen. Genet., 209, 221-226
(1987). .
Vain, P., et al., "Osomotic Pretreatment Enhances Particle
Bombardment-Mediated Transient and Stable Transformation of Maize",
Plant Cell Rep., 12, 84-88 (1993). .
Vasil, I.K., et al., "Culture of Protoplasts Isolated from
Embryogenic Cell Suspension Cultures of Sugarcane and Maize", IAPTC
Abstracts, p. 443 (1986). .
Vasil, I.K., "Transgenic Cereals Becoming a Reality",
Bio/Technology, 8, 797 (Sep. 1990). .
Vasil, V., et al., "Isolation and Maintenance of Embryonic Cell
Suspension Cultures of Gramineae", In: Cell Culture and Somatic
Cell Genetics of Plants, vol. I, Academic Press, pp. 152-158
(1984). .
Vasil, V., et al., "Plant Regeneration from Friable Embryonic
Callus and Cell Suspension Cultures of Zea mays L.", J. Plant
Physiol., 124, 399-408 (1986). .
Vasil, V., et al., "Regeneration of Plants from Embryogenic
Suspension Culture Protoplasts of Wheat (Triticum aestivum L.)",
Bio/Technology, 8, 429-434 (May 1990). .
Walbot, V., et al., "Molecular Genetics of Corn", In: Corn and Corn
Improvement, 3rd Edition, Sprague, G.F., et al. (eds.), American
Society of Agronomy, Inc., Madison, WI, pp. 389-430 (1988). .
Waldron, C., et al., "Resistance to Hygromycin B", Plant Mol.
Biol., 5, 103-108 (1985). .
Walters, D.A., et al., "Transformation and Inheritance of
Hygromycin Phosphotransferase Gene in Maize Plants", Plant Mol.
Biol., 18, 189-200, (1992). .
Wan, Y., et al., "Generation of Large Numbers of Independently
Transformed Fertile Barley Plants", Plant Physiol., 104, 37-48
(1994). .
Wang, Y., et al., "Characterization of cis-Acting Elements
Regulating Transcription from the Promoter of a Constitutively
Active Rice Actin Gene", Mol. Cell. Biol., 12, 3399-3406 (1992).
.
Wang, Y., et al., "Transient Expression of Foreign Genes in Rice,
Wheat, and Soybean Cells Following Particle Bombardment", Plant
Mol. Biol., 11, 433-439 (1988). .
Wong, E.Y., et al., "Arabidopsis thaliana Small Subunit Leader and
Transit Peptide Ehnance the Expression of Bacillus thuringiensis
Proteins in Transgenic Plants", Plant Mol. Biol., 20, 81-93 (1992).
.
Weising, K., et al., "Foreing Genes in Plants: Transfer, Structure,
Expression and Applicatioins", Ann. Rev. Genet., 22, 421-478
(1988). .
White, J., et al., "A Cassette Containing the bar Gene of
Streptomyces hygroscopicus: a Selectable Marker for Plant
Transformation", Nuc. Acids Res., 18, 1062 (1989). .
Whitely, H.R., et al., "The Molecular Biology of Parasporal Crystal
Body Formation in Bacillus thuringiensis", Ann. Rev. Microbiol.,
40, 549-576 (1986). .
Xue, Q., et al., "Genotypic Variation in Osmotic Adjustment Among
Closely Related Wheat Lines," Agronomy Abstracts, 1995 Annual
Meetings, St. Louis, MO, p. 78 (Oct. 29-Nov. 3, 1995). .
Yang, H., et al., "Production of Kanamycin Resistant Rice Tissues
Following DNA Uptake into Protoplasts", Plant Cell Rep., 7, 421-425
(1988). .
Yanisch-Perron, C., et al., "Improved M13 Phage Cloning Vectors and
Host Strains: Nucleotide Sequences of the M13mp18 and pUC19
Vectors", Gene, 33, 103-119 (1985). .
Yugari, Y., et al., "Coordinated End-Product Inhibition in Lysine
Synthesis in Escherichia coli", Biochem. Biophys. Acta, 62, 612-614
(1962). .
Abstracts, 35th Annual Maize Genetics Conference, St. Charles, IL,
p. 5, 30, 45-46, (Mar. 18-21, 1993). .
"Ciba-Geigy Joins Maize Tranformers", AGROW, No. 118, 20, (Aug. 31,
1990). .
"European Firm Devises Insect-Resistant Plants", Agricultural
Biotechnology News, 1, 6 (Mar.-Apr. 1986). .
European Patent Office, Decision T153/88 (Stahlwerke
Peine-Salzgitter/Hot strip) Issued by Technical Board of Appeal
3.3.3 on Jan. 9, 1991 (Not Published in the Official Journal):
English Translation from [1997] EPOR pp. 371 to pp. 378, 371-378
(1997). .
European Patent Office, Notice of European Publication No. and
Information on the Application of Article 67(3) EPC, for European
Patent No. 0 485 506, 1 p. (Apr. 13, 1992). .
In Vitro Cellular & Developmental Biology, 21, Program Issue:
Thirty-Sixth Annual Meeting of the Tissue Culture Association, New
Orleans, LA, 88 p., (Jun. 2-6, 1985). .
In Vitro Cellular & Developmental Biology, 23, Program Issue:
Thirty-Eighth Annaul Meeting of the Tissue Culture Association,
Washington, D.C., 93 p., (May 27-30, 1987). .
In Vitro Cellular & Developmental Biology, 24, Program Issue:
Thirty-Ninth Annual Meeting of the Tissue Culture Association, Las
Vegas, NV, 92, p., (Jun. 12-15, 1988). .
In Vitro Cellular & Developmental Biology, 25, Program Issue:
Fortieth Annual Meeting of the Tissue Culture Association, Orlando,
Fl, 73 p., (Jun. 11-14, 1989). .
In Vitro Cellular & Developmental Biology, 26, Program Issue:
Forty-First Annual Meeting of the Tissue Culture Association,
Houston, TX, 88 p., (Jun., 1990). .
In Vitro Cellular & Develomental Biology, 28, Program Issue,
1992 World Congress on Cell and Tissue Culture, Washington, D.C.,
ISSN 0883-8364, (Mar. 1992). .
"Molecular Strategies for Crop Improvement", Journal of Cellular
Biochemistry, Supplement 14e, List of Plenary and Poster Sessions,
organized by Arnitzen, C., et al., for The Keystone Conference on
Molecular Strategies for Crop Plant Improvement, held at the 19th
UCLA Symposia, 257, (1990). .
"Monsanto, DeKalb Gunning for Insect-, Disease-Resistant Corn",
Biotechnology Newswatch, 4-5 (May 7, 1990). .
Pioneer Hi-Bred International, Inc., Application Under 7 C.F.R.
340, Release of Genetically Engineered Corn Plants, Permit No.
92-212-01, CBI-Deleted, p. 11, (Nov. 16, 1992). .
"Plant Science Produces Transformed Corn", Chemical and Engineering
News, 7, (Jan. 29, 1990). .
Abbe, E.C., et al., "The Growth of the Shoot Apex in Maize:
Embryogeny", American Journal of Botany, 41, 285-293, (Apr. 1954).
.
Abe, K., et al., "Molecular Cloning of a Cysteine Proteinase
Inhibitor of Rice (Oryzacystatin)", The Journal of Biological
Chemistry, 262, 16793-16797, (Dec. 15, 1987). .
Adang, M.J., et al., "Expression of a Bacillus thuringiensis
Insecticidal Crystal Protein Gene in Tobacco Plants", Molecular
Strategies for Crop Protection, Arntizen, C.J., et al. (eds.), Alan
R. Liss, Inc., New York, 345-353, (1987). .
Al-Feel, W., et al., "Cloning of the Yeast FAS3 Gene and Primary
Structure of Yeast Acetyl-CoA Carboxylase", Proc. Natl. Acad. Sci.
USA, 89, 4534-4538, (May 1992). .
Anderson, J.M., et al., "The Encoded Primary Sequence of a Rice
Seed ADP-glucose Pyrotphosphorylase Subunit and Its Homology to the
Bacterial Enzyme", The Journal of Biological Chemistry, 264,
12238-12242, (Jul. 25, 1989). .
Anderson, P.C., et al., "Herbicide-Tolerant Mutants of Corn",
Genome, 31, 994-999, (1989). .
Angus, T.A., "Implications of Some Recent Studies of Bacillus
thuringiensis --A Personal Purview", Proceedings of the 4th
International Colloguium on Insect Pathology, College Park, MD,
183-189, (Aug. 25-28, 1970). .
Armaleo, D., et al., "Biolistic Nuclear Nuclear Transformation of
Saccharomyces cerevisiae and Other Fungi", Curr. Genet., 17,
97-103, (1990). .
Armstrong, C.L., et al., "Developmental and Availability of
Germplasm with High Type II Culture Formation Response", Maize
Genetics Cooperation Newsletter, 65, 92-93, (Mar. 1, 1991). .
Arondel, V., et al., "Map-Based Cloning of a Gene Controlling
Omega-3 Fatty Acid Desaturation in Arabidopsis", Science, 258,
1353-1355, (Nov. 20, 1992). .
Aronson, A.I., et al., "Bacillus thuringiensis and Related Insect
Pathogens", Microbiological Reviews, 50, 1-24, (Mar. 1986). .
Aronson, J.N., et al., "Toxic Trypsin Digest Fragment from the
Bacillus thuringiensis Parasporal Protein", Applied and
Environmental Microbiology, 53, 416-421, (Feb. 1987). .
Bartels, D., et al., "An ABA and GA Modulated Gene Expressed in the
Barley Embryo Encodes an Aldose Reductase Related Protei", EMBO
Journal, 10, 1037-1043, (May 1991). .
Bartley, G.E., et al., "Molecular Cloning and Expression in
Photosynhtetic Bacteria of a Soybean cDNA Coding for Phytoene
Desaturase, an Enzyme of the Carotenoid Biosynthesis Pathway", Pro.
Natl. Acad. Sci. USA, 88, 6532-6536, (Aug. 1991). .
Barton, K.A., et al., "Bacillus thuringiensis .delta.-Endotoxin
Expressed in Transgenic Nicotania tabacum Provides Resistance to
Lepidopteran Insects", Plant Physiol., 85, 1103-1109, (1987). .
Barton, K.A., et al., "Production of Bacillus thuringiensis
Insectidcidal Proteins in Plants", Transgenic Plants, vol. 1, Kung,
S.-D., et al., (eds.), Academica Press, Inc., San Diego, CA,
297-315, (1993). .
Birk, Y., et al., "Separation of a Tribolium-Protease Inhibitor
from Soybeans on a Calcium Phosphate Column", Biochem. Biophys.
Acta, 67, 326-328, (Feb. 12, 1963). .
Bishop, D.H., et al., "Genetically Engineered Viral Insecticides--A
Progress Report 1986-1989", Pestic. Sci., 27, 173-189, (1989).
.
Bol, J.F., et al., "Plant Pathogenesis-Related Proteins Induced by
Virus Inection", Annu. Rev. Phytopathol., 28, 113-138, (1990).
.
Bowler, C., et al., "Superoxide Dismutase and Stress Tolerance",
Annu. Rev. Plant Physiol. Plant Mol. Biol., 43, 83-116, (1992).
.
Boylan-Pett, W., et al., "Effectiveness of Bacillus
thuringiensis-Transgenic Potato Plants for Control of Colorado
Potato Beeltes, 1991", Insecticide & Acaricide Tests: 1992, 17,
124-125, (1992). .
Boynton, J.E., et al., "Chloroplast Transformation in Chlamydomonas
with High Velocity Microprojectiles", Science, 240, 1534-1537,
(Jun. 10, 1988). .
Bryant, J.A., "At Last: Transgenic Cereal Plants from Genetically
Engineered Protoplasts", Trends in Biotechnology, 6, 291-292, (Dec.
1988). .
Burgerjon, A., et al., "Industrial and International
Standardization of Microbial Pesticides--I. Bacillus
thuringiensis", Entomophaga, 22, 121-129, (1977). .
Busvine, J.R., A Critical Review of the Techniques for Testing
Insecticides, Table of Contents, Commonwealth Agricultural Bureaux,
Slough, England, iii-xi, (1971). .
Bytebier, B., et al., "T-DNA Organization in Tumor Cultures and
Transgenic Plants of the Monocotyledon Asparagus officinalis",
Proc. Natl. Acad. Sci. USA, 84, 5345-5349, (Aug. 1987). .
Calabrese, D.M., et al., "A Comparison of Protein Crystal Subunit
Sizes in Bacillus thuringiensis", Canadian Journal of Microbiology,
26, 1006-1010,, (Aug. 1980). .
Caplan, A., et al., "Introduction of Genetic Material into Plant
Cells", Science, 222, 815-821, (Nov. 18, 1983). .
Carozzi, N.B., et al., "Expression of a Chimeric CaMV 35S Bacillus
thuringiensis Insecticidal Protein Gene in Transgenic Tobacco",
Plant Molecular Biology, 20, 539-548, (1992). .
Chaleff, R.S., "Induction, Maintenance, and Differentiation of Rice
Callus Cultures on Ammonium as Sole Nitrogen Source", Plant Cell
Tissue Organ Culture, 2, 29-37, (1983). .
Christou, P., et al., "Inheritance and Expression of Foreign Genes
in Transgenic Soybean Plants", Proc. Natl. Acad. Sci. USA, 86,
7500-7504, (Oct. 1989). .
Christou, P., et al., "Production of Transgenic Rice (Oryza sativa
L.) Plants from Agronomically Important Indica and Japonica
Varieties via Electric Discharge Particle Acceleration of Exogenous
DNA into Immature Zygotic Embryos", Bio/Technology, 9, 957-962,
(Oct. 1991). .
Cooksey, K.E., "Purification of a Protein from Bacillus
thuriniensis Toxic to Larvae of Lepidoptera", Biochem. J., 106,
445-454, (1968). .
De Block, M., et al., "Expression of Foreign Genes in Regenerated
Plants and Their Progeny", EMBO J., 3, 1681-1689, (1984). .
De Block, M., et al., "The Use of Phosphinothricin Resistance as a
Selectable Marker in Tobacco Protoplast Transformation", In:
Progress in Plant Protoplast Research, Proceedings of the 7th
International Protoplast Symposium, Wageningen, The Netherlands,
Puite, K.J., et al., (eds.), Kluwer Academic Publishers, Dordrecht,
389-390, (Dec. 6-11, 1987). .
Denecke, J., et al., "Quantification of Transient Expression Levels
of Genes Transferred to Plant Protoplasts by Electroporation",
Progress in Plant Protoplast Research, Puite, K.J., et al., (eds.),
Proceedings of the 7th International Protoplast Symposium,
Wageningen, The Netherlands, 337-338, (Dec. 6-11, 1987). .
Denholm, I., et al., "Tactics for Managing Pesticide Resistance in
Arthropods: Theory and Practice", Annu. Rev. Entomol., 37, 91-112,
(1992). .
Depicker, A.G., et al., "A Negative Selection Scheme for Tobacco
Protoplast-Derived Cells Expressing the T-DNA Gene 2", Plant Cell
Reports, 7, 63-66, (1988). .
Domoney, C., et al., "Cloning and Characterization of Complementary
DNA for Convicilin, a Major Seed Storage Protein in Pisum sativum
L.", Planta, 159, 446-453, (1983). .
Duncan, D.R., et al., "The Production of Callus Capable of Plant
Regeneration for Immature Embryos of Numerous Zea Mays Genotypes",
Planta, 165, 322-332, (1985). .
Dunder, E., et al., "High Frequency Transformation of Maize by
Microprojectile Bombardment of Immature Embryos", Abstracts, 35
Annual Maize Genetics Conference, St. Charles, IL, Poster No. 16,
p. 30, (Mar. 18-21, 1993). .
Dunder, E., et al., "Transgenic Anthocyanin Color Phenotypes
Produced in Callus, Plants and Progeny of Maize", Abstracts, 35th
Annual Maize Genetics Conference, St. Charles, IL, Poster No. 15,
p. 30, (Mar. 18-31, 1993). .
Dunleavy, J.M., "Curtobacterium planatarum sp. nov. is Ubiquitous
in Plant Leaves and Is Seed Transmitted in Soybean and Corn",
International Journal of Systemic Bacteriology, 39, 240-249, (Jul.
1989). .
Dunn, G.M., et al., "Inheritance of Cyclic Hydroxamates in Zea mays
L.", Can. J. Plant Sci., 61, 583-593, (Jul. 1981). .
Dure III, L., et al., "Common Amino Acid Sequence Domains Among the
LEA Proteins of Higher Plants", Plant Molecular Biology, 12,
475-486, (1989). .
Dybvig, K., et al., "Transposition of Gram-Positive Transposon
Tn916 in Acholeplasma laidlawii and Mycoplasma pulmonis", Science,
235, 1392-1394, (Mar. 13, 1987). .
Edallo, S., et al., "Chromosomal Variation and Frequency of
Spontaneous Mutation Associated with in vitro Culture and Plant
Regeneration in Maize", Maydica, 26, 39-56, (1981). .
Fast, P.G., et al., "Bacillus thuringiensis .delta.-Endotoxin:
Evidence that Toxin Acts at the Surface of Susceptible Cells",
Experientia, 34, 762-763, (1978). .
Faust, R.M., et al., "Bacteria and Their Toxins as Insecticides",
In: Microbial and Viral Pesticides, Kurstak, E., (ed.), Marcel
Dekker, Inc., New York, 75-208, (1982). .
Finkle, B.J., et al., "Growth and Regeneration of Alfalfa Callus
Lines After Freezing in Liquid Nitrogen", Plant Science, 42,
133-140, (1985). .
Finney, D.J., In: Probit Analysis: A Statistical Treatment of the
Sigmoid Response Curve, Table of Contents, 3 p. (1952). .
Fischoff, D.A., et al., "Insect Tolerant Transgenic Tomato Plants",
Bio/technology, 5, 807-812, (1987). .
Fisher, D.K., et al., "Starch Branching Enzyme II from Maize
Endosperm", Plant Physiol., 102, 1045-1046, (1993). .
Fromm, M., et al., "Transient Expression and Stable Transformation
of Maize Using Microprojectiles", In: Plant Molecular Biology, vol.
2, Herrmann, R.G., et al., (eds.), Plenum Press, New York, 219,
(1991). .
Fukuto, T.R., "Physicochemical Aspects of Insecticidal Action", In:
Insecticidal Biochemistry and Physiology, Wilkinson, C.F., (ed.),
Plenum Press, New York, 397-428, (1976). .
Gallagher, S., "Progress and Promise of the Particle Gun", Ag
Biotechnology News, 6, 12-13, (Mar.-Apr. 1989). .
Gallie, D.R., et al., "The 5'-leader Sequence of Tobacco Mosaic
Virus RNA Enhances the Expression of Foreign Gene Transcripts In
Vitro and in Vivo", Nucleic Acids Research, 15, 3257-3273, (1987).
.
Gatehouse, A.M., et al., "Assessment of the Antimetabolic Effects
of Trypsin Inhibitors from Cowpea (Vigna unguiculata) and Other
Legumes on Development of the Bruchid Beetle Collosobruchus
maculatus", J. Sci. Food Agric., 34, 345-350, (1983). .
Genovesi, A.D., et al., "Embryogenesis in Callus Derived from Rice
Microspores", Plant Cell Reports, 1, 257-260, (1982). .
Georghiou, G.P., et al., "Factors Influencing the Evolution of
Resistance", In: Pesticide Resistance: Strategies and Tactics for
Management, Committee on Strategies for the Management of Pesticide
Resistant Pest Populations, Board on Agricultural, National
Research Council, National Academy Press, Washington, D.C.,
157-169, (1986). .
Gepts, P., et al., "Enhanced Available Methionine Concentration
Associated with Higher Phaseolin Levels in Common Bean Seeds",
Theor. Appl. Genet., 69, 47-53, (1984). .
Gerlach, W.L., "Genetic Engineering: Its Place in Plant Breeding",
In: Plant Breeding and Genetic Engineering, Zakri, A.H., (ed.),
Society for the Advancement of Breeding Researches in Asia and
Oceania, Bangi, Malaysia, 269-277, (1988). .
Goff, S. A., et al., "Transactivation of Anthocyanin Biosynthetic
Genes Following Transfer of B Regulatory Genes into Maize Tissues,"
EMBO Journal, 9, 2517-2522 (1990). .
Goldburg, R.J., et al., "Are B.T.K. Plants Really Safe to Eat?",
Bio/Technology, 8, 1011-1015, (Nov. 1990). .
Goldfarb, B., et al., "Transient Expression of
Microprojectile-Introduced DNA in Doublas-Fir", J. Cell. Biochem.,
Suppl. 0 (13 Par D), Abstract No. M 121, p. 259, (Apr. 1-7, 1989).
.
Goldman, S.L., et al., "Transformation of Zea mays by Agrobacterium
tumefaciens: Evidence for Stable Genetic Alterations", Journal of
Cellular Biochemistry, 11B, Abstract No. F 202, p. 26, (1987).
.
Gordon, P.N., et al., "Plant Regeneration from Tissue Cultures of
Maize", Maize Genetics Cooperation Newsletter, 51, 79-80, (Mar. 1,
1977). .
Gordon-Kamm, W.J., et al., "Transformation of Maize Cells and
Regeneration of Fertile Transgenic Plants", The Plant Cell, 2,
603-618, (Jul. 1990). .
Gordon-Kamm, W.J., et al., "Transformation of Maize Using
Microprojectile Bombardment: An Update and Perspective", In Vitro
Cellular and Developmental Biology, 21, 21-27, (Jan. 1991). .
Green, C.E., "New Developments in Plant Tissue Culture and Plant
Regeneration", In: Basic Biology of New Developments in
Biotechnology, Hollaender, A., et al., (eds.), Plenum Press, New
York, 195-209, (1983). .
Green, C.E., "Somatic Embryogenesis and Plant Regeneration from the
Friable Callus of Zea mays", Proceedings of the 5th International
Congress on Plant Tissue & Cell Culture, Tokyo, Japan, 107-108,
(1982). .
Guerrero, F.D., et al., "Turgor-Responsive Gene Transcription and
RNA Levels Increase Rapidly When Pea Shoots are Wilted. Sequence
and Expression of Three Inducible Genes", Plant Mol. Biol., 15,
11-26, (1990). .
Gupta, A.S., et al., "Increased Resistance to Oxidative Stress in
Transgenic Plants that Overexpress Chloroplastic Cu/Zn Superoxide
Dismutase", Proc. Natl. Acad. Sci. USA, 90, 1629-1633, (Feb. 1993).
.
Haccius, B., "Question of Unicellular Origin of Non-Zygotic Embryos
in Callus Cultures", Phytomorphology, 28, 74-81, (1978). .
Hallborn, J., et al., "Xylitol Production By Recombinant
Saccharomyces Cerevisiae", Bio/Technology, 9, 1090-1095, (Nov.
1991). .
Harms, C.T., et al., "Regeneration of Plantlets from Callus
Cultures of Zea mays L.", Z. Ptlanzenzuchtg. 77, 347-351, (1976).
.
Hartree, E.F., "Determination of Protein: A Modification of the
Lowry Method that Gives a Linear Photometric Response", Analytical
Biochemistry, 48, 422-427, (1972). .
Harvey, W.R., et al., "Potassium Ion Transport ATPase in Insect
Epithelia", J. Exp. Biol., 106, 91-117, (1983). .
Heimpel, A.M., et al., "Recent Advances in the Knowledge of Some
Bacterial Pathogens of Insects", Proceedings of the Tenth
International Congress of Entomology, vol. 4, 711-722, (1956).
.
Heimpel, A.M., et al., "The Site of Action of Crystalliferous
Bacteria in Lepidoptera Larvae", Journal of Insect Pathology, 1,
152-170 (1959). .
Hernalsteens, J.P., et al., "An Agrobacterium-Transformed Cell
Culture from the Monocot Asparagus Officinalis", The EMBO Journal,
3, 3039-3041, (Dec. 1984). .
Hibberd, K.A., "Induction, Selection, and Characterization of
Mutants in Maize Cell Cultures", In: Cell Culture and Somatic Cell
Genetics of Plants, vol. 1, Vasil, I.K., (ed.), Academic Press,
Inc., Orlando, FL, 571-576, (1984). .
Hickle, L.A., et al., "Analytical Chemistry of Bacillus
thuringiensis: An Overview", In: Analytical Chemistry of Bacillus
thuringiensis, Hickle, L.A., et al., (eds.), Developed from a
Symposium Sponsored by the Division of Agrochemicals at the 198th
National Meeting of te American Chemical Society, Miami Beach, FL,
vii-ix, 1-8, (Se. 10-15, 1989). .
Hilder, V.A., et al., "A Novel Mechanism of Insect Resistance
Engineered into Tobacco", Nature, 330, 160-163, (Nov. 12, 1987).
.
Hodges, T.K., et al., "Genotype Specificity of Somatic
Embryogenesis and Regeneration in Maize", Bio/technology, 4,
219-223, (Mar. 1986). .
Hodges, T.K., et al., "Regeneration of Maize", In: Biotechnology in
Plant Science, Zaitlin, M., et al., (ed.), Academic Press, Inc.,
Orlando, FL, 15-33, (1985). .
Hoekema, A., et al., "Codon Replacement in the PGK1 Gene of
Saccharomyces cerevisiae: Experimental Approach to Study the Role
of Biased Codon Usage in Gene Expression", Molecular and Cellular
Biology, 7, 2914-2924, (Aug. 1987). .
Hofmann, C., et al., "Binding of the Delta Endotoxin from Bacillus
thuringiensis to Brush-Border Membrane Vesicles of the Cabbage
Butterfly (Pieris Brassicae)", Eur. J. Biochem., 173, 85-91,
(1988). .
Hofmann, C., et al., "Specificity of Bacillus thuringiensis
.delta.-Endotoxins is Correlated with the Presence of High-Affinity
Binding Sites in the Brush Border Membranes of Target Insect
Midguts", Proc. Natl. Acad. Sci., USA, 85, 7844-7848, (Nov. 1988).
.
Hofte, H., et al., "Monoclonal Antibody Analysis and Insecticidal
Spectrum of Three Types of Lepidopteran-Specific Insecticidal
Crystal Proteins of Bacillus thuriniensis", Applied and
Environmental Microbiology, 54, 2010-2017, (Aug. 1988). .
Hofte, H., et al., "Structural and Functional Analysis of a Cloned
Delta Endotoxin of Bacillus thuriniensis berliner 1715", Eur. J.
Biochem., 161, 273-280, (1986). .
Hollingworth, R.M., "The Biochemical and Physiological Basis of
Selective Toxicity", In: Insecticidal Biochemistry and Physiology,
Wilkinson, C.F., (ed.), Plenum Press, New York, 431-506, (1976).
.
Hong, B., et al., "Cloning and Characterization of cDNA Encoding a
mRNA Rapidly-Induced by ABA in Barley Aleurone Layers", Plant
Molecular Biology, 11, 495-506, (1988). .
Horsch, R.B., et al., "A Simple and General Method for Transferring
Genes into Plants", Science, 227, 1229-1231, (Mar. 8, 1985). .
Hu, N.T., et al., "Primary Structure of a Genomic Zein Sequence of
Maize", The EMBO Journal, 1, 1337-1342, (1982). .
Huber, H.E., et al., "Bacillus thuringiensis delta-Endotoxin:
Composition and Activation", In: Pathogenesis of Invertebrate
Microbial Diseases, Davidson, E.W., (ed.), Allanheld, Osmun &
Co. Publishers, Inc., Totowa, NJ, 209-234, (1981). .
Huber-Lukac, M., et al., "Characterization of Monoclonal Antibodies
to a Crystal Protein of Bacillus thuringiensis subsp. kustaki",
Infection and Immunity, 54, 228-232, (Oct. 1986). .
Imbrie-Milligan, C.W., et al., "Microcallus Formation from Maize
Protoplasts Prepared from Embryogenic Callus", Planta, 168,
395-401, (1986). .
Jarrett, P., "Potency Factors in the .delta.-Endotoxin of Bacillus
thuringiensis var. aizawi and the Significance of Plasmids in their
Control", Journal of Applied Bacteriology, 58, 437-448, (1985).
.
Jaworski, J.G., et al., "A Cerulenin Insensitive Short Chain
3-Ketoacyl-Acyl Carrier Protein Synthase in Spinacia oleracea
Leaves", Plant Physiol., 90, 41-44, (1989). .
Johnson, D.E., "Toxicity of Bacillus thuringiensis Entomocidal
Protein Toward Cultured Insect Tissue", Journal of Invertebrate
Pathology, 38, 94-101, (1981). .
Josefsson, L.G., et al., "Structure of a Gene Encoding the 1.7 S
Storage Protein, Napin, from Brassica napus", The Journal of
Biological Chemistry, 262, 12196-12201, (Sep. 5, 1987). .
Kaasen, I., et al., "Molecular Cloning and Physical Mapping of the
otsBA Genes, Which Encode the Osmoregulatory Trehalose Pathway of
Escherichia coli: Evidence that Transcrpition is Activated by KatF
(AppR)", Journal of Bacteriology, 174, 889-898, (Feb. 1992). .
Kim, C.S., et al., "Improvement of Nutritional Value and Functional
Properties of Soybean Glycinin by Protein Engineering", Protein
Engineering, 3, 725-731, (1990). .
King, P., et al., "Maize", In: Handbook of Plant Cell Culture, vol.
2, Sharp, W.R., et al., (eds.), Macmillan Publishing Company, New
York, 69-91, (1984). .
Klein, T.M., et al., "Advances in Direct Gene Transfer into
Cereals", In: Genetic Engineering: Principles and Methods, vol. 11,
Setlow, J.K., (ed.), Plenum Publishing Corp., New York, 13-31,
(1989). .
Klein, T.M., et al., "Particle Bombardment: A Universal Approach
for Gene Transfer to Cells and Tissues", Current Opinion in
Biotechnology, 4, 583-590, (1993). .
Klein, T.M., et al., "Particle Gun Technology: A Novel Method for
the Introduction of DNA into Living Cells", Program and Abstracts
for an International Symposium: "Biotechnology in Plant Science:
Relevance to Agriculture in the Eighties", Poster, #28, Ithaca, NY,
25, (Jun. 23-27, 1985). .
Klein, T.M., et al., "Stable Genetic Transformation of Intact
Nicotiana Cells by the Particle Bombardment Process", Proc. Natl.
Acad. Sci. USA, 95, 5502-5505, (Nov. 1988). .
Klein, T.M., et al., "Transformation of Microbes, Plants and
Animals by Particle Bombardment", Biotechnology, 10, 286-291, (Mar.
1992). .
Knight, M.R., et al., "Transgenic Plant Aequorin Reports the
Effects of Touch and Cold-Shock and Elicitors on Cytoplasm
Calcium", Nature, 352, 524-526, (Aug. 8, 1991). .
Knowles, B.H., et al., "Characterization and Partial Purification
of a Plasma Membrane Receptor for Bacillus thuringiensis Kurstaki
Lepidopteran-Specific .delta.-Endotoxin", J. Cell. Sci., 83,
89-101, (1986). .
Knowles, B.H., et al., "Lectin-Like Binding of Bacillus
thuringiensis var. kurstaki Lepidopteran-Specific Toxin is an
Initial Step in Insecticidal Action", FEBS Letters, 168, 197-202,
(Mar. 1984). .
Konomowics, H., et al., "Subdomains of the Octopine Synthase
Upstream Activating Element Direct Cell-Specific Expression in
Transgenic Tobacco Plants", The Plan Cell, 4, 17-27, (Jan. 1992).
.
Kriz, A.L., et al., "Characterization of the Maize Globulin-2 Gene
and Analysis of Two Null Alleles", Biochemical Genetics, 29,
241-254, (1991). .
Lamark, T., et al., "DNA Sequence and Analysis of the bet Genes
Encoding the Osmoregulatory Choline-Glycine Betaine Pathway of
Escherichia coli", Molecular Microbiology, 5, 1049-1064, (1991).
.
Lamppa, G., et al., "Analysis of Two Linked Genes Coding for the
Acyl Carrier Protein (ACP) from Arabidopsis thaliana (Columbia)",
Plant Molecular Biology, 16, 469-474, (1991). .
Langridge, W.H., et al., "Electric Field Mediated DNA
Transformation in Plant Protoplasts", Program and Abstracts for an
International Symposium: "Biotechnology in Plant Science: Relevance
to Agriculture in the Eighties", Ithaca, NY, Poster #30, p. 25,
(Jun. 23-27, 1985). .
Larkins, B.A., et al., "Modification of Maize-Seed Protein
Quality", Am. J. Clin. Nutr., 58, 264S-269S, (1993). .
Leason, M., et al., "Inhibition of Pea Leaf Glutamine Synthetase by
Methionine Sulphoximine, Phosphinothricin and Other Glutamate
Analogues", Biochemistry, 21, 855-857, (1982). .
Lee, B., "Cereal Transformation", Plants Today, 9-11, (Jan.-Feb.
1989). .
Lin, F.F., et al., "Transformation and Analysis of Inducible PAL
Genes in Potato", In Vitro Cellular and Developmental Biology, 28,
Abstract No. P-1129, p. 123A, (Mar. 1992). .
Lorz, H., et al., "Gene Transfer to Cereal Cells Mediated by
Protoplast Transformation", Mol. Gen. Genet., 199, 178-182, (1985).
.
Lowe, K., et al., "Plant Regeneration via Organogenesis and
Embryogenesis in the Maize Inbred Line B73", Plant Science, 41,
125-132, (1985). .
Luckow, V.A., et al., "Trends in the Development of Baculovirus
Expression Vectors", Bio/Technology, 6, 47-55, (Jan. 1988). .
Luthy, P., "Insecticidal Toxins of Bacillus thuringiensis", FEMS
Microbiology Letters, 8, 1-7, (1980). .
Mackey, C.J., et al., "Transgenic Maize", In: Transgenic Plants,
vol. 2, Kung, S.-D., et al., (eds.), Academic Press, Inc., 21-33,
(Oct. 1992). .
Malan, C., et al., "Correlation Between CuZn Superoxide Dismutase
and Glutathione Reductase, and Environmental and Xenobiotic Stress
Tolerance in Maize Inbreds", Plant Science, 69, 157-166, (1990).
.
Mangano, M.L., et al., "Long-Term Cold Storage of Regenerable Maize
Callus", In Vitro Cellular and Developmental Biology, 25, Abstract
No. 224, p. 66A, (Mar. 1989). .
Mariani, T., et al., "The Production and Analysis of
Genetically-Engineered Male-Sterile Plants of Maize", Abstracts,
35th Annual Maize Genetics Conference, St. Charles, IL, Poster No.
46, p. 45, (Mar. 18-21, 1993). .
Marks, M.D., et al., "Nucleotide Sequence Analysis of Zein mRNAs
from Maize Endosperm", The Journal of Biological Chemistry, 260,
16451-16459, (Dec. 25, 1985). .
Martens, J.W., et al., "Insecticidal Activity of a Bacterial
Crystal Protein Expressed by a Recombinant Baculovirus in Insect
Cells", Applied and Environmental Microbiology, 56, 2764-2770,
(Sep. 1990). .
Matthews, B.F., et al., "Nutritional Improvement of the Aspartate
Family of Amino Acids in Edible Crop Plants", Amino Acids, 4,
21-34, (1993). .
McElroy, D., et al., "Isolation of an Efficient Actin Promoter for
Use in Rice Transformation", The Plant Cell, 2, 163-171, (Feb.
1990). .
Merryweather, A.T., et al., "Construction of Genetically Engineered
Baculovirus Insecticides Containing the Bacillus thuringiensis
subsp. kurstaki HD-73 Delta Endotoxin", Journal of General
Virology, 71, 1535-1544, (1990). .
Mikula, B.C., "Programming Heritable Epigenetic Change in Gene
Expression with Temperature and Light", Abstracts, 35th Annual
Maize Genetics Conference, St. Charles, IL, p. 5, (Mar. 18-21,
1993). .
Mink, G.I., "Pollen- and Seed-Transmitted Viruses and Viroids",
Annu. Rev. Phytopathol., 31, 375-402, (1993). .
Molnar, S.J., et al., "Initiation of Totipoten Tissue Cultures from
Undeveloped Axillary and Secondary Ears", Maize Genetics
Cooperation Newsletter, 54, 52-53, (Mar. 31, 1980). .
Montoliu, L., et al., "A Tandem of .delta.-Tubulin Genes
Preferentially Expressed in Radicular Tissues from Zea mays", Plant
Molecular Biology, 14, 1-15, (1989). .
Morris, G.D., "Ciba-Geigy Enters the $1.5-Billion/Year Corn Biotech
Race", Chemical Week, (Sep. 12, 1990). .
Mundy, J., et al., "Abscisic Acid and Water-Stress Induce the
Expression of a Novel Rice Gene", The EMBO Journal, 7, 2279-2286,
(1988). .
Mundy, J., et al., "Selective Expression of a Probable
Amylase/Protease Inhibitor in Barley Aleurone Cells: Comparison to
the Barley Amylase/Subtilisin Inhibitor", Planta, 169, 51-63,
(1986). .
Murphy, D.W., et al., "Bacillus thuringiensis Enzyme-Digested Delta
Endotoxin: Effect on Cultured Insect Cells", Science, 194, 954-956,
(Nov. 26, 1976). .
Murray, E.E., et al., "Analysis of Unstable RNA Transcripts of
Insecticidal Crystal Protein Genes of Bacillus thuringiensis in
Transgenic Plants and Electroporated Protoplasts", Plant Molecular
Biology, 16, 1035-1050, (1991). .
Nishida, I., et al., "The Gene and the RNA for the Precursor to the
Plastid-Located Glycerol-3-phosphate Acyltransferase of Arabidopsis
thaliana", Plant Molecular Biology, 21, 267-277, (1993). .
Nishiitsutsuji-Uwo, J., et al., "Mode of Action of Bacillus
thuringiensis .delta.-Endotoxin: Effect on TN-368 Cells", Journal
of Invertebrate Pathology, 34, 267-275, (1979). .
O'Reilly, D.R., et al., "A Baculovirus Blocks Insect Molting by
Producing Ecdysteroid UDP-Glucosyl Transferase", Science, 245,
1110-1112, (Sep. 8, 1989). .
Ochatt, S.J., et al., "Selection for Salt/Drought Tolerance Using
Isolated Protoplasts and Protoplast-Derived Calli for Colt Cherry
(Prunus avium X pseudocerasus)", In: Progress in Plant Protoplast
Research, Puite, K.J., et al., (eds.), Kluwer Academic Publishers,
Dordrecht, The Netherlands, 391-392, (1988). .
Oeda, K., et al., "Formation of Crystals of the Insecticidal
Proteins of Bacillus thuringiensis subsp. aizawai IPL7 in
Escherichia coli", Journal of Bacteriology, 171, 3568-3571, (Jun.
1989). .
Pang, Y., et al., "Synthesis and Toxicity of Full-Length and
Truncated Bacterial CryIVD Mosquitocidal Proteins Expressed in
Lepidopteran Cells Using a Baculovirus Vector", Journal of General
Virology, 73, 89-101, (1992). .
Park, W.D., et al., "High-Level, Sucrose-Inducible Expression of a
Chimeric Patatin-GUS Gene In Leaf Explants of Transgenic Tobacco
Plants", Journal of Cellular Biochemistry, 13D, Abstract No. M 343,
p. 310, (Mar. 27-Apr. 7, 1989). .
Perlak, F.J., et al., "Expression of Bacillus thuringiensis
Proteins in Transgenic Plants", In: Biotechnology, Biological
Pesticides and Novel Plant-Pest Resistance for Insect Pest
Management, Roberts, D.W., et al., (eds.), Insect Pathology
Resource Center, Boyce Thompson Institute for Plant Research,
Cornel University, Ithaca, NY, 77-81, (1988). .
Perlak, F.J., et al., "Genetically Improved Potatoes: Protection
from Damage by Colorado Potato Beetles", Plant Molecular Biology,
22, 313-321, (1993). .
Perlak, F.J., et al., "Insect Resistant Cotton Plants",
Bio/Technology, 8, 939-943, (Oct. 1990). .
Piatkowski, D., et al., "Characterization of Five Abscisic
Acid-Responsive cDNA Clones Isolated from the Desiccation-Tolerant
Plant Craterostigma plantagineum and Their Relationship to Other
Water-Stress Genes", Plant Physiology, 94, 1682-1688, (Jun. 1990).
.
Poehlman, J.M., et al., In: Breeding Field Crops, 3rd Edition, AVI
Publishing Company, Inc., Westport, CT, 149-152, (1987). .
Poethig, R.S., "Maize--The Plant and Its Parts", In: Maize for
Biological Research, Sheridan, W.F., (ed.), Plant Molecular Biology
Association., Charlottesville, VA, 9-18, (1982). .
Porobo-Dessai, A., et al., "Expression of gusA Gene with an Intron
in Sweet Potato and Garden Egg Plant", In Vitro and Developmental
Biology, 13D, Abstract No. P-1130, 123A, (Mar. 1992). .
Potrykus, I., et al., "Direct Gene Transfer: State of the Art and
Future Potential", Plant Molecular Biology Reporter, 3, 117-128,
(Summer 1985). .
Raineri, D.M., et al., "VirA, the Plant-Signal Receptor, is
Responsible for the Ti Plasmid-Specific Transfer of DNA to Maize by
Agrobacterium", Proc. Natl. Acad. Sci. USA, 90, 3549-3553, (Apr.
1993). .
Randolph, L.F., et al., "Developmental Morphology of the Caryopsis
in Maize", Journal of Agricultural Research, 53, 881-916, (Dec. 15,
1936). .
Rhodes, C.A., et al., "Cytogenetic Stability of Aneuploid Maize
Tissue Cultures", Can. J. Genet. Cytol., 28, 374-384, (1986). .
Rhodes, C.A., et al., "Factors Affecting Tissue Culture Initiation
from Maize Tassels", Plant Science, 46, 225-232, (1986). .
Rice, T.B., "Tissue Culture Induced Genetic Variation in
Regenerated Maize Inbreds", Proceedings of the 37th Annual Corn
& Sorghum Industry Research Conference, 148-162, (1982). .
Rosahl, S., et al., "Expression of a Tuber-Specific Storage Protein
In Transgenic Tobacco Plants: Demonstration Of An Esterase
Activity", EMBO J, 6, Press Limited, Oxford, England, 1155, (1987).
.
Roth, B.A., et al., "C1- and R-Dependent Expression of the Maize
Bzl Gene Requires Sequences with Homology to Mammalian myb and myc
Binding Sites", The Plant Cell, 3, 317-325, (Mar. 1991). .
Roth, B.A., et al., "Genetic Regulation of Transient Expression of
Maize Anthocyanin Pathway Genes Introduced into Intact Maize
Tissues by Microprojectile Bombardment", Journal of Cellular
Biochemistry, 13D, Abstract No. M 344, 310, (Mar. 27-Apr. 7, 1989).
.
Roush, R.T., et al., "Ecological Genetics of Insecticidal and
Acaricide Resistance", Ann. Rev. Entomol., 32, 361-380, (1987).
.
Russell, J.A., et al., "Physical Trauma and Tungsten Toxicity
Reduce the Efficiency of Biolistic Transformation", Plant Physiol.,
98, 1050-1056, (1992). .
Ryan, A.J., et al., "The Expression of the Napin Gene Under the
Control of Its Own Promoter in Transgenic Tobacco Plants", Journal
of Cellular Biochemistry, 13D, Abstract No. M 345, p. 310, (Mar.
27-Apr. 7, 1989). .
Sanford, J.C., "The Biolistic Process", Plant Physiology, 89,
Abstract No. 9, 2, (Apr. 1989). .
Sanford, J.C., et al., "Delivery of DNA into Regenerable Tissues of
Monocots, Using High-Velocity Microprojectiles", Grant Application
No. 86-0183, United States Department of Agriculture, Science and
Education, 48, p., (Feb. 27, 1986). .
Sass, J.E., "Comparative Leaf Number in the Embryos of Some Types
of Maize", Iowa State Coll. J. Sci., 25, 509-512, (1951). .
Schafer, W., et al., "T-DNA Integration and Expression in a Monocot
Crop Plant after Induction of Agrobacterium", Nature, 327, 529-532,
(Jun. 11, 1987). .
Schardl, C.L., et al., "Design and Construction of a Versatile
System for the Expression of Foreign Genes in Plants", Gene, 61,
1-11, (1987). .
Schnepf, H.E., et al., "Delineation of a Toxin-Encoding Segment of
a Bacillus thuringiensis Crystal Protein Gene", The Journal of
Biological Chemistry, 260, 6273-6280, (1985). .
Schnepf, H.E., et al., "Specificity-Determining Regions of a
Lepidopteran-Specific Insecticidal Protein Produced by Bacillus
thuringiensis", The Journal of Biological Chemistry, 265,
20923-20930, (Dec. 5, 1990). .
Sewell, G.H., et al., "Irish Potato, Control of Potato-Eating
Aphids, 1991", Insecticidal and Acaricide Tests: 1992, 17, 138,
(1992). .
Sewell, G.H., et al., "Transgenic Potato Plants, Control of
Colorado Potato Beetle, 1991", Insecticidal and Acaricide Tests:
1992, 17, 138-139, (1992). .
Shaner, D.L., et al., "Mechanism of Action of the Imidazolinones
and Cell Culture Selection of Tolerant Maize", In: Biotechnology in
Plant Sciences, Zaitlin, M., et al., (eds.), Academic Press,
Orlando, FL, 287-299, (1985). .
Sharman, B.C., "Developmental Anatomy of the Shoot of Zea mays L.",
Annals of Botany, VI, 246-281, (Apr. 1942). .
Shields, R., "Towards Insect-Resistant Plants", Nature, 328, 12-13,
(Jul. 2, 1987). .
Shivakumar, A.G., et al., "Vegetative Expression of the
.delta.-Endotoxin Genes of Bacillus thuringiensis subsp. in
Bacillus subtilis", Journal of Bacteriology, 166, 194-204, (Apr.
1986). .
Shotwell, M.A., et al., "Analysis of Seed Storage Protein Genes of
Oats", The Journal of Biological Chemistry, 265, 9652-9658, (Jun.
15, 1990). .
Smith, G.E., et al., "Molecular Engineering of the Autographa
californica Nuclear Polyhedrosis Virus Genome: Deletion Mutations
Within the Polyhedrin Gene", Journal of Virology, 46, 584-593, (May
1983). .
Smith, I.K., et al., "Properties and Functions of Glutathione
Reductase in Plants", Physiol. Plant., 77, 449-456, (1989). .
Sorenson, K.A., et al., "Colorado Potato Beetle Control with
Bioinsecticides, 1991", Insecticide and Acaricide Tests: 1992, 17,
139, (1992). .
St. Julian, G., et al., "Bacteria, Spirochetes, and Rickettsia as
Insecticides", Annals of the New York Academy of Sciences, 217,
65-75, (1973). .
Stalker, D.M., et al., "Herbicide Resistance in Transgenic Plants
Expressing a Bacterial Detoxification Gene", Science, 242, 419-422,
(Oct. 21, 1988). .
Stark, D.M., et al., "Regulation of the Amount of Starch in Plant
Tissues by ADP Glucose Pyrophosphorylase", Science, 258, 287-291,
(Oct. 9, 1992). .
Stiefel, V., et al., "Expression of a Maize Cell Wall
Hydroxyproline-Rich Glycoprotein Gene in Early Leaf and Root
Vascular Differentiation", The Plant Cell, 2,785-793, (Aug. 1990).
.
Stolle, C.A., et al., "Cellular Factor Affecting the Stability of
beta-globulin mRNA", Gene, 62, 65-74, (1988). .
Stougaard, J., "Substrate-Dependent Negative Selection in Plants
Using a Bacterial Cytosine Deaminase Gene", The Plant Journal, 3,
755-761, (1993). .
Strauch, E., et al., "Cloning of a Phosphinothricin
N-Acetyltransferase Gene from Streptomyces Viridochromogenes Tu494
and its Expression in Streptomyces lividans and Escherichia coli",
Gene, 63, 65-74, (1988). .
Stroo, H.F., et al., "Heterotrophic Nitrification in an Acid Forest
Soil and by an Acid-Tolerant Fungus", Applied and Environmental
Microbiology, 52, 1107-1111, (Nov. 1986). .
Sukhapinda, K., et al., "Maize Haploid Protoplast Transformation
and Regeneration of Transgenic Plants", In Vitro Cellular and
Developmental Biology, 28, Abstract No. P-1132, p. 123A, (Mar.
1992). .
Suprasanna, P., et al., "Plantlet Regeneration from Glume Calli of
Maize (Zea mays L.)", Theor. Appl. Genet., 72, 120-122, (1986).
.
Thomas, W.E., et al., "Mechanism of Action of Bacillus
thuringiensis var. israelensis Insecticidal .delta.-Endotoxin",
FEBS Letters, 154, 362-368, (Apr. 1983). .
Tojo, A., et al., "Dissolution and Degradation of Bacillus
thuringiensis .delta.-Endotoxin by Gut Juice Protease of the
Silkworm Bombyx mori", Applied and Environmental Microbiology, 45,
576-580, (Feb. 1983). .
Tomes, D.T., "Cell Culture, Somatic Embryogenesis and Plant
Regeneration in Maize, Rice, Sogrhum and Millets", In: Cereal
Tissue and Cell Culture, Bright, S.W.J., et al., (eds.), Martinus
Nijnoff/Dr. W. Junk, Amsterdam, The Netherlands, 175-203, (1985).
.
Tomes, D.T., "Initiation of Embryogenic Callus Cultures from
Immature Embryos of Elite Corn (Zea mays L.) Germplasm", In Vitro,
20, Abstract No. 146, p. 276, (Mar. 1984). .
Tomes, D.T., et al., "The Effect of Parental Genotype on Initiation
of Embryogenic Callus from Elite Maize (Zea mays L.) Germplasm",
Theor. Appl. Genet., 70, 505-509, (1985). .
Torne, J.M., et al., "Regeneration of Plants from Mesocotyl Tissue
Cultures of Immature Embryos of Zea mays L.", Plant Science
Letters, 17, 339-344, (1980). .
Vaeck, M., et al., "Bacillus thuringiensis Endotoxin Gene
Expression and Insect Resistance in Higher Plants", Pesticide
Science, 20, 319-320, (1987). .
Vaeck, M., et al., "Engineering Improved Crops for Agriculture:
Protection from Insects and Resistance to Herbicides", In: Plant
Gene Systems and Their Biology, Key, J.L., et al., (eds.), Alan R.
Liss, New York, 171-181, (1987). .
Vaeck, M., et al., "Engineering of Insect Resistant Plants Using a
B. thuringiensis Gene", In: Molecular Strategies for Crop
Protection, New York, Alan R. Liss, Inc., 355-356, (1987). .
Vaeck, M., et al., "Insect Resistance in Transgenic Plants
Expressing Bacillus thuringiensis Toxin Gens", An. Soc. Entomol.
Brasil, 16, 427-435, (1987). .
Vaeck, M., et al., "Protein Engineering in Plants: Expression of
Bacillus thuringiensis Insecticidal Protein Genes", Cell Culture
and Somatic Cell Genetics of Plants, 6, 425-439, (1989). .
Vaeck, M., et al., "Transgenic Plants Protected from Insect
Attack", Nature, 328, 33-37, (Jul. 2, 1987). .
van den Elzen, P.J., et al., "A Chimaeric Hygromycin Resistance
Gene as a Selectable Marker in Plant Cells", Plant Molecular
Biolog, 5, 299-302, (1985). .
van den Elzen, P.J., et al., "Simple Binary Vectors for DNA
Transfer to Plant Cells", Plant Molecular Biology, 5, 149-154,
(1985). .
Van Lammeren, A.A., "Developmental Morphology and Cytology of the
Young Maize Embryo (Zea mays L.)", Acta Bot. Neerl., 35, 169-188,
(Aug. 1986). .
Vasil, I.K., "Isolation and Culture of Protoplasts of Grasses",
International Review of Cytology, Supplement 16, Bourne, G.H., et
al., (eds.), Academic Press, New York, 79-88, (1983). .
Vasil, V., et al., "Histology of Somatic Embryogenesis in Cultured
Immature Embryos of Maize (Zea mays L.)", Protoplasma, 127, 1-8,
(1985). .
Vernon, D.M., et al., "A Novel Methyl Transferase Induced by
Osmotic Stress in the Faculative Halophyte Mesembryanthemum
crystallinum", The EMBO Journal, 11, 2077-2085, (1992). .
Viotti, A., et al., "Each Zein Gene Class Can Produce Polypeptides
of Different Sizes", The EMBO J., 4, 1103-1110, (1985). .
Visser, B., et al., "Transgenic Tobacco Plants Expressing a
Modified Bacillus thuringiensis cryIC Gene", Journal of Cellular
Biochemistry, Supplement 16F, Abstract No. Y 136, p. 213, (Apr.
3-16, 1992). .
Wan, Y., et al., "Maize Transformation and Regeneration of
Transgenic Plants by Microprojectile Bombardment of Type I Callus",
Abstracts, 35th Annual Maize Genetics Conference, St. Charles, IL,
p. 5, (Mar. 18-21, 1993). .
Warren, G.W., et al., "Field Evaluation of Transgenic Tobacco
Containing a Bacillus thuringiensis Insecticidal Protein Gene",
Journal of Economic Entomology, 85, 1651-1659, (1992). .
Watson, S.A., "Corn Marketing, Processing and Utilization", In:
Corn and Corn Improvement, 3rd Edition, Sprague, G.F., et al.,
(eds.), American Society of Agronomy, Inc., et al., Madison, WI,
881-939, (1988). .
Webb, R.P., et al., "Superoxide Dismutase Gene Expression in
Transgenic Plants", Journal of Cellular Biochemistry, Supplement
16F, Abstract No. Y 137, 213, (Apr. 3-16, 1992). .
Weck, E., "Are Colorized DNA Sequences an Application of Fuzzy
Logic?", Abstracts, 35th Annual Maize Genetics Conference, St.
Charles, IL, Poster No. 45, p. 45, (Mar. 18-21, 1993). .
Weeks, J.T., et al., "Rapid Production of Multiple Independent
Lines of Fertile Transgenic Wheat (Triticum aestivum)", Plant
Physiol., 102, 1077-1084, (1993). .
Weigel, Jr., R.C., et al., "Somatic Embryogenesis in Barley", In
Vitro, 20, Abstract No. 147, p. 277, (Mar. 1984). .
Weissinger, A., et al., "Maize Transformation via Microprojectile
Bombardment", In: Genetic Improvements of Agriculturally Important
Crops, Fraley, R.T., et al., (eds.), Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY, 21-25, (1988). .
Weissinger, A., et al., "Microprojectile Bombardment for Maize
Transformation", In Vitro Cellular and Developmental Biology, 23,
Program Issue, 38th Annual Meeting of the Tissue Culture
Association, Washington, D.C., Abstract No. 254, (Mar. 1987). .
Wernicke, W., et al., "Adventious Embryoid and Root Formation from
Rice Leaves", Z. Pflanzenphysiol. Bd., 103, 361-365, (1981). .
Werr, W., et al., "Structure of the Sucrose Synthase Gene on
Chromosome 9 of Zea mays L.", The EMBO Journal, 4, 1373-1380,
(1985). .
White, D.W., et al., "Auxin-Inducible Response Promoter Elements",
Journal of Cellular Biochemistry, Supplemental 16F, Abstract No. Y
138, 213, (Apr. 3-16, 1992). .
Williams, R., et al., "Expression of the Maize Homeobox Gene
Knotted-1 in Transgenic Maize", Abstracts, 35th Annual Maize
Genetics Conference, St. Charles, IL, Poster No. 47, p. 46, (Mar.
18-21, 1993). .
Williams, S., et al., "Chemical Regulation of Bacillus
thuringiensis .delta.-Endotoxin Expression in Transgenic Plants",
Bio/technology, 10, 540-543, (May 1992). .
Wilson, F.D., et al., "Resistance of Cotton Lines Containing a
Bacillus thuringiensis Toxin to Pink Bollworm (Lepitoptera:
Gelechiidae) and Other Insects", J. Econ. Entomol., 85, 1516-1521,
(1992). .
Withers, L., et al., "Proline: A Novel Cryoprotectant for the
Freeze Preservation of Cultured Cells of Zea mays L.", Plant
Physiology, 64, 675-678, (1979). .
Witt, D.P., et al., "Cytotoxicity of Bacillus thuringiensis
.delta.-Endotoxins to Cultured Cf-1 Cells Does Not Correlate with
In Vivo Activity Toward Spruce Budworm Larvae", In: Fundamental and
Applied Aspects of Invertebrate Pathology, Samson, R.A., et al.,
(eds.), Fourth International Colloquium of Invertebrate Pathology,
Wangingen, The Netherlands, 3-6, (Aug. 18-22, 1986). .
Wohlleben, W., et al., "Nucleotide Sequence of the Phosphinothricin
N-Acetyltransferase Gene from Streptomyces viridochromogenes Tu494
and Its Expression in Nicotania tabacum", Gene, 70, 25-37, (1988).
.
Wolter, F.P., et al., "Chilling Sensitivity of Arabidopsis thaliana
with Genetically Engineered Membrane Lipids", The EMBO Journal, 11,
4685-4692, (1992). .
Wong, J.R., et al., "Anthocyanin Regulatory Genes from Maize
(B-Peru and C1) Activate the Anthocyanin Pathway in Wheat, Barley
and Oat Cells", Journal of Cellular Biochemistry, Supplement 15A,
159, (1991). .
Wood, M., "Blast Those Genes!", Agricultural Research, 2 p., (Jun.
1989). .
Wu, S., et al., "Characterization of Chitinase cDNA Clones for
Acidic and Basic Isoforms of Maize", Abstracts, 35th Annual Maize
Genetics Conference, St. Charles, IL, Poster No. 48, p. 46, (Mar.
18-21, 1993). .
Xiang, C., et al., "The Anti-nptII Gene --A Potential Negative
Selectable Marker for Plants", Plant Physiol., 102, 287-293,
(1993). .
Yamaguchi-Shinozaki, K., et al., "Molecular Cloning and
Characterization of 9 cDNAs for Genes that are Responsive to
Desiccation in Arabidopsis thaliana: Sequence Analysis of One cDNA
Clone that Encodes a Putative Transmembrane Channel Protein", Plant
Cell Physiol., 33, 217-224, (1992). .
Yang, N.S., et al., "Maize Sucrose Synthase-1 Promoter Directs
Phloem Cell-Specific Expression of Gus Gene in Transgenic Tobacco
Plants", Proc. Natl. Acad. Sci. USA, 87, 4144-4148, (Jun. 1990).
.
Yenofsky, R.L., et al., "Isolation and Characterization of a
Soybean (Glycine max) Lipoxygenase-3 Gene", Mol. Gen. Genet., 211,
215-222, (1988). .
Zhang, W., et al., "Analysis of Rice Actl 5' Region Activity in
Transgenic Rice Plants and the Study of Regulatory Elements in This
Region", Journal of Cellular Biochemistry, Supplement 16F, Abstract
No. Y 139, p. 213, (Apr. 3-16, 1992). .
Beermann et al., "Tyrosinase as a marker for transgenic mice,"
Nucl. Acids Research, 19(4):958, 1991. .
Gordon-Kamm et al., "Transformation of Maize Cells and Regeneration
of Fertile Transgenic Plants," The Plant Cell, 2:603-618, Jul.,
1990. .
Perl et al., "Bacterial Dihydrodipicolinate Synthase and
Desensitized Aspartate Kinase: Two Novel Selectable Markers for
Plant Transformation", Bio/Technology, 11:715-718, Jun., 1993 .
Perlak et al., "Modification of the coding sequence enhances plant
expression of insect control protein genes," Proc. Natl. Acad. Sci.
USA, 88:3324-3328, Apr., 1991. .
Spencer et al., "Segregation of transgenes in maize," Plant
Molecular Biology, 18:201-210, 1992. .
Sugiyama et al., "Use of the Tyrosinase Gene from Streptomyces to
Probe Promoter Sequences for Escherichia coli," Plasmid,
23:237-241, 1990. .
Wong et al., "Arabidopsis thaliana small subunit leader and transit
peptide enhance the expression of Bacillus thuringienses proteins
in transgenic plants," Plant Molecular Biology, 20:81-93, 1992.
.
Van den Broeck, G., et al., "Targeting of a Foreign Protein to
Chloroplasts by Fusion to the Transit Peptide from the Small
Subunit of Ribulose 1,5-bisphosphate Carboxylase", Nature, 313,
358-363, (Jan. 31, 1985)..
|
Primary Examiner: Benzion; Gary
Attorney, Agent or Firm: Schwegman, Lundberg, Woessner &
Kluth, P.A.
Parent Case Text
The present application is a divisional of co-pending application
U.S. Ser. No. 08/113,561, filed Aug. 25, 1993, which was
continuation-in-part of U.S. Ser. No. 07/513,298, filed Apr. 17,
1990.
Claims
What is claimed is:
1. A method for increasing the amount of free phosphorus in a maize
seed, comprising:
(a) preparing a DNA composition comprising a DNA sequence encoding
phytase operably linked to a heterologous seed specific
promoter;
(b) transforming regenerable maize cells with said DNA composition
to yield transformed cells comprising said DNA sequence linked to
said promoter;
(c) selecting said transformed cells;
(d) regenerating a fertile transgenic plant wherein said DNA
sequence is heritable; and
(e) obtaining seeds from said fertile transgenic plant, wherein the
free phosphorous content of said seeds expressing said DNA sequence
is higher than the free phosphorous content of seed not expressing
said DNA sequence.
2. A method according to claim 1, further comprising:
(a) preparing a transgenic progeny plant of any generation
comprising said DNA sequence encoding phytase; and
(b) obtaining seeds from said transgenic progeny plant, wherein the
free phosphorous content of said seeds is higher than the free
phosphorous content of seed not comprising said DNA sequence.
3. The method of claim 2, further comprising breeding said progeny
with a non-transgenic maize plant, to prepare an offspring fertile,
transgenic maize plant that comprises the DNA sequence.
4. The method of claim 2, further comprising breeding said progeny
with a second transgenic maize plant to prepare an offspring
fertile, transgenic maize plant that comprises the DNA
sequence.
5. The method of claim 2, further comprising cultivating said seed
to prepare a fertile, transgenic maize plant that comprises the DNA
sequence.
6. The method of claim 1, wherein the maize cells comprise callus
cells, gametic cells, or meristematic cells.
7. The method of claim 6, wherein said cells comprise cells of
immature embryos.
8. The method of claim 6, wherein said cells comprise embryogenic
callus cells.
9. The method of claim 1, wherein the fertile, transgenic maize
plant is an inbred plant.
10. The method of claim 1, wherein said promoter comprises a CaMV
35S, CaMV 19S, nos, Adh, sucrose synthase, R-allele or root cell
promoter.
11. The method of claim 1, wherein the DNA sequence is bombarded
into the maize cells to be transformed.
12. The method of claim 1, wherein the wherein the DNA composition
comprises plasmids.
13. The method of claim 1, wherein cells are selected by incubation
in contact with a selective medium.
14. The method of claim 1, wherein uptake of the DNA by recipient
cells is achieved by microprojectile bombardment of the cells, by
passing particles on which the DNA composition has been coated
through a screen and into the cells.
15. The method of claim 14, wherein the particles comprise gold,
tungsten or platinum.
16. The method of claim 1, wherein the DNA sequence is introduced
by means of electroporation.
17. The method of claim 1, wherein regenerating plants from
transformed recipient cells comprises the steps of:
(a) culturing recipient cells which have received the DNA
composition in a media comprising an embryogenic promoting hormone
until callus organization is observed;
(b) transferring said cells to a media which includes a tissue
organization promoting hormone;
(c) subculturing said cells onto media without said hormones, to
allow for shoot elongation or root development; and
(d) transferring said cells onto a minimal medium, to provide for
hardening of the plant.
18. The method of claim 1, wherein the fertile, transgenic maize
plant is a hybrid plant.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to reproducible systems for
genetically transforming monocotyledonous plants such as maize, to
methods of selecting stable genetic transformants from suspensions
of transformed cells, and to methods of producing fertile plants
from the transformed cells. Exemplary transformation methods
include the use of microprojectile bombardment to introduce nucleic
acids into cells, and selectable and/or screenable marker systems,
for example, genes which confer resistance (e.g., antibiotic,
herbicide, etc.), or which contain an otherwise phenotypically
observable or other detectable trait. In other aspects, the
invention relates to the production of stably transformed and
fertile monocot plants, gametes and offspring from the transgenic
plants.
2. Description of the Related Art
Ever since the human species emerged from the hunting-gathering
phase of its existence, and entered an agricultural phase, a major
goal of human ingenuity and invention has been to improve crop
yield and to alter and improve the characteristics of plants. In
particular, man has sought to alter the characteristics of plants
to make them more tasty and/or nutritious, to produce increased
crop yield or render plants more adaptable to specific
environments.
Up until recent times, crop and plant improvements depended on
selective breeding of plants with desirable characteristics.
Initial breeding success was probably accidental, resulting from
observation of a plant with desirable characteristics, and use of
that plant to propagate the next generation. However, because such
plants had within them heterogenous genetic complements, it was
unlikely that progeny identical to the parent(s) with the desirable
traits would emerge. Nonetheless, advances in controlled breeding
have resulted from both increasing knowledge of the mechanisms
operative in hereditary transmission, and by empirical observations
of results of making various parental plant crosses.
Recent advances in molecular biology have dramatically expanded
man's ability to manipulate the germplasm of animals and plants.
Genes controlling specific phenotypes, for example specific
polypeptides that lend antibiotic or herbicide resistance, have
been located within certain germplasm and isolated from it. Even
more important has been the ability to take the genes which have
been isolated from one organism and to introduce them into another
organism. This transformation may be accomplished even where the
recipient organism is from a different phylum, genus or species
from that which donated the gene (heterologous transformation).
Attempts have been made to genetically engineer desired traits into
plant genomes by introduction of exogenous genes using genetic
engineering techniques. These techniques have been successfully
applied in some plant systems, principally in dicotyledonous
species. The uptake of new DNA by recipient plant cells has been
accomplished by various means, including Agrobacterium infection
(Nester et al., 1984), polyethylene glycol (PEG)-mediated DNA
uptake (Lorz et al., 1985), electroporation of protoplasts (Fromm
et al., 1986) and microprojectile bombardment (Klein et al., 1987).
Unfortunately, the introduction of exogenous DNA into
monocotyledonous species and subsequent regeneration of transformed
plants has proven much more difficult than transformation and
regeneration in dicotyledonous plants. Moreover, reports of methods
for the transformation of monocotyledons such as maize, and
subsequent production of fertile maize plants, have not been
forthcoming. Consequently, success has not been achieved in this
area and commercial implementation of transformation by production
of fertile transgenic plants has not been achieved. This failure
has been particularly unfortunate in the case of maize, where there
is a particularly great need for methods for improving genetic
characteristics.
Problems in the development of genetically transformed
monocotyledonous species have arisen in a variety of general areas.
For example, there is generally a lack of methods which allow one
to introduce nucleic acids into cells and yet permit efficient cell
culture and eventual regeneration of fertile plants. Only limited
successes have been noted. In rice, for example, DNA transfer has
only recently been reported using protoplast electroporation and
subsequent regeneration of transgenic plants (Shimamoto et al.,
1989). Furthermore, in maize, transformation using protoplast
electroporation has also been reported (see, e.g., Fromm et al.,
1986).
However, recovery of stably transformed plants has not been
reproducible. A particularly serious failure is that the few
transgenic plants produced in the case of maize have not been
fertile (Rhodes et al., 1988). While regeneration of fertile corn
plants from protoplasts has been reported (Prioli & Sondahl,
1989; Shillito et al., 1989), these reported methods have been
limited to the use of non-transformed protoplasts. Moreover,
regeneration of plants from protoplasts is a technique which
carries its own set of significant drawbacks. Even with vigorous
attempts to achieve fertile, transformed maize plants, reports of
success in this regard have not been forthcoming.
A transformation technique that circumvents the need to use
protoplasts is microprojectile bombardment. Although transient
expression of a reporter gene was detected in bombarded tobacco
pollen (Twell et al., 1989), stable transformation by
microprojectile bombardment of pollen has not been reported for any
plant species. Bombardment of soybean apical meristems with
DNA-coated gold particles resulted in chimeric plants containing
transgenic sectors. Progeny containing the introduced gene were
obtained at a low frequency (McCabe et al., 1988). Bombardment of
shoot meristems of immature maize embryos resulted in sectors of
tissue expressing a visible marker, anthocyanin, the synthesis of
which was triggered by the introduction of a regulatory gene
(Tomes, 1990). An analysis of cell lineage patterns in maize
(McDaniel & Poethig, 1988) suggests that germine transformation
of maize by such an approach may be difficult.
A second major problem in achieving successful monocot
transformation has resulted from the lack of efficient marker gene
systems which have been employed to identify stably transformed
cells. Marker gene systems are those which allow the selection of,
and/or screening for, expression products of DNA. For use as assays
for transformed cells, the selectable or screenable products should
be those from genetic constructs introduced into the recipient
cells. Hence, such marker genes can be used to identify stable
transformants.
Of the more commonly used marker gene systems are gene systems
which confer resistance to aminoglycosides such as kanamycin. While
kanamycin resistance has been used successfully in both rice (Yang
et al., 1988) and corn protoplast systems (Rhodes et al., 1988), it
remains a very difficult selective agent to use in monocots due to
high endogenous resistance (Hauptmann, et al., 1988). Many monocot
species, maize, in particular, possess high endogenous levels of
resistance to aminoglycosides. Consequently, this class of
compounds cannot be used reproducibly to distinguish transformed
from non-transformed tissue. New methods for reproducible selection
of or screening for transformed plant cells are therefore
needed.
Accordingly, it is clear that improved methods and/or approaches to
the genetic transformation of monocotyledonous species would
represent a great advance in the art. Furthermore, it would be of
particular significance to provide novel approaches to monocot
transformation, such as transformation of maize cells, which would
allow for the production of stably transformed, fertile corn plants
and progeny into which desired exogenous genes have been
introduced. Furthermore, the identification of marker gene systems
applicable to monocot systems such as maize would provide a useful
means for applying such techniques generally. Thus, the development
of these and other techniques for the preparation of stable
genetically transformed monocots such as maize could potentially
revolutionize approaches to monocot breeding.
SUMMARY OF THE INVENTION
The present invention addresses one or more of the foregoing or
other shortcomings in the prior art by providing compositions and
methods for the preparation of stably transformed, monocotyledonous
cells and the subsequent regeneration of fertile, transgenic plants
and progeny, particularly maize. The invention particularly
provides techniques for the preparation of transgenic, fertile
monocots, such as maize, which have been stably transformed through
the introduction of discrete DNA sequences into the plant
genome.
The invention thus relates generally to methods for the production
of transgenic plants. As used herein, the term "transgenic plants"
is intended to refer to plants that have incorporated DNA
sequences, including but not limited to genes which are perhaps not
normally present, DNA sequences not normally transcribed into RNA
or translated into a protein ("expressed"), or any other genes or
DNA sequences which one desires to introduce into the
non-transformed plant, such as genes which may normally be present
in the non-transformed plant but which one desires to either
genetically engineer or to have altered expression. It is
contemplated that in some instances the genome of transgenic plants
of the present invention will have been augmented through the
stable introduction of the transgene. However, in other instances,
the introduced gene will replace an endogenous sequence.
Exemplary genes which may be introduced include, for example, DNA
sequences or genes from another species, or even genes or sequences
which originate with or are present in the same species, but are
incorporated into recipient cells by genetic engineering methods
rather than classical reproduction or breeding techniques. However,
the term "exogenous", is also intended to refer to genes which are
not normally present in the cell being transformed, or perhaps
simply not present in the form, structure, etc., as found in the
transforming DNA segment or gene, or genes which are normally
present yet which one desires, e.g., to have overexpressed. Thus,
the term "exogenous" gene or DNA refers to any gene or DNA segment
that is introduced into a recipient cell, regardless of whether a
similar gene may already be present in such a cell. Introduced, in
this context, is known in the art to mean introduced by the hand of
man.
The most preferred monocots for use in the present invention will
be cereals such as maize. The present invention is exemplified
through the use of A188.times.B73 cell lines, cell lines developed
from other genotypes and immature embryos. Hence, it will be
understood that the invention is in no way limited to a particular
genotype or cell line. To date, a variety of different Zea mays
lines and germplasms have been tested for their ability to be
successfully employed in the preparation of fertile, transgenic
corn. The status of these studies is set forth in some detail
hereinbelow. Generally speaking, these studies have demonstrated
that 24 out of 36 maize cultures were transformable. Of those cell
lines tested, 11 out of 20 have produced fertile plants.
One exemplary embodiment for generating a stably transformed
monocot includes culturing recipient corn cells in suspension
cultures using embryogenic cells in Type II callus, selecting for
small (10-30 .mu.) isodiametric, cytoplasmically dense cells,
introducing a desired DNA segment into these cells, growing the
transformed cells in or on culture medium containing hormones,
subculturing into a progression of media to facilitate development
of shoots and roots, and finally, hardening the transgenic plant
and readying it metabolically for growth in soil.
The present invention is suitable for use in transforming any maize
variety. While not all cell lines developed out of a particular
variety or cross will necessarily show the same degree of stable
transformability, it has been the inventors' finding that a
reasonable percentage of cell lines developed from essentially
every genotype tested to date can be developed into fertile,
transgenic plants. Thus, where one desires to prepare transformants
in a particular cross or variety, it will generally be desirable to
develop several cell lines from the particular cross or variety
(e.g., 8 to 10), and subject all of the lines so developed to the
transformation protocols hereof.
Another exemplary embodiment for generating a stably transformed
monocot includes introducing a desired DNA segment into cells of
organized tissues such as immature embryos, growing the embryos on
a culture medium, subculturing into a progression of media to
facilitate development of shoots and roots, and finally, hardening
the transgenic plant and readying it metabolically for growth in
soil. In this embodiment the invention is capable of transforming
any variety of maize. Through the use of the present invention it
is possible to simultaneously deliver DNA segments to a large
number of embryos. It has been the inventor's finding that a
percentage of the embryos that are contacted by exogenous DNA will
develop into fertile transgenic plants, similar to delivering DNA
to a large population of cultured cells. The present invention is
exemplified through the use of immature embryos from the genotypes
H99 and Hi-II, but is in no way limited to these genotypes. To date
only experiments with these genotypes have progressed to the point
where one would reasonably expect to recover transformants.
Generally speaking one would expect to be able to recover fertile
transgenic plants from any variety of maize.
Moreover, the ability to provide even a single fertile, transgenic
corn line would be generally sufficient to allow the introduction
of the transgenic component (e.g., recombinant DNA) of that line
into a second corn line of choice. This is because by providing
fertile, transgenic offspring, the practice of the invention allows
one to subsequently, through a series of breeding manipulations,
move a selected gene from one corn line into an entirely different
corn line. For example, studies have been conducted wherein the
gene for resistance to the herbicide Basta.RTM., bar, has been
moved from two transformants derived from cell line SC716 and one
transformant derived from cell line SC82 into 18 elite inbred lines
by backcrossing. It is possible with these inbreds to produce a
large number of hybrids. Eleven such hybrids have been made and are
in field tests.
I. Recipient Cells
Practicing the present invention includes the generation and use of
recipient cells. As used herein, the term "recipient cells" refers
to monocot cells that are receptive to transformation and
subsequent regeneration into stably transformed, fertile monocot
plants.
A. Sources of Cells
Recipient cell targets include, but are not limited to, meristem
cells, Type I Type II, and Type III callus, immature embryos and
gametic cells such as microspores pollen, sperm and egg cells. Type
I, Type II, and Type III callus may be initiated from tissue
sources including, but not limited to, immature embryos, seedling
apical meristems, microspores and the such. Those cells which are
capable of proliferating as callus are also recipient cells for
genetic transformation. The present invention provides techniques
for transforming immature embryos followed by initiation of callus
and subsequent regeneration of fertile transgenic plants. Direct
transformation of immature embryos obviates the need for long term
development of recipient cell cultures. Pollen, as well as its
precursor cells, microspores, may be capable of functioning as
recipient cells for genetic transformation, or as vectors to carry
foreign DNA for incorporation during fertilization. Direct pollen
transformation would obviate the need for cell culture.
Meristematic cells (i.e., plant cells capable of continual cell
division and characterized by an undifferentiated cytological
appearance, normally found at growing points or tissues in plants
such as root tips, stem apices, lateral buds, etc.) may represent
another type of recipient plant cell. Because of their
undifferentiated growth and capacity for organ differentiation and
totipotency, a single transformed meristematic cell could be
recovered as a whole transformed plant. In fact, it is proposed
that embryogenic suspension cultures may be an in vitro
meristematic cell system, retaining an ability for continued cell
division in an undifferentiated state, controlled by the media
environment.
In certain embodiments, cultured plant cells that can serve as
recipient cells for transforming with desired DNA segments include
corn cells, and more specifically, cells from Zea mays L. Somatic
cells are of various types. Embryogenic cells are one example of
somatic cells which may be induced to regenerate a plant through
embryo formation. Non-embryogenic cells are those which will
typically not respond in such a fashion. An example of
non-embryogenic cells are certain Black Mexican Sweet (BMS) corn
cells. These cells have been transformed by microprojectile
bombardment using the neo gene followed by selection with the
aminoglycoside, kanamycin (Klein et al., 1989). However, this BMS
culture was not found to be regenerable.
The development of embryogenic maize calli and suspension cultures
useful in the context of the present invention, e.g., as recipient
cells for transformation, has been described in U.S. Pat. No.
5,134,074, incorporated herein by reference.
The present invention also provides certain techniques that may
enrich recipient cells within a cell population. For example, Type
II callus development, followed by manual selection and culture of
friable, embryogenic tissue, generally results in an enrichment of
recipient cells for use in, e.g., micro-projectile transformation.
Suspension culturing, particularly using the media disclosed
herein, may also improve the ratio of recipient to non-recipient
cells in any given population. Manual selection techniques which
employed to select recipient cells may include, e.g., assessing
cell morphology and differentiation, or may use various physical or
biological means. Cryopreservation is also contemplated as a
possible method of selecting for recipient cells.
Manual selection of recipient cells, e.g., by selecting embryogenic
cells from the surface of a Type II callus, is one means employed
by the inventors in an attempt to enrich for recipient cells prior
to culturing (whether cultured on solid media or in suspension).
The preferred cells may be those located at the surface of a cell
cluster, and may further be identifiable by their lack of
differentiation, their size and dense cytoplasm. The preferred
cells will generally be those cells which are less differentiated,
or not yet committed to differentiation. Thus, one may wish to
identify and select those cells which are cytoplasmically dense,
relatively unvacuolated with a high nucleus to cytoplasm ratio
(e.g., determined by cytological observations), small in size
(e.g., 10-20 .mu.m), and capable of sustained divisions and somatic
proembryo formation.
It is proposed that other means for identifying such cells may also
be employed. For example, through the use of dyes, such as Evan's
blue, which are excluded by cells with relatively non-permeable
membranes, such as embryogenic cells, and taken up by relatively
differentiated cells such as root-like cells and snake cells
(so-called due to their snake-like appearance).
Other possible means of identifying recipient cells include the use
of isozyme markers of embryogenic cells, such as glutamate
dehydrogenase, which can be detected by cytochemical stains (Fransz
et al., 1989). However, it is cautioned that the use of isozyme
markers such as glutamate dehydrogenase may lead to some degree of
false positives from non-embryogenic cells such as rooty cells
which nonetheless have a relatively high metabolic activity.
B. Media
In certain embodiments, recipient cells are selected following
growth in culture. Where employed, cultured cells will preferably
be grown either on solid supports or in the form of liquid
suspensions. In either instance, nutrients may be provided to the
cells in the form of media, and environmental conditions
controlled. There are many types of tissue culture media comprised
of amino acids, salts, sugars, growth regulators and vitamins. Most
of the media employed in the practice of the invention will have
some similar components (see, e.g., Table 1 herein below), the
media differ in the composition and proportions of their
ingredients depending on the particular application envisioned. For
example, various cell types usually grow in more than one type of
media, but will exhibit different growth rates and different
morphologies, depending on the growth media. In some media, cells
survive but do not divide.
Various types of media suitable for culture of plant cells have
been previously described. Examples of these media include, but are
not limited to, the N6 medium described by Chu et al. (1975) and MS
media (Murashige & Skoog, 1962). The inventors have discovered
that media such as MS which have a high ammonia/nitrate ratio are
counterproductive to the generation of recipient cells in that they
promote loss of morphogenic capacity. N6 media, on the other hand,
has a somewhat lower ammonia/nitrate ratio, and is contemplated to
promote the generation of recipient cells by maintaining cells in a
proembryonic state capable of sustained divisions.
C. Cell Cultures
1. Initiation
In the practice of the invention it is sometimes, but not always,
necessary to develop cultures which contain recipient cells.
Suitable cultures can be initiated from a number of whole plant
tissue explants including, but not limited to, immature embryos,
leaf bases, immature tassels, anthers, microspores, and other
tissues containing cells capable of in vitro proliferation and
regeneration of fertile plants. In one exemplary embodiment,
recipient cell cultures are initiated from immature embryos of Zea
mays L. by growing excised immature embryos on a solid culture
medium containing growth regulators including, but not limited to,
dicamba., 2,4-D, NAA, and IAA. In some instances it will be
preferred to add silver nitrate to culture medium for callus
initiation as this compound has been reported to enhance culture
initiation (Vain et al., 1989). Embryos will produce callus that
varies greatly in morphology including from highly unorganized
cultures containing very early embryogenic structures (such as, but
not limited to, type II cultures in maize), to highly organized
cultures containing large late embryogenic structures (such as, but
not limited to, type I cultures in maize). This variation in
culture morphology may be related to genotype, culture medium
composition, size of the initial embryos and other factors. Each of
these types of culture morphologies is a source of recipient
cells.
The development of suspension cultures capable of plant
regeneration may be used in the context of the present invention.
Suspension cultures may be initiated by transferring callus tissue
to liquid culture medium containing growth regulators. Addition of
coconut water or other substances to suspension culture medium may
enhance growth and culture morphology, but the utility of
suspension cultures is not limited to those containing these
compounds. In some embodiments of this invention, the use of
suspension cultures will be preferred as these cultures grow more
rapidly and are more easily manipulated than callus cells growing
on solid culture medium.
When immature embryos or other tissues directly removed from a
whole plant are used as the target tissue for DNA delivery, it will
only be necessary to initiate cultures of cells insofar as is
necessary for identification and isolation of transformants. In an
illustrative embodiment, DNA is introduced by particle bombardment
into immature embryos following their excision from the plant.
Embryos are transferred to a culture medium that will support
proliferation of tissues and allow for selection of transformed
sectors, 0-14 days following DNA delivery. In this embodiment of
the invention it is not necessary to establish stable callus
cultures capable of long term maintenance and plant
regeneration.
2. Maintenance
The method of maintenance of cell cultures may contribute to their
utility as sources of recipient cells for transformation. Manual
selection of cells for transfer to fresh culture medium, frequency
of transfer to fresh culture medium, composition of culture medium,
and environment factors including, but not limited to, light
quality and quantity and temperature are all important factors in
maintaining callus and/or suspension cultures that are useful as
sources of recipient cells. It is contemplated that alternating
callus between different culture conditions may be beneficial in
enriching for recipient cells within a culture. For example, it is
proposed that cells may be cultured in suspension culture, but
transferred to solid medium at regular intervals. After a period of
growth on solid medium cells can be manually selected for return to
liquid culture medium. It is proposed that by repeating this
sequence of transfers to fresh culture medium it is possible to
enrich for recipient cells. It is also contemplated that passing
cell cultures through a 1.9 mm sieve is useful in maintaining the
friability of a callus or suspension culture and may be beneficial
is enriching for transformable cells.
3. Cryopreservation
Additionally, the inventors propose that cryopreservation may
effect the development of, or perhaps select for, recipient cells.
Cryopreservation selection may operate due to a selection against
highly vacuolated, non-embryogenic cells, which may be selectively
killed during cryopreservation. The inventors propose that there is
a temporal window in which cultured cells retain their regenerative
ability, thus, it is believed that they must be preserved at or
before that temporal period if they are to be used for future
transformation and regeneration.
For use in transformation, suspension or callus culture cells may
be cryopreserved and stored for periods of time, thawed, then used
as recipient cells for transformation. An illustrative embodiment
of cryopreservation methods comprises the steps of slowly adding
cryoprotectants to suspension cultures to give a final
concentration of 10% dimethyl sulfoxide, 10% polyethylene glycol
(6000MW), 0.23 M proline and 0.23 M glucose. The mixture is then
cooled to -35.degree. C. at 0.5.degree. C. per minute. After an
isothermal period of 45 minutes, samples are placed in liquid
N.sub.2 (modification of methods of Withers and King (1979); and
Finkle et al. (1985)). To reinitiate suspension cultures from
cryopreserved material, cells may be thawed rapidly and pipetted
onto feeder plates similar to those described by Rhodes et al.
(Vaeck et al., 1987).
II. DNA Sequences
Virtually any DNA composition may be used for delivery to recipient
monocotyledonous cells to ultimately produce fertile transgenic
plants in accordance with the present invention. For example, DNA
segments in the form of vectors and plasmids, or linear DNA
fragments, in some instances containing only the DNA element to be
expressed in the plant, and the like, may be employed.
In certain embodiments, it is contemplated that one may wish to
employ replication-competent viral vectors in monocot
transformation. Such vectors include, for example, wheat dwarf
virus (WDV) "shuttle" vectors, such as pW1-11 and PW1-GUS (Ugaki et
al., 1991). These vectors are capable of autonomous replication in
maize cells as well as E. coli, and as such may provide increased
sensitivity for detecting DNA delivered to transgenic cells. A
replicating vector may also be useful for delivery of genes flanked
by DNA sequences from transposable elements such as Ac, Ds, or Mu.
It has been proposed (Laufs et al., 1990) that transposition of
these elements within the maize genome requires DNA replication. It
is also contemplated that transposable elements would be useful for
introducing DNA fragments lacking elements necessary for selection
and maintenance of the plasmid vector in bacteria, e.g., antibiotic
resistance genes and origins of DNA replication. It is also
proposed that use of a transposable element such as Ac, Ds, or Mu
would actively promote integration of the desired DNA and hence
increase the frequency of stably transformed cells.
Vectors, plasmids, cosmids, YACs (yeast artificial chromosomes) and
DNA segments for use in transforming such cells will, of course,
generally comprise the cDNA, gene or genes which one desires to
introduce into the cells. These DNA constructs can further include
structures such as promoters, enhancers, polylinkers, or even
regulatory genes as desired. The DNA segment or gene chosen for
cellular introduction will often encode a protein which will be
expressed in the resultant recombinant cells, such as will result
in a screenable or selectable trait and/or which will impart an
improved phenotype to the regenerated plant. However, this may not
always be the case, and the present invention also encompasses
transgenic plants incorporating non-expressed transgenes.
A. Regulatory Elements
The construction of vectors which may be employed in conjunction
with the present invention will be known to those of skill of the
art in light of the present disclosure (see e.g., Sambrook et al.,
1989; Gelvin et al., 1990). Preferred constructs will generally
include a plant promoter such as the CaMV 35S promoter (Odell et
al., 1985), or others such as CaMV 19S (Lawton et al., 1987), nos
(Ebert et al., 1987), Adh (Walker et al., 1987), sucrose synthase
(Yang & Russell, 1990), .alpha.-tubulin, actin (Wang et al.,
1992), cab (Sullivan et al., 1989), PEPCase (Hudspeth & Grula,
1989) or those associated with the R gene complex (Chandler et al.,
1989). Tissue specific promoters such as root cell promoters
(Conkling et al., 1990) and tissue specific enhancers (Fromm et
al., 1989) are also contemplated to be particularly useful, as are
inducible promoters such as ABA- and turgor-inducible
prompters.
Constructs will also include the gene of interest along with a 3'
end DNA sequence that acts as a signal to terminate transcription
and allow for the polya-denylation of the resultant mRNA. The most
preferred 3' elements are contemplated to be those from the
nopaline synthase gene of Agrobacterium tumefasciens (Bevan et al.,
1983), the terminator for the T7 transcript from the octopine
synthase gene of Agrobacterium tumefasciens, and the 3' end of the
protease inhibitor I or II genes from potato or tomato. Regulatory
elements such as Adh intron 1 (Callis et al., 1987), sucrose
synthase intron (Vasil et al., 1989) or TMV omega element (Gallie,
et al., 1989), may further be included where desired.
As the DNA sequence between the transcription initiation site and
the start of the coding sequence, i.e., the untranslated leader
sequence, can influence gene expression, one may also wish to
employ a particular leader sequence. Preferred leader sequences are
contemplated to include those which include sequences predicted to
direct optimum expression of the attached gene, i.e., to include a
preferred consensus leader sequence which may increase or maintain
mRNA stability and prevent inappropriate initiation of translation.
The choice of such sequences will be known to those of skill in the
art in light of the present disclosure. Sequences that are derived
from genes that are highly expressed in plants, and in maize in
particular, will be most preferred.
It is contemplated that vectors for use in accordance with the
present invention may be constructed to include the ocs enhancer
element. This element was first identified as a 16 bp palindromic
enhancer from the octopine synthase (ocs) gene of agrobacterium
(Ellis et al., 1987), and is present in at least 10 other promoters
(Bouchez et al., 1989). It is proposed that the use of an enhancer
element, such as the ocs element and particularly multiple copies
of the element, will act to increase the level of transcription
from adjacent promoters when applied in the context of monocot
transformation.
Ultimately, the most desirable DNA segments for introduction into a
monocot genome may be homologous genes or gene families which
encode a desired trait (e.g., increased yield per acre) and which
are introduced under the control of novel promoters or enhancers,
etc., or perhaps even homologous or tissue specific (e.g., root-,
collar/sheath-, whorl-, stalk-, earshank-, kernel- or
leaf-specific) promoters or control elements. Indeed, it is
envisioned that a particular use of the present invention will be
the targeting of a gene in a tissue-specific manner. For example,
insect resistant genes may be expressed specifically in the whorl
and collar/sheath tissues which are targets for the first and
second broods, respectively, of ECB. Likewise, genes encoding
proteins with particular activity against rootworm may be targeted
directly to root tissues.
Vectors for use in tissue-specific targeting of genes in transgenic
plants will typically include tissue-specific promoters and may
also include other tissue-specific control elements such as
enhancer sequences. Promoters which direct specific or enhanced
expression in certain plant tissues will be known to those of skill
in the art in light of the present disclosure. These include, for
example, the rbcS promoter, specific for green tissue; the ocs, nos
and mas promoters which have higher activity in roots or wounded
leaf tissue; a truncated (-90 to +8) 35S promoter which directs
enhanced expression in roots, an .alpha.-tubulin gene that directs
expression in roots and promoters derived from zein storage protein
genes which direct expression in endosperm. It is particularly
contemplated that one may advantageously use the 16 bp ocs enhancer
element from the octopine synthase (ocs) gene (Ellis et al., 1987;
Bonchez et al, 1989), especially when present in multiple copies,
to achieve enhanced expression in roots.
It is also contemplated that tissue specific expression may be
functionally accomplished by introducing a constitutively expressed
gene (all tissues) in combination with an antisense gene that is
expressed only in those tissues where the gene product is not
desired. For example, a gene coding for the crystal toxin protein
from B. thuringiensis (Bt) may be introduced such that it is
expressed in all tissues using the 35S promoter from Cauliflower
Mosaic Virus. Expression of an antisense transcript of the Bt gene
in a maize kernel, using for example a zein promoter, would prevent
accumulation of the Bt protein in seed. Hence the protein encoded
by the introduced gene would be present in all tissues except the
kernel.
Alternatively, one may wish to obtain novel tissue-specific
promoter sequences for use in accordance with the present
invention. To achieve this, one may first isolate cDNA clones from
the tissue concerned and identify those clones which are expressed
specifically in that tissue, for example, using Northern blotting.
Ideally, one would like to identify a gene that is not present in a
high copy number, but which gene product is relatively abundant in
specific tissues. The promoter and control elements of
corresponding genomic clones may then be localized using the
techniques of molecular biology known to those of skill in the
art.
It is contemplated that expression of some genes in transgenic
plants will be desired only under specified conditions. For
example, it is proposed that expression of certain genes that
confer resistance to environmental stress factors such as drought
will be desired only under actual stress conditions. It is
contemplated that expression of such genes throughout a plants
development may have detrimental effects. It is known that a large
number of genes exist that respond to the environment. For example,
expression of some genes such as rbcS, encoding the small subunit
of ribulose bisphosphate carboxylase, is regulated by light as
mediated through phytochrome. Other genes are induced by secondary
stimuli. For example, synthesis of abscisic acid (ABA) is induced
by certain environmental factors, including but not limited to
water stress. A number of genes have been shown to be induced by
ABA (Skriver and Mundy, 1990). It is also anticipated that
expression of genes conferring resistance to insect predation would
be desired only under conditions of actual insect infestation.
Therefore, for some desired traits inducible expression of genes in
transgenic plants will be desired.
It is proposed that in some embodiments of the present invention
expression of a gene in a transgenic plant will be desired only in
a certain time period during the development of the plant.
Developmental timing is frequently correlated with tissue specific
gene expression. For example, expression of zein storage proteins
is initiated in the endosperm about 15 days after pollination.
Additionally, vectors may be constructed and employed in the
intracellular targeting of a specific gene product within the cells
of a transgenic plant or in directing a protein to the
extracellular environment. This will generally be achieved by
joining a DNA sequence encoding a transit or signal peptide
sequence to the coding sequence of a particular gene. The resultant
transit, or signal, peptide will transport the protein to a
particular intracellular, or extracellular destination,
respectively, and will then be post-translationally removed.
Transit or signal peptides act by facilitating the transport of
proteins through intracellular membranes, e.g., vacuole, vesicle,
plastid and mitochondrial membranes, whereas signal peptides direct
proteins through the extracellular membrane.
A particular example of such a use concerns the direction of a
herbicide resistance gene, such as the EPSPS gene, to a particular
organelle such as the chloroplast rather than to the cytoplasm.
This is exemplified by the use of the rbcS transit peptide which
confers plastid-specific targeting of proteins. In addition, it is
proposed that it may be desirable to target certain genes
responsible for male sterility to the mitochondria, or to target
certain genes for resistance to phytopathogenic organisms to the
extracellular spaces, or to target proteins to the vacuole.
It is also contemplated that it may be useful to target DNA itself
within a cell. For example, it may be useful to target introduced
DNA to the nucleus as this may increase the frequency of
transformation. Within the nucleus itself it would be useful to
target a gene in order to achieve site specific integration. For
example, it would be useful to have an gene introduced through
transformation replace an existing gene in the cell.
B. Marker Genes
In order to improve the ability to identify transformants, one may
desire to employ a selectable or screenable marker gene as, or in
addition to, the expressible gene of interest. "Marker genes" are
genes that impart a distinct phenotype to cells expressing the
marker gene and thus allow such transformed cells to be
distinguished from cells that do not have the marker. Such genes
may encode either a selectable or screenable marker, depending on
whether the marker confers a trait which one can `select` for by
chemical means, i.e., through the use of a selective agent (e.g., a
herbicide, antibiotic, or the like), or whether it is simply a
trait that one can identify through observation or testing, i.e.,
by `screening` (e.g., the R-locus trait). Of course, many examples
of suitable marker genes are known to the art and can be employed
in the practice of the invention.
Included within the terms selectable or screenable marker genes are
also genes which encode a "secretable marker" whose secretion can
be detected as a means of identifying or selecting for transformed
cells. Examples include markers which encode a secretable antigen
that can be identified by antibody interaction, or even secretable
enzymes which can be detected by their catalytic activity.
Secretable proteins fall into a number of classes, including small,
diffusible proteins detectable, e.g., by ELISA; small active
enzymes detectable in extracellular solution (e.g.,
.alpha.-amylase, .beta.-lactamase, phosphinothricin
acetyltransferase); and proteins that are inserted or trapped in
the cell wall (e.g., proteins that include a leader sequence such
as that found in the expression unit of extensin or tobacco
PR-S).
With regard to selectable secretable markers, the use of a gene
that encodes a protein that becomes sequestered in the cell wall,
and which protein includes a unique epitope is considered to be
particularly advantageous. Such a secreted antigen marker would
ideally employ an epitope sequence that would provide low
background in plant tissue, a promoter-leader sequence that would
impart efficient expression and targeting across the plasma
membrane, and would produce protein that is bound in the cell wall
and yet accessible to antibodies. A normally secreted wall protein
modified to include a unique epitope would satisfy all such
requirements.
One example of a protein suitable for modification in this manner
is extensin, or hydroxyproline rich glycoprotein (HPRG). The use of
the maize HPRG (Steifel et al., 1990) which is preferred as this
molecule is well characterized in terms of molecular biology,
expression and protein structure. However, any one of a variety of
extensins and/or glycine-rich wall proteins (Keller et al., 1989)
could be modified by the addition of an antigenic site to create a
screenable marker.
One exemplary embodiment of a secretable screenable marker concerns
the use of the maize genomic clone encoding the wall protein HPRG,
modified to include the unique 15 residue epitope M A T V P E L N C
E M P P S D (SEQ ID NO: 1) from the pro-region of murine
interleukin-1-.beta. (IL-1-.beta.). However, virtually any
detectable epitope may be employed in such embodiments, as selected
from the extremely wide variety of antigen:antibody combinations
known to those of skill in the art. The unique extracellular
epitope, whether derived from IL-1-.beta. or any other protein or
epitopic substance, can then be straightforwardly detected using
antibody labeling in conjunction with chromogenic or fluorescent
adjuncts.
Elements of the present disclosure are exemplified in detail
through the use of the bar and/or GUS genes, and also through the
use of various other markers. Of course, in light of this
disclosure, numerous other possible selectable and/or screenable
marker genes will be apparent to those of skill in the art in
addition to the one set forth hereinbelow. Therefore, it will be
understood that the following discussion is exemplary rather than
exhaustive. In light of the techniques disclosed herein and the
general recombinant techniques which are known in the art, the
present invention renders possible the introduction of any gene,
including marker genes, into a recipient cell to generate a
transformed monocot.
1. Selectable Markers
Possible selectable markers for use in connection with the present
invention include, but are not limited to, a neo gene (Potrykus et
al., 1985) which codes for kanamycin resistance and can be selected
for using kanamycin, G418, etc.; a bar gene which codes for
bialaphos resistance; a mutant aroA gene which encodes an altered
EPSP synthase protein (Hinchee et al,, 1988) thus conferring
glyphosate resistance; a nitrilase gene such as bxn from Klebsiella
ozaenae which confers resistance to bromoxynil (Stalker et al.,
1988); a mutant acetolactate synthase gene (ALS) which confers
resistance to imidazolinone, sulfonylurea or other ALS inhibiting
chemicals (European Patent Application 154,204, 1985); a
methotrexate resistant DHFR gene (Thillet et al., 1988), or a
dalapon dehalogenase gene that confers resistance to the herbicide
dalapon; or a mutated anthranilate synthase gene that confers
resistance to 5-methyl tryptophan. Where a mutant EPSP synthase
gene is employed, additional benefit may be realized through the
incorporation of a suitable chloroplast transit peptide, CTP
(European Patent Application 0,218,571, 1987).
An illustrative embodiment of a selectable marker gene capable of
being used in systems to select transformants is the genes that
encode the enzyme phosphinothricin acetyltransferase, such as the
bar gene from Streptomyces hygroscopicus or the pat gene from
Streptomyces viridochromogenes. The enzyme phosphinothricin acetyl
transferase (PAT) inactivates the active ingredient in the
herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine
synthetase, (Murakami et al., 1986; Twell et al., 1989) causing
rapid accumulation of ammonia and cell death. The success of the
inventors in using this selective system in conjunction with
monocots was particularly surprising because of the major
difficulties which have been reported in transformation of cereals
(Potrykus, 1989).
Where one desires to employ a bialaphos resistance gene in the
practice of the invention, the inventors have discovered that a
particularly useful gene for this purpose is the bar or pat genes
obtainable from species of Streptomyces (e.g., ATCC No. 21,705).
The cloning of the bar gene has been described (Murakami et al.,
1986; Thompson et al., 1987) as has the use of the bar gene in the
context of plants other than monocots (De Block et al, 1987; De
Block et al., 1989).
2. Screenable Markers
Screenable markers that may be employed include a
.beta.-glucuronidase or uidA gene (GUS) which encodes an enzyme for
which various chromogenic substrates are known; an R-locus gene,
which encodes a product that regulates the production of
anthocyanin pigments (red color) in plant tissues (Dellaporta et
al., 1988); a .beta.-lactamase gene (Sutcliffe, 1978), which
encodes an enzyme for which various chromogenic substrates are
known (e.g., PADAC, a chromogenic cephalosporin); a xy/E gene
(Zukowsky et al., 1983) which encodes a catechol dioxygenase that
can convert chromogenic catechols; an .alpha.-amylase gene (Ikuta
et al., 1990); a tyrosinase gene (Katz et al., 1983) which encodes
an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone
which in turn condenses to form the easily-detectable compound
melanin; a .beta.-galactosidase gene, which encodes an enzyme for
which there are chromogenic substrates; a luciferase (lux) gene (Ow
et al., 1986), which allows for bioluminescence detection; or even
an aequorin gene (Prasher et al., 1985) which may be employed in
calcium-sensitive bioluminescence detection.
Genes from the maize R gene complex are contemplated to be
particularly useful as screenable markers. The R gene complex in
maize encodes a protein that acts to regulate the production of
anthocyanin pigments in most seed and plant tissue. Maize strains
can have one, or as many as four, R alleles which combine to
regulate pigmentation in a developmental and tissue specific
manner. The present inventors have applied a gene from the R gene
complex to maize transformation, because the expression of this
gene in transformed cells does not harm the cells. Thus, an R gene
introduced into such cells will cause the expression of a red
pigment and, if stably incorporated, can be visually scored as a
red sector. If a maize line is carries dominant alleles for genes
encoding the enzymatic intermediates in the anthocyanin
biosynthetic pathway (C2, A1, A2, Bz1 and Bz2), but carries a
recessive allele at the R locus, transformation of any cell from
that line with R will result in red pigment formation. Exemplary
lines include Wisconsin 22 which contains the rg-Stadler allele and
TR112, a K55 derivative which is r-g, b, PI. Alternatively any
genotype of maize can be utilized if the C1 and R alleles are
introduced together.
The inventors further propose that R gene regulatory regions may be
employed in chimeric constructs in order to provide mechanisms for
controlling the expression of chimeric genes. More diversity of
phenotypic expression is known at the R locus than at any other
locus (Coe et al., 1988). It is contemplated that regulatory
regions obtained from regions 5' to the structural R gene would be
valuable in directing the expression of genes for, e.g., insect
resistance, herbicide tolerance or other protein coding regions.
For the purposes of the present invention, it is believed that any
of the various R gene family members may be successfully employed
(e.g., P, S, Lc, etc.). However, the most preferred will generally
be Sn (particularly Sn:bol3). Sn is a dominant member of the R gene
complex and is functionally similar to the R and B loci in that Sn
controls the tissue specific deposition of anthocyanin pigments in
certain seedling and plant cells, therefore, its phenotype is
similar to R.
A further screenable marker contemplated for use in the present
invention is firefly luciferase, encoded by the lux gene. The
presence of the lux gene in transformed cells may be detected
using, for example, X-ray film, scintillation counting, fluorescent
spectrophotometry, low-light video cameras, photon counting cameras
or multiwell luminometry. It is also envisioned that this system
may be developed for populational screening for bioluminescence,
such as on tissue culture plates, or even for whole plant
screening.
C. Transgenes for Corn Modification
A particularly important advance of the present invention is that
it provides methods and compositions for the transformation of
plant cells with genes in addition to, or other than, marker genes.
Such transgenes will often be genes that direct the expression of a
particular protein or polypeptide product, but they may also be
non-expressible DNA segments, e.g., transposons such as Ds that do
no direct their own transposition. As used herein, an "expressible
gene" is any gene that is capable of being transcribed into RNA
(e.g., mRNA, antisense RNA, etc.) or translated into a protein,
expressed as a trait of interest, or the like, etc., and is not
limited to selectable, screenable or non-selectable marker genes.
The invention also contemplates that, where both an expressible
gene that is not necessarily a marker gene is employed in
combination with a marker gene, one may employ the separate genes
on either the same or different DNA segments for transformation. In
the latter case, the different vectors are delivered concurrently
to recipient cells to maximize cotransformation.
The choice of the particular DNA segments to be delivered to the
recipient cells will often depend on the purpose of the
transformation. One of the major purposes of transformation of crop
plants is to add some commercially desirable, agronomically
important traits to the plant. Such traits include, but are not
limited to, herbicide resistance or tolerance; insect resistance or
tolerance; disease resistance or tolerance (viral, bacterial,
fungal, nematode); stress tolerance and/or resistance, as
exemplified by resistance or tolerance to drought, heat, chilling,
freezing, excessive moisture, salt stress; oxidative stress;
increased yields; food content and makeup; physical appearance;
male sterility; drydown; standability; prolificacy; starch
properties; oil quantity and quality; and the like. One may desire
to incorporate one or more genes conferring any such desirable
trait or traits, such as, for example, a gene or genes encoding
herbicide resistance.
In certain embodiments, the present invention contemplates the
transformation of a recipient cell with more than one advantageous
transgene. Two or more transgenes can be supplied in a single
transformation event using either distinct transgene-encoding
vectors, or using a single vector incorporating two or more gene
coding sequences. For example, plasmids bearing the bar and aroA
expression units in either convergent, divergent, or colinear
orientation, are considered to be particularly useful. Further
preferred combinations are those of an insect resistance gene, such
as a Bt gene, along with a protease inhibitor gene such as pinII,
or the use of bar in combination with either of the above genes. Of
course, any two or more transgenes of any description, such as
those conferring herbicide, insect, disease (viral, bacterial,
fungal, nematode) or drought resistance, male sterility, drydown,
standability, prolificacy, starch properties, oil quantity and
quality, or those increasing yield or nutritional quality may be
employed as desired.
1. Herbicide Resistance
The genes encoding phosphinothricin acetyltransferase (bar and
pat), glyphosate tolerant EPSP synthase genes, the glyphosate
degradative enzyme gene gox encoding glyphosate oxidoreductase, deh
(encoding a dehalogenase enzyme that inactivates dalapon),
herbicide resistant (e.g., sulfonylurea and imidazolinone)
acetolactate synthase, and bxn genes (encoding a nitrilase enzyme
that degrades bromoxynil) are good examples of herbicide resistant
genes for use in transformation. The bar and pat genes code for an
enzyme, phoshinothricin acetyltransferase (PAT), which inactivates
the herbicide phosphinothricin and prevents this compound from
inhibiting glutamine synthetase enzymes. The enzyme
5-enolpyruvylshikimate 3-phosphate synthase (EPSP Synthase), is
normally inhibited by the herbicide N-(phosphonomethyl)glycine
(glyphosate). However, genes are known that encode
glyphosate-resistant EPSP Synthase enzymes. These genes are
particularly contemplated for use in monocot transformation. The
deh gene encodes the enzyme dalapon dehalogenase and confers
resistance to the herbicide dalapon. The bxn gene codes for a
specific nitrilase enzyme that converts bromoxynil to a
non-herbicidal degradation product.
2. Insect Resistance
An important aspect of the present invention concerns the
introduction of insect resistance-conferring genes into
monocotyledonous plants such as maize. Potential insect resistance
genes which can be introduced include Bacillus thuringiensis
crystal toxin genes or Bt genes (Watrud et al., 1985). Bt genes may
provide resistance to lepidopteran or coleopteran pests such as
European Corn Borer (ECB). Preferred Bt toxin genes for use in such
embodiments include the CrylA(b) and CrylA(c) genes. Endotoxin
genes from other species of B. thuringiensis which affect insect
growth or development may also be employed in this regard.
The poor expression of procaryotic Bt toxin genes in plants is a
well-documented phenomenon, and the use of different promoters,
fusion proteins, and leader sequences has not led to significant
increases in Bt protein expression (Vaeck et al., 1989; Barton et
al., 1987). It is therefore contemplated that the most advantageous
Bt genes for use in the transformation protocols disclosed herein
will be those in which the coding sequence has been modified to
effect increased expression in plants, and more particularly, those
in which maize preferred codons have been used. Examples of such
modified Bt toxin genes include the variant Bt CrylA(b) gene termed
lAb6 (Perlak et al., 1991) and the synthetic CrylA(c) genes termed
1800a and 1800b.
Protease inhibitors may also provide insect resistance (Johnson et
al., 1989), and will thus have utility in maize transformation. The
use of a protease inhibitor II gene, pinII, from tomato or potato
is envisioned to be particularly useful. Even more advantageous is
the use of a pinII gene in combination with a Bt toxin gene, the
combined effect of which has been discovered by the present
inventors to produce synergistic insecticidal activity. Other genes
which encode inhibitors of the insects' digestive system, or those
that encode enzymes or co-factors that facilitate the production of
inhibitors, may also be useful. This group may be exemplified by
oryzacystatin and amylase inhibitors such as those from wheat and
barley.
Also, genes encoding lectins may confer additional or alternative
insecticide properties. Lectins (originally termed
phytohemagglutinins) are multivalent carbohydrate-binding proteins
which have the ability to agglutinate red blood cells from a range
of species. Lectins have been identified recently as insecticidal
agents with activity against weevils, ECB and rootworm (Murdock et
al., 1990; Czapla & Lang, 1990). Lectin genes contemplated to
be useful include, for example, barley and wheat germ agglutinin
(WGA) and rice lectins (Gatehouse et al., 1984), with WGA being
preferred.
Genes controlling the production of large or small polypeptides
active against insects when introduced into the insect pests, such
as, e.g., lytic peptides, peptide hormones and toxins and venoms,
form another aspect of the invention. For example, it is
contemplated that the expression of juvenile hormone esterase,
directed towards specific insect pests, may also result in
insecticidal activity, or perhaps cause cessation of metamorphosis
(Hammock et al., 1990).
Transgenic maize expressing genes which encode enzymes that affect
the integrity of the insect cuticle form yet another aspect of the
invention. Such genes include those encoding, e.g., chitinase,
proteases, lipases and also genes for the production of nikkomycin,
a compound that inhibits chitin synthesis, the introduction of any
of which is contemplated to produce insect resistant maize plants.
Genes that code for activities that affect insect molting, such
those affecting the production of ecdysteroid UDP-glucosyl
transferase, also fall within the scope of the useful transgenes of
the present invention.
Genes that code for enzymes that facilitate the production of
compounds that reduce the nutritional quality of the host plant to
insect pests are also encompassed by the present invention. It may
be possible, for instance, to confer insecticidal activity on a
plant by altering its sterol composition. Sterols are obtained by
insects from their diet and are used for hormone synthesis and
membrane stability. Therefore alterations in plant sterol
composition by expression of novel genes, e.g., those that directly
promote the production of undesirable sterols or those that convert
desirable sterols into undesirable forms, could have a negative
effect on insect growth and/or development and hence endow the
plant with insecticidal activity. Lipoxygenases are naturally
occurring plant enzymes that have been shown to exhibit
anti-nutritional effects on insects and to reduce the nutritional
quality of their diet. Therefore, further embodiments of the
invention concern transgenic plants with enhanced lipoxygenase
activity which may be resistant to insect feeding.
The present invention also provides methods and compositions by
which to achieve qualitative or quantitative changes in plant
secondary metabolites. One example concerns transforming maize to
produce DIMBOA which, it is contemplated, will confer resistance to
European corn borer, rootworm and several other maize insect pests.
Candidate genes that are particularly considered for use in this
regard include those genes at the bx locus known to be involved in
the synthetic DIMBOA pathway (Dunn et al., 1981). The introduction
of genes that can regulate the production of maysin, and genes
involved in the production of dhurrin in sorghum, is also
contemplated to be of use in facilitating resistance to earworm and
rootworm, respectively.
Tripsacum dactyloides is a species of grass that is resistant to
certain insects, including corn root worm. It is anticipated that
genes encoding proteins that are toxic to insects or are involved
in the biosynthesis of compounds toxic to insects will be isolated
from Tripsacum and that these novel genes will be useful in
conferring resistance to insects. It is known that the basis of
insect resistance in Tripsacum is genetic, because said resistance
has been transferred to Zea mays via sexual crosses (Branson and
Guss, 1972).
Further genes encoding proteins characterized as having potential
insecticidal activity may also be used as transgenes in accordance
herewith. Such genes include, for example, the cowpea trypsin
inhibitor (CpTI; Hilder et al., 1987) which may be used as a
rootworm deterrent; genes encoding avermectin (Avermectin and
Abamectin., Campbell, W. C., Ed., 1989; Ikeda et al., 1987) which
may prove particularly useful as a corn rootworm deterrent;
ribosome inactivating protein genes; and even genes that regulate
plant structures. Transgenic maize including anti-insect antibody
genes and genes that code for enzymes that can covert a non-toxic
insecticide (pro-insecticide) applied to the outside of the plant
into an insecticide inside the plant are also contemplated.
3. Environment or Stress Resistance
Improvement of corn's ability to tolerate various environmental
stresses such as, but not limited to, drought, excess moisture,
chilling, freezing, high temperature, salt, and oxidative stress,
can also be effected through expression of novel genes. It is
proposed that benefits may be realized in terms of increased
resistance to freezing temperatures through the introduction of an
"antifreeze" protein such as that of the Winter Flounder (Cutler et
al., 1989) or synthetic gene derivatives thereof. Improved chilling
tolerance may also be conferred through increased expression of
glycerol-3-phosphate acetyltransferase in chloroplasts (Murata et
al., 1992; Wolter et al., 1992). Resistance to oxidative stress
(often exacerbated by conditions such as chilling temperatures in
combination with high light intensities) can be conferred by
expression of superoxide dismutase (Gupta et al., 1993), and may be
improved by glutathione reductase (Bowler et al., 1992). Such
strategies may allow for tolerance to freezing in newly emerged
fields as well as extending later maturity higher yielding
varieties to earlier relative maturity zones.
It is contemplated that the expression of novel genes that
favorably effect plant water content, total water potential,
osmotic potential, and turgor will enhance the ability of the plant
to tolerate drought. As used herein, the terms "drought resistance"
and "drought tolerance" are used to refer to a plants increased
resistance or tolerance to stress induced by a reduction in water
availability, as compared to normal circumstances, and the ability
of the plant to function and survive in lower-water environments.
In this aspect of the invention it is proposed, for example, that
the expression of genes encoding for the biosynthesis of
osmotically-active solutes, such as polyol compounds, may impart
protection against drought. Within this class are genes encoding
for mannitol dehydrogenase (Lee and Saier, 1982) and
trehalose-6-phosphate synthase (Kaasen et al., 1992). Through the
subsequent action of native phosphatases in the cell or by the
introduction and coexpression of a specific phosphatase, these
introduced genes will result in the accumulation of either mannitol
or trehalose, respectively, both of which have been well documented
as protective compounds able to mitigate the effects of stress.
Mannitol accumulation in transgenic tobacco has been verified and
preliminary results indicate that plants expressing high levels of
this metabolite are able to tolerate an applied osmotic stress
(Tarczynski et al., 1992, 1993).
Similarly, the efficacy of other metabolites in protecting either
enzyme function (e.g. alanopine or propionic acid) or membrane
integrity (e.g., alanopine) has been documented (Loomis et al.,
1989), and therefore expression of genes encoding for the
biosynthesis of these compounds might confer drought resistance in
a manner similar to or complimentary to mannitol. Other examples of
naturally occurring metabolites that are osmotically active and/or
provide some direct protective effect during drought and/or
desiccation include fructose, erythritol (Coxson et al., 1992),
sorbitol, dulcitol (Karsten et al., 1992), glucosylglycerol (Reed
et al., 1984; ErdMann et al., 1992), sucrose, stachyose (Koster and
Leopold, 1988; Blackman et al., 1992), raffinose (Bernal-Lugo and
Leopold, 1992), proline (Rensburg et al., 1993) and glycinebetaine
(Wyn-Jones and Storey, 1982), ononitol and pinitol (Vernon and
Bohnert, 1992). Continued canopy growth and increased reproductive
fitness during times of stress will be augmented by introduction
and expression of genes such as those controlling the osmotically
active compounds discussed above and other such compounds.
Currently preferred genes which promote the synthesis of an
osmotically active polyol compound are genes which encode the
enzymes mannitol-1-phosphate dehydrogenase, trehalose-6-phosphate
synthase and myoinositol 0-methyltransferase.
It is contemplated that the expression of specific proteins may
also increase drought tolerance. Three classes of Late Embryogenic
Proteins have been assigned based on structural similarities (see
Dure et al., 1989). All three classes of LEAs have been
demonstrated in maturing (i.e. desiccating) seeds. Within these 3
types of LEA proteins, the Type-II (dehydrin-type) have generally
been implicated in drought and/or desiccation tolerance in
vegetative plant parts (i.e. Mundy and Chua, 1988; Piatkowski et
al., 1990; Yamaguchi-Shinozaki et al., 1992). Recently, expression
of a Type-III LEA (HVA-1) in tobacco was found to influence plant
height, maturity and drought tolerance (Fitzpatrick, 1993).
Expression of structural genes from all three LEA groups may
therefore confer drought tolerance. Other types of proteins induced
during water stress include thiol proteases, aldolases and
transmembrane transporters (Guerrero et al., 1990), which may
confer various protective and/or repair-type functions during
drought stress. It is also contemplated that genes that effect
lipid biosynthesis and hence membrane composition might also be
useful in conferring drought resistance on the plant.
Many of these genes for improving drought resistance have
complementary modes of action. Thus, it is envisaged that
combinations of these genes might have additive and/or synergistic
effects in improving drought resistance in corn. Many of these
genes also improve freezing tolerance (or resistance); the physical
stresses incurred during freezing and drought are similar in nature
and may be mitigated in similar fashion. Benefit may be conferred
via constitutive expression of these genes, but the preferred means
of expressing these novel genes may be through the use of a
turgor-induced promoter (such as the promoters for the
turgor-induced genes described in Guerrero et al., 1987 and Shagan
et al., 1993 which are incorporated herein by reference). Spatial
and temporal expression patterns of these genes may enable corn to
better withstand stress.
It is proposed that expression of genes that are involved with
specific morphological traits that allow for increased water
extractions from drying soil would be of benefit. For example,
introduction and expression of genes that alter root
characteristics may enhance water uptake. It is also contemplated
that expression of genes that enhance reproductive fitness during
times of stress would be of significant value. For example,
expression of genes that improve the synchrony of pollen shed and
receptiveness of the female flower parts, i.e., silks, would be of
benefit. In addition it is proposed that expression of genes that
minimize kernel abortion during times of stress would increase the
amount of grain to be harvested and hence be of value.
Given the overall role of water in determining yield, it is
contemplated that enabling corn to utilize water more efficiently,
through the introduction and expression of novel genes, will
improve overall performance even when soil water availability is
not limiting. By introducing genes that improve the ability of corn
to maximize water usage across a full range of stresses relating to
water availability, yield stability or consistency of yield
performance may be realized.
4. Disease Resistance
It is proposed that increased resistance to diseases may be
realized through introduction of genes into monocotyledonous plants
such as maize. It is possible to produce resistance to diseases
caused by viruses, bacteria, fungi and nematodes. It is also
contemplated that control of mycotoxin producing organisms may be
realized through expression of introduced genes.
Resistance to viruses may be produced through expression of novel
genes. For example, it has been demonstrated that expression of a
viral coat protein in a transgenic plant can impart resistance to
infection of the plant by that virus and perhaps other closely
related viruses (Cuozzo et al., 1988, Hemenway et al., 1988, Abel
et al., 1986). It is contemplated that expression of antisense
genes targeted at essential viral functions may impart resistance
to said virus. For example, an antisense gene targeted at the gene
responsible for replication of viral nucleic acid may inhibit said
replication and lead to resistance to the virus. It is believed
that interference with other viral functions through the use of
antisense genes may also increase resistance to viruses. Further it
is proposed that it may be possible to achieve resistance to
viruses through other approaches, including, but not limited to the
use of satellite viruses.
It is proposed that increased resistance to diseases caused by
bacteria and fungi may be realized through introduction of novel
genes. It is contemplated that genes encoding so-called "peptide
antibiotics," pathogenesis related (PR) proteins, toxin resistance,
and proteins affecting host-pathogen interactions such as
morphological characteristics will be useful. Peptide antibiotics
are polypeptide sequences which are inhibitory to growth of
bacteria and other microorganisms. For example, the classes of
peptides referred to as cecropins and magainins inhibit growth of
many species of bacteria and fungi. It is proposed that expression
of PR proteins in monocotyledonous plants such as maize may be
useful in conferring resistance to bacterial disease. These genes
are induced following pathogen attack on a host plant and have been
divided into at least five classes of proteins (Bol, Linthorst, and
Cornelissen, 1990). Included amongst the PR proteins are .beta.-1,
3-glucanases, chitinases, and osmotin and other proteins that are
believed to function in plant resistance to disease organisms.
Other genes have been identified that have antifungal properties,
e.g., UDA (stinging nettle lectin) and hevein (Broakaert et al.,
1989; Barkai-Golan et al., 1978). It is known that certain plant
diseases are caused by the production of phytotoxins. It is
proposed that resistance to these diseases would be achieved
through expression of a novel gene that encodes an enzyme capable
of degrading or otherwise inactivating the phytotoxin. It is also
contemplated that expression novel genes that alter the
interactions between the host plant and pathogen may be useful in
reducing the ability the disease organism to invade the tissues of
the host plant, e.g., an increase in the waxiness of the leaf
cuticle or other morphological characteristics.
Plant parasitic nematodes are a cause of disease in many plants,
including maize. It is proposed that it would be possible to make
the corn plant resistant to these organisms through the expression
of novel genes. It is anticipated that control of nematode
infestations would be accomplished by altering the ability of the
nematode to recognize or attach to a host plant and/or enabling the
plant to produce nematicidal compounds, including but not limited
to proteins.
5. Mycotoxin Reduction/Elimination
Production of mycotoxins, including aflatoxin and fumonisin, by
fungi associated with monocotyledonous plants such as maize is a
significant factor in rendering the grain not useful. These fungal
organisms do not cause disease symptoms and/or interfere with the
growth of the plant, but they produce chemicals (mycotoxins) that
are toxic to animals. It is contemplated that inhibition of the
growth of these fungi would be reduce the synthesis of these toxic
substances and therefore reduce grain losses due to mycotoxin
contamination. It is also proposed that it may be possible to
introduce novel genes into monocotyledonous plants such as maize
that would inhibit synthesis of the mycotoxin without interfering
with fungal growth. Further, it is contemplated that expression of
a novel gene which encodes an enzyme capable of rendering the
mycotoxin nontoxic would be useful in order to achieve reduced
mycotoxin contamination of grain. The result of any of the above
mechanisms would be a reduced presence of mycotoxins on grain.
6. Grain Composition or Quality
Genes may be introduced into monocotyledonous plants, particularly
commercially important cereals such as maize, to improve the grain
for which the cereal is primarily grown. A wide range of novel
transgenic plants produced in this manner may be envisioned
depending on the particular end use of the grain.
The largest use of maize grain is for feed or food. Introduction of
genes that alter the composition of the grain may greatly enhance
the feed or food value. The primary components of maize grain are
starch, protein, and oil. Each of these primary components of maize
grain may be improved by altering its level or composition. Several
examples may be mentioned for illustrative purposes but in no way
provide an exhaustive list of possibilities.
The protein of cereal grains including maize is suboptimal for feed
and food purposes especially when fed to pigs, poultry, and humans.
The protein is deficient in several amino acids that are essential
in the diet of these species, requiring the addition of supplements
to the grain. Limiting essential amino acids may include lysine,
methionine, tryptophan, threonine, valine, arginine, and histidine.
Some amino acids become limiting only after corn is supplemented
with other inputs for feed formulations. For example, when corn is
supplemented with soybean meal to meet lysine requirements
methionine becomes limiting. The levels of these essential amino
acids in seeds and grain may be elevated by mechanisms which
include, but are not limited to, the introduction of genes to
increase the biosynthesis of the amino acids, decrease the
degradation of the amino acids, increase the storage of the amino
acids in proteins, or increase transport of the amino acids to the
seeds or grain.
One mechanism for increasing the biosynthesis of the amino acids is
to introduce genes that deregulate the amino acid biosynthetic
pathways such that the plant can no longer adequately control the
levels that are produced. This may be done by deregulating or
bypassing steps in the amino acid biosynthetic pathway which are
normally regulated by levels of the amino acid end product of the
pathway. Examples include the introduction of genes that encode
deregulated versions of the enzymes aspartokinase or
dihydrodipicolinic acid (DHDP)-synthase for increasing lysine and
threonine production, and anthranilate synthase for increasing
tryptophan production. Reduction of the catabolism of the amino
acids may be accomplished by introduction of DNA sequences that
reduce or eliminate the expression of genes encoding enzymes that
catalyze steps in the catabolic pathways such as the enzyme
lysine-ketoglutarate reductase.
The protein composition of the grain may be altered to improve the
balance of amino acids in a variety of ways including elevating
expression of native proteins, decreasing expression of those with
poor composition, changing the composition of native proteins, or
introducing genes encoding entirely new proteins possessing
superior composition. Examples may include the introduction of DNA
that decreases the expression of members of the zein family of
storage proteins. This DNA may encode ribozymes or antisense
sequences directed to impairing expression of zein proteins or
expression of regulators of zein expression such as the opaque-2
gene product. It is also proposed that the protein composition of
the grain may be modified through the phenomenon of cosupression,
i.e., inhibition of expression of an endogenous gene through the
expression of an identical structural gene or gene fragment
introduced through transformation (Goring et al., 1991).
Additionally, the introduced DNA may encode enzymes which degrade
zeins. The decreases in zein expression that are achieved may be
accompanied by increases in proteins with more desirable amino acid
composition or increases in other major seed constituents such as
starch. Alternatively, a chimeric gene may be introduced that
comprises a coding sequence for a native protein of adequate amino
acid composition such as for one of the globulin proteins or 10 kD
zein of maize and a promoter or other regulatory sequence designed
to elevate expression of said protein. The coding sequence of said
gene may include additional or replacement codons for essential
amino acids. Further, a coding sequence obtained from another
species, or, a partially or completely synthetic sequence encoding
a completely unique peptide sequence designed to enhance the amino
acid composition of the seed may be employed.
The introduction of genes that alter the oil content of the grain
may be of value. Increases in oil content may result in increases
in metabolizable-energy-content and -density of the seeds for uses
in feed and food. The introduced genes may encode enzymes that
remove or reduce rate-limitations or regulated steps in fatty acid
or lipid biosynthesis. Such genes may include, but are not limited
to, those that encode acetyl-CoA carboxylase, ACP-acyltransferase,
.beta.-ketoacyl-ACP synthase, plus other well known fatty acid
biosynthetic activities. Other possibilities are genes that encode
proteins that do not possess enzymatic activity such as acyl
carrier protein. Genes may be introduced that alter the balance of
fatty acids present in the oil providing a more healthful or
nutritive feedstuff. The introduced DNA may also encode sequences
that block expression of enzymes involved in fatty acid
biosynthesis, altering the proportions of fatty acids present in
the grain such as described below.
Genes may be introduced that enhance the nutritive value of the
starch component of the grain, for example by increasing the degree
of branching, resulting in improved utilization of the starch in
cows by delaying its metabolism.
Besides affecting the major constituents of the grain, genes may be
introduced that affect a variety of other nutritive, processing, or
other quality aspects of the grain as used for feed or food. For
example, pigmentation of the grain may be increased or decreased.
Enhancement and stability of yellow pigmentation is desirable in
some animal feeds and may be achieved by introduction of genes that
result in enhanced production of xanthophylls and carotenes by
eliminating rate-limiting steps in their production. Such genes may
encode altered forms of the enzymes phytoene synthase, phytoene
desaturase, or lycopene synthase. Alternatively, unpigmented white
corn is desirable for production of many food products and may be
produced by the introduction of DNA which blocks or eliminates
steps in pigment production pathways.
Feed or food comprising primarily maize or other cereal grains
possesses insufficient quantities of vitamins and must be
supplemented to provide adequate nutritive value. Introduction of
genes that enhance vitamin biosynthesis in seeds may be envisioned
including, for example, vitamins A, E, B.sub.12, choline, and the
like. Maize grain also does not possess sufficient mineral content
for optimal nutritive value. Genes that affect the accumulation or
availability of compounds containing phosphorus, sulfur, calcium,
manganese, zinc, and iron among others would be valuable. An
example may be the introduction of a gene that reduced phytic acid
production or encoded the enzyme phytase which enhances phytic acid
breakdown. These genes would increase levels of available phosphate
in the diet, reducing the need for supplementation with mineral
phosphate.
Numerous other examples of improvement of maize or other cereals
for feed and food purposes might be described. The improvements may
not even necessarily involve the grain, but may, for example,
improve the value of the corn for silage. Introduction of DNA to
accomplish this might include sequences that alter lignin
production such as those that result in the "brown midrib"
phenotype associated with superior feed value for cattle.
In addition to direct improvements in feed or food value, genes may
also be introduced which improve the processing of corn and improve
the value of the products resulting from the processing. The
primary method of processing corn is via wetmilling. Maize may be
improved though the expression of novel genes that increase the
efficiency and reduce the cost of processing such as by decreasing
steeping time.
Improving the value of wetmilling products may include altering the
quantity or quality of starch, oil, corn gluten meal, or the
components of corn gluten feed. Elevation of starch may be achieved
through the identification and elimination of rate limiting steps
in starch biosynthesis or by decreasing levels of the other
components of the grain resulting in proportional increases in
starch. An example of the former may be the introduction of genes
encoding ADP-glucose pyrophosphorylase enzymes with altered
regulatory activity or which are expressed at higher level.
Examples of the latter may include selective inhibitors of, for
example, protein or oil biosynthesis expressed during later stages
of kernel development.
The properties of starch may be beneficially altered by changing
the ratio of amylose to amylopectin, the size of the starch
molecules, or their branching pattern. Through these changes a
broad range of properties may be modified which include, but are
not limited to, changes in gelatinization temperature, heat of
gelatinization, clarity of films and pastes, rheological
properties, and the like. To accomplish these changes in
properties, genes that encode granule-bound or soluble starch
synthase activity or branching enzyme activity may be introduced
alone or combination. DNA such as antisense constructs may also be
used to decrease levels of endogenous activity of these enzymes.
The introduced genes or constructs may possess regulatory sequences
that time their expression to specific intervals in starch
biosynthesis and starch granule development. Furthermore, it may be
worthwhile to introduce and express genes that result in the in
vivo derivatization, or other modification, of the glucose moieties
of the starch molecule. The covalent attachment of any molecule may
be envisioned, limited only by the existence of enzymes that
catalyze the derivatizations and the accessibility of appropriate
substrates in the starch granule. Examples of important derivations
may include the addition of functional groups such as amines,
carboxyls, or phosphate groups which provide sites for subsequent
in vitro derivatizations or affect starch properties through the
introduction of ionic charges. Examples of other modifications may
include direct changes of the glucose units such as loss of
hydroxyl groups or their oxidation to aldehyde or carboxyl
groups.
Oil is another product of wetmilling of corn, the value of which
may be improved by introduction and expression of genes. The
quantity of oil that can be extracted by wetmilling may be elevated
by approaches as described for feed and food above. Oil properties
may also be altered to improve its performance in the production
and use of cooking oil, shortenings, lubricants or other
oil-derived products or improvement of its health attributes when
used in the food-related applications. Novel fatty acids may also
be synthesized which upon extraction can serve as starting
materials for chemical syntheses. The changes in oil properties may
be achieved by altering the type, level, or lipid arrangement of
the fatty acids present in the oil. This in turn may be
accomplished by the addition of genes that encode enzymes that
catalyze the synthesis of novel fatty acids and the lipids
possessing them or by increasing levels of native fatty acids while
possibly reducing levels of precursors. Alternatively DNA sequences
may be introduced which slow or block steps in fatty acid
biosynthesis resulting in the increase in precursor fatty acid
intermediates. Genes that might be added include desaturases,
epoxidases, hydratases, dehydratases, and other enzymes that
catalyze reactions involving fatty acid intermediates.
Representative examples of catalytic steps that might be blocked
include the desaturations from stearic to oleic acid and oleic to
linolenic acid resulting in the respective accumulations of stearic
and oleic acids. Another example is the blockage of elongation
steps resulting in the accumulation of c.sub.8 to c.sub.12
saturated fatty acids.
Improvements in the other major corn wetmilling products, corn
gluten meal and corn gluten feed, may also be achieved by the
introduction of genes to obtain novel corn plants. Representative
possibilities include but are not limited to those described above
for improvement of food and feed value.
In addition it may further be considered that the corn plant be
used for the production or manufacturing of useful biological
compounds that were either not produced at all, or not produced at
the same level, in the corn plant previously. The novel corn plants
producing these compounds are made possible by the introduction and
expression of genes by corn transformation methods. The vast array
of possibilities include but are not limited to any biological
compound which is presently produced by any organism such as
proteins, nucleic acids, primary and intermediary metabolites,
carbohydrate polymers, etc. The compounds may be produced by the
plant, extracted upon harvest and/or processing, and used for any
presently recognized useful purpose such as pharmaceuticals,
fragrances, industrial enzymes to name a few.
Further possibilities to exemplify the range of grain traits or
properties potentially encoded by introduced genes in transgenic
plants include grain with less breakage susceptibility for export
purposes or larger grit size when processed by dry milling through
introduction of genes that enhance .gamma.-zein synthesis, popcorn
with improved popping quality and expansion volume through genes
that increase pericarp thickness, corn with whiter grain for food
uses though introduction of genes that effectively block expression
of enzymes involved in pigment production pathways, and improved
quality of alcoholic beverages or sweet corn through introduction
of genes which affect flavor such as the shrunken gene (encoding
sucrose synthase) for sweet corn.
7. Plant Agronomic Characteristics
Two of the factors determining where corn can be grown are the
average daily temperature during the growing season and the length
of time between frosts. Within the areas where it is possible to
grow corn, there are varying limitations on the maximal time it is
allowed to grow to maturity and be harvested. The corn to be grown
in a particular area is selected for its ability to mature and dry
down to harvestable moisture content within the required period of
time with maximum possible yield. Therefore, corn of varying
maturities is developed for different growing locations. Apart from
the need to dry down sufficiently to permit harvest is the
desirability of having maximal drying take place in the field to
minimize the amount of energy required for additional drying
post-harvest. Also the more readily the grain can dry down, the
more time there is available for growth and kernel fill. It is
considered that genes that influence maturity and/or dry down can
be identified and introduced into corn lines using transformation
techniques to create new corn varieties adapted to different
growing locations or the same growing location but having improved
yield to moisture ratio at harvest. Expression of genes that are
involved in regulation of plant development may be especially
useful, e.g., the liguleless and rough sheath genes that have been
identified in corn.
It is contemplated that genes may be introduced into corn that
would improve standability and other plant growth characteristics.
Expression of novel genes which confer stronger stalks, improved
root systems, or prevent or reduce ear droppage would be of great
value to the farmer. It is proposed that introduction and
expression of genes that increase the total amount of
photoassimilate available by, for example, increasing light
distribution and/or interception would be advantageous. In addition
the expression of genes that increase the efficiency of
photosynthesis and/or the leaf canopy would further increase gains
in productivity. Such approaches would allow for increased plant
populations in the field.
Delay of late season vegetative senescence would increase the flow
of assimilate into the grain and thus increase yield. It is
proposed that overexpression of genes within corn that are
associated with "stay green" or the expression of any gene that
delays senescence would achieve be advantageous. For example, a
nonyellowing mutant has been identified in Festuca pratensis
(Davies et al., 1990). Expression of this gene as well as others
may prevent premature breakdown of chlorophyll and thus maintain
canopy function.
8. Nutrient Utilization
The ability to utilize available nutrients may be a limiting factor
in growth of monocotyledonous plants such as maize. It is proposed
that it would be possible to alter nutrient uptake, tolerate pH
extremes, mobilization through the plant, storage pools, and
availability for metabolic activities by the introduction of novel
genes. These modifications would allow a plant such as maize to
more efficiently utilize available nutrients. it is contemplated
that an increase in the activity of, for example, an enzyme that is
normally present in the plant and involved in nutrient utilization
would increase the availability of a nutrient. An example of such
an enzyme would be phytase. It is also contemplated that expression
of a novel gene may make a nutrient source available that was
previously not accessible, e.g., an enzyme that releases a
component of nutrient value from a more complex molecule, perhaps a
macromolecule.
9. Male Sterility
Male sterility is useful in the production of hybrid seed. It is
proposed that male sterility may be produced through expression of
novel genes. For example, it has been shown that expression of
genes that encode proteins that interfere with development of the
male inflorescence and/or gametophyte result in male sterility.
Chimeric ribonuclease genes that express in the anthers of
transgenic tobacco and oilseed rape have been demonstrated to lead
to male sterility (Mariani et al, 1990).
A number of mutations were discovered in maize that confer
cytoplasmic male sterility. One mutation in particular, referred to
as T cytoplasm, also correlates with sensitivity to Southern corn
leaf blight. A DNA sequence, designated TURF-13 (Levings, 1990),
was identified that correlates with T cytoplasm. It is proposed
that it would be possible through the introduction of TURF-13 via
transformation to separate male sterility from disease sensitivity.
As it is necessary to be able to restore male fertility for
breeding purposes and for grain production it is proposed that
genes encoding restoration of male fertility may also be
introduced.
10. Negative Selectable Markers
Introduction of genes encoding traits that can be selected against
may be useful for eliminating undesirable linked genes. It is
contemplated that when two or more genes are introduced together by
cotransformation that the genes will be linked together on the host
chromosome. For example, a gene encoding a Bt gene that confers
insect resistance on the plant may be introduced into a plant
together with a bar gene that is useful as a selectable marker and
confers resistance to the herbicide IGNITE.RTM. (phosphinothricin)
on the plant. However, it may not be desirable to have an insect
resistant plant that is also resistant to the herbicide
IGNITE.RTM.. It is proposed that one could also introduce an
antisense bar gene that is expressed in those tissues where one
does not want expression of the bar gene, e.g., in whole plant
parts. Hence, although the bar gene is expressed and is useful as a
selectable marker, it is not useful to confer herbicide resistance
on the whole plant. The bar antisense gene is a negative selectable
marker.
It is also contemplated that a negative selection is necessary in
order to screen a population of transformants for rare homologous
recombinants generated through gene targeting. For example, a
homologous recombinant may be identified through the inactivation
of a gene that was previously expressed in that cell. The antisense
gene to neomycin phosphotransferase II (nptII) has been
investigated as a negative selectable marker in tobacco (Nicotiana
tabacum) and Arabidopsis thaliana (Xiang, C. and Guerra, D. J.
1993). In this example both sense and antisense npt II genes are
introduced into a plant through transformation and the resultant
plants are sensitive to the antibiotic kanamycin. An introduced
gene that integrates into the host cell chromosome at the site of
the antisense nptII gene, and inactivates the antisense gene, will
make the plant resistant to kanamycin and other aminoglycoside
antibiotics. Therefore, rare site specific recombinants may be
identified by screening for antibiotic resistance. Similarly, any
gene, native to the plant or introduced through transformation,
that when inactivated confers resistance to a compound, may be
useful as a negative selectable marker.
It is contemplated that negative selectable markers may also be
useful in other ways. One application is to construct transgenic
lines in which one could select for transposition to unlinked
sites. In the process of tagging it is most common for the
transposable element to move to a genetically linked site on the
same chromosome. A selectable marker for recovery of rare plants in
which transposition has occurred to an unlinked locus would be
useful. For example, the enzyme cytosine deaminase may be useful
for this purpose (Stouggard, J., 1993). In the presence of this
enzyme the compound 5-fluorocytosine is converted to 5-fluorouracil
which is toxic to plant and animal cells. If a transposable element
is linked to the gene for the enzyme cytosine deaminase, one may
select for transposition to unlinked sites by selecting for
transposition events in which the resultant plant is now resistant
to 5-fluorocytosine. The parental plants and plants containing
transpositions to linked sites will remain sensitive to
5-fluorocytosine. Resistance to 5-fluorocytosine is due to loss of
the cytosine deaminase gene through genetic segregation of the
transposable element and the cytosine deaminase gene. Other genes
that encode proteins that render the plant sensitive to a certain
compound will also be useful in this context. For example, T-DNA
gene 2 from Agrobacterium tumefaciens encodes a protein that
catalyzes the conversion of .alpha.-naphthalene acetamide (NAM) to
.alpha.-naphthalene acetic acid (NAA) renders plant cells sensitive
to high concentrations of NAM (Depicker et al., 1988).
It is also contemplated that negative selectable markers may be
useful in the construction of transposon tagging lines. For
example, by marking an autonomous transposable element such as Ac,
Master Mu, or En/Spn with a negative selectable marker, one could
select for transformants in which the autonomous element is not
stably integrated into the genome. It is proposed that this would
be desirable, for example, when transient expression of the
autonomous element is desired to activate in trans the
transposition of a defective transposable element, such as Ds, but
stable integration of the autonomous element is not desired. The
presence of the autonomous element may not be desired in order to
stabilize the defective element, i.e., prevent it from further
transposing. However, it is proposed that if stable integration of
an autonomous transposable element is desired in a plant the
presence of a negative selectable marker may make it possible to
eliminate the autonomous element during the breeding process.
D. Non-Protein-Expressing Sequences
1. RNA-Expressing
DNA may be introduced into corn and other monocots for the purpose
of expressing RNA transcripts that function to affect plant
phenotype yet are not translated into protein. Two examples are
antisense RNA and RNA with ribozyme activity. Both may serve
possible functions in reducing or eliminating expression of native
or introduced plant genes.
Genes may be constructed or isolated, which when transcribed,
produce antisense RNA that is complementary to all or part(s) of a
targeted messenger RNA(s). The antisense RNA reduces production of
the polypeptide product of the messenger RNA. The polypeptide
product may be any protein encoded by the plant genome. The
aforementioned genes will be referred to as antisense genes. An
antisense gene may thus be introduced into a plant by
transformation methods to produce a novel transgenic plant with
reduced expression of a selected protein of interest. For example,
the protein may be an enzyme that catalyzes a reaction in the
plant. Reduction of the enzyme activity may reduce or eliminate
products of the reaction which include any enzymatically
synthesized compound in the plant such as fatty acids, amino acids,
carbohydrates, nucleic acids and the like. Alternatively, the
protein may be a storage protein, such as a zein, or a structural
protein, the decreased expression of which may lead to changes in
seed amino acid composition or plant morphological changes
respectively. The possibilities cited above are provided only by
way of example and do not represent the full range of
applications.
Genes may also be constructed or isolated, which when transcribed
produce RNA enzymes, or ribozymes, which can act as
endoribonucleases and catalyze the cleavage of RNA molecules with
selected sequences. The cleavage of selected messenger RNA's can
result in the reduced production of their encoded polypeptide
products. These genes may be used to prepare novel transgenic
plants which possess them. The transgenic plants may possess
reduced levels of polypeptides including but not limited to the
polypeptides cited above that may be affected by antisense RNA.
It is also possible that genes may be introduced to produce novel
transgenic plants which have reduced expression of a native gene
product by a mechanism of cosuppression. It has been demonstrated
in tobacco, tomato, and petunia (Goring et al, 1991; Smith et al.,
1990; Napoli, C. et al., 1990; van der Krol et al., 1990) that
expression of the sense transcript of a native gene will reduce or
eliminate expression of the native gene in a manner similar to that
observed for antisense genes. The introduced gene may encode all or
part of the targeted native protein but its translation may not be
required for reduction of levels of that native protein.
2. Non-RNA-Expressing
For example, DNA elements including those of transposable elements
such as Ds, Ac, or Mu, may be inserted into a gene and cause
mutations. These DNA elements may be inserted in order to
inactivate (or activate) a gene and thereby "tag" a particular
trait. In this instance the transposable element does not cause
instability of the tagged mutation, because the utility of the
element does not depend on its ability to move in the genome. Once
a desired trait is tagged, the introduced DNA sequence may be used
to clone the corresponding gene, e.g., using the introduced DNA
sequence as a PCR primer together with PCR gene cloning techniques
(Shapiro, 1983; Dellaporta et al., 1988). Once identified, the
entire gene(s) for the particular trait, including control or
regulatory regions where desired may be isolated, cloned and
manipulated as desired. The utility of DNA elements introduced into
an organism for purposed of gene tagging is independent of the DNA
sequence and does not depend on any biological activity of the DNA
sequence, i.e., transcription into RNA or translation into protein.
The sole function of the DNA element is to disrupt the DNA sequence
of a gene.
It is contemplated that unexpressed DNA sequences, including novel
synthetic sequences could be introduced into cells as proprietary
"labels" of those cells and plants and seeds thereof. It would not
be necessary for a label DNA element to disrupt the function of a
gene endogenous to the host organism, as the sole function of this
DNA would be to identify the origin of the organism. For example,
one could introduce a unique DNA sequence into a plant and this DNA
element would identify all cells, plants, and progeny of these
cells as having arisen from that labelled source. It is proposed
that inclusion of label DNAs would enable one to distinguish
proprietary germplasm or germplasm derived from such, from
unlabelled germplasm.
Another possible element which may be introduced is a matrix
attachment region element (MAR), such as the chicken lysozyme A
element (Stief, 1989), which can be positioned around an
expressible gene of interest to effect an increase in overall
expression of the gene and diminish position dependent effects upon
incorporation into the plant genome (Stief et al., 1989; Phi-Van et
al., 1990).
III. DNA Delivery
Following the generation of recipient cells, the present invention
generally next includes steps directed to introducing an exogenous
DNA segment, such as a cDNA or gene, into a recipient cell to
create a transformed cell. The frequency of occurrence of cells
receiving DNA is believed to be low. Moreover, it is most likely
that not all recipient cells receiving DNA segments will result in
a transformed cell wherein the DNA is stably integrated into the
plant genome and/or expressed. Some may show only initial and
transient gene expression. However, certain cells from virtually
any monocot species may be stably transformed, and these cells
developed into transgenic plants, through the application of the
techniques disclosed herein.
There are many methods for introducing transforming DNA segments
into cells, but not all are suitable for delivering DNA to plant
cells. Suitable methods are believed to include virtually any
method by which DNA can be introduced into a cell, such as by
Agrobacterium infection, direct delivery of DNA such as, for
example, by PEG-mediated transformation of protoplasts (Omirulleh
et al., 1993), by desiccation/inhibition-mediated DNA uptake, by
electroporation, by agitation with silicon carbide fibers, by
acceleration of DNA coated particles, etc. In certain embodiments,
acceleration methods are preferred and include, for example,
microprojectile bombardment and the like.
A. Electroporation
Where one wishes to introduce DNA by means of electroporation, it
is contemplated that the method of Krzyzek et al. (U.S. Ser. No.
07/635,279 filed Dec. 28, 1990, incorporated herein by reference)
will be particularly advantageous. In this method, certain cell
wall-degrading enzymes, such as pectin-degrading enzymes, are
employed to render the target recipient cells more susceptible to
transformation by electroporation than untreated cells.
Alternatively, recipient cells are made more susceptible to
transformation, by mechanical wounding.
To effect transformation by electroporation one may employ either
friable tissues such as a suspension culture of cells, or
embryogenic callus, or alternatively, one may transform immature
embryos or other organized tissues directly. One would partially
degrade the cell walls of the chosen cells by exposing them to
pectin-degrading enzymes (pectolyases) or mechanically wounding in
a controlled manner. Such cells would then be recipient to DNA
transfer by electroporation, which may be carried out at this
stage, and transformed cells then identified by a suitable
selection or screening protocol dependent on the nature of the
newly incorporated DNA.
B. Microprojectile Bombardment
A further advantageous method for delivering transforming DNA
segments to plant cells is microprojectile bombardment. In this
method, particles may be coated with nucleic acids and delivered
into cells by a propelling force. Exemplary particles include those
comprised of tungsten, gold, platinum, and the like.
It is contemplated that in some instances DNA precipitation onto
metal particles would not be necessary for DNA delivery to a
recipient cell using microprojectile bombardment. In an
illustrative embodiment, non-embryogenic BMS cells were bombarded
with intact cells of the bacteria E. coli or Agrobacterium
tumefaciens containing plasmids with either the
.beta.-glucoronidase or bar gene engineered for expression in
maize. Bacteria were inactivated by ethanol dehydration prior to
bombardment. A low level of transient expression of the
.beta.-glucoronidase gene was observed 24-48 hours following DNA
delivery. In addition, stable transformants containing the bar gene
were recovered following bombardment with either E. coli or
Agrobacterium tumefaciens cells. It is contemplated that particles
may contain DNA rather than be coated with DNA. Hence it is
proposed that DNA-coated particles may increase the level of DNA
delivery via particle bombardment but are not, in and of
themselves, necessary.
An advantage of microprojectile bombardment, in addition to it
being an effective means of reproducibly stably transforming
monocots, is that neither the isolation of protoplasts (Cristou et
al., 1988) nor the susceptibility to Agrobacterium infection is
required. An illustrative embodiment of a method for delivering DNA
into maize cells by acceleration is a Biolistics Particle Delivery
System, which can be used to propel particles coated with DNA or
cells through a screen, such as a stainless steel or Nytex screen,
onto a filter surface covered with corn cells cultured in
suspension. The screen disperses the particles so that they are not
delivered to the recipient cells in large aggregates. It is
believed that a screen intervening between the projectile apparatus
and the cells to be bombarded reduces the size of projectiles
aggregate and may contribute to a higher frequency of
transformation by reducing damage inflicted on the recipient cells
by projectiles that are too large.
For the bombardment, cells in suspension are preferably
concentrated on filters or solid culture medium. Alternatively,
immature embryos or other target cells may be arranged on solid
culture medium. The cells to be bombarded are positioned at an
appropriate distance below the macroprojectile stopping plate. If
desired, one or more screens are also positioned between the
acceleration device and the cells to be bombarded. Through the use
of techniques set forth herein one may obtain up to 1000 or more
foci of cells transiently expressing a marker gene. The number of
cells in a focus which express the exogenous gene product 48 hours
post-bombardment often range from 1 to 10 and average 1 to 3.
In bombardment transformation, one may optimize the prebombardment
culturing conditions and the bombardment parameters to yield the
maximum numbers of stable transformants. Both the physical and
biological parameters for bombardment are important in this
technology. Physical factors are those that involve manipulating
the DNA/microprojectile precipitate or those that affect the flight
and velocity of either the macro- or microprojectiles. Biological
factors include all steps involved in manipulation of cells before
and immediately after bombardment, the osmotic adjustment of target
cells to help alleviate the trauma associated with bombardment, and
also the nature of the transforming DNA, such as linearized DNA or
intact supercoiled plasmids. It is believed that prebombardment
manipulations are especially important for successful
transformation of immature embryos.
Accordingly, it is contemplated that one may wish to adjust various
of the bombardment parameters in small scale studies to fully
optimize the conditions. One may particularly wish to adjust
physical parameters such as gap distance, flight distance, tissue
distance, and helium pressure. One may also minimize the trauma
reduction factors (TRFs) by modifying conditions which influence
the physiological state of the recipient cells and which may
therefore influence transformation and integration efficiencies.
For example, the osmotic state, tissue hydration and the subculture
stage or cell cycle of the recipient cells may be adjusted for
optimum transformation. Results from such small scale optimization
studies are disclosed herein and the execution of other routine
adjustments will be known to those of skill in the art in light of
the present disclosure.
IV. Production and Characterization of Stable Transgenic Corn
After effecting delivery of exogenous DNA to recipient cells by any
of the methods discussed above, the next steps of the invention
generally concern identifying the transformed cells for further
culturing and plant regeneration. As mentioned above, in order to
improve the ability to identify transformants, one may desire to
employ a selectable or screenable marker gene as, or in addition
to, the expressible gene of interest. In this case, one would then
generally assay the potentially transformed cell population by
exposing the cells to a selective agent or agents, or one would
screen the cells for the desired marker gene trait.
A. Selection
An exemplary embodiment of methods for identifying transformed
cells involves exposing the bombarded cultures to a selective
agent, such as a metabolic inhibitor, an antibiotic, herbicide or
the like. Cells which have been transformed and have stably
integrated a marker gene conferring resistance to the selective
agent used, will grow and divide in culture. Sensitive cells will
not be amenable to further culturing.
To use the bar-bialaphos or the EPSPS-glyphosate selective system,
bombarded tissue is cultured for 0-28 days on nonselective medium
and subsequently transferred to medium containing from 1-3 mg/l
bialaphos or 1-3 mM glyphosate as appropriate. While ranges of 1-3
mg/l bialaphos or 1-3 mM glyphosate will typically be preferred, it
is proposed that ranges of 0.1-50 mg/l bialaphos or 0.1-50 mM
glyphosate will find utility in the practice of the invention.
Tissue can be placed on any porous, inert, solid or semi-solid
support for bombardment, including but not limited to filters and
solid culture medium. Bialaphos and glyphosate are provided as
examples of agents suitable for selection of transformants, but the
technique of this invention is not limited to them.
An example of a screenable marker trait is the red pigment produced
under the control of the R-locus in maize. This pigment may be
detected by culturing cells on a solid support containing nutrient
media capable of supporting growth at this stage and selecting
cells from colonies (visible aggregates of cells) that are
pigmented. These cells may be cultured further, either in
suspension or on solid media. The R-locus is useful for selection
of transformants from bombarded immature embryos. In a similar
fashion, the introduction of the C1 and B genes will result in
pigmented cells and/or tissues.
The enzyme luciferase is also useful as a screenable marker in the
context of the present invention. In the presence of the substrate
luciferin, cells expressing luciferase emit light which can be
detected on photographic or x-ray film, in a luminometer (or liquid
scintillation counter), by devices that enhance night vision, or by
a highly light sensitive video camera, such as a photon counting
camera. All of these assays are nondestructive and transformed
cells may be cultured further following identification. The photon
counting camera is especially valuable as it allows one to identify
specific cells or groups of cells which are expressing luciferase
and manipulate those in real time.
It is further contemplated that combinations of screenable and
selectable markers will be useful for identification of transformed
cells. In some cell or tissue types a selection agent, such as
bialaphos or glyphosate, may either not provide enough killing
activity to clearly recognize transformed cells or may cause
substantial nonselective inhibition of transformants and
nontransformants alike, thus causing the selection technique to not
be effective. It is proposed that selection with a growth
inhibiting compound, such as bialaphos or glyphosate at
concentrations below those that cause 100% inhibition followed by
screening of growing tissue for expression of a screenable marker
gene such as luciferase would allow one to recover transformants
from cell or tissue types that are not amenable to selection alone.
In an illustrative embodiment embryogenic type II callus of Zea
mays L. was selected with sub-lethal levels of bialaphos. Slowly
growing tissue was subsequently screened for expression of the
luciferase gene and transformants were identified. In this example,
neither selection nor screening conditions employed were sufficient
in and of themselves to identify transformants. Therefore it is
proposed that combinations of selection and screening will enable
one to identify transformants in a wider variety of cell and tissue
types.
B. Regeneration and Seed Production
Cells that survive the exposure to the selective agent, or cells
that have been scored positive in a screening assay, may be
cultured in media that supports regeneration of plants. In an
exemplary embodiment, the inventors have modified MS and N6 media
(see Table 1) by including further substances such as growth
regulators. A preferred growth regulator for such purposes is
dicamba or 2,4-D. However, other growth regulators may be employed,
including NAA, NAA+2,4-D or perhaps even picloram. Media
improvement in these and like ways was found to facilitate the
growth of cells at specific developmental stages. Tissue is
preferably maintained on a basic media with growth regulators until
sufficient tissue is available to begin plant regeneration efforts,
or following repeated rounds of manual selection, until the
morphology of the tissue is suitable for regeneration, at least two
weeks, then transferred to media conducive to maturation of
embryoids. Cultures are transferred every two weeks on this medium.
Shoot development will signal the time to transfer to medium
lacking growth regulators.
The transformed cells, identified by selection or screening and
cultured in an appropriate medium that supports regeneration, will
then be allowed to mature into plants. Developing plantlets are
transferred to soilless plant growth mix, and hardened, e.g., in an
environmentally controlled chamber at about 85% relative humidity,
600 ppm CO.sub.2, and 25-250 microeinsteins
m.sup.-2.multidot.s.sup.-1 of light. Plants are preferably matured
either in a growth chamber or greenhouse. Plants are regenerated
from about 6 weeks to 10 months after a transformant is identified,
depending on the initial tissue. During regeneration, cells are
grown on solid media in tissue culture vessels. Illustrative
embodiments of such vessels are petri dishes and Plant Con.RTM.s.
Regenerating plants are preferably grown at about 19 to 28.degree.
C. After the regenerating plants have reached the stage of shoot
and root development, they may be transferred to a greenhouse for
further growth and testing.
In one study, R.sub.0 plants were regenerated from transformants of
an A188.times.B73 suspension culture line (SC82), and these plants
exhibited a phenotype expected of the genotype of hybrid
A188.times.B73 from which the callus and culture were derived. The
plants were similar in height to seed-derived A188 plants (3-5 ft
tall) but had B73 traits such as anthocyanin accumulation in stalks
and prop roots, and the presence of upright leaves. It would also
be expected that some traits in the transformed plants would differ
from their source, and indeed some variation will likely occur.
In an exemplary embodiment, the proportion of regenerating plants
derived from transformed callus that successfully grew and reached
maturity after transfer to the greenhouse was 97% (73 of 76).
R.sub.0 plants in the greenhouse are tested for fertility by
backcrossing the transformed plants with seed-derived plants by
pollinating the R.sub.0 ears with pollen from seed derived inbred
plants and this resulted in kernel development. In addition, pollen
was collected from R.sub.0 plants and used to pollinate seed
derived inbred plants, resulting in kernel development. Although
fertility can vary from plant to plant greater than 100 viable
progeny can be routinely recovered from each transformed plant
through use of both the ear and pollen for doing crosses.
Note, however, that occasionally kernels on transformed plants may
require embryo rescue due to cessation of kernel development and
premature senescence of plants. To rescue developing embryos, they
are excised from surface-disinfected kernels 10-20 days
post-pollination and cultured. An embodiment of media used for
culture at this stage comprises MS salts, 2% sucrose, and 5.5 g/l
agarose. In an illustrative embodiment of embryo rescue, large
embryos (defined as greater than 3 mm in length) are germinated
directly on an appropriate media. Embryos smaller than that were
cultured for one week on media containing the above ingredients
along with 10.sup.-5 M abscisic acid and then transferred to growth
regulator-free medium for germination.
Progeny may be recovered from the transformed plants and tested for
expression of the exogenous expressible gene by localized
application of an appropriate substrate to plant parts such as
leaves. In the case of bar transformed plants, it was found that
transformed parental plants (R.sub.0) and their progeny (R.sub.1)
exhibited no bialaphos-related necrosis after localized application
of the herbicide Basta.RTM. to leaves, if there was functional PAT
activity in the plants as assessed by an in vitro enzymatic assay.
In one study, of 28 progeny (R.sub.1) plants tested, 50% (N=14) had
PAT activity. All PAT positive progeny tested contained bar,
confirming that the presence of the enzyme and the resistance to
bialaphos were associated with the transmission through the
germline of the marker gene.
C. Characterization
To confirm the presence of the exogenous DNA or "transgene (s)" in
the regenerating plants, a variety of assays may be performed. Such
assays include, for example, "molecular biological" assays, such as
Southern and Northern blotting and PCR; "biochemical" assays, such
as detecting the presence of a protein product, e.g., by
immunological means (ELISAs and Western blots) or by enzymatic
function; plant part assays, such as leaf or root assays; and also,
by analyzing the phenotype of the whole regenerated plant.
1. DNA Integration, RNA Expression and Inheritance
Genomic DNA may be isolated from callus cell lines or any plant
parts to determine the presence of the exogenous gene through the
use of techniques well known to those skilled in the art. Note,
that intact sequences will not always be present, presumably due to
rearrangement or deletion of sequences in the cell.
The presence of DNA elements introduced through the methods of this
invention may be determined by polymerase chain reaction (PCR).
Using this technique discreet fragments of DNA are amplified and
detected by gel electrophoresis. This type of analysis permits one
to determine whether a gene is present in a stable transformant,
but does not prove integration of the introduced gene into the host
cell genome. It is the experience of the inventors, however, that
DNA has been integrated into the genome of all transformants that
demonstrate the presence of the gene through PCR analysis. In
addition, it is not possible using PCR techniques to determine
whether transformants have exogenous genes introduced into
different sites in the genome, i.e., whether transformants are of
independent origin. It is contemplated that using PCR techniques it
would be possible to clone fragments of the host genomic DNA
adjacent to an introduced gene.
Positive proof of DNA integration into the host genome and the
independent identities of transformants may be determined using the
technique of Southern hybridization. Using this technique specific
DNA sequences that were introduced into the host genome and
flanking host DNA sequences can be identified. Hence the Southern
hybridization pattern of a given transformant serves as an
identifying characteristic of that transformant. In addition it is
possible through Southern hybridization to demonstrate the presence
of introduced genes in high molecular weight DNA, i.e., confirm
that the introduced gene has been integrated into the host cell
genome. The technique of Southern hybridization provides
information that is obtained using PCR e.g., the presence of a
gene, but also demonstrates integration into the genome and
characterizes each individual transformant.
It is contemplated that using the techniques of dot or slot blot
hybridization which are modifications of Southern hybridization
techniques one could obtain the same information that is derived
from PCR, e.g., the presence of a gene.
Both PCR and Southern hybridization techniques can be used to
demonstrate transmission of a transgene to progeny. It is the
experience of the inventors that in most instances the
characteristic Southern hybridization pattern for a given
transformant will segregate in progeny as one or more Mendelian
genes (Spencer et al., 1992; Spencer et al, in press) indicating
stable inheritance of the transgene. For example, in one study, of
28 progeny (R.sub.1) plants tested, 50% (N=14) contained bar,
confirming transmission through the germline of the marker gene.
The nonchimeric nature of the callus and the parental transformants
(R.sub.0) was suggested by germline transmission and the identical
Southern blot hybridization patterns and intensities of the
transforming DNA in callus, R.sub.0 plants and R.sub.1 progeny that
segregated for the transformed gene.
Whereas DNA analysis techniques may be conducted using DNA isolated
from any part of a plant, RNA will only be expressed in particular
cells or tissue types and hence it will be necessary to prepare RNA
for analysis from these tissues. PCR techniques may also be used
for detection and quantitation of RNA produced from introduced
genes. In this application of PCR it is first necessary to reverse
transcribe RNA into DNA, using enzymes such as reverse
transcriptase, and then through the use of conventional PCR
techniques amplify the DNA. In most instances PCR techniques, while
useful, will not demonstrate integrity of the RNA product. Further
information about the nature of the RNA product may be obtained by
Northern blotting. This technique will demonstrate the presence of
an RNA species and give information about the integrity of that
RNA. The presence or absence of an RNA species can also be
determined using dot or slot blot Northern hybridizations. These
techniques are modifications of Northern blotting and will only
demonstrate the presence or absence of an RNA species.
2. Gene Expression
While Southern blotting and PCR may be used to detect the gene(s)
in question, they do not provide information as to whether the gene
is being expressed. Expression may be evaluated by specifically
identifying the protein products of the introduced genes or
evaluating the phenotypic changes brought about by their
expression.
Assays for the production and identification of specific proteins
may make use of physical-chemical, structural, functional, or other
properties of the proteins. Unique physical-chemical or structural
properties allow the proteins to be separated and identified by
electrophoretic procedures, such as native or denaturing gel
electrophoresis or isoelectric focussing, or by chromatographic
techniques such as ion exchange or gel exclusion chromatography.
The unique structures of individual proteins offer opportunities
for use of specific antibodies to detect their presence in formats
such as an ELISA assay. Combinations of approaches may be employed
with even greater specificity such as western blotting in which
antibodies are used to locate individual gene products that have
been separated by electrophoretic techniques. Additional techniques
may be employed to absolutely confirm the identity of the product
of interest such as evaluation by amino acid sequencing following
purification. Although these are among the most commonly employed,
other procedures may be additionally used.
Assay procedures may also be used to identify the expression of
proteins by their functionality, especially the ability of enzymes
to catalyze specific chemical reactions involving specific
substrates and products. These reactions may be followed by
providing and quantifying the loss of substrates or the generation
of products of the reactions by physical or chemical procedures.
Examples are as varied as the enzyme to be analyzed and may include
assays for PAT enzymatic activity by following production of
radiolabeled acetylated phosphinothricin from phosphinothricin and
.sup.14 C-acetyl CoA or for anthranilate synthase activity by
following loss of fluorescence of anthranilate, to name two.
Very frequently the expression of a gene product is determined by
evaluating the phenotypic results of its expression. These assays
also may take many forms including but not limited to analyzing
changes in the chemical composition, morphology, or physiological
properties of the plant. Chemical composition may be altered by
expression of genes encoding enzymes or storage proteins which
change amino acid composition and may be detected by amino acid
analysis, or by enzymes which change starch quantity which may be
analyzed by near infrared reflectance spectrometry. Morphological
changes may include greater stature or thicker stalks. Most often
changes in response of plants or plant parts to imposed treatments
are evaluated under carefully controlled conditions termed
bioassays. An example is to evaluate resistance to insect
feeding.
The inventors have been successful in producing fertile transgenic
monocot plants (maize) where others have failed. Aspects of the
methods of the present invention for producing the fertile,
transgenic corn plants comprise, but are not limited to, isolation
of recipient cells using media conducive to specific growth
patterns, choice of selective systems that permit efficient
detection of transformation; modifications of DNA delivery methods
to introduce genetic vectors with exogenous DNA into cells;
invention of methods to regenerate plants from transformed cells at
a high frequency; and the production of fertile transgenic plants
capable of surviving and reproducing.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Schematic representation of plasmids (vectors) used in
bombardment experiments.
FIG. 1(A). Schematic representation of the expression cassette of
pDPG165 containing the bar gene.
FIG. 1(B). Schematic representation of the expression cassette of
pDPG208 containing the uidA gene encoding .beta.-glucoronidase
(GUS).
FIG. 1(C). Map of plasmid pDPG165 containing the bar gene.
FIG. 1(D) Map of plasmid pDPG208 containing the uidA gene.
FIG. 1(E) Map of plasmid pAGUS1, also known as pDPG141, in which
the 5'-noncoding and 5'-coding sequences were modified to
incorporate the Kozak consensus sequence and HindIII restriction
site. The nucleotide sequence is SEQ ID NO:2.
FIG. 1(F). Restriction map of the plasmid pDPG237 containing the
Sn:bol3 cDNA.
FIG. 1(G). Map of plasmid pDPG232 incorporating the Rsn cDNA with a
35S promoter and Tr 7 3' end.
FIG. 1(H). Map of plasmid pDPG313 containing the aroA gene and the
35S-histone fusion promoter in addition to the bar expression
cassette.
FIG. 1(I). Map of plasmid pDPG314 containing the aroA gene and the
35S-histone fusion promoter in addition to the bar expression
cassette.
FIG. 1(J). Map of plasmid pDPG315 containing the aroA gene and the
histone fusion promoter in addition to the bar expression
cassette.
FIG. 1(K). Map of plasmid pDPG316 containing the aroA gene and the
histone fusion promoter in addition to the bar expression
cassette.
FIG. 1(L). Map of plasmid pDPG317 containing the aroA gene and the
35S-histone fusion promoter in addition to the bar expression
cassette.
FIG. 1(M). Map of plasmid pDPG318 containing the aroA gene and the
.alpha.-tubulin promoter in addition to the bar expression
cassette.
FIG. 1(N). Map of plasmid pDPG319 containing the aroA gene and the
.alpha.-tubulin promoter in addition to the bar expression
cassette.
FIG. 1(O). Map of plasmid pDPG290 containing the B. thuringiensis
crystal toxin protein gene lab6 with a 35S promoter.
FIG. 1(P). Map of plasmid pDPG300 containing the B. thuringiensis
crystal toxin protein gene lab6 with a 35S promoter in addition to
the bar expression cassette from pDPG165.
FIG. 1(Q). Map of plasmid pDPG301 containing the B. thuringiensis
crystal toxin protein gene lab6 with a 35S promoter in addition to
the bar expression cassette from pDPG165.
FIG. 1(R). Map of plasmid pDPG302 containing the B. thuringiensis
crystal toxin protein gene lab6 with a 35S promoter in addition to
the bar expression cassette from pDPG165.
FIG. 1(S). Map of plasmid pDPG303 containing the B. thuringiensis
crystal toxin protein gene lab6 with a 35S promoter in addition to
the bar expression cassette from pDPG165.
FIG. 1(T). Map of plasmid pDPG386, a plasmid containing the wheat
dwarf virus replicon and containing a neomycin phosphotransferase
II gene. This virus replicates in plant cells as well as
bacteria.
FIG. 1(U). Map of plasmid pDPG387, a plasmid containing the wheat
dwarf virus replicon and containing a neomycin phosphotransferase
II gene and the uidA gene encoding GUS. This virus replicates in
plant cells as well as bacteria.
FIG. 1(V). Map of plasmid pDPG388, a plasmid containing the wheat
dwarf virus replicon and containing a neomycin phosphotransferase
II gene and the bar. This virus replicates in plant cells as well
as bacteria.
FIG. 1(W). Map of plasmid pDPG389, a plasmid containing the wheat
dwarf virus replicon and containing a neomycin phosphotransferase
II gene and the bar gene. This virus replicates in plant cells as
well as bacteria.
FIG. 1(X). Map of plasmid pDPG140.
FIG. 1(Y). Map of plasmid pDPG172 containing the luciferase gene
and the maize alcohol dehydrogenase I promoter and intron one.
FIG. 1(Z). Map of plasmid pDPG425 containing a maize EPSPS gene
mutated to confer resistance to glyphosate.
FIG. 1(AA). Map of plasmid pDPG427 containing a maize EPSPS gene
mutated to confer resistance to glyphosate.
FIG. 1(BB). Map of plasmid pDPG451 containing the 35S promoter--adh
intron--mtID--Tr7 expression cassette. Expression of this cassette
will lead to accumulation of mannitol in the cells.
FIG. 1(CC). Map of plasmid pDPG354 containing a synthetic Bt gene
(see FIG. 12).
FIG. 1(DD). Map of plasmid pDPG344 containing the proteinase
inhibitor II gene from tomato.
FIG. 1(EE). Map of plasmid pDPG337 containing a synthetic Bt gene
(see FIG. 12).
FIG. 2. Appearance of cell colonies which emerge on selection
plates with bialaphos. Such colonies appear 6-7 weeks after
bombardment.
FIG. 2(A) SC82 bialaphos-resistant colony selected on 1 mg/l
bialaphos.
FIG. 2(B) Embryogenic SC82 bialaphos-resistant callus selected and
maintained on 1 mg/l bialaphos.
FIG. 3. Phosphinothricin acetyl transferase (PAT) activity in
embryogenic SC82 callus transformants designated E1-E11 and a
nonselected control (EO). 25 .mu.g of protein extract were loaded
per lane. B13 is a BMS-bar transformant. BMS is Black Mexican Sweet
corn. Activities of the different transformants varied
approximately 10 fold based on the intensities of the bands.
FIG. 4. Integration of the bar gene in bialaphos-resistant SC82
callus isolates E1-E11. DNA gel blot of genomic DNA (4
.mu.g/digest) from E1-E11 and a nonselected control (EO) digested
with EcoRI and HindIII. The molecular weights in kb are shown on
the left and right. The blot was hybridized with .sup.32 P-labeled
bar from pDPG165 (.about.25.times.10.sup.6 Cerenkov cpm). Lanes
designated 1 and 5 copies refer to the diploid genome and contain
1.9 and 9.5 pg respectively of the 1.9 kb bar expression unit
released from pDPG165 with EcoRI and HindIII.
FIG. 5. Integration of exogenous genes in bialaphos-resistant SC716
isolates R1-R21.
FIG. 5(A) DNA gel blot of genomic DNA (6 .mu.g/digest) from
transformants isolated from suspension culture of A188.times.B73
(SC716), designated R1-R21, were digested with EcoRI and HindIII
and hybridized to .sup.32 P-labeled bar probe
(.about.10.times.10.sup.6 Cerenkov cpm). Molecular weight markers
in kb are shown on the left and right. Two copies of the bar
expression unit per diploid genome is 5.7 pg of the 1.9 kb
EcoRI/Hind fragment from pDPG165.
FIG. 5(B) The blot from A was washed and hybridized with .sup.32
P-labelled GUS probe (.about.35.times.10.sup.6 Cerenkov cpm). Two
copies of the 2.1 kb GUS-containing EcoRI/HindIII fragment from
pDPG208 is 6.3 pg.
FIG. 6. Histochemical determination of GUS activity in
bar-transformed SC82 callus line Y13. This bialaphos-resistant
callus line, Y13, which contained intact GUS coding sequences was
tested for GUS activity three months post-bombardment. In this
figure, differential staining of the callus was observed.
FIG. 7. Mature R.sub.0 Plant, Developing Kernels and Progeny.
FIG. 7(A). Mature transgenic R.sub.0 plant regenerated from an
E2/E5 callus.
FIG. 7(B) Progeny derived from an E2/E5 plant by embryo rescue;
segregant bearing the resistance gene on the right, and lacking the
gene on the left.
FIG. 7(C) Using pollen from transformed R.sub.1 plants to pollinate
B73 ears, large numbers of seed have been recovered.
FIG. 7(D) A transformed ear from an R.sub.1 plant crossed with
pollen from a non-transformed inbred plant.
FIG. 8. Functional Expression of Introduced Genes in Transformed
R.sub.0 and R.sub.1 Plants.
FIG. 8(A) Basta.sup.R resistance in transformed R.sub.0 plants. A
Basta.sup.R solution was applied to a large area (about 4.times.8
cm) in the center of leaves of nontransformed A188.times.B73 plant
(left) and a transgenic R.sub.0 E3/E4/E6 plant (right).
FIG. 8(B) Basta.sup.R resistance in transformed R.sub.1 plants.
Basta.sup.R was also applied to leaves of four R.sub.1 plants; two
plants without bar (left) and two plants containing bar (right).
The herbicide was applied to R.sub.1 plants in 1 cm circles to four
locations on each leaf, two on each side of the midrib. Photographs
were taken six days after application.
FIG. 8(C) GUS activity in leaf tissue of a transgenic R.sub.0
plant. Histochemical determination of GUS activity in leaf tissue
of a plant regenerated from cotransformed callus line Y13 (right)
and a nontransformed tissue culture derived plant (left). Bar=1
cm.
FIG. 8(D) Light micrograph of the leaf segment from a Y13 plant
shown in (C), observed in surface view under bright field optics.
GUS activity was observed in many cell types throughout the leaf
tissue (magnification=230.times.).
FIG. 8 (E) Light micrograph as in (D) of control leaf.
FIG. 9. PAT Activity in Protein Extracts of R.sub.0 Plants.
Extracts from one plant derived from each of the four transformed
regenerable callus lines from a suspension culture of
A188.times.B73, SC82 (E10, E11, E2/E5, and E3/E4/E6) were tested
for PAT activity (The designations E2/E5 and E3/E4/E6 represent
transformed cell lines with identical DNA gel blot hybridization
patterns; the isolates were most likely separated during the
culturing and selection process.) Protein extracts from a
nontransformed B73 plant and a Black Mexican Sweet (BMS) cell
culture bar transformant were included as controls. Approximately
50 micrograms of total protein was used per reaction.
FIG. 10. DNA Gel Blot Analysis of Genomic DNA from Transformed
Callus and Corresponding R.sub.0 Plants Probed with bar. Genomic
DNA was digested with EcoRI and HindIII, which released the 1.9 kb
bar expression unit (CaMV 35S promoter-bar-Tr7 3'-end) from pDPG
165, the plasmid used for microprojectile bombardment
transformation of SC82 cells, and hybridized to bar. The molecular
weights in kb are shown on the left and right. Lanes designated
E3/E4/E6, E11, E2/E5, and E10 contained 5 .mu.g of either callus
(C) or R.sub.0 plant DNA. The control lane contained DNA from a
nontransformed A188.times.B73 plant. The lane designated "1 copy"
contained 2.3 pg of the 1.9 kb EcoRI/HindIII fragment from pDPG165
representing one copy per diploid genome.
FIG. 11. PAT Activity and DNA Gel Blot Analysis of Segregating
Progeny of E2/E5 R.sub.0 Plants.
FIG. 11(A) Analysis of PAT activity in ten progeny (lanes a-j) and
a nontransformed control plant (lane k). Lanes designated a, b-h,
i, and j contained protein extracts from progeny of separate
parental R.sub.0 plants. The lane designated callus contained
protein extract from E2/E5 callus. Approximately 25 micrograms of
total protein were used per reaction.
FIG. 11(B) DNA gel blot analysis of genomic DNA isolated from the
ten progeny analyzed in A. Genomic DNA (5 .mu.g/lane) was digested
with Smal, which releases a 0.6 kb fragment containing bar from
pDPG165, and hybridized with bar probe. The lane designated R.sub.0
contained DNA from the R.sub.0 parent of progeny a. The lane
designated 1 copy contained pDPG165 digested with SmaI to represent
approximately 1 copy of the 0.6 kb fragment per diploid genome (0.8
pg).
FIG. 12 DNA sequence of a synthetic Bt gene coding for the toxin
portion of the endotoxin protein produced by Bacillus thuringiensis
subsp.kurstaki strain HD73 (M. J. Adang et al. 1985). This gene was
synthesized and assembled using standard techniques to contain
codons that are more preferred for translation in maize cells. A
translation stop codon was introduced after the 613th codon to
terminate the translation and allow synthesis of a Bt endotoxin
protein consisting of the first 613 amino acids (including the
f-met) of the Bt protein. The nucleic acid sequence is represented
by seq id no:10 and the amino acid sequence by seq id no:11.
FIG. 13 DNA sequence of a synthetic Bt gene coding for the toxin
portion of the endotoxin protein produced by Bacillus thuringiensis
strain HD1. This gene was synthesized and assembled using standard
techniques to contain codons that are more preferred for
translation in maize cells. The nucleic acid sequence is
represented by SEQ ID NO:12 and the amino acid sequence by SEQ ID
NO:13.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the first time, fertile transgenic maize plants have been
produced, opening the door to new vistas of crop improvement based
on in vitro genetic transformation. The inventors have succeeded
where others have failed by combining and modifying numerous steps
in the overall process leading from somatic cell to transgenic
plant. Although the methods disclosed herein are part of a unified
process, for illustrative purposes they may be subdivided into:
culturing cells to be recipients for exogenous DNA; cryopreserving
recipient cells; constructing vectors to deliver the DNA to cells;
delivering DNA to cells; assaying for successful transformations;
using selective agents if necessary to isolate stable
transformants; regenerating plants from transformants; assaying
those plants for gene expression and for identification of the
exogenous DNA sequences; determining whether the transgenic plants
are fertile; and producing offspring of the transgenic plants. The
invention also relates to transformed maize cells, transgenic
plants and pollen produced by said plants.
Recipient Cells
Tissue culture requires media and controlled environments. "Media"
refers to the numerous nutrient mixtures that are used to grow
cells in vitro, that is, outside of the intact living organism. The
medium is usually a suspension of various categories of ingredients
(salts, amino acids, growth regulators, sugars, buffers) that are
required for growth of most cell types. However, each specific cell
type requires a specific range of ingredient proportions for
growth, and an even more specific range of formulas for optimum
growth. Rate of cell growth will also vary among cultures initiated
with the array of media that permit growth of that cell type.
Nutrient media is prepared as a liquid, but this may be solidified
by adding the liquid to materials capable of providing a solid
support. Agar is most commonly used for this purpose. Bactoagar,
Hazelton agar, Gelrite, and Gelgro are specific types of solid
support that are suitable for growth of plant cells in tissue
culture.
Some cell types will grow and divide either in liquid suspension or
on solid media. As disclosed herein, maize cells will grow in
suspension or on solid medium, but regeneration of plants from
suspension cultures requires transfer from liquid to solid media at
some point in development. The type and extent of differentiation
of cells in culture will be affected not only by the type of media
used and by the environment, for example, pH, but also by whether
media is solid or liquid. Table 1 illustrates the composition of
various media useful for creation of recipient cells and for plant
regeneration.
B. Culturing Cells to be Recipients for Transformation
It is believed by the inventors that the ability to prepare and
cryopreserve cultures of maize cells is important to certain
aspects of the present invention, in that it provides a means for
reproducibly and successfully preparing cells for particle-mediated
transformation, electroporation, or other methods of DNA
introduction. The studies described below set forth techniques
which have been successfully applied by the inventors to generate
transformable and regenerable cultures of maize cells. A variety of
different types of media have been developed by the inventors and
employed in carrying out various aspects of the invention. The
following table, Table 1, sets forth the composition of the media
preferred by the inventors for carrying out these aspects of the
invention.
TABLE 1 Illustrative Embodiments of Tissue Culture Media Which are
Used for Type II Callus Development, Development of Suspension
Cultures and Regeneration of Plant Cells (Specifically Maize Cells)
MEDIA BASAL OTHER COMPONENTS** NO. MEDIUM SUCROSE pH (Amount/L) 7
MS* 2% 6.0 .25 mg thiamine .5 mg BAP .5 mg NAA Bactoagar 10 MS 2%
6.0 .25 mg thiamine 1 mg BAP 1 mg 2,4-D 400 mg L-proline Bactoagar
19 MS 2% 6.0 .25 mg thiamine .25 mg BAP .25 mg NAA Bactoagar 20 MS
3% 6.0 .25 mg 1 mg BAP 1 mg NAA Bactoagar 52 MS 2% 6.0 .25 mg
thiamine 1 mg 2,4-D 10.sup.-7 M ABA BACTOAGAR 101 MS 3% 6.0 MS
vitamins 100 mg myo-inositol Bactoagar 142 MS 6% 6.0 MS vitamins 5
mg BAP 0.186 mg NAA 0.175 mg IAA 0.403 mg 2IP Bactoagar 157 MS 6%
6.0 MS vitamins 100 mg myo-inositol Bactoagar 163 MS 3% 6.0 MS
vitamins 3.3 mg dicamba 100 mg myo-inositol Bactoagar 171 MS 3% 6.0
MS vitamins .25 mg 2,4-D 10 mg BAP 100 mg myo-inositol Bactoagar
173 MS 6% 6.0 MS vitamins 5 mg BAP .186 mg NAA .175 mg IAA .403 mg
2IP 10.sup.-7 M ABA 200 mg myo-inositol Bactoagar 177 MS 3% 6.0 MS
vitamins .25 mg 2,4-D 10 mg BAP 10.sup.-7 M ABA 100 mg myo-inositol
Bactoagar 185 MS -- 5.8 3 mg BAP .04 mg NAA RT vitamins 1.65 mg
thiamine 1.38 g L-proline 20 g sorbitol Bactoagar 189 MS -- 5.8 3
mg BAP .04 mg NAA .5 mg niacin 800 mg L-asparagine 100 mg casaminio
acids 20 g sorbitol 1.4 g L-proline 100 mg myo-inositol Gelgro 201
N6 2% 5.8 N6 vitamins 2 mg L-glycine 1 mg 2,4-D 100 mg casein
hydrolysate 2.9 g L-proline Gelgro 205 N6 2% 5.8 N6 vitamins 2 mg
L-glycine .5 mg 2,4-D 100 mg casein hydrolysate 2.9 g L-proline
Gelgro 209 N6 6% 5.8 N6 vitamins 2 mg L-glycine 100 mg casein
hydrolysate 0.69 g L-proline Bactoagar 210 N6 3% 5.5 N6 vitamins 2
mg 2,4-D 250 mg Ca pantothenate 100 mg myo-inositol 790 mg
L-asparagine 100 mg casein hydrolpate 1.4 g L-proline Hazelton
agar**** 2 mg L-glycine 212 N6 3% 5.5 N6 vitamins 2 mg L-glycine 2
mg 2,4-D 250 mg Ca pantothenate 100 mg myo-inositol 100 mg casein
hydrolysate 1.4 g L-proline Hazelton agar**** 227 N6 2% 5.8 N6
vitamins 2 mg L-glycine 13.2 mg dicamba 100 mg casein hydrolysate
2.9 g L-proline Gelgro 273 N6 2% 5.8 N6 vitamins 2 mg L-glycine 1
mg 2,4-D 16.9 mg AgNO.sub.3 100 mg casein hydrolysate 2.9 g
L-proline 279 N6 2% 5.8 3.3 mg dicamba 1 mg thiamine .5 mg niacin
800 mg L-asparagine 100 mg casein hydrolysate 100 mg myoinositol
1.4 g L-proline Gelgro**** 288 N6 3% 3.3 mg dicamba 1 mg thiamine
.5 mg niacin .8 g L-asparagine 100 mg myo-inositol 1.4 g L-proline
100 mg casein hydrolysate 16.9 mg AgNO.sub.3 Gelgro 401 MS 3% 6.0
3.73 mg Na.sub.2 EDTA .25 mg thiamine 1 mg 2,4-D 2 mg NAA 200 mg
casein hydrolysate 500 mg K.sub.2 SO.sub.4 400 mg KH.sub.2 PO.sub.4
100 mg myo-inositol 402 MS 3% 6.0 3.73 mg Na.sub.2 EDTA .25 mg
thiamine 1 mg 2,4-D 200 mg casein hydrolysate 2.9 g L-proline 500
mg K.sub.2 SO.sub.4 400 mg KH.sub.2 PO.sub.4 100 mg myo-inositol
409 MS 3% 6.0 3.73 mg Na.sub.2 EDTA .25 mg thiamine 9.9 mg dicamba
200 mg casein hydrolysate 2.9 g L-proline 500 mg K.sub.2 SO.sub.4
400 mg KH.sub.2 PO.sub.4 100 mg myo-inositol 401 Clark's 2% 5.7
Medium*** 607 1/2 .times. MS 3% 5.8 1 mg thiamine 1 mg niacin
Gelrite 615 MS 3% 6.0 MS vitamins 6 mg BAP 100 mg myo-inositol
Bactoagar 617 1/2 .times. MS 1.5% 6.0 MS vitamins 50 mg
myo-inositol Bactoagar 708 N6 2% 5.8 N6 vitamins 2 mg L-glycine 1.5
mg 2,4-D 200 mg casein hydrolysate 0.69 g L-proline Gelrite 721 N6
2% 5.8 3.3 mg dicamba 1 mg thiamine .5 mg niacin 800 mg
L-asparagine 100 mg myo-inositol 100 mg casein hydrolysate 1.4 g
L-proline 54.65 g mannitol Gelgro 726 N6 3% 5.8 3.3 mg dicamba .5
mg niacin 1 mg thiamine 800 mg L-asparagine 100 mg myo-inositol 100
mg casein hydrolysate 1.4 g L-proline 727 N6 3% 5.8 N6 vitamins 2
mg L-glycine 9.9 mg dicamba 100 mg casein hydrolysate 2.9 g
L-proline Gelgro 728 N6 3% 5.8 N6 vitamins 2 mg L-glycine 9.9 mg
dicamba 16.9 mg AgNO.sub.3 100 mg casein hydrolysate 2.9 g
L-proline Gelgro 734 N6 2% 5.8 N6 vitamins 2 mg L-glycine 1.5 mg
2,4-D 14 g Fe sequestreene (replaces Fe-EDTA) 200 mg casein
hydrolysate 0.69 g L-proline Gelrite 735 N6 2% 5.8 1 mg 2,4-D .5 mg
niacin .91 g L-asparagine 100 mg myo-inositol 1 mg thiamine .5 g
MES .75 g MgCl.sub.2 100 mg casein hydrolysate 0.69 g L-proline
Gelgro 2004 N6 3% 5.8 1 mg thiamine 0.5 mg niacin 3.3 mg dicamba 17
mg AgNO.sub.3 1.4 g L-proline 0.8 g L-asparagine 100 mg casein
hydrolysate 100 mg myo-inositol Gelrite 2008 N6 3% 5.8 1 mg
thiamine 0.5 mg niacin 3.3 mg dicamba 1.4 g L-proline 0.8 g
L-asparagine Gelrite *Basic MS medium described in Murashige and
Skoog (1962). This medium is typically modified by decreasing the
NH.sub.4 NO.sub.3 from 1.64 g/l to 1.55 g/l, and omitting the
pyridoxine HCl, nicotinic acid, myo-inositol and glycine.
**NAA = Naphthol Acetic Acid IAA = Indole Acetic Acid 2-IP = 2,
isopentyl adenine 2,4-D = 2,4-Dichlorophenoxyacetic Acid BAP =
6-benzyl aminopurine ABA = abscisic acid ***Basic medium described
in Clark (1982) ****These media may be made with or without
solidifying agent.
A number of transformable maize cultures have been developed using
the protocols outlined in the following examples. A compilation of
the cultures initiated and tested for transformability is set forth
in Table 2, with the results of the studies given in the two
right-hand columns. The Table indicates the general selection
protocol that was used for each of these cultures. The numeral
designations under "Protocol" represent the following:
1. Tissue (suspension) was plated on filters, bombarded and then
filters were transferred to culture medium. After 2-7 days, the
filters were transferred to selective medium. Approximately 3 weeks
after bombardment, tissue was picked from filters as separate
callus clumps onto fresh selective medium.
2. As in 1. above, except after bombardment the suspension was put
back into liquid--subjected to liquid selection for 7-14 days and
then pipetted at a low density onto fresh selection plates.
3. Callus was bombarded while sitting directly on medium or on
filters. Cells were transferred to selective medium 1-14 days after
particle bombardment. Tissue was transferred on filters 1-3 times
at 2 weeks intervals to fresh selective medium. Callus was then
briefly put into liquid to disperse the tissue onto selective
plates at a low density.
4. Callus tissue was transferred onto selective plates one to seven
days after DNA introduction. Tissue was subcultured as small units
of callus on selective plates until transformants were
identified.
The totals demonstrate that 27 of 37 maize cultures were
transformable. Of those cell lines tested 11 out of 20 have
produced fertile plants and 7 are in progress. As this table
indicates, transformable cultures have been produced from ten
different genotypes of maize, including both hybrid and inbred
varieties. These techniques for development of transformable
cultures are also important in direct transformation of intact
tissues, such as immature embryos as these techniques rely on the
ability to select transformants in cultured cell systems.
TABLE 2 Genotype Culture Method Transformable Fertile Plants A188 x
B73 G(1x6)92 1 + - G(1x6)716 1, 2 + + G(1x6)82 1 + + G(1x6)98 1 -
NA G(1x6)99 1 - NA D(1x6)122#3 2 - NA D(1x6)114 2 - NA D(1x6)17#33
2 In progress In progress HB13-3 3 + In progress HA133-227 2 - NA
G(6x1)17#25 3 + In progress C ABT4 4 + + ABT3 4 + + AB60 4 + + AB61
4 + + AB63 4 + + AB80 4 + + AB82 4 + In progress ABT6 4 + ND AB12 4
+ + PH2 4 + + AB69 4 + - AB44 4 + - AB62 4 + ND A188xB84 G(1xM)82 1
+ - A188xH99 HJ11-7 3 + In progress B73xA188 G(6x1)12#7 2 - NA
D(6x1)11#43 2 - NA E1 2 + - Hi-II G(CW)31#24 + In progress B73
(6)91#3 2 - NA (6)91#2 2 - NA B73-derived AT824 1, 2, 3 + + N1017A
AZ11137a 2 + In progress Cat 100 CB 2 + ND CC 2 + ND A188 E4 2 + -
The symbol "-" indicates that the line was not transformable after
3 attempts or plants were sterile NA indicates Not Applicable ND
indicates Not Done
EXAMPLE 1
Initiation of the Suspension Culture G(A188.times.B73)716
(Designated SC716) for Use in Transformation
This Example describes the development of a maize suspension
culture, designated SC716, which was employed in various of the
transformation studies described hereinbelow. The Type II tissue
used to initiate the cell suspension was initiated from immature
embryos of A188.times.B73 plated onto N6-based medium with 1 mg/ml
2,4-D (201; see Table 1). A Type II callus was initiated by visual
selection of fast growing, friable embryogenic cells. The
suspension was initiated within 6 months after callus initiation.
Tissue chosen from the callus to initiate the suspension consisted
of undifferentiated Type II callus. The characteristics of this
undifferentiated tissue include the earliest stages of embryo
development and soft, friable, undifferentiated tissue underlying
it.
Approximately one gram of tissue was added to 20 mls of liquid
medium. In this example, the liquid medium was medium 402 to which
different slow-release growth regulator capsule treatments were
added (Adams, W. R., Adams, T. R., Wilston, H. M., Krueger, R. W.,
and Kausch, A. P, Silicone Capsules for Controlled Auxin Release,
in preparation). These capsule treatments included 2,4-D, NAA,
2,4-D plus NAA, and two NAA capsules. One flask was initiated for
each of the different 402 media plus growth regulator combinations.
Every 7 days each culture was subcultured into fresh medium by
transferring a small portion of the cellular suspension to a new
flask. This involved swirling the original flask to suspend the
cells (which tend to settle to the bottom of the culture vessel),
tilting the flask on its side and allowing the denser cells and
cell aggregates to settle slightly. One ml of packed cells was then
drawn off from this pool of settled cells together with 4 mls of
conditioned medium and added to a flask containing 20 ml fresh
medium. A sterile ten ml, wide tip, pipet was used for this
transfer (Falcon 7304). Any very large aggregates of cells which
would not pass easily through the pipet tip were excluded. If a
growth regulator capsule was present, it was also transferred to
the new flask.
After approximately 7 weeks, the loose embryogenic cell aggregates
began to predominate and fragment in each of the cultures, reaching
a state referred to as "dispersed." The treatment which yielded the
highest proportion of embryogenic clusters was the 402 medium plus
one NAA capsule. After the cultures became dispersed and were
doubling approximately every two to three days as determined by
increase in packed cell volume, a one ml packed cell volume
inoculum from each culture was transferred into 20 ml 401 medium
using a ten ml narrow tip pipet (Falcon 7551). These transfers were
performed about every 31/2 days. An inoculum from the 402 plus
2,4-D plus NAA capsules culture was also used to initiate a culture
in 409 medium (402 without 2,4-D and including 10 mg/l dicamba)
either with or without 1 ml coconut water (Gibco 670-8130AG) per 25
ml culture medium.
The most dispersed cultures were cryopreserved after 2 weeks, 2
months or 5 months.
The culture grown on 409 with coconut water was thawed eight months
after cryopreservation, cultured for two weeks on solid 201 culture
medium using BMS as a feeder layer (Rhodes et al., 1988) and
transferred to media 409 without coconut water. The culture was
maintained by subculturing twice weekly in 409 medium by the method
described above.
EXAMPLE 2
Initiation of the Suspension Culture (A188.times.B73)82 (Designated
SC82) for Use in Transformation
This Example describes the development of another cell line
employed in various of the transformation studies set forth below,
termed SC82. In the development of SC82, inoculum for suspension
culture initiation was visually selected from a Type II callus that
was initiated from A188.times.B73 immature embryos plated on a
N6-based medium containing 13.2 mg/l dicamba (227, Table 1). The
suspension culture was initiated within 3 months of initiation of
the Type II callus. Small amounts (50-100 mg) of callus
distinguishable by visual inspection because of its highly
proembryonic morphology, were isolated from more mature or
organized structures and inoculated into a 50 ml flask containing 5
mls of filter-sterilized conditioned medium from the various
G(A188.times.B73) 716 suspension cultures (402 medium with four
types of capsule treatments and 409 medium).
After one week, this 5 ml culture was sieved through a 710 micron
mesh and used to inoculate 20 mls of corresponding fresh and
filter-sterilized conditioned medium from the established
G(A188.times.B73) 716 cultures in 150 ml flasks. After one week or
more of growth, two mls of packed cells were subcultured to fresh
media by the method described above. The suspension culture
maintained on 409 by this method was then cryopreserved within 3
months. The original cell line, which was maintained on 409 (not a
reinoculated cryopreserved culture) was used in experiments 1 and 2
months later which resulted in stable transformation and selection
(see Table 6 below). The cryopreserved culture was used for
experiment 6 (see Table 6 below).
EXAMPLE 3
Initiation and Maintenance of Cell Line AT824
This example describes the initiation and maintenance of cell line
AT824 which has been used routinely for transformation experiments.
Immature embryos (0.5-1.0 mm) were excised from the B73-derived
inbred line AT and cultured on N6 medium with 100 uM silver
nitrate, 3.3 mg/L dicamba, 3% sucrose and 12 mM proline (2004). Six
months after initiation type I callus was transferred to medium
2008. Two months later type I callus was transferred to a medium
with a lower concentration of sucrose (279). A sector of type II
callus was identified 17 months later and was transferred to 279
medium. This cell line is uniform in nature, unorganized, rapid
growing, and embryogenic. This culture is desirable in the context
of this invention as it is easily adaptable to culture in liquid or
on solid medium.
The first suspension cultures of AT824 were initiated 31 months
after culture initiation. Suspension cultures may be initiated in a
variety of culture media including media containing 2,4-D as well
as dicamba as the auxin source, e.g., media designated 210, 401,
409, 279. Cultures are maintained by transfer of approximately 2 ml
packed cell volume to 20 ml fresh culture medium at 31/2 day
intervals. AT824 can be routinely transferred between liquid and
solid culture media with no effect on growth or morphology.
Suspension cultures of AT824 were initially cryopreserved 33-37
months after culture initiation. The survival rate of this culture
was improved when it was cryopreserved following three months in
suspension culture. AT824 suspension cultures have been
cryopreserved and reinitiated from cryopreservation at regular
intervals since the initial date of freezing. Repeated cycles of
freezing have not affected the growth or transformability of this
culture.
EXAMPLE 4
Initiation and Maintenance of Cell Lines ABT3, ABT4, ABT6, AB80,
AB82, AB12, AB44, AB60, AB61, AB62, AB63, AB69
Friable, embryogenic maize callus cultures were initiated from
hybrid immature embryos produced by pollination of inbred A188
plants (University of Minnesota, Crop Improvement Association) with
pollen of inbred line B73 plants (Iowa State University). Ears were
harvested when the embryos had reached a length of 1.5 to 2.0 mm.
The whole ear was surface sterilized in 50% v/v commercial bleach
(2.63% w/v sodium hypochlorite) for 20 min. at room temperature.
The ears were then washed with sterile distilled, deionized water.
Immature embryos were aseptically isolated and placed on nutrient
agar initiation/maintenance media with the root/shoot axis exposed
to the medium. Initiation/maintenance medium (hereinafter referred
to as medium 734) consisted of N6 basal medium (Chu 1975) with 2%
(w/v) sucrose, 1.5 mg per liter 2,4-dichlorophenoxyacetic acid
(2,4-D), 6 mM proline, and 0.25% Gelrite (Kelco, Inc. San Diego).
The pH was adjusted to 5.8 prior to autoclaving. Unless otherwise
stated, all tissue culture manipulations were carried out under
sterile conditions.
The immature embryos were incubated at 26.degree. C. in the dark.
Cell proliferation from the scutellum of the immature embryos were
evaluated for friable consistency and the presence of well defined
somatic embryos. Tissue with this morphology was transferred to
fresh media 10 to 14 days after the initial plating of the immature
embryos. The tissue was then subcultured on a routine basis every
14 to 21 days. Sixty to eighty milligram quantities of tissue were
removed from pieces of tissue that had reached a size of
approximately one gram and transferred to fresh medium.
Subculturing always involved careful visual monitoring to be sure
that only tissue of the correct morphology was maintained. The
presence of somatic embryos ensured that the cultures would give
rise to plants under the proper conditions. The cell cultures named
ABT3, ABT4, ABT6, AB80, AB82, AB12, AB44, AB60, AB61, AB62, AB63,
AB69 were initiated in this manner. The cell lines ABT3, ABT4, and
ABT6 were initiated from immature embryos of a 5-methyltryptophan
resistant derivative of A188.times.B73.
EXAMPLE 5
Initiation and Maintenance of Type II Callus of the Genotype
Hi-II
The Hi-II genotype of corn was developed from an A188.times.B73
cross. This genotype was developed specifically for a high
frequency of initiation of type II cultures (100% response rate,
Armstrong et al., 1991). Immature embryos (8-12 days
post-pollination, 1 to 1.2 mm) were excised and cultured embryonic
axis down on N6 medium containing 1 mg/L 2,4-D, 25 mM L-proline
(201) or N6 medium containing 1.5 mg/L 2,4-D, 6 mm L-proline (734).
Type II callus can be initiated either with or without the presence
of 100 .mu.M AgNo.sub.3. Cultures initiated in the presence of
AgNo.sub.3 was transferred to medium lacking this compound 14-28
days after culture initiation. Callus cultures were incubated in
the dark at 23-28.degree. C. and transferred to fresh culture
medium at 14 day intervals.
Hi-II type II callus is maintained by manual selection of callus at
each transfer. Alternatively, callus can be resuspended in liquid
culture medium, passed through a 1.9 mm sieve and replated on solid
culture medium at the time of transfer. It is believed that this
sequence of manipulations is one way to enrich for recipient cell
types. Regenerable type II callus that is suitable for
transformation can be routinely developed from the Hi-II genotype
and hence new cultures are developed every 6-9 months. Routine
generation of new cultures reduces the period of time over which
each culture is maintained and hence insures reproducible, highly
regenerable, cultures that routinely produce fertile plants.
EXAMPLE 6
Initiation of Cell Line E1
An ear of the genotype B73 was pollinated by A188. Immature embryos
(1.75-2.00 mm) were excised and cultured on 212 medium (see Table
1). About 4 months after embryo excision, approximately 5 ml PCV
type II callus was inoculated into 50 ml liquid 210 medium (see
Table 1). The suspension was maintained by transfer of 5 ml
suspension to 50 ml fresh 210 medium every 31/2 days. This
suspension culture was cryopreserved about 4 months after
initiation.
D. Cryopreservation Methods
Cryopreservation is important because it allows one to maintain and
preserve a known transformable cell culture for future use, while
eliminating the cumulative detrimental effects associated with
extended culture periods.
Cell suspensions and callus were cryopreserved using modifications
of methods previously reported (Finkle, 1985; Withers & King,
1979). The cryopreservation protocol comprised adding a pre-cooled
(0.degree. C.) concentrated cryoprotectant mixture stepwise over a
period of one to two hours to pre-cooled (0.degree. C.) cells. The
mixture was maintained at 0.degree. C. throughout this period. The
volume of added cryoprotectant was equal to the initial volume of
the cell suspension (1:1 addition), and the final concentration of
cryoprotectant additives was 10% dimethyl sulfoxide, 10%
polyethylene glycol (6000 MW), 0.23 M proline and 0.23 M glucose.
The mixture was allowed to equilibrate at 0.degree. C. for 30
minutes, during which time the cell suspension/cryoprotectant
mixture was divided into 1.5 ml aliquot (0.5 ml packed cell volume)
in 2 ml polyethylene cryo-vials. The tubes were cooled at
0.5.degree. C./minute to -8.degree. C. and held at this temperature
for ice nucleation.
Once extracellular ice formation had been visually confirmed, the
tubes were cooled at 0.5.degree. C./minute from -8.degree. C. to
-35.degree. C. They were held at this temperature for 45 minutes
(to insure uniform freeze-induced dehydration throughout the cell
clusters). At this point, the cells had lost the majority of their
osmotic volume (i.e. there is little free water left in the cells),
and they could be safely plunged into liquid nitrogen for storage.
The paucity of free water remaining in the cells in conjunction
with the rapid cooling rates from -35 to -196.degree. C. prevented
large organized ice crystals from forming in the cells. The cells
are stored in liquid nitrogen, which effectively immobilizes the
cells and slows metabolic processes to the point where long-term
storage should not be detrimental.
Thawing of the extracellular solution was accomplished by removing
the cryo-tube from liquid nitrogen and swirling it in sterile
42.degree. C. water for approximately 2 minutes. The tube was
removed from the heat immediately after the last ice crystals had
melted to prevent heating the tissue. The cell suspension (still in
the cryoprotectant mixture) was pipetted onto a filter, resting on
a layer of BMS cells (the feeder layer which provided a nurse
effect during recovery). Dilution of the cryoprotectant occurred
slowly as the solutes diffused away through the filter and
nutrients diffused upward to the recovering cells. Once subsequent
growth of the thawed cells was noted, the growing tissue was
transferred to fresh culture medium. The cell clusters were
transferred back into liquid suspension medium as soon as
sufficient cell mass had been regained (usually within 1 to 2
weeks). After the culture was reestablished in liquid (within 1 to
2 additional weeks), it was used for transformation experiments.
When desired, previously cryopreserved cultures may be frozen again
for storage.
E. DNA Segments Comprising Exogenous Genes
As mentioned previously, there are several methods to construct the
DNA segments carrying DNA into a host cell that are well known to
those skilled in the art. The general construct of the vectors used
herein are plasmids comprising a promoter, other regulatory
regions, structural genes, and a 3' end.
Several plasmids encoding a variety of different genes have been
constructed by the present inventors, the important features of
which are represented below in Table 3. Certain of these plasmids
are also shown in FIG. 1: pDPG165, FIG. 1(A, C); pDPG208, FIG. 1(B,
D); pDPG141, FIG. 1(E); pDPG237, FIG. 1(F); pDPG313 through
pDPG319, FIG. 1(H) through FIG. 1(N); pDPG290, FIG. 1(O); pDPG300
through pDPG304, FIG. 1(P) through FIG. 1(S); pDPG386 through
pDPG389, FIG. 1(T) through FIG. 1(W); pDPG140, FIG. 1(X); pDPG172,
FIG. 1(Y); pDPG425, FIG. 1(Z); pDPG427, FIG. 1(AA); pDPG451, FIG.
1(BB); pDPG 354, FIG. 1(CC); pDPG344, FIG. 1(DD); pDPG337, FIG.
1(EE).
TABLE 3 RECOMBINANT DELIBERATE VECTOR DESIG- PARENT EXPRESSION
NATION & SOURCE REPLICON INSERT DNA ATTEMPT pDPG140 pUC19 1,
118, 102, 1 103 pDPG141 pUC19 1, 100, 101 1 pDPG165 pUC19 2, 100,
101 2 pDPG172 pUC19 3, 118, 102, 3 103 pDPG182 pUC19 2, 118, 102, 2
103 pDPG205 pVK101 1, 101, 102 1 pDPG208 pUC19 1, 100 1 pDPG215
pUC18 3, 100, 102, 3 103 pDPG215 pUC19 3, 100, 101, 3 102 pDPG226
pUC19 4, 100, 101 4 pDPG230-231, 251, pUC19 1, 2, 100, 1, 2
262-264, 279, 282, 101 283 pDPG238-239 pUC19 2, 4, 100, 2, 4 101
pDPG240-241 pUC19 2, 5, 100, 2, 5 101 pDPG243-244 pUC19 2, 6, 100,
2, 6 101 pDPG246 pUC19 7, 100, 101 7 pDPG265 pBR325 9, 100 9
pDPG266-267 pUC19 8, 100, 101 8 pDPG268-269 pUC19 1, 100, 102 1
pDPG270-273 pUC19 1, 100, 101 1 pDPG274 pUC19 9, 100, 101 9 pDPG275
pUC18 10, 3, 100 10, 3 pDPG287 pUC19 2, 103, 105 2 pDPG288 pUC13
11, 100, 11 103 pDPG290 pUC19 12, 100, 12 103 pDPG291 pUC19 1, 103,
104 1 pPPG300 PUC19 2, 12, 100, 2, 12 101, 102, 103 pDPG301 pUC19
2, 12, 100, 2, 12 101, 102, 103 pDPG302 pUC18 2, 12, 100, 2, 12
101, 102, 103 pDPG303 pUC18 2, 12, 100, 2, 12 101, 102, 103 pDPG304
CoIE1 13, 100, 13 103 pDPG313 pUC18 2, 4, 100, 2, 4 103, 106, 107
pDPG314 pUC19 2, 4, 100, 2, 4 103, 106, 107 pDPG315 pUC23 2, 4,
100, 2, 4 103, 106, 108 pDPG316 pUC23 2, 4, 100, 2, 4 103, 106, 108
pDPG317 pUC23 2, 4, 100, 2, 4 103, 106, 107 pDPG318 pUC23 2, 4,
100, 2, 4 103, 106, 109 pDPG319 pUC23 2, 4, 100, 2, 4 103, 106, 109
pDPG320 pUC18 11, 100, 11 102, 103 pDPG324 pUC19 1, 2, 100, 1, 2
101 pDPG325 pUC19 1, 2, 100, 1, 2 101 pDPG326 pUC19 1, 2, 100, 1, 2
101, 102 pDPG327 pUC19 1, 2, 100, 1, 2 101, 102 pDPG328 pUC19 1, 2,
100, 1, 2 101, 113 pDPG329 pUC19 1, 2, 100, 1, 2 101, 113 pDPG332
pUC19 14, 100, 14 110 pDPG334 pGEM3 15, 111, 15 121, 103 pDPG335
pUC119 15, 112, 15 122, 114 pDPG336 pIC20H 19, 100, 19 117, 103
pDPG337 pIC20H 19, 100, 19 117, 103 pDPG338 pUC120 16, 112, 16 114,
115 pDPG339 pUC119 17, 111, 17 103 pDPG340 pUC19 18, 111, 18 103
pDPG344 pSK 11, 100, 11 102, 110 pDPG345 pSK 2, 14, 100, 2, 14 102,
110, 103 pDPG346 pSK 2, 14, 100, 2, 14 102, 110, 103 pDPG347 pSK 2,
14, 100, 2, 14 102, 110, 103 pDPG348 pSK 2, 14, 100, 2, 14 102,
110, 103 pDPG351 pUC19 3, 100, 101 3 pDPG354 pSK- 19, 100, 19 101,
110 pDPG355 pUC19 1, 100, 102, 1 103 pDPG356 pUC19 1, 100, 116, 1
103 pDPG357 pIC20H 1, 100, 117, 1 103 pDPG358 pUC8 1, 118, 102, 1
103 pDPG359 pUC119 1, 119, 103 1 pDPG360 pUC119 1, 120, 103 1
pDPG361 pUC19 1, 111, 103 1 pDPG362 pUC120 1, 112, 103 1 pDPG363
pSP73 2, 100, 102, 2 103 pDPG364 pUC119N 20, 100 20 pDPG365 pUC19
21, 100, 21 103 pDPG366 pSP73 22, 100, 22 102, 103 pDPG367 pBS+ 22,
100, 22 102, 103 pDPG368 pSP73 24, 100, 24 102, 103 pDPG369 pIC20H
24, 100, 24 117, 103 pDPG370 pBS+ 5, 100, 116, 5 103 pDPG371 pSP73
15, 100, 15 121, 103 pDPG372 pUC119 15, 100, 15 122, 103 pDPG373
pUC119 16, 120, 16 115 pDPG374 pUC120 16, 112, 16 114 pDPG375
pUC119 16, 111, 16 115 pDPG376 pUC119 18, 111, 18 103 pDPG377
pUC119 18, 111, 18 103 pDPG378 pUC119 17, 111, 17 103 pDPG379
pUC119 17, 111, 17 103 pDPG380 pUC119 17, 111, 17 103 pDPG381
pIC20H 19, 100, 19 117, 103 pDPG382 pIC20H 19, 100, 19 117, 103
pDPG384 pUC8 19, 100, 19 102, 103 pDPG385 pSP73 23, 100, 23 121,
103 pDPG386 pACYC177 6,114 6 pDPG387 pACYC177 1, 6, 100, 114 1, 6
pDPG388 pACYC177 2, 6, 100, 103, 2, 6 114 pDPG389 pACYC177 2, 6,
100, 103, 2, 6 114, pDPG391 pUC8 19, 100, 19 102, 103 pDPG392 pUC19
2, 100, 101 2 pDPG393 pSK- 4, 109, 102, 4 106, 103 pDPG394 pSK- 4,
124, 106, 4 103 pDPG396 pBS+ 19, 100, 19 102, 7, 103, 121 pDPG404
pSK- 1, 108, 103 1 pDPG405 pSK- 1, 107, 103 1 pDPG406 pSK- 1, 109,
103 1 pDPG407 pSK- 1, 109, 102, 1 103 pDPG408 pSK- 1, 124, 103 1
pDPG411 pBS+ 19, 100, 19 103, 121 pDPG415 pUC8 19, 118, 19 103
pDPG418 pGEM 15, 122, 15 123 pDPG419 pUC19 3, 100, 101, 1 3 16,
pDPG420 pUC19 3, 100, 101, 1 3 16 pDPG421 pSP72 2, 103, 126 2
pDPG422 pBS 1, 103, 126 1 pDPG424 pSK- 4, 124, 102, 4 103 pDPG427
pSK- 25, 124, 25 102, 103 pDPG434 pSK- 25, 103, 126 25 pDPG436 pSK-
26, 100, 102, 25 103 pDPG437 pUC19 2.100, 101, 1 2 02 pDPG438 pUC19
2, 100, 101, 1 2 02 pDPG439 pUC19 2, 100, 101, 1 2 02 pDPG441 pSK-
25, 103, 108 25 pDPG443 pSK- 25, 100, 103, 25 108 pDPG447 pSK- 25,
102, 103, 25 109 pDPG451 pUC18 26, 100, 102, 26 103 pDPG452 pGEM 2,
123 2 pDPG453 pUC19 2, 103, 127 2 pDPG456 pSK- 19, 100, 19 101, 110
pDPG457 pSK- 19, 100, 19 101, 110 pDPG458 pSK- 1, 103, 127 1
pDPG465 pSK- 25, 100, 101, 25 102 pDPG467 pSK- 25, 102, 118 25
pDPG469 pUC19 26, 118, 102, 26 103 pDPG474 pUC19 27, 100, 102, 27
103
Key
Insert DNA and Deliberate Expression Attempt
1. The uidA gene from E. Coli encodes .beta.-glucuronidase (GUS).
Cells expressing uidA produce a blue color when given the
appropriate substrate. Jefferson, R. A. 1987. Plant Mol. Biol. Rep
5: 387-405.
2. The bar gene from Streptomyces hygroscopicus encodes
phosphinothricin acetyltransferase (PAT). Cells expressing PAT are
resistant to the herbicide Basta. White, J., Chang, S.-Y. P., Bibb,
M. J., and Bibb, M. J. 1990. Nucl. Ac. Research 18: 1062.
3. The lux gene from firefly encodes luciferase. Cells expressing
lux emit light under appropriate assay conditions. deWet, J. R.,
Wood, K. V., DeLuca, M., Helinski, D. R., Subramani, S. 1987. Mol.
Cell. Biol. 7: 725-737.
4. The aroA gene from Salmonella typhimurium encodes
5-enolpyruvylshikimate 3-phosphate synthase (EPSPS). Comai, L.,
Sen, L. C., Stalker, D. M., Science 221: 370-371, 1983.
5. The dhfr gene from mouse encodes dihydrofolate reductase (DHFR).
Cells expressing dhfr are resistant to methotrexate. Eichholtz, D.
A., Rogers, S. G., Horsch, R. B., Klee, H. J., Hayford, M.,
Hoffman, N. L., Bradford, S. B., Fink, C., Flick, J., O'Connell, K.
M., Frayley, R. T. 1987. Somatic Cell Mol. Genet. 13: 67-76.
6. The neo gene from E. Coli encodes aminoglycoside
phosphotransferase (APH). Cells expressing neo are resistant to the
aminoglycoside antibiotics. Beck, E., Ludwig, G., Auerswald, E. A.,
Reiss, B., Schaller, H. 1982. Gene 19: 327-336.
7. The amp gene from E. Coli encodes .beta.-lactamase. Cells
expressing .beta.-lactamase produce a chromogenic compound when
given the appropriate substrate. Sutcliffe, J. G. 1978. Proc. Nat.
Acad. Sci. USA 75: 3737-3741.
8. The xylE gene from Ps. putida encodes catechol dihydroxygenase.
Cells expressing xylE produce a chromogenic compound when given the
appropriate substrate. Zukowsky et al. 1983. Proc. Nat. Acad. Sci.
USA 80: 1101-1105.
9. The R,C1 and B genes from maize encode proteins that regulate
anthocyanin biosynthesis in maize. Goff, S., Klein, T., Ruth, B.,
Fromm, M., Cone, K., Radicella, J., Chandler, V. 1990. EMBO J.:
2517-2522.
10. The als gene from Zea mays encodes acetolactate synthase. The
enzyme was mutated to confer resistance to sulfonylurea herbicides.
Cells expressing als are resistant to the herbicide Gleen. Yang, L.
Y., Gross, P. R., Chen, C. H., Lissis, M. 1992. Plant Molecular
Biology 18: 1185-1187.
11. The proteinase inhibitor II gene was cloned from potato and
tomato. Plants expressing the proteinase inhibitor II gene show
increased resistance to insects. Potato: Graham, J. S., Hall, G.,
Pearce, G., Ryan, C. A. 1986 Mol. Cell. Biol. 2: 1044-1051. Tomato:
Pearce, G., Strydom, D., Johnson, S., Ryan, C. A. 1991. Science
253: 895-898.
12. The Bt gene from Bacillus thuringensis berliner 1715 encodes a
protein that is toxic to insects. Plants expressing this gene are
resistant to insects. This gene is the coding sequence of Bt 884
modified in two regions for improved expression in plants. Vaeck,
M., Reynaerts, A., Hofte, H., Jansens, S., DeBeuckeleer, M., Dean,
C., Aeabeau, M., Van Montagu, M., and Leemans, J. 1987. Nature 328:
33-37.
13. The bxn gene from Klebsiella ozaeneae encodes a nitrilase
enzyme specific for the herbicide bromoxynil. Cells expressing this
gene are resistant to the herbicide bromoxynil. Stalker, D. m.,
McBride, K. E., and Malyj, L. Science 242: 419-422, 1988.
14. The WGA-A gene encodes wheat germ agglutinin. Expression of the
WGA-A gene confers resistance to insects. The WGA-A gene was cloned
from wheat. Smith, J. J., Raikhel, N. V. 1989. Plant Mol. Biology
13: 601-603.
15. The dapA gene was cloned from E. Coli. The dapA gene codes for
dihydrodipicolinate synthase. Expression of this gene in plant
cells produces increased levels of free lysine. Richaud, F.,
Richaud, C., Rafet, P. and Patte, J. C. 1986. J. Bacteriol. 166:
297-300.
16. The Z10 gene codes for a 10 kd zein storage protein from maize.
Expression of this gene in cells alters the quantities of 10 kD
Zein in the cells. Kirihara, J. A., Hunsperger, J. P., Mahoney, W.
C., and Messing, J. 1988. Mol. Gen. Genet. 211: 477-484.
17. The A20 sequence encodes the 19 kd zein storage protein of Zea
mays. Expression of the construct in maize alters quantities of the
native 19 kd zein gene.
18. The Z4 sequence is for the 22 kd zein storage protein of Zea
mays. Expression of this construct in maize alters quantities of
the native 22 kd zein gene.
19. The Bt gene cloned from Bacillus thuringensis Kurstaki encodes
a protein that is toxic to insects. The gene is the coding sequence
of the cry IA(c) gene modified for improved expression in plants.
Plants expressing this gene are resistant to insects. Hofte, H. and
Whiteley, H. R., 1989. Microbiological Reviews. 53: 242-255.
20. The als gene from Arabidopsis thaliana encodes a sulfonylurea
herbicide resistant acetolactate synthase enzyme. Cells expressing
this gene are resistant to the herbicide Gleen. Haughn, G. W.,
Smith, J., Mazur, B., and Somerville, C. 1988. Mol. Gen. Genet.
211: 266-271.
21. The deh1 gene from Pseudomonas putida encodes a dehalogenase
enzyme. Cells expressing this gene are resistant to the herbicide
Dalapon. Buchanan-Wollaston, V., Snape, A., and Cannon, F. 1992.
Plant Cell Reports 11: 627-631.
22. The hygromycin phosphotransferase II gene was isolated from E.
coli. Expression of this gene in cells produces resistance to the
antibiotic hygromycin. Waldron, C., Murphy, E. B., Roberts, J. L.,
Gustafson, G. D., Armour, S. L., and Malcolm, S. K. Plant Molecular
Biology 5: 103-108, 1985.
23. The lysC gene from E. coli encodes the enzyme aspartyl kinase
III. Expression of this gene leads to increased levels of lysine in
cells.
24. The hygromycin phosphotransferase II gene was isolated from
Streptomyces hygroscopicus. Expression of this gene in cells
produces resistance to the antibiotic hygromycin.
25. The EPSPS gene (5-enolpyruvy/shikimate--3-phosphate synthase)
gene from Zea Mays was mutated to confer resistance to the
herbicide ROUNDUP.RTM. (glyphosate). An isoleucine has been
substituted for threonine at amino acid position 102 and a serine
has been substituted for proline at amino acid position 106.
26. The mtlD gene was cloned from E. coli. This gene encodes the
enzyme mannitol-1-phosphate dehydrogenase. Lee and Saier, 1983. J.
of Bacteriol. 153:685.
27. The HVA-1 gene encodes a Late Embryogenesis Abundant (LEA)
protein. This gene was isolated from barley. Dure, L., Crouch, M.,
Harada, J., Ho, T.-H. D. Mundy, J., Quatrano, R, Thomas, T, and
Sung, R., Plant Molecular Biology 12: 475-486.
Regulatory Sequences
100. Promoter sequences from the Cauliflower Mosaic Virus genome.
Odell, J. T., Nagy, F., and Chua, N.-H. 1985. Nature 313:
810-812.
101. Promoter and terminator sequences from the Ti plasmid of
Agrobacterium tumefaciens. (a) Bevan, M., 1984. Nucleic Acid
Research 12: 8711-8721; (b) Ingelbrecht, I. L. W., Herman, L. M.
F., DeKeyser, R. A., Van Montagu, M. C., Depicker, A. G. 1989. The
Plant Cell 1: 671-680; (c) Bevan, M., Barnes, W. M., Chilton, M.
D., 1983. Nucleic Acid Research. 11: 369-385; (d) Ellis, J. G.,
Llewellyn, D. J., Walker, J. C., Dennis, E. S., Peacocu, W. J.
1987. EMBO J. 6: 3203-3208.
102. Enhancer sequences from the maize alcohol dehydrogenase gene.
Callis, J., Fromm, M. E., Walbot, V., 1987. Genes Dev. 1:
1183-1200.
103. Terminator sequences from Ti plasmid of Agrobacterium
tumefaciens. (a) Bevan, M., 1984. Nucleic Acid Research 12:
8711-8721; (b) Ingelbrecht, I. L. W., Herman, L. M. F., DeKeyser,
R. A., Van Montagu, M. C., Depicker, A. G. 1989. The Plant Cell 1:
671-680; (c) Bevan, M., Barnes, W. M., Chilton, M. D., 1983.
Nucleic Acid Research. 11: 369-385.
104. Pollen specific promoter sequence ZM13 from maize.
105. Transit peptide sequence from rbcS gene from pea. Fluhr, R.,
Moses, P., Morelli, G., Coruzzi, C., Chua, N.-H. 1986. EMBO J. 5:
2063-2071.
106. Optimized transit peptide sequence consisting of sequences
from sunflower and maize. Constructed by Rhone Poulenc
Agrochimie.
107. Fused promoter sequences from Cauliflower Mosaic Virus genome
and Arabidopsis thaliana H4 histone gene. Constructed by Rhone
Poulenc Agrochimie.
108. Promoter sequence from Arabidopsis thaliana histone H4 gene.
Chaboute, H. E., Chambet, N., Philipps, G., Ehling, M. and Grigot,
C. 1987. Plant Mol. Biol. 8: 179-191.
109. Promoter sequence from maize .alpha.-tubulin gene.
110. Terminator sequences from the potato proteinase inhibitor II
gene. An, G., Mitra, A., Choi, H. K., Costa, M. A., An, K.,
Thornburg, R. W., Ryan, C. A. 1989. Plant Cell 1: 115-122.
111. Promoter from the maize 10 kd zein gene.
112. Promoter from the maize 27 kd zein gene. Ueda, T. and Messing,
J. 1991. Theor. Appl. Genet. 82: 93-100.
113. The matrix attachment region (MAR) was isolated from chicken.
Use of this DNA sequence reduces variations in gene expression due
to integration position effects. Stief, A., Winter, D., Stratling,
W. H., Sippel, A. E. 1989. Nature 341: 343.
114. Terminator sequ e nces from the Cauliflower Mosaic Virus
genome. Timmermans, M. C. P., Maliga, P., Maliga, P., Vieiera, J.
and Messing, J. 1990. J. Biotechnol. 14: 333-344.
115. Terminator from maize 10 kd zein gene. Kirihara, J. A.,
Hunsperger, J. P., Mahoney, W. C., Messing, J. 1988. Mol. Gen.
Genet. 211: 477-484.
116. Enhancer sequence from the shrunken-1 gene of Zea mays. Vasil,
V., Clancy, M., Ferl, R. J., Vasil, I. K., Hannah, L. C. 1989.
Plant Physiol. 91: 1575-1579.
117. RNA leader sequence from the ribulose-bis-phosphate
carboxylase gene from Glycine max. Joshi, C. P. 1987. Nucleic Acids
Res. 15:6643-9640.
118. Promoter sequence from the alcohol dehydrogenase gene of Zea
mays. Walker, J. C., Howard, E. A., Dennis, E. S., Peacock, W. J.
1987. P.N.A.S. 84: 6624-6628.
119. Promoter sequence from the glutamine synthetase gene of Zea
mays.
120. Promoter sequence from the 22 kD (Z4) zein gene of Zea mays.
Schmidt, R. J., Ketudat, M., Ankerman, M. J. and Hoschek, G. 1992.
Plant Cell 4: 689-700.
121. Transit peptide sequence of the ribulose bis-phosphate
carboxylase small subunit gene from Zea mays. GenBank Accession
Y00322.
122. Transit peptide sequence of the dihydropicolinic acid synthase
gene of Zea mays.
123. Globulin-1, glb1, promoter and terminator sequences from Zea
mays. Belanger and Kriz. 1991.
124. Promoter sequence from maize histone H3C4. Chaubet, N.,
Clement, B., Philipps, G. and Gigot, C. 1991. Plant Molecular
Biology 17: 935-940.
125. DNA sequence encoding first 8 amino acids of the mature
ribulose bisphosphate carboxylase gene of Zea mays.
126. Actin-1 5' region including promoter from Zea mays. Wang, Y.,
Zhang, W., Cao, J., McEhoy, D. and Ray Wu. 1992. Molecular and
Cellular Biology 12: 3399-3406.
127. The DS element isolated from Zea mays.
DNA segments encoding the bar gene were constructed into a plasmid,
termed pDPG165, which was used to introduce the bialaphos
resistance gene into recipient cells (see FIGS. 1A and C). The bar
gene was cloned from Streptomyces hygroscopicus (White et al.,
1990) and exists as a 559-bp Sma I fragment in plasmid pIJ4101. The
sequence of the coding region of this gene is identical to that
published (Thompson et al., 1987). To create plasmid pDPG165, the
Sma I fragment from pIJ4104 was ligated into a pUC19-based vector
containing the Cauliflower Mosaic Virus (CaMV) 35S promoter
(derived from pBI221.1. provided by R. Jefferson, Plant Breeding
Institute, Cambridge, England), a polylinker, and the transcript 7
(Tr7) 3' end from Agrobacterium tumefaciens (3' end provided by D.
Stalker, Calgene, Inc., Davis, Calif.).
An additional vector encoding GUS, pDPG208, (FIGS. 1B and 1D) was
used in these experiments. It was constructed using a 2.1 kb
BamHI/EcoRI fragment from pAGUS1 (provided by J. Skuzeski,
University of Utah, Salt Lake City, Utah) containing the coding
sequence for GUS and the nos 3'-end from Agrobacterium tumefaciens.
In pAGUS1 the 5'-noncoding and 5'-coding sequences for GUS were
modified to incorporate the Kozak consensus sequence (Kozak, 1984)
and to introduce a new HindIII restriction site 6 bp into the
coding region of the gene (see FIG. 1E). The 2.1 kb BamHI/EcoRI
fragment from pAGUS1 was ligated into a 3.6 kb BamHI/EcoRI fragment
of a pUC19-based vector pCEV1 (provided by Calgene, Inc., Davis,
Calif.). The 3.6 kb fragment from pCEV1 contains pUC19 and a 430 bp
35S promoter from cauliflower mosaic virus adjacent to the first
intron from maize Adh1.
In terms of a member of the R gene complex for use in connection
with the present invention, the most preferred vectors contain the
35S promoter from Cauliflower Mosaic Virus, the first intron from
maize Adh1 gene, the Kozak consensus sequence, Sn:bol3 cDNA, and
the transcript 7 3' end from Agrobacterium tumefaciens. One such
vector prepared by the inventors is termed pDPG237. To prepare
pDPG237 (see FIG. 1F), the cDNA clone of Sn:bol3 was obtained from
S. Dellaporta (Yale University, USA). A genomic clone of Sn was
isolated from genomic DNA of Sn:bol3 which had been digested to
completion with HindIII, ligated to lambda arms and packaged in
vitro. Plaques hybridizing to two regions of cloned R alleles, R-nj
and R-sc (Dellaporta et al., 1988) were analyzed by restriction
digest. A 2 kb Sst-HincIII fragment from the pSn7.0 was used to
screen a cDNA library established in lambda from RNA of
light-irradiated scutellar nodes of Sn:bol3. The sequence and a
restriction map of the cDNA clone was established.
The cDNA clone was inserted into the same plant expression vector
described for pDPG 165, the bar expression vector (see above), and
contains the 35S Cauliflower mosaic virus promoter, a polylinker
and the transcript 7 3' end from Agrobacterium tumefaciens. This
plasmid, pDPG232, was made by inserting the cDNA clone into the
polylinker region; a restriction map of pDPG232 is shown in FIG.
1G. The preferred vector, pDPG237, was made by removing the cDNA
clone and Tr7 3' end from pDPG232, with Aval and EcoRI and ligating
it with a BamHI/EcoRI fragment from pbPG208. The ligation was done
in the presence of a BamHI linker as follows (upper strand, SEQ ID
NO:3; lower strand, SEQ ID NO:4):
GATCCGTCGACCATGGCGCTTCAAGCTTC
GCAGCTGGTACCGCGAAGTTCGAAGGGCT
The final construct of pDPG237 contained a Cauliflower mosaic virus
35S promoter, the first intron of Adh1, Kozak consensus sequence,
the BamHI linker, cDNA of Sn:Bol3, and the Tr7 3' end and is shown
in FIG. 1F.
Additional vectors have been prepared using standard genetic
engineering techniques. For example, a vector, designated pDPG128,
has been constructed to include the neo coding sequence (neomycin
phosphotransferase (APH(3')-II)). Plasmid pDPG128 contains the 35S
promoter from CaMV, the neomycin phosphotransferase gene from Tn5
(Berg et al., 1980) and the Tr7 terminator from Agrobacterium
tumefaciens. Another vector, pDPG154, incorporates the crystal
toxin gene and was also prepared by standard techniques. Plasmid
pDPG154 contains the 35S promoter, the entire coding region of the
crystal toxin protein of Bacillus thuringiensis var. kurstaki HD
263, and the Tr7 promoter.
Various tandem vectors have also been prepared. For example, a
barlaroA tandem vector (pDPG238) was constructed by ligating a
blunt-ended 3.2 kb DNA fragment containing a mutant EPSP synthase
aroA expression unit (Barkai-Golan et al., 1978) to NdeI-cut
pDPG165 that had been blunted and dephosphorylated (NdeI introduces
a unique restriction cut approximately 200 bp downstream of the Tr7
3'-end of the bar expression unit). Transformants having aroA in
both orientations relative to bar were identified.
Additional bar gene vectors employed are pDPG284 and
pDPG313-pDPG319 (FIG. 1H-N), the latter series being obtained from
Rhone-Poulenc Agrochimie (RPA). The orientation of the bar gene in
DPG165 was inverted with respect to the pUC vector, to obtain
pDPG284. An additional 32 bp of DNA has been inserted into the Ndel
site of pDPG165 and pDPG284, to obtain pDPG295 and pDPG297 and
pDPG298, respectively. This extra 32 bp of sequence preserves the
unique NdeI site in each vector and adds four additional
restriction sites with the following orientation, relative to the
unique NarI site:
NarI-52 bp-HpaI-NotI-NruI-EcoRI-NdeI.
Tandem bar-aroA vectors with a 35S-histone promoter (constitutive
and meristem enhanced expression) in convergent (pDPG314),
divergent (pDPG313), and colinear orientations (pDPG317) have also
been employed, as have aroA vectors with a histone promoter
(meristem-specific promoter, (pDPG315/pDPG316) and an
.alpha.-tubulin promoter (root-specific, pDPG318/pDPG319) in
colinear and divergent orientations to bar respectively.
Plasmid pDPG290 incorporates the modified Bt CryIA(b) gene, IAb6,
obtained from Plant Genetic Systems, PGS. A 1.8 kb NcoI-NheI
fragment containing IAb6 was ligated together with the Tr7 3'
region on a 0.5 Kb NheI-EcoRI fragment from pDPG145 and 3.6 Kb
NcoI-EcoRI fragment from pDGP208 containing the 35S promoter, Adh1
intron I, and the required plasmid functions to create pDPG290
(FIG. 1, O).
In the construction of IAb6-bar tandem vectors, modifications were
made to the separate bar and IAb6 expression units so that IAb6
could be inserted as a NotI-flanked cassette into the
bar-containing plasmid. A NotI recognition site was introduced
through a series of ligations into plasmids which contained the bar
expression unit in two orientations with respect to the new NotI
recognition site. The bar expression unit was removed from pDPG165
as a HindIII-EcoRI fragment and ligated to HindIII-EcoRI cut pUC18
to give the plasmid pDPG284. This reversed the orientation of the
bar expression unit with respect to the pUC plasmid. An
oligonucleotide containing HpaI, Pmil, NruI, EcoRI, and NdeI
restriction sites was ligated to NdeI cut pDPG165 and pDPG284 to
produce pDPG285/pDPG286 and pDPG292/pDPG293, respectively. These
pairs of plasmids were the two orientations of the oligonucleotide.
These four plasmids were then cut with PmII in order to introduce a
NotI linker which destroyed the PmII recognition site. Plasmids
pDPG292 and pDPG293 containing the NotI linker were designated
pDPG298 and pDPG297, respectively. A NotI site was introduced
adjacent to the 3' end of the Tr7 3' region by removing a 200 bp
EcoRI fragment from pDPG294. This vector was designated
pDPG296.
An IAb6 vector with flanking NotI sites was constructed via a 4-way
ligation consisting of the Tr7 3' region (as a 500 bp HpaI-BgIII
fragment from pDPG296), the IAb6 gene (as a 1.8 Kb BamHI-NcoI
fragment from pDPG290), the 35S promoter-Adh1 intron 1 cassette (as
a 800bp XbaI-NcoI fragment from pDPG208), and the pBluescript II
SK(-)plasmid (as a 2.95 Kb XbaI-HindII fragment). The pBluescript
plasmid has a polylinker that positioned a second NotI recognition
site next to the 5' end of the IAb6 expression unit. The plasmid
which contained the NotI-flanked IAb6 expression unit was
designated pDPG299. The IAb6 expression unit was excised from
pDPG299 as a 3.lkb NotI fragment and ligated to NotI cut pDPG295
and pDPG298 to yield pDPG300/pDPG301 and pDPG302/pDPG303,
respectively (FIG. 1P-S). The pairs are the two orientations
possible for each ligation.
A plasmid DNA, pDPG310, was constructed that contains a bar
expression unit and a single copy of the matrix attachment region
from the chicken lysozyme gene. The nuclear matrix attachment
region (MAR, or "A-element") from the chicken genomic DNA region 5'
to the lysozyme gene is contained on a 2.95 kb KpnI-PstI fragment
in plasmid pUC19 B1-X1 (received from A. E. Sippel, Freiburg). It
has been reported that genes flanked by MAR elements result in
tissue independent gene expression and enhanced transcriptional
activity. Plasmid DNA pDPG310 was constructed by performing a 3-way
litigation among the following DNAs:
1) 2.9 kb NotI-KpnI fragment from pBluescript II SK(-),
2) 2.95 kb KpnI-PstI MAR fragment from pUC19 B1-X1, and
3) 2.1 kp PstI-NotI bar-containing fragment from pDPG294.
Plasmid pDPG310 contains three SacI sites, one in each of the above
DNA fragments. A second MAR element was inserted into the SacI site
at the end of the pBluescript II SK(-) multiple cloning region. The
resulting plasmid has a unique NotI site, into which future traits
of interest could be cloned.
In regard to vectors encoding protease inhibitors, plasmid DNA,
pRJ15, containing the genomic DNA sequence for the potato pinII
gene, was obtained from Clarence Ryan (Washington State University)
and renamed pDPG288. Another plasmid DNA, pT2-47, containing the
cDNA sequence for the tomato pinII gene, was obtained from Clarence
Ryan and renamed pDPG289. The potato pinII gene in pDPG288 is
flanked by a 35S promoter and a Tr7 3' end.
Tandem vectors were constructed containing a bar expression unit
and a potato or tomato pinII expression unit in either convergent
or colinear orientation. In each construct, the bar and pinII
expression units were contained on a HindIII fragment that also
contains a 1.9 kb fragment of Adh1 but lacks the Amp.sup.R gene and
the plasmid origin of replication. The 1.9 kb Adh1 region provides
a locus for recombination into the plant genome without disruption
of either the bar or pinII expression units. These HindIII
fragments are available for bombardment experiments as either
linear, circular, or supercoiled DNAs.
To construct a plant expression vector containing the potato pinII
terminator, the potato pinII terminator was cloned into pBluescript
II SK(-) via a three-part ligation. To obtain the pinII terminator,
a 3.7 kb PstI fragment was first removed from pDPG288 and
subsequently digested with RsaI/PstI to yield the 930 bp pinII
terminator. The pBluescript II vector was digested with ScaI/PstI
and ScaI/SmaI in two separate reactions; the appropriate two
plasmid fragments were gel-purified. These fragments and the pinII
terminator were ligated to give plasmid pDPG331.
In order to construct pDPG320, a pinII expression vector containing
the 35S promoter-AdhI intronI-pinII (with intron and
terminator)-Tr7 terminator vector, the following protocol was used.
pDPG309 was cut with BgIII/EcoRI and the vector fragment was
isolated. pDPG157 was cut with PstI/EcoRI and the 500 bp Tr7
fragment was isolated. To isolate the AdhI intron 3'-end, pDPG309
was cut with BgIII/XbaI. Finally, pDPG288 was restricted with
XbaI/PstI and the potato pinII gene (with intron and terminator)
was isolated. After purification, the four fragments were ligated
together and transformed into competent DH5.alpha. cells. Miniprep
analysis identified the correct clone.
A further plant expression vector that contains the potato pinII
terminator is pDPG343. This plasmid contains the 420-bp 35S
promoter, maize Adh1 intron I, a multiple cloning region, and the
potato pinII terminator. pDPG343 was constructed by way of a
three-part ligation of the following DNAs:
1) 3330 bp EcoRI-PstI fragment of pDPG309, containing the
pBluescript SK(-) and the 420 bp 35S promoter,
2) 580 bp PstI-XbaI fragment of pDPG309, containing the maize Adh1
intron 1, and
3) 960 bp XbaI-EcoRI fragment of pDPG331, containing the potato
pinII terminator.
Plasmid pDPG343 contains the following restriction sites between
the Adh1 intron I and the potato pinII terminator:
BamHI-SalI-XbaI-SpeI-BamHI
Of the above sites, SpeI in the only unique one in pDPG343. While
BamHI can readily be used for one-step cloning of trait genes, use
of SaII or XbaI will require either three-part (or greater)
ligations, or multiple cloning steps.
The DNA fragment encoding the firefly luciferase protein was
inserted into a pUC18-based vector containing the 35S promoter from
Cauliflower Mosaic Virus, the first intron from the maize Adh1
gene, and the transcript 7 3' end from Agrobacterium tumefaciens
(provided in the plasmid pCEV1 from Calgene, Inc., Davis, Calif.).
This luciferase expression vector is referred to as pDPG215, and
contains the same regulatory elements as the bar-expression vector
pDPG165.
Two additional luciferase vectors were created, both utilizing
intron VI from Adh1 (derived from vector pDPG273) fused to firefly
luciferase (obtained from vector pDPG215). These elements were
inserted into either the pDPG282 (4 OCS inverted-35S) to create
pDPG350, or into the pDPG283 (4 OCS-35S) backbone to create pDPG351
(bar was excised as a BamHI/NheI fragment and the intron plus
luciferase gene inserted). The 4 OCS-35S promoter has been shown
with the uidA gene to give very high levels of transient
expression.
Replication-competent viral vectors are also contemplated for use
in maize transformation. Two wheat dwarf virus (WDV) "shuttle"
vectors were obtained from J. Messing (Rutgers). These vectors,
pWI-11 (pDPG386) and pWI-GUS (pDPG387) (FIG. 1T,U), are capable of
autonomous replication in cells derived from electroporated maize
endosperm protoplasts (Ugaki et al., 1991). Both of these vectors
encode a viral replicase and contain viral and E. coli origins of
replication. In both of these vectors, the viral coat protein
coding sequence has been replaced by the neo gene. pDPG387
(pWI-GUS) was created by insertion of a GUS expression cassette
(35S-GUS-35S 3') into the BamHI site of pDPG386 (pWI-11).
The expression and integration of marker genes introduced into
maize cells on a replicating vector was examined using pDPG387
(pWI-GUS) and BMS cells. Six filters of BMS cells were bombarded
with pDPG387/pDPG165 (35S-bar-Tr7) and as a control, six filters
were bombarded with pDPG128 (35S-neo-Tr7)/pDPG165. Tissue from
three filters of each cotransformation was selected on bialaphos (1
mg/l) and tissue from the remaining three filters of each
cotransformation was selected on kanamycin (100 mg/l). Selection of
kanamycin-resistant colonies from tissue bombarded with pDPG387 was
very inefficient (4 colonies) as compared to the control treatment
in which cells were bombarded with pDPG128/pDPG165 (364 colonies).
It also appears that bialaphos selection was less efficient for
cells bombarded with pDPG387/pDPG165 (59 colonies) than it was for
the control in which cells were bombarded with PDPG128/pDPG165 (274
colonies).
There are several potential reasons for the low selection
efficiencies in bombardments using pDPG387. The neo gene carried by
pDPG387 is driven by the native WDV coat protein promoter; this
promoter may not be strong enough to confer kanamycin resistance.
Alternatively, the relatively low number of bialaphos-resistant
colonies recovered from cells bombarded with pDPG387/pDPG165,
infers some sort of negative impact of pDPG387 on the ultimate
selection for expression of a marker gene on a separate,
non-replicating vector. The nature of this negative impact, and its
relationship to the low yield of kanamycin-resistant colonies, is
currently been investigated.
WDV-bar vectors were constructed to help address the question of
the effect of promoter strength on selection as well as to provide
replicating vectors for eventual use with embryogenic cultures. The
35S-bar-Tr7 expression cassette was isolated from pDPG165 as an
EcoRI/HindIII fragment and protruding ends were filled in with T4
DNA polymerase. This fragment was ligated into pDPG386 (pWI-11)
that had been linearized with BamHI, filled in with T4 DNA
polymerase, and alkaline phosphatase treated. Vectors containing
both orientations of the insert were generated and designated
pDPG388 and pDPG389 (FIG. 1 V,W).
A gene encoding the enzyme EPSPS was cloned from Zea mays. Two
mutations were introduced into the amino acid sequence of EPSPS to
confer glyphosate resistance, i.e., a substitution of isoleucine
for threonine at amino acid position 102 and a substitution of
serine for proline at amino acid position 106. Seven plant
expression vectors were constructed using the promoterless mutant
maize EPSPS expression vector received from Rhone Poulenc
(pDPG425). The mutant EPSPS gene in this vector encodes an enzyme
with amino acid changes at positions 102 (threonine to isoleucine)
and 106 (proline to serine). Seven promoters (.+-. introns) were
used in vector constructions using the mutant maize EPSPS gene. A
description of the construction of these vectors is presented
below.
Four vectors (pDPG434, 436, 441, and 443) were constructed by
cloning four promoters into SmaI-linearized pDPG425. Linearized
vectors were treated with calf alkaline phosphatase to prevent
recircularization prior to ligation. The rice actin promoter and
intron were isolated as a 1.5 kb HindIII fragment from pDPG421
(pDM302; Cao et al., Plant Cell Rep (1992) 11:586-591). The
35S/adh1 intron I promoter was isolated from pDPG208 as a 0.9 kb
HindIII fragment . The 2.times.Arabidopsis histone promoter was
isolated as a 1.4 kb EcoRI/HindIII fragment from pDPG404. The
2.times.35S/Arabidopsis histone promoter was isolated as a 1.8 kb
EcoRI/HindIII fragment from pDPG405. The above mentioned promoter
fragments were T4 DNA polymerase-treated to create blunt ends prior
to ligation into SmaI linearized pDPG425 (FIG. 1(Z)). To create
pDPG447, a 2.1 EcoRI/NcoI .alpha.-tubulin/adh1 intron I fragment
was isolated from pDPG407 and ligated into EcoRI/NcoI digested
pDPG425 (FIG. 1(Z)). The adh1 promoter and intron I were isolated
from pDPG172 (FIG. 1(Y), a derivative of pDPG140 (FIG. 1(X), as a
1.8 kb EcoRI fragment and ligated into EcoRI digested, calf
alkaline phosphatase-treated pDPG425 (FIG. 1(Z)). The resulting
plasmid was designated pDPG465. The 2.times.OCS promoter and adhl
intron VI were isolated from pDPG354 as a 0.6 kb SacI/NcoI fragment
and ligated into SacI/NcoI digested pDPG425 (FIG. 1(Z)). This
plasmids was designated pDPG467. A list of all of the mutant maize
EPSPS vectors that were constructed is shown in Table 4.
TABLE 4 List of mutant maize EPSPS plant expression vectors
constructed using pDPG425, and various promoters. DEKALB Plasmid
Designation Plant Expression Cassette pDPG434 actin - EPSPS - nos
pDPG436 35S/adh1 intron I - EPSPS - nos pDPG441 2X Arabidapsis
histone - EPSPS - nos pDPG443 2X 35S/Arabidopsis histone - EPSPS -
nos pDPG447 .alpha.-tubulin/adh1 intron I - EPSPS - nos pDPG465 2X
OCS/adh1 intron VI - EPSPS - nos pDPG467 adh1 promoter/adh1 intron
I - EPSPS - nos
Several vectors were constructed containing genes which may
increase stress resistance in transgenic plants, including the mtID
gene from E. coli and the HVA-1 gene from barley. The mannitol
operon was originally cloned and characterized by Lee and Saier,
1983 . The mtID gene has been shown to confer stress resistance on
transgenic tobacco plants (Tarczynski, M. C. et al., 1993). A
plasmid designated pCD7.5, containing the mtID gene from this
operon (encoding mannitol-1-phosphate dehydrogenase) was obtained
from M. Muller, University of Freiburg. The structural gene was
isolated as a 1500 bp fragment after digestion of pCD7.5 with NsiI
and PstI, and was ligated into a pUC18-based vector containing the
35S promoter from Cauliflower Mosaic Virus, the first intron from
the maize Adh1 gene, and the transcript 7 3' end from Agrobacterium
tumefaciens. The backbone and regulatory elements were prepared for
this construction by removing the luciferase structural gene from
pDPG215 (35s-AdhI.sub.1 -luc-Tr7 3'; further described in this
document), and then religating with an oligonucleotide that created
a unique NsiI site between the intron and Tr7 element (this
intermediate vector was designated pDPG431). pDPG431 was then
linearized using NsiI and the mtID gene was inserted. The final
vector was designated pDPG451 (FIG. 1 (BB)).
A second expression vector for the mtID gene was created by
removing the bar gene from pDPG182 using SmaI. After blunting the
ends of the mtID gene, it was ligated into the pUC-based vector;
between the maize AdhIpromoter/AdhI.sub.1 intron and the transcript
7 3' end from Agrobacterium tumefaciens (provided in pCEV5 from
Calgene, Inc., Davis, Calif.). This plasmid vector was designated
pDPG469.
A gene isolated from barley that encodes a Late Embryogenic
Abundant protein (Dure, L., et al., 1989). (HVa-1) was obtained
from Dr. H. D. Ho (Washington University), isolated as an NciI/SphI
fragment and cloned into the polylinker of pCDNA II (Invitrogen,
Inc). It was then reisolated as a BamHI/NsiI fragment and cloned
into the polylinker site of pDPG431 (see above). The result was the
pUC-based vector with the following expression unit, 35s-AdhI.sub.1
-HVa1-Tr7 3' (designated pDPG474).
Plasmid constructs designed for increasing the level of lysine in
the plant were designed to place a dapA polypeptide-coding
sequence, modified to contain a sequence corresponding to one of
two maize plastid transit peptide sequences, under the control of
various plant promoter elements. These constructs include the
widely-used CaMV 35S promoter, maize endosperm-specific promoters
from genes encoding either a 27 kD (Z27) or a 10 kD (Z10) zein
storage protein, and an embryo-specific promoter from the maize
Globulin1 gene (GIb1), which encodes an abundant embryo storage
protein. The transit peptide sequences used here correspond to
those present in genes encoding either a maize rubisco small
subunit polypeptide (MZTP) or the native maize DHDPS polypeptide
(DSTP). Features of these constructs, along with their lab
designations, are as follows:
expression promoter/transit construct peptide/coding seq./3'
regulatory sequence pDPG 334 Z10/MZTP/dapA/nos 335
Z27/DSTP/dapA/35S 371 35S/MZTP/dapA/nos 372 35S/DSTP/dapA/nos 418
Glb1/DSTP/dapA/Glb1
Construction of these plasmids was performed as follows:
pDPG371: In this construct, the synthetic pea chloroplast transit
peptide. encoding sequence described in U.S. patent application
Ser. No. 07/204,388 was replaced with a synthetic sequence
corresponding to that encoding a maize chloroplast transit peptide
(from a rubisco small subunit sequence; GenBank Accession Y00322).
Eight oligonucleotides were synthesized in order to reconstruct the
maize ssu transit peptide sequence by the same strategy described
for synthesis of the pea chloroplast transit peptide sequence (in
U.S. Pat. No. 5,258,300). Sequences of these oligonucleotides, in
the the final context of the synthetic gene fragment, are as
follows:
HindIII MZTP46 MZTP49
AGCTTGCAGCGAGTACATACATACTAGGCAGCCAGGCAGCCATGGCGCCCACC
ACGTCGCTCATGTATGTATGATCCGTCGGTCCGTCGGTACCGCGGGTGG MZTP25 MZTP45
MZTP51 GTGATGATGGCCTCGTCGGCCACCGCCGTCGCTCCGTTCCAGGGGCTCAAGTCC
CACTACTACCGGAGCAGCCGGTGGCGGCAGCGAGGCAAGGTCCCCGAGTTCAGG MZTP53
MZTP39 ACCGCCAGCCTCCCCGTCGCCCGCCGGTCCTCCAGAAGCCTCGGCAACGTCAGC
TGGCGGTCGGAGGGGCAGCGGGCGGCCAGGAGGTCTTCGGAGCCGTTGCAGTCG MZTP54 SphI
AACGGCGGAAGGATCCGGTGCATG TTGCCGCCTTCCTAGGCCAC
The upper line of the above sequence is represented by SEQ ID NO:14
and the lower line by SEQ ID NO:15.
The sequence is identical to that of the rubisco ssu gene described
in GenBank Y00322, except for the introduction of a
HindIII-compatible sequence generated by the addition of AGCTT to
the 5' end of MZTP46 and an A residue to the 3' end of MZTP25. The
ATG initiation codon is indicated in bold type, as is the TGC
cysteine codon corresponding to the carboxyterminal residue of the
native maize ssu transit peptide. This corresponds to a 47 amino
acid transit peptide sequence, from the initiating methionine to
the carboxyterminal cysteine.
Using the same strategy as described for synthesis and
reconstruction of the pea transit peptide sequence, equimolar
amounts of oligonucleotides MZTP49, 51, 39, 25,45, and 53 were
phosphorylated at their 5' ends in a polynucleotide kinase
reaction; these were then combined with equimolar amounts of MZTP46
and MZTP54. This mixture was then added to a ligation reaction
mixture containing the pGem3 vector (Promega Biotec, Madison, Wis.)
which had previously been cleaved with the restriction enzymes
HindIII and SphI to yield plasmid 9106. To fuse the ssu transit
peptide sequence (MZTP) to the dapA polypeptide coding sequence, a
1170 bp SphI/EcoRI fragment, corresponding to the dapAlnos 3'
cassette present in plasmid pDAP4201 (in U.S. patent application
Ser. No. 07/204,388), was ligated into plasmid 9106 that had been
cleaved with SphI and EcoRI to yield pDAP9284. To place this novel
construct under control of the plant 35S promoter, a 1300 bp
HindIII fragment from pDAP9284 , containing the MZTP/dapA/nos3'
cassette, was ligated into the HindIII site of plasmid 35-227 (U.S.
patent application Ser. No. 07/204,388), which contains the 35S
promoter, to yield plasmid 9305. To facilitate use of the
35S/MZTP/dapA/nos3' cassette in future manipulations, the entire
cassette was isolated as a 1790 bp ClaI/SmaI fragment from plasmid
9305 and inserted into the commercial cloning vector pSP73
(Promega) which had been cleaved with ClaI and SmaI. This final
construct is designated pDPG371.
pDPG335: In this construct the synthetic MZTP ssu transit peptide
sequence was replaced with DNA encoding the transit peptide
sequence from the native maize DHDPS enzyme. The plasmid pMDS-1,
containing a cDNA clone corresponding to maize DHDPS (Frisch et al.
Mol. Gen. Genet. 228:287-293, 1991), was a gift from B. Gengenbach,
University of Minnesota, Minneapolis. The EcoRI fragment containing
the full-length maize DHDPS cDNA was inserted into EcoRI-cleaved
pSP73 to yield pMDS73A; this step was performed to facilitate
subsequent cloning steps. A 215 bp ClaI/XbaI fragment from pMDS73A
containing the transit peptide coding region was inserted into the
ClaI and XbaI sites of plasmid p35-227, thereby fusing the transit
peptide sequence to the 35S promoter sequence contained in p35-227
and yielding the plasmid pPoI35SDTP. The 35S/DSTP cassette was
subsequently fused to the dapA coding sequence. This was performed
by cloning the cassette into the plasmid pHDAP73, which was
constructed as follows: The 2728 bp hygromycin phosphotransferase
cassette from plasmid pHygI1 (U.S. patent application Ser. No.
07/204,388) was cloned as an EcoRI/HindIII fragment into the EcoRI
and HindIII sites of pSP73, to yield pHyg73. This plasmid was then
cleaved with BgIII and ClaI, and the 35S/MZTP/dapA/nos cassette
obtained as an 1800bp BgIII/ClaI fragment from pDPG371 was inserted
to yield pHDAP73. This latter plasmid was then cleaved at the SphI
site, at which point the MZTP sequence joins the dapA sequence. The
SphI 3' overhang was filled in by using Klenow fragment to produce
a blunt end, and the resultant linear plasmid was subsequently
cleaved with BgIII, removing the 35S/MZTP portion from pHDAP73. The
35S/DSTP cassette was isolated from pPoI35SDTP by cleavage with
XbaI, followed by digestion with mung bean nuclease to remove the
resultant 5' overhang. This treatment was followed by BamHI
cleavage, which yielded a 674 bp fragment that was inserted into
the cleaved pHDAP73 plasmid in place of the 35S/MZTP sequence. This
novel plasmid, containing the cassette 35S/DSTP/dapA/nos, is
designated pHDTP. A 1095 bp EcoRI/BamHI fragment, containing the
DSTPIdapA region, was cloned into the EcoRI and BamHI sites of the
commercial vector pUC119 (BRL) to yield pDSTP119. Nucleotide
sequence analysis of this latter clone revealed a 2 bp deletion,
apparently caused by the cloning process, at the junction of the
DSTP and dapA sequences. This mutation was corrected in such a way
as to restore the original reading frame and to introduce an
additional MaeII restriction enzyme site as follows:
DSTP dapA target sequence: ATC ACT .linevert split. TTC ACG GGA CT
deleted in pDSTP119 ile thr phe thr gly modify to: ATC ACG
.linevert split. TTC ACG GCA
The upper nucleic acid sequence is represented by SEQ ID NO:16, the
lower nucleic acid sequence by SEQ ID NO:17, and the amino acid
sequence by SEQ ID NO:18.
This manipulation leaves the desired reading frame intact and
introduces the ACGT MaeII site at the junction between the DSTP and
dapA sequences. Mutagenesis was accomplished with the reagents
supplied in the BioRad Mutagene kit by using the following
oligonucleotide (SEQ ID NO:19):
5' CCTTGGCAGCCATCACGTTCACGGGAAGTATTGTC 3'
The resultant plasmid, designated pMae2-1, was cleaved with EcoRI,
treated with Klenow polymerase to generate blunt ends, then cleaved
with BamHI to yield an 1100 bp fragment consisting of the DSTP/dapA
cassette. This fragment was cloned into the Sma and BamHI sites of
pZ27Z10 (in U.S. patent application Ser. No. 07/636,089), replacing
the Z10 coding region and placing the DSTP/dapA sequence under
control of the Z27 promoter and the 35S 3' regulatory region. This
final construct is designated pDPG335.
pDPG372: To place the DSTP/dapA cassette under control of the 35S
promoter, a 1221 bp ScaI/EcoRI fragment from pHDTP, containing
pSP73 vector sequences and the 35S promoter, was inserted into the
ScaI and EcoRI sites of pMae2-1 to yield p35MDAP. Tto join the nos
3' regulatory region to the 35S/DSTP/dapA cassette, an 800 bp
fragment of p35MDAP from the NdeI site just upstream of the 35S
promoter to an NheI site internal to the dapA sequence was inserted
into the NdeI and NheI sites of pDPG371, effectively replacing the
35S/MZTP cassette with the 35S/DSTP sequence. The resultant
plasmid, containing the 35S/DSTP/dapA/nos 3' cassette, is
designated p35DSD. Subsequent nucleotide sequence analysis of 35DSD
revealed the presence of a cloning artifact that introduced an ATG
translation initiation codon 13 codons upstream of the authentic
DSTP initiation codon. This problem was corrected by substituting
this region of p35DSD with the corresponding region from pDPG335,
as follows: a 525 bp fragment from pDPG335, extending from a Kpnl
site at the 3' end of the 35S promoter to a BstEII site internal to
the dapA sequence, was inserted into Kpnl/BstEII-cleaved p35DSD to
yield pDPG372, which contains a functional 35S/DSTP/dapA/nos
cassette.
pDPG334: In this construct, the MZTP/dapA/nos cassette was placed
under control of the Z10 promoter region as follows: a 1137 bp
HindIII/NcoI fragment from pG10B-H3 (Kirihara et al, Gene
71:359-370, 1988), consisting of the Z10 promoter, was inserted
into HindIII/NcoI cleaved pDAP9284, yielding pDPG334 which consists
of the Z10/MZTP/dapA/nos cassette.
pDPG418: In this construct, the DSTP/dapA cassette was placed under
control of the 5' and 3' regulatory regions of the maize Globulin1
(Glb1) gene (Belanger and Kriz Genetics 129:863-872, 1991) as
follows: a 1050 bp KpnI/PstI fragment from pDPG335, consisting of
the DSTP/dapA cassette, was inserted into the KpnI/PstI sites of
the Glb1 expression vector pGEMSV3 (GenBank Accession No. L22295)
to yield pDPG418.
Features of introduced genes used for selection of transformed
cells are described above. Specific plasmid constructs used in
these experiments are as follows:
selection construct Selectable/screenable marker pDPG 165 bar 231
bar, gus 283 bar 355 gus 363 bar 366 hpt 367 hpt
Constructs pDPG 165, 231, 283, and 363 are as described above.
Constructs pDPG355 and 367 are described in Walters et al., 1992 as
pBII221 and pHygI1, respectively. Construct pDPG366 was made by
transferring the hygromycin expression cassette (35S/AdhI1/hpt/nos)
from pDPG367 as an EcoRI/HindIII fragment into EcoRI/HindIII
cleaved pSP73.
Three plasmids containing the gene encoding the 10 kD zein protein
were constructed. The plasmid pDPG375 is a 7 kb pUC119 plasmid
containing a 3.9 kb HindIII fragment of a genomic clone encoding
the 10 kD zein (Kirihara et al., 1988). This gene is under control
of the native promoter, and contains the native 3' sequence. The
plasmid pDPG373 is a pUC119-based plasmid containing a HindIII-RsaI
Z4 (22 kD zein) promoter fragment and an NcoI-EcoRI fragment with
the 10 kD zein coding and 3' sequences, and pDPG338 is a
pUC119-based plasmid containing the 1.1 kb 27 kD zein promoter, 2.3
kb of the 10 kD zein coding and 3' sequences, and a cauliflower
mosaic virus (CaMV) 35S poly(A) sequence. These plasmids are
hereafter designated as the methionine constructs. Selectable
marker genes used were hygromycin phosphotransferase (HPT, pHYGI1
also known as pDPG367; 35S promoter::Adh1 intron::HPT coding
sequence:: nos poly(A)sequence; Walters et al., 1992) and bar, the
gene conferring resistance to the herbicide Basta (35S::bar::Tr7,
pDPG165, described earlier in this CIP) or pDPG363
(35S::Adh1::bar::nos). The plasmid pDPG363 was constructed by
inserting a 0.5 kb SmaI fragment with BamHI linkers containing the
bar gene into pHYG73, replacing the HPT gene. The plasmid pHYG73
was constructed by insertion of a 2.1 kb EcoRI-HindIII fragment
containing the HPT coding sequence from pDPG367 (cited above) into
pSP73 (Promega). The screenable marker gene of pBII221, which
encodes .beta.-glucuronidase (GUS) was also used
(35S::Adh1::GUS::nos). The plasmid pBII221 was constructed by
adding a 0.75 kb fragment containing the Adh 1 intron between the
35S CaMV promoter and the GUS coding sequence of pBI221 (Clontech;
pBI221 is pBI121 in pUC19 rather than pBIN19; Jefferson et al.,
1987).
The plasmid pDPG380 contains the entire BalI-EcoRI 711 bp coding
sequence of the gene encoding the 19 kD A20 zein and the 0.5 kb 5'
sequence encoding the A20 preprotein (reconstructed independently
from the coding sequence by PCR) in antisense orientation, with
1137 bp of the 10 kD zein promoter and 250 bp of nos 3' sequence.
The plasmid pDPG340 is a pUC119-based plasmid containing 1137 bp of
Z10 promoter sequence, a 980 bp XbaI-SacI fragment with the entire
Z4 coding sequence in antisense orientation, and 250 bp of nos 3'
sequence. These genes are hereafter referred to as antisense
constructs. For transformation experiments, pDPG165 (35S::bar::Tr7,
described elsewhere in this CIP), pDPG363 (35S::Adh1::bar::nos,
also described elsewhere in this CIP) or pDPG367
(35S::Adh1::HPT::nos, described elsewhere) were used as selectable
marker genes, and were cobombarded with the antisense
constructs.
The vector pDPG354 contains an expression cassette for producing Bt
endotoxin in maize (see FIG. 1(CC) for map). It was constructed to
contain the following DNA:
(i) A promoter, consisting of two ocs enhancers (J. G. Ellis et
al., 1987) placed in the reverse orientation and located upstream
of the TATA box derived from the cauliflower mosaic virus (CaMV)
35S promoter (Eco RV site to the transcription start site; H.
Guilley et al., 1982 ; R. Kay et al. 1987), located upstream
from:
(ii) an intron (intron VI) derived from the maize Adh 1 gene
(Callis, J., Fromm, M., Walbot, V.,1987), a 423 bp AccI-MspI
fragment from a genomic clone of the Adh 1 gene) that was located
upstream from:
(iii) a synthetic Bt gene on a Nco I to Kpn I fragment of DNA
coding for the toxin portion of the endotoxin protein produced by
Bacillus thuringiensis subsp.kurstaki strain HD73 (M. J. Adang et
al. 1985). This gene was synthesized and assembled using standard
techniques to contain codons that are more preferred for
translation in maize cells. A translation stop codon was introduced
after the 613th codon to terminate the translation and allow
synthesis of a Bt endotoxin protein consisting of the first 613
amino acids (including the f-met) of the Bt protein (see FIG. 12
for sequence of gene).
(iv) The DNA coding for the Bt protein was followed by a 930bp
RsaI-PstI segment of DNA derived from the potato proteinase II
inhibitor gene (G.An et al., 1989).
This expression cassette was inserted into the E. coli plasmid
pBluescript SK-(Stratagene, Inc.) and can be made available from
the ATCC.
The vector pDPG344 was designed to mediate the expression of the
tomato protease inhibitor II (pin) gene in maize and was
constructed to contain the following DNA (see FIG. 1(DD):
(i) 420 bp of DNA derived from the 35S promoter from CaMV located
upstream of:
(ii) 550 bp derived from the intronl of the maize AdhI gene
(Callis, J., Fromm, M. E., Walbot, V., 1987.) located immediately
upstream from:
(iii) 470 bp of DNA coding for the cDNA of the tomato protease
inhibitor II gene (Graham et al., 1985), followed by:
(iii) 930 bp of DNA derived from the 3' region of the potato
protease inhibitor II gene (derived from pRJ13; Johnson et al.,
1989);
This cassette was assembled on the E. coli plasmid pBluescript
SK(-) (Stratagene Inc.) and can be made available from the
ATCC.
The plasmid vector pDPG337 (also known as pLK487) consists of an E.
coli replicon (pBS+;Stratagene Inc.) containing the following DNA
(see FIG. 1(EE)):
1. a segment of DNA containing the promoter for the 35S transcript
derived from CaMV, fused at the location of initiation of
transcription of the 3S transcript to:
2. a segment of DNA (5' ATC TGG CAG CAG AAA AAC AAG TAG TTG AGA ACT
AAG AAG AAG AAA 3'); SEQ ID NO:20: derived from the untranslated 5'
leader sequence to the small subunit of the ribulose biscarboxylase
gene of soybean (S. L. Berry-Lowe et al.,1982) which is joined at
its 3' terminus to:
3. a synthetic Bt gene coding for the endotoxin from Bacillus
thuringiensis subsp.kurstaki strain HD73 (see construction of pDPG
354 above).
4. The Bt gene was followed by a segment of DNA derived from the 3'
of "transcript 7" gene from Agrobacterium tumefasciens (P. Dhaese
et al.,1983,).
Samples of E. coli containing pDPG337 can be made available through
the ATCC.
EXAMPLE 7
Intracellular Targeting of the Bar Gene
As mentioned above, the bar gene codes for an enzyme, PAT, that
inactivates the herbicide phosphinothricin. Phosphinothricin is an
inhibitor of both cytoplasmic and chloroplast glutamine
synthetases. Current expression vectors target PAT to the cell
cytoplasm. To determine if there is an advantage to also targeting
PAT to the chloroplast, a transit:bar chimeric gene was
constructed. A sequence encoding the rbcS transit peptide and part
of the rbcS mature polypeptide, present on a 300 bp XbaI-BamHI
fragment from pDPG226, was cloned adjacent to the bar sequence in
pDPG165, to produce pDPG287. This resulted in an in-frame fusion of
the two protein coding regions, with the intervening sequence
coding for the following amino acids:
rbcS-Pro-Arg-Gly-Ser-Thr-bar
Protoplasts were electroporated with pDPG287 and assayed for PAT
activity. Using proteinase treatment and protection studies, it was
then determined that the PAT enzyme is sequestered within an
organelle, particularly the plastid.
F. Preferred Methods of Delivering DNA to Cells
Preferred DNA delivery systems do not require protoplast isolation
or use of Agrobacterium DNA . There are several potential cellular
targets for DNA delivery to produce fertile transgenic plants:
pollen, microspores, meristems, immature embryos and cultured
embryogenic cells are but a few examples. Germline transformation
in maize has not been previously reported.
One of the newly emerging techniques for the introduction of
exogenous DNA constructs into plant cells involves the use of
microprojectile bombardment. The details of this technique and its
use to introduce exogenous DNA into various plant cells are
discussed in Klein, 1989, Wang, et al., 1988 and Christou, et al.,
1988. One method of determining the efficiency of DNA delivery into
the cells via microprojectile bombardment employs detection of
transient expression of the enzyme .beta.-glucuronidase (GUS) in
bombarded cells. For this method, plant cells are bombarded with a
DNA construct which directs the synthesis of the GUS enzyme.
Apparati are available which perform microprojectile bombardment. A
commercially available source is an apparatus made by Biolistics,
Inc. (now DuPont), but other microprojectile or acceleration
methods are within the scope of this invention. Of course, other
"gene guns" may be used to introduce DNA into cells.
Several modifications of the microprojectile bombardment method
were made by the inventors. For example, stainless steel mesh
screens were introduced below the stop plate of the bombardment
apparatus, i.e., between the gun and the cells. Furthermore,
modifications to existing techniques were developed by the
inventors for precipitating DNA onto the microprojectiles.
Another newly emerging technique for the introduction of DNA into
plant cells is electroporation of intact cells. The details of this
technique are described in Krzyzek and Laursen (PCT publication WO
92/12250). Similar to particle bombardment, the efficiency of DNA
delivery into cells by electroporation can be determined by using
the .beta.-glucuronidase gene. The method of electroporation of
intact cells and by extension intact tissues, e.g., immature
embryos, were developed by Krzyzek and Laursen and represent
improvements over published procedures. Generation of fertile
plants using these techniques were described by Spencer et al.
(Spencer, T. M., Laursen, C. M., Krzyzek, R. A., Anderson, P. C.,
and Flick, C. E., 1993, Transgenic maize by electroporation of
pectolyase-treated suspension culture cells. Proceedings of the
NATO Advanced Study Institute on Plant Molecular Biology,
Molecular-Genetic Analysis of Plant Metabolism and Development, In
Press.) and Laursen et al. (Laursen, C. M., Krzyzek, R. A., Flick,
C. E., Anderson, P. C. and Spencer, T. M. Transformation of maize
by electroporation of suspension culture cells. Submitted to Plant
Molecular Biology.)
Other methods may also be used for introduction of DNA into plants
cells, e.g., agitation of cells with DNA and silicon carbide
fibers.
EXAMPLE 8
Microproiectile Bombardment--SC82, SC94 and SC716
For bombardment, friable, embryogenic Type-II callus (Armstrong
& Green, 1985) was initiated from immature embryos essentially
as set forth above in Examples 1 and 2. The callus was initiated
and maintained on N6 medium (Chu et al., 1975) containing 2 mg/l
glycine, 2.9 g/l L-proline, 100 mg/l casein hydrolysate, 13.2 mg/l
dicamba or 1 mg/l 2,4-D, 20 g/l sucrose, pH 5.8, solidified with 2
g/l Gelgro (ICN Biochemicals). Suspension cultures initiated from
these callus cultures were used for bombardment.
In the case of SC82, suspension culture SC82 was initiated from
Type-II callus maintained in culture for 3 months. SC82 cells (see
Example 2) were grown in liquid medium for approximately 4 months
prior to bombardment (see Table 5, experiments #1 and #2). SC82
cells were also cryopreserved 5 months after suspension culture
initiation, stored frozen for 5 months, thawed and used for
bombardment (experiment #6).
In the case of suspension culture SC716 (see Example 1), it was
initiated from Type-II callus maintained 5 months in culture. SC716
cells were cultured in liquid medium for 5 months, cryopreserved
for 8 months, thawed, and used two months later in bombardment
experiments #4 and #5. SC94 was initiated from 10 month old Type-II
callus; and cultured in liquid medium for 5 months prior to
bombardment (experiment #3).
Prior to bombardment, recently subcultured suspension culture cells
were sieved through 1000 .mu.m stainless steel mesh. From the
fraction of cell clusters passing through the sieve, approximately
0.5 ml packed cell volume (PCV) was pipetted onto 5 cm filters
(Whatman #4) and vacuum-filtered in a Buchner funnel. The filters
were transferred to petri dishes containing three 7 cm filters
(Whatman #4) moistened with 2.5 ml suspension culture medium.
The dish containing the filters with the suspension cells was
positioned 6 cm below the lexan plate used to stop the nylon
macroprojectile. With respect to the DNA, when more than a single
plasmid was used, plasmid DNA was precipitated in an equimolar
ratio onto tungsten particles (average diameter approximately 1.2
.mu.m, GTE Sylvania) using a modification of the protocol described
by Klein, et al. (1987). In the modified procedure, tungsten was
incubated in ethanol at 65.degree. C. for 12 hours prior to being
used for precipitation. The precipitation mixture included 1.25 mg
tungsten particles, 25 .mu.g plasmid DNA, 1.1 M CaCl.sub.2 and 8.7
mM spermidine in a total volume of 575 .mu.l. After adding the
components in the above order, the mixture was vortexed at
4.degree. C. for 10 min, centrifuged (500.times.G) for 5 min and
550 .mu.l of supernatant was decanted. From the remaining 25 .mu.l
of suspension, 1 .mu.l aliquots were pipetted onto the
macroprojectile for bombardment.
Each plate of suspension cells was bombarded twice at a vacuum of
28 inches Hg. In bombarding the embryogenic suspensions of
A188.times.B73 and A188.times.B84, 100 .mu.m or 1000 .mu.m
stainless steel screens were placed about 2.5 cm below the stop
plate in order to increase the number of foci while decreasing
their size and also to ameliorate injury to the bombarded tissue.
After bombardment, the suspension cells and the supporting filter
were transferred onto solid medium or the cells were scraped from
the filter and resuspended in liquid culture medium.
Cells from embryogenic suspension cultures of maize were bombarded
with the bar-containing plasmid pDPG165 alone or in combination
with a plasmid encoding GUS, pDPG208 (FIG. 1). In experiments in
which a GUS plasmid was included, two of the filters containing
bombarded cells were histochemically stained 48 h post-bombardment.
The total number of foci (clusters of cells) per filter transiently
expressing GUS was at least 1000. In two separate studies designed
to quantitate transiently expressing cells (using an SC82
(A188.times.B73) suspension culture), the mean number of
GUS-staining foci per filter was 1472 and 2930. The number of cells
in individual foci that expressed GUS averaged 2-3 (range 1-10).
Although histochemical staining can be used to detect cells
transformed with the gene encoding GUS, those cells will no longer
grow and divide after staining. For detecting stable transformants
and growing them further, e.g., into plants, selective systems
compatible with viability are required.
EXAMPLE 9
Microprojectile Bombardment: AB12
Cell line AB12 was initiated as described in example 4. The
microprojectile bombardment instrument, microprojectiles and
stopping plates were obtained from Biolistics (Ithaca, N.Y.). Five
clumps of 7- to 12-day-old callus, each approximately 50 mg in wet
weight, were arranged in a cross pattern in the center of an empty
60 mm.times.15 mm Petri plate. Plates were stored in a closed
container with moist paper towels throughout the bombardment
process.
Plasmids were coated onto M-10 tungsten particles (Biolistics) as
described by Klein et al. (1988, 1989) except that 5 .mu.g of DNA
was used, the DNA precipitation onto the particles was performed at
0.degree. C. and the tubes containing the DNA-coated tungsten
particles were stored on ice throughout the bombardment process.
When both plasmids were used, each was present in an amount of 2.5
.mu.g. Control bombardments contained TE buffer (10 mM Tris, 1 mM
EDTA, pH 8.0) with no DNA.
The sample plate tray was placed 5 cm below the bottom of the
stopping plate tray of the microprojectile instrument, with the
stopping plate platform in the slot nearest to the barrel. A 3
mm.times.3 mm mesh galvanized steel screen was placed over the open
dish. The instrument was operated as described by the manufacturer
(Biolistics, Inc.), using a gunpowder charge as the motive force.
Each plate of tissue was bombarded once.
EXAMPLE 10
Microprojectile Bombardment--AT824
Suspension culture AT824 (described in example 3) was subcultured
to fresh medium 409 2 days prior to particle bombardment. Cells
were plated on solid 409 medium 16-24 hours before bombardment
(about 0.5 ml packed cell volume per filter). Tissue was treated
with 409 medium containing 200 mOsm sorbitol (medium 431) for 1
hour prior to bombardment.
DNA was introduced into cells using the DuPont BIOLISTICS PDS1000He
particle bombardment device.
DNA was precipitated onto gold particles as follows. A stock
solution of gold particles was prepared by adding 60 mg of 1 um
gold particles to 1000 ul absolute ethanol and incubating for at
least 3 hours at room temperature followed by storage at -20 C.
Twenty to thirty five ul sterile gold particles are centrifuged in
a microcentrifuge for 1 min. The supernatant is removed and one ml
sterile water is added to the tube, followed by centrifugation at
2000 rpm for 5 minutes. Microprojectile particles are resuspended
in 30 ul of DNA solution (30 ug total DNA) containing 10 ug each of
the following vectors: pDPG165 (bar), pDPG344 (tomato proteinase
inhibitor II gene), and pDPG354 (B. thuringiensis crystal toxin
protein gene). Two hundred twenty microliters sterile water, 250 ul
2.5 M CaCl.sub.2 and 50 ul spermidine are added. The mixture is
thoroughly mixed and placed on ice, followed by vortexing at 4 C.
for 10 minutes and centrifugation at 500 rpm for 5 minutes. The
supernatant is removed and the pellet resuspended in 600 ul
absolute ethanol. Following centrifugation at 500 rpm for 5 minutes
the pellet is resuspended in 36 ul of absolute ethanol.
Ten ul of the particle preparation were dispensed on the surface of
the flyer disk and the thanol was allowed to dry completely.
Particles were accelerated by a helium blast of approximately 1100
psi. One day following bombardment cells were transferred to liquid
medium 409 (10 ml). Tissue was subcultured twice per week. During
the first week there was no selection pressure applied.
EXAMPLE 11
Further Optimization of Ballistic Transformation
This example describes the optimization of the ballistic
transformation protocol. Both physical and biological parameters
for bombardment have been addressed. Physical factors are those
that involve manipulating the DNA/microprojectile precipitate or
those that affect the flight and velocity of either the macro- or
microprojectiles. Biological factors include all steps involved in
manipulation of cells immediately after bombardment. The
prebombardment culturing conditions, such as osmotic environment,
the bombardment parameters, and the plasmid configuration have been
adjusted to yield the maximum numbers of stable transformants.
Physical Parameters
Gap Distance The variable nest (macro holder) can be adjusted to
vary the distance between the rupture disk and the macroprojectile,
i.e., the gap distance. This distance can be varied from 0 to 2 cm.
The predicted effects of a shorter gap are an increase of velocity
of both the macro- and microprojectiles, an increased shock wave
(which leads to tissue splattering and increased tissue trauma),
and deeper penetration of microprojectiles. Longer gap distances
would have the opposite effects but may increase viability and
therefore the total number of recovered stable transformants.
The effect of gap distance was investigated by bombarding the E1
suspension with pDPG208. Plates were shot in triplicate at gaps of
3, 6, 9, and 12 mm. Tissue was assayed for GUS activity and foci
were counted. Using a 3 mm gap, GUS foci were the most numerous and
well distributed across the filter. The gas shock wave appeared to
be the greatest at this distance as shown by the degree of tissue
splattering. Previous experiments performed at this gap size have
also shown poor tissue recovery. Gaps of 6 mm and 9 mm showed
little to no tissue splattering. GUS foci were well distributed
across the filter but were fewer in number than those in the 3 mm
samples. Samples bombarded with a gap distance of 12 mm showed
nearly equivalent numbers of GUS foci as with sample bombarded at 6
mm and 9 mm but they were located almost exclusively at the center
of the filter. No tissue splattering was observed. Based on these
observations, it is suggested that bombardments be conducted with a
gap distance of 6 to 9 mm.
Flight Distance The fixed nest (contained within the variable nest)
can be varied between 2 and 2 cm in predetermined increments by the
placement of spacer rings to adjust the flight path traversed by
the macroprojectile. Short flight paths allow for greater stability
of the macroprojectile in flight but reduces the overall velocity
of the microprojectiles. Increased stability in flight increases
the number of centered GUS foci. Greater flight distances (up to
some point) increase velocity but also increases instability in
flight.
The effect of the macroprojectile flight path length was
investigated using E1 suspension cells. The flight distances tested
were 0, 1.0, 1.5, and 2.0 cm. Samples were bombarded with pDPG208
GUS vector and were assayed 48 hours after bombardment for GUS
activity. The number of GUS foci was the greatest at a flight path
length of 1.0 cm and least at 0 cm. No tissue splattering was
observed at 0 cm, very little at 1.0 cm, and greater amount at 1.5
and 2.0 cm. Based on these observations, it is recommended that
bombardments be done with a flight path length of 1.0 cm.
Tissue distance Placement of tissue within the gun chamber should
have significant effects on microprojectile penetration. Increasing
the flight path of the microprojectiles will decrease velocity and
trauma associated with the shock wave. A decrease in velocity will
also result in shallower penetration of the microprojectiles.
Helium pressure By manipulation of the type and number of rupture
disks, pressure can be varied between 400 and 2000 psi within the
gas acceleration tube. Optimum pressure for stable transformation
has been determined to be between 1000 and 1200 psi.
Biological Parameters
Culturing conditions and other factors can influence the
physiological state of the target cells and may have profound
effects on transformation and integration efficiencies. First, the
act of bombardment could stimulate the production of ethylene which
could lead to senescence of the tissue. The addition of
antiethylene compounds could increase transformation efficiencies.
Second, it is proposed that certain points in the cell cycle may be
more appropriate for integration of introduced DNA. Hence
synchronization of cell cultures may enhance the frequency of
production of transformants. Third, the degree of tissue hydration
may also contribute to the amount of trauma associated with
bombardment as well as the ability of the microprojectiles to
penetrate cell walls.
It has also been reported that slightly plasmolyzed yeast cells
allow increased transformation efficiencies (Armaleo et al., 1990).
It was hypothesized that the altered osmotic state of the cells
helped to reduce trauma associated with the penetration of the
microprojectile. Lastly, the growth and cell cycle stage may be
important with respect to transformation.
Osmotic adjustment It has been suggested that osmotic pre-treatment
could potentially reduce bombardment associated injury as a result
of the decreased turgor pressure of the plasmolyzed cell. Two
studies were done in which E1 suspension cells were osmotically
adjusted with media supplemented with sorbitol. Cells were plated
onto osmotic media 24 hours prior to bombardment. The osmotic
values of the media were 200, 400, and 600 mOSM/kg. Samples were
bombarded with either pDPG208 (GUS) or a coprecipitate of pDPG165
(bar) and pDPG290 (Bt). GUS samples were assayed and foci were
counted and plotted. Cells osmotically adjusted at 400 mOSM/kg
showed an approximately 25% increase in the number of transient GUS
foci. Samples bombarded with bar/Bt were selected in liquid (2 mg/l
bialaphos) and thin plated on medium containing 3 mg/l bialaphos.
Cells treated with 600 mOSM/kg medium grew more slowly than cells
treated with media of other osmotic strengths in this study.
A second study investigated the effects of short duration osmotic
adjustment at 500 mOSM/kg on both transient GUS expression and
stable transformation. The rationale for the short duration of
osmotic adjustment was that cells should be plasmolyzed just before
bombardment, using longer time periods of pretreatment may allow
the cells to adjust to the osmoticum (i.e. re-establishing turgor).
The first control was bombarded (0 min., no new medium) followed by
cells pretreated for 45 minutes and 90 minutes with 500 mOSM/kg
medium with either pDPG208 or pDPG165 with pDPG290. Since the
pretreatment required media changes (i.e. fresh 500 mOSM/kg media),
a set of controls were also washed using fresh medium without the
osmoticum. After bombardment the cells were put on to solid medium
to recover overnight followed by resuspension in liquid medium.
After one week, liquid selection was started using 2 .mu.g/ml
bialaphos. Cells were plated on 3 .mu.g/ml bialaphos at 0.1 ml PCV
eleven days after bombardment. Transient GUS activity was assayed
48 hours after bombardment.
The number of cells transiently expressing GUS increased following
subculture into both fresh medium and osmotically adjusted medium.
Pretreatment times of 90 minutes showed higher numbers of GUS
expressing foci than shorter times. Cells incubated in 500 mOSM/kg
medium for 90 minutes showed an approximately 3.5 fold increase in
transient GUS foci than the control.
Plasmid configuration In some instances it will be desirable to
deliver DNA to maize cells that does not contain DNA sequences
necessary for maintenance of the plasmid vector in the bacterial
host, e.g., E. coli, such as antibiotic resistance genes, including
but not limited to ampicillin, kanamycin, and tetracycline
resistance, and prokaryotic origins of DNA replication. In one such
experiment the 4.4 kb HindIII fragment of pDPG325 containing the
bar expression cassette and 2 kb of the uidA expression cassette
(structural gene and 3' end) were purified by gel electrophoresis
on a 1.2% low melting temperature agarose gel. The 4.4 kb DNA
fragment was recovered from the agarose gel by melting gel slices
in a 6-10 fold excess of Tris-EDTA buffer (10 mM Tris-HCl pH 8.0, 1
mM EDTA, 70-72 C.); frozen and thawed (37 C.); and the agarose
pelleted by centrifugation. A Qiagen Q-100 column was used for
purification of DNA. For efficient recovery of DNA it was necessary
to reduce the flow rate of the column to 40 ml/hr. Isolated DNA
fragments can be recovered from agarose gels using a variety of
electroelution techniques, enzyme digestion of the agarose, or
binding of DNA to glass beads (e.g., Gene Clean). In addition HPLC
and/or use of magnetic particles may be used to isolate DNA
fragments. This DNA was delivered to AT824 cells using
microprojectile bombardment. Twenty four transformants were
recovered following selection on bialaphos containing culture
medium. No transformants contained the ampicillin resistance gene
or origin of DNA replication present in the plasmid vector. R.sub.0
plants have been produced from 11 of these transformed cell lines.
Fertility has been demonstrated in plants from ten transformants
and R.sub.1 seed has been planted in field tests.
As an alternative to isolation of DNA fragments a plasmid vector
can be digested with a restriction enzyme and this DNA delivered to
maize cells without prior purification of the expression cassette
fragment. In one experiment pDPG165 was digested with EcoRI and
HindIII. This digestion produces an approximately 1900 base pair
fragment containing the 35S-bar-Tr7 expression cassette and an
approximately 2600 base pair DNA fragment containing the ampicillin
resistance gene and bacterial origin of DNA replication. This DNA
was delivered to AT824 cells using microprojectile bombardment and
2/9 transformants (22%) isolated did not contain the ampicillin
resistance gene. In a second experiment pDPG165 digested with
restriction enzymes as described above was delivered to AT824 cells
via electroporation. Eight of twenty four transformants (33%)
recovered lacked the ampicillin resistance gene. Plant regeneration
is in progress from transformants lacking the ampicillin resistance
gene that were produced in these two experiments.
EXAMPLE 12
Bombardment of Immature Embryos
Immature embryos (1.2-2.0 mm in length) were excised from
surface-sterilized, greenhouse-grown ears of Hi-II 11-12 days
post-pollination. The Hi-II genotype was developed from an
A188.times.B73 cross for high frequency development of type II
callus from immature embryos (Armstrong et al., 1991).
Approximately 30 embryos per petri dish were plated axis side down
on a modified N6 medium containing 1 mg/l 2,4-D, 100 mg/l casein
hydrolysate, 6 mM L-proline, 0.5 g/l 2-(N-morpholino)ethanesulfonic
acid (MES), 0.75 g/l MgCI.sub.2, and 2% sucrose solidified with 2
g/l Gelgro, pH 5.8 (#735 medium) Embryos were cultured in the dark
for two days at 24.degree. C.
Approximately four hours prior to bombardment, embryos were
transferred to the above culture medium with the sucrose
concentration increased from 3% to 12%. When embryos were
transferred to the high osmoticum medium they were arranged in
concentric circles on the plate, starting 2 cm from the center of
the dish, positioned such that their coleorhizal end was orientated
toward the center of the dish. Usually two concentric circles were
formed with 25-35 embryos per plate.
Preparation of gold particles carrying plasmid DNA was described in
example 10. Particles were prepared containing 10 ug pDPG215
(luciferase), pDPG415 (Bt), and pDPG417 (bar) or 30 ug pDPG265
containing the maize R and C1B genes for anthocyanin
biosynthesis.
The plates containing embryos were placed on the third shelf from
the bottom, 5 cm below the stopping screen. The 1100 psi rupture
discs were used. Each plate of embryos was bombarded once. A total
of 420 embryos were bombarded on 14 plates with the luciferase,
bar, and Bt genes. Embryos were allowed to recover overnight on
high osmotic strength medium prior to initiation of selection. A
set of plates was also bombarded with the C1B vector pDPG265. Red
spots representing transient expression of anthocyanin pigments are
observed 24 hours after DNA introduction.
EXAMPLE 13
Electroporation Experiment EP413: Stable Transformation of SC716
and AT824 Cells using pDPG165 and pDPG208
Maize suspension culture cells were enzyme treated and
electroporated using conditions described in Krzyzek and Laursen
(PCT Publication WO 92/12250). SC716 or AT824 suspension culture
cells, three days post subculture, were sieved through 1000 .mu.m
stainless steel mesh and washed, 1.5 ml packed cells per 10 ml, in
incubation buffer (0.2 M mannitol, 0.1% bovine serum albumin, 80 mM
calcium chloride, and 20 mM 2-(N-morpholino)-ethane sulfonic acid,
pH 5.6). Cells were then treated for 90 minutes in incubation
buffer containing 0.5% pectolyase Y-23 (Seishin Pharmaceutical,
Tokyo, Japan) at a density of 1.5 ml packed cells per 5 ml of
enzyme solution. During the enzyme treatment, cells were incubated
in the dark at approximately 25.degree. C. on a rotary shaker at 60
rpm. Following pectolyase treatment, cells were washed once with 10
ml of incubation buffer followed by three washes with
electroporation buffer (10 mM HEPES, 0.4 mM mannitol). Cells were
resuspended in electroporation buffer at a density of 1.5 ml packed
cells in a total volume of 3 ml.
Linearized plasmid DNA, 100 ug of EcoRI digested pDPG165 and 100 ug
of EcoRI digested pDPG208, was added to 1 ml aliquots of
electroporation buffer. The DNA/electroporation buffer was
incubated at room temperature for approximately 10 minutes. To
these aliquots, 1 ml of suspension culture cells/electroporation
buffer (containing approximately 0.5 ml packed cells) were added.
Cells and DNA in electroporation buffer were incubated at room
temperature for approximately 10 minutes. One half ml aliquots of
this mixture were transferred to the electroporation chamber
(Puite, 1985) which was placed in a sterile 60.times.15 mm petri
dish. Cells were electroporated with a 70, 100, or 140 volt (V)
pulse discharged from a 140 microfarad (.mu.f) capacitor.
Approximately 10 minutes post-electroporation, cells were diluted
with 2.5 ml 409 medium containing 0.3 M mannitol. Cells were then
separated from most of the liquid medium by drawing the suspension
up in a pipet, and expelling the medium with the tip of the pipet
placed against the petri dish to retain the cells. The cells, and a
small amount of medium (approximately 0.2 ml) were dispensed onto a
filter (Whatman #1, 4.25 cm) overlaying solid 227 medium (Table 1)
containing 0.3 M mannitol. After five days, the tissue and the
supporting filters were transferred to 227 medium containing 0.2 M
mannitol. After seven days, tissue and supporting filters were
transferred to 227 medium without mannitol.
EXAMPLE 14
Electroporation of Immature Embryos
Immature embryos (0.4-1.8 mm in length) were excised from a
surface-sterilized, greenhouse-grown ear of the genotype H99 11
days post-pollination. Embryos were plated axis side down on a
modified N6 medium containing 3.3 mg/l dicamba, 100 mg/l casein
hydrolysate, 12 mM L-proline, and 3% sucrose solidified with 2 g/l
Gelgro.RTM., pH 5.8 (#726 medium), with about 30 embryos per dish.
Embryos were cultured in the dark for two days at 24.degree. C.
Immediately prior to electroporation, embryos were enzymatically
treated with 0.5% Pectolyase Y-23 (Seishin Pharmaceutical Co.) in a
buffer containing 0.2 M mannitol, 0.2% bovine serum albumin, 80 mM
calcium chloride and 20 mM 2-(N-morpholino)-ethane sulfonic acid
(MES) at pH 5.6. Enzymatic digestion was carried out for 5 minutes
at room temperature. Approximately 140 embryos were treated in
batch in 2 ml of enzyme and buffer. The embryos were washed two
times with 1 ml of 0.2 M mannitol, 0.2% bovine serum albumin, 80 mM
calcium chloride and 20 mM MES at pH 5.6 followed by three rinses
with electroporation buffer consisting of 10 mM
4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and 0.4
M mannitol at pH 7.5. For the electroporations, the final rinse of
electroporation buffer was removed and the embryos were incubated
with 0.33 mg/ml linearized pDPG165, 0.33 mg/ml supercoiled pDPG215
and 0.33 mg/ml linearized pDPG344 in electroporation buffer. One
half ml aliquots of DNA in electroporation buffer and twenty
embryos were transferred to the electroporation chamber that was
placed in a sterile 60.times.15 mm Petri dish. An electrical pulse
was passed through the cells from a 500 .mu.f capacitor that was
charged to 100 volts (400 V/cm field strength, 160 ms pulse decay
time; exponential pulse).
Immediately following electroporation, embryos were diluted 1:10
with 726 medium containing 0.3 M mannitol. Embryos were then
transferred to Gelgro.RTM. solidified 726 medium containing 0.3 M
mannitol. Embryos were incubated in the dark at 24.degree. C. After
five days embryos were transferred to Gelgro solidified 726 medium
containing 0.2 M mannitol. Two days later embryos were transferred
to selection medium.
EXAMPLE 15
DNA Delivery using Silicon Carbide Fibers
Kaeppler et al. 1990 reported transformation of tobacco and BMS
suspensions using fibers having a size of 0.6.times.10 to 80 .mu.m.
Transformations were accomplished by vortexing the silar fibers
together with cells in a DNA solution. DNA passively enters as the
cell are punctured. It is contemplated that fibers and/or particles
of other types would also be useful. The suspension culture SC82
was tested for transformability using the silicon carbide (silar)
transformation method described by Kaeppler et al. The initiation
of cell line SC82 is described in example 2.
A 2% mixture of silar in absolute ethanol was prepared. Microfuge
tubes were prepared (one per sample) by pipetting 80 .mu.l of silar
into each tube. The fibers were pelleted and the ethanol removed.
Samples were then washed with sterile water, pelleted, and the
water removed. Plasmid DNA (25 .mu.l of 1 mg/ml) was added to each
tube. Tissue samples were prepared by adding 0.25 ml PCV of cells
to a second set of microfuge tubes. Cells were pelleted and the
medium removed. A 100 .mu.l aliquot of fresh medium was next added
to each tissue sample. The silar/DNA mixture was resuspended and
added to the cells. The transformation was carried out by inverting
the microfuge tubes and vortexing for 10 seconds followed by
placing the tube upright and vortexing for an additional one
minute. Samples were then removed and cultured in small petri
dishes with 3 ml of medium. Transient GUS activity was observed two
days after DNA delivery.
In a second experiment with SC82 a bead beater or a vortex was
utilized to agitate samples. Samples were prepared as described
above.
G. Identification of Transformed Cells using Selectable Markers
In order to improve the ability to identify transformants, one may
employ a selectable marker gene that encodes a selectable marker
that confers a trait which one can select for by chemical means,
i.e., through the use of a selective agent. In the population of
surviving cells are those cells wherein generally the
resistance-conferring gene has been integrated and expressed at
sufficient levels to permit cell survival. Cells may be tested
further to confirm stable integration of the exogenous DNA. Using
embryogenic suspension cultures, stable transformants are recovered
at a frequency of approximately 1 per 1000 transiently expressing
foci. A specific embodiment of this procedure is shown in Example
17.
One of the difficulties in cereal transformation, e.g., corn, has
been the lack of an effective selective agent for transformed
cells, from totipotent cultures (Potrykus, 1989). Stable
transformants were recovered from bombarded nonembryogenic Black
Mexican Sweet (BMS) maize suspension culture cells, using the neo
gene and selection with the aminoglycoside, kanamycin (Klein,
1989). This approach, while applicable to the present invention, is
not preferred because many monocots are insensitive to high
concentrations of aminoglycosides (Dekeyser et al., 1989; Hauptmann
et al., 1988). The stage of cell growth, duration of exposure and
concentration of the antibiotic, may be critical to the successful
use of aminoglycosides as selective agents to identify
transformants (Lyznik et al., 1989; Yang et al., 1988; Zhang et
al., 1988). For example, D'Halluin et al. (1992) demonstrated that
using the neo gene and selecting with kanamycin transformants could
be isolated following electroporation of immature embryos of the
genotype H99 or type I callus of the genotype PA91. In addition,
use of the aminoglycosides, kanamycin or G418, to select stable
transformants from embryogenic maize cultures, in the inventors'
experience, often results in the isolation of resistant calli that
do not contain the neo gene.
One herbicide which has been suggested as a desirable selection
agent is the broad spectrum herbicide bialaphos. Bialaphos is a
tripeptide antibiotic produced by Streptomyces hygroscopicus and is
composed of phosphinothricin (PPT), an analogue of L-glutamic acid,
and two L-alanine residues. Upon removal of the L-alanine residues
by intracellular peptidases, the PPT is released and is a potent
inhibitor of glutamine synthetase (GS), a pivotal enzyme involved
in ammonia assimilation and nitrogen metabolism (Ogawa et al.,
1973). Synthetic PPT, the active ingredient in the herbicides
Basta.RTM. or Ignite.RTM. is also effective as a selection agent.
Inhibition of GS in plants by PPT causes the rapid accumulation of
ammonia and death of the plant cells.
The organism producing bialaphos and other species of the genus
Streptomyces also synthesizes an enzyme phosphinothricin acetyl
transferase (PAT) which is encoded by the bar gene in Streptomyces
hygroscopicus and the pat gene in Streptomyces viridochromogenes.
The use of the herbicide resistance gene encoding phosphinothricin
acetyl transferase (PAT) is referred to in DE 3642 829 A wherein
the gene is isolated from Streptomyces viridochromogenes. In the
bacterial source organism this enzyme acetylates the free amino
group of PPT preventing auto-toxicity (Thompson et al., 1987). The
bar gene has been cloned (Murakami et al., 1986; Thompson et al.,
1987) and expressed in transgenic tobacco, tomato and potato plants
(De Block, 1987) and Brassica (De Block, 1989). In previous
reports, some transgenic plants which expressed the resistance gene
were completely resistant to commercial formulations of PPT and
bialaphos in greenhouses.
PCT Application No. WO 87/00141 refers to the use of a process for
protecting plant cells and plants against the action of glutamine
synthetase inhibitors. This application also refers to the use of
such of a process to develop herbicide resistance in determined
plants. The gene encoding resistance to the herbicide BASTA
(Hoechst, phosphinothricin) or Herbiace (Meiji Seika, bialaphos)
was said to be introduced by Agrobacterium infection into tobacco
(Nicotiana tabacum cv Petit Havan SR1), potato (Solanum tuberosum
cv Benolima) and tomato (Lycopersicum esculentum) and conferred on
plants resistance to application of herbicides.
Another herbicide which is useful for selection of transformed cell
lines in the practice of this invention is the broad spectrum
herbicide glyphosate. Glyphosate inhibits the action of the enzyme
EPSPS which is active in the aromatic amino acid biosynthetic
pathway. Inhibition of this enzyme leads to starvation for the
amino acids phenylalanine, tyrosine, and tryptophan and secondary
metabolites derived thereof. U.S. Pat. No. 4,535,060 describes the
isolation of EPSPS mutations which infer glyphosate resistance on
the Salmonella typhimurium gene for EPSPS, aroA. The EPSPS gene was
cloned from Zea mays and mutations similar to those found in a
glyphosate resistant aroA gene were introduced in vitro. The mutant
gene encodes a protein with amino acid changes at residues 102 and
106. Although these mutations confer resistance to glyphosate on
the enzyme EPSPS it is anticipated that other mutations will also
be useful.
An exemplary embodiment of vectors capable of delivering DNA to
plant host cells is the plasmid, pDPG165 and the vectors pDPG433,
pDPG434, pDPG435, and pDPG436. The plasmid pDPG165 is illustrated
in FIGS. 1A and 1C. A very important component of this plasmid for
purposes of genetic transformation is the bar gene which encodes a
marker for selection of transformed cells exposed to bialaphos or
PPT. Plasmids pDPG434 and pDPG436 contain a maize EPSPS gene with
mutations at amino acid residues 102 and 106 driven by the actin
promoter and 35S promoter-Adh1 intron I respectively. A very
important component of these plasmids for purposes of genetic
transformation is the mutated EPSPS gene which encodes a marker for
selection of transformed cells.
EXAMPLE 16
Selection of bar Transformants Using Bialaphos in the Cell Line
SC82 Following Particle Bombardment
The suspension culture (designated SC82) used in the initial
experiments (see Example 8) was derived from embryogenic Type-II
callus of A188.times.B73. Following bombardment (see Example 8),
cells on filters were resuspended in nonselective liquid medium,
cultured for 1 to 2 weeks and transferred to filters overlaying
solid medium containing 1 or 3 mg/l bialaphos. The degree of
inhibition of tissue growth during selection was dependent upon the
density of the cells on the filter and on the concentration of
bialaphos used. At the density plated (0.5 PCV/filter), growth of
cells cultured on 1 mg/l bialaphos was only partially inhibited
(.about.30-50% of nonselected growth) and after 3 to 4 weeks much
of this tissue was transferred as discrete clumps (.about.5 mm in
diameter) to identical medium. On medium containing 3 mg/l
bialaphos, the growth of cells on the original selection filter was
severely inhibited (.about.10% of nonselected growth) and selection
was carried out without removing the tissue from the original
filter.
Using either selection protocol (1 or 3 mg/l bialaphos), resistant
cell colonies emerged on the selection plates of SC82 bombarded
with pDPG165 approximately 6 to 7 weeks after bombardment (FIG.
2A). Bialaphos-resistant calli were maintained and expanded on
selection medium. Much of this tissue was embryogenic (FIG. 2B). No
colony growth occurred on plates to which cells were added from
untransformed suspension cultures. These were controls which
confirm the prediction that cells without the bar gene are not
resistant to bialaphos.
Colonies on solid supports are visible groups of cells formed by
growth and division of cells plated on such support. Colonies can
be seen in FIG. 2A on a petri dish. In this figure, the cells
capable of growth are those that are resistant to the presence of
the herbicide bialaphos, said resistance resulting from integration
and expression of the bar gene. Exposure of cells was to 1 mg/l
bialaphos. FIG. 2B is a magnification showing the morphology of one
bialaphos-resistant culture maintained on selection media
indicating that growth is embryogenic.
As a confirmation that the cells forming the colonies shown in FIG.
2 had indeed incorporated the bar gene and were expressing it,
bialaphos-resistant callus lines were analyzed for activity of the
bar gene product, phosphinothricin acetyl transferase (PAT), by
thin-layer chromatography. Protein extracts from eleven callus
lines (E1-11) isolated from SC82 bombardment experiments contained
PAT activity as shown in FIG. 3 and activity levels varied
approximately 10-fold among the isolates.
Still further and more direct confirmation of the presence of the
bar gene was obtained by analysis of the genomic DNA of potential
transformants by DNA gel blots (FIG. 4). The sources of DNA which
were electrophoresed through the gel were the bialaphos-resistant
callus lines designated E1-E11 and a non-selected control, E0.
(FIG. 1 indicates the cleavage sites of those enzymes within the
bar gene plasmid). After the DNA was electrophoresed through the
gel and transferred to nylon membranes, the resulting blot was
hybridized with a .sup.32 P-labeled bar gene sequence from the
plasmid pDPG165. The radioactivity used per blot was approximately
25.times.10.sup.6 Cerenkov cpm. The lane in FIG. 4 designated "1"
and "5" copies contain 1.9 and 9.5 pg respectively of the 1.9 kb
bar expression unit released from the plasmid pDPG165 by
application of the EcoRI and HindIII enzymes; these amounts
represent about 1 and 5 copies per diploid genome.
Genomic DNA from all eleven bialaphos-resistant isolates contained
bar-hybridizing sequences as shown in FIG. 4. The hybridization in
all isolates to a fragment migrating slightly larger than 2 kb may
be due to contaminating pUC19 sequences contained in this bar probe
preparation; no such hybridization occurred in subsequent
experiments using the same genomic DNA and a different preparation
of the bar probe. Hybridization to a 1.9 kb fragment in eight of
the eleven isolates indicated that these isolates contained intact
copies of the 1.9 kb bar expression unit. The estimated copy
numbers of the intact unit ranged from one or two (E1, E7, E8, E10,
E11) to approximately 20 (E3, E4, E6). Hybridization with the bar
probe in isolates E2 and E5 occurred only to a single, higher
molecular weight fragment (.about.3 kb).
To establish that the PAT coding sequence was intact in isolates E2
and E5, genomic DNA was digested with Smal, which releases a 559 bp
fragment containing the PAT structural gene (FIG. 1A), and
subjected to DNA gel blot analysis using .sup.32 P-labeled bar.
This analysis confirmed the presence of a single intact copy of
bar. Expression of PAT in these isolates may not be dependent on
the 35S promoter or the Tr7 3' end. The hybridization patterns of
some of the isolates were identical (E2 and E5; E7 and E8; E3, E4,
and E6); therefore, it is probable that some isolates did not arise
from independent transformation events but represent transformants
that were separated during selection.
Seven hybridization patterns were unique, likely representing seven
independent single-cell transformation events. The patterns and
intensities of hybridization for the seven transformants were
unchanged during four months in culture, providing evidence for the
stability of the integrated sequences. The seven independent
transformants were derived from two separate bombardment
experiments. Four independent transformants representing isolates
E2/E5, E3/E4/E6, E1 and E7/E8, were recovered from a total of four
original filters from bombardment experiment #1 and the three
additional independent transformants, E9, E10, and E11, were
selected from tissue originating from six bombarded filters in
experiment #2. These data are summarized in Table 5.
TABLE 5 Summary of Maize Transformation Experiments # of # with
Independent Intact # with bar bar GUS # with Cointegration
Coexpression Exp. Culture # of Filters Transformants Expression
Coding GUS Frequency Frequency # Bombarded Bombarded Recovered
Units Sequence Activity (%) (%) 1 SC82 4 4 3 n.a 2 SC82 6 3 2 n.a.
3 SC94 10 8 6 n.a. 4 SC716* 8 13 8 11 3 85 23 5 SC716* 8 7 4 6 1 86
14 6 SC82* 4 19 17 13 3 68 16 TOTALS 40 54 40 30 7 77 18 (30/39)
(7/39) culture reinitiated from cryopreserved cells n.a. not
applicable; only pDPG165 DNA used or co-transformation analysis not
done
Studies with other embryogenic suspension cultures produced similar
results. Using either an SC82 culture that was reinitiated from
cryopreserved cells (experiment #6) or an A188.times.B84 (SC94)
suspension culture (experiment #3), numerous independent
transformants were recovered (19 and 18 respectively; Table 5). All
transformants contained the bar gene and expressed PAT. The copy
number of bar-hybridizing sequences and levels of PAT expression
were comparable to the studies described above.
EXAMPLE 17
Integration of the Bar Gene into Cell Lines Derived from the SC716
Suspension Culture
Bombardment studies and subsequent analyses were also performed on
the A188.times.B73 suspension culture, termed SC716 (see Example
1). The resultant transformed plant cells were analyzed for
integration of bar genes. To carry out this analysis, genomic DNA
was obtained from R1-R21 isolates; 6 .mu.g of DNA was digested with
the restriction endonucleases EcoRI and HindIII, and DNA gel blot
analysis was performed using the bar gene as probe. In FIG. 5,
molecular weights in kb are shown to the right and left. The
untransformed control is designated "RO," and the last column to
the right contains the equivalent of two copies of the bar gene
expression unit per diploid genome. For the DNA load used, two
copies the bar expression unit per diploid genome is 5.7 pg of the
1.9 kb EcoRI/Hind fragment from the plasmid pDPG165. The DNA
separated on the gel blot was hybridized to a .sup.32 P-labeled bar
probe. The label activity in the hybridization was approximately
10.times.10.sup.6 Cerenkov cpm. In A, the presence of an intact bar
expression unit is inferred from the hybridization of the bar probe
to a 1.9 kb band in the gel.
EXAMPLE 18
Assays for Integration and Expression of GUS
SC716 transformants discussed in Example 17, were further analyzed
for integration and expression of the gene encoding GUS. As
determined by histochemical assay, four of the SC716 transformants
(R5, R7, R16, and R21) had detectable GUS activity 3 months
post-bombardment. Expression patterns observed in the four
coexpressing callus lines varied. The number of cells with GUS
activity within any given transformant sampled ranged from
.about.5% to .about.90% and, in addition, the level of GUS activity
within those cells varied. The cointegration frequency was
determined by washing the genomic blot hybridized with bar (FIG.
5A) and probing with .sup.32 P-labeled GUS sequence as shown in
FIG. 5B. EcoRI and HindIII, which excise the bar expression unit
from pDPG165, also release from pDPG208 a 2.1 kb fragment
containing the GUS coding sequence and the nos 3' end (FIG.
1B).
Seventeen of the independent bar transformants contained sequences
that hybridized to the GUS probe; three, R2, R14 and R19 did not.
Transformants in which GUS activity was detected (R5, R7, R16 and
R21) had intact copies of the 2.1 kb EcoRI/HindIII fragment
containing the GUS structural gene (FIG. 5B). Transformants that
contained large numbers of fragments that hybridized to bar (R1,
R5, R21) also contained comparable number of fragments that
hybridized to the gene encoding GUS (FIGS. 5A and B). This
observation is consistent with those reported using independent
plasmids-in PEG-mediated transformation of A188.times.BMS
protoplasts (Lyznik et al., 1989) and in studies conducted by the
inventors involving bombardment-mediated transformation of BMS
suspension cells.
EXAMPLE 19
Transformation of Cell Line AT824 Using Bialaphos Selection
Following Particle Bombardment--Selection in Liquid Medium
The suspension culture (designated AT824) used in this experiment
was derived from an elite B73-derived inbred (described in example
3). The culture was maintained in medium 409. Four filters were
bombarded as described in example 10.
Following one week culture in liquid medium 409 without selection
pressure, tissue was transferred to liquid medium 409 containing 1
mg/L bialaphos. Cells were transferred twice per week into fresh
medium containing 1 mg/L bialaphos for two weeks. Tissue was thin
planted 3 weeks following bombardment at a concentration of 0.1 ml
packed cell volume per petri dish containing medium 425 (with 3
mg/L bialaphos). Transformants were identified as discreet colonies
6 weeks following bombardment. It is the experience of the
inventors that all cell lines that grow on 3 mg/L bialaphos contain
the bar gene. Fifty transformed cell lines were recovered from this
experiment. Twenty four of these cell lines contained the Bt
gene.
EXAMPLE 20
Transformation of Cell Line AT824 Using Bialaphos Selection
Following Particle Bombardment--Solid Medium Selection
Cells in experiment S10 were bombarded as described in example 10
except the gold particle-DNA preparation was made using 25 ul
pDPG319 DNA (bar gene and aroA expression cassette containing the
.alpha.-tubulin promoter). Following particle bombardment cells
remained on solid 279 medium in the absence of selection for one
week. At this time cells were removed from solid medium,
resuspended in liquid 279 medium, replated on Whatman filters at
0.5 ml PCV per filter, and transferred to 279 medium containing 1
mg/L bialaphos. Following one week, filters were transferred to 279
medium containing 3 mg/L bialaphos. One week later, cells were
resuspended in liquid 279 medium and plated at 0.1 ml PCV on 279
medium containing 3 mg/L bialaphos. Nine transformants were
identified 7 weeks following bombardment.
EXAMPLE 21
Transformation of Cell Line ABT4 Using Bialaphos Following Particle
Bombardment
Initiation of cell line ABT4 is described in example 4. ABT4 was
maintained as a callus culture. At the time of subculture, tissue
was scraped off the solid culture medium and resuspended in 20 mls
of 708 medium containing 0.2M mannitol. Tissue was dispersed with a
large bore 10 ml pipette by picking up and dispensing several times
until one could pickup 0.5 ml packed cell volume (PCV) for
subculture to fresh solid 708 medium. Prior to bombardment three
week old 708 maintenance cultures of ABT4 were transferred from
solid medium to 20 mls 708+0.2M mannitol and 0.5 ml PCV was plated
on glass fiber filters over 708+0.2M mannitol medium. Cultures were
allowed to plasmolyze for 2-4 hours prior to bombardment. At the
time of bombardment tissue on a glass fiber filter was placed on
top of 3 filter papers moistened with 2.5 mls of 708+0.2M mannitol.
Six ul of DNA/gold particles (described in example 10) was placed
on flyers prior to bombardment with the Dupont Biolistics PDS1000He
particle delivery device. Particles were accelerated by a 1100 psi
blast of helium gas. Following bombardment tissue was returned to
708+0.2M mannitol and allowed to recover for 2-5 days. Selection
began at this point by moving the tissue/filter to 708+1 mg/L
bialaphos for 12 days. At this time tissue was transferred to 30-40
ml 708+0.5 mg/L bialaphos, dispersed, and thin plated at 0.05 to
0.10 PCV on 708+0.5 mg/L bialaphos solid medium. Transformants were
identified 5-12 weeks following thin plating. Following
identification transformants were maintained on 708+3 mg/L
bialaphos.
EXAMPLE 22
Transformation of Immature Embryos of the Genotype Hi-II using
Bialaphos as a Selective Agent Following Particle Bombardment
Immature embryos of the genotype Hi-Il were bombarded as described
in example 12. Embryos were allowed to recover on high osmoticum
medium (735, 12% sucrose) overnight (16-24 hours) and were then
transferred to selection medium containing 1 mg/l bialaphos (#739,
735 plus 1 mg/l bialaphos or #750, 735 plus 0.2M mannitol and 1
mg/l bialaphos). Embryos were maintained in the dark at 24.degree.
C. After three to four week on the initial selection plates about
90% of the embryos had formed Type II callus and were transferred
to selective medium containing 3 mg/l bialaphos (#758). Responding
tissue was subcultured about every two weeks onto fresh selection
medium (#758). Nineteen transformants were identified six to eight
weeks after bombardment. Fifteen of nineteen transformants
contained the B. thuringiensis (Bt) crystal toxin gene. Plants have
been regenerated from one transformant containing the Bt gene and
transferred to soil in the greenhouse. Regeneration of plants from
remaining lines containing the Bt gene is in progress.
EXAMPLE 23
Transformation of AT824 and SC716 Using Bialaphos Selection
Following Electroporation
Cells of AT824 and SC716 were electroporated and allowed to recover
from electroporation as described in example 13. Five days later,
tissue growing on filters was removed from the filter and
transferred as clumps (approximately 0.5 cm in diameter) to the
surface of solid selection medium. The selection medium consisted
of 227 medium supplemented with 1 mg/L bialaphos. Three weeks
later, slowly growing tissue was transferred, as 0.5 cm clumps, to
227 medium containing 3 mg/L bialaphos. Three to four weeks later,
callus sectors that continued to grow were transferred to fresh 227
medium containing 3 mg/L bialaphos. Callus lines that continued to
grow after this subculture were considered to be transgenic and
perpetuated further, by transfer to fresh selection medium every
two weeks. One SC716 and seven AT824 callus lines were selected in
this example. The SC716 callus line was recovered from an
electroporation at 140 .mu.f, 100 V. Three AT824 callus lines were
recovered from 140 .mu.f, 70 V electroporations and four AT824
callus lines were recovered from electroporation at 140 .mu.f, 140
V.
Three bialaphos resistant callus lines selected in this example,
one derived from SC716 and two derived from AT824, were randomly
chosen and assayed for phosphinothricin acetyltransferase (PAT)
activity. PAT is the bar gene product, and PAT activity is
determined by the ability of total protein extracts from
potentially transformed cells to acetylate phosphinothricin (PPT),
using .sup.14 C-acetyl coenzyme A as the acetyl donor. This
transfer is detected, using thin layer chromatography and
autoradiography, by a shift in the mobility of .sup.14 C labelled
compound from that expected for .sup.14 C-acetyl coenzyme A to that
expected for .sup.14 C-N-acetyl PPT. The assay used for detection
of PAT activity has been described in detail (Adams et al.,
published PCT application no. WO91/02071; Spencer et al.1990). All
three callus lines tested contained PAT activity.
In this example, suspension culture cells were electroporated with
a second plasmid, pDPG208, encoding .beta.-glucuronidase (GUS).
Detection of GUS activity can be performed histochemically using
5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) as the substrate
for the GUS enzyme, yielding a blue precipitate inside of cells
containing GUS activity. This assay has been described in detail
(Jefferson1987). One of the seven AT824 callus lines selected in
this example, EP413-13, contained cells that turned blue in the
histochemical assay. The callus line derived from SC716 in this
example did not contain detectable GUS activity.
Southern blot analysis was performed on three bialaphos resistant
callus lines to determine the presence and integration of the bar
gene in genomic callus DNA. Southern blot analysis was performed as
follows. Genomic DNA was isolated using a procedure modified from
Shure et al. (1983). Approximately one gram of callus tissue from
each line was lypholyzed overnight in 15 ml polypropylene tubes.
Freeze-dried tissue was ground to a powder in the tube using a
glass rod. Powdered tissue was mixed thoroughly with 3 ml
extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0,
0.01 M EDTA, 1 % sarcosine). Tissue/buffer homogenate was extracted
with 3 ml phenol/chloroform. The aqueous phase was separated by
centrifugation, and precipitated twice using 1/10 volume of 4.4 M
ammonium acetate pH 5.2, and an equal volume of isopropanol. The
precipitate was washed with 75% ethanol and resuspended in 100-500
.mu.l TE (0.01 M Tris-HCl, 0.001 M EDTA, pH 8.0). Genomic DNA was
digested with a 3-fold excess of restriction enzymes,
electrophoresed through 0.8% agarose (FMC), and transferred
(Southern, 1975) to Nytran (Schleicher and Schuell) using
10.times.SCP (20.times.SCP: 2 M NaCl, 0.6 M disodium phosphate,
0.02 M disodium EDTA). Filters were prehybridized in 6.times.SCP,
10% dextran sulfate, 2% sarcosine, and 500 .mu.g/ml heparin (Chomet
et al., 1987) for approximately 10 minutes. Filters were hybridized
overnight at 65.degree. C. in 6.times.SCP containing 100 .mu.g/ml
denatured salmon sperm DNA and .sup.32 P-labelled probe. Probe was
generated by random priming (Feinberg and Vogelstein, 1983);
Boehringer-Mannheim). Hybridized filters were washed in
2.times.SCP, 1% SDS at 65.degree. for 30 minutes and visualized by
autoradiography using Kodak XAR5 film.
In this example, genomic DNA isolated from bialaphos resistant
callus lines was digested with HindIII and EcoRI, which release a
1.9 kb bar fragment from pDPG165 (FIG. 1A). Genomic DNA was probed
with .sup.32 P labelled 0.6 kb Smal bar fragment from pDPG165 (FIG.
1A). All three EP413 callus lines analyzed contained DNA that
hybridized to the bar probe. Copy number in the transformed callus
ranged from one to two copies (EP413-3) to greater than 20 copies
of bar (EP413-1). Furthermore, the restriction digest used, yielded
bar-hybridizing fragments in callus DNA samples that were larger
than the bar fragment released from pDPG165 in the same restriction
digest. This result is indicative of stable integration of
introduced DNA into the maize genome.
Thirty-nine plants were regenerated from seven of the eight
bialaphos resistant callus lines selected in this example. Plants
were regenerated from six AT824 callus lines and the single SC716
callus line. The plant regenerated from the SC716 callus line
(EP413-4) did not survive to maturity. For plant regeneration,
callus growing on 227 medium containing 3 mg/L bialaphos, was
transferred to 189 medium (Table 1). Somatic embryos matured on 189
medium after one, two, or three two week subculture periods in the
dark at 25.degree. C. As somatic embryos developed on 189 medium,
clumps of tissue containing these embryos were transferred to
growth regulator free 101 medium (Table 1) and placed in the light
(25-250 .mu.E M.sup.-2 s.sup.-1). Plantlets developed on this
medium after one, two, or three subculture periods. Plantlets were
subsequently transferred to 501 medium (Table 1) in Plant Con.sup.R
containers for rooting and further growth. Regenerates (R.sub.0
plants) were subsequently transferred to a soilless mix in 0.5
liter pots and acclimated to ambient humidity in a growth chamber
(200-450 .mu.E M.sup.-2 s.sup.-1 ; 14 h photoperiod). The soilless
mix has been described in detail (Adams et al., published PCT
application no. WO91/02071). Plants were then transferred to a
soilless mix in 16 liter pots and grown to maturity in a
greenhouse.
Plants regenerated from five different EP413 callus lines were
assayed for PAT activity as described for callus earlier in this
example. All five plants contained PAT activity. Three plants
regenerated from the single EP413 callus line that exhibited GUS
activity (EP413-13) were analyzed for GUS activity. All three
EP413-13 R.sub.0 plants were positive for GUS activity. Files of
blue cells were observed in leaf tissue of EP413-13 plants upon
incubation with X-Gluc.
EP413 R.sub.0 plants were also analyzed for the presence and
integration of bar by Southern blot. DNA was isolated from leaf
tissue as described for callus except that fresh, rather than
lypholyzed tissue was used. Prior to the addition of extraction
buffer, fresh leaf tissue was frozen in liquid nitrogen and ground
to a fine powder in a 15 ml polypropylene tube using liquid
nitrogen and a glass rod. DNA was isolated from four EP413 R.sub.0
plants, each representing a different callus line. DNA was
analyzed, digested with HindIII and BgIII, or undigested, for
hybridization to bar. R.sub.0 DNA was probed with .sup.32 P
labelled 0.6 kb Smal bar fragment from pDPG165 (FIG. 1A).
HindIII/BgIII digestion of pDPG165 releases a fragment containing
35S-bar of approximately 1.3 kb (FIG. 1A). Genomic DNA from all
four plants contained at least one copy of the 1.3 kb HindIII/BgIII
35S-bar fragment. In addition, undigested genomic DNA from all four
plants exhibited hybridization to bar only in high molecular weight
DNA (>20 kb), indicating integration of pDPG165 into maize
chromosomal DNA.
Progeny were recovered from outcrosses made between
electroporation-derived, transgenic R.sub.0 plants and
non-transformed inbred plants. Four EP413-3 R.sub.0 plants were the
first of the plants to reach maturity and flower. One of the plants
was outcrossed as the male to a CD inbred plant. This cross
resulted in 22 kernels. Sixteen of these kernels were planted in
soilless mix and all germinated. Approximately two weeks
post-germination, the progeny (R.sub.1) plants were analyzed for
PAT activity. Three of sixteen plants contained PAT activity. Four
transgenic EP413-3 R.sub.0 plants were also outcrossed as the
female, using pollen collected from nontransformed inbred plants.
Kernels developed on ears of all four EP413-3 R.sub.0 plants.
Thirty-seven kernels were recovered from an ear on an EP413-3
R.sub.0 plant treated with pollen collected from a seed-derived,
non-transformed FBLL inbred plant. Sixteen of these kernels were
planted in soil and twelve germinated. Eight of these plants were
analyzed for PAT activity; three of eight were positive for PAT
activity.
These eight plants were also analyzed by Southern blot
hybridization for the presence of bar. Genomic DNA isolated from
these eight EP413-3 R.sub.1 plants was digested with restriction
enzymes HindIII and BgIII, which release a 1.3 kb fragment
containing bar from pDPG165 (FIG. 1A). In addition to DNA from the
eight EP413-3 R.sub.1 plants, DNA isolated from EP413-3 callus and
DNA from the EP413-3 R.sub.0 plant yielding these eight R.sub.1
plants was included in the analysis. Genomic DNA was probed with
.sup.32 P labelled 0.6 kb Smal bar fragment from pDPG165 (FIG. 1A).
Hybridization to bar was detected in the DNA isolated from callus,
R.sub.0 and the three R.sub.1 plants that contained PAT activity.
Each of the bar-positive plants contained the expected 1.3 kb
HindIII/BgIII fragment from pDPG165 (FIG. 1A) as well as an
additional, larger bar-hybridizing fragment of approximately 2.0
kb. This result, as well as the PAT activity found to be present in
EP413-3 R.sub.1 plants, conclusively demonstrates the sexual
transmission to progeny of a functional gene introduced into maize
cells by electroporation.
EXAMPLE 24
Transformation of H99 Immature Embryos Using Bialaphos as the
Selective Agent Following Electroporation
Immature embryos of H99 were electroporated as described in example
14. Five days after electroporation embryos were transferred to
Gelgro solidified 726 medium containing 0.2 M mannitol. Two days
later embryos were transferred to selection medium, 726 medium
containing 1 mg/l bialaphos, 16 embryos per dish.
Embryos were cultured in the dark at 24.degree. C. for about seven
weeks. Seventy-eight of the approximately one hundred and twenty
embryos plated on selection medium produced Type I callus. All
responding callus was transferred to modified MS-based medium
containing 1 mg/l NAA, 1 mg/l BAP and 3% sucrose solidified with 8
g/l Bactoagar (20 medium) for maturation. After about two weeks the
tissue was transferred to 20 medium containing 1 mg/l bialaphos.
Two weeks later the tissue was transferred to a modified MS-based
medium containing 0.5 mg/l NAA, 0.5 mg/l BAP and 2% sucrose
solidified with 8 g/l Bactoagar (7 medium) with 1 mg/l bialaphos.
For rooting the tissue was transferred to a modified MS-based
medium containing 0.25 mg/l NAA, 0.25 mg/l BAP and 2% sucrose
solidified with 8 g/l Bactoagar and finally 1/2 strength MSO.
Tissue from twenty-three of initial seventy-eight responding
embryos survived the regeneration and selection and produced
plants. A total of seventy-five plants were transferred to soil.
Four of the plants died and the remaining seventy-one plants were
transferred to the greenhouse.
Plants in the greenhouse were tested for the presence of the bar
gene by PCR analysis of DNA extracted from leaf tissue or by
painting the leaves with 2% Basta. One PCR positive plant from
embryo # 31 was identified. All of the other plants were either PCR
negative or showed severe necrosis in the Basta painting assay. DNA
from leaf tissue of plant 3101 was further analyzed by Southern
blot hybridization and gave a positive signal when probed with the
Sma I fragment of pDPG165. This plant was selfed on June 7 and June
8 and backcrossed on Jun. 9, 1993. Nine seed were harvested from
this plant. All seed germinated and seven of nine R.sub.1 plants
contain the bar gene as determined by PCR analysis.
EXAMPLE 25
Transformation of AB12 Using Hygromycin as a Selective Agent
Following Particle Bombardment
AB12 callus was bombarded as described in example 9. Callus was
transferred (ten 25 mg clumps per plate) onto 734 medium (see Table
1) containing 15 mg/l hygromycin B (Calbiochem) immediately after
bombardment. After 14 days all tissue was transferred to round 2
selection plates that contained 60 mg/l hygromycin. After 21 days
on the round 2 selection plates, most of the material was
transferred to F medium containing 60 mg/l hygromycin (round 3
selection plates). Both round 2 and round 3 plates were then
observed periodically for the appearance of viable sectors of
callus. Putative transformed callus line PH1 was observed on a
round 2 plate, 70 days after bombardment. Putative transformants
PH2 and PH3 were observed on round 3 plates, 58 and 79 days after
bombardment, respectively. Lines were then maintained on F medium
containing 60 mg/l hygromycin. Plant regeneration and analysis of
transformants are described in Walters et al. (1992). Fertile
transgenic plants were regenerated and transmission of the chimeric
gene for hygromycin resistance was demonstrated through two
complete generations.
EXAMPLE 26
Transformation of AT824 Using Glyphosate as A Selective Agent
Following Particle Bombardment
A mutant maize EPSPS gene was introduced into AT824 suspension
culture cells via particle bombardment as described in example 10.
In this example, the mutant maize EPSPS gene was carried by plasmid
pDPG436. Plasmid pDPG436 contains a maize EPSPS gene with two amino
acid changes, Thr to IIe at position 102 and Pro to Ser at position
106. In this plasmid, the mutant maize EPSPS expression cassette
contains a 35S promoter/adh1 intron I combination and the nos 3'
end. Following bombardment with gold particles coated with pDPG436,
AT824 cells were cultured on 279 medium (Table 1) for four days.
Subsequently, the cells were returned to liquid 401 medium (Table
1), at a density of 2 ml packed cell volume (PCV) per 20 ml, and
cultured for four days. The cells were then transferred, at a
density of 2 ml PCV/20 ml, to fresh 401 medium containing 1 mM
glyphosate and cultured for four days. The subculture into 401 plus
1 mM glyphosate was repeated and after four days the cells were
plated at a density of 0.1 ml PCV per 100.times.15 mm petri dish
containing 279 plus 1 mM glyphosate. Six to eight weeks after
bombardment, glyphosate resistant colonies were removed from the
selection plates and subcultured onto fresh 279 plus 1 mM
glyphosate. Seven glyphosate resistant callus lines were recovered
in this example, at a frequency of zero to seven callus lines per
bombardment. Two randomly chosen callus lines were analyzed for the
presence of the introduced DNA by Southern blot hybridization (see
example 23). Genomic DNA isolated from the callus lines was
analyzed undigested or digested with Notl, which releases the
mutant EPSPS expression cassette from pDPG436. The callus DNA was
probed with .sup.32 P-labelled nos fragment. The nos fragment was
isolated as an approximately 250 bp Notl/Xbal fragment from
pDPG425. The nos fragment was chosen as the probe to avoid
background hybridization possible using an EPSPS probe due to the
presence of an endogenous maize EPSPS gene. Genomic DNA from both
callus lines was positive for hybridization to nos in both the
undigested and Notl-digested samples. Both callus DNA samples
contained nos-hybridizing bands identical in size to the 35S/adh1
intron I--EPSPS--nos fragments released from pDPG436 upon digestion
with Notl, as well as additional nos-hybridizing bands.
In a second experiment, AT824 cells were bombarded with a mutant
EPSPS gene under control of the rice actin promoter and intron (Cao
et al., Plant Cell Rep (1992) 11:586-591). The plasmid used,
pDPG434,contains the rice actin 5' region, the mutant EPSPS gene
described in the previous example, and the nos 3' end. Bombarded
AT824 cells were cultured and selected as described in the previous
example. Thirteen glyphosate resistant callus lines were isolated
in this example. Four to seven glyphosate resistant callus lines
were recovered per bombardment in this example. As in the previous
example, two randomly chosen callus lines were analyzed for the
introduced DNA by Southern blot hybridization. Using the same
analysis as in the previous example, both callus lines were found
to contain DNA sequence that hybridized to the nos probe,
confirming introduction of, and selection for expression of, the
introduced mutant EPSPS gene.
H. Identification of Transformed Cells Using Screenable Markers
In addition to selectable markers such as the bar and aroA genes,
various screenable marker genes have been employed by the present
inventors in maize transformation. It is contemplated that
screenable markers may be used to ultimately achieve three
objectives: (1) the detection of expressing colonies in a
population, which may not necessarily employ a visible marker; (2)
the visualization, by microscope or unaided eye, of expressing
cells within a population or tissue; and (3) the ability to assess
tissue- and/or cell-specific expression in gene expression studies.
A screenable marker which meets either objective would be useful
and one that meets both criteria would be particularly
advantageous. Of the potential candidates being considered as
screenable markers, luciferase (Example 27) and aequorin satisfy
only the first requirement, while modified extension (Example 28)
and tyrosinase could potentially meet both goals.
Tyrosinase
The tyrosinase gene is considered to be a potential screenable
marker. Normally, melanin production requires the expression of two
genes which encode for tyrosinase and a Cu.sup.++ transfer protein.
Recently, an E. coli transformant was isolated by Claudio Denoyo
(Pfizer) in which the Cu-transfer protein does not appear to be
required. There is still a requirement for copper as a coenzyme for
tyrosinase, but this is satisfied by 1 mM Cu.sup.++ and the
tyrosinase acts as a copper scavenger. The gene itself is small
with a high GC content which should be expressed in maize.
Aequorin
This gene was cloned by Dr. M. Cormier (University of Georgia) and
encodes a protein called apoaequorin that is normally produced in
jellyfish. When this protein complexes with a class of lipophilic
fluorophores referred to as coelenterazines, the activated complex
becomes sensitive to Ca.sup.++. When the complex comes into contact
with Ca.sup.++, the coelenterazine is reduced to an amide and a
photon of light is emitted. Thus, this gene encoded the
proteinaceous portion of a calcium-sensitive bioluminescent
complex.
This gene has been placed behind the 35S promoter and used to
generate aequorin expressing tobacco plants which are being
employed to study calcium levels in plant tissue. However, there
are certain technical difficulties with developing this system into
a screenable marker. Firstly, coelenterazines are difficult to
obtain. Secondly, the intensity of the bioluminescence emitted by
this complex is probably an order of magnitude lower than
luciferase and the detection systems needed to visualize this
reaction are very sophisticated and expensive.
However light emission from aequorin expressing cells have never
been measured while the cells were being flooded with both
coelenterazine and Ca.sup.++. This is an important point. The
apoaequorin protein is not the rate limiting factor in this
reaction, it is the regeneration of reduced coelenterazine from the
coelenteramide. Thus there is a requirement for a strong reducing
agent in the assay. Using 1% DMSO, coelenterazine and calcium could
drive the light emission up to detectable levels. Conversely, when
these substrates are not present, i.e. in the plant, this normally
energy-requiring reaction would not be occurring.
EXAMPLE 27
Luciferase as a Screenable Marker
The lux gene, encoding firefly luciferase, was initially tested as
a potential screenable marker using C16 protoplast electroporation
to evaluate transient expression, and cotransformation of BMS.
Using X-ray film to detect bioluminescence, transient expression in
C16 protoplasts was detected, but expression in BMS was not high
enough for detection on X-ray film. Published results on luciferase
expression in tobacco (Ow et al., 1986), indicate that as few as
350 expressing cells could be viably detected.
Two technical developments prompted the inventors to re-examine the
feasibility of using this marker. The first is a Polaroid ASA
20,000 ELISA-type film detection system that is easy to use, with
sensitivity comparable to, or slightly more sensitive than, X-ray
film. The second is a new Luciferase Assay System (Promega), which
through the oxidation of luciferyl-CoA, as opposed to luciferin, is
claimed to provide a light reaction with greater total intensity
and with a greatly extended half-life.
While the scintillation counter and multiwell luminometer afford
one means of testing the utility of luciferase screening, i.e.
populational screening for bioluminescence, it would be ideal to be
able to visualize transformants on the tissue culture plate. This
would be even more valuable if the method was not limited to
specific cultures and/or tissue types, and if it could be extended
to the whole plant (i.e. for gene expression studies).
Computer-enhanced video microscopy has been recognized as a
potentially valuable tool for these applications. Recently, the
Photon Counting Camera (Hamamatsu) has provided a new level of
sensitivity for the video-imaging of bioluminescence.
Bombarded E1 suspension cells were assayed using both the
scintillation counter and the Polaroid detection system. Extracting
1/4 of the cells on a filter 48 hours after bombardment, luciferase
activity was at the lower limit of detection using the
scintillation counter. Using much smaller aliquots of cells, due to
the microtiter wells in the assay system, no discernible activity
was observed using the Polaroid detection system.
Using dilutions of purified luciferin in both the scintillation
counter and the Polaroid system, and comparing these results to
scintillation counts of transient lux expression after bombardment
of E1 cells, it was estimated that there is probably only a 10-fold
discrepancy between the transient expression levels and the ability
to detect a signal using this film. Further studies were thus
conducted to bridge this detection gap. The luciferase system was
optimized both with respect to the assay mixture and also with the
creation of further luciferase expression vectors.
Luciferase Assay Mixture
The first step in this process was to re-evaluate the composition
of the assay mixture, both in terms of relative luminescence and
subsequent viability of the tissue. The addition of coenzyme A to
the reaction mix has been reported to improve the bioluminescence
kinetics of the luciferase assay. This has been one of the features
incorporated into the Luciferase Assay System sold by Promega. In
comparing the Promega mixture to the luciferase assay mixture
usually employed, no significant difference was observed in
assaying purified luciferase enzyme. However, when cell extract
from a transformed E1 callus line was used, the Promega mixture
produced approximately an 18-fold increase in signal (measured over
a two minute period using the scintillation counter).
Multiple experiments were performed to assess the influence of the
components of these assay mixtures; varying both the species and
concentration of reducing agent, salts, coenzymes, protective
proteins, and the substrate itself, luciferin. The type and amount
of reducing agent was a point of concern for tissue viability, so
two alternatives were compared for signal strength and tissue
viability. Both glutathione (i.e. 10-50 mM) and DTT (5-33 mM) were
found to produce strong bioluminescence signals in intact cell
clusters, although the results were more variable with glutathione.
5 mM DDT provided the best compromise for enhanced signal strength
and growth of callus after exposure to the mixture for 20 minutes.
The most effective combination found to date is a hybrid, taking
components from both the Promega recipe and the previously used
standard mixture. This combination resulted in a 2-4 fold increase
in signal over the Promega mixture. The recipe for this improved
mix is:
25 mM Tris, PO.sub.4 (pH 7.8), 1% BSA (Fraction 5), 5 mM DTT, 1 mM
EDTA, 0.3 mM ATP, 8 mM MgCl.sub.2, 0.47 mM firefly luciferin, 0.3
mM coenzyme A.
Detection of Luciferase Expression
Once the assay mixture had been optimized, the scintillation
counter and luminometer were evaluated as to their utility for
screening of transformants. Using cell clusters ranging between 100
to 200 um in diameter, both instruments were capable of detecting
luciferase activity in transformants with high expression levels.
The luminometer was more sensitive, being able to detect
transformants with lower expression levels and/or smaller groups of
cells consistently. Plastic covers for the multiwell dishes were
obtained that have a minimal effect on reducing the bioluminescent
signal, and allow this assay to be performed under sterile
conditions.
Reconstruction studies were initiated, placing 10-15 small
transformed tissue pieces (all below 150 .mu.m diameter) into 0.75
ml of non-transformed suspension cells. Initial screening was
encouraging as luciferase activity could be detected even within
this large non-transformed population. This also illustrated the
advantages and disadvantages of the two detection devises; the
scintillation counter is convenient for screening large aliquots of
cells, while the luminometer is more sensitive but more labor
intensive.
To take advantage of the relative merits of both devises, in the
second reconstruction experiment the scintillation counter and then
the luminometer were used for sequential screening. Again, 10-15
transformed cell clusters were mixed into a non-transformed
population (1.25 ml of suspension) and placed on the shaker for 2
hours. The suspension was then pipetted into seven scintillation
vials and assayed for luciferase activity. Positive signals were
recorded for 5/7 samples, and these five were pipetted onto fresh
227 solid medium and allowed to grow for one week. At this time,
two of the samples were aliquoted into multiwell dishes and assayed
for activity using the luminometer. Each of these wells contained
approximately 25 .mu.l of tissue. Six and 7 positive wells were
recorded for these two samples, and the tissue again was
transferred back onto fresh 227 medium.
These results exemplify the power of the luminometer, because the
sample size in each well is small the enrichment is much greater
(this single screen eliminated approximately 95% of the
population). The drawback to this type of screening is the amount
of tissue manipulation and risk of contamination. Despite some
contamination it is extremely encouraging that the enrichment
technique was successful and that the tissue remained healthy
(based on visual assessment and subsequent growth).
Improved Luciferase Expression Vectors
Recent improvements in the luciferase assay mixture increased the
sensitivity enough so that detection of stable transformed sectors
appeared feasible. To further improve the chances of successfully
screening for transformants, expression should also be optimized.
Towards this goal, two new luciferase vectors were constructed to
boost expression levels in maize cells. Both vectors utilize intron
VI from Adh1 (derived from vector pDPG273) fused to firefly
luciferase (obtained from vector pDPG215). These elements were
inserted into either the pDPG282 (4 OCS inverted-35S) or the
pDPG283 (4 OCS-35S) backbone (bar was excised as a BamHI/Nhel
fragment and the intron plus luciferase gene inserted). The 4
OCS-35S promoter has been shown with the uidA gene to give very
high levels of transient expression. When this promoter is fused to
luciferase it was anticipated that it would result in high levels
of expression.
Transient expression levels from each of these vectors was
determined in bombarded E1 suspension culture cells. The two new
vectors were also compared to pDPG215 (35S-intron I-luciferase-Tr7
3') as the standard. At least for transient expression, the 4
OCS-35S promoter was not found to be better than the 35S promoter.
Vector pDPG351 gave significantly higher levels of transient
expression than pDPG350, but not higher than pDPG215.
For independent stable transformants, a wide range of luciferase
expression has been observed in experiments using either pDPG215 or
pDPG315. For both plasmids luciferase expression as measured in
callus using the scintillation counter ranged between 100 and
2.times.10.sup.6 CPM. Luciferase expression has been confirmed in
R.sub.0 plants.
Microspore-derived cell clusters (genotype G238) were bombarded
with the p350 and p351 constructs. This tissue was grown on
non-selective 227 medium, and was screened 2-3 weeks
post-bombardment using the multiwell luminometer. Out of six plates
screened, two wells produced readings potentially above background.
This tissue was transferred to fresh 227. Also, AT824 suspension
samples were bombarded with the p350 and p351. After 3 days on the
filter, the tissue was put back into liquid and screening for
luciferase activity was started 12 days post-bombardment.
EXAMPLE 28
Extension: A Secreted Screenable Marker
Initially, candidates considered as screenable markers have been
genes encoding intracellular proteins that require diffusible
substrates or permeation of cells to perform the assay. An
alternative is a secretable marker. Three general types have been
considered: (i) functional secreted enzymes detectable by assaying
catalytic activity, (ii) small diffusible proteins detectable by
ELISA, such as IL-2, or (iii) secreted markers that remain
sequestered in the cell wall that also contain unique epitopes for
antibody detection.
Candidates for functional secreted markers that could be detected
through catalytic action would include such enzymes as
.beta.-galactosidase and .beta.-glucuronidase. Unfortunately, these
enzymes are modified during the secretion process in a manner which
renders them inactive. For example, GUS enters the endoplasmic
reticulum and is N-glycosylated which blocks enzyme activity
(Iturraga et al., 1989). Recently, the N-linked glycosylation site
was altered by site-directed mutagenesis (Farrell & Beachy,
1990), but no reports on secretion and/or functional activity have
yet followed. In using GUS, it is not clear whether the
colorimetric product would remain localized to the point where
clear demarcation of expressing and non-expressing cells could be
achieved, but this is still a promising marker.
A number of small proteins such as interleukins have been well
characterized in terms of molecular genetics and immunodetection.
However, even if properly targeted across the plasma membrane, the
best candidates are all small enough to diffuse readily through the
cell wall into the extracellular solution. Thus, they could be
detected by ELISA methods, but could not be localized to specific
cells. A variety of mammalian genes are known that would provide a
unique epitope for labeling. However, large mammalian proteins
secreted across the plasma membrane would not be likely to reach
the surface of the wall (and hence be relatively inaccessible),
while small proteins would diffuse into the extracellular
space.
The requirements of a secreted antigen construct were thus
determined to be: encoding a unique epitope sequence that would
provide low background in plant tissue; a promoter-leader sequence
that would impart efficient expression and targeting across the
plasma membrane; and the production of a protein which is bound in
the cell wall and yet accessible to antibodies. The expression of a
modified, but otherwise normally-secreted, cell wall constituent
was considered to be an ideal candidate for a secretable marker.
Extension, HPRG, was the cell wall protein chosen since this
molecule is fairly well characterized in terms of molecular
biology, expression and protein structure, and the maize genomic
HPRG sequence was available (from Dr. Pedro Puigdomenech).
The strategy for visualizing the expression of the introduced
extension gene revolves around introducing a novel epitope into the
secreted protein, which could then be localized using immunological
techniques. Certain preliminary tests need to be performed before
making such a construct. A novel epitope must be identified for
which a high-titer antibody is available; maize extracts should be
reacted with the antibody to ensure there is no non-specific
background labeling; and the feasibility of immunolabeling the cell
wall of living cells should be determined.
The epitope chosen was a 15 amino acid sequence from the pro-region
of murine interleukin-1-.beta., MATVPELNCEMPPSD (SEQ ID NO:1),
which was recognized by polyclonal antibodies. A dot-blot was
performed loading either 0, 10, or 50 ng of a 31 kd recombinant
protein, and testing with either R1682 serum, normal rabbit serum,
Fc-purified R1684, or Fc-purified normal rabbit. With the higher
protein load (50 ng), background was observed in the normal rabbit
and the Fc-purified normal rabbit at the higher antibody
concentrations (i.e. 1:300, and 1:100). No background was observed
in the 10 ng dots at antibody dilutions greater (less concentrated)
than 1:100. For the R1682 serum, protein was detected for both the
10 and 50 ng dots at all antibody dilutions, even down to 1:3000.
The Fc-purified R1684 was approximately 10-fold less sensitive.
This result indicates that the R1682 antibody is very high-titer,
and should be useful as a marker system.
On analyzing the IL-1-.beta. pro sequence in computer gene and
protein data banks, no sequence homology was found in either plants
or fungi. Testing extracts from maize suspension cells and from
cell walls confirmed that no background labeling exists.
Using colloidal gold conjugated secondary antibody followed by
silver enhancement, surface labeling of "living" root tips was
verified. The labeling of the surface with both the primary and
secondary antibodies was performed under physiological conditions
(low concentrations of organic buffers and/or salts). However, in
order to visualize the gold label a silver enhancement process was
then utilized, and this is toxic. The use of a new fluorophore,
phycoerythrin, conjugated to the secondary antibody is also
contemplated. This should eliminate problems with endogenous
background fluorescence and increase resolution.
The necessary oligonucleotides were made and a cloning strategy was
developed for inserting the novel IL-1 sequence into the
carboxyl-end of the extension structural gene and placing this into
a plant expression vector (CaMV 35S promoter, Agrobacterium
tumefaciens transcript 7 3' region).
K. Co-Transformation
Co-transformation may be achieved using a vector containing the
marker and another gene or genes of interest. Alternatively,
different vectors, e.g., plasmids, may contain the different genes
of interest, and the plasmids may be concurrently delivered to the
recipient cells. Using this method, the assumption is made that a
certain percentage of cells in which the marker has been
introduced, have also received the other gene(s) of interest. As
can be seen in the following examples, not all cells selected by
means of the marker, will express the other genes of interest which
had been presented to the cells concurrently. For instance, in
Example 29, successful cotransformation occurred in 17/20
independent transformants (see Table 5), coexpression occurred in
4/20. In some transformants, there was variable expression among
transformed cells.
EXAMPLE 29
Co-Integration and Co-Expression of the Bar Gene and the GUS Gene
to Cell Lines Derived from the SC82 Suspension Culture
Of the bialaphos-resistant isolates selected from a reinitiation of
cryopreserved SC82 cells transformed with separate plasmids (as
described for SC716), nineteen independent transformants were
selected in this experiment (experiment #6, Table 5). The frequency
of cointegration and coexpression in those isolates was similar to
that described for SC716 isolates (Table 5). The pattern of GUS
staining in these transformants varied in a manner similar to that
described for coexpressing SC716 transformants. A transformant,
Y13, which contained intact GUS coding sequence, exhibited varying
levels of GUS activity as shown in FIG. 6. This type of expression
pattern has been described previously in cotransformed BMS cells
(Klein et al., 1989). Variable activity detected in the cells from
a single transformant may be attributed to unequal penetration of
the GUS substrate, or differential expression, methylation, or the
absence of the gene in some cells.
These results show that both the bar gene and the GUS gene are
present in some of the cells bombarded with the two plasmids
containing these genes. Cotransformation has occurred. In the
cotransformation examples described herein and summarized in Table
5, cotransformation frequency of the non-selected gene was 77%;
coexpression frequency was 18%.
L. Regeneration of Plants from Transformed Cells
For use in agriculture, transformation of cells in vitro is only
one step toward commercial utilization of these new methods. Plants
must be regenerated from the transformed cells, and the regenerated
plants must be developed into full plants capable of growing crops
in open fields. For this purpose, fertile corn plants are required.
The invention disclosed herein is the first successful production
of fertile maize plants (e.g., see FIG. 7A) from transformed
cells.
During suspension culture development, small cell aggregates
(10-100 cells) are formed, apparently from larger cell clusters,
giving the culture a dispersed appearance. Upon plating these cells
to solid media, somatic embryo development can be induced, and
these embryos can be matured, germinated and grown into fertile
seed-bearing plants. The characteristics of embryogenicity,
regenerability, and plant fertility are gradually lost as a
function of time in suspension culture. Cryopreservation of
suspension cells arrests development of the culture and prevents
loss of these characteristics during the cryopreservation
period.
EXAMPLE 30
Regeneration of Plants from SC82 and SC716
One efficient regeneration system involves transfer of embryogenic
callus to MS (Murashige & Skoog, 1962) medium containing 0.25
mg/l 2,4-dichlorophenoxyacetic acid and 10.0 mg/l
6-benzyl-aminopurine. Tissue was maintained on this medium for
approximately 2 weeks and subsequently transferred to MS medium
without growth regulators (Shillito et al., 1989). Shoots that
developed after 2-4 weeks on growth regulator-free medium were
transferred to MS medium containing 1 % sucrose and solidified with
2 g/l Gelgro.sup.R in Plant Con.sup.R containers where rooting
occurred.
Another successful regeneration scheme involved transfer of
embryogenic callus to N6 (Chu et al., 1975) medium containing 6%
sucrose and no growth regulators (Armstrong & Green, 1985) for
two weeks followed by transfer to MS medium without growth
regulators as described above. Regeneration was performed at
25.degree. C. under fluorescent lights (250
microeinsteins.multidot.m.sup.-2.multidot.s.sup.-1). After
approximately 2 weeks developing plantlets were transferred to a
Plant Con.RTM. container containing medium 501. When plantlets had
developed 3 leaves and 2-3 roots they were transferred to soil,
hardened off in a growth chamber (85% relative humidity, 600 ppm
CO.sub.2, 250 microeinsteins.multidot.m.sup.-2.multidot.s.sup.-1),
and grown to maturity either in a growth chamber or the
greenhouse.
Regeneration of plants from transformed cells requires careful
attention to details of tissue culture techniques. One of the major
factors is the choice of tissue culture media. There are many media
which will support growth of plant cells in suspension cultures,
but some media give better growth than others at different stages
of development. Moreover, different cell lines respond to specific
media in different ways. A further complication is that treatment
of cells from callus initiation through transformation and
ultimately to the greenhouse as plants, requires a multivariate
approach. A progression consisting of various media types,
representing sequential use of different media, is needed to
optimize the proportion of transformed plants that result from each
cell line. Table 6 illustrates one sequential application of
combinations of tissue culture media to cells at different stages
of development. Successful progress is ascertained by the total
number of plants regenerated.
It can be seen that using the same group of media, cell lines will
vary in their success rates (number of plants) (Table 6). There was
also variation in overall success rate, line AO1-15 yielding the
greatest number of plants overall. (It should be noted, however,
that because tissue was limiting not all combinations of media were
used on all lines, therefore, overall comparisons are limited.)
A preferred embodiment for use on cell lines SC82 and SC716, at
least initially, is the combination shown in the second column
under the regeneration media progression (media 227, 171, 101,
501). Media 227 is a good media for the selective part of the
experiments, for example, to use for growth of callus in the
presence of bialaphos. This media contains the growth regulator
dicamba. NAA and 2,4-D are growth regulators in other media. In
liquid media, these may be encapsulated for controlled release
(Adams, W. et al., in preparation).
Thus, it can be seen from Table 1 that the various media are
modified so as to make them particularly applicable to the
development of the transformed plant at the various stages of the
transformation process. For example, subculture of cells in media
171 after applying the selective agent, yields very small embryos.
Moreover, it is believed that the presence of BAP in the media
facilitates development of shoots. Myo-inositol is believed to be
useful in cell wall synthesis. Shoot elongation and root
development proceeds after transfer to media 101. 101 and 501 do
not contain the growth regulators that are required for earlier
stages of regeneration.
TABLE 6 Plants to Soil From Bombardment of SC716 (Expts 1, 2; Table
6). REGENERATION MEDIA PROGRESSIONS 227b 227b 227b 227b 227b 227b
227b 227b # 227b 201b 52 163 205 227b 201b 205 163 227b 201b PLANTS
227b 171 171 171 171 171 173 173 173 173 177 177 TO Cell Line 101
101 101 101 101 101 101 101 101 101 101 101 SOIL CONTROLS A01C-11 X
4 X X X X 2 X X X X X 6* A01C-01 X 7 X X X X 27 X X X X X 34* TOTAL
X 11 X X X X 29 X X X X X 40* TRANSFORMED A01C-11 X X X 0 0 0 X X 0
0 X X 0 A01C-12 X 2 X 0 0 0 X X 0 0 X X 2 A01C-13 X 5 1 4 0 0 1 1 1
1 X X 14* A01C-14 X 2 X 0 0 0 X X 1 0 X X 3* A01C-15 X 28 0 12 7 1
23 13 0 0 0 0 84* A01C-17 X 7 0 0 0 0 17 0 0 0 0 0 24 A01C-18 X 12
0 0 X 0 21 10 0 X 2 0 45* A01C-19 X 0 X X 0 X 0 X X 0 X 0 0 A01C-20
X 10 X 0 0 X 0 X X 0 X 0 10* A01C-21 X 0 X X X X 0 X X X X 0 0
A01C-24 2 4 0 0 0 0 6 5 0 0 0 0 17* A01C-25 X 9 X X 0 0 1 X 0 0 X X
10 A01C-27 X 0 X X X X 10 X X X X 0 10* TOTAL 2 79 1 16 7 1 79 29 2
1 2 0 219* COMBINED CONTROLS X 11 X X X X 29 X X X X X 40*
TRANSFORMED 2 79 1 16 7 1 79 29 2 1 2 0 219* TOTAL 2 90 1 16 7 1
108 29 2 1 2 0 259* X = Regeneration not attempted by this route.
*= More plants could bave been taken to soil. 201b = 201 with 1
mg/1 bialophos. 227b = 227 with 1 mg/1 bialophos.
Transfer of regenerating plants is preferably completed in an
agar-solidified media adapted from a nutrient solution developed by
Clark (1982), media 501. The composition of this media facilitates
the hardening of the developing plants so that they can be
transferred to the greenhouse for final growth as a plant. The salt
concentration of this media is significantly different from that of
the three media used in the earlier stages, forcing the plant to
develop its own metabolic pathways. These steps toward independent
growth are required before plants can be transferred from tissue
culture vessels (e.g. petri dishes, plant cans) to the
greenhouse.
Approximately 50% of transformed callus lines derived from the
initial SC82 and SC716 experiments were regenerable by the routes
tested. Transgenic plants were regenerated from four of seven
independent SC82 transformants and ten of twenty independent SC716
transformants.
Regeneration of thirteen independently, transformed cell lines and
two control lines of SC716 was pursued. Regeneration was successful
from ten of thirteen transformants. Although a total of 458
plantlets were regenerated, due to time and space constraints only
219 transformed plants (representing approximately 48% of the total
number of regenerants) were transferred to a soilless mix (see
below). Approximately 185 plants survived. Twelve regeneration
protocols were investigated and the number of plants regenerated
from each route has been quantified (Table 6). There appeared to be
no significant advantage to maturing the tissues on 201, 52, 163,
or 205 (see Table 1 for media codes) prior to transfer to medium
171 or 173. The majority of the plants were generated by
subculturing embryogenic callus directly from 227 to either 171 or
173. These plantlets developed roots without addition of exogenous
auxins, and plantlets were then transferred to a soilless mix, as
was necessary for many of the transformants regenerated from
SC82.
The soilless mix employed comprised Pro Mix, Micromax, Osmocote
14-14-14 and vermiculite. Pro Mix is a commercial product used to
increase fertility and porosity as well as reduce the weight of the
mixture. This is the bulk material in the mixture. Osmocote is
another commercial product that is a slow release fertilizer with a
nitrogen-phosphorus-potassium ratio of 14:14:14. Micromax is
another commercial fertilizer that contains all of the essential
micronutrients. The ratio used to prepare the soilless mix was: 3
bales (3 ft.sup.3 each) Pro Mix; 10 gallons (vol.) vermiculite; 7
pounds Osmocote; 46 ml Micromax. The soilless mix may be
supplemented with one or two applications of soluble Fe to reduce
interveinal chlorosis during early seedling and plant growth.
Regeneration of transformed SC82 selected cell lines yielded 76
plants transferred to the soilless mix, and 73 survived. The plants
were regenerated from six bialaphos-resistant isolates,
representing four of seven clonally independent transformants.
Eighteen protocols were used successfully to regenerate the seventy
six plants (Table 7). Differences in morphology between cell lines
deemed some protocols more suitable than others for
regeneration.
TABLE 7 EFFECTS OF PROGRESSION OF MEDIA ON THE NUMBER OF PLANTS
REGENERATED (SC82)* 227B 227B 227B 227B 227B 227B 227B 227B 227B
227B 227B 227B 201B 227B 201B 201B 201B 201B 227B 227B 227B 227A
227A 227A 171 52 52 52 171 201B 227B 205 227B 205 1 52 142 173 171
205 209 173 173 173 173 171 173 173 178 171 177 177 178 171 CELL
110 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101
101 # OF LINE 501 501 501 501 501 501 501 501 501 501 501 501 501
501 501 501 501 501 PLANTS B3-14-4 1 X 14 X X X 1 1 X 2 X X 5 X 5 X
X X 29 B3-14-9 X X 1 1 X 4 1 X X X X X X 1 X 1 X X 9 B3-14-7 X X X
X X X X X X X 6 2 X X X X X 1 9 B3-14-6 X X X X 1 X X X X X X X X X
X X X X 1 B3-14-3 X X X X X X X X X X X X X X X X X X 0 B3-14-2 X X
X X X X X X X X X X X X X X X X 0 B3-14-1 X X X X X X X X X X X X X
X X X X X 0 B3-14-5 X X X X X X X X X X X X X X X X X X 0 B3-13-5 X
X X X X X X X X X X X X X X X X X 0 B3-13-2 X 1 13 X X X 3 2 2 X X
X X X 1 X X X 22 B3-13-1 X 3 X 1 X X X X 1 X X X X X X X 1 X 6
TOTAL 1 4 28 2 1 4 5 3 3 2 6 2 5 1 6 1 1 1 76 *= See table 1 for
media codes. X = This media progression was either attempted and
unsuccessful or not attempted. 227A = 227 with 10.sup.-7 M ABA.
227B = 227 with 1 mg/1 bialaphos.
Prior to regeneration, the callus was transferred to either a) an
N6-based medium containing either dicamba or 2,4-D or b) an
MS-based medium containing 2,4-D. These steps allowed further
embryoid development prior to maturation. Most of the maturation
media contained high BAP levels (5-10 mg/l) to enhance shoot
development and cause proliferation. An MS-based medium with low
2,4-D (0.25 mg/l) and high BAP (10 mg/l), as described by Shillito
et al., 1989, was found to be quite effective-for regeneration.
Likewise, an MS-based medium containing 1 .mu.m NAA, 1 .mu.m IAA, 2
.mu.m 2-IP, and 5 mg/l BAP (modified from Conger et al., 1987) also
promoted plant regeneration of these transformants. After plantlets
recovered by any of the regenerative protocols had grown to five
cm, they were transferred to a nutrient solution described by
Clark, 1982, supplemented with 2% sucrose and solidified with
Gelgro. Plantlets which were slow to develop roots were treated
with 3 .mu.l droplets of 0.3% IBA at the base of the shoot to
stimulate rooting. Plants with well developed root systems were
transferred to a soilless mix and grown in controlled environmental
chambers from 5-10 days, prior to transfer to the greenhouse.
EXAMPLE 31
Regeneration of AT824 Transformants
Transformants were produced as described in examples 19 and 20. For
regeneration tissue was first transferred to solid medium 223 and
incubated for two weeks. Transformants may be initially subcultured
on any solid culture that supports callus growth, e.g., 223, 425,
409 and so forth. Subsequently transformants were subcultured one
to three times, but usually twice on 189 medium (first passage in
the dark and second passage in low light) and once or twice on 101
medium in petri dishes before being transferred to 607 medium in
Plant Cons.COPYRGT.. Variations in the regeneration protocol are
normal based on the progress of plant regeneration. Hence some of
the transformants were first subcultured once on 425 medium, twice
on 189 medium, once or twice on 101 medium followed by transfer to
501 medium in Plant Cons.COPYRGT.. As shoots developed on 101
medium, the light intensity was increased by slowly adjusting the
distance of the plates from the light source located overhead. All
subculture intervals were for about 2 weeks at 24.degree. C.
Transformants that developed 3 shoots and 2-3 roots were
transferred to soil.
Plantlets in soil were incubated in an illuminated growth chamber
and conditions were slowly adjusted to adapt or condition the
plantlets to the drier and more illuminated conditions of the
greenhouse. After adaptation/conditioning in the growth chamber,
plants were transplanted individually to 5 gallon pots of soil in
the greenhouse.
M. Assays for Integration of Exogenous DNA and Expression of DNA in
R.sub.0 R.sub.1 Plants
Studies were undertaken to determine the expression of the
transformed gene(s) in transgenic R.sub.0 and R.sub.1 plants.
Functional activity of PAT was assessed by localized application of
a commercial herbicide formulation containing PPT to leaves of SC82
R.sub.0 and R.sub.1 plants. No necrosis was observed on leaves of
R.sub.0 plants containing either high levels (E2/E5), or low levels
(E3/E4) of PAT. Herbicide-treated E3/E4/E6 and control leaves are
shown in FIG. 8A. Herbicide was also applied to leaves of E2/E5
progeny segregating for bar. As demonstrated in FIG. 8B, leaves of
R.sub.1 plants expressing bar exhibited no necrosis six days after
application of the herbicide while R.sub.1 plants without bar
developed necrotic lesions. No necrosis was observed on transformed
leaves up to 30 days post-application.
Twenty-one R.sub.0 plants, representing each of the four
regenerable transformed SC82 callus lines, were also analyzed for
expression of the bar gene product, PAT, by thin-layer
chromatographic techniques. Protein extracts from the leaves of the
plants were tested. PAT activity of one plant regenerated from each
callus line is shown in FIG. 9.
All 21 plants tested contained PAT activity. Furthermore, activity
levels were comparable to levels in the callus lines from which the
plants were regenerated. The nontransformed plant showed no PAT
activity (no band is in the expected position for acetylated PPT in
the autoradiograph from the PAT chromatogram). A band appears in
the BMS lane that is not in lanes containing protein extracts from
the plant leaves. This extra band was believed to be an
artifact.
As another method of confirming that genes had been delivered to
cells and integrated, genomic (chromosomal) DNA was isolated from a
nontransformed plant, the four regenerable callus lines and from
two R.sub.0 plants derived from each callus line. FIG. 10
illustrates results of gel blot analysis of genomic DNA from the
four transformed calli (C) and the R.sub.0 plants derived from
them. The transformed callus and all plants regenerated from
transformed callus contained sequences that hybridized to the bar
probe, indicating the presence of DNA sequences that were
complementary to bar. Furthermore, in all instances, hybridization
patterns observed in plant DNA were identical in pattern and
intensity to the hybridization profiles of the corresponding callus
DNA.
DNA from E3/E4/E6 callus and the desired R.sub.0 plants contained
approximately twenty intact copies of the 1.9 kb bar expression
unit (Cauliflower Mosaic Virus 35S promoter-bar-Agrobacterium
transcript 7 3'-end) as well as numerous other bar-hybridizing
fragments. E11 callus and plant DNA contained 1-2 copies of the
intact expression unit and 5-6 additional non-intact hybridizing
fragments. E10 callus and plants contained 1-2 copies of the intact
bar expression unit. E2/E5 DNA contained a single fragment of
approximately 3 kb that hybridized to the probe. To confirm that
the hybridizing sequence observed in all plants were integrated
into the chromosomal DNA, undigested genomic DNA from one plant
derived from each independent transformant was analyzed by DNA gel
blot hybridization. Hybridization to bar was observed only in high
molecular weight DNA providing evidence for the integration of bar
into the maize genome.
Plants were regenerated from the coexpressing callus line, Y13,
shown in FIG. 6. Plants regenerated from Y13 (experiment #6, Table
5) were assayed for GUS activity and histochemically stained leaf
tissue from one plant is shown in FIGS. 8C, D, E. Numerous cell
types including epidermal, guard, mesophyll and bundle sheath cells
stained positive for GUS activity. Staining intensity was greatest
in the vascular bundles. Although all leaf samples from the
regenerated plants tested (5/5) expressed the nonselected gene,
some non-expressing leaf sectors were also observed. Leaf tissue
extracts from three Y13 and three control plants were also assayed
for GUS activity by fluorometric analysis (Jefferson, 1987).
Activity detected in two opposing leaves from each of three Y13
plants tested was at least 100-fold higher than that in control
leaves.
EXAMPLE 32
General Methods for Assays
A method to detect the presence of phosphinothricin acetyl
transferase (PAT) activity is to use an in vitro enzyme reaction
followed by thin layer chromatography.
An example of such detection is shown in FIG. 9 wherein various
protein extracts prepared from homogenates of potentially
transformed cells, and from control cells that have neither been
transformed nor exposed to bialaphos selection, are assayed by
incubation with PPT and .sup.14 C-Acetyl Coenzyme A followed by
thin layer chromatography. 25 .mu.g of protein extract were loaded
per lane. The source in lanes E1-E11 were SC82 transformants; B13
is a BMS (Black Mexican Sweet corn nonembryogenic) bar
transformant. E0 is a nonselected, nontransformed control.
As can be seen at the position indicated by the arrow (the position
expected for the mobility of .sup.14 C-N-AcPPT), all lanes except
the nontransformed control exhibit PAT activity by the formation of
a compound with the appropriate mobility expected for .sup.14
C-N-Acetyl PPT. Variation in activity levels among the
transformants was approximately 10 fold, as demonstrated by the
relative intensity of the bands. The results of this assay provide
confirmation of the expression of the bar gene which codes for PAT.
For analysis of PAT activity in plant tissue, 100-200 mg of leaf
tissue was extracted in sintered glass homogenizers and assayed as
described previously.
GUS activity was assessed histochemically as described using
5-bromo-4-chloro-3-indolyl glucuronide (Jefferson, 1987); tissue
was scored for blue cells 18-24 h after addition of substrate.
Fluorometric analysis was performed as described by Jefferson
(1987) using 4-methyl umbelliferyl glucuronide.
DNA analysis was performed as follows. Genomic DNA was isolated
using a procedure modified from Shure, et al., 1983. Approximately
1 gm callus tissue was ground to a fine powder in liquid N2 using a
mortar and pestle. Powdered tissue was mixed thoroughly with 4 ml
extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0,
0.01 M EDTA, 1% sarcosine). Tissue/buffer homogenate was extracted
with 4 ml phenol/ chloroform. The aqueous phase was separated by
centrifugation, passed through Miracloth, and precipitated twice
using 1/10 volume of 4.4 M ammonium acetate, pH 5.2 and an equal
volume of isopropanol. The precipitate was washed with 70% ethanol
and resuspended in 200-500 .mu.l TE (0.01 M Tris-HCl, 0.001 M EDTA,
pH 8.0). Plant tissue may also be employed for the isolation of DNA
using the foregoing procedure.
The presence of a gene in a transformed cell may be detected
through the use of polymerase chain reaction (PCR). Using this
technique specific fragments of DNA can be amplified and detected
following agarose gel electrophoresis. For example the bar gene may
be detected using PCR. Two hundred to 1000 ng genomic DNA is added
to a reaction mix containing 10 mM Tris-HCl pH 8.3, 1.5 mM
MgCl.sub.2, 50 mM KCl, 0.1 mg/ml gelatin, 200 uM each dATP, dCTP,
dGTP, dTTP, 0.5 uM each forward and reverse DNA primers, 20%
glycerol, and 2.5 units Taq DNA polymerase. The forward primer (SEQ
ID NO:21) is CATCGAGACAAGCACGGTCAACTTC. The reverse primer (SEQ ID
NO:22) is AAGTCCCTGGAGGCACAGGGCTTCAAGA. PCR amplification of bar
using these primers requires the presence of glycerol, but this
component is not needed for most other applications. The reaction
is run in a thermal cycling machine as follows: 3 minutes at 94 C.,
39 repeats of the cycle 1 minute at 94 C., 1 minute at 50 C., 30
seconds at 72 C., followed by 5 minutes at 72 C. Twenty ul of each
reaction mix is run on a 3.5% NuSieve gel in TBE buffer (90 mM
Tris-borate, 2 mM EDTA) at 50V for two to four hours. Using these
primers a 279 base pair fragment of the bar gene is amplified.
For Southern blot analysis genomic DNA was digested with a 3-fold
excess of restriction enzymes, electrophoresed through 0.8% agarose
(FMC), and transferred (Southern, 1975) to Nytran (Schleicher and
Schuell) using 10.times.SCP (20.times.SCP: 2 M NaCl, 0.6 M disodium
phosphate, 0.02 M disodium EDTA). Filters were prehybridized at
65.degree. C. in 6.times.SCP, 10% dextran sulfate, 2% sarcosine,
and 500 .mu.g/ml heparin (Chomet et al., 1987) for 15 min. Filters
were hybridized overnight at 65.degree. C. in 6.times.SCP
containing 100 .mu.g/ml denatured salmon sperm DNA and .sup.32
P-labeled probe. The 0.6 kb SmaI fragment from pDPG165 and the 1.8
kb BamHI/EcoRI fragment from pCEV5 were used in random priming
reactions (Feinberg & Vogelstein, 1983; Boehringer-Mannheim) to
generate labeled probes for detecting sequences encoding PAT or
GUS, respectively. Filters were washed in 2.times.SCP, 1% SDS at
65.degree. C. for 30 min. and visualized by autoradiography using
Kodak XAR5 film. Prior to rehybridization with a second probe, the
filters were boiled for 10 min. in distilled H.sub.2 O to remove
the first probe and then prehybridized as described above.
N. Fertility of Transgenic Plants
To recover progeny the regenerated, genetically transformed maize
plants (designated R.sub.0), were backcrossed with pollen collected
from nontransformed plants derived from seeds. Alternatively pollen
was collected from R.sub.0 plants and used to pollinate
nontransformed plants. Progeny (designated R.sub.1) that contained
and expressed bar were recovered from crosses in which the
transformant was used as a male or female parent.
An important aspect of this invention is the production for the
first time of fertile, genetically transformed maize plants
(R.sub.0) and progeny (R.sub.1). These were regenerated from
embryogenic cells that were transformed. R.sub.1 plants are those
resulting from backcrossing of R.sub.0 plants.
Pollination of transgenic R.sub.0 ears with non-transformed B73
pollen resulted in kernel development. In addition, kernels
developed from pistillate flowers on male inflorescences that were
pollinated with non-transformed B73 pollen. Kernels on transformed
R.sub.0 plants from SC82 developed normally for approximately 10-14
days post-pollination but after this period the kernels ceased
development and often collapsed. Most plants exhibited premature
senescence at this time. A total of 153 kernels developed
sporadically on numerous plants (see Table 8): 8 of 37 E2/E5
plants, 2 of 22 E10 plants, and 3 of 6 E11 plants. Viable progeny
were recovered by embryo rescue from 11 E2/E5 plants and one E10
plant.
SC716 R.sub.0 plants were also backcrossed with seed-derived B73
plants. To date, from the 35 mature SC716 R.sub.0 plants nine
plants (representing four independent callus lines) yielded 51
kernels, 31 of which produced vigorous R.sub.1 seedlings (Table 8).
Most kernels that developed on SC716 plants did not require embryo
rescue. Kernels often developed for 30-40 days on the plant and
some were germinated in soil. The remaining seed was germinated on
MS-based medium to monitor germination and transferred to soil
after a few days. In addition to the improved kernel development
observed on SC716 R.sub.0 plants relative to SC82 R.sub.0 plants,
pollen dehisced from anthers of several SC716 plants and some of
this pollen germinated in vitro (Pfahler, 1967). Transmission of
the foreign gene has occurred both through SC716 R.sub.1 ears and
using SC716 R.sub.1 -derived pollen on non-transformed ears.
TABLE 8 Regenerated Plants (R.sub.o) and Progeny (R.sub.1) # of
Independent # of bar Regenerable # of # # of R.sub.o # of # of Exp.
Culture Transformants Transformed R.sub.o Reaching Producing
Kernels R.sub.1 # Bombarded Recovered Callus Lines Plants Maturity
Kernels Recovered Plants 1, 2 SC82 7 4 76 73 23 153 40 4, 5 SC716
20 10 219 (35) (9) (51) (31) 3 SC94 8 2.sup.a 11.sup.a (0) (0) (0)
(0) 6 SC82 19 4.sup.a 23.sup.a (0) (0) (0) (0) .sup.a Regeneration
in progress. ( ) Experiment still in progress, data still being
collected.
To date fertile plants from 267 transgenic lines have produced over
59, 577 seed (about 227 R.sub.1 seed per transgenic line). Table 2
indicates that these plants were derived from 11 different cell
lines. In addition both male and female fertility has been observed
in many of these cells lines. Kernels routinely mature on plants
for which the transformant is either the male or the female parent.
Embryo rescue is only necessary under unusual circumstances.
Pollen obtained from transformed R.sub.1 plants has been
successfully employed to pollinate B73 ears and a large number of
seeds have been recovered (see FIG. 7C). Moreover, a transformed
ear from an R.sub.1 plant crossed with pollen from a
non-transformed inbred plant is shown in FIG. 7D. The fertility
characteristics of the R.sub.1 generation has been confirmed both
from a standpoint of the pollen's ability to fertilize
non-transformed ears, and the ability of R.sub.1 ears to be
fertilized by pollen from non-transformed plants. Fertility of
transgenic plants has been maintained for at least 12
generations.
By providing fertile, transgenic offspring, the practice of the
invention allows one to subsequently, through a series of breeding
manipulations, move a selected gene from one corn line into an
entirely different corn line without the need for further
recombinant manipulation. Movement of genes between corn lines is a
basic tenet of the corn breeding industry, involving simply
backcrossing the corn line having the desired gene (trait).
Introduced transgenes are valuable in that they behave genetically
as any other corn gene and can be manipulated by breeding
techniques in a manner identical to any other corn gene. Exemplary
procedures of this nature have been successfully carried out by the
inventors. In these backcrossing studies, the gene for resistance
to the herbicide Basta.RTM., bar, has been moved from two
transformants derived from cell line SC716 and one transformant
derived from cell line SC82 into 18 elite inbred lines by
backcrossing. It is possible from these 18 inbreds to make a large
number of hybrids of commercial importance. Eleven of the possible
hybrids have been made and are being field tested for yield and
other agronomic characteristics and herbicide tolerance. Additional
backcrossing to a further 68 elite inbred lines is underway.
EXAMPLE 33
Analysis of Progeny (R.sub.1) of Transformed R.sub.0 Plants for PAT
and Bar
A total of 40 progeny of E2/E5 R.sub.0 plants were analyzed for PAT
activity, ten of which are shown in FIG. 11A. Of 36 progeny which
were assayed, 18 had PAT activity. Genomic DNA from the same ten
progeny analyzed for PAT activity was analyzed by DNA gel blot
hybridization for the presence of bar as shown in FIG. 11B. The six
progeny tested that expressed PAT contained a single copy of bar
identical in mobility to that detected in callus and R.sub.0
plants; the four PAT-negative progeny tested did not contain
bar-hybridizing sequences. In one series of assays, the presence of
the bar gene product in 18 of 36 progeny indicates a 1:1
segregation of the single copy of bar found in E2/E5 R.sub.0 plants
and is consistent with inheritance of PAT expression as a single
dominant trait. A dominant pattern of inheritance would indicate
the presence in the plant of at least one copy of the gene coding
for PAT. The single progeny recovered from an E10 R.sub.0 plant
tested positive for PAT activity.
It was determined that the methods disclosed in this invention
resulted in transformed R.sub.0 and R.sub.1 plants that produced
functionally active PAT. This was determined by applying Basta
(PPT) to the leaves of plants and determining whether necrosis
(tissue destruction) resulted from this application. If
functionally active PAT is produced by the plants, the leaf tissue
is protected from necrosis. No necrosis was observed on R.sub.0
plants expressing high levels of PAT (E2/E5) or on plants
expressing low levels (E3/E4/E6) (FIG. 8A).
Herbicide was also applied to leaves of R.sub.1 progeny segregating
for bar. In these studies, no necrosis was observed on R.sub.1
plants containing and expressing bar, however, necrosis was
observed on those R.sub.1 plants lacking the bar gene. This is
shown in FIG. 8B.
Segregation of bar did not correlate with the variability in
phenotypic characteristics of R.sub.1 plants such as plant height
and tassel morphology. In FIG. 5B, the plant on the right contains
bar, the plant on the left does not. In addition, most plants were
more vigorous than the R.sub.0 plants.
Of the 23 R.sub.1 seedlings recovered in this experiment from the
SC716 transformants, ten of 16 had PAT activity. PAT activity was
detected in four of ten progeny from R.sub.0 plants representing
callus line R18 and six of six progeny from R.sub.0 plants
representing callus line R9.
O. Embryo Rescue
In cases where embryo rescue was required, developing embryos were
excised from surface disinfected kernels 10-20 days
post-pollination and cultured on medium containing MS salts, 2%
sucrose and 5.5 g/l Seakem agarose. Large embryos (>3 mm) were
germinated directly on the medium described above. Smaller embryos
were cultured for approximately 1 week on the above medium
containing 10.sup.-5 M abscisic acid and transferred to growth
regulator-free medium for germination. Embryos that became
bacterially contaminated; these embryos were transferred to medium
containing 300 .mu.g/ml cefoxitin. Developing plants were
subsequently handled as described for regeneration of R.sub.0
plants.
EXAMPLE 34
Embryo Rescue
Viable progeny, recovered from seven SC82 E2/E5 plants and one SC82
E10 plant, were sustained by embryo rescue. This method consisted
of excising embryos from kernels that developed on R.sub.0 plants.
Embryos ranged in size from about 0.5 to 4 mm in length. Small
embryos were cultured on maturation medium containing abscisic acid
while larger embryos were cultured directly on germination medium.
Two of the approximately forty viable progeny recovered from SC82
R.sub.0 plants by embryo rescue are shown in FIG. 7B.
P. Phenotype of Transgenic Plants
Most of the R.sub.0 plants regenerated from SC82 transformants
exhibited an A188.times.B73 hybrid phenotype. Plants were similar
in height to seed derived A188 plants (3-5 feet) but had B73 traits
such as anthocyanin accumulation in stalks and prop roots, and the
presence of upright leaves. Many plants, regardless of the callus
line from which they were regenerated, exhibited phenotypic
abnormalities including leaf splitting, forked leaves, multiple
ears per node, and coarse silks. Although many of the phenotypic
characteristics were common to all R.sub.0 plants, some
characteristics were unique to plants regenerated from specific
callus lines. Such characteristics were exhibited regardless of
regeneration route and the time spent in culture during
regeneration.
Nontransformed control plants were not regenerated from this
culture and, therefore, cannot be compared phenotypically.
Pistillate flowers developed on tassels of one E11 (1/6), several
E10 (3/22) and almost one-third of the E2/E5 (12/37) plants with a
range of three to approximately twenty ovules per tassel. Primary
and secondary ears developed frequently on most E2/E5, E10, and E11
plants; a mature E2/E5 plant is shown in FIG. 7A. Anthers rarely
extruded from the tassels of plants regenerated from SC82
transformants and the limited number of anthers which were extruded
did not dehisce pollen. Some phenotypic characteristics observed
were unique to plants regenerated from a specific callus line such
as the lack of ears on E3/E4/E6 plants and a "grassy" phenotype (up
to 21 long narrow leaves) exhibited by all E11 plants.
All SC82 plants senesced prematurely; leaf necrosis began
approximately two weeks after anthesis. The R.sub.0 plants
regenerated from SC82 transformed cell lines have tended to senesce
prematurely; typically before the developing kernels were mature.
This has necessitated the use of embryo rescue to recover progeny
(R.sub.1 generation). Segregation of bar in the R.sub.1 generation
does not correlate with the variability in phenotypic
characteristics of R.sub.1 plants such as plant height and tassel
morphology. In FIG. 7B, the plant on the right contains bar, the
plant on the left does not. In addition, most of the R.sub.1 plants
are more vigorous than the R.sub.0 plants. Transformed progeny (R1)
have produced kernels and progeny testing has now been advanced to
the R.sub.12 generation.
Of 219 plants regenerated from 10 independent SC716 transformants,
approximately 35 reached maturity (Table 8). The SC716 plants did
not exhibit the phenotypic differences which characterized the
plants regenerated from the individual callus lines of SC82. These
plants were more uniform and abnormalities less frequent. The
phenotype of these plants closely resembled that of control plants
regenerated from a SC716 cryopreserved culture which was not
bombarded. Plant height ranged from three to six feet with the
majority of the plants between five and six feet. Most mature
plants produced large, multi-branched tassels and primary and
secondary ears. Pistillate flowers also developed on tassels of
several SC716 plants. Although anther extrusion occurred at
approximately the same low frequency as in the SC82 plants, a small
amount of pollen dehisced from some extruded anthers. For most of
the SC716 plants that reached maturity, senescence did not commence
until at least 30 days after anthesis.
The improved characteristics of SC716 plants over SC82 plants
indicate that differences between the suspension cultures may be
responsible. This observation has been supported by further
experiments in which AT824 plants have been regenerated. These
plants are normal in appearance. Plants produce normal tassels and
shed viable pollen. In addition plants do not prematurely senesce
and seed will mature on the plant. Many plants derived from this
cell line and the lines ABT4 and Hi-II are indistinguishable from
nontransformed plants.
I. Transformation with Genes for Desirable Traits
One of the distinct advantages provided by the present invention is
the ability to transform monocot plants, such as maize, with a gene
or genes which imparts a desirable trait to the resultant
transgenic plants. These traits include, for example, resistance to
insects, herbicides, drought, etc., and the improvement of
characteristics such as appearance, yield, nutritional quality, and
the like. Certain such genes which are highly desirable in monocot
transformation have been discussed as selectable markers, for
example, bar and EPSPS. These genes encode proteins which confer
herbicide resistance on the plant. Other particularly preferred
transgenes include those that have insecticidal activities, such as
toxins, proteinase inhibitors and lectins, and those genes that
alter the nutritional quality of the grain. The following examples
illustrate the use of the present invention in generating
advantageous transgenic plants. Table 9 lists all of the genes
successfully introduced into maize by the inventors and summarizes
the status of analysis for the presence of the introduced DNA and
expression. The Table indicates that stable transformants have been
recovered containing all genes attempted. Expression has been
detected from all structural genes listed in at least one
transformed cell line in studies that have progressed to this
stage. Detection of expression is dependent on the promoter and
enhancers used to drive expression of the structural gene, the
structural gene itself, and the limits of the detection system. At
this point in time fertile plants containing the uidA, bar, Bt,
aroA, dapA, 10 kD zein storage protein and hygromycin resistance
genes have been recovered from transformants. Expression of the bar
gene has been detected in progeny from all transformants examined
(19/19). Expression of the uidA gene has been detected in the
progeny of one out of five transformants assayed.
The protocols employed for preparing the transgenic plants
described in the foregoing Table were as described above. The
preparation of the various vectors, etc., was accomplished through
the application of molecular biology techniques as described above
and/or using routine laboratory procedures. The numeral
designations under "Protocol" represent the following:
1. Tissue (suspension) was plated on filters, bombarded and then
filters were transferred to culture medium. After 2-7 days, the
filters were transferred to selective medium. Approximately 3 weeks
after bombardment, tissue was picked from filters as separate
callus clumps onto fresh selective medium.
2. As in 1. above, except after bombardment the suspension was put
back into liquid--subjected to liquid selection for 7-14 days and
then pipetted at a low density onto fresh selection plates.
3. Callus was bombarded while sitting directly on medium or on
filters. Cells were transferred to selective medium 1-14 days after
particle bombardment. Tissue was transferred on filters 1-3 times
at 2 weeks intervals to fresh selective medium. Callus was then
briefly put into liquid to disperse the tissue onto selective
plates at a low density.
4. Callus bombardment. The tissue was transferred onto selective
plates one to seven days after DNA introduction. Tissue was
subcultured as small units of callus on selective plates until
transformants were identified.
TABLE 9 Gene in Callus Gene in Ro Ro Plant Gene in Progeny Plant
Expression Cassette Protocol Callus Expression Plant Expression
Progeny Plant Expression uidA (GUS, reporter 1, 2, 3, 4 + + + + + +
gene) bar (bialaphos 1, 2, 3, 4 + + + + + + resistance, selectable
marker) lux (luciferase reporter, 2 + + + + In progress gene) hyg 4
+ + + + + + (hygromycin resistance, selectable marker) 35S-adh-aroA
2 + + + + + + (Gyphosate tolerance) a-tubulin-aroA 2 + + + + In
progress (Glyphosate tolerance) 2xhis-aroA (Glyphosate 2 + - ND ND
In progress tolerance) 35Shis-aroA (Glyphosate 2 + - ND ND In
progress tolerance) R,C1 (anthocyarin 1 + + pigment synthesis)
35S-IaB6 (Bt) 2 + ND + ND In progress 35S-HD73 4 + - + - + ND (Bt)
35S-1800b 2, 4 + - + + + + (Bt) 2730CS-AdhVI-1800b 2 + ND + + In
progress (Bt) 35S-Adh1-1800b (Bt) 2, 4 + ND + In progress
35S-MZTP-1800b (Bt) 2, 4 + In progress Adh1-adh1-1800b (Bt) 4 + + +
- Completed potato pinII (proteinase 2 + + + ND In progress
inhibitor confers insect resistance) tomato pinII (proteinase 2 +
ND + ND In progress inhibitor confers insect resistance) 35S-dapA
(altered lysine 3, 4 + + In progress production) Z27-dapA (altered
lysine 3, 4 + NA ND ND In progress production in seed) Z27Z10
(altered storage 3, 4 + NA ND NA + + protein in seed) Z4Z10
(altered storage 3, 4 + NA ND NA In progress protein in seed)
Z10Z10 (altered storage 3, 4 + NA ND NA In progress protein in
seed) 10Z4ENT (altered 3, 4 + NA ND NA In progress storage protein
in seed) 1020P (altered storage 3, 4 + NA ND NA In progress protein
in seed) 535S-adh1-mtID 2 + In progress (enhanced stress
resistance) deh (resistance to 4 ND + In Progress dalapon
herbicide) NA indicates not applicable, e.g., gene does not express
in that tissue type. ND indicates not done, but tissue was
available. Blank space indicates experiment has not progressed to
this point or was terminated before this point. The symbol "+"
indicates that expression of the gene was detected by RNA, protein,
enzyme assay or biological assay.
1. Herbicide Resistance
EXAMPLE 35
Glyphosate resistance--Transformants Containing the Salmonella
typhimurium aroA Gene
This example describes certain methods relating to the use of an
aroA gene construct in maize transformation. The herbicide
glyphosate acts by inhibiting the enzyme EPSP Synthase. EPSP
Synthase is presents in plants and bacteria and the gene used in
this example, aroA, was isolated from Salmonella typhimurium.
Certain mutated versions of the aroA gene are known which encode
variant EPSP Synthase enzymes which are insensitive to glyphosate
(Comai et al., 1983).
Transformation studies were conducted employing pDPG238, a tandem
bar-aroA construct containing a Calgene aroA plant expression
cassette. Transformation using the SC716 culture yielded four
clones that produced forty-five plants in the greenhouse. Results
from PCR analysis demonstrated that three of these four clones
contained the aroA gene and one line also expressed the gene at the
limit of detection by Western analysis. A plant from this clone was
pollinated, two embryos rescued and two R.sub.1 plants grown
(designated TGB-4 and TGB-5). Both R.sub.1 plants contained the
aroA gene as determined by PCR analysis and one plant (TGB-5)
expressed the gene as determined by Western analysis. Progeny of
the aroA expressing plant (TGB-5) were included in field tests.
An experiment was conducted to examine the level of resistance to
glyphosate (Roundup.RTM.) in crosses of the aroA expressing line
TGB-5 produced using pDPG238. This line contains both the bar and
aroA genes and hence is expected to confer resistance to both
Basta.RTM. and Roundup.RTM.. A single progeny of TGB-5, designated
TGB-56, was crossed to four elite inbreds, representing four
different heterotic groups. The progeny were grown and
self-pollinated to increase seed, and the resultant seeds were
planted in two experiments. The first experiment was sprayed with
1.5 lb/A Basta.RTM. to confirm Mendlian segregation of the
introduced DNA (Table 10). The remaining plants were divided into
four blocks and sprayed with application rates of Roundup.RTM. of 2
oz/A, 4 oz/A, 8 oz/A, and 16 oz/A. All plants were killed in the 8
oz and 16 oz treatments (normal field application rates for weed
control). At 4 oz/A a portion of the transformed plants were killed
and a portion were stunted in growth. The ratio of dead plants to
slow growing plants was not significantly different from the
expected 3:1 ratio in progeny from three of the four self
pollinations (Table 11), indicating that there was a low level of
expression of the aroA gene providing partial resistance to
herbicide application.
TABLE 10 Segregation of Basta .RTM. resistance. Resistant
Susceptible (CD .times. TGB-56) 128 56 x.sup.2 = 1.22 (AW .times.
TGB-56) 129 52 x.sup.2 = 1.10 (CN .times. TGB-56) 136 48 x.sup.2 =
.075 (AF .times. TGB-56) 107 44 x.sup.2 = 1.17
TABLE 10 Segregation of Basta .RTM. resistance. Resistant
Susceptible (CD .times. TGB-56) 128 56 x.sup.2 = 1.22 (AW .times.
TGB-56) 129 52 x.sup.2 = 1.10 (CN .times. TGB-56) 136 48 x.sup.2 =
.075 (AF .times. TGB-56) 107 44 x.sup.2 = 1.17
Studies involving the E1 cell line yielded nine clones that have
produced sixty-five plants in the greenhouse. Results from PCR
analysis demonstrated that five of these clones contain aroA, and
Western analysis of leaf tissue indicated that certain plants
(clone #58) express aroA. No R.sub.1 progeny were recovered from E1
plants.
Several tandem bar-aroA vectors were utilized in which aroA
expression units had been introduced into pDPG295 and pDPG298, as
described earlier (see section E, DNA segments). Briefly, these
include vectors with a 35S-histone promoter fusion, in which the
genes are placed in convergent, divergent, and colinear
orientations (pDPG314, pDPG313, and pDPG317, respectively) with
respect to the bar expression cassette; colinear and divergent
vectors employing a histone promoter (pDPG315 and pDPG316,
respectively); and colinear and divergent vectors employing an
a-tubulin promoter (pDPG318 and pDPG319, respectively). DNA of five
of these constructs was prepared for bombardment (pDPG313, pDPG314,
pDPG315, pDPG317, pDPG319).
It was firstly determined which of the tandem bar-aroA
orientation-promoter combinations functioned best under the
experimental employed. The 5 DNA constructs, pDPG313, pDPG314,
pDPG315, pDPG317, and pDPG319, were bombard into the E1 cell line.
Many transformed clones were recovered which revealed that no
construct was more useful than any other using bialaphos selection.
PCR analysis showed that co-transformation frequencies were about
identical (75%) regardless of which construct was used. It was
therefore concluded that all constructs were functioning, and that
no one construct was better than another for transformation. Clones
from these studies were cryopreserved for future analysis.
Since all constructs appeared to be functioning similarly, efforts
were concentrated on using the 3 divergently constructed tandems
pDPG315, pDPG317, and pDPG319 in which the aroA gene is driven by
the 2.times. histone, Camv 35S-histone, and .alpha.-tubulin
promoters, respectively. Bombardments were initiated using 16 new
cell lines (other than E1 ). These lines include AT824, SC716, E4,
ABT4, and various other new A188.times.B73 and B73.times.A188
cultures. aroA transformants were successfully recovered from cell
lines AT824, SC716, and E4 (A1880 cell culture revived from EniMont
cryopreservation). Regeneration was begun on aroA confirmed clones
of all three lines. Regenerated plants from the AT824 and SC716
clones are in the greenhouse. Four SC716 transformants containing
the .alpha.-tubulin promoter-aroA expression vector produced
R.sub.1 seed. AT824 transformants produced R.sub.1 seed as follows:
five transformants containing the .alpha.-tubulin promoter, two
transformants containing the CaMV 35S-histone fusion promoter and
six transformants containing the 2.times. histone promoter. These
transformants are currently in field tests to determine levels of
glyphosate resistance.
EXAMPLE 36
Tissue Specific Expression of aroA in Roots of Transgenic
Plants
Transformants were maintained on medium 223 (Table 1). For
regeneration cells were transferred to medium 189 (Table 1) and
cultured in the dark. Cultures were subcultured two weeks later
onto fresh medium 189 (Table 1). Regenerating tissue was
transferred to medium 101(Table 1) in low light, followed by
rooting of shoots on medium 607 (Table 1) or 501 (Table 1) and
transfer to Plant Cons.RTM.. Rooted plants were grown
hydroponically to avoid soil and microbial contamination when
attempting to assay plants for root specific expression of the
EPSPS gene.
Expression of the EPSPS gene, aroA, was assayed by Western blot
analysis. Leaf and root samples were harvested from transgenic
plants. Approximately 1 gram of tissue was ground in a glass
hormogenizer with 400 ul RIPA buffer (150 mM NaCl, 1% NP-40, 0.1%
SDS, 50 mM Tris-HCl pH 8.0). Extracts were centrifuged at
14,000.times.g and supernatants collected for protein analysis.
Forty ul of each protein extract was run on a 12.5% polyacrylamide
denaturing gel (Laemmli, 1970). The gel was run overnight at 50
volts. Following running the gel was electroblotted to
nitrocellulose paper and the nitrocellulose dried at 37 C. The blot
was washed in 50 ml 5% nonfat dry milk (NFD) in TBS (20 mM Tris-HCl
pH 7.5, 0.5M NaCl) for 30-60 minutes followed by incubation
overnight in 50 ml 5% NFD, TBS containing 100 ul EPSPS rabbit
antiserum. The nitrocellulose blot was washed 3 times for 5 minutes
each in TBS and then incubated in 50 ml 5% NFD, TBS containing 100
ul goat anti-rabbit antiserum conjugated to horseradish peroxidase
for two hours. The nitrocellulose blot was washed 3 times with TBS
for 5 minutes each prior to staining. The blot was stained as
follows. Twenty four mg 4-chloro-1-naphthol was dissolved in 8 ml
methanol. Forty two ul 3% H.sub.2 O.sub.2 was added. Thirty minutes
after initiation of staining 400 ul of H.sub.2 O.sub.2 was added.
The staining reaction was stopped by adding water and drying the
blot. Western blots were stored in the dark.
Expression of EPSPS was detected in roots derived from plants of
transformant S10AV13. No expression was observed in leaf tissue.
The protein expressed in the root was identical in size to EPSPS
protein isolated from Salmonella typhimurium and run on the same
gel as a positive control. This is the expected expression profile
expected, because the a-tubulin promoter is root specific in maize.
The aroA expression cassette in pDPG319 also contains a transit
peptide of about 130 amino acids to target the EPSPS protein to the
plastids. As the protein expressed in maize is identical in
molecular weight to the protein isolated from S. typhimurium it is
apparent that the transit peptide has been correctly cleaved from
the EPSPS protein. Hence it is believed that the EPSPS protein was
targeted to the plastids as demonstrated in example 7.
EXAMPLE 37
Herbicide Application (Basta.RTM.)
The herbicide formulation used, Basta TX.sup.R, contains 200 g/l
glufosinate, the ammonium salt of phosphinothricin. Young leaves
were painted with a 2% Basta solution (v/v) containing 0.1% (v/v)
Tween-20. The prescribed application rate for this formulation is
0.5-1%.
In FIG. 8A, Basta.sup.R solution was applied to a large area (about
4.times.8 cm) in the center of leaves of a nontransformed
A188.times.B73 plant (left) and a transgenic R.sub.0 E3/E4/E6 plant
(right). In FIG. 8B, Basta was also applied to leaves of four
R.sub.1 plants; two plants without bar and two plants containing
bar. The herbicide was applied to R.sub.1 plants in 1 cm circles to
four locations on each leaf, two on each side of the midrib.
Photographs were taken six days after application.
EXAMPLE 38
Resistance in the Field to the Herbicide Ignite.RTM./Basta.RTM.
Experiments have been undertaken to determine whether transformants
containing the bar gene exhibit sufficient levels of herbicide
resistance to be useful commercially. Eleven independent bar
transformants were evaluated for field levels of resistance to the
herbicide Basta.RTM. (a.k.a. Ignite.RTM.). The field design used a
split-split plot with 2 repetitions. Whole plots were spray rates
(1.times., 3.times. and 7.times.) and subplots were transformant
sources. Transformant sources were planted in four-row plots with
two rows sprayed with Ignite and two rows sprayed with water. A
spray rate of 0.33 lb/A (1.times.) was used to test for efficacy.
This will probably be the field rate for weed control in corn
fields.
The range of responses was too narrow and field variation too large
for a rating system to be useful for evaluating field levels of
resistance. At the normal field application rate of Ignite.RTM. all
transformant sources demonstrated resistance to the herbicide.
Differences were observed between the transformants at an
application rate that was three times the normal rate. Each plot
was examined by comparing sprayed versus unsprayed rows for 1)
leaf-necrosis in the whorl where the herbicide accumulated at
spraying; 2) chlorosis of the whorl tissue; 3) abnormal leaf growth
in the whorl after spraying; 4) variability and stunting of sprayed
planting compared to unsprayed; and 5) overall reduction in plant
growth of sprayed versus unsprayed rows.
Differences in herbicide sensitivity were not dramatic, but
consistent enough to rank each transformant, i.e. all transformant
showed resistance to the herbicide. Transformants could be roughly
classified into three major response groups with little difference
between sources within the group . Transformants A24, B16 and E29
were most resistant to the herbicide. The sources A24 and B16 were
the best, with no phenotypic difference between sprayed and
unsprayed plots. Source E29 was also very good, but was somewhat
variable or slightly shorter in sprayed plots. Sources A18, V11,
and E19 were intermediate in response to Ignite.RTM.. The sprayed
rows were slightly shorter, but were uniform and did not have any
of the phenotypic abnormalities seen in the more sensitive
transformants. Transformant sources G18, G20, K20, E14 and E27 were
clearly sensitive to the 3.times. application rate of Ignite.RTM..
They were shorter and had plants with necrotic lesions, chlorotic
whorls and leaf abnormalities group.
These experiments clearly demonstrate that transformants containing
the bar gene are useful for production of herbicide resistant
commercial hybrids.
2. Grain Quality
EXAMPLE 39
Elevation of Lysine Levels in Maize Grain
As described in the previous U.S. patent application Ser. No.
07/204,388 (most claims of which have been granted), one approach
to enhancing lysine levels in maize grain involves lysine
overproduction through deregulation of the lysine biosynthetic
pathway. A key regulatory point in the lysine biosynthetic pathway
occurs at the condensation reaction in which pyruvuate and aspartyl
semialdehyde form dihydrodipicolinic acid. This reaction is
catalyzed by the enzyme dihydrodipicolinic acid synthase (DHDPS),
which is normally feedback-inhibited by free lysine. In that
previous patent application, data were presented which demonstrate
that expression of a lysine-tolerant version of DHDPS, encoded by
the E. coli dapA gene, in transgenic tobacco plants leads to
elevated lysine levels in plant cells. As presented below, we have
transferred similar gene constructs to maize cells and have
successfully regenerated transgenic plants which contain these dapA
gene constructs and express the lysine-tolerant DHDPS in maize
seeds.
Plasmid constructs were introduced, in various combinations, into
maize cells by particle bombardment as described above. Transgenic
cell lines were identified on the basis of resistance to the
appropriate selectable agent, either hygromicin (Hyg),
phosphoinothricin (Ppt), or bialophos (Blp), included in the growth
medium. These lines were then screened at the callus level for
presence of appropriate DNA sequences by PCR amplification assays.
Several cell lines have been established which are at various
stages of plant regeneration. Current status of transformed plants
that have been transferred to soil is summarized in the following
Table 12:
TABLE 12 DPG plasmid Transgenic constructs used line(s) carried for
Recipient Selection through plant bombardment cell line agent
regeneration Status 334/367 AB61 Hyg HAL R2 seed 334/366 AB61 Hyg
Dap2 R2 plants 334/371/367 AB61 Hyg Dap3 R2 plants 335/355 HAL Ppt
Dap4 R1 seed 371/363 ABT4 Ppt ND1-1 R1 plants ND1-4 335/372/231
ABT4 Blp dAH03CF-10 R0 plants dAH06CF-10 dAH06CF-15 dAH09CF-11
335/372/231 ABT4 Blp dAH04CG-11 R0 plants 335/372/283 dAH07CF-11
dAH07CF-12 dAH07CF-15 dAH07CF-19 dAH07CF-24 dAH07CG-17 335/165
HB13-3 Blp dAU01CG-10 R0 plants
For each of the most recent experiments, where only R0 plants have
been generated to date, several additional cell lines are in the
plant regeneration process. In these experiments, in which the main
objective is to obtain expression of the DSTP/dapA transgene in
various tissues, several dozen transformants have been obtained by
co-bombardment with multiple plasmids. Only those lines which, when
assayed at the callus level, are PCR-positive for the selectable
marker transgene and the dapA constructs) of interest are
transferred to the plant regeneration program. In summary, these
experiments have yielded the following numbers of bar-positive
transformants:
Genotype by PCR assay No. transformants DPG 335/372 35 DPG 335 21
DPG 372 26 DPG418 20
PCR-amplification assays of DNA extracted from callus samples were
performed by standard procedures. In each assay, one
oligonucleotide primer (primer 1 in the table below) was specific
to the promoter present in the transgene, and a second primer
(primer 2) corresponded to the dapA coding region or, for pDPG418,
the Glb1 3' sequence. Designations of the primers used for the
PCR-amplification assays of the dapA constructs, along with the
sizes of the amplified fragment products, are provided in the
following Table 13:
TABLE 13 Construct Primer 1 Primer 2 Fragment size 334 Z10P965
dapAPCR1 572 bp Z10/MZTP/dapA/nos 335 Z27mid DAP6 1011 bp
Z27/DSTP/dapA/355 371 35SPCR1 dapAPCR1 480 bp 35S/MZTP/dapA/nos
35SPCR1 DAP6 610 bp 372 35SPCR1 dapAPCR1 486 bp 35S/DSTP/dapA/nos
35SPCR1 DAP6 616 bp 418 Glb15' Glb13' 1300 bp Glb1/DSTP/dapA/Glb1
Glb15' dapAPCR1 464 bp Glb15' DAP6 594 bp
Expression of dapA transgenes in transformed plant cells has been
analyzed to date primarily by assaying for the presence of
lysine-tolerant DHDPS activity essentially as described in U.S.
patent application Ser. No. 07/204,388, except that modifications
have been made for use of the assay in a qualitative manner in a
microtiter plate format as follows: a few milligrams of each tissue
sample are placed in the wells of a 96-well plate with 50 ul of
0.225 M tris, 17.3 mM sodium pyruvate, pH8.2, covered, then
transferred to a -20.degree. C. freezer for at least one hour.
After the samples are thawed briefly, 50 ul of the reaction mix
described by Yugari et al (J. Biol. Chem, 240:4710-4716, 1965),
supplemented with L-lysine to 0.45 mM, was added and the reactions
were incubated at 37.degree. C. for 1-2 hours. Reactions were
quenched by the addition of 175 ul stop buffer, and pink color was
allowed to develop at room temperature for 15-60 minutes, at which
time the samples were scored as plus or minus lysine-tolerant DHDPS
activity on the basis of presence or absence, respectively, of pink
color. This assay has been applied in this form to portions of
cultured maize callus, portions of immature seeds, fragments of
mature dry kernels, and leaf sections from plants at various stages
of growth. Results of lysine-tolerant DHDPS expression assays in
the transgenic maize lines from which mature plants have been
obtained are summarized in the following Table 14:
TABLE 14 dapA Immature Transgenic promoter kernels Mature line
construct(s) Callus Leaf (20 DAP) kernels HAL 334 (Z10) no nd nd nd
Dap 2 334 (Z10) no no yes yes Dap 3 334 (Z10) nd no yes yes 371
(35S) Dap 4 335 (Z27) nd nd nd nd ND1-1 371 (35S) yes nd nd n.d.
ND1-4 371 (35S) yes yes nd no
The expression of the dapA transgene in both developing and mature
maize kernels from transgenic plants is significant with respect to
use of these, and related, gene constructs in development of
high-lysine maize types through deregulation of the lysine
biosynthetic pathway. This trait is transmitted and expressed at
least through the R2 generation, as R2 seeds of both Dap2 and Dap3
contain lysine-tolerant DHDPS activity.
The following additional lines have been assayed for
lysine-tolerant DHDPS activity at the callus level. These lines
have either produced plants that have recently been transferred to
soil or are in the early stages of plant regeneration (Table
15).
TABLE 15 Lys-tolerant Cell line dapA construct(s) DHDPS activity
dAH03CF-10 335/372 + dAH06CF-10 + dAH06CF-15 - dAH09CF-11 -
dAH04CG-11 335/372 - dAH07CF-11 - dAH07CF-12 + dAH07CF-15 -
dAH07CF-19 - dAH07CF-24 - dAH07CG-17 + dAU01CG-10 335 + dAR01E1-10
418 - dAR01E1-11 + dAR01E1-13 + dAR01E1-14 + dAR01E1-15 -
dAR01E1-16 + dAR01E1-17 - dAR01E1-18 + dAR01E1-19 + dAR01E1-20 +
dAR01E1-21 + dAR01E1-23 - dAR01E1-24 -
Expression of the dapA transgene in seeds of transformed plants as
described above is very encouraging with respect to our goal of
deregulating lysine biosynthesis in maize kernels. To date,
expression of the lysine-tolerant dapA gene product has been
accomplished by using the endosperm-specific promoters Z10 and Z27,
and it is anticipated that use of the embryo-specific Glb1 promoter
will result in expression of the dapA gene product in embryos as
well.
EXAMPLE 40
Enhanced Methionine Content of Maize Seeds
The purpose of these experiments is to enhance methionine content
of maize kernels for improved poultry feed. This goal is achieved
through particle bombardment of maize cells with DNA-coated
microprojectiles and subsequent selection of transformed cells,
followed by regeneration of stably transformed, fertile transgenic
maize plants which transmit the introduced genes to progeny. The
gene used for enhanced methionine content encodes a 10 kD zein seed
storage protein which is 23% methionine, and seeds of transformed
plants overexpress this gene, leading to increased 10 kD zein and
increased methionine content.
The zeins are a large family of related proteins which accounts for
more than 50% of the total protein in maize seeds. The
.alpha.-zeins, which are low in lysine, methionine and tryptophan,
are the most abundant of the zeins. Thus, maize seeds are deficient
in these amino acids because such a large fraction of the total
protein is .alpha.-zein. One method to correct for this deficiency,
and to substantially increase the seed levels of various amino
acids, especially methionine, is to overexpress a gene encoding a
10 kD .delta.-zein containing 23% methionine.
U.S. patent application Ser. No. 07/636,089, filed Dec. 28, 1990,
describes the production of transgenic Zea mays plants and seeds,
which have been transformed with recombinant DNA encoding the 10 kD
.delta.-zein. Transgenic plants are obtained by bombardment of
friable, embryogenic callus with microprojectiles coated with
recombinant DNA encoding the 10 kD zein and a selectable marker
gene, followed by selection of transformed callus and regeneration
of fertile plants, which transmit the introduced gene to
progeny.
A transformed cell line, designated Met1, was obtained by
bombarding AB63S cells with the plasmids pDPG367, pDPG338, and
pBII221. Selection was on 60 mg/l hygromycin, and the presence of
the HPT, GUS and Z27Z10 genes was confirmed by PCR analysis.
Additionally, the presence of the HPT coding sequence and the
Z27Z10 gene was confirmed by Southern analysis. Met1 exhibited
strong resistance to hygromycin, and was only 20% inhibited at 200
mg/l hygromycin. Thirty two additional lines carrying methionine
constructs were identified (using selection procedures described
elsewhere in this CIP) as shown in Table 16.
TABLE 16 Genotypes of Cell Lines PCR.sup.+ for Methionine
Constructs Cell Line Genotype Met1 Z27Z10 MD 64-1 Z27Z10, Z10Z10 MD
84-34 Z27Z10, Z4Z10 MD 84-31 Z4Z10, Z10Z10 MD 84-2 Z4Z10 MD 52-8
Z4Z10, Z10Z10 MD 52-11 Z27Z10, Z4Z10, Z10Z10 MD 52-10 Z4Z10 MD 44-2
Z4Z10, Z10Z10 MD 42-1 Z27Z10, Z4Z10, Z10Z10 MD 32-2 Z10Z10 MD 32-1
Z27Z10, Z10Z10 A6-101 Z27Z10, Z4Z10, Z10Z10 A6-115 Z27Z10, Z4Z10,
Z10Z10 A6-181 Z27Z10, Z10Z10 A6-151 Z27Z10, Z4Z10, Z10Z10 AG-161
Z4Z10, Z10Z10 A6-907 Z27Z10, Z4Z10, Z10Z10 A8-113 Z10Z10 A8-301
Z27Z10, Z4Z10, Z10Z10 A10-2 Z27Z10, Z4Z10, Z10Z10 A10-7 Z27Z10,
Z4Z10, Z10Z10 B1-72 Z27Z10 B1-82 Z27Z10 B1-94 Z27Z10 B1-101 Z27Z10
B1-401 Z27Z10 B1-601 Z27Z10 B1-702 Z27Z10 B1-703 Z27Z10 B1-703
Z27Z10 B1-704 Z27Z10 B1-705 Z27Z10 B1-901 Z27Z10
Transformants were identified by PCR analysis. The Z27Z10 chimeric
gene was distinguished from endogenous genes by generation of a PCR
product which spanned the junction of the Z27 promoter and the Z10
coding sequence. Similarly, the Z10Z10 introduced gene was
identified by a PCR product which spanned the junction of the pUC
plasmid which carried the construct and the Z10 promoter, and the
Z4Z10 construct was identified by a PCR product spanning the
junction between the Z4 promoter and the Z10 coding sequence.
Forty five plants were regenerated from Met1 callus. These plants
were selfed and reciprocal crosses were made using 6 inbred lines.
Immature seed was harvested at 21-24 DAP for Northern analysis, and
genotype of the progeny was also examined by PCR. In all cases, the
HPT and Z27Z10 genes cosegregated, consistent with Mendelian
segregation of a single locus, and indicating linkage of the
introduced HPT and chimeric Z27Z10 genes. Additionally, the GUS
gene was shown to cosegregate with the HPT and Z27Z10 genes,
allowing the use of a GUS assay to be used to identify the Z27Z10
genotype. Northern analysis confirmed that the chimeric Z27Z10 gene
was expressed only in seeds PCR.sup.+ for the Z27Z10 gene. As with
PCR analysis, the presence of the Z27Z10 transcript was confirmed
using a probe which spanned the junction between Z27 and Z10
sequences.
ELISA analysis of Met1 R.sub.1 seed using a Z10-specific antibody
revealed a trend of increased 10 kD zein levels as compared to
controls. Seeds carrying the Z27Z10 gene showed 2 to 3-fold higher
levels of 10 kD zein per unit protein than nontransformed seed.
Even more striking results were obtained in ELISA analysis of
R.sub.2 seeds. In these experiments, embryos were isolated from
seeds and germinated, and PCR analysis for the Z27Z10 gene was
carried out on the seedlings from the excised embryos, and protein
analysis was carried out on the remaining seed tissue. The Z10 gene
product accounted for up to 0.6% of the dry seed weight, or 6% of
the total protein. An average 7-fold increase in 10 kD zein
expression was found. Field test data from 90 bulked R.sub.3 seed
samples indicated a positive correlation between elevated 10 kD
zein levels and the presence of the Z27Z10 construct. For ELISA
analysis, zeins were extracted from corn meal samples in 70%
ethanol and 2% B-mercaptoethanol at room temperature. Extracts were
dried down on 96-well microtiter plates and incubated sequentially
with 1% BSA, primary antibody, peroxidase-conjugated secondary
antibody, and enzyme substrates (for peroxidase). Absorbances at
490 minus 410 nanometers were collected, and a standard curve using
purified 10 kd-specific antibody was used to calibrate each plate.
Three extractions were carried out for each sample, and each
extraction was assayed in 3 wells. Thus, 9 absorbance measurements
were made for each sample.
Protein levels were measured by near infra-red reflectance
spectroscopy, and methionine levels were measured by oxidation of
meal, followed by acid hydrolysis with detection of the released
methionine sulfone by PITC (phenyl-isothiocarbymate) pre-column
derivitization and reverse-phase HPLC. The presence of Z27Z10 DNA
was confirmed by PCR and/or Southern analysis.
PCR, 10 Kd zein, methionine and protein analyses were carried out
on field test samples from 65 ears. Of the three lines analyzed, it
was demonstrated that PCR.sup.+ ears contained higher levels of 10
Kd zein, regardless of genotype. In addition, a correlation was
shown between increased Z10 gene product, as determined by ELISA
analysis, and elevated methionine levels in the seed, as determined
by amino acid analysis.
EXAMPLE 41
Improved Protein and Starch Content of Maize Seeds by Antisense
DNA
The purpose of these experiments is to improve the nutritional
content of maize kernels by reducing the expression of
.alpha.-zeins, with a concommitant increase in the levels of other
proteins or starch. The reduction in .alpha.-zein expression is to
be achieved by particle bombardment of maize cells with
microprojectiles coated with antisense genes to the 19 and 22 kD
.alpha.-zein families, to reduce translation of .alpha.-zein
mRNA.
The majority of the zein proteins, which account for over 50% of
the total seed protein, are the 19 and 22 kD .alpha.-zeins. The
high levels of .alpha.-zeins, which are low in methionine, lysine
and tryptophan, result in seeds low in these amino acids. Maize
seed protein levels are inversely correlated with starch, thus
reduced .alpha.-zein levels would potentially result in increased
starch. Increased levels of other proteins are also associated with
reduced levels of .alpha.-zeins in opaque and floury mutants, which
reduce levels of .alpha.-zeins.
The .alpha.-zeins are encoded by a large multigene family with
regions of sequence homology. Consequently, a small number of
introduced antisense genes (with transcripts complementary to the
conserved regions of homology in .alpha.-zein transcripts) would
likely be needed. Introduction of antisense genes and selection for
reduced .alpha.-zein content and increases in starch or other
proteins of interest, would be followed by introduction of these
selected lines into a breeding program to optimize desirable
characteristics. It is believed that, in light of the present
disclosure, one of skill in the art would now be able to alter the
nutritional content of maize seeds through transformation of maize
plants using genes encoding antisense genes to the
.alpha.-zeins.
Two .alpha.-zein antisense genes to the 19 kD zein (A20 gene) and
22 kD zein (Z4 gene) under control of the 10 kD zein promoter have
been used to transform maize cells. These two plasmids were chosen
from a variety of plasmids containing antisense sequences to
.alpha.-zeins based on reduction of .alpha.-zein protein levels
following hybrid arrest of .alpha.-zein RNA using antisense
transcripts, and in vitro translation of .alpha.-zein mRNA not
removed by hybridization. In these experiments, in vitro
synthesized sense and antisense RNAs were prepared and mixed using
a 4:1 ratio of antisense to sense RNA. Annealing conditions were
determined by the appearance of sense::antisense hybrids on agarose
gels. Although RNAs were successfully translated in both wheat germ
and rabbit reticulocyte systems, the rabbit reticulocyte system was
shown to be more efficient. Laser densitometry was used to
quantitate the results of the in vitro translations. Several
plasmids carrying antisense genes or parts of antisense genes were
examined, and the plasmids p1020p and pZ4ENT were shown to be the
most efficient in these assays.
Stable transformants were obtained by bombarding maize cells with
the antisense constructs and selectable marker genes, and selection
was carried out as described elsewhere, using Basta, bialaphos or
hygromycin. Presumptive transformed calli were screened for
antisense constructs by PCR, using primers to the Z10 promoter and
the nos 3' sequence. Seven lines were identified which were
PCR-positive for pZ4ENT, 15 lines were PCR-positive for p1020P, and
1 line was positive for both constructs. These lines were
regenerated and crossed to various inbred lines. Further
transformation experiments using pDPG165 as the selectable marker
gene, resulted in an additional 13 transformants which carried
p1020P, 13 with pZ4ENT, and 42 which were PCR.sup.+ for both
plasmids. These transformed cell lines are now being regenerated
according to standard procedures.
R.sub.1 seeds were collected from regenerated plants, and 110
R.sub.1 seeds from 6 antisense lines were grown in the greenhouse.
Seed was uniform in appearance and synchronous germination occurred
at 95%. Plants appeared normal, and selection for Basta resistance
was carried out one month after planting by leaf painting with 2%
Basta. Twenty four resistant plants were identified in this manner.
These plants were selfed and crossed to inbred lines. Immature
kernels of selfed plants were harvested at 10, 12 and 16 days after
pollination and frozen in liquid nitrogen for future Northern
analysis of antisense constructs.
3. Insect Resistance
The yield and efficiency of producing grain from maize throughout
the world is affected by the action of a number of insect pests.
The insect pests that currently affect the US maize crop include:
the European Corn Borer (Ostrinia nubilalis;Hbn), Southwestern Corn
Borer (Diatraea grandiosella), Southern Cornstalk Borer (Diatraea
crambidoides), Lesser Cornstalk Borer (Elasmopalpus lignosellus),
the corn rootworm (Diabrotica spp.), the corn earworm (Heliothis
zea), armyworms (Spodoptera frugiperda; Pseudaletia unipuncta),
cutworms (e.g. black cutworm: Agrotis ipsilon), wireworms, assorted
grubs, Chinch Bugs (Blissus leucopterus), Corn Flea Beetles,
Billbugs, Corn Root Aphids, Corn Leaf Aphids, Corn Planthopper. As
well as directly affecting growth and yield, insect feeding can
also lead to increased damage due to infection by other pathogens,
e.g. when the insect serves actively as a vector for the pathogen
(maize chlorotic mottle virus) or passively by opening the plant
tissue to infection (stalk, root and ear rot fungi). Infection of
the ear by fungi can also lead to unacceptable levels of fungal
toxins (aflatoxin) in maize grain. Furthermore, grain harvested
from maize can also be damaged in storage by a variety of insects
(e.g. seed corn maggot, meal moths, worms, beetles and
weevils).
The control of insect pests to prevent damage is achieved in the US
mainly by adopting good integrated pest management (IPM) procedures
that include the use of certain farming (and storage) practices,
the use of chemical and biological control measures and the use of
maize germplasm that confers resistance or tolerance to insect
pests. The use of some of these aspects of IPM are not always
compatible with efficient, cost-effective farming or can
detrimentally impact the environment through the use of chemical
insecticides. Also, while traditional breeding has produced
resistance or tolerance to some insect pests, the level of
resistance to several important insect pests has either been
inadequate to prevent economic levels of damage or is incompatible
with maintaining high yield. To circumvent these problems and to
reduce the use of chemical insecticide, it would be advantageous to
introduce insect resistance genes into maize from a variety of
sources.
In the examples described below we have utilized the transformation
process to introduce into maize plants two genes from diverse
sources that can, or have the potential to, control insect damage.
We have demonstrated expression and inheritance of the genes in
maize and have also demonstrated that the gene(s) can be used to
confer resistance to a major insect pest of maize, the European
Corn Borer.
In the first example (see example 42), DNA coding for the endotoxin
from a soil bacterium, Bacillus thuringiensis (Bt gene), and DNA
coding for protease inhibitor II protein from tomato (Lycopersicum
esculentum) were simultaneously transformed into maize cells and
plants were regenerated to produce fertile transgenic maize plants
containing one or both of the genes. In the second example (Example
43), a Bt gene alone was introduced. In both examples a selectable
marker coding for resistance to the herbicide bialaphos was also
introduced and used to initially identify transformants. The close
genetic linkage of the herbicide resistance and insect resistance
genes may provide some utility by allowing breeders to follow the
inheritance of the insect resistance genes by screening for
herbicide resistance.
Potential insect resistance genes which can be introduced include
the Bacillus thuringiensis crystal toxin genes or Bt genes (Watrud
et al., 1985). Preferred Bt toxin genes for use in such embodiments
include the CrylA(b) and CrylA(c) genes (H. Hofte and H. R.
Whiteley, 1989. Microbiol. Revs. 53: 242-255).
The poor expression of the prokaryotic Bt toxin genes in plants is
a well-documented phenomenon, and the use of different promoters,
fusion proteins, and leader sequences has not led to sufficient
gene expression to produce resistance in several plant species
(Perlak et al, 1991). We have previously introduced expression
vectors into maize that contain the native coding sequence for the
HD73 Bt gene {a representative of the crylA(C) class of Bt genes}.
The gene was derived by cloning from the B.thuringiensis strain and
modified by removing the genetic elements necessary for expression
in its original host and replacing them with elements known to be
capable of directing the initiation and termination of
transcription of other foreign genes in maize. The expression
vector produced was transformed into regenerable maize cells that
were eventually regenerated into plants. The transformed maize
cells and plants that were recovered that contained the Bt
expression vector failed to provide resistance to ECB larvae.
To reduce this factor as an influence on Bt gene expression in
maize, we have synthesized new DNA sequences for the HD73 and HD1
Bt genes that code for the same amino acid sequences as their
native counterparts but which replace codons that are rarely used
in actively expressed maize genes (less than 19% of the time) with
codons that are most frequently used in highly expressed maize
genes. The synthetic DNA sequencse coded for the active portion of
the Bt genes and contained approximately the first 613 codons of
the Bt genes (including the f-met initiation codon; see FIGS. 1 and
2 for sequences). The HD73 Bt endotoxin gene was introduced into a
plant expression vector similar to that previously used for the
native Bt gene and also into expression vectors with modified
expression control elements designed to increase expression. Other
examples of modified Bt toxin genes reported by others include the
synthetic Bt CrylA(b) gene and CrylA(c) genes (Perlak et al.,
1991).
In the current examples, genes coding for protease inhibitors have
also been introduced into maize. The use of protease inhibitors to
mediate resistance to insect pests has been described before (R.
Johnson et al.,1989; V. A. Hilder et al., 1987) but none of these
genes have previously been reported to have been introduced into
maize using the transformation process. The use of a protease
inhibitor II gene (PIN) from tomato or potato is envisioned to be
particularly useful. Even more advantageous is the use of a PIN
protein in combination with a Bt toxin protein, the combined effect
of which has been discovered by the present inventors to produce
synergistic insecticidal activity.
The two examples cited below illustrate the utility and benefits of
using the current invention to introduce insect resistance genes
into maize.
EXAMPLE 42
Insect Resistance in Transgenic Plants
In this example AT824 cells were bombarded with 10 ug each pDPG165,
pDPG354 and pDPG44 as described in example 10. Transformants were
selected similar to example 19. The bombarded cells were removed
from the microprojectile gun chamber, incubated on the wet filters
in the petri dish for 16-24 hours, scraped from the filter and
placed in liquid 409 medium (10 ml medium in a 125 ml conical
flask). Flasks were incubated at ambient temperature (20-25.degree.
C.) in an orbital shaker (New Brunswick Scientific, controlled
environment, incubator shaker; 125-150 rpm). Cells were subcultured
(2 ml PCV into 20 ml medium) every 3.5 days for one week without
herbicide then subcultured in fresh 409 medium plus 1 mg/L
bialaphos (medium 434) every 3.5 days for 2 weeks. Cells were then
dispensed onto solid 425 medium (3 mg/L bialaphos) at a density of
0.1 ml PCV per plate and incubated in the dark at ambient
temperature. Approximately 250 plates were generated per original
bombarded filter and 3-5 weeks post plating colonies of cells
potentially resistant to the herbicide were identified.
Bialaphos resistant transformants were transferred to fresh solid
425 medium and subcultured twice (once every two weeks) before
selected samples were taken for analysis by polymerase chain
reaction (PCR) to detect the presence of the Bt and/or protease
inhibitor (PIN) genes.
For PCR analysis, standard protocols were followed using the
following primers (SEQ ID NO:23 through SEQ ID NO:26,
respectively):
PCR primers for PIN gene were:
PIN-1 (MD-1): 5'-GCT TAC CTA CTA ATT GTT CTT GG-3'
PIN-4: (MD-4): 5'-CAG GGT ACA TAT TTG CCT TGG G-3'
PCR primers for Bt gene were:
BTSN64: 5'-AAC CCT GAA TGG AAG TGC-3'
BTASN506: 5'-ACG GAC AGA TGC AGA TTG G-3'.
Forty-two of the putative transformants (Table 17) were analyzed by
PCR for the Bt gene and in most cases also for the PIN gene: A
number were positive for Bt or PIN alone and a majority of PCR
positive transformants were positive for both genes.
Regeneration of plants was similar to example 31. To regenerate the
transformed maize cells, the bialaphos resistant maize clones were
passaged (every two weeks; 24.degree. C.) on the following media at
24.degree. C.:
(i) On solid 223 medium or 425 medium and maintained for 1-10
passages (2-3 weeks per passage).
(ii) Passaged one to three times on 189 medium (first passage in
the dark; later passages in low light; 16 hours light:8 hours
dark),
(iii) Passaged one to four times on 101 medium in higher light.
(iv) Passaged one to four times on 607 or 501 medium in Plant
Con.RTM. containers in higher light.
Once shoots were observed in tissue incubated on 101 medium, the
light intensity (fluorescent light: 25-250 mE.M.sup.-2.S.sup.-1)
was increased by slowly adjusting the distance of the plates from
the light source located overhead. Transformants that developed 3
leaves and 2-3 roots were then transferred to a soilless plant
growth mix. In some cases indolebutyric acid (3 ml of 0.3%w/v
solution) was applied to the base of rootless plants to stimulate
root development.
Plantlets in soil were incubated in an illuminated growth chamber
and conditions were slowly adjusted to adapt or condition the
plantlets to the drier and more illuminated conditions of the
greenhouse. After adaptation/conditioning in the growth incubator,
plants (R0 generation) were transplanted individually to large (5
gal) pots of soil and transferred to the greenhouse.
Genotypic Analysis
The genotype of several of the R0 plants was further analyzed by
Southern blot to determine if the transformants were independent
and had Bt DNA inserted in variable locations within the maize
genome. This was achieved by: (i) cutting DNA isolated from the
transformants with a restriction endonuclease (e.g. Kpn I) which
cleaves to the 3' terminus of the Bt coding sequence and does not
cleave the DNA sequence 5' to the Bt gene in the vector and (ii)
carrying out a Southern blot probing the DNA with a radioactively
labeled DNA probe specific to the Bt gene. The size and number of
the resulting bands detected by autoradiography were indicative of
the location of the nearest restriction endonuclease site located
in the maize genome 5' to the inserted Bt DNA sequence. These
varied in size for different independent insertion events. The
results showed that, for most of the transformants analyzed, the Bt
DNA inserted into different sites in the maize genome and most of
the transformants were independent transformants (i.e. not clonally
related to each other).
Demonstration of Expression of Bt Endotoxin and PIN Genes
Insect Bioassay (Resistance to European Corn Borer)
The regenerated (R0) plants were grown to early whorl stage
(18"-26" extended leaf height with 5-6 leaves) and infested with
neonate European corn borer larvae. A `Davis` inoculator (BIO-SERV,
Frenchtown, N.J.) was used to reproducibly introduce a fixed number
(80-120) of newly hatched European corn borer larvae(dispersed with
corn cob grits.) into the whorl of the plants. Following
inoculation, the larvae were allowed to feed on the plants for 2
weeks before they were evaluated for leaf damage. This infestation
provided a simulation of an infestation with first brood (first
generation) European corn borer larvae.
As shown in Table 18, high levels of resistance to ECB were seen in
several transformants containing the Bt gene. Since DNA, introduced
into plants by a variety of methods, can insert into a wide variety
of locations within the maize genome, the level of expression of
any inserted gene is variable and partly dependent on the location
of insertion into the genome. The average level and pattern
(developmental or temporal) of expression is also dependent on the
composition of the inserted DNA. This also appears to be the case
for the current example, since while several of the individual
transformants showed high levels of resistance to insect feeding
although a lower number containing the Bt gene did not. Depending
on the composition of the introduced DNA it would usually be
appropriate to evaluate a number of transformants to obtain
transformants with the optimum level of expression of the
introduced DNA.
Demonstration of Transcription of Bt and Protease Inhibitor
Genes
The transgenic R0 plants were further analyzed to determine whether
transcription (production of gene-specific RNA) of the introduced
genes could be detected. Total RNA was isolated from leaf tissue
excised from the transgenic maize plants and suitable negative
controls and analyzed by northern blotting procedures. The RNA was
first separated according to size by electrophoresis into an
agarose gel (under denaturing conditions), transferred and bound to
a membrane support and then hybridized with gene specific,
radio-labelled probes. The probes used were:
Bt gene: A fragment of DNA containing the first 1364 bp of the
coding sequence of the synthetic Bt gene (approximately from the
Nco I site at the 5' terminus of the Bt gene to the Bam HI site
1364 bp into the Bt gene).
Tom PIN gene: The Xba I-Bam HI fragment of pDPG344 containing the
cDNA coding sequence of the tomato protease inhibitor I gene.
barR gene: The Bam HI-Kpn I fragment from pDPG165 comprising the
coding sequence of the barR gene.
After hybridization and washing to remove non-specifically bound
probes, the membranes were exposed to X-ray film and analyzed. The
appearance of bands representing probe hybridizations to specific
species of RNA demonstrated the transcription of the introduced
genes in the transgenic maize plants. The presence of Bt RNA
correlated well with the appearance of resistance to the ECB
larvae. In this case since expression of the Tom PIN gene was also
detected the contribution of this gene to the resistance could not
be determined. Other transformants that are resistant and contain
only the Bt gene, with no PIN gene present, indicate that the Bt
gene can significantly increase the resistance of maize to ECB
larvae (see Example 43 below).
Sexual Competency of R0 Transgenic Plants Containing Insect
Resistance Genes
The S23BI3602 and S23BI3702 R0 plants, containing the introduced
insect resistance genes, were grown to sexual maturity and crossed
to non-transgenic inbred maize lines (e.g. inbreds "CN" and "AW")
either by fertilizing the non-transgenic inbred maize plants with
pollen derived from transgenic maize or fertilizing the transgenic
plants with pollen from non-transgenic inbreds. The techniques used
to cross and self-pollinate transgenic maize plants were described
in the CIP (filed Apr. 11, 1990) of U.S. patent application Ser.
No. 07/467983 (filed Jan. 22, 1990). The yield of progeny was
variable and depended on the inbred parent used, but sufficient
seed was recovered to demonstrate that the transgenic plants were
fertile.
Sexual Transmission, Segregation and Expression of Insect
Resistance Genes in Progeny
The harvested seed (R1 generation) was harvested, planted in soil
in 5 gal pots and grown in the greenhouse. When the plants had
grown so they had at least one true leaf extended, a 2%(w/v)
solution of a commercial formulation of bialaphos (BASTA.RTM.,
Hoechst TX100) was painted on a small circle of leaf tissue and
after one week the plants were evaluated for herbicide resistance.
Resistance to the herbicide was identified by the lack of a
browning reaction (necrosis) in the area treated with herbicide
(tissue browning=sensitivity, no browning=resistance).
Following this assay, samples were taken to determine the genotype
of the segregants (by PCR assay) and the plants were infested with
ECB larvae to determine insect resistance phenotype. The results
(Table 19) showed that the progeny inherited the Bt and PIN genes
together with the resistance to bialaphos and ECB larvae. The low
insect damage rating number (high insect resistance) correlated
with the presence of the Bt. No significant resistance to ECB
larvae above the no-Bt controls was ever been detected in
transgenic maize with only the BarR gene present. Furthermore, in a
separate experiment when only the pDPG354 and pDPG165 expression
cassettes were maintained in the transformed cells, R0 and R1
plants (transformant S25BJ18) the insect resistance phenotype was
still inherited, suggesting that the Bt gene (without PIN gene) is
capable of conferring resistance to ECB larvae.
There was no independent assortment of the introduced genes,
indicating that the Bt, PIN and bialaphos resistance genes in
transformant S23BI36 or S23BI37 were closely linked. Resistance was
inherited independent of the inbred used. Close linkage of the
herbicide resistance and insect resistance will provide an
advantage for the production of commercial maize seed containing
the insect resistance gene, since the presence of the Bt gene in
subsequent generations can be detected and followed by screening
for herbicide resistance. This will allow for screening for the Bt
gene to take place in locations and times when infestation with
insects is impossible or difficult (e.g. in winter nurseries).
TABLE 17 PCR Analysis of transgenic maize cells (S23Bl31 clones)
containing Bt and/or Tom PIN genes. Bt PIN Clone PCR PCR 01 - + 02
- ND 03 - ND 04 - ND 05 + + 06 - ND 07 + + 08 - + 09 SG SG 10 + -
11 + + 12 + + 13 + + 14 + + 15 SG SG 16 + - 17 SG SG 18 - ND 19 -
ND 20 - ND 21 SG SG 22 + + 23 + + 24 + + 25 ND ND 26 - ND 27 ND ND
28 - - 29 + + 30 + + 31 + + 32 + + 33 + + 34 - - 35 + - 36 + + 37 +
+ 38 + + 39 - + 40 - + 41 - + 42 + + 43 + + 44 + + 45 + + 46 - - 47
- - 48 - - Key: + = target DNA present - = target DNA not present
ND = not determined SG = tissue stopped growing.
TABLE 18 Expression of Bt gene in transgenic maize plants. Bt
Resistance PIN bar R0 plant RNA Rating RNA RNA S23Bl3015 +++ 1 + ++
S23Bl3016 +++ 1 + ++ S23Bl3119 +++ 1 + ++ 523Bl3128 +++ 1 + ++
S23Bl3203 - 5 - + S23Bl3202 - 8 - + S23Bl3204 - 8 - + 523Bl3704 +++
ND + ++ 523Bl3708 +++ 2 ++ +++ S23Bl3709 +++ 1 ++ +++ S23Bl3712 +++
1 ++ +++ S23Bl3715 +++ 1 ++ +++ S23Bl3716 +++ 2 ++ + S23Bl372O + 3
ND ND No-Bt control - 5-9 - - Key: - = no RNA detected + = low
level Bt RNA ++ = intermediate level of Bt RNA +++ = higher level
of Bt RNA ND = not determined Resistance ratings: 1 = highly
resistant 9 = highly susceptible
TABLE 19 Inheritance and expression of insect resistance in progeny
from Example 42. Transformant Plant PIN BAR ECB {R:S RATIO} Number
Bt PCR PCR resistance resistance S23Bl3602(CN) 02 - - S 6 {4R:65}
05 - S 6 07 ND ND S ND 08 + + R 1 09 - - S 6 10 + + R 1 11 ND ND S
9 13 - - S 3 14 + + R 1 15 + + R 1 S23Bl3604(AW) 01 - - S 5 {6R:9S}
02 + + R 1 03 ND ND S 9 04 - - S 7 05 ND ND S ND 06 - ND S 6 07 + +
R 1 08 + + R 1 09 + + R 1 10 - - S 7 11 + + R 1 12 ND ND S 9 13 ND
ND S 9 14 ND ND S ND 15 + + R 1 S23Bl3702(bk) 01 ND ND S 9 {6R:5S}
02 + ND R 1 03 + + R 1 05 + + R 1 06 + + R 1 07 + + R 1 08 ND ND S
6 09 ND ND S 9 10 ND ND S 9 12 + ND R 1 13 - - S 6 15 ND ND S 9
S25BJ1801(AW) 05 + ND R 1 {5R:2S} 08 + ND R 1 10 + ND R 1 11 ND ND
S 9 13 ND ND R 3 14 - ND R 1 15 ND ND S 9 Key for Table 19: + = DNA
present - = DNA not present S = susceptible to bialaphos R =
resistant to bialaphos ND = Not determined ECB resistance: 1 =
Highly resistant 9 = highly susceptible
EXAMPLE 43
Insect Resistant Transgenic Plants
Microprojectiles were coated with DNA as described in Example 10
except 14 ul of pDPG165 and 14 ul of pDPG337 DNA were used. The
bombarded cells were transferred (on the filter) onto solid 409
medium and moistened with 0.5 ml of liquid 409 medium. Tissue was
returned to liquid 401 plus coconut water one day after
bombardment. Selection in liquid 409 plus 1 mg/L bialaphos (434
medium) began 8 days post-bombardment and the cells were then
treated as described in Example 42.
Genotype Analysis
The data obtained using the Bt PCR primers and techniques described
in Example 42 above showed that 5 out of 7 clones tested contained
the Bt gene.
Regeneration of Transformants
Clones positive for Bt were subcultured on 425 medium for 2-5
months and depending on the clone either:
(i) passaged on 409 solid medium (1 st passage about 2 months and
second passage about 2 weeks) or passaged on solid 223 medium for
about 19 days before:
(ii) two passages on 189 solid medium (1st for about 14-19 days and
second for about 10-14 days) followed by:
(iii) three passages on 101 solid media and;
(iv) one to two passages on 501 solid medium (about 2 weeks per
passage) in Plant Con.RTM. containers.
Bioassay of R0 Plants
Clones developing shoots and roots on 501 medium in Plant Con.RTM.
containers were transferred to a soilless mix, grown in the growth
room, transferred to soil and the greenhouse and assayed for insect
resistance as described above. Two individual transformants,
S18BF1102 and S18BF1401, were assayed for resistance to first brood
ECB larvae and were given ratings of 8 and 1, respectively. Since
the average rating for the no-Bt controls was about 7, S18BF1401
(one R0 plant from each clone) was considered highly resistant and
S18BF1102 was considered susceptible. Since the high resistance of
clone S18BF1401 to ECB larvae has not been seen for any regenerated
maize plants unless they contained a Bt gene (with or without a PIN
gene), we concluded that the resistance was due to the expression
of the introduced Bt gene.
Sexual Transmission, Segregation and Expression of Bt Gene in
Progeny
The S18BF1401 plant was sexually crossed with inbred line "AW" and
the harvested seed was germinated, grown and assayed for
inheritance of bialaphos resistance phenotype, Bt genotype and ECB
resistance phenotype.
Seed harvested from R0 plant (R1 seed) was planted in soil in 5 gal
pots, grown in the greenhouse and assayed for resistance to
bialaphos and ECB larvae as described above. Samples were taken to
determine the genotype of the segregants (by PCR assay). The
results (Table 20) show that the progeny inherited the bialaphos
resistance and Bt genes and also inherited the resistance to ECB
larvae. The low insect damage rating number (high insect
resistance) correlated with the presence of the Bt. There was no
independent assortment of the selected (Bt) genes, indicating that
the Bt and bialaphos resistance genes in transformant S18BF1401
were closely linked.
These results show that the transformation process can be used to
introduce genes that confer resistance to insects and that the
genes can be inherited.
Examples of Other Expression Vectors
The structural gene or the genetic elements associated with the
introduced DNA are not limited to those described in the specific
examples mentioned above. We have introduced the pDPG354 vector
with a vector that carries the potato protease inhibitor I gene, as
well as the bialaphos resistance gene. We have also obtained
transformants that contain one or more of the following Bt
expression cassettes:
(1) cassette which contains the promoter from the Adh I gene of
maize, the intron I from the Adh I gene, the HD73 synthetic Bt
(FIG. 12) gene followed by a 3' sequence containing the poly A site
from the nopaline synthase (nos) gene of Agrobacterium
tumefaciens.
(2) cassette which contains the 35S promoter from CaMV, intron I
from Adh I, synthetic Bt gene (FIG. 12) followed by the nos poly
A.
(3) cassette which contains the 35S promoter, Adh intron I, transit
peptide derived from the maize rbcs (RuBISCO) gene fused directly
to the HD73 synthetic Bt gene (FIG. 12), followed by the nos poly A
sequence.
(4) cassette which contains the 35S promoter, maize RuBISCO transit
peptide fused to the synthetic Bt gene (FIG. 12) such that the
codons coding for the first 8 amino acids the Bt protein are
substituted with the first 9 amino acids of the mature maize
RuBISCO protein, followed by the `transcript 7`3' sequence (see
Example 43). In each case the transformants also contained the bar
gene.
TABLE 20 Inheritance and expression of Bt gene in progeny of
Example 43. Transgenic Bt Bt ECB Plant BarR DNA RNA Resistance 03 R
+ + 3 05 R + + 3 07 R ND + 3 10 R + + 3 13 R + + 3 15 R + + 3 17 R
+ ND 3 01 S - - 9 02 S - - 9 04 S - ND ND 06 S - - 9 08 S - - 9 09
S - - 6 11 S - ND ND 12 S - ND ND 14 S - ND 9 16 S - ND 8 AT824
.times. AW (non-transformant controls) 1 S ND ND 8 2 S ND ND 9 3 S
ND ND 9 4 S ND ND 9 5 S ND ND 9 6 S ND ND 9 Key: R = Resistant to
BASTA; ND = Not determined; S = Sensitive to bialaphos; + =
detected; - = not detected
Further genes encoding proteins characterized as having potential
insecticidal activity may also be used as transgenes in accordance
herewith. Such genes, which could be used alone or in combinations
include, for example:
1. Other Bt Genes
Endotoxin genes from other species of Bacillus thuringiensis that
are toxic either affecting viability, growth or development of the
pest insects (Hofte, H. and Whitely, H. R., 1989).
2. Digestion Inhibitors
Genes that code for inhibitors of the insect pest's digestive
system. The gene products may themselves inhibit digestion or could
code for enzymes or co-factors that facilitate the production of
inhibitors: e.g. protease inhibitors such as the cowpea trypsin
inhibitor (CpTI; V. A. Hilder et al. 1987.) and oryzacystatin from
rice (K. Abe et al., 1987 ) and amylase inhibitors such as amylase
inhibitor from wheat and barley (J. Mundy and J. C. Rogers 1986 ).
(For a reviews see C. A. Ryan. 1981. and C. A. Ryan, 1989).
3. Lectins
Genes that control the production of lectins (T. H. Czapla and B.
A. Lang. 1990; Chrispiels et al., 1991) such as wheat germ
agglutinin (Raikhol, N. V. and Wilkins, T. A., 1987) that can
affect the viability and/or growth of the insect pest.
4. Biological Peptides
Genes controlling the production of large or small polypeptides
active against insects when introduced into the insect pests, such
as (i) lytic peptides (Westerhoff et al., 1989), (ii) peptide
hormones (Kattaoka, H. et al., 1989; Keeley, L. L. and Hayes, T.
K., 1987) and (iii) toxins and venoms (Zlotkin, E., 1985; Dee, A.
et al., 1990). Such polypeptides could be synthesized in the plant
as mono- or oligomers, as fusion proteins fused to carrier
proteins, such as Bt, or delivered to the insects in the presence
of other agents, e.g. lectins, that may stimulate uptake or
activity. Biological peptides may include peptides designed by
molecular modeling to interact with components in or on insects to
affect growth, development, viability and/or behavior.
5. Lipoxygenases
These naturally occurring plant enzymes have been shown to have
anti-nutritional effects on insects and to reduce the nutritional
quality of their diet. Plants with enhanced lipoxygenase activity
may be resistant to insect feeding (S. S. Duffey and G. W. Felton,
1991).
6. Production of Inadequate Nutrients or Removal of Essential
Nutrients
Genes that code for enzymes that facilitate the production of
compounds that reduce the nutritional quality of the host plant to
insect pests. Examples include: (i) genes that alter the sterol
composition of plants may have a negative effect on insect growth
and/or development and hence provide the plant with insecticidal
activity. Essential sterols could be converted to undesirable
sterols or undesirable sterols could be produced directly; (ii)
increasing levels or the characteristics of polyphenol oxidases
and/or its substrate thereby increasing the production of toxic
products or conversion of protein nutrients to undesirable
by-products (Duffey, S. S. and Felton, G. W., 1991).
7. Qualitative or Quantitative Changes in Plant Secondary
Metabolites
DIMBOA: It has been demonstrated that some lines of maize show
resistance to first brood European Corn borer larvae due to the
production of DIMBOA (Klun, J. A. et al., 1967) in the plant. There
are also suggestions that DIMBOA production could have an impact on
rootworm damage. The introduction of DNA that changes quantity,
timing or/and location of DIMBOA production may lead to improved
resistance to several maize insect pests. Candidate genes for
consideration would include those involved in the pathway for
production of DIMBOA, e.g. genes at the bx locus (Dunn, G. M. et
al., 1981)
Maysin: Since maysin has been implicated in the resistance of maize
to earworm (Guildner, R. C., et al., 1991) the introduction of
genes that can regulate the production of maysin may be beneficial
to the production of insect resistant maize. Since the current
invention allows for the transfer of genes from diverse sources
into maize, the invention could also make possible the transfer of
the capability to produce any other secondary metabolite from any
biological source into maize provided the genes needed to control
the production of the metabolite are available. Dhurrin: genes
involved in the production of dhurrin in sorghum (Branson, T. F.,
et al., 1969) which could be transferred to maize and facilitate
resistance to corn rootworms.
8. Genes Transferred from Native Grasses
There are a number of native grasses that are resistant to some of
the insect pests of commercial inbred maize are susceptible to.
Selected landraces of Tripsacum dactyloides have been reported to
be resistant to corn rootworms (Branson, T. F., 1971). Genes coding
for the resistance trait in this species could be isolated and
transformed into maize to produce rootworm resistant maize.
9. Cuticle Degradating Enzymes
Genes that code for enzymes that affect the integrity of the insect
cuticle such as chitinase, protease and lipase (M. S. Goettel et
al., 1989; J. D. G. Jones et al., 1988) could be introduced into
maize to produce insect resistant plants. Including with these
genes would be genes that code for activities that affect insect
molting such those affecting the production of ecdysteroid
UDP-glucosyl transferase (D. R. O'Reilly and L. K. Miller,
1989).
10 Antibiotics
Genes that control the production of antibiotics that affect insect
viability, growth or development, e.g. genes for the production of
nikkomycin--a compound that inhibits chitin synthesis (U. Schluter
and G. Serfert, 1989) and avermectin and abamectin (Campbell, W.
C., Ed., 1989; Ikeda et al., 1987) and insecticides from fungi (P.
F. Dowd and O. K. Miller, 1990).
11. Antibodies
Genes that can control the production of antibodies that can
inhibit insects. Antibodies have been produced in transgenic plants
(Hiatt, A. et al., 1989). The genes coding for the antibodies to
insect targets could be cloned, engineered and transferred to maize
using the current invention.
12. Pro-insecticides
Another approach that can use genes introduced into maize is the
introduction of genes that code for enzymes that can covert a
non-toxic insecticide (pro-insecticide) applied to the outside of
the plant into an insecticide inside the plant. The benefits would
be to: (i) reduce the levels of toxic insecticides applied to crops
and (ii) make the insecticide very selective since it would only be
converted to the insecticide inside the transgenic plants. Plants
could further be engineered to degrade residual insecticide in
plants parts destined for consumption by introducing genes coding
for degradative enzymes that are expressed temporally or spacially
to degrade the insecticide in selected tissues.
13. Others
There are numerous other genes that have the potential to
facilitate resistance to insects if introduced and expressed in
maize. These include: ribosome inactivating proteins (A. M. R.
Gatehouse et al., 1990) genes controlling expression of juvenile
hormones (Hammock et al, 1990), genes that regulate plant
structures (e.g. thickness of leaves and stalks, presence of
trichomes, size of root system), the production of chemicals that
can deter insect pests, act as feeding deterrents or reduce the
immunity of the insect pest to disease (D. W. Stanley-Samuelson et
al., 1991).
In the above examples, depending on the source of the DNA, the DNA
to be introduced and expressed in maize may need to be modified to
obtain optimum expression (level, timing and location of
expression) by changing the genetic elements that regulate
expression (promoters, introns, etc.) and the coding sequence (to
improve translation, RNA stability and/or gene product
activity).
The main element required for expression of an introduced gene is
the structural gene for the protein that mediates the resistance
either directly as in the case of the insecticidal Bt protein, or
indirectly such as in the case of an enzyme that might degrade
nutrients essential for insect growth. In practice, most expression
vectors will contain:(i) a promoter, located 5' to the coding
sequence, to initiate transcription of the introduced gene; (ii)
the DNA sequence of the gene coding for the insect resistance
factor and (iii) a sequence located 3' to the coding sequence to
stimulate termination of transcription. Additional sequences
(enhancers, introns, leader sequences, transit or signal sequences
and 3' elements (transcription terminators or poly-adenylation
sites) may be used to increase expression or accumulation of the
gene product.
Promoters
Promoters that could be used include promoters from:
(a) the maize Adh I (Walker et al., 1987), cab (T. Sullivan et al.,
1989. ) rbcs (Lebrun et al., 1987), PEPCase (R. L. Hudspeth and J.
W. Grula. 1989) genes;
(b) genes that express in pollen (e.g., Hansen et al., 1989)
(c) genes isolated from tissue-specific libraries;
(d) any gene that is functional in maize;
(e) pathogens that replicate in plants, especially;
monocotyledonous plants;
(f) synthetic promoters that utilize elements from various plant
genes or gene from pathogens that replicate in plants;
(g) genes that are expressed in leaves, stalks, earshanks, collar
sheaths or roots;
(h) genes that are expressed in leaves, stalks, earshanks, collar
sheaths or roots but are not expressed in developing kernels.
In addition to promoters that produce adequate levels of the insect
resistance gene product in the tissues eaten by the insect pest, it
may sometimes be required to construct vectors that express the
anti-sense mRNA of an insect resistance gene in the kernel, or
other parts of the plant, in order to inhibit accumulation of the
gene product in locations where it may be undesirable.
Enhancers
Transcription enhancers or duplications of enhancers could be used
to increase expression. These enhancers are often found 5' to the
start of transcription in a promoter that functions in eukaryotic
cells, but can often be inserted in the forward or reverse
orientation 5' or 3' to the coding sequence. Examples of enhancers
include elements from the CamV 35S promoter and octopine synthase
genes (Ellis et al., 1987). and even promoters from non-plant
enkayotes (e.g. yeast; J. MA et al.,1988 Nature 334:631-633).
Leader Sequences
The DNA sequence between the transcription initiation site and the
start of the coding sequence is termed the untranslated leader
sequence. The leader sequence can influence gene expression and
compilations of leader sequences have been made to predict optimum
or sub-optimum sequences and generate "consensus" and preferred
leader sequences (C. P. Joshi, 1987). The sequences may increase or
maintain mRNA stability and prevent inappropriate initiation of
translation. Sequences that are derived from genes that are highly
expressed in plants, and in maize in particular, would be
preferred. The leader sequence from the soybean rbcs (RuBISCO) gene
was used in pDPG337.
Transit or Signal Peptides
Sequences that are joined to the coding sequence of the resistance
gene, which are removed post-translationally from the initial
translation product and which facilitate the transport of the
protein into or through intracellular or extracellular membranes
are termed transit (usually into vacuoles, vesicles, plastids and
other intracellular organelles) and signal sequences (usually to
the outside of the cellular membrane). By facilitating the
transport of the protein into compartments inside and outside the
cell these sequences may increase the accumulation of gene product
protecting them from proteolytic degradation. These sequences also
allow for additional mRNA sequences from highly expressed genes to
be attached to the coding sequence of the insect resistance genes.
Since mRNA being translated by ribosomes is more stable than naked
mRNA, the presence of translatable mRNA in front of the gene may
increase the overall stability of the mRNA transcript from the
insect resistance gene and thereby increase synthesis of the gene
product. Since transit and signal sequences are usually
post-translationally removed from the initial translation product,
the use of these sequences allows for the addition of extra
translated sequences that may not appear on the final
polypeptide.
In two examples (see section entitled "Examples of other expression
vectors." above) listed above, the transit peptide sequence for the
maize RUBISCO gene was fused to the Bt gene and transformed into
regenerable maize cells.
3' Elements
The most commonly used 3' elements include a sequence of DNA that
acts as a signal to terminate transcription and allow for the
poly-adenylation of the 3' end of the mRNA coding for the gene
product. These sequences can be obtained from a number of genes
that are transcribed in maize and often can be isolated from genes
that expressed in other plants or pathogens that infect plants. The
most commonly used 3' elements are the 3' elements from: (i) the
nopaline synthase gene from Agrobacterium tumefasciens (M. Bevan et
al., 1983. Nucleic Acids Res. 11:369-385), (ii) the terminator for
the T7 transcript from the octopine synthase gene of Agrobacterium
tumefasciens (and the 3' end of the protease inhibitor I or II
genes from potato or tomato.
Conclusions
The examples described above show that the invention can be used to
introduce insect resistance genes into maize and that functional
genes can be successfully inherited. Thus the invention shows great
utility in producing transgenic maize plants of significant
commercial value and benefit, allowing for improved resistance to
insect pests, improved productivity to the farmer and improved
quality of the environment by reducing the dependency on chemical
insecticides.
While the invention is susceptible to various modifications and
alternative forms, specific embodiments thereof have been shown by
way of example in the drawings and herein be described in detail.
It should be understood, however, that it is not intended to limit
the invention to the particular forms disclosed, but on the
contrary, the intention is to cover all modifications, equivalents,
and alternatives falling within the spirit and scope of the
invention as defined by the appended claims.
REFERENCES
The references listed below are incorporated herein by reference to
the extent that they supplement, explain, provide a background for,
or teach methodology, techniques, and/or compositions employed
herein.
Abe, K. et al., (1987) J.Biol.Chem. 262: 16793-16797
Abel, P. P., Nelson, R. S., De, B., Hoffman, N., Rogers, S. G.,
Fraley, R. T. and Beachy, R. N. 1986. Science 232:738-743.
Adams, W. R., Adams, T. R., Wilston, H. M., Krueger, R. W., and
Kausch, A. P., Silicone Capsules for Controlled Auxin Release, in
preparation.
Adang, M. J. et al. (1985) Gene 289-300.
An, G. et al., (1989) Plant Cell 1: 115-122.
Armaleo et al. (1990) Current Genetics 17:97-103.
Armstrong C. L., Green C. E. (1985). Planta 164:207-214.
Armstrong, C. L., Green, C. E., and Phillips, R. L. 1991. Maize
Gentics Coop Newsletter 65:92-93.
Barkai-Golan, R., Mirelman, D., Sharon, N. (1978) Arch. Microbiol
116:119-124.
Barton, K. A., Whiteley, H. R. & Yang, K. S. (1987) Plant
Physiol. 85, 1103-1109.
Beck, E., Ludwig, G., Auerswald, E. A., Reiss, B., Schaller, H.
1982. Gene 19: 327-336.
Belanger and Kriz Genetics 129:863-872. 1991
Benfey, P. N., Ren, L. & Chua, N. H. (1989) EMBO Journal,
8(8):2195-2202.
Berg, D. E., Egner, C., Hirschel, B. J., Howard, J., Jorgensen, R.,
and Tisty, T. D. (1980) Cold Spring Harbor Symposium
45:448-465.
Bernal-Lugo, I. and Leopold, A. C. 1992. Plant Physiol.
98:1207-1210.
Berry-Lowe, S. L. et al., 1982. J.Mol.Appl.Genet 1:483-498
Bevan, M., 1984. Nucleic Acid Research 12: 8711-8721.
Bevan, M., Barnes, W. M., Chilton, M. D., 1983. Nucleic Acid
Research. 11:369-385.
Blackman, S. A., Obendorf, R. L., Leopold, A. C. 1992. Plant
Physiol. 100:225-230.
Bol, J. F., Linthorst, H. J. M., Cornelissen, B. J. C. 1990. Annu.
Rev. Phytopath. 28:113-138.
Bottino P. J., (1975). Botany 15:1-16.
Bouchez D., Tokuhisa J. G., Llewellyn D. J., Dennis E. S. and Ellis
J. G., (1989) EMBO Journal 8(13):4197-4204.
Bowler, C., Van Montagu, M., and Inze, D. 1992. Ann Rev. Plant
Physiol. 43:83-116.
Branson, T. F. et al., (1969) J. Econ.Entom. 62: 1375-1378.
Branson, T. F. (1971) Annals of Am. Soc of Entomol. 64:861-863.
Branson, T. F. and Guss, P. L. 1972. Proceedings North Central
Branch Entomological Society of America 27:91-95.
Broakaert, W. F., Parijs, J., Leyns, F., Joos, H., Peumans, W. J.
(1989) Science 245:1100-1102.
Buchanan-Wollaston, V., Snape, A., and Cannon, F. 1992. Plant Cell
Reports 11:627-631.
Callis, J., Fromm, M., Walbot, V. (1987), Genes and Develop.
1:1183-1200.
W. C. Campbell, ed. 1989. Avermectin and Abamectin.
Cao et al., Plant Cell Rep (1992) 11:586-591.
Carlsson J., Drevin H., Axen R. (1978). Biochem J. 173:723.
Cavener & Ray (1991). Nucl Acids Res 19:3185-3192.
Chauboute, H. E., Chambet, N., Philipps, G., Ehling, M. and Grigot,
C. 1987. Plant Mol. Biol. 8: 179-191.
Chaubet, N., Clement, B., Philipps, G. and Gigot, C. 1991. Plant
Molecular Biology 17: 935-940.
Chandler, V. L., Radicella, J. P., Robbins, P. P., Chen, J., Turks,
D. (1989), The Plant Cell 1: 1175-1183
Chomet P. S., Wessler S., Dellaporta S. L. (1978). EMBO J
6:295-302.
Chrispiels, M. A. et al., (1991) The Plant Cell 3:1-9
Chu C. C., Wang C. C., Sun C. S., Hsu C., Yin K. C., Chu C. Y., Bi
F. Y. (1975). Scientia Sinica 18:659-668.
Clark, R. (1982). J. of Plant Nutrition 5:1039.
Coe, E. H., Neuffer, M. G., and Hoisington, D. A. (1988), in Corn
and Corn Improvement, Sprague, G. F. and Dudley, J. W., eds., pp.
81-258
Comai, L., U.S. Pat. No. 4,535,060; and ATCC deposit 39256.
Comai L., Gacciotti D., Hiatt W. R., Thompson G., Rose R. E.,
Stalker D. (1985). Nature 317:741-744
Comai, L., Sen, L. C., Stalker, D. M. 1983. Science
221:370-371.
Conger, B. V., Novak, F. J., Afza, R., Erdelsky, K. (1987), Plant
Cell Rep 6:345-347
Conkling, M. A., Cheng, C. L., Yamamoto, Y. T., Goodman, H. M.
(1990), Plant Physiol. 93:1203-1211.
Coxson, D. S., Mcintyre, D. D., and Vogel, H. J. 1992. Biotropica
24: 121-133.
Cristou P., McCabe D. E., Swain W. F. (1988). Plant Physiol
87:671-674.
Cuozzo, M., O'Connell, K. M., Kaniewski, W., Fang, R. X., Chua, N.
and Turner, N. 1988. Bio/Technology 6:549-553.
Cutler, A. J., Saleem, M., Kendell, E., Gusta, L. V., Georges, F.,
Fletcher, G. L. (1989), J Plant Physiol 135:351-354.
Czapla and Lang (1990), J. Econ. Entomol. 83:2480-2485.
Davies, T. G. E., Thomas, H., Thomas, B., Rogers, L. J. 1990. Plant
Physiol. 93:588-595.
De Block, M., Botterman J., Vandiwiele M., Dockx J., Thoen C.,
Gossele V, Movva N. R., Thompson C., Van Montagu M., Leemans J.
(1987). EMBO J. 6:2513-2518; see also PCT Publication number WO
87/05629, published Sep. 24, 1987.
De Block, M., Botterman J., Vandiwiele M., Dockx J., Thoen C.,
Gossele V, Movva N. R., Thompson C., Van Montagu M., Leemans J.
(1989). Plant Physiol 91:694-701.
DE 3642 B29 A.
Dee. A., R. M. Belagaje, K. Ward, E. Chio and Mei-Huei T. Lai
(1990) BioTechnology 8:339-342.
Dekeyser R., Claes B., Marichal M., Van Montagu M., Caplan A.
(1989). Plant Physiol 90:217-223.
Dekeyser et al. (1990), Plant Cell, 2:591-602.
Delannay X., LaVallee B. J., Proksch R. K., Fuchs R. L., Sims S.
R., Greenplate J. R., Marrone P. G., Dodson R. B., Augustine J. J.,
Layton J. G., Fischhoff D. A. (1989). Bio/Technol 7:1265-1269.
Dellaporta, S., Greenblatt, I., Kermicle, J., Hicks, J. B.,
Wessler, S. (1988) in Chromosome Structure and Function: Impact of
New Concepts, 18th Stadler Genetics Symposium, J. P. Gustafson and
R. Appels, eds (New York: Plenum Press), pp. 263-282.
Dellaporta, S. L., Greenblatt, I. M., Kermicle, J., Hicks, J. B.,
and Wessler, S. (1988), Stadler Symposium 11:263-282.
Depicker, A. G., Jacobs, A. M., and Van Montagu, M. C. 1988. Plant
Cell Reports 7:63-66.
DeWet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., Subramani,
S. 1987. Mol. Cell Biol. 7:725-737.
Dhaese, P. et al.,1983, EMBO J. 2,419-426.
D'Halluin, K., Bonne, E., Bossut, M. De Beuckeleer, M., and
Leemans, J. The Plant Cell 4: 1495-1505.
Doring, H. P. and Starlinger (1986), Ann. Rev. Genet.
20:175-200
Dowd, P. F. and O. K. Miller (1990) Entomol. exp. appl. 57:
23-28.
Duffey, S. S. and G. W. Felton, 1991. "Bioregulators," P. A. Hedin,
Ed., ACS Symp.Series #449).
Dunn, G. M. et al.,(1981) Can.J. Plant Sci., 61:583-593).
Dure, L., Crouch, M., Harada, J., Ho, T.-H. D., Mundy, J.,
Quatrano, R., Thomas, T., and Sung, Z. R. 1989. Plant Molecular
Biology 12:475-486.
Ebert, P. R., Ha, S. B., An. G. (1987), PNAS 84:5745-5749.
Eichholtz, D. A., Rogers, S. G., Horsch, R. B., Klee, H. J.,
Hayford, M., Hoffman, N. L., Bradford, S. B., Fink, C., Flick, J.,
O'Connell, K. M., Frayley, R. T. 1987. Somatic Cell Mol. Genet. 13:
67-76.
Ellis J. G., Llewellyn D. J., Walker J. C., Dennis E. S., and
Peacock W. J., (1987) EMBO Journal 6(11):3203-3208.
Erdmann, N., Fulda, S., and Hagemann, M. 1992. J. Gen. Microbiology
138:363-368.
European Patent Application 154,204 (Sep. 11, 1985).
European Patent Application publication number 0218571 A2,
published Apr. 15, 1987.
Farrell & Beachy, (1990), Plant Mol. Biol. 15:821.
Federoff, N. (1989), "Maize Transposable Elements", in Mobile
DNA.
Wowe, M. M. and Berg, D. E., eds., Amer. Soc. Microbiol., Wash.,
D.C., pp. 377-411.
Feinberg A. P., Vogelstein B. (1983). Anal Biochem 132:6-13.
Finkle B. J., Ulrich J. M., Rains W., Savarek S. J. (1985). Plant
Sci 42:133-140.
Fischhoff D. A., Bowdish K. S., Perlak F. J., Marrone P. G.,
McCormick S. M., Niedermeyer J. G., Dean D. A., Kusano-Kretzmer K.,
Mayer E. M., Rochester D. E., Rogers S. G., Fraley R. T.
Bio/Technol 5:807-813.
Fitzpatrick, T. 1993. Gen. Engineering News 22 (March 7): 7.
Fluhr, R., Moses, P., MOrelli, G., Coruzzi, C., Chua, N.-H. 1986.
EMBO J. 5: 2063-2071.
Fransz, P. F., de Ruijter, N. C. A., Schel, J. H. N. (1989), Plant
Cell Rep 8:67-70
Frisch et al. Mol. Gen. Genet. 228:287-293, 1991
Fromm M. E., Taylor L. P., Walbot V. (1986). Nature
312:791-793.
Fromm, H., Katagiri, F., Chua, N. H. (1989), The Plant Cell
1:977-984.
Gallie, D. R., Lucas, W. J., Walbot, V. (1989), The Plant Cell
1:301-311.
Gatehouse, A. M., Dewey, F. M., Dove, J., Fenton, K. A., Dusztai,
A. (1984), J Sci Food Agric 35:373-380.
Gatehouse, A. M. R., Barbieri, L., Stirpe, F. and Croy, R. R. D.
1990. Entomol. Exp. Appl. 54:43-51.
Gelvin, S. B., Schilperoort, R. A., Varma, D. P. S., eds. Plant
Molecular Biology Manual (1990).
Goettel, M. S., R. J. St. Leger, N. W. Rizzo, R. C. Staples, and D.
W. Roberts (1989) J. Gen. Microbiol. 135:2233-2239.
Goff, S., Klein, T., Ruth, B., Fromm, M., Cone, K., Radicella, J.,
Chandler, V. 1990. EMBO J.: 2517-2522.
Graham, J. S., Hall, G., Pearce, G., Ryan, C. A. 1986 Mol. Cell.
Biol. 2:1044-1051.
Graham, J. S. et al., 1985, J Biol Chem 260: 6561-6564
Guerrero, F. D., Jones, J. T., Mullet, J. E. 1990. Plant Molecular
Biology 15: 11-26.
Guildner, R. C. et al., 1991, in "Naturally Occurring Pest
Bioregulators." ed. P. A. Hedin. ACS Sympos. Series #449)
Gupta, A. S., Heinen, J. L., Holaday, A. S., Burke, J. J., and
Allen, R. D. 1993. Proc. Natl. Acad. Sci USA 90:1629-1633.
Goring, D. R., Thomson, L., Rothstein, S. J. 1991. Proc. Natl. Acad
Sci. USA 88:1770-1774.
Guilley, H. et al., 1982 Cell 30:763-773.
Hammock, B. D., Bonning, B. C., Possee, R. D., Hanzlik, T. N., and
Maeda, S. (1990), Nature 344:458-461.
Hansen, D. D. et al 1989. Plant Cell 1:173-179
Haughn G. W., Smith J., Mazur B., Somerville, C. (1988). Mol Gen
Genet 211:266-271.
Hauptmann R. M., Vasil V., Ozias-Aikins P., Tabaeizadeh Z., Rogers
S. G., Fraley R. T., Horsch R. B., Vasil I. K. (1988). Plant
Physiol 86:602-606.
Heidecker & Messing (1986). Ann Rev Plant Physiol,
37:439-466.
Hemenway, C., Fang, R., Kaniewski, W. K., Chua, N. and Turner, N.
E. 1988. The EMBO J. 7:1273-1280.
Hiatt. A., R. Caffetterkey and K. Bowdish (1989) Nature
342:76-78.
Hilder, V. A., Gatehouse, A. M. R., Sheerman, S. E., Barker, R. F.,
Boulter, D. (1987) Nature 330:160-163.
Hinchee, M. A. W., Connor-Ward, D. V., Newell, C. A., McDonell, R.
E.,
Sato, S. J., Gasser, C. S., Fischhoff, D. A., Re, C. B., Fraley, R.
T., Horsch, R. B. (1988) Bio/technol 6:915-922.
Hofte, H. and Whiteley, H. R., 1989. Microbiological Reviews. 53:
242-255.
Hudspeth, R. L. and J. W. Grula. 1989. Plant Mol. Biol.
12:579-589.
Ikuta, N., Souza, M. B. N., Valencia, F. F., Castro, M. E. B.,
Schenberg, A. C. G., Pizzirani-Kleiner, A., Astolfi-Filho, S.
(1990), Bio/technol 8:241-242.
Ikeda, H., Kotaki, H., Omura, S. (1987), J Bacteriol
169:5615-5621.
Ingelbrecht, I. L. W., Herman, L. M. F., Dekeyser, R. A., Van
Montagu, M. C., Depicker, A. G. (1989), The Plant Cell
1:671-680.
IPRF European Patent Application No. 90033A.
Iturraga, G et al. (1989), Plant Cell 1:8447.
Jefferson R. A. (1987). P1 Mol Biol Repr 5:387-405.
Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W. 1987. EMBO J.
6: 3901-3907.
Jones, J. D. G., C. Dean, D. Gidoni, D. Gilbert, D. Bond-Nutter, R.
Lee, J. Bedbrook, and P Dunsmuir. (1988) Mol. Gen. Genet. 212:
536-542.
Johnson, R., Norvdez, J., An, G, and Ryan, C. (1989), Proc. Natl.
Acad. Sci. USA 86:9871-9875.
Joshi, C. P. (1987) Nucleic Acids Res., 15:6643-6653.
Kaasen, I., Falkenberg, P., Styrvold, O. B., Strom, A. R. 1992. J.
Bacteriology 174:889-898.
Kaeppler et al. (1990) Plant Cell Reports 9: 415-418.
Karsten, U., West, J. A. and Zuccarello, G. 1992. Botanica Marina
35:11-19.
Kattaoka, H., R. G. Troetschler, J. P. Li, S. J. Kramer, R. L.
Carney and D. A. Schooley. (1989) PNAS 86:2976-2980.
Katz et al. (1983) J. Gen. Microbiol. 129:2703-2714.
Kay, R. et al. (1987) Science 236, 1299-1302
Keeley, L. L. and T. K. Hayes (1987). Insect Biochem
17:639-651.
Keller et al. (1989), EMBO J., 8(5):1309-1314.
Kirihara, J. A., Petri, J. B., and Messing, J. 1988. Gene
71:359-370,
Kirihara, J. A., Hunsperger, J. P., Mahoney, W. C., Messing, J.
1988. Mol. Gen. Genet. 211: 477-484.
Klein, T. M., Gradziel, T., Fromm, M. E., Sanford, J. C. 1988.
Bio/Technology 6:559-563.
Klein T. M., Kornstein L., Sanford J. C., Fromm M. E. (1987).
Nature 327:70-73.
Klein T. M., Kornstein L., Sanford J. C., Fromm M. E. (1989). Plant
Physiol 91:440-444.
Klun, J. A. et al., (1967) J. Econ. Entom. 60:1529-1533)
Koster, K. L. and Leopold, A. C. 1988. Plant Physiol.
88:829-832.
Kozak M. (1984). Nucl Acids Res 12:857-872.
Krzyzek, R., and Laursen, C. PCT Publication WO 92/12250.
Krzyzek et al. (1990), U.S. patent application Ser. No. 07/635,279,
filed Dec. 28, 1990.
Laemmli, U. K. 1970. Nature 227:280.
Laufs, J., Wirtz, U., Kammann, M., Matzeit, V., Schaefer, S.,
Schell, J., Czernilofsky, A. P., Baker, B., and Gronenborn, B.
1990. Proc. Natl. Acad. Sci: 7752-7756.
Laursen, C. M., Krzyzek, R. A., Flick, E. E., Anderson, P. C.,
Spencer, T. M. 1993. Plant Molecular Biology. Submitted.
Lawton, M. A., Tierney, M. A., Nakamura, I., Anderson, E., Komeda,
Y., Dube, P., Hoffman, N., Fraley, R. T., Beachy, R. N. (1987),
Plant
Mol. Biol. 9:315-324.
Lebrun, M., Waksman, G., and Freyssinet, G. 1987. Nucl. Acid. Res.
15:4360
Lee et al. (1991), PNAS, 88:6389-6393.
Lee and Saier, 1983. J. of Bacteriol. 153-685.
Levings, C. S., III. 1990. Science 250: 942-947.
Lindsey and Jones (1987a), Planta, 172:346-355.
Lindsey and Jones (1987b), Plant Mol. Biol., 10:43-52.
Lindsey and Jones (1990), Physiol. Plant, 79:168-172.
Lorz H., Baker B., Schell J. (1985). Mol Gen Genet 199:178-182.
Loomis, S. H., Carpenter, J. F., Anchordoguy, T. J., Crowe, J. H.,
and Branchini, B. R. 1989. J. Expt. Zoology 252:9-15.
Lyznik L. A., Ryan R. D., Ritchie S. W., Hodges T. K. (1989). Plant
Mol Biol 13:151-16.
MA, J. et al., 1988 Nature 334:631-633).
Maniatis, T., E. F. Fritsch and J. Sambrook (1982) Molecular
Cloning. Cold Spring Harbor Laboratory. First Ed.
Mariani, C., De Beuckeleer, M., Truettner, J., Leemans, J. and
Goldberg, R. B. 1990. Nature 347:737-741.
McCabe D. E., Swain W. F., Martinell B. J., Cristou P. (1988).
Bio/Technol 6:923-926.
McDaniel C. N., Poethig R. S. (1988). Planta 175:13-22.
Mundy, J. and J. C. Rogers (1986) Planta 169:51-63
Mundy, J. and Chua, N.-H. 1988. The EMBO J. 7: 2279-2286.
Murdock et al., (1990) Phytochemistry 29:85-89.
Murakami T., Anzai H., Imai S., Satoh A., Nagaoka K., Thompson C.
J. (1986). Mol Gen Genet 205:42-50.
Murashige T., Skoog F. (1962). Physiol Plant 15:473-497.
Napoli, C., Lenieux, C., Jorgense, R. 1990. Plant Cell
2:279-289.
Nelson R. S., McCormick S. M., Delannay X., Dube P., Layton J.,
Anderson E. J., Kaniewska M., Proksch R. K., Horsch R. B., Rogers
S. G., Fraley R. T. Beachy R. N. (1988). Bio/Technol 6:403-409.
Nester, E. W. et al., (1984). Ann. Rev. Plant Physiol
35:387-413.
Odell, J. T., Nagy, F., Chua, N. H. (1985) Nature 313:810-812.
Ogawa, Y. et al (1973). Sci. Rep., Meija Seika 13:42-48.
Omirulleh, S, Abraham, M., Golovkin, M., Stefanov, I., Karabaev, M.
K., Mustardy, L., Morocz, S., Dudits, D. Plant Molecular Biology
21:415-428.
O'Reilly, D. R. and L. K. Miller (1989) Science 245: 1110-1112.
Ow, D. W., Wood, K. V., DeLuca, M., deWet, J. R., Helinski, D. R.,
Howell, S. H. (1986) Science 234:856-859.
PCT No. WO 87/-00141.
Pearce, G., Strydom, D., Johnson, S., Ryan, C. A. 1991. Science
253: 895-898.
Perlak F. J., Fuchs R. L., Dean D. A., McPherson S. L., and
Fischhoff D. A., (1991) Proc. Natl. Acad. Sci. USA
88:3324-3328.
Pfahler P. L. (1967). Can J. Bot 45:836-845.
Phi-Van, L., Kries, J. P., Ostertag, W., Stratling, W. H. (1990),
Mol Cell Biol 10:2302-2307.
Piatkowski, D., Schneider, K., Salamini, F. and Bartels, D. 1990.
Plant Physiol. 94:1682-1688.
Potrykus, I., Saul, M. W., Petruska, J., Paszkowski, J., Shillito,
R. D. (1985), Mol Gen Genet 199:183-188
Potrykus I. (1989) Trends Biotechnol 7:269-273.
Prasher, et al. (1985) Biochem. Biophys. Res. Commun.,
126(3):1259-1268.
Prioli L. M., Sondahl M. R. (1989). Bio/Technol 7:589-594.
Puite et al. (1985) Plant Cell Rep. 4:274-276.
Raikhol, N. V. and T. A. Wilkins, 1987, PNAS 84:6745-6749.
Reed, R. H., Richardson, D. L., Warr, S. R. C., Stewart, W. D. P.
1984. J. Gen. Microbiology 130:1-4.
Rhodes C. A., Pierce D. A., Mettler I. J., Mascarenhas D., Detmer
J. J. (1988). Science 240:204-207.
Richaud, R., Richaud, C., Rafet, P. and Patte, J. C. 1986. J.
Bacteriol. 166: 297-300.
Ryan, C. A. (1981) Biochemistry of Plants 6: ch. 6, Acad. Press
Ryan, C. A. (1989) BioEssays 10:20-24.
Sambrook, J., Fritsch, E. F., and Maniatus, T. (1989), Molecular
Cloning, A Laboratory Manual 2nd ed.
Schluter, U. and Seifert, G. 1989. J. Inver. Pathol.
53:387-391.
Schmidt, R. J., Ketudat, M., Ankerman, M. J. and Hoschek, G. 1992.
Plant Cell 4: 689-700.
Shagan, T., Bar-Zvi, D. 1993. Plant Physiol. 101:1397-1398.
Shah D. M., Horsch R. B., Klee H. J., Kishore G. M., Winter J. A.,
Tumer N. E., Hironaka C. M., Sanders P. R., Gasser C. S., Aykent
S., Siegel N. R., Rogers S. G., Fraley R. T. (1986). Science
233:478-481.
Shapiro, J. A. (1983), Mobile Genetic Elements, Academic Press,
N.Y.
Shillito R. D., Carswell G. K., Johnson C. M., DiMaio J. J., Harms
C. T. (1989). Bio/Technol 7:581-587.
Shimamoto K., Terada R., Izawa T., Fujimoto H. (1989). Nature
338:274-276.
Shure M., Wesler S., Federoff, N. (1983). Cell 35:225-233.
Skriver, K. and Mundy, J. 1990. Plant Cell 2:503-512.
Smith, J. J., Raikhel, N. V. 1989. Plant Mol. Biology 13:
601-603.
Smith, C. J. S., Watson, C. F., Bird, C. R., Ray, J., Schuch, W.
and Grierson, D. 1990. Mol. Gen. Genet. 224:447-481.
Southern E. M. (1975). J Mol Biol 98:503-517.
Spencer, T. M., Gordon-Kamm, W., Daines, R., Start, W., Lemaux, P.
1990. Theor. Appl. Genet. 79: 625-631.
Spencer, T. M., O'Brien, J. V., Start, W. G., Adams, T. R.,
Gordon-Kamm, W. J. and Lemaux, P. G. 1992. Plant Molecular Biology
18:201-210.
Spencer, T. M., Laursen, C. M., Krzyzek, R. A., Anderson, P. C. and
Flick, C. E. 1993. Proceedings of the NATO Advanced Study Institute
on Plant Molecular Biology. In press.
Stalker, D. M., McBride, K. E., and Malyj, L. Science 242: 419-422,
1988.
Stalker, D. M., Malyj, L. D., McBride, K. E. (1988), J Biol Chem
263:6310-6314.
Stanley-Samuelson. D. W., E. Jensen, K. W. Nickerson, K. Tiebel, C.
L. Ogg and R. W. Howard (1991) PNAS 88: 1064-1068.
Stief, A., Winter, D., Stratling, W. H., and Sippel, A. E. (1989),
Nature 341:343.
Stiefel et al. (1990), The Plant Cell, 2:785-793.
Stougaard, J. 1993. The Plant Journal 3:755-761.
Sullivan, T. et al., 1989. Mol. Gen. Genet 215:431-440)
Sutcliffe, J. G. (1978), Proc Natl Acad Sci USA 75:3737-3741.
Szoka, U.S. Pat. No. 4,394,448.
Tarczynski, M. C., Jensen, R. G., and Bohnert, H. J. (1992), Proc.
Natl. Acad. Sci. USA, 89: 2600
Tarczynski, M. C., Jensen, R. G., and Bohnert, H. J. 1993. Science
259:508-510.
Thillet, J., Absil, J., Stone, S. R., Pictet, R. (1988), J Biol
Chem 263:12500-12508.
Thompson C. K., Movva N. R., Tizard R., Crameri R., Davies J. E.,
Lauwereys M., Botterman J. (1987). EMBO J 6:2519-2623.
Timmermans, M. C. P., Maliga, P., Maliga, P., Vieiera, J. and
Messing, J. 1990. J. Biotechnol. 14: 333-344.
Tomes D. (1990). Annual Meting Proceedings, 26th Annual Corn
Breeders School, University of Illinois, Feb. 26-27, pp. 7-9.
Topfer et al. (1989), Plant Cell, 1:133-139.
Topfer et al. (1990), Physiol. Plant, 79:158-162.
Twell D., Klein T. M., Fromm M. E., McCormick S. (1989). Plant
Physiol 91:1270-1274.
Ueda, T. and Messing, J. 1991. Theor. Appl. Genet. 82: 93-100.
Ugaki et al., (1991). Nucl Acid Res, 19:371-377.
U.S. Pat. No. 4,535,060.
Vaeck M., Reynaerts A., Hofte H., Jansens S., De Beuckeleer M.,
Dean C., Zabeau M., Van Montagu M., Leemans J. (1987). Nature
328:33-37.
Vain, P., Yean, H., and Flament, P. 1989. Plant Cell, Tissue and
Organ Culture 18: 143-151.
van der Krol, A. R., Mur, L. A., Beld, M., Mol, J. N. M. 1990.
Plant Cell 2:291-299.
van Rensburg, L., Kruger, G. H. J., and Kruger, H. 1993. J. Plant
Physiol. 141:188-194.
Vasil, V., Clancy, M., Ferl, R. J., Vasil, I. K., Hannah, L. C.
(1989), Plant Physiol. 91:1575-1579.
Vernon, D. M. and Bohnert, H. J. 1992. The EMBO J.
11:2077-2085.
Waldron, C., Murphy, E. B., Roberts, J. L., Gustafson, G. D.,
Armour, S. L., and Malcolm, S. K. Plant Molecular Biology 5:
103-108, 1985.
Walker, J. C., Howard, E. A., Dennis, E. S., Peacock, W. J (1987),
PNAS 84:6624-6628.
Walters, D. A., Vetsch, C. S., Potts, D. E., and Lundquist, R. C.
Plant Mol Biol 18:189-200, 1992.
Wang, Y., Klein, T., Fromm, M., Cao, J., Sanford, J., Wu, R. 1988.
Plant Molecular Biology 11:433-439.
Wang, Y., Zhang, W., Cao, J., McEhoy, D. and Ray Wu. 1992.
Molecular and Cellular Biology 12: 3399-3406.
Watrud, L. S., Perlak, F. J., Tran, M.-T., Kusano, K., Mayer, E.
J., Miller-Widemann, M. A., Obukowicz, M. G., Nelson, D. R.,
Kreitinger, J. P., and Kaufman, R. J. (1985), in Engineered
Organisms and the Environment, H. O. Halvorson et al., eds., Am.
Soc. Microbiol., Washington, D.C.
Westerhoff, H. V., D. Juretic, R. W. hendler and M. Zasloff. (1989)
PNAS 86: 6597-6601.
White, J., Chang, S. P., Bibb, M. J., Bibb, M. J. (1990), Nucl
Acids Res, 18:1062.
Withers L. A., King P. J. (1979). Plant Physiol 64:675-678.
Wolter, F., Schmidt, R., and Heinz, E. 1992. The EMBO J.
4685-4692.
Wong, Y. C. et al. (1988). Plant Mol Biol 11:433-439.
Wyn Jones, R. G., and Storey, R. 1981. Physiology and Biochemistry
of Drought Resistance in Plants:171-204.
Xiang, C. and Guerra, D. J. 1993. Plant Physiol. 102:287-293.
Yamaguchi-Shinozaki, K., Koizumi, M., Urao, S., Shinozaki, K. 1992.
Plant Cell Physiol. 33:217-224.
Yang, N. S., Russell, D. (1990), PNAS 87:4144-4148.
Yang H., Zhang M. H., Davey M. R., Mulligan B. J., Cocking E. C.
(1988). Plant Cell Rep 7:421-425.
Yang, L. Y., Gross, P. R., Chen, C. H., Lissis, M. 1992. Plant
Molecular Biology 18: 1185-1187.
Yugari et al J. Biol. Chem 240:4710-4716, 1965.
Zhang M. H., Yang H., Rech E. L., Golds T. J., David A. S.,
Mulligan B. J., Cocking E. C., Davey E. R. (1988). Plant Cell Rep
7:379-384.
Zlotkin, E. 1985. Comprehensive Insect Physiol. Biochem. Parmacol.
vol 10, chapter 15:499-541
Zukowsky et al. (1983), Proc. Natl. Acad. Sci. USA
80:1101-1105.
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 26 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 15 amino acid residues (B) TYPE: amino
acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 1 Met Ala Thr Val Pro Glu Leu Asn Cys Glu
Met Pro Pro Ser Asp 1 5 10 15 (2) INFORMATION FOR SEQ ID NO: 2: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 2 GAGGATCCGT CGACATGGTA AGCTTAGCGG
GCCCC 35 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 3 GATCCGTCGA CCATGGCGCT TCAAGCTTC 29 (2)
INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4
GCAGCTGGTA CCGCGAAGTT CGAAGGGCT 29 (2) INFORMATION FOR SEQ ID NO:
5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 49 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 CTAGACAACA AAGCAGCAAC
CATGGCCAGC ATGCAAGGCC TCATGCATC 49 (2) INFORMATION FOR SEQ ID NO:
6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 49 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6 CCGGGATGCA TGAGGCCTTG
CATGCTGGCC ATGGTTGCTG CTTTGTTGT 49 (2) INFORMATION FOR SEQ ID NO:
7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acid residues
(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7 Met Ala Ser Met Gln Gly Leu
Met His Pro Gly 1 5 10 (2) INFORMATION FOR SEQ ID NO: 8: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acid residues (B)
TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 8 Val Lys Cys Met Gln Val 1 5 (2)
INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9
AAGUGAAGUG AAGUGAAG 18 (2) INFORMATION FOR SEQ ID NO: 10: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 1845 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B)
LOCATION: 1..1839 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10 ATG GAT
AAC AAT CCG AAC ATC AAT GAA TGC ATT CCT TAC AAT TGC CTC 48 Met Asp
Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu 1 5 10 15
AGC AAC CCT GAA GTG GAA GTG CTG GGT GGC GAA CGC ATC GAA ACC GGT 96
Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly 20
25 30 TAC ACC CCA ATC GAT ATT TCC CTG TCC CTG ACC CAA TTT CTG CTG
AGC 144 Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu
Ser 35 40 45 GAA TTT GTG CCC GGT GCT GGC TTT GTG CTG GGC CTG GTG
GAT ATC ATC 192 Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val
Asp Ile Ile 50 55 60 TGG GGC ATT TTT GGT CCC TCC CAA TGG GAC GCC
TTT CTG GTG CAA ATT 240 Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala
Phe Leu Val Gln Ile 65 70 75 80 GAA CAG CTG ATT AAC CAA CGC ATC GAA
GAA TTC GCT AGG AAC CAA GCC 288 Glu Gln Leu Ile Asn Gln Arg Ile Glu
Glu Phe Ala Arg Asn Gln Ala 85 90 95 ATT TCC CGC CTG GAA GGC CTG
AGC AAT CTG TAC CAA ATT TAC GCC GAA 336 Ile Ser Arg Leu Glu Gly Leu
Ser Asn Leu Tyr Gln Ile Tyr Ala Glu 100 105 110 TCC TTT CGC GAG TGG
GAA GCC GAT CCT ACC AAT CCA GCC CTG CGC GAA 384 Ser Phe Arg Glu Trp
Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu 115 120 125 GAG ATG CGC
ATT CAA TTC AAT GAC ATG AAC AGC GCC CTG ACC ACC GCT 432 Glu Met Arg
Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala 130 135 140 ATT
CCT CTG TTT GCC GTG CAA AAT TAC CAA GTG CCT CTG CTG TCC GTG 480 Ile
Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val 145 150
155 160 TAC GTG CAA GCT GCC AAT CTG CAT CTG TCC GTG CTG CGC GAT GTG
TCC 528 Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val
Ser 165 170 175 GTG TTT GGC CAA AGG TGG GGC TTT GAT GCC GCC ACC ATC
AAT AGC CGC 576 Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile
Asn Ser Arg 180 185 190 TAC AAT GAT CTG ACC AGG CTG ATT GGC AAC TAC
ACC GAT TAC GCT GTG 624 Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr
Thr Asp Tyr Ala Val 195 200 205 CGC TGG TAC AAT ACC GGC CTG GAA CGC
GTG TGG GGC CCA GAT TCC CGC 672 Arg Trp Tyr Asn Thr Gly Leu Glu Arg
Val Trp Gly Pro Asp Ser Arg 210 215 220 GAT TGG GTG AGG TAC AAT CAA
TTT CGC CGC GAA CTG ACC CTG ACC GTG 720 Asp Trp Val Arg Tyr Asn Gln
Phe Arg Arg Glu Leu Thr Leu Thr Val 225 230 235 240 CTC GAT ATC GTG
GCT CTG TTC CCA AAT TAC GAT AGC CGC CGC TAC CCA 768 Leu Asp Ile Val
Ala Leu Phe Pro Asn Tyr Asp Ser Arg Arg Tyr Pro 245 250 255 ATT CGA
ACC GTG TCC CAA CTG ACC CGC GAA ATT TAC ACC AAC CCA GTG 816 Ile Arg
Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val 260 265 270
CTG GAA AAT TTT GAT GGT AGC TTT CGC GGC TCC GCT CAG GGC ATC GAA 864
Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu 275
280 285 CGC AGC ATT AGG AGC CCA CAT CTG ATG GAT ATC CTG AAC AGC ATC
ACC 912 Arg Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile
Thr 290 295 300 ATC TAC ACC GAT GCT CAT AGG GGT TAC TAC TAC TGG TCC
GGC CAT CAA 960 Ile Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser
Gly His Gln 305 310 315 320 ATC ATG GCT TCC CCT GTG GGC TTT TCC GGG
CCA GAA TTC ACC TTT CCA 1008 Ile Met Ala Ser Pro Val Gly Phe Ser
Gly Pro Glu Phe Thr Phe Pro 325 330 335 CTG TAC GGC ACG ATG GGC AAT
GCC GCT CCA CAA CAA CGC ATT GTG GCT 1056 Leu Tyr Gly Thr Met Gly
Asn Ala Ala Pro Gln Gln Arg Ile Val Ala 340 345 350 CAA CTG GGT CAG
GGC GTG TAC CGC ACC CTG TCC TCC ACC CTG TAC CGC 1104 Gln Leu Gly
Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg 355 360 365 CGC
CCT TTT AAT ATC GGC ATC AAC AAC CAG CAA CTG TCC GTG CTG GAC 1152
Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp 370
375 380 GGC ACC GAA TTT GCT TAC GGC ACC TCC TCC AAT CTG CCA TCC GCT
GTA 1200 Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser
Ala Val 385 390 395 400 TAC CGC AAG AGC GGC ACC GTG GAT TCC CTG GAT
GAA ATC CCA CCA CAG 1248 Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu
Asp Glu Ile Pro Pro Gln 405 410 415 AAT AAC AAC GTG CCA CCT AGG CAA
GGC TTT AGC CAT CGC CTG AGC CAT 1296 Asn Asn Asn Val Pro Pro Arg
Gln Gly Phe Ser His Arg Leu Ser His 420 425 430 GTG TCC ATG TTT CGC
TCC GGC TTT AGC AAT AGC AGC GTG AGC ATC ATC 1344 Val Ser Met Phe
Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile 435 440 445 CGC GCT
CCT ATG TTC TCC TGG ATC CAT CGC AGC GCT GAA TTT AAC AAC 1392 Arg
Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn 450 455
460 ATC ATT GCC TCC GAT AGC ATT ACC CAA ATC CCT GCC GTG AAG GGC AAC
1440 Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly
Asn 465 470 475 480 TTT CTG TTT AAT GGT TCC GTG ATT TCC GGC CCA GGC
TTT ACC GGT GGC 1488 Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro
Gly Phe Thr Gly Gly 485 490 495 GAC CTG GTG CGC CTG AAT AGC AGC GGC
AAT AAC ATT CAG AAT CGC GGC 1536 Asp Leu Val Arg Leu Asn Ser Ser
Gly Asn Asn Ile Gln Asn Arg Gly 500 505 510 TAC ATT GAA GTG CCA ATT
CAC TTC CCA TCC ACC TCC ACC CGC TAC CGC 1584 Tyr Ile Glu Val Pro
Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg 515 520 525 GTG CGC GTG
CGC TAC GCT TCC GTG ACC CCA ATT CAC CTC AAC GTT AAC 1632 Val Arg
Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn 530 535 540
TGG GGC AAT TCC TCC ATT TTT TCC AAT ACC GTG CCA GCT ACC GCT ACC
1680 Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala
Thr 545 550 555 560 TCC CTG GAT AAT CTG CAA TCC AGC GAT TTT GGT TAC
TTT GAA AGC GCC 1728 Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly
Tyr Phe Glu Ser Ala 565 570 575 AAT GCT TTT ACC TCC TCC CTG GGT AAT
ATC GTG GGT GTG CGC AAT TTT 1776 Asn Ala Phe Thr Ser Ser Leu Gly
Asn Ile Val Gly Val Arg Asn Phe 580 585 590 AGC GGC ACC GCC GGC GTG
ATC ATC GAC CGC TTT GAA TTT ATT CCA GTG 1824 Ser Gly Thr Ala Gly
Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val 595 600 605 ACC GCC ACC
CTC GAG TAGGTA 1845 Thr Ala Thr Leu Glu 610 (2) INFORMATION FOR SEQ
ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 613 amino
acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 Met Asp Asn Asn
Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu 1 5 10 15 Ser Asn
Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly 20 25 30
Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser 35
40 45 Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile
Ile 50 55 60 Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu
Val Gln Ile 65 70 75 80 Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe
Ala Arg Asn Gln Ala 85 90 95 Ile Ser Arg Leu Glu Gly Leu Ser Asn
Leu Tyr Gln Ile Tyr Ala Glu 100 105 110 Ser Phe Arg Glu Trp Glu Ala
Asp Pro Thr Asn Pro Ala Leu Arg Glu 115 120 125 Glu Met Arg Ile Gln
Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala 130 135 140 Ile Pro Leu
Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val 145 150 155 160
Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser 165
170 175 Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser
Arg 180 185 190 Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp
Tyr Ala Val 195 200 205 Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp
Gly Pro Asp Ser Arg 210 215 220 Asp Trp Val Arg Tyr Asn Gln Phe Arg
Arg Glu Leu Thr Leu Thr Val 225 230 235 240 Leu Asp Ile Val Ala Leu
Phe Pro Asn Tyr Asp Ser Arg Arg Tyr Pro 245 250 255 Ile Arg Thr Val
Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val 260 265 270 Leu Glu
Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu 275 280 285
Arg Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr 290
295 300
Ile Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln 305
310 315 320 Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr
Phe Pro 325 330 335 Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln
Arg Ile Val Ala 340 345 350 Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu
Ser Ser Thr Leu Tyr Arg 355 360 365 Arg Pro Phe Asn Ile Gly Ile Asn
Asn Gln Gln Leu Ser Val Leu Asp 370 375 380 Gly Thr Glu Phe Ala Tyr
Gly Thr Ser Ser Asn Leu Pro Ser Ala Val 385 390 395 400 Tyr Arg Lys
Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln 405 410 415 Asn
Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His 420 425
430 Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile
435 440 445 Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe
Asn Asn 450 455 460 Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala
Val Lys Gly Asn 465 470 475 480 Phe Leu Phe Asn Gly Ser Val Ile Ser
Gly Pro Gly Phe Thr Gly Gly 485 490 495 Asp Leu Val Arg Leu Asn Ser
Ser Gly Asn Asn Ile Gln Asn Arg Gly 500 505 510 Tyr Ile Glu Val Pro
Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg 515 520 525 Val Arg Val
Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn 530 535 540 Trp
Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr 545 550
555 560 Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser
Ala 565 570 575 Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val
Arg Asn Phe 580 585 590 Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe
Glu Phe Ile Pro Val 595 600 605 Thr Ala Thr Leu Glu 610 (2)
INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 1848 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix)
FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1842 (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 12 ATG GAT AAC AAT CCG AAC ATC AAT GAA TGC
ATT CCT TAC AAT TGC CTC 48 Met Asp Asn Asn Pro Asn Ile Asn Glu Cys
Ile Pro Tyr Asn Cys Leu 1 5 10 15 AGC AAC CCT GAA GTG GAA GTG CTG
GGT GGC GAA CGC ATC GAA ACC GGT 96 Ser Asn Pro Glu Val Glu Val Leu
Gly Gly Glu Arg Ile Glu Thr Gly 20 25 30 TAC ACC CCA ATC GAT ATT
TCC CTG TCC CTG ACC CAA TTT CTG CTG AGC 144 Tyr Thr Pro Ile Asp Ile
Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser 35 40 45 GAA TTT GTG CCC
GGT GCT GGC TTT GTG CTG GGC CTG GTG GAT ATC ATC 192 Glu Phe Val Pro
Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile 50 55 60 TGG GGC
ATT TTT GGT CCC TCC CAA TGG GAC GCC TTT CTG GTG CAA ATT 240 Trp Gly
Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile 65 70 75 80
GAA CAG CTG ATT AAC CAA CGC ATC GAA GAA TTC GCT AGG AAC CAA GCC 288
Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala 85
90 95 ATT TCC CGC CTG GAA GGC CTG AGC AAT CTG TAC CAA ATT TAC GCC
GAA 336 Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala
Glu 100 105 110 TCC TTT CGC GAG TGG GAA GCC GAT CCT ACC AAT CCA GCC
CTG CGC GAA 384 Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala
Leu Arg Glu 115 120 125 GAG ATG CGC ATT CAA TTC AAT GAC ATG AAC AGC
GCC CTG ACC ACC GCT 432 Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser
Ala Leu Thr Thr Ala 130 135 140 ATT CCT CTG TTT GCC GTG CAA AAT TAC
CAA GTG CCT CTG CTG TCC GTG 480 Ile Pro Leu Phe Ala Val Gln Asn Tyr
Gln Val Pro Leu Leu Ser Val 145 150 155 160 TAC GTG CAA GCT GCC AAT
CTG CAT CTG TCC GTG CTG CGC GAT GTG TCC 528 Tyr Val Gln Ala Ala Asn
Leu His Leu Ser Val Leu Arg Asp Val Ser 165 170 175 GTG TTT GGC CAA
AGG TGG GGC TTT GAT GCC GCC ACC ATC AAT AGC CGC 576 Val Phe Gly Gln
Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg 180 185 190 TAC AAT
GAT CTG ACC AGG CTG ATT GGC AAC TAC ACC GAT TAC GCT GTG 624 Tyr Asn
Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp Tyr Ala Val 195 200 205
CGC TGG TAC AAT ACC GGC CTG GAA CGC GTG TGG GGC CCA GAT TCC CGC 672
Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg 210
215 220 GAT TGG GTG AGG TAC AAT CAA TTT CGC CGC GAA CTG ACC CTG ACC
GTG 720 Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr
Val 225 230 235 240 CTC GAT ATC GTG GCT CTG TTC CCA AAT TAC GAT AGC
CGC CGC TAC CCA 768 Leu Asp Ile Val Ala Leu Phe Pro Asn Tyr Asp Ser
Arg Arg Tyr Pro 245 250 255 ATT CGA ACC GTG TCC CAA CTG ACC CGC GAA
ATT TAC ACC AAC CCA GTG 816 Ile Arg Thr Val Ser Gln Leu Thr Arg Glu
Ile Tyr Thr Asn Pro Val 260 265 270 CTG GAA AAT TTT GAT GGT AGC TTT
CGC GGC TCC GCT CAG GGC ATC GAA 864 Leu Glu Asn Phe Asp Gly Ser Phe
Arg Gly Ser Ala Gln Gly Ile Glu 275 280 285 CGC AGC ATT AGG AGC CCA
CAT CTG ATG GAT ATC CTG AAC AGC ATC ACC 912 Arg Ser Ile Arg Ser Pro
His Leu Met Asp Ile Leu Asn Ser Ile Thr 290 295 300 ATC TAC ACC GAT
GCT CAT AGG GGT TAC TAC TAC TGG TCC GGC CAT CAA 960 Ile Tyr Thr Asp
Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln 305 310 315 320 ATC
ATG GCT TCC CCT GTG GGC TTT TCC GGG CCA GAA TTC ACC TTT CCA 1008
Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro 325
330 335 CTG TAC GGC ACG ATG GGC AAT GCC GCT CCA CAA CAA CGC ATT GTG
GCT 1056 Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile
Val Ala 340 345 350 CAA CTG GGT CAG GGC GTG TAC CGC ACC CTG TCC TCC
ACC CTG TAC CGC 1104 Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser
Ser Thr Leu Tyr Arg 355 360 365 CGC CCT TTT AAT ATC GGC ATC AAC AAC
CAG CAA CTG TCC GTG CTG GAC 1152 Arg Pro Phe Asn Ile Gly Ile Asn
Asn Gln Gln Leu Ser Val Leu Asp 370 375 380 GGC ACC GAA TTT GCT TAC
GGC ACC TCC TCC AAT CTG CCA TCC GCT GTA 1200 Gly Thr Glu Phe Ala
Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val 385 390 395 400 TAC CGC
AAG AGC GGC ACC GTG GAT TCC CTG GAT GAA ATC CCA CCA CAG 1248 Tyr
Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln 405 410
415 AAT AAC AAC GTG CCA CCT AGG CAA GGC TTT AGC CAT CGC CTG AGC CAT
1296 Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser
His 420 425 430 GTG TCC ATG TTT CGC TCC GGC TTT AGC AAT AGC AGC GTG
AGC ATC ATC 1344 Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser
Val Ser Ile Ile 435 440 445 CGC GCT CCT ATG TTC TCC TGG ATC CAC CGC
TCC GCT GAG TTC AAC AAC 1392 Arg Ala Pro Met Phe Ser Trp Ile His
Arg Ser Ala Glu Phe Asn Asn 450 455 460 ATC ATC CCG TCC TCC CAA ATC
ACC CAA ATC CCG CTC ACC AAG TCC ACG 1440 Ile Ile Pro Ser Ser Gln
Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr 465 470 475 480 AAC CTC GGC
TCC GGC ACG TCC GTC GTC AAG GGC CCG GGC TTC ACC GGC 1488 Asn Leu
Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly 485 490 495
GGC GAC ATC CTC CGC CGC ACG TCC CCG GGC CAG ATC TCC ACC CTC CGC
1536 Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu
Arg 500 505 510 GTC AAC ATC ACG GCT CCG CTG AGC CAG CGC TAC AGG GTG
CGC ATC AGA 1584 Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg
Val Arg Ile Arg 515 520 525 TAC GCT AGC ACG ACC AAC CTG CAA TTC CAC
ACG TCC ATC GAC GGC AGA 1632 Tyr Ala Ser Thr Thr Asn Leu Gln Phe
His Thr Ser Ile Asp Gly Arg 530 535 540 CCG ATC AAC CAG GGC AAC TTC
AGC GCG ACG ATG AGC TCC GGG TCC AAC 1680 Pro Ile Asn Gln Gly Asn
Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 545 550 555 560 CTC CAG TCC
GGC TCC TTC CGC ACG GTC GGT TTC ACC ACG CCG TTC AAC 1728 Leu Gln
Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn 565 570 575
TTC TCC AAC GGC TCC TCC GTC TTC ACG CTC TCC GCT CAC GTC TTC AAC
1776 Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe
Asn 580 585 590 TCC GGC AAC GAG GTG TAC ATC GAC CGC ATC GAG TTC GTC
CCG GCC GAG 1824 Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe
Val Pro Ala Glu 595 600 605 GTC ACC TTC GAG CTC GAG TAGGTA 1848 Val
Thr Phe Glu Leu Glu 610 (2) INFORMATION FOR SEQ ID NO: 13: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 614 amino acids (B) TYPE:
amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 13 Met Asp Asn Asn Pro Asn Ile Asn
Glu Cys Ile Pro Tyr Asn Cys Leu 1 5 10 15 Ser Asn Pro Glu Val Glu
Val Leu Gly Gly Glu Arg Ile Glu Thr Gly 20 25 30 Tyr Thr Pro Ile
Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser 35 40 45 Glu Phe
Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile 50 55 60
Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile 65
70 75 80 Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn
Gln Ala 85 90 95 Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln
Ile Tyr Ala Glu 100 105 110 Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr
Asn Pro Ala Leu Arg Glu 115 120 125 Glu Met Arg Ile Gln Phe Asn Asp
Met Asn Ser Ala Leu Thr Thr Ala 130 135 140 Ile Pro Leu Phe Ala Val
Gln Asn Tyr Gln Val Pro Leu Leu Ser Val 145 150 155 160 Tyr Val Gln
Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser 165 170 175 Val
Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg 180 185
190 Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp Tyr Ala Val
195 200 205 Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp
Ser Arg 210 215 220 Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu
Thr Leu Thr Val 225 230 235 240 Leu Asp Ile Val Ala Leu Phe Pro Asn
Tyr Asp Ser Arg Arg Tyr Pro 245 250 255 Ile Arg Thr Val Ser Gln Leu
Thr Arg Glu Ile Tyr Thr Asn Pro Val 260 265 270 Leu Glu Asn Phe Asp
Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu 275 280 285 Arg Ser Ile
Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr 290 295 300 Ile
Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln 305 310
315 320 Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe
Pro 325 330 335 Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg
Ile Val Ala 340 345 350 Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser
Ser Thr Leu Tyr Arg 355 360 365 Arg Pro Phe Asn Ile Gly Ile Asn Asn
Gln Gln Leu Ser Val Leu Asp 370 375 380 Gly Thr Glu Phe Ala Tyr Gly
Thr Ser Ser Asn Leu Pro Ser Ala Val 385 390 395 400 Tyr Arg Lys Ser
Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln 405 410 415 Asn Asn
Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His 420 425 430
Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile 435
440 445 Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn
Asn 450 455 460 Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr
Lys Ser Thr 465 470 475 480 Asn Leu Gly Ser Gly Thr Ser Val Val Lys
Gly Pro Gly Phe Thr Gly 485 490 495 Gly Asp Ile Leu Arg Arg Thr Ser
Pro Gly Gln Ile Ser Thr Leu Arg 500 505 510 Val Asn Ile Thr Ala Pro
Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg 515 520 525 Tyr Ala Ser Thr
Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg 530 535 540 Pro Ile
Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 545 550 555
560 Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn
565 570 575 Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val
Phe Asn 580 585 590 Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe
Val Pro Ala Glu 595 600 605
Val Thr Phe Glu Leu Glu 610 (2) INFORMATION FOR SEQ ID NO: 14: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 185 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 14 AGCTTGCAGC GAGTACATAC
ATACTAGGCA GCCAGGCAGC CATGGCGCCC ACCGTGATGA 60 TGGCCTCGTC
GGCCACCGCC GTCGCTCCGT TCCAGGGGCT CAAGTCCACC GCCAGCCTC 120
CCGTCGCCCG CCGGTCCTCC AGAAGCCTCG GCAACGTCAG CAACGGCGGA AGGATCCGG
180 GCATG 185 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 177 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 15 ACGTCGCTCA TGTATGTATG ATCCGTCGGT
CCGTCGGTAC CGCGGGTGGC ACTACTACCG 60 GAGCAGCCGG TGGCGGCAGC
GAGGCAAGGT CCCCGAGTTC AGGTGGCGGT CGGAGGGGC 120 GCGGGCGGCC
AGGAGGTCTT CGGAGCCGTT GCAGTCGTTG CCGCCTTCCT AGGCCAC 177 (2)
INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
16 ATCACTTTCA CGGGA 15 (2) INFORMATION FOR SEQ ID NO: 17: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 17 ATCACGTTCA CGGCA 15 (2)
INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18 Ile
Thr Phe Thr Gly 1 5 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 19 CCTTGGCAGC CATCACGTTC ACGGGAAGTA TTGTC
35 (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
20 ATCTGGCAGC AGAAAAACAA GTAGTTGAGA ACTAAGAAGA AGAAA 45 (2)
INFORMATION FOR SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
21 CATCGAGACA AGCACGGTCA ACTTC 25 (2) INFORMATION FOR SEQ ID NO:
22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22 AAGTCCCTGG AGGCACAGGG
CTTCAAGA 28 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 23 GCTTACCTAC TAATTGTTCT TGG 23 (2)
INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
24 CAGGGTACAT ATTTGCCTTG GG 22 (2) INFORMATION FOR SEQ ID NO: 25:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 25 AACCCTGAAT GGAAGTGC 18 (2)
INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
26 ACGGACAGAT GCAGATTGG 19
* * * * *