U.S. patent number 5,219,759 [Application Number 07/574,540] was granted by the patent office on 1993-06-15 for recombinant dna encoding pdgf a-chain polypeptide and expression vectors.
This patent grant is currently assigned to Chiron Corporation. Invention is credited to Graeme I. Bell, Christer Betsholtz, Carl-Henrik Heldin, Timothy J. Knott, James Scott, Bengt Westermark.
United States Patent |
5,219,759 |
Heldin , et al. |
June 15, 1993 |
Recombinant DNA encoding PDGF A-chain polypeptide and expression
vectors
Abstract
DNA encoding two forms of PDGF A-chain polypeptide, the
construction of expression vectors for expressing such DNA in yeast
and mammalian cells, and the expression of such DNA in yeast and
mammalian cells to produce active PDGF A-chain homodimer and active
PDGF A-chain/B-chain heterodimer are disclosed.
Inventors: |
Heldin; Carl-Henrik (Uppsala,
SE), Betsholtz; Christer (Uppsala, SE),
Westermark; Bengt (Uppsala, SE), Knott; Timothy
J. (London, GB2), Scott; James (London,
GB2), Bell; Graeme I. (San Francisco, CA) |
Assignee: |
Chiron Corporation (Emeryville,
CA)
|
Family
ID: |
26717999 |
Appl.
No.: |
07/574,540 |
Filed: |
August 27, 1990 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
41299 |
Apr 22, 1987 |
|
|
|
|
Current U.S.
Class: |
435/320.1;
435/69.4; 530/324; 530/399; 536/23.5; 536/23.51 |
Current CPC
Class: |
C07K
14/49 (20130101); C12N 9/0089 (20130101); C12N
15/62 (20130101); C12N 15/81 (20130101); C12N
15/85 (20130101); C07K 2319/00 (20130101); C07K
2319/02 (20130101); C07K 2319/50 (20130101); C07K
2319/75 (20130101); C12N 2800/108 (20130101); C12N
2830/002 (20130101); C12N 2830/005 (20130101); C12N
2830/15 (20130101); C12N 2830/36 (20130101); C12N
2830/55 (20130101); C12N 2830/702 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/49 (20060101); C12N
9/02 (20060101); C12N 15/62 (20060101); C12N
15/85 (20060101); C12N 15/81 (20060101); C12N
015/18 (); C12N 015/19 () |
Field of
Search: |
;530/399,324 ;536/27
;435/69.4,240.1,255,252.3 |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Heldin et al., (1986) Nature 319:511-514. .
Gazit et al., (1984) Cell 39:89-97. .
Clarke et al., (1984) Nature 308:464-467. .
Collins et al., (1985) Nature 316:748-750. .
Josephs et al., (1984) Science 225:636-639. .
Kelly et al., (1985) EMBO Journal 4(13A):3399-3405. .
Devare et al., (1984) Cell 36:43-49. .
Wang et al., (1984) J. Biol. Chem. 259(17):10645-10648. .
Hannink et al., (1986) Molecular and Cellular Biology
6(4):1343-1348. .
Fry et al., (1986) Journal of Cellular Physiology 128:313-321.
.
Waterfield et al., (1983) Nature 304:35-39. .
Doolittle et al., (1983) Science 221:275-277. .
Robbins et al., (1983) Nature 305:605-608. .
King et al., (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5295-5299.
.
Westermark et al., (1986) Proc. Natl. Acad. Sci. U.S.A.
83:7197-7200. .
Johnsson et al., (1984) EMBO Journal 3(5):921-928. .
Betsholtz et al., (1986) Nature 320:695-699..
|
Primary Examiner: Hill, Jr.; Robert J.
Assistant Examiner: Allen; Marianne Porta
Attorney, Agent or Firm: McClung; Barbara G. Robins; Roberta
L. Collins; Amy L.
Parent Case Text
This application is a continuation of application Ser. No. 041,299,
filed Apr. 22, 1987 now abandoned.
Claims
We claim:
1. A Recombinant DNA molecule encoding a human platelet-derived
growth factor (PDGF) A-chain polypeptide substantially free of DNA
molecules that do not encode PDGF A-chain polypeptide, wherein said
recombinant DNA molecule encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 87-211, inclusive, in
FIG. 1.
2. A Recombinant DNA molecule encoding a human platelet-derived
growth factor (PDGF) A-chain polypeptide substantially free of DNA
molecules that do not encode PDGF A-chain polypeptide, wherein said
recombinant DNA molecule encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 1-196, inclusive, in
FIG. 1 or FIG. 2.
3. A Recombinant DNA molecule encoding a human platelet-derived
growth factor (PDGF) A-chain polypeptide substantially free of DNA
molecules that do not encode PDGF A-chain polypeptide, wherein said
recombinant DNA molecule encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 1-211, inclusive, in
FIG. 1.
4. An expression vector which contains and is effective in
expressing a DNA sequence which encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 87-211, inclusive, in
FIG. 1.
5. An expression vector which contains and is effective in
expressing a DNA sequence which encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 1-196, inclusive, in
FIG. 1 or FIG. 2.
6. An expression vector which contains and is effective in
expressing a DNA sequence which encodes a PDGF A-chain polypeptide
comprising the amino acid sequence numbered 1-211, inclusive, in
FIG. 1.
Description
TECHNICAL FIELD
The invention is in the fields of biochemistry, molecular biology,
and genetic engineering. More particularly it relates to the
identification and isolation of genes for human platelet-derived
growth factor (PDGF) A-chain polypeptides and precursor
polypeptides, recombinant vectors for cloning and expressing those
genes in prokaryotic or eukaryotic hosts, methods for producing
recombinant PDGF A-chain polypeptides, and PDGF comprised of
recombinant PDGF A-chain polypeptides.
BACKGROUND
PDGF is the major mitogen in serum for mesenchymal-derived cells.
PDGF is stored in platelet .alpha.-granules and released locally
during platelet activation when blood vessels are injured. PDGF is
a potent chemoattractant for monocytes and neutrophils and for
fibroblasts and smooth muscle cells. These activities make PDGF an
important component in tissue repair processes.
Purified native PDGF is a glycoprotein of approximately 30,000
daltons and is composed of two disulfide-linked chains. There are
two types of chains, designated A and B. Whether native PDGF is a
heterodimer, a mixture of homodimers or a mixture of heterodimer
and homodimer(s) is not known, but the dimer structure is
functionally important, since reduction irreversibly destroys the
biological activity of PDGF.
The B-chain is derived by proteolytic processing of a 241 amino
acid precursor. The B-chain precursor is encoded by the c-sis gene,
the cellular counterpart to the transforming gene v-sis of simian
sarcoma virus (SSV). cDNA encoding the B-chain has been reported
previously in Nature (1985) 316:748-750. There is homology between
the B-chain and the transforming protein v-sis. The cloning and
expression of the v-sis gene is described in EPA 85112852.0
(Publication no. 0177957). Studies of v-sis indicate that B-chain
homodimers have mitogenic activity. Also, sequencing of porcine
PDGF has revealed that it contains only one type of chain,
corresponding to human B-chain (EMBO J (1984) 3:2963-2967).
Johnsson, A., et al, EMBO J (1984) 3:921-928 describe a partial
amino acid sequence for PDGF A-chain. See also Nature (1983) 304:
35-39 and Science (1983) 221: 275-277. Heldin, C. H. et al, Nature
(1986) 319:511-514 describes an osteosarcoma-derived growth factor
(ODGF) that is structurally related to putative PDGF A-chain
homodimer. The studies of ODGF suggest that PDGF A-chain homodimer
would exhibit biological activity.
DISCLOSURE OF INVENTION
The present invention is based on the isolation of cDNAs encoding
two forms of PDGF A-chain precursors, the preparation of vectors
for cloning and expressing PDGF A-chain polypeptides, and the
expression of biologically active PDGF A-chain proteins using such
expression vectors.
Accordingly, one aspect of the invention is recombinant DNA
encoding a PDGF A-chain polypeptide.
Cloning and expression vectors containing such recombinant DNA are
another aspect of the invention.
Hosts such as transformed yeast and mammalian cells which contain
such expression vectors and are capable of producing biologically
active (as measured by the assay described in .sctn.5 of the
examples) recombinant PDGF comprised of PDGF A-chain polypeptides
are another aspect of the invention.
Methods for producing biologically active PDGF A-chain proteins
which employ such hosts are still another aspect of the
invention.
Recombinant PDGF comprised of PDGF A-chain polypeptide is a further
aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the nucleotide sequence and deduced amino acid
sequence of one form of PDGF A-chain precursor (designated D1).
FIG. 2 shows the nucleotide sequence and deduced amino acid
sequence of a second form of PDGF A-chain precursor (designated
13-1).
FIG. 3 is a diagram of plasmid pSV7d-PDGF-A102 (13-1) described in
the examples.
FIG. 4 is a diagram of plasmid pSV7D-PDGF-e103 (D1) described in
the examples.
FIG. 5 is a diagram illustrating the scheme used to produce
chimeric plasmid pSV7d-PDGF A102-B1 described in the examples.
FIG. 6 is a diagram illustrating the scheme used to produce
chimeric plasmid pSV7d-PDGF A103-B1 described in the examples.
FIG. 7 is the nucleotide sequence of the SV40 region used to make
plasmid pSV7d described in the examples.
FIG. 8 is a map of the plasmid pSV7d described in the examples.
FIG. 9 is a map of the plasmid pYpA6 described in the examples
(.sctn.3.1.2).
FIG. 10 is a map of the plasmid pYpA134 described in the examples
(.sctn.3.1.2).
FIG. 11 is a map of the plasmids pAB24-AGMetPDGFADl/A13.1 described
in the examples (.sctn.3 2.2).
FIG. 12 is a map of the plasmids pAB24-AGhSODhPDGF ADl/13.1
described in the examples (.sctn.3.3.2).
FIG. 13 is a map of the plasmid pSOD-MethPDGF-A13.1 described in
the examples (.sctn.4.2).
FIG. 14 is a map of the plasmid pSOD-MethPDGF-AD1 described in the
examples (.sctn.4.2).
MODES FOR CARRYING OUT THE INVENTION 1. Definitions
The term "recombinant" as used herein to characterize DNA encoding
PDGF A-chain polypeptides intends DNA of genomic, cDNA,
semisynthetic, or synthetic origin which, by virtue of its origin
or manipulation is (1) not associated with all or a portion of the
DNA with which it is associated in nature and/or (2) linked to DNA
other than that to which it is linked in nature.
A "replicon" is any genetic element (e.g., a plasmid, a chromosome,
a virus) that behaves as an autonomous unit of polynucleotide
replication within a cell; i.e., capable of replication under its
own control.
A "vector" is a replicon in which another polynucleotide segment is
attached, so as to bring about the replication and/or expression of
the attached segment. An "expression vector" refers to a vector
capable of autonomous replication or integration and contains
control sequences which direct the transcription and translation of
the PDGF A-chain DNA in an appropriate host.
A "coding sequence" is a polynucleotide sequence which is
transcribed and/or translated into a polypeptide.
A "promoter sequence" is a DNA regulatory region capable of binding
RNA polymerase and initiating transcription of a downstream (i.e.,
in the 3' direction) coding sequence.
A coding sequence is "under the control" of the promoter sequence
in a cell when transcription of the coding sequence results from
the binding of RNA polymerase to the promoter sequence; translation
of the resulting mRNA then results in the polypeptide encoded
within the coding sequence.
"Operably linked" refers to a juxtaposition wherein the components
are configured so as to perform their usual function. Thus, control
sequences operably linked to a coding sequence are capable of
effecting the expression of the coding sequence.
"Control sequences" refers to those sequences which control the
transcription and/or translation of the coding sequence(s); these
may include, but are not limited to, promoter sequences,
transcriptional initiation and termination sequences, and
translational intitiation and termination sequences. In addition,
"control sequences" refers to sequences which control the
processing of the polypeptide encoded within the coding sequence;
these may include, but are not limited to sequences controlling
secretion, protease cleavage, and glycosylation of the
polypeptide.
"Transformation" is the insertion of an exogenous polynucleotide
into a host cell. The exogenous polynucleotide may be maintained as
a plasmid, or alternatively, may be integrated within the host
genome.
2. Recombinant PDGF A-Chain DNA
The recombinant PDGF A-chain DNA of the invention encodes at least
amino acids 87-193, inclusive of the boxed amino acid sequence
shown in FIG. 1 and analogs of that amino acid sequence which are
substantially homologous and functionally equivalent thereto. The
term "substantially homologous" intends that the number of amino
acid variations (including substitutions and/or deletions) in said
sequence be less than about 10 preferably less than about 3. The
term "functionally equivalent" intends that the sequence of the
analog defines a chain that will produce a protein having the
biological activity of PDGF (as measured by the assay described in
.sctn.5 of the examples). The DNA may include in addition DNA
encoding one or more of amino acid residues 194-196, inclusive of
the boxed sequences of FIGS. 1 or 2, DNA encoding one or more of
amino acid residues 197-211, inclusive, of the boxed sequence shown
in FIG. 1 and/or DNA encoding all or a portion of amino acids 1-86,
inclusive of the boxed amino acid sequence shown in FIG. 1. A
preferred DNA sequence encoding said amino acids 87-193 for
expression in mammalian systems is the DNA sequence shown in FIG.
1. For expression in other organisms, it may be desirable to use
sequences that employ codons preferred by the particular host in
which the DNA is expressed.
The recombinant PDGF A-chain DNA may be genomic, cDNA or synthetic
DNA. By way of example, the sequences shown in FIGS. 1 and 2 were
obtained from a cDNA library prepared from mRNA of a PDGF-producing
cell line. The library was probed with two probes having sequences
based on the reported partial amino acid sequence of PDGF A-chain.
Clones that hybridized to both probes provided the illustrated
sequences. Those sequences may be used to probe human genomic
libraries to obtain analogous genomic DNA encoding PDGF A-chain
polypeptides. Based on the amino acid sequence deduced from the
illustrated sequences, synthetic genes encoding PDGF A-chain
polypeptides may be prepared in vitro by synthesizing individual
overlapping complementary oligonucleotides and filling in single
stranded nonoverlapping portions using DNA polymerase in the
presence of the deoxyribonucleotide triphosphates.
The deduced amino acid sequence shown in FIG. 1 differs from the
reported partial amino acid sequence derived by amino acid
sequencing PDGF A-chain at amino acids 119, 141 and 143. The
reported residues at those positions were assigned Val, Arg and
Thr, respectively. As shown in FIG. 1, the PDGF A-chain cDNA
indicates these residues are instead Ile, Gln, and Ser,
respectively.
3. Cloning of pDGF A-Chain DNA
The PDGF A-chain DNA can be cloned into any suitable replicon to
create a vector, and thereby be maintained in a composition which
is substantially free of vectors that do not contain the PDGF
A-chain gene (e.g., other clones derived from the library).
Numerous cloning vectors are known to those of skill in the art,
and the selection of an appropriate cloning vector is a matter of
choice. Examples of vectors for cloning and host cells which they
can transform include the bacteriophage .lambda. (E. coli), pBR 322
(E. coli), pACYC 177 (E. coli), pKT 230 (gram-negative bacteria),
pGV1106 (gram-negative bacteria), pLAFRI (gram-negative bacteria),
pME290 (non-E. coli gram-negative bacteria), pHV 14 (E. coli and
Bacillus subtilis), pBD9 (Bacillus), pIJ61 (Streptomyces), pUC6
(Streptomyces), actinophage .phi.C31 (Streptomyces, YIp5
(Saccharomyces, YCp19 (Saccharomyces, and bovine papilloma virus
(mammalian cells).
4. Expression of PDGF A-Chain DNA
The polynucleotide sequence encoding the PDGF A-chain polypeptide
is expressed by inserting the sequence into an appropriate replicon
thereby creating an expression vector, and introducing the
resulting expression vector into a compatible host.
In creating an expression vector the sequence encoding the PDGF
A-chain polypeptide is located in the vector with the appropriate
control sequences. The positioning and orientation of the coding
sequence with respect to the control sequences is such that the
coding sequence is transcribed under the control of the control
sequences: i.e., the promoter will control the transcription of the
mRNA derived from the coding sequence; and the ribosomes will bind
at the ribosomal binding site to begin the translational process;
and the stop codon used to terminate translation will be upstream
from the transcriptional termination codon. Commonly used
prokaryotic control sequences include such commonly used promoters
as the .beta.-lactamase (penicillinase) and lactose (lac) promoter
systems (Chang et al, Nature (1977) 198:1056) and the tryptophan
(trp) promoter system (Goeddel et al, Nucleic Acids Res (1980)
8:4057) and the lambda-derived P.sub.L promoter and N-gene ribosome
binding site (Shimatake et al, Nature (1981) 292:128). Control
sequences for yeast vectors include promoters for the synthesis of
glycolytic enzymes (Hess et al, J Adv Enzyme Reg (1968) 7:149;
Holland et al, Biochemistry (1978) 17:4900). Additional promoters
known in the art include the promoter for 3-phosphoglycerate kinase
(Hitzeman et al, J Biol Chem (1980) 255:2073). Other promoters,
which have the additional advantage of transcription controlled by
growth conditions and/or genetic background are the promoter
regions for alcohol dehydrogenase 2 (ADH2), isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen
metabolism, the alpha factor system and enzymes responsible for
maltose and galactose utilization. It is also believed terminator
sequences are desirable at the 3' end of the coding sequences. Such
terminators are found in the 3' untranslated region following the
coding sequences in yeast-derived genes. Expression vectors for
mammalian cells such as VERO, Hela or CHO cells, ordinarily include
promoters and control sequences compatible with such cells as, for
example, the commonly used early and late promoters from Simian
Virus 40 (SV40) (Fiers et al, Nature (1978) 273:113), or other
viral promoters such as those derived from polyoma, Adenovirus 2,
bovine papilloma virus, or avian sarcoma viruses. The controllable
promoter, hMTII (Karin, M., et al, Nature (1982) 299:797-802) may
also be used.
In addition to control sequences, it may be desirable to add
regulatory sequences which allow for regulation of the expression
of the PDGF A-chain gene relative to the growth of the host cell.
Examples of regulatory systems are those which cause the expression
of a gene to be turned on or off in response to a chemical or
physical stimulus, including the presence of a regulatory compound.
In prokaryotic systems these would include the lac and trp operator
systems. In eukaryotic systems induction can occur in
methallothionein genes with heavy metals and the Mouse Mammary
Tumor Virus (MMTV) system with steroids. In these cases, the
sequence encoding the PDGF A-chain polypeptides would be placed in
tandem with the regulatory element.
There are also selective elements which give rise to DNA
amplification which in turn can result in higher levels of specific
protein production. In eukaryotic systems these include the
dihydrofolate reductase gene (dhfr) which is amplified in the
presence of methotrexate, and adenosine deaminase (ADA) in the
presence of deoxycorfomycin. In these cases the sequence encoding
the PDGF A-chain polypeptides may either be present on the same
plasmid or merely be cotransfected together with the selectable
element to allow for integration within the host cell genome near
each other.
Other types of regulatory elements may also be present in the
vector, i.e., those which are not necessarily in tandem with the
sequence encoding PDGF A-chain. An example is the SV40 enhancer
sequence, which, by its mere presence, causes an enhancement of
expression of genes distal to it.
Modification of the sequence encoding PDGF A-chain. Prior to its
insertion into the replicon, may be desirable or necessary,
depending upon the expression system chosen. For example, in some
cases, it may be necessary to modify the sequence so that it may be
attached to the control sequences with the appropriate orientation,
i.e., to maintain the reading frame. In some cases, it may be
desirable to add sequences which cause the secretion of the
polypeptide from the host organism, with subsequent cleavage of the
secretory signal. The techniques for modifying nucleotide sequences
utilizing cloning are well known to those skilled in the art. They
include, e.g., the use of restriction enzymes, of enzymes such as
Ba131 to remove excess nucleotides, and of chemically synthesized
oligonucleotides for use as adapters, to replace lost nucleotides,
and in site directed mutagenesis.
The appropriately modified sequence encoding the PDGF A-chain
polypeptide may be ligated to the control sequences prior to
insertion into a vector. Alternatively, the coding sequence can be
cloned directly into an expression vector which already contains
the control sequences and an appropriate restriction site. For
expression of the PDGF A-chain polypeptide in prokaryotes and in
yeast, the control sequences will necessarily be heterologous to
the coding sequence. In cases where the PDGF A-chain gene is to be
expressed in cell lines derived from vertebrates, the control
sequences may be either heterologous or homologous, depending upon
the particular cell line.
Depending on the host cell used, transformation is done using
standard techniques appropriate to such cells. The calcium
treatment employing calcium chloride, as described by Cohen, S. N.,
proc Natl Acad Sci (USA) (1972) 69:2110, or the RbCl.sub.2 method
described in Maniatis et al, Molecular Cloning: A Laboratory Manual
(1982) Cold Spring Harbor press, p. 254 and Hanahan, D., J Mol Biol
(1983) 166: 557-580 may be used for prokaryotes or other cells
Which contain substantial cell wall barriers. For mammalian cells
without such cell walls, the calcium phosphate precipitation method
of Graham and van der Eb, Virology (1978) 52:546, optionally as
modified by Wigler, M., et al, Cell (1979) 16:777-785 may be used.
Transformations into yeast may be carried out according to the
method of Beggs, J. D., Nature (1978) 275:104-109 or of Hinnen, A.,
et al, Proc Natl Acad Sci (USA) (1978) 75:1929.
Transformed cells are then grown under conditions which permit
expression of the PDGF A-chain gene and assembly of the expression
product into a biologically active PDGF (i.e., into a dimeric
form). As shown in the following experimental section, initial
attempts to produce recombinant PDGF A-chain homodimers in bacteria
produced little, if any, biologically active PDGF. This may be due
to a variety of reasons, such as improper dimer formation or
improper folding. In addition to producing recombinant PDGF A-chain
homodimer, the present invention permits production of heterodimers
of PDGF A-chain and PDGF B-chain by co-expressing the genes for
both PDGF A-chain and PDGF B-chain through use of separate vectors
or a single vector that contains an A-chain gene and the B-chain
gene. The thus synthesized recombinant PDGF protein is then
isolated from the host cells and purified. If the expression system
secretes the PDGF into the growth media, the PDGF is isolated
directly from the media. If the recombinant PDGF is not secreted,
it is isolated from cell lysates. The selection of the appropriate
growth conditions and recovery methods are within the skill of the
art. With regard to purification, see for instance, EPA publication
No. 0177957 and Nature (1986) 319:511-514.
Use and Administration of Recombinant PDGF
Recombinant PDGF prepared according to the invention is generally
applied topically to wounds such as cutaneous, dermal, mucosal, or
epithelial wounds in vertebrates, particularly mammals including
man, domestic and farm animals, sports animals and pets. It may be
used to treat any type of full or partial thickness wounds
including traumatic wounds, surgical wounds, thermal or chemical
wounds (burns) radiation wounds, and ulcers such as decubiti and
cutaneous ulcers caused by vascular, hematologic and metabolic
diseases, infections, or neoplasms.
The PDGF may be formulated using available excipients and carriers
in the form of a lotion, spray, gel, ointment or as a controlled or
sustained release dosage form. Additional ingredients such as other
growth factors (FGF, CTAP-III, EGF, IGF-1, IGF-2, TGF-.beta.,
TGF-.alpha.), buffers, local anesthetics, antibiotics, gelling
agents, and the like may be included in the formulation.
For topical administration, which is the most appropriate with
regard to cutaneous lesions, standard topical formulations are
employed using, for example, 0.1-10% concentrations of PDGF are
normally applied. The concentration of formulation depends, of
course, on the severity of the wound and nature of the subject. In
some treatment regimens, the dose is lowered with lime to lessen
likelihood of scarring.
Controlled or sustained release formulations of recombinant PDGF
are made by incorporating the PDGF in carriers or vehicles such as
liposomes, nonresorbable semipermeable polymers such as
ethylene-vinyl acetate copolymers and Hytrel.RTM. copolymers,
swellable polymers such as hydrogels, or resorbable polymers such
as collagen and certain polyacids or polyesters such as those used
to make resorbable sutures to provide for sustained release of the
PDGF to the wound site over an extended time period, typically from
one day to one week. Such incorporation may be particularly
desirable when the PDGF is incorporated into a wound dressing. The
mechanism of PDGF release from the formulation may be diffusion,
osmosis, leaching, dissolution, erosion, or combinations thereof.
In diffusional sustained release formulations the PDGF dissolves in
and diffuses through the carrier or vehicle on which it is
encapsulated/dispersed. In leaching or dissolution formulations,
the PDGF is leached from the carrier by body fluids. The
concentration of polypeptide in the sustained release formulation
will normally be at least 1 .mu.g/ml, usually between 10 .mu.g/ml
and 10 mg/ml. In some instances it may be desirable to continually
maintain the treatment composition at the affected area or wound
site during the healing period. This may be achieved via a
multiplicity of intermittent applications of the treatment
composition, or by administering the PDGF via a sustained release
dosage form such as those described above. In this regard, the term
"continually" denotes true continuous administration such as is
achieved by such sustained release dosage forms or that achieved by
such repeated applications that provide a pharmacokinetic pattern
that mimics that achieved by true continuous administration.
EXAMPLES
The following examples further describe the isolation of DNA
encoding PDGF A-chain polypeptides and the expression of that DNA
in various hosts to produce biologically active PDGF.
In the following, "digestion" refers to the enzymatic cleavage of
DNA by restriction endonucleases. Restriction endonucleases
commonly referred to as restriction enzymes are well characterized
and commercially available and used in accordance with
manufacturer's specifications. Digestion with restriction enzymes
is frequently followed by treatment with alkaline phosphatase
according to manufacturer's specifications to remove the terminal
5' phosphates, thus preventing self ligation of a vector having two
compatible ends.
"Fill in" refers to the enzymatic process of creating blunt ends by
repairing overhanging ends generated by certain restriction
enzymes. The repair is a function of DNA polymerase I large
fragment (Klenow) and deoxynucleotide triphosphates and is used
according to manufacturer's specifications.
Gel isolation of a DNA restriction fragment refers to the recovery
of a specific fragment, electrophoretically separated on either an
agarose gel or polyacrylamide gel (depending on size of fragment),
by either electroelution or melting and extraction of gel
slice.
All DNA manipulations are done according to standard procedures.
See Maniatis et al, Molecular Cloning, Cold Spring Harbor Lab.,
1982. All enzymes used are obtained from commercial sources and
used according to the manufacturer's specifications.
1. Isolation and Characterization of PDGF A-Chain cDNA
A .lambda.gt10 cDNA library was constructed from poly (A).sup.+ RNA
from the human clonal glioma cell line U-343 MGaC12:6 using the
LiCl/urea method modified as described by Betsholtz, C., et al,
Cell (1984) 39:447-457. Oligo(dT)-primed synthesis of ds cDNA was
performed according to Gubler, U., and Hoffman, B. J., Gene (1983)
25:263-299. The resulting cDNA was treated with T4 DNA polymerase
and subcloned into EcoRI-cleaved .lambda.gt10 using EcoRI linkers.
The recombinant phage were plated in E. coli C600hfl.
Two oligonucleotide probes, designated PDGF-A-1 and PDGF-A-2 were
synthesized based on the known partial amino acid sequence of PDGF
A-chain. Both were made using solid-phase phosphoramidite
methodology. The double-stranded probe PDGF-A-1 was synthesized as
two overlapping 50-bp oligonucleotides and radiolabeled using
[.alpha.-.sup.32 P]-deoxynucleoside triphosphates and Klenow
fragment of DNA polymerase I. PDGF-A-2 was synthesized as a 37-base
template and a 12-base complementary primer and was radiolabeled as
PDGF-A-1. The nucleotide sequences (single strand) of the two
probes are given below.
PDGF-A-1 (86-mer)
CCATCGAGGAGGCCGTGCCTGCAGTGTGC
AAGAACCCGCACCGTGATCTATGAGATCCCCCGCTCC
CAGGTCGACCCCACCTCCGCC
PDGF-A-2 (37-mer)
AAGCGCTGCACCGGCTGCTGCAACACCAGCAGCGTGA
These probes were used to screen the library (2.times.10.sup.6
clones). Duplicate nitrocellulose filter lifts were hybridized with
the probes at 42.degree. C. in 20% formamide, 5.times.SSC, 50 mM
sodium phosphate pH 7.0, 5.times.Denhardt's, 0.10% SDS, 200
.mu.g/ml sonicated salmon sperm DNA and washed in 0.5.times.SSC,
0.1% SDS at 42.degree. C. Clones D1 and 13-1 were selected from
among those that hybridized to both probes and sequenced by dideoxy
nucleotide chain termination after subcloning into M13 phage
derivatives. Partial nucleotide sequences of D1 and 13-1 are shown
in FIGS. 1 and 2.
The longest open reading frame of D1 predicts a PDGF A-chain
precursor of 211 amino acids (shown in FIG. 1); the boxed portion
designates the 125-amino acid PDGF A-chain polypeptide.
The deduced amino acid sequence of FIG. 1 matches the reported
partial sequence of the PDGF A-chain obtained by amino acid
sequencing except at amino acids 119, 141, and 143, found to be
Ile, Gln, and Ser, respectively, instead of the previously assigned
Val, Arg, and Thr. The ATG codon at amino acid position 1 precedes
a basic amino acid (Arg) followed by 18 hydrophobic residues. This
is characteristic of a signal peptide sequence and is consistent
with the observation that PDGF A-chain homodimers produced by human
osteosarcoma cells are secreted. Comparison with preferred signal
peptidase cleavage sites suggests that processing may occur between
amino acids Ala20 and Glu21. The N-terminal sequence of platelet
PDGF A-chain is found at amino acid 87. indicating that a
propeptide of 66 amino acids (44% charged residue) is cleaved from
the precursor to generate a 125-amino-acid A-chain protein. This
cleavage occurs after a run of four basic amino acids,
Arg-Arg-Lys-Arg. Additional proteolytic processing may occur in the
C-terminal region.
The corresponding open reading frame of 13-1 (FIG. 2) predicts a
PDGF A-chain precursor of 196 amino acids identical in sequence to
the precursor of D1 but lacking 15 C-terminal residues. Again, the
mature polypeptide is boxed in FIG. 2.
cDNA for PDGF B-chain was isolated from the same cDNA library for
use in the following experiments in which D1, 13-1, and B-chain
cDNA were cloned in an analogous manner.
2. Mammalian Cell Expression
In order to establish a permanent cell line producing PDGF, the
entire cDNA was cloned into a mammalian cell expression vector
which contains a transcriptional regulatory element, a
polyadenylation site, and a transcriptional terminator signal. The
resulting plasmid along with a selectable marker was introduced
into Chinese hamster ovary cells (CHO).
2.1. Constructions of Mammalian Cell Expression Vectors
pSV7d-PDGF-A102, pSV7d-PDGF-A103, and pSV7d-PDGF-B1.
Three separate mammalian cell expression vectors were constructed
by isolating EcoRI fragments from each of the three cDNA clones and
ligating them into pSV7d (see .sctn.2.4 below) previously digested
with EcoRI and treated with alkaline phosphatase. The resulting
clones pSV7d-PDGF-A103 (D1). pSV7d-PDGF-A102 (13-1), and
pSV7d-PDGF-B1 (B-chain) were isolated and characterized by
restriction digests. These plasmids were used to produce the
chimeric plasmids pSV7d-PDGF A102-B1 and pSV7d-PDGF A103-B1 for
coexpression of B-chain and A-chain. Large-scale plasmid
preparations were carried out for all of the constructions
described. The DNA was used to transfect CHO cells.
2.2 CHO Cell Transfections
Transfections were performed as follows:
CHO dhfr.sup.- cells (Urlaub and Chasin, Proc. Natl Acad Sci USA
(1980) 77:4216) were plated at a density of 5.times.10 to 10.sup.6
cells per 10 cm dish the day prior to transfection in nutrient
medium (F12 supplemented with 1.18 mg/ml Na.sub.2 CO.sub.3, 292
.mu.g/ml glutamine, 110 .mu.g/ml sodium pyruvate, 100 U/ml
penicillin, 100 U/ml streptomycin, 200 .mu.g/ml proline, and 10%
FCS). The CHO cells were transfected with each of the pSV7d-PDGF
expression plasmids that were mixed with plasmid pAD-dhfr which
bears a selectable marker (a dhfr gene driven by the adenovirus
major late promoter, see below), using a modification of the
procedure described by Graham and van der Eb, Virology (1973)
52:456-467. The samples, containing a total of 10 .mu.g of plasmid
DNA, were added to the dishes and allowed to settle onto the cells
in a carbon dioxide incubator (37.degree. C.). Six hours later, the
supernatants were aspirated, the cells rinsed gently with Ca and
Mg-free phosphate-buffered saline (PBS-CMF), and the dishes exposed
to 15% glycerol as an adjuvant for 3.5-4 min. The cells were then
rinsed gently and fed with the above-described medium.
Forty-eight hours after the addition of DNA to the cells, the cells
were split 1:20 into selective medium (DMEM supplemented with a 1:1
mixture of fetal calf serum and dialyzed fetal calf serum in
addition to the components described above). After growth in
selective medium for 1-2 weeks, colonies appeared and were isolated
and grown individually. Assays for PDGF were performed on each of
the clones (as described below).
Transfections in which pSV7d-PDGF-A103 plus pSV7d-PDGF-B1 and
pSV7d-PDGF-A102 plus pSV7d-PDGF-B1 are coprecipitated were also
performed in addition to transfections with the chimeric plasmids
described in .sctn.2.1 in order to establish cell lines that are
producing PDGF as a heterodimer of A-chain and B-chain.
The plasmid pAD-dhfr, bearing the mouse dihydrofolate reductase
(dhfr) gene was constructed by fusing the major late promoter from
adenovirus-2 (Ad-MLP, map units 16-17.3) to the mouse dhfr cDNA
(Subramani et al, J Mol Cell Biol (1982) 1:584-864) at the 5' end.
DNA coding for the intron for SV40 small t antigen and the SV40
early region polyadenylation site was obtained from pSV2-neo
(Southern and Berg, J Mol Appl Genet (1982) 1:327-341), and fused
to the 3' end of the dhfr cDNA. These three segments were subcloned
into pBR322 to obtain the plasmid pAD-dhfr.
Several of the primary CHO transfected cell lines secreted PDGF
into the medium at levels of 1-2 ng/ml/24hr as determined by the
mitogen assay described in .sctn.5.
Several primary clones from each of the transfected lines were
selected for amplification in increasing amounts of methotrexate,
0.05 and 0.1, and 1.0 .mu.M concentrations. Amplification and
selection of methotrexate-resistant colonies were performed
according to Kaufman, R. S., and Sharp. P. A., J Mol Biol (1982)
159:601-621.
2.3. Results of PDGF Expression
Results of PDGF expression from CHO cells are summarized in Table 1
below. Media from CHO cell lines transfected with PDGF expression
plasmids were assayed by the PDGF mitogen assay described in
.sctn.5. The results of these experiments indicate that the PDGF
A-chain homodimer is active.
TABLE 1 ______________________________________ CHO Cells
Transfected with PDGF Expression Plasmids: Level of Active PDGF
Secreted into Media Level of Cell Lines Plasmid PDGF/24 hr
______________________________________ EXPERIMENT 1 Primary Cell
Lines pSV7d-PDGF-A102 1-2 ng/ml pSV7d-PDGF-A103 no cells survived
pSV7d-PDGF-B1 1-2 ng/ml Amplified cell lines methotrexate level:
0.1 .mu.M pSV7d-PDGF-A102 50-100 ng/ml pSV7d-PDGF-B1 100-150 ng/ml
Methotrexate level: 1 .mu.M pSV7d-PDGF-A102 50-100 ng/ml
pSV7d-PDGF-B1 100-150 ng/ml EXPERIMENT 2 Primary Cell Lines
pSV7d-PDGF-A102 10-20 ng/ml pSV7d-PDGF-A103 1-2 ng/ml pSV7d-PDGF-B1
10-20 ng/ml pSV7d-PDGF-A102 + 1-2 ng/ml pSV7d-PDGF-B1
pSV7D-PDGF-A103 + 1-2 ng/ml pSV7d-PDGF-B1 Amplified Cell lines
methotrexate level: 1 .mu.M & 2 .mu.M No increase in level of
PDGF secreted into media. EXPERIMENT 3 Primary Cell Lines
pSV7D-PDGF 40 ng/ml A102-B1 pSV7D-PDGF no secretion A103-B1
detected ______________________________________
2.4. Construction of pSV7d
The mammalian cell shuttle vector plasmid pSV7d contains the SV40
origin of replication and early promoter (315 bp, PvuII pos
272-StuI pos 5193 with an 8 bp deletion between nucleotides 173 and
182), a polylinker, and the SV40 poly A addition site (217 bp, BclI
pos 2775-pos 2558). Buchman, L., et al "The SV40 Nucleotide
Sequence" pp 799-841 DNA TUMOR VIRUSES Second Edition edited by
Tooze, J. The sequence of the SV40 region is shown in FIG. 7. The
SV40 sequences were cloned into the pBR322 derivative pML (Lusky
and Botchan, (1984) Cell 36:391) between nucleotide 4210 and Nrul
pos 973. Maniatis, T., et al "Nucleotide Sequence of pBR322" (1983)
Molecular Cloning: A Laboratory Manual. The SV40 sequences are
positioned such that the direction of transcription from the early
promoter is in the same direction as the ampicillin gene of the
vector. A map of the plasmid is shown in FIG. 8.
3. Yeast Expression
Due to the ability of yeast to secrete and process proteins, the
genes for the mature PDGF A-chains and B-chain were fused with the
sequence of the .alpha.-factor leader, a yeast secretory signal
sequence which would allow for secretion of PDGF. Yeast transformed
with these plasmids would be expected to synthesize a protein
containing an NH2-terminal .alpha.-factor leader and COOH-terminal
PDGF chain separated by Lys-Arg. Since this molecule is targeted
for secretion, cleavage after the processing site Lys-Arg by the
yeast should result in secretion of the mature growth factor.
Lys-Arg is the processing site used by the natural prepro-PDGF, as
well as the prepro-.alpha.-factor.
3.I. Regulatable Secretion in Yeast
PDGF B-chain protein, and the two forms of the A-chain protein, D1
and 13-1, are produced and secreted by yeast strain Saccharomyces
cerevisiae AB110 (Mata, ura 3-52, leu 2-04, or both leu 2-3 and leu
2-112, pep 4-3, his 4,580, cir.degree.) transformed with yeast
expression plasmids pYpNB4, pYpA6, and pYpA134 respectively. The
plasmids contain the sequence coding for their respective mature
PDGF protein along with pBR322 sequences including the origin of
replication and the ampicillin resistance gene, as well as yeast
sequences including the 2-micron and selectable markers leu and ura
genes. Expression of the mature PDGF genes is under the control of
the regulatable promoter
ADH2-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and
.alpha.-factor terminator (see .sctn.3.1.4).
3.1.1. Construction of pYpNB4: A Yeast Expression Vector for PDGF
B-Chain
The entire gene coding for the mature PDGF B-chain was synthesized
by automated oligonucleotide synthesis on a silica support as
described by Urdea et al, proc Natl Acad Sci USA (1983)
80:7461-7465, using N,N-diisopropyl phosphoramidites.
Yeast-preferred codons were used. The synthetic gene was cloned as
a 350-bp XbaI-SalI fragment into pAG (see .sctn.3.1.4), which was
digested with XbaI and SalI and gel isolated to give pAGSB-4.
The expression cassette containing the synthetic PDGF B-chain gene
was cut out as a BamHI fragment and cloned into the yeast shuttle
vector pAB24 (see .sctn.3.1.4), Previously digested with BamHI and
treated with alkaline phosphatase, to give pYpNB4.
3.1.2. Construction of pYpA6 and pYpA134: Yeast Expression Vectors
for PDGF A-Chain
In vitro mutaqenesis was used to qenerate XbaI and SalI sites at
the end of the two different mature PDGF A-chain qenes in order to
clone the qenes into pAG (see .sctn.3.1.4). In vitro mutaqenesis
was performed according to the procedure of Zoller and Smith, DNA
(1984) 3(6):479-488. A Sacl-HindIII fragment, containing the entire
coding region for the mature polypeptide, was cloned from each of
the PDGF A-chain genes into M13mp19 in order to generate
single-stranded template. The following synthetic oligonucleotides
were used as mutagenic primers.
__________________________________________________________________________
MutationSequence of Primer
__________________________________________________________________________
##STR1## 13-1 and D1 ##STR2## clone D1 ##STR3## clone 13-1
__________________________________________________________________________
Mutagenesis of clone D1 was carried out using primers 1 and 2;
primers 1 and 3 were used for clone 13-1. An approximately 400-bp
XbaI-SalI (partial) fragment from clone D1 and an approximately
360-bp XbaI-SalI (partial) fragment from clone 13-1 were each
isolated and cloned into pAG, which was digested with the XbaI and
SalI and gel isolated, to give pAG-AD1 and pAG-A13.1. respectively.
The expression cassettes containing the two forms of the mature
PDGF A-chain gene were cut out as BamHI fragments and each cloned
into pAB24, Previously digested with BamHI and treated with
alkaline phosphatase, to give plasmids pYpA6 and pYpA134.
3.1.3. Yeast Transformation and Expression
Yeast expression plasmids pYpNB4, pYpA6, and pYp134 were
transformed into into yeast strain S. cerevisiae AB110 (Mata, ura
3-52, leu 2-04, or both leu 2-3 and leu 2-112, pep 4-3, his 4-580,
cir.degree.), as described by Hinnen et al (proc Natl Acad Sci USA
(1978) 75:1929-1933) and plated on ura-, 8% glucose, sorbitol
plates. Transformants are grown in leu-, 8% glucose liquid medium
for 24 hr and then plated onto leu.sup.-, 8% glucose sorbitol
plates to get individual colonies. Individual colonies are picked
and grown in 3 ml of leu.sup.-, 8% glucose medium for 24 hr at
30.degree. C., and then inoculated (1:50) into 1 liter of
ura.sup.-, 1% glucose media and grown for 75 hr at 30.degree. C.
Yeast culture medium was assayed for PDGF activity by the human
foreskin fibroblast mitogen assay (see .sctn.5). The yeast
transformant pYpNB4-2 secretes PDGF B-chain into the medium at a
level of 500 ng/ml, transformant pYpA6-NT1 secretes PDGF A-chain
(D1 form) into the medium at a level of 750 ng/ml and transformant
pYpA134-NT1 secretes PDGF A-chain (13-1 form) into the medium at a
level of 325 ng/ml.
Proteins from the above cultures were run on a proteins from the
above cultures were run on a 15% polyacrylamide SDS gel. The
B-chain migrates at the expected size of 14.5 Kd. The 13.1 form of
A-chain migrates as 2 bands at 18 and 18.5 Kd respectively. The
size for the expected single species is 18 Kd. The D1 form of
A-chain migrates as 3 bands at 19, 18.5 and 18 Kd. Its expected
size on the same gel for a single species is calculated at 19.5 Kd.
The extra bands for both A-chains are due to proteolytic cleavage
at either the amino-terminus and/or the carboxy-terminus.
3.1.4. plasmids Used for The preparation of Yeast Expression
Vectors
pAG- is a general yeast expression cassette vector derived from
pAG-TNF where pAG-TNF is only used for convenience of cloning with
the pAG- construct being relevant to this application.
The expression cassette vector, pAG-TNF, contains the regulatable
ADH2-GAPDH promoter, the .alpha.-factor leader, the synthetic TNF
gene, and the .alpha.-factor terminator cloned in pBR.DELTA.RI-Sal.
The ADH2-GAPDH promoter was isolated as a 1.0-Kbp BamHI-NcoI
fragment from pAG.DELTA.XbaGAPl. The 5' end of the .alpha.-factor
leader was supplied as a synthetic adaptor for the following
sequence and having NcoI- and PstI-compatible overhangs:
CATGAGATTCCTTCAATTTTTACTGCA TCTAAGGAAGTTAAAAATG
The 3' end of the .alpha.-factor leader, the synthetic TNF gene and
the .alpha.-factor terminator was isolated as a PstI-BamHI fragment
from pHG100-TNF. The three fragments were ligated together and
cloned into pBR.DELTA.RI-Sal which had been previously digested
with BamHI and treated with alkaline phosphatase.
pBR.DELTA.RI-Sal was constructed by digesting pBR322 with EcoRI and
SalI, filling in the overhangs with Klenow fragment, and ligating
on BamHI linkers. The vector and linkers were digested with BamHI
and the BamHI-BamHI 3.8 kb vector was gel isolated and
recircularized by self-ligation. The resulting plasmid was
designated pBR.DELTA.RI-Sal.
The plasmid pAG.DELTA.XbaGApl contains the ADH2-GAPDH hybrid
promoter and the GAPDH terminator cloned into pBR.DELTA.RI-Sal. The
ADH2-GAPDH promoter (the only sequence pertinent to this
application) was isolated as a 1.1-kb BamHI-NcoI fragment from
pJSI03 (described below). In addition, an approximately 90-bp
XbaI-XbaI deletion was introduced into the 5' end of the promoter
fragment by cutting the plasmid with XbaI, filling in the overhang
ends with Klenow fragment, and dNTPs and recircularizing the
plasmid, thus giving pAG.DELTA.XbaGApl.
pHG100-TNF contains the .alpha.-factor promoter, leader, and
terminator with the synthetic gene coding for TNF inserted in frame
at the 3' end of the leader. The 1.0 kb pst-BamHI fragment isolated
from this plasmid contains 240 bp of the 3' end of the
.alpha.-factor leader, the 494-bp synthetic TNF gene (as an
XbaI-SalI fragment) and the 272-bp .alpha.-factor terminator. The
.alpha.-factor sequences which are the only sequences relevant to
this application are derived from pAB114. pAB114 is described in
EPO 0 116 201, pages 14-18, and Brake, A. J., et al, proc Natl Acad
Sci USA (1984), 81:4642-4646. The only difference is that a silent
mutation was introduced by M13 mutagenesis to create an XbaI site
at the 3' end of the leader to facilitate cloning of heterologous
genes.
The comparison of the 3' end of the .alpha.-factor leader from the
wild type (pAB114) versus the altered .alpha.-factor (pHG100)
illustrated below shows that a silent mutation was incorporated to
code for an XbaI site just 5' to the processing site (LysArg). This
allows for insertion of heterologous genes without the "spacer"
codons (must provide the LysArg processing site and maintain
reading frame). ##STR4##
pJS103
Plasmid pJS103 contains the inducible hybrid ADH2-GAPDH promoter.
The hybrid promoter is made up of the transcriptional and
translational initiation region from the GAPDH promoter and is
under the regulatory control of the ADH2 transcriptional regulatory
region. The ADH2 transcriptional regulatory region is derepressed
in the absence of a readily available source such as glucose
(without exogenous inducer). By allowing for glucose exhaustion
after the yeast culture is grown to high density, the
transcriptional control region will be derepressed and expression
of the desired peptide will occur.
Plasmid pJS103 was constructed as follows. The ADH2 portion of the
promoter was constructed by cutting a plasmid containing the
wild-type ADH2 gene from plasmid pADR2 (Beier et al, Nature (1982)
300:724-728) with restriction enzyme EcoRV, which cuts at position
+66 relative to the ATG start codon, as well as in two other sites
in pADR2, outside of the ADH2 region. The resulting mixture of a
vector fragment and two smaller fragments was resected with Ba131
exonuclease to remove about 300 bp. Synthetic XhoI linkers were
ligated onto the Ba131-treated DNA. The resulting DNA linker vector
fragment (about 5 kb) was separated from the linkers by column
chromatography, cut with restriction enzyme XhoI, religated, and
used to transform E. coli to ampicillin resistance. The positions
of the XhoI linker were determined by DNA sequencing. One plasmid
which contained an XhoI linker within the 5' nontranscribed region
of the ADH2 gene (position -232 from ATG) was cut with the
restriction enzyme XhoI, treated with nuclease Sl, and subsequently
treated with the restriction enzyme EcoRI to create a linear vector
molecule having one blunt end at the site of the XhoI linker and an
EcoRI end. The GAP portion of the promoter was constructed by
cutting plasmid pPGAPl with the enzymes BamHI and EcoRI, followed
by the isolation of the 0.4 Kbp DNA fragment. This purified
fragment was then completely digested with the enzyme AluI and an
approximately 200 bp fragment was isolated.
This GAP promoter fragment was ligated to the ADH2 fragment present
on the linear vector described above to give plasmid pJS103.
pPGAP1
pPGAP1 is a yeast expression cassette vector which has a
polyrestriction site linker between the GAPDH terminator and a
truncated GAPDH promoter region. The polyrestriction site contains
the recognition sites for NcoI, EcoRI, and SalI, and the cassette
is excisable as a BamHI fragment. The preparation of pPGAP1 is
described in EPO 0 164 556 and Travis, J., et al, J Biol Chem
(1985) 260(7)14384-4389. In both references pPGAP1 is referred to
pPGAP.
pAB24
pAB24 is a yeast shuttle vector which contains the complete 2.mu.
sequences (Broach, In: Molecular Biology of the Yeast
Saccharomyces, 1:445, Cold Spring Harbor press (1981)) and pBR322
sequences. It also contains the yeast URA3 gene derived from
plasmid YEp24 (Botstein et al, Gene (1979) 8:17) and the yeast
LEU2.sup.d gene derived from plasmid pCl/1 (described in European
patent Application publication no. EPO116201). Insertion of the
expression cassette was in the BamHI site of pBR322, thus
interrupting the gene for bacterial resistance to tetracycline.
3.2. Intracellular Expression in Yeast
PDGF B-chain and the two forms of the A-chain protein, D1 and 13.1,
can be produced internally by Yeast strain S. cerevisiae AB110
transformed with pAB24-AGMetPDGF-SB, pAB24-AGMetPDGF-AD1, and
pAB24-AGMetPDGF-A13.1 respectively. The plasmids contain the
sequence coding for their respective mature PDGF protein with an
additional methionine at the amino terminus which allows for direct
expression. Expression of the mature PDGF genes is under the
control of the regulatable promoter ADH2-GAPDH and the GAPDH
terminator.
3.2.1. Construction of pAB24-AGMetPDGF-SB: A Yeast Expression
Vector for PDGF B-Chain
In order to express the mature B-chain internally in yeast, plasmid
pAGSB-4 (.sctn.3.1.1) is digested with BolII and then treated with
Sl nuclease to remove the 5' overhang and generate a blunt end. A
linker of the following sequence:
5'- GATCTATGTC -3'
ATACAG
(which contains a BolII overhang, a start codon, and regenerates
the codon coding for the first amino acid, serine, of the mature
PDGF B-chain) is ligated to pAGSB-4 and then the plasmid is
digested with BolII and SalI. The 345 bp BolII-SalI fragment is gel
isolated and ligated into BglII and XhoI digested pRSP101 to
generate plasmid pAB24-AGMetPDGF-SB.
The plasmid pRSP101 is a yeast expression vector containing the
regulatable ADH2-GAPDH promoter and GAPDH terminator and was
derived from pAB24 and pBS100. Plasmid pRSP100 was constructed by
excising the BamHI cassette from pBS100 and ligating it into pAB24
which had been previously digested with BamHI and treated with
phosphatase. The intermediate vector was then digested with NcoI
and SalI, to remove the fragment between the promoter and the
terminator, and then treated with Sl nuclease to remove the
single-stranded overhangs and make the ends blunt. A linker of the
following sequence:
5'- AGATCTCTTGCTCGAG -3' TCTAGAGAACGAGCTC
was then ligated in to add unique sites for BglII and XhoI. Plasmid
pBS100 is a yeast expression cassette vector cloned into a pBR322
derivative pAB12. The expression cassette contains the hybrid
ADH2-GAPDH promoter and the GAPDH terminator flanking a gene
segment from the HIV envelope gene. The ADH2-GAPDH promoter is a
1200 bp BamHI-NcoI fragment isolated from pJSI03 (.sctn.3.1.4) and
the GAPDH terminator is a 900 by SalI-BamHI fragment isolated from
plasmid pPGAP1 (.sctn.3.1.4). Plasmid pBS100 also contains a
non-essential fragment between the NcoI and SalI sites which is
replaced by gene fragments of interest. The expression cassette can
be removed from pBS100 by digestion with BamHI and cloned into
Yeast shuttle vectors for introduction into yeast cells.
Plasmid pAB12 is a pBR322 derivative lacking the region between the
single HindIII and SalI sites and containing a BamHI linker
inserted between the unique EcoRI site. This vector was constructed
by digesting pBR322 to completion with HindIII and SalI followed by
limited digestion with Ba131 nuclease, repair of the ends so
created with the Klenow fragment of E. coli DNA polymerase I, and
blunt-end ligation with T4 DNA ligase to reform closed covalent
circles. The plasmid was the opened up with EcoRI. treated with the
Klenow fragment of E. coli DNA polymerase I (to fill-in the 5'
overhangs), blunt-end ligated with BamHI linkers, digested with
BamHI to remove excess linkers, and then ligated to form closed
circles.
3.2.2. Construction of DAB24-AGMetPDGF-AD1 and
pAB24-AGMetPDGF-A13.1: Yeast Expression Vectors for PDGF
A-Chain
In order to clone the two mature A-chains of PDGF, to be expressed
internally in yeast, the semisynthetic NcoI-HindIII fragments are
isolated from the internal bacterial expression vectors
pSOD-MethPDGF-AD1 and pSOD-MethPDGF-A13.1 (.sctn.4.2). These
fragments contain the translational start codon ATG followed by the
mature PDGF A-chain gene and the 3' untranslated region. The
approximately 613 bp and 544 bp NcoI-HindIII fragments coding for
D1 and 13.1 respectively are each ligated into pBS100 which is
previously digested with NcoI and HindIII (cuts in the 5' end of
the terminator region) to give the resulting plasmids
pAGMetPDGF-AD1 and pAGMetPDGF-A13.1. The expression cassette
containing the ADH2-GAPDH hybrid promoter, mature PDGF A-chain
gene, and the GAPDH terminator is excised as a BamHI fragment and
ligated into pAB24 which is previously digested with BamHI and
treated with phosphatase to yield plasmids pAB24-AGMetPDGF-AD1 and
pAB24-AGMetPDGF-A13.1.
3.2.3. Yeast Transformation and Expression
The yeast expression plasmids containing MetPDGF B-chain and two
forms of A-chain: pAB24-AGMetPDGF-SB, PAB24-AGMetPDGF-AD1, and
pAB24-AGMetPDGF-A13.1, were each transformed into yeast S.
cerevisiae AB110 as described previously in .sctn.3.1.3.
3.3. Internal Expression as an SOD-Fusion
3.3.1. Construction of pAB24-AGhSOD-hPDGF: A Yeast Expression
Vector for an SOD-PDGF B-Chain Fusion protein
To make the above plasmid, the BglII-SalI fragment encoding the
mature PDGF B-chain is excised from pYpNB4. The following linker is
ligated onto the 5' end:
5'-AATTCTAAAA
GATTTTCTAG-3'
This linker includes a lys arg cleavage site for the Kex2 protease
to allow separation of human superoxide dismutase (hSOD) and PDGF
B-chain. The EcoRI-SalI fragment is then cloned into
phosphatase-treated pSI4 (described in European patent Application
86104066.5, publication no 0196056) digested with EcoRI and SalI.
The BamHI cassette is then excised and subcloned into
phosphatase-treated pAB24 digested with BamHI.
3.3.2. Construction of pAB24-AGSOD-hPDGF A (13.1 or D1): A Yeast
Expression Vector for an SOD-PDGFA (13.1 or D1) Fusion protein
To make the above plasmid, the SalI fragments containing 102 and 87
of the N-terminal amino acids of mature PDGF A-chain forms D1 and
13.1 respectively are isolated. They are ligated to linkers that
restore the first 23 amino acids of PDGF A-chain, introduce a lys
arg (Kex2) cleavage site between SOD and PDGF, and an EcoRI
restriction site at the 5' end. ##STR5##
The EcoRI-SalI fragment (355 and 392 bp for clones 13.1 and D1
respectively) are then ligated into phosphatase treated pSI4
digested with EcoRI and SalI. The BamHI cassette is excised and
subcloned into phosphatase-treated pAB24 digested with BamHI.
4. E. coli: Expression
In order to stabilize the expression of PDGF in E. coli, the gene
for PDGF was fused 3' to the hSOD sequence which is expressed
stably and in high levels in E. coli. To clone the gene for the
mature PDGF A-chain (forms D1 and 13.1) and B-chain, the DNA
sequences encoding the mature polypeptides were modified to include
an NcoI site at the 5' end, this would result in a Methionine
initiation codon in frame with the rest of the coding sequence.
4.1. Construction of pSOD-MethPDGF-SB: A Bacterial Expression
Vector for PDGF B-Chain
The entire coding region for the PDGF B-chain was synthesized as
described previously (.sctn.3.1.1) except that an NcoI site was
generated at the 5' end instead of the XbaI site. The 350 bp
NcoI-SalI PDGF B fragment was ligated into pSODCF2, digested
previously with NcoI and SalI and gel isolated, to give plasmid
pSOD-MethPDGF-SB.
pSODCF2 is an E. coli expression vector containing the TacI
promoter (a hybrid trp-lac promoter) followed by a cDNA copy of the
hSOD gene and a polylinker (for cloning COOH terminal fusions)
cloned into pBR322. pSODCF2 is described in Steimer, K. S., et al,
J Virol (1986) 58:9-16.
4.2. Construction of pSOD-MethPDGF-AD1 and pSOD-MethPDGF-A13.1:
Bacterial Expression Vectors for PDGF A-Chain
In order to clone the two forms of the mature PDGF A-chain for E.
coli expression the first 69 nucleotides were synthesized to
include an NcoI site and code for a methionine at the 5' end and a
SalI site at the 3' end. This fragment was ligated with each of the
approximately 475-bp SalI HindIII fragment from clone 13-1 and the
approximately 545 bp SalI-HindIII fragment from clone D1.
The resulting semisynthetic genes for both of the A-chains were
cloned as NcoI-HindIII fragments into pbaFGF.sub.Fix which was
previously digested with NcoI and HindIII and gel isolated to give
pSOD-MethPDGF-AD1 and pSOD-MethPDGF-A13.1, respectively.
The plasmid pbaFGF.sub.Fix is plasmid pSODCF2 containing a 436-bp
NcoI-SalI fragment coding for fibroblast growth factor (FGF) and
was used only for convenience due to the presence of a HindIII site
within the FGF sequences. Translation stop codons for PDGF are
present, as evidenced by the sequence.
4.3. E. coli: Transformation and Expression
The E. coli expression plasmids pSOD-MethPDGF-AD1,
pSOD-MethPDGF-A13.1, and pSOD-MethPDGF-SB were transformed into E.
coli strain RR.DELTA.M15. Individual colonies were grown in L-broth
medium with 100 .mu.g/ml ampicillin and expression was induced as
described by Hallewell, R. A., et al, Nucl Acid Res (1985)
13:2017-2034. The E. coli extracts were analyzed for PDGF activity.
No activity was detected, although a protein of the expected size
was found for the direct expression of form 13.1.
5. Bioassay for PDGF Activity
5.1. PDGF produced in Mammalian Cells
Chinese hamster ovary cells (CHO) used in the process are normally
grown in medium supplemented with 10% fetal calf serum (FCS). This
presented a problem in assaying for PDGF due to the background
contributed by the native bovine PDGF in FCS. Thus, it was
necessary to devise culture conditions that support production of
recombinant products while reducing the background. Using CHO cells
transfected with the human 8-interferon gene, it was found that
expression levels reached approximately 50% of those observed in
10% FCS with culture medium supplemented by 5% platelet-deficient
horse plasma (PDHS). This medium, when added to either the cell
growth of mitogen assays, gave no background.
CHO transformants were assayed by adding 10 .mu.l of a 24-hr
supernatant harvest in 5% PDHS (and necessary dilutions, usually
serial twofold and threefold) to the well of a 96-well plates of
the assay.
5.2. PDGF Produced in Yeast
Samples of superantants of yeast which had expressed PDGF were
appropriately diluted, depending upon expected activity, and then
serially diluted in DMEM containing 1% bovine serum albumin (BSA).
Aliquots (10 .mu.l) of each dilution were placed in the wells of
the assay plates.
5.3. Human Foreskin Fibroblast (HFF) Mitogen Assay for PDGF
HFF stocks were stored frozen; freezing was at passage 13. Prior to
use, HFF were thawed, and grown in T75 flasks until confluent,
which usually occurred at 5-7 days. Growth medium contained
Dulbecco's Modified Eagles Medium (DMEM), 20% fetal bovine serum
(FBS), 1 mM sodium pyruvate, 300 .mu.g/ml L-glutamine, 100U/ml
penicillin, and 100 .mu.g/ml streptomycin. Cells were incubated at
37.degree. C. in humidified 7% CO.sub.2, 93% air atmosphere. At
confluency, cells were passaged by rinsing the monolayer with
phosphate buffered saline (PBS) lacking Ca.sup.++ and Mg.sup.++,
dissociating them in trypsin containing EDTA, and diluting them
with Growth Medium. Cells were passaged no more than 8 times after
thawing.
To assay for PDGF, HFFs were plated as follows. The cells were
rinsed and dissociated with trypsin as above. The trypsinized cells
were pelleted, and resuspended to a concentration of
1.times.10.sup.5 cells/ml in medium similar to Growth Medium,
except that 5% FBS replaced 20% FBS; 100 .mu.l of suspension was
dispensed into each well of a 96 well microtiter plate, and the
cells were incubated 5-6 days under the above described
conditions.
PDGF in the sample was determined by monitoring .sup.3 H-thymidine
incorporation into HFF DNA stimulated by PDGF. Samples were added
to the wells containing HFF monolayers, and the assay plates
incubated as above for 18 hours. The HFF cultures were then pulsed
with [Methyl-3H]thymidine (10 .mu.C/ml final concentration, 1
.mu.C/well) at 37.degree. C. under the above described incubation
conditions for 8 hours. After incubation, the cells were rinsed
with PBS and fixed. Fixing was by incubation with 5% trichloracetic
acid (TCA) and then 100% methanol for 15 minutes, followed by
drying in air. The cells were then solubilized with 0.3N NaOH, and
counted in a liquid scintillation counter.
Control samples were treated as the samples described above, and
were prepared as follows. For positive controls, PDGF, purchased
from PDGF, Inc., was dissolved to a final concentration of 100
ng/ml in DMEM containing 10 mg/ml BSA. A standard curve was
prepared; the first point was 10 ng/ml, the remaining points were
2-fold serial dilutions. Each dilution was tested in triplicate.
Negative controls, which lacked both sample and control PDGF, were
also run.
Modifications of the above-described modes for carrying out the
invention that are obvious to those of skill in the fields related
to the invention are intended to be within the scope of the
following claims.
* * * * *