U.S. patent number 5,721,127 [Application Number 08/474,140] was granted by the patent office on 1998-02-24 for pullulanase.
This patent grant is currently assigned to Genencor International, Inc.. Invention is credited to Antoine Amory, Philippe Deweer.
United States Patent |
5,721,127 |
Deweer , et al. |
February 24, 1998 |
Pullulanase
Abstract
The invention relates to a heat-stable pullulanase having the
property of hydrolysing glucosidic bonds of the .alpha.- 1,6 type
in amylopectin and having an enzymatic activity in an acid medium
and at a temperature of about 60.degree. C. The invention also
relates to strains of microorganisms which produce this pullulanase
and processes for the preparation of this pullulanase. The
invention also relates to the uses thereof and compositions
comprising the product. The invention also relates to a DNA
molecule. The invention relates to an expression vector containing
this DNA molecule and to a chromosomal integration vector
containing this DNA molecule.
Inventors: |
Deweer; Philippe (Aalst,
BE), Amory; Antoine (Rixensart, BE) |
Assignee: |
Genencor International, Inc.
(Rochester, NY)
|
Appl.
No.: |
08/474,140 |
Filed: |
June 7, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
174893 |
Dec 28, 1993 |
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Dec 28, 1992 [BE] |
|
|
09201156 |
Jul 15, 1993 [BE] |
|
|
09300744 |
Nov 19, 1993 [BE] |
|
|
09301278 |
|
Current International
Class: |
C12N 009/44 ();
C07H 021/04 () |
Field of
Search: |
;435/210 ;536/23.2 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 063 909A1 |
|
Nov 1982 |
|
EP |
|
0 063 909B2 |
|
Sep 1990 |
|
EP |
|
0 405 283A2 |
|
Jan 1991 |
|
EP |
|
Other References
Norman, "A Novel Bacillus Pullulanase-Its Properties and
Application in the Glucose Syrups Industry," J. Jpn. Soc. Starch
Sci., vol. 30, No. 2 (1983), pp. 200-211. .
Harwood et al., "Molecular Biological Methods for Bacillus," John
Wiley and Sons (1990), pp. 150-151. .
Manners, "Structural Analysis of Starch Components by Debranching
Enzymes, New Approaches to Research on Cereal Carbohydrates",
Edited by R.D. Hill and L. Munck, Elsevier Science Publishers B.V.,
Amsterdam, (1985), pp. 45-54. .
Enevoldsen, "Aspects of the Fine Structure of Starch," New
Approaches to Research on Cereal Carbohydrates, Edited by R.D. Hill
and L. Munck, Elsevier Science Publishers B.V., Amsterdam, (1985),
pp. 55-603. .
Maniatis et al., "Molecular Cloning," A Laboratory Manual, Cold
Spring Harbor Laboratory (1982), pp. 150-152 and 374-379. .
Freudl, "Protein Secretion in Gram-Positive Bacteria," Journal of
Biotechnology, vol. 23 (1992), pp. 231-240. .
Sullivan et al., "New Shuttle Vectors for Bacillus subtilis and
Escherichia coli Which Allow Rapid Detection of Inserted
Fragments," Gene,vol. 29 (1984), pp. 21-26. .
Sanger et al., "DNA Sequencing with Chain-Terminating Inhibitors,"
Proc. Natl. Acad. Sci. USA, vol. 74, No. 12 (Dec. 1977), pp.
5463-5467. .
Beaucage et al., "Deoxynucleoside Phosphoramidites-A New Class of
Key Intermediates for Deoxypolynucleotide Synthesis," Tetrahedron
Letters, vol. 22, No. 20 (1981), pp. 1859-1862. .
Molecular Cloning-A Laboratory Manual-Sambrook, Fritsch,
Maniatis-Second Edition (1989). .
Norton Nelson, "A Photometric Adaptation of the Somogyi Method for
the Determination of Glucose," J. Biol. Chem., vol. 153 (1944), pp.
375-380. .
Michael Somogyi, "A New Reagent for the Determination of Sugars,"
J. Biol. Chem., vol. 160 (1945), pp. 61-68. .
Bauw et al., "Alterations in the Phenotype of Plant Cells Studied
NH.sub.2 -Terminal Amino Acid-Sequence Analysis of Proteins
Electroblotted from Two-Dimensional Gel-Separated Total Extracts,"
Proc. Natl. Acad. Sci. USA, vol. 84 (1987), pp. 4806-4810. .
Takashi Kuriki et al., "New Type of Pullulanase from Bacillus
stearothermophilus and Molecular Cloning and Expression of the Gene
in Bacillus subtilis," Journal of Bacteriology, vol. 170, No. 4,
pp. 1554-1559 (Apr. 1988). .
European Search Report Dated Mar. 10, 1994, In Corresponding
European Patent Publication No. 93 20 3593. .
Jensen, et al., "Bacillus acidopullulyticus Pullulanase:
Application and Regulatory Aspects for Use in the Food Industry",
Process Biochemistry, pp. 129-134 (Aug. 1984)..
|
Primary Examiner: Wax; Robert A.
Assistant Examiner: Hobbs; Lisa J.
Attorney, Agent or Firm: Cooley Godward LLP
Parent Case Text
This is a continuation of application Ser. No. 08/174,893, filed
Dec. 28, 1993 now abandoned.
Claims
We claim:
1. Isolated pullulanase obtained from the species Bacillus
deramificans or a derivative or a mutant thereof that retains all
identifying characteristics of said species, wherein the
pullulanase obtained from said species or said derivative or said
mutant catalyzes hydrolysis of .alpha.-1,6-glucosidic bonds and
comprises an N-terminal sequence (SEQ ID NO:1) as follows, in the
aminocarboxyl sense and from left to right: ##STR4##
2. Isolated and purified pullulanase comprising the amino acid
sequence illustrated in FIG. 4 (SEQ ID NO:11) from amino acid 1 to
928 or a modified sequence derived therefrom, wherein said modified
sequence catalyzes hydrolysis of .alpha.-1,6-glucosidic bonds.
3. Isolated and purified pullulanase according to claim 2, wherein
said pullulanase is synthesized in the form of a precursor
containing an additional sequence of 29 amino acids (SEQ ID
NO:12).
4. Isolated pullulanase heterologously produced by a microorganism
of the genus Bacillus containing a gene which codes for an alkaline
protease in the wild state, said gene having been deleted from the
microorganism of the genus Bacillus, wherein said pullulanase has
an N-terminal sequence as shown in SEQ ID NO:1.
5. Isolated pullulanase obtained from a transformed strain of
Bacillus licheniformis comprising an isolated DNA molecule encoding
a pullulanase of Bacillus deramificans of a nucleotide sequence
shown in SEQ ID NO:10 or a modified sequence derived therefrom,
wherein said modified sequence catalyzes hydrolysis of
.alpha.-1,6-glucosidic bonds.
6. Isolated pullulanase obtained from a transformed strain of
Bacillus licheniformis comprising an expression vector or a
chromosomal integration vector containing an isolated DNA molecule
encoding a pullulanase of Bacillus deramificans of a nucleotide
sequence shown in SEQ ID NO:10 or a modified sequence derived
therefrom, wherein said modified sequence catalyzes hydrolysis of
.alpha.-1,6-glucosidic bonds.
7. Isolated pullulanase obtained from a transformed strain of
Bacillus licheniformis comprising expression vector pUBDEBRA1 or
chromosomal integration vector pUBCDEBRA11DNSI.
8. Isolated pullulanase obtained from the strain Bacillus
deramificans T 89.117D (LMG P-13056) or a derivative or a mutant of
said strain that retains all identifying characteristics of said
strain, wherein the pullulanase obtained from said strain or said
derivative or said mutant catalyzes hydrolysis of
.alpha.-1,6-glucosidic bonds.
9. Isolated pullulanase obtained from a microorganism of the genus
species Bacillus deramificans that in the wild state contains a
gene which codes for an alkaline protease, said gene having been
deleted from the microorganism of the genus species Bacillus
deramificans, wherein said pullulanase has an N-terminal sequence
as shown in SEQ ID NO:1.
Description
The invention relates to a new pullulanase. The invention also
relates to a new strain of microorganisms which produce this
pullulanase and the processes for the preparation of this
pullulanase. The invention also relates to uses thereof and
compositions comprising this product. The invention also relates to
a DNA molecule containing the gene of this pullulanase and to an
expression vector containing this DNA molecule, which can be used
to express pullulanase in Bacillus strains.
Starch, the essential constituents of which are amylose and
amylopectin, can be converted into simple sugars by an enzymatic
process carried out in two stages: one stage of liquefaction of the
starch and one stage of saccharification of the liquefied starch.
In order to obtain a high conversion level of the starch, it has
already been proposed to add an enzyme which hydrolyses
.alpha.-1,6-glucosidic bonds, such as, for example, a pullulanase,
during the saccharification of the liquefied starch.
European Patent 0 063 909 describes a so-called debranching enzyme,
that is to say an enzyme which is capable of hydrolysing the
.alpha.-1,6-glucosidic bonds in amylopectin, which has a
pullulanase activity and has an optimum activity at a pH of 4-5 at
60.degree. C. This enzyme is derived from a strain of Bacillus
acidopullulyticus.
U.S. Pat. No. 5,055,403 furthermore has proposed a pullulanase
which has an enzymatic activity in an acid medium and is derived
from a strain of Bacillus naganoensis. This enzyme has a maximum
activity at a pH of about 5, measured at 60.degree. C., and a
maximum activity at a temperature of about 62.5.degree. C.,
measured at a pH of 4.5.
Although active at acid pH and at a temperature of about 60.degree.
C. and therefore suitable for use in the saccharification of
liquefied starch, the pullulanases of the prior art have the
disadvantage of having a very low stability under such temperature
and pH conditions, their half-life at a temperature of 60.degree.
C. and at a pH of about 4.5 in the absence of substrate not
exceeding a few tens of minutes.
There is consequently currently a demand for a pullulanase which
can be used in the saccharification of liquefied starch and is very
stable within a wide temperature and pH range, in particular at a
temperature of about 60.degree. C. and at a pH of about 4.5.
The object of the present invention is to provide a new pullulanase
which is active at an acid pH, has a heat stability at an acid pH
which is very greatly superior to that. of the pullulanases of the
prior art and has a half-life of several hours under the
abovementioned conditions.
The object of the present invention is also to identify, isolate
and provide a strain, and particularly a Bacillus strain, which
naturally produces the said pullulanase.
The object of the present invention is also to isolate and provide
a nucleotide sequence which codes for the said pullulanase.
The object of the present invention is also to prepare and provide
an expression vector and a chromosomal integration vector
containing the nucleotide sequence which codes for the said
pullulanase.
The object of the present invention is also to prepare and provide
a Bacillus host transformed with the expression vector or the
integration vector containing the nucleotide sequence of the strain
of Bacillus which codes for the said pullulanase.
To this effect, the invention relates to a pullulanase produced by
a Bacillus, and more particularly by an aerobic and
non-thermophilic microorganism, such as Bacillus deramificans.
Bacillus deramificans T 89.117D or a derivative or mutant of this
strain of Bacillus deramificans are preferably employed.
The isolated and purified pullulanase is preferably made up of a
single type of polypeptide having a molecular weight of about 100
(.+-.10) kDa.
Moreover, the N-terminal sequence (SEQ ID NO:1) of the said
pullulanase is as follows, in the amino-carboxyl sense and from
left to right: ##STR1##
The invention relates to an isolated and purified pullulanase
comprising the amino acid sequence of 1 to 928 amino acids (SEQ ID
NO:11) or a modified sequence derived therefrom. This sequence is
the complete amino acid sequence of the said pullulanase, as
illustrated in FIGS. 4 (4a to 4f).
The complete nucleotide sequence (SEQ ID NO:10) which codes for
pullulanase and its translation into amino acids is given in FIG.
4.
Particularly preferably, the said pullulanase has an isoelectric
point of between 4.1 and 4.5.
The pullulanase according to the invention is heat stable and
active in a wide temperature range. The pullulanase is active at an
acid pH.
The said pullulanase is capable of catalysing the hydrolysis of
.alpha.-1,6-glucosidic bonds present both in amylopectin and in
pullulane. It is therefore a so-called deramifying or debranching
enzyme. The said pullulanase is preferably capable of hydrolysing
glucosidic bonds of the .alpha.-1,6 type in amylopectin.
The pullulanase according to the invention preferably breaks down
pullulane into maltotriose and amylopectin into amylose.
Moreover, the pullulanase of the present invention hydrolyses
amylopectin to form oligosaccharides (maltooligosaccharides).
During this hydrolysis, the formation of oligosaccharides made up
of about 13 glucose units (degree of polymerization of 13, this
molecule is also called "chain A") is observed, followed by the
formation of oligosaccharides made up of about 47 glucose units
(degree of polymerization of 47, this molecule is also called
"chain B").
The oligosaccharides with chains A and B are defined with reference
to D. J. MANNERS ("Structural Analysis of Starch components by
Debranching Enzymes" in "New Approaches to research on Cereal
Carbohydrates", Amsterdam, 1985, pages 45-54) and B. E. ENEVOLDSEN
("Aspects of the fine structure of starch" in "New Approaches to
research on Cereal Carbohydrates", Amsterdam, 1985, pages
55-60).
The pullulanase of the present invention preferably hydrolyses
potato amylopectin. This hydrolysis can be carried out with an
aqueous suspension of amylopectin in the presence of the
pullulanase under the conditions of optimum activity of the
pullulanase, that is to say at a temperature of about 60.degree. C.
and at a pH of about 4.3.
The pullulanase of the present invention catalyses the condensation
reaction of maltose to form tetraholo-sides sides (oligosaccharides
having 4 glucose units).
The pullulanase of the invention has a half-life of about 55 hours,
measured at a temperature of about 60.degree. C. in a solution
buffered at a pH of about 4.5 and in the absence of substrate.
Half-life means that the pullulanase shows a relative enzymatic
activity of at least 50%, measured after an incubation of 55 hours
at a temperature of about 60.degree. C. in a solution buffered at a
pH of about 4.5 and in the absence of substrate.
The pullulanase according to the invention is heat stable at an
acid pH. In fact, the pullulanase according to the invention shows
a relative enzymatic activity of at least 55%, measured after an
incubation of 40 hours at a temperature of 60.degree. C. in a
solution buffered at a pH of about 4.5 and in the absence of
substrate. It shows a relative enzymatic activity of at least 70%,
measured after an incubation of 24 hours under these same
conditions.
Relative enzymatic activity means the ratio between the enzymatic
activity measured in the course of a test carried out under the
given pH, temperature, substrate and duration conditions, and the
maximum enzymatic activity measured in the course of this same
test, the enzymatic activity being measured starting from the
hydrolysis of pullulane and the maximum enzymatic activity being
fixed arbitrarily at the value of 100.
The pullulanase according to the invention is furthermore stable in
a wide range of acid pH values.
Under the conditions described below, it is active at a pH greater
than or equal to 3. In fact, the said pullulanase shows a relative
enzymatic activity of at least 85%, measured after an incubation of
60 minutes at a temperature of about 60.degree. C. in the absence
of substrate and in a pH range greater than or equal to about
3.5.
Under the conditions described below, it is active at a pH of less
than or equal to 7. In fact, the said pullulanase shows a relative
enzymatic activity of at least 85%, measured after an incubation of
60 minutes at a temperature of about 60.degree. C. in the absence
of substrate and in a pH range less than or equal to about 5.8.
It preferably shows a relative enzymatic activity of greater than
90%, measured in a pH range of between about 3.8 and about 5 under
these same conditions.
The pullulanase according to the invention develops an optimum
enzymatic activity, measured at a temperature of about 60.degree.
C. in a pH range greater than 4.0. The pullulanase according to the
invention develops an optimum enzymatic activity, measured at a
temperature of about 0.degree. C. in a pH range less than 4.8. The
said pullulanase preferably develops an optimum enzymatic activity,
measured at a temperature of about 60.degree. C. at a pH of about
4.3.
The pullulanase according to the invention furthermore develops an
optimum enzymatic activity, measured at a pH of about 4.3, in a
temperature range of between 55.degree. and 65.degree. C. and more
particularly at 60.degree. C.
The pullulanase according to the invention develops an enzymatic
activity of more than 80% of the maximum enzymatic activity (the
maximum enzymatic activity being measured at a temperature of
60.degree. C. and at a pH of 4.3) in a pH range between about 3.8
and about 4.9 at a temperature of about 60.degree. C.
The pullulanase according to the invention furthermore has all the
appropriate properties compatible with actual industrial conditions
of saccharification of starch. These properties are an optimum pH
of less than 5, an optimum temperature at about 60.degree. C. and a
good stability of the enzyme under these conditions of acid pH and
elevated temperature. The acid medium is imposed by the
simultaneous use of glucoamylase and pullulanase in the industrial
saccharification of starch. In fact, the glucoamylase used for
saccharification of starch is generally produced by a fungus and in
particular by an Aspergillus strain, such as Aspergillus niger,
Aspergillus awamori or Aspergillus foetidus. The ideal conditions
which are suitable for saccharification of liquefied starch in the
presence of a glucoamylase are a temperature of about 60.degree. C.
and a pH of about 4.0 to 4.5. This is the case, in particular, for
the glucoamylase sold under the trade names DIAZYME.RTM. L-200 by
SOLVAY ENZYMES (Elkhart, United States) and OPTIDEX.RTM. by SOLVAY
ENZYMES (Hanover, Germany). Furthermore, the saccharification stage
lasts several hours, in general 40 to 60 hours, and it is essential
that the enzymes used are stable, active and effective throughout
this stage, and these enzymes should therefore have a high heat
stability in an acid medium and the longest possible half-life. For
this reason, the pullulanase of the present invention is more
effective than the known pullulanases.
The present invention also relates to a process for the production
of a pullulanase which comprises culture of an aerobic (and
non-thermophilic) bacterium which is capable of producing
pullulanase in a suitable nutrient medium containing sources of
carbon and nitrogen and mineral salts under aerobiotic conditions,
and harvesting of the pullulanase thus obtained. This culture
medium may be solid or liquid. The culture medium is preferably
liquid.
The present invention also relates to a process for the production
of a pullulanase which comprises culture of the strain Bacillus
deramificans T 89.117D (LMG P-13056) or a derivative of this strain
which is capable of producing pullulanase in a suitable nutrient
medium containing sources of carbon and nitrogen and mineral salts
under aerobiotic conditions, and harvesting of the pullulanase thus
obtained.
The culture conditions for these bacteria, such as the components
of the culture medium, culture parameters, temperature, pH,
aeration and stirring, are well-known to the expert.
The sources of carbon in the culture medium are usually chosen from
starch, partially hydrolysed starch, soluble starch,
oligosaccharides, glucose, amylose, amylopectin or a mixture of two
or more of these. The sources of carbon in the culture medium are
preferably chosen from partially hydrolysed starch, pullulane,
glucose or a mixture of these. Good results have been obtained with
glucose and partially hydrolysed starch. The sources of nitrogen in
the culture medium are usually chosen from yeast extract, soya
flour, cottonseed flour, fish meal, gelatin, potato flour or a
mixture of two or more of these. The sources of nitrogen in the
culture medium are preferably chosen from yeast extract, soya flour
or a mixture of these. Good results have been obtained with yeast
extract. The mineral salts in the culture medium are generally
chosen, with respect to the anions, from chloride, carbonate,
phosphate and sulphate, and, with respect to the cations, from
potassium, sodium, ammonium, magnesium, calcium or a mixture of two
or more of these. Good results have been obtained with a mixture of
the following salts: KH.sub.2 PO.sub.4, K.sub.2 HPO.sub.4.3H.sub.2
O, (NH.sub.4).sub.2 SO.sub.4, MgCl.sub.2.6H.sub.2 O and
CaCl.sub.2.2H.sub.2 O.
Culture is generally carried out at a temperature of between
20.degree. and 45.degree. C. preferably between 25.degree. and
40.degree. C.
Culture is generally carried out at a pH of between 3.5 and 6,
preferably between 4 and 6.
Culture is carried out under aerobiotic conditions in the presence
of air or oxygen and while stirring.
The techniques for harvesting the pullulanase produced are well
known to the expert. Centrifugation, ultrafiltration, evaporation,
precipitation, filtration, microfiltration, crystallization or a
combination of one or other of these techniques, such as
centrifugation followed by ultrafiltration, is usually
employed.
The pullulanase can then be purified, if necessary. The techniques
for purification of enzymes are known to the expert, such as, in
particular, precipitation with the aid of a salt such as ammonium
sulphate, or a solvent such as, chiefly, acetone.
The pullulanase can also be dried by spraying or
lyophilization.
The present invention also relates to identification and provision
of a new isolated aerobic bacterium which produces pullulanase.
Generally, this belongs to the family of Bacillaceae. It preferably
belongs to the Bacillus genus. The said Bacillus is particularly
preferably the strain Bacillus deramificans T 89.117D or a
derivative or mutant of this strain.
Derivative or mutant of this strain means any naturally or
artificially modified bacterium. The derivatives of this strain can
be obtained by known modification techniques, such as ultra-violet
radiation, X-rays, mutagenic agents or genetic engineering.
The strain Bacillus deramificans T 89.117D has been deposited in
the collection called BELGIAN COORDINATED COLLECTIONS OF
MICROORGANISMS (LMG culture collection, University of Ghent,
Laboratory of Microbiology-K. L. Ledeganckstraat 35, B-9000 GHENT,
Belgium) in accordance with the Treaty of Budapest under number LMG
P-13056 on 9 Dec. 1992. The invention thus relates to an isolated
and purified culture of Bacillus deramificans T 89.117D and a
derived or mutated culture thereof.
The strain of the present invention has been identified by its
biochemical characteristics: a Gram-positive, aerobic, rod-shaped
bacterium which forms an endospore.
The invention also relates to the isolation and provision of a DNA
molecule comprising a nucleotide sequence (SEQ ID NO:10) which
codes for the pullulanase of Bacillus deramificans T 89.117D (LMG
P-13056) or a modified sequence derived therefrom. This DNA
molecule preferably comprises the entire gene of the pullulanase of
Bacillus deramificans T 89.117D. The entire gene of the pullulanase
means at least the transcription promoter(s), the signal
sequence(s), the nucleotide sequence which codes for the mature
pullulanase and the transcription terminator(s).
The DNA molecule according to the invention comprises at least the
nucleotide sequence (SEQ ID NO:10) which codes for the mature
pullulanase of Bacillus deramificans T 89.117D (LMG P-13056) and
its signal sequence (presequence) (SEQ ID NO:13). This DNA molecule
preferably comprises the entire gene of the pullulanase of Bacillus
deramificans T 89.117D. Good results have been obtained with a DNA
molecule comprising the nucleotide sequence (SEQ ID NO:8). The
nucleotide sequence (SEQ ID NO:8) is made up of, in the
amino-carboxyl sense and from left to right, the nucleotide
sequence (SEQ ID NO:14), the nucleotide sequence (SEQ ID NO:13),
the nucleotide sequence (SEQ ID NO:10) and the nucleotide sequence
(SEQ ID NO:15).
The pullulanase of the invention is synthesized in the form of a
precursor containing an additional sequence of 29 amino acids (SEQ
ID NO:12).
The invention also relates to a modified pullulanase, that is to
say an enzyme in which the amino acid sequence differs from that of
the wild enzyme by at least one amino acid. These modifications can
be obtained by the conventional techniques of mutagenesis on DNA,
such as exposure to ultra-violet radiation, or to chemical
products, such as sodium nitrite or O-methylhydroxylamine, or by
genetic-engineering techniques, such as, for example, site-directed
mutagenesis or random mutagenesis.
The invention also relates to a mutated pullulanase obtained by
modification of the nucleotide sequence of the gene which codes for
the pullulanase defined above. The techniques for obtaining such
mutated pullulanases are known to the expert and are described in
particular in Molecular Cloning--a laboratory manual--SAMBROOK,
FRITSCH, MANIATIS--second edition, 1989, in chapter 15.
The invention also relates to the preparation and provision of an
expression vector containing the DNA molecule which comprises the
nucleotide sequence which codes for the pullulanase of Bacillus
deramificans T 89.117D. The DNA molecule preferably comprises the
structural gene which codes for the mature pullulanase of Bacillus
deramificans T 89.117D. This vector is particularly preferably the
vector pUBDEBRA1. Good results have also been obtained with the
vector pUBCDEBRA11.
Expression vector means any DNA sequence which comprises a replicon
and other DNA regions (nucleotide sequences) and which functions
independently of the host as a complete gene expression unit.
Complete gene expression unit means the structural gene and the
promoter region(s) and the regulation region(s) necessary for
transcription and translation. Structural gene means the coding
sequence which is used for transcription into RNA and allows
synthesis of the protein by the host.
The preferred expression vector is the vector pUBDEBRA1. This
vector contains the gene which codes for the pullulanase of the
strain Bacillus deramificans T 89.117D according to the invention.
This vector can be introduced into a suitable host. This host is
generally a strain of Bacillus. This host is preferably a strain of
Bacillus licheniformis. This host is particularly preferably a
strain of Bacillus licheniformis SE2. Excellent results have been
obtained with this vector when it is introduced into the strain
Bacillus licheniformis SE2 delap1, used as the host.
The invention also relates to the preparation and provision of a
chromosomal integration vector containing the DNA molecule which
comprises the nucleotide sequence which codes for the pullulanase
of Bacillus deramificans T 89.117D. The DNA molecule preferably
comprises the structural gene which codes for the mature
pullulanase of Bacillus deramificans T 89.117D. This chromosomal
integration vector is particularly preferably the vector
pUBCDEBRA11DNSI.
The present invention also relates to recombinant strains in which
the said gene which codes for pullulanase is introduced by
genetic-engineering techniques. The gene can be introduced on a
plasmid by an expression vector or integrated into the host
chromosome in one or more copies by a chromosomal integration
vector.
The invention also relates to the strains of microorganisms which
are different from the starting producer organism and in which the
nucleotides which code for the pullulanase are introduced by
transformation, either in a form integrated in the chromosomal DNA
or in autoreplicative form (plasmid).
The invention relates to the transformed strain of Bacillus
licheniformis which comprises the DNA molecule described above. The
invention relates to the transformed strain of Bacillus
licheniformis which comprises the expression vector or the
chromosomal integration vector which comprises this DNA molecule.
The invention preferably relates to the transformed strain of
Bacillus licheniformis which comprises the expression vector
pUBDEBRA1 or the chromosomal integration vector
pUBCDEBRA11DNSI.
The invention also relates to a process for the preparation of a
pullulanase starting from a recombinant organism, the process
comprising isolation of a DNA fragment which codes for pullulanase,
insertion of this DNA fragment into a suitable vector, introduction
of this vector into a suitable host or introduction of this DNA
fragment into the chromosome of a suitable host, culture of this
host, expression of the pullulanase and harvesting of the
pullulanase. The suitable host is generally chosen from the group
comprising Escherichia coli, Bacillus or Aspergillus
microorganisms. The host is usually chosen from the Bacilli. The
host is preferably chosen from (aerobic) microorganisms of the
genus Bacillus. The host is particularly preferably chosen from the
microorganisms Bacillus subtilis, Bacillus licheniformis, Bacillus
alcalophilus, Bacillus pumilus, Bacillus lentus, Bacillus
amyloliquefaciens or Bacillus deramificans T 89.117D (LMG
P-13056).
Good results have been obtained when the host for expression of the
pullulanase according to the present invention is a recombinant
strain derived from Bacillus licheniformis, and preferably the
strain Bacillus licheniformis SE2 delap1.
The strain of Bacillus licheniformis SE2 was deposited on 21 Jun.
1993 in the collection called BELGIAN COORDINATED COLLECTIONS OF
MICROORGANISMS (LMG culture collection, Ghent, Belgium) in
accordance with the Treaty of Budapest under number LMG
P-14034.
The transformed strain SE2 delap1 thus obtained from Bacillus
licheniformis SE2 differs from the parent strain by the sole fact
that it does not contain in its chromosome the DNA sequence which
codes for the mature protease.
The invention also relates to a pullulanase produced in a
heterologous manner by a microoganism of the genus Bacillus which
contains a gene which codes for an alkaline protease in the wild
state. This microorganism is preferably a strain of Bacillus
licheniformis comprising the DNA molecule which comprises the
nucleotide sequence which codes for the pullulanase of Bacillus
deramificans T 89.117D. The gene which codes for the alkaline
protease has particularly preferably been deleted from this strain
of Bacillus. This strain is preferably the strain Bacillus
licheniformis SE2 delap1.
Produced in a heterologous manner means production which is not
effected by the natural microorganism, that is to say the
microorganism which contains, in the wild state, the gene which
codes for the pullulanase.
The pullulanase according to the invention has several outlets in
various industries, such as, for example, the food industry, the
pharmaceuticals industry or the chemical industry.
The pullulanase can in particular be used in baking as an
"anti-staling" agent, that is to say as an additive to prevent
bread becoming stale during storage, or in brewing during
production of low-calorie beers.
The pullulanase can also be used in the preparation of low-calorie
foods in which amylose is used as a substitute for fats.
The pullulanase can also be used to hydrolyse amylopectin and to
form oligosaccharides starting from this amylopectin.
The pullulanase can also be used to form tetraholosides starting
from maltose.
The pullulanase can also be used to condense mono- or
oligo-saccharides, creating bonds of the alpha-1,6 type.
The pullulanase can be used, for example, to clarify fruit
juices.
The pullulanase can be used for liquefaction of starch.
For food applications, the pullulanase can be immobilized on a
support. The techniques for immobilization of enzymes are well
known to the expert.
The pullulanase according to the invention is particularly suitable
for treatment of starch and pullulane.
The invention relates to the use of the pullulanase for
saccharification of liquefied starch.
The present invention also relates to the use of the pullulanase in
a process for breaking down starch or partially hydrolysed starch
comprising a stage of saccharification of the starch or the
partially hydrolysed starch in the presence of a pullulanase. This
process is in general carried out in the presence of one or more
other enzymes, such as glucoamylase, .alpha.-amylase,
.beta.-amylase, .alpha.-glucosidase or other saccharifying
enzymes.
Given its biochemical properties, the pullulanase according to the
present invention allows the saccharification stage to be carried
out under strongly acid conditions, that is to say down to a pH of
at least 3.9. This pH is more acid than that which is acceptable to
the known pullulanases.
Given its biochemical properties, the pullulanase according to the
present invention allows the saccharification stage to be carried
out at relatively high temperatures, that is to say up to at least
a temperature of 65.degree. C.
Addition of the pullulanase according to the present invention to
the saccharification medium allows the content of glucose in the
final composition obtained to be increased and therefore the yield
of the reaction to be increased.
Moreover, addition of the pullulanase of the present invention to
the saccharification medium allows the saccharification period to
be reduced.
The pullulanase of the present invention allows a high starch
conversion level to be achieved.
Furthermore, during the saccharification stage, it is possible for
a large proportion (at least 60%) of the glucoamylase usually used
to be replaced by the pullulanase of the present invention without
affecting the yield of glucose. This replacement is particularly
advantageous, and in fact it allows the amount of by-products
usually obtained to be reduced considerably. Since the glucoamylase
is present in a small proportion, it is unable to catalyse the
synthesis reaction of oligosaccharides (containing .alpha.-1,6
bonds) starting from glucose; under the normal conditions,
glucoamylase catalyses this inverse reaction of oligosaccharide
synthesis when high concentrations of dextrose are reached in the
saccharification medium, which limits the starch conversion
level.
Furthermore, the pullulanase of the present invention allows a
concentrated saccharification medium, that is to say a medium
having a high content of liquefied starch, to be used. This is
advantageous from the economic point of view, and in fact allows
the evaporation costs to be reduced.
The present invention also relates to enzymatic compositions
comprising the pullulanase according to the invention.
The compositions comprising the pullulanase of the present
invention can be used in the solid or liquid form.
The pullulanase is formulated according to the intended uses.
Stabilizers or preservatives can also be added to the enzymatic
compositions comprising the pullulanase according to the invention.
For example, the pullulanase can be stabilized by addition of
propylene glycol, ethylene glycol, glycerol, starch, pullulane, a
sugar, such as glucose and sorbitol, a salt, such as sodium
chloride, calcium chloride, potassium sorbate and sodium benzoate,
or a mixture of two or more of these products. Good results have
been obtained with propylene glycol. Good results have been
obtained with a mixture of starch, sodium benzoate and potassium
sorbate.
The enzymatic compositions according to the invention can also
comprise, in addition to the pullulanase, one or more other
enzymes. Such enzymes are, in particular, carbohydrate hydrolases,
such as, for example, glucoamylase, .alpha.-amylase,
.beta.-amylase, .alpha.-glucosidase, isoamylase, cyclomaltodextrin
glucotransferase, .beta.-glucanase and glucose isomerase,
saccharifying enzymes, enzymes which cleave glucosidic bonds or a
mixture of two or more of these.
The present invention preferably relates to an enzymatic
composition comprising a glucoamylase and a pullulanase.
FIG. 1 shows the restriction map of the plasmid pUBDEBRA1.
FIG. 2 shows the restriction map of the plasmid pLD1.
FIG. 3 shows the restriction map of the plasmid
pUBCDEBRA11DNSI.
FIG. 4 (FIGS. 4a to 4f) shows the nucleotide sequence (SEQ ID
NO:10) which codes for the mature pullulanase, and its translation
into amino acids (SEQ ID NO:11).
FIG. 5 (FIGS. 5a to 5g) shows the nucleotide sequence (SEQ ID NO:8)
of the DNA fragment from the BamHI site to the PstI site of the
plasmid pUBCDEBRA11, and the translation into amino acids (SEQ ID
NO:9) of signal and mature sequences of the pullulanase. The
nucleotides which have not been determined with certainty have been
shown by the symbol N.
The meaning of the symbols and abbreviations used in these figures
is summarized in the following table.
______________________________________ Symbol Abbreviation Meaning
______________________________________ ORIEC Replication origin in
E. coli REP Protein required for replication ORI+ Replication
origin of the + strand ORI- Replication origin of the - strand KMR
Gene carrying resistance to kanamycin BLMR Gene carrying resistance
to bleomycin AMPR Gene carrying resistance to amplicillin PP
Pre/pro sequence BLIAPR Sequence which codes for the alkaline
protease of B. licheniformis 5'BLIAPR 5' sequence situated before
the sequence which codes for the alkaline protease of B.
licheniformis 3'BLIAPR 3' sequence situated after the sequence
which codes for the alkaline protease of B. licheniformis BDEPUL
Sequence which codes for the pullulanase of B. deramificans
______________________________________
The present invention is illustrated by the following examples.
EXAMPLE 1
Isolation and characterization of the strain of Bacillus
deramificans
The strain Bacillus deramificans T 89.117D was isolated from soil
on an agar-agar nutrient medium and selected for its ability to
break down a coloured derivative of pullulane known by the name
AZCL-pullulane and sold by the company MEGAZYME.
This strain was cultured at 37.degree. C. in MYE growth medium, the
composition of which is as follows: KH.sub.2 PO.sub.4 33 mM;
K.sub.2 HPO.sub.4.2H.sub.2 O 6 mM; (NH.sub.4).sub.2 SO.sub.4 45 mM;
MgCl.sub.2.6H.sub.2 O 1 mM; CaCl.sub.2.2H.sub.2 O 1 mM; yeast
extract 0.5% (weight/volume); glucose 0.5% (weight/volume). The pH
of the medium is adjusted to pH 4.5 with H.sub.3 PO.sub.4.
The agar-agar medium (MYE/agar) additionally comprises 2%
(weight/volume) of agar.
The strain of the present invention was identified by its
biochemical characteristics: Gram-positive, aerobic, rod-shaped
bacterium which forms an endospore. It thus belongs to the Bacillus
genus.
The vegetative cells of this strain in a culture on MYE medium at
37.degree. C. have the form of a bacillus of size 0.7.times.3.0-3.5
.mu.m. The motility of the vegetative cells is low.
After growth for three days at 37.degree. C. on the MYE medium,
microscopic observation reveals the presence of slightly deformed
and elliptical (sub)terminal sporangia.
The catalase test is weakly positive in the presence of 10% of
hydrogen peroxide. The oxidase test is positive in the presence of
1% of tetramethyl-1,4-phenylenediammonium dichloride.
This strain is aerobic, that is to say it develops under
aerobiosis. It does not develop under anaerobiosis, that is to say
under an atmosphere of 84% (v/v) of N.sub.2, (v/v) of CO.sub.2 and
8% (v/v) of H.sub.2 at 37.degree. C., but on the other hand it
develops under microanaerobiosis, that is to say under an
atmosphere of 82.5% (v/v) of N.sub.2, 6% (v/v) of O.sub.2, 7.5%
(v/v) of H.sub.2 and 4% (v/v) of CO.sub.2 at 37.degree. C. The
abbreviation % (v/v) represents a percentage expressed as volume
per volume.
This strain is not thermophilic. It shows normal development after
incubation in MYE medium at 20.degree. C., 30.degree. C. 37.degree.
C. and 45.degree. C., but on the other hand it does not develop at
50.degree. C. and 55.degree. C. It shows normal development after
incubation in MYE medium buffered with phosphate buffer to the
following pH values: pH 4.0, pH 4.5, pH 5.0 and pH 5.5, but on the
other hand it does not develop at pH 7.0. It shows normal
development after incubation in MYE medium in the presence of NaCl
at concentrations of 2.0% (w/v) and 3.5% (w/v), shows weak
development in the presence of 5.0% (w/v) of NaCl and does not
develop in the presence of 7.0% (w/v) of NaCl. The abbreviation %
(w/v) represents a percentage expressed as weight per volume.
This strain does not hydrolyse casein: in fact, no lysis zone could
be observed after more than 2 weeks of incubation at 37.degree. C.
It decomposes tyrosine slightly, does not produce acetoin from
pyruvate and does not reduce nitrate to nitrite or to N.sub.2.
The strain Bacillus deramificans T 89.117D according to the
invention is taxonomically different from the strain of Bacillus
acidopullulyticus described in European Patent 0 063 909 and from
the strain of Bacillus naganoensis described in U.S. Pat. No.
5,055,403. The strain Bacillus deramificans T 89.117D shows growth
at a pH of between 4.7 and 5.5, shows no growth at a pH of 7.0,
develops in the presence of 3.5% (w/v) of NaCl decomposes tyrosine
and does not reduce nitrate to nitrite.
The strain Bacillus deramificans T 89.117D has been deposited in
the collection called the BELGIAN COORDINATED COLLECTIONS OF
MICROORGANISMS (LMG culture collection) under number LMG
P-13056.
EXAMPLE 2
Preparation of pullulanase
The strain Bacillus deramificans T 89.117D is cultured in a liquid
medium (MYA), the composition of which is identical to that of the
MYE medium except that the content of yeast extract and glucose is
replaced by starch, that is to say:
Yeast extract 2.5% (w/v)
Potato starch 2.5% (w/v).
The culture is carried out while stirring, with effective aeration,
at a temperature of 37.degree. C.
After 68 hours of culture, the pullulanase and the cell biomass are
separated by centrifugation (5000 revolutions per minute for 30
minutes, BECKMAN JA-10). The pullulanase produced by the strain
Bacillus deramificans T 89.117D is extracellular.
The pullulanase is then concentrated by ultrafiltration (AMICON S10
Y10 membrane) to obtain a concentrated aqueous solution of
pullulanase.
The enzymatic activity of the solution obtained is measured.
One enzymatic unit of pullulanase (PUN) is defined as the amount of
enzyme which, at a pH of 4.5, at a temperature of 60.degree. C. and
in the presence of pullulane, catalyses the release of reducing
sugars at a rate of 1 .mu.M glucose equivalent per minute.
The pullulanase enzymatic activity is measured in accordance with
the following protocol. 1 ml of a 1% strength solution of pullulane
in a 50 mM acetate buffer at pH 4.5 is incubated at 60.degree. C.
for 10 minutes. 0.1 ml of a solution of pullulanase corresponding
to an activity of between 0.2 and 1 PUN/ml is added thereto. The
reaction is stopped after 15 minutes by addition of 0.4 ml of 0.5M
NaOH. The reducing sugars released are analysed by the method of
SOMOGYI-NELSON [J. Biol. Chem., 153 (1944) pages 375-380; and J.
Biol. Chem., 160 (1945), pages 61-68], and as in the other examples
of this Application.
A second method is used to analyse the pullulanase. The enzymatic
reaction in the presence of pullulane is carried out in accordance
with the test conditions, and is then stopped by addition of
sulphuric acid (0.1N). The hydrolysis products of pullulane are
then subjected to HPLC chromatography (HPX-87H column from BIO-RAD;
the mobile phase is 10 mM H.sub.2 SO.sub.4) in order to separate
the various constituents. The amount of maltotriose formed is
estimated by measurement of the area of the peak obtained.
The so-called debranching activity, that is to say the hydrolysis
of the .alpha.-1,6-glucosidic bonds present in amylopectin, can be
quantified by the increase in the blue coloration caused, in the
presence of iodine, by the release of amylose from amylopectin.
The debranching enzymatic activity is measured in accordance with
the following protocol. 0.4 ml of a 1% strength amylopectin
solution containing a 50 mM acetate buffer at pH 4.5 is incubated
at 60.degree. C. for 10 minutes. The reaction is initiated by
addition of 0.2 ml of pullulanase, and is stopped after 30 minutes
by addition of 0.4 ml of 0.3M HCl. 0.8 ml of a 0.0025% (v/v)
strength solution of iodine is then added to 0.2 ml of this
reaction mixture and the optical density is measured at 565 nm.
In order to purify the pullulanase, the aqueous concentrated
solution of pullulanase is diafiltered by 6 portions of 500 ml of
an aqueous solution of 9 g/l of NaCl, and the pH of the aqueous
solution thus obtained is adjusted to pH 3.5 by addition of 25%
(v/v) strength HCl at room temperature. The diafiltration comprises
mixing the pullulanase solution with the NaCl solution and then
subjecting the solution obtained to ultrafiltration.
The precipitate obtained is removed by centrifugation (5000
revolutions per minute for 30 minutes, BECKMAN JA-10), and the
supernatant from the centrifugation is collected. The pH of this
supernatant is adjusted to pH 6.0 by addition of 5M NaOH. The
precipitate obtained is removed by centrifugation.
The supernatant from the centrifugation is collected and is heated
at 55.degree. C. for 15 minutes.
The precipitate formed is removed again by centrifugation (5000
revolutions per minute for 30 minutes, BECKMAN JA-10). The
supernatant from the centrifugation is collected.
Acetone is added to this supernatant to a final concentration of
60% (v/v), and the suspension formed is brought to 4.degree. C.
over a period of 2 hours. The precipitate formed at 4.degree. C. is
dissolved in a buffer of 20 mM MES (2-(N-morpholino)ethanesulphonic
acid) and 1 mM CaCl.sub.2 (pH 6.0). This pullulanase solution is
called solution A.
This solution A is concentrated again by ion exchange
chromatography in order to purify it. A column of about 20 ml
internal volume, sold under the trade name S-SEPHAROSE.RTM. HP HI
LOAD 16/10, is first equilibrated with a buffer of 50 mM CH.sub.3
COONa and 100 mM NaCl (pH 4.0) at a flow rate of 5 ml/minute.
Solution A is diluted 10 times in the acetate buffer and 15 ml of
this dilute solution are deposited on the column. An isocratic
phase is ensured by elution of 80 ml of acetate buffer (100 mM
NaCl), followed by elution by 200 ml of 50 mM acetate buffer
(pH=4.0) containing a linear gradient of NaCl (100-500 mM).
The pullulanase activity is measured in each fraction.
The most active fractions are combined into a solution called B (12
ml containing 0.025 mg/ml of proteins and having a pullulanase
activity of 0.7 PUN/ml).
Starting from this solution B, precipitation is effected with
acetone at a final concentration of 80% (v/v). The precipitate
obtained is dissolved in a volume of 0.6 ml of buffer comprising 20
mM MES and 1 mM CaCl.sub.2 (pH 6.0).
This pullulanase solution is called solution C.
Solution C has a protein content of 0.4 mg/ml, an enzymatic
activity of 12 PUN/ml and a specific activity of PUN/mg.
The results are summarized in Table 1.
TABLE 1 ______________________________________ Pullulanase Specific
Proteins activity activity Volume mg/ PUN/ PUN/ Fractions ml ml
Total % ml Total % mg ______________________________________
Solution A 1.5 6.48 9.7 100 17.5 26.3 100 2.7 Solution B 12 0.025
0.3 3 0.7 8.4 32 28 ______________________________________
Table 1 shows that this purification stage has increased the
specific pullulanase activity of the enzymatic solution by a factor
of 10.
The debranching activity, that is to say the hydrolysis activity
with regard to alpha-1,6 bonds in amylopectin, of the pullulanase
was also measured as described above by coloration with iodine
after hydrolysis of amylopectin. The results show that the
debranching activity has also been increased.
EXAMPLE 3
Molecular weight determination
Precipitation by means of trichloroacetic acid (10% (v/v) final
strength) is carried out on solution C as obtained in Example 2.
The precipitate obtained is taken up in a buffer composed of 10 mM
TRIS/HCl (pH=8.0), 1 mM EDTA, 2.5% (w/v) of SDS (sodium dodecyl
sulphate), 5% (v/v) of .beta.-mercaptoethanol and 0.01% (w/v) of
bromophenol blue.
4 .mu.l of the precipitate taken up in the buffer are deposited on
a polyacrylamide gel. The gel system used is the PHASTSYSTEM system
from PHARMACIA LKB BIOTECHNOLOGY, with gels containing a
polyacrylamide gradient of 10-15% (v/v) in the presence of SDS. The
electrophoresis conditions are those prescribed by the supplier.
Coloration of the gel with Coomassie blue reveals a polypeptide of
molecular weight of about 105 kDaltons, which is the main component
of solution C.
This is confirmed by the estimation made from the amino acid
sequence of the mature form of the pullulanase (without the signal
sequence), as described in Example 4, and a molecular weight of 102
KDaltons is deduced by calculation.
EXAMPLE 4
1. Determination of the N-terminal sequence
Starting from the gel described in Example 3, the N-terminal
sequence of the pullulanase is identified by following the
technique described by BAUW et al., (1987), Proc. Natl. Acad. Sci.
U.S.A., 84, pages 4806-4810.
This sequence (SEQ ID NO:1) thus determined is as follows in the
amino-carboxyl sense and from left to right:
2. Determination of the amino acid sequence of the pullulanase
The nucleotide sequence (SEQ ID NO:8) of the BamHI-PstI fragment of
about 4.5 Kb of the plasmid pUBCDEBRA11 containing the gene which
codes for the pullulanase, as obtained in Example 21, was
determined by the chain termination method using
dideoxy-nucleotides of SANGER et al. (1977) Proc. Natl. Acad. Sci.
U.S.A. 74, pages 5463-5467.
The synthetic oligonucleotides used to initiate the elongation
reactions by the T7 DNA polymerase were synthesized by the method
of BEAUCAGE et al. (1981) Tetrahedron letters 22, pages 1859-1882.
The sequencing was carried out in accordance with the protocol
given by the supplier of the sequence analysis kit (PHARMACIA),
proceeding with denaturation of double-stranded DNA by treatment
with NaOH.
The sequence analysis strategy is described by SAMBROOK, 1989,
pages 13.15 and 13.17. The polyacrylamide gels for the sequence
analysis were prepared in accordance with the technique described
by SAMBROOK, 1989, pages 13.45-13.58.
The nucleotide sequence (SEQ ID NO:8) of the DNA fragment from the
BamHI site to the PstI site of pUBCDEBRA11, and also the
translation into amino acids (SEQ ID NO:9) of the signal and mature
sequences of the pullulanase, was identified (FIG. 5). The
nucleotides which have not been determined with certainty have been
shown by the symbol N.
Analysis of this sequence shows the presence of an open reading
frame which codes for the pullulanase. The nucleotide sequence
which codes for the mature pullulanase (SEQ ID NO:10) is
identified. The amino acid sequence of the mature pullulanase (SEQ
ID NO:11) is thus deduced by translation of this open reading
frame. FIG. 4 shows the nucleotide sequence which codes for the
mature pullulanase and also its translation into amino acids.
It is verified that the N-terminal sequence determined
experimentally from the protein as described above corresponds to
that translated from the DNA sequence.
This shows that the pullulanase is synthesized in the form of a
precursor containing an additional sequence of 29 amino acids
(presequence). This sequence of 29 amino acids is identified (SEQ
ID NO:12), as is the corresponding nucleotide sequence (SEQ ID
NO:13). This additional sequence shows the typical characteristics
of a secretion signal sequence, which is eliminated during
exportation of the enzyme to the outside of the cell (Freudl,
(1992), Journal of Biotechnology, 23, pages 231-240).
This sequence of 29 amino acids is as follows: ##STR2##
EXAMPLE 5
Amino acid distribution
The amino acid distribution of the mature pullulanase, determined
from the amino acid sequence of pullulanase (Example 4), is
summarized in Table 2.
TABLE 2 ______________________________________ (by molecular Symbol
Amino acids Number weight) % ______________________________________
D aspartic acid 75 8.5 N asparagine 69 7.7 V valine 72 7.0 T
threonine 70 6.9 Y tyrosine 42 6.7 L leucine 60 6.7 K lysine 48 6.0
S serine 64 5.5 I isoleucine 47 5.2 E glutamic acid 40 5.1 Q
glutamine 39 4.9 A alanine 69 4.8 P proline 46 4.4 G glycine 75 4.2
F phenylalanine 27 3.9 W tryptophan 18 3.3 M methionine 23 3.0 H
histidine 22 3.0 R arginine 18 2.8 X unknown 3 0.3 C cysteine 1 0.1
______________________________________
EXAMPLE 6
Determination of the isoelectric point
IEF (isoelectrofocusing) electrophoresis is carried out on solution
C, as obtained in Example 2, in a pH gradient varying from 4.0 to
6.5.
A volume corresponding to 0.12 pullulanase units is deposited in
triplicate on the gel. After migration, one third of the gel is
coloured with Coomassie blue.
The other two portions of the gel are covered by agar gels (1%
weight/volume) buffered with 100 mM CH.sub.3 COONa, 1 mM CaCl.sub.2
and 1 mM MgCl.sub.2 (pH 4.5) and containing, respectively 0.1%
(w/v) of AZCL-pullulane or 1% (w/v) of amylopectin. The combination
(acrylamide gel/agar gel) thus obtained is then incubated at
60.degree. C. in an atmosphere of saturated humidity for 16 hours.
The gel covered by the top layer of amylopectin is then incubated
at room temperature in a solution containing 3 mM I.sub.2 and 50 mM
KI in order to demonstrate the debranching activity by appearance
of the blue coloration.
Development of the iodine of the amylopectin gel reveals a deep
blue halo, indicating a debranching activity, at an isoelectric
point between about 4.1 and about 4.5 for the enzyme of the present
invention. Development of the pullulanase activity indicates the
same result.
This demonstrates that the pullulanase of the present invention has
a pullulanase activity and a debranching activity.
This demonstrates that the pullulanase of the present invention is
capable of hydrolysing bonds of the .alpha.-1,6 type, both in
pullulane and in amylopectin. This demonstrates a low specificity
of the pullulanase of the present invention with respect to its
substrate.
This is confirmed by the estimation made starting from the amino
acid sequence of the mature form of the pullulanase (without the
signal sequence) as described in Example 4, and an isoelectric
point of 4.5 is deduced by calculation.
EXAMPLE 7
Activity profile as a function of pH and temperature for the
pullulanase produced by the natural strain (Bacillus
deramificans)
The enzymatic activity of the pullulanase is measured at various
temperatures (55.degree., 60.degree. and 65.degree. C.) and at
various pH values (from 3.25 to 7) in 50 mM citrate/phosphate
buffer by measuring the reducing sugars released. Solution C of
pullulanase as obtained in Example 2, diluted to about 1 PUN/ml, is
used.
The results are summarized in Table 3.
In the course of this test, the maximum enzymatic activity was
measured by measuring the reducing sugars released for a sample
placed at a pH of about 4.3 and at a temperature of about
60.degree. C. over a period of 15 minutes. By definition, a
relative enzymatic activity of 100% was thus attributed to this
sample.
This example shows that the pullulanase according to the invention
has an optimum enzymatic activity, measured at a temperature of
about 60.degree. C. in a pH range of between 4.0 and 4.8.
This example also shows that the pullulanase according to the
invention has an optimum enzymatic activity, measured at a pH of
about 4.3, in a temperature range of between 55.degree. and
65.degree. C.
Furthermore, this example shows that the pullulanase according to
the invention develops an enzymatic activity of more than 80% of
the maximum enzymatic activity in a pH range of between about 3.8
and about 4.9.
TABLE 3 ______________________________________ Relative activity of
the enzyme % Temperature .degree.C. pH 55 60 65
______________________________________ 3.25 5.7 2.2 4.3 3.75 80.8
83.7 11.5 4.30 87.9 100 84.1 4.90 82.4 87.1 68 5.50 50.6 39.6 13.5
6.00 7.5 2.9 0 6.40 0 0 0
______________________________________
EXAMPLE 8
pH stability of the pullulanase produced by the natural strain
(Bacillus deramificans)
Solution A of the pullulanase as obtained in Example 2 is diluted
such that it develops an enzymatic activity of about 0.7 PUN/ml in
various 100 mM citrate/phosphate buffers at pH values varying
between pH 3.0 and 7.0. The various dilute solutions containing the
pullulanase are incubated at 60.degree. C. for 60 minutes.
The enzymatic activity of these different solutions after
incubation for 60 minutes at pH 4.2 at 60.degree. C. in the
presence of 1.6% (weight/volume) of pullulane is then measured. The
amount of maltotriose formed is measured by HPLC chromatography (as
described in Example 2). The results are summarized in Table 4.
In the course of this test, the maximum enzymatic activity was
measured for a sample placed at a pH of about 4.5 and at a
temperature of about 60.degree. C. By definition, a relative
enzymatic activity of 100% was thus attributed to this sample.
This example shows that the pullulanase according to the invention
is stable in a wide acid pH range, and in fact it has a relative
enzymatic activity of at least 85%, measured after incubation for
60 minutes at a temperature of about 60.degree. C. in the absence
of substrate and in a pH range of between about 3.5 and about 5.8.
This example also shows that it has a relative enzymatic activity
greater than 90%, measured in a pH range of between about 3.8 and
about 5 under these same conditions, and that it is inactivated
only at a pH of less than or equal to 3 or greater than or equal to
7.
TABLE 4 ______________________________________ pH Relative activity
% ______________________________________ 3 0 3.5 90 4 98 4.5 100 5
96 5.5 92 6 89 6.5 75 7 0
______________________________________
EXAMPLE 9
Determination of the half-life of the pullulanase produced by the
natural strain (Bacillus deramificans)
Solution C of the pullulanase as obtained in Example 2 is diluted
such that it develops an enzymatic activity of about 0.7 PUN/ml in
a 100 mM sodium acetate buffer at a pH of 4.5. The dilute solution
containing the pullulanase is incubated at 60.degree. C. and
samples are taken at various times.
The enzymatic activity is then measured by the reducing sugars
method (method of SOMOGYI described above).
In the course of this test, the maximum enzymatic activity was
measured for the sample at time 0. By definition, a relative
enzymatic activity of 100% was thus attributed to this sample.
The results are summarized in Table 5.
TABLE 5 ______________________________________ Time Relative
activity hours % ______________________________________ 0 100 16 76
24 74 40 57 48 54 64 47 ______________________________________
This example shows that the pullulanase is heat stable at an acid
pH.
This example shows that the half-life of the pullulanase is about
55 hours under these conditions. In fact, the pullulanase has a
relative enzymatic activity of at least 50%, measured after an
incubation of 55 hours at a temperature of about 60.degree. C. in a
solution buffered at a pH of about 4.5 and in the absence of
substrate.
This example shows moreover that the pullulanase according to the
invention has a relative enzymatic activity of at least 55%,
measured after an incubation of 40 hours at a temperature of about
60.degree. C. in a solution buffered at a pH of about 4.5 and in
the absence of substrate. This example also shows that it has a
relative enzymatic activity of at least 70%, measured after an
incubation of 24 hours under these same conditions.
EXAMPLE 10 AND EXAMPLE 11R (COMPARISON)
Saccharification
A saccharification medium is prepared by suspending, in water,
maize starch at a concentration of 35% (weight/weight) by weight of
starch dry matter and calcium chloride at a concentration of 0.02%
(weight/volume).
This maize-starch suspension is liquefied in the presence of
.alpha.-amylase, sold under the trade name TAKATHERM.RTM. L-340 by
SOLVAY ENZYMES, at 105.degree. C. for 5 minutes at pH 6.0.
The liquefied starch thus obtained is cooled rapidly to a
temperature of 95.degree. C. and the hydrolysis is continued for
120 minutes at 95.degree. C. while stirring. At this stage, the
degree of hydrolysis is between 10 and 12 DE (DE represents the
unit of "dextrose equivalents", that is to say the number of
reducing ends expressed as glucose equivalent).
The liquefied starch thus obtained is diluted to a final
concentration of 32 g of dry weight per 100 g of saccharification
medium.
The saccharification medium obtained is cooled to a temperature of
60.degree. C.
The pH of this saccharification medium is adjusted to various
values of from 3.9 to 4.8 with acetic acid and is kept constant in
the course of the saccharification.
An amount of glucoamylase corresponding to 0.176 DU/g.ds (enzymatic
units of glucoamylase per g of dry matter of the saccharification
medium) is added to the saccharification medium, the glucoamylase
used being sold under the trade name DIAZYME L-200 by SOLVAY
ENZYMES.
For Example 10 according to the invention, an amount of pullulanase
corresponding to 0.075 PUN/g of dry matter is also added to the
saccharification medium in the form of an aqueous concentrated
solution of pullulanase (solution A) as described in Example 2.
Comparison Example 11R is carried out as described above for
Example 10, but without addition of pullulanase.
After 48 hours, the saccharification is stopped and the products
obtained are analysed by chromatography (as described in Example
2).
The results are summarized in Table 6.
This example shows that the pullulanase according to the invention
is effective in saccharification. The pullulanase of the invention
thus has all the appropriate properties compatible with the actual
industrial conditions of saccharification of starch.
This example shows that the starch conversion level is greater in
the presence of the pullulanase according to the invention at
various pH values down to a highly acid pH, that is to say to at
least 3.9.
TABLE 6 ______________________________________ Products obtained in
% pH Examples Glucose DP2 DP3 >DP3
______________________________________ 3.9 11R 94.18 2.92 0,54 2.37
10 95.63 2.90 0.73 0.73 4.2 11R 94.18 2.98 0.56 2.29 10 94.79 4.30
0.56 0.38 4.5 11R 93.72 2.88 0.57 2.83 10 95.49 3.00 0.75 0.76 4.8
11R 93.32 2.79 0.60 3.30 10 95.25 2.70 0.87 1.18
______________________________________
DP2 represents the oligosaccharides containing two glucose units
(glucose dimer), DP3 the oligosaccharides containing three glucose
units (glucose trimer) and >DP3 the oligosaccharides containing
more than 3 glucose units.
EXAMPLE 12 AND EXAMPLE 13R (COMPARISON)
Saccharification
Example 10 is repeated, but the pH of the saccharification medium
is fixed at a pH of 4.2.
An amount of glucoamylase corresponding to 0.17 DU/g.ds (enzymatic
units per g of dry matter of the saccharification medium) is added
to the saccharification medium, the glucoamylase used being sold
under the trade name DIAZYME L-200 by SOLVAY ENZYMES.
For Example 12 according to the invention, various amounts of
pullulanase corresponding to, respectively, 0.0325 PUN/g.ds., 0.050
PUN/g.ds., 0.075 PUN/g.ds. and 0.10 PUN/g.ds. (enzymatic units of
pullulanase per gram of dry matter of the saccharification medium)
are also added to the saccharification medium in the form of an
aqueous concentrated solution of pullulanase (solution A) as
described in Example 2.
Comparison Example 13R is carried out as described above for
Example 12, but without addition of pullulanase.
The results are summarized in Table 7.
This example shows that the amount of pullulanase which it is
necessary to use to observe an increase in the percentage of
glucose produced less than 0.0325 PUN/g.ds.
TABLE 7 ______________________________________ Pullulanase Products
obtained in % Examples PUN/g.ds. Glucose DP2 DP3 >DP3
______________________________________ 13R 0 94.78 3.55 0.73 0.94
12 0.0325 95.16 3.45 0.78 0.61 0.050 95.30 3.39 0.74 0.56 0.075
95.25 3.47 0.74 0.55 0.10 95.27 3.49 0.70 0.53
______________________________________
EXAMPLE 14
Construction of the plasmid pUBDEBRA1
The plasmid pUBDEBRA1 (FIG. 1) contains the gene which codes for
the pullulanase of the strain Bacillus deramificans T 89.117D under
the control of its own transcription promoter introduced into the
vector pUB131. Construction of the plasmid pUBDEBRA1 is described
below.
The chromosomal DNA is extracted and purified from a culture of the
strain Bacillus deramificans T 89.117D (identified under the number
LMG P-13056).
For this purpose, a culture of 200 ml of this bacillus is carried
out in liquid MYE medium (Example 1).
When this culture has been realized and is in the stationary phase,
it is centrifuged (BECKMAN JA-10 rotor) at 5000 revolutions per
minute for 10 minutes. The centrifugation pellet thus obtained is
taken up in 9 ml of buffer comprising 0.1M TRIS-HCl
(tris(hydroxymethyl)aminomethane acidified with HCl at a pH of 8,
0.1M EDTA (ethylenediaminetetraacetic acid) and 0.15M NaCl
containing 18 mg of lysozyme, and the suspension thus obtained is
incubated for 15 minutes at 37.degree. C.
The lysate thus obtained is then treated with 200 .mu.l of a
solution of 10 mg/ml of RNAse at 50.degree. C. for 20 minutes. 1 ml
of a 10% strength solution of SDS (sodium dodecyl sulphate) is then
added to this lysate. This lysate is then incubated for 30 minutes
at 70.degree. C.
The lysate is then cooled to about 45.degree. C. and 0.5 ml of a
solution of 20 mg/ml of proteinase K (prepared extemporaneously) is
then added thereto.
The lysate is incubated at 45.degree. C. while stirring manually,
until a transparent solution is obtained.
Several extractions with phenol are carried out on this transparent
solution under the conditions and in accordance with the procedures
described in Molecular Cloning--a laboratory manual--SAMBROOK,
FRITSCH, MANIATIS--second edition, 1989, on page E.3, until a
proper interface, as described there, is obtained.
The DNA is precipitated by 20 ml of ethanol. The precipitate is
collected by centrifugation at 5000 revolutions per minute for 5
minutes, and is then suspended in 2 ml of TE buffer at pH 8.0 (10
mM TRIS-HCl, 1 mM EDTA at pH 8.0).
The DNA thus obtained is then partly cleaved by the restriction
enzyme Sau3AI. The restriction conditions in this example and in
all the other examples of this application are those described by
SAMBROOK et al. (page 5.28-5.32), except that these restriction
conditions are increased by a factor of 10 in order to obtain a
sufficient amount of DNA for the following purification stages.
The ratio between the amount of DNA used and the amount of enzyme
is adjusted in order to obtain a maximum of fragments of a size
between 5 and 10 kbp (kbp: 10.sup.3 base pairs).
The combined fragments thus obtained are then subjected to agarose
gel electrophoresis (0.8%) as described by SAMBROOK et al. (page
6.01-6.19), and the fragments of a size between 5 and 10 kbp are
isolated and purified by the GENE CLEAN method. They are then
spliced with the plasmid pBR322, which is sold by the company
BIOLABS [CLONTECH LABORATORIES (U.S.A.) catalogue No. 6210-1], cut
at the BamHI site and dephosphorylated as described by SAMBROOK et
al. (page 1.60-1.61). This same technique is used in the other
examples.
The splice thus obtained is transformed into cells of E. coli
MC1061 [CLONTECH LABORATORIES, catalogue No. C-1070-1] by
electroporation (SAMBROOK et al., page 1.75-1.81); the transformed
strains are selected on a Petri dish containing LB (Luria-Bertani)
agar-agar medium and 100 .mu.g/ml of ampicillin, after growth at
37.degree. C. for about 18 hours. The LB medium is described by
SAMBROOK et al. (page A.4). This medium contains 10 g/l of
tryprone, 5 g/l of yeast extract and 10 g/l of sodium chloride.
The colonies obtained on these dishes are then replicated on two
dishes of the same medium.
One of the two dishes is covered with an agar-agar medium
containing 1% (w/v) of agar, 100 mM sodium acetate (pH 4.5) and
0.1% (w/v) of AZCL-pullulane. After incubation at 60.degree. C. for
18 hours, the colony showing the largest zone of hydrolysis of the
AZCL-pullulane is identified and the corresponding colony is
isolated on the other replicated dish.
A strain is thus obtained from which the plasmid called pBRDEBRA3
is extracted. The EcoRI-BamHI fragment of about 4.6 kbp of the
plasmid pBRDEBRA3 is obtained by double digestion of the plasmid
pBRDEBRA3 with BamHI and EcoRI, and purification by agarose gel
electrophoresis (0.8% w/v). This fragment is then spliced with the
vector pUB131 (described in European Patent Application 0 415 296),
which was previously the subject of double digestion with BamHI and
EcoRI at the BamHI and EcoRI sites using the strain Bacillus
subtilis PSL1 as the host.
The strain Bacillus subtilis PSL1 can be obtained from the B.G.S.C.
collection under number 1A510 (BACILLUS GENETIC STOCK CENTER, Ohio
State University, United States).
The plasmid pUBDEBRA1 thus obtained is isolated and purified from
transformed PSL1 cells by the technique of alkaline lysis (SAMBROOK
et al., page 1.25-1.28). This same technique is used in the other
examples.
All the transformed strains of Bacillus subtilis are capable of
expressing the gene of pullulanase and of secreting
pullulanase.
The transformed PSL1 strains containing the plasmid pUBDEBRA1 are
subcultured on a Petri dish containing LB medium with 25 .mu.g/ml
of kanamycin.
The colonies obtained are covered by a top layer of agarose (1%
weight/volume) containing AZCL-pullulane (0.1% weight/volume) and
sodium acetate (100 mM, pH 4.5). After incubation at 60.degree. C.
for 18 hours, it is found that all the colonies of the transformed
strains are surrounded by a hydrolysis halo of AZCL-pullulane.
EXAMPLE 15
Preparation of the strain Bacillus licheniformis SE2 delap1
Identification of the terminal parts of the gene of the alkaline
protease of the host strain of Bacillus licheniformis SE2
This example relates to identification of the terminal parts of the
gene of the alkaline protease of the host strain of Bacillus
licheniformis in order to prepare the deletion plasmid for deletion
of the said gene of Bacillus licheniformis SE2.
1. Extraction of the chromosomal DNA from B. licheniformis SE2
In order to isolate the gene of the alkaline protease of the
chromosomal DNA of Bacillus licheniformis SE2, the chromosomal DNA
is first extracted in accordance with the method described in
Example 14 for extraction of chromosomal DNA, except that the
culture medium comprises LB medium and is purified.
2. Identification of the C-terminal part of the gene of the
alkaline protease
The chromosomal DNA extracted is subjected to a restriction
analysis described in Molecular Cloning--SAMBROOK et al. (page
1.85) and Molecular Cloning, a laboratory Manual, MANIATIS et al.,
1982 Cold Spring Harbor Laboratory, pages 374-379. The DNA
fragments obtained from these digestions are separated according to
their size on an 0.8% (weight/volume) agarose gel.
The agarose gel is then subjected to analysis by the SOUTHERN BLOT
technique (technique described by SAMBROOK et al.--page 9.31) in
order to identify the fragments which contain the nucleotide
sequences of the C-terminal part of the gene of the alkaline
protease.
The probe constructed, which is used for the hybridizations, is a
synthetic oligonucleotide corresponding to the C-terminal part of
the gene of the alkaline protease. The technique used to construct
the synthetic oligonucleotide is described in BEAUCAGE, S. L. et
al. (1981), Tetrahedron Letters, 22, pages 1859-1882, using
.beta.-cyanoethyl-phosphoramidites in a BIOSEARCH CYCLONE
SYNTHESIZER apparatus. The synthetic oligonucleotide sequence which
was constructed is as follows (SEQ ID NO:2):
These results show that the C-terminal part of the gene of the
alkaline protease is located on the PstI fragment of about 2.7
kbp.
The hybridization with the DNA probes is carried out in accordance
with the technique described in Molecular Cloning--SAMBROOK et
al.--page 9.52-9.55. This same technique is used in the other
examples.
The preparation of the extracted chromosomal DNA originating from
the strain of Bacillus licheniformis SE2 is then digested with the
enzyme PstI and the fragments obtained are separated according to
their size by agarose gel electrophoresis (0.8%).
The PstI fragments obtained of about 2.7 kbp are extracted from the
gels and purified by the so-called "GENE CLEAN" technique, which
uses glass beads and is marketed by the company BIO101
(U.S.A.).
The PstI fragments of 2.7 kbp are then spliced (SAMBROOK et al.,
page 1.68-1.69) with the plasmid pUC18 (CLONTECH Laboratories, No.
6110-1) which has first been digested at the PstI site and
dephosphorylated. The splice thus obtained was then transformed
into the cells of Escherichia coli MC1061 by the technique with
CaCl.sub.2 (SAMBROOK et al.--page 1.82-1.84). The technique which
allows dephosphorylation of the DNA fragments or linearization of
the vectors is described by SAMBROOK et al. (page 1.60-1.61). The
splicing technique is also described by SAMBROOK et al. (page
1.68-1.69).
The transformed strains are selected on Petri dishes containing LB
agar-agar medium supplemented with 100 .mu.g/ml of ampicillin. The
strains transformed starting from E. coli MC1061 thus obtained are
then selected by hybridization with the synthetic oligonucleotide
labelled using the C-terminal probe used in the SOUTHERN study and
the plasmid pKC1 is isolated.
The synthetic oligonucleotide is labelled by phosphorylation with
.sup.32P- .gamma.-ATP using the T4 polynucleotide kinase of the
phage T4 and in accordance with the technique described by SAMBROOK
et al. (page 11.31-11.33).
3. Identification of the N-terminal part of the gene of the
alkaline protease
The chromosomal DNA extracted is subjected to restriction analysis.
The DNA fragments obtained from these digestions are separated
according to their size on a 0.8% agarose gel.
The agarose gel is then subjected to analysis by the SOUTHERN BLOT
technique in order to identify the fragments which contain the
nucleotide sequences of the N-terminal part of the gene of the
alkaline protease.
The probe which is used for the hybridizations is a synthetic
oligonucleotide corresponding to the N-terminal part of the gene of
the alkaline protease. The sequence of the synthetic
oligonucleotide which has been constructed is as follows (SEQ ID
NO:3):
These results show that the N-terminal part of the gene of the
alkaline protease is located on the PstI fragment of about 5.5 kbp
and also on a smaller BclI-PstI fragment of about 2 kbp. This
fragment does not contain the restriction sites XbaI, ClaI, HpaI
and SphI.
The preparation of the extracted chromosomal DNA originating from
the strain of Bacillus licheniformis SE2 is then digested with the
enzyme PstI and the fragments obtained are separated according to
their size by agarose gel electrophoresis (0.8%).
The fragments obtained of about 5.5 kbp are extracted from the gels
and purified by the so-called "GENE CLEAN" technique (company BIO
101).
The PstI fragments of 5.5 kbp thus obtained are then subjected to a
series of digestions with BclI, XbaI, ClaI, HpaI and SphI. The DNA
fragments thus produced are spliced with the plasmid pMK4 (as
described in SULLIVAN et al., (1984), Gene 29, pages 1-26) which
has first been linearized by BamHI and PstI. The plasmid pMK4 can
be obtained from the B.G.S.C. collection (Bacillus Genetic Stock
Center (Ohio State University) Columbus, Ohio, U.S.A.) under number
1E29.
The splices thus obtained were then transformed into the cells of
Escherichia coli MC1061 by the technique with CaCl.sub.2.
The transformed strains are selected on Petri dishes containing LB
agar-agar medium supplemented with 100 .mu.g/ml of ampicillin. The
strains transformed starting from E. coli MC1061 thus obtained are
then selected by hybridization with the synthetic oligonucleotide
labelled using the N-terminal probe in the SOUTHERN study and the
plasmid pKP1 is isolated.
EXAMPLE 16
Sequences of the alkaline protease
The sequences of the fragments introduced into the plasmids pKP1
and pKC1 are determined from the Pst1 sites up to the SacI sites in
accordance with the technique described by SAMBROOK et al. (pages
13.15 and 13.17 and FIG. 13.3B).
EXAMPLE 17
Construction of the plasmid pLD1
The plasmid pLD1 (FIG. 2) is constructed with the aim of preparing
the strain Bacillus licheniformis SE2 delap1. The construction of
the plasmid pLD1 is described below.
The plasmid pKP1 (as obtained in Example 15) is unstable in E. coli
MC1061. For this reason, the chromosomal DNA fragment containing
the N-terminal part of the gene of the alkaline protease of B.
licheniformis SE2 was introduced into the vector pACYC184 (BIOLABS,
U.S.A., under number #401-M). This introduction was carried out by
introducing the EcoRI-EcoRI fragment of 1849 bp of the plasmid pKP1
into the EcoRI site of the plasmid pACYC184 and the splicing is
used to transform the cells of E. coli MC1061. The plasmid pKPN11
is thus obtained.
The transformed strains are selected on a Petri dish containing LB
agar-agar medium supplemented with 2.5 .mu.g/ml of tetracycline.
The orientation of the EcoRI-EcoRI fragment of 1849 bp in the
plasmid pKPN11 is determined by restriction analysis (SAMBROOK et
al.--page 1.85 and MANIATIS et al.--page 374-379).
The plasmid pKPN12 is obtained in the following manner: the
StyI-StyI fragment of 1671 bp of the plasmid pKPN11 is removed by
digestion with StyI, followed by replacement of this fragment by
the following synthetic double-stranded DNA, which has been
produced beforehand:
__________________________________________________________________________
5' CTTG GAGCTC GTTAAC AGATCT 3' (SEQ ID NO:4) 3' CTCGAG CAATTG
TCTAGA GTTC 5' (SEQ ID NO:5) (StyI) SacI HpaI BalII (StyI)
__________________________________________________________________________
Digestion of plasmids with restriction enzymes is carried out in
accordance with the technique described by SAMBROOK et
al.--1989--chapters 5.28-5.32.
The DNA fragment originating from the plasmid pUB131 which codes
for the resistance to kanamycin and to bleomycin or to phleomycin
was obtained as follows:
The PstI-TaqI fragment of 2666 bp, which carries the genes which
code for resistance to kanamycin and to bleomycin or to phleomycin,
is obtained by double digestion of PstI-TaqI of the plasmid pUB131.
This fragment is introduced into the PstI-AccI sites of the plasmid
pBS--(STRATAGENE, U.S.A., under number 211202). The plasmid pBSKMPM
is thus obtained.
During the preparation of the plasmid pBSKMPM, a small deletion in
the region of the bond with the plasmid pBS- appears, which causes
the loss of the SphI and PstI sites in the plasmid pBSKMPM. The
plasmid pBSKMPM is used to produce a single-stranded DNA used to
effect site-directed mutagenesis with the aim of introducing the
two synthetic nucleotides, the SmaI sites of which are identified
below, one being situated in front of and the other after the genes
of resistance to kanamycin and to phleomycin.
The technique of site-directed mutagenesis is described by SAMBROOK
et al.--page 15.74-15.79. It uses the mutagenesis kit sold by
BIO-RAD (No. 170-3576).
The sequences of the synthetic oligonucleotides used for the
mutagenesis are as follows (SEQ ID NO:6 and SEQ ID NO:7
respectively): ##STR3##
The plasmid obtained by this mutagenesis in the presence of the two
oligonucleotides is the plasmid pBSKMPM1. This plasmid contains two
SmaI restriction sites which allow isolation of the DNA fragment
containing the genes which code for resistance to kanamycin and
phleomycin.
The SmaI-SmaI fragment of 1597 bp of the plasmid pBSKMPM1 is then
introduced into the SmaI site of the plasmid pKPN12, and the
plasmid pKPN14 is thus obtained.
Proper orientation of the fragment introduced into the plasmid
pKPN14 is verified by carrying out a selection on preparations of
plasmid DNA by restriction analysis (SAMBROOK et al.--page
1.85).
The DNA fragment present on the plasmid pKC1 and located before the
N-terminal sequence of the alkaline protease is isolated on the
SacI-HindIII fragment of 1.2 kbp of the plasmid pKC1 (as obtained
in Example 15) by digestion, initially with HindIII.
The projecting 5' end of HindIII is rendered blunt-ended by
treatment with the Klenow fragment of DNA polymerase (SAMBROOK et
al.--page F.2-F.3). The SacI restriction is thus effected in order
to produce the desired blunt-ended SacI-HindIII fragment. This
fragment is introduced into the HpaI and SacI sites of the plasmid
pKPN14, producing the plasmid pLID1.
All these constructions are effected by transformation of the
strain E. coli MC1061 in the presence of tetracycline (12 .mu.g/ml)
for selection of the transformed strains.
A plasmid which is capable of multiplying in B. subtilis and in B.
licheniformis is constructed from the plasmid pLID1 by replacing
the replication functions of the E. coli, which are carried by the
BglII-BglII fragment of 3623 bp of the plasmid pLID1, by the
fragment which carries the replication functions of the Bacillus:
fragment BglII-BamHI of 2238 bp isolated from the plasmid
pUB131.
This replacement of replication functions of E. coli by Bacillus
cells was effected by first isolating the BglII-BglII fragment of
3.6 kbp from the plasmid pLID1 by digestion of the plasmid pLID1
with BglII and BamHI. Supplementary BamHI digestion was necessary,
and in fact BglII digestion alone would result in fragments of
identical size which could not be separated by agarose gel
electrophoresis. The BglII-BglII fragment of 3.6 kbp is thus cloned
in the strain of Bacillus subtilis SE3 in the fragment BglII-BamHI
of 2238 bp which has been isolated from the plasmid pUB131,
producing the plasmid pLD1 (FIG. 2).
The strain Bacillus subtilis SE3 was deposited on 21 Jun. 1993 at
the collection called the BELGIAN COORDINATED COLLECTIONS OF
MICROORGANISMS in accordance with the Treaty of Budapest under
number LMG P-14035.
EXAMPLE 18
Construction of Bacillus licheniformis SE2 delap1
The desired modifications in the chromosomal DNA of the strain
Bacillus licheniformis SE2 are effected by techniques based on
homologous recombination. The modifications cations are effected to
produce the strain Bacillus licheniformis SE2 delap1.
The plasmid pLD1 is transformed in B. licheniformis SE2 by the
protoplast technique described by Molecular Biological Methods for
Bacillus (pages 150-151) and under the conditions defined, except
for the following modifications: the lysozyme powder is added in an
amount of 5 mg/ml in the SMMP, instead of 1 mg/ml as defined in
stage 7 of the procedure described, the incubation period to obtain
maximum lysis with the lysozyme is 60 minutes, and the regeneration
is carried out in DM3 medium (described by Molecular Biological
Methods for Bacillus (HARWOOD et al., eds) John Wiley and Sons
(1990) (pages 150-151)) containing 200 .mu.g/ml of kanamycin.
A transformed strain is isolated and the restriction map of the
plasmid pLD1 introduced into this strain is verified.
The transformed strain is cultured in 50 ml of an LB medium
supplemented with 2 g/l of glucose and 25 .mu.g/ml of kanamycin for
18 hours at 37.degree. C.
A sample of culture (0.1 ml) is taken and used to inoculate a
conical flask containing 50 ml of the same LB medium. The culture
is incubated at 37.degree. C. for 18 hours. A sample of this
culture is taken and tested on a Petri dish containing LB agar-agar
medium supplemented with 25 .mu.g/ml of kanamycin and 1%
(weight/volume) of skimmed milk (DIFCO) to detect the presence of
protease.
The absence of a hydrolysis halo around the colonies which show
growth on these Petri dishes indicates that these colonies are
unable to produce an alkaline protease.
The cultures and tests are repeated until a strain (apr.sup.-,
Km.sup.r), that is to say both no longer producing alkaline
protease (apr.sup.-) and resistant to kanamycin (Km.sup.r), is
obtained.
The plasmid pLD1 present in this strain of Bacillus licheniformis
SE2 delap1 is then removed from it by culture on a growth medium at
37.degree. C. in the absence of antibiotic.
This strain is cultured in 50 ml of LB medium supplemented with 2
g/l of glucose for 18 hours at 37.degree. C. A volume of 0.1 ml of
this culture is taken and used to inoculate another conical flask
also containing 50 ml of the same medium, culture lasting 18 hours
at 37.degree. C. A sample is then taken and is spread out on a
Petri dish containing LB medium. The colonies isolated are
subcultured on a second dish of LB medium supplemented with 25
.mu.g/ml of kanamycin. A strain which is sensitive to kanamycin
(Km.sup.s) is isolated. Its phenotype is confirmed (apr.sup.-,
Km.sup.s).
The chromosomal DNA of this strain is then isolated and purified
and the structure of the chromosomal deletion is verified by the
SOUTHERN BLOT technique. The deletions identified are correct as
regards their position, having taken place by homologous double
recombination in the sequences situated before (5') and after (3')
in the gene of the alkaline protease.
The strain obtained is called B. licheniformis SE2 delap1. It does
not produce alkaline protease.
EXAMPLE 19
Transformation of Bacillus licheniformis SE2 delap1 with the
expression vector
The plasmid pUBDEBRA1 (FIG. 1) described in Example 14 is extracted
from its host, isolated and purified (SAMBROOK et al., 1989, pages
1.25-1.28).
A culture of the strain B. licheniformis SE2 delap1 described in
Example 18 is prepared and this strain is then transformed with
this plasmid in accordance with the protoplast technique described
by MANIATIS et al. (pages 150-151).
The transformed strain is selected on a Petri dish, isolated and
purified by screening.
EXAMPLE 20
Production of pullulanase by B. licheniformis SE2 delap1
(pUBDEBRA1)
The strain B. licheniformis SE2 delap1 transformed by the plasmid
pUBDEBRA1 as obtained in Example 19 is cultured for 17 hours at
37.degree. C. in a preculture LB medium supplemented with 0.5%
(w/v) of glucose and 20 .mu.g/ml of kanamycin. This preculture is
transferred (5% v/v) into 50 ml of M2 medium supplemented with 20
.mu.g/ml of kanamycin. The M2 medium contains 30 g of soya flour,
75 g of soluble starch, 2 g of sodium sulphate, 5 mg of magnesium
chloride, 3 g of NaH.sub.2 PO.sub.4, 0.2 g of CaCl.sub.2.H.sub.2 O
and 1000 ml of water. The pH of this M2 medium is adjusted to 5.8
with 10N NaOH before its sterilization. The culture is incubated,
while stirring, for 80 hours at 37.degree. C. After 80 hours, the
biomass is eliminated by centrifugation at 5000 revolutions per
minute for 10 minutes. The supernatant from the centrifugation is
kept. The enzymatic activity of this supernatant is measured and
the presence of a pullulanase activity is recorded.
EXAMPLE 21
Construction of Bacillus licheniformis SE2 delap1
(pUBCDEBRA11DNSI)--chromosomal integration
This example relates to integration of the gene which codes for the
pullulanase into the chromosome of the strain Bacillus
licheniformis SE2 delap1.
For this purpose, the EcoRI-BamHI fragment of 4.6 kb of the plasmid
pBRDEBRA3 is cloned into the EcoRI and BamHI sines of the pUBC131
vector by transformation of the strain E. coli MC1061, thus
generating the plasmid pUBCDEBRA11.
The integration vector pUBCDEBRA11DNSI (FIG. 3) is then constructed
by deleting the NsiI-NsiI fragment of 886 bp of the plasmid
pUBCDEBRA11. The plasmid thus obtained has lost the possibility of
replicating itself in Bacillus owing to the loss of the NsiI
fragment of 886 bp.
To effect this construction, the plasmid pUBCDEBRA11 is cleaved by
the NsiI restriction enzyme and the NsiI-NsiI fragment of about 9.4
kbp is purified by agarose gel electrophoresis. This fragment is
then subjected to splicing in order to recircularize it. The
splicing is transformed into E. coli MC1061 and the plasmid
pUBCDEBRA11DNSI1 is obtained.
In order to integrate the plasmid pUBCDEBRA11DNSI1 into the strain
B. licheniformis SE2 delap1, it is necessary for this plasmid to
carry a DNA fragment homologous to the chromosomal DNA. Chromosomal
Sau3AI fragments originating from B. licheniformis were thus cloned
into the BamHI site of the integration vector pUBCDEBRA11DNSI1.
For this purpose, the chromosomal DNA extracted from the strain
Bacillus licheniformis SE2 delap1 is partially cleaved by the
Sau3AI restriction enzyme. The DNA fragments of a size between 1.5
and 3 kb are then purified by agarose gel and spliced with the
plasmid pUBCDEBRA11DNSI cleaved by the BamHI restriction enzyme and
dephosphorylated. The splice thus obtained is transformed into the
cells of MC1061 by electroporation. After selection on LB agar-agar
medium containing 100 .mu.g/ml of ampicillin, about 3000 colonies
are obtained. All of these colonies are suspended in LB medium and
the plasmids are extracted by the alkaline lysis technique
(SAMBROOK et al., pages 1.25-1.28).
The preparation of plasmids thus obtained is thus introduced into
the strain Bacillus licheniformis SE2 delap1 by transformation by
the protoplast technique. The transformed cells are selected on DM3
regeneration medium (described in Molecular Biological Methods for
Bacillus (Harwood, C. R. and Cutting, S. M., eds) J. Wiley and
sons, 1990, pages 150-151) for their resistance to phleomycin (17
.mu.g/ml), which can be conferred on them only by chromosomal
integration of one of the plasmids constructed above.
The colonies thus obtained are subcultured on LB agar-agar medium
supplemented with 5 .mu.g/ml of phleomycin and 0.06% of
AZCL-pullulane. The colony having the largest hydrolysis halo of
AZCL-pullulane is then isolated and subcultured on LB agar-agar
medium.
The plasmid content of this strain is then extracted. The
preparation thus obtained is subjected to analysis by agarose gel
electrophoresis, which shows the absence of plasmid.
The chromosomal DNA is extracted and purified as described in
Example 14 and subjected to analysis by the SOUTHERN technique,
which shows that the plasmid pUBCDEBRA11DNSI has been integrated
into the chromosomal DNA by homologous recombination into an Sau3AI
fragment of about 3 kb.
This demonstrates that the gene which codes for the pullulanase of
B. deramificans is expressed in B. licheniformis in the integrated
state in the chromosome.
EXAMPLE 22
Process for the production of pullulanase by the strain Bacillus
licheniformis SE2 delap1 (pUBCDEBRA11DNSI)
The strain B. licheniformis SE2 delap1 containing the gene of
pullulanase in the integrated form in the chromosomal DNA as
obtained in Example 21 is cultured for 17 hours at 37.degree. C. in
a preculture LB medium supplemented with 0.5% (w/w) of glucose and
5 .mu.g/ml of phleomycin. A volume of 10 ml of this preculture is
inoculated in 250 ml of M2 medium (described in Example 20)
supplemented with 5 .mu.g/ml of phleomycin in baffled flasks.
After incubation for 24 hours, while stirring, at 37.degree. C. all
of the culture thus obtained is introduced into a fermenter
containing 6.5 1 of M2 medium. Fermentation is continued for 72
hours at 37.degree. C. The pH is kept at a value below 7.0 by
addition of concentrated phosphoric acid, the air flow rate is kept
at 4 liters/minute and the stirring is adjusted in order to obtain
a dissolved oxygen content of greater than 30% (v/v) of the content
of saturation.
After addition to the culture obtained of 50 ml of a flocculating
agent based on polyamine, sold under the trade name OPTIFLOC.RTM.
FC 205 by SOLVAY DEUTSCHLAND, the biomass is removed by
centrifugation (BECKMAN JA-10) at 5000 revolutions/minute for 15
minutes and the supernatant obtained is acidified to pH 4.5 with a
solution of 1M HCl. The solution obtained is centrifuged again at
8000 revolutions/minute for 15 minutes (BECKMAN JA-10).
The supernatant is then concentrated to a final volume of 1 liter
by ultrafiltration using an ultrafiltration unit fitted with a
membrane with a resolution limit of 5000 Daltons.
Acetone is then added to this concentrated solution to a final
concentration of 60% (v/v). The suspension formed is incubated at
4.degree. C. for 2 hours and then centrifuged at 8000
revolutions/minute for 15 minutes (BECKMAN JA-10). The
centrifugation residue obtained is suspended in 100 ml of an
aqueous solution containing 30% (w/v) of starch of the trade name
MALTRIN.RTM. 250 (GRAIN PROCESSING CORPORATION), 0.3% (w/v) of
sodium benzoate and 0.15% (w/v) of potassium sorbate at a pH of
4.5. The purified preparation of the pullulanase produced by the
recombinant strain thus obtained is called solution D.
The activity of the pullulanase of solution D, measured by the
reducing sugars method, is 150 PUN/ml.
EXAMPLE 23
Stability of the pullulanase produced by the strain Bacillus
licheniformis St2 delap1 (pUBCDEBRA11DNSI) with respect to
temperature
Solution D of pullulanase as obtained in Example 22 is diluted such
that it develops an enzymatic activity of between 10 and 15 PUN/ml
in a 0.05M citrate/phosphate buffer at a pH of 4.75.
This dilute solution containing the pullulanase is divided into 9
tubes in an amount of 5 ml of dilute solution per tube.
The various tubes containing the dilute solution are incubated in
water baths at temperatures of between 40.degree. and 80.degree. C.
for 75 minutes.
After this incubation, the tubes are placed in an ice bath for
rapid cooling.
The enzymatic activity of the various solutions is then measured
(measurement conditions: temperature of 60.degree. C. pH of 4.5,
incubation period of 15 minutes).
In the course of this test, the maximum enzymatic activity was
measured for the sample placed at a pH of about 4.75 and at a
temperature of about 55.degree. C. By definition, a relative
enzymatic activity of 100% was thus attributed to this sample.
The results are summarized in Table 12.
TABLE 12 ______________________________________ Relative enzymatic
Temperature activity % ______________________________________ 40 99
45 99 50 100 55 100 60 96 65 83 70 2 80 1
______________________________________
This example shows that the pullulanase according to the invention
has a relative enzymatic activity of at least 80%, measured after
an incubation of 75 minutes at a pH of 4.75 in the absence of
substrate and in a temperature range of less than or equal to
65.degree. C.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 15 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE:
N-terminal fragment (vi) ORIGINAL SOURCE: (A) ORGANISM: Bacillus
deramificans (B) STRAIN: T 89.117D (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:1: AspGlyAsnThrThrThrIleIleValHisTyrPheCysProAlaGly 151015
AspTyrGlnPro 20 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
nucleic acid (other); (A) DESCRIPTION: synthetic DNA (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2: GGCGGAGCAAGCTTTGTGG19 (2) INFORMATION FOR
SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: nucleic acid (other); (A) DESCRIPTION:
synthetic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ATGGCTCCTGGCGCAGGC18 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
nucleic acid (other); (A) DESCRIPTION: synthetic DNA (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:4: CTTGGAGCTCGTTAACAGATCT22 (2) INFORMATION
FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: nucleic acid (other); (A) DESCRIPTION:
synthetic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CTTGAGATCTGTTAACGAGCTC22 (2) INFORMATION FOR SEQ ID NO:6: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: nucleic acid (other); (A) DESCRIPTION: synthetic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CATCTAATCTTCAACACCCGGGCCCGTTTGTTGAAC36 (2) INFORMATION FOR SEQ ID
NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: nucleic acid (other); (A) DESCRIPTION:
synthetic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CAAAATAAAAAAGATACAACCCGGGTCTCTCGTATCTTTTAT42 (2) INFORMATION FOR
SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4464 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: genomic DNA (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:8:
GGATCCTGTTAGACTATTTGAGGAGTTTGCAACACTTGATGTTTTATCCAAAGGAAGGGC60
CGGAGATCATCGCTGGTCGAGGTGCTTTCGGTGAAGCATTTTCGCTATTTTGGGTATAAC120
CGGGCGCATTACGATCAATTGTTTGAAGAGCATCTTGATTTACTTCAAAAGCTGAATGCT180
TCGAAAAGAATAACATGGAGCGGGCTTTATCGAACACCTATACATGATGCAGATATCGCA240
CCCCGCCCTGTTCAGAAAAACATTCCTTTGTGGGTTGGGGTGGGTGGGACNMNTGAAASC300
NSYKCKYYGTGCRNVSNNNTATGGTGCCGGCTTAGCATGGGTATTTTGTCAGGCGATTGG360
CTTCGGTTTAAGGCACTTTCGGACCTTTATCGGCAGGCCGGCCAACAAGCANGGTATTCA420
CCGAACGATCTGAAAGTAGGAGTGACAGGGCATGCGTTTATTGGAAAGACGTCGCAGCAG480
GCACTCAATGACTATTACCCCTATCACGCGAATTATTGGCTAACACTGAACCAACAATTA540
GGGCAGCCGTTACCCCAGCAATACGTGAGGGAATTTAATTTATTAGCCTCCCCAGAGCAA600
GCCTTATATGTGGGAAGCTCTCAACAAGTGGGCAGGNAAAAATTTTGCGCCAACATGAGG660
NATTTGGTNATAAACGTTTTATCGCACAGATCGACATTGGCGGAATGCCCTTTAAAACAG720
TGGCCAAGAATATTGAGCGGTTAGGCCACTGAGGTTGCACCTGTCGTACGAAGAGCAACA780
AGAGGGTAATGGTAATAATCTATTTAACTGTTTATTAGAAAACTTGGTATCTGTTTAATT840
AAATAACAGGAGCCTGGAAGTGGGCCAAGGCTCCTTTCTAGGGAAACCTTTTTCTATTTA900
TATAGGCGTTGTTGCCTAAGGCTAAAGTAGGATTTTATTAAAAATATAGGAATTGCTCTT960
TTATTCGACACAATTATTCAATGGAATACGATAAAATGGAGAGTGTATGTAAGCGTTATA1020
TTTTATTGGGGGGCTGATAGAAGAAAAGGGATGCGACAGGGTCTATTAGCTAGTTTGGTA1080
TTCGATTTCAGATCAATGCAACGTACGAGTTTTTTATTGACTGCTTTGTGCAAGCGATTG1140
CATTGAAACAAAGGAGGACATTATGGCTAAAAAACTAATTTATGTGTGTTTAAGTGTTTG1200
TTTAGTGTTGACCTGGGCTTTTAATGTAAAAGGGCAATCTGCTCATGCTGATGGGAACAC1260
GACAACGATCATTGTCCACTATTTTTGCCCTGCTGGTGATTATCAACCTTGGAGTCTATG1320
GATGTGGCCAAAAGACGGAGGTGGGGCTGAATACGATTTCAATCAACCGGCTGACTCTTT1380
TGGAGCTGTTGCAAGTGCTGATATTCCAGGAAACCCAAGTCAGGTAGGAATTATCGTTCG1440
CACTCAAGATTGGACCAAAGATGTGAGCGCTGACCGCTACATAGATTTAAGCAAAGGAAA1500
TGAGGTGTGGCTTGTAGAAGGAAACAGCCAAATTTTTTATAATGAAAAAGATGCTGAGGA1560
TGCAGCTAAACCCGCTGTAAGCAACGCTTATTTAGATGCTTCAAACCAGGTGCTGGTTAA1620
ACTTAGCCAGCCGTTAACTCTTGGGGAAGGNNNAAGCGGCTTTACGGTTCATGACGACAC1680
AGCAAATAAGGATATTCCAGTGACATCTGTGAAGGATGCAAGTCTTGGTCAAGATGTAAC1740
CGCTGTTTTGGCAGGTACCTTCCAACATATTTTTGGAGGTTCCGATTGGGCACCTGATAA1800
TCACAGTACTTTATTAAAAAAGGTGACTAACAATCTCTATCAATTCTCAGGAGATCTTCC1860
TGAAGGAAACTACCAATATAAAGTGGCTTTAAATGATAGCTGGAATAATCCGAGTTACCC1920
ATCTGACAACATTAATTTAACAGTCCCTGCCGGCGGTGCACACGTCACTTTTTCGTATAT1980
TCCGTCCACTCATGCAGTCTATGACACAATTAATAATCCTAATGCGGATTTACAAGTAGA2040
AAGCGGGGTTAAAACGGATCTCGTGACGGTTACTCTAGGGGAAGATCCAGATGTGAGCCA2100
TACTCTGTCCATTCAAACAGATGGCTATCAGGCAAAGCAGGTGATACCTCGTAATGTGCT2160
TAATTCATCACAGTACTACTATTCAGGAGATGATCTTGGGAATACCTATACACAGAAAGC2220
AACAACCTTTAAAGTCTGGGCACCAACTTCTACTCAAGTAAATGTTCTTCTTTATGACAG2280
TGCAACGGGTTCTGTAACAAAAATCGTACCTATGACGGCATCGGGCCATGGTGTGTGGGA2340
AGCAACGGTTAATCAAAACCTTGAAAATTGGTATTACATGTATGAGGTAACAGGCCAAGG2400
CTCTACCCGAACGGCTGTTGATCCTTATGCAACTGCGATTGCACCAAATGGAACGAGAGG2460
CATGATTGTGGACCTGGCTAAAACAGATCCTGCTGGCTGGAACAGTGATAAACATATTAC2520
GCCAAAGAATATAGAAGATGAGGTCATCTATGAAATGGATGTCCGTGACTTTTCCATTGA2580
CCCTAATTCGGGTATGAAAAATAAAGGGAAGTATTTGGCTCTTACAGAAAAAGGAACAAA2640
GGGCCCTGACAACGTAAAGACGGGGATAGATTCCTTAAAACAACTTGGGATTACTCATGT2700
TCAGCTTATGCCTGTTTTCGCATCTAACAGTGTCGATGAAACTGATCCAACCCAAGATAA2760
TTGGGGTTATGACCCTCGCAACTATGATGTTCCTGAAGGGCAGTATGCTACAAATGCGAA2820
TGGTAATGCTCGTATAAAAGAGTTTAAGGAAATGGTTCTTTCACTCCATCGTGAACACAT2880
TGGGGTTAACATGGATGTTGTCTATAATCATACCTTTGCCACGCAAATCTCTGACTTCGA2940
TAAAATTGTACCAGAATATTATTACCGTACGATGATGCAGGTAATTATACCAACGGATCA3000
GGTACTGGAAATGAAATTGCANGCNGAAAGGCCAATGGTTCAAAAATTTATTATTGATTC3060
CCTTAAGTATTGGGTCAATGAGTATCATATTGACGGCTTCCGTTTTGACTTAATGGCGCT3120
GCTTGGAAAAGACACGATGTCCAAAGCTGCCTCGGAGCTTCATGCTATTAATCCAGGAAT3180
TGCACTTTACGGTGAGCCATGGACGGGTGGAACCTCTGCACTGCCAGATGATCAGCTTCT3240
GACAAAAGGAGCTCAAAAAGGCATGGGAGTAGCGGTGTTTAATGACAATTTACGAAACGC3300
GTTGGACGGCAATGTCTTTGATTCTTCCGCTCAAGGTTTTGCGACAGGTGCAACAGGCTT3360
AACTGATGCAATTAAGAATGGCGTTGAGGGGAGTATTAATGACTTTACCTCTTCACCAGG3420
TGAGACAATTAACTATGTCACAAGTCATGATAACTACACCCTTTGGGACAAAATAGCCCT3480
AAGCAATCCTAATGATTCCGAAGCGGATCGGATTAAAATGGATGAACTCGCACAAGCAGT3540
TGTTATGACCTCACAAGGCGTTCCATTCATGCAAGGCGGGGAAGAAATGCTTCGTANAAA3600
AGGCGGCAACGACAATAGTTATAATGCAGGCGATGCGGTCAATGAGTTTGATTGGAGCAG3660
GAAAGCTCAATATCCAGATGTTTTCAACTATTATAGCGGGCTAATCCACCTTCGTCTTGA3720
TCACCCAGCCTTCCGCATGACGACAGCTAATGAAATCAATAGCCACCTCCAATTCCTAAA3780
TAGTCCAGAGAACACAGTGGCCTATGAATTAACTGATCATGTTAATAAAGACAAATGGGG3840
AAATATCATTGTTGTTTATAACCCAAATAAAACTGTAGCAACCATCAATTTGCCGAGCGG3900
GAAATGGGCAATCAATGCTACGAGCGGTAAGGTAGGAGAATCCACCCTTGGTCAAGCAGA3960
GGGAAGTGTCCAAGTACCAGGTATATCTATGATGATCCTTCATCAAGAGGTAAGCCCAGA4020
CCACGGTAAAAAGTAATAGAAAAAAGTAAAATCCCCTCAAGATGTTTGAGGGGGATTTAG4080
TTACTTATTATCCAATTAATTTGCGGCTTCGGTGTTTTCAATGGGCTCCGTATCCGTTCG4140
GTTGTGTGATCGGACAAATGGGAGTGAATAGGTCACAAGAGCAGCAGCCATTTCAAGCAG4200
ACCAGCGAAAGTAAACATTCGTTCTGGTGCAAATCGGGTCATCAACCAACCGGTAATTGC4260
TTGGGAAATAGGGATGGACCCTGACATCACGATAATCATAATACTAATAACACGACCGAA4320
TAACTTAGGTGGAATAAGCGTATGGTTAACGCTTGGAGCAATAATATTAACCGCCGTTTC4380
ATGAGCGCCAACAAGCACTAGAAGGGCTAAAATAACCCATAAGTTGTGTGTAAATCCTAT4440
AAAAAATAACATAAGGCCCTGCAG4464 (2) INFORMATION FOR SEQ ID NO:9: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 4464 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: genomic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGATCCTGTTAGACTATTTGAGGAGTTTGCAACACTTGATGTTTTATCCAAAGGAAGGGC60
CGGAGATCATCGCTGGTCGAGGTGCTTTCGGTGAAGCATTTTCGCTATTTTGGGTATAAC120
CGGGCGCATTACGATCAATTGTTTGAAGAGCATCTTGATTTACTTCAAAAGCTGAATGCT180
TCGAAAAGAATAACATGGAGCGGGCTTTATCGAACACCTATACATGATGCAGATATCGCA240
CCCCGCCCTGTTCAGAAAAACATTCCTTTGTGGGTTGGGGTGGGTGGGACNMNTGAAASC300
NSYKCKYYGTGCRNVSNNNTATGGTGCCGGCTTAGCATGGGTATTTTGTCAGGCGATTGG360
CTTCGGTTTAAGGCACTTTCGGACCTTTATCGGCAGGCCGGCCAACAAGCANGGTATTCA420
CCGAACGATCTGAAAGTAGGAGTGACAGGGCATGCGTTTATTGGAAAGACGTCGCAGCAG480
GCACTCAATGACTATTACCCCTATCACGCGAATTATTGGCTAACACTGAACCAACAATTA540
GGGCAGCCGTTACCCCAGCAATACGTGAGGGAATTTAATTTATTAGCCTCCCCAGAGCAA600
GCCTTATATGTGGGAAGCTCTCAACAAGTGGGCAGGNAAAAATTTTGCGCCAACATGAGG660
NATTTGGTNATAAACGTTTTATCGCACAGATCGACATTGGCGGAATGCCCTTTAAAACAG720
TGGCCAAGAATATTGAGCGGTTAGGCCACTGAGGTTGCACCTGTCGTACGAAGAGCAACA780
AGAGGGTAATGGTAATAATCTATTTAACTGTTTATTAGAAAACTTGGTATCTGTTTAATT840
AAATAACAGGAGCCTGGAAGTGGGCCAAGGCTCCTTTCTAGGGAAACCTTTTTCTATTTA900
TATAGGCGTTGTTGCCTAAGGCTAAAGTAGGATTTTATTAAAAATATAGGAATTGCTCTT960
TTATTCGACACAATTATTCAATGGAATACGATAAAATGGAGAGTGTATGTAAGCGTTATA1020
TTTTATTGGGGGGCTGATAGAAGAAAAGGGATGCGACAGGGTCTATTAGCTAGTTTGGTA1080
TTCGATTTCAGATCAATGCAACGTACGAGTTTTTTATTGACTGCTTTGTGCAAGCGATTG1140
CATTGAAACAAAGGAGGACATTATGGCTAAAAAACTAATTTATGTGTGT1189
MetAlaLysLysLeuIleTyrValCys 25
TTAAGTGTTTGTTTAGTGTTGACCTGGGCTTTTAATGTAAAAGGGCAA1237
LeuSerValCysLeuValLeuThrTrpAlaPheAsnValLysGlyGln 20-15-10- 5
TCTGCTCATGCTGATGGGAACACGACAACGATCATTGTCCACTATTTT1285
SerAlaHisAlaAspGlyAsnThrThrThrIleIleValHisTyrPhe 1+1510
TGCCCTGCTGGTGATTATCAACCTTGGAGTCTATGGATGTGGCCAAAA1333
CysProAlaGlyAspTyrGlnProTrpSerLeuTrpMetTrpProLys 152025
GACGGAGGTGGGGCTGAATACGATTTCAATCAACCGGCTGACTCTTTT1381
AspGlyGlyGlyAlaGluTyrAspPheAsnGlnProAlaAspSerPhe 303540
GGAGCTGTTGCAAGTGCTGATATTCCAGGAAACCCAAGTCAGGTAGGA1429
GlyAlaValAlaSerAlaAspIleProGlyAsnProSerGlnValGly 45505560
ATTATCGTTCGCACTCAAGATTGGACCAAAGATGTGAGCGCTGACCGC1477
IleIleValArgThrGlnAspTrpThrLysAspValSerAlaAspArg 657075
TACATAGATTTAAGCAAAGGAAATGAGGTGTGGCTTGTAGAAGGAAAC1525
TyrIleAspLeuSerLysGlyAsnGluValTrpLeuValGluGlyAsn 808590
AGCCAAATTTTTTATAATGAAAAAGATGCTGAGGATGCAGCTAAACCC1573
SerGlnIlePheTyrAsnGluLysAspAlaGluAspAlaAlaLysPro 95100105
GCTGTAAGCAACGCTTATTTAGATGCTTCAAACCAGGTGCTGGTTAAA1621
AlaValSerAsnAlaTyrLeuAspAlaSerAsnGlnValLeuValLys 110115120
CTTAGCCAGCCGTTAACTCTTGGGGAAGGNNNAAGCGGCTTTACGGTT1669
LeuSerGlnProLeuThrLeuGlyGluGlyXaaSerGlyPheThrVal 125130135140
CATGACGACACAGCAAATAAGGATATTCCAGTGACATCTGTGAAGGAT1717
HisAspAspThrAlaAsnLysAspIleProValThrSerValLysAsp 145150155
GCAAGTCTTGGTCAAGATGTAACCGCTGTTTTGGCAGGTACCTTCCAA1765
AlaSerLeuGlyGlnAspValThrAlaValLeuAlaGlyThrPheGln 160165170
CATATTTTTGGAGGTTCCGATTGGGCACCTGATAATCACAGTACTTTA1813
HisIlePheGlyGlySerAspTrpAlaProAspAsnHisSerThrLeu 175180185
TTAAAAAAGGTGACTAACAATCTCTATCAATTCTCAGGAGATCTTCCT1861
LeuLysLysValThrAsnAsnLeuTyrGlnPheSerGlyAspLeuPro 190195200
GAAGGAAACTACCAATATAAAGTGGCTTTAAATGATAGCTGGAATAAT1909
GluGlyAsnTyrGlnTyrLysValAlaLeuAsnAspSerTrpAsnAsn 205210215220
CCGAGTTACCCATCTGACAACATTAATTTAACAGTCCCTGCCGGCGGT1957
ProSerTyrProSerAspAsnIleAsnLeuThrValProAlaGlyGly 225230235
GCACACGTCACTTTTTCGTATATTCCGTCCACTCATGCAGTCTATGAC2005
AlaHisValThrPheSerTyrIleProSerThrHisAlaValTyrAsp 240245250
ACAATTAATAATCCTAATGCGGATTTACAAGTAGAAAGCGGGGTTAAA2053
ThrIleAsnAsnProAsnAlaAspLeuGlnValGluSerGlyValLys 255260265
ACGGATCTCGTGACGGTTACTCTAGGGGAAGATCCAGATGTGAGCCAT2101
ThrAspLeuValThrValThrLeuGlyGluAspProAspValSerHis 270275280
ACTCTGTCCATTCAAACAGATGGCTATCAGGCAAAGCAGGTGATACCT2149
ThrLeuSerIleGlnThrAspGlyTyrGlnAlaLysGlnValIlePro
285290295300 CGTAATGTGCTTAATTCATCACAGTACTACTATTCAGGAGATGATCTT2197
ArgAsnValLeuAsnSerSerGlnTyrTyrTyrSerGlyAspAspLeu 305310315
GGGAATACCTATACACAGAAAGCAACAACCTTTAAAGTCTGGGCACCA2245
GlyAsnThrTyrThrGlnLysAlaThrThrPheLysValTrpAlaPro 320325330
ACTTCTACTCAAGTAAATGTTCTTCTTTATGACAGTGCAACGGGTTCT2293
ThrSerThrGlnValAsnValLeuLeuTyrAspSerAlaThrGlySer 335340345
GTAACAAAAATCGTACCTATGACGGCATCGGGCCATGGTGTGTGGGAA2341
ValThrLysIleValProMetThrAlaSerGlyHisGlyValTrpGlu 350355360
GCAACGGTTAATCAAAACCTTGAAAATTGGTATTACATGTATGAGGTA2389
AlaThrValAsnGlnAsnLeuGluAsnTrpTyrTyrMetTyrGluVal 365370375380
ACAGGCCAAGGCTCTACCCGAACGGCTGTTGATCCTTATGCAACTGCG2437
ThrGlyGlnGlySerThrArgThrAlaValAspProTyrAlaThrAla 385390395
ATTGCACCAAATGGAACGAGAGGCATGATTGTGGACCTGGCTAAAACA2485
IleAlaProAsnGlyThrArgGlyMetIleValAspLeuAlaLysThr 400405410
GATCCTGCTGGCTGGAACAGTGATAAACATATTACGCCAAAGAATATA2533
AspProAlaGlyTrpAsnSerAspLysHisIleThrProLysAsnIle 415420425
GAAGATGAGGTCATCTATGAAATGGATGTCCGTGACTTTTCCATTGAC2581
GluAspGluValIleTyrGluMetAspValArgAspPheSerIleAsp 430435440
CCTAATTCGGGTATGAAAAATAAAGGGAAGTATTTGGCTCTTACAGAA2629
ProAsnSerGlyMetLysAsnLysGlyLysTyrLeuAlaLeuThrGlu 445450455460
AAAGGAACAAAGGGCCCTGACAACGTAAAGACGGGGATAGATTCCTTA2677
LysGlyThrLysGlyProAspAsnValLysThrGlyIleAspSerLeu 465470475
AAACAACTTGGGATTACTCATGTTCAGCTTATGCCTGTTTTCGCATCT2725
LysGlnLeuGlyIleThrHisValGlnLeuMetProValPheAlaSer 480485490
AACAGTGTCGATGAAACTGATCCAACCCAAGATAATTGGGGTTATGAC2773
AsnSerValAspGluThrAspProThrGlnAspAsnTrpGlyTyrAsp 495500505
CCTCGCAACTATGATGTTCCTGAAGGGCAGTATGCTACAAATGCGAAT2821
ProArgAsnTyrAspValProGluGlyGlnTyrAlaThrAsnAlaAsn 510515520
GGTAATGCTCGTATAAAAGAGTTTAAGGAAATGGTTCTTTCACTCCAT2869
GlyAsnAlaArgIleLysGluPheLysGluMetValLeuSerLeuHis 525530535540
CGTGAACACATTGGGGTTAACATGGATGTTGTCTATAATCATACCTTT2917
ArgGluHisIleGlyValAsnMetAspValValTyrAsnHisThrPhe 545550555
GCCACGCAAATCTCTGACTTCGATAAAATTGTACCAGAATATTATTAC2965
AlaThrGlnIleSerAspPheAspLysIleValProGluTyrTyrTyr 560565570
CGTACGATGATGCAGGTAATTATACCAACGGATCAGGTACTGGAAATG3013
ArgThrMetMetGlnVaLIleIleProThrAspGlnValLeuGluMet 575580585
AAATTGCANGCNGAAAGGCCAATGGTTCAAAAATTTATTATTGATTCC3061
LysLeuXaaAlaGluArgProMetValGlnLysPheIleIleAspSer 590595600
CTTAAGTATTGGGTCAATGAGTATCATATTGACGGCTTCCGTTTTGAC3109
LeuLysTyrTrpValAsnGluTyrHisIleAspGlyPheArgPheAsp 605610615620
TTAATGGCGCTGCTTGGAAAAGACACGATGTCCAAAGCTGCCTCGGAG3157
LeuMetAlaLeuLeuGlyLysAspThrMetSerLysAlaAlaSerGlu 625630635
CTTCATGCTATTAATCCAGGAATTGCACTTTACGGTGAGCCATGGACG3205
LeuHisAlaIleAsnProGlyIleAlaLeuTyrGlyGluProTrpThr 640645650
GGTGGAACCTCTGCACTGCCAGATGATCAGCTTCTGACAAAAGGAGCT3253
GlyGlyThrSerAlaLeuProAspAspGlnLeuLeuThrLysGlyAla 655660665
CAAAAAGGCATGGGAGTAGCGGTGTTTAATGACAATTTACGAAACGCG3301
GlnLysGlyMetGlyValAlaValPheAsnAspAsnLeuArgAsnAla 670675680
TTGGACGGCAATGTCTTTGATTCTTCCGCTCAAGGTTTTGCGACAGGT3349
LeuAspGlyAsnValPheAspSerSerAlaGlnGlyPheAlaThrGly 685690695700
GCAACAGGCTTAACTGATGCAATTAAGAATGGCGTTGAGGGGAGTATT3397
AlaThrGlyLeuThrAspAlaIleLysAsnGlyValGluGlySerIle 705710715
AATGACTTTACCTCTTCACCAGGTGAGACAATTAACTATGTCACAAGT3445
AsnAspPheThrSerSerProGlyGluThrIleAsnTyrValThrSer 720725730
CATGATAACTACACCCTTTGGGACAAAATAGCCCTAAGCAATCCTAAT3493
HisAspAsnTyrThrLeuTrpAspLysIleAlaLeuSerAsnProAsn 735740745
GATTCCGAAGCGGATCGGATTAAAATGGATGAACTCGCACAAGCAGTT3541
AspSerGluAlaAspArgIleLysMetAspGluLeuAlaGlnAlaVal 750755760
GTTATGACCTCACAAGGCGTTCCATTCATGCAAGGCGGGGAAGAAATG3589
ValMetThrSerGlnGlyValProPheMetGlnGlyGlyGluGluMet 765770775780
CTTCGTANAAAAGGCGGCAACGACAATAGTTATAATGCAGGCGATGCG3637
LeuArgXaaLysGlyGlyAsnAspAsnSerTyrAsnAlaGlyAspAla 785790795
GTCAATGAGTTTGATTGGAGCAGGAAAGCTCAATATCCAGATGTTTTC3685
ValAsnGluPheAspTrpSerArgLysAlaGlnTyrProAspValPhe 800805810
AACTATTATAGCGGGCTAATCCACCTTCGTCTTGATCACCCAGCCTTC3733
AsnTyrTyrSerGlyLeuIleHisLeuArgLeuAspHisProAlaPhe 815820825
CGCATGACGACAGCTAATGAAATCAATAGCCACCTCCAATTCCTAAAT3781
ArgMetThrThrAlaAsnGluIleAsnSerHisLeuGlnPheLeuAsn 830835840
AGTCCAGAGAACACAGTGGCCTATGAATTAACTGATCATGTTAATAAA3829
SerProGluAsnThrValAlaTyrGluLeuThrAspHisValAsnLys 845850855860
GACAAATGGGGAAATATCATTGTTGTTTATAACCCAAATAAAACTGTA3877
AspLysTrpGlyAsnIleIleValValTyrAsnProAsnLysThrVal 865870875
GCAACCATCAATTTGCCGAGCGGGAAATGGGCAATCAATGCTACGAGC3925
AlaThrIleAsnLeuProSerGlyLysTrpAlaIleAsnAlaThrSer 880885890
GGTAAGGTAGGAGAATCCACCCTTGGTCAAGCAGAGGGAAGTGTCCAA3973
GlyLysValGlyGluSerThrLeuGlyGlnAlaGluGlySerValGln 895900905
GTACCAGGTATATCTATGATGATCCTTCATCAAGAGGTAAGCCCAGAC4021
ValProGlyIleSerMetMetIleLeuHisGlnGluValSerProAsp 910915920
CACGGTAAAAAGTAATAGAAAAAAGTAAAATCCCCTCAAGATGTTTGAGGGG4073
HisGlyLysLys 925
GATTTAGTTACTTATTATCCAATTAATTTGCGGCTTCGGTGTTTTCAATGGGCTCCGTAT4133
CCGTTCGGTTGTGTGATCGGACAAATGGGAGTGAATAGGTCACAAGAGCAGCAGCCATTT4193
CAAGCAGACCAGCGAAAGTAAACATTCGTTCTGGTGCAAATCGGGTCATCAACCAACCGG4253
TAATTGCTTGGGAAATAGGGATGGACCCTGACATCACGATAATCATAATACTAATAACAC4313
GACCGAATAACTTAGGTGGAATAAGCGTATGGTTAACGCTTGGAGCAATAATATTAACCG4373
CCGTTTCATGAGCGCCAACAAGCACTAGAAGGGCTAAAATAACCCATAAGTTGTGTGTAA4433
ATCCTATAAAAAATAACATAAGGCCCTGCAG4464 (2) INFORMATION FOR SEQ ID
NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2784 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: genomic DNA (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:10:
GATGGGAACACGACAACGATCATTGTCCACTATTTTTGCCCTGCTGGTGATTATCAACCT60
TGGAGTCTATGGATGTGGCCAAAAGACGGAGGTGGGGCTGAATACGATTTCAATCAACCG120
GCTGACTCTTTTGGAGCTGTTGCAAGTGCTGATATTCCAGGAAACCCAAGTCAGGTAGGA180
ATTATCGTTCGCACTCAAGATTGGACCAAAGATGTGAGCGCTGACCGCTACATAGATTTA240
AGCAAAGGAAATGAGGTGTGGCTTGTAGAAGGAAACAGCCAAATTTTTTATAATGAAAAA300
GATGCTGAGGATGCAGCTAAACCCGCTGTAAGCAACGCTTATTTAGATGCTTCAAACCAG360
GTGCTGGTTAAACTTAGCCAGCCGTTAACTCTTGGGGAAGGNNNAAGCGGCTTTACGGTT420
CATGACGACACAGCAAATAAGGATATTCCAGTGACATCTGTGAAGGATGCAAGTCTTGGT480
CAAGATGTAACCGCTGTTTTGGCAGGTACCTTCCAACATATTTTTGGAGGTTCCGATTGG540
GCACCTGATAATCACAGTACTTTATTAAAAAAGGTGACTAACAATCTCTATCAATTCTCA600
GGAGATCTTCCTGAAGGAAACTACCAATATAAAGTGGCTTTAAATGATAGCTGGAATAAT660
CCGAGTTACCCATCTGACAACATTAATTTAACAGTCCCTGCCGGCGGTGCACACGTCACT720
TTTTCGTATATTCCGTCCACTCATGCAGTCTATGACACAATTAATAATCCTAATGCGGAT780
TTACAAGTAGAAAGCGGGGTTAAAACGGATCTCGTGACGGTTACTCTAGGGGAAGATCCA840
GATGTGAGCCATACTCTGTCCATTCAAACAGATGGCTATCAGGCAAAGCAGGTGATACCT900
CGTAATGTGCTTAATTCATCACAGTACTACTATTCAGGAGATGATCTTGGGAATACCTAT960
ACACAGAAAGCAACAACCTTTAAAGTCTGGGCACCAACTTCTACTCAAGTAAATGTTCTT1020
CTTTATGACAGTGCAACGGGTTCTGTAACAAAAATCGTACCTATGACGGCATCGGGCCAT1080
GGTGTGTGGGAAGCAACGGTTAATCAAAACCTTGAAAATTGGTATTACATGTATGAGGTA1140
ACAGGCCAAGGCTCTACCCGAACGGCTGTTGATCCTTATGCAACTGCGATTGCACCAAAT1200
GGAACGAGAGGCATGATTGTGGACCTGGCTAAAACAGATCCTGCTGGCTGGAACAGTGAT1260
AAACATATTACGCCAAAGAATATAGAAGATGAGGTCATCTATGAAATGGATGTCCGTGAC1320
TTTTCCATTGACCCTAATTCGGGTATGAAAAATAAAGGGAAGTATTTGGCTCTTACAGAA1380
AAAGGAACAAAGGGCCCTGACAACGTAAAGACGGGGATAGATTCCTTAAAACAACTTGGG1440
ATTACTCATGTTCAGCTTATGCCTGTTTTCGCATCTAACAGTGTCGATGAAACTGATCCA1500
ACCCAAGATAATTGGGGTTATGACCCTCGCAACTATGATGTTCCTGAAGGGCAGTATGCT1560
ACAAATGCGAATGGTAATGCTCGTATAAAAGAGTTTAAGGAAATGGTTCTTTCACTCCAT1620
CGTGAACACATTGGGGTTAACATGGATGTTGTCTATAATCATACCTTTGCCACGCAAATC1680
TCTGACTTCGATAAAATTGTACCAGAATATTATTACCGTACGATGATGCAGGTAATTATA1740
CCAACGGATCAGGTACTGGAAATGAAATTGCANGCNGAAAGGCCAATGGTTCAAAAATTT1800
ATTATTGATTCCCTTAAGTATTGGGTCAATGAGTATCATATTGACGGCTTCCGTTTTGAC1860
TTAATGGCGCTGCTTGGAAAAGACACGATGTCCAAAGCTGCCTCGGAGCTTCATGCTATT1920
AATCCAGGAATTGCACTTTACGGTGAGCCATGGACGGGTGGAACCTCTGCACTGCCAGAT1980
GATCAGCTTCTGACAAAAGGAGCTCAAAAAGGCATGGGAGTAGCGGTGTTTAATGACAAT2040
TTACGAAACGCGTTGGACGGCAATGTCTTTGATTCTTCCGCTCAAGGTTTTGCGACAGGT2100
GCAACAGGCTTAACTGATGCAATTAAGAATGGCGTTGAGGGGAGTATTAATGACTTTACC2160
TCTTCACCAGGTGAGACAATTAACTATGTCACAAGTCATGATAACTACACCCTTTGGGAC2220
AAAATAGCCCTAAGCAATCCTAATGATTCCGAAGCGGATCGGATTAAAATGGATGAACTC2280
GCACAAGCAGTTGTTATGACCTCACAAGGCGTTCCATTCATGCAAGGCGGGGAAGAAATG2340
CTTCGTANAAAAGGCGGCAACGACAATAGTTATAATGCAGGCGATGCGGTCAATGAGTTT2400
GATTGGAGCAGGAAAGCTCAATATCCAGATGTTTTCAACTATTATAGCGGGCTAATCCAC2460
CTTCGTCTTGATCACCCAGCCTTCCGCATGACGACAGCTAATGAAATCAATAGCCACCTC2520
CAATTCCTAAATAGTCCAGAGAACACAGTGGCCTATGAATTAACTGATCATGTTAATAAA2580
GACAAATGGGGAAATATCATTGTTGTTTATAACCCAAATAAAACTGTAGCAACCATCAAT2640
TTGCCGAGCGGGAAATGGGCAATCAATGCTACGAGCGGTAAGGTAGGAGAATCCACCCTT2700
GGTCAAGCAGAGGGAAGTGTCCAAGTACCAGGTATATCTATGATGATCCTTCATCAAGAG2760
GTAAGCCCAGACCACGGTAAAAAG2784 (2) INFORMATION FOR SEQ ID NO:11: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 928 amino acids (B) TYPE:
amino acids (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:11:
AspGlyAsnThrThrThrIleIleValHisTyrPheCysProAlaGly 151015
AspTyrGlnProTrpSerLeuTrpMetTrpProLysAspGlyGlyGly 202530
AlaGluTyrAspPheAsnGlnProAlaAspSerPheGlyAlaValAla 354045
SerAlaAspIleProGlyAsnProSerGlnValGlyIleIleValArg 505560
ThrGlnAspTrpThrLysAspValSerAlaAspArgTyrIleAspLeu 65707580
SerLysGlyAsnGluValTrpLeuValGluGlyAsnSerGlnIlePhe 859095
TyrAsnGluLysAspAlaGluAspAlaAlaLysProAlaValSerAsn 100105110
AlaTyrLeuAspAlaSerAsnGlnValLeuValLysLeuSerGlnPro 115120125
LeuThrLeuGlyGluGlyXaaSerGlyPheThrValHisAspAspThr 130135140
AlaAsnLysAspIleProValThrSerValLysAspAlaSerLeuGly 145150155160
GlnAspValThrAlaValLeuAlaGlyThrPheGlnHisIlePheGly 165170175
GlySerAspTrpAlaProAspAsnHisSerThrLeuLeuLysLysVal 180185190
ThrAsnAsnLeuTyrGlnPheSerGlyAspLeuProGluGlyAsnTyr 195200205
GlnTyrLysValAlaLeuAsnAspSerTrpAsnAsnProSerTyrPro 210215220
SerAspAsnIleAsnLeuThrValProAlaGlyGlyAlaHisValThr 225230235240
PheSerTyrIleProSerThrHisAlaValTyrAspThrIleAsnAsn 245250255
ProAsnAlaAspLeuGlnValGluSerGlyValLysThrAspLeuVal 260265270
ThrValThrLeuGlyGluAspProAspValSerHisThrLeuSerIle 275280285
GlnThrAspGlyTyrGlnAlaLysGlnValIleProArgAsnValLeu 290295300
AsnSerSerGlnTyrTyrTyrSerGlyAspAspLeuGlyAsnThrTyr 305310315320
ThrGlnLysAlaThrThrPheLysValTrpAlaProThrSerThrGln 325330335
ValAsnValLeuLeuTyrAspSerAlaThrGlySerValThrLysIle 340345350
ValProMetThrAlaSerGlyHisGlyValTrpGluAlaThrValAsn 355360365
GlnAsnLeuGluAsnTrpTyrTyrMetTyrGluValThrGlyGlnGly 370375380
SerThrArgThrAlaValAspProTyrAlaThrAlaIleAlaProAsn 385390395400
GlyThrArgGlyMetIleValAspLeuAlaLysThrAspProAlaGly 405410415
TrpAsnSerAspLysHisIleThrProLysAsnIleGluAspGluVal 420425430
IleTyrGluMetAspValArgAspPheSerIleAspProAsnSerGly 435440445
MetLysAsnLysGlyLysTyrLeuAlaLeuThrGluLysGlyThrLys 450455460
GlyProAspAsnValLysThrGlyIleAspSerLeuLysGlnLeuGly 465470475480
IleThrHisValGlnLeuMetProValPheAlaSerAsnSerValAsp
485490495 GluThrAspProThrGlnAspAsnTrpGlyTyrAspProArgAsnTyr
500505510 AspValProGluGlyGlnTyrAlaThrAsnAlaAsnGlyAsnAlaArg
515520525 IleLysGluPheLysGluMetValLeuSerLeuHisArgGluHisIle
530535540 GlyValAsnMetAspValValTyrAsnHisThrPheAlaThrGlnIle
545550555560 SerAspPheAspLysIleValProGluTyrTyrTyrArgThrMetMet
565570575 GlnValIleIleProThrAspGlnValLeuGluMetLysLeuXaaAla
580585590 GluArgProMetValGlnLysPheIleIleAspSerLeuLysTyrTrp
595600605 ValAsnGluTyrHisIleAspGlyPheArgPheAspLeuMetAlaLeu
610615620 LeuGlyLysAspThrMetSerLysAlaAlaSerGluLeuHisAlaIle
625630635640 AsnProGlyIleAlaLeuTyrGlyGluProTrpThrGlyGlyThrSer
645650655 AlaLeuProAspAspGlnLeuLeuThrLysGlyAlaGlnLysGlyMet
660665670 GlyValAlaValPheAsnAspAsnLeuArgAsnAlaLeuAspGlyAsn
675680685 ValPheAspSerSerAlaGlnGlyPheAlaThrGlyAlaThrGlyLeu
690695700 ThrAspAlaIleLysAsnGlyValGluGlySerIleAsnAspPheThr
705710715720 SerSerProGlyGluThrIleAsnTyrValThrSerHisAspAsnTyr
725730735 ThrLeuTrpAspLysIleAlaLeuSerAsnProAsnAspSerGluAla
740745750 AspArgIleLysMetAspGluLeuAlaGlnAlaValValMetThrSer
755760765 GlnGlyValProPheMetGlnGlyGlyGluGluMetLeuArgXaaLys
770775780 GlyGlyAsnAspAsnSerTyrAsnAlaGlyAspAlaValAsnGluPhe
785790795800 AspTrpSerArgLysAlaGlnTyrProAspValPheAsnTyrTyrSer
805810815 GlyLeuIleHisLeuArgLeuAspHisProAlaPheArgMetThrThr
820825830 AlaAsnGluIleAsnSerHisLeuGlnPheLeuAsnSerProGluAsn
835840845 ThrValAlaTyrGluLeuThrAspHisValAsnLysAspLysTrpGly
850855860 AsnIleIleValValTyrAsnProAsnLysThrValAlaThrIleAsn
865870875880 LeuProSerGlyLysTrpAlaIleAsnAlaThrSerGlyLysValGly
885890895 GluSerThrLeuGlyGlnAlaGluGlySerValGlnValProGlyIle
900905910 SerMetMetIleLeuHisGlnGluValSerProAspHisGlyLysLys
915920925 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 29 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:12:
MetAlaLysLysLeuIleTyrValCysLeuSerValCysLeuValLeu 25-20-15
ThrTrpAlaPheAsnValLysGlyGlnSerAlaHisAla 10- 5-1 (2) INFORMATION FOR
SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 87 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:13: ATGGCTAAAAAACTAATTTATGTGTGTTTAAGTGTTTGTTTAGTGTTG48
MetAlaLysLysLeuIleTyrValCysLeuSerValCysLeuValLeu 25-20-15
ACCTGGGCTTTTAATGTAAAAGGGCAATCTGCTCATGCT87
ThrTrpAlaPheAsnValLysGlyGlnSerAlaHisAla 10-5-1 (2) INFORMATION FOR
SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1162 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:14:
GGATCCTGTTAGACTATTTGAGGAGTTTGCAACACTTGATGTTTTATCCAAAGGAAGGGC60
CGGAGATCATCGCTGGTCGAGGTGCTTTCGGTGAAGCATTTTCGCTATTTTGGGTATAAC120
CGGGCGCATTACGATCAATTGTTTGAAGAGCATCTTGATTTACTTCAAAAGCTGAATGCT180
TCGAAAAGAATAACATGGAGCGGGCTTTATCGAACACCTATACATGATGCAGATATCGCA240
CCCCGCCCTGTTCAGAAAAACATTCCTTTGTGGGTTGGGGTGGGTGGGACNMNTGAAASC300
NSYKCKYYGTGCRNVSNNNTATGGTGCCGGCTTAGCATGGGTATTTTGTCAGGCGATTGG360
CTTCGGTTTAAGGCACTTTCGGACCTTTATCGGCAGGCCGGCCAACAAGCANGGTATTCA420
CCGAACGATCTGAAAGTAGGAGTGACAGGGCATGCGTTTATTGGAAAGACGTCGCAGCAG480
GCACTCAATGACTATTACCCCTATCACGCGAATTATTGGCTAACACTGAACCAACAATTA540
GGGCAGCCGTTACCCCAGCAATACGTGAGGGAATTTAATTTATTAGCCTCCCCAGAGCAA600
GCCTTATATGTGGGAAGCTCTCAACAAGTGGGCAGGNAAAAATTTTGCGCCAACATGAGG660
NATTTGGTNATAAACGTTTTATCGCACAGATCGACATTGGCGGAATGCCCTTTAAAACAG720
TGGCCAAGAATATTGAGCGGTTAGGCCACTGAGGTTGCACCTGTCGTACGAAGAGCAACA780
AGAGGGTAATGGTAATAATCTATTTAACTGTTTATTAGAAAACTTGGTATCTGTTTAATT840
AAATAACAGGAGCCTGGAAGTGGGCCAAGGCTCCTTTCTAGGGAAACCTTTTTCTATTTA900
TATAGGCGTTGTTGCCTAAGGCTAAAGTAGGATTTTATTAAAAATATAGGAATTGCTCTT960
TTATTCGACACAATTATTCAATGGAATACGATAAAATGGAGAGTGTATGTAAGCGTTATA1020
TTTTATTGGGGGGCTGATAGAAGAAAAGGGATGCGACAGGGTCTATTAGCTAGTTTGGTA1080
TTCGATTTCAGATCAATGCAACGTACGAGTTTTTTATTGACTGCTTTGTGCAAGCGATTG1140
CATTGAAACAAAGGAGGACATT1162 (2) INFORMATION FOR SEQ ID NO:15: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 431 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:15:
TAATAGAAAAAAGTAAAATCCCCTCAAGATGTTTGAGGGGGATTTAGTTACTTATTATCC60
AATTAATTTGCGGCTTCGGTGTTTTCAATGGGCTCCGTATCCGTTCGGTTGTGTGATCGG120
ACAAATGGGAGTGAATAGGTCACAAGAGCAGCAGCCATTTCAAGCAGACCAGCGAAAGTA180
AACATTCGTTCTGGTGCAAATCGGGTCATCAACCAACCGGTAATTGCTTGGGAAATAGGG240
ATGGACCCTGACATCACGATAATCATAATACTAATAACACGACCGAATAACTTAGGTGGA300
ATAAGCGTATGGTTAACGCTTGGAGCAATAATATTAACCGCCGTTTCATGAGCGCCAACA360
AGCACTAGAAGGGCTAAAATAACCCATAAGTTGTGTGTAAATCCTATAAAAAATAACATA420
AGGCCCTGCAG431
__________________________________________________________________________
* * * * *