U.S. patent number 6,261,797 [Application Number 08/713,404] was granted by the patent office on 2001-07-17 for primer-mediated polynucleotide synthesis and manipulation techniques.
This patent grant is currently assigned to Stratagene. Invention is credited to Kerstien A. Padgett, Joseph A. Sorge.
United States Patent |
6,261,797 |
Sorge , et al. |
July 17, 2001 |
Primer-mediated polynucleotide synthesis and manipulation
techniques
Abstract
The invention provides improved techniques for conveniently
manipulating polynucleotides of interest without the need to rely
upon the presence of naturally occurring restriction sites.
Additionally, using the methods and primers of the invention, one
may synthesize a polynucleotide of interest in a form which is
easily and directionally cloned into a DNA sequence of choice
without necessarily introducing extraneous nucleotides in the final
polynucleotide product. The methods of the invention employ
releasable primers that comprise a recognition site for a releasing
enzyme joined to a region for annealing to the polynucleotide
template of interest. Polynucleotide sequences of interest are
synthesized using one or more synthesis primers, wherein at least
one of the primers is a releasable primer. After synthesis, the
synthesis product is cleaved by a releasing enzyme. In a preferred
embodiment of the invention, inhibitory base analogs are
incorporated in the synthesis product to protect against the
formation of unwanted internal cleavage products. In another
embodiment of the invention, at least one of the releasable primers
is bound to an immobilizing solid phase support so as to produce
immobilized synthesis products that may be conveniently released by
a releasing enzyme. Another aspect of the invention is to provide
releasable primers and kits for performing the subject methods.
Typically, such kits may comprise a releasing enzyme and one or
more reagents for performing a polynucleotide synthesis reaction,
preferably a cyclic amplification reaction.
Inventors: |
Sorge; Joseph A. (Rancho Santa
Fe, CA), Padgett; Kerstien A. (San Diego, CA) |
Assignee: |
Stratagene (La Jolla,
CA)
|
Family
ID: |
27081577 |
Appl.
No.: |
08/713,404 |
Filed: |
September 13, 1996 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
592938 |
Jan 29, 1996 |
|
|
|
|
Current U.S.
Class: |
435/41; 435/6.12;
435/6.15; 530/350 |
Current CPC
Class: |
C12N
15/10 (20130101); C12N 15/66 (20130101); C12Q
1/686 (20130101); C12Q 1/686 (20130101); C12Q
2525/131 (20130101); C12Q 2525/117 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12N 15/10 (20060101); C12N
15/66 (20060101); C12P 001/00 (); C12Q 001/68 ();
C07K 014/00 () |
Field of
Search: |
;435/5,6,810,41 ;530/350
;536/23.1,24.2,24.3,24.33 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Scharf S., "Cloning with PCR", in PCR Protocols: A Guide to Methods
and Applications, pp. 84-91, Editors: Innis et al., Academic Press,
SanDiego, CA 1990.* .
The New England Biolabs Catalog, p. 110 (1993/1994 Edition).* .
The New England Biolabs Catalog, p. 31 (1993/1994 Edition).* .
Berger, 1994, Analytical Biochemistry 222:1-8. .
Kim et al., 1988, "Cleaving DNA At Any Predetermined Site With
Adapters-Primers and Class-IIS Restriction Enzymes," Science
24:504-506. .
Horton et al., Gene 77:61-68 (1989). .
Lin and Schwartz, Bio Techniques 12:28-30 (1992). .
Oakley et al., Bioconjug. Chem. 5:242-247 (1994). .
Padgett et al., 1996, "Creating Seamless Junctions Independent Of
Restriction Sites in PCR Cloning," Gene, 168(1):31-35. .
Russek et al., Cell Mol. Biol. Res. 39:177-182 (1993). .
Stillman et al., PCR Methods and Applications 3(6): 320-31 (1994).
.
Szybalski et al., Gene 100:13-26 (1991). .
Weiner, M.P., BioTechniques 15:502-505 (1993). .
Yon et al., Nucl. Acids Res. 17:4895 (1989)..
|
Primary Examiner: Whisenant; Ethan
Attorney, Agent or Firm: Finnegan, Henderson, Farabow,
Garrett & Dunner, L.L.P.
Parent Case Text
CROSS REFERENCE TO RELATED APPLICATION
The present application is a continuation-in-part of U.S.
application Ser. No. 08/592,938, filed Jan. 29, 1996, and now
abandoned the disclosure of which is expressly incorporated by
reference herein.
Claims
What is claimed is:
1. A method of producing a polynucleotide of interest, the method
comprising:
synthesizing the polynucleotide of interest in a polynucleotide
synthesis reaction employing a first releasable primer, whereby a
polynucleotide synthesis product comprising at least one methylated
inhibitory base analog is produced; and
cleaving the polynucleotide synthesis product with Eam1104I,
whereby a released synthesis product comprising the polynucleotide
of interest and containing at least one methylated inhibitory base
analog is produced.
2. The method of claim 1, wherein the methylated inhibitory base
analog is 5-methyl-cytosine.
3. A method of producing a polynucleotide of interest, the method
comprising:
synthesizing the polynucleotide of interest in a polynucleotide
synthesis reaction employing a first releasable primer and a second
releasable primer, whereby a polynucleotide synthesis product
comprising at least one methylated inhibitory base analog is
produced; and
cleaving the polynucleotide synthesis product with Eam11O4I,
whereby a released synthesis product comprising the polynucleotide
of interest and at least one methylated inhibitory base analog is
produced.
4. The method of claim 3, wherein the methylated inhibitory base
analog is 5-methyl-cytosine.
5. A method of constructing a polynucleotide of interest, the
method comprising:
synthesizing a first polynucleotide of interest in a first
polynucleotide synthesis cyclic amplification reaction employing
first and second primers, wherein the first and second primers are
releasable primers, whereby a first polynucleotide synthesis
product comprising at least one methylated inhibitory base analog
is produced;
cleaving the first polynucleotide synthesis product with Eam1104I,
whereby a first released synthesis product is produced;
synthesizing a second polynucleotide of interest in a second
polynucleotide synthesis cyclic amplification reaction employing
third and fourth primers, wherein the third and fourth primers are
releasable primers, whereby a second polynucleotide synthesis
product is produced;
cleaving the second polynucleotide synthesis product with the
releasing enzyme specific for a recognition site of the third
releasable primer, whereby a second releasable synthesis product is
produced; and
ligating the first released synthesis product to the second
released synthesis product to produce a ligated product, wherein
the ligated product comprises the polynucleotide of interest.
6. The method according to claim 5, wherein at least one inhibitory
base analog is present in the second polynucleotide synthesis
product.
7. The method according to claim 5, wherein the inhibitory base
analog is a methylated analog.
8. The method according to claim 5, wherein the inhibitory base
analog is 5-methyl-cytosine.
9. A kit for seamless polynucleotide synthesis comprising
Eam11O4I.
10. The kit according to claim 9, further comprising 5
methyl-cytosine triphosphate.
Description
FIELD OF THE INVENTION
The invention is in the field of polynucleotide manipulation
techniques, particularly amplification and cloning techniques.
BACKGROUND OF THE INVENTION
A significant problem with many of the currently available
molecular biology techniques is their reliance upon naturally
occurring convenient restriction sites. Modifications of the
polymerase chain reaction (PCR) and other similar amplification
techniques have been developed in an attempt to overcome this
problem. In the absence of naturally occurring convenient
restriction sites, it is possible to introduce restriction sites
into the sequence of interest by using primers and PCR. However,
this technique results in the presence of extraneous
polynucleotides in the amplification products even after
restriction digestion. Such extraneous polynucleotides can be
problematic. For example, the introduction of unwanted nucleotides
often imposes design limitations on the cloned product which may
interfere with the structure and function of the desired gene
products.
One method of joining DNA without introducing extraneous bases or
relying on the presence of restriction sites is splice overlap
extension (SOE). Yon et al., 1989, Nucl. Acids Res. 17:4895. Horton
et al., 1989, Gene 77:61-68. This method is based on the
hybridization of homologous 3' single-stranded overhangs to prime
synthesis of DNA using each complementary strand as template.
Although this technique can join fragments without introducing
extraneous nucleotides (in other words, seamlessly), it does not
permit the easy insertion of a DNA segment into a specific location
when seamless junctions at both ends of the segment are required.
Nor does this technique function to join fragments with a vector.
Ligation with a vector must be subsequently performed by
incorporating restriction sites onto the termini of the final SOE
fragment. Finally, this technique is particularly awkward when
trying to exchange polynucleotides encoding various domains or
mutation sites between genetic constructs encoding related
proteins.
Another commonly used genetic manipulation technique is immobilized
amplification, e.g., immobilized PCR. In techniques involving
immobilized PCR, i.e., bound PCR, polynucleotide amplification
products are immobilized on a solid phase support. Immobilization
is typically accomplished through the use of streptavidin (or
avidin) and biotinylated polynucleotides, antibody-hapten binding
interactions, or through the covalent attachment of nucleic acids
to solid supports. A serious limitation, however, of such
conventional immobilization techniques is that the amplification
products cannot be conveniently unbound from the solid phase
support for use in subsequent manipulations, e.g., sequencing of
the amplification products.
An additional problem with conventional techniques, particularly
the manipulation of amplification reaction products, is that
cleavage at certain restriction sites must be avoided in order to
obtain desired polynucleotides. Presently, however, this can only
be accomplished by cumbersome techniques such as partial digestions
and methylase protection.
Accordingly, in view of the foregoing limitations of current
recombinant DNA technology, it is of interest to provide improved
techniques for conveniently manipulating polynucleotides without
having to rely on naturally occurring convenient restriction sites.
It is also of interest to provide methods of synthesizing
polynucleotides in which some or all of the nucleotides introduced
through synthesis primers may be conveniently removed from the
final synthesis product. Additionally, it is of interest to provide
improved methods of manipulating polynucleotide synthesis products
by restriction enzymes which overcome the problems of cleavage at
internal sites within the synthesis products. Further, it is of
interest to provide an improved method of releasing amplification
products that are bound to a solid phase support. The present
invention meets these needs.
SUMMARY OF THE INVENTION
The present invention relates to improved methods of synthesizing
polynucleotides of interest. The invention is based, in part, on
the use of enzymes, referred to herein as releasing enzymes, which
cleave polynucleotide substrates. In one embodiment of the
invention, it is preferred that the site cleaved by the releasing
enzyme is different or distal from the enzyme recognition site on
the substrate. The methods of the invention employ primers which
comprise a recognition site for a releasing enzyme joined to a
region for annealing to the polynucleotide template of interest.
These primers are referred to as releasable primers. Preferably,
the recognition site for the releasing enzyme is joined 5' to the
annealing region.
In one embodiment of the invention, the releasable primers comprise
a recognition site for a type IIS restriction endonuclease. The
type IIS restriction endonuclease recognizes this site, but then
cleaves the DNA in a sequence independent manner several base pairs
3' to the recognition site. Optionally, releasable primers of the
invention comprise additional nucleotides located 5' and adjacent
to the recognition site.
The releasable primers may be used for priming polynucleotide
synthesis reactions, including, but not limited to, polymerase
chain reactions and other amplification reactions.
The methods of the invention comprise the steps of synthesizing a
polynucleotide sequence of interest with at least one releasable
primer. The polynucleotide synthesis reaction may be, but is not
necessarily, a cyclic amplification reaction. When polynucleotide
synthesis occurs in a cyclic amplification reaction, the polymerase
chain reaction (PCR) is particularly preferred for use. After
synthesis, the synthesis product is cleaved by a releasing enzyme
capable of recognizing the recognition site on the releasable
primer. Restriction endonuclease inhibitory base analogs may be
incorporated in the synthesis product to protect against unwanted
cleavage of internal recognition sites by the releasing enzyme, yet
still permit cleavage of the desired sites introduced by the
releasable primer or primers.
In another embodiment of the invention, i.e., seamless domain
replacement, a first synthesis product is produced using a pair of
primers and a second synthesis product is produced using a second
pair of primers, wherein at least one member of each pair of
primers is a releasable primer. Both first and second synthesis
products are subsequently cleaved by releasing enzymes. The
resultant released first and second synthesis products may then be
ligated to one another so as to produce a recombinant DNA construct
that does not contain extraneous nucleotides introduced by the
synthesis primers. This method may be used to conveniently replace
one segment of a genetic construct with a similar (but different)
segment of a second genetic construct.
In another embodiment of the invention, at least one releasable
primer is bound to a solid phase support. After synthesis of a
polynucleotide of interest using the bound primer, an immobilized
synthesis product is produced. The immobilized synthesis product
may be released by means of a releasing enzyme. Restriction
endonuclease inhibitory base analogs may be incorporated in the
synthesis product to protect against unwanted cleavage of internal
restriction sites by the selected releasing enzyme, yet still
permit cleavage of the desired restriction sites introduced by the
releasable primer(s).
Another aspect of the invention is to provide releasable primers
and kits for performing the subject methods. Typically, such kits
comprise a releasing enzyme and one or more reagents for performing
polynucleotide synthesis, e.g., a cyclic amplification reaction.
Optionally, such kits further comprise nucleotide base analogs
capable of inhibiting or substantially inhibiting cleavage by the
releasing enzyme. Preferably, such inhibitory nucleotide base
analogs are in the form of nucleoside triphosphates. The kits may
also optionally comprise a polynucleotide primer comprising a
recognition site for a releasing enzyme.
The methods of the invention permit one to efficiently synthesize
and manipulate polynucleotides of interest by primer mediated
polynucleotide synthesis, e.g., PCR, without introducing extraneous
primer-derived nucleotides into the ultimate synthesis products,
i.e., seamless polynucleotide synthesis. The invention allows the
efficient directional cloning of a desired DNA sequence into any
location without the limitation of naturally occurring convenient
restriction sites. Additionally, the invention permits DNA
synthesis products to be manipulated by restriction enzymes without
problems of cleavage at undesired restriction sites.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic diagram of an embodiment of the invention in
which two sets of releasable primers are used to produce two
different synthesis products that are subsequently ligated to one
another to produce a plasmid of interest. Part (A) of the figure
shows a first polynucleotide synthesis product obtained by PCR. The
figure shows the methods of the invention being employed to replace
the D region on the plasmid in part (B) with the D' region on the
plasmid of part (A). In part (A), PCR is performed with releasable
primers in the presence of .sup.m5 dCTP (5-methyldCTP), thereby
forming an amplification product. The amplification product is
subsequently exposed to the releasing enzyme Eam1104I to produce a
released synthesis product with overhanging, i.e., "sticky",
non-identical non-palindromic ends to provide for directional
cloning. The procedure shown in part (B) is essentially the same as
in part (A) except different primers (with a different orientation)
and a different template are used. In part (C), the two released
synthesis products are ligated together in the presence of
Eam1104I. The symbol .cndot. is used to indicate the Eam1104I
recognition sequence CTCTTC.
FIG. 2 is a schematic representation of cycles within a PCR
reaction. The diagram indicates that PCR is performed in the
presence of an inhibitory base analog. The last cycle of PCR is
performed in the absence of the inhibitory base analog. "M"
represents the inhibitory base analog, i.e., a modified base. The
products of the last cycle only have inhibitory base analogs in one
strand.
DEFINITIONS
The term "cyclic amplification reaction," as used herein, refers to
a variety of enzyme mediated polynucleotide synthesis reactions
that employ pairs of polynucleotide primers to amplify a given
polynucleotide and proceed through one or more cycles, each cycle
resulting in polynucleotide replication, i.e., synthesis. A cyclic
amplification reaction cycle typically comprises the steps of
denaturing the double-stranded template, annealing primers to the
denatured template, and synthesizing polynucleotides from the
primers. The cycle may be repeated several times so as to produce
the desired amount of newly synthesized polynucleotide product.
Guidance in performing the various steps of cyclic amplification
reactions can be obtained from reviewing literature describing the
polymerase chain reaction ("PCR") including, PCR: A Practical
Approach, M. J. McPherson, et al., IRL Press (1991), PCR Protocols:
A Guide to Methods and Applications, by Innis, et al., Academic
Press (1990), and PCR Technology: Principals and Applications of
DNA Amplification, H. A. Erlich, Stockton Press (1989). PCR is also
described in numerous U.S. patents, including U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; 4,965,188; 4,889,818; 5,075,216;
5,079,352; 5,104,792, 5,023,171; 5,091,310; and 5,066,584, which
are hereby incorporated by reference. Many variations of
amplification techniques are known to the person of ordinary skill
in the art of molecular biology. These variations include rapid
amplification of cDNA ends (RACE-PCR), PLCR (a combination of
polymerase chain reaction and ligase chain reaction), ligase chain
reaction (LCR), self-sustained sequence replication (SSR), Q-beta
phage amplification (as described in Shah et al., Journal of
Medical Micro. 33(6): 1435-41 (1995)), strand displacement
amplification, (SDA), splice overlap extension PCR (SOE-PCR), 3SR
amplification (as described in Stillman et al., PCR Methods and
Applications 3(6): 320-31 (1994), and the like. A person of
ordinary skill in the art may use these known methods to design
variations of the releasable primer mediated cyclic amplification
reaction based methods explicitly described in this
application.
The term "oligonucleotide," as used herein with respect to
releasable primers, is intended to be construed broadly.
Oligonucleotides include not only DNA but various analogs thereof.
Such analogs may be, depending upon the specific releasing enzyme
selected for use in a given embodiment of the invention, base
analogs and/or backbone analogs, e.g., phosphorothioates,
phosphonates, and the like. Techniques for the synthesis of
oligonucleotides, e.g., through phosphoramidite chemistry, are well
known to the person of ordinary skill in the art and are described,
among other places, in Oligonucleotides and Analogues: A Practical
Approach, ed. Eckstein, IRL Press, Oxford (1992). Preferably, the
oligonucleotides used as releasable primers are DNA molecules.
The terms "amplification", "amplification products",
"polynucleotide synthesis", and "polynucleotide synthesis products"
are used herein as a matter of convenience and should not be
interpreted to limit the subject invention to PCR or other cyclic
amplification reactions. Accordingly, one skilled in the art having
the benefit of this disclosure will appreciate that the present
invention contemplates synthesis of end products through means
other than PCR and related cyclic amplification reactions, e.g.,
DNA synthesis, DNA replication, cDNA synthesis, and the like.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
The present invention is based, in part, on the discovery that
enzymes which cleave polynucleotides at a position which is
different or distal from their recognition site may be used to
clone or modify virtually any polynucleotide sequence independent
of naturally occurring restriction sites. Accordingly, in certain
embodiments of the invention, releasable primers are used to
introduce recognition sites for enzymes which cleave
polynucleotides at a site distinct from the recognition site.
Particularly preferred are sites recognized by type IIS restriction
endonucleases. When these primers are used to amplify a
polynucleotide product, and then treated with type IIS restriction
endonucleases, the polynucleotide sequences in the synthesis
product which comprise the type IIS recognition sequence are
completely or partially removed. Thus, using the methods of the
invention, one may efficiently synthesize and manipulate
polynucleotides of interest by primer mediated polynucleotide
synthesis, e.g., PCR, without introducing some or all of the
primer-derived nucleotides into the ultimate synthesis
products.
The invention also allows directional cloning of a desired DNA
sequence into any location. Additionally, the invention permits the
treatment of polynucleotide synthesis products, including cyclic
amplification reaction products, with releasing enzymes to produce
the desired end products without cleaving internal restriction
sites. The present invention also allows for the convenient release
of polynucleotide synthesis products that are immobilized on solid
phase supports.
In one specific embodiment of the invention described merely by way
of illustrative example herein, the primers and methods of the
invention are used to switch predetermined regions of a
polynucleotide construct in a manner independent of any naturally
occurring restriction sites. This method, referred to herein as
"seamless domain replacement," affords the skilled practitioner
unprecedented freedom to design, manipulate, and clone desired
polynucleotide products.
Releasable Primers and Their Cognate Releasing Enzymes
In accordance with the embodiments of the invention, releasable
primers and pairs of releasable primers, are provided. "Releasable
primers" comprise a single stranded oligonucleotide and have two
separate regions: (1) the "releasing enzyme recognition site" and
(2) the "annealing region". In a preferred embodiment of the
invention, the releasing enzyme recognition site is located 5' to
the annealing region. The releasable primer may further comprise
additional nucleotides located adjacent, preferably 5', to the
releasing enzyme recognition site.
The "releasing enzyme recognition site" of a releasable primer may
consist of the nucleotides which identify the recognition site for
a given restriction endonuclease, in other words, a restriction
endonuclease recognition site. In fact, the recognition site may be
any site that is recognized by a sequence specific DNA binding
protein. The recognition site may alternatively be a binding site
for an "artificial restriction enzyme" which makes use of organic
cleaving molecules such as those described in U.S. Pat. No.
4,942,227, issued Jul. 17, 1990. In certain embodiments of the
invention, it is preferred that the "recognition site" is the
recognition site for a restriction endonuclease wherein a base in
one strand of the recognition site is lacking in the other strand
of the recognition site. Such enzymes are defined herein for
purposes of the invention as Class A enzymes (see infra).
Alternatively, releasing enzyme recognition sites may be sites
which are recognized by Class B or Class C enzymes. Class B and
Class C enzymes are described more fully below in the next
section.
In a preferred embodiment of the invention, the recognition site is
recognized by a type IIS restriction endonuclease wherein one
strand of the recognition sequence lacks a base that is present on
the complementary strand of the recognition sequence. A type IIS
restriction endonuclease is a restriction endonuclease that cleaves
outside of the recognition site. A review of type IIS (also
referred to as class IIS) restriction endonucleases can be found in
Szybalski et al., Gene 100:13-26 (1991). In accordance with
particularly preferred embodiments of the invention, the
recognition site is for the type IIS restriction endonuclease
Eam1104I. This recognition site is particularly preferred because
it contains three cytosine residues in one strand which are lacking
in the complementary strand of the recognition site.
Alternatively, the "releasing enzyme recognition site" of a
releasable primer may consist of a protein or polypeptide (or
biotin or other hapten) which is recognized by an enzyme capable of
cleaving a polynucleotide substrate. In this case, the releasable
primer will be a hybrid molecule comprised of protein (or biotin or
other hapten) linked to a polynucleotide. The releasing enzyme
recognizes the site on the protein portion of the releasable
primer, and then cleaves the polynucleotide portion of the
releasable primer. The cleavage may be performed by a catalytic
protein domain of the releasing enzyme, or may be performed by an
organic cleaving moiety linked to the releasing enzyme. In
embodiments of the invention in which the hybrid molecules are
comprised of biotin or other haptens, the releasing enzyme will
recognize the biotin or hapten portion of the hybrid molecule.
The "annealing region" of a releasable primer of the invention
comprises a polynucleotide sequence designed to anneal to target
polynucleotides and prime synthesis of a desired polynucleotide at
a specific location on a polynucleotide template. Polynucleotide
synthesis products produced in a synthesis reaction employing a
releasable primer may be contacted with a releasing enzyme that
cleaves within the recognition site of the releasable primer or
outside the recognition site (when the releasing enzyme is a type
IIS restriction endonuclease). The precise nucleotide sequence of
the annealing region in a specific embodiment of the invention is
dependent upon the nucleotide sequence to which the releasable
primer is designed to anneal.
Principles for designing amplification primers that anneal to and
amplify polynucleotides of interest are well known to the person of
ordinary skill in the art and may be readily applied for use in the
design of annealing regions of the releasable primers of the
invention. The annealing region hybridizes to templates for
synthesis in a manner essentially identical to the annealing of
primers in conventional PCR. The annealing region should be of
sufficient length to permit specific annealing to the targeted
sites. Preferably, the annealing region is at least nucleotides in
length, more preferably, at least 20 nucleotides in length. While
the annealing region may be 30 nucleotides in length or
significantly longer, the increased length is usually not necessary
to produce the desired synthesis products. Additionally, a
releasable primer with a long annealing region, i.e., greater than
about 30 nucleotides, may be unnecessarily difficult and expensive
to synthesize.
In certain embodiments of the invention, it may be of interest to
provide portions of the annealing region that do not necessarily
anneal to the target template, thereby providing for the
introduction of additional polynucleotide sequences into the
synthesis product. These additional nucleotides may be used to
introduce site-directed mutations or to facilitate additional
sequence manipulations.
Releasable primers may further comprise additional nucleotides
located 5' and adjacent to the recognition site. These additional
nucleotides are optionally present in releasable primers of the
invention. Such additional nucleotides located 5' to the
recognition site may enhance the activity of the selected releasing
enzyme. Preferably, the additional 5' nucleotides are of minimal
length to reduce the possibility of hybridization to non-targeted
polynucleotide sequences. Nucleotide sequence information of a
polynucleotide comprising the target sequence for synthesis may be
used in designing the sequence of any additional nucleotides
located 5' to the recognition site so that the releasable primers
do not anneal to non-targeted segments of the polynucleotide for
synthesis or self-anneal to segments of the primer. In those
embodiments of the invention in which the releasing enzyme is
Eam1104I, preferably at least two additional nucleotides are
present 5' to the Eam1104I recognition site. Another aspect of the
present invention is the discovery that these two or more
additional nucleotides significantly improves Eam1104I
activity.
"Releasing enzymes" are enzymes which are capable of cleaving
polynucleotide substrates at desired sites introduced by the
releasable primer or primers of the invention and, when used in
accordance with methods of the invention, are either incapable of
or may be rendered incapable of undesired cleavage at internal
sites. Releasing enzymes useful in the present invention are
restriction endonucleases capable of recognizing the releasing
enzyme recognition site introduced by a given releasable primer.
Releasing enzymes may be naturally occurring restriction enzymes,
or may be hybrid molecules comprised of a polynucleotide binding
domain attached to a cleaving domain. For example, releasing
enzymes may include hybrid enzymes such as those described in U.S.
Pat. No. 5,436,150, issued Jul. 25, 1995, wherein the cleavage
domain of the Fok I enzyme is linked to the recognition domain of
another protein. Additionally, the recognition domain of the
releasing enzyme may be linked to a non-protein cleaving agent, for
example, an organic DNA cleaving moiety, such those described by
Oakley et al. (1994), Bioconjug. Chem. 5:242-247. Further, the
releasing enzyme may be an "artificial restriction enzyme" similar
to those described in U.S. Pat. No. 4,942,227, issued Jul. 17,
1990.
In preferred embodiments of the invention, the releasing enzyme is
a type IIS restriction endonuclease wherein the type IIS
endonuclease may also be further characterized as a Class A, B or C
enzyme (as defined herein infra.). Type IIS restriction
endonucleases of interest recognize a specific nucleotide sequence
and catalyze a double-stranded cleavage in a region outside the
specific sequence of the restriction endonuclease recognition site.
By using type IIS restriction endonucleases as releasing enzymes,
all or part of the nucleotides introduced by the releasable primers
of the invention may be removed from the polynucleotide
product.
Preferred type IIS restriction endonucleases for use as releasing
enzymes cleave DNA 3' with respect to the recognition site. The
type IIS restriction endonuclease Eam1104I has been found
particularly useful in the methods of the invention, and its use is
specifically described by way of example herein. Many different
type IIS restriction endonucleases and other restriction
endonucleases are known to the person of ordinary skill in art, for
example, see Szybalski, et al., Gene 100:13-26 (1991); and Ausubel,
et al., Current Protocols in Molecular Biology, John Wiley &
Sons (1995). It will be further appreciated by a person of ordinary
skill in the art that new restriction endonucleases are continually
being discovered and may be readily adapted for use in the subject
invention.
Releasing enzymes may also include enzymes which cleave
polynucleotides but which recognize a site which is other than a
polynucleotide sequence, for example, another protein. Examples of
such releasing enzymes are, for example, exonucleases and
polymerases having exonuclease activity.
In one embodiment of the invention, a polynucleotide of interest is
synthesized in a polynucleotide synthesis reaction employing a
primer that is a releasable primer. The polynucleotide synthesis
reaction may be, but is not necessarily, a cyclic amplification
reaction. In those embodiments of the invention in which synthesis
occurs in a cyclic amplification reaction, typically 10-30
amplification cycles are used; however, the number of cycles may be
as low as 1. Amplification reaction parameters, e.g., temperature
and time, may be determined by reference to conventional cyclic
amplification techniques such as the polymerase chain reaction
(PCR). In a cyclic amplification reaction employing a pair of
primers, at least one of the primers is a releasable primer. In a
preferred embodiment of the invention, the first and second primers
of a cyclic amplification reaction are both releasable primers.
In accordance with the invention, the polynucleotide synthesis
reaction of the invention results in the generation of a
polynucleotide synthesis product, i.e., a double-stranded
polynucleotide, which incorporates at least one releasable primer.
After the desired synthesis product is produced, the synthesis
product is contacted with a releasing enzyme. The releasing enzyme
cleaves the synthesis product according to the sites introduced by
the releasable primer during the synthesis reaction, whereby a
released synthesis product is produced. Releasing enzymes that are
type IIS restriction endonucleases, and thus cleave outside the
releasing enzyme recognition site, may be used to produce released
synthesis products that do not contain either all or part of the
nucleotide sequences derived from the releasable primer or primers
used to generate the polynucleotide synthesis product. Pairs of
releasable primers may be used to produce released polynucleotide
synthesis products that have non-identical overhanging ends,
thereby permitting directional cloning of the released
polynucleotide synthesis product in a predetermined
orientation.
Preventing Cleavage at Internal Sites
Treatment of synthesis products with releasing enzymes may result
in the formation of undesired digestion products because of the
presence of "internal", i.e., pre-existing, restriction sites in
regions of the synthesis products not derived from the synthesis
primers. These internal restriction sites may be identified prior
to synthesis or may be cryptic because no prior sequence
information exists about the entire polynucleotide being
synthesized.
This potential problem with internal restriction sites can be
avoided by incorporating inhibitory base analogs into the
polynucleotide synthesis products to protect or substantially
protect the internal restriction sites from cleavage by the
releasing enzyme. In accordance with an aspect of the invention,
protection of internal restriction sites is accomplished by
selection of a releasing enzyme that is an analog sensitive
releasing enzyme with respect to the nucleotide base analog or
analogs selected for use.
Analog sensitive releasing enzymes are releasing enzymes that are
inhibited or substantially inhibited by a base analog at a
nucleotide or nucleotides of the recognition site and/or the
cleavage site of the restriction endonuclease. It will be
appreciated by those skilled in the art that a given analog
sensitive releasing enzyme is not inhibited or substantially
inhibited by all nucleotide base analogs.
Accordingly a given releasing enzyme is analog sensitive with
respect to a given nucleotide base analog. Conversely, a nucleotide
base analog that inhibits or substantially inhibits the releasing
enzyme is an inhibitory base analog with respect to that releasing
enzyme. An example of an analog sensitive releasing enzyme is
Eam1104I, which is inhibited by 5-methylcytosine (5-methyl-dCTP) at
the recognition site, i.e., 5-methylcytosine is an inhibitory base
analog with respect to Eam1104I.
Synthesis of a polynucleotide of interest with inhibitory base
analogs may be accomplished by performing a polymerase mediated
polynucleotide synthesis reaction with a nucleoside triphosphate
mixture comprising the four basic nucleoside triphosphates
(deoxyadenosine triphosphate, deoxyguanosine triphosphate,
deoxycytidine triphosphate, and deoxythymidine triphosphate) or
functional equivalents thereof, wherein at least one of the four
basic nucleoside triphosphates is modified to comprise an
inhibitory base analog rather than a conventional, i.e.,
non-inhibiting, nucleotide.
Examples of inhibitory base analogs include 6-methyladenine,
5-methylcytosine, 5-hydroxymethylcytosine, and the like. Inhibitory
base analogs may be in the form of deoxyribonucleotide
triphosphates (or functional equivalents thereof), in order to
provide for polymerase mediated incorporation. Inhibitory
nucleotide analogs may also be alpha-thio-deoxyribonucleotide
triphosphate analogs. The present invention contemplates the use of
any of a multitude of possible nucleotide base analogs as
inhibitory base analogs, including, but not limited to,
2'-deoxyriboinosine, 5-iodo-2'-deoxyribocytosine,
5-mecuri-2'-deoxyriboguanosine. Accordingly, those skilled in the
art will appreciate that alternative nucleotide base analogs may be
suitably utilized as inhibitory base analogs in the invention,
provided that such analogs are capable of being specifically
incorporated within and protecting or substantially protecting
double stranded DNA from cleavage by the selected releasing enzyme.
It will also be readily appreciated by persons skilled in the art
that in addition to the use of base analogs, analogs of
phosphorylated sugars, e.g., phosphorothioates may be used to
inhibit releasing enzyme activity. In a preferred embodiment of the
invention, the inhibitory base analog is a methylated base analog,
and the releasing enzyme is a methylation sensitive releasing
enzyme.
The choice of a particular inhibitory base analog or analogs for
use in a given embodiment of the invention is dependent upon the
particular releasing enzyme selected for use. Certain releasing
enzymes for use in the subject methods are inhibited or
substantially inhibited by inhibitory base analogs in the
recognition site of the restriction endonuclease. The term
"substantially inhibited" is used to indicate that the inhibition
of the enzymatic activity need not be complete. In many embodiments
of the invention, the level of inhibition may be significantly less
than complete inhibition because only partial inhibition is
necessary to produce a useful amount of the ultimately desired
released synthesis product. Inhibition of releasing enzyme cleavage
may be achieved by incorporation of the inhibitory base analog into
the recognition site and/or the restriction endonuclease cleavage
site (when the recognition site and cleavage site are separate from
one another).
The inhibitory effects of several nucleotide base analogs
(particularly, naturally occurring methylated bases) on the
activity of many restriction endonucleases is well described in the
literature of molecular biology (see for example, Ausubel et al.,
Protocols in Molecular Biology, John Wiley & Sons (1995)).
However, it may be necessary to determine whether or not a given
nucleotide base analog is an inhibitory base analog with respect to
a given restriction endonuclease. The determination of whether or
not a given nucleotide base analog is inhibitory with respect to a
given releasing enzyme may be made by techniques well known to a
person of ordinary skill in the art. For example, a polynucleotide
known to be cleaved by a given releasing enzyme can be synthesized
with a nucleotide base analog of interest using conventional
enzymatic or chemical polynucleotide synthesis techniques. After
synthesis, the polynucleotide is treated, i.e., digested, with a
restriction endonuclease for potential use as a releasing enzyme
which cleaves at the anticipated cleavage sites. The results of the
digestion are then analyzed by gel electrophoresis (or the
functional equivalent thereof) in order to determine if the
anticipated digestion products are produced.
Additionally, the choice of an inhibitory base analog for use in a
given embodiment of the invention will in part be determined by the
sequence of the restriction endonuclease recognition site and the
annealing region. The relationship of such sequences to the
nucleotide base analog inhibition sensitivities of the releasing
enzyme is an important factor in selecting the nucleotide base
analog or analogs for use in a given embodiment of the invention.
This relationship is of particular importance for purposes of the
present invention because the inhibitory base analogs selected for
use should not significantly interfere with the ability of the
selected releasing enzyme to cleave at either the recognition site
or a cleavage site within the annealing region of the releasable
primer or primers. If inhibitory base analogs incorporated into the
synthesis products at locations complementary to the releasable
primer significantly inhibit cleavage, then the synthesis products
will not be converted into the desired released synthesis products
by the releasing enzyme.
In accordance with the invention, alternative approaches may be
used to avoid potential inhibition of released synthesis product
formation. One way is to select a releasing enzyme having a
recognition sequence that is asymmetric, wherein one strand of the
recognition sequence lacks a base that is present on the
complementary strand of the recognition sequence, and modification
of that base inhibits the activity of the enzyme. These types of
enzymes are referred to herein as Class A enzymes. An example of
such a Class A releasing enzyme and inhibitory base analog
combination is Eam1104I (having a recognition site 5'-CTCTTC-3')
and 5-methylcytosine (or other cytosine derived inhibitory
analogs). Because cytosine does not base pair with the cytosine or
thymine of the recognition site of the releasable primer,
5-methylcytosine cannot be incorporated into the complementary
strand of the Eam1104I recognition site of the releasable primer.
Thus, 5-methylcytosine cannot interfere with the ability of
Eam1104I to produce released synthesis products. Therefore, when
the releasing enzyme used in the subject methods is the
particularly preferred Eam1104I, 5-methylcytosine may be used as
the inhibitory base analog.
The problem of potential inhibition of released synthesis product
formation may also be avoided by using a releasing enzyme that
cleaves when the recognition site of the enzyme has the selected
inhibitory base analog in one strand, but is inhibited when the
inhibitory base analog is present in both strands of the
recognition site. In this embodiment of the invention, the
restriction site may be identical and symmetric on both strands, or
may be asymmetric. These enzymes, which are inhibited only when
both strands contain the inhibitory base analog, are referred to as
Class B enzymes. The desired nucleotide product is synthesized
using an appropriate inhibitory base analog and the releasable
primer (which does not itself contain an inhibitory base analog).
Since the recognition sequence in the releasable primer
incorporates inhibitory base analog in only one strand (the
synthesized complementary strand), the releasing enzyme will cleave
at the primer sequence.
Yet another way to allow for the release of synthesis product
formation, while avoiding cleavage at internal sites, is by
utilizing a primer which lacks inhibitory base analogs, and
incorporating inhibitory base analogs into polynucleotide strands
primed by the releasable primer but not incorporating the
inhibitory analogs into the strand complementary to the releasable
primer. The resultant polynucleotide does not have an inhibitory
base analog in either strand of the recognition site introduced by
the releasable primer. These polynucleotides may then be treated
with a releasing enzyme that is inhibited by inhibitory base
analogs incorporated into either one or both strands of a
restriction site. These types of releasing enzymes are referred to
as Class C enzymes. The releasing enzyme may have a symmetric
recognition site or an asymmetric site.
One method of producing polynucleotide synthesis products that have
inhibitory base analogs in only one strand of the internal
recognition sites is through cyclic amplification reactions (see
FIG. 2). Inhibitory base analogs may be present during initial
reaction cycles of the cyclic amplification reaction, but omitted
from the last synthesis step. A purification reaction to remove
unincorporated inhibitory base analogs may be performed prior to
this last synthesis step, thereby increasing the yield of the
desired hemi-modified polynucleotide synthesis product.
Enzymes that may be used to catalyze polynucleotide synthesis in
the synthesis steps of the invention, including cyclic
amplification reactions, are well known to the person skilled in
the art and include, but are not limited to, Taq DNA polymerase,
Pfu DNA polymerase (Stratagene), phage T7 polymerase, phage T4
polymerase, E. coli DNA polymerase I, Vent.TM. (New England
Biolabs, Beverly Mass.) DNA polymerase, Deep Vent.TM. DNA
polymerase (New England Biolabs, Beverly Mass.), Moloney Murine
Leukemia Virus reverse transcriptase, and the like. In those
embodiments of the invention in which polynucleotide synthesis is
achieved by means of a cyclic amplification reaction, the enzyme
used to catalyze the polynucleotide synthesis reaction is
preferably a thermostable DNA polymerase.
When the DNA sequence for synthesis is relatively long and
synthesis is achieved by means of a cyclic amplification reaction,
it may be desirable to use a mixture of thermostable DNA
polymerases, wherein one of the DNA polymerases has 5'-3'
exonuclease activity and the other DNA polymerase lacks or
substantially lacks 5'-3' exonuclease activity. A description of
how to amplify long regions of DNA using these polymerase mixtures
can be found, among other places, in U.S. Pat. No. 5,436,149, Cheng
et al., Proc. Natl. Aca. Sci. USA 91:5695-9 (1994), and Barnes
Proc. Natl. Aca. Sci. USA 91:2216-2220 (1994) and U.S. patent
application Ser. Nos. 08/164,290, and 08/197,791.
Seamless Domain Replacement
The invention is particularly useful because it may be applied to
the convenient switching of polynucleotide sequences in related
genetic constructs either with or without the introduction of
additional nucleotides. This embodiment of the invention is
referred to herein as "seamless domain replacement." Seamless
domain replacement involves the use of seamless synthesis reactions
to produce a polynucleotide of interest by synthesizing two
different polynucleotide sequences using separate sets of primers,
cleaving the synthesis products with a releasing enzyme, and
ligating together the two sets of released synthesis products.
Either all the primers in the two synthesis reactions are
releasable primers or one of the primers in each of the two
synthesis reactions is a releasable primer. In a preferred
embodiment of the invention, all of the primers used for seamless
domain replacement are releasable primers. In a particularly
preferred embodiment of the invention, which may be used to prevent
the introduction of extraneous nucleotides, the releasing enzyme
recognition sites of the releasable primers are sites for type IIS
restriction endonucleases. The primers may be selected so as to
produce released polynucleotide synthesis products that have
non-identical overhanging ends, thereby permitting directional
cloning.
An example of an embodiment of seamless domain replacement can be
found in FIG. 1. FIG. 1 is a schematic diagram of seamless domain
replacement showing a first (A) and a second (B) cyclic
amplification reaction using releasable primers. The embodiment of
the method of the invention shown in FIG. 1 results in the
replacement of polynucleotide sequence D with polynucleotide
sequence D'. This replacement method comprises the following steps:
a polynucleotide of interest is amplified using first and second
releasable primers, thereby producing a first synthesis product.
The first synthesis product is then treated, i.e., contacted, with
a releasing enzyme to produce a first released synthesis product.
The method further comprises the step of performing a second cyclic
amplification reaction using third and fourth releasable primers to
produce a second synthesis product. The second synthesis product is
then treated with a selected releasing enzyme to produce a second
released synthesis product. The first and second released synthesis
products may then be ligated together to produce the genetic
construct of interest. Performing the ligation step in the presence
of the releasing enzyme reduces the time and steps required to
obtain the desired product.
The method of the invention can be used to directionally clone any
synthesis product by designing the releasable primers such that the
releasing enzyme or enzymes produce non-identical sticky ends
(i.e., overhanging ends as opposed to blunt ends). Thus, to
directionally clone the seamless domain replacement shown in FIG.
1, the released synthesis products produced by the first and second
releasable primers produce a first released synthesis product
having non-identical non-palindromic sticky ends that are ligatable
(in a directed orientation) with the sticky ends of the second
released synthesis product produced from the third and fourth
releasable primers.
Another aspect of the invention is to provide releasable primer
sets suitable for carrying out seamless domain replacement methods
of the invention. The subject primer sets comprise (1) a first
primer pair consisting of first and second releasable primers and
(2) a second primer pair consisting of third and fourth releasable
primers. The releasing enzyme recognition sites of all members of a
set of releasable primers for seamless domain replacement may be
identical. The annealing regions of the releasable primers are
selected subject to the following constraints: (1) a first released
synthesis product, resulting from treatment of the synthesis
product by a releasing enzyme, has two non-identical sticky ends,
(2) a second released synthesis product, resulting from treatment
of the synthesis product by a releasing enzyme, has two
non-identical sticky ends that are homologous, i.e., capable of
being ligated, to the two non-identical sticky ends of the first
released synthesis product.
Use of the Invention To Release Polynucleotides from Solid
Supports
The present invention is also directed to methods for the
convenient release of synthesis products bound or immobilized on a
solid support. Performing cyclic amplification reactions so as to
produce a bound, i.e., immobilized, synthesis product has numerous
applications, particularly in the field of assays for a
polynucleotide of interest. Such assays may have diagnostics
applications for the detection of microorganisms or indicia of
disease. Furthermore, cyclic amplification reactions that produce
an immobilized synthesis product, particularly a releasable
synthesis product, may readily be adapted for use with automated
equipment.
Polynucleotide synthesis products may be produced in a form
attached to solid phase supports by employing the subject methods
of synthesis, wherein polynucleotide synthesis is primed by at
least one releasable primer attached to a solid phase support. The
releasable primer may be attached to the solid phase support by any
of a variety of means, including covalent and non-covalent bonds.
Methods for the attachment of polynucleotides to solid supports are
well known to the person of ordinary skill in the art. Descriptions
of methods for attachment of nucleic acids to a variety of solid
supports can be found, among other places, as follows:
nitrocellulose (Ranki et al., Gene 21:77-85 (1983), cellulose
(Goldkorn and Prockop, Nucl. Acids Res. 14:9171-9191 (1986),
polystyrene (Ruth et al., Conference of Therapeutic and Diagnostic
Applications of Synthetic Nucleic Acids, Cambridge U.K. (1987),
teflon-acrylamide (Duncan et al. Anal. Biochem 169:104-108 (1988)),
polypropylene (Polsky-Cynkin et al. Clin. Chem 31:1438-1443
(1985)), nylon (Van Ness et al., Nucl. Acids Res. 19:3345-3350
(1991)), agarose (Polsky-Cynkin et al., Clin. Chem. 31:1438-1443
(1985)), sephacryl (Langdale and Malcolm, Gene 36:201-210 (1985)),
latex (Wolf et al., Nucl. Acids Res. 15:2911-2926 (1987) and
paramagnetic beads (Albretsen et al. Anal. Biochem. 189:40-50
(1990), Lang et al. Nucl. Acids Res. 16:10861-10880 (1988)).
As the polynucleotide synthesis reaction proceeds, the synthesis
products produced are bound to a solid support. Preferably, the
polynucleotide synthesis reaction is a cyclic amplification
reaction. The synthesis product may be released by contacting the
bound synthesis products with a suitable releasing enzyme, thereby
producing released synthesis products from the immobilized
synthesis products. Released polynucleotide synthesis products may
be readily transferred from the site of synthesis and subjected to
further manipulation or analysis.
Kits for Practice of the Invention
Another aspect of the invention is to provide kits for performing
the methods of the invention. The kits of the invention comprise
one or more of the enzymes or other reagents for use in performing
the subject methods. Kits may contain reagents in pre-measured
amounts to ensure both precision and accuracy when performing the
subject methods. Preferably, kits contain written instructions that
describe how to perform the methods of the subject invention. At a
minimum, the kits of the invention comprise a restriction
endonuclease and either a nucleoside triphosphate with a base
analog inhibitory for that restriction endonuclease or a
thermostable DNA polymerase suitable for use in a cyclic
amplification reaction. The restriction endonuclease in the kit may
be a type IIS restriction endonuclease. In addition, to these
embodiments, the kits of the invention may further comprise one or
more of the following components: concentrated reaction buffer, DNA
ligase, nucleoside triphosphates, mixtures of nucleoside
triphosphates in equimolar amounts, nucleoside triphosphates having
inhibitory base analogs, mixtures of nucleoside triphosphates and
nucleoside triphosphates having inhibitory base analogs,
thermostable DNA polymerases, frozen competent cells,
positive/negative control templates, control releasable primers,
and the like. An example of a kit of the invention is a kit
comprising the restriction endonuclease Eam1104I and
5-methylcytosine triphosphate as the inhibitory base analog.
The invention having been described, the following example is
offered by way of illustrating the invention and not by way of
limitation.
EXAMPLE
Seamless Domain Replacement
Experiments were performed to use the methods of the invention to
replace a segment of a plasmid with a corresponding segment of a
second plasmid. The experiments did not rely on the use of
convenient restriction sites in either plasmid.
Two commercially available plasmids were used for the experiments.
The plasmid pBluescripts.RTM. II KS contains an alpha complementing
fragment of LacZ. The plasmid pWhitescript5.7 is a derivative of
pbluescript.RTM. II KS (Stratagene) and contains a single point
mutation that introduces an ochre stop codon 22 nucleotides
downstream from the lacZ ATG. This mutation prevents expression of
a functional .alpha.-complementing .beta.Gal protein, resulting in
bacterial colonies that remain white when plated on media
supplemented with XGal and IPTG. Exchanging the region that
contains the stop codon with that of the parental pBluescript II
vector was expected to restore the original blue phenotype of the
lacZ gene.
The vector backbone and each domain of interest was PCR amplified
in the presence of .sup.m5 dCTP. The primers are given in table I;
the underlined segments of the polynucleotide indicate the
restriction endonuclease recognition site.
TABLE 1 (1F) AGTTACTCTTCACCATGATTACGCCAAGCGC (SEQ ID NO:1) (1R)
AGTTACTCTTCAGTGAGCGCGCGTAATACG (SEQ ID NO:2) (2F)
AGTTACTCTTCACACTGGCCGTCGTTTTACAACG (SEQ ID NO:3) (2R)
AGTTACTCTTCATGGTCATAGCTGTTTCCTGTG (SEQ ID NO:4)
Sense and antisense primers for the plasmid backbone (Primers 2R
and 2F) were designed to amplify all but a 190-bp region of the
lacZ gene of pWhitescript5.7 that contained the point mutation. The
primer pair (1F and 1R) for the 190-bp domain of interest was
designed to amplify the fragment from pBluescript II needed to
reconstitute the complete lacZ gene. The sense primer was
engineered to lie within the lacZ gene, downstream from the
translation start site. The PCR products were digested with
Eam1104I and subsequently ligated together in the presence of the
restriction enzyme, for details see Lin and Schwartz, BioTechniques
12:28-30 (1992); Russek et al., Cell Mol. Biol. Res. 36:177-182
(1993); Weiner, M. P., BioTechniques 15:502-505 (1993). The
negative control reaction received no ligase and did not yield
colonies upon transformation.
The domain of interest was prepared by PCR amplification of ng
pBluescript II SK+ DNA template in a 50-.mu.l reaction containing
200 .mu.M of each dNTP/2.5.mu. Taq DNA polymerase/2.5.mu.
TaqExtender.TM. additive/200 nM of each primer 1F and 1R/20 mM Tris
Cl pH 8.5/10 mM KCl/10 mM (NH.sub.4).sub.4 SO.sub.4 /2 mM
MgCl.sub.2 /0.1 mg/ml BSA/0.1% Triton X-100. The reaction was
overlaid with mineral oil and amplified once at 94.degree. C. for 3
min/58.degree. C. for 2 min/72.degree. C. for 3 min/with 9
subsequent cycles at 94.degree. C. for 45s/58.degree. C. for
35s/72.degree. C. for 1 min. 5 additional cycles were performed in
the presence of .sup.m5 dCTP by adding a 50 .mu.M solution of 200
.mu.M each dATP, dGTP, dTTP/1 mM .sup.m5 dCTP/2.5.mu. each Taq DNA
polymerase and TaqExtender.TM. additive(Stratagene, La Jolla,
Calif.) in the same buffer. The cycling parameters were kept
constant except for the denaturation cycle which was increased to
95.degree. C. for 1.5 min. Modification of the denaturation cycle
was required because methylated DNA has a higher melting
temperature compared to unmethylated DNA. Subsequently, we
determined that the length of the denaturation cycle could be
reduced to 45 sec. without compromising the product yield.
The vector backbone was prepared in the same fashion as the domain
of interest, except for the following modifications. The extension
time was changed from 1 min to 12 min to accommodate the slower
processivity of the enzyme. The denaturation time was held constant
at 45 sec. The resulting PCR products were phenol: chloroform
extracted and ethanol precipitated. Approx. 0.3 pmol of vector and
1 pmol of insert were combined and digested with 24 units of
Eam1104I in 1.times. universal buffer (100 mM KoAc, 25 mM tris
acetate pH 7-6, 10 mM MgOAc, 0.5 mM .beta.-mercaptoethanol, 10
.mu.g/ml BSA) 1/10 of the crude digest was ligated for 30 min at
37.degree. C. in a 20 .mu.l reaction containing 50 mM Tris-HCl/10
mM MgCl/10 mM DTT/20 .mu.g BSA per ml/1 mM ATP/8 or 6 units
Eam1104I/6 Weiss units T4 DNA ligase.
Competent XL-1 Blue MRF'/E. coli cells were transformed with 4
.mu.l of the ligation according to the manufacturer's instructions
and plated on ampicillin selection medium supplemented with 100
.mu.M IPTG and 10 .mu.g XGal/ml.
The data showed that 2% of the bacterial colonies remained white,
whereas 98% exhibited the blue color that was expected of clones
carrying the restored lacZ gene (data not shown). The high
percentage of blue colonies suggests that the addition of Eam1104I
to the ligation reaction provided a selection for the formation of
the desired product. The presence of the restriction endonuclease
in the ligation mixture not only maintains unmethylated vector in a
linear state, but also re-digests unwanted ligation products and
thus contributes to the assembly and maintenance of only accurately
joined insert: vector pairings, which results in higher cloning
efficiency.
Incorporation by Reference
All patents, patents applications, and publications cited are
incorporated herein by reference.
Equivalents
The foregoing written specification is considered to be sufficient
to enable one skilled in the art to practice the invention. Indeed,
various modifications of the above-described methods for carrying
out the invention which are obvious to those skilled in the field
of molecular biology or related fields are intended to be within
the scope of the following claims.
SEQUENCE LISTING <100> GENERAL INFORMATION: <160>
NUMBER OF SEQ ID NOS: 4 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 1 <211> LENGTH: 31 <212> TYPE:
DNA <213> ORGANISM: Unknown <220> FEATURE: <223>
OTHER INFORMATION: Description of Unknown Organism primer for
amplification and replication <400> SEQUENCE: 1 agttactctt
caccatgatt acgccaagcg c 31 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 2 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Unknown <220> FEATURE: <223>
OTHER INFORMATION: Description of Unknown Organism primer for
amplification and replication <400> SEQUENCE: 2 agttactctt
cagtgagcgc gcgtaatacg 30 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 3 <211> LENGTH: 34 <212> TYPE:
DNA <213> ORGANISM: Unknown <220> FEATURE: <223>
OTHER INFORMATION: Description of Unknown Organism primer for
amplification and replication <400> SEQUENCE: 3 agttactctt
cacactggcc gtcgttttac aacg 34 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 4 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Unknown <220> FEATURE: <223>
OTHER INFORMATION: Description of Unknown Organism primer for
amplification and replication <400> SEQUENCE: 4 agttactctt
catggtcata gctgtttcct gtg 33
* * * * *