U.S. patent number 11,213,514 [Application Number 16/079,548] was granted by the patent office on 2022-01-04 for alpha-1-adrenergic receptor agonist therapy.
This patent grant is currently assigned to The Regents of the University of California, The University of North Carolina at Chapel Hill. The grantee listed for this patent is The Regents of the University of California, The University of North Carolina at Chapel Hill. Invention is credited to Brian C. Jensen, Paul C. Simpson, Jr..
United States Patent |
11,213,514 |
Simpson, Jr. , et
al. |
January 4, 2022 |
Alpha-1-adrenergic receptor agonist therapy
Abstract
Presented herein, inter alia, are novel methods of treating
heart diseases.
Inventors: |
Simpson, Jr.; Paul C. (San
Francisco, CA), Jensen; Brian C. (Chapel Hill, NC) |
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California
The University of North Carolina at Chapel Hill |
Oakland
Chapel Hill |
CA
NC |
US
US |
|
|
Assignee: |
The Regents of the University of
California (Oakland, CA)
The University of North Carolina at Chapel Hill (Chapel
Hill, NC)
|
Family
ID: |
1000006031768 |
Appl.
No.: |
16/079,548 |
Filed: |
February 24, 2017 |
PCT
Filed: |
February 24, 2017 |
PCT No.: |
PCT/US2017/019522 |
371(c)(1),(2),(4) Date: |
August 23, 2018 |
PCT
Pub. No.: |
WO2017/147532 |
PCT
Pub. Date: |
August 31, 2017 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20190117623 A1 |
Apr 25, 2019 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
62450996 |
Jan 26, 2017 |
|
|
|
|
62300549 |
Feb 26, 2016 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K
45/06 (20130101); A61K 31/704 (20130101); A61P
9/10 (20180101); A61K 31/4164 (20130101); A61K
31/4164 (20130101); A61K 2300/00 (20130101); A61K
31/704 (20130101); A61K 2300/00 (20130101) |
Current International
Class: |
A61K
31/4164 (20060101); A61K 45/06 (20060101); A61K
31/704 (20060101); A61P 9/10 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Musselman, D.M. et al., BJU International, "A randomized crossover
study to evaluate Ro 115-1240, a selective alpha-1
A/1L-adrenoceptor partial agonist in women with stress urinary
incontinence", 2003, vol. 93, pp. 78-83 (Year: 2003). cited by
examiner .
Pubchem, "Dabuzalgron hydrochloride"; also available at
https://pubchem.ncbi.nlm.nih.gov/compound/Dabuzalgron-hydrochloride#secti-
on=MeSH-Entry-Terms&fullscreen=true; viewed online Jan. 16,
2020 (Year: 2020). cited by examiner .
Beak, J. Y. et al., J. Am. Coll. Cardiol. Basic Trans Science "An
Oral Selective Alpha-1A Adrenergic Receptor Agonist Prevents
Doxorubicin Cardiotoxicity", 2017, vol. 2, No. 1, pp. 39-53 (Year:
2017). cited by examiner .
"Prevent", WordNet Search 3.1, obtained from
wordnetweb.princeton.edu/perl; last obtained 2021 (Year: 2021).
cited by examiner .
ALLHATT. (Apr. 19, 2000). Major cardiovascular events in
hypertensive patients randomized to doxazosin vs chlorthalidone:
The antihypertensive and lipid-lowering treatment to prevent heart
attack trial (ALLHATT). JAMA. 283(15):1967-1975. cited by applicant
.
Amin, J.K. et al. (2001). "Reactive oxygen species mediate
.alpha.-adrenergic receptor-stimulated hypertrophy in adult rat
ventricular myocytes," J Mol Cell Cardiol. 33:131-139. cited by
applicant .
Bielecka-Dabrowa, A. et al. (2008). "New methods in laboratory
diagnostics of dilated cardiomyopathy, "Cardiology J.
15(4):388-395. cited by applicant .
Bishop M.J. (2007). "Recent advances in the discovery of
.alpha..sub.I-adrenoceptor agonists," Curr Top Med Chem. 7:135-145.
cited by applicant .
Bloom, M.W. et al. (Jan. 2016). "Cancer therapy-related cardiac
dysfunction and heart failure: Part 1: Definitions,
pathophysiology, risk factors, and imaging," Circ Heart Fail.
9(1):e002661. cited by applicant .
Blue, D.R. et al. (Jan. 2004). "Pharmacological characteristics of
Ro 115-1240, a selective .alpha.1A/1L-adrenoceptor partial agonist:
a potential therapy for stress urinary incontinence," BJU Int.
93(1):162-170. cited by applicant .
Bristow, M.R. et al. (1988). "Alpha-1 adrenergic receptors in the
nonfailing and failing human heart," J Pharmacol Exp Ther. 247(3):
1039-1045. cited by applicant .
Bullard, J.H. et al. (2010). "Evaluation of statistical methods for
normalization and differential expression in mrna-seq experiments,"
BMC bioinformatics 11:94. cited by applicant .
Cardinale, D. et al. (Jun. 2, 2015). "Early detection of
anthracycline cardiotoxicity and improvement with heart failure
therapy," Circulation. 131:1981-1988. cited by applicant .
Chan T. et al. (2008). Abstract 5355 "An alpha-la-adrenergic
receptor subtype agonist prevents cardiomyopathy without increasing
blood pressure," Circulation 118:No. Suppl 18. cited by applicant
.
Chaulet H. et al. (Apr. 2006, e-published Mar. 6, 2006). "Sustained
augmentation of cardiac .alpha..sub.1A-adrenergic drive results in
pathological remodeling with contractile dysfunction, progressive
fibrosis and reactivation of matricellular protein genes," J Mol
Cell Cardiol. 40(4):540-552. cited by applicant .
Collette, K.M et al. (2014). "Long-term alphalb-adrenergic receptor
activation shortens lifespan, while .alpha..sub.1A-adrenergic
receptor stimulation prolongs lifespan in association with
decreased cancer incidence," Age 36:9675. cited by applicant .
Dash, R. et al. (Oct. 2011, e-published Feb. 28, 2011). "A
molecular MRI probe to detect treatment of cardiac apoptosis in
vivo," Magn. Reson. Med. 66(4): 1152-1162. cited by applicant .
Doze, V.A. et al. (2011). "Long-term .alpha..sub.1A-adrenergic
receptor stimulation improves synaptic plasticity, cognitive
function, mood, and longevity," Mol Pharmacol. 80(4):747-758. cited
by applicant .
Du ,X.J. et al. (2004). "Genetic enhancement of ventricular
contractility protects against pressure-overload-induced cardiac
dysfunction," J Mot Cell Cardiol. 37:979-987. cited by applicant
.
Du, X.J. et al. (2006). "Transgenic .alpha..sub.1A-adrenergic
activation limits post-infarct ventricular remodeling and
dysfunction and improves survival," Cardiovasc Res. 71:735-743.
cited by applicant .
Esbenshade, T.A. et al. (May 1995). "Cloning of the human .alpha.
1d-adrenergic receptor and inducible expression of three human
subtypes in SK-N-MC cells," Mol. Pharmacal. 47(5):977-985. cited by
applicant .
Extended European Search Report dated Sep. 5, 2019, for EP Patent
Application No. 17757383.9, 6 pages. cited by applicant .
Gottlieb, E. et al. (2003). "Mitochondrial membrane potential
regulates matrix configuration and cytochrome c release during
apoptosis," Cell Death Differ. 10:709-717. cited by applicant .
Graham, R.M. et al. (May 1996). ".alpha.1-adrenergic receptor
subtypes. Molecular structure, function, and signaling," Circ Res
78(5):737-749. cited by applicant .
Guo. J. et al. (2009). "P66shc links .alpha..sub.1A-adrenergic
receptors to a reactive oxygen species-dependent akt-foxo3a
phosphorylation pathway in cardiomyocytes," Circ Res. 104:660-669.
cited by applicant .
Huang Y. et al. (Feb. 13, 2007).
".alpha.1A-adrenergic-extracellular signal-regulated kinase
survival signaling pathway in cardiac myocytes," Circulation
115:763-772. cited by applicant .
International Search Report dated May 11, 2017, for PCT Application
No. PCT/US2017/019522, filed Feb. 24, 2017, 3 pages. cited by
applicant .
Jensen, B.C. et al. (2009). The .alpha.-1D is the predominant
alpha-1-adrenergic receptor in human epicardial coronary arteries.
JACC. 54:1137-1145. cited by applicant .
Jensen, B.C. et al. (2009). ".alpha.1-adrenergic receptor subtypes
in nonfailing and failing human myocardium," Circ Heart Fail.
2:654-663. cited by applicant .
Jensen, B.C. et al. (2011). ".alpha.-1-adrenergic receptors:
Targets for agonist drugs to treat heart failure," JMol Cell
Cardiol. 51:518-528. cited by applicant .
Jensen B.C. et al. (2014). ".alpha.-1-adrenergic receptors in heart
failure: The adaptive arm of the cardiac response to chronic
catecholamine stimulation," J Cardiovasc Pharmacol. 63:291-301.
cited by applicant .
KREGE,,J.H. et al. (1995). "A noninvasive computerized tail-cuff
system for measuring blood pressure in mice," Hypertension.
25:1111-1115. cited by applicant .
Li, B. et al. (2011). "RSEM: Accurate transcript quantification
from ma-seq data with or without a reference genome," BMC
bioinformatics. 2011:12:323. cited by applicant .
Lin, F. et al. (Aug. 17, 2001). "Targeted .alpha..sub.1A-adrenergic
receptor overexpression induces enhanced cardiac contractility but
not hypertrophy," Circ Res. 89:343-350. cited by applicant .
Minneman, K.P. et al. (Nov. 1994). "Selectivity of agonists for
cloned .alpha. 1-adrenergic receptor subtypes," Mol Pharmacol
46(5):929-936. cited by applicant .
Minneman, K.P. et al. (1994). ".alpha. 1-adrenergic receptor
subtypes," Annu Rev Pharmacol Toxicol 34:117-133. cited by
applicant .
Moslehi, J. et al. (Feb. 27, 2017). "Cardio-Oncology: Time to Get
More Mechanistic," JACC Basic Transl Sci 2(1):54-55. cited by
applicant .
Musselman, D.M. et al. (2004). "A randomized crossover study to
evaluate Ro 115-1240, a selective .alpha..sub.1A/1L-adrenoceptor
partial agonist in women with stress urinary incontinence," BJU
International. 93:78-83. cited by applicant .
Nellessen, U. et al. (May 2006). Serial analysis of troponin I
levels in patients with ischemic and nonischemic dilated
cardiomyopathy, Clin. Cardial. 29(5):219-224. cited by applicant
.
O'Connell, T.D. et al. (Jan. 2014). Cardiac
.alpha..sub.I-adrenergic receptors: Novel aspects of expression,
signaling mechanisms, physiologic function, and clinical
importance. Pharmacological reviews. 66:308-333. cited by applicant
.
Patel,M.B. et al. (Nov. 1991). "Altered function and structure of
the heart in dogs with chronic elevation in plasma norepinephrine,"
Circulation. 84:2091-2100. cited by applicant .
(Pubchem) CID 216249 Dabuzalgron. PubChem Open Chemistry database
[online]. Aug. 9, 2005 [retrieved on Apr. 19, 2017]. Retrieved from
the Internet: <URL:
https://pubchem.ncbi.nlm.nih.gov/compound/Dabuzalgron>; 15
pages. cited by applicant .
(Pubchem) A 61603 Hydrochloride. PubChem Open Chemistry database
[online]. Oct. 25, 2006 [retrieved on Apr. 19, 2017]. Retrieved
from the Internet: <URL:
https://pubchem.ncbi.nlm.nih.gov/compound/Dabuzalgron>; 14
pages. cited by applicant .
Rokosh, D.G et al. (Jul. 9, 2002). "Knockout of the .alpha.1
A/C-adrenergic receptor subtype: The .alpha.A/C is expressed in
resistance arteries and is required to maintain arterial blood
pressure," Proc Natl Acad Sci USA. 99(14):9474-9479. cited by
applicant .
Rorabaugh ,B.R. et al. (2005). ".alpha..sub.1A--but not
.alpha..sub.1B-adrenergic receptors precondition the ischemic heart
by a staurosporine-sensitive, chelerythrine-insensitive mechanism,"
Cardiovasc Res.65:436-445. cited by applicant .
Rosca, M.G. et al. (Feb. 2013). "Mitochondria in cardiac
hypertrophy and heart failure," JMol Cell Cardiol. 55:31-41. cited
by applicant .
Shibata, K. et al. (Aug. 1995). "KMD-3213, a novel, potent,
.alpha.1a-adrenoceptor-selective antagonist: characterization using
recombinant human .alpha.1-adrenoceptors and native tissues," Mol.
Pharmacal 48(2):250-258. cited by applicant .
Shibata, K. et al. (Jan. 3, 2003, e-published Oct. 29, 2002).
".alpha.1-Adrenergic receptor subtypes differentially control the
cell cycle of transfected CHO cells through a cAMP-dependent
mechanism involving p27Kip1," J Biol Chem 278(1):672-678. cited by
applicant .
Simpson, P. et al. (1982). "Differentiation of rat myocytes in
single cell cultures with and without proliferating nonmyocardial
cells. Cross-striations, ultrastructure, and chronotropic response
to isoproterenol," Circ Res. 50:101-116. cited by applicant .
Subramanian, A. et al. (Oct. 25, 2005). "Gene set enrichment
analysis: A knowledgebased approach for interpreting genome-wide
expression profiles," Proc Natl Acad Sci USA. 102:15545-15550.
cited by applicant .
Suliman, H.B. et al. (Dec. 2007). The co/ho system reverses
inhibition of mitochondrial biogenesis and prevents murine
doxorubicin cardiomyopathy. J Clin Invest. 117:3730-3741. cited by
applicant .
Tokarska-Schlattner, M. et al. (2006). "New insights into
doxorubicin-induced cardiotoxicity: The critical role of cellular
energetics," Mol Cell Cardiol. 41:389-405. cited by applicant .
Turnbull, L. et al. (2003). "Alpha.sub.1-Adrenergic receptor
responses in .alpha..sub.1ab-AR knockout mouse hearts suggest the
presence of .alpha..sub.ID-AR," Am J Physiol Heart Circ Physiol.
284:H1104-1109. cited by applicant .
Van Der Pal, H.J. et al. (2010). "Cardiac function in 5-year
survivors of childhood cancer: A long-term follow-up study.
Archives of internal medicine," 170(14):1247-1255. cited by
applicant .
Varga, Z.V. et al. (2015). "Drug-induced mitochondrial dysfunction
and cardiotoxicity," Am J Physiol Heart Circ Physiol.
309:H1453-1467. cited by applicant .
Wang, K. et al. (Aug. 28, 2010). "Mapsplice: Accurate mapping of
RNA-seq reads for splice junction discovery," Nucleic acids
research 38(18):e178. cited by applicant .
Weinberg, D.H. et al. (Jun. 30, 1994). "Cloning, expression and
characterization of human a adrenergic receptors .alpha.1A,
.alpha.1B and .alpha.1C," Biochem Biophys Res Common
201(3):1296-1304. cited by applicant .
Written Opinion dated May 11, 2017, for PCT Application No.
PCT/US2017/019522, filed Feb. 24, 2017, 6 pages. cited by applicant
.
Zakir R.M. et al. (May-Jun. 2009). "The use of midodrine in
patients with advanced heart failure," Congest Heart Fail.
15:108-111. cited by applicant.
|
Primary Examiner: Craigo; Bahar
Attorney, Agent or Firm: Mintz, Levin, Cohn, Ferris, Glovsky
and Popeo, P.C.
Government Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
This invention was made with government support under grant nos.
R01 HL031113, K08 HL085293, HL080074, TR000111 and HL096836,
awarded by the National Institutes of Health. The government has
certain rights in the invention.
Parent Case Text
CROSS-REFERENCES TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application
No. 62/300,549, filed Feb. 26, 2016 and U.S. Provisional
Application No. 62/450,996, filed Jan. 26, 2017, which is
incorporated herein by reference in its entirety and for all
purposes.
Claims
What is claimed is:
1. A method of treating cardiomyopathy in a patient in need of such
treatment, said method comprising administering a therapeutically
or prophylactically effective amount of dabuzalgron, a
pharmaceutically acceptable salt, or prodrug thereof to said
patient.
2. The method of claim 1, wherein said cardiomyopathy is associated
with anthracycline administration, hypertension, heart valve
disease, myocardial ischemia, or heart failure.
3. The method of claim 1, wherein said cardiomyopathy is associated
with anthracycline administration.
4. The method of claim 3, wherein said anthracycline is
doxorubicin, daunorubicin, epirubicin, idarubucin, adriamycin, or
valrubicin.
5. The method of claim 3, wherein the dabuzalgron is
co-administered with the anthracycline.
6. The method of claim 3, wherein the dabuzalgron is administered
before administration of the anthracycline.
7. The method of claim 3, wherein the dabuzalgron is administered
after administration of the anthracycline.
8. The method of claim 1, wherein said patient's blood pressure
does not increase as a result of said administration.
9. The method of claim 1, wherein said patient's blood pressure
increases by an amount equal to or less than 50, 40, 30, 20, 10, 9,
8, 7, 6, 5, 4, 3, 2, or 1 mmHg as a result of said
administration.
10. The method of claim 9, wherein said blood pressure is a
systolic blood pressure.
11. The method of claim 1, wherein said effective amount is between
about 0.001 and 1000, 0.1 and 100, 1 and 50, or 5 and 25
micrograms/kilogram patient weight.
12. The method of claim 1, wherein said effective amount is about
20 micrograms/kilogram patient weight.
13. The method of claim 1, wherein said effective amount is 20
micrograms/kilogram patient weight.
14. The method of claim 1, wherein said effective amount is the
total amount administered to said patient in a day.
15. The method of claim 1, wherein said administering is
parenteral, intravenous, intraarterial, buccal, sublingual, oral,
peroral, transdermal, or nasal.
Description
REFERENCE TO A SEQUENCE LISTING, A TABLE OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII TEXT FILE
The Sequence Listing written in file 48536-556001WO_ST25.TXT,
created on Feb. 24, 2017, 5,878 bytes, machine format IBM-PC, MS
Windows operating system, is hereby incorporated by reference.
BACKGROUND OF THE INVENTION
Most drugs for treating heart muscle disease are antagonists or
inhibitors, such as beta-adrenergic blockers, or angiotensin
converting enzyme inhibitors, or aldosterone or angiotensin
receptor blockers. The basic rationale for using these antagonists
is to block cellular pathways that are toxic or harmful to the
cell. These drugs may be effective in conditions such as heart
failure, but their efficacy is limited. At the present time, no
drugs are commonly used, which take the approach of activating
cellular pathways that are beneficial or helpful to the cell.
Alpha-1-adrenergic receptors control numerous adaptive processes in
the heart. Alpha-1-adrenergic receptor agonists in current clinical
use are designed to stimulate smooth muscle contraction, for
example to treat hypotension or urinary incontinence, and are used
in amounts that result in smooth muscle contraction. Such smooth
muscle contraction may not be beneficial for patients with many
heart or brain related diseases. The present invention provides
solutions to these and other problems in the art.
BRIEF SUMMARY OF THE INVENTION
In a first aspect is provided a method of treating or preventing
cardiomyopathy in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of the alpha-1A (.alpha.1A) adrenergic receptor
agonist, dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof.
In another aspect is provided a method of treating or preventing
heart failure in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof. In embodiments, the method
includes improving (e.g. increasing) heart contraction.
In another aspect is provided a method of improving heart
contraction in a subject in need of such treatment, the method
including administering a therapeutically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
In another aspect is provided a method of treating or preventing
cardiotoxicity in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof.
In another aspect is provided a method of modulating the activity
of an .alpha.1A adrenergic receptor. The method including
contacting the .alpha.1A adrenergic receptor with an effective
amount of a compound described herein (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof).
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1C. Dabuzalgron does not affect blood pressure or cause
myocardial hypertrophy in uninjured wild type mice. FIG. 1A. Blood
pressure (BP) and heart rate (HR) were measured non-invasively in
male mice for 10 consecutive days using a CODA Volume Pressure
Recording tail cuff system (Kent Scientific). All daily values
represent the average of at least 20 cuff inflations. Mice were
acclimatized to the apparatus for the first 5 days, during which no
drug was administered. On Days 6-10, mice received Dabuzalgron (100
ng/kg-100 .mu.g/kg) or water by gavage twice daily. HR and systolic
BP are unaffected by 5 days of treatment with Dabuzalgron. FIG. 1B.
Male mice were treated with Dabuzalgron 10 .mu.g/kg by gavage twice
daily for 7 days. Heart weight (HW, in mg) was indexed to tibia
length (TL, in mm). FIG. 1C. Quantitative RT-PCR was performed
using heart tissue snap frozen at the time of sacrifice. Target
transcripts (ANP=atrial natriuretic peptide; MHC.beta.=myosin heavy
chain beta; .alpha.-skAct=alpha skeletal actin) were quantified
relative to two standard transcripts (Polr2a=DNA-directed RNA
polymerase II, subunit A; TBP=TATA-binding protein).
FIGS. 2A-2B. Dabuzalgron protects mice against doxorubicin
cardiotoxicity by activating the .alpha.1A-AR. Wild type (WT) mice
and knockout mice lacking the .alpha.1A-AR (AKO) underwent baseline
echocardiography, then received either DOX 20 mg/kg or vehicle
control (VC, phosphate buffered saline) by a single i.p. injection
followed by 7 days of treatment with either dabuzalgron 10 .mu.g/kg
or water by gavage twice daily. On Day 7 the mice underwent
echocardiography prior to sacrifice. FIG. 2A. Fractional
shortening, a measure of contractile function, with representative
M-mode echocardiogram images. Results were compared across
treatment conditions by ANOVA. FIG. 2B. Heart sections from some of
these mice (i.e. wild type mice) stained with Masson Trichrome.
Fibrosis (weighted average collagen content) was quantified using
Aperio ImageScope software. Results were compared across treatment
conditions by ANOVA.
FIGS. 3A-3E. Dabuzalgron augments mitochondrial transcript
expression and function in hearts from mice treated with
doxorubicin. Male mice were treated with either doxorubicin 20
mg/kg or vehicle (phosphate buffered saline, PBS) by a single
intraperitoneal injection followed by 7 days of treatment with
either Dabuzalgron 10 .mu.g/kg or water by gavage twice daily.
Heart tissue was collected immediately after sacrifice on Day 7.
FIG. 3A. RNAseq was performed on an Illumina HiSeq2000 system using
RNA isolated from the hearts of 3 mice per treatment group
(PBS+water; PBS+Dabuzalgron; Doxorubicin+water;
Doxorubicin+Dabuzalgron). Gene set analysis was performed on the
DESeq2-derived statistics from an omnibus test across these four
categories. The results were highly enriched in gene sets involved
in mitochondrial processes, a selection of which are shown here.
FIG. 3B. RNA abundance for all sequenced cytochrome C oxidase
subunits (25 genes), mitochondrial complex I subunits (42 genes),
and ATP synthase subunits (17 genes) was aggregated by group and
compared to vehicle treatment. FIG. 3C. Quantitative RT-PCR for
peroxisome proliferator-activated receptor gamma coactivator
1-alpha (PGC1.alpha.) was performed on mouse heart tissue (n in
individual bars) FIG. 3D. ATP content was measured in freshly
harvested mouse heart tissue (total n in individual bars), then
quantified relative to protein content. Results are presented
relative to vehicle treatment for 4 independent experiments. FIG.
3E. Thiobarbituric acid reactive substances (TBARS) were assayed in
mouse myocardium.
FIGS. 4A-4F. In neonatal rat ventricular myocytes, dabuzalgron
activates ERK, a canonical downstream signaling partner of the
.alpha.1A-AR. Neonatal rat ventricular myocytes (NRVMs) were
pre-treated with the .beta.-AR antagonist propranolol then exposed
for 15 minutes to various concentrations of dabuzalgron, using the
non-selective .alpha.1-AR agonist norepinephrine (NE) as a positive
control. The reaction was stopped immediately and lysates were
blotted for total and phospho-ERK (pERK). FIG. 4A. Representative
Western blot. FIG. 4B. The EC50 was calculated from 4
concentrations of Dabuzalgron across 5 separate experiments. FIG.
4C. Summary of pERK/ERK for experiments using 5 different NRVM
isolations. The average pERK/ERK ratio for each experiment was
derived from at least 2 individual wells and normalized to the
pERK/ERK ratio for vehicle treated NRVMs. FIG. 4D and FIG. 4E. Mice
were treated with DOX, DOX and dabuzalgron, trametinib (Tram), or
DOX, dabuzalgron and Trm for 7 days. Heart lysates were blotted for
pERK and ERK. Results were compared using one way ANOVA with Tukey
post-test. FIG. 4F. Mice underwent conscious echocardiography after
7 days of treatment with Tram, DOX and Tram, or DOX, Tram and
dabuzalgron.
FIGS. 5A-5B. In neonatal rat ventricular myocytes, dabuzalgron
protects against apoptotic and necrotic cell death due to
doxorubicin. Neonatal rat ventricular myocytes (NRVMs) were treated
for 4 hours with doxorubicin 204 in the presence and absence of
dabuzalgron 10 .mu.M. Apoptosis was detected using FITC-labeled
Annexin V, cell death was detected using propridium iodide, and
nuclei were labeled with Hoechst. FIG. 5A. Representative
epifluorescence microscopy for each treatment condition. FIG. 5B.
Fluorescence intensity was analyzed using Image J software for 3
independent experiments, using at least 2 wells per condition for
each experiment.
FIG. 6A-6C. In neonatal rat ventricular myocytes, dabuzalgron
regulates activators of apoptosis and protects mitochondrial
membrane potential after treatment with doxorubicin. Neonatal rat
ventricular myocytes (NRVMs) were treated for 4 hours with
doxorubicin 2 .mu.M in the presence and absence of Dabuzalgron 10
.mu.M. FIG. 6A. Mitochondrial membrane potential was assessed using
JC-1 and fluorescent intensity was quantified using a plate reader.
Red indicates intact mitochondrial membrane potential; green
indicates compromised mitochondrial membrane potential (relative).
Representative images and summary findings are presented in FIGS.
6B-6C. Lysates were blotted for selected regulators of apoptosis
and mitochondrial cell death effectors. Representative Western
blots and summary findings from 3 independent experiments with at
least 2 wells per condition in each experiment are shown.
FIG. 7. Ro-115 (i.e. dabuzalgron) protects neonatal rat ventricular
myocytes from toxic stimuli. Consistent with activation of
cardioprotective ERK, dabuzalgron prevents myocyte death caused by
toxic injuries. Shown in FIG. 7 is dabuzalgron (Ro-115) prevents
myocyte death caused by oxidative stress with H.sub.2O.sub.2.
FIG. 8. Ro-115 (i.e., dabuzalgron) protects the mouse heart in vivo
from pressure overload cardiomyopathy caused by transverse aortic
constriction (AOC). Mice had TAC surgery on day 0, and 4 weeks
later had osmotic minipumps implanted under the skin, to
continuously deliver Ro-115 (i.e., dabuzalgron) or vehicle. Two
doses of Ro-115 (i.e., dabuzalgron) were given, 20 ug/kg/d or 200
ug/kg/d. Cardiac function was measured before TAC, and every 2
weeks, using echocardiography. At the study end on day 55, both
doses of Ro-115 (i.e., dabuzalgron) caused significant improvement
in cardiac function (fractional shortening) compared with vehicle,
indicating treatment of rescue of cardiomyopathy.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
The abbreviations used herein have their conventional meaning
within the chemical and biological arts. The chemical structures
and formulae set forth herein are constructed according to the
standard rules of chemical valency known in the chemical arts.
"Pharmaceutically acceptable excipient" and "pharmaceutically
acceptable carrier" refer to a substance that aids the
administration of an active agent to and absorption by a subject
and can be included in the compositions of the present invention
without causing a significant adverse toxicological effect on the
patient. Non-limiting examples of pharmaceutically acceptable
excipients include water, NaCl, normal saline solutions, lactated
Ringer's, normal sucrose, normal glucose, binders, fillers,
disintegrants, lubricants, coatings, sweeteners, flavors, salt
solutions (such as Ringer's solution), alcohols, oils, gelatins,
carbohydrates such as lactose, amylose or starch, fatty acid
esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors,
and the like. Such preparations can be sterilized and, if desired,
mixed with auxiliary agents such as lubricants, preservatives,
stabilizers, wetting agents, emulsifiers, salts for influencing
osmotic pressure, buffers, coloring, and/or aromatic substances and
the like that do not deleteriously react with the compounds,
agents, or drugs of the invention. One of skill in the art will
recognize that other pharmaceutical excipients are useful in the
present invention.
The term "pharmaceutically acceptable salts" is meant to include
salts of the active compounds that are prepared with relatively
nontoxic acids or bases, depending on the particular substituents
found on the compounds described herein. When compounds of the
present invention contain relatively acidic functionalities, base
addition salts can be obtained by contacting the neutral form of
such compounds with a sufficient amount of the desired base, either
neat or in a suitable inert solvent. Examples of pharmaceutically
acceptable base addition salts include sodium, potassium, calcium,
ammonium, organic amino, or magnesium salt, or a similar salt. When
compounds of the present invention contain relatively basic
functionalities, acid addition salts can be obtained by contacting
the neutral form of such compounds with a sufficient amount of the
desired acid, either neat or in a suitable inert solvent. Examples
of pharmaceutically acceptable acid addition salts include those
derived from inorganic acids like hydrochloric, hydrobromic,
nitric, carbonic, monohydrogencarbonic, phosphoric,
monohydrogenphosphoric, dihydrogenphosphoric, sulfuric,
monohydrogensulfuric, hydriodic, or phosphorous acids and the like,
as well as the salts derived from relatively nontoxic organic acids
like acetic, propionic, isobutyric, maleic, malonic, benzoic,
succinic, suberic, fumaric, lactic, mandelic, phthalic,
benzenesulfonic, p-tolylsulfonic, citric, tartaric, oxalic,
methanesulfonic, and the like. Also included are salts of amino
acids such as arginate and the like, and salts of organic acids
like glucuronic or galactunoric acids and the like (see, for
example, Berge et al., "Pharmaceutical Salts", Journal of
Pharmaceutical Science, 1977, 66, 1-19). Certain specific compounds
of the present invention contain both basic and acidic
functionalities that allow the compounds to be converted into
either base or acid addition salts.
As used herein, the term "salt" refers to acid or base salts of the
compounds used in the methods of the present invention.
Illustrative examples of acceptable salts are mineral acid (e.g.,
hydrochloric acid, hydrobromic acid, phosphoric acid, and the like)
salts, organic acid (e.g., acetic acid, propionic acid, glutamic
acid, citric acid and the like) salts, quaternary ammonium (e.g.,
methyl iodide, ethyl iodide, and the like) salts.
Thus, the compounds of the present invention may exist as salts,
such as with pharmaceutically acceptable acids. The present
invention includes such salts. Examples of such salts include
hydrochlorides, hydrobromides, sulfates, methanesulfonates,
nitrates, maleates, acetates, citrates, fumarates, tartrates (e.g.,
(+)-tartrates, (-)-tartrates, or mixtures thereof including racemic
mixtures), succinates, benzoates, and salts with amino acids such
as glutamic acid. These salts may be prepared by methods known to
those skilled in the art.
In addition to salt forms, the present invention provides
compounds, which are in a prodrug form. Prodrugs of the compounds
described herein are those compounds that undergo chemical changes
under physiological conditions to provide the compounds of the
present invention. Additionally, prodrugs can be converted to the
compounds of the present invention by chemical or biochemical
methods in an ex vivo environment. For example, prodrugs can be
converted to the compounds of the present invention when placed in
a transdermal patch reservoir with a suitable enzyme or chemical
reagent. In some embodiments, prodrugs of the compounds described
herein (also referred to herein as "compound of the present
invention") may be used in the methods described herein (including
embodiments).
Certain compounds of the present invention can exist in unsolvated
forms as well as solvated forms, including hydrated forms. In
general, the solvated forms are equivalent to unsolvated forms and
are encompassed within the scope of the present invention. Certain
compounds of the present invention may exist in multiple
crystalline or amorphous forms. Certain compounds of the present
invention can exist in polymorphic forms. In general, all physical
forms are equivalent for the uses contemplated by the present
invention and are intended to be within the scope of the present
invention.
Certain compounds of the present invention may possess asymmetric
carbon atoms (optical or chiral centers) or double bonds; the
enantiomers, racemates, diastereomers, tautomers, geometric
isomers, stereoisometric forms that may be defined, in terms of
absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for
amino acids, and individual isomers are encompassed within the
scope of the present invention. The compounds of the present
invention do not include those which are known in art to be too
unstable to synthesize and/or isolate. The present invention is
meant to include compounds in racemic and optically pure forms
unless specified otherwise. Optically active (R)- and (S)-, or (D)-
and (L)-isomers may be prepared using chiral synthons or chiral
reagents, or resolved using conventional techniques. When the
compounds described herein contain olefinic bonds or other centers
of geometric asymmetry, and unless specified otherwise, it is
intended that the compounds include both E and Z geometric
isomers.
As used herein, the term "isomers" refers to compounds having the
same number and kind of atoms, and hence the same molecular weight,
but differing in respect to the structural arrangement or
configuration of the atoms.
The term "tautomer," as used herein, refers to one of two or more
structural isomers which exist in equilibrium and which are readily
converted from one isomeric form to another.
It will be apparent to one skilled in the art that certain
compounds of this invention may exist in tautomeric forms, all such
tautomeric forms of the compounds being within the scope of the
invention.
Unless otherwise stated, a compound described herein is also meant
to include all stereochemical forms of the compound; i.e., the R
and S configurations for each asymmetric center. Therefore, single
stereochemical isomers as well as enantiomeric and diastereomeric
mixtures of the present compounds are within the scope of the
invention.
Unless otherwise stated, compound described herein are also meant
to include compounds which differ only in the presence of one or
more isotopically enriched atoms. For example, compounds described
herein with replacement of a hydrogen by a deuterium or tritium, or
the replacement of a carbon by .sup.13C- or .sup.14C-enriched
carbon are within the scope of this invention.
The compounds of the present invention may also contain unnatural
proportions of atomic isotopes at one or more of the atoms that
constitute such compounds. For example, the compounds may be
radiolabeled with radioactive isotopes, such as for example tritium
(.sup.3H), iodine-125 (.sup.125I), or carbon-14 (.sup.14C). All
isotopic variations of the compounds of the present invention,
whether radioactive or not, are encompassed within the scope of the
present invention.
It should be noted that throughout the application that
alternatives are written in Markush groups. It is specifically
contemplated that each member of the Markush group should be
considered separately, thereby comprising another embodiment.
The terms "a" or "an," as used in herein means one or more. In
addition, the phrase "substituted with a[n]," as used herein, means
the specified group may be substituted with one or more of any or
all of the named substituents. For example, where a group, such as
an alkyl or heteroaryl group, is "substituted with an unsubstituted
C.sub.1-C.sub.20 alkyl, or unsubstituted 2 to 20 membered
heteroalkyl," the group may contain one or more unsubstituted
C.sub.1-C.sub.20 alkyls, and/or one or more unsubstituted 2 to 20
membered heteroalkyls. Moreover, where a moiety is substituted with
an R substituent, the group may be referred to as "R-substituted."
Where a moiety is R-substituted, the moiety is substituted with at
least one R substituent and each R substituent is optionally
different.
Description of compounds of the present invention is limited by
principles of chemical bonding known to those skilled in the art.
Accordingly, where a group may be substituted by one or more of a
number of substituents, such substitutions are selected so as to
comply with principles of chemical bonding and to give compounds
which are not inherently unstable and/or would be known to one of
ordinary skill in the art as likely to be unstable under ambient
conditions, such as aqueous, neutral, and several known
physiological conditions.
The term "modulator" refers to a composition that increases or
decreases the level of a target molecule or the function of a
target molecule or the level or function of a target cell (e.g., a
target may be .alpha.1 adrenergic receptor (e.g., .alpha.1A-AR) and
the function to be increased or decreased may be receptor
activation or downstream signaling from the receptor (e.g. ERK
protein, phosphorylated ERK, or pathway) or a target may be a
cardiac cell and the modulator may increase or decrease the level
or number of cells or modulate the health or survival of the cell).
In some embodiments, a modulator is a compound that reduces the
severity of one or more symptoms of a disease (e.g., loss of cell
function, loss of cells). In some embodiments, a modulator reduces
the deterioration of heart muscle cells or heart muscle cell
function.
The term "preparation" is intended to include the formulation of
the active agents (e.g. compound, drug) with material as a carrier
providing a dosage form in which the active component with or
without other carriers, is associated with a carrier. Similarly,
cachets and lozenges are included. Tablets, powders, capsules,
pills, cachets, and lozenges can be used as solid dosage forms
suitable for oral administration.
The terms "treating" or "treatment" refers to any indicia of
success in the treatment or amelioration of an injury, disease,
pathology or condition, including any objective or subjective
parameter such as abatement; remission; diminishing of symptoms or
making the injury, pathology or condition more tolerable to the
patient; slowing in the rate of degeneration or decline; making the
final point of degeneration less debilitating; improving a
patient's physical or mental well-being. The treatment or
amelioration of symptoms can be based on objective or subjective
parameters; including the results of a physical examination,
neuropsychiatric exams, and/or a psychiatric evaluation. For
example, the certain methods presented herein successfully treat
cardiomyopathy. For example, the certain methods presented herein
successfully treat cardiotoxicity. For example, the certain methods
presented herein successfully treat cardiomyopathy by decreasing
the incidence of cardiomyopathy and/or preventing, stopping,
reversing, or slowing the development of cardiomyopathy. For
example, the certain methods presented herein successfully treat
cardiotoxicity by decreasing the incidence of cardiotoxicity and/or
preventing, stopping, reversing, or slowing the development of
cardiotoxicity. The term "treating" and conjugations thereof,
include prevention of an injury, pathology, condition, or disease
(e.g. cardiomyopathy or cardiotoxicity). The term "treating" and
conjugations thereof, includes a reduction the symptoms of an
injury, pathology, condition, or disease (e.g. cardiomyopathy or
cardiotoxicity). In embodiments treating is preventing. In
embodiments, treating does not include preventing.
An "effective amount" is an amount sufficient to accomplish a
stated purpose (e.g. achieve the effect for which it is
administered, treat a disease, increase enzyme activity, reduce one
or more symptoms of a disease or condition). An example of an
"effective amount" is an amount sufficient to contribute to the
treatment, prevention, or reduction of a symptom or symptoms of a
disease, which could also be referred to as a "therapeutically
effective amount." The full therapeutic effect does not necessarily
occur by administration of one dose, and may occur only after
administration of a series of doses (e.g., divided doses wherein
the therapeutically effective amount may be the amount in each
individual dose that has a therapeutic effect when administered in
a series of such doses or the therapeutically effective dose may be
the amount in each individual dose wherein the therapeutic effect
is achieved by each dose). Thus, a therapeutically effective amount
may be administered in one or more administrations. A "reduction"
of a symptom or symptoms (and grammatical equivalents of this
phrase) means decreasing of the severity or frequency of the
symptom(s), or elimination of the symptom(s). A "prophylactically
effective amount" of an agent (e.g. compound, drug, or dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof)
is an amount of an agent (e.g. compound, drug, or dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof)
that, when administered to a subject, will have the intended
prophylactic effect, e.g., preventing or delaying the onset (or
reoccurrence) of an injury, disease, pathology or condition, or
reducing the likelihood of the onset (or reoccurrence) of an
injury, disease, pathology, or condition, or their symptoms. The
full prophylactic effect does not necessarily occur by
administration of one dose, and may occur only after administration
of a series of doses. Thus, a prophylactically effective amount may
be administered in one or more administrations. An "activity
decreasing amount," as used herein, refers to an amount of an agent
(e.g. compound, drug, antagonist, or dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) required to
decrease the activity of an enzyme relative to the absence of the
agent (e.g. compound, drug, antagonist, or dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof). A
"function disrupting amount," as used herein, refers to the amount
of an agent (e.g. compound, drug, antagonist, or dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
required to disrupt the function of an enzyme or protein relative
to the absence of the agent (e.g. compound, drug, antagonist, or
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof). A "function increasing amount," as used herein,
refers to the amount of an agent (e.g. compound, drug, agonist, or
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof) required to increase the function of an enzyme or
protein relative to the absence of the agent (e.g. compound, drug,
agonist, or dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof). The exact amounts will depend on the
purpose of the treatment, and will be ascertainable by one skilled
in the art using known techniques (see, e.g., Lieberman,
Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art,
Science and Technology of Pharmaceutical Compounding (1999);
Pickar, Dosage Calculations (1999); and Remington: The Science and
Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott,
Williams & Wilkins).
"Control" or "control experiment" is used in accordance with its
plain ordinary meaning and refers to an experiment in which the
subjects or reagents of the experiment are treated as in a parallel
experiment except for omission of a procedure, reagent, or variable
of the experiment. In some instances, the control is used as a
standard of comparison in evaluating experimental effects. In
embodiments, a control is a patient not administered an .alpha.1
adrenergic receptor agonist (e.g. dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof). In
embodiments, a control is a biological sample not administered an
.alpha.1 adrenergic receptor agonist (e.g. dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof). In
embodiments, a control is a cell not administered an .alpha.1
adrenergic receptor agonist (e.g. dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof). In
embodiments, a control is a cell not administered dabuzalgron. In
embodiments, a control is a patient not administered dabuzalgron.
In embodiments, a control is a biological sample not administered
dabuzalgron.
"Contacting" is used in accordance with its plain ordinary meaning
and refers to the process of allowing at least two distinct species
(e.g. agent (e.g. compound, drug, antagonist, agonist, or
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof), chemical compounds including biomolecules, or
cells) to become sufficiently proximal to react, interact or
physically touch. It should be understood, however, that the
resulting reaction product can be produced directly from a reaction
between the added reagents or from an intermediate from one or more
of the added reagents which can be produced in the reaction
mixture.
The term "contacting" may include allowing two species to react,
interact, or physically touch, wherein the two species may be an
agent (e.g. compound, drug, antagonist, agonist, or dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof) as
described herein and a receptor (e.g. .alpha.1 adrenergic receptor,
.alpha.1A-AR, .alpha.1B-AR, or .alpha.1D-AR); or an agent (e.g.
compound, drug, antagonist, agonist, or dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) as described
herein and a cardiac cell or heart cell. In embodiments, a receptor
is .alpha.1A-AR. In embodiments, a receptor is human
.alpha.1A-AR.
As defined herein, the term "inhibition", "inhibit", "inhibiting"
and the like in reference to a target-agent (e.g. compound, drug,
antagonist) or protein-inhibitor interaction means negatively
affecting (e.g., decreasing) the activity or function of the target
or protein relative to the activity or function of the target or
protein in the absence of the inhibitor or agent (e.g. compound,
drug, antagonist). Thus, inhibition includes, at least in part,
partially or totally blocking stimulation, decreasing, preventing,
or delaying activation, or inactivating, desensitizing, or
down-regulating signal transduction or enzymatic activity. In some
embodiments, an "inhibitor" may be a compound that inhibits DNA
replication or induces cell death, e.g., by binding, partially or
totally blocking stimulation, decrease, prevent, or delay
activation, or inactivate, desensitize, or down-regulate signal
transduction or enzymatic activity necessary for DNA replication,
cell viability, or cell survival.
As defined herein, the term "activation", "activate", "activating",
"increase", "increasing" and the like in reference to a
target-agent (e.g. compound, drug, agonist) or protein-agonist
interaction means positively affecting (e.g. increasing) the
activity or function of the target or protein relative to the
activity or function of the target or protein in the absence of the
activator or agent (e.g. compound, drug, agonist, or dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug
thereof). Thus, activation includes, at least in part, partially or
totally increasing stimulation, increasing, enabling, or
accelerating activation, or activating, sensitizing, or
up-regulating signal transduction or enzymatic activity. In some
embodiments, an "activator" may be a compound that increases DNA
replication or reduces cell death, e.g., by binding, partially or
totally increasing stimulation, increase, enable, or accelerate
activation, or activate, sensitize, or up-regulate signal
transduction or enzymatic activity necessary for DNA replication,
cell viability, or cell survival. In embodiments, an activator is
dabuzalgron. In embodiments, an activator is dabuzalgron or an
analog, derivative, or prodrug thereof.
"Patient" or "subject in need thereof" refers to a living organism
suffering from or prone to a condition that can be treated by
administration of an agent (e.g. compound, drug, antagonist,
agonist, or dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof) or pharmaceutical composition as provided
herein. Non-limiting examples include humans, other mammals (e.g.
mice, rats, dogs, monkeys, cows, goats, sheep, rabbits) and other
non-mammalian animals. In some embodiments, a patient or subject in
need thereof is a human with a disease or condition (e.g. heart
muscle damage, cardiomyopathy, cardiotoxicity, or heart
failure).
"Disease" or "condition" refer to a state of being or health status
of a patient or subject capable of being treated with the compounds
or methods provided herein. In some embodiments, the disease is a
disease related to (e.g. caused by) heart muscle damage (e.g.
cardiomyopathy, cardiotoxicity, heart failure). In some instances,
"disease" or "condition" refers to cardiomyopathy, cardiotoxicity,
heart failure, or cardiovascular disease. In some embodiments, the
disease is heart muscle damage. In some embodiments, the disease is
heart failure. In some embodiments, the disease is cardiomyopathy.
In some embodiments, the disease is cardiotoxicity. In some
embodiments, the disease is cardiotoxicity associated with
anticancer agent administration to the subject. In some
embodiments, the disease is cardiotoxicity associated with
anthracycline administration to the subject. In some embodiments,
the disease is cardiotoxicity associated with doxorubicin
administration to the subject. In some embodiments, the disease is
hypertrophic cardiomyopathy. In some embodiments, the disease is
restrictive cardiomyopathy. In some embodiments, the disease is
dilated cardiomyopathy. In some embodiments, the disease is dilated
cardiomyopathy. In some embodiments, the disease is dilated
congestive cardiomyopathy. In some embodiments, the disease is
congestive cardiomyopathy. In some embodiments, the disease is
cardiomyopathy associated with or caused by hypertension, heart
valve disease, myocardial ischemia, myocardial inflammation,
myocardial infarction, heart failure, pulmonary hypertension,
myocardial stunning, myocardial hibernation, cardiac surgery,
pressure overload-induced cardiac hypertrophy, or coronary
intervention. In some embodiments, the disease is heart failure
associated with or caused by cardiomyopathy. In some embodiments,
the disease is heart failure associated with or caused by
cardiomyopathy (e.g. associated with or caused by hypertension,
heart valve disease, myocardial ischemia, myocardial inflammation,
myocardial infarction, pulmonary hypertension, myocardial stunning,
myocardial hibernation, cardiac surgery, pressure overload-induced
cardiac hypertrophy, or coronary intervention). In some
embodiments, the disease is heart failure associated with or caused
by idiopathic cardiomyopathy. In some embodiments, the disease is a
cardiovascular disease. In some embodiments, the disease is
cardiomyopathy associated with or caused by hypertension, heart
valve disease, myocardial ischemia, myocardial inflammation, heart
failure, pulmonary hypertension, myocardial stunning, myocardial
hibernation, cardiac surgery, pressure overload-induced cardiac
hypertrophy, or coronary intervention. In some embodiments, the
disease is heart failure associated with or caused by
cardiomyopathy (e.g. associated with or caused by hypertension,
heart valve disease, myocardial ischemia, myocardial inflammation,
pulmonary hypertension, myocardial stunning, myocardial
hibernation, cardiac surgery, pressure overload-induced cardiac
hypertrophy, or coronary intervention). In some embodiments, the
disease is cardiomyopathy associated with or caused by
hypertension, heart valve disease, myocardial inflammation, heart
failure, pulmonary hypertension, myocardial stunning, myocardial
hibernation, cardiac surgery, pressure overload-induced cardiac
hypertrophy, or coronary intervention. In some embodiments, the
disease is heart failure associated with or caused by
cardiomyopathy (e.g. associated with or caused by hypertension,
heart valve disease, myocardial inflammation, pulmonary
hypertension, myocardial stunning, myocardial hibernation, cardiac
surgery, pressure overload-induced cardiac hypertrophy, or coronary
intervention). In embodiments, the disease is not cardiomyopathy
associated with or caused by myocardial infarction. In some
embodiments, the disease is not heart failure associated with or
caused by cardiomyopathy associated with or caused by myocardial
infarction. In embodiments, the disease is not cardiomyopathy
associated with or caused by myocardial ischemia. In some
embodiments, the disease is not heart failure associated with or
caused by cardiomyopathy associated with or caused by myocardial
ischemia.
As used herein, the term "cardiovascular disease" refers to a
disease or condition affecting the circulatory system, including
the heart and blood vessels. In embodiments, cardiovascular disease
includes diseases caused by or exacerbated by atherosclerosis.
Exemplary cardiovascular diseases that may be treated with a
compound or method provided herein include heart muscle damage,
alcoholic cardiomyopathy, cardiomyopathy, cardiotoxicity,
cardiomyopathy associated with anthracycline administration,
cardiotoxicity associated with anthracycline administration,
cardiotoxicity associated with doxorubicin administration,
cardiomyopathy associated with doxorubicin administration,
cardiomyopathy associated with anticancer agent administration,
cardiotoxicity associated with anticancer agent administration,
coronary artery disease, congenital heart disease, arrhythmogenic
right ventricular cardiomyopathy, restrictive cardiomyopathy,
noncompaction cardiomyopathy, diabetes mellitus, hypertension,
hyperhomocysteinemia, hypercholesterolemia, atherosclerosis,
ischemic heart disease, heart failure, cor pulmonale, hypertensive
heart disease, left ventricular hypertrophy, coronary heart
disease, (congestive) heart failure, hypertensive cardiomyopathy,
cardiac arrhythmias, inflammatory heart disease, endocarditis,
inflammatory cardiomegaly, myocarditis, valvular heart disease,
stroke, hypertension, heart valve disease, myocardial ischemia,
myocardial inflammation, heart failure, pulmonary hypertension,
myocardial stunning, myocardial hibernation, cardiomyopathy
associated with cardiac surgery, cardiomyopathy associated with
coronary intervention or myocardial infarction, cardiomyopathy
caused by genetic changes in cardiac proteins, cardiomyopathy
associated with genetic mutations in one or more cardiac proteins,
cardiomyopathy associated with aberrant expression or function of
one or more cardiac proteins.
Exemplary cardiovascular diseases that may be treated with a
compound or method provided herein include heart muscle damage,
alcoholic cardiomyopathy, cardiomyopathy, cardiotoxicity,
cardiomyopathy associated with anthracycline administration,
cardiotoxicity associated with anthracycline administration,
cardiotoxicity associated with doxorubicin administration,
cardiomyopathy associated with doxorubicin administration,
cardiomyopathy associated with anticancer agent administration,
cardiotoxicity associated with anticancer agent administration,
coronary artery disease, congenital heart disease, arrhythmogenic
right ventricular cardiomyopathy, restrictive cardiomyopathy,
noncompaction cardiomyopathy, diabetes mellitus, hypertension,
hyperhomocysteinemia, hypercholesterolemia, atherosclerosis,
ischemic heart disease, heart failure, cor pulmonale, hypertensive
heart disease, left ventricular hypertrophy, coronary heart
disease, (congestive) heart failure, hypertensive cardiomyopathy,
cardiac arrhythmias, inflammatory heart disease, endocarditis,
inflammatory cardiomegaly, myocarditis, valvular heart disease,
stroke, hypertension, heart valve disease, myocardial ischemia,
myocardial inflammation, heart failure, pulmonary hypertension,
myocardial stunning, myocardial hibernation, cardiomyopathy
associated with cardiac surgery, cardiomyopathy associated with
coronary intervention or myocardial infarction, cardiomyopathy
caused by genetic changes in cardiac proteins, cardiomyopathy
associated with genetic mutations in one or more cardiac proteins,
cardiomyopathy associated with aberrant expression or function of
one or more cardiac proteins.
Exemplary cardiovascular diseases that may be treated with a
compound or method provided herein include heart muscle damage,
alcoholic cardiomyopathy, coronary artery disease, congenital heart
disease, arrhythmogenic right ventricular cardiomyopathy,
restrictive cardiomyopathy, noncompaction cardiomyopathy, diabetes
mellitus, hypertension, hyperhomocysteinemia, hypercholesterolemia,
atherosclerosis, heart failure, cor pulmonale, hypertensive heart
disease, left ventricular hypertrophy, coronary heart disease,
(congestive) heart failure, hypertensive cardiomyopathy, cardiac
arrhythmias, inflammatory heart disease, endocarditis, inflammatory
cardiomegaly, myocarditis, valvular heart disease, stroke,
hypertension, heart valve disease, myocardial inflammation, heart
failure, pulmonary hypertension, myocardial stunning, myocardial
hibernation, cardiomyopathy associated with cardiac surgery,
cardiomyopathy associated with coronary intervention,
cardiomyopathy caused by genetic changes in cardiac proteins,
cardiomyopathy associated with genetic mutations in one or more
cardiac proteins, cardiomyopathy associated with aberrant
expression or function of one or more cardiac proteins. In some
embodiments, treating a cardiovascular disease includes treating a
condition or symptom caused by a cardiovascular disease. A
non-limiting example of such a treatment is treating complications
due to a myocardial infarction, after the myocardial infarction has
occurred. In some embodiments, a cardiovascular disease is
cardiomyopathy. In some embodiments, cardiomyopathy is caused by
another disease (e.g. a cardiovascular disease) and treatment of
cardiomyopathy includes treating the causative disease (e.g.
cardiovascular disease) of the cardiomyopathy. In some embodiments,
the cardiomyopathy is dilated cardiomyopathy. In some embodiments,
the cardiomyopathy is hypertrophic cardiomyopathy. In some
embodiments, the cardiomyopathy is hypertrophic, restrictive, or
dilated. In embodiments, cardiovascular disease does not include
myocardial infarction. In embodiments, treating cardiovascular
disease does not include treating a condition or symptom associated
with or caused by myocardial infarction (e.g. after the myocardial
infarction has occurred). In embodiments, cardiovascular disease
does not include myocardial ischemia. In embodiments, treating
cardiovascular disease does not include treating a condition or
symptom associated with or caused by myocardial ischemia (e.g.
after the myocardial ischemia has occurred). In embodiments,
cardiovascular disease does not include ischemic heart disease. In
embodiments, cardiovascular disease is cardiomyopathy. In
embodiments, cardiovascular disease is cardiotoxicity. In
embodiments, cardiovascular disease is cardiomyopathy associated
with anthracycline administration. In embodiments, cardiovascular
disease is cardiotoxicity associated with anthracycline
administration. In embodiments, cardiovascular disease is
cardiotoxicity associated with doxorubicin administration. In
embodiments, cardiovascular disease is cardiomyopathy associated
with doxorubicin administration. In embodiments, cardiovascular
disease is cardiomyopathy associated with anticancer agent
administration. In embodiments, cardiovascular disease is
cardiotoxicity associated with anticancer agent administration.
As used herein, the term "cardiomyopathy" refers to a disease or
condition affecting the heart, wherein a heart muscle (e.g., cell
of the heart muscle) is damaged or the function of a heart muscle
(e.g., cell of the heart muscle) is impaired (e.g., relative to a
healthy fully functioning heart, heart muscle, of heart muscle
cell. Exemplary cardiomyopathy that may be treated with a compound
or method provided herein include heart muscle damage, alcoholic
cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy,
restrictive cardiomyopathy, noncompaction cardiomyopathy, heart
failure, (congestive) heart failure, hypertensive cardiomyopathy,
cardiomyopathy associated with cardiac surgery, cardiomyopathy
associated with coronary intervention or myocardial infarction,
cardiomyopathy caused by genetic changes in cardiac proteins,
cardiomyopathy associated with genetic mutations in one or more
cardiac proteins, cardiomyopathy associated with aberrant
expression or function of one or more cardiac proteins, and
cardiomyopathy associated with anthracycline (e.g., doxocycline)
treatment. In some embodiments, treating a cardiomyopathy includes
treating a condition or symptom caused by a cardiomyopathy. In some
embodiments, cardiomyopathy is caused by another disease (e.g., a
cardiovascular disease) and treatment of cardiomyopathy includes
treating the causative disease (e.g. cardiovascular disease) of the
cardiomyopathy. In some embodiments, the cardiomyopathy is dilated
cardiomyopathy. In some embodiments, the cardiomyopathy is
hypertrophic cardiomyopathy. In some embodiments, the
cardiomyopathy is hypertrophic, restrictive, or dilated.
As used herein, the term "cardiotoxicity" refers to a disease or
condition affecting the heart, wherein a heart muscle (e.g., cell
of the heart muscle) is damaged or the function of a heart muscle
(e.g., cell of the heart muscle) is impaired (e.g., relative to a
healthy fully functioning heart, heart muscle, of heart muscle
cell), by a toxic agent (e.g., exogenous toxic agent,
anthracycline, doxorubicin, agent administered to the subject,
administered systemically, administered to the heart, administered
locally, administered to a subject for treating another disease
(e.g., cancer)). In embodiments, cardiotoxicity includes
cardiomyopathy, heart muscle damage, alcoholic cardiomyopathy,
arrhythmogenic right ventricular cardiomyopathy, restrictive
cardiomyopathy, noncompaction cardiomyopathy, heart failure,
(congestive) heart failure, hypertensive cardiomyopathy,
cardiomyopathy associated with cardiac surgery, cardiomyopathy
associated with coronary intervention or myocardial infarction,
cardiomyopathy caused by genetic changes in cardiac proteins,
cardiomyopathy associated with genetic mutations in one or more
cardiac proteins, cardiotoxicity associated with anthracycline
(e.g., doxocycline) treatment, and cardiomyopathy associated with
anthracycline (e.g., doxocycline) treatment; all associated with
administration of an agent toxic to the heart, heart tissue, heart
muscle, or a heart cell. In some embodiments, treating a
cardiotoxicity includes treating a condition or symptom caused by a
cardiotoxicity. In embodiments, cardiotoxicity includes atrial
arrhythmia. In embodiments, cardiotoxicity includes ventricular
arrhythmia. In embodiments, cardiotoxicity includes conduction
system abnormalities. In embodiments, cardiotoxicity includes
prolongation of the QT interval.
As used herein, the term "disease-related cells" means cells that
are associated with a disease or condition, which include but are
not limited to cells that initiate a disease, cells that propogate
a disease, cells that cause a disease, cells that cause one or more
symptoms of a disease, cells that are a hallmark of a disease;
cells that contain a particular protein or mRNA molecule that
causes a symptom of the disease. In some embodiments, the disease
is cardiotoxicity or cardiomyopathy and disease-related cells
include heart muscle cells, cardiac muscle cells, or
cardiomyocytes.
The term "expression" refers to a gene that is transcribed or
translated at a detectable level. As used herein, expression also
encompasses "overexpression," which refers to a gene that is
transcribed or translated at a detectably greater level, usually in
a disease-related cell, in comparison to a normal cell. Expression
can be detected using conventional techniques for detecting protein
(e.g., ELISA, Western blotting, flow cytometry, immunofluorescence,
immunohistochemistry, etc.) or mRNA (e.g., RT-PCR, PCR,
hybridization, etc.).
As used herein, the term "marker" refers to any biochemical marker,
serological marker, genetic marker, or other clinical or
echographic characteristic that can be used to diagnose or provide
a prognosis for a disease (e.g., cardiomyopathy, cardiovascular
disease).
The term "sample" includes sections of tissues such as biopsy and
autopsy samples, and frozen sections taken for histological
purposes. Such samples include blood and blood fractions or
products (e.g., serum, plasma, platelets, red blood cells, and the
like), sputum, tissue, cultured cells (e.g., primary cultures,
explants, and transformed cells), stool, urine, other biological
fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid,
renal fluid, lung fluid, cerebrospinal fluid, and the like), etc. A
sample is typically obtained from a "subject" such as a eukaryotic
organism, most preferably a mammal such as a primate, e.g.,
chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig,
rat, mouse; rabbit; or a bird; reptile; or fish. In some
embodiments, the sample is obtained from a human.
A "biopsy" refers to the process of removing a tissue sample for
diagnostic or prognostic evaluation, and to the tissue specimen
itself. Any biopsy technique known in the art can be applied to the
diagnostic and prognostic methods of the present invention (e.g.
muscle biopsy or heart biopsy). The biopsy technique applied will
depend on the tissue type to be evaluated (e.g., heart, muscle,
etc.), among other factors. Representative biopsy techniques
include, but are not limited to, excisional biopsy, incisional
biopsy, needle biopsy, and surgical biopsy. A diagnosis or
prognosis made by endoscopy or fluoroscopy can require a
"core-needle biopsy", or a "fine-needle aspiration biopsy" which
generally obtains a suspension of cells. Biopsy techniques are
discussed, for example, in Harrison's Principles of Internal
Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and
throughout Part V.
As used herein, the term "administering" means oral administration,
parenteral administration, administration as a suppository, topical
contact, intravenous, intraperitoneal, intramuscular,
intralesional, intrathecal, intranasal or subcutaneous
administration, or the implantation of a slow-release device, e.g.,
a mini-osmotic pump, to a subject. Administration is by any route,
including parenteral and transmucosal (e.g., buccal, sublingual,
palatal, gingival, nasal, vaginal, rectal, or transdermal).
Parenteral administration includes, e.g., intravenous,
intramuscular, intra-arteriole, intradermal, subcutaneous,
intraperitoneal, intraventricular, and intracranial. Other modes of
delivery include, but are not limited to, the use of liposomal
formulations, intravenous infusion, transdermal patches, etc. By
"co-administer" it is meant that a composition described herein is
administered at the same time, just prior to, or just after the
administration of one or more additional therapies, for example
additional agents (e.g. compounds, drugs, inhibitors, antagonists,
agonists) useful in the treatment of cardiomyopathy or
cardiotoxicity or agents useful in the treatment of one or more
other symptoms of a cardiomyopathy associated disease or
cardiotoxicity associated disease. The agents (e.g. compounds,
drugs, agonists, or dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof) of the invention can be
administered alone or can be coadministered to the patient.
Coadministration is meant to include simultaneous or sequential
administration of the agents (e.g. compounds, drugs, agonists, or
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof) individually or in combination (more than one
agent (e.g. compound, drug, agonist)). Thus, the preparations can
also be combined, when desired, with other active substances (e.g.,
to reduce metabolic degradation). The compositions of the present
invention can be delivered transdermally, by a topical route,
formulated as applicator sticks, solutions, suspensions, emulsions,
gels, creams, ointments, pastes, jellies, paints, powders, and
aerosols.
"Analog" is used in accordance with its plain ordinary meaning
within Chemistry and Biology and refers to a chemical compound that
is structurally similar to another compound (i.e., a so-called
"reference" compound) but differs in composition, e.g., in the
replacement of one atom by an atom of a different element, or in
the presence of a particular functional group, or the replacement
of one functional group by another functional group, or the
absolute stereochemistry of one or more chiral centers of the
reference compound, including isomers thereof. Accordingly, an
analog is a compound that is similar or comparable in function and
appearance but not in structure or origin to a reference compound.
In some embodiments, a reference compound is dabuzalgron. In
embodiments, a dabuzalgron analog is a compound similar, but not
identical in structure to dabuzalgron, having similar (e.g.,
identical) function on cardiomyopathy or cardiotoxicity or a
symptom of cardiomyopathy or a symptom of cardiotoxicity.
The term "dabuzalgron" refers to
N-[6-chloro-3-(4,5-dihydro-1H-imidazol-2-ylmethoxy)-2-methylphenyl]methan-
esulfonamide, or any salt form thereof (e.g.
N-[6-chloro-3-(4,5-dihydro-1H-imidazol-2-ylmethoxy)-2-methylphenyl]methan-
esulfonamide hydrobromide), or any isomer thereof. Dabuzalgron has
also been shown to be a potent and a more selective .alpha.1A AR
agonist than the non-selective .alpha.1AR agonist phenylephrine.
Dabuzalgron has also been shown to be a potent and a more selective
.alpha.1A AR agonist than the non-selective .alpha.1AR agonists
phenylephrine, methoxamine, and midodrine. In embodiments,
dabuzalgron is
N-[6-chloro-3-(4,5-dihydro-1H-imidazol-2-ylmethoxy)-2-methylphenyl]methan-
esulfonamide. Dabuzalgron is a partial agonist at the
alpha-1A-adrenergic receptor. In embodiments, dabuzalgron is a salt
form of
N-[6-chloro-3-(4,5-dihydro-1H-imidazol-2-ylmethoxy)-2-methylphenyl]methan-
esulfonamide. In embodiments, dabuzalgron is
N-[6-chloro-3-(4,5-dihydro-1H-imidazol-2-ylmethoxy)-2-methylphenyl]methan-
esulfonamide hydrobromide.
"Blood Pressure" is the pressure of the blood against the walls of
the arteries when the heart contracts (systolic pressure) and when
the heart is at rest (diastolic pressure). In some embodiments,
hypertensive blood pressure may be considered systolic pressure of
about 140 mmHg or higher and/or diastolic pressure of about 90 mmHg
or higher. In some embodiments, hypertensive blood pressure may be
considered systolic pressure of 140 mmHg or higher and/or diastolic
pressure of 90 mmHg or higher. "Undesirable blood pressure" or
"unhealthy blood pressure" or "high blood pressure" are
interchangeable terms and refer to blood pressure levels that are
above normal or above healthy blood pressure levels (e.g.
hypertensive blood pressure). In some embodiments, high blood
pressure is/can be determined by a person of ordinary skill in the
art (e.g. doctor, cardiologist, internist, medical doctor). In some
embodiments, a high blood pressure is hypertensive blood pressure.
In some embodiments, a high blood pressure is 140/90 mmHg or
higher. In some embodiments, a high blood pressure or undesirable
blood pressure or unhealthy blood pressure is a blood pressure
greater than the desirable blood pressure range recommended by the
American Heart Association. In some embodiments, a high blood
pressure or undesirable blood pressure or unhealthy blood pressure
is a blood pressure categorized as hypertensive or pre-hypertensive
by the American Heart Association.
In some aspects, the terms "associated" or "associated with" is
used herein to describe a first disease in relation to a medical
event, a biological compound or a second disease (e.g. a protein
associated disease, a cardiomyopathy associated with another
disease). Where used to describe a first disease in relation to
such a medical event, a biological compound or a second disease,
the terms "associated" or "associated with" means that the first
disease (e.g., cardiomyopathy) results from, is correlated with, is
caused by, or is a symptom of the medical event, biological
compound or a second disease (e.g., cardiotoxicity). For example,
cardiomyopathy associated with hypertension may be a cardiomyopathy
that results (entirely or partially) from hypertension or
cardiomyopathy wherein a particular symptom of the disease is
caused (entirely or partially) by hypertension. For example,
cardiomyopathy associated with anticancer agent administration
(e.g., anthracycline) may be a cardiomyopathy that results
(entirely or partially) from anticancer agent administration (e.g.,
anthracycline) or cardiomyopathy wherein a particular symptom of
the disease is caused (entirely or partially) by anticancer agent
administration (e.g., anthracycline). For example, cardiotoxicity
associated with anticancer agent administration (e.g.,
anthracycline) may be a cardiotoxicity that results (entirely or
partially) from anticancer agent administration (e.g.,
anthracycline) or cardiotoxicity wherein a particular symptom of
the disease is caused (entirely or partially) by anticancer agent
administration (e.g., anthracycline). For example, heart failure
associated with heart damage (heart muscle damage) may be heart
failure that results (entirely or partially) from heart damage
(e.g. heart muscle damage) wherein a particular symptom of the
disease is caused (entirely or partially) by heart damage (e.g.
heart muscle damage). For example, heart failure associated with
cardiomyopathy may be heart failure that results (entirely or
partially) from cardiomyopathy wherein a particular symptom of the
disease is caused (entirely or partially) by cardiomyopathy. For
example, heart failure associated with cardiotoxicity may be heart
failure that results (entirely or partially) from cardiotoxicity
wherein a particular symptom of the disease is caused (entirely or
partially) by cardiotoxicity. As used herein, what is described as
being associated with a disease, if a causative agent, could be a
target for treatment of the disease. For example, heart failure
associated with cardiomyopathy or a cardiomyopathy associated heart
failure, may be treated with dabuzalgron, in the instance where
cardiomyopathy causes the heart failure. For example,
cardiomyopathy associated with hypertension may be cardiomyopathy
that a subject with hypertension is at higher risk of developing as
compared to a subject without hypertension. In some embodiments,
where the first disease is "associated" or "associated with" the
medical event, biological compound or a second disease, the first
disease (or symptom thereof) is caused by the medical event,
biological compound or a second disease.
The term "aberrant" as used herein refers to different from normal.
When used to described enzymatic activity, aberrant refers to
activity that is greater or less than a normal control or the
average of normal non-diseased control samples. Aberrant activity
may refer to an amount of activity that results in a disease,
wherein returning the aberrant activity to a normal or
non-disease-associated amount (e.g., by administering a compound or
using a method as described herein), results in reduction of the
disease or one or more disease symptoms.
Cardiomyopathy is a disease of the heart muscle, which may be
characterized by heart cell dysfunction or heart muscle
dysfunction. This form of heart disease is often distinctive, both
in general symptoms and in patterns of blood flow, to allow a
diagnosis to be made. Increasing recognition of this disease, along
with improved diagnostic techniques, has shown that cardiomyopathy
is the major cause of heart failure, which has high morbidity and
mortality. Cardiomyopathy can result from a variety of structural
or functional abnormalities of the ventricular myocardium. There
are three clinical classifications of cardiomyopathy: hypertrophic,
restrictive, and dilated congestive. Dilated cardiomyopathy is a
disorder of myocardial function where impaired systolic dysfunction
and ventricular dilation occur, classified as ischemic or
non-ischemic (e.g., toxic, genetic, idiopathic, etc.). Restrictive
cardiomyopathy is a rare form that occurs as a consequence of the
ventricular walls becoming rigid so that the chambers are unable to
fill adequately, caused for example by infiltration with amyloid or
some other foreign material. Hypertrophic cardiomyopathy is
characterized by ventricular hypertrophy and may be congenital or
acquired, commonly caused by hypertension. The prognosis for all
three types of disease is guarded at best and often poor. Current
treatment of cardiomyopathy involves beta-blockers, angiotensin
converting enzyme inhibitors, use of anti-coagulants, and cardiac
transplantation. When cardiomyopathy is sufficiently advanced, it
causes congestive heart failure, with physiological symptoms
including breathlessness with exertion or even at rest, swelling of
the legs, ankles and feet, bloating (distention) of the abdomen
with fluid, fatigue, irregular heartbeats, and dizziness,
lightheadedness and fainting.
The .alpha.1 adrenergic receptors (.alpha.1-ARs) are important
mediators of sympathetic nervous system responses, particularly
those involved in cardiovascular homeostasis, such as arteriolar
smooth muscle constriction and cardiac contraction. In addition,
.alpha.1-ARs have more recently been implicated in cardiac
hypertrophy, cardio-protection, and in ischemic preconditioning.
.alpha.1-ARs are activated by the catecholamines, norepinephrine
and epinephrine.
The .alpha.1 adrenergic receptors are members of the superfamily of
G protein-coupled receptors and mediate effects related to the
regulation of cellular growth and function (Shibata et al. 2003, J.
Bio. Chem. 278:672-678). .alpha.1-ARs consist of three subtypes:
.alpha.1 A-, .alpha.1 B-, and .alpha.1 D-ARs Graham et al., 1996.
Circ. Res. 78:737-749). The three different .alpha.1-AR subtypes
are expressed in different tissues and various cell types. As a
result, studies on the physiological effects mediated by each of
the .alpha.1-ARs in individual tissues are complicated by the
co-existence of multiple .alpha.1-AR subtypes (Minneman et al.
1994, Mol. Pharmacal. 46:929-936; Minneman and Esbenshade, 1994.
Annu. Rev. Pharmacal. Toxicol., 34:117-133; Weinberg et. al, 1994;
Biochem. Bio-phys Res. Commun. 201:1296-1304; Esbenshade et al.
1995; Mol. Pharmacal. 47:977-985; Shibata et al. 1995; Mol.
Pharmacal. 48:250-258). Alpha-1-adrenergic receptor agonists are
shown herein to be useful in the treatment and prevention of heart
and brain diseases. Furthermore, alpha-1-adrenergic receptor
agonists (e.g. dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof) are notable for increasing
beneficial processes at both functional levels, for example cardiac
contraction, and at trophic/protective levels, for example
preventing cell death and repairing injury. In some embodiments,
the present invention includes the use of alpha-1-adrenergic
agonists at doses that are below those that have an effect on
smooth muscle contraction.
The terms "Mitogen-activated protein kinase" and "MAPK" and
"extracellular signal-regulated kinases" and "ERK" refer to a
protein (including homologs, isoforms, and functional fragments
thereof) with kinase activity in the MAP Kinase signaling pathway.
The term includes any recombinant or naturally-occurring form of
MAPK or variants thereof that maintain MAP Kinase activity (e.g.
within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%
activity compared to wildtype MAP Kinase). In embodiments, the MAP
Kinase protein encoded by the MAPK gene has the amino acid sequence
set forth in or corresponding to Entrez 5594, UniProt P28482, or
RefSeq (protein) NP_002736 of MAPK1 or ERK2. In embodiments, the
MAP Kinase gene has the nucleic acid sequence set forth in RefSeq
(mRNA) NM_002745 (MAPK1 or ERK2). In embodiments, the amino acid
sequence or nucleic acid sequence is the sequence known at the time
of filing of the present application. In embodiments, the sequence
corresponds to NP_002736.3 (MAPK1 or ERK2). In embodiments, the
sequence corresponds to NM_002745.4 (MAPK1 or ERK2). In
embodiments, the MAP Kinase is a human MAP Kinase, such as a human
cancer causing MAP Kinase. In embodiments, the MAP Kinase protein
encoded by the MAPK gene has the amino acid sequence set forth in
or corresponding to Entrez 5595, UniProt P27361, or RefSeq
(protein) NP_002737 of MAPK3 or ERK1. In embodiments, the MAP
Kinase gene has the nucleic acid sequence set forth in RefSeq
(mRNA) NM_002746 (MAPK3 or ERK1). In embodiments, the amino acid
sequence or nucleic acid sequence is the sequence known at the time
of filing of the present application. In embodiments, the sequence
corresponds to NP_002737.2 (MAPK3 or ERK1). In embodiments, the
sequence corresponds to NM_002746.2 (MAPK3 or ERK1). In
embodiments, the MAP Kinase is a human MAP Kinase, such as a human
cancer causing MAP Kinase. In embodiments "ERK" refers to an ERK2.
In embodiments "ERK" refers to an ERK1. In embodiments "ERK" refers
to both ERK1/2.
The terms "alpha-1A adrenergic receptor" and ".alpha.1A" and
".alpha.1A-AR" and "ADRA1A" refer to a protein (including homologs,
isoforms, and functional fragments thereof) with activity in the
alpha-1A adrenergic receptor signaling pathway. The term includes
any recombinant or naturally-occurring form of .alpha.1A-AR or
variants thereof that maintain .alpha.1A-AR activity (e.g. within
at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% activity
compared to wildtype .alpha.1A-AR). In embodiments, the
.alpha.1A-AR protein encoded by the .alpha.1A-AR gene has the amino
acid sequence set forth in or corresponding to Entrez 148, UniProt
P35348, or RefSeq (protein) NP_000671. In embodiments, the
.alpha.1A-AR gene has the nucleic acid sequence set forth in RefSeq
(mRNA) NM_000680. In embodiments, the amino acid sequence or
nucleic acid sequence is the sequence known at the time of filing
of the present application. In embodiments, the sequence
corresponds to NP_000671.2. In embodiments, the sequence
corresponds to NM_000680.3. In embodiments, the .alpha.1A-AR
protein encoded by the .alpha.1A-AR gene has the amino acid
sequence set forth in or corresponding to Entrez 148, UniProt
P35348, or RefSeq (protein) NP_150645. In embodiments, the
.alpha.1A-AR gene has the nucleic acid sequence set forth in RefSeq
(mRNA) NM_033302. In embodiments, the amino acid sequence or
nucleic acid sequence is the sequence known at the time of filing
of the present application. In embodiments, the sequence
corresponds to NP_150645.2. In embodiments, the sequence
corresponds to NM_033302.3.
II. Methods of Treatment
In a first aspect is provided a method of treating or preventing
cardiomyopathy in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof. In embodiments, the method
includes administering dabuzalgron.
In a another aspect is provided a method of treating or preventing
cardiomyopathy in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron.
In embodiments of the method, the cardiomyopathy is dilated
cardiomyopathy. In embodiments of the method, the cardiomyopathy is
hypertrophic cardiomyopathy. In embodiments of the method, the
cardiomyopathy is associated with hypertension, heart valve
disease, myocardial ischemia, myocardial inflammation, myocardial
infarction, heart failure, pulmonary hypertension, myocardial
stunning, myocardial hibernation, cardiac surgery, pressure
overload-induced cardiac hypertrophy, or coronary intervention. In
embodiments, the method includes treating the cardiomyopathy. In
some embodiments, the method includes preventing the
cardiomyopathy. In some embodiments, the method does not include
preventing the cardiomyopathy. In embodiments, the method includes
cardiomyopathy associated with anthracycline treatment. In
embodiments, the cardiomyopathy is associated with anthracycline
treatment. In some embodiments, the cardiomyopathy is associated
with doxorubicin treatment. In embodiments, the cardiomyopathy is
associated with chemotherapy treatment. In embodiments, the
cardiomyopathy is idiopathic cardiomyopathy. In embodiments, the
cardiomyopathy is associated with myocardial infarction. In
embodiments, the cardiomyopathy is associated with hypertension,
heart valve disease, myocardial ischemia, myocardial inflammation,
heart failure, pulmonary hypertension, myocardial stunning,
myocardial hibernation, cardiac surgery, pressure overload-induced
cardiac hypertrophy, or coronary intervention. In embodiments, the
cardiomyopathy is associated with myocardial ischemia. In
embodiments, the cardiomyopathy is associated with hypertension,
heart valve disease, myocardial inflammation, heart failure,
pulmonary hypertension, myocardial stunning, myocardial
hibernation, cardiac surgery, pressure overload-induced cardiac
hypertrophy, or coronary intervention. In embodiments, the method
includes treating or preventing cardiomyopathy in a patient
undergoing treatment with an anthracycline (e.g. doxorubicin,
daunorubicin, epirubicin, idarubicin, adriamycin, or valrubicin).
In embodiments, the cardiomyopathy is associated with (e.g., caused
by) cardiotoxicity. In embodiments, the method includes treating
cardiomyopathy in a patient undergoing treatment with an
anthracycline (e.g. doxorubicin, daunorubicin, epirubicin,
idarubicin, adriamycin, or valrubicin). In embodiments, the method
includes preventing cardiomyopathy in a patient undergoing
treatment with an anthracycline (e.g., doxorubicin, daunorubicin,
epirubicin, idarubicin, adriamycin, or valrubicin). In embodiments,
the method includes preventing the anthracycline-induced
cardiomyopathy. In embodiments, the method includes treating but
not preventing cardiomyopathy. In embodiments, the method includes
treating but not preventing anthracycline-induced cardiomyopathy.
In embodiments, the method includes preventing cardiomyopathy in a
patient. In embodiments, the method includes administering
dabuzalgron.
In another aspect is provided a method of treating or preventing
heart failure in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof. In some embodiments, the
method includes improving (e.g. increasing) heart contraction. In
embodiments, the method includes improving (e.g., increasing)
cardiogenesis. In embodiments, the method is treating heart failure
in a subject in need of such treatment. In embodiments, the method
is preventing heart failure in a subject in need of such treatment.
In embodiments, the method is treating but not preventing heart
failure in a subject in need of such treatment. In embodiments, the
method includes administering dabuzalgron.
In another aspect is provided a method of improving heart
contraction in a subject in need of such treatment, the method
including administering a therapeutically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof. In some embodiments, improving heart contraction
treats heart failure. In embodiments, improving heart contraction
includes improving the volume of the heart contraction, improving
strength of the heart contraction, or improving length of the
contraction. In embodiments, the method includes administering
dabuzalgron.
In another aspect is provided a method of treating or preventing
cardiotoxicity in a subject in need of such treatment, the method
including administering a therapeutically or prophylactically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof. In embodiments, the method
includes administering dabuzalgron.
In embodiments, the method includes treating the cardiotoxicity. In
some embodiments, the method includes preventing the
cardiotoxicity. In some embodiments, the method does not include
preventing the cardiotoxicity. In embodiments, the method includes
cardiotoxicity associated with anthracycline treatment. In
embodiments, the cardiotoxicity is associated with anthracycline
treatment. In some embodiments, the cardiotoxicity is associated
with doxorubicin treatment. In embodiments, the cardiotoxicity is
associated with chemotherapy treatment. In embodiments, the
cardiotoxicity is idiopathic cardiotoxicity. In embodiments, the
method includes treating or preventing cardiotoxicity in a subject
undergoing treatment with an anthracycline (e.g., doxorubicin,
daunorubicin, epirubicin, idarubicin, adriamycin, or valrubicin).
In embodiments, treating a cardiotoxicity includes treating a
condition or symptom induced by a cardiotoxicity. In embodiments,
cardiotoxicity includes atrial arrhythmia. In embodiments,
cardiotoxicity includes ventricular arrhythmia. In embodiments,
cardiotoxicity includes conduction system abnormalities. In
embodiments, cardiotoxicity includes prolongation of the QT
interval. In embodiments, the method includes treating
cardiotoxicity in a patient undergoing treatment with an
anthracycline (e.g., doxorubicin, daunorubicin, epirubicin,
idarubicin, adriamycin, or valrubicin). In embodiments, the method
includes preventing cardiotoxicity in a patient undergoing
treatment with an anthracycline (e.g., doxorubicin, daunorubicin,
epirubicin, idarubicin, adriamycin, or valrubicin). In embodiments,
the method includes administering dabuzalgron.
In some embodiments of the methods, the subject's blood pressure
does not increase as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 50, 40, 30, 20, 10, 9, 8, 7, 6,
5, 4, 3, 2, or 1 mmHg as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 50 mmHg as a result of the
administration. In some embodiments of the methods, the subject's
blood pressure increases by an amount equal to or less than 40 mmHg
as a result of the administration. In some embodiments of the
methods, the subject's blood pressure increases by an amount equal
to or less than 30 mmHg as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 20 mmHg as a result of the
administration. In some embodiments of the methods, the subject's
blood pressure increases by an amount equal to or less than 10 mmHg
as a result of the administration. In some embodiments of the
methods, the subject's blood pressure increases by an amount equal
to or less than 9 mmHg as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 8 mmHg as a result of the
administration. In some embodiments of the methods, the subject's
blood pressure increases by an amount equal to or less than 7 mmHg
as a result of the administration. In some embodiments of the
methods, the subject's blood pressure increases by an amount equal
to or less than 6 mmHg as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 5 mmHg as a result of the
administration. In some embodiments of the methods, the subject's
blood pressure increases by an amount equal to or less than 4 mmHg
as a result of the administration. In some embodiments of the
methods, the subject's blood pressure increases by an amount equal
to or less than 3 mmHg as a result of the administration. In some
embodiments of the methods, the subject's blood pressure increases
by an amount equal to or less than 2 mmHg as a result of the
administration. In some embodiments of the methods, the subject's
blood pressure increases by an amount equal to or less than 1 mmHg
as a result of the administration. In some embodiments of the
methods, the blood pressure that increases or does not increase
following administration of dabuzalgron is systolic blood pressure.
In some embodiments of the methods, the blood pressure that
increases or doesn't increase following administration of
dabuzalgron is diastolic blood pressure. In some embodiments of the
methods, the patient's blood pressure does not become hypertensive
blood pressure from normal blood pressure as a result of the
administration. In some embodiments of the methods, the patient's
systolic blood pressure does not become hypertensive blood pressure
from normal blood pressure as a result of the administration. In
some embodiments of the methods, the patient's diastolic blood
pressure does not become hypertensive blood pressure from normal
blood pressure as a result of the administration. In some
embodiments of the methods, the patient's blood pressure does not
become prehypertensive blood pressure from normal blood pressure as
a result of the administration. In some embodiments of the methods,
the patient's systolic blood pressure does not become
prehypertensive blood pressure from normal blood pressure as a
result of the administration. In some embodiments of the methods,
the patient's diastolic blood pressure does not become
prehypertensive blood pressure from normal blood pressure as a
result of the administration. In some embodiments of the methods,
the patient's blood pressure does not become high blood pressure or
undesirable blood pressure or unhealthy blood pressure as a result
of the administration. In some embodiments of the methods, the
patient's blood pressure does not increase to more than 140/90 mmHg
as a result of the administration. In embodiments, the method
includes administering dabuzalgron.
In some embodiments of the methods, the effective amount is between
about 0.0001 and 10000, 0.001 and 1000, 0.01 and 100, 0.1 and 10,
0.005 and 0.1, 0.005 and 0.05, or 0.007 and 0.02
micrograms/kilogram patient weight. In some embodiments of the
methods, the effective amount is about 0.01 micrograms/kilogram
patient weight. In some embodiments of the methods, the effective
amount is 0.01 micrograms/kilogram patient weight. In some
embodiments of the methods, the effective amount is the total
amount administered to the patient in a day (e.g. between about
0.0001 and 10000, 0.001 and 1000, 0.01 and 100, 0.1 and 10, 0.005
and 0.1, 0.005 and 0.05, or 0.007 and 0.02 micrograms/kilogram
patient weight/day or about 0.01 micrograms/kilogram patient
weight/day). In some embodiments of the methods, the effective
amount of dabuzalgron administered to a patient or subject in need
thereof is about 0.0001, 0.0002, 0.0003, 0.0004, 0.0005, 0.0006,
0.0007, 0.0008, 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006,
0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07,
0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200,
300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000,
6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000,
70000, 80000, 90000, or 100000 micrograms dabuzalgron/kilograms
patient or subject in need thereof/administration. In some
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is about
0.0001, 0.0002, 0.0003, 0.0004, 0.0005, 0.0006, 0.0007, 0.0008,
0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008,
0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1,
0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600,
700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000,
9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000,
90000, or 100000 micrograms dabuzalgron/kilograms patient or
subject in need thereof/day.
In some embodiments of the methods, the effective amount is between
about 0.0001 and 10000, 0.001 and 1000, 0.01 and 100, 0.1 and 100,
1 and 100, 10 and 100, 25 and 75, 1 and 50, 1 and 20, 5 and 15, 10
and 1000, 10 and 500, 10 and 250, 10 and 150, 50 and 150, 75 and
125, or 100 and 125 micrograms/kilogram patient weight. In some
embodiments of the methods, the effective amount is about 10
micrograms/kilogram patient weight. In some embodiments of the
methods, the effective amount is 100 micrograms/kilogram patient
weight. In some embodiments of the methods, the effective amount is
the total amount administered to the patient in a day (e.g. between
about 0.0001 and 10000, 0.001 and 1000, 0.01 and 100, 0.1 and 100,
1 and 100, 10 and 100, 25 and 75, 1 and 50, 1 and 20, 5 and 15, 10
and 1000, 10 and 500, 10 and 250, 10 and 150, 50 and 150, 75 and
125, or 100 and 125 micrograms/kilogram patient weight/day or about
10 micrograms/kilogram patient weight/day or about 100
micrograms/kilogram patient weight/day). In some embodiments of the
methods, the effective amount of dabuzalgron administered to a
patient or subject in need thereof is 0.0001, 0.0002, 0.0003,
0.0004, 0.0005, 0.0006, 0.0007, 0.0008, 0.0009, 0.001, 0.002,
0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03,
0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60,
70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000,
2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000,
30000, 40000, 50000, 60000, 70000, 80000, 90000, or 100000
micrograms dabuzalgron/kilograms patient or subject in need
thereof/administration. In some embodiments of the methods, the
effective amount of dabuzalgron administered to a patient or
subject in need thereof is 0.0001, 0.0002, 0.0003, 0.0004, 0.0005,
0.0006, 0.0007, 0.0008, 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005,
0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06,
0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100,
200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000,
5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000,
60000, 70000, 80000, 90000, or 100000 micrograms
dabuzalgron/kilograms patient or subject in need thereof/day. In
some embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
about 20 micrograms dabuzalgron/kilograms patient or subject. In
some embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
about 20 micrograms dabuzalgron/kilograms patient or subject/day.
In some embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
about 40 micrograms dabuzalgron/kilograms patient or subject/day.
In embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is about 1.5
mg. In embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
about 3.0 mg/day. In embodiments of the methods, the effective
amount of dabuzalgron administered to a patient or subject in need
thereof is about 0.5 to 2.5 mg. In embodiments of the methods, the
effective amount of dabuzalgron administered to a patient or
subject in need thereof is about 0.5 to 5 mg. In embodiments of the
methods, the effective amount of dabuzalgron administered to a
patient or subject in need thereof is about 0.5 to 10 mg. In
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is about 0.5
to 25 mg. In some embodiments of the methods, the effective amount
of dabuzalgron administered to a patient or subject in need thereof
is 20 micrograms dabuzalgron/kilograms patient or subject. In some
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is 20
micrograms dabuzalgron/kilograms patient or subject/day. In some
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is 40
micrograms dabuzalgron/kilograms patient or subject/day. In
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is 1.5 mg. In
embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is 3.0 mg/day.
In embodiments of the methods, the effective amount of dabuzalgron
administered to a patient or subject in need thereof is 0.5 to 2.5
mg. In embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
0.5 to 5 mg. In embodiments of the methods, the effective amount of
dabuzalgron administered to a patient or subject in need thereof is
0.5 to 10 mg. In embodiments of the methods, the effective amount
of dabuzalgron administered to a patient or subject in need thereof
is 0.5 to 25 mg.
In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof once. In some embodiments of the methods, the effective
amount of dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof, is administered to a patient or subject
in need thereof for one day. In some embodiments of the methods,
the effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for two days. In some embodiments of the
methods, the effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, is
administered to a patient or subject in need thereof for three
days. In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for four days. In some embodiments of the methods, the
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for five days. In some embodiments of
the methods, the effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, is
administered to a patient or subject in need thereof for six days.
In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for seven days. In some embodiments of the methods, the
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for two weeks. In some embodiments of
the methods, the effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, is
administered to a patient or subject in need thereof for three
weeks. In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for four weeks. In some embodiments of the methods, the
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for about one month. In some embodiments
of the methods, the effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, is
administered to a patient or subject in need thereof for about two
months. In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for about three months. In some embodiments of the methods,
the effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for about four months. In some
embodiments of the methods, the effective amount of dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof, is
administered to a patient or subject in need thereof for about five
months. In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for about six months. In some embodiments of the methods,
the effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a patient
or subject in need thereof for about 7, 8, 9, 10, 11, or 12
months.
In some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for about one, two, three, four, five, six, seven, eight,
nine, ten, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, or more years. In
some embodiments of the methods, the effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a patient or subject in need
thereof for the duration of the disease (e.g. cardiomyopathy,
cardiotoxicity, disease associated with cardiomyopathy,
cardiomyopathy associated with chemotherapy treatment (e.g.,
anthracycline treatment, doxorubicin treatment), or cardiotoxicity
associated with chemotherapy treatment (e.g., anthracycline
treatment, doxorubicin treatment)). In some embodiments of the
methods, the administering is parenteral, intravenous,
intraarterial, buccal, sublingual, oral, peroral, transdermal, or
nasal. In some embodiments of the methods, the administering is to
the heart. In some embodiments of the methods, the administering is
to the heart muscle.
In some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
once. In some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for one day. In some embodiments of the methods, the effective
amount of dabuzalgron is administered to a patient or subject in
need thereof for two days. In some embodiments of the methods, the
effective amount of dabuzalgron is administered to a patient or
subject in need thereof for three days. In some embodiments of the
methods, the effective amount of dabuzalgron is administered to a
patient or subject in need thereof for four days. In some
embodiments of the methods, the effective amount of dabuzalgron is
administered to a patient or subject in need thereof for five days.
In some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for six days. In some embodiments of the methods, the effective
amount of dabuzalgron is administered to a patient or subject in
need thereof for seven days. In some embodiments of the methods,
the effective amount of dabuzalgron is administered to a patient or
subject in need thereof for two weeks. In some embodiments of the
methods, the effective amount of dabuzalgron is administered to a
patient or subject in need thereof for three weeks. In some
embodiments of the methods, the effective amount of dabuzalgron is
administered to a patient or subject in need thereof for four
weeks. In some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for about one month. In some embodiments of the methods, the
effective amount of dabuzalgron is administered to a patient or
subject in need thereof for about two months. In some embodiments
of the methods, the effective amount of dabuzalgron is administered
to a patient or subject in need thereof for about three months. In
some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for about four months. In some embodiments of the methods, the
effective amount of dabuzalgron is administered to a patient or
subject in need thereof for about five months. In some embodiments
of the methods, the effective amount of dabuzalgron is administered
to a patient or subject in need thereof for about six months. In
some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for about 7, 8, 9, 10, 11, or 12 months.
In some embodiments of the methods, the effective amount of
dabuzalgron is administered to a patient or subject in need thereof
for about one, two, three, four, five, six, seven, eight, nine,
ten, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, or more years. In some
embodiments of the methods, the effective amount of dabuzalgron is
administered to a patient or subject in need thereof for the
duration of the disease (e.g. cardiomyopathy, cardiotoxicity,
disease associated with cardiomyopathy, cardiomyopathy associated
with chemotherapy treatment (e.g., anthracycline treatment,
doxorubicin treatment), or cardiotoxicity associated with
chemotherapy treatment (e.g., anthracycline treatment, doxorubicin
treatment)). In some embodiments of the methods, the administering
is parenteral, intravenous, intraarterial, buccal, sublingual,
oral, peroral, transdermal, or nasal. In some embodiments of the
methods, the administering is to the heart. In some embodiments of
the methods, the administering is to the heart muscle.
In some embodiments, the methods include an effective amount of
dabuzalgron. In some embodiments, the methods include an effective
amount of an analog of dabuzalgron. In some embodiments, the
methods include an effective amount of an isomer of dabuzalgron. In
some embodiments, the methods include an effective amount of a
pharmaceutically acceptable salt of dabuzalgron. In some
embodiments, the methods include an effective amount of a prodrug
of dabuzalgron.
Therapeutically effective doses of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, for use in a
mammal, which have no effect on blood pressure or which result in
no significant increase in blood pressure or result in an
acceptable increase in blood pressure (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, or 50 mmHg, or does not change
normal blood pressure to prehypertensive or hypertensive blood
pressure, or does not cause the blood pressure to become unhealthy
blood pressure or high blood pressure or undesirable blood
pressure, or does not cause the blood pressure to be greater than
140/90 mmHg), yet prevent the onset or progression of
cardiomyopathy or cardiotoxicity, are determined through standard
methods in the art. For example, varying doses of dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof,
are administered to a patient (e.g suffering from cardiomyopathy or
at risk of developing cardiomyopathy or a patient suffering from
cardiotoxicity or a patient at risk of developing cardiotoxicity or
a person suffering from or at risk of suffering from cardiomyopathy
or cardiotoxicity associated with chemotherapy (e.g., anthracycline
treatment)), followed by monitoring of blood pressure. Assays to
determine whether or not dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, is effective
in preventing the onset of cardiomyopathy, or reducing its
progression, are known to persons having ordinary skill in the art
and include monitoring of fractional shortening, ejection fraction,
end-diastolic volume and troponin levels (methods described in
Bielecka-Dabrowa et al. 2008, Cardiology J. 278:1-5; Nellessen et
al. 2006, Clin. Cardial. 29:219-224). Assays to determine whether
or not dabuzalgron, or an analog, pharmaceutically acceptable salt,
or prodrug thereof, is effective in preventing the onset of
cardiotoxicity, or reducing its progression, are known to persons
having ordinary skill in the art and include monitoring of
fractional shortening, ejection fraction, end-diastolic volume and
troponin levels (methods described in Bielecka-Dabrowa et al. 2008,
Cardiology J. 278:1-5; Nellessen et al. 2006, Clin. Cardial.
29:219-224). In one embodiment, no increase in blood pressure is
observed when the blood pressure is measured 24 hours after
treatment, in another embodiment no increase in blood pressure is
observed when the blood pressure is measured 48 hours, 72 hours, 1
week or 1 month after treatment. In yet another embodiment, blood
pressure, when measured after 48 hours, 72 hours, 1 week, or 1
month, increases less than 10% or less than 15% after treatment
with dabuzalgron, or an analog, pharmaceutically acceptable salt,
or prodrug thereof. In some embodiments, blood pressure increases
(e.g., by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or
50 mmHg) following administration of a therapeutically effective or
prophylactically effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In some
embodiments, blood pressure increases following administration of a
therapeutically effective or prophylactically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, but does not change from normal to prehypertensive
or from normal to hypertensive or from prehypertensive to
hypertensive blood pressure. In some embodiments, blood pressure
increases following administration of a therapeutically effective
or prophylactically effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, but does not
become an undesirable blood pressure, high blood pressure, or
unhealthy blood pressure. In some embodiments, blood pressure
increases following administration of a therapeutically effective
or prophylactically effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, but does not
become greater than 140/90 mmHg.
Therapeutically effective doses of dabuzalgron for use in a mammal,
which have no effect on blood pressure or which result in no
significant increase in blood pressure or result in an acceptable
increase in blood pressure (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, or 50 mmHg, or does not change normal blood
pressure to prehypertensive or hypertensive blood pressure, or does
not cause the blood pressure to become unhealthy blood pressure or
high blood pressure or undesirable blood pressure, or does not
cause the blood pressure to be greater than 140/90 mmHg), yet
prevent the onset or progression of cardiomyopathy or
cardiotoxicity, are determined through standard methods in the art.
For example, varying doses of dabuzalgron are administered to a
patient (e.g suffering from cardiomyopathy or at risk of developing
cardiomyopathy or a patient suffering from cardiotoxicity or a
patient at risk of developing cardiotoxicity or a person suffering
from or at risk of suffering from cardiomyopathy or cardiotoxicity
associated with chemotherapy (e.g., anthracycline treatment)),
followed by monitoring of blood pressure. Assays to determine
whether or not dabuzalgron is effective in preventing the onset of
cardiomyopathy, or reducing its progression, are known to persons
having ordinary skill in the art and include monitoring of
fractional shortening, ejection fraction, end-diastolic volume and
troponin levels (methods described in Bielecka-Dabrowa et al. 2008,
Cardiology J. 278:1-5; Nellessen et al. 2006, Clin. Cardial.
29:219-224). Assays to determine whether or not dabuzalgron is
effective in preventing the onset of cardiotoxicity, or reducing
its progression, are known to persons having ordinary skill in the
art and include monitoring of fractional shortening, ejection
fraction, end-diastolic volume and troponin levels (methods
described in Bielecka-Dabrowa et al. 2008, Cardiology J. 278:1-5;
Nellessen et al. 2006, Clin. Cardial. 29:219-224). In one
embodiment, no increase in blood pressure is observed when the
blood pressure is measured 24 hours after treatment, in another
embodiment no increase in blood pressure is observed when the blood
pressure is measured 48 hours, 72 hours, 1 week or 1 month after
treatment. In yet another embodiment, blood pressure, when measured
after 48 hours, 72 hours, 1 week, or 1 month, increases less than
10% or less than 15% after treatment with dabuzalgron. In some
embodiments, blood pressure increases (e.g. by 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, or 50 mmHg) following
administration of a therapeutically effective or prophylactically
effective amount of dabuzalgron. In some embodiments, blood
pressure increases following administration of a therapeutically
effective or prophylactically effective amount of dabuzalgron but
does not change from normal to prehypertensive or from normal to
hypertensive or from prehypertensive to hypertensive blood
pressure. In some embodiments, blood pressure increases following
administration of a therapeutically effective or prophylactically
effective amount of dabuzalgron but does not become an undesirable
blood pressure, high blood pressure, or unhealthy blood pressure.
In some embodiments, blood pressure increases following
administration of a therapeutically effective or prophylactically
effective amount of dabuzalgron but does not become greater than
140/90 mmHg.
Progression of cardiomyopathy may be monitored in part by measuring
levels of serum biomarkers, such as creatine kinase, troponin, ST2
(e.g. soluble ST2), GDF-15, or brain natriuretic peptide (BNP).
Progression of cardiotoxicity may be monitored in part by measuring
levels of serum biomarkers, such as creatine kinase, troponin, ST2
(e.g. soluble ST2), GDF-15, or brain natriuretic peptide (BNP).
Progression of cardiomyopathy may be assessed in part by measuring
fractional shortening (FS) or ejection fraction (EF). Progression
of cardiotoxicity may be assessed in part by measuring fractional
shortening (FS) or ejection fraction (EF). FS is used to measure
left ventricle performance by measuring the change in the diameter
of the left ventricle between the contracted and relaxed state on
M-mode tracings and calculating the ratio according to the formula:
[(LV end-diastolic diameter-LV end-systolic diameter)/LV
end-diastolic diameter)].times.100. EF is calculated from left
ventricular volumes determined by 2-dimensional echo, as [(LV
end-diastolic volume-LV end-systolic volume)/LV end-diastolic
volume)].times.100. A decrease in FS or EF is indicative of heart
damage. In embodiments, a therapeutically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a subject suffering from or at
risk of cardiomyopathy or cardiotoxicity, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
prevents more than 5-30% (e.g. more than 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30%) reduction in the FS or EF as compared to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof. In another embodiment, administration of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity prevents more than 5% reduction in
the FS or EF as compared to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, not administered dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof. In
one embodiment, a therapeutically effective amount of dabuzalgron
is administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron prevents
more than 5-30% (e.g. more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30%)
reduction in the FS or EF as compared to a subject suffering from
or at risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron. In another embodiment, administration of dabuzalgron
to a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity prevents more than 5% reduction in the FS or EF as
compared to a subject suffering from or at risk of cardiomyopathy
or cardiotoxicity, not administered dabuzalgron.
In one embodiment, a therapeutically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, is administered to a subject suffering from or at
risk of cardiomyopathy or cardiotoxicity, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
prevents more than 5-30% (e.g. more than 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30%) increase in the end-diastolic volume as compared to a
subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In another
embodiment, administration of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof, to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity
prevents more than 5% increase in the end-diastolic volume as
compared to a subject suffering from or at risk of cardiomyopathy
or cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In one
embodiment, a therapeutically effective amount of dabuzalgron is
administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron prevents
more than 5-30% (e.g. more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30%)
increase in the end-diastolic volume as compared to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron. In another embodiment, administration of
dabuzalgron to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity prevents more than 5% increase in
the end-diastolic volume as compared to a subject suffering from or
at risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron.
In some embodiments, cardiomyopathy or cardiotoxicity is detected
by a method selected from the group consisting of X-ray (e.g.
chest), echocardiogram, electrocardiogram, cardiac catheterization,
cardiac biopsy, computerized tomography, and magnetic resonance
imaging.
It is well known that creatine kinase (CK) or troponin are released
from myocytes when myocyte necrosis occurs. Accordingly, measuring
levels of CK or troponin in the serum may be done to assess the
onset and progression of cardiomyopathy or cardiotoxicity in a
subject. Measuring serum CK levels is done using methods known to
those of ordinary skill in the art, for example, by a coupled
reaction of glucokinase and glucose-6-phosphate dehydrogenase using
a diagnostic kit. In one embodiment, a therapeutically effective
amount of dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof, is administered to a subject suffering
from or at risk of cardiomyopathy or cardiotoxicity, wherein the
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, reduces the level of CK in the serum of the
subject as compared to CK levels found in the serum of a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof. In some embodiments, a therapeutically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity,
wherein the dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof, reduces the level of troponin, BNP,
GDF-15, or ST2 (e.g. soluble ST2) in the serum of the subject as
compared to troponin, BNP, GDF-15, or ST2 (e.g. soluble ST2) levels
respectively found in the serum of a subject suffering from or at
risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof. In one embodiment, a therapeutically effective
amount of dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof, is administered to a subject suffering
from or at risk of cardiomyopathy or cardiotoxicity, wherein the
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, increases the level GDF-15 in the serum of the
subject as compared to GDF-15 levels found in the serum of a
subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In some
embodiments, a therapeutically effective amount of dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof, is
administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof, does
not modulate the level of troponin, BNP, GDF-15, or ST2 (e.g.
soluble ST2) in the serum of the subject as compared to troponin,
BNP, GDF-15, or ST2 (e.g. soluble ST2) levels respectively found in
the serum of a subject suffering from or at risk of cardiomyopathy
or cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In some
embodiments, a therapeutically effective amount of dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof, is
administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof,
improves the level of troponin, BNP, GDF-15, or ST2 (e.g. soluble
ST2) in the serum of the subject as compared to troponin, BNP,
GDF-15, or ST2 (e.g. soluble ST2) levels respectively found in the
serum of a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In some
embodiments, improvement of the level of BNP, GDF-15, or ST2 (e.g.
soluble ST2) in the serum of the subject is lowering of the level.
In some embodiments, improvement of the level of BNP, GDF-15, or
ST2 (e.g. soluble ST2) in the serum of the subject is increasing
the level. In some embodiments, improvement of the level of BNP,
GDF-15, or ST2 (e.g. soluble ST2) in the serum of the subject is as
recommended by the American Heart Association. In some embodiments,
determining what constitutes an improvement of the level of BNP,
GDF-15, or ST2 (e.g. soluble ST2) in the serum of the subject is
well within the skill of a person of ordinary skill in the art
(e.g. doctor, cardiologist, internist).
In one embodiment, a therapeutically effective amount of
dabuzalgron is administered to a subject suffering from or at risk
of cardiomyopathy or cardiotoxicity, wherein the dabuzalgron
reduces the level of CK in the serum of the subject as compared to
CK levels found in the serum of a subject suffering from or at risk
of cardiomyopathy or cardiotoxicity, not administered dabuzalgron.
In some embodiments, a therapeutically effective amount of
dabuzalgron is administered to a subject suffering from or at risk
of cardiomyopathy or cardiotoxicity, wherein the dabuzalgron
reduces the level of troponin, BNP, GDF-15, or ST2 (e.g. soluble
ST2) in the serum of the subject as compared to troponin, BNP,
GDF-15, or ST2 (e.g. soluble ST2) levels respectively found in the
serum of a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron. In one embodiment, a
therapeutically effective amount of dabuzalgron is administered to
a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, wherein the dabuzalgron increases the level GDF-15
in the serum of the subject as compared to GDF-15 levels found in
the serum of a subject suffering from or at risk of cardiomyopathy
or cardiotoxicity, not administered dabuzalgron. In some
embodiments, a therapeutically effective amount of dabuzalgron is
administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron does not
modulate the level of troponin, BNP, GDF-15, or ST2 (e.g. soluble
ST2) in the serum of the subject as compared to troponin, BNP,
GDF-15, or ST2 (e.g. soluble ST2) levels respectively found in the
serum of a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron. In some embodiments,
a therapeutically effective amount of dabuzalgron is administered
to a subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, wherein the dabuzalgron improves the level of
troponin, BNP, GDF-15, or ST2 (e.g. soluble ST2) in the serum of
the subject as compared to troponin, BNP, GDF-15, or ST2 (e.g.
soluble ST2) levels respectively found in the serum of a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron. In some embodiments, improvement of the
level of BNP, GDF-15, or ST2 (e.g. soluble ST2) in the serum of the
subject is lowering of the level. In some embodiments, improvement
of the level of BNP, GDF-15, or ST2 (e.g. soluble ST2) in the serum
of the subject is increasing the level. In some embodiments,
improvement of the level of BNP, GDF-15, or ST2 (e.g. soluble ST2)
in the serum of the subject is as recommended by the American Heart
Association. In some embodiments, determining what constitutes an
improvement of the level of BNP, GDF-15, or ST2 (e.g. soluble ST2)
in the serum of the subject is well within the skill of a person of
ordinary skill in the art (e.g. doctor, cardiologist,
internist).
Another indicator of cardiomyopathy or cardiotoxicity is increased
cardiomyocyte apoptosis. Cardiomyocyte apoptosis may be measured by
methods known in the art, including for example by MRI, optionally
including probes such as Annexin V (ANX), superparamagnetic iron
oxide (SPIO), ANX conjugated to SPIO (ANX-SPIO), ANX conjugated to
other detectable moieties, other phosphatidylserine binding
detectable moieties, or other MM probes known in the art (see Dash,
R. et al. Magn. Reson. Med. 2011; 66:1152-1162 incorporated herein
in its entirety). Cardiomyopathy or cardiotoxicity may also be
accompanied by an increase in fibrosis of the cardiac tissue.
Fibrosis may be measured using Sirius Red staining, a method well
known to skilled artisans. In one embodiment, a therapeutically
effective amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, is administered to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity,
wherein the dabuzalgron, or an analog, pharmaceutically acceptable
salt, or prodrug thereof, reduces the area of fibrosis in the heart
as compared to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, not administered dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof. In
one embodiment, a therapeutically effective amount of dabuzalgron
is administered to a subject suffering from or at risk of
cardiomyopathy or cardiotoxicity, wherein the dabuzalgron reduces
the area of fibrosis in the heart as compared to a subject
suffering from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron.
In one embodiment, the method prevents a decrease in fractional
shortening in the subject by more than 5% to 30% (e.g. more than 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, or 30%) as compared to fractional
shortening in a subject suffering from or at risk of cardiomyopathy
or cardiotoxicity, not administered dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof. In one
embodiment, the method prevents a decrease in fractional shortening
in the subject by more than 5% to 30% (e.g. more than 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30%) as compared to fractional shortening in a
subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron.
In one embodiment, the method prevents an increase in the amount of
creatine kinase or troponin in the serum of the subject by more
than 2-fold, 4-fold, or 5-fold as compared to the amount of
creatine kinase or troponin in the serum of the subject suffering
from or at risk of cardiomyopathy or cardiotoxicity, not
administered dabuzalgron. In one embodiment, the method prevents an
increase in the amount of ST2 (interleukin 1 receptor-like 1)
(e.g., soluble ST2), GDF-15 (growth differentiation factor 15), or
BNP (brain natriuretic peptide) as compared to the amount of ST2,
GDF-15, or BNP in the serum of the subject suffering from or at
risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron. In one embodiment, the method increases the amount of
ST2 (interleukin 1 receptor-like 1) (e.g., soluble ST2), GDF-15
(growth differentiation factor 15), or BNP (brain natriuretic
peptide) as compared to the amount ST2, GDF-15, or BNP in the serum
of the subject suffering from or at risk of cardiomyopathy or
cardiotoxicity, not administered dabuzalgron. In one embodiment,
the method decreases the amount of ST2 (interleukin 1 receptor-like
1) (e.g., soluble ST2), GDF-15 (growth differentiation factor 15),
or BNP (brain natriuretic peptide) as compared to the amount ST2,
GDF-15, or BNP in the serum of the subject suffering from or at
risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron.
In one embodiment, the method prevents an increase in the
percentage of cardiac fibrosis area by more than 1% to 20% (e.g. by
more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20%) in the heart of the subject suffering from or
at risk of cardiomyopathy or cardiotoxicity, not administered
dabuzalgron.
In some embodiments, the methods include improving (e.g.,
increasing) heart contraction in a patient. In some embodiments,
the methods include preventing heart muscle cells from dying. In
some embodiments, the methods include stimulating repair of heart
muscle. In some embodiments, the methods include stimulating
anabolic processes or function in cells (e.g., cardiac muscle
cells) or tissue (e.g., cardiac tissue).
Any of the methods including administration or use of dabuzalgron
described herein, may instead administer or use an analog of
dabuzalgron. Any of the methods including administration or use of
dabuzalgron described herein, may instead administer or use a
pharmaceutically acceptable salt of dabuzalgron. Any of the methods
including administration or use of dabuzalgron described herein,
may instead administer or use a prodrug of dabuzalgron.
The compounds of the invention can be administered alone or can be
coadministered to the patient. Coadministration is meant to include
simultaneous or sequential administration of the compounds
individually or in combination (more than one compound). Thus, the
preparations can also be combined, when desired, with other active
substances (e.g., to reduce metabolic degradation).
The compounds of the present invention can be prepared and
administered in a wide variety of oral, parenteral and topical
dosage forms. Oral preparations include tablets, pills, powder,
dragees, capsules, liquids, lozenges, cachets, gels, syrups,
slurries, suspensions, etc., suitable for ingestion by the patient.
The compounds of the present invention can also be administered by
injection, that is, intravenously, intracranially, intracardiac
administration, intramuscularly, intracutaneously, subcutaneously,
intraduodenally, or intraperitoneally. Also, the compounds
described herein can be administered by inhalation, for example,
intranasally. Additionally, the compounds of the present invention
can be administered transdermally. It is also envisioned that
multiple routes of administration (e.g., intramuscular, oral,
transdermal) can be used to administer the compounds of the
invention. Accordingly, the present invention also provides
pharmaceutical compositions comprising a pharmaceutically
acceptable excipient and one or more compounds of the
invention.
For preparing pharmaceutical compositions from the compounds of the
present invention, pharmaceutically acceptable carriers can be
either solid or liquid. Solid form preparations include powders,
tablets, pills, capsules, cachets, suppositories, and dispersible
granules. A solid carrier can be one or more substances that may
also act as diluents, flavoring agents, binders, preservatives,
tablet disintegrating agents, or an encapsulating material.
Suitable solid excipients include, but are not limited to,
magnesium carbonate; magnesium stearate; talc; pectin; dextrin;
starch; tragacanth; a low melting wax; cocoa butter; carbohydrates;
sugars including, but not limited to, lactose, sucrose, mannitol,
or sorbitol, starch from corn, wheat, rice, potato, or other
plants; cellulose such as methyl cellulose,
hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose;
and gums including arabic and tragacanth; as well as proteins
including, but not limited to, gelatin and collagen. If desired,
disintegrating or solubilizing agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt
thereof, such as sodium alginate.
Dragee cores are provided with suitable coatings such as
concentrated sugar solutions, which may also contain gum arabic,
talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol,
and/or titanium dioxide, lacquer solutions, and suitable organic
solvents or solvent mixtures. Dyestuffs or pigments may be added to
the tablets or dragee coatings for product identification or to
characterize the quantity of active compound (i.e., dosage).
Pharmaceutical preparations of the invention can also be used
orally using, for example, push-fit capsules made of gelatin, as
well as soft, sealed capsules made of gelatin and a coating such as
glycerol or sorbitol.
Liquid form preparations include solutions, suspensions, and
emulsions, for example, water or water/propylene glycol solutions.
For parenteral injection, liquid preparations can be formulated in
solution in aqueous polyethylene glycol solution.
When parenteral application is needed or desired, particularly
suitable admixtures for the compounds of the invention are
injectable, sterile solutions, preferably oily or aqueous
solutions, as well as suspensions, emulsions, or implants,
including suppositories. In particular, carriers for parenteral
administration include aqueous solutions of dextrose, saline, pure
water, ethanol, glycerol, propylene glycol, peanut oil, sesame oil,
polyoxyethylene-block polymers, and the like. Ampules are
convenient unit dosages. The compounds of the invention can also be
incorporated into liposomes or administered via transdermal pumps
or patches. Pharmaceutical admixtures suitable for use in the
present invention are well-known to those of skill in the art and
are described, for example, in Pharmaceutical Sciences (17th Ed.,
Mack Pub. Co., Easton, Pa.) and WO 96/05309, the teachings of both
of which are hereby incorporated by reference.
Aqueous solutions suitable for oral use can be prepared by
dissolving the active component in water and adding suitable
colorants, flavors, stabilizers, and thickening agents as desired.
Aqueous suspensions suitable for oral use can be made by dispersing
the finely divided active component in water with viscous material,
such as natural or synthetic gums, resins, methylcellulose, sodium
carboxymethylcellulose, hydroxypropylmethylcellulose, sodium
alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and
dispersing or wetting agents such as a naturally occurring
phosphatide (e.g., lecithin), a condensation product of an alkylene
oxide with a fatty acid (e.g., polyoxyethylene stearate), a
condensation product of ethylene oxide with a long chain aliphatic
alcohol (e.g., heptadecaethylene oxycetanol), a condensation
product of ethylene oxide with a partial ester derived from a fatty
acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or
a condensation product of ethylene oxide with a partial ester
derived from fatty acid and a hexitol anhydride (e.g.,
polyoxyethylene sorbitan mono-oleate). The aqueous suspension can
also contain one or more preservatives such as ethyl or n-propyl
p-hydroxybenzoate, one or more coloring agents, one or more
flavoring agents and one or more sweetening agents, such as
sucrose, aspartame or saccharin. Formulations can be adjusted for
osmolarity.
Also included are solid form preparations that are intended to be
converted, shortly before use, to liquid form preparations for oral
administration. Such liquid forms include solutions, suspensions,
and emulsions. These preparations may contain, in addition to the
active component, colorants, flavors, stabilizers, buffers,
artificial and natural sweeteners, dispersants, thickeners,
solubilizing agents, and the like.
Oil suspensions can contain a thickening agent, such as beeswax,
hard paraffin or cetyl alcohol. Sweetening agents can be added to
provide a palatable oral preparation, such as glycerol, sorbitol or
sucrose. These formulations can be preserved by the addition of an
antioxidant such as ascorbic acid. As an example of an injectable
oil vehicle, see Minto, J. Pharmacol. Exp. Ther. 281:93-102, 1997.
The pharmaceutical formulations of the invention can also be in the
form of oil-in-water emulsions. The oily phase can be a vegetable
oil or a mineral oil, described above, or a mixture of these.
Suitable emulsifying agents include naturally-occurring gums, such
as gum acacia and gum tragacanth, naturally occurring phosphatides,
such as soybean lecithin, esters or partial esters derived from
fatty acids and hexitol anhydrides, such as sorbitan mono-oleate,
and condensation products of these partial esters with ethylene
oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion
can also contain sweetening agents and flavoring agents, as in the
formulation of syrups and elixirs. Such formulations can also
contain a demulcent, a preservative, or a coloring agent.
The compositions of the present invention may additionally include
components to provide sustained release and/or comfort. Such
components include high molecular weight, anionic mucomimetic
polymers, gelling polysaccharides and finely-divided drug carrier
substrates. These components are discussed in greater detail in
U.S. Pat. Nos. 4,911,920; 5,403,841; 5,212,162; and 4,861,760. The
entire contents of these patents are incorporated herein by
reference in their entirety for all purposes.
Pharmaceutical compositions provided by the present invention
include compositions wherein the active ingredient is contained in
a therapeutically effective amount, i.e., in an amount effective to
achieve its intended purpose. The actual amount effective for a
particular application will depend, inter alia, on the condition
being treated. When administered in methods to treat a disease,
such compositions will contain an amount of active ingredient
effective to achieve the desired result, e.g., modulating the
activity of a target molecule (e.g. .alpha.1 adrenergic receptor),
and/or reducing, eliminating, or slowing the progression of disease
symptoms (e.g. cardiomyopathy or cardiotoxicity). Determination of
a therapeutically effective amount of a compound of the invention
is well within the capabilities of those skilled in the art,
especially in light of the detailed disclosure herein.
The dosage and frequency (single or multiple doses) administered to
a mammal can vary depending upon a variety of factors, for example,
whether the mammal suffers from another disease, and its route of
administration; size, age, sex, health, body weight, body mass
index, and diet of the recipient; nature and extent of symptoms of
the disease being treated, kind of concurrent treatment,
complications from the disease being treated or other
health-related problems. Other therapeutic regimens or agents can
be used in conjunction with the methods and compounds of
Applicants' invention. Adjustment and manipulation of established
dosages (e.g., frequency and duration) are well within the ability
of those skilled in the art.
For any compound described herein, the therapeutically effective
amount can be initially determined from cell culture assays. Target
concentrations will be those concentrations of active compound(s)
that are capable of achieving the methods described herein, as
measured using the methods described herein or known in the art. As
is well known in the art, therapeutically effective amounts for use
in humans can also be determined from animal models. For example, a
dose for humans can be formulated to achieve a concentration that
has been found to be effective in animals. The dosage in humans can
be adjusted by monitoring compounds effectiveness and adjusting the
dosage upwards or downwards, as described above. Adjusting the dose
to achieve maximal efficacy in humans based on the methods
described above and other methods is well within the capabilities
of the ordinarily skilled artisan.
Dosages may be varied depending upon the requirements of the
patient and the compound being employed. The dose administered to a
patient, in the context of the present invention should be
sufficient to effect a beneficial therapeutic response in the
patient over time. The size of the dose also will be determined by
the existence, nature, and extent of any adverse side-effects.
Determination of the proper dosage for a particular situation is
within the skill of the practitioner.
Dosage amounts and intervals can be adjusted individually to
provide levels of the administered compound effective for the
particular clinical indication being treated. This will provide a
therapeutic regimen that is commensurate with the severity of the
individual's disease state.
Utilizing the teachings provided herein, an effective prophylactic
or therapeutic treatment regimen can be planned that does not cause
substantial toxicity and yet is effective to treat the clinical
symptoms demonstrated by the particular patient. This planning
should involve the careful choice of active compound by considering
factors such as compound potency, relative bioavailability, patient
body weight, presence and severity of adverse side effects,
preferred mode of administration and the toxicity profile of the
selected agent.
The ratio between toxicity and therapeutic effect for a particular
compound is its therapeutic index and can be expressed as the ratio
between LD.sub.50 (the amount of compound lethal in 50% of the
population) and ED.sub.50 (the amount of compound effective in 50%
of the population). Compounds that exhibit high therapeutic indices
are preferred. Therapeutic index data obtained from cell culture
assays and/or animal studies can be used in formulating a range of
dosages for use in humans. The dosage of such compounds preferably
lies within a range of plasma concentrations that include the
ED.sub.50 with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the route of
administration utilized. See, e.g. Fingl et al., In: THE
PHARMACOLOGICAL BASIS OF THERAPEUTICS, Ch. 1, p. 1, 1975. The exact
formulation, route of administration and dosage can be chosen by
the individual physician in view of the patient's condition and the
particular method in which the compound is used.
In another embodiment, the compositions of the present invention
are useful for parenteral administration, such as intravenous (IV)
administration or administration into a body cavity or lumen of an
organ. The formulations for administration will commonly comprise a
solution of the compositions of the present invention dissolved in
a pharmaceutically acceptable carrier. Among the acceptable
vehicles and solvents that can be employed are water and Ringer's
solution, an isotonic sodium chloride. In addition, sterile fixed
oils can conventionally be employed as a solvent or suspending
medium. For this purpose any bland fixed oil can be employed
including synthetic mono- or diglycerides. In addition, fatty acids
such as oleic acid can likewise be used in the preparation of
injectables. These solutions are sterile and generally free of
undesirable matter. These formulations may be sterilized by
conventional, well known sterilization techniques. The formulations
may contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions such as pH
adjusting and buffering agents, toxicity adjusting agents, e.g.,
sodium acetate, sodium chloride, potassium chloride, calcium
chloride, sodium lactate and the like. The concentration of the
compositions of the present invention in these formulations can
vary widely, and will be selected primarily based on fluid volumes,
viscosities, body weight, and the like, in accordance with the
particular mode of administration selected and the patient's needs.
For IV administration, the formulation can be a sterile injectable
preparation, such as a sterile injectable aqueous or oleaginous
suspension. This suspension can be formulated according to the
known art using those suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation can also be a
sterile injectable solution or suspension in a nontoxic
parenterally-acceptable diluent or solvent, such as a solution of
1,3-butanediol.
In another embodiment, the formulations of the compositions of the
present invention can be delivered by the use of liposomes which
fuse with the cellular membrane or are endocytosed, i.e., by
employing receptor ligands attached to the liposome, that bind to
surface membrane protein receptors of the cell resulting in
endocytosis. By using liposomes, particularly where the liposome
surface carries receptor ligands specific for target cells, or are
otherwise preferentially directed to a specific organ, one can
focus the delivery of the compositions of the present invention
into the target cells in vivo. (See, e.g., Al-Muhammed, J.
Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol.
6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587,
1989).
In some embodiments, co-administration includes administering one
active agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours
of a second active agent. Co-administration includes administering
two active agents simultaneously, approximately simultaneously
(e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other),
or sequentially in any order. In some embodiments,
co-administration can be accomplished by co-formulation, i.e.,
preparing a single pharmaceutical composition including both active
agents. In other embodiments, the active agents can be formulated
separately. In another embodiment, the active and/or adjunctive
agents may be linked or conjugated to one another.
As non-limiting examples, the compositions, drugs, and compounds
described herein can be co-administered with or used in combination
with cardiomyopathy or cardiotoxicity agents including, but not
limited to beta-adrenergic blockers, angiotensin converting enzyme
inhibitors, or aldosterone or angiotensin receptor blockers. As
non-limiting examples, the compositions, drugs, and compounds
described herein can be co-administered with or used in combination
with other agents useful in increasing the cellular uptake (e.g.
uptake by cardiac cells) of the compositions, drugs, or compounds
(e.g., dabuzalgron, or an analog, pharmaceutically acceptable salt,
or prodrug thereof) for treating diseases (e.g., cardiomyopathy,
cardiotoxicity, heart muscle damage). In some embodiments the
cellular uptake is increased by activating a transporter protein in
the cell.
The pharmaceutical compositions of the present invention may be
sterilized by conventional, well-known sterilization techniques or
may be produced under sterile conditions. Aqueous solutions can be
packaged for use or filtered under aseptic conditions and
lyophilized, the lyophilized preparation being combined with a
sterile aqueous solution prior to administration. The compositions
can contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
adjusting and buffering agents, tonicity adjusting agents, wetting
agents, and the like, e.g., sodium acetate, sodium lactate, sodium
chloride, potassium chloride, calcium chloride, sorbitan
monolaurate, and triethanolamine oleate.
Formulations suitable for oral administration can comprise: (a)
liquid solutions, such as an effective amount of a packaged
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, suspended in diluents, e.g., water, saline, or PEG
400; (b) capsules, sachets, or tablets, each containing a
predetermined amount of dabuzalgron, or an analog, pharmaceutically
acceptable salt, or prodrug thereof, as liquids, solids, granules
or gelatin; (c) suspensions in an appropriate liquid; and (d)
suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise dabuzalgron, or an
analog, pharmaceutically acceptable salt, or prodrug thereof, in a
flavor, e.g., sucrose, as well as pastilles comprising dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
in an inert base, such as gelatin and glycerin or sucrose and
acacia emulsions, gels, and the like, containing, in addition to
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof, carriers known in the art.
The alpha-1 adrenergic receptor agonist of choice (e.g.
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof), alone or in combination with other suitable
components, can be made into aerosol formulations (i.e., they can
be "nebulized") to be administered via inhalation. Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the like.
In some embodiments, aerosol formulations are used to administer an
alpha-1 adrenergic receptor agonist of choice (e.g. dabuzalgron, or
an analog, pharmaceutically acceptable salt, or prodrug thereof) to
the lungs.
Formulations suitable for parenteral administration, such as, for
example, by intraarticular (in the joints), intravenous,
intramuscular, intratumoral, intradermal, intraperitoneal,
intracranial, intracardiac, and subcutaneous routes, include
aqueous and non-aqueous, isotonic sterile injection solutions,
which can contain antioxidants, buffers, bacteriostats, and solutes
that render the formulation isotonic with the blood of the intended
recipient, and aqueous and non-aqueous sterile suspensions that can
include suspending agents, solubilizers, thickening agents,
stabilizers, and preservatives. Injection solutions and suspensions
can also be prepared from sterile powders, granules, and tablets.
In the practice of the present invention, compositions can be
administered, for example, by intravenous infusion, intracardiac
administration, orally, topically, intraperitoneally,
intravesically, intracranially, or intrathecally. Parenteral
administration, oral administration, and intravenous administration
are the preferred methods of administration. The formulations of
compounds can be presented in unit-dose or multi-dose sealed
containers, such as ampoules and vials.
The pharmaceutical preparation is preferably in unit dosage form.
In such form the preparation is subdivided into unit doses
containing appropriate quantities of the active component, e.g.,
dabuzalgron. In such form the preparation is subdivided into unit
doses containing appropriate quantities of the active component,
e.g., dabuzalgron, or an analog, pharmaceutically acceptable salt,
or prodrug thereof. The unit dosage form can be a packaged
preparation, the package containing discrete quantities of
preparation, such as packeted tablets, capsules, and powders in
vials or ampoules. Also, the unit dosage form can be a capsule,
tablet, cachet, or lozenge itself, or it can be the appropriate
number of any of these in packaged form. The composition can, if
desired, also contain other compatible therapeutic agents.
The compounds described herein can be used in combination with one
another, with other active agents known to be useful in treating
cardiomyopathy, cardiotoxicity, cardiovascular diseases, or with
adjunctive agents that may not be effective alone, but may
contribute to the efficacy of the active agent.
In another aspect is provided a method of modulating the activity
of an .alpha.1A adrenergic receptor. The method including
contacting the .alpha.1A adrenergic receptor with an effective
amount of a compound described herein (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof). In
embodiments, the modulating the activity of the .alpha.1A
adrenergic receptor is increasing the activity of the alpha-1
adrenergic receptor. In embodiments, the modulating the activity of
the .alpha.1A adrenergic receptor is increasing the activity of the
.alpha.1A adrenergic receptor relative to the absence of the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof). In some embodiments of the
method of modulating the activity of an .alpha.1A adrenergic
receptor, the compound is less effective at modulating the activity
of other adrenergic receptors. In some embodiments of the method,
the compound modulates the activity of .alpha.1A adrenergic
receptor at least two-fold more than it modulates the activity of
other adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least five-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 10-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 50-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 100-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 1000-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method of
modulating the activity of an .alpha.1A adrenergic receptor, the
compound is less effective at modulating the activity of other
.alpha.1 adrenergic receptors. In some embodiments of the method,
the compound modulates the activity of an .alpha.1A adrenergic
receptor at least two-fold more than it modulates the activity of
other al adrenergic receptors. In some embodiments of the method,
the compound modulates the activity of an .alpha.1A adrenergic
receptor at least five-fold more than it modulates the activity of
other .alpha.1 adrenergic receptors. In some embodiments of the
method, the compound modulates the activity of an .alpha.1A
adrenergic receptor at least 10-fold more than it modulates the
activity of other .alpha.1 adrenergic receptors. In some
embodiments of the method, the compound modulates the activity of
an .alpha.1A adrenergic receptor at least 50-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound modulates the activity
of an .alpha.1A adrenergic receptor at least 100-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound modulates the activity
of an .alpha.1A adrenergic receptor at least 1000-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors.
In another aspect is provided a method of increasing the activity
of an .alpha.1A adrenergic receptor. The method including
contacting the .alpha.1A adrenergic receptor with an effective
amount of a compound described herein (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof). In
embodiments, increasing the activity of the .alpha.1A adrenergic
receptor is increasing the activity of the .alpha.1A adrenergic
receptor relative to the absence of the compound (e.g., dabuzalgron
or an analog, pharmaceutically acceptable salt, or prodrug
thereof). In some embodiments of the method of increasing the
activity of an .alpha.1A adrenergic receptor, the compound is less
effective at increasing the activity of other adrenergic receptors.
In some embodiments of the method, the compound increases the
activity of .alpha.1A adrenergic receptor at least two-fold more
than it increases the activity of other adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of .alpha.1A adrenergic receptor at least five-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 10-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 50-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 100-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 1000-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method of increasing the activity of an
.alpha.1A adrenergic receptor, the compound is less effective at
increasing the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least two-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least five-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 10-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 50-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 100-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 1000-fold more than it
increases the activity of other al adrenergic receptors.
In embodiments of the methods described herein the compound (e.g.,
dabuzalgron or an analog, pharmaceutically acceptable salt, or
prodrug thereof) activates ERK. In embodiments of the methods
described herein the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) increases the
activity of ERK. In embodiments of the methods described herein,
the compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) increases the cytoprotective
activity of ERK. In embodiments of the methods described herein the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) reduces cell death (e.g., cell
death associated with anthracycline administration). In embodiments
of the methods described herein, the compound (e.g., dabuzalgron or
an analog, pharmaceutically acceptable salt, or prodrug thereof)
reduces cytochrome c release (e.g., from the membrane, from
mitochondria, from mitochondrial membrane). In embodiments of the
methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
mitigates (e.g., reduced or counteracted) reduction or loss of
mitochondrial membrane potential. In embodiments of the methods
described herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) prevents
heart failure. In embodiments of the methods described herein, the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) treats heart failure. In
embodiments of the methods described herein, the compound (e.g.,
dabuzalgron or an analog, pharmaceutically acceptable salt, or
prodrug thereof) treats systolic heart failure. In embodiments of
the methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
treats cardiomyocyte injury (e.g., associated with anthracycline
treatment). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) does not modulate
transcription or expression levels of atrial natriuretic peptide,
beta myosin heavy chain, or alpha-skeletal actin. In embodiments of
the methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
prevents or treats decrease in contractile function associated with
anthracycline treatment. In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) treats or
prevents cardiac fibrosis (e.g., associated with anthracycline
treatment). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) increases levels of cytochrome
c oxidase proteins. In embodiments of the methods described herein,
the compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) increases levels of complex 1
proteins. In embodiments of the methods described herein, the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) increases the levels of
complex 1 proteins and ATP synthase proteins. In embodiments of the
methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
increases ATP levels in cells (e.g., cardiomyocytes, heart cells,
ATP levels in heart cells relative to ATP levels in heart cells
associated with anthracycline treatment). In embodiments of the
methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
increases ERK phosphorylation. In embodiments of the methods
described herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) reduces cell
death (e.g., apoptosis or necrosis). In embodiments of the methods
described herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) reduces cell
death associated with anthracycline treatment (e.g., apoptosis or
necrosis). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron or an analog, pharmaceutically
acceptable salt, or prodrug thereof) reduced cytochrome c release
(e.g., associated with anthracycline treatment). In embodiments of
the methods described herein, the compound (e.g., dabuzalgron or an
analog, pharmaceutically acceptable salt, or prodrug thereof)
reduced caspase cleavage or PARP cleavage (e.g., associated with
anthracycline treatment). In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) does not
cause cardiac hypertrophy. In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) does not
increase blood pressure. In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) does not
increase heart rate. In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) increases the
force or energy of muscle contractions (e.g., compared to the
absence of the compound). In embodiments of the methods described
herein, the compound (e.g., dabuzalgron or an analog,
pharmaceutically acceptable salt, or prodrug thereof) increases the
activity of ERK (e.g., compared to the absence of the compound). In
embodiments of the methods described herein, the compound (e.g.,
dabuzalgron or an analog, pharmaceutically acceptable salt, or
prodrug thereof) increases the activity of MEK (e.g., compared to
the absence of the compound).
In another aspect is provided a method of modulating the activity
of an .alpha.1A adrenergic receptor. The method including
contacting the .alpha.1A adrenergic receptor with an effective
amount of a compound described herein (e.g., dabuzalgron). In
embodiments, the modulating the activity of the .alpha.1A
adrenergic receptor is increasing the activity of the alpha-1
adrenergic receptor. In embodiments, the modulating the activity of
the .alpha.1A adrenergic receptor is increasing the activity of the
.alpha.1A adrenergic receptor relative to the absence of the
compound (e.g., dabuzalgron). In some embodiments of the method of
modulating the activity of an .alpha.1A adrenergic receptor, the
compound is less effective at modulating the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least two-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least five-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 10-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 50-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 100-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method, the
compound modulates the activity of .alpha.1A adrenergic receptor at
least 1000-fold more than it modulates the activity of other
adrenergic receptors. In some embodiments of the method of
modulating the activity of an .alpha.1A adrenergic receptor, the
compound is less effective at modulating the activity of other
.alpha.1 adrenergic receptors. In some embodiments of the method,
the compound modulates the activity of an .alpha.1A adrenergic
receptor at least two-fold more than it modulates the activity of
other .alpha.1 adrenergic receptors. In some embodiments of the
method, the compound modulates the activity of an .alpha.1A
adrenergic receptor at least five-fold more than it modulates the
activity of other .alpha.1 adrenergic receptors. In some
embodiments of the method, the compound modulates the activity of
an .alpha.1A adrenergic receptor at least 10-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound modulates the activity
of an .alpha.1A adrenergic receptor at least 50-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound modulates the activity
of an .alpha.1A adrenergic receptor at least 100-fold more than it
modulates the activity of other al adrenergic receptors. In some
embodiments of the method, the compound modulates the activity of
an .alpha.1A adrenergic receptor at least 1000-fold more than it
modulates the activity of other .alpha.1 adrenergic receptors.
In another aspect is provided a method of increasing the activity
of an .alpha.1A adrenergic receptor. The method including
contacting the .alpha.1A adrenergic receptor with an effective
amount of a compound described herein (e.g., dabuzalgron). In
embodiments, the increasing the activity of the .alpha.1A
adrenergic receptor is increasing the activity of the .alpha.1A
adrenergic receptor relative to the absence of the compound (e.g.,
dabuzalgron). In some embodiments of the method of increasing the
activity of an .alpha.1A adrenergic receptor, the compound is less
effective at increasing the activity of other adrenergic receptors.
In some embodiments of the method, the compound increases the
activity of .alpha.1A adrenergic receptor at least two-fold more
than it increases the activity of other adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of .alpha.1A adrenergic receptor at least five-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 10-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 50-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 100-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
.alpha.1A adrenergic receptor at least 1000-fold more than it
increases the activity of other adrenergic receptors. In some
embodiments of the method of increasing the activity of an
.alpha.1A adrenergic receptor, the compound is less effective at
increasing the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least two-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least five-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 10-fold more than it
increases the activity of other al adrenergic receptors. In some
embodiments of the method, the compound increases the activity of
an .alpha.1A adrenergic receptor at least 50-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 100-fold more than it
increases the activity of other .alpha.1 adrenergic receptors. In
some embodiments of the method, the compound increases the activity
of an .alpha.1A adrenergic receptor at least 1000-fold more than it
increases the activity of other .alpha.1 adrenergic receptors.
In embodiments of the methods described herein the compound (e.g.,
dabuzalgron) activates ERK. In embodiments of the methods described
herein the compound (e.g., dabuzalgron) increases the activity of
ERK. In embodiments of the methods described herein, the compound
(e.g., dabuzalgron) increases the cytoprotective activity of ERK.
In embodiments of the methods described herein the compound (e.g.,
dabuzalgron) reduces cell death (e.g., cell death associated with
anthracycline administration). In embodiments of the methods
described herein, the compound (e.g., dabuzalgron) reduces
cytochrome c release (e.g., from the membrane, from mitochondria,
from mitochondrial membrane). In embodiments of the methods
described herein, the compound (e.g., dabuzalgron) mitigates (e.g.,
reduced or counteracted) reduction or loss of mitochondrial
membrane potential. In embodiments of the methods described herein,
the compound (e.g., dabuzalgron) prevents heart failure. In
embodiments of the methods described herein, the compound (e.g.,
dabuzalgron) treats heart failure. In embodiments of the methods
described herein, the compound (e.g., dabuzalgron) treats systolic
heart failure. In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) treats cardiomyocyte injury (e.g.,
associated with anthracycline treatment). In embodiments of the
methods described herein, the compound (e.g., dabuzalgron) does not
modulate transcription or expression levels of atrial natriuretic
peptide, beta myosin heavy chain, or alpha-skeletal actin. In
embodiments of the methods described herein, the compound (e.g.,
dabuzalgron) prevents or treats decrease in contractile function
associated with anthracycline treatment. In embodiments of the
methods described herein, the compound (e.g., dabuzalgron) treats
or prevents cardiac fibrosis (e.g., associated with anthracycline
treatment). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) increases levels of cytochrome c
oxidase proteins. In embodiments of the methods described herein,
the compound (e.g., dabuzalgron) increases levels of complex 1
proteins. In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) increases the levels of complex 1
proteins and ATP synthase proteins. In embodiments of the methods
described herein, the compound (e.g., dabuzalgron) increases ATP
levels in cells (e.g., cardiomyocytes, heart cells, ATP levels in
heart cells relative to ATP levels in heart cells associated with
anthracycline treatment). In embodiments of the methods described
herein, the compound (e.g., dabuzalgron) increases ERK
phosphorylation. In embodiments of the methods described herein,
the compound (e.g., dabuzalgron) reduces cell death (e.g.,
apoptosis or necrosis). In embodiments of the methods described
herein, the compound (e.g., dabuzalgron) reduces cell death
associated with anthracycline treatment (e.g., apoptosis or
necrosis). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) reduced cytochrome c release (e.g.,
associated with anthracycline treatment). In embodiments of the
methods described herein, the compound (e.g., dabuzalgron) reduced
caspase cleavage or PARP cleavage (e.g., associated with
anthracycline treatment). In embodiments of the methods described
herein, the compound (e.g., dabuzalgron) does not cause cardiac
hypertrophy. In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) does not increase blood pressure. In
embodiments of the methods described herein, the compound (e.g.,
dabuzalgron) does not increase heart rate. In embodiments of the
methods described herein, the compound (e.g., dabuzalgron)
increases the force or energy of muscle contractions (e.g.,
compared to the absence of the compound). In embodiments of the
methods described herein, the compound (e.g., dabuzalgron)
increases the activity of ERK (e.g., compared to the absence of the
compound). In embodiments of the methods described herein, the
compound (e.g., dabuzalgron) increases the activity of MEK (e.g.,
compared to the absence of the compound).
III. Additional Embodiments
Embodiment P1
A method of treating or preventing cardiomyopathy in a subject in
need of such treatment, said method comprising administering a
therapeutically or prophylactically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
Embodiment P2
The method of embodiment P1, wherein said cardiomyopathy is
associated with anthracycline administration, hypertension, heart
valve disease, myocardial ischemia, myocardial infarction,
myocardial inflammation, heart failure, pulmonary hypertension,
myocardial stunning, myocardial hibernation, cardiac surgery,
genetic mutation, genetic changes in cardiac proteins, or coronary
intervention.
Embodiment P3
The method of embodiment P1, wherein said cardiomyopathy is
associated with anthracycline administration.
Embodiment P4
The method of embodiment P3, wherein said anthracycline is
doxorubicin, daunorubicin, epirubicin, idarubucin, adriamycin, or
valrubicin.
Embodiment P5
The method of one of embodiments P2 to P4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
is co-administered with the anthracycline.
Embodiment P6
The method of one of embodiments P1 to P4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
is administered before administration of the anthracycline.
Embodiment P7
The method of one of embodiments P1 to P4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof,
is administered after administration of the anthracycline.
Embodiment P8
The method of one of embodiments P1 to P7, wherein said method
comprises treating said cardiomyopathy.
Embodiment P9
The method of one of embodiments P1 to P7, wherein said method
comprises preventing said cardiomyopathy.
Embodiment P10
The method of one of embodiments P1 to P9, wherein said patient's
blood pressure does not increase as a result of said
administration.
Embodiment P11
The method of one of embodiments P1 to P9, wherein said patient's
blood pressure increases by an amount equal to or less than 50, 40,
30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mmHg as a result of said
administration.
Embodiment P12
The method of embodiment P11, wherein said blood pressure is
systolic blood pressure.
Embodiment P13
The method of one of embodiments P1 to P12, wherein said effective
amount is between about 0.001 and 1000, 0.1 and 100, 1 and 50, or 5
and 25 micrograms/kilogram patient weight.
Embodiment P14
The method of one of embodiments P1 to P12, wherein said effective
amount is about 20 micrograms/kilogram patient weight.
Embodiment P15
The method of one of embodiments P1 to P12, wherein said effective
amount is 20 micrograms/kilogram patient weight
Embodiment P16
The method of one of embodiments P1 to P15, wherein said effective
amount is the total amount administered to said patient in a
day.
Embodiment P17
The method of one of embodiments P1 to P16, wherein said
administering is parenteral, intravenous, intraarterial, buccal,
sublingual, oral, peroral, transdermal, or nasal.
Embodiment P18
A method of treating or preventing cardiac cell mitochondria
dysfunction, said method comprising contacting the cardiac cell
with an effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof.
Embodiment P19
A method of treating or preventing cardiac cell death, said method
comprising contacting the cardiac cell with an effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
Embodiment P20
The method of embodiment P19, wherein the cardiac cell death is
apoptosis.
Embodiment P21
The method of embodiment P19, wherein the cardiac cell death is
necrosis.
Embodiment P22
A method of treating or preventing heart failure in a patient in
need of such treatment, said method comprising administering a
therapeutically or prophylactically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
IV. Further Embodiments
Embodiment 1
A method of treating or preventing cardiomyopathy in a subject in
need of such treatment, said method comprising administering a
therapeutically or prophylactically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
Embodiment 2
The method of embodiment 1, wherein said cardiomyopathy is
associated with anthracycline administration, hypertension, heart
valve disease, myocardial ischemia, myocardial infarction,
myocardial inflammation, heart failure, pulmonary hypertension,
myocardial stunning, myocardial hibernation, cardiac surgery,
genetic mutation, genetic changes in cardiac proteins, or coronary
intervention.
Embodiment 3
The method of embodiment 1, wherein said cardiomyopathy is
associated with anthracycline administration.
Embodiment 4
The method of embodiment 3, wherein said anthracycline is
doxorubicin, daunorubicin, epirubicin, idarubucin, adriamycin, or
valrubicin.
Embodiment 5
The method of one of embodiments 2 to 4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof
(e.g., dabuzalgron), is co-administered with the anthracycline.
Embodiment 6
The method of one of embodiments 1 to 4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof
(e.g., dabuzalgron), is administered before administration of the
anthracycline.
Embodiment 7
The method of one of embodiments 1 to 4, wherein the dabuzalgron,
or an analog, pharmaceutically acceptable salt, or prodrug thereof
(e.g., dabuzalgron), is administered after administration of the
anthracycline.
Embodiment 8
The method of one of embodiments 1 to 7, wherein said method
comprises treating said cardiomyopathy (e.g., but not
preventing).
Embodiment 9
The method of one of embodiments 1 to 7, wherein said method
comprises preventing said cardiomyopathy (e.g., but not
treating).
Embodiment 10
The method of one of embodiments 1 to 9, wherein said patient's
blood pressure does not increase as a result of said
administration.
Embodiment 11
The method of one of embodiments 1 to 9, wherein said patient's
blood pressure increases by an amount equal to or less than 50, 40,
30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mmHg as a result of said
administration.
Embodiment 12
The method of embodiment 11, wherein said blood pressure is
systolic blood pressure.
Embodiment 13
The method of one of embodiments 1 to 12, wherein said effective
amount is between about 0.001 and 1000, 0.1 and 100, 1 and 50, or 5
and 25 micrograms/kilogram patient weight.
Embodiment 14
The method of one of embodiments 1 to 12, wherein said effective
amount is about 20 micrograms/kilogram patient weight.
Embodiment 15
The method of one of embodiments 1 to 12, wherein said effective
amount is 20 micrograms/kilogram patient weight
Embodiment 16
The method of one of embodiments 1 to 15, wherein said effective
amount is the total amount administered to said patient in a
day.
Embodiment 17
The method of one of embodiments 1 to 16, wherein said
administering is parenteral, intravenous, intraarterial, buccal,
sublingual, oral, peroral, transdermal, or nasal.
Embodiment 18
A method of treating or preventing cardiac cell mitochondria
dysfunction, said method comprising contacting the cardiac cell
with an effective amount of dabuzalgron, or an analog,
pharmaceutically acceptable salt, or prodrug thereof.
Embodiment 19
A method of treating or preventing cardiac cell death, said method
comprising contacting the cardiac cell with an effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof.
Embodiment 20
The method of embodiment 19, wherein the cardiac cell death is
apoptosis.
Embodiment 21
The method of embodiment 19, wherein the cardiac cell death is
necrosis.
Embodiment 22
A method of treating or preventing heart failure in a patient in
need of such treatment, said method comprising administering a
therapeutically or prophylactically effective amount of
dabuzalgron, or an analog, pharmaceutically acceptable salt, or
prodrug thereof (e.g., dabuzalgron).
V. Examples
There are three alpha-1 adrenergic receptor (.alpha.1-AR) subtypes:
A, B, and D. The .alpha.1A and B are found in the myocardium,
whereas the .alpha.1D predominates in coronary arteries. The oral
.alpha.1A-AR agonist, dabuzalgron, was well tolerated in multiple
clinical trials of treatment for urinary incontinence, but
development was halted due to lack of efficacy. Doxorubicin (DOX)
is a widely used antineoplastic agent with dose-limiting
cardiotoxicity that can lead to heart failure. Treatment options
for DOX-induced cardiotoxicity are limited. Mice lacking the
.alpha.1A-AR (AKO) and wild type (WT) littermates were treated with
DOX, then an oral subpressor, non-hypertrophic dose of dabuzalgron
or vehicle for 7 days. Dabuzalgron preserved contractile function
and limited cardiac fibrosis in DOX-treated WT mice. AKO mice had
worse survival and contractile function after DOX; neither was
improved by dabuzalgron. RNAseq on DOX-treated heart tissue
identified dabuzalgron-mediated differences in pathways related to
mitochondrial function and energy production, and dabuzalgron
preserved cardiac ATP production after DOX. These beneficial
effects were abrogated by ERK1/2 inhibition with trametinib. In
cardiomyocytes, dabuzalgron protected against DOX-induced cell
death and preserved mitochondrial membrane potential. Selective
activation of the .alpha.1A-AR with the well-tolerated oral agonist
dabuzalgron prevents DOX cardiotoxicity, likely due in part to
preservation of mitochondrial function in cardiomyocytes.
Alpha-1-adrenergic receptor agonists can be used for the prevention
and treatment of heart muscle injuries and diseases. One part of
the invention is to use a drug or drugs that activate alpha-1
adrenergic receptors in cardiac muscle cells or other cardiac
cells, to treat heart muscle diseases, or to prevent heart muscle
disease from occurring. Diseases treated by giving an alpha-1
adrenergic agonist after the disease is present would include, but
not be limited to: cardiotoxicity, heart failure; cardiomyopathy
from hypertension or valve disease or ischemia or idiopathic;
myocardial stunning; myocardial hibernation; myocardial dysfunction
post-myocardial infarction; myocardial dysfunction post-cardiac
surgery; myocardial dysfunction post-coronary intervention;
anthracycline-induced cardiomyopathy; other cancer
chemotherapy-induced cardiomyopathy; right ventricle failure from
pulmonary hypertension or other causes. Diseases prevented by
giving an alpha-1-adrenergic agonist before the disease is present
would be the same, with two specific examples being
anthracycline-induced cardiomyopathy and preconditioning before
coronary intervention or bypass or other invasive procedures.
For all cardiac indications, a drug or drugs would be given to
activate alpha-1-adrenergic receptors, receptors that normally are
activated by catecholamines such as norepinephrine or epinephrine.
The drug might activate all subtypes of alpha-1-adrenergic receptor
(there are currently 3 known subtypes), or only one or two of the
subtypes, or only a particular active state of the subtype
(receptors have multiple active states). The effect of the drug
would be to increase post-receptor signaling in the cell, for
example the cardiac muscle cell, and this increased signaling would
have beneficial effects in the heart by increasing beneficial
anabolic or trophic or metabolic processes, or by stimulating
mechanisms that protect from cell injury or death, or by increasing
cardiogenesis. The therapeutic potential of .alpha.1A activation in
the heart has not been explored well. Doxorubicin (DOX) is a widely
used antineoplastic agent with dose-limiting cardiotoxicity that
can lead to heart failure. Treatment options for DOX-induced
cardiotoxicity are limited. The selective oral .alpha.1A agonist
dabuzalgron was well tolerated in clinical trials, but development
was halted due to lack of efficacy in the treatment of urinary
incontinence. In some embodiments, the drug or compound (e.g.
dabuzalgron) and/or methods described herein bind to the alpha-1A
subtype.
Another mechanism of benefit, in addition to the trophic and
protective mechanisms described herein above, is to stimulate acute
adaptive processes. This includes improving cardiac function by
activating contraction.
Example 1
An Oral Selective Alpha-1A Adrenergic Receptor Agonist Prevents
Doxorubicin Cardiotoxicity
Mice were treated with DOX followed by a subpressor and
non-hypertrophic dose of dabuzalgron or vehicle by mouth for 7
days. Treatment with dabuzalgron preserved contractile function and
limited fibrosis in wild type mice but had no effect in mice
lacking the .alpha.1A-AR. RNAseq on heart tissue identified
differences in pathways related to mitochondrial function and
energy production and dabuzalgron preserved ATP production after
DOX. In cardiomyocytes, dabuzalgron activated cytoprotective ERK,
protected against DOX-induced cell death, decreased cytochrome c
release and apoptotic effectors, and mitigated loss of
mitochondrial membrane potential. Selective activation of the
.alpha.1A-AR with the well-tolerated oral agonist dabuzalgron
prevents doxorubicin (DOX) cardiotoxicity, likely due in part to
preservation of mitochondrial function in cardiomyocytes.
Evidence from numerous studies in cells and animals indicates that
alpha-1 adrenergic receptors (.alpha.1-ARs) play numerous
protective roles in the heart. [1] There are three .alpha.1-AR
subtypes: .alpha.1A, .alpha.1B, and .alpha.1D. In rodent and human
myocardium, the .alpha.1A and .alpha.1B predominate and there is no
measurable .alpha.1D. The .alpha.1D is the major .alpha.1-AR
subtype in human and mouse coronary arteries, where its activation
promotes vasoconstriction. [2,3] The role of the .alpha.1B remains
unclear, but multiple lines of evidence suggest that the
cardioprotective effects of non-selective .alpha.1-AR agonists are
mediated by the .alpha.1A. Mice overexpressing the .alpha.1A have
increased contractility,[4] and are protected from
ischemia-reperfusion injury,[5] myocardial infarction,[6] and
transverse aortic constriction.[7] Abrogation of these beneficial
processes may also account for the two-fold increase in incident
heart failure (HF) in hypertensive patients treated with the
non-selective doxazosin in ALLHAT. [8] This and other evidence from
animal and human studies suggest that activating myocardial
.alpha.1-ARs could be therapeutically effective in HF.
In this study, we used the selective .alpha.1A agonist dabuzalgron
to test our hypothesis that selective stimulation of myocardial
.alpha.1As could confer cardioprotection without increasing
afterload through vascular .alpha.1-AR activation. Dabuzalgron
(also referred to herein as Ro 115-1240, or 1240) was developed for
the treatment of urinary incontinence. It showed excellent
.alpha.1A selectivity in preclinical testing[9] and was well
tolerated by a total of 1,223 women in a Phase 1 trial (11) two
Phase 2 randomized multicenter trials; (Roche NN16378 and NN16691,
roche-trials.com) and a subsequent open-label study. (Roche
NN16586) Importantly, there were no significant changes in BP in
the subjects who received dabuzalgron in any of these trials,
suggesting that the chosen dose did not affect vascular tone. When
interim analysis of the Phase 2 trials revealed no clinically
meaningful difference in urinary incontinence between the
dabuzalgron and placebo groups, enrollment was closed and further
development of dabuzalgron was halted.
We chose initially to test the therapeutic efficacy of dabuzalgron
using an anthracycline injury model.[11-13] Anthracyclines,
including DOX, are highly effective and commonly used
chemotherapeutic agents, but have dose-limiting cardiotoxicity.
Though the incidence of anthracycline-induced cardiomyopathy has
declined with contemporary dosing regimens, left ventricular
dysfunction still occurs in 20-30% of anthracycline recipients [14,
15] and remains an important cause of systolic HF. Numerous
mechanisms contribute to cardiomyocyte injury after anthracycline
administration, but mitochrondrial dysfunction and broad deficits
in cardiomyocyte energy production are central to the
pathogenesis.[16]
We show that dabuzalgron protects against the cardiotoxic effects
of DOX in vitro and in vivo by activating the .alpha.1A-AR and
demonstrate that the preservation of mitochondrial function is one
novel mechanism underlying this benefit.
Example 2
Selective .alpha.1-AR Activation with Dabuzalgron does not Affect
Heart Rate, Blood Pressure, or Heart Size in Wild Type Mice
Given that non-selective .alpha.1-AR agonists such as phenylephrine
can increase BP and cause cardiomyocyte hypertrophy, we sought to
determine whether the selective .alpha.1A agonist, dabuzalgron,
would have similar effects. Untreated mice were trained on the tail
cuff apparatus daily for 5 days. On Days 6-10, mice received
dabuzalgron (1-100 .mu.g/kg/day) or vehicle by gavage twice daily
for 5 days with daily BP measurements. After 5 days, there was no
difference in systolic BP or HR between mice treated with vehicle
and mice treated with any dose of dabuzalgron (FIG. 1A).
To test the effect of an .alpha.1A agonist on cardiac hypertrophy,
we administered dabuzalgron (1-100 .mu.g/kg/day) or vehicle by
gavage twice daily for 7 days. There was no measurable change in
body weight or heart weight at any dose (Table 1), and no
difference in heart weight indexed to tibia length could be found
when comparing wild type mice treated with dabuzalgron and water.
(FIG. 1B). Collectively these findings suggest that the chosen
doses of dabulzagron do not increase vascular tone or promote
cardiac hypertrophy, two properties attributed to non-selective
.alpha.1-AR activation.
TABLE-US-00001 TABLE 1 Indexed heart weight after 7-day gavage
treatment with dabuzalgron (Ro 115-1240) in uninjured mice. Ro
115-1240 Heart weight/ .mu.g/kg/day (n) Body weight, Body weight,
Tibia Heart Heart/body tibia length Wild type initial (g) final (g)
length (mm) weight (mg) weight (%) (mg/mm) Vehicle (12) 27.2 .+-.
1.0 26.9 .+-. 0.8 17.5 .+-. 0.2 109 .+-. 4 0.40 .+-. 0.01 6.2 .+-.
0.2 0.2 (3) 25.5 .+-. 0.3 25.3 .+-. 0.4 17.3 .+-. 0.1 106 .+-. 4
0.42 .+-. 0.01 6.1 .+-. 0.3 2 (6) 26.0 .+-. 0.8 25.9 .+-. 0.8 17.5
.+-. 0.1 106 .+-. 4 0.41 .+-. 0.02 6.1 .+-. 0.2 20 (12) 27.9 .+-.
1.2 27.3 .+-. 1.1 17.5 .+-. 0.1 110 .+-. 4 0.41 .+-. 0.01 5.9 .+-.
0.2 200 (7) 28.4 .+-. 1.8 27.4 .+-. 1.6 17.6 .+-. 0.2 113 .+-. 6
0.41 .+-. 0.01 6.1 .+-. 0.3 All values are mean .+-. SEM, n given
in parentheses
We used qRT-PCR to assay traditionally accepted molecular markers
of hypertrophy in the hearts of mice treated with dabuzalgron.
There was no change in the transcript abundance of atrial
natriuretic peptide, beta myosin heavy chain, or alpha-skeletal
actin. (FIG. 1C)
Example 3
Dabuzalgron Protects Against Doxorubicin Cardiotoxicity by
Activating the .alpha.1A-AR
To test whether therapeutic activation of the .alpha.1A could
prevent DOX-induced cardiac injury, we treated WT mice and mice
lacking the .alpha.1A (AKO) with DOX 20 mg/kg intraperitoneal
(i.p.) injection followed by 7 days gavage with either water or
dabuzalgron 10 .mu.g/kg twice daily. (FIG. 2A) There was no
difference in baseline heart weight in WT and AKO mice. (Table 2)
All animals treated with DOX lost 10-15% of their body weight. Raw
heart weight and heart weight indexed to tibia length were lower in
mice treated with DOX than in vehicle-treated WT and AKO controls.
(Table 2) Survival was 78% in wild type mice treated with DOX and
86% (p=NS by Fisher's exact test) in mice treated with DOX and
gavaged with dabuzalgron. Survival in 16 AKO mice treated with DOX
was 38% (p=0.08 vs. DOX-treated WT mice by Fisher's exact test) and
unaffected by dabuzalgron administration.
TABLE-US-00002 TABLE 2 Indexed heart weight after 7-day doxorubicin
treatment with or without dabuzalgron (Ro 115-1240) 20 .mu.g/kg/d.
7-day Body Wt Body Wt Tibia Heart Wt HW/BW HW/TL Lung Wt/TL
Treatment survival Day 0 (g) Day 7 (g) (mm) (mg) (%) (mg/mm)
(mg/mm) WILD TYPE Vehicle (12) 100% 27.3 .+-. 0.6 27.8 .+-. 0.6
17.2 .+-. 0.1 126 .+-. 3 0.45 .+-. 0.01 7.3 .+-. 0.2 7.1 .+-. 1.2
Dox + vehicle (14) 78% 28.1 .+-. 0.7 25.1 .+-. 1.2* 17.9 .+-. 0.2
104 .+-. 7* 0.41 .+-. 0.01* 5.8 .+-. 0.4* 8.2 .+-. 0.3 Dox +
dabuzalgron (14) 86% 27.3 .+-. 0.5 24.3 .+-. 0.6* 17.6 .+-. 0.1 97
.+-. 5* 0.41 .+-. 0.02* 5.5 .+-. 0.3* 7.7 .+-. 0.4 .alpha.1A-KO
Vehicle (3) 100% 26.7 .+-. 0.9 26.7 .+-. 0.9 17.0 .+-. 0.0 118 .+-.
7 0.44 .+-. 0.02 6.9 .+-. 0.4 5.2 .+-. 0.3 Dox + vehicle (3) 38%
29.9 .+-. 0.7 26.8 .+-. 1.2 17.5 .+-. 0.3 101 .+-. 9 0.42 .+-. 0.02
5.8 .+-. 0.3* 5.0 .+-. 0.3 Dox + dabuzalgron (4) 50% 29.3 .+-. 0.6
26.4 .+-. 1.2 17.4 .+-. 0.1 101 .+-. 5* 0.39 .+-. 0.01* 5.6 .+-.
0.2* 5.1 .+-. 0.2 All values are mean .+-. SEM, n given in
parentheses. Anatomic data are included only for mice that survived
7 days. HW = heart weight; BW = body weight; TL = tibia length; Wt
= weight
DOX treatment decreased survival and this decrease was not fully
mitigated by treatment with dabuzalgron in this experiment and over
this time period. Survival in AKO mice treated with DOX was 50% and
unaffected by dabuzalgron administration, as seen in Table 2.
Conscious echocardiography on Day 7 revealed a decrease in
contractile function after DOX treatment in WT mice that was
prevented by administration of dabuzalgron. (FIG. 2A, Table 3)
TABLE-US-00003 TABLE 3 Echocardiographic parameters after
doxorubicin treatment with or without dabuzalgron (Ro 115-1240) 20
.mu.g/kg/d. HR LVIDd LVIDs FS LVd vol LVs vol IVSd PWd WILD TYPE
Dox + vehicle (14) 658 .+-. 30 2.9 .+-. 0.1 1.4 .+-. 0.1 54 .+-. 2
34 .+-. 4 5 .+-. 1 0.9 .+-. 0.sup. 0.8 .+-. 0.sup. Day 0 Day 7 613
.+-. 23 2.8 .+-. 0.1 1.5 .+-. 0.1 46 .+-. 2 31 .+-. 3 7 .+-. 2 0.9
.+-. 0.sup. 0.8 .+-. 0.sup. Dox + 1240 (14) 630 .+-. 59 3.0 .+-.
0.2 1.4 .+-. 0.1 50 .+-. 3 36 .+-. 6 5 .+-. 1 0.9 .+-. 0.1 0.9 .+-.
0.sup. Day 0 Day 7 667 .+-. 10* 2.8 .+-. 0.1 1.3 .+-. 0* 53 .+-. 1*
31 .+-. 2 5 .+-. 0* 0.9 .+-. 0.sup. 0.9 .+-. 0.sup. .alpha. 1A-KO
Dox + vehicle (3) 679 .+-. 38 3.0 .+-. 0.1 1.3 .+-. 0.0 55 .+-. 1
34 .+-. 2 5 .+-. 0 1.1 .+-. 0.1 1.1 .+-. 0.1 Day 0 Day 7 661 .+-.
21 3.0 .+-. 0.2 1.7 .+-. 0.1 43 .+-. 2 34 .+-. 4 9 .+-. 2 1.2 .+-.
0.0 1.1 .+-. 0.0 Dox + 1240 (3) 703 .+-. 13 2.8 .+-. 0.1 1.3 .+-.
0.1 54 .+-. 1 30 .+-. 3 4 .+-. 1 1.1 .+-. 0.0 1.1 .+-. 0.1 Day 0
Day 7 618 .+-. 19 2.8 .+-. 0.1 1.6 .+-. 0.0 42 .+-. 2 29 .+-. 2 8
.+-. 1 1.1 .+-. 0.0 1.1 .+-. 0.1 2D guided M-mode echocardiography
was performed on unanesthetized mice, n given in parentheses. All
values are mean .+-. SEM, *p < 0.05 vs. Dox + vehicle. FS =
Fractional Shortening (%); HR = Heart Rate (beats per minute); IVSd
= Interventricular Septal thickness, diastole (cm); LVd vol = Left
Ventricular diastolic volume (mL); LVs vol = Left Ventricular
systolic volume (mL); LVIDd = Left Ventricular Internal Diameter,
diastole (cm); LVIDs = Left Ventricular Internal Diameter, systole
(cm); LVm = LV mass, calculated; PWd = Posterior Wall, diastole
(cm).
Previous studies in rodents(20) and humans(21) have demonstrated
that .quadrature.1-AR activation increases inotropy in failing
heart tissue, though has minimal effects on contractility of the
uninjured heart. Conscious echocardiography on Day 7 after DOX
treatment in WT mice revealed a decrease in contractile function
that was prevented by administration of dabuzalgron. (FIG. 2B,
Table 3) Fractional shortening and left ventricular end systolic
volume both were preserved in animals that received dabuzalgron
after DOX, (Table 3) though dabuzalgron had no effect on
echocardiographic parameters in uninjured mice. There was no
difference in baseline contractile function of WT and AKO mice.
(FIG. 2B) However, the surviving DOX-treated AKO mice had
significantly lower fractional shortening than DOX-treated WT mice.
(p<0.01, FIG. 2B) This profound reduction in contractile
function was not rescued by dabuzalgron. (FIG. 2B) The burden of
fibrosis as detected by Masson Trichrome increased significantly
after DOX, (FIG. 2C) but treatment with dabuzalgron mitigated this
increase.
In summary, treatment with dabuzalgron preserved contractile
function and reduced fibrosis after DOX administration. AKO mice
treated with DOX had worse survival and more profoundly impaired
contractile function than WT mice. Neither parameter was affected
by dabulzagron in AKOs, indicating that the beneficial effects of
dabulzagron require the presence of the .alpha.1A.
Example 4
Dabuzalgron Preserves In Vivo Abundance of Mitochondrial Function
Transcripts, Upregulates PGC1.alpha., and Restores ATP Synthesis
after Treatment with Doxorubicin
To investigate the mechanisms behind dabuzalgron's cardioprotective
effects after DOX, we used RNAseq to analyze heart tissue from mice
treated with DOX with and without dabuzalgron. An omnibus test of
transcript abundance across all groups was performed with DESeq2
with groups encoded as categorical variables. One hundred-one genes
were identified as significant by meeting the q<0.05 threshold
(the set of genes with a 5% false discovery rate). Note, genes of
potential interest can be found in Table 4.
TABLE-US-00004 TABLE 4 Genes of potential interest Gene Base Mean
log2FoldChange lfcSE stat pvalue padj Cox7a1|12865 341 0.5 0.2 39.1
0 1.61E-06 Myl2|17906 28101 0.43 0.14 38.4 0 1.61E-06 Aqp1|11826
318 0.97 0.2 35.7 0 3.79E-06 Atp5k|11958 362 0.37 0.16 30.4 0
4.44E-05 Fhl2|14200 790 0.19 0.2 27.8 0 0.00011 Atp5j2|57423 337
0.36 0.17 27.7 0 0.00011 Cox7b|66142 421 0.58 0.16 28.3 0 0.00011
Cox6b1|110323 805 0.44 0.13 28.1 0 0.00011 Fabp4|11770 560 0 0.15
25.8 0 0.00021 Enah|13800 99 -0.72 0.22 25.7 0 0.00021 Gm12070 375
0.17 0.15 25.5 0 0.00022 Apoe|11816 197 -0.22 0.18 25.3 0 0.00023
Ttll1|319953 189 0.17 0.17 24.8 0 0.00028 Rrad|56437 84 -1.1 0.27
23.5 0 0.0005 Armc2|213402 142 0.09 0.19 23.2 0 0.00054 Fabp3|14077
3374 -0.14 0.16 22.9 0 0.00059 Actb|11461 194 0.31 0.22 21.8 0
0.00101 Atp5g1|11951 590 0.48 0.16 20.9 0 0.00152 Sesn1|140742 85
1.07 0.24 19.7 0.0001 0.00229 Tpm1|22003 27599 0.47 0.2 19.8 0.0001
0.00229 Gm12070|654472 4048 0.55 0.17 19.8 0.0001 0.00229
Ndufa4|17992 454 0.38 0.18 19.9 0 0.00229 Tmsb4x|19241 137 0.68
0.21 19.4 0.0001 0.00249 Myom2|17930 1191 0.48 0.22 19.3 0.0001
0.00252 Mtus2|77521 148 -0.41 0.19 18.9 0.0001 0.00297 Nr1d1|217166
84 -0.95 0.26 18.8 0.0001 0.00314 Ubc|22190 2230 0.65 0.16 18.6
0.0001 0.00324 Mylk4|238564 336 0.36 0.22 18.4 0.0001 0.00349
Ivns1abp|117198 1353 0.68 0.16 18.1 0.0001 0.00406 Eno3|13808 845
0.56 0.18 17.4 0.0002 0.00478 Actg1|11465 116 0.63 0.28 17.7 0.0001
0.00478 Myh14|71960 259 -0.36 0.21 17.5 0.0002 0.00478 Cox8b|12869
376 0.16 0.14 17.3 0.0002 0.00478 Pfkfb2|18640 282 0.67 0.2 17.6
0.0002 0.00478 Atp5o|28080 740 0.39 0.14 17.3 0.0002 0.00478
Rhobtb1|69288 157 0.63 0.2 17.5 0.0002 0.00478 Fam160b2|239170 176
0.46 0.2 17.3 0.0002 0.00479 Dgat2|67800 362 0.47 0.15 17.2 0.0002
0.00479 Ckmt2|76722 2127 0.42 0.21 17.2 0.0002 0.00479 Gapdh|14433
3001 0.49 0.17 16.9 0.0002 0.00544 Lrpprc|72416 274 0.14 0.16 16.8
0.0002 0.0056 Frmd5|228564 181 0.82 0.21 16.2 0.0003 0.00708
Atp2a2|11938 21514 0.3 0.19 16.2 0.0003 0.00708 Flot1|14251 139
-0.76 0.23 16.1 0.0003 0.00727 Casq2|12373 590 0.31 0.18 15.9
0.0003 0.00781 Acaa2|52538 588 0.26 0.2 15.4 0.0004 0.00945
Ttn|22138 2150 0.06 0.17 15.4 0.0005 0.00945 Hrc|15464 1924 0.24
0.13 15.4 0.0004 0.00945 Fkbp4|14228 283 0.18 0.2 15.5 0.0004
0.00945 Plec|18810 246 -0.71 0.2 15.3 0.0005 0.00969 Cox4i1|12857
1701 0.39 0.15 15.1 0.0005 0.01081 Ndufs2|226646 778 0.33 0.16 15
0.0006 0.011 Spag7|216873 203 0.3 0.18 14.9 0.0006 0.01128
Doc2g|60425 335 -0.31 0.2 14.9 0.0006 0.01128 Uqcrq|22272 230 -0.95
0.26 14.6 0.0007 0.01259 Klhl21|242785 285 0.41 0.23 14.3 0.0008
0.0141 Vegfa|22339 509 0.36 0.15 14.1 0.0009 0.01563 Ehd4|98878 268
-0.1 0.2 14.1 0.0009 0.01571 Rplp1|56040 121 -0.78 0.23 14 0.0009
0.01631 Uqcrh|66576 505 0.5 0.18 13.6 0.0011 0.01913 Polr2a|20020
191 -0.22 0.21 13.5 0.0012 0.02023 Ifngr2|15980 98 0.4 0.23 13.2
0.0014 0.02279 Adssl1|11565 121 -0.18 0.24 13.2 0.0014 0.02279
Ankrd23|78321 261 -0.62 0.25 13 0.0015 0.02419 Ncor2|20602 120
-0.61 0.22 13 0.0015 0.02419 Cpt2|12896 108 -0.14 0.24 12.8 0.0017
0.02657 Lamb2|16779 341 -0.26 0.15 12.6 0.0018 0.02714 Oxct1|67041
565 0.17 0.17 12.6 0.0018 0.02714 Tnnt2|21956 51047 0.45 0.13 12.7
0.0018 0.02714 Ndufa3|66091 174 0.23 0.17 12.5 0.0019 0.02827
Mef2d|17261 170 -0.66 0.19 12.5 0.0019 0.02839 Cox6c|12864 579 0.35
0.15 12.5 0.002 0.02856 Adck3|67426 332 0.09 0.14 12.2 0.0022
0.02983 Hspa5|14828 256 -0.63 0.18 12.3 0.0021 0.02983
Chchd10|103172 311 -0.67 0.24 12.3 0.0022 0.02983 Uba52|22186 267
0.58 0.19 12.2 0.0022 0.02983 Ndufv3|78330 253 0.23 0.18 12.3
0.0021 0.02983 Nme2|18103 155 0.49 0.18 12.2 0.0023 0.03034
Perp|64058 90 0.19 0.24 12.1 0.0024 0.03119 Tnni3|21954 14712 0.33
0.17 11.9 0.0026 0.0334 Pln|18821 9408 0.33 0.15 11.9 0.0026 0.0334
Atp1a1|11928 724 -0.43 0.14 11.9 0.0027 0.03361 Fyco1|17281 957
0.03 0.17 11.9 0.0027 0.03361 Ddrgk1|77006 132 0.23 0.22 11.8
0.0028 0.03365 Mb|17189 51394 0.36 0.2 11.8 0.0028 0.03365
Hspa8|15481 686 0.06 0.16 11.8 0.0028 0.03365 Prkar1a|19084 375
-0.41 0.17 11.6 0.003 0.03653 Idh3b|170718 504 0.31 0.15 11.4
0.0034 0.04026 D19Wsu162e|226178 142 0.42 0.2 11.4 0.0034 0.04026
Hk1|15275 162 -0.28 0.2 11.2 0.0036 0.04125 Cryab|12955 3327 0.14
0.15 11.2 0.0037 0.04125 Nfic|18029 168 -0.52 0.2 11.2 0.0036
0.04125 Atp5f1|11950 580 0.34 0.17 11.2 0.0037 0.04125 Tpt1|22070
420 0.42 0.24 11.2 0.0036 0.04125 Pdk4|27273 369 -2.22 0.72 11.2
0.0038 0.04154 Etfb|110826 728 0.33 0.14 10.8 0.0044 0.04746
Mdh1|17449 1465 0.23 0.15 10.8 0.0044 0.04746 Uqcrc2|67003 455 0.29
0.17 10.8 0.0045 0.04746 Sdhb|67680 590 0.19 0.17 10.9 0.0044
0.04746
Gene set analysis was performed based on the univariate statistics
calculated from DESeq2. (Table 5 and Table 6) Marked differences
were identified in numerous pathways related to mitochondrial
function, as seen in FIG. 3A.
TABLE-US-00005 TABLE 5 RNAseq pathways enriched with p value <
10.sup.-4 Genes Pathways P value in set
REACTOME_TCA_CYCLE_AND_RESPIRATORY_ELECTRON_TRANSPORT 7.68E-12 112
HALLMARK_OXIDATIVE_PHOSPHORYLATION 1.04E-11 194
MOOTHA_HUMAN_MITODB_6_2002 5.17E-11 407 MOOTHA_MITOCHONDRIA
2.04E-10 421
REACTOME_RESPIRATORY_ELECTRON_TRANSPORT_ATP_SYNTHESIS_BY_CHEMIOSMOTIC_COUP-
LING 3.20E-10 76 KAAB_HEART_ATRIUM_VS_VENTRICLE_DN 4.19E-10 245
KEGG_OLFACTORY_TRANSDUCTION 1.25E-09 233 MODULE_152 4.00E-09 120
PID_CD8_TCR_PATHWAY 5.69E-09 50 KEGG_PARKINSONS_DISEASE 9.16E-09
105 BIOCARTA_PML_PATHWAY 9.73E-09 16
REACTOME_RESPIRATORY_ELECTRON_TRANSPORT 1.12E-08 61
KEGG_OXIDATIVE_PHOSPHORYLATION 1.36E-08 106 MOOTHA_VOXPHOS 1.60E-08
83 BURTON_ADIPOGENESIS_6 2.09E-08 176 MODULE_62 3.31E-08 86
KEGG_ALZHEIMERS_DISEASE 4.12E-08 143 TERAO_AOX4_TARGETS_SKIN_UP
8.54E-08 32 REACTOME_DNA_REPAIR 9.42E-08 100 MOOTHA_PGC 1.06E-07
392 WONG_MITOCHONDRIA_GENE_MODULE 1.20E-07 212
HSIAO_HOUSEKEEPING_GENES 1.20E-07 357 MODULE_114 1.42E-07 309
MODULE_60 1.67E-07 380 RIBONUCLEOPROTEIN_BINDING 1.78E-07 12
KAMMINGA_EZH2_TARGETS 1.79E-07 39 MODULE_151 2.56E-07 292
STEIN_ESRRA_TARGETS_UP 2.64E-07 344 KEGG_HUNTINGTONS_DISEASE
2.70E-07 153 BIOCARTA_RELA_PATHWAY 3.01E-07 16 MITOCHONDRION
4.19E-07 315
HEMATOPOIETIN_INTERFERON_CLASSD200_DOMAIN_CYTOKINE_RECEPTOR_BINDING
4.32E-- 07 22 GNF2_ELAC2 6.36E-07 43 HALLMARK_MYOGENESIS 6.48E-07
190 POSITIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS
1.66E-06 54
REACTOME_TRANSPORT_OF_MATURE_MRNA_DERIVED_FROM_AN_INTRONLESS_TRANSCRIPT
1.- 71E-06 32 KEGG_REGULATION_OF_AUTOPHAGY 1.78E-06 34 GNF2_SPINK1
1.90E-06 11 CROONQUIST_IL6_DEPRIVATION_DN 2.51E-06 94
REACTOME_ANTIGEN_PROCESSING_UBIQUITINATION_PROTEASOME_DEGRADATION
3.05E-06- 189 ELVIDGE_HIF1A_AND_HIF2A_TARGETS_UP 3.07E-06 39
chr1q41 3.07E-06 26 REACTOME_HIV_INFECTION 3.36E-06 177
STEIN_ESRRA_TARGETS 3.83E-06 474 MODULE_6 4.11E-06 346
MOSERLE_IFNA_RESPONSE 4.32E-06 22 chr15q14 4.37E-06 34 MODULE_12
5.25E-06 326 BARRIER_COLON_CANCER_RECURRENCE_UP 6.39E-06 40
HALLMARK_FATTY_ACID_METABOLISM 6.65E-06 151 MODULE_1 7.47E-06 336
MODULE_5 8.08E-06 379 KEGG_CARDIAC_MUSCLE_CONTRACTION 8.54E-06 64
TGACCTY_V$ERR1_Q2 8.97E-06 891 SWEET_LUNG_CANCER_KRAS_DN 9.74E-06
395 HALLMARK_ADIPOGENESIS 1.03E-05 191 MODULE_93 1.03E-05 160
KIM_ALL_DISORDERS_OLIGODENDROCYTE_NUMBER_CORR_UP 1.08E-05 695
MODULE_83 1.14E-05 295 MODULE_2 1.26E-05 354
GSE1432_1H_VS_6H_IFNG_MICROGLIA_DN 1.42E-05 176
REACTOME_ASPARAGINE_N_LINKED_GLYCOSYLATION 1.65E-05 79 MORF_RAN
1.67E-05 256 GSE14000_TRANSLATED_RNA_VS_MRNA_DC_UP 1.88E-05 188
KEGG_FOLATE_BIOSYNTHESIS 1.93E-05 11
REACTOME_SYNTHESIS_OF_BILE_ACIDS_AND_BILE_SALTS 2.17E-05 18
WAGNER_APO2_SENSITIVITY 2.18E-05 19
REACTOME_NEP_NS2_INTERACTS_WITH_THE_CELLULAR_EXPORT_MACHINERY
2.46E-05 27 MODULE_38 2.75E-05 407 MARTINEZ_TP53_TARGETS_DN
2.82E-05 509 HUMMERICH_SKIN_CANCER_PROGRESSION_DN 2.99E-05 97
KIM_BIPOLAR_DISORDER_OLIGODENDROCYTE_DENSITY_CORR_UP 3.05E-05 625
BERENJENO_TRANSFORMED_BY_RHOA_DN 3.30E-05 365
PROTEIN_METHYLTRANSFERASE_ACTIVITY 3.55E-05 13
GSE10236_KLRG1INT_VS_KLRG1HIGH_EFF_CD8_TCELL_DN 3.69E-05 170
GSE7460_CD8_TCELL_VS_TREG_ACT_DN 3.73E-05 184
SULFOTRANSFERASE_ACTIVITY 3.73E-05 22
FLECHNER_BIOPSY_KIDNEY_TRANSPLANT_REJECTED_VS_OK_DN 3.81E-05 497
YOSHIMURA_MAPK8_TARGETS_UP 3.93E-05 1081
REACTOME_GPCR_DOWNSTREAM_SIGNALING 3.94E-05 549
S_ADENOSYLMETHIONINE_DEPENDENT_METHYLTRANSFERASE_ACTIVITY 4.05E-05
22 REGULATION_OF_IMMUNE_SYSTEM_PROCESS 4.35E-05 50 chr13q13
4.37E-05 20 YU_MYC_TARGETS_UP 4.39E-05 38 chr11p12 4.50E-05 11
BIOCARTA_CYTOKINE_PATHWAY 4.56E-05 11 STRUCTURAL_MOLECULE_ACTIVITY
4.69E-05 193 REACTOME_NEGATIVE_REGULATION_OF_FGFR_SIGNALING
4.81E-05 29 CYTOPLASMIC_PART 4.84E-05 1256 MORF_SOD1 5.17E-05 265
CHEOK_RESPONSE_TO_MERCAPTOPURINE_UP 5.41E-05 12 SUMI_HNF4A_TARGETS
5.56E-05 27 MARTINEZ_RB1_TARGETS_UP 5.75E-05 597 FEEDING_BEHAVIOR
5.98E-05 12 WEST_ADRENOCORTICAL_TUMOR_MARKERS_UP 6.06E-05 19
MODULE_77 6.39E-05 27 DNA_REPLICATION 6.53E-05 91
SHIN_B_CELL_LYMPHOMA_CLUSTER_9 6.56E-05 16
GSE24634_TEFF_VS_TCONV_DAY7_IN_CULTURE_UP 6.74E-05 175
CHEN_ETV5_TARGETS_TESTIS 6.76E-05 15 MODULE_22 6.94E-05 44
MCBRYAN_PUBERTAL_BREAST_4_5WK_DN 6.98E-05 180 GNF2_MYL3 7.22E-05 29
AGTCTTA, MIR-499 7.83E-05 64 PID_P38_ALPHA_BETA_PATHWAY 8.11E-05 31
WONG_ADULT_TISSUE_STEM_MODULE 8.14E-05 660 PID_TXA2PATHWAY 8.20E-05
54 KANG_DOXORUBICIN_RESISTANCE_UP 8.63E-05 50 MODULE_43 8.94E-05 91
MODULE_88 9.07E-05 672 MORF_ACTG1 9.12E-05 127
GSE17974_0H_VS_4H_IN_VITRO_ACT_CD4_TCELL_DN 9.29E-05 167 GNF2_MYL2
9.71E-05 30 REACTOME_ZINC_TRANSPORTERS 9.90E-05 13
REACTOME_NUCLEOTIDE_EXCISION_REPAIR 9.98E-05 46
TABLE-US-00006 TABLE 6 RNAseq pre-specified pathway analysis Genes
in Pathways P value set
REACTOME_TCA_CYCLE_AND_RESPIRATORY_ELECTRON_TRANSPORT 7.68E-12 112
HALLMARK_OXIDATIVE_PHOSPHORYLATION 1.04E-11 194
REACTOME_RESPIRATORY_ELECTRON_TRANSPORT_ATP_SYNTHESIS_BY_CHEMIOSMOTIC_COUP-
LING 3.20E-10 76 KAAB_HEART_ATRIUM_VS_VENTRICLE_DN 4.19E-10 245
REACTOME_RESPIRATORY_ELECTRON_TRANSPORT 1.12E-08 61 MOOTHA_PGC
1.06E-07 392 MITOCHONDRION 4.19E-07 315
HALLMARK_FATTY_ACID_METABOLISM 6.65E-06 151
KEGG_CARDIAC_MUSCLE_CONTRACTION 8.54E-06 64 YANG_BCL3_TARGETS_UP
0.000321895 323 STRUCTURAL_CONSTITUENT_OF_MUSCLE 0.000690522 29
REACTOME_FORMATION_OF_ATP_BY_CHEMIOSMOTIC_COUPLING 0.000834816 13
HALLMARK_HYPOXIA 0.00178533 183 REGULATION_OF_HEART_CONTRACTION
0.003647298 23 HALLMARK_P53_PATHWAY 0.013850996 188
KYNG_RESPONSE_TO_H2O2 0.017897901 65 MOOTHA_GLYCOLYSIS 0.026451641
18 HALLMARK_GLYCOLYSIS 0.033988771 191 KEGG_PPAR_SIGNALING_PATHWAY
0.035107916 63 KEGG_GLYCOLYSIS_GLUCONEOGENESIS 0.037928758 54
REACTOME_GLYCOLYSIS 0.056439728 23
KEGG_REGULATION_OF_ACTIN_CYTOSKELETON 0.065196891 194
CHEN_LVAD_SUPPORT_OF_FAILING_HEART_DN 0.07199588 38
FATTY_ACID_METABOLIC_PROCESS 0.11200352 57
NADH_DEHYDROGENASE_COMPLEX 0.116276143 14
ELECTRON_TRANSPORT_GO_0006118 0.142743659 48 BIOCARTA_P53_PATHWAY
0.257777775 16
Further analysis of transcripts within these mitochondrial pathways
revealed that DOX decreased the abundance of Complex I (42 genes)
and ATP synthase subunits (17 genes). (FIG. 3B) Treatment with
dabuzalgron restored expression of these gene sets and also
increased expression of Cytochrome C oxidase subunits (25 genes)
after DOX. Treatment with dabuzalgron in the absence of DOX
increased Complex I subunit abundance, but had no significant
effect on Cytochrome C or ATP synthase. (FIG. 3B). Many of the
genes encoding electron transport and other key mitochondrial
proteins are under transcriptional regulation by peroxisome
proliferator-activated receptor gamma coactivator 1-alpha.(22) We
found that DOX decreased PGC1.alpha. abundance in vivo, (FIG. 3C)
consistent with prior reports. (23) Treatment with dabuzalgron
increased PGC1.alpha. abundance in the hearts of mice treated with
either DOX or vehicle control. (FIG. 3C). To assess the functional
effect of these transcriptional differences, we assayed ATP content
in freshly harvested heart homogenates. DOX decreased ATP content
by 23.+-.7% compared to untreated hearts, consistent with previous
reports.(17) (FIG. 3D) Treatment with dabuzalgron restored ATP
content in the hearts of DOX-treated mice, but did not affect ATP
in uninjured mice. Using the highly selective MEK inhibitor,
trametinib, we found that inhibiting activation of ERK1/2 abrogated
dabuzalgron's beneficial effect on ATP synthesis after DOX.
Oxidative stress is central to the pathobiology of DOX
cardiotoxicity and arises in part from compromised mitochondrial
function.(24) To assess further the functional implications of
these transcriptional findings, we measured thiobarbituric acid
reactive substances (TBARS), in mouse heart tissue. TBARS, a
measure of lipid peroxidation, were more abundant in the hearts of
mice treated with DOX. Co-administration of dabuzalgron normalized
TBARS content. (FIG. 3E), In summary, dabuzalgron protected against
the reduction in transcripts related to mitochondrial function,
preserved ATP content, and reduced oxidative stress in the hearts
of mice treated with DOX. These beneficial effects may be mediated
by activation of ERK1/2 and upregulation of PGC1a.
To assess the functional effect of these transcriptional
differences, we assayed ATP content in freshly harvested heart
homogenates. DOX decreased ATP content by 23.+-.7% compared to
untreated hearts. (FIG. 3C) Treatment with dabuzalgron restored ATP
content in the hearts of DOX-treated mice, but did not affect ATP
in untreated mice.
In summary, dabuzalgron protected against the reduction in
transcripts related to mitochondrial function and preserved ATP
content in the hearts of mice treated with DOX.
Dabuzalgron protects neonatal rat ventricular myocytes from cell
death due to doxorubicin. ERK1/2 activation contributes to the
cardioprotective effects of dabuzalgron. Neonatal rat ventricular
myocytes (NRVMs) express the .alpha.1A and .alpha.1B subtypes, have
been used extensively to assess the effects of non-selective
.alpha.1-AR activation, and faithfully predict in vivo .alpha.1-AR
biology.(25,26) To test the effect of an .alpha.1A agonist on
uninjured NRVMs, we administered various concentrations of
dabuzalgron. After 15 minutes of treatment, we blotted NRVM lysates
for activation of ERK, (FIG. 4A) a canonical downstream signaling
partner of the .alpha.1A that mediates the cytoprotective effects
of .alpha.1A activation in vitro.(13) Dabuzalgron increased ERK
phosphorylation in a dose-dependent fashion with an EC50 of
4.8.times.10-7 M. (FIG. 4B) The pERK/ERK ratio was increased
roughly 1.5 fold after treatment with dabuzalgron 10 .mu.M, an
effect equivalent to norepinephrine (NE) 1 .mu.M (in the presence
of the non-selective .alpha.-AR blocker, propranolol 1 .mu.M).
(FIG. 4C). We then tested the role of ERK activation in
dabuzalgron's cardioprotective effects in vivo, using trametinib.
Trametinib (1 mg/kg by gavage once daily) almost completely
eliminated ERK activation. (FIG. 4D and FIG. 4E) DOX also reduced
ERK activation, consistent with previous reports.(27) Treatment
with dabuzalgron partially mitigated that effect but could not
restore ERK activation after trametinib. (FIG. 4D and FIG. 4E)
Co-administration of trametinib with DOX and dabuzalgron abrogated
dabuzalgron's protective effect on contractile function, (FIG. 4F)
suggesting that .alpha.1A-mediated positive inotropy requires ERK
activation.
To test the cytoprotective effects of an .alpha.1A agonist, we
treated NRVMs with DOX 204 in the presence and absence of
dabuzalgron 1004 then assayed apoptosis and cell death using
Annexin V-Fluos and propidium iodide (FIG. 5A). Four hour treatment
with DOX increased apoptosis (Annexin V staining), and necrotic
cell death (costaining with Annexin V and propidium iodide). (FIG.
5B) Concomitant treatment with dabuzalgron abrogated these effects.
Treatment with dabuzalgron in the absence of DOX did not change
Annexin V or propidium iodide staining when compared to untreated
cells.
Example 5
Dabuzalgron Regulates Activators of Apoptosis and Mitochondrial
Membrane Potential in Neonatal Rat Ventricular Myocytes
In light of our findings that treatment with dabuzalgron preserved
mitochondrial function in vivo and protected against cell death in
vitro after DOX exposure, we sought to explore the effect of
dabuzalgron on aspects of mitochondrial function in NRVMs.
Maintenance of mitochondrial membrane potential is essential to ATP
generation, and loss of membrane potential can contribute to
apoptosis by increasing cytochrome c release[24], leading to
activation of pro-apoptotic effectors. DOX interferes with the
cellular capacity to maintain mitochondrial membrane potential and
mitochondrial dysfunction contributes significantly to doxorubicin
cardiotoxicity.[25]
To test the effect of .alpha.1A activation on mitochondrial
membrane potential, we treated NRVMs with DOX 204 for 4 hours in
the presence of absence of dabuzalgron 10 .mu.M then stained with
the membrane permeant dye, JC-1. JC-1 exists as a green fluorescent
monomer at low mitochondrial membrane potential and a red
fluorescent aggregate at high mitochondrial membrane potential. DOX
led to a profound loss of mitochondrial membrane potential that was
partially rescued by coadministration of dabuzalgron. (FIGS.
6A-6C).
To examine the role of .alpha.1A-mediated mitochondrial protection
on DOX-induced apoptosis, we immunoblotted lysates from NRVMs for
cytochrome c and downstream effectors of apoptosis. DOX increased
cytochrome c release and caused cleavage of caspases and PARP,
suggesting that mitochondrial damage induced activation of the
intrinsic apoptosis pathway, consistent with previous
characterizations of doxorubicin cytotoxicity.[26]
Co-administration of dabuzalgron abrogated these changes (FIGS.
6A-6C).
In summary, activation of the .alpha.1A-AR with dabuzalgron
mitigated the detrimental effects of DOX on mitochondrial membrane
potential and abrogated the activation of important elements of the
apoptotic response to mitochondrial damage. These findings suggest
that preservation of mitochondrial function may underlie the
cytoprotective effects of .alpha.1A activation (FIGS. 5A-5B).
An important finding of this study is the demonstration that the
oral selective .alpha.1A-AR agonist, dabuzalgron, is protective
against anthracycline-induced cardiotoxicity. We chose to study
dabuzalgron because of its .alpha.1A subtype selectivity and the
fact that it was well tolerated in two large randomized clinical
trials. We found that its cardioprotective effect is mediated in
part through preservation of mitochondrial function, a mechanism
that has not been attributed previously to .alpha.1A
activation.
.alpha.1-ARs play central roles in cardiovascular biology. They are
best known for their roles in the vasculature, where .alpha.1-AR
activation promotes vasoconstriction. Though cardiac .alpha.1-ARs
are a minor AR subpopulation relative to .beta.1-ARs, they
contribute to numerous important processes in the heart.[27] At
high doses, non-selective .alpha.1-AR agonists such as
phenylephrine and norepinephrine increase BP experimentally and
clinically. Importantly, subpressor doses of non-selective
.alpha.1-AR agonist can cause cardiac hypertrophy, indicating a
direct and load-independent effect.[28] In this study, we found no
effect on BP or HR in mice treated with a range of dabuzalgron
doses. We chose to use 10 .mu.g/kg for subsequent experiments
because this dose had no effect on BP in either pigs or rabbits[9]
when dabuzalgron was under development. These findings mirror the
published human experience with dabuzalgron as a potential
treatment for urinary incontinence, wherein administration of 1.5
mg by mouth twice daily did not alter BP or HR.[10]
We also found that activation of the .alpha.1A did not cause
myocardial hypertrophy, consistent with various genetically altered
.alpha.1A mouse models. We show here that mice lacking the
.alpha.1A on a congenic C57Bl6 background have normal heart size,
consistent with the .alpha.1AKO mouse on a mixed background.[29]
Heart size also is normal in mice with global and cardiac-specific
.alpha.1A overexpression.[4-6] Mice lacking both myocardial al
subtypes (.alpha.1ABKO) have small hearts, as do mice lacking the
.alpha.1B on a congenic background.[30] Collectively, these
findings suggest that cardiomyocyte hypertrophy induced by
non-selective .alpha.1-AR agonists is mediated by the .alpha.1B
subtype.
.alpha.1-ARs are best known as vascular receptors, where
.alpha.1-AR activation promotes vasoconstriction. At high doses,
non-selective .alpha.1-AR agonists such as phenylephrine increase
BP experimentally and clinically. In this study, we found no effect
on BP or HR in mice treated with a range of dabuzalgron doses. We
chose to use 10 .mu.g/kg for subsequent experiments because Roche
studied this dose in pigs and rabbits.(10) Our findings mirror the
published human experience with dabuzalgron as a treatment for
urinary incontinence, wherein administration of 1.5 mg by mouth
twice daily did not alter BP or HR. ((11) and roche-trials.com)
Though cardiac .alpha.1-ARs are a minor AR subpopulation relative
to .alpha.1-ARs, they contribute to numerous important processes in
the heart.(26) Subpressor doses of non-selective .alpha.1-AR
agonist also can cause cardiac hypertrophy, indicating a direct and
load-independent effect on the heart.(30) We found that activation
of the .alpha.1A did not cause myocardial hypertrophy, consistent
with the fact that heart size is normal in mice with global and
cardiac-specific .alpha.1A overexpression.(4-6) .alpha.1AKO mice on
a congenic C57Bl6 background also have normal heart size and blood
pressure. Mice lacking both myocardial al subtypes (.alpha.1ABKO)
have small hearts.(31) Collectively, these findings suggest the
.alpha.1B subtype mediates cardiomyocyte hypertrophy induced by
non-selective .alpha.1-AR agonists.
We found that oral administration of a subpressor dose of
dabuzalgron protected WT mice against DOX cardiotoxicity. This
beneficial effect was absent in AKO mice, indicating that
dabuzalgron's adaptive effects result from on-target activation of
the .alpha.1A. High mortality and very poor contractile function in
DOX-treated AKO mice further reinforce the cardioprotective
function of the .alpha.1A-AR. Though other labs have used
transgenic overexpression of the .alpha.1A to identify
cardioprotective effects, ours is the first study to demonstrate
greater susceptibility to cardiac injury in AKO mice. As such, we
present evidence supporting adaptive functions for cardiac
.alpha.1A-ARs using both novel pharmacological gain-of-function and
novel genetic loss-of-function approaches.
The function of .alpha.1-ARs in cardiomyocyte mitochondria has not
been explored to any significant extent previously. In our study,
dabuzalgron protected against DOX-induced apoptosis and necrosis in
NRVMs and decreased levels of intrinsic apoptotic effectors,
suggesting that this benefit may be associated with preservation of
mitochondrial integrity and function. Analysis of our RNAseq
results showed rescue of pathways associated with mitochondrial
function and metabolism after therapeutic .alpha.1A activation, a
previously unrecognized mechanism for .alpha.1A activity. Treatment
with DOX diminished transcript abundance within these pathways,
whereas co-administration of dabuzalgron restored expression of
Complex I, Cytochrome c oxidase, and ATP synthase genes. Treatment
with dabuzalgron abrogated the DOX-induced reduction in myocardial
ATP levels, indicating functional significance of the
transcriptional changes. Though we cannot exclude a contribution
from other cell types to these findings, they seem most likely to
represent changes in cardiomyocytes as the .alpha.1A is not
expressed on non-myocytes in the heart.(32)
We show that dabuzalgron activates ERK, a canonical downstream
signaling partner of the .alpha.1A in NRVMs, and partially restores
ERK activation in the hearts of mice treated with DOX. Using the
highly selective MEK inhibitor, trametinib, we demonstrate that ERK
phosphorylation is important for dabuzalgron's protective effects
on inotropy and ATP synthesis. ERK activation was found to be
critical to .alpha.1A-mediated cytoprotection in previous work
using adenoviral constructs in vitro,(13) but our experiments are
the first to show ERK activation in vivo by an .alpha.1A agonist.
Interestingly, dabuzalgron-mediated cardioprotection does not
require full restoration of ERK activation to levels seen in
uninjured heart. Given the broad cellular effects of DOX, it is
possible that DOX impairs ERK activation through multiple pathways,
not all of which are modified by .alpha.1A activation. .alpha.1-ARs
can activate ERK through multiple pathways, both PKC-dependent (33)
and PKC-independent,(34) suggesting signaling resilience.
Furthermore, .alpha.1A activation might mitigate the adverse
effects of DOX on abundance of activated ERK by targeting activated
ERK to caveolae, where its function is enhanced, as shown
previously in vitro.(35,36)
We administered 20 mg/kg of DOX intraperitoneally, a dose that
allometrically scales to roughly 60 mg/m2 in humans
(fda.gov/downloads/Drugs/Guidances/UCM078932.pdf). Though this
scaled dose is at the upper limit of the typical range for
treatment of breast cancer and lymphoma, the observed mortality in
our studies is out of proportion to the insult to cardiac function,
suggesting that mice may suffer non-cardiac toxicities at this dose
that are not fully representative of the human response. The
pathogenesis and signaling associated with acute DOX cardiotoxicity
likely are distinct from chronic DOX cardiomyopathy and the
contribution of oxidative stress in this model may be
disproportionately represented.
Chronic cardiomyopathy is the most significant source of
DOX-associated cardiac morbidity, however, numerous studies
indicate that acute DOX cardiotoxicity is more common than
previously thought (11%(37)-21%(38)) and predicts poor outcomes. In
one recent study, 32% of subjects had elevated TnI acutely after
DOX. Ejection fraction (EF) dropped measurably in most subjects by
3 months and early +TnI predicted durable reduction in EF.(39) In a
follow-up study, the authors found that early institution of
evidence-based HF therapy protected against chronic anthracycline
cardiomyopathy.(40) Collectively, these findings suggest that acute
DOX cardiotoxicity may be a clinically meaningful and actionable
entity.
Dabuzalgron protected against DOX-induced apoptosis and necrosis in
NRVMs and decreased levels of cytochrome c and intrinsic apoptotic
effectors, suggesting that this benefit may be associated with
preservation of mitochondrial integrity and function.
Interestingly, previous studies have linked non-selective
.alpha.1-AR activation to generation of reactive oxygen
species,[31,32] though .alpha.1-ARs clearly are protective against
cardiac insults that induce oxidative stress such as
ischemia-reperfusion, myocardial infarction, and doxorubicin. [27]
As such, it is possible that the effects of myocardial .alpha.1s
are dependent on subtype, context, and dose.
Mitochondrial dysfunction and impaired cardiomyocyte energetics are
central to the pathobiology of HF regardless of etiology. [34]
Unlike .beta.-ARs, which are downregulated and dysfunctional, the
abundance of .alpha.1A is maintained or increased in failing human
heart tissue.[36, 37] The prospect of using a non-selective
.alpha.1-AR agonist to treat HF is intuitively unappealing, given
the effects on vascular tone at commonly used doses. Long-term
systemic 2-fold overexpression of the .alpha.1A is associated with
prolonged lifespan, decreased cancer incidence,[40] and improved
cognition.[41]
Example 6
Methods and Experimental Setup
Verification of Dabuzalgron Chemical Structure.
Dabuzalgron was synthesized per published chemical structure.1 The
purity (>95%) and identity of the compound were confirmed by
nuclear magnetic resonance (NMR) spectrum and mass spectrum (MS).
1H NMR spectrum was acquired on a Varian Mercury spectrometer with
400 MHz for proton. MS data was acquired in positive ion mode using
an Agilent 6110 single quadrupole mass spectrometer with an
electrospray ionization (ESI) source.
Animals.
C57Bl6J mice were from Jackson Laboratory or from our breeding
colony. .alpha.1A-AR knockout (AKO) mice from Paul C. Simpson were
congenic on a C57Bl6J background for at least 10 generations and
produced by heterozygous breeding in our animal facility. 8-12 week
old males were used in all experiments. Female Sprague-Dawley rats
with newborn litters were from Charles River. Animal care and
experimental protocols were approved by the UNC IACUC and complied
with Guide for the Care and the use of Laboratory Animals (National
Research Council Committee for the Update of the Guide for the Care
and Use of Laboratory Animals, 2011).
Tail Cuff Blood Pressure Measurement:
Tail cuff blood pressure (BP) and heart rate (HR) were obtained on
awake mice by repeated measurements using a CODA Volume Pressure
Recording tail cuff system (Kent Scientific).2 Mice were trained to
the apparatus for 5 days prior to data collection. Systolic BP and
HR measurements represent the average of at least 20 tail cuff
inflations per mouse each afternoon.
Doxorubicin injection; dabuzalgron and trametinib gavage: Mice were
trained with 3 days handling then on Day 0 mice underwent
echocardiography. On Day 1, mice underwent intraperitoneal (i.p.)
injection with DOX 20 mg/kg or saline vehicle using a 0.5 cc
insulin syringe. On Days 1 through 7, mice received dabuzalgron
10.quadrature.g/kg or saline by gavage (Kent #FNC20-1.5) in volume
of 1% of weight twice daily. Some mice received trametinib
(Selleck) 1 mg/kg by gavage once daily either alone or in
combination with doxorubicin or dabuzalgron. On Day 7, mice
underwent echocardiography and were sacrificed by cervical
dislocation after an overdose of isoflurane.
Quantitative Reverse Transcriptase PCR (qRT-PCR):
Total RNA was isolated from cells and tissue (QiagenRNeasy Plus
mini kit #74134) and analyzed using a NanoDrop (ThermoScientific).
For qRT-PCR, one .quadrature.g of RNA was reverse transcribed using
High Capacity cDNA Reverse Transcription Kit (Life Technologies
#4368814). Two step qRT-PCR reactions contained 2% of the cDNA
product. All reactions were performed in triplicate in a Roche 480
Light Cycler. Relative quantitation of PCR products used the
.DELTA..DELTA.Ct method relative to two validated reference genes
(Tbp and Polr2a). Similar efficiencies were confirmed for all
primers. All probes and primers were from Roche.
TABLE-US-00007 qRT-PCR primers: Reference genes: Tbp mouse F:
ggcggtttggctaggttt; (SEQ ID NO: 1) R: gggttatcttcacacaccatga; (SEQ
ID NO: 2) UPL Probe # 107; rat F: ggggagctgtgatgtgaagt; (SEQ ID NO:
3) R: ccaggaaataattctggctcata; (SEQ ID NO: 4) UPL Probe # 97;
Polr2a mouse F: aatccgcatcatgaacagtg; (SEQ ID NO: 5) R:
tcatcatccattttatccacca; (SEQ ID NO: 6) UPL Probe # 69; rat: F:
ttcggctcagtggagagg; (SEQ ID NO: 7) R: gctcccaccatttctccag; (SEQ ID
NO: 8) UPL Probe # 71. Target genes: Alpha 1A-AR mouse F:
attgtggtgggatgcttcgtcct; (SEQ ID NO: 9) R:
tgtttccggtggcttgaaattcgg; (SEQ ID NO: 10) UPL Probe # 105; rat F:
ggttgcttcgtcctctgct; (SEQ ID NO: 11) R: gaaatccgggaagaaagacc; (SEQ
ID NO: 12) UPL Probe # 105; ANF mouse F: cacagatctgatggatttcaaga;
(SEQ ID NO: 13) R: cctcatcttctaccggcatc; (SEQ ID NO: 14) UPL Probe
# 25; rat F: cacagatctgatggatttcaaga; (SEQ ID NO: 15) R:
cctcatcttctaccggcatc; (SEQ ID NO: 16) UPL Probe # 25; skAct mouse
F: cctgccatgtatgtggctatc; (SEQ ID NO: 17 R: ccagaatccaacacgatgc;
(SEQ ID NO: 18) UPL Probe # 56; rat F: tgaagcctcacttcctaccc; (SEQ
ID NO: 19) R: cgtcacacatggtgtctagtttc; (SEQ ID NO: 20) UPL Probe #
81; MHC-beta mouse F: ctgcaggacctggtggac; (SEQ ID NO: 21) R:
ggaacttggacaggttggtg; (SEQ ID NO: 22) UPL Probe # 64; rat F:
ctccacgcaccctcactt; (SEQ ID NO: 23) R: catgaccagggggttgtc; (SEQ ID
NO: 24) UPL Probe # 80; PGC1-alpha mouse F: agcctgcgaacatatttgaga;
(SEQ ID NO: 25) R: atgagggcaatccgtcttc; (SEQ ID NO: 26) UPL probe #
47; rat F: gcagtcgcaacatgctca; (SEQ ID NO: 27) R:
gggtcatttggtgactctgg; (SEQ ID NO: 28) UPL probe # 6.
Mouse Echocardiography:
Conscious transthoracic echocardiography was performed on loosely
restrained mice in the McAllister Heart Institute Animal Models
Core using a VisualSonics Vevo 2100 ultrasound system
(VisualSonics, Inc., Toronto, Ontario, Canada). Two-dimensional and
M-mode echocardiography were performed in the parasternal long-axis
view at the level of the papillary muscle. Left ventricular
systolic function was assessed by fractional shortening (%
FS=[(LVEDD-LVESD)/LVEDD].times.100). Reported values represent the
average of at least five cardiac cycles per mouse. Sonographers and
investigators were blinded to mouse treatment condition during
image acquisition and analysis.
Mouse Heart Histology:
Mice were heparinized and the heart was perfused with 10 mL PBS
followed by 20 mL of 4% PFA/PBS through a 23 G butterfly needle,
excised and placed in 4% PFA/PBS for 24 hours then transferred to
70% EtOH. Hearts were stained using standard methods in the UNC
Histology Research Core. Fibrosis was analyzed in 3 Masson
Trichrome (MT)-stained sections of 4 or 5 hearts from each
treatment group. Slides were scanned using an Aperio ScanScope
(Aperio Technologies, Vista, Calif.) and analyzed in Aperio
ImageScope software. The Algorithm Positive Pixel Count v9 was used
to measure collagen staining by MT using hue value (0.66) and hue
width (0.1) The N positive/N total value was used to determine a
weighted average collagen content (%) for each section.
RNAseq:
RNAseq was performed at the Carolina Center for Genome Sciences
High Throughput Sequencing Facility. Libraries were prepared using
an Illumina RNA TruSeq kit for total RNA. Single read sequencing
(1.times.100) was performed on an Illumina HiSeq 2000 system.
QC-passed reads were aligned to the mouse reference genome (mm9)
using MapSplice.3 The alignment profile was determined by Picard
Tools v1.64 (broadinstitute.github.io/picard/). Aligned reads were
sorted and indexed using SAMtools and translated to transcriptome
coordinates then filtered for indels, large inserts, and zero
mapping quality using UBU v1.0 (github.com/mozack/ubu). Transcript
abundance estimates for each sample were performed using RSEM, an
expectation-maximization algorithm4 using the UCSC knownGene
transcript and gene definitions. Raw RSEM read counts for all
RNAseq samples were normalized to the overall upper quartile.5 Gene
level differential expression testing was performed using the
method of Love et al. (2014) implemented in the R package DESeq2.
Gene set level tests were performed using the method of Efron and
Tibshirani (2006) and gene sets as defined in the molecular
signatures database, mSigdb.6 .GEO accession number is pending.
ATP Activity Assay:
Mouse hearts were removed and immediately processed for
luciferin-luciferase ATP assay (ThermoFisher Scientific A22066)
according to manufacturer instruction. Tissue was homogenized and
heated at 95 C for 7 minutes, centrifuged at 14000 rpm for 5
minutes. Total protein in the supernatant was quantified using the
Bradford Assay (Pierce #23200). Luminescence was measured at 560
nm.
NRVM Isolation and Culture:
Female Sprague-Dawley rats were from Charles River. NRVMs were
isolated as previously described.7 Briefly, hearts from 1-2 day old
rat pups were minced, digested serially in collagenase
(Worthington)-containing solution, filtered, then pre-plated to
exclude non-myocyotes. NRVMs were then plated on laminin-coated
dishes in DMEM with 5% fetal bovine serum (Sigma F2442) for 24
hours. Experiments were carried out after 36-96 hours of serum
starvation in the presence of insulin, transferrin, and BrdU.
ERK Activation in NRVMs:
Serum-starved NRVMs were treated for 15 minutes with adrenergic
agonists and antagonists then lysed rapidly on ice in RIPA buffer
containing protease (Sigma P8340) and phosphatase inhibitors (Roche
PhosSTOP #04906837001). Lysates were flash frozen and stored at -80
C.
Annexin V-Fluos:
After 36 h serum starvation, NRVMs were treated with DOX
2.quadrature.M or vehicle in the presence and absence of
dabuzalgron 10.quadrature.M for 4 hrs. Cells were washed with cold
PBS two times then incubated with 200 .mu.l binding buffer (10 mM
HEPES, 140 mM NaCl, and 2.5 mM CaCl2, pH 7.4) including 10 .mu.L
fluorescein isothiocyanate (FITC)-labeled Annexin V, 2 .mu.L
propidium iodide (PI) and 1 .mu.g/mL Hoechst 33342 (Molecular
Probes, USA) for 15 min at room temperature. They were examined
under a epifluorescence microscopy (Olympus IX81 Inverted Light
Microscope, UNC Microscopy Core). Images were analyzed using Image
J software. The experiment was carried out three independent times
with duplicates of each treatment condition. An average of 352
nuclei were counted in an average of 6 microscopic fields per
experiment.
Mitochondrial membrane potential: Mitochondrial membrane potential
in NRVMs was determined by 5, 5', 6, 6'-tetrachloro-1, 1', 3,
3'-tetraethylbenzimidazolylcarbocyanine iodide (JC-1) reduction.
Cells were stained with JC-1 (Mitoprobe, Cayman Chemical Company)
according to the manufacturer's protocol. In brief, serum-starved
NRVMs were treated with DOX or vehicle in the presence or absence
of dabuzalgron. JC-1 2 .mu.M was added to each for 30 min. Cells
were washed once with medium then analyzed by plate reader
(CLARIOstar, BMG LABTECH, Germany). JC-1 green fluorescence was
excited at 488 nm and emission was detected using a 530.+-.40 nm
filter. JC-1 red fluorescence was excited at 488 nm and emission
was detected using a 613.+-.20 nm filter.
Immunoblotting and Antibodies:
Homogenized tissue or cells were lysed in RIPA buffer with protease
and phosphatase inhibitor (as above) and the lysate was passed
through a Qiashredder. Equal protein abundance was assured with the
Bradford assay (tissue lysates) or equal cell number (NRVMs).
Samples were run for 2 hours at 140 v on ice on a Novex NuPAGE
4-12% Bis-Tris gel then transferred to a PVDF membrane at 90V for 1
hour on ice. Membranes were blocked in 5% milk at room temperature
for 1 hour. We used Cell Signaling kit #9100 (pERK Thr202/Tyr204
1:250, ERK 1:1000, anti-rabbit HRP 1:1000). BID: (Santa Cruz,
SC-11423); Cytochrome C: (Santa Cruz, SC-13560); AIF: (Santa Cruz,
SC-13116); Caspase 8: (MBL international corporation, JM-3020-100);
PARP: (Cell Signaling, #9532); Caspase 3: (Cell Signaling, #9665);
Cleaved caspase 3: (Cell Signaling, #9664)
Drugs:
Dabuzalgron was synthesized. We also used norepinephrine (Sigma
#N5785), propranolol (Sigma P-8688), DOX (Tocris #2252), and
trametinib (Selleck S2673).
Statistics:
All results are presented as mean.+-.SEM. Comparisons were made
using t-test (groups of 2) or one-way ANOVA (groups of 3) with
Tukey's post-hoc analysis (GraphPad Prism). EC50 for ERK activation
was calculated using sigmoidal dose-response analysis (Prism).
REFERENCES
1. O'Connell T D, Jensen B C, Baker A J, Simpson P C. Cardiac
alpha1-adrenergic receptors: Novel aspects of expression, signaling
mechanisms, physiologic function, and clinical importance.
Pharmacological reviews. 2014; 66:308-333. 2. Turnbull L, McCloskey
D T, O'Connell T D, Simpson P C, Baker A J. Alpha 1-adrenergic
receptor responses in alpha 1ab-ar knockout mouse hearts suggest
the presence of alpha 1d-ar. Am J Physiol Heart Circ Physiol. 2003;
284:H1104-1109 3. Jensen B, Swigart P, Laden M-E, DeMarco T, Hoopes
C, Simpson P. The alpha-1d is the predominant alpha-1-adrenergic
receptor in human epicardial coronary arteries. JACC. 2009;
54:1137-1145 4. Lin F, Owens W A, Chen S, Stevens M E, Kesteven S,
Arthur J F, Woodcock E A, Feneley M P, Graham R M. Targeted
alpha(1a)-adrenergic receptor overexpression induces enhanced
cardiac contractility but not hypertrophy. Circ Res. 2001;
89:343-350. 5. Rorabaugh B R, Ross S A, Gaivin R J, Papay R S,
McCune D F, Simpson P C, Perez D M. Alpha1a--but not
alpha1b-adrenergic receptors precondition the ischemic heart by a
staurosporine-sensitive, chelerythrine-insensitive mechanism.
Cardiovasc Res. 2005; 65:436-445. 6. Du X J, Gao X M, Kiriazis H,
Moore X L, Ming Z, Su Y, Finch A M, Hannan R A, Dart A M, Graham R
M. Transgenic alpha1a-adrenergic activation limits post-infarct
ventricular remodeling and dysfunction and improves survival.
Cardiovasc Res. 2006; 71:735-743. 7. Du X J, Fang L, Gao X M,
Kiriazis H, Feng X, Hotchkin E, Finch A M, Chaulet H, Graham R M.
Genetic enhancement of ventricular contractility protects against
pressure-overload-induced cardiac dysfunction. J Mol Cell Cardiol.
2004; 37:979-987. 8. ALLHAT CRG. Major cardiovascular events in
hypertensive patients randomized to doxazosin vs chlorthalidone:
The antihypertensive and lipid-lowering treatment to prevent heart
attack trial (allhat). [see comments]. Jama. 2000; 283:1967-1975.
9. Blue D R, Daniels D V, Gever J R, Jett M F, O'Yang C, Tang H M,
Williams T J, Ford A P. Pharmacological characteristics of ro
115-1240, a selective alpha1a/11-adrenoceptor partial agonist: A
potential therapy for stress urinary incontinence. BJU
international. 2004; 93:162-170. 10. Musselman D M, Ford A P,
Gennevois D J, Harbison M L, Laurent A L, Mokatrin A S, Stoltz R R,
Blue D R. A randomized crossover study to evaluate ro 115-1240, a
selective alpha1a/11-adrenoceptor partial agonist in women with
stress urinary incontinence. BJU international. 2004; 93:78-83. 11.
Chan T, Dash R, Simpson P. An alpha-1a-adrenergic receptor subtype
agonist prevents cardiomyopathy without increasing blood pressure
(abstract). Circulation. 2008; in press. 12. Huang Y, Wright C D,
Merkwan C L, Baye N L, Liang Q, Simpson P C, O'Connell T D. An
alpha1a-adrenergic-extracellular signal-regulated kinase survival
signaling pathway in cardiac myocytes. Circulation. 2007;
115:763-772. 13. Dash R, Chung J, Chan T, Yamada M, Banal J,
Nishimura D, Yang P C, Simpson P C. A molecular mri probe to detect
treatment of cardiac apoptosis in vivo. Magnetic resonance in
medicine. 2011; 66:1152-1162. 14. van der Pal H J, van Dalen E C,
Hauptmann M, Kok W E, Caron H N, van den Bos C, Oldenburger F,
Koning C C, van Leeuwen F E, Kremer L C. Cardiac function in 5-year
survivors of childhood cancer: A long-term follow-up study.
Archives of internal medicine. 2010; 170:1247-1255. 15. Bloom M W,
Hamo C E, Cardinale D, Ky B, Nohria A, Baer L, Skopicki H, Lenihan
D J, Gheorghiade M, Lyon A R, Butler J. Cancer therapy-related
cardiac dysfunction and heart failure: Part 1: Definitions,
pathophysiology, risk factors, and imaging. Circ Heart Fail. 2016;
9:e002661. 16. Tokarska-Schlattner M, Zaugg M, Zuppinger C,
Wallimann T, Schlattner U. New insights into doxorubicin-induced
cardiotoxicity: The critical role of cellular energetics. J Mol
Cell Cardiol. 2006; 41:389-405. 17. Bishop M J. Recent advances in
the discovery of alpha1-adrenoceptor agonists. Curr Top Med Chem.
2007; 7:135-145. 18. Krege J H, Hodgin J B, Hagaman J R, Smithies
O. A noninvasive computerized tail-cuff system for measuring blood
pressure in mice. Hypertension. 1995; 25:1111-1115. 19. Wang K,
Singh D, Zeng Z, Coleman S J, Huang Y, Savich G L, He X,
Mieczkowski P, Grimm S A, Perou C M, MacLeod J N, Chiang D Y, Prins
J F, Liu J. Mapsplice: Accurate mapping of rna-seq reads for splice
junction discovery. Nucleic acids research. 2010; 38:e178. 20. Li
B, Dewey C N. Rsem: Accurate transcript quantification from rna-seq
data with or without a reference genome. BMC bioinformatics. 2011;
12:323. 21. Bullard J H, Purdom E, Hansen K D, Dudoit S. Evaluation
of statistical methods for normalization and differential
expression in mrna-seq experiments. BMC bioinformatics. 2010;
11:94. 22. Subramanian A, Tamayo P, Mootha V K, Mukherjee S, Ebert
B L, Gillette M A, Paulovich A, Pomeroy S L, Golub T R, Lander E S,
Mesirov J P. Gene set enrichment analysis: A knowledge-based
approach for interpreting genome-wide expression profiles. Proc
Natl Acad Sci USA. 2005; 102:15545-15550. 23. Simpson P, Savion S.
Differentiation of rat myocytes in single cell cultures with and
without proliferating nonmyocardial cells. Cross-striations,
ultrastructure, and chronotropic response to isoproterenol. Circ
Res. 1982; 50:101-116. 24. Gottlieb E, Armour S M, Harris M H,
Thompson C B. Mitochondrial membrane potential regulates matrix
configuration and cytochrome c release during apoptosis. Cell Death
Differ. 2003; 10:709-717 25. Varga Z V, Ferdinandy P, Liaudet L,
Pacher P. Drug-induced mitochondrial dysfunction and
cardiotoxicity. Am J Physiol Heart Circ Physiol. 2015;
309:H1453-1467. 26. Suliman H B, Carraway M S, Ali A S, Reynolds C
M, Welty-Wolf K E, Piantadosi C A. The co/ho system reverses
inhibition of mitochondrial biogenesis and prevents murine
doxorubicin cardiomyopathy. J Clin Invest. 2007; 117:3730-3741. 27.
Jensen B C, O'Connell T D, Simpson P C. Alpha-1-adrenergic
receptors in heart failure: The adaptive arm of the cardiac
response to chronic catecholamine stimulation. J Cardiovasc
Pharmacol. 2014; 63:291-301. 28. Patel M B, Stewart J M, Loud A V,
Anversa P, Wang J, Fiegel L, Hintze T H. Altered function and
structure of the heart in dogs with chronic elevation in plasma
norepinephrine. Circulation. 1991; 84:2091-2100. 29. Rokosh D G,
Simpson P C. Knockout of the a1a/c-adrenergic receptor subtype: The
a1a/c is expressed in resistance arteries and is required to
maintain arterial blood pressure. Proc Natl Acad Sci USA. 2002;
99:9474-9479. 30. Rodrigo M C, Joho S, Swigart P M, Foster E,
O'Connell T D, Grossman W, Simpson P. The alpha-1-b adrenergic
receptor subtype is required for physiological cardiac hypertrophy
in normal development (abstract). Circulation. 2005; 112:123. 31.
Amin J K, Xiao L, Pimental D R, Pagano P J, Singh K, Sawyer D B,
Colucci W S. Reactive oxygen species mediate alpha-adrenergic
receptor-stimulated hypertrophy in adult rat ventricular myocytes.
J Mol Cell Cardiol. 2001; 33:131-139. 32. Guo J, Gertsberg Z, Ozgen
N, Steinberg S F. P66shc links alpha1-adrenergic receptors to a
reactive oxygen species-dependent akt-foxo3a phosphorylation
pathway in cardiomyocytes. Circ Res. 2009; 104:660-669 33.
Cardinale D, Colombo A, Bacchiani G, Tedeschi I, Meroni C A, Veglia
F, Civelli M, Lamantia G, Colombo N, Curigliano G, Fiorentini C,
Cipolla C M. Early detection of anthracycline cardiotoxicity and
improvement with heart failure therapy. Circulation. 2015;
131:1981-1988. 34. Rosca M G, Tandler B, Hoppel C L. Mitochondria
in cardiac hypertrophy and heart failure. J Mol Cell Cardiol. 2013;
55:31-41. 35. Jensen B C, O'Connell T D, Simpson P C.
Alpha-1-adrenergic receptors: Targets for agonist drugs to treat
heart failure. J Mol Cell Cardiol. 2011; 51:518-528. 36. Jensen B
C, Swigart P M, De Marco T, Hoopes C, Simpson P C. {alpha}
1-adrenergic receptor subtypes in nonfailing and failing human
myocardium. Circ Heart Fail. 2009; 2:654-663. 37. Bristow M R,
Minobe W, Rasmussen R, Hershberger R E, Hoffman B B. Alpha-1
adrenergic receptors in the nonfailing and failing human heart. J
Pharmacol Exp Ther. 1988; 247:1039-1045. 38. Zakir R M, Folefack A,
Saric M, Berkowitz R L. The use of midodrine in patients with
advanced heart failure. Congest Heart Fail. 2009; 15:108-111. 39.
Chaulet H, Lin F, Guo J, Owens W A, Michalicek J, Kesteven S H,
Guan Z, Prall O W, Mearns B M, Feneley M P, Steinberg S F, Graham R
M. Sustained augmentation of cardiac alpha1a-adrenergic drive
results in pathological remodeling with contractile dysfunction,
progressive fibrosis and reactivation of matricellular protein
genes. J Mol Cell Cardiol. 2006; 40:540-552. 40. Collette K M, Zhou
X D, Amoth H M, Lyons M J, Papay R S, Sens D A, Perez D M, Doze V
A. Long-term alpha1b-adrenergic receptor activation shortens
lifespan, while alpha1a-adrenergic receptor stimulation prolongs
lifespan in association with decreased cancer incidence. Age. 2014;
36:9675. 41. Doze V A, Papay R S, Goldenstein B L, Gupta M K,
Collette K M, Nelson B W, Lyons M J, Davis B A, Luger E J, Wood S
G, Haselton J R, Simpson P C, Perez D M. Long-term
alpha1a-adrenergic receptor stimulation improves synaptic
plasticity, cognitive function, mood, and longevity. Mol Pharmacol.
2011; 80:747-758.
It is understood that the examples and embodiments described herein
are for illustrative purposes only and that various modifications
or changes in light thereof will be suggested to persons skilled in
the art and are to be included within the spirit and purview of
this application and scope of the appended claims. All
publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
SEQUENCE LISTINGS
1
28118DNAArtificial SequenceSynthetic polynucleotide 1ggcggtttgg
ctaggttt 18222DNAArtificial SequenceSynthetic polynucleotide
2gggttatctt cacacaccat ga 22320DNAArtificial SequenceSynthetic
polynucleotide 3ggggagctgt gatgtgaagt 20423DNAArtificial
SequenceSynthetic polynucleotide 4ccaggaaata attctggctc ata
23520DNAArtificial SequenceSynthetic polynucleotide 5aatccgcatc
atgaacagtg 20622DNAArtificial SequenceSynthetic polynucleotide
6tcatcatcca ttttatccac ca 22718DNAArtificial SequenceSynthetic
polynucleotide 7ttcggctcag tggagagg 18819DNAArtificial
SequenceSynthetic polynucleotide 8gctcccacca tttctccag
19923DNAArtificial SequenceSynthetic polynucleotide 9attgtggtgg
gatgcttcgt cct 231024DNAArtificial SequenceSynthetic polynucleotide
10tgtttccggt ggcttgaaat tcgg 241119DNAArtificial SequenceSynthetic
polynucleotide 11ggttgcttcg tcctctgct 191220DNAArtificial
SequenceSynthetic polynucleotide 12gaaatccggg aagaaagacc
201323DNAArtificial SequenceSynthetic polynucleotide 13cacagatctg
atggatttca aga 231420DNAArtificial SequenceSynthetic polynucleotide
14cctcatcttc taccggcatc 201523DNAArtificial SequenceSynthetic
polynucleotide 15cacagatctg atggatttca aga 231620DNAArtificial
SequenceSynthetic polynucleotide 16cctcatcttc taccggcatc
201721DNAArtificial SequenceSynthetic polynucleotide 17cctgccatgt
atgtggctat c 211819DNAArtificial SequenceSynthetic polynucleotide
18ccagaatcca acacgatgc 191920DNAArtificial SequenceSynthetic
polynucleotide 19tgaagcctca cttcctaccc 202023DNAArtificial
SequenceSynthetic polynucleotide 20cgtcacacat ggtgtctagt ttc
232118DNAArtificial SequenceSynthetic polynucleotide 21ctgcaggacc
tggtggac 182220DNAArtificial SequenceSynthetic polynucleotide
22ggaacttgga caggttggtg 202318DNAArtificial SequenceSynthetic
polynucleotide 23ctccacgcac cctcactt 182418DNAArtificial
SequenceSynthetic polynucleotide 24catgaccagg gggttgtc
182521DNAArtificial SequenceSynthetic polynucleotide 25agcctgcgaa
catatttgag a 212619DNAArtificial SequenceSynthetic polynucleotide
26atgagggcaa tccgtcttc 192718DNAArtificial SequenceSynthetic
polynucleotide 27gcagtcgcaa catgctca 182820DNAArtificial
SequenceSynthetic polynucleotide 28gggtcatttg gtgactctgg 20
* * * * *
References