U.S. patent number 5,597,570 [Application Number 07/964,471] was granted by the patent office on 1997-01-28 for protein recognized by antibodies raised against native p28 of schistosoma mansoni.
This patent grant is currently assigned to Transgene S.A.. Invention is credited to Jean-Marc Balloul, Andre Capron, Jean-Marie Grzych, Marie-Paule Kieny, Jean-Pierre Lecocq, Gerard Loison, Raymond Pierce, Paul Sondermeyer.
United States Patent |
5,597,570 |
Sondermeyer , et
al. |
January 28, 1997 |
Protein recognized by antibodies raised against native P28 of
schistosoma mansoni
Abstract
The present invention relates to the development of a vaccine
against schistosomiasis. It relates to a protein which includes the
epitopes of the p28 protein, a poxvirus containing a gene coding
for the said protein, a cell incorporating a vector for the
expression of the said protein, a method for preparing the said
protein, a DNA sequence coding for the p28 protein, a
pharmaceutical composition, antibodies raised against the said
protein and their application by way of diagnostic agents for
schistosomiasis. The present invention also relates to the
application of the said protein by way of an agent possessing
glutathione S-transferase activity.
Inventors: |
Sondermeyer; Paul (Strasbourg,
FR), Balloul; Jean-Marc (Lille, FR),
Pierce; Raymond (Seclin, FR), Grzych; Jean-Marie
(Marcq en Baroeul, FR), Kieny; Marie-Paule
(Strasbourg, FR), Loison; Gerard (Strasbourg,
FR), Capron; Andre (Phalempin, FR), Lecocq;
Jean-Pierre (Reichstett, FR) |
Assignee: |
Transgene S.A.
(FR)
|
Family
ID: |
27251391 |
Appl.
No.: |
07/964,471 |
Filed: |
October 21, 1992 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
819600 |
Jan 9, 1992 |
|
|
|
|
663805 |
Mar 4, 1991 |
|
|
|
|
449449 |
Dec 12, 1989 |
|
|
|
|
88615 |
Aug 24, 1987 |
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Aug 22, 1986 [FR] |
|
|
8611986 |
Apr 22, 1987 [FR] |
|
|
8705691 |
Apr 22, 1987 [FR] |
|
|
8705692 |
|
Current U.S.
Class: |
424/191.1;
530/324; 435/193; 530/350 |
Current CPC
Class: |
A61P
39/02 (20180101); C07K 14/4354 (20130101); C12N
15/73 (20130101); C12N 15/86 (20130101); C12N
9/1088 (20130101); A61P 33/02 (20180101); C07K
14/005 (20130101); C12N 15/81 (20130101); C07K
14/43559 (20130101); C12N 9/12 (20130101); A61K
39/00 (20130101); C12N 2710/24143 (20130101); C07K
2319/00 (20130101); C07K 2319/02 (20130101); C12N
2760/20122 (20130101); Y02A 50/30 (20180101); Y02A
50/423 (20180101) |
Current International
Class: |
C12N
15/863 (20060101); C12N 15/81 (20060101); C12N
9/10 (20060101); C12N 9/12 (20060101); C12N
15/73 (20060101); C07K 14/145 (20060101); C07K
14/005 (20060101); C07K 14/435 (20060101); A61K
39/00 (20060101); A61K 039/002 (); C07K 014/00 ();
C12N 009/10 () |
Field of
Search: |
;424/88,191.1
;530/350,324 ;435/193 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Cordingley et al, Molecular and Biochemical Parasitology, 18 (1986)
73-88. .
Balloul et al, Molecular and Biochemical Parasitology, 17 (1985)
105-114. .
Taylor et al, Chem. Abs. 101, No. 21, 184923. .
Aronstein et al, Chem. Abs. Nos. 103, 19, 158710m. .
Iino et al, Chem. Abs. 105, No. 13, 1097805. .
Knight et al, Chem. Abs. 104, No. 19, 1628629. .
Smith et al, Proc. Natl. Acad. Sci. USA (1986) 83 (22), 8703-7 (CA
106(5):28407u). .
Davern et al, Immunol. Cell Biol, (1987) 65(6), 473-82, (CA 109
(1), 4955q). .
Cordingley et al; Molecular and Biochemical Parasitology, 18 (1986)
73-88; "Identification by Message Selection of cDNA Clones Encoding
Antigens of `Schistosoma Mansoni`". .
Balloul et al; Molecular and Biochemical Parasitology, 17 (1985)
105-114; "In Vitro Synthesis of a 28 Kilokalton Antigen Present on
the Surface of the Schistosomulum of `Schistosoma Mansoni`". .
J. M. Balloul et al. "Molecular Cloning of a Protective Antigen of
Schistosomes" Nature 326:149-153 (Mar. 1987). .
Taylor et al. Chem Abs 101, No. 21, 184923 (Nov. 1984). .
Aronstein et al. Chem Abs 103, No. 19 158710m (Nov. 1985). .
Iino et al. Chem Abs 105 No. 13 109780s (Sep. 1986). .
Knight et al. Chem Abs 104 No. 19 162862a (May 1986). .
Smith et al., Proc. Nat'l Aca. Sci (USA) 1986 83(22), pp.
8703-8707, [CA 106(5): 28407 u]. .
Davern et al., Immunol Cell Biol. (1987), 65(6) pp. 473-482, [CA
109(1), 4955g]. .
Taylor et al, Chem. Abs. 101, No. 21, 184923 (Nov. 1984). .
Aronstein et al, Chem. Abs. 103, No. 19, 158710m (Nov. 1985). .
Iino et al, Chem. Abs. 105, No. 13, 1097805 (Sep. 1986). .
Knight et al, Chem. Abs. 104, No. 19, 1628629 (May 1986). .
Chem. Abs., 101, No. 21, 184923, Taylor et al (Nov. 1984). .
Chem. Abs., 103, No. 19, 158710m, Aronstein et al (Nov. 1985).
.
Chem. Abs. 105, No. 13, 109780s, Iino et al (Sep. 1986). .
Chem. Abs. 104, No. 19, 162862a, Knight et al (May 1986)..
|
Primary Examiner: Wax; Robert A.
Assistant Examiner: Prouty; Rebecca
Attorney, Agent or Firm: Cushman Darby & Cushman,
L.L.P.
Parent Case Text
This is a continuation of application No. 07/819,600, filed Jan. 9,
1992, which was abandoned upon the filing hereof which is a
continuation of 07/663,805, filed Mar. 4, 1991, now abandoned;
which is a continuation of 07/449,449 filed Dec. 12, 1989; now
abandoned; which is a continuation of 07/088,615, filed Aug. 24,
1987, now abandoned.
Claims
We claim:
1. A substantially purified protein having an amino acid sequence
substantially as shown in FIGS. 1a-1c.
2. The protein according to claim 1, wherein said protein is
recombinantly produced.
3. A substantially purified protein wherein said protein is
recognized by antibodies raised against native p28 protein of
Schistosoma mansoni.
4. A vaccine against schistosomiasis comprising the protein
according to claim 1, together with a pharmaceutically acceptable
carrier or adjuvant.
Description
The present invention relates to the development of a vaccine
against schistosomiasis.
Schistosomiasis (or bilharziasis) is a parasitic disease of the
tropical and subtropical regions of the whole world (except for
North America): it is even spreading in North Africa; there is a
substantial source of it in Egypt and attention has been drawn to a
few sources in Spain and Portugal.
This disease affects from 200 to 400 million human beings. The
parasite responsible, the schistosome, is a small flatworm whose
complex life cycle involves an intermediate host which is a
freshwater mollusc. For this reason, the disease is spreading with
the creation of dams and irrigation networks designed for the
purpose of developing the tropical areas.
Five types of schistosomes which are pathogenic for man are known:
the most widespread, S. mansoni, is common to Africa and America;
two species, S. haematobium and intercalatum, are found only in
Africa, and two others, S. japonicum and mekongi, in Asia.
Knowledge of the life cycle of the parasite is necessary for the
development of a strategy for preventing the disease.
In effect, the parasite shows an almost perfect adaptation to the
host's natural defenses: when it reaches the adult stage, it
completely eludes the immune mechanisms and may live for 5 to 20
years in the blood vessels close to the intestinal wall or to the
bladder, depending on the species (S. mansoni or S. haematobium,
respectively). The parasite does not multiply in man but the female
lays up to 3,000 eggs per day. These eggs and the waste products of
the worm's metabolism appear in the host's circulation and produce
various disorders (intestinal and urinary disorders, weakness,
anemia, granuloma formation with obstruction of the capillary blood
vessels leading to tissue fibrosis and, in particular, to serious
liver inflammation).
The eggs, provided with a spur, can pass through the intestinal or
bladder wall where they produce microlesions, and they are then
eliminated. If they rapidly make contact with water, they release
ciliated larvae (miracidia) therein, which swim until they
penetrate a mollusc. In this intermediate host, the larva engages
in cycles of asexual multiplication which will give rise to
cercariae which will be released into the water. (A mollusc
infected by a single miracidium can produce more than 50,000
cercariae in a Life span of 8 to 10 months).
The cercaria is a swimming larva which lives for only 1 to 2 days.
When it encounters a mammal, especially man, it penetrates through
the latter's skin. In the skin, it is converted to a
schistosomulum, an immature form of the parasite, which will be
carried in the blood circulation, successively to the heart, the
lungs and finally the liver. It is in the hepatic circulation that
the parasite becomes adult. The male and the female mate; the
female lodges in a canal formed by the infolding of the male's
body, and the pair settles permanently in an abdominal blood vessel
where the female begins laying eggs.
The complete maturation of the schistosomulum to adult worm takes
about 15 days. At the adult stage, the parasite has adsorbed
molecules of its host at its surface and, by virtue of this
camouflage, it eludes the host's immune recognition and defense
mechanisms. In addition, the parasite secretes substances which
have an immuno-suppressant capacity. Thus protected, each pair of
schistosomes can live in its host for many years while laying
thousands of eggs each day.
A drug exists which is effective against the adult parasite, namely
praziquantel, but it is too expensive for its wide-spread use to be
envisaged in developing countries. Furthermore, it does not prevent
reinfection; in point of fact, in endemically infected areas, the
populations are in regular contact with water contaminated with the
larvae.
The only serious hope of preventing the disease lies in developing
an effective vaccine against the immature form of the parasite, the
schistosomulum. This vaccine should be administered to young
children so as to avoid the primary infection, and to already
contaminated individuals after a treatment with praziquantel to
prevent reinfection.
This vaccine should contain one (or more) major antigen(s) of the
schistosomulum and induce an effective immune reaction against the
larva before the latter eludes the host's defense mechanisms.
Recent work (see review by Capron and Dessaint-1985) has made it
possible to identify a limited number of protein antigens present
at the surface of the parasite and its larva, and which might play
an important part in the induction of an immune response.
One of these antigens has been demonstrated by Balloul et al.
(1985): after immunization of rats with extracts of S. mansoni
purified on gel, the induced antibodies recognize a 28-kd antigen,
referred to as p28, which is present on the adult and larval forms
of the parasite. These same antibodies recognize a product of in
vitro translation of the mRNAs extracted from the adult parasite
and one of the external proteins of the schistosomulum, the protein
being identified by labeling with .sup.125 I.
Although they cannot by themselves neutralize the schistosomulum,
these anti-p28 antibodies activate the cytotoxic cellular response
which can kill the schistosomula.
Rats and mice were inoculated with a sample of the purified p28
protein; the immunized animals developed a high degree of
protection against an experimental infection with the schistosomula
(Balloul et al. 1986).
This set of observations demonstrates the importance of the p28
antigen in the induction of a protective immune response.
The present invention relates to the identification and
determination of the cDNA sequence which codes for the p28 antigen,
or at least for a polypeptide which includes the epitopes of p28
which are recognized by antibodies raised against the native p28
protein.
Thus, the present invention relates, in the first place, to the DNA
sequence coding for the mature p28 protein as depicted in FIG.
1a-1c.
The present invention also relates to the protein whose synthesis
is directed by this cDNA, a synthesis which can be accomplished in
different host cells, bacteria, yeasts or higher cells, depending
on the vector into which the cDNA is inserted and the signals for
control of the expression under which it is placed.
The protein according to the present invention can have a primary
structure identical to that of the native p28 protein present in
the schistosomulum, but it can also be a derivative of the latter
or a p28 protein which is incomplete but includes the epitopes that
are important for recognition by the antibodies and hence for
induction of the immunity. This protein or the incomplete protein
can also be fused to another protein (or protein fragment) as a
result of a genetic manipulation of the corresponding DNA segments
which is designed to favor improved expression of the protein in
the host cell or, where appropriate, to cause it to be excreted out
of the cell.
The technologies by means of which a foreign gene may be cloned and
expressed in different host cells are known to those versed in the
art. They will be illustrated in the examples below, it being
understood that other vectors and other host cells may be used.
The expression of the gene corresponding to p28 in a bacterium,
specifically E. coli, was obtained with a vector which includes the
lambda P.sub.L promoter and the cII rbs as ribosome binding site.
The hybrid protein obtained contains a portion of the cII protein,
and the p28 protein or a portion of the latter.
In the case where the host is a yeast, for example S. cerevisiae,
it is possible to use a plasmid vector for yeast containing a
functional origin of replication in yeast, for example the origin
of replication of the 2.mu. plasmid, and a selection gene such as
URA3. In the present case, the promoter used is that of the PGK
gene with the 5' portion of the PGK gene which leads either to a
fused protein or to a mature protein.
Finally, when the host is a mammalian cell, a poxvirus, for example
vaccinia virus, in which the gene coding for the protein will be
placed under the control of a sequence for expression of this gene
by the poxvirus, will preferably be used as an expression vector.
This recombinant virus will contain the gene coding for a protein
according to the invention, preferably inserted in the TK gene of
the vaccinia and under the control of a strong promoter such as the
7.5 K protein promoter of the vaccinia. The gene coding for the
protein according to the invention may also be fused to a region
coding for a functional signal sequence, for example the signal
sequence for interleukin-2 or for the rabies glycoprotein, in order
to provide for the excretion of the protein out of the cell; in
this case the corresponding protein will be a hybrid protein
containing a protein portion not originating from the
schistosomula.
The gene coding for the protein according to the invention may also
be fused to a region coding for the transmembrane region of the
rabies virus glycoprotein, in order to provide for anchoring of the
protein in the cytoplasmic membrane of the infected cells.
The invention also relates to the host cells transformed by the
vectors for expression of the proteins according to the present
invention, as well as to a method for preparing such proteins,
wherein these host cells are cultured and wherein the proteins
according to the invention are recovered.
The culture methods and those of recovery and separation of the
proteins will obviously depend on the host, but are known to those
versed in the art.
Finally, the present invention relates to the pharmaceutical
compositions which are useful as vaccines against schistosomiasis,
which vaccines contain at least one protein or one poxvirus
according to the invention, in a pharmaceutically acceptable
vehicle.
The present invention relates especially to live vaccines, which
contain live recombinant vaccinia viruses that express the protein
according to the invention and which are presented in a
pharmaceutically acceptable vehicle.
Preferably, these vaccines will be in a form that may be
administered, for example, by injection. The pharmaceutically
acceptable vehicle may be an aqueous vehicle for injection.
The vaccination process will have to be appropriate to the type of
vaccine used (protein or live virus).
Finally, the present invention relates to the antisera raised
against a protein according to the present invention.
The present invention relates, in addition, to the demonstration
that the recombinant p28 protein (or p28I) has glutathione
S-transferase enzyme activity.
Glutathione S-transferases are very widely distributed enzymes
which are present in both plants and animals and which play a part
in the detoxification of various molecules (hydrophobic
electrophilic compounds, endogenous superoxides, alkylating agents,
herbicides, etc.).
The work of Smith et al. (1986) shows that the parasite Schistosoma
japonicum synthesizes a glutathione S-transferase which might play
a part in protecting the parasite against the free radicals
produced by the cells which are the effectors of the infected
host's immunity.
The present invention relates more especially to the demonstration
that the p28 protein derived from Schistosoma mansoni and
synthesized in E. coli or S. cerevisiae, and whose value as a
vaccinal antigen has been shown above, has glutathione
S-transferase activity.
More especially, the present invention relates to the application
of a protein as described above by way of an agent possessing
glutathione S-transferase activity, such as the p28 protein.
The present invention also relates to the application of the cells,
transformed or infected with a block for expression of the protein
described above, by way of an agent possessing glutathione
S-transferase activity.
These proteins and these cells can be used as a conversion agent in
a microbiological conversion process employing glutathione
S-transferase activity.
The present invention encompasses the identification and
determination of the cDNA sequence which codes for a second p28
protein recognized by the antibodies raised against the native p28
protein.
The present invention relates, in effect, to the DNA sequence
coding for the mature p28II protein as depicted in FIG.
16a-16e.
The present invention also relates to a protein whose synthesis is
directed by this cDNA or a portion of this cDNA, the said protein
being recognized by the antibodies raised against the native p28
protein.
The present invention also relates to the cells which incorporate
cDNA coding for the mature p28II protein or a fragment of the
latter as described above.
Although in the examples below the protein is expressed only in a
bacterium, E. coli, its synthesis may also be accomplished in
different host cells, bacteria, yeasts or higher cells, depending
on the vector into which the cDNA is inserted, as has been
described above.
The expression of the gene corresponding to p28II was obtained with
the vector described above, which includes the lambda P.sub.L
promoter and the cII rbs ribosome binding site.
The present invention also relates to the preparation of the said
proteins by culturing the cells described above.
Finally, the invention relates to the pharmaceutical composition
for the treatment or prevention of schistosomiasis, which contains
by way of active agent at least one protein as described above.
Naturally, if the cDNA is incorporated in a poxvirus such as
vaccinia, this poxvirus may, in some cases, be used directly as a
vaccinating agent.
It is also possible to raise antibodies against these proteins.
These antibodies and these proteins may be used as a diagnostic
agent for schistosomiasis.
In the present invention, the nucleotide sequences of the genes or
amino acid sequences of the proteins which are shown in the figures
are not restated, but are an integral part of the invention and of
the present description.
The examples below are designed to demonstrate other
characteristics and advantages of the present invention.
The description will be given using the attached figures.
The attached figures are as follows:
FIGS. 1a-1c show the complete sequence of the cDNA deduced from the
sequences of .lambda. TG06, .lambda. TG08, .lambda. TG09, .lambda.
TG10 and .lambda. TG11.
The open reading-frame which begins at the 7th nucleotide codes for
a polypeptide of 211 amino acids having a molecular weight of 28
kd.
FIG. 2 shows the construction of pTG44 by integration of an EcoRI
insert of .lambda. TG06 in pTG1924. pTG1924 is a derivative of
pTG908 with an EcoRI site placed in phase, situated 46 bp
downstream from the initiation codon of cII. pTG44 codes for a
cII/p28 fused protein having a molecular weight of 25 kd.
FIGS. 3a and 3b show the sequence of the cII/p28 fusion protein
encoded by the expression block inserted into pTG44.
FIG. 4 shows total extracts and insoluble fractions of the extracts
of E. coli TGE901 pTG44 after electrophoresis on SDS-acrylamide gel
and staining with Coomassie blue.
The arrow shows the position of the 25-kd protein.
A. total extract of TGE901 pTG44 at 30 .degree. C.
B. insoluble fraction of the same extract
C. total extract of TGE901 pTG44 after induction for 7 hours at
37.degree. C.
D. insoluble fraction of the same extract
E. total extract of TGE901 pTG44 after induction for 7 hours at
42.degree. C.
F. insoluble fraction of the same extract
G. fraction F. solubilized in 0.2% SDS
H. total extract of control culture of TGE901 pTG1924 after 7 hours
at 42.degree. C.
I. insoluble fraction of the same extract.
FIG. 5 shows extracts of S. cerevisiae TGY1sp4 producing the p28
protein encoded by the constructions pTG1885 and pTG1886, after
electrophoresis on SDS-acrylamide gel and staining with Coomassie
blue.
A. extract of TGY1sp4/pTG1885 (non-fused 28-kd protein)
B. extract of TGY1sp4 control culture
C. extract of TGY1sp4/pTG1886 (fused 30-kd protein).
FIG. 6 shows extracts of E. coli and S. cerevisiae producing a
fused or mature 28-kd protein, the extracts being analyzed by
"Western blotting" with rabbit antibodies specific for the native
p28. The bound antibodies are recognized by biotin-labeled
anti-rabbit antibodies and this complex is then visualized by means
of a streptavidin-peroxidase reagent and staining with HRP
(Bio-Rad).
A. total extract of coli TGE901 pTG44
B. insoluble fraction of the same extract
C. total extract of S. cerevisiae, TGY1sp4/pTG1885, producing the
mature protein
D. total extract of S. cerevisiae producing the mature protein
fused to the first 22 amino acids of PGK, TGY1sp4/pTG1886
E. extract of negative control S. cerevisiae
F.,G. same extracts as C and D, at half the concentration.
FIG. 7 shows the placing in phase of the EcoRI site by directed
mutagenesis in the region of the cDNA corresponding to the first 9
amino acids of human interleukin-2.
FIG. 8 shows the construction of pTG45 and pTG46 by insertion of
the EcoRI fragments of .lambda. TG06 and .lambda. TG09 in the EcoRI
site of pTG188-I (see construction of FIG. 7).
FIGS. 9a-9b show the structure of the IL2/p28 fusion protein
encoded by pTG45. The presence is noted of a signal peptide which
permits the excretion of a 24-kd protein that includes most of
p28.
FIGS. 10a and 10b show the structure of the IL2/p28 fusion protein
encoded by pTG46. The signal peptide permits the excretion of a
16-kd protein which contains the central portion of the p28
antigen.
FIG. 11 shows the insertion of the gene coding for IL2/p28, placed
under the control of the vaccinia 7.5K promoter, into a plasmid
carrying the vaccinia TK gene. Insertion of this expression block
into the viral genome by double recombination between the TK
sequences.
FIG. 12 shows the detection of the proteins secreted into the
culture medium of BHK21 cells infected with the recombinant viruses
VV.TG.p28 Sm-1 and VV.TG.p28 Sm-2, by means of the rabbit or rat
antibody specific for the native p28.
A and D supernatant of VV.TG.p28Sm-1
B and E supernatant of VV.TG.p28Sm-2
C and F supernatant of culture infected with a wildtype VV
A, B, C detection with rabbit antibodies
D, E, F detection with rat antibodies.
The numbers correspond to independent isolations.
FIG. 13 shows the detection of the anti-p28 antibodies by the
"Western blot" test with the native p28 protein, in the sera of
rats immunized with the cII/p28 protein synthesized by E. coli.
NRS: serum of control, non-inoculated rat
SR28-20,D8, D11, D16, D23: serum of rats harvested 8, 11, 16 and 23
days after inoculation with the cII/p28 protein
SR28: serum of rat inoculated with the native p28 protein.
FIG. 14 shows the biological activity of the same sera as in FIG.
13, measured in a test of eosinophil-dependent cytotoxicity against
schistosomula (see Tables I, II and III).
SR28-20 shows the antiserum directed against a 20-kd cloned
fragment corresponding to the 28-kd antigen of S. mansoni recovered
at different times after the second injection
SR-28 shows the antiserum directed against native p28 and recovered
14 days after the second injection.
FIG. 15 shows the following curves:
GT of rat liver (.tangle-solidup.9 .mu.g . 6 .mu.g)
crude extracts of E. coli, control (o) and
TGE901/pTG54(.box-solid.)
crude extracts of S. cerevisiae, control (o), transformed with a
plasmid vector (.DELTA.) and TGY2sp13b/pTG2800 (+).
FIGS. 16a-16c show the cDNA sequence of the p28II protein, as well
as the corresponding protein sequence according to the 3
reading-frames.
FIG. 17 shows an electrophoresis on acrylamide gel of E. coli
extracts after staining with Coomassie blue:
A, C, and F total extract
B, D and E insoluble fraction of the same extracts
A, B, C, D E. coli TGE901/pTG56
E, F E. coli TGE901/pTG908 (control vector)
G molecular mass markers.
EXAMPLE 1
IDENTIFICATION AND CLONING OF A cDNA CODING FOR A p28 PROTEIN
The strategy chosen for cloning the gene coding for a p28 antigen
whose sequence is unknown was to identify the expression products
in E. coli of a schistosome cDNA library, using polyclonal
antibodies specifically raised against the p28. These antibodies
were induced by immunizing rabbits and rats with extracts,
fractionated on gel, of the adult S. mansoni parasite.
Preparation of the cDNA library
From the RNA extracted from adult schistosomes, the complementary
DNA strand is synthesized by the action of MLV reverse
transcriptase. The DNA, made double-stranded by the action of the
Klenow fragment of coli polymerase, is then treated with S1
nuclease to make its ends blunt. The fragments corresponding to the
size sought, that is to say between 500 and 4,000 bp, are selected
on a sucrose gradient. A tail of dG residues is added to these
fragmerits and they a reinserted into the EcoRI site of the phage
lambda derivative gt 10 (Huynh, 1984) via a synthetic adapter
5'-AATTC CCCCCCCCCC-3' (Le Bouc et al. 1986).
After ligation, the recombinant phages are packaged in vitro. A
library of 2.times.10.sup.6 phages thereby formed is then amplified
by inoculation into E. coli POP 101 (Lathe, 1977).
After amplification, the phages are concentrated with PEG and
purified by two CsCl gradient centrifugations, and their DNA is
extracted. The cDNA inserts are recovered by digestion with EcoRI
and purified on a sucrose gradient. The 500- to 2,000-bp fractions
are then inserted into an expression vector, the phage lambda
derivative gt 11 which permits the expression of foreign genes
under the control of the lac promoter, after fusion of the cDNA
with the .beta.-galactosidase gene of E. coli (Young and Davis,
1983).
Screening of the library and selection of candidates
A sample of this library in lambda gt 11 is inoculated into E. coli
strain Y1090 (Young and Davis, 1983) at a dilution representing
1.times.10.sup.5 phages per dish 90 mm in diameter.
The induction of the expression of the protein under the control of
the lac promoter is triggered at 42.degree. C. in the presence of
isopropyl-.beta.-D-thiogalactopyranoside.
The synthesized proteins are adsorbed onto nitrocellulose filters
and incubated in the presence of rabbit antibody specific for p28.
The bound antibodies are recognized by a second, biotin-labeled
anti-rabbit antibody; this complex is then visualized by means of a
streptavidin-peroxidase reaction followed by staining with HRP
(Bio-Rad).
This detection with antibody enables the recombinant phages to be
identified in which the cDNA insert directs the synthesis of a
protein or protein fraction carrying the epitopes recognized by the
specific anti-p28 antibodies.
A first selection leads to 3 independent isolates, lambda TG06,
lambda TG08 and lambda TG09, which contain cDNA inserts of 650, 700
and 350 base pairs, respectively.
The nucleotide sequences of the inserts carried by these candidates
overlap and include a region which might correspond to the
C-terminal region of a hypothetical protein having a molecular
weight of 28 kd. A .sup.32 P-labeled synthetic nucleotide
5'-GGAATAGTTGGTTTGATT-3' complementary to the 5' end of the coding
region of the insert of lambda TG06 was synthesized and used to
perform a fresh screening of the cDNA library in lambda gt 10.
In this manner, two new candidates were able to be isolated, lambda
TG10 and lambda TG11, both of which contain a complete nucleotide
sequence coding for a protein of 211 amino acids and corresponding
to a MW of 28 kd.
Determination of the cDNA sequence carried by the recombinant
phages and that of the corresponding protein
The complete cDNA sequence (confirmed by determining the sequence
for different candidates) and the primary amino acid structure
resulting therefrom are shown in FIGS. 1a-1c.
This result and the work which is at present published provide no
information about the N-terminal sequence of the initial product of
translation of the native gene, nor about the possible existence of
a precursor and a signal peptide preceding the mature protein.
Nevertheless, the exact localization of the first amino acid is not
essential in the context of the invention, since the strategy
adopted for the isolation of this gene and for its expression
comprises the search for major epitopes which are present in the
p28 and which are recognized by the host's immune system.
This reasoning will be used in the examples that follow, which
describe the expression of the major epitopes in different
organisms.
Expression of the p28 antigen
The general strategy developed for the expression of the antigenic
epitopes present in the p28 was to fuse the cloned cDNA fragment in
the correct reading-frame to a nucleotide sequence coding for the
N-terminal region of an efficiently expressed and well
characterized protein. The hybrid protein thereby obtained will
generally be recognized by the antibodies raised against the native
mature p28, and can be expected to induce an immune response
against the parasite. With this working hypothesis, different host
systems were used for analyzing the immunogenic properties of the
fusion proteins, both in vivo and in vitro, and they will be
developed in the examples which follow.
EXAMPLE 2
EXPRESSION IN E. COLI
To obtain the expression of a p28 antigen in E. coli, a derivative
of the expression plasmid pTG908, described in patent application
83/00,909, was used for synthesizing a fusion protein whose
structure is shown in FIGS. 3a and 3b.
The vector pTG908 contains an origin of replication, the P.sub.L
promoter of bacteriophage lambda and the cII ribosome binding
sequence including the N-terminal end of the cII gene with suitable
restriction sites downstream from the translation initiation
signal. The BamHI site 39 bp downstream from the ATG codon was used
for inserting an EcoRI site by means of a double-stranded adapter
comprising the following oligomers: ##STR1##
The resulting plasmid, pTG1924, contains a single EcoRI site with
the GAA codon in phase with the initiation codon of the cII gene.
All the cDNA inserts originating from the lambda gt11 recombinants
which gave a positive signal after selection with the anti-p28
serum were inserted directly into this site. When the insert is
present in the correct orientation, this gives a nucleotide
sequence coding for the N-terminal end of the cII gene and
continuing in phase with the cDNA sequence coding for the p28
antigen, or for a portion of the latter.
One of the resulting plasmid constructions, pTG44, containing the
insertion into this EcoRI site of the fragment derived from lambda
TG06, is shown in FIG. 2. The sequence of the cII/p28 fusion
protein, with a calculated molecular weight of 25 kd, is given in
FIGS. 3a and 3b.
A culture of E. coli N4830 transformed with pTG44 is grown on LB
medium to an OD.sub.600 of 0.2, and the synthesis thesis of the
fusion protein is then induced by raising the temperature to
42.degree. C. for the following 8 hours.
On completion of the culturing, the cell extracts were analyzed on
SDS-acrylamide gel by staining with Coomassie blue (FIG. 4). The
cII/p28 fusion product is recovered in the insoluble fraction
obtained after lysis of the cells by sonication. The protein is
recovered with a purity of the order of 80% by extracting the
insoluble fraction in the presence of 0.2% SDS. Analysis of the
final preparation by "Western blotting" shows that this particular
protein is efficiently recognized by the rabbit antibodies raised
against the native p28 antigen (FIG. 5).
EXAMPLE 3
EXPRESSION IN YEAST S. CEREVISIAE
Two types of constructions were carried out to express the p28 cDNA
in yeast: the first leads to a fusion protein comprising, on the
N-terminal side, the first 22 amino acids of yeast phosphoglycerate
kinase (PGK); the second gives a protein resembling the natural
mature protein.
CONSTRUCTION OF A VECTOR CARRYING A FUSION OF GENES CODING FOR PGK
AND p28 (pTG1886)
1) The EcoRI insert of lambda TG10 containing the cDNA of the p28
protein was introduced into a coli/yeast shuttle plasmid,
pTG836.
This plasmid is a derivative of pBR322 which contains the origin of
replication of the 2-micron plasmid of yeast, th e URA 3 gene
(patent 84/12,598) and the yeast PGK gene (Hitzemann et al.
1982).
A single EcoRI site was introduced between the BamHI site (situated
20 codons downstream from the PGK initiation codon) and the SalI
site (present in the pBR322 sequence) by inserting a synthetic
adapter: ##STR2## the resulting plasmid being pTG1880. The
insertion of the EcoRI fragment of lambda TG10 in the EcoRI site of
pTG1880, in the correct orientation, gives pTG1883.
2) The PGK/p28 expression block carried by this plasmid will be
recovered and inserted in an expression vector for yeast, pTG848
(French patent 85/06,672). This requires an intermediate
manipulation in phage M13:
A HindIII-BglII fragment containing the PGK/p28 expression block is
inserted in M13TG131 (Kieny et al. 1983) between the HindIII and
BamHI sites, to give M13TG1884.
As a result of the existence of neighboring restriction sites, this
construction enables the same expression block to be recovered in
the form of an SmaI-BglII fragment.
This fragment is then introduced between the SmaI and BglII sites
of the expression vector pTG848.
The resulting plasmid is pTG1886.
3) Yeast TGY1sp4 was transformed with this plasmid pTG1886.
Crude cell extracts of these cultures were analyzed by
electrophoresis on SDS--acrylamide gel and by the "Western blot"
technique. FIGS. 5 and 6 show clearly the appearance of a new
protein band having an MW of 30 kd, as expect ed for the PGK/p28
fusion protein, and which is recognized by the antibodies raised
against the native p28 extracted from the schistosomes.
CONSTRUCTION OF AN EXPRESSION VECTOR CARRYING ONLY THE p28 cDNA,
UNDER THE CONTROL OF THE PGK PROMOTER
1) In the M13TG1884 construction described above, the initiation
codon for the p28 protein is preceded by the first 22 codons of the
PGK gene and by 8 codons due to the cloning technique (especially
dC residues). These 90 additional base pairs were deleted by in
vitro mutagenesis of the single-stranded M13TG1884 in the presence
of the oligonucleotide: ##STR3## which corresponds to the first 16
nucleotides of the PGK mRNA leader sequence followed by the
nucleotides of the beginning of the p28 coding sequence; between
these two sequences, there is the ATG which coincides with both the
initiation ATG of the PGK and that of p28.
2) The correctly deleted derivative M13TG1884m was digested with
SmaI and BlgII and the fragment carrying the non-fused p28 cDNA,
placed under the control of the PGK promoter, was inserted in the
expression vector pTG848 (as described above) to give pTG1885.
3) The yeast TGY1sp4 was transformed with this plasmid pTG1885.
Crude cell extracts of these cultures were analyzed by
electrophoresis on SDS-acrylamide gel and by the "Western blot"
technique. FIGS. 5 and 6 show clearly the appearance of a new
protein band having an MW of 28 kd, and which is recognized by the
antibodies raised against the native p28 extracted from the
schistosomes.
EXAMPLE 4
EXPRESSION IN RECOMBINANT VACCINIA VIRUSES
a) Construction of a recombinant vaccinia virus which expresses a
p28 fused to the first amino acids of IL-2.
The cDNAs carried by the phages lambda TG06 and TG09 were
introduced into suitable vectors so that they could subsequently be
inserted into the genome of vaccinia virus, and thereby be
expressed in mammalian cells.
The vectors according to the present invention are derived from the
vectors which were employed for the expression of human
interleukin-2 (see French Patent No. 85/09,480). A derivative of
pTG188 was thus constructed which contains an EcoRI site in a
region of the nucleotide sequence which corresponds to 9 amino
acids downstream from the N-terminal alanine residue of native
interleukin-2 (FIG. 7). The lambda TG06 and lambda TG09 cDNA
inserts were inserted in the correct orientation between the EcoRI
sites of pTG188-I, to give plasmids pTG45 and pTG46 which code for
an IL-2/p28 fusion protein having a molecular weight of 24 kd and
16 kd, respectively, (FIG. 8), as shown in FIGS. 9a and 9b, FIGS.
10a and 10b. The Presence of a signal peptide upstream from the
construction permits the secretion of the protein into the culture
medium.
The major portions of plasmids pTG45 and pTG46 contain the TK viral
gene interrupted by the sequence coding for the IL-2/p28 fusion
protein, this sequence being placed under the control of an
efficient promoter, that for the 7.5K vaccinia protein.
These sequences inserted into the TK gene of vaccinia can be
transferred into the genome of vaccinia virus by a double
reciprocal recombination (FIG. 11), as described previously
(Panicalii and Paoletti, 1982; Mackett et al., 1982; Kieny et al.,
1984).
The recombinant viruses VV.TG.p28Sm-1 and VV.TG.p28Sm-2 containing
the cDNAs derived from lambda TG06 and lambda TG09, respectively,
are used for infecting a monolayer of BHK21 cells. After 24 hours
at 37.degree. C., the culture supernatant is tested to determine
the presence of the IL-2/p28 fusion protein, this being performed
by adsorption onto a nitrocellulose filter and incubation with rat
or rabbit antibodies specific for the native p28.
The detection of the bound antibodies is performed by incubation
with a biotin-coupled antiserum raised against rat or rabbit whole
immunoglobulins; this complex is then visualized by means of a
streptavidin-peroxidase reaction and final staining in the presence
of an HRP staining reagent (Bio-Rad).
For both V V.TG.p28Sm-1 and VV.TG.p28Sm-2, specific antigens (more
than 100 ng/ml) can be detected (FIG. 12) in the culture medium,
this being the case for different independent recombinants, whereas
the supernatants of cells infected only with the wild-type virus do
not give a significant signal.
b) Construction of a recombinant vaccinia virus which expresses a
p28 fused to the signal peptide of the rabies glycoprote in
(VV.TG.1184).
Construction of the bacteriophage M13TG177
The bacteriophage M13TG169 (French patent 86/05,043) contains the
coding sequence of the env gene of the HIV-I virus, flanked at the
5' end by the sequence coding for the signal peptide of the rabies
glycoprotein and at the 3' end by the sequence coding for the
transmembrane region and the intracytoplasmid region of the rabies
glycoprotein.
An EcoRI site was introduced between the KpnI and HindIII sites of
M13TG169 to generate M13TG176, having the following structure:
##STR4## S: signal of the rabies gp TM: transmembrane region of the
rabies gp
The EcoRI site situated downstream from the peptide signal was then
eliminated by localized mutagenesis using the following
oligonucleotide:
5' GGGGAAATCGTAATC 3'
The resulting bacteriophage M13TG177 hence possesses a single EcoRI
site.
Construction of the bacteriophage M13TG1105
The EcoRI restriction fragment of .lambda. TG10 containing the
coding sequence for the p28 is introduced into M13TG177 to generate
M13TG1105, having the following structure: ##STR5## Construction of
the bacteriophage M13TG1108
The first two amino acids following the peptide signal S are fused
in phase with the coding sequence for the p28 by localized
mutagenesis with the following oligonucleotid
5'CTTGATATGCTCGC CAGCAATAGGGAATTTCCCAAA 3'
The resulting bacteriophage is referred as M13TG1108.
Construction of plasmid pTG1184
The bacteriophage M13TG1108 is partially digested with PstI in
order to isolate the fragment containing the whole of the sequence
coding for the p28, and inserted at the PstI site of plasmid
pTG186POLY to generate pTG1184.
c) Construction of a recombinant vaccinia virus which expresses a
p28 fused to the signal peptide and to the transmembrane region of
the rabies glycoprotein (VV.TG.1185)
Construction of the bacteriophage M13TG1109
In the bacteriophage M13TG1108, the Last amino acid before the
translation termination codon is fused in phase with the first
amino acid of the transmembrane region TM by virtue of the
following oligonucleotide:
The resulting bacteriophage is referred to as M13TG1109.
Construction of plasmid pTG1185
As for the construction of pTG1184, the bacteriophage M13TG1109 is
subjected to partial digestion with PstI and the fragment
containing the whole of the sequence coding for the p28 is inserted
at the PstI site of pTG186POLY to generate pTG1185.
d) Characterization of the viruses VV.TG.1184 and 1185
Plasmids pTG1184 and 1185 are used for transferring the gene coding
for the p28 into the genome of vaccinia virus as described
above.
The virus VV.TG.1184 expresses the p28 fused to the signal peptide
of the rabies glycoprotein.
The virus VV.TG.1185 expresses the p28 fused to the signal peptide
and to the transmembrane region of the rabies glycoprotein.
BHK21 cells are infected with VV.TG.1184 or 1185 viruses (0.2
puf/cell) for 16 hours. After addition of [.sup.35 S]methionine for
4 h, the labeled proteins are immunoprecipitated using a rabbit
antibody directed against the p28. In the case of the virus
VV.TG.1184, a band corresponding to a molecular weight of 28 kd is
demonstrated. This protein is also present in abundance in the
culture supernatant, showing that the protein is secreted.
In the case of the virus VV.TG.1185, a band corresponding to a
molecular weight of 35 kd is demonstrated. This protein is absent
from the culture supernatants, demonstrating that it is retained in
the cell membrane by the transmembrane region of the rabies
glycoprotein.
EXAMPLE 5
VACCINATION OF ANIMALS WITH THE p28 ANTIGEN PRODUCED BY GENETIC
MANIPULATION
The biological effect of the recombinant proteins containing one or
more major-epitopes of native p28 was analyzed in comparison with
the response observed after immunization of rats with the mature
native p28 isolated from total extracts of adult parasites. The
fusion proteins produced both by microorganisms such as E. coli or
S. cerevisiae or by recombinant vaccinia virus may be a used for
such an approach, but only the results obtained with the cII/p28
fusion protein are detailed below.
IMMUNIZATION OF RATS
20 3-month-old "Fischer" male rats are immunized by intraperitoneal
injection with 50 .mu.g of a cII/p28 fusion protein (Example 2) in
the presence of Freund's adjuvant, The animals receive a second
dose after 2 weeks and the antisera are drawn starting on day
8.
4 pools of sera each comprising 5 samples are assayed in triplicate
to test for the presence of antibodies which recognize the native
p28 protein and the cytotoxicity of the sera with respect to
schistosomula.
DETECTION OF SPECIFIC ANTIBODIES
The sera of rats immunized with the cII/p28 protein extracted from
E. coli are assayed in a "Western blot" test for their reaction
against the p28 of a whole extract of adult parasites, the p28
being separated by electrophoresis on SDS-polyacrylamide gel. FIG.
13 shows unambiguous recognition of the native p28 protein by these
sera.
The maximal intensity of this response is attained on day 23 and is
virtually equal to that observed with the sera of animals immunized
with the native antigen.
ASSESSMENT OF THE EOSINOPHIL-DEPENDENT CYTOTOXICITY
The same sera were assessed in a test of eosinophil-dependent
cytotoxicity according to the technique described by Capron et al.
(1981):
50 schistosomula of S. mansoni are incubated in the presence of
each test serum (unheated), or of appropriate controls, and in the
presence of eosinophils (Lou rat non-adherent peritoneal cells
containing from 40% to 70% of eosinophils). The reaction mixture
comprises 6000 effector cells for 1 schistosomulum, in a total
volume of 200 .mu.l. After 48 hours' incubation at 37.degree. C.,
the percentage mortality of the schistosomula is assessed by
microscopic examination.
The results shown in Table I show clearly the presence of a
cytotoxic factor capable of inducing a high level of mortality of
the schistosomula, the level being very close to that induced by a
serum of a rat infected with S. mansoni.
DEMONSTRATION OF THE ROLE OF SPECIFIC IgE's IN THE CYTOTOXICITY
REACTION
The same cytotoxicity test was performed with heated serum (2 hours
at 56.degree. C.) and with heated serum to which complement was
added. The results shown in Table II show that the factor
responsible for the cytotoxicity is temperature-sensitive and that
this loss in activity cannot be compensated by adding
complement.
In addition, it is possible to remove the IgE's selectively from
the test sera by adsorption with a goat antiserum specific for rat
IgE's, coupled to Sepharose B. The sera treated in this manner and
then dialyzed are tested for their eosinophil-dependent cytotoxic
activity.
Table III shows that the selective depletion of the rat sera in
respect of IgE prevents the expression of the cytotoxicity. The
latter is hence very specific to the IgE's of the sera of rats
immunized with the cII/p28 protein.
DEMONSTRATION OF THE PROTECTION OF ANIMALS AGAINST A TEST INJECTION
WITH CERCARIAE
Fischer rats were injected (as described above) with the p28
antigen produced in E. coli or in yeast, in the presence of
aluminum hydroxide, or with which expresses the p28 antigen,
VV.TG.1185 (5.times.10.sup.7 pfu of recombinant virus per animal).
The control animals are injected with aluminum hydroxide alone.
Six weeks after the immunization, the animals are infected
subcutaneously with 1,000 cercariae (infectious larval state of the
schistosome).
21 days after the test inoculation, the rats are sacrificed and
their content of adult parasites is assessed. The latter are
harvested by perfusion of the hepatic portal vein with
physiological saline and then counted.
A reduction is observed in the parasite content compared with the
controls, equivalent to:
64.+-.4% with the antigen produced in E. coli
70.+-.10% with the antigen produced in yeast
60.+-.8% with the antigen produced by vaccinia.
TABLE I ______________________________________ Test of
eosinophil-dependent cytotoxicity Study of the sera of rats
immunized with the cII/p28 protein produced in E. coli. Source
Final % cytotoxicity of dilution of after 48 antibody the serum
hours' incubation ______________________________________ Serum of
rat immunized with cII/p28, harvested on day D8 1/16 60.5 .+-. 2.5
1/32 55.5 .+-. 5 1/64 6.5 .+-. 6.5 D10 1/16 85.5 .+-. 0.5 1/32 76
.+-. 3.5 1/64 57 .+-. 4.7 D16 1/16 85.5 .+-. 0.5 1/32 78 .+-. 6
1/64 52 .+-. 3 D23 1/16 88 .+-. 3.5 1/32 92 .+-. 0 1/64 52 .+-.
11.5 Serum of rat infected 1/16 97 .+-. 1 with S. mansoni Serum of
healthy rat 1/16 0 ______________________________________
TABLE II ______________________________________
Eosinophil-dependent cytotoxicity Study of the participation of
complement Serum of rat immunized with the cII/p28 protein produced
% cytotoxicity by E. coli (final dilution: after 48 hours' 1/16) 16
days after immunization incubation
______________________________________ Unheated serum 85.5 .+-. 0.5
Heated serum 26.5 .+-. 5.5 Heated serum + 38.5 .+-. 0.5 guineapig
complement Heated serum + 21.5 .+-. 1.5 heated guineapig complement
______________________________________
TABLE III ______________________________________
Eosinophil-dependent cytotoxicity Study of the participation of
antibodies of IgE isotype Source % ctyotoxicity of after 48 hours'
antibodies incubation ______________________________________ Serum
of rat immunized with cII/p28 produced in E. coli, harvested on day
D16 48.5 D23 40 Serum of healthy rat 0 Anti-IgE column effluent D16
0 D23 0 Serum of healthy rat 0
______________________________________
EXAMPLE 6
The glutathione S-transferase activity was demonstrated in the
extracts of E. coli TGE901/pTG54 and S. cerevisiae TGY2s
p13b/pTG2800 which express the p28I protein of Schistosoma mansoni
(pTG2800 differs from pTG1894 described in Example 3 only in
respect of a deletion of 170 bp in the ura3 gene promoter
region).
The cultures are centrifuged and the pellets resuspended in buffer
(100 mM Tris-HCl pH 7.5, 1 mM DTT). The yeast is ground with glass
beads; the bacteria are treated with ultrasound. The extracts are
centrifuged to remove the cell debris and the activity is measured
in the supernatant (according to the techniques published by Moore
et al. 1986 and Habig et al. 1974). From 40 to 100 .mu.l of crude
extract, 10 .mu.l of 100 mM CDNB reagent
(1-chloro-2,4-dinitrobenzene dissolved in 100% ethanol) and 1 ml of
100 mM KH.sub.2 PO.sub.4 (P H 6.5)/2.5 mM reduced glutathione are
mixed in a spectrophotometer cell.
As a positive control, rat glutathione S-transferase (provided by
Sigma) was used at a final concentration of 9 .mu.g and 6 .mu.g per
test.
As negative controls, an extract of E. coli TGE901/pTG959 carrying
a vector without a p28 sequence and an extract of S. cerevisiae
TGY2sp13b and TGY2sp13b/pTG848 carrying a vector without a p28
sequence were used.
All the extracts of bacteria and yeast are adjusted to a total
protein concentration of 0.33 mg/ml.
A yellow color appears in the cells where there is glutathione
transferase activity. The change in OD is measured in the
spectrophotometer at 340 nm every minute for 15 minutes.
The results shown in FIG. 15 show that the extracts of E. coli and
S. cerevisiae which contain the recombinant p28 protein show strong
glutathione S-transferase activity.
EXAMPLE 7
SCREENING OF THE LIBRARY AND SELECTION OF THE .lambda.TG07
CANDIDATE
Screening of the cDNA library in .lambda. gt11, described in
Example 1, enabled several types of candidates to be
visualized.
By immunodetection with a rat polyclonal antibody (induced by
injecting the p28 purified from schistosomes), a new candidate,
.lambda. TG07, was selected which is not recognized by the
synthetic probes which were used for selecting the candidates
.lambda. TG10 and .lambda. TG11 described in Example 1, and whose
sequence is hence different. Since the protein is recognized by the
same anti-p28 antibodies, this new protein will be referred to as
p28II, (and that which had been identified previously will be
referred to as p28I).
EXAMPLE 8
DETERMINATION OF THE cDNA SEQUENCE CARRIED BY THE PHAGE
.lambda.TG07
Various restriction fragments of the cDNA were recloned in M13 and
sequenced.
The complete cDNA sequence and the primary amino acid structure
which can be deduced therefrom (in the 3 reading-frames) are shown
in FIGS. 16a-16c.
EXAMPLE 9
CREATION OF A BamHI SITE AT THE BEGINNING OF THE cDNA SEQUENCE
To facilitate the insertion of the cDNA into a suitable expression
vector, a BamHI site was created at the beginning of the coding
sequence by directed mutagenesis.
The mutagenesis was performed on the DNA cloned into M13 with the
following synthetic oligomer, which is a 21-mer complementary to
nucleotides 18 to 38 of the sequence shown in FIG. 1a, with the
exception of the nucleotides to be mutated: ##STR6##
The cDNA sequence can hence be recovered in the form of a BamHI
fragment, a second BamHi site being present in the M13 polylinker,
downstream from the coding sequence.
EXAMPLE 10
EXPRESSION OF THE p28II PROTEIN IN E. COLI
The cDNA sequence coding for p28II was recovered in the form of a
BamHI fragment and introduced into the expression vector pTG908, in
the BamHI site.
The structure of the recombinant obtained is identical to that
shown schematically in FIG. 2.
This vector contains an origin of replication, the P.sub.L promoter
of phage lambda and the cII ribosome binding sequence including the
N-terminal end of the cII gene, with a BamHI restriction site 39 bp
downstream from the translation initiation site.
The p28II cDNA insert is hence present in phase with the N-terminal
end of the clI gene.
A recombinant plasmid carrying the insert in the correct
orientation was selected, pTG56, and the construction was checked
by sequencing.
An E. coli TGE901 culture transformed by this plasmid is cultured
on LB medium to an OD.sub.600 of 0.2; the synthesis of the
cII/p28II protein is then induced by increasing the temperature to
42.degree. C. for the following 8 hours.
On completion of culturing, the cell extracts are recovered after
treatment with ultrasound, and analyzed after electrophoresis on
SDS-acrylamide gel and staining with Coomassie blue (FIG. 17).
A band of apparent molecular mass 28K is distinctly visible in the
TGE901/pTG56 extracts (FIG. 17: bands A, B, C, D).
Analysis by "Western blotting" of a purified preparation of this
protein extracted from E. coli shows that it is recognized by the
rat antibodies directed against the native p28 purified from the
schistosomes.
Possible glutathione S-transferase enzyme activity was tested for,
but the test is negative. This negative result was expected, given
the absence of homology between the sequences of the 2 p28
proteins.
EXAMPLE 11
VACCINATION OF RATS WITH THE p28II ANTIGEN PRODUCED BY E. COLI
The rats are immunized according to the protocol described in
Example 5, and their sera are assessed in an eosinophil-dependent
cytotoxicity test.
The results shown in Table IV show that the cytotoxic capacity of
these sera is comparable to that of rats immunized with the first
antigen p28I or with the native p28.
TABLE IV ______________________________________ Test of
eosinophil-dependent cytotoxicity: study of the sera of rats
immunized with the native p28 protein, and cII/p28 and cII/p28II
produced in E. coli (dilution of the serum 1/16). Rats %
cytotoxicity of the serum immunized harvested on day with: 7 14 21
______________________________________ Native p28 52.5% 29% 73%
cII/p28I-coli 24.5% 20% 59.5% cII/p28II-coli 55% 68% 61.5% Adjuvant
alone 30% (BSA + Pertusis) Uninjected rats 0% Rats infected with
89.5% S. mansoni ______________________________________
The antibodies of rats immunized with the p28II protein produced in
E. coli do not recognize the p28I protein. Similarly, the
antibodies of rats immunized with the p28I protein produced in E.
coli do not recognize the p28II protein. However, both types of
antibodies recognize the native p28 preparation purified from the
schistosomes, and the antibodies raised against the native p28
recognize both recombinant proteins.
This result is explained by a heterogeneity of the preparation of
native p28 purified from schistosomes. Careful observation of the
immunoprecipitation after 2-dimensional migration on gel of the
native p28 protein or that translated in vitro on the mRNAs of
schistosomes reveals the existence of a minor band which represents
the splitting of the 28K band [Figure published by J. M. Balloul,
R. J. Pierce, J. M. Grzych and A. Capron, Mol. Biochem.
Parasit-ology 17 (1985) 105-114]. This minor band must correspond
to p28II.
Deposition of strains
The following strains were deposited with the Collection Nationale
de Culture de Microorganismes (National Collection of Microorganism
Cultures), 28 rue du Docteur Roux--75724 Paris:
The E. coli strain N 4830, mentioned in Example 2, transformed with
plasmid pTG44 was deposited on 6th Jun. 1986 under no. I 562.
The strain TGE901/pTG56 was deposited with the Collection Nationale
de Culture de Microorganismes (National Collection of Microorganism
Cultures), 25 rue du Docteur Roux, 75724 Paris, on 3rd Apr. 1987,
under no. I.656.
BIBLIOGRAPHY
Capron, A. and Dessaint, J. P. (1985) Ann. Rev. Immunol. 3,
455-476
Balloul, J. M., Pierce, R. J./Grzych, J. M. and Capron, A. (1985)
Mol. Biochem. Parasitol. 17, 105-114
Balloul, J. M., Grzych, J. M., Pierce, R. J. and Capron, A. (1986)
submitted for publication
Young, R. A. and Davis, R. W. (1983) Science 222, 778-782
Huynh, T. V. in DNA Cloning Techniques: A Practical Approach
(Glover, D., Ed.) IRL Press, Oxford (1984)
Le Bouc, Y., Dreyer, D., Jaeger, F., Binoux, M. and Sondermeyer, P.
(1986) FEBS Lett. 196, 108-112
Lathe, R. and Lecocq, J-P. (1977) Virology 83, 204-206
Hitzemann, R. A., Hagie, F. E., Hayflick, J. S., Chen, C. Y.,
Seeburg, P. H. and Derynck, R. (1982) Nucleic Ac. Res. 10,
7791-7808
Kieny, M. P., Lathe, R. and Lecocq, J-P. (1983) Gene 26, 91-99
Smith, G. L., Mackett, M. and Moss, B. (1983) Nature 302,
490-495
Panicalii, D. and Paoletti, E. (1982) Proc. Natl. Acad. Sci. USA
79, 4927-4931
Mackett, M., Smith, J. L. and Moss, B. (1982) Proc. Natl. Acad.
Sci. USA 79, 7415-7419
Kieny, M. P., Lathe, R., Drillien, R., Spehner, D., Skory, S.,
Schmitt, D., Wiktor, T., Koprowski, H. and Lecocq, J-P. (1984)
Nature 312, 163-166
Capron, M., Bazin, H., Torpier, G., Joseph, M. and Capron, A.
(1981) J. Immunol. 126, 1764-1768
Habig, W. H., Pabst, M. J. and Jakoby, W. B. J. Biol. Chem. 249,
7130 (1974)
Moore, R. E., Davies, M. S., O'Connell, K. M., Harding, E. I.,
Wiegand, R. C. and Tiemeier, D. C. Nucl. Ac. Res. 14, 7227
(1986)
Smith, D. B., Davern, R. M., Board, P. G., Tiu, W. U., Garcia, E.
G. and Mitchell, G. F. Proc. Natl. Acad. Sci. USA 83, 8703
(1986)
* * * * *