U.S. patent number 5,523,209 [Application Number 08/214,770] was granted by the patent office on 1996-06-04 for methods for identifying inhibitors of integrin activation.
This patent grant is currently assigned to The Scripps Research Institute. Invention is credited to Mark H. Ginsberg, Timothy E. O'Toole.
United States Patent |
5,523,209 |
Ginsberg , et al. |
June 4, 1996 |
**Please see images for:
( Certificate of Correction ) ** |
Methods for identifying inhibitors of integrin activation
Abstract
The invention features a method for inhibiting the ligand
binding of an integrin in a cell involving introducing into the
cell a compound which inhibits integrin activation, a method for
identifying compounds which inhibit integrin activation, and
chimeric integrin molecules.
Inventors: |
Ginsberg; Mark H. (San Diego,
CA), O'Toole; Timothy E. (San Diego, CA) |
Assignee: |
The Scripps Research Institute
(LaJolla, CA)
|
Family
ID: |
22800356 |
Appl.
No.: |
08/214,770 |
Filed: |
March 14, 1994 |
Current U.S.
Class: |
435/7.2; 435/7.1;
435/7.8; 436/501 |
Current CPC
Class: |
C07K
14/70557 (20130101); C07K 16/2848 (20130101); G01N
33/68 (20130101); G01N 2500/00 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/705 (20060101); C07K
16/28 (20060101); C07K 16/18 (20060101); G01N
33/68 (20060101); G01N 033/53 () |
Field of
Search: |
;435/7.1,7.2,69.7
;436/501 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Adams, et al., Changes in Keratinocyte Adhesion During Terminal
Differentiation: Reduction in Fibronectin Binding Precedes
.alpha..sub.5 .beta..sub.1 Integrin Loss from the Cell Surface,
Cell 63:425-435 (1990). .
Albelda, et al., Integrins and other cell adhesion molecules,
FASEB, J. 4:2868-2880 (1990). .
Altieri, Occupancy of CD11b/CD18 (Mac-1) Divalent Ion Binding
Site(s) Induces Leukocyte Adhesion, The Journal of Immunology
147:1891-1898 (1991). .
Altieri, et al., Oligospecificity of the Cellular Adhesion Receptor
MAC-1 Encompasses an Inducible Recognition Specificity for
Fibrinogen, The Journal of Cell Biology 107:1893-1900 (1988). .
Bennett, et al., Exposure of Platelet Fibrinogen Receptors by ADP
and Epinephrine, J. Clin. Invest. 64:1393-1401 (1979). .
Bennett, et al., Interaction of Fibrinogen with Its Platelet
Receptor, The Journal of Biological Chemistry 263:12948-12953
(1988). .
Bosco, et al., Multiple Functional Forms of the Integrin VLA-2 Can
be Derived from a Single .alpha..sup.2 cDNA Clone: Interconversion
of Forms . . . The Journal of Cell Biology 120:537-543 (1993).
.
Burger, et al., Induced Cell Surface Expression of Functional
.alpha..sub.2 .beta..sub.1 Integrin during Megakaryocytic
Differentiation of K562 Leukemic Cells, Experimental Cell Research
201:28-35 (1992). .
Conforti, et al., Modulation of Vitronectin Receptor Binding by
Membrane Lipid Composition, The Journal of Biological Chemistry
265:4011-4019 (1990). .
Danilov, et al., Phorbol Ester Modulation of Integrin-mediated Cell
Adhesion: A Postreceptor Event, The Journal of Cell Biology
108:1925-1933 (1989). .
Du, et al., Ligands "Activate" Integrin .alpha..sub.IIb
.beta..sub.3 (Platelet GPIIb-IIIa), Cell 65:409-416 (1991). .
Dustin, et al., Regulation of Locomotion and Cell-Cell Contact Area
by the LFA-1 and ICAM-1 Adhesion Receptors, The Journal of
Immunology 148:2654-2663 (1992). .
Elices, et al., The human integrin VLA-2 is a collagen receptor on
some cells and a collagen/laminin receptor on others, Proc. Natl.
Acad. Sci. USA 86:9906-9910 (1989). .
Faull, et al., Affinity Modulation of Integrin .alpha.5.beta.1:
Regulation of the Functional Response by Soluble Fibronectin, The
Journal of Cell Biology 121:155-162 (1993). .
Frelinger, et al., Monoclonal Antibodies to Ligand-occupied
Comformers of Integrin .alpha..sub.IIb .beta..sub.3 (Glycoprotein
IIb-IIIa) Alter . . . The Journal of Biological Chemistry
266:17106-17111 (1991). .
Frelinger, et al., Selective Inhibition of Integrin Function by
Antibodies Specific for Ligand-occupied Receptor Conformers, The
Journal of Biological Chemistry 265:6346-6352 (1990). .
Gailit, et al., Regulation of the Fibronectin Receptor Affinity by
Divalent Cations, The Journal of Biological Chemistry
263:12927-12932 (1988). .
Ginsberg, et al., The Mechanism of Thrombin-Induced Platelet Factor
4 Secretion, Blood 55:661-668 (1980). .
Ginsberg, et al., Inside-out Integrin signaling, Current Opinion in
Cell Biology 4:766-771 (1992). .
Grant, et al., Effects of Chymotrypsin on the Release Reaction and
Aggregation of Blood Platelets, Proceedings of the Society for
Experimental Biology and Medicine 165:114-117 (1980). .
Hemler, VLA Proteins in the Integrin Family, Structures, Functions,
and Their Role on Leukocytes, Annu. Rev. Immunol. 8:365-400 (1990).
.
Hermanowski-Vosatka, et al., Integrin Modulating Factor-1: A Lipid
That Alters the Function of Leukocyte Integrins, Cell 68:341-352
(1992). .
Hynes, Integrins: Versatility, Modulation, and Signaling in Cell
Adhesion, Cell 69:11-25 (1992). .
Hynes, et al., Integrin Heterodimer and Receptor Complexity in
Avian and Mammalian Cells, The Journal of Cell Biology, 109:409-420
(1989). .
Kirchhofer, et al., Cation-dependent Changes in the Binding
Specificity of the Platelet Receptor GPIIb/IIIa, The Journal of
Biological Chemistry 265:18525-18530 (1990). .
Kovach, et al., A Monoclonal Antibody to .beta..sub.1 Integrin
(CD29) Stimulates VLA-dependent Adherence of Leukocytes to Human
Umbilical Vein . . . The Journal of Cell Biology 116:499-509
(1992). .
Kunkel, Rapid and efficient site-specific mutagenesis without
phenotypic selection, Proc. Natl. Acad. Sci. USA 82:488 -492
(1985). .
Loftus, et al., A .beta..sub.3 Integrin Mutation Abolishes Ligand
Binding and Alters Divalent Cation-Dependent Conformation, Science
249:915-918 (1990). .
Masumoto et al, Multiple Activation States of VLA-4, The Journal of
Biological Chemistry 268:228-234 (1993). .
Munson, et al., Ligand: Versatile Computerized Approach for
Characterization of Ligand-Binding Systems, Analytical Biochemistry
107:220-239 (1980). .
Neugebauer, et al., Cell-surface regulation of .beta..sub.1
-integrin activity on developing retinal neurons, Nature 350:68-71
(1991). .
O'Toole, et al., Modulation of the Affinity of Integrin
.alpha..sub.IIb .beta..sub.3 GPIIb-IIIa) by the Cytoplasmic Domain
of .alpha..sub.IIb, Science 254:845-847 (1991). .
O'Toole, et al., Affinity modulation of the .alpha..sub.IIb
.beta..sub.3 integrin (platelet GPIIb-IIIa) is an intrinsic
property of the receptor, Cell Regulation 1:883t14 893 (1990).
.
O'Toole, et al., Efficient Surface Expression of Platelet
GPIIb-IIIa Requires Both Subunits, Blood 74:14-18 (1989). .
Plow, et al., Related Binding Mechanisms for Fibrinogen,
Fibronectin, von Willebrand Factor, and Thrombospondin on
Thrombin-Stimulated Human Platelets, Blood 66:724-727 (1985). .
Ruoslahti, Integrins, J. Clinical Investigation 87:1-5 (1991).
.
Smyth, et al., Fibrinogen Binding to Purified Platelet Glycoprotein
IIb-IIIa (Integrin .alpha..sub.IIb .beta..sub.3 is Modulated by
Lipids, The Journal of Biological Chemistry 267:15568-15577 (1992).
.
Springer, Adhesion receptors of the immune system, Nature
346:425-434 (1990). .
Weitzman, et al., The Function and Distinctive Regulation of the
Integrin VLA-3 in Cell Adhesion, Spreading, and Homotypic Cell
Aggregation, The journal of Biological Chemistry 268:8651-8657
(1993). .
Werb, et al., Signal Transduction through the Fibronectin Receptor
Induces Collagenase and Stromelysin Gene Expression, The Journal of
Cell Biology 109:877-889 (1989). .
Ylanne, et al., Distinct Functions of Integrin .alpha. and .beta.
Subunit Cytoplasmic Domains in Cell Spreading and Formation of
Focal Adhesions, The Journal of Cell Biology 122:223-233 (1993).
.
Zucker, et al., Platelet Activation, Arteriosclerosis 5:2-18
(1985). .
O'Toole et al, J. Cell Biol. 124 1047-1059 (1994). .
Picker et al, Eur. J. Immunol. 23 2751-2757 (1993)..
|
Primary Examiner: Draper; Garnette D.
Assistant Examiner: Brown; Karen E.
Attorney, Agent or Firm: Fish & Richardson
Government Interests
This invention was supported in part by the U.S. Government under
grant numbers HL48728, HL28235, and AR27214 awarded by the National
Institute of Health. The Government has certain rights in the
invention.
Claims
What is claimed is:
1. A method of measuring the ability of a candidate compound to
inhibit activation of a target integrin mediated by the cytoplasmic
domain of said target integrin, said method comprising the steps
of:
(a) providing a cell expressing a chimeric integrin comprising the
extracellular and transmembrane domains of a reporter integrin
fused to the cytoplasmic domain of said target integrin;
(b) culturing said cell in the presence of said candidate compound
and under conditions in which said chimeric integrin would be
activated in the absence of an inhibitor of integrin
activation;
(c) contacting said cell with a ligand that binds to said reporter
integrin, only when said reporter integrin is activated; and
(d) determining the level of said ligand bound to said reporter
integrin, wherein a decrease in ligand binding indicates that the
compound is an inhibitor of activation of said target integrin; and
(e) determining the level of said ligand bound to said reporter
integrin in the presence of an activating antibody, wherein an
increase in ligand binding in the presence of the activating
antibody compared to the ligand binding in the absence of the
activating antibody indicates that the candiate compound is an
inhibitor of activation of said target integrin.
2. The method of claim 1, wherein said reporter integrin is
.alpha..sub.IIb .beta..sub.3.
3. The method of claim 2, wherein the subunit of said target
integrin is .alpha..sub.5, .alpha..sub.2, .alpha..sub.6a, or
.alpha..sub.6b.
4. The method of claim 3, wherein the .beta. subunit of said target
integrin is .beta..sub.3.
5. The method of claim 2, wherein said target integrin is
.alpha..sub.5 .beta..sub.1.
6. The method of claim 1, wherein said target integrin is selected
from the group consisting of .alpha..sub.v .beta..sub.3,
.alpha..sub.M .beta..sub.2, .alpha..sub.L 2, .alpha..sub.2
.beta..sub.1, .alpha..sub.5 .beta..sub.1, .alpha..sub.6A
.beta..sub.1, .alpha..sub.6B .beta..sub.1, .alpha..sub.IIb
.beta..sub.3, and .alpha..sub.4 .beta..sub.1.
7. The method of claim 1, wherein said ligand is an antibody.
8. The method of claim 7, wherein said antibody is PACl.
9. The method of claim 1, wherein said ligand is fibrinogen.
Description
BACKGROUND OF THE INVENTION
Cells alter their adhesiveness in response to developmental events
and environmental cues. These adaptations are often mediated
through integrins, adhesion receptors composed of two transmembrane
subunits, .alpha. and .beta. (Hynes, Cell 69:11-25, 1992). Rapid
changes in integrin function are critical in cell migration,
cellular aggregation, and leukocyte transmigration during
inflammation (Hynes, Cell 69:11-25, 1992; Albelda and Buck, FASEB
4:2868-2880, 1990; Hemler, Annu. Rev. Immunol. 8:365-400, 1990;
Dustin et al., J. Immunol. 148:2654-2663, 1992; Springer, Nature
346:425-434, 1990; Ginsberg et al., Curr. Opin. Cell Biol.
4:766-771, 1992; Ruoslahti, J. Clin. Invest. 87:1-5, 1991). A given
integrin may also manifest varying adhesive competence depending on
its cellular environment (Chan and Hemler, J. Cell. Biol.
120:537-543, 1993; Masumoto and Hemler, J. Biol. Chem. 268:228-234,
1993; Weitzman et al., J. Biolo Chem. 268:8651-8657, 1993; Elices
and Hemler, Proc. Natl. Acad. Sci. USA 86:9906-9910, 1989;
Kirchofer et al., J. Biol. Chem. 265:18525-18530, 1990), or the
state of differentiation of the cell in which it is expressed
(Haimovich et al., Cell Regulation 2:271-283, 1991; Neugebauer and
Reichardt, Nature 350:68-71, 1991; Adams and Watt, Cell 63:425-435,
1990; Chan and Hemler, J. Cell Biol. 120:537-543, 1993). Such
variations in function may be due to changes in ligand binding
affinity as occurs with certain .beta..sub.3 (Bennett and Vilaire,
J. Clin. Invest. 64:1393-1401, 1979), .beta..sub.2 (Altieri et al.,
J. Cell Biol. 107:1893-1900, 1988), and .beta..sub.1 (Faull et al.,
J. Cell Biol. 121:155-162, 1993) integrins. Changes in adhesive
function may also occur without changes in ligand binding affinity.
For example, phorbol esters stimulate the .alpha..sub.5
.beta..sub.1 -dependent adhesion of Chinese Hamster ovary cells
(Danilov and Juliano, J. Cell. Biol. 108:1925-1933, 1989) to
fibronectin (Fn) with no change in Fn binding affinity. Similarly,
certain .beta..sub.3 mutations reduce .alpha..sub.IIb .beta..sub.3
-dependent cell adhesion to fibrinogen (Fg) without changing Fg
binding affinity (Ylanne et al., J. Cell Biol. 122:223-233, 1993).
Such affinity-independent changes in integrin function are ascribed
to "post receptor occupancy events" (Danilov and Juliano, J. Cell.
Biol. 108:1925-1933, 1989). Nevertheless, the host cell governs the
capacity of solubilized recombinant .alpha..sub.2 .beta..sub.1 to
bind to collagen sepharose (Chan and Hemler, J. Cell. Biol.
120:537-543, 1993). This last result suggests that some cell
type-specific differences in integrin function may be due to
differences in ligand binding affinity.
A variety of in vitro treatments may alter integrin affinity. When
purified .alpha..sub.IIb .beta..sub.3 is pretreated with RGD
peptides, it subsequently binds Fg and PACl (Duet al., Cell
65:409-416, 1991; Smyth et al., J. Biol. Chem. 267:15568-15577,
1992). Certain anti-.beta..sub.3 antibodies directly increase the
Fg binding affinity of .alpha..sub.IIb .beta..sub.3 (Frelinger et
al., J. Biol. Chem. 266:17106-17111, 1991) and certain
anti-.beta..sub.1 antibodies activate .alpha..sub.5 .beta..sub.1 to
bind Fn with high affinity (Faull et al., J. Cell Biolo
121:155-162, 1993). Changes in the divalent cation composition of
the extracellular medium, proteolytic digestion, and treatment with
reducing agents may also "activate" integrins (Kirchofer et al., J.
Biol. Chem. 265:18525-18530, 1990; Gailit and Ruoslahti, J. Biol.
Chem. 263:12927-12932, 1988; Altieri, J. Immunol. 147:1891-1898,
1991; Masumoto and Hemler, J. Biol. Chem. 268:228-234, 1993;
Weitzman et al., J. Biol. Chem. 268:8651-8657, 1993; Zucker and
Nachmias, Arteriosclerosis 5:2-18, 1985; Grant and Zucker, Proc.
Soc. Exp. Biol. Med. 165:114-117, 1980). Thus, moieties that
interact with the extracellular domain can modulate integrin
affinity. Furthermore, lipid environment can alter the ligand
binding capacity of an integrin (Smyth et al., J. Biol. Chem.
267:15568-15577, 1992; Conforti et al., J. Biol. Chem.
265:4011-4019, 1990) and an apparently novel lipid, IMF-1, may
regulate .alpha..sub.M .beta..sub.2 (Hermanowski-Vosatka et al.,
Cell 68:341-352, 1992). Although many treatments may change
integrin affinity in vitro, the mechanism(s) of physiological
modulation has not been defined.
SUMMARY OF THE INVENTION
We have shown that the cytoplasmic domain of integrin molecules is
involved in modulating the ligand binding activity of the integrin
extracellular domain.
Accordingly, the invention features, in one aspect, a method for
measuring the ability of a candidate compound to inhibit activation
of a target integrin. In this method, a cell expressing a chimeric
integrin is cultured in the presence of the candidate compound. The
cell is then contacted with a ligand that binds to the reporter
integrin only when the reporter integrin is activated. The level of
ligand bound to the chimeric integrin in the presence of the
candidate compound is a measure of the ability of the candidate
compound to inhibit activation of the target integrin. In a
preferred embodiment, the reporter integrin is .alpha..sub.IIb
.beta..sub.3. In another preferred embodiment, the target integrin
is selected from the group consisting of .alpha..sub.v
.notident..sub.3, .alpha..sub.M .beta..sub.2, .alpha..sub.L
.beta..sub.2, .alpha..sub.2 .beta..sub.1, .alpha..sub.5
.beta..sub.1, .alpha..sub.6A .beta..sub.1, .alpha..sub.6B
.beta..sub.1, .alpha..sub.IIb .beta..sub.3, and .alpha..sub.4
.beta..sub.1.
"Integrin activation" as used herein, is defined as the process
whereby the cytoplasmic domain of the integrin stimulates the
ligand binding activity of the extracellular domain.
A "chimeric integrin", as used herein, is defined as an integrin
comprising the extracellular and transmembrane domains from a
reporter integrin and the cytoplasmic domain from a target
integrin. Accordingly, "reporter integrin" is defined as an
integrin from which the extracellular and transmembrane domains of
a chimeric integrin are derived, while "target integrin" is defined
as an integrin from which the cytoplasmic domain of a chimeric
integrin is derived.
The ligand used in the screening method of the invention can be any
molecule, e.g., an antibody, that binds to the reporter integrin
only when the reporter is activated. In the case of the
.alpha..sub.IIb .beta..sub.3 reporter integrin, the ligand is
preferably the PACl antibody or fibrinogen.
The cell used in the screening method of the invention is
preferably one in which the target integrin is naturally expressed
and activated. Cell types that can be used in the invention
include, but are not limited to, leukocytes, fibroblasts, and
cancer cells. Specific examples of useful cells include: Jurkat
(e.g., Jurkat clone E6-1, which can be obtained from the American
Type Culture Collection, Rockville, Md.; ATCC TIB 152), K562 (human
erythroleukemia cells; ATCC CCL 243), CHO (Chinese Hamster Ovary
cells; ATCC CCL 61), THP-1 (human monocytes; ATCC TIB 202), U937
(human histiocytic lymphoma cells; ATCC CRL 1593), WI-38 (human
lung fibroblasts; ATCC CCL 75), and MG63 (human osteosarcoma cells;
ATCC CRL 1427) cells. In addition, peripheral blood T cells and
blood platelets, both of which can be isolated by standard methods,
can be used in the invention.
In another aspect, the invention features a chimeric integrin
molecule, as defined above. Any integrin can be used as a reporter
and/or a target integrin. In a preferred embodiment, the reporter
integrin is .alpha..sub.IIb .beta..sub.3. Preferred target
integrins include, but are not limited to .alpha..sub.v
.beta..sub.3, .alpha..sub.M .beta..sub.2, .alpha..sub.L
.beta..sub.2, .alpha..sub.2 .beta..sub.1, .alpha..sub.5
.beta..sub.1, .alpha..sub.6A .beta..sub.1, .alpha..sub.6B
.beta..sub.1, .alpha..sub.IIb .beta..sub.3, and .alpha..sub.4
.beta..sub.1.
The invention also features a method of inhibiting the ligand
binding activity of an integrin molecule in a cell involving
introducing into the cell a compound which inhibits integrin
activation. Preferably, the compound used to inhibit integrin
activation is a small organic molecule, and the cell in which the
compound inhibits integrin activation is a leukocyte, a platelet,
or a cancer cell.
The inhibitors of the invention can be used to treat mammals, such
as humans, who have or are at risk of developing an unwanted immune
response, e.g., inflammation, or an immune response resulting from
autoimmune disease or the presence of a transplanted organ or
tissue. In addition, the inhibitors can be used to treat patients
who have, or are at risk of developing cancer, as well as to treat
patients who have, or are at risk of developing a thrombus.
The invention provides a rapid and facile method for identifying
inhibitors of integrin activation in which a large number of
compounds can be screened. The use of chimeric integrins allows
inhibitors for target integrins to be identified even in cases in
where an activation-specific ligand for the target integrin has not
been identified. .alpha..sub.IIb .beta..sub.3 is a particularly
useful reporter integrin, as the activation-specific ligands for
.alpha..sub.IIb .beta..sub.3, PACl and Fg, do not bind to other
commonly expressed tissue integrins.
Other features and advantages of the invention will become apparent
from the following detailed description, and from the claims.
DETAILED DESCRIPTION
The drawings are first described.
Drawings
FIG. 1A is a graph showing the levels of fibronectin bound to CHO
cells, K562 cells, and K562 cells in the presence of the
"activating" antibody 8A2. The graph also shows the levels of
fibronectin bound to the above-listed cells in the presence of an
anti-.alpha..sub.5 antibody.
FIG. 1B is a graph of results from flow cytometry analysis of K562
and CHO cells stained with an irrelevant mouse IgG (dotted line),
an anti-.beta..sub.1 antibody (solid line), and an
anti-.alpha..sub.5 antibody (dashed line).
FIG 1C is a graph showing the levels of fibronectin bound to
resting CHO cells; CHO cells in the presence of the
anti-.alpha..sub.5 antibody (PB1); CHO cells incubated with
deoxyglucose and sodium azide (DOG/Az); and CHO cells washed free
of deoxyglucose and sodium azide, and returned to glucose medium
(Wash+Glc).
FIG. 2 is a listing of the amino acid sequences (SEQ ID NOs: 1-12)
of wild type and variant integrin cytoplasmic domains.
FIG. 3A is a graph of results from flow cytometry analysis of CHO
and K562 cells stably transfected with chimeric integrins
containing the cytoplasmic domains of .alpha.5 and .beta..sub.1 and
the extracellular domains of .alpha..sub.IIb and .beta..sub.3.
FIG. 3B is an autoradiogram of immunoprecipitates of lysates
prepared from surface iodinated wild type K562 cells (None) or
stable K562 transfectants expressing the .alpha. subunit indicated
at the tops of the lanes (.alpha..sub.IIb .alpha..sub.5
=.alpha..sub.5 cytoplasmic domain chimera), fractionated by
SDS-PAGE. The immunoprecipitations were carried out with antibodies
specific for the specific integrin domains indicated below each of
the lanes.
FIG. 3C is an illustration of the locations of the 2bsf, 2bcyt and
.alpha..sub.5 cyt primers used for PCR analysis. The transmembrane
(TM: crosshatched), 3' untranslated (3'UT:stippled), and
cytoplasmic and extracellular domain (clear) sequences are
indicated. Also shown is a photograph of an agarose gel upon which
amplified products were fractionated, with arrows indicating the
positions of the 393 and 294 bp bands. The transfectant type is
listed above, while the 3' primer used is indicated below.
FIG. 4A is a graph of results from flow cytometry analysis of PACl
binding to stable CHO transfectants expressing the .alpha..sub.5
and .alpha..sub.1 cytoplasmic domain chimeras in the absence (solid
line) and presence (dotted line) of 2 mM GRGDSP (SEQ ID NO: 13)
(Inhibitors: deoxyglucose+NAN.sub.3).
FIG. 4B is a graph showing the levels of Fg bound to stable CHO
transfectants expressing the cytoplasmic domains indicated below
the graph.
FIG. 5A is a graph of results from flow cytometry analysis of PACl
binding to CHO cells transiently transfected with subunits
comprised of the extracellular and transmembrane domains of
.alpha..sub.IIb and .beta..sub.3 joined to the indicated
cytoplasmic domains. Binding was analyzed in the absence (solid
line) or presence (dotted line) of GRGDSP (SEQ ID NO: 13)
peptide.
FIG. 5B is a graph of results from flow cytometry analysis of PACl
binding to CHO cells CHO cell lines stably expressing recombinant
.alpha..sub.IIb .beta..sub.3 chimeras containing the indicated
cytoplasmic domains. Binding was analyzed in the absence (solid
line) or presence (dotted line) of GRGDSP (SEQ ID NO: 13)
peptide.
FIG. 6A is a graph showing the activation index for CHO cells
transiently transfected with chimeric .alpha. subunits consisting
of extracellular and transmembrane .alpha..sub.IIb with the
indicated cytoplasmic domains, and .beta..sub.3.
FIG. 6B is a graph showing the activation index for CHO cells
transiently transfected with chimeric .alpha. subunits containing
the indicated cytoplasmic sequences and a .beta..sub.3 subunit in
which the cytoplasmic domain was truncated (.beta..sub.3
.DELTA.724), contained the S.sup.752 .fwdarw.P mutation (S752P), or
had been exchanged for the homologous region of .beta..sub.1.
FIG. 7A is a series of graphs of the results of flow cytometry
analysis of PACl binding to stable CHO cell lines co-transfected
with .alpha..sub.IIb containing the indicated .alpha. cytoplasmic
domain with wild type .beta..sub.3.
FIG. 7B is a series of graphs of the results of flow cytometry
analysis of PACl binding to CHO cells transiently transfected with
chimeras of the extracellular and transmembrane domains of
.alpha..sub.IIb .beta..sub.3 joined to the indicated cytoplasmic
domains.
FIG. 8 is an illustration of a model for affinity modulation of
integrins.
INHIBITORS
We have shown that the integrin cytoplasmic domain plays a role in
activating the ligand binding activity of the integrin
extracellular domain. Integrin-ligand binding interactions play
central roles in a number of physiological processes, including
activation of the immune response, inflammation, hemostasis,
thrombosis, cell migration, and tumor cell invasion. Thus,
inhibiting integrin activation can be useful in modulating these
processes.
Inhibition of the ligand binding activity of an integrin can be
achieved by administering a compound that inhibits integrin
activation. Such a compound can be identified by methods ranging
from rational drug design to screening of random compounds. The
latter method is preferable, as a simple and rapid assay for
carrying out this method is available. Small organic molecules are
desirable candidate compounds for this analysis as frequently these
molecules are capable of passing through the plasma membrane so
that they can potentially act on integrin cytoplasmic domains.
The screening of small, membrane-permeable organic molecules for
the ability to inhibit integrin activation is carried out as
follows. First, compounds are tested in cultured cells expressing
chimeric integrin molecules. Second, compounds which test positive
in the cultured cells are tested in an animal model system.
Chimeric integrin molecules used in the cell culture-based
screening method contain the extracellular and transmembrane
domains of a reporter integrin fused to the intracellular domain of
a target integrin. The preferred reporter integrin of the invention
is .alpha..sub.IIb .beta..sub.3, as its known ligands, PACl
(Shattil et al., J. Biol. Chem. 260:11107-11114, 1985) and Fg, bind
specifically to activated .alpha..sub.IIb .beta..sub.3, and not to
inactive .alpha..sub.IIb .beta..sub.3, or other integrins. Other
integrins may also be used as reporter integrins in the invention,
provided that an activation-specific ligand is available. Preferred
target integrins include, but are not limited to .alpha..sub.v
.beta..sub.3, .alpha..sub.M .beta..sub.2, .alpha..sub.L
.beta..sub.2, .alpha..sub.2 .beta..sub.1, .alpha..sub.5
.beta..sub.1, .alpha..sub.6A .beta..sub.1, .alpha..sub.6B
.beta..sub.1, .alpha..sub.IIb .beta..sub.3 and .alpha..sub.4
.beta..sub.1. Chimeric integrins can be generated using standard
methods of molecular biology (Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd, Cold Spring Harbor Laboratory Press,
1989).
The cell culture assay for identifying inhibitors of integrin
activation involves culturing cells expressing a chimeric integrin
in the presence or absence of a candidate compound, and determining
the level of reporter integrin activation by contacting the cell
with a ligand that binds to the reporter integrin only when the
reporter integrin is activated. A compound tests positive in the
cell culture assay if the amount of ligand bound to the reporter
integrin in the presence of the compound is less than the amount
bound in its absence.
Any reagent that binds to a reporter integrin specifically when it
is activated, e.g., an activation-specific antibody, can be used as
the ligand in the screening method of the invention. In the case of
the .alpha..sub.IIb .beta..sub.3 reporter integrin, PACl and Fg are
preferable ligands. The ligand can be tagged with a label, e.g., an
enzymatic, chromogenic, radioactive, or luminescent label, which
can be detected using standard methods in the art, including flow
cytometry, direct radio-ligand binding assays, and ELISA. Binding
of the ligand to the reporter integrin can also be detected by the
use of antibodies which specifically bind to the ligand which can
be detected by standard methods.
Compounds found to affect integrin activation in the cell culture
assay can be further tested in animal model systems. A candidate
compound can be administered to an appropriate animal, e.g., an
immunocompetent mouse which has a non-MHC matched skin graft, and
the effect of the compound can be determined by monitoring the
immune response of the mouse.
Role of Cytoplasmic Tail in Integrin Activation
Cell type-specific and energy-dependent affinity modulation of
integrin .alpha..sub.5 .beta..sub.1.
There is evidence for cell type-specific control of the adhesive
function of integrins. To begin to investigate the cell
type-specific control of ligand binding affinity, we analyzed the
binding of soluble fibronectin (Fn) to cells expressing integrin
.alpha..sub.5 .beta..sub.1. The cells analyzed fell into two
groups: those that bound Fn with only low affinity (Kd>1 .mu.M),
e.g., K562, THP1, U937, and peripheral blood T cells, and those
that bound with moderate affinity (Kd.about.100 nM), e.g., CHO,
WI-38, and MG63 cells. The low affinity .alpha..sub.5 .beta..sub.1
integrin was intrinsically functional since it bound Fn after
"activation" with the 8A2 monoclonal antibody (Faull et al., J.
Cell Biol. 121:155-162, 1993). Specificity of Fn binding to high
affinity .alpha..sub.5 .beta..sub.1 was verified by inhibition with
an anti-.alpha..sub.5 antibody (FIG. 1A; .sup.125 I-Fn (50 nM) was
incubated at 22.degree. C. with CHO or K562 cells. After 30
minutes, bound Fn was assessed by centrifugation through a sucrose
cushion, as described below. .alpha..sub.5 .beta..sub.1 -specific
binding was established by blocking Fn binding to the CHO cells
with PB1, an anti-hamster .alpha..sub.5 antibody. Binding to K562
cells was induced by addition of 20 nM "activating" antibody (8A 2)
and was inhibited by the anti-.alpha..sub.5 antibody (BIIG2). The
levels of surface expression of .alpha..sub.5 .beta..sub.1 in the
two cell types was also determined (FIG. 1B; CHO and K562 cells
were stained with irrelevant mouse IgG (dotted line), an
anti-.beta..sub.1 antibody (K562:SA2, CHO:7E2) (solid line), or an
anti-.alpha..sub.5 antibody (K562:BIIG2, CHO:PB1) (dashed line) and
then analyzed by flow cytometry as described below).
To determine whether spontaneous high affinity Fn binding to
.alpha..sub.5 .beta..sub.1 is an active process, we treated CHO
cells with a combination of inhibitors of oxidative phosphorylation
(NAN.sub.3) and anaerobic glycolysis (2-deoxyglucose). This
resulted in loss of specific high affinity Fn binding. This effect
was partially reversible since washout of the metabolic inhibitors
resulted in restoration of 75% of the high affinity binding (FIG.
1C; the binding of .sup.125 I-Fn to CHO cells (Resting), to cells
incubated in medium containing 2 mM deoxyglucose and 0.1% sodium
azide (DOG/Az), or to cells washed free of these inhibitors and
returned to glucose-containing medium (Wash+Glc) was determined.
Specificity of binding to .alpha..sub.5 .beta..sub.1 was verified
by inhibition with the PB1 antibody). Thus, high affinity Fn
binding to integrin .alpha..sub.5 .beta..sub.1 is cell
type-specific and an active cellular process.
The cytoplasmic domains of .alpha..sub.5 .beta..sub.1 confer an
energy-dependent high affinity state on .alpha..sub.IIb
.beta..sub.3 in some cells but not others.
To determine whether the cytoplasmic domains of .alpha..sub.5
.beta..sub.1 are involved in cell type-specific affinity
modulation, we generated chimeras in which the cytoplasmic domains
of .alpha..sub.IIb and .beta..sub.3 were replaced with the
corresponding sequences from .alpha..sub.5 and .beta..sub.1 (FIG.
2; Amino acid sequences of wild type and variant integrin
cytoplasmic domains. Single letter amino acid code is used. The
arrows underneath the .alpha..sub.IIb (residue 990) and
.beta..sub.3 (residue 727) sequences denote the position at which
chimeric cytoplasmic domains were joined to the extracellular and
transmembrane domains of .alpha..sub.IIb and .beta..sub.3. The
position of stop codons producing cytoplasmic truncations are noted
by triangles, while the S.sup.752 .fwdarw.P point mutation in
.beta..sub.3 is indicated. The residues deleted in the
.alpha..sub.L .DELTA. cytoplasmic domain are overlain by the heavy
line). The .alpha. and .beta. chimeras were co-transfected into CHO
or K562 cells, and the affinity state of the extracellular
.alpha..sub.IIb.beta..sub.3 reporter group was assayed by binding
of PACl, an antibody specific for the high affinity state of
.alpha..sub.IIb .beta..sub.3 (Shattil et al., J. Biol. Chem.
260:11107-11114, 1985). The double chimera bound PACl when it was
expressed in CHO cells. Since wild-type .alpha..sub.IIb
.beta..sub.3 does not bind PACl when expressed in CHO cells
(O'Toole et al., Cell Regulation 1:883-893, 1990), it is concluded
that the .alpha..sub.5 .beta..sub.1 cytoplasmic domains conferred
the high affinity state on .alpha..sub.IIb .beta..sub.3. In sharp
contrast, PACl did not bind to the double chimera in K562 cells.
However, PACl bound after addition of an activating antibody,
anti-LIBS6, confirming that the ligand binding site was intact
(FIG. 3A; CHO or K562 cells were stably transfected with chimeras
containing the cytoplasmic domains of .alpha..sub.5 and
.beta..sub.1 and the affinity state of the .alpha..sub.IIb
.beta..sub.3 extracellular domain was assayed by its ability to
bind PACl in the absence (solid line) or presence (dotted line) of
1 mM GRGDSP (SEQ ID NO: 13). Depicted are flow cytometry
histograms. The K562 transfectants specifically bound PACl only
after incubation with 6 [M activating antibody, anti-LIBS 6). Thus,
the capacity of cell type-specific elements to modulate affinity
depends on the integrin cytoplasmic domains.
Since K562 cells express endogenous .alpha..sub.IIb under certain
conditions (Burger et al., Exp. Cell Res. 202:28-35, 1992), it was
necessary to verify that all of the .alpha..sub.IIb expressed in
the .alpha. chimera transfectants contained the .alpha..sub.5
cytoplasmic domain. Immunoprecipitation of surface iodinated
.alpha. chimera transfectants with an anti-.alpha..sub.5
cytoplasmic domain antibody isolated polypeptides corresponding to
transfected .alpha..sub.IIb and .beta..sub.3 chimeras and
endogenous .alpha..sub.IIb .beta..sub.1. In contrast, an
anti-.alpha..sub.II.sub.b cytoplasmic domain antibody
immunoprecipitated no labeled polypeptides. An anti-.alpha..sub.5
cytoplasmic antibody precipitated only endogenous .alpha..sub.5
.beta..sub.1 from wild-type .alpha..sub.IIb .beta..sub.3
transfectants (FIG. 3B; Immunoprecipitation analysis of K562
transfectants. Wild type K562 cells (None) or stable transfectants
expressing the .alpha. subunit noted in the figure (.alpha..sub.IIb
.beta..sub.5 =.alpha..sub.5 cytoplasmic domain chimera) were
surface iodinated, lysed, and immunoprecipitated with polyclonal
antibodies specific for the .alpha..sub.5 and .alpha..sub.IIb
cytoplasmic domains, or with a monoclonal antibody reactive with
the extracellular domain of .alpha..sub.IIb .beta..sub.3 (2G12).
Immunoprecipitates were resolved by SDS-PAGE and constituent
polypeptides were visualized by autoradiography).
In addition, we confirmed fidelity of expression at the mRNA level.
Reverse transcriptase-polymerase chain reaction was performed using
a 5' primer specific for the extracellular domain of
.alpha..sub.IIb and 3' primers specific for cytoplasmic domains of
.alpha..sub.IIb or .alpha..sub.5. A specific 393 base pair band was
observed from .alpha. chimera transfectants when primed with the 3'
.alpha..sub.IIb oligonucleotide. No bands were observed when
inappropriate 3' primers were used (FIG. 3C; Reverse
transcriptase-polymerase chain reaction (RT-PCR) analysis. RT-PCR
was performed as described below with the 5' 2bsf primer and 3'
primers specific for .alpha..sub.IIb or .alpha..sub.5 3 '
untranslated sequences, and the amplified products were analyzed by
agarose gel electrophoresis).
As was shown in FIG. 1, high affinity Fn binding to .alpha..sub.5
.beta..sub.1 depends on active cellular metabolism. We therefore
analyzed the effects of NaN.sub.3 and 2-deoxyglucose on the
affinity state of the double chimera in CHO cells. These inhibitors
blocked both PACl (FIG. 4A; Stable CHO transfectants expressing the
.alpha..sub.5 and .beta..sub.1 cytoplasmic domain chimeras were
assayed for PACl binding in the absence (solid line) and presence
(dotted line) of 2 mM GRGDSP (SEQ ID NO: 13) by flow cytometry.
Transfectants incubated with 2 mg/ml deoxyglucose and 0.1%
NaN.sub.3 (Inhibitors), as described below, manifested loss of
specific binding. Addition of 6 .mu.M anti-LIBS2
(Inhibitors+Anti-LIBS2) or washout of these inhibitors
(Inhibitors+washout) and return to glucose-containing medium
reconstituted specific PAC1 binding) and Fg (FIG. 4B; Stable CHO
transfectants expressing the cytoplasmic domains noted below the
graph were analyzed for Fg binding as described below. Constitutive
binding to transfectants expressing the .alpha..sub.5 and
.beta..sub.1 chimeras was inhibited by 2 mg/ml deoxyglucose plus
0.1% NAN.sub.3 ; binding to transfectants expressing the
.alpha..sub.IIb .DELTA.991 or .alpha..sub.L .DELTA. variant was not
inhibited (see below)) binding. Anti-LIBS2, an activating antibody
(Frelinger et al., J. Biol. Chem. 266:17106-17111, 1991), restored
high affinity binding. Furthermore, the metabolic blockade was
reversible since high affinity ligand binding reappeared after the
inhibitors were washed out (FIG. 4A). These results show that
.alpha..sub.5 .beta..sub.1 cytoplasmic sequences confer a cell
type-specific, energy-dependent, high affinity state on the
extracellular domain of .alpha..sub.IIb .beta..sub.3.
Both .alpha. and .beta. cytoplasmic domains are involved in
affinity modulation.
To determine which cytoplasmic domain specified the high affinity
state in CHO cells, we transfected each subunit chimera with a
complementary wild-type subunit. Transfectants expressing both
.alpha. and .beta. chimeras or expressing the chimeric .alpha. but
wild-type .beta..sub.3 subunits bound PACl. In contrast, cells
expressing the .beta. chimera with wild-type .alpha..sub.IIb were
in a low affinity state and bound PACl only after addition of
anti-LIBS2 (FIG. 5A; CHO cells were transiently transfected with
subunits comprised of the extracellular and transmembrane domains
of .alpha..sub.IIb and .beta..sub.3 joined to the indicated
cytoplasmic domains. The affinity state of the extracellular
portion of .alpha..sub.IIb .beta..sub.3 was assessed by PACl
binding. Binding was analyzed in the absence (solid line) or
presence (dotted line) of GRGDSP (SEQ ID NO: 13) peptide. Graphs of
cells incubated in the presence of 6 .mu.M anti-LIBS2 are depicted
in the lower panels. Specific PACl binding is present in both
transfectants containing the .beta..sub.5 cytoplasmic domain
irrespective of the presence of either the .beta..sub.3 or
.beta..sub.1 cytoplasmic domain on the .beta..sub.3 subunit. In
contrast, PACl specifically bound to those transfectants containing
the .alpha..sub.IIb cytoplasmic domain only in the presence of the
activating antibody, anti-LIBS2). These results show that .alpha.
cytoplasmic sequences are involved in specifying affinity
state.
To find out if the .beta. subunit was also involved in specifying
the high affinity state in CHO cells, we constructed two
.beta..sub.3 cytoplasmic variants, .beta..sub.3 .DELTA.724 and
.beta..sub.3 (S.sup.752 .fwdarw.P). The former is a truncation
mutant that ends at D.sup.723, while the latter contains a single
nucleotide alteration resulting in a Ser.sup.752 .fwdarw.Pro
substitution (FIG. 2). These .beta..sub.3 cytoplasmic domain
mutants were co-transfected with the .alpha. chimera. In contrast
to wild-type .beta..sub.3, coexpression of either .beta..sub.3
variant with chimeric .alpha. resulted in a receptor that failed to
bind PACl constitutively (FIG. 5B; Stable CHO cell lines expressing
recombinant .alpha..sub.IIb .beta..sub.3 chimeras containing the
noted cytoplasmic domains were reacted with PACl and bound antibody
was detected by flow cytometry as described below. Binding was
analyzed in the absence (solid line) or presence (dotted line) of
GRGDSP (SEQ ID NO: 13) peptide. The intrinsic functionality of each
construct was assessed by PACl binding in the presence of 6 .mu.M
anti-LIBS2 (lower panels). A .beta..sub.3 cytoplasmic truncation
(.DELTA.724) and single amino acid substitution(S.sup.752
.fwdarw.P) both abolished the constitutive high affinity state
conferred by the cytoplasmic domain of .alpha..sub.5). Thus, the
cytoplasmic domain of the .beta. subunit as well as the .alpha.
subunit is involved in affinity modulation.
Regulation of integrin affinity by the .alpha. subunit cytoplasmic
domain is .alpha. subunit-specific
These data established that the cytoplasmic domains of
.alpha..sub.IIb and .alpha..sub.5 specify different affinity states
in CHO cells; .alpha..sub.IIb the low and .alpha..sub.5 the high
affinity state. To determine whether there are consensus
"activation" sequences, we constructed chimeras with the
cytoplasmic domains of six additional .alpha. subunits and analyzed
their affinity state after co-transfection with .beta..sub.3 into
CHO cells. The .alpha. cytoplasmic domains of three other
.beta..sub.1 family members (.alpha..sub.2, .alpha..sub.6 A,
.alpha..sub.6 B) conferred PACl binding (FIG. 6A), while those
chimeras containing .alpha. subunit cytoplasmic domains from
.beta..sub.2 (.alpha..sub.M, .alpha..sub.L) or .beta..sub.3
(.alpha..sub.v) families did not (FIG. 6A; Chimeric .alpha.
subunits consisting of extracellular and transmembrane
.alpha..sub.IIb with the indicated cytoplasmic domain were
transiently co-transfected with .beta..sub.3 into CHO cells. PACl
binding was quantified by flow cytometry and the activation index
was calculated as:
where:
F.sub.O =Mean Fluorescence Intensity in the absence of
inhibitor
F.sub.R =Mean Fluorescence Intensity in the presence of GRGDSP
(SEQ ID NO: 13). Depicted are the Mean.+-.S.D. of at least 3
independent experiments for each .alpha. chimera). The same result
was obtained with the .beta. chimeras containing cytoplasmic
domains of the relevant .beta. subunit partner (.beta..sub.1 for
.alpha..sub.2, .alpha..sub.v, .alpha..sub.6 A, and .alpha..sub.6 B
or .beta..sub.2 for .alpha..sub.L and .alpha..sub.M). Similar to
the .alpha..sub.5 chimera, constitutive PACl binding was also
dependent upon the .beta. cytoplasmic domain. It was lost when the
.beta..sub.2, .alpha..sub.6 A, or .alpha..sub.6 B chimeras were
co-transfected with .beta..sub.3 .DELTA.724 or .beta.S752P (FIG.
6B; .alpha. subunit chimeras containing the indicated cytoplasmic
sequences were co-transfected with a .beta..sub.3 subunit in which
the cytoplasmic domain was truncated (.beta..sub.3 .DELTA.724),
contained the S.sup.752 .fwdarw.P mutation (S752P), or had been
exchanged for the homologous region of .beta..sub.1. PACl binding
was analyzed as described for FIG. 6A. Mean.+-.S.D. of at least 3
independent experiments for each .alpha. .beta. pair are depicted).
Thus, the .alpha. subunit cytoplasmic domain designates
integrinspecific affinity differences. The .beta. subunit
cytoplasmic domain may be permissive for the high affinity
state.
Deletion of conserved .alpha. cytoplasmic sequences results in high
affinity ligand binding that is independent of metabolic energy and
the .beta. subunit cytoplasmic domain
We previously reported that constitutive ligand binding to
.alpha..sub.IIb .beta..sub.3 results from a truncation of the
cytoplasmic domain of .alpha..sub.IIb (O'Toole et al., Science
254:845-847, 1991). To identify the important deleted
.alpha..sub.IIb cytoplasmic residues, we generated additional
variants. Integrin .alpha. subunit cytoplasmic domains contain a
highly conserved GFFKR (SEQ ID NO: 14) sequence at their NH.sub.2
-termini (FIG. 2). As previously reported (O'Toole et al., Science
254:845-847, 1991; Ylanne et al., J. Cell Biol. 122:223-233, 1993),
the .alpha..sub.IIb .DELTA.911 truncation eliminates this motif and
results in constitutive PACl binding whereas a truncation after the
GFFKR (SEQ ID NO: 14) (.alpha..sub.IIb .DELTA.996) does not (FIG.
7A). This pinpoints the conserved motif as a regulator of integrin
affinity. To test this idea, we removed the LGFFK (SEQ ID NO: 15)
residues from the cytoplasmic domain of an .alpha..sub.L
cytoplasmic domain chimera (FIG. 2). This chimera was selected
because it possesses the longest .alpha. cytoplasmic domain.
Coexpression of this chimeric internal deletion mutant
(.alpha..sub.L .DELTA.) in CHO cells with .beta..sub.3 resulted in
high affinity PACl binding (FIG. 7B). Finally, to further exclude
contributions from downstream .alpha. sequences, we generated a
variant that contains a 24-residue random cytoplasmic sequence
(FIG. 2). This construct (.alpha..sub.Ra) also conferred high
affinity binding when expressed in CHO cells with wild-type
.beta..sub.3 (FIG. 7A; Stable CHO cell lines were established by
co-transfection of .alpha..sub.IIb containing the .alpha.
cytoplasmic domain indicated in the figure with wild type
.beta..sub.3. PACl binding in the absence (solid line) and presence
(dotted line) of GRGDSP (SEQ ID NO: 13) was assessed by flow
cytometry. The .alpha..sub.IIb .DELTA.991 transfectant, which lacks
GFFKR (SEQ ID NO: 14), specifically binds PACl. In contrast the
.alpha..sub.IIb .DELTA.996 transfectant, which retains GFFKR (SEQ
ID NO: 14), binds only after "activation" with anti-LIBS2.
Replacement of the .alpha..sub.IIb cytoplasmic domain with random
sequence also induces PACl binding (.alpha..sub.Ra)).
To gain insight into the mechanisms of high affinity binding
conferred by the GFFKR (SEQ ID NO: 14) deletion mutants, we
examined the requirements for cellular metabolism and .beta.
cytoplasmic sequences. In contrast to the constitutively active
chimeras, high affinity PACl binding in the GFFKR (SEQ ID NO: 14)
deletion variants was maintained when they were coexpressed with
the truncated .beta..sub.3 subunit (FIG. 7B). In addition, in
contrast to transfectants expressing constitutively active .alpha.
chimeras, transfectants expressing the GFFKR (SEQ ID NO: 14)
deletion retained high affinity for Fg and PACl (FIG. 7B) when
treated with the metabolic inhibitors NaN.sub.3 and 2-deoxyglucose.
Finally, the .alpha..sub.L .DELTA. mutant conferred cell-type
independent activation, since it was active in K562 (FIG. 7B; CHO
cells were transiently transfected with chimeras of the
extracellular and transmembrane domains of .alpha..sub.IIb
.beta..sub.3 joined to the cytoplasmic domains indicated in the
figure. Specific PACl binding to the population of cells expressing
.alpha..sub.IIb .beta..sub.3 was detected as in FIG. 7A. A GFFKR
(SEQ ID NO: 14) "loop out" mutant manifested PACl binding
(.alpha..sub.L.DELTA. .beta..sub.3) that was maintained in the
presence of 0.1% NaN.sub.3 and 2 mM 2-deoxyglucose (inhibitors).
This treatment abolished ligand binding to an .alpha..sub.IIb
.beta..sub.3 chimera bearing the cytoplasmic domain of
.alpha..sub.5 .beta..sub.1. High affinity state was also maintained
despite an extensive deletion of the .beta..sub.3 cytoplasmic
domain (.alpha..sub.L.DELTA. .beta..sub. .DELTA.724) that disrupted
PACl binding to the .alpha..sub.5 .beta..sub.1 chimera. Similar
results were obtained with .alpha..sub.IIb .DELTA.991 and
.alpha..sub.Ra transfectants. A stable K562 cell line bearing the a
GFFKR (SEQ ID NO: 14) deletion mutant specifically bound PACl
(.alpha..sub.L.DELTA. .beta..sub.3), but the .alpha..sub.5
.beta..sub.1 chimera was not active in these cells) and COS, as
well as in CHO cells. Thus, deletions in the highly conserved GFFKR
(SEQ ID NO: 14) motif resulted in a cell type-independent high
affinity state that was resistant to metabolic inhibitors and
truncation of the .beta. subunit.
Experimental Procedures:
Antibodies and reagents.
The anti-.alpha..sub.IIb .beta..sub.3 antibody D57 was produced
using previously described methods (Frelinger et al., J. Biol.
Chem. 265:6346-6352, 1990). It binds to Chinese hamster ovary (CHO)
cells transfected with .alpha..sub.IIb .beta..sub.3, but not
.alpha..sub.v .beta..sub.3, and does not block Fg binding to
.alpha..sub.IIb .beta..sub.3. This antibody was biotinylated with
biotin-N-hydroxy-succinimide (Sigma Chemical, St. Louis, Mo.)
according to manufacturer's directions. The .alpha..sub.IIb
.beta..sub.3 complex specific antibody, 2G12 (Plow et al., Blood
66:724-727, 1985), was used as dilutions of ascites fluid. The
anti-hamster .alpha..sub.5 (PB1) and anti-.beta..sub.1 (7E2)
antibodies, the .beta..sub.1 activating antibody, 8A2 (Kovach et
al., J. Cell Biol. 116:499-509, 1992); a human anti-.alpha.
antibody, BIIG2 (Werb et al., J. Cell Biol. 109:877-889, 1989); a
polyclonal anti-peptide antibody against the cytoplasmic domain of
human .alpha..sub.5 (Hynes et al., J. Cell Biol. 109:409-420,
1989); anti-LIBS6, anti-LIBS2, and anti-.alpha..sub.IIb cytoplasmic
domain antibodies (Frelinger et al., J. Biol. Chem. 265:6346-6352,
1990; O'Toole et al., Science 254:845-847, 1991); and PACl (Shattil
et al., J. Biol. Chem. 260:11107-11114, 1985) have been described
previously. Glucose and 2-deoxyglucose were purchased from Sigma
and sodium azide was purchased from Fisher Scientific Co.
(Pittsburgh, Pa.). The peptide GRGDSP (SEQ ID NO: 13) was obtained
from Peninsula Laboratories (Belmont, Calif.). Its purity and
composition were verified by high performance liquid chromatography
and fast atom bombardment mass spectroscopy.
Cell culture and transfection.
The human cell lines K562, U937, W1-38, and MG63 were obtained from
the American Type Culture Collection (ATCC; Rockville, Md.) and
maintained in RPMI 1640 media (Biowhittaker, Walkersville, Md.)
containing 10% fetal bovine serum (Biowhittaker, Walkersville, Md.)
1% glutamine (Sigma) and 1% penicillin and streptomycin (Sigma).
THP-1 cells (ATCC; Rockville, Md.) were maintained in the same
medium with the addition of 10 mM Hepes and 20 mM
2-mercaptoethanol. Chinese hamster ovary (CHO) cells (ATCC;
Rockville, Md.) were maintained in DMEM media (Biowhittaker;
Walkersville, MD) with 10% fetal calf serum, the above noted
antibiotics, and 1% non-essential amino acids (Sigma). Human T
lymphocytes were purified from peripheral blood of normal donors by
centrifugation on a Ficoll-Paque gradient (Pharmacia Fine
Chemicals, Piscataway, N.J.), panning for monocytes on serum-coated
dishes, and passage over a nylon wool column.
CHO cells were transiently transfected by electroporation. Cells in
log phase growth were harvested with trypsin (Irvine Scientific),
washed with PBS, and combined with appropriate cDNAs (10 .mu.g of
each subunit). 3.times.10.sup.7 cells in 0.5 ml of growth media
were electroporated at 350 volts, 960 .mu.F, in a BTX (BTX, San
Diego, Calif.) electroporator. Media were changed after 24 hours
and cells analyzed for surface expression, or PACl binding after 48
hours. Stable CHO transfectants were established as above with
co-transfection of 0.6 .mu.g of CDNeo. After 48 hours, these cells
were selected for 2 weeks in 700 .mu.G418 (Gibco) and clonal lines
were established by single cell sorting in a FACStar (Becton
Dickinson). Stable K562 transfectants were established by
electroporation of 1.times.10.sup.7 cells in 0.8 ml of PBS at 300
volts and 500 .mu.F. After 48 hours the cells were maintained in
media containing 1 mg/ml G418, and clonal lines established by
limiting dilution cloning.
Flow Cytometry
Surface expression of integrins was analyzed by flow cytometry with
specific antibodies as described (Loftus et al., Science
249:915-918, 1990; O'Toole et al., Blood 74:14-18, 1989). Briefly,
5.times.10.sup.5 cells were incubated on ice for 30 minutes with
primary antibody, washed, and incubated on ice for 30 minutes with
an FITC-conjugated goat anti-mouse (Tago, Burlingame, Calif.)
secondary antibody. Cells were pelleted, resuspended, and analyzed
on a FACScan (Becton Dickinson). PACl binding was analyzed by two
color flow cytometry. Cell staining was carried out in Tyrode's
buffer (Ginsberg et al., Blood 55:661-668, 1980) containing 2 mM
MgCl.sub.2 and CaCl.sub.2 and 1 mg/ml BSA (Sigma) and dextrose.
Single cell suspensions were obtained by harvesting with 3.5 mM
EDTA, incubating for 5 minutes in 1 mg/ml TPCK trypsin
(Worthington), and diluting with an equal volume of Tyrode's buffer
containing 10% fetal calf serum and 0.1% soybean trypsin inhibitor
(Sigma). After washing, 5.times.10.sup.5 cells were incubated in a
final volume of 50 .mu.l containing 0.1% PACl ascites fluid in the
presence or absence of 1 mM GRGDSP (SEQ ID NO: 13) peptide. After a
30 minute incubation at room temperature, cells were washed with
cold Tyrode's buffer and then incubated on ice with biotinylated
antibody D57. After 30 minutes cells were washed and then incubated
on ice with Tyrode's buffer containing 10% FITC-conjugated goat
anti-mouse IgM (Tago) and 4% phycoerythrin-streptavidin (Molecular
Probes Inc., Junction City, Oreg.). Thirty minutes later, cells
were diluted to 0.5 ml with Tyrode's buffer and analyzed on a
FACScan (Becton Dickinson) flow cytometer as described (O'Toole et
al., Cell Regulation 1:883-893, 1990). PACl binding (FITC staining)
was analyzed only on a gated subset of cells positive for
.alpha..sub.IIb .beta..sub.3 expression (phycoerythrin staining).
To define affinity state, histograms depicting PACl staining in the
absence or presence of 1 mM GRGDSP (SEQ ID NO: 13) were
superimposed. Since RGD peptides are inhibitors of PACl binding to
.alpha..sub.IIb .beta..sub.3 (Bennett et al., J. Biol. Chem.
263:12948-12953, 1988), a rightward shift in the histogram in the
absence of RGD peptide is indicative of the presence of high
affinity .alpha..sub.IIb .beta..sub.3 integrin. To compare the
effects of multiple .alpha. subunits, pooling of data involving
experiments from different days was required. To do this, a
numerical activation index was defined as:
where:
F.sub.O =Mean Fluorescence Intensity in the absence of inhibitor,
and
F.sub.R =Mean Fluorescence Intensity in the presence of GRGDSP (SEQ
ID NO: 13).
DNA Constructs
The generation of CDM8 constructs encoding .alpha..sub.IIb,
.alpha..sub.IIb .DELTA.991, .alpha..sub.IIb .DELTA.996,
.beta..sub.3, and .beta..sub.3 .DELTA.728 has been previously
described (O'Toole et al., Blood 74:14-18, 1989; O'Toole et al.,
Science 254:845-847, 1991; Ylanne et al., J. Cell Biol. 22:223-233,
1993). The .beta..sub.3 truncation, .DELTA.724, and amino acid
substitution, S.sup.752 .fwdarw.p, were first generated in BS3a
(O'Toole et al., Blood 74:14-18, 1989) by oligonucleotide-directed
mutagenesis (Kunkel, Proc. Natl. Acad. Sci. USA 82:488-492, 1985),
digested with HincII to isolate coding sequences, ligated to BstXI
linkers (InVitrogen) and subcloned into the BstXI sites of CDM8.
The .beta..sub.3 chimera, containing the .beta..sub.1 cytoplasmic
domain, was constructed by first generating an EcoRI site at bases
2387-2392 of .beta..sub.1 cDNA sequence. After HindIII digestion, a
400 bp fragment containing the complete .beta..sub.1 cytoplasmic
domain and partial 3' non-coding sequences was isolated and
subcloned into the HindIII site of CDM8. This construct was then
digested with EcoRI and ligated with a 2.2 kb EcoRI fragment from
CD3a (O'Toole et al., Blood 74:14-18, 1989) containing its
transmembrane and extracellular domains. .beta..sub.2 cytoplasmic
sequences were first isolated by the polymerase chain reaction
(PCR) from a .beta..sub.2 cDNA and then subcloned into the MluI and
XhoI sites of CDM8. The .beta..sub.2 cytoplasmic domain chimera was
then generated by digestion with MluI and HindIII and ligation with
a corresponding MluI-HindIII fragment from CD3a containing its
extracellular and transmembrane sequences. Chimeric .alpha.
subunits were generated following a previously described strategy
(O'Toole et al., Science 254:845-847, 1991). Cytoplasmic sequences
from .alpha..sub.v, .alpha..sub.M, .alpha..sub.2, .alpha..sub.6 A,
and .alpha..sub.6 B were isolated from the appropriate cDNA clones
by PCR (Loftus et al., Science 249:915-918, 1990). Amplified
products were digested with HindIII and XbaI and subcloned into
HindIII and XbaI cut CDM8. After digesting with HindIII, these
constructs were ligated with a HindIII fragment from CD2b (O'Toole
et al., Blood 74:14-18, 1989) containing its extracellular and
transmembrane domains. PCR oligonucleotides for .alpha..sub.L
.DELTA. were designed to omit the VGFFK (SEQ ID NO: 16) sequence.
Its construction followed the procedure for other .alpha. chimeras.
The .alpha..sub.Ra variant was made by first generating a SalI site
in CD2b coding sequences corresponding to bases 3061-3066. This
vector was then digested with SalI and XbaI and ligated to a
SalI-XbaI Bluescript vector sequence (bases 674-731). All
constructs were verified by DNA sequencing and purified by CsC1
centrifugation before transfection. Oligonucleotides were
synthesized on a Model 391 DNA Synthesizer (Applied
Biosystems).
Ligand Binding
The binding of .sup.125 I-Fg or .sup.125 I-Fn to cultured cells was
carried out as described (O'Toole et al., Cell Regulation
1:883-893, 1990; Faull et al., J. Cell Biol. 121:155-162, 1993).
Cells were harvested with EDTA and trypsin as described above for
flow cytometry analysis, and resuspended in a modified Tyrode's
buffer (150 mM NaCl, 2.5 mM KCl, 2 mM NaHCO.sub.3, 2 mM MgCl.sub.2,
2 mM CaCl.sub.2, 1 mg/ml BSA, and 1 mg/ml dextrose). A typical
assay included 120 .mu.l of cells (2.times.10.sup.6 cells per
tube), 40 .mu.l of radiolabelled protein, and 40 .mu.l of inhibitor
(GRGDSP (SEQ ID NO: 13) peptide, blocking antibodies) or agonist
(activating antibody). After 30 minutes at room temperature 50
.mu.l aliquots were layered in triplicate on 0.3 ml of 20% sucrose
and centrifuged for 3 minutes at 12,000 rpm. .sup.125 I-labelled
protein associated with the cell pellet was determined by
scintillation spectrometry. Non-saturable binding was determined in
the presence of 2 mM GRGDSP (SEQ ID NO: 13) peptide. Data were fit
to equilibrium binding models by the nonlinear least squares
curve-fitting LIGAND program (Munson and Rodbard, Anal. Biochem.
107:220-239, 1980). In binding experiments utilizing metabolic
inhibitors, the cells were first incubated with 2 mg/ml
2-deoxyglucose and 0.1% sodium azide for 30 minutes at room
temperature before addition of radiolabelled ligand. In washout
experiments, cells treated in this way were washed, incubated with
Tyrode's buffer containing 1 mg/ml dextrose for 30 minutes at room
temperature, and then analyzed for ligand binding.
Immunoprecipitation
Transfectants were surface labelled by the Iodogen method according
to the manufacturer's instructions (Pierce Chemical) and
solubilized in lysis buffer (10 mM Hepes (pH 7.5), 0.15M NaCl, 50
mM octylglucoside, 1 mM CaCl.sub.2, 1 mM MgCl.sub.2, 1 mM
phenylmethylsulfonyl fluoride, 0.1 mM leupeptin, and 10 mM
N-ethylmaleimide). Cell extracts were immunoprecipitated with
polyclonal antiserum directed against the .alpha..sub.IIb or
.alpha..sub.5 cytoplasmic domains, and a monoclonal antibody
against the .alpha..sub.IIb .beta..sub.3 complex (2G12). The
antibodies were attached to preswollen protein A-Sepharose beads
(Pharmacia LKB Biotechnology Inc.) by incubation at 4.degree. C.
overnight. The antibody-conjugated Sepharose beads were washed,
pelleted by centrifugation, and then incubated with the detergent
lysates from the surface labelled cells overnight with shaking. The
Sepharose beads were washed extensively in lysis buffer,
resuspended in sample buffer (Laemmli, Nature 227:680-685, 1970),
and boiled for 5 minutes. After centrifugation, the precipitated
proteins were resolved by SDS-PAGE (non-reducing, 7.5% acrylamide
gels). Gels were dried and radiolabelled polypeptides were
visualized by autoradiography.
Polymerase Chain Reaction
Total RNA was isolated from 10.sup.6 transfected cells using the
RNAzol reagent (Cinna Biotecx). First strand cDNA synthesis from 5
.mu.g of RNA was performed with the cDNA cycle kit (Invitrogen, San
Diego, Calif.) using oligo dT as a primer. Coding sequences
downstream of the .alpha..sub.IIb transmembrane region were
specifically amplified with a 5' primer specific for transmembrane
.alpha..sub.IIb (2bsf: CGGGCCTTGGAGGAGAGGGCCATTC (SEQ ID NO: 17))
and 3' primers specific for the cytoplasmic sequences of
.alpha..sub.IIb (.alpha..sub.IIb cYt: CTCTGTTGGGAGGGAAACGA (SEQ ID
NO: 18); and .alpha..sub.5 .alpha..sub.5 scYt: TGTAAACAAGGGTCCTTCAC
(SEQ ID NO: 19)). Amplified products were analyzed by agarose gel
electrophoresis.
Use of Inhibitors
The invention provides methods for identifying compounds which
inhibit integrin activation. Integrins are surface adhesive
molecules which play roles in a number of physiological processes,
including activation of the immune response, inflammation, and
thrombosis. Thus, the inhibitors of the invention can be used in
methods to modulate the above-listed physiological processes. In
addition to playing a role in the migration of normal cells,
integrins are also involved in the migration and metastasis of
tumor cells. Thus, the inhibitors of the invention may be useful in
treating patients with tumors or cancer.
The inhibitors can be administered to the patient by any
appropriate method suitable for the particular inhibitor, e.g.,
orally, intravenously, parenterally, transdermally, or
transmucosally. Therapeutic doses are determined specifically for
each inhibitor, most administered within the range of 0.001-100.0
mg/kg body weight, or within a range that is clinically determined
as appropriate by those skilled in the art.
Other Embodiments
From the above description, one skilled in the art can easily
ascertain the essential characteristics of the present invention,
and without departing from the spirit and scope thereof, can make
various changes and modifications of the invention to adapt it to
various usages and conditions. Other embodiments are in the claims
set forth below.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 19 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 1: LysValGlyP hePheLysArgAsnArgProProLeuGluGluAspAsp 151015
GluGluGlyGlu 20 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 32 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 2: ArgMetGlyPhePheLysArgValArgProProGlnGluGluGlnGlu 151015
ArgGluGlnLeuGlnProHisGluAsnGlyGluGlyAsnSerGluThr 202530 (2)
INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 24 (B) TYPE: amino acid ( C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
LysLeuGlyPhePheLysArgGlnTyrLysAspMetMetSerGluGly 151015
GlyProProGlyAlaGluPro Gln 20 (2) INFORMATION FOR SEQ ID NO: 4: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 58 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 4: LysValGlyPhePheLysArgAsnLeuLysGluLysMetGluA laGly 151015
ArgGlyValProAsnGlyIleProAlaGluAspSerGluGlnLeuAla 202530 Ser
GlyGlnGluAlaGlyAspProGlyCysLeuLysProLeuHisGlu 354045
LysAspSerGluSerGlyGlyGlyLysAsp 5055 (2) INFORMATION FOR SEQ ID NO:
5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 (B) TYPE: amino
acid (C) STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 5:
LysValAspGlyIleAspLysLeuAspIleGluPheLeuGlnProGly 15 1015
GlySerThrSerSerArgGlySerTrp 2025 (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 (B) TYPE: amino acid
(C) STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION:
SEQ ID NO: 6: LysLeuGlyPhePheLysArgLysTyrGluLysMetThrLysAsnPro
151015 AspGluIleAspGluThrThrGluLeuSe rSer 2025 (2) INFORMATION FOR
SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 (B)
TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 7: LysLeuGlyPhePheLysArgSerLeu
ProTyrGlyThrAlaMetGlu 151015 LysAlaGlnLeuLysProProAlaThrSerAspAla
2025 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 36 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 8: LysCysGlyPhePheLysArgAsnLysLysAspHisTyrAspAlaThr 15 1015
TyrHisLysAlaGluIleHisAlaGlnProSerAspLysGluArgLeu 202530
ThrSerAspAla 35 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 54 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 9: LysLeuGlyPhePheLysArgSerArgTyrAspAspSerValProArg 15 1015
TyrHisAlaValArgIleArgLysGluGluArgGluIleLysAspGlu 202530
LysTyrIleAspAsnLeuGluLysLysGln TrpIleThrLysTrpAsn 354045
ArgAsnGluSerTyrSer 50 (2) INFORMATION FOR SEQ ID NO: 10: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 47 (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ
ID NO: 10: LysLeuLeuIleThrIleHisAspArgLysGluPheAlaLysPheGlu 151015
GluGluArgAlaArgAlaLysTrpAsp ThrAlaAsnAsnProLeuTyr 202530
LysGluAlaThrSerThrPheThrAsnIleThrTyrArgGlyThr 3540 45 (2)
INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 46 (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
LysAlaLeuIleHisLeuSerAspLeuArgGluTyrArgArgPheGlu 1 51015
LysGluLysLeuLysSerGlnTrpAsnAsnAspAsnProLeuPheLys 202530
SerAlaThrThrThrV alMetAsnProLysPheAlaGluSer 354045 (2) INFORMATION
FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 47 (B)
TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 12:
LysLeuLeuMetIleIleHisAspArgArgGluPheAlaLysPheGlu 151015
LysGluLysMetAsnAlaLysTrpAspThrGlyGluAsnProIleT yr 202530
LysSerAlaValThrThrValValAsnProLysTyrGluGlyLys 354045 (2)
INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 6 (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: GlyArgGlyAspSerPro
15 (2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: GlyPhePheLysArg 15
(2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: LeuGlyPhePheLys 15
(2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16: ValGly PhePheLys
15 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
CGGGCCTTGGAGGAGAGGGCCATTC 25 (2) INFORMATION FOR SEQ ID NO: 18: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 18: CTCTGTTGGGAGGGAAACGA20 (2) INFORMATION
FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: TGTAAACAAGGGTCCTTCAC20
__________________________________________________________________________
* * * * *