U.S. patent number 5,530,114 [Application Number 07/847,055] was granted by the patent office on 1996-06-25 for oligonucleotide modulation of arachidonic acid metabolism.
This patent grant is currently assigned to Isis Pharmaceuticals, Inc.. Invention is credited to Clarence F. Bennett, Stanley T. Crooke, David J. Ecker, Christopher K. Mirabelli.
United States Patent |
5,530,114 |
Bennett , et al. |
June 25, 1996 |
Oligonucleotide modulation of arachidonic acid metabolism
Abstract
Compositions and methods are provided for the treatment and
diagnosis of diseases amenable to modulation of the synthesis or
metabolism of arachidonic acid and related compounds. In accordance
with preferred embodiments, oligonucleotides and oligonucleotide
analogs are provided which are specifically hybridizable with
nucleic acids encoding 5-lipoxygenase, 5-lipoxygenase activating
proteins, LTA.sub.4 hydrolase, phospholipase A.sub.2, phospholipase
C, and coenzyme A-independent transacylase. The oligonucleotide
comprises nucleotide units sufficient in identity and number to
effect said specific hybridization. In other preferred embodiments,
the oligonucleotides are specifically hybridizable with a
transcription initiation site, a translation initiation site, and
intron/exon junction. Methods of treating animals suffering from
disease amenable to therapeutic intervention by modulating
arachidonic acid synthesis or metabolism with an oligonucleotide or
oligonucleotide analog specifically hybridizable with RNA or DNA
corresponding to one of the foregoing proteins are disclosed.
Methods for treatment of diseases responding to modulation of
arachidonic acid synthesis or metabolism are disclosed.
Inventors: |
Bennett; Clarence F. (Carlsbad,
CA), Ecker; David J. (Carlsbad, CA), Crooke; Stanley
T. (Carlsbad, CA), Mirabelli; Christopher K. (Encinitas,
CA) |
Assignee: |
Isis Pharmaceuticals, Inc.
(Carlsbad, CA)
|
Family
ID: |
24057818 |
Appl.
No.: |
07/847,055 |
Filed: |
April 3, 1992 |
PCT
Filed: |
April 17, 1991 |
PCT No.: |
PCT/US91/02628 |
371
Date: |
April 03, 1992 |
102(e)
Date: |
April 03, 1992 |
PCT
Pub. No.: |
WO91/16901 |
PCT
Pub. Date: |
November 14, 1991 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
516969 |
Apr 30, 1990 |
|
|
|
|
Current U.S.
Class: |
536/24.3;
536/24.1; 435/6.16 |
Current CPC
Class: |
C12Q
1/6839 (20130101); C12Y 303/02006 (20130101); G01N
33/88 (20130101); C12Q 1/6883 (20130101); A61P
43/00 (20180101); C12Y 301/01004 (20130101); C12N
9/0006 (20130101); C12Y 113/11012 (20130101); C12N
15/1137 (20130101); C12Y 301/04003 (20130101); C12Q
1/68 (20130101); C12N 2310/15 (20130101); C12Q
2600/158 (20130101); C12N 2310/315 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12N 15/11 (20060101); C12N
9/04 (20060101); G01N 33/88 (20060101); C07H
021/04 (); A61K 048/00 (); C12Q 001/68 () |
Field of
Search: |
;536/24.31,24.1 ;514/44
;435/6 |
Other References
Uhlmann et al. (Jun. 1990) Chemical Reviews 90:544-584. .
Hoshiko et al. (Dec. 1990) P.N.A.S. 87:9073-9077. .
Rather, M. (Mar. 1989) Bio/Technology, 7:207. .
Stein et al. (20 Aug. 1993) Science 261:1004-1021. .
Chubb et al. (Apr. 1992) TibTech 10:132-136. .
Aiyar et al., Solubilization of rat liver vasopressin receptors as
a complex with a guanine-nucleotide-binding protien and
phosphoinoside-specific phospholipase C, Biochem. J., 261:63-70,
1989. .
Archer et al., Accumulation of inflammatory cells in respone to
intracutaneous platelet activating factor (Paf-acether) in man, Br.
J. Dermatol., 112:285-290, 1985. .
Balcarek et al., Isolation and characterization of a cDNA clone
encoding rat 5-lipoxygenase, J. Biol. Chem., 263:13937-13941, 1988.
.
Barst and Mullane, The Release of a leukotriene D.sub.4 -like
substance following myocardial infarction in rabbits, Eur. J.
Pharmacol., 114:383-387, 1985. .
Bell et al., Diglyceride lipase: A pathway for arachidontae release
from human platelets, Proc. Natl. Acad. Sci. U.S.A., 76:3238-3241.
.
Bennett et al., Differential effects of manoalide on secreted and
intracellular phospholipases, Biochem. Pharm., 36:733-740, 1987.
.
Bennett and Crooke, Purification and characterization of a
phosphoinositide-specific phospholipase C from guinea pig uterus,
J. Biol. Chem., 262:18789-13797, 1987. .
Berridge et al., Changes in levels of inositol phosphates after
agonist-dependent hydrolysis of membrane phosphoinositides,
Biochem. J., 212:473-482, 1983. .
Berridge, Inositol Trisphosphate and Diacylglycerol: Two
interacting second messangers, Ann. Rev. Biochem., 56:159-193,
1987. .
Black, Leukotriene C.sub.4 Induces Vasogenic Cerebral Edema in
Rats, Prostaglandins Leukotriene Med., 14:339-340, 1984. .
Bonaa et al., Effect of Eicosapentaenoic and Docosahexaenoic Acids
on Blood Pressure in Hypertension, New Eng. J. Med., 322:795-801,
1990. .
Braquet et al., The Promise of Platelet-Activating Factor, ISI
Atlas of Science: Pharmacology, 187-198, 1987. .
Burke et al., Leukotrienes C.sub.4, D.sub.4 and E.sub.4 : Effects
on Human and Guinea-Pig Crdiac Preparation in vitro, J. Pharmacol.
Exper. Therap., 221:235-241, 1982. .
Camp et al., Responses of human skin to intradermal injection of
leukotrienes C.sub.4, D.sub.4 and B.sub.4 ; Br. J. Pharmacol.,
80:497-502, 1983. .
Chilton and Connell, 1-Ether-linked Phosphoglycerides, J. Biol.
Chem., 263:5260-5265, 1988. .
Crooke and Bennett, Mammalian phosphoinositide-specific
phospholipase C isoenzymes, Cell Calcium, 10:309-323, 1989. .
Crunkhorn and Willis, Cutaneous reactions to intradermal
prostaglandins, Br. J. Pharmacol., 41:49-56, 1971. .
Cuss et al., Effects of inhaled platelet activating factor on
pulmonary function and bronchial responsiveness in man, Lancet,
2:189, 1986. .
Dahlen et al., Allergen challenge of lung tissue from asthmatics
elicits bronchial contraction that correlates with the release of
leukotrienes C.sub.4, D.sub.4 and E.sub.4, Proc. Natl. Acad. Sci.
U.S.A., 80:1712-1716, 1983. .
Dahlen et al., Leukotrienese are potent constrictors of human
bronchi, Nature, 288:484-486, 1980. .
Davidson et al., Lerukotriene B.sub.4, a mediator of inflammation
present in synovial fluid in rheumatoid arthritis, Ann. Rheum.
Dis., 42:677-679, 1983. .
Dixon et al., Cloning of the cDNA for human 5-lipoxygenase, Proc.
Natl. Acad. Sci. USA, 85:416-420, 1988. .
Dixon et al., Requirement of a 5-lipoxygenase-activating protein
for leukotriene synthesis, Nature, 343:282-284, 1990. .
Emori et al., A second type of rat phospholinositide-specific
phospholipase C containing a src-related sequence not essential for
phosphoinositide-hydrolyzing activity, J. Biol. Chem.,
264:21885-21890. .
Ford-Hutchinson, A. W., Leukotriene B.sub.4 in inflammation, Crit.
Rev. in Immunol., 10:1-12, 1989. .
Franson et al., Isolation and characterization of a phospholipase
A.sub.2 from an inflammatory exudate, J. Lipid Res., 19:18-23,
1978. .
Funk et al., Characterization of the human 5-lipoxygenase gene,
Proc. Natl. Acad. Sci. USA, 86:2587-2591, 1989. .
Funk et al., Molecular cloning and amino acid sequence of
leukotriene A.sub.4 hydrolase, Proc. Natl. Acad. Sci USA,
84:6677-6881, 1987. .
Hoffman and Majerus, Identification adn properties of two district
phosphatidylinositol-specific phospholipase C enzymes from sheep
seminal vesicular glands, J. Biol. Chem., 257:6461-6469, 1982.
.
Hogaboom et al., Purification, Characterization, and Structural
Properties of a Singel Protein from Rat Basophilic Leukemia (RBL-1)
Cells Possessing 5-Lipoxygenase and Leukotriene A.sub.4 Synthetase
Activities, Mol. Pharmacol., 30:510-519, 1986. .
Humes et al., Evidence for Two Sources of Areachidonic Acid for
Oxidative Metabolism by Mouse Peritoneal Macrophages, J. Biol.
Chem., 257:1591-1594. .
Klickstein et al., Lipoxygenation of arachidonic acid as a source
of polymorphonuclear leukocyte chemotactic factors in synovial
fluid and tissue in reheumatoid arthritis and spondyloarthritis, J.
Clin. Invest., 66:1166-1170, 1980. .
Kragballe and Herlin, Benoxaprofen Improves Psoriasis, Arch.
Dermatol., 119:548-552, 1983. .
Kramer et al., Structure and Properties of a Human Non-pancreatic
phospholipase A.sub.2, J. Biol. Chem., 264:5768-5775, 1989. .
Letts and Piper, The actions of leukotrienes C.sub.4 and D.sub.4 on
guinea-pig isolated hearts, Br. J. Pharmacol., 76:169-176, 1982.
.
Mahadevappa and Holub, Diacylglycerol Lipase Pathway in a Minor
Source of Release Arachidonic Acid in Thrombin-Stimulated Human
Platelets, Biochem. Biophys. Res. Comm., 134:1327-1333, 1986. .
Mallet et al., Platelet Activating Factor in Chronic Plaque
Psoriasis, Adv. in Prostaglandins, Thromboxanes, Leukotrienes and
Related Compounds, vol. 17B:640-642, 1987. .
Margolis et al., EGF Induces Tyrosine Phosphorylation of
Phospholipase C-11: A potential mechanism for EGF receptor
signaling, Cell, 57:1101-1107, 1989. .
Marone et al., Cardiovascular and Metabolic Effects of Peptide
Leukotrienes in Man, Biology of the Leukotrienes, ed. by R. Levi
and R. D. Krell, Ann. New York Acad. Sci. 524, pp. 321-323, New
York Academy of Sciences, New York, 1988. .
Matsumoto et al., Molecular cloning and amino acid seqeucne of
human 5-lioxygenase, Proc. Natl. Acad. Sci. USA, 85:26-30, 1988.
.
McGee and Fitzpatrick, Enzymatic Hydration of Leukotriene A.sub.4,
J. Biol. Chem., 260:12832-12837. .
Miller et al., Identification and isolation of a membrane protein
necessary for leukotriene production, Nature, 343:276-281, 1990.
.
Minami et al., Molecular cloning of a cDNA coding for huamn
leukotriene A.sub.4 hydrolase, J. Biol. Chem., 262:13873-13876,
1987. .
Mong et al., Characterization of the leukotriene D.sub.4 receptor
in guinea-pig lung, Eur. J. Pharmacol., 102:1-11, 1984. .
Ohishi et al., Leukotriene A.sub.4 hydrolase in the human lung, J.
Biol. Chem., 262:10200-10205, 1987. .
Ohta et al., Complete cDNA encoding a putative phospholipase C from
transformed human lymphocytes, FEBS Lett., 242:31-35, 1988. .
Palmer et al., Electrophysiological response of cerebellar purkinje
neurons to leukotriene D.sub.4 adn B.sub.4, J. Pharmacol. Exp.
Ther., 219:91-96, 1981. .
Pruzanski and Vadas, Secretory synovial fluid phospholipase A.sub.2
and its role in the pathogenesis of inflammation in arthritis, J.
Rheumatol., 15:1601-1603, 1988. .
Radmark et al., Leukotriene A.sub.4 hydrolase in human leukocytes,
J. Biol. Chem., 259:12339-12345, 1984. .
Rangi et al., Suppression by ingested eicosapentaenoic acid of the
increases in nasal mucosal blood flow and eosinophilia of
ryegrass-allergic reactions, J. Allergy Clin. Immunol., 85:484-489,
1990. .
Rhee et al., Studies of inositol phospholipid-specific
phospholipase C, Science, 244:546-550, 1989. .
Rosam et al., Potent ulcerogenic actions of platelet-activating
factro on the stomach, Nature, 319:54-56, 1986. .
Roth and Leffer, Studies on the mechanism of leukotriene induced
coronary artery constriction, Prostaglandins, 26:573-581, 1983.
.
Rothenberg et al., Oligonucleotides as anti-sense inhibitors of
gene expression: therapeutic implications, J. Natl. Cancer Inst.,
81:1539-1544, 1989. .
Rouzer and Samuelsson, On the nature of the 5-lipoxygenase reaction
in human leukocytes: enzyme purification and requirement for
multiple stimulatory factors, Proc. Natl. Acad. Sci. U.S.A.,
82:6040-6044, 1985. .
Rouzer et al., On the nature of the 5-lipoxygenase reaction in
human leukocytes: characterization of a membrane-associate
stimulatory factor, Proc. Natl. Acad. Sci. USA, 82:7505-7509, 1985.
.
Rouzer and Samuelsson, Reversible, calcium-dependent membrane
association of human leukocyte 5-lipoxygenase, Proc. Natl. Acad.
Sci. USA, 84:7393-7397, 1987. .
Rouzer and Kargman, translocation of 5-lipoxygenase to the membrane
in human leukocytes challenged with ionophore A23187, J. Biol.
Chem., 263:10980-10988, 1988. .
Rouzer et al., MK886, A potent and specific leukotriene
biosynthesis inhibitor blocks and reverses the membrane association
of 5-lipoxygenase in ionophore-challenged leukocytes, J. Biol.
Chem., 265:1436-1442, 1990. .
Sasaki et al., Detection of leukotriene B.sub.4 in cardiac tissues
and its role in infarct extension through leucocyte migration,
Cardiovasc. Res., 22:142-148, 1988. .
Schellenberg and Foster, Differential activity of leukotrienes upon
human pulmonary vein and artery, Prostaglandins, 27:475-482, 1984.
.
Seilhamer et al., Cloning and recombinant expression of
phospholipase A.sub.2 present in rheumatoid arthritic synovial
fluid, J. Biol. Chem., 264:5335-5338, 1989. .
Sirois et al., Pharmacological activity of leukotrienes A.sub.4,
B.sub.4, C.sub.4 and D.sub.4 on sleected guinea-pig, rat, rabbit,
and human smooth muscles, Prost. Leuk. Med., 7:327-340, 1981. .
Skerrett et al., Arachidonic Acid Metabolism, Cytokine Release, and
Antimicrobial Activity, J. Immunol., 144:1052-1061, 1990. .
Smith et al., Beneficial Effects of the Peptidoleukotriene Receptor
Antagonist, Sk&F 104353, on the responses to experimental
endotoxemia in the conscious rat. Circ. Shock, 25:21-31, 1988.
.
Sugiura et al., Transacylation of lyso platelet-activating factor
and other lysophosphilipids by macrophage microsomes, J. Biol.
Chem., 262:1199-1205, 1987. .
Terano et al., Effect of orally administered eicosapentaenoic acid
(EPA) on the formation of leukotriene B.sub.4 and leukotriene
B.sub.5 by rat leukocytes, Biochem. Pharmacol., 33:3071-3076, 1984.
.
Ueda et al., Purification of arachidonate 5-lioxygenase from
porcine leukocytes and its reactivity with
hydroperoxyeicosatetraenoic acids, J. Biol. Chem., 261:7982-7988,
1986. .
Wahl et al., Epidermal growth factor stimulates tyrosine
phosphorylation of phospholipase C-II independently of receptor
internalization and extracellular calcium, Proc. Natl. Acad. Sci.
USA, 86:1568-1572, 1989. .
Wallace et al., Evidence for platelet-activating factor as a
mediator of endotoxin-induced gastrointestinal damage in the rat,
Gastroenterology, 1987 in press. .
Wong et al., Interaction of 5-lipoxygenase with membranes: studies
on the association of soluble enzyme with membranes and alterations
in enzyme activity, Biochemistry, 27:6763-6769, 1988. .
Zon, G., Oligonucleotide analogues as potential chemotherapeutic
agents, Pharmaceutical Res., 5:539-549..
|
Primary Examiner: Jones; W. Gary
Assistant Examiner: Arthur; Lisa
Attorney, Agent or Firm: Law Offices of Jane Massey
Licata
Parent Case Text
This application is a continuation of application Ser. No.
07/516,969, filed Apr. 30, 1990, now abandoned.
Claims
What is claimed is:
1. A phosphorothioate oligonucleotide having a sequence:
5' . . . 3'
TCGGCGCGGCGGTCCAGGTGTCCGCATCTA,
ACGGTGACCGTGTAGGAGGGCATGGCGCGG,
AATGGTGAATCTCACGTGTGCCACCAGCAG,
AGGTGTCCGCATCTA,
CGGTCCAGGTGTCCGCATCT,
CATGGCGCGGGCCGCGGG,
GACCGTGTAGGAGGGCAT,
AGGCATGGCTCTGGGAAGTG,
AAGGCATGGCTCTGGGAAAGTG (SEQ ID NO. 1),
ACATGGGCTACCAGCAGCTGGGTGG (SEQ ID NO. 2),
TTGACTCTGTCACTCAAGAG (SEQ ID NO. 3), or
GCCTGCCCAGAGAGCTGCTG (SEQ ID NO. 5).
Description
FIELD OF THE INVENTION
This invention relates to therapies, diagnostics, and research
reagents for disease states which respond to modulation of the
synthesis or metabolism of arachidonic acid. In particular, this
invention relates to antisense oligonucleotide interactions with
certain messenger ribonucleic acids or DNA involved in the
synthesis of proteins regulating arachidonic acid synthesis or
metabolism. These oligonucleotides have been found to lead to the
modulation of the activity of the RNA or DNA, and thus to the
modulation of the synthesis and metabolism of arachidonic acid.
Palliation and therapeutic effect result.
BACKGROUND OF THE INVENTION
The Eicosanoids
Metabolites of arachidonic acid and related fatty acids exhibit a
wide range of biological activities affecting every organ system in
the body. There are over thirty metabolites of arachidonic acid
which exhibit biological activity. These metabolites are
collectively termed eicosanoids.
Arachidonic acid is stored in the cell esterified to membrane
lipids. Once released from membrane lipids, arachidonic acid may
either be re-esterified back into membrane lipids or metabolized
via a variety of oxidative enzymes. There are two oxidative
pathways which are of importance for therapeutic intervention; the
cyclo-oxygenase pathway which generates prostaglandins,
thromboxanes and prostacyclin, and the lipoxygenase pathway which
generates leukotrienes, lipoxins, hydroperoxyeicosatetraenoic acids
and the mono- and di-hydroxyeicosatetraenoic acids (mono- and
di-HETE's). (See FIG. 1). Although platelet activating factor (PAF)
is not a direct metabolite of arachidonic acid, it is generated
through one of the pathways which generate free arachidonic acid.
Thus, in some cases, generation of free arachidonic acid also
results in the generation of lyso-PAF, a direct precursor for
PAF.
Prostaglandins of the E series (PGE.sub.1, PGE.sub.2) are potent
vasodilators and smooth muscle relaxants. Thus, PGE.sub.2 promotes
hypotension and relaxes bronchial, tracheal and uterine smooth
muscle. Other effects of these prostaglandins include inhibition of
platelet aggregation, inhibition of mediator release from mast
cells, increased renal blood flow, diuresis, increased circulating
concentrations of ACTH, and inhibition of gastric acid secretion.
PGEs cause pain when injected intradermally and sensitize afferent
nerve endings to the effects of chemicals or mechanical
stimuli.
Prostaglandin D2, like PGE1, is an inhibitor of platelet
aggregation. PGD2 enhances the release of histamine from basophils,
promotes chemokinesis and enhances the chemotactic response of
other mediators in polymorpholeukocytes. Prostacyclin (PGI.sub.2)
is a potent vasodilatory substance and, general smooth muscle
relaxant. PGI.sub.2 is 30 to 50 times more potent than PGE2 and
PGD2 in inhibiting platelet aggregation. PGI2 inhibits gastric acid
secretion, relaxes bronchial and uterine smooth muscle, and
increases renal blood flow. Thus, PGE2, PGI2, and, to a lesser
extent PGD2, are important in maintaining normal homeostasis and
have beneficial effects in many clinical situations.
Prostaglandins of the F series, i.e., PGF2.alpha., in general
exhibit biological activity opposite to PGE on smooth muscle
tissue. PGF2.alpha. contracts bronchial and tracheal smooth muscle,
contracts both pregnant and nonpregnant uterine smooth muscle, and
contracts gastrointestinal smooth muscle. In subprimates
PGF2.alpha. is the leutolytic hormone.
Thromboxane A.sub.2 (TXA.sub.2) is a potent smooth muscle
contractile agent, contracting all smooth muscle strips tested
including vasculature, bronchial, and tracheal. TXA.sub.2 promotes
platelet aggregation and decreases renal blood flow.
In general, the peptidoleukotrienes (leukotrienes C.sub.4, D.sub.4,
and E.sub.4) are potent smooth muscle contractile agents, while
leukotriene B.sub.4 (LTB4) is a chemotactic factor for circulating
neutrophils and monocytes. LTB.sub.4 also promotes lysosomal enzyme
release and superoxide anion generation from neutrophils, both of
which cause local tissue damage (Ford-Hutchinson, A. W., Crit. Rev.
in Immunol., 10:1-12, 1989). Lipoxins have been shown to contract
guinea pig parenchymal strips, inhibit natural killer cells, and to
stimulate superoxide generation in neutrophils.
Platelet activating factor (PAF) induces platelet aggregation,
increases vascular permeability, acts as a bronchoconstrictor,
decreases renal blood flow, decreases mesenteric circulation, and
is the most potent gastric ulcerogen yet described (Rosam et al.,
Nature, 319: 54-56, 1986). PAF activates inflammatory cells
promoting neutrophil and eosinophil chemotaxis and degranulation
(Braquet et al., ISI Atlas of Science: Pharmacology, 187-198,
1987).
PATHOPHYSIOLOGY OF THE EICOSANOIDS
Respiratory System
The effects of the leukotrienes on the respiratory system have been
studied extensively because of the proposed role leukotrienes play
in immediate type hypersensitivity reactions such as asthma. High
levels of peptidoleukotrienes have been detected in nasal secretion
and lung lavage fluids in patients suffering from asthma, allergic
rhinitis, cystic fibrosis, and chronic bronchitis (Dahlen et al.,
Proc. Natl. Acad. Sci. U.S.A., 80:1712-1716, 1983). Leukotrienes C4
and D4 are potent smooth muscle contractile agents, promoting
bronchoconstriction in a variety of species, including humans
(Dahlen et al., Nature, 288:484-486, 1980). Leukotrienes C4 and D4
(LTC4 and LTD4) are about equi-potent in promoting bronchial
constriction and about 1000-fold more potent than histamine (Dahlen
et al., Nature, 288: 484-486, 1980; Sirois et al., Prost. Leuk.
Med., 7: 327-340, 1981). In general, LTC4 and LTD4 are more active
in promoting contraction of peripheral airways rather than central
airways. In guinea pig tracheal strips, LTE4 is about 10-fold less
potent than LTC4 and LTD4. The bronchoconstriction produced by LTC4
and LTD4 are due to an interaction with specific cell surface
receptors (Mong et al., Eur. J. Pharmacol., 102: 1-11, 1984). It is
still controversial whether distinct receptors exist for LTC4 and
LTD4. Leukotriene E4 appears to act as a bronchoconstrictive agent
by interactions with the LTD4 receptor. Leukotriene B4 produces
relatively weak contractions of isolated trachea and lung
parenchyma. The contractions elicited by LTB4 are blocked in part
by inhibitors of cyclo-oxygenase suggesting that the contraction
are secondary to the release of prostaglandins.
Like the peptidoleukotrienes, platelet activating factor is a
potent bronchoconstrictive agent. In addition, PAF induces an
increase in airway reactivity to other agents in humans which may
last up to 7 days following inhalation (Cuss et al., Lancet, 2:
189, 1986). The prostanoids PGF2.alpha. and TXA.sub.2 also contract
airway smooth muscle and have been implicated as contributory to
the asthmatic response.
Cardiovascular System
Leukotrienes also act as vasoconstrictors, however, marked
differences exist for different vascular beds. LTC4 and LTD4 are
potent constrictors of coronary arteries in a variety of species
(Roth and Leffer, Prostaglandins, 26: 573-581, 1983; Burke et al.,
J. Pharmacol. Exper. Therap., 221:235-241, 1982; Letts and Piper,
Br. J. Pharmacol., 76: 169-176, 1982). As in the lung, LTE4 is
about 10-fold less potent than LTC4 and LTD4, while LTB4 is without
activity. In humans, LTC4 and LTD4 are potent contractile agents
for pulmonary vein and weak contractants of pulmonary artery
(Schellenberg and Foster, Prostaglandins, 27: 475-482, 1984).
Intravenous injection of 2 nmol LTC4 into normal, healthy human
volunteers produced a fall in mean arterial pressure, an increase
in heart rate, a decrease in coronary blood flow and an increase in
coronary vascular resistance (Marone et al., in Biology of the
Leukotrienes, ed. by R. Levi and R. D. Krell, Ann. New York Acad.
Sci. 524, New York Academy of Sciences, N.Y., pp. 321-333, 1988).
Similar effects were reported for LTD4. LTC4 and LTD4 directly
increase vascular permeability probably by promoting retraction of
capillary endothelial cells.
There is increasing evidence which suggests that leukotrienes
contribute to cardiac reperfusion injury following myocardial
ischemia (Barst and Mullane, Eur. J. Pharmacol., 114: 383-387,
1985; Sasaki et al., Cardiovasc. Res., 22: 142-148, 1988). In
experimental models of cardiac reperfusion injury, dual
cyclo-oxygenase/lipoxygenase inhibitors have been shown to reduce
the myocardial infarct size. The available evidence suggests that
the beneficial effect of the dual inhibitors is by inhibition of
LTB4 biosynthesis. However, these data must be interpreted
cautiously as the compounds used in the studies inhibited both
cyclo-oxygenase and lipoxygenases, in addition to having inherent
anti-oxidant properties. Specific inhibitors of 5-LO or LTB4
antagonists are needed to verify these findings. Leukotrienes are
also implicated as pathological mediators in endotoxic shock, in
that selective LTD4 receptor antagonist significantly increase
survival in animal models (Smith et al., Circ. Shock, 25: 21-31,
1988). The beneficial effects of LTD4 antagonists in endotoxic
shock models may be due in part by their ability to reverse the
increased capillary permeability caused by LTD4.
Platelet activating factor and thromboxane A.sub.2 constrict
coronary blood vessels thus decreasing coronary perfusion; the net
result being impaired cardiac output, a decrease in blood pressure
and acute circulatory collapse. PAF also promotes ST-segment
depression. In experimental animal models of shock, there is a
relationship between endotoxin-induced hypotension and the level of
PAF. Further support for a role of PAF in endotoxic shock was the
finding that PAF antogonists decrease the hypotension observed in
animal models of shock (Braquet et al., ISY Atlas of Science:
Pharmacology; 187-198, 1987).
Gastrointestinal System
The guinea pig ileum is the classical tissue to measure smooth
muscle contraction by the peptido-leukotrienes (SRS-A). In
addition, LTC4 and LTD4 contract guinea pig stomach. LTB4 is
without effect on both tissues. There are marked differences
between species and muscle layers in their responsiveness to
leukotrienes. Human gastrointestinal mucosa synthesize and release
leukotrienes, which is increased in response to injury or an
inflammatory reaction. In experimental animal models, leukotriene
receptor antagonists have been reported to decrease the
gastrointestinal damage caused by ethanol, indomethacin, and
aspirin. The gastrointestinal damage caused by leukotrienes may be
due in part to their potent vasoconstrictive properties, thus
shunting blood flow away from mucosa. Several studies have
demonstrated elevations of LTB4 and the peptidoleukotrienes in
patients suffering from inflammatory bowel disease. In animal
models of inflammatory bowel disease, 5-LO inhibitors decrease the
amount of damage and inflammation.
As already mentioned, PAF is the most potent ulcerogen in the rat
yet described. PAF is also proposed to be involved in necrotizing
enterocolitis (Wallace et al., Gastroenterology, 1987 in
press).
Central Nervous System
Leukotrienes are synthesized and released from normal brain tissue
stimulated with calcium ionophore, suggesting that they may
function as neuromodulators. LTC4 and LTD4 produce prolonged
excitation of cerebellar purkinje cells (Palmer etal., J.
Pharmacol. Exp. Ther., 219:91-96, 1981). In addition to a possible
role as a neuromodulator, leukotrienes may contribute to pathology
of nervous tissue following injury such as cerebral ischemia since
they are potent constrictors of cerebral blood vessels. LTB4, LTC4,
and LTD4 decrease the blood brain barrier by increasing vascular
permeability, with LTB4 being the most potent (Black,
Prostaglandins Leukotriene Med., 14: 339-340, 1984).
Prostaglandins contribute to the pain associated with injury,
inflammation, and headache, thus explaining the therapeutic benefit
of nonsteroidal anti-inflammatory agents in these diseases. At
lower doses, prostaglandins E2 and PGF2.sup.-- sensitize pain
receptors to mechanical and chemical stimulation producing a
hyperalgesia.
Cutaneous System
Leukotrienes produce marked inflammatory responses in human skin.
Injection of 0.15 to 1.5 nmol of LTB4 into human skin caused raised
edematous areas which appeared 30 minutes after injection and
lasted for at least 4 hours. Histology demonstrated a marked
polymorphonuclear leukocyte infiltrate into the dermis (Camp etal.,
Br. J. Pharmacol., 80: 497-502, 1983). Topical application of as
little as 5 ng of LTB4 produced a delayed inflammatory reaction
which first appeared at 12 hours and lasted for several days.
Initially, the infiltrate consisted of polymorphonuclear
leukocytes, but mononuclear leukocytes predominated at the later
stages of the inflammatory reaction. Tachyphylaxis develops in
response to repeated topical administration of LTB4 (Dowd et al.,
1987).
In contrast to LTB4, the peptidoleukotrienes produce an immediate
flair reaction upon intradermal injection, with no later sequelae.
Some of the best evidence for the involvement of leukotrienes in a
human disease is in psoriasis. Leukotrienes have been found in
psoriatic lesions. Benoxaprofen, a 5-lipoxygenase inhibitor, was
found to be effective in patients with severe psoriasis who did not
respond to standard therapy (Kragballe and Herlin, Arch. Dermatol.,
119: 548-552, 1983). However, benoxaprofen was withdrawn from the
market due to unacceptable side effects.
Prostaglandins E1 and E2 cause vasodilation and whealing when
injected into the skin Crunkhorn and Willis, Br. J. Pharmacol., 41:
49-56, 1971). Prostacyclin (PGI2) increases vascular permeability
due to other mediators. Prostaglandin D2 is much weaker than PGE's
in promoting redness and whealing following intradermal
injection.
PAF is a potent pro-inflammatory agent in human skin. Injection of
picomole amounts of PAF into human skin promotes a biphasic
response with the early response ocurring 5 minutes after injection
followed 3-6 hours later by a late phase response (Archer et al.,
Br. J. Dermatol., 112:285-290, 1985). PAF has been isolated from
scale and chamber fluid from lesional skin of patients with
psoriasis (Mallet et al., Adv. in Prostaglandins, Thromboxanes,
Leukotrienes and Related Compounds, Vol 17B: 640-642, 1987).
Musco-Skeletal System
High levels of leukotrienes and monohydroxy derivatives of
arachidonic acid have been detected in synovial fluid from patients
with rheumatoid arthritis, spondylarthritis, and gout (Klickstein
et al., J. Clin. Invest., 66: 1166-1170, 1950; Davidson et al.,
Ann. Rheum. Dis., 42:677-679, 1983). The high levels of
lipoxygenase products in synovial fluid may contribute to
neutrophil infiltration and increased enzyme release from activated
neutrophil into the synovial cavity, Inhibitors of 5-lipoxygenase
have been shown to reduce tissue damage in collagen-induced
arthritis in rodents, Inhibition of leukotriene biosynthesis
reduces neutrophil and monocyte infiltration into the synovial
space and the resultant tissue damage caused by these cells.
Current Therapeutic Agents Modulating Lipid Metabolism
It is evident by the wide variety of effects of eicosanoids on the
major organ systems of the body and their association in a variety
of pathological conditions that inhibitors of the metabolism of
arachidonic acid would have immense therapeutic utility. Currently
there are several classes of agents on the market which modulate
arachidonic acid metabolism. However, with each class there a
number of untoward effects due to their lack of specificity. In
addition, most of the agents currently on the market fail to
inhibit either the lipoxygenase pathway or platelet activating
factor.
Inhibition of the enzyme, cyclo-oxygenase, by aspirin, ibuprofen,
naproxen, indomethacin and related nonsteroidal analgesics has been
well documented to exert beneficial effects in a variety of disease
states. Nonsteroidal anti-inflammatory agents are the mainstay for
the treatment of rheumatoid arthritis. These agents have proven
very effective in relieving the symptoms associated with rheumatoid
arthritis such as pain and swelling, however, they do little to
alter the course of the disease. In addition, inhibitors of
cyclo-oxygenase nondiscriminantly block production of all
prostaglandins, some of which exert beneficial effects. This may in
part be the mechanism for many of their side effects, such as their
ulcerogenic activity. Cyclo-oxygenase inhibitors have no effect on
either leukotriene-production or platelet activating factor, thus
leaving a void in the therapy of a variety of diseases.
Steroids exhibiting glucocorticoid activity also exhibit
anti-inflammatory activity, possibly by inhibiting the release of
arachidonic acid from cell membranes. Steroids constitute one of
the most widely prescribed classes of agents currently available.
They are used to treat a variety of inflammatory, allergic, and
nonimmune mediated disorders such as rheumatoid arthritis,
osteoarthritis, lupus, anaphylaxis, urticaria, contact dermatitis,
asthma, psoriasis, chronic ulcerative colitis, cerebral edema,
septic shock, malignancies, and hepatitis. With the exception of
substitution therapy for the treatment of adrenal insufficiency,
glucocorticoid therapy is not curative. In addition, long term
treatment with glucocorticoid leads to substantial and often life
threatening side effects. As many of the uses of glucocorticoids
are for the treatment of chronic disorders, their side effects
limit their usefulness.
Changes in dietary intake of essential fatty acid precursors to
arachidonic acid have demonstrated modest activity in inflammatory
and cardiovascular diseases (Bonaa et al., New Eng. J. Med., 322
795-801, 1990; Rangi et al., J. Allergy Clin. Immunol., 85:484-489,
1990). Fish oils contain eicosapentaenoic acid (EPA), which is a
poor substrate for cyclo-oxygenase and acts as a competitive
inhibitor of cyclo-oxygenase. EPA is metabolized similar to
arachidonic acid by lipoxygenases, but give much less active
metabolites (Terano et al., Biochem. Pharmacol., 33:3071-3076,
1984). Thus, EPA competes with arachidonic acid for incorporation
into cellular membranes and subsequent metabolism by lipoxygenases.
It is difficult to completely restrict dietary intact of linoleic,
linolenic and arachidonic acids thus limiting the usefulness of
fish oil therapies.
Inhibition of 5-lipcoxygenase by an iron complexing reagent, a
hydroxamic acid derivative, is currently undergoing clinical
trials. Historically, this approach has yielded less than promising
results. To date, no current agents for modulation of the storage
or release of arachidonic acid from cellular membranes nor
metabolism via the lipoxygenase pathways have proven to be useful
therapeutic agents. There is a great, but as yet unfulfilled, need
to provide a safe and efficacious method to modulate arachidonic
acid synthesis or metabolism. A means to modulate the production of
proteins at critical points in the arachidonic acid pathway, rather
than seeking to inhibit specific enzymes directly, would overcome
the problems encountered by prior workers.
OBJECTS OF THE INVENTION
It is a principal object of the invention to provide therapies for
immunological, cardiovascular, and other diseases through
perturbations in the synthesis or metabolism of arachidonic acid
and related compounds.
It is a further object of the invention to provide antisense
oligonucleotides which are capable of inhibiting the function of
RNA encoding proteins involved in the synthesis and metabolism of
arachidonic acid and related compounds.
Yet another object is to provide means .for diagnosis of
dysfunctions of arachidonic acid synthesis or metabolism.
These and other objects of this invention will become apparent from
a review of the instant specification.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic of the synthesis and metabolism of
arachidonic acid.
FIG. 2 is a schematic of the pathway for platelet activating factor
synthesis.
FIG. 3 is a human 5-lipoxygenase mRNA sequence.
FIG. 4 is a human synovial fluid PLA.sub.2 mRNA sequence.
FIG. 5 is a human 5-lipoxygenase activating protein sequence.
FIG. 6 is a human LTA.sub.4 hydrolase mRNA sequence.
FIG. 7 is a human phosphoinositde-specific phospholipase C mRN
sequence.
FIG. 8 is a graphical representation of the kinetics of
5-lipoxygenase induction in HL-60 cells.
FIG. 9 is a graphical representation of the antisense
oligonucleotide inhibition of 5-lipoxygenase expression in HL-60
cells.
FIG. 10 s a graphical representation of antisense oligonucleotide
inhibiton of 5-lipoxygenase expression in rat basophilic leukemia
cells.
FIG. 11 is a graphical representation of antisense oligonucleotide
inhibition of 5-lipoxygenase expression in vita D.sub.3
differentiated HL-60 cells.
FIG. 12 is a graphical representation of antisense oligonucleotide
inhibition of 5-lipoxygenase expression in RBL-1 rat cells.
FIG. 13 is a graphical representation of antisense oligonucleotide
inhibition of specific regions of 5-lipoxygenase mRNA in RBL-1 rat
cells.
FIG. 14 is a graphical representation of HPLC analysis of secreted
PLA.sub.2 from A431 cells.
FIG. 15 is a graphical representation of increased secretion of
PLA.sub.2 caused by primary human keratinocytes.
SUMMARY OF THE INVENTION
In accordance with the present invention, oligonucleotides and
oligonucleotide analogs are provided which specifically hybridize
with nucleic acids encoding 5-lipoxygenase, a 5-lipoxygenase
activating protein (FLAP), phospholipase A.sub.2, Phospholipase C,
LTA.sub.4 hydrolase, and other proteins regulating lipid
metabolism. The oligonucleotide or oligonucleotide analog is
designed to bind directly to mRNA or to a selected gene forming a
triple stranded structure, thereby modulating the amount of mRNA
made from the gene.
The former relationship is commonly denominated as "antisense". The
oligonucleotides and oligonucleotide analogs are able to inhibit
the function of RNA or DNA, either its translation into protein,
its translocation into the cytoplasm, or any other activity
necessary to its overall biological function. The failure of the
RNA or DNA to perform all or part of its function results in
failure of a portion of the genome controlling arachidonic
metabolism to be properly expressed, thus modulating said
metabolism.
It is preferred to target specific genes for antisense attack. It
has been discovered that the genes coding for a 5-lipoxygenase,
5-lipoxygenase activating protein, phospholipase A.sub.2, LTA.sub.4
hydrolase, phospholipase C, and coenzyme A-independent transacylase
are particularly useful for this approach.
Methods of modulating arachidonic acid metabolism comprising
contacting the animal with an oligonucleotide or oligonucleotide
analog hybridizable with nucleic acids encoding a protein capable
of modulating arachidonic acid synthesis or metabolism are
provided. Oligonucleotides or analogs hybridizable with RNA or DNA
coding for a 5-lipoxygenase, 5-lipoxygenase activating protein,
phospholipase A.sub.2, LTA.sub.4 hydrolase, phospholipase C,
thromboxane synthetase and coenzyme A independent transacylase are
preferred.
DETAILED DESCRIPTION OF THE INVENTION
Antisense oligonucleotides hold great promise as therapeutic agents
for the treatment of many human diseases. Conceptually, it is much
easier to design compounds which interact with a primary structure
such as an RNA molecule by base pairing than it is to design a
molecule to interact with the active site of an enzyme.
Oligonucleotides specifically bind to the complementary sequence of
either pre-mRNA or mature mRNA, as defined by Watson-Crick base
pairing, inhibiting the flow of genetic information from DNA to
protein. The properties of antisense oligonucleotides which make
them specific for their target sequence also makes them
extraordinarily versatile. Because antisense oligonucleotides are
long chains of four monomeric units, they may be readily
synthesized for any target RNA sequence. Numerous recent studies
have documented the utility of antisense oligonucleotides as
biochemical tools for studying target proteins (Rothenberg et al.,
J. Natl. Cancer Inst., 81:1539-1544, 1989; Zon, G., Pharmaceutical
Res., 5:539-549). Because of recent advances in oligonucleotide
chemistry, synthesis of nuclease resistant oligonucleotides, and
oligonucleotide analogs which exhibit enhanced cell uptake, it is
now possible to consider the use of antisense oligonucleotides as a
novel form of therapeutics.
Antisense oligonucleotides offer an ideal solution to the problems
encountered in prior art approaches. They can be designed to
selectively inhibit a given isoenzyme, they inhibit the production
of the enzyme, and they avoid non-specific mechanisms such as free
radical scavenging. A complete understanding of enzyme mechanism is
not needed to design specific inhibitors.
Current agents which modulate the metabolism of arachidonic acid
exhibit many unacceptable side effects due to their lack of
specificity, or they exhibit only limited effectiveness in treating
the disease. The instant invention circumvents problems encountered
by prior workers by inhibiting the production of the enzyme, rather
than inhibiting the enzyme directly, to achieve the therapeutic
effect. There are many enzymes involved in the synthesis or
metabolism of arachidonic acid which are of interest. Of these many
enzymes, six have been selected as the most critical targets based
upon their key role in arachidonic acid synthesis or their
selectivity in the generation of specific arachidonic acid
metabolites. As shown in FIG. 1, we have identified a number of
proteins at key points in the arachidonic acid pathway. In the
instant invention, the oligonucleotides or oligonucleotide analog
is designed to bind directly to mRNA or to a gene forming a triple
stranded structure which modulates the amount of mRNA made from the
gene.
Arachidonic acid is an essential fatty acid which must be obtained
from the diet either directly or by dietary intake of linoleic or
linolenic acids, both of which may be metabolized to arachidonic
acid in mammalian tissues. Arachidonic acid is stored esterified to
membrane lipids. These include the neutral lipids such as
triglycerides and diglycerides; phospholipids such as
phosphatidylcholine, phosphatidylethanolamine,
phosphatidylinositol, and phosphatidylserine; and cholesterol
esters. Esterified arachidonic acid is not available for metabolism
by the cyclo-oxygenase and lipoxygenase pathways. Thus, the rate
limiting step for the synthesis of prostaglandins and leukotrienes
is release from cellular membranes. In most mammalian cells, the
major source of arachidonic acid for prostaglandin and leukotriene
synthesis appears to be phospholipids. Cells stimulated with
specific agonists release arachidonic acid from membrane
phospholipids via a number of distinct pathways (FIG. 1). In a
given tissue type all pathways may be operational, however, the
most direct route for generation of free arachidonic acid, i.e.,
phospholipase A.sub.2, appears to account for the greatest mass of
arachidonic acid released. In some cell types, the phospholipase
C/diglyceride lipase pathway may contribute significantly to the
mass of arachidonic acid released from membrane lipids (Bell et
al., Proc. Natl. Acad. Sci. U.S.A., 76: 3238-3241; Mahadevappa and
Holub, Biochem. Biophys. Res. Comm., 134: 1327-1333, 1986).
Several recent studies suggest that the phospholipid pool from
which arachidonic acid is released is different for the
cyclo-oxygenase and lipoxygenase pathways (Humes et al., J. Biol.
Chem., 257:1591-1594; Chilton and Connell, J. Biol. Chem., 263:
5260-5265, 1988; Skerrett et al., J. Immunol., 144: 1052-1061,
1990). Thus, modulating distinct lipid pools may have different
effects on the synthesis of prostaglandins and leukotrienes. In
particular, a distinct subspecies of phosphatidylcholine with an
ether linkage at position 1 (1-O-Alkyl, 2-arachidonyl
phosphatiydylcholine) appears to be the major source of arachidonic
acid used for LTB.sub.4 synthesis in human neutrophils (Chilton and
Connel, J. Biol. Chem., 263: 5260-5265). Hydrolysis of this lipid
species by a phospholipase A.sub.2 results in free arachidonic acid
and 1-O-Alkyl lysophosphatidylcholine, a direct precursor for
platelet activating factor (FIG. 2). Inhibition of either the
synthesis of this lipid species through inhibition of coenzyme
A-independent transacylase or inhibition of the hydrolysis of the
lipid through inhibition of phospholipase A.sub.2 would inhibit
both the production of leukotrienes and platelet activating
factor.
Arachidonic acid released from membrane lipids may be re-esterified
back into the lipids by an acyltransferase or further metabolized
by a variety of oxygenases. Therapeutically, the two most important
classes of oxygenases are cyclo-oxygenase and the lipoxygenases.
Cyclo-oxygenase oxygenates and cyclizes arachidonic acid forming
the cyclic endoperoxide intermediate PGH2, the first step in the
synthesis of the prostaglandins (FIG. 1). There are multiple
lipoxygenase enzymes in mammalian cells which are classified
according to the position of the double bond in which they insert
molecular oxygen, i.e., 5-lipoxygenase, 12-lipoxygenase, and
15-lipoxygenase. Although 12- and 15-lipoxygenase products have
some biological activity, the best characterized lipoxygenase
products are those derived from 5-lipoxygenase. The 5-lipoxygenase
products, the leukotrienes, have potent biological activity and are
implicated in contributing to the pathology in a variety of disease
states. As part of the activation mechanism for 5-lipoxygenase, the
enzyme apparently undergoes a calcium-induced translocation from
the cytosolic fraction to the membrane where it interacts with a
specific membrane protein termed 5-lipoxygenase activating protein
(FLAP). The interaction of 5-lipoxygenase with FLAP appears to be
obligatory for leukotriene synthesis in cells (Rouzer et al., J.
Biol. Chem., 265: 1436-1442; Dixon et al., Nature, 343:
282-284).
The identified antisense oligonucleotide targets are
5-lipoxygenase, 5-lipoxygenaee activating protein, specific
isoenzymes of phospholipase C, specific isoenzymes of phospholipase
A.sub.2, LTA.sub.4 hydrolase, and coenzyme A-independent
transacylase. These targets represent several important subpathway
approaches to arachidonic acid metabolism. The lipoxygenase pathway
and platelet activating factor synthesis are approached by either
inhibiting the synthesis of the precursor phospholipid 1-O-Alkyl,
2-arachidonyl phosphatidylcholine (coenzyme A-independent
transacylase) or the release of arachidonic acid from the membrane
phospholipids (phospholipase A.sub.2 and phospholipase C). The
lipoxygenase pathway may also be specifically blocked by inhibiting
the metabolism of arachidonic acid into leukotrienes
(5-lipoxygenase and LTA.sub.4 hydrolase), or the activation of
5-lipoxygenase (5-lipoxygenase activating protein). As can be seen
by the selection of the targeted points, the means of modulation of
arachidonic acid metabolism is dependent upon the protein
selected.
DESCRIPTION OF TARGETS
Lipoxygenases are a family of dioxygenases which incorporate one
molecule of oxygen into unsaturated fatty acids. Lipoxygenases
maybe classified by the oxygenation site in the substrate molecule.
5-lipoxygenase (5-LO) is a dioxygenase which incorporates one
oxygen molecule at the C5-double bond of arachidonic acid producing
5-hydroperoxy-6,8,11,14-eicosatetraenoic acid (5-HPETE). Purified
5-LO also converts 5-HPETE to a conjugated triene epoxide
5,6-leukotriene A.sub.4. Thus, the first two enzymatic steps in
leukotriene B.sub.4 and the peptidoleukotrienes (leukotriene
C.sub.4, leukotriene D.sub.4, and leukotriene E.sub.4) biosynthetic
pathways are performed by a single enzyme.
5-lipoxygenase (5-LO) has been purified to homogeneity from the
cytosolic fraction of a number of cell types (Rouzer and
Samuelsson, Proc. Natl. Acad. Sci. U.S.A., 82:6040-6044, 1985;
Hogaboom et al., Mol. Pharmacol., 30:510-519, 1986; Ueda et al., J.
Biol. Chem., 261: 7982-7988,1986). The purified enzyme exhibits a
molecular weight of 74 to 80 kDa as determined by SDS.
polyacrylamide gel electrophoresis. 5-Lipoxygenase is a suicide
enzyme, in that it inactivates itself in an irreversible manner
during the course of the enzyme reaction. The exact mechanism by
which 5-LO inactivates itself has not been elucidated. 5-LO can use
both arachidonic acid and 5-HEPTE as substrates to synthesize
LTA.sub.4. With rat basophil 5-LO, exogenous 5-HPETE is about
50-fold less active as a substrate for LTA.sub.4 synthesis than
5-HPETE supplied by the enzymes from the 5-lipoxygenase
reaction.
The purified enzyme is activated by both calcium and ATP, as well
as several unknown cellular factors which are removed from the
enzyme during purification (Rouzer et al., Proc. Natl. Acad. Sci.
USA, 82: 7505-7509, 1985; Hogaboom et al., Mol. Pharm., 30:510-519,
1986). Both ATP and the stimulatory factors increase the initial
velocity of the enzyme without exerting a stabilization effect
towards the enzyme. Stimulation by ATP does not appear to involve
protein phosphorylation nor does hydrolysis of the phosphodiester
bond appear to be a requirement as ADP and AMP also stimulate. One
mechanism by which calcium activates 5-LO is to promote the binding
of 5-LO to cellular membranes (Rouzer and Samuelsson, Proc. Natl.
Acad. Sci. USA, 84:7393-7397, 1987; Wong et al., Biochemistry,
27:6763-6769, 1988). Most agonists which promote leukotriene
biosynthesis cause an increase in intracellular calcium, thus the
translocation of 5-LO from the cytosol to cellular membranes may be
an important regulatory event in leukotriene biosynthesis. This
hypothesis is further supported by the observation that treatment
of cells with calcium ionophore causes a translocation of 5-LO to
the membrane with a concomitant production of leukotrienes (Rouzer
and Kargman, J. Biol. Chem., 263:10980-10988, 1988).
The cDNA and genomic clones for human 5-lipoxygenase (Dixon et al.,
Proc. Natl. Acad. Sci. USA, 85:416-420, 1988; Matsumoto et al.,
Proc. Natl. Acad. Sci. USA, 85:26-30, 1988; Funk et al., Proc.
Natl. Acad. Sci. USA, 86:2587-2591, 1989) and the cDNA sequence and
predicted protein sequence for rat 5-LO have been published
(Balcarek et al., J. Biol. Chem., 263:13937-11941, 1988). We have
isolated and partially sequenced the rat genomic clone for 5-LO.
The message for 5-LO is about 2700 bases in length. Human 5-LO is
674 amino acids in length with a calculated molecular weight of
77,839, while rat 5-LO is 670 amino acids in length. The protein
sequence for human and rat 5-LO were 93% identical, while the cDNA
sequences were over 80% identical. The major transcription
initiation start site is 65 bp upstream from the AUG translation
initiation colon. Human 5-LO mRNA contains 434 bp of 3'
-nontranslated sequence prior to the polyadenylation site. 5-LO
contains 2 domains which show 50- to 60% homology to the 17 amino
acid consensus sequence for calcium-dependent membrane binding
proteins such as lipocortin. The similarities between 5-LO and the
calcium-dependent membrane binding proteins may explain the
calcium-dependent translocation of 5-LO from the cytosol to
membranes.
The human 5-LO gene is over 80,000 bases in length. The gene
contains 14 exons and 13 introns which range in size from 192 base
pairs (bp) to over 26 kb, which makes it among the largest genes
known. The 5-LO gene appears to be a single copy gene. The 5-LO
gene contains no TATA or CCAAT sequences in close proximity to the
transcription initiation start site, a feature shared by several
housekeeping genes. The putative promoter region does contain 8
sites for binding to the Sp1 transcription factor.
As discussed above, since 5-LO is involved in the biosynthetic
pathways leading to leukotriene A.sub.4, leukotriene B.sub.4, and
the peptidoleukotrienes, inhibition of 5-LO could be useful for
modulating arachidonic acid metabolism. Certain antisense
oligonucleotides and oligonacleotide analogs may be identified as
useful for this purpose.
As indicated above 5-lipoxygenase requires a membrane factor for
the synthesis of leukotrienes (Rouzer and Samuelsson, Proc. Natl.
Acad. Sci. USA, 82:6040-6044). The identification of a novel
leukotriene biosynthesis inhibitor which had no direct effects on
5-lipoxygenase, MK886, lead to the identification of an 18 kDa
membrane protein which activates 5-lipoxygenase called
5-lipoxygenase activating protein (FLAP) (Miller et al., Nature,
343:276-281, 1990; Rouzer et al., J. Biol. Chem., 265: 1436-1442,
1990). The cDNA for FLAP encodes for a 161 amino acid protein with
a high content of hydrophobic amino acids (FIG. 3) (Dixon et al.,
Nature, 343:282-284, 1990). The mRNA for FLAP is 1 kb in
length.
Several experiments demonstrate that FLAP is obligatory for
leukotriene synthesis in intact cells. Osteosarcoma cells
transfected with the 5-lipoxygenase cDNA express 5-lipoxygenase
enzymatic activity but do not synthesize leukotrienes when
stimulated with calcium ionophore. However, cells transfected with
both 5-lipoxygenase and FLAP cDNA's express 5-lipoxygenase enzyme
activity and produce leukotrienes following stimulation with
calcium ionophore (Dixon et al., Nature, 343:282-284). Secondly, it
was shown that MK886 can prevent translocation of 5-lipoxygenase
from the cytosol to the membrane following calcium ionophore
treatment and the subsequent production of leukotrienes. Rank order
potency of MK886 anaologs correlated very nicely between inhibition
of leukotriene synthesis and inhibition of 5-lipoxygenase
translocation (Rouzer et al., J. Biol. Chem., 265:1436-1442). These
data suggest that antisense oligonucleotides directed against FLAP
is an alternative strategy for inhibition of leukotriene
production.
Phospholipases A.sub.2 (EC 3.1.1.4) form a diverse family of
enzymes which hydrolyze the sn-2 fatty acyl ester bond of membrane
phospholipias producing free fatty acids such as arachidonic acid
and lysophospholipids. Phospholipase A.sub.2 (PLA.sub.2) are found
in a variety of snake and bee venoms and secreted in mammalian
pancreatic fluid as a lipolytic enzyme. PLA.sub.2 enzymes are also
found in most mammalian tissues and are secreted into the
extracellular medium from activated platelets and inflammatory
cells. PLA.sub.2 serves multiple roles in mammalian cells,
including remodeling of cell membranes surfactant biosynthesis,
digestive enzyme in pancreatic fluid, release from platelets and
inflammatory cells as part of the inflammatory response, and
release of arachidonic acid esterified to cellular phospholipids.
Release of free arachidonic acid by PLA.sub.2 is proposed to be the
rate limiting step for prostaglandin biosynthesis and the critical
first step in leukotriene and platelet activating factor
biosynthesis. In addition to the liberation of precursors of
inflammatory mediators, PLA.sub.2 at high concentrations may be
directly cytotoxic to cells by promoting cell lysis. The multiple
functions which PLA.sub.2 serves in the cell may explain the need
for multiple PLA.sub.2 enzymes. The PLA.sub.2 isoenzyme found in
inflammatory exudates (Pruzanski and Vadas, J. Rheumatol.,
15:1601-1603, 1988) is of particular interest as an antisense
oligonucleotide target. This enzyme not only may play a role in the
release of arachidonic acid from cellular membranes for eicosanoid
biosynthesis, but may have a direct cytotoxic effect at the site of
release.
Recently Seilhamer et al. (J. Biol. Chem., 264:5335-5338, 1989) and
Kramer et al. (J. Biol. Chem., 264:5768-5775, 1989) reported the
cDNA and genomic cloning, respectively of a human PLA.sub.2 present
in rheumatoid arthritis patients synovial fluid. The gene for the
PLA.sub.2 isolated from human synovial fluid (SF-PLA.sub.2) was 4.5
kilobases in length and is processed to a mRNA 800 bases in length.
The cDNA clone encodes a protein 144 amino acids in length, with
the first 20 amino acids processed as a signal peptide for
secretion from cells. The amino acid sequence of SF-PLA.sub.2 is
distinct from pancreatic PLA.sub.2, more closely related to group
II PLA.sub.2 enzymes such as those present in rattlesnake
venom.
PLA.sub.2 is a low abundance protein in non-pancreatic tissues and
fluids, comprising 0.01 to 0.001% of the total protein. The mRNA
for SF-PLA.sub.2 is also a low abundance mRNA which exhibits a
limited tissue distribution. The limited tissue distribution, low
abundance of the mRNA, correlation between enzyme activity and
severity of the inflammatory disorder makes the SF-PLA.sub.2 and
attractive target for antisense oligonucleotide therapy.
Certain applications of antisense oligonucleotides and
oligonucleotide analogs are apparent. For example, because gamma
interferon increases PLA.sub.2 synthesis in the presence of an
interferon regulatory element in the 5'-nontranscribed region,
antisense oligonucleotides may be used to inhibit the release of
PLA.sub.2 from gamma interferon treated human keratinocytes.
Antisense oligonucleotide therapy may also be useful in the
treatment of inflammatory disorders of the skin, since SF-PLA.sub.2
is secreted from a human epidermal carcinoma cell line and primary
human epidermal keratinocytes. In addition, PLA.sub.2 may play a
mediating role in the inflammatory activity of gamma interferon in
the skin since gamma interferon induced PLA.sub.2 release from
human keratinocytes.
Leukotriene A.sub.4 hydrolase (LTA.sub.4 hydrolase) catalyzes the
hydrolysis of leukotriene A.sub.4, formed by 5-lipoxygenase, to
leukotriene B.sub.4 a potent inflammatory mediator. LTA.sub.4
hydrolase is a cytosolic protein-which has been purified to
homogeneity from human lung (Ohishi et al., J. Biol. Chem.,
262:10200-10205, 1987), human leukocytes (Radmark et al., J. Biol.
Chem., 259:12339-12345, 1984) and human erythrocytes (McGee and
Fitzpatrick, J. Biol. Chem., 260:12832-12837). The enzymes purified
from lung and leukocytes differed from the erythrocyte LTA.sub.4
hydrolase in terms of molecular weight, kinetic properties and
substrate preference. From the standpoint of human antisense
oligonucleotide therapeutics, the leukocyte enzyme is of more
interest than the erythrocyte LTA.sub.4 hydrolase. Brythrocytes
lack 5-lipoxygenase which is required for LTA.sub.4 synthesis,
therefore, these cells must rely upon LTA.sub.4 released from
activated neutrophils. The cDNA sequence for human LTA.sub.4
hydrolase is known (Funk et al., Proc. Natl. Acad. Sci USA,
84:6677-6681, 1987; Minami et al., J. Biol. Chem., 262:13873-13876,
1987). The 2250 nucleotide mRNA encodes for a 610 amino acid
protein (FIG. 5) which contains no sequence similarities to other
epoxide hydrolases. Therefore, inhibition of LTA.sub.4 hydrolase
with antisense oligonulceotides will have no effect on microsomal
epoxide hydrolases.
Phospholipases C (EC 3.1.4.3) are a family of enzymes which
hydrolyze the sn-3 phosphodiester bond in membrane phospholipids
producing diacylglycerol and a phosphorylated polar head group.
Mammalian phospholipase C (PLC) enzymes exhibit specificity for the
polar head group which is hydrolyzed, i.e., phosphatidylcholine,
phosphatidylinositol, etc. Recently, much interest has been
generated in the those PLC enzymes which selectively hydrolyze
phosphoinositide lipids in response to receptor occupancy by
agonist. Hydrolysis of phosphatidylinositol 4,5-bisphosphate
generates two second messenger molecules; diacylglycerol, a
co-factor required for activation of protein kinase C, and inositol
1,4,5-trisphosphate, a soluble second messenger molecule which
promotes the release of intracellular nonmitochrondrial stores of
calcium (Berridge, Ann. Rev. Biochem., 56:159-193, 1987). The
diacylglycerol released may be further metabolized to free
arachidonic acid by sequential actions of diglycerol lipase and
monoglycerol lipase. Thus, phospholipases C are not only important
enzymes in the generation of second messenger molecules, but may
serve an important role in making arachidonic acid available for
eicosanoid biosynthesis in select tissues.
Mammalian tissues contain multiple distinct forms of
phosphoinositide-specific PLC (Crooke and Bennett, Cell Calcium,
10:309-323, 1989; Rhee et al., Science, 244:546-550, 1989). It is
proposed that each of the enzymes couple to distinct classes of
cell surface receptors, i.e., PLC-.alpha. couples to vasopressin
receptors, PLC-.delta. couples to growth factor receptors, etc.
(Aiyar et al., Biochem. J., 261:63-70, 1989; Crooke and Bennett,
Cell Calcium, 10:309-323 1989; Margolis et al., Cell, 57:1101-1107,
1989; Wahl et al., Proc. Natl. Acad. Sci. USA, 86:1568-1572, 1989).
Because of the heterogeneity of PI-PLC enzymes it is possible to
selectively inhibit the signal transduction pathway of
proinflammatory agonists without effecting the signal transduction
pathway of noninflammatory agonists.
To date, the cDNA for 6 distinct PI-PLC enzymes have been cloned.
The enzymes range in size from 504 amino acids to 1250 amino acids,
and are remarkably divergent considering that the exhibit similar
biochemical properties. Four of the five enzymes (PLC-.beta.,
PLC-.delta.1, PLC-.delta.2, and PLC-.alpha.) contain two domains
approximately 250 amino acids in length which exhibit between 50 to
80% sequence similarity. PLC-.alpha. contains sequences with 35%
similarity to the first domain only (Crooke and Bennett, Cell
Calcium, 10:309-323, 1989). The marked differences in DNA sequences
for the different PI-PLC enzyme allows the selective targeting of
one PI-PLC enzyme, without affecting other enzymes using antisense
technology. The human cDNA clone has been reported only for
PLC-.delta.2 (FIG. 6), (Ohta et al., FEBS Lett., 242:31-35, 1988).
The rest are rat cDNA clones. The genomic clones have not been
reported for any of the PI-PLC enzymes.
All mammalian tissues which have been studied exhibit one or more
PI-PLC enzymes. Generally, more than one enzyme exists in a single
mammalian cell type. PI-PLC enzymes do exhibit tissue selectivity
in their distribution. PLC-.beta. is found predominantly in neural
tissues and is the major enzyme in the brain. PLC-.delta.1 is found
in brain and many peripheral tissues. PLC-.delta.2 is found in
immune cells, and PLC-.alpha. appears to be predominantly in
peripheral tissues. To date, a PI-PLC enzyme found exclusively in
inflammatory cells has not been reported. However, PI-PLC-.delta.2
appears to be an important enzyme in immunocompetent cells (Emori
et al., J. Biol. Chem., 264:21885-21890). The protein is a
moderately abundant protein comprising 0.1 to 0.05% of total
cytosolic protein. No information is available concerning the
genetic regulation of PI-PLC enzymes, mRNA or protein
stability.
Coenzyme A-independent transacylase catalyzes the transfer of
C.sub.20 and C.sub.22 polyunsaturated fatty acids from
diacyl-phospholipids to lysophospholipids (FIG. 7). Arachidonic
acid being a 20 carbon fatty acid with 4 double bonds at position
5, 8, 11, and 14. Coenzyme A-independent transacylase is an
important enzyme in the generation of arachidonyl containing ether
phospholipids which serve as a precursor for platelet activating
factor and leukotrienes (FIG. 7). Coenzyme A-independent
transacylase is an integral membrane protein localized to the
microsomal membrane, with an apparent molecular weight of 50-60 kDa
as determined by gel filtration chromatography (C. F. Bennett,
unpublished data). The enzyme is unique in that it does not require
coenzyme A for activity, unlike other fatty acid transacylases or
acyltransferases. In addition, it exhibits rather strict
specificity for both the donor lipid species and the acceptor
lipid. The enzyme prefers diacyl phosphatidylcholine species
containing C.sub.20 or C.sub.22 polyunsaturated fatty acids in the
sn-2 position as the donor lipid (Sugiura et al., J. Biol. Chem.,
262:1199-1205, 1987). Phosphatidyl-ethanolamine was less effective
as a donor lipid species than phosphatidylcholine, and
phosphatidylinositol did not serve as a fatty acid donor. Fatty
acids less than 20 carbons in length, such as palmitic and linoleic
acids, were transferred much less efficiently. The enzyme also
exhibited specificity towards acceptor lysophospholipids.
Lysophospholipids containing inositol, serine and phosphate as the
polar head group did not serve as acceptors for coenzyme
A-independent transacylation. 1-O-Alkyl lysophosphatidylcholine was
the preferred acceptor lipid species with 1-alkenyl
lysphosphatidylcholine, 1-acyl lysophosphatidylcholine, 1-alkenyl
lysophosphatidylethanolamine, 1-alkyl lysophosphatidylethanolamine,
and 1-acyl lysophosphatidylethanolamine each exhibiting
approximately 50% the activity as that of 1-alkyl
lysophosphatidylcholine as acceptor lipids.
For therapeutics, an animal suspected of having a disease which can
be modulated by decreasing 5-lipoxygenase, 5-1ipoxygenase
activating protein, SF-PLA.sub.2, PI-PLC-.delta.2, leukotriene
A.sub.4 hydrolase, and coenzyme A-independent transacylase, is
treated by administering oligonucleotide in accordance with this
invention. Persons of ordinary skill can easily determine optimum
dosages, dosing methodologies and repetition rates. Such treatment
is generally continued until either a cure is effected or a
diminution in the diseased state is achieved. Long term treatment
is likely for some diseases.
The present invention employs oligonucleotides and oligonucleotide
analogs for use in antisense inhibition of the function of RNA and
DNA corresponding to proteins capable of modulating arachidonic
acid metabolism. In the context of this invention, the term
"oligonucleotide" refers to a polynucleotide formed from naturally
occurring bases and cyclofuranasyl groups joined by native
phosphodiester bonds. This term effectively refers to
naturally-occurring species or synthetic species formed from
naturally-occurring subunits or their close homologs.
"Oligonucleotide analog", as that term is used in connection with
this invention, refers to moieties which function similarly to
oligonucleotides but which have non-naturally-occurring portions
which are not closely homologous. Thus, oligonucleotide analogs may
have altered sugar moieties or inter-sugar linkages. Exemplary
among these are the phosphorothioate and other sulfur containing
species which are known for use in the art. In accordance with some
preferred embodiments, at least some of the phosphodiester bonds of
the oligonucleotide have been substituted with a structure which
functions to enhance the ability of the compositions to penetrate
into the region of cells where the RNA or DNA whose activity to be
modulated is located. It is preferred that such substitutions
comprise phosphorothioate bonds, methyl phosphorothioate bonds, or
short chain alkyl or cycloalkyl structures. In accordance with
other preferred embodiments, the phosphodiester bonds are
substituted with other structures which are, at once, substantially
non-ionic and non-chiral. Persons of ordinary skill in the art will
be able to select other linkages for use in practice of the
invention.
Oligonucleotide analogs may also include species which include at
least some modified base forms. Thus, purines and pyrimidines other
than those normally found in nature may be so employed. Similarly,
modifications on the cyclofuranasyl portions of the nucleotide
subunits may also occur, as long as the essential tenets of this
invention are adhered to.
Such analogs are best described as being functionally
interchangeable with natural oligonucleotides (or synthesized
oligonucleotides along natural lines), but which have one or more
differences from natural structure. All such analogs are
comprehended by this invention, so long as they function
effectively to hybridize with RNA and DNA deriving from a gene
corresponding to one of the proteins capable of modulating
arachidonic metabolism. The oligonucleotides and oligonucleotide
analogs in accordance with this invention preferably comprise from
about 3 to about 50 subunits. It is more preferred that such
oligonucleotides and analogs comprise from about 8 to 25 subunits,
and still more preferred to have from about 12 to 22 subunits. As
will be appreciated, a subunit is a base-sugar combination suitably
bound to adjacent subunits through phosphodiester or other
bonds.
The oligonucleotides and analogs used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors, including Applied Biosystems.
Any other means for such synthesis may also be employed, however,
the actual synthesis of the oligonucleotides are well within the
talents of the routineer.
It is also well known to use similar techniques to prepare other
oligonucleotide analogs such as the phosphorothioates and alkylated
derivatives.
In accordance with this invention, persons of ordinary skill in the
art will understand that messenger RNA identified by the open
reading frames (ORFs) of the DNA from which they are transcribed
includes not only the information from the ORFs of the DNA, but
also associated ribonucleotides which form a region known to such
persons as the 5' untranslated region, the 3' untranslated region,
and intron/exon junction ribonucleotides. Thus, oligonucleotides
and oligonucleotide analogs may be formulated in accordance with
this invention which are targeted wholly or in part to these
associated ribonucleotides as well as to the informational
ribonucleotide. In preferred embodiments, the oligonucleotide or
analog is specifically hybridizable with a transcription initiation
site, a translation initiation site, or an intron/exon junction.
Most preferably, the oligonucleotide or oligonucleotide analog is
specifically hybridizable with sequences adjacent to the 5' cap
site.
In accordance with this invention, the oligonucleotide is
specifically hybridizable with nucleic acids encoding a protein
which modulates the synthesis or metabolism of arachidonic acid. In
preferred embodiments, said proteins are 5-lipoxygenase,
5-lipoxygenase activating protein, phospholipase A.sub.2, LTA.sub.4
hydrolase, phospholipase C, and coenzyme A independent
transacylase. Oligonucleotides or analogs comprising the
corresponding sequence, or part thereof, are useful in the
invention. For example, FIG. 3 is a human 5-lipoxygenase mRNA
sequence; FIG. 4 is a human synovial fluid PLA.sub.2 mRNA sequence;
FIG. 5 is a human 5-lipoxygenase activating protein sequence; FIG.
6 is a human LTA.sub.4 hydrolase mRNA sequence; and FIG. 7 is a
human phosphoinositide-specific phospholipase C mRNA sequence.
Oligonucleotides or analogs useful in the invention comprise one of
these sequences, or part thereof. Thus, it is preferred to employ
any of these oligonucleotides (or their analogs) as set forth
above, or any of the similar nucleotides which persons of ordinary
skill in the art can prepare from knowledge of the preferred
antisense targets for the modulation of the synthesis or metabolism
of arachidonic acid.
Several preferred embodiments of this invention are exemplified in
accordance with the following examples. The target mRNA species for
modulation relates to 5-lipoxygenase. Persons of ordinary skill in
the art will appreciate that the present invention is not so
limited, however, and that it is generally applicable. The
inhibition or modulation of production of the enzyme 5-lipoxygenase
is expected to have significant therapeutic benefits in the
treatment of disease. In order to assess the effectiveness of the
compositions, an assay or series of assays is required.
EXAMPLES
Example 1
The cellular assays for 5-lipoxygenase use the human promyelocytic
leukemia cell line HL-60. These cells can be induced to
differentiate into either a monocytic-like cell or neutrophil-like
cell by various known agents. Treatment of the cells with 1.3%
dimethyl sulfoxide (DMSO) is known to promote differentiation of
the cells into neutrophils. It has now been found that basal HL-60
cells synthesize 5-lipoxygenase protein or secrete leukotrienes (a
downstream product of 5-lipoxygenase) at the lower limit of current
detection methods. Differentiation of the cells with DMSO causes an
appearance of 5-lipoxygenase protein and leukotriene biosynthesis
48 hours after addition of DMSO. The induction kinetics of
5-lipoxygenase mRNA and leukotriene B.sub.4 release from calcium
ionophore stimulated HL-60 cells is shown in FIG. 8.
Differentiation of the cells may also he accomplished with
1,25-dihydroxyvitamin D.sub.3 and results in an eight to ten fold
increase in 5-lipoxygenase enzyme activity at least 24 hours after
addition of 1,25-dihydroxyvitamin D.sub.3. Thus, induction of
5-lipoxygenase protein synthesis can be utilized as a test system
for analysis of antisense oligonucleotides which interfere with
5-lipoxygenase synthesis in these cells.
An effect of inhibition of 5-lipoxygenase biosynthesis is a
diminution in the quantities of leukotrienes released from
stimulated cells. DMSO-differentiated HL-60 cells release
leukotriene B4 upon stimulation with the calcium ionophore A.sub.2
3187. Leukotriene B4 released into the cell medium can be
quantitated by radioimmunoassay, using commercially available
diagnostic kits (New England Nuclear, Boston, Mass.). Leukotriene
B4 production can he detected in HL-60 cells 48 hours following
addition of DMSO to differentiate the cells into a neutrophil-like
cell. Cells (2.times.10.sup.5 cells/mL) are treated with increasing
concentrations of antisense oligonucleotides for 48-72 hours in the
presence bf 1.3% DMSO. The cells are washed and resuspended at a
concentration of 5.times.10.sup.6 cell/mL in Dulbecco's phosphate
buffered saline containing 1% delipidated bovine serum albumin.
Cells are stimulated with 10 .mu.M calcium ionophore A.sub.2 3187
for 15 minutes, and the quantity of LTB4 produced from
5.times.10.sup.5 cell determined by radioimmunoassay as described
by the manufacturer.
Example 2
A second test system for antisense oligonucleotides makes use of
the fact that 5-lipoxygenase is a "suicide" enzyme in that it
inactivates itself upon reacting with substrate. Treatment of
differentiated HL-60 or other cells expressing 5 lipoxygenase, with
10 .mu.M A.sub.2 3187, a calcium ionophore, promotes translocation
of 5-lipoxygenase from the cytosol to the membrane with subsequent
activation of the enzyme. Following activation and several rounds
of catalysis, the enzyme becomes catalytically inactive. Thus,
treatment of the cells with calcium ionophore inactivates
endogenous 5-lipoxygenase. It takes the cells approximately 24
hours to recover from A.sub.2 3187 treatment as measured by their
ability to synthesize leukotriene B.sub.4.
Preliminary data demonstrate that antisense oligonucleotides have
an effect in this model system (FIG. 9). HL-60 cells were
differentiated with DMSO for 72 hours, treated with 10 .mu.M
A.sub.2 3187 and washed three times in phosphate buffered saline to
remove the ionophore. The cells were resuspended in RPMI-1640
containing 10% fetal bovine serum at a concentration of
1.times.10.sup.6 cells/ml and the oligonucleotides added to a final
concentration of either 25 .mu.M or 75 .mu.M. The oligonucleotides
used are shown below with N indicating a phosphodiester linkage and
S indicating a phosphorothioate linkage.
2N & 2S: 5'-ACGGTGACCGTGTAGGAGGGCATGGCGCGG-3'
8N & 8S: 5'-AATGGTGAATCTCACGTGTGCCACCAGCAG-3'
21N & 21S: 5'-AGGTGTCCGCATCTA-3'
22N & 22S: 5'-TCGGCGCGGCGGTCCAGGTGTCCGTATCTA-3'
The results suggest that phosphodiester oligonucleotides were not
active in the assay, however, the analogous phosphorothioate
oligonucleotide exhibited varying degrees of activity (FIG. 9). The
most active oligonucleotide, 8S, targeted the 3' side of the
intron/exon junction for intron H.
Example 3
The most direct effect which antisense oligonucleotides exert on
intact cells which can be easily be quantitated is specific
inhibition of 5-lipoxygenase protein synthesis. To perform this
technique, cells are labelled with .sup.35 S-methionine (50
.mu.Ci/mL) for 2 hours at 37.degree. C. to label newly-synthesized
protein. Cells are extracted to solubilize total cellular proteins,
and 5-lipoxygenase is immunoprecipitated with 5-lipoxygenase
antibody. The immune complexes are trapped with protein A Sepharose
beads. The inununoprecipitated proteins are resolved by
SDS-polyacrylamide gel electrophoresis and exposed for
autoradiography. The amount of immunoprecipitated 5-lipoxygenase is
quantitated by scanning densitometry.
A predicted result from these experiments would be as follows. The
amount of 5-lipoxygenase protein immunoprecipated from control
cells would be normalized to 100%. Treatment of cells with 1 .mu.M,
10 .mu.M, and 30 .mu.M of effective antisense oligonucleotide for
48 hours would reduce immunoprecipitated 5-LO to 5%, 25%, and 75%
of control, respectively.
Example 4
Measurement of 5-lipoxygenase enzyme activity in cellular
homogenates is also useful to quantitate the amount of enzyme
present which is capable of synthesizing leukotrienes. A
radiometric assay has now been developed for quantitating
5-lipoxygenase enzyme activity in cell homogenates using reverse
phase HPLC. Cells are broken by sonication in a buffer containing
protease inhibitors and EGTA. The cell homogenate is centrifuged at
8,000.times. g for 15 minutes and the supernatants analyzed for
5-lipoxygenase activity. Cytosolic proteins are incubated with 10
.mu.M .sup.14 C-arachidonic acid, 2 mM ATP, 50 .mu.M free calcium,
and 50 mM bis-Tris buffer, pH 7.0, for 10 min at 37.degree. C. The
reactions are quenched by the addition of an equal volume of
acetone and the fatty acids extracted with ethyl acetate. The
substrate and reaction products are separated by reverse phase HPLC
on a Novapak C18 column (Waters Inc., Millford, Mass.). Radioactive
peaks are detected by a Beckman model 171 radio-chromatography
detector. The amount of arachidonic acid converted into di-HETE's,
5-HPETE, and 5-HETE are used as a measure of 5-lipoxygenase
activity.
Preliminary data using quantitation of enzyme activity as a means
of detecting effects of antisense oligonucleotides on
5-lipoxygenase expression is shown in FIG. 10. A rat basophilic
leukemia cell line, RBL-1 cells, which expresses high amounts of
5-lipoxygenase activity under basal conditions were used for the
assay. Cells were either treated for 48 hours with 50 .mu.M
oligonucleotide or for 24 hours with 50 .mu.M oligonucleotide, then
an additional 50 .mu.M oligonucleotide was added and the cells
incubated for an additional 24 hours. The cells were harvested and
the amount of 5-lipoxygenase enzyme activity using 10 .mu.g protein
of 5000.times. g supernatant. The oligonucleotides used contained
phosphorothioate linkages. The sequence of the oligonucleotides
were:
r5LO-1S:5'-AGGCATGGCTCTGGGAAGTG-3'
H5LO-27S:5'-CGACTCCGTGCTGGCTCTGA-3'
The oligonucleotide r5LO-1S corresponds to sequences hybridizing to
the AUG translation initiation codon of the rat 5-lipoxygenase
mRNA, while H5LO-27S is a control oligonucleotide with a random
sequence which does not hybridize to any known cellular RNA's. The
results demonstrate that under both treatment condition the
antisense oligonucleotide to 5-lipoxygenase reduced the enzyme
activity 48% and 56%, respectively. The control oligonucleotide
H27S did not significantly reduce 5-lipoxygenase activity when
given as a single dose and inhibited activity by 17% when given as
a double dose (FIG. 10).
Example 5
Antisense oligonucleotides were also tested for their ability to
inhibit 5-lipoxygenase activity in 1,25-dihydroxyvitamin D.sub.3
differentiated HL-60 cells. For oligonucleotide treatment, cells
were washed three times in serum free medium (Opti-MEM) and
resuspended at a concentration of 4.times.10.sup.6 cells/mi. Five
ml of cell suspension were placed in a 25 cm.sup.2 tissue culture
flask for each oligonucleotide treatment. To each flask, 32 .mu.M
commercial DOTMA was added to enhance oligonucleotide uptake and 1
.mu.M of each antisense oligonucleotide. Cells were incubated for 4
hours in the presence of DOTMA and oligonucleotide at 27.degree.
C., then centrifuged at 400.times. g for 10 minutes to pellet the
cells. Cell pellets were resuspended in 10 ml RPMI 1640 medium
containing 10% fetal bovine serum, 10 .mu.M oligonucleotide and 0.1
.mu.M 1,25-dihydroxyvitamin D.sub.3. Following differentiation for
84 hours, 5-lipoxygenase enzyme activity was determined as
described in Example 4, using 100 .mu.g of cellular homogenate.
The antisense oligonucleotides used in this series of experiments
were phosphorothioate oligonucleotides having the sequences:
##STR1## ISIS 1820, ISIS 1821 add ISIS 1822 decreased
5-lipoxygenase enzyme activity 60.9%, 67.9% and 58.8% respectively,
compared to non-oligonucleotide treated cells (FIG. 11). These data
demonstrate the utility of antisense oligonucleotides in inhibiting
5-lipoxygenase expression in a human cell line.
Example 6
Antisense oligonucleotides are also effective in inhibiting
5-lipoxygenase expression in rat cells. Rat basophilic leukemia
cells (RBL-1) constitutively express twenty fold more
5-lipoxygenase enzyme activity than differentiated HL-60 cells.
RBL-1 cells were treated with 1 .mu.M oligonculeotide in the
presence of 16 .mu.M DOTMA for 4 hours in serum free medium.
Thereafter, cells were incubated with 5 .mu.M oligonucleotide in
DMEM medium containing fetal calf serum. The half-life for
5-lipoxygenase is approximately 24 hours, therefore, the cells were
treated with oligonucleotide for 5 days. At the end of 5 days,
cells were sonicated and 5-lipoxygenase activity in cell extracts
determined, as described in Example 4.
Oligonucleotides ISIS 2177, ISIS 1827, and ISIS 1831 all reduced
5-lipoxygenase enzyme activity 35% (FIG. 12). The oligonucleotides
all had phosphorothioate linkages and had the following sequences:
##STR2##
Example 7
Another series of antisense oligonucleotide inhibition reactions
provided evidence that specific regions of the mRNA are more
sensitive to inhibition with antisense oligonucleotides. RBL-1
cells were treated with oligonucleotides, as described in Example
6, and cells were assayed for 5 lipoxygenase enzyme activity 5 days
following treatment with oligonucleotides. Cells were treated with
oligonucleotides ISIS 2817, ISIS 2821, and ISIS 2822, however, only
ISIS 2821, which hybridizes to 3'-untranslated sequences, inhibited
5-lipoxygenase enzyme activity (FIG. 13). The oligonucleotides were
all phosphorothioate oligonucleotides having the following
sequences: ##STR3##
Example 8
Inhibition of the production of 5-lipoxygenase in the mouse can be
demonstrated in accordance with the following protocol. Topical
application of arachidonic acid results in the rapid production of
leukotriene B.sub.4, leukotriene C.sub.4 and prostaglandin E.sub.2
in the skin, followed by edema and cellular infiltration. Certain
inhibitors of 5-lipoxygenase have been shown to exhibit activity in
this assay. For the assay, 2 mg of arachidonic acid is applied to a
mouse ear with the contralateral ear serving as a control. The
polymorphonuclear cell infiltrate is assayed by myeloperoxidase
activity in homogenates taken from a biopsy 1 hour following the
administration of arachidonic acid. The edematous response is
quantitated by measurement of ear thickness and wet weight of a
punch biopsy. Measurement of leukotriene B.sub.4 produced in biopsy
specimens is performed as a direct measurement of 5-lipoxygenase
activity in the tissue. Antisense oligonucleotides are applied
topically to both ears 12 to 24 hours prior to administration of
arachidonic acid to allow optimal activity of the compounds.
Example 9
Inhibition of the expression of 5-lipoxygenase for the treatment of
allergic and inflammatory disorders and trauma.
Representative molecules that fall within the scope of this
invention are described below. The first three molecules described
in this example preferably bind to 5-lipoxygenase mRNA. A fourth
molecule binds to the 5-lipoxygenase gene forming a triple stranded
structure, thus modulating the amount of mRNA made from the
5-lipoxygenase gene.
1) In the first representative molecule, the base sequence is
complementary to the 5-lipoxygenase mRNA beginning at the
initiation codon and extending into the reading frame, hybridizing
to a total of 15 ribonucleotide units of the 5-lipoxygenase mRNA:
##STR4##
2) The second representative molecule is complementary to the 12
contiguous ribonucleotides that precede the translational
termination signal of the 5-lipoxygenase mRNA. ##STR5##
3) The third representative molecule is complementary to 30
contiguous ribonucleotides near the 5' end of the 5'lipoxygenase
mRNA, and also includes the sequence described in the first
representative molecule directed to 5-lipoxygenase. ##STR6##
4) The fourth representative molecule will bind to the DNA of the
5-lipoxygenase gene forming a triple stranded structure that would
modulate expression of the gene. ##STR7##
Where a number of specific embodiments have been set forth, the
present invention is to be limited only in accordance with the
following claims.
Example 10
There are several PLA.sub.2 isoenzymes expressed in mammalian
cells. Before antisense oligonucleotides can be tested for
inhibition of synovial fluid PLA.sub.2, it was necessary to
identify human cell lines which express the appropriate isoenzymes.
Over twenty human cell lines were screened for the presence of
SF-PLA.sub.2 by Northern blot analysis and polymerass chain
reaction. Two Cell lines were identified as expressing the
SF-PLA.sub.2, A431 cells and primary human keratinocytes. As
predicted from the cDNA sequence of SF-PLA.sub.2, (FIG. 4), both
cell lines secrete PLA.sub.2 enzyme into the medium. The PLA.sub.2
enzyme activity may be measured by either the E. coli assay or
1-palmitoyl, 2-.sup.14 C-arachidonyl phosphatidylethanolamine, as
described in Example 11. The pH optima, calcium requirements, and
substrate specificity for the secreted enzymes were the same as
previously reported for the SF-PLA.sub.2 (Kramer, et al., J. Biol.
Chem., 264:5768-5775).
Reverse phase HPLC analysis of the tissue culture supernatant
indicated that only one PLA.sub.2 isoenzyme is secreted from A431
cells. Cell culture supernatant was clarified by centrifugation at
14,000.times. g for 10 minutes. The clarified supernatant (2 ml)
was applied to a C.sub.4 silica matrex column equilibrated with
0.1% TFA. Protein was eluted from the column with a linear 60 ml 0%
to 100% acetonitrile gradient at 1 ml/min. Fractions were collected
(1 ml) and assayed for PLA.sub.2 enzyme activity, as described in
Example 11. The results demonstrate that only one PLA.sub.2 enzyme
is secreted from A431 cells (FIG. 14). Therefore, an assay which
could be used to test antisense oligonucleotide inhibition of
SF-PLA.sub.2 synthesis would be to treat A431 cells grown to
confluence in 24 well plates with 1 .mu.M oligonucleotide plus 40
.mu.M DOTMA in serum free medium for six hours. The medium is
replaced with DMEM medium containing 1 mg/ml bovine serum albumin
and 10 .mu.M oligonucleotide. The amount of PLA.sub.2 secreted into
tissue culture medium 24 hours after addition of DMEM containing 1
mg/ml BSA would be determined as described in Example 11.
We have demonstrated that interferon-.gamma., but not interleukin
1.beta., tumor necrosis factor-.alpha., or forskolin plus isobutyl
methylxanthanine, increased the secretion of SF-PLA.sub.2 into the
medium, measured in counts per minute, cpm (FIG. 15). Supporting
our finding that interferon-.gamma. increases PLA.sub.2 synthesis
is the presence of an interferon regulatory element in the 5'-
nontranscribed region of the SF-PLA.sub.2 gene. Antisense
oligonucleotides could, therefore, be used to inhibit the release
of PLA.sub.2 from interferon-.gamma. treated human keratinocytes.
The cells, grown in 24-well plates, would be treated with 1 .mu.M
antisense oligonucleotide plus 32 .mu.M DOTMA in serum-free medium
for 4 hours. Following the 4 hr treatment in serum free medium, the
medium would be replaced with KGM (Clonetics, San Diego, Calif.)
and 5 .mu.M oligonucleotide and incubated for an additional 3
hours. Interferon-.gamma. would be added to the cells (300
units/ml) and the amount of PLA.sub.2 enzyme activity secreted from
the cells would be determined 24 hr following the addition of
interferon-.gamma..
The fact that we have been able to detect SF-PLA.sub.2 secretion
from a human epidermal carcinoma cell line (A431 cells) and primary
human epidermal keratinocytes suggests that antisense
oligonucleotides which inhibit SF-PLA.sub.2 expression would be
useful in the treatment of inflammatory disorders of the skin. In
addition, we have found that interferon-.gamma. induces PLA.sub.2
release from human keratinocytes, possibly mediating in part the
inflammatory activity of interferon-.gamma. in the skin.
The following oligonucleotides or oligonucleotide analogs would be
useful in inhibiting SF-PLA.sub.2 expression. ##STR8##
Example 11
In vitro biochemical assays for PLA.sub.2 enzyme activity are
relatively easy assays to perform and can be configured to a high
throughput assay. The most common assays measure the release of
radiolabeled fatty acid from either E. coli prelabelled with
.sup.14 C-fatty acid (Franson et al., J. Lipid Res., 19:18-23,
1978) or pure phospholipid substrates (Bennett et al., Biochem.
Pharm., 36:733-740, 1987). Cellular assays for PLA.sub.2 measure
the release of fatty acids from cells prelabelled with
radiolabelled arachidonic acid. Alternatively, in those cell
systems which secrete PLA.sub.2 into the extracellular medium,
PLA.sub.2 may be detected by a direct enzyme assay of the culture
medium, as described above. We have identified expression of human
synovial fluid PLA.sub.2 (human SF-PLA.sub.2) in the human
epidermal carcinoma cell line A431.
A predicted result from an experiment treating A431 cells with an
antisense oligonucleotide is described below. A431 cells are plated
in 100 mm petri dishes and allowed to obtain confluence. The cells
are treated with 1, 10, and 50 .mu.M antisense oligonucleotide
containing the sequence 5'GGTCTTCATGGTAAGAGTTCTTGG-3' for 36 hours
at 37.degree. C. Phospholipase A.sub.2 enzyme activity was measured
in crude cellular homogenates by the release of arachidonic acid
from 1-acyl-2-[1-.sup.14 C]arachidonyl phosphatidylethanolamine (25
.mu.M final concentration in 1 mg/ml deoxycholate). Antisense
oligonucleotide reduced phospholipase A.sub.2 enzyme activity to
3%, 60%, and 95% of control, following treatment with 1 .mu.M, 10
.mu.M, and 50 .mu.M, respectively.
Example 12
In vivo assays for PLA.sub.2 have not been well defined. One assay
which is gaining popularity as a screen for PLA.sub.2 inhibitors is
the direct injection of purified PLA.sub.2 into a rat paw. The
resulting edema is quantitated as a measure of PLA.sub.2 activity.
This assay would be inappropriate as an antisense assay.
Alternative assays which may prove useful for identify antisense
oligonucleotides which inhibit the synthesis of PLA.sub.2 include
glycogen-induced ascites in rabbits, casein-induced peritonitis in
rats, and gram negative septic shock in rabbits. In each of the
model systems, an elevation of PLA.sub.2 in the extracellular fluid
has been documented.
Example 13
5-Lipoxygenase activating protein may be directly assayed by
quantitating the amount of immunoreactive protein using an ELISA
assay. Antibodies prepared against FLAP expressed in E. coli are
used for the assay. E. coli expressed FLAP is also used as the
standard to quantitate the assay. For the assay, HL-60 cells are
treated with antisense oligonucleotides for 24 to 72 hours. The
cells are disrupted by sonication and centrifuged at 5000.times. g
for 15 minutes. The supernatant fraction are centrifuged at
100,000.times. g for 1 hour and the 100,000.times. g pellet
extracted with 1% CHAPS detergent in 50 mM Tris-HCl, 140 mM NaCl,
0.5 mM DTT; pH=7.4. The solubilized membrane protein are used in a
competitive ELISA assay. Recombinant FLAP (25 ng) is bound to each
well of a microtiter plate overnight at 4.degree. C. The wells of
the plate are then blocked for 90 minutes with 5% goat serum in 20
mM Tris-HCl; pH=7.4, 150 mM NaCl (TBS). The cell extracts or
purified FLAP standard are incubated with a 1:2000 dilution of FLAP
polyclonal antibody in a total volume of 100 .mu.L for 90 minutes.
The wells are washed with TBS containing 0.05% tween 20 (TBST) and
incubated with a 1:1000 dilution of biotinylated conjugated goat
anti-rabbit IgG for 1 hour. The plates are washed with TBST again
and incubated with a 1:1000 dilution of peroxidase conjugated
streptavidin for 1 hour. The plates are washed again with TBST and
the amount of peroxidase labelled streptavidin bound to the plates
quantitated by development with tetramethylbenzidine.
Example 14
Inhibition of 5-lipoxygenase activating protein (FLAP) activity
with antisense oligonucleotides may also be detected by inhibition
of calcium ionophore induced translocation of 5-lipoxygenase from
the cytosol to the membrane fraction of cells, and a subsequent
inhibition of leukotriene formation. For the assay, differentiation
of HL-60 cells model are used, as described under Example 1.
Antisense oligonucleotides which hybridize to FLAP mRNA are added
to the culture of HL60 cells at the time DMSO is added to
differentiate the cells. The cells are assayed for FLAP activity 48
to 72 hours following the addition of DMSO to the culture medium.
The cells are stimulated with 10 .mu.M calcium ionophore for 15
minutes at 37.degree. C. The cells are collected by centrifugation
at 1000.times. g for 10 minutes. The amount of leukotriene B.sub.4
synthesized by the cells and released into the supernatant is
determined by radioimmunoassay, as described in Example 1. The cell
pellet is washed one time with phosphate buffered saline and the
cells disrupted by sonication, as described in Example 4. The
5000.times. g supernatant is centrifuged at 100,000.times. g for 1
hour and the amount of 5-lipoxygenase associated with the membrane
fraction (100,000.times. g pellet) determined by Western blotting.
Cytosolic and membrane proteins (100 .mu.g each) are resolved on a
SDS-polyacrylamide gel, transferred to nitrocellulose paper and
incubated with 5-lipoxygenase antibody, followed by .sup.125
I-protein A (Bennett and Crooke, J Biol Chem., 262:18789-13797
1987). The nitrocellulose paper is then exposed for autoradiography
and the amount of 5-lipoxygenase in each cellular fraction
determined by scanning the autoradiographs by laser
densitometry.
Example 15
Leukotriene A.sub.4 hydrolase is determined by a direct enzyme
assay of cytosolic fraction of cells treated with antisense
oligonucleotides, as described by Ohishi et al. (J. Biol. Chem.,
262:10200-10205, 1987). Briefly, HL-60 cells treated with antisense
oligonucleotides are disrupted by sonication and cytosolic fraction
isolated by centrifugation at 100,000.times. g for 1 hour. The
reaction mixture contains 100 mM Tris-HCl buffer (pH=7.8) and
enzyme in a total volume of 50 .mu.L. After preincubating the
enzyme for 3-4 minutes at 37.degree. C., leukotriene A.sub.4 in
ethanol containing lithium hydroxide was added to a final
concentration of 75 .mu.M and a final ethanol concentration of 2%.
The enzyme was incubated for 1 minute at 37.degree. C. and the
reaction terminated by the addition of 100 .mu.L of
acetonitrile/methanol/acetic acid, 150:50:3 (v/v/v) containing 0.3
nmol prostaglandin B.sub.2 as an internal standard. Protein is
precipitated by incubation at -20.degree. C. for 30 minutes
followed by centrifugation at 10,000.times. g for 10 minutes. A 120
.mu.L aliquot of the supernatant was removed and 20 .mu.L of 0.35%
disodium EDTA is added. The amount of leukotriene B4 formed in 50
.mu.L aliquot of the resulting solution is determined by reverse
phase HPLC using a C.sub.18 column. Samples are eluted
isocratically with solvent containing
acetonitrile/methanol/water/acetic acid (3:1:3:0.006, v/v/v/v,
0.05% disodium EDTA). The absorbance at 270 nm is monitored to
quantitate the amount of leukotriene B.sub.4 formed.
A predicted result from treatment of HL60 cells with a
phosphorothioate antisense oligonucleotide having the following
sequence 5'-TATCTCGGGCATGGCTCTGGG-3' hybridizing to sequences
corresponding to the initiation of translation for leukotriene
A.sub.4 hydrolase is described. Cells were treated with 10 .mu.M,
30 .mu.M, and 75 .mu.M oligonucleotide for 36 hours. The cells were
harvested and the amount of LTA.sub.4 hydrolase quantitated, as
previously described. Treatment with antisense oligonucleotide
reduced LTA.sub.4 hydrolase enzyme activity by 0%, 15%, and 45%,
respectively.
Example 16
Assays for PI-PLC enzyme activity in cell extracts utilize
radiolabeled phosphoinositides as substrates which are commercially
available (Hoffman and Majerus, J. Biol. Chem., 257:6461-6469,
1982). Enzyme assays for PI-PLC can be easily configured to high
throughout assays. However, enzymatic assays do not discriminate
for effects of compounds on specific PI-PLC isoenzymes, but
instead, measure total PI-PLC activity in cellular extracts. To
determine the effects of antisense oligonucleotides on a specific
PI-PLC isoenzyme, it will be necessary to utilize an immunochemical
assay. Antibodies specific for PI-PLC-.delta.2 are prepared by
immunizing rabbits with a peptide such as NH.sub.2
-SKRKSTPERRTVQVT-COOH or similar peptides specific for
PI-PLC-.delta.2 conjugated to keyhole limpet hemocyanin. The
antibodies are used in a competitive ELISA assay, as described in
Example 9.
Example 17
PI-PLC enzyme activity in intact cells can be directly measured by
quantitating the formation of 3H-inositol phosphates, following
agonist stimulation in cells prelabelled with 3H-inositol. For
screening for effects of antisense oligonucleotides on
PI-PLC-.delta.2 expression, HL-60 cells will be used. The cells are
labeled with 20 .mu.Ci/ml .sup.3 H-myoinositol for 36 hours at
37.degree. C. The antisense oligonucleotide which specifically
hybridizes to PI-PLC-.delta.2 mRNA such as
5'-GTGGTGGACATTGTGGCCGCT-3' is added to the cells during the 36
hour labelling with .sup.3 H-myoinositol. The cells are washed with
Hank's balanced salt solution (HBSS) to remove unincorporated
.sup.3 H-myoinositol and resuspended at a final concentration of
5.times.10.sup.6 cells/mi. Cells (0.3 ml) are then stimulated with
the appropriate agonist (fMet-Leu-Phe, epidermal growth factor,
GM-CSF. gamma-interferon, platelet derived growth factor,
leukotriene D.sub.4, etc.) for 2 min. at 37.degree. C. Water
soluble inositol phosphates are extracted with 0.93 ml
chloroform/methanol (1:2, v/v), followed by 0.3 ml chloroform and
0.3 ml water. Inositol phosphates are separated by chromatography
on Dowex AG1XS, as previously described (Betridge et al., Blochem.
J., 212:473-482, 1983).
Active compounds in the cell based assays can then be tested for
activity in a variety of standard pharmacological assays, such
carrageenan induced peritonitis, arachidonic acid induced
inflammation in mice ears, etc.
Example 18
Coenzyme A-independent transacylase enzyme activity may be measured
in microsomal fraction from cells treated with antisense
oligonucleotides using .sup.3 H-1-alkyl lysophosphatidylcholine as
a substrate. We have identified that the human promonocytic
leukemia cell line, U937, is a good source for measuring coenzyme
A-independent transacylase activity. Following treatment, for
various periods of time cells are washed in phosphate buffered
saline then suspended in 10 mM bis Tris; pH=7.0, 10 mM NaCl, 2 mM
EGTA, 1 mM MgCl.sub.2, 0.1 mM leupeptin, and 10 .mu.g/ml aprotinin
at a concentration of 10.sup.7 cells/ml. The cells are disrupted by
sonication 30% power and microsomal fraction obtained by
differential centrifugation. The crude homogenate is centrifuged at
10,000.times. g for 20 min, the supernatant is then centrifuged at
100,000.times. g for 60 min. The 100,000.times. g pellet is
resuspended in 10 mM phosphate, 150 mM NaCl; pH=7.4 and used for
the assays. Between 10 and 50 .mu. g of protein were incubated with
1 .mu.M .sup.3 H-1-O-alkyl lysophosphatidylcholine, 1 mg/ml bovine
serum albumin in a total volume of 100 .mu.L for 10 minutes at
37.degree. C. The reactions were terminated by the sequential
addition of 100 .mu.L chloroform:methanol (1:2), 100 .mu.L
chloroform, and 100 .mu.L of 1 M KCl. The samples are vortexed and
centrifuged at 10,000.times. g for 4 minutes. The material in the
organic phase is spotted onto silica gel G plates and
chromatographed using a solvent containing
chloroform:methanol:acetic acid:water (100:60:16:8). The plates are
stained with iodine vapor, the band corresponding to 1-alkyl,
2-arachidonyl phosphatidylcholine collected, and the amount of
radioactive material determined in a liquid scintillation
counter.
An expected result from treating U937 cells with an antisense
phophorothioate oligonucleotide directed against coenzyme
A-independent transacylase is described below. U937 cells are
treated with 1, 10, and 50 .mu.M antisense oligonucleotide 20 bases
in length containing the sequence CAT at position 10-12,
corresponding to the initiation of translation for 72 hours at
37.degree. C. The cells are harvested and analyzed for coenzyme
A-independent transacylase activity, as described above. Treatment
with the drug at concentrations of 1, 10, and 50 .mu.M reduced
coenzyme A-independent transacylase activity by 4%, 22% and 72%,
respectively.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 14 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:1: AAGGCATGGCTCTGGGAAGTG21 (2)
INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 25 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:2: ACATGGGCTACCAGCAGCTGGGTGG25 (2) INFORMATION FOR SEQ ID
NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv)
ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TTGACTCTGTCACTCAAGAG20 (2) INFORMATION FOR SEQ ID NO:4: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:4: GGAAGGCATGGCTCTGGGAA20 (2)
INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:5: GCCTGCCCAGAGAGCTGCTG20 (2) INFORMATION FOR SEQ ID
NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv)
ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GGAAGATCTACAGCCTGCCA20 (2) INFORMATION FOR SEQ ID NO:7: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:7: TTCATGGTAAGAGTTCTTGGG21 (2)
INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:8: TCTGCCCCGGCCGTCGCTCCC21 (2) INFORMATION FOR SEQ ID
NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE:
nucleic acid (C ) STRANDEDNESS: single (D) TOPOLOGY: linear (iv)
ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CAAAGATCATGATCACTGCCA21 (2) INFORMATION FOR SEQ ID NO:10: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:10: TCCCATGGGCCTGCAGTAGGC21 (2)
INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:11: CCTGCAGTAGGCCTGGAAGGA21 (2) INFORMATION FOR SEQ ID
NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv)
ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GGAAGGTTTCCAGGGAAGAGG21 (2) INFORMATION FOR SEQ ID NO:13: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:13: CAGAGGACTCCAGAGTTGTAT21 (2)
INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:14: GGGTGGGTATAGAAGGGCTCC21
__________________________________________________________________________
* * * * *