U.S. patent number 10,716,839 [Application Number 15/566,333] was granted by the patent office on 2020-07-21 for compositions and methods for producing bacterial conjugate vaccines.
This patent grant is currently assigned to University of Maryland, Baltimore. The grantee listed for this patent is University of Maryland, Baltimore. Invention is credited to Myron M. Levine, Raphael Simon, Sharon M. Tennants.
![](/patent/grant/10716839/US10716839-20200721-D00001.png)
![](/patent/grant/10716839/US10716839-20200721-D00002.png)
![](/patent/grant/10716839/US10716839-20200721-D00003.png)
![](/patent/grant/10716839/US10716839-20200721-D00004.png)
![](/patent/grant/10716839/US10716839-20200721-D00005.png)
![](/patent/grant/10716839/US10716839-20200721-D00006.png)
![](/patent/grant/10716839/US10716839-20200721-D00007.png)
![](/patent/grant/10716839/US10716839-20200721-D00008.png)
![](/patent/grant/10716839/US10716839-20200721-D00009.png)
![](/patent/grant/10716839/US10716839-20200721-D00010.png)
![](/patent/grant/10716839/US10716839-20200721-D00011.png)
View All Diagrams
United States Patent |
10,716,839 |
Tennants , et al. |
July 21, 2020 |
Compositions and methods for producing bacterial conjugate
vaccines
Abstract
Longer chain antigenic O-polysaccharide chains for use as a
hapten in conjugate vaccines can be produced in a controlled manner
using recombinant Gram-negative bacteria that overexpress native or
heterologous genes of the wzz family, for example wzzB. Bacteria
expressing a chosen wzz gene have modified O-polysaccharide chain
lengths, allowing the bacteria to produce lipopolysaccharides
having the longer O-polysaccharides. The LPS produced by the
bacteria can be hydrolyzed to form core-O-polysaccharide molecules
that can be conjugated to a carrier molecule, for example
flagellin, to produce a vaccine. The invention also provides
recombinant bacteria producing the longer chain O-polysaccharides,
the polysaccharide molecules, themselves, conjugated vaccines
comprising the O-polysaccharides, pharmaceutical compositions and
kits.
Inventors: |
Tennants; Sharon M. (Baltimore,
MD), Simon; Raphael (Baltimore, MD), Levine; Myron M.
(Columbia, MD) |
Applicant: |
Name |
City |
State |
Country |
Type |
University of Maryland, Baltimore |
Baltimore |
MD |
US |
|
|
Assignee: |
University of Maryland,
Baltimore (Baltimore, MD)
|
Family
ID: |
57127007 |
Appl.
No.: |
15/566,333 |
Filed: |
April 13, 2016 |
PCT
Filed: |
April 13, 2016 |
PCT No.: |
PCT/US2016/027325 |
371(c)(1),(2),(4) Date: |
October 13, 2017 |
PCT
Pub. No.: |
WO2016/168324 |
PCT
Pub. Date: |
October 20, 2016 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20180099038 A1 |
Apr 12, 2018 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
62146545 |
Apr 13, 2015 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K
39/0275 (20130101); C12P 19/04 (20130101); A61K
39/02 (20130101); C08B 37/006 (20130101); Y02A
50/30 (20180101); A61K 2039/55594 (20130101); A61K
2039/55583 (20130101); A61K 2039/6087 (20130101); A61K
2039/522 (20130101); A61K 2039/6037 (20130101); A61K
2039/6031 (20130101); A61K 39/0011 (20130101) |
Current International
Class: |
A61K
39/112 (20060101); A61K 39/02 (20060101); A61K
39/385 (20060101); C08B 37/00 (20060101); A61K
39/00 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Murray et al., Molecular Microbiology, 2003; 47(5): 1395-1406
(Year: 2003). cited by examiner .
Carter et al., Microbiology, 2009; 155: 3260-3269 (Year: 2009).
cited by examiner .
Brady et al., BioProcess International, 2012;
https://bioprocessintl.com/manufacturing/monoclonal-antibodies/carrier-pr-
otein-outsourcing-337128/ (Year: 2012). cited by examiner .
Finn, British Medical Bulletin, 2004; 70: 1-14 (Year: 2004). cited
by examiner .
Cuadros et al., Infection and Immunity, 2004; 72(5): 2810-2816
(Year: 2004). cited by examiner .
Burrows et al., Journal of Bacteriology, 1997; 179(5): 1482-1489
(Year: 1997). cited by examiner .
International Search Report and Written Opinion for corresponding
PCT Application PCT/US2016/027435, dated Aug. 11, 2016, pp. 1-13.
cited by applicant .
Chinchilla, M., et al., "Enhanced immunity to Plasmodium falciparum
circumsporozoite protein (PfCSP) by using Salmonella enterica
serovar Typhi expressing PICSP and a PfCSP-encoding DNA vaccine in
a heterologous prime-boost strategy," Infect. Immun., May 2007,
vol. 75, pp. 3769-3779. cited by applicant .
Islam, S., et al., "Synthesis of bacterial polysaccharides via the
Wzx/Wzy-dependent pathway," Can. J. Microbial. Sep. 2014, vol. 60,
pp. 697-716. cited by applicant .
McKenzie, G., et al., "Fast, easy and efficient: site-specific
insertion of transgenes into enterobacterial chromosomes using Tn7
without need for selection of the insertion event," BMC Microbial.,
Apr. 2006, vol. 6, pp. 1-7. cited by applicant .
Murray, G., et al., "Regulation of Salmonella typhimurium
lipopolysaccha ride O antigen chain length is required for
virulence; identification of FepE as a second Wzz," Mol.
Microbial., Feb. 2003, vol. 47 , pp. 1395-1406. cited by applicant
.
Tennant, S., et al., "Engineering and preclinical evaluation of
attenuated nontyphoidal Salmonella strains serving as live oral
vaccines and as reagent strains," Infect. Immun., Aug. 2011, vol.
79, pp. 4175-4185. cited by applicant .
"Cloning Vector pUC19: Product Information Sheet #V33202," MoBiTec,
Dec. 1, 2013, pp. 1-3. cited by applicant .
Bardotti, A., Averani, G., Berti, F., Berti, S., Carinci, V., et
al. (2008) Physiochemical characterisation of glycoconjugate
vaccines for prevention of meningococcal diseases. Vaccine 26:
2284-2296. cited by applicant .
Carter, J., Jimenez, J., Zaldivar, M., Alvarez, S., Marolda, C., et
al. (2009) The cellular level of O-antigen polymerase Wzy
determines chain length regulation by WzzB and WzzpHS-2 in Shigella
flexneri 2a. Microbiology 155: 3260-3269. cited by applicant .
Cohen, D., Ashkenazi, S., Green, M., Gdalevich, M., Robin, G., et
al. (1997) Double-blind vaccine-controlled randomised efficacy
trial of an investigational Shigella sonnei conjugate vaccine in
young adults. The Lancet 349: 155-159. cited by applicant .
Darveau et al. J. (1983) Procedure for Isolation of bacterial
Lipopolysaccharides from Both Smooth and Rough Pseudomonas
aeruginosa and Salmonella typhimurium strains. Journal of
Bacteriology, 155(2):831-838. cited by applicant .
Datsenko, K., et al. (2000) One-step Inactivation of Chromosonal
Genes in Escherichia coli K-12 using PCR products. Proceedings of
the National Academy of Sciences. U.S.A. 97(12):6640-6645. cited by
applicant .
Kothari, S., et al., "Purification of O-specific polysaccharide
from lipopolysaccharide produced by Salmonella anterica serovar
Paratyphi A," Vaccine. 2014; 32(21):2457-62. Epub Mar. 12, 2014.
http://dx.doi.org/10.1016/j.vaccine.2014.02.090. cited by applicant
.
Kubler-Kielb, J., Vinogradov, E., Mocca, C., Pozsgay, V., Coxon,
B., et al. (2010) Immunochemical studies of Shigella flexneri 2a
and 6, and Shigella dysenteriae type 1 O-specific
polysaccharide-core fragments and their protein conjugates as
vaccine candidates. Carbohydrate Research 345:1600-1608. cited by
applicant .
Lindberg, A.A., Le Minor, L. (1984) Serology of Salmonella. In:
Bergan, T, editor. Methods in Microbiology: Academic Press. pp.
1-141. cited by applicant .
Robbins, J., Kubler-Kielb, J., Vinogradov, E., Mocca, C., Pozsgay,
V., et al. (2009) Synthesis, characterization, and immunogenicity
in mice of Shigella sonnei O-specific oligosaccharide-core-protein
conjugates. Proceedings of the National Academy of Sciences. U S A
106(19): 7974-7978. cited by applicant .
Rondini, S. et al. (2011) Evaluation of the Immunogenicity and
Biological Activity of the Citrobacter Freundii VI-CRM197 Conjugate
as a Vaccine for Salmonella enterica Serovar Typhi. Clinical and
Vaccine Immunology. 18 (3):460-468. cited by applicant .
Simon, R., Tennant, S. Wang, J., Schmidlein, P., Lees, A., et al.
(2011) Salmonella enterica serovar enteritidis core
O-polysaccharide conjugated to H:g,m flagellin as a candidate
vaccine for protection against invasive infection with S.
enteritidis. Infection and Immunity 79(10): 4240-4249. cited by
applicant .
Svenson, S., Lindberg, A. (1981) Artificial Salmonella vaccines:
Salmonella typhimurium O-antigen-specific oligosaccharide-protein
conjugates elicit protective antibodies in rabbits and mice.
Infection and Immunity 32(2): 490-496. cited by applicant .
Watson, D., Robbins, J., Szu, S. (1992) Protection of mice against
Salmonella typhimurium with an O-specific polysaccharide-protein
conjugate vaccine. Infection and Immunity 60(11): 4679-4686. cited
by applicant .
Westphal,O., et al. (1965) Extraction with Phenol-Water and Further
Applications of the Procedure. Ch. 25 Bacterial Lipopolysaccarides.
Methods in Carbohydrate Chemistry. 5:83-91. cited by applicant
.
Zink, Phd, Gilbert L. (1980) Immunizing Agents and Diagnostic
Antigens. Remingtons Pharmaceutical Sciences, Ch. 73:1334-1340.
cited by applicant.
|
Primary Examiner: Nickol; Gary B
Assistant Examiner: Jackson-Tongue; Lakia J
Attorney, Agent or Firm: Beusse Wolter Sanks & Maire
Molinelli; Eugene J. Cassidy; Martha
Parent Case Text
CROSS REFERENCE TO RELATED APPLICATIONS
This application is a 371 national stage application of PCT
Application No. PCT/US2016/027325 filed Apr. 13, 2016 which claims
the benefit of provisional application 62/146,545, entitled
"Compositions and Methods for Producing Bacterial Conjugate
Vaccines," filed Apr. 13, 2015, the entire contents of which are
incorporated herein.
Claims
What is claimed is:
1. A Salmonella enterica serotype Typhimurium CVD 1925
core-O-polysaccharide hapten purified from Salmonella enterica
serotype Typhimurium CVD 1925 which overexpresses a Salmonella
enterica serotype Typhimurium wzz family protein.
2. The core-O-polysaccharide hapten of claim 1, wherein the wzz
family protein is wzzB.
3. The core-O-polysaccharide hapten of claim 1, further comprising
a carrier protein.
4. The conjugate or complexed vaccine of claim 3, wherein the
core-O-polysaccharide hapten is covalently linked or complexed to a
carrier protein.
5. The conjugate or complexed vaccine of claim 3, wherein the
core-O-polysaccharide hapten and the carrier protein are chemically
conjugated or complexed using a cross-linker or polymer.
6. The conjugate vaccine of claim 3, wherein the carrier protein is
from a homologous bacterial strain or a heterologous bacterial
strain.
7. The conjugate vaccine of claim 3, wherein the carrier protein is
flagellin and selected from the group consisting of flagellin A,
flagellin B, phase 1 flagella protein, and phase 2 flagella
protein.
8. The conjugate vaccine of claim 7, wherein the flagellin is from
the homologous or a heterologous species as the
core-O-polysaccharide hapten.
9. The core-O-polysaccharide hapten of claim 1, formulated as a
conjugate vaccine or a complexed vaccine.
Description
BACKGROUND
Bacterial capsular and outer membrane saccharides are abundant cell
surface antigens that are generally accessible by antibodies and
targets for protective immune responses. The surface carbohydrates
of un-encapsulated Gram-negative bacteria (GNB) are
lipopolysaccharides (LPS). LPS comprise a lipid A membrane anchor
that links a single core polysaccharide to a polymer of
O-polysaccharide (OPS) containing a number of repeated saccharide
monomer units, which form short, intermediate, long or very long
O-chains. While the core polysaccharide is mostly conserved within
individual bacterial species, the O-polysaccharide can be variable
and is used to distinguish serotypes.
Antibodies specific for the OPS of several important GNB human
pathogens have protected against infection with the homologous
pathogen in preclinical animal models [1,2] and clinical trials
[3]. There is marked interest in the use of OPS as the basis of
vaccines. However, isolated OPS are poorly immunogenic. Chemical
linkage to protein carriers has improved their immunogenicity, and
a functional boost response can be achieved by repeated
administration of OPS conjugates. Despite their promise as vaccine
antigens, the natural variability in polymer size represents a
practical challenge in their commercial use. Longer chain and
higher molecular weight saccharide haptens tend to be more
immunogenic, but some bacterial strains produce the longer chains
in lesser amounts, creating difficulties in developing different
conjugation synthesis strategies, producing a uniform product, and
producing high glycoconjugate immunogenicity. Size fractionation
can be used to obtain the desired saccharide size; however,
addition of a sizing step can introduce extraneous cost to the
production process. Furthermore, the desired polysaccharide size
may constitute only a minor proportion of the total saccharide
population. A need exists for safe and efficient production of more
numerous and longer OPS at less cost, for use in producing
conjugate vaccines.
Wzz proteins are chain length regulators, expressed in the
bacterial periplasm that control the activity of the Wzy OPS
polymerase. The modal number of OPS monomer repeats produced by GNB
using the Wzy LPS synthesis system is controlled by Wzz proteins.
The protein structure and specificity of wzz family members varies
between bacterial species. Some bacteria encode several different
wzz genes, and their expression can be subject to control by growth
phase and environmental conditions.
SUMMARY
The invention described herein relates to a method of controlling
the length of and/or lengthening the O-polysaccharide chains
produced by a Gram-negative bacterium in culture to produce
bacterial LPS with longer, higher molecular weight O-polysaccharide
chains. Embodiments of the invention include methods for increasing
the production of intermediate-, long- and/or very long-chain OPS
by overexpressing a wzz family gene product which can influence
bacterial metabolism to produce longer chains. Such antigenic
longer chain OPS haptens are thereby produced in greater quantity
and at less cost than prior methods. Therefore, the invention
described herein includes, at least in part, the following.
Embodiments of the invention include a method of manipulating the
length of OPS produced by a Gram-negative bacterium in culture
comprising overexpressing wzz family proteins from the
Gram-negative bacterium in a homologous Gram-negative bacterial
strain or in a heterologous Gram-negative bacterial strain to
generate a high yield of large molecular weight lipopolysaccharides
containing intermediate or long O-polysaccharide chains. A desired
chain length is the one which produces maximal immunogenicity in
the context of a given vaccine construct. Certain embodiments
further comprise repressing wzz family gene products from the
Gram-negative bacterium in a homologous Gram-negative bacterial
strain or in a heterologous Gram-negative bacterial strain.
In preferred embodiments, the wzz family protein is selected from
the group consisting of wzzB, wzz, wzz.sub.SF, wzz.sub.ST, fepE,
wZZ.sub.fepE, wzz, 1 and wzz2, most preferably wzzB.
In preferred embodiments of the method, the Gram-negative bacterium
is selected from the group consisting of Acinetobacter,
Burkholderia, Bordetella, Campylobacter, Escherichia coli,
Francisella, Haemophilus, Helicobacter, Pseudomonas, Salmonella
enterica, Shigella, Vibrio, and Yersinia species. More preferably,
the Gram-negative bacterial strain is selected from the group
consisting of Salmonella enterica serotype Enteritidis CVD 1943,
Salmonella enterica serotype Typhimurium CVD 1925, Salmonella
enterica serotype Paratyphi A CVD 1902, and Shigella flexneri CVD
1208S.
According to embodiments of the invention, the overexpression of
the wzzB gene occurs from a high copy number plasmid, such as, for
example, pSE280 or pUCP19. Alternatively, the overexpression of the
wzzB gene occurs from a low copy number plasmid, such as, for
example, pSEC10. In a further alternative embodiment, the
overexpression of the wzz family gene occurs from the chromosome,
where the endogenous wzz gene may or may not be deleted.
In highly preferred embodiments of the invention, the
overexpression of wzzB shifts production of lipopolysaccharides
containing intermediate chain length to liposaccharides containing
long chain length.
Embodiments of the invention also include lipopolysaccharides
produced by the methods described herein, preferably from the
Gram-negative bacterium, Salmonella enterica serotype Typhimurium.
Alternatively, the lipopolysaccharide produced by these methods is
a Gram-negative strain selected from the group consisting of
Salmonella enterica serotype Typhimurium CVD 1925, Salmonella
enterica serotype Paratyphi A CVD 1902, and Shigella flexneri CVD
1208S. Therefore, embodiments of the invention also include a
core-O-polysaccharide hapten purified from wzz family protein
overexpressing Gram-negative bacteria, preferably Salmonella
enterica serotype Typhimurium CVD 1925 or Salmonella enterica
serotype Paratyphi A CVD 1902.
Further embodiments of the invention include a
core-O-polysaccharide hapten purified from a Gram-negative
bacterial strain overexpressing a wzz family protein for use as a
vaccine antigen either as a conjugate or complexed vaccine. The wzz
family protein preferably is wzzB. In addition, the invention
encompasses embodiments such as a conjugate or complexed vaccine
comprising one or more of these core-O-polysaccharide haptens,
wherein the core-O-polysaccharide hapten is covalently linked or
complexed to a carrier protein. The core-O-polysaccharide hapten
and the carrier protein optionally are chemically conjugated or
complexed using a cross-linker or polymer. In these conjugate
vaccines, the carrier protein is from a homologous bacterial strain
or a heterologous bacterial strain.
Other embodiments of the invention include an O-polysaccharide
chain purified from a Gram-negative bacterial strain overexpressing
a wzz family protein for use as a vaccine antigen either as a
conjugate or complexed vaccine. The wzz family protein is
preferably wzzB.
In certain preferred embodiments of the invention, the carrier
protein is flagellin, optionally selected from the group consisting
of flagellin A, flagellin B, phase 1 flagella protein, and phase 2
flagella protein. The flagellin can be from the homologous or a
heterologous species as the core-O-polysaccharide hapten.
The invention also encompasses a method of inducing an enhanced
immune response in a subject comprising administering to the
subject any of the vaccines described herein, preferably in the
form of a pharmaceutical composition comprising the vaccine and a
pharmaceutically acceptable carrier or adjuvant.
Additional embodiments of the invention also include a kit
comprising a package which houses one or more containers which
comprises one or more of the vaccines as described herein,
instructions for administering the vaccine to a subject, and,
optionally, further comprising one or more therapeutic agents.
Furthermore, the embodiments of the invention also encompass a
recombinant Gram-negative bacterial strain that constitutively
expresses a Wzz family protein and produces increased amounts of
long-chain O-polysaccharide for use in conjugate vaccines.
These and other features, aspects, and advantages of the present
invention will become better understood with regard to the
following description, appended claims, and accompanying
figures.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and
are included to further demonstrate certain embodiments of the
present invention. The invention may be better understood by
reference to one or more of these drawings in combination with the
detailed description of specific embodiments presented herein.
FIG. 1 is a schematic diagram of gram-negative bacterial
lipopolysaccharide (LPS);
FIG. 2 is a schematic diagram of a pSEC10-wzzB expression plasmid.
The Salmonella enterica serotype Typhimurium wzzB gene was cloned
downstream of PompC in the highly stable, kanamycin-resistant
plasmid, pSEC10; according to an embodiment;
FIG. 3 is a photograph illustrating visualization of LPS produced
by Salmonella enterica serotype Typhimurium CVD 1925
over-expressing wzzB. The wzzB gene was expressed from the
chromosome and from two different plasmids, pSE280 (high copy
number, ampicillin resistant, Ptrc promoter) and pSEC10 (low copy
number, kanamycin resistant, PompC promoter [salt inducible]). LPS
micro preparations from whole cells were separated by SDS-PAGE and
stained for polysaccharide. Salmonella enterica serotype
Enteritidis LPS was included as a control. Lane descriptions are
indicated. Where applicable, high and low salt media growth
conditions are indicated; according to an embodiment;
FIG. 4A-FIG. 4B are photographs illustrating visualization of LPS
produced by Salmonella enterica Paratyphi A CVD 1902 overexpressing
wzzB. In FIG. 4A, the wzzB gene was expressed in Salmonella
enterica Paratyphi A from pSE280 plasmid. In FIG. 4B, the wzzB gene
was expressed in Salmonella enterica Paratyphi A from pSEC10. LPS
from whole cells was separated by SDS-PAGE and visualized by
staining for polysaccharide. Lane descriptions are indicated;
according to an embodiment;
FIG. 5 is a photograph illustrating visualization of LPS produced
by Shigella flexneri CVD 1208S over-expressing wzzB. The wzzB gene
was expressed from pSEC10. LPS micro preparations from whole cells
were separated by SDS-PAGE and stained for polysaccharide. Lane
descriptions are indicated; according to an embodiment;
FIG. 6 is a schematic diagram illustrating characterization of
purified native COPS from Salmonella enterica serotype Newport CVD
1962; according to an embodiment;
FIG. 7 is a schematic diagram illustrating characterization of
purified native COPS form Salmonella enterica serotype Newport CVD
1962 (very-long+long chain length) vs. COPS from Salmonella
enterica serotype Newport wzzB CVD 1966 (long-chain only);
according to an embodiment;
FIG. 8 is a photograph of a Western Blot gel illustrating
overexpression of wzz2 from Pseudomonas aeruginosa in various
Pseudomonas strains; according to an embodiment;
FIG. 9 is a schematic diagram of a pUC19wzz2 expression plasmid.
The wzz2 gene was cloned downstream from the amp promoter in the
ampicillin-resistant plasmid pUCP19wzz2;
FIG. 10 is a schematic diagram illustrating producing an
identifiable peak by HPLC-SEC indicating soluble released
polysaccharide that was separated from residual impurities that
were all lower molecular weight; according to an embodiment;
FIG. 11 is an HPLC-SEC analysis of COPS purified from Salmonella
enterica serotype Typhimurium CVD 1925 and Shigella flexneri CVD
108S overexpressing wzzB. Purified COPS from Salmonella enterica
serotype Typhimurium CVD 1925 pSEC10-wzzB (thin gray line) and CVD
1208S pSEC10-wzzB (thick black line) were separated by HPLC-SEC and
detected by refractive index; according to an embodiment; and
FIG. 12 is an illustration providing recognition of COPS purified
from Salmonella enterica serotype Typhimurium CVD 1925
overexpressing wzzB by a type-specific monoclonal antibody. COPS
from independent lots were assessed by direct ELISA using various
dilutions of a serogroup-specific anti-O epitope 4 monoclonal
antibody.
DETAILED DESCRIPTION
Surfaces of bacteria mediate a multitude of functions in the
environment and in an infected host, including adhesion to both
biotic and abiotic substrata, motility, immune system interaction
and (or) activation, biofilm formation, and cell-cell
communication, with many of these features directly influenced by
cell-surface glycans. In Gram-negative bacteria, the majority of
cell-surface polysaccharides are produced via the Wzx/Wzy-dependent
assembly pathway. The key components of this assembly pathway
include the Wzz chain-length regulator proteins, which until
recently have resisted detailed structural and functional
characterization.
Conjugate vaccines represent among the most complex and expensive
vaccines to manufacture, due to several contributing factors. These
factors include the need to manufacture the hapten and carrier
separately, variability in production of the saccharide hapten
which often requires separate sizing steps, and the need to link
the saccharide and protein carrier together. Previous attempts to
standardize the hapten molecular weight in capsular polysaccharide
conjugate vaccines include a sizing step where the large capsule
polymer is chemically or mechanically broken down into well-defined
and homogenous smaller fragments [4]. A similar strategy has been
reported for Salmonella enterica serotype Typhimurium OPS haptens,
whereby a phage-associated endorhamnosidase was used to degrade the
O-polysaccharide enzymatically into various modal lengths that were
used to establish the minimal immunogenic hapten size [5].
Biochemical size fraction has also been used for Shigella OPS,
whereby a preferential saccharide size population was established
for use in glycoconjugate vaccines [6,7]. In an effort to overcome
these drawbacks and produce larger amounts of a more standardized,
antigenic, polysaccharide hapten, the invention described herein
has used controlled expression of Wzz proteins to bias production
of a single saccharide size.
The O-antigen component of the lipopolysaccharide (LPS) is a
population of polysaccharide molecules with nonrandom (modal) chain
length distribution. The number of the repeat O units in each
individual O-antigen polymer (and therefore the length and
molecular weight of the polymer chain) depends on the Wzz chain
length regulator, an inner membrane protein belonging to the
polysaccharide copolymerase (PCP) family. Different Wzz proteins
confer vastly different ranges of modal lengths (4 to >100
repeat units), despite having remarkably conserved structural
folds. It has been discovered that overexpression of wzz family
proteins (e.g., wzzB) in Gram-negative bacteria allows one to
manipulate O-polysaccharide length, to shift or bias bacterial
production of OPS of certain length ranges, and to enhance
production of high-yield large molecular weight lipopolysaccharides
containing intermediate or long O-polysaccharides for use as
haptens in conjugate vaccines without the need for an additional
sizing step.
In the following description, for the purposes of explanation,
numerous specific details are set forth in order to provide a
thorough understanding of the present invention. It will be
apparent, however, to one skilled in the art that the present
invention may be practiced without these specific details. In order
that the invention may be readily understood and put into practical
effect, particular preferred embodiments will now be described by
way of the following non-limiting examples.
1. Definitions
Unless otherwise defined, all technical and scientific terms used
herein are intended to have the same meaning as commonly understood
in the art to which this invention pertains and at the time of its
filing. Although various methods and materials similar or
equivalent to those described herein can be used in the practice or
testing of the present invention, suitable methods and materials
are described below. However, the skilled should understand that
the methods and materials used and described are examples and may
not be the only ones suitable for use in the invention. Moreover,
it should also be understood that as measurements are subject to
inherent variability, any temperature, weight, volume, time
interval, pH, salinity, molarity or molality, range, concentration
and any other measurements, quantities or numerical expressions
given herein are intended to be approximate and not exact or
critical figures unless expressly stated to the contrary. Hence,
where appropriate to the invention and as understood by those of
skill in the art, it is proper to describe the various aspects of
the invention using approximate or relative terms and terms of
degree commonly employed in patent applications, such as: so
dimensioned, about, approximately, substantially, essentially,
consisting essentially of, comprising, and effective amount.
Generally, nomenclature used in connection with, and techniques of,
cell and tissue culture, molecular biology, immunology,
microbiology, genetics, protein, and nucleic acid chemistry and
hybridization described herein are those well-known and commonly
used in the art. The methods and techniques of the present
invention are performed generally according to conventional methods
well known in the art and as described in various general and more
specific references that are cited and discussed throughout the
present specification unless otherwise indicated. See, e.g.,
Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989); Ausubel et al., Current Protocols in Molecular Biology,
Greene Publishing Associates (1992, and Supplements to 2002);
Harlow and Lan, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1990); Principles of
Neural Science, 4th ed., Eric R. Kandel, James H. Schwartz, Thomas
M. Jessell editors. McGraw-Hill/Appleton & Lange: New York,
N.Y. (2000). Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art.
For the purpose of interpreting this specification, the following
definitions will apply and whenever appropriate, terms used in the
singular will also include the plural and vice versa. In the event
that any definition set forth below conflicts with the usage of
that word in any other document, including any document
incorporated herein by reference, the definition set forth below
shall always control for purposes of interpreting this
specification and its associated claims unless a contrary meaning
is clearly intended (for example in the document where the term is
originally used). The use of "or" means "and/or" unless stated
otherwise. The use of "a" herein means "one or more" unless stated
otherwise or where the use of "one or more" is clearly
inappropriate. The use of "comprise," "comprises," "comprising,"
"include," "includes," and "including" are interchangeable and
intended to be non-limiting. Furthermore, where the description of
one or more embodiments uses the term "comprising," those skilled
in the art would understand that, in some specific instances, the
embodiment or embodiments can be alternatively described using the
language "consisting essentially of" and/or "consisting of."
The term "manipulating" as used herein means to direct change, or
alteration, or a tunable method to control the length of
O-polysaccharides by overexpressing wzz family proteins, (e.g.,
wzzB, wzz, WZZ.sub.SF, WZZ.sub.ST, fepE, WZZ.sub.fepE, wzz1 and
wzz2) and/or switching off (i.e., repressing, deleting, removing)
wzz family proteins from a Gram-negative bacterial strain.
The term "O-polysaccharide" "OAg" or "O-antigen," as used herein,
means a repetitive glycan polysaccharide contained within a
lipopolysaccharide (LPS) as shown in FIG. 1. The O-polysaccharide,
or OAg, or O-antigen is attached to the core oligosaccharide, and
comprises the outermost domain of the LPS molecule. The term
"core-O-polysaccharide" as used herein refers to the
O-polysaccharide, or Oag, or O-antigen attached to the core
oligosaccharide.
The term "subject" as used herein refers to animals, such as
mammals. For example, mammals contemplated include humans,
primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens,
mice, rats, rabbits, guinea pigs, and the like. The terms
"subject", "patient", and "host" are used interchangeably.
The term "hapten" as used herein refers to a small molecule that
elicits an immune response only when attached to a large carrier
such as a protein.
The term "induce an immune response," as used herein, means
inducing a physiological response of the subject's immune system to
an immunizing composition. An immune response may include an innate
immune response, an adaptive immune response, or both. A protective
immune response confers immunological cellular memory upon the
subject, with the effect that a secondary exposure to the same or a
similar antigen is characterized by one or more of the following
characteristics: shorter lag phase than the lag phase resulting
from exposure to the selected antigen in the absence of prior
exposure to the immunizing composition; production of antibody
which continues for a longer period than production of antibody
resulting from exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; a change in the type
and quality of antibody produced in comparison to the type and
quality of antibody produced upon exposure to the selected antigen
in the absence of prior exposure to the immunizing composition; a
shift in class response, with IgG antibodies appearing in higher
concentrations and with greater persistence than IgM, than occurs
in response to exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; an increased average
affinity (binding constant) of the antibodies for the antigen in
comparison with the average affinity of antibodies for the antigen
resulting from exposure to the selected antigen in the absence of
prior exposure to the immunizing composition; and/or other
characteristics known in the art to characterize a secondary immune
response.
The term "modal length" as used herein means number of O
polysaccharide repeat units. A "short modal length" as used herein
means a low number of repeat units (e.g., 1-15). An "intermediate"
or "long" modal length as used herein means a moderate number of
repeat units (e.g., 16-50). A "very long modal length" as used
herein means >50 O-polysaccharide repeat units.
The term "vaccine," as used herein, means any preparation of
biological material containing an antigenic material that upon
administration to a subject provides active acquired immunity to at
least the pathogenic organism from which the antigenic material was
derived. Vaccines can be delivered prophylactically or
therapeutically. Conjugate vaccines are used when the antigenic
material is poorly immunogenic on its own (such as, for example,
polysaccharide antigens), and must be linked to an immunogenic
(usually protein) carrier so that it can be recognized more
effectively by the immune system. Such poorly immunogenic antigens
are termed "haptens." A "hapten," therefore, as used herein, is a
small or poorly immunogenic molecule that generally elicits a
strong immune response only when attached to a large carrier such
as a protein. A "carrier," as used herein, refers to a large
molecule, usually a protein, to which a hapten may be attached in a
conjugate to produce a vaccine. Carriers can be a molecule that
does not elicit an immune response by itself.
The term "wzz family protein," as used herein, means chain length
determinant protein of which wzzB, wzz, wZZ.sub.SF, WZZ.sub.ST,
fepE, wZZ.sub.fepE, wzz1 and wzz2 are described. The GenBank
accession numbers for the wzz gene sequences are AF011910 for
E4991/76, AF011911 for F186, AF011912 for M70/1-1, AF011913 for
79/311, AF011914 for Bi7509-41, AF011915 for C664-1992, AF011916
for C258-94, AF011917 for C722-89, and AF011919 for EDL933. The
GenBank accession numbers for the G7 and Bi316-41 wzz genes
sequences are U39305 and U39306, respectively.
2. Overview
Gram-negative bacteria can cause many types of infections and are
spread to humans in a variety of ways. Several species, including
Escherichia coli, are common causes of food-borne disease and cause
the majority of urinary tract infections. Vibrio cholerae--the
bacteria responsible for cholera--is a waterborne pathogen.
Gram-negative bacteria can also cause respiratory infections, such
as certain types of pneumonia, and sexually transmitted diseases,
including gonorrhea. Yersinia pestis, the Gram-negative bacterium
responsible for plague, is transmitted to people through the bite
of an infected insect or handling an infected animal. Acinetobacter
baumanii causes disease mainly in healthcare settings. In addition,
wound infections caused by Acinetobacter have been found in U.S.
military personnel who were deployed to Iraq and Afghanistan.
Pseudomonas aeruginosa causes bloodstream infections and pneumonia
in hospitalized patients. It is a common cause of pneumonia in
patients with cystic fibrosis. Klebsiella pneumoniae causes many
types of healthcare-associated infections, including pneumonia,
urinary tract infections, and bloodstream infections. Neisseria
gonorrhoeae, which causes the sexually transmitted disease
gonorrhea, is the second most commonly reported infectious disease
in the United States.
Gram-negative bacteria are a common source of clinically-relevant
bacterial infections that can be established throughout the body.
To date, the only major Gram-negative pathogen that is preventable
through vaccination is Haemophilus influenza type b. Infections by
the Gram-negative bacteria that are not currently addressed by any
prophylactic therapy cause significant morbidity and mortality, and
are associated with large direct and indirect expenses to the
healthcare system. Drug-resistant Gram-negative infections, such as
Klebsiella, Pseudomonas, and Acinetobacter, have emerged as major
concerns in hospitals, nursing homes and other healthcare settings.
In some cases, bacteria can enter the body through urinary and
intravenous catheters, ventilators, or wounds and can lead to
pneumonia and infections of the bloodstream, bones, joints, and
urinary tract. These types of infections disproportionately affect
the very ill and the elderly and are often difficult to treat.
Therefore, there is a marked interest in the use of
O-polysaccharides as the basis of vaccines.
As isolated antigens, O-polysaccharides are poorly immunogenic.
Chemical linkage to protein carriers has improved their
immunogenicity. However, variability in polymer size represents a
practical challenge. In commercial use, the size of the saccharide
hapten can influence the compatibility with different conjugation
synthesis strategies, product uniformity, and conjugate
immunogenicity. Controlling the expression of a Wzz family protein
chain length regulator through manipulation of the O-polysaccharide
synthesis pathway allows for production of a desired length of
O-polysaccharide chains in a variety of Gram-negative bacterial
strains.
3. Embodiments
Longer-chain antigenic O-polysaccharide chains for use as a hapten
in conjugate vaccines can be produced in a controlled manner using
recombinant Gram-negative bacteria that overexpress and/or switch
off (e.g., repress, remove, delete) native or heterologous genes of
the wzz family, for example wzzB. A preferable length is a length
that produces maximal immunogenicity in the context of a given
vaccine construct. Bacteria expressing a chosen wzz gene have
modified O-polysaccharide chain lengths, allowing the bacteria to
produce lipopolysaccharides having the longer O-polysaccharides.
The LPS produced by the bacteria can be hydrolyzed to form
core-O-polysaccharide molecules that can be conjugated to a carrier
molecule, for example flagellin, to produce a vaccine. The
invention also provides recombinant bacteria producing the longer
chain O-polysaccharides, the polysaccharide molecules, themselves,
conjugated vaccines comprising the O-polysaccharides,
pharmaceutical compositions and kits.
Recombinant Methods of Manipulating O-Polysaccharide Length to Bias
Production of Saccharide Size
As illustrated in FIG. 1, LPS is a major component of the outer
membrane of Gram-negative bacteria and comprises three domains, or
regions: (i) an inner hydrophobic lipid A region (endotoxin), (ii)
an oligosaccharide core, and (iii) a an outer O-polysaccharide that
is exposed to the bacterial surface and synthesized by a wzz family
of proteins. As used herein, the term OPS refers to the outer
O-polysaccharide moiety, and COPS refers to the core-O joined
polysaccharide, lacking the lipid A region. The O-polysaccharide
component of the lipopolysaccharide (LPS) represents a population
of polysaccharide molecules with modal chain length distribution.
The number of the repeat O units in each individual O-antigen
polymer depends on the Wzz chain length regulator, an inner
membrane protein belonging to the polysaccharide copolymerase (PCP)
family. Different Wzz proteins confer vastly different ranges of
modal lengths (4 to >100 repeat units), despite having
remarkably conserved structural folds. Gram-negative bacteria often
have two different Wzz proteins that confer two distinct OAg modal
chain lengths, one longer and one shorter. The Wzz proteins are 36-
to 40-kDa inner membrane proteins with substantial variation in
sequence identity (.about.15 to .about.80%) but a conserved
structural organization.
Methods are provided for manipulating the length of
O-polysaccharides produced by a Gram-negative bacterium in culture
comprising overexpressing a wzz family protein (e.g., wzzB) from a
Gram-negative bacterium in a homologous Gram-negative bacterial
strain or in a heterologous Gram-negative bacterial strain to
generate a high yield of high molecular weight lipopolysaccharides
containing intermediate or long O-polysaccharide chains. A desired
chain length is the one which produces maximal immunogenicity in
the context of a given vaccine construct. In other embodiments,
methods are provided for overexpressing a wzz family protein (e.g.,
wzzB) from a Gram-negative bacterium in a homologous Gram-negative
bacterial strain or in a heterologous Gram-negative bacterial
strain and/or switching off (i.e., repressing, deleting, removing)
a second wzz gene (e.g., wzzB) to generate a high yield of high
molecular weight lipopolysaccharides containing intermediate or
long O-polysaccharide chains. For example, overexpress wzz2 but
also switch off wzz1. Or, in the alternative, overexpress wzzfepE
and switch off wzzB. In another embodiment, it may be preferable to
overexpress wzzB but switch off wzzfepE.
The Gram-negative bacterium preferably is selected from the group
consisting of Acinetobacter, Burkholderia, Bordetella,
Campylobacter, Escherichia coli, Francisella, Haemophilus,
Helicobacter, Pseudomonas, Salmonella enterica, Shigella, Vibrio,
and Yersinia species. More preferably, the Gram-negative bacterial
strain is selected from the group consisting of Salmonella enterica
serotype Enteritidis CVD 1943, Salmonella enterica serotype
Typhimurium CVD 1925, Salmonella enterica serotype Paratyphi A CVD
1902, and Shigella flexneri CVD 1208S.
Representative bacterial strains are set forth in Table 1.
Gram-negative bacterial strains in preferred embodiments are
selected from the group consisting of Salmonella Enteritidis CVD
1943, Salmonella Typhimurium CVD 1925, Salmonella Paratyphi A CVD
1902, Salmonella Newport CVD 1962, and Shigella flexneri CVD 1280S.
A description of the generation of these bacterial strains
sequences is found in U.S. Patent Application Pub. No. 2013/0129776
A1, which is hereby incorporated by reference.
TABLE-US-00001 TABLE 1 Representative Bacterial Strains and
Plasmids Bacteria and plasmids Genotype Characteristics Reference
Bacterial strains Salmonella enterica serovar .DELTA.guaBA
.DELTA.clpP .DELTA.fliD Reagent strain for conjugate Tennant et al
Enteritidis CVD 1943 vaccine production Infect Immun 2011 79:
4175-85 Salmonella enterica serovar .DELTA.guaBA .DELTA.clpP
.DELTA.fliD .DELTA.fljB Reagent strain for conjugate Tennant et al
Typhimurium CVD 1925 vaccine production Infect Immun 2011 79:
4175-85 Salmonella enterica serovar .DELTA.guaBA .DELTA.clpX
Candidate live attenuated Paratyphi A CVD 1902 vaccine Shigella
flexneri CVD 1208S .DELTA.guaBA .DELTA.set .DELTA.sen Candidate
live attenuated Kotloff et al vaccine 2007 (Human Vaccines 3:
628-275) Salmonella enterica serovar .DELTA.guaBA .DELTA.clpX
Reagent strain for conjugate Newport CVD 1962 vaccine production
Pseudomonas aeruginosa PAO1 Wild-type Pseudomonas aeruginosa PAK
Wild-type Pseudomonas aeruginosa O1 Wild-type Pseudomonas
aeruginosa O2 Wild-type Pseudomonas aeruginosa O3 Wild-type
Pseudomonas aeruginosa O4 Wild-type Pseudomonas aeruginosa O6
Wild-type Pseudomonas aeruginosa O10 Wild-type Pseudomonas
aeruginosa O11 Wild-type Pseudomonas aeruginosa O12 Wild-type
Plasmids pSEC10 7.2 kb, low copy number, Kan Stokes et al.
resistant 2007. Infection and Immunity. 75(4): 1827-34 pSE280 3.9
kb, high copy number, Amp resistant pUCP19 5.9 kb, high copy
number, Amp Schweizer Gene resistant 1991 97: 109-21
The Wzy Pathway
Synthesis of bacterial polysaccharides via the Wzx/Wzy-dependent
pathway is described in Islam and Lam, Can. J. Microbiol. 60:
697-716 2015, pp. 697-716 which is incorporated herein by
reference. The role of wzz was first identified via the loss of
preferred O-polysaccharide chain modalities in mutants, leading to
initial gene names such as regulator of O-chain length (rol)
(Batchelor et al. 1991) or chain length determinant (cld) (Bastin
et al. 1993). These PCP proteins can be readily identified via
standard BLASTp searches. Also, wzz position within the chromosome
of a particular species is often conserved. For example, in
Pseudomonas aeruginosa, wzz1 is the next gene downstream of himD in
all 20 serotypes (Raymond et al. 2002).
The modal number of O-polysaccharide polymer repeats for
Gram-negative bacteria using the Wzy LPS synthesis system is
controlled by Wzz proteins. The protein structure and specificity
of Wzz family members varies between bacterial species. Table 3
illustrates wzz genes in representative bacterial strains. Some
bacteria encode several different wzz genes (e.g., Salmonella
Typhimurium and Salmonella flexneri). Their expression can be
subject to control by growth phase and environmental conditions.
Controlled expression of Wzz proteins can be used to bias
production of a single saccharide size. Manipulation of the
O-polysaccharide synthesis pathway represents an efficient and
economical approach to achieve high yields of these
O-polysaccharide size populations, as this approach enables
enhanced expression and minimal requirements for additional later
process steps.
TABLE-US-00002 TABLE 2 wzz genes in Representative Bacterial
Strains Gram-negative Bacterium wzz gene Modal Length Escherichia
coli wzzK12 Short/medium: <16 repeat units GenBank: AAC75088
Salmonella enterica ser. wzzB Long: 16 to 35 repeat units
Enteritidis GenBank: AM933172.1 wzzBfepE Very Long: >100 repeat
units GenBank: CP007468.1 Salmonella enterica ser. wzzST Long: 16
to 35 repeat units Typhimurium GenBank: Z17278.1 wzzFepE Very Long:
>100 repeat units NCBI Reference Sequence: NC_003197.1
Salmonella enterica ser. wzzB Short/medium: <16 repeat units
Paratyphi A GenBank: CP011967.1 Salmonella enterica ser. wzzB Long:
16 to 35 repeat units Newport GenBank: CP007216.1 wzzBfepE Very
Long: >100 repeat units GenBank: CP007216.1 Shigella flexneri
wzzSF Intermediate: 11-17 repeat units GenBank: X71970.1
wzz.sub.pHS-2 Very Long: 90-100 repeat units Salmonella enterica
ser. wzzSTY Long: 16 to 35 repeat units Typhi GenBank: CAD02441
Pseudomonas aeruginosa wzz1 Long: 20 to 50 repeat units GenBank:
AE004091.2 Pseudomonas aeruginosa wzz2 Very Long: >100 repeat
units GenBank: AE004091.2 Vibrio cholerae wzz.sub.O139 Short: 1
repeat unit GenBank: X90547.1 Yersinia pestis wzzYP GenBank:
CAC92336
In Salmonella enterica serovar Typhimurium, we observed that
despite encoding a Wzz protein that specifies intermediate modal
length O-polysaccharide, the LPS is primarily short with the
intermediate molecular weight population poorly expressed under
normal growth conditions. In certain embodiments, overexpression of
the intermediate O-polysaccharide modal length wzz gene from a
plasmid overcame this deficiency, resulting in the production of
.about.10-fold higher levels of the desired saccharide size.
Salmonella enterica serovar Paratyphi A is a serogroup A Salmonella
producing OPS that are structurally very similar to Salmonella
enterica serovar Typhimurium [8], and express almost entirely
short-chain OPS. In certain embodiments of this invention,
overexpression of wzzB from Salmonella enterica serovar Typhimurium
in Salmonella enterica serovar Paratyphi A shifted the saccharide
population to intermediate length LPS. Shigella flexneri 2a
expresses separate chromosomally- and plasmid-encoded wzz genes
that specify either short or very-long LPS types [9]. These wzz
genes are discordantly regulated, and neither produces the modal
length specified by Salmonella enterica serovar Typhimurium wzzB.
High level expression of wzzB from Salmonella enterica serovar
Typhimurium in Shigella flexneri supplanted almost fully the action
of the endogenously encoded Wzz proteins, producing a homogenous
population of relatively intermediate molecular weight LPS. This
discovery as further described herein provides precedent for
shifting the saccharide size from both long and short towards an
intermediate and uniform size.
Plasmids as a Tool for Overexpression of Wzz Family of Proteins
Vector DNA can be introduced into host organisms by transformation.
Some vectors not only allow the isolation an dpurificaiton of a
particular DNA but also drive the expression of genes within the
insert DNA. These plasmids are called expression vectors and have
transcriptional promoters, derived from the host cell, immediately
adjacent to the site of insertion. Expression vectors, or
expression constructs, are usually a plasmid or virus designed for
gene expression in cells. Representative plasmids are described in
Table 1.
If the coding region of a gene (without its promoter) is placed at
the site of insertion in the proper orientation, then the inserted
gene will be transcribed into mRNA and translated into protein by
the host cell. The vector is used to introduce a specific gene into
a target cell, and can commandeer the cell's mechanism for protein
synthesis to produce the protein encoded by the gene. Expression
vectors are the basic tools in biotechnology for the production of
proteins. The plasmid is engineered to contain regulatory sequences
that act as enhancer and promoter regions and lead to efficient
transcription of the gene carried on the expression vector. The
goal of a well-designed expression vector is the efficient
production of protein, and this may be achieved by the production
of significant amount of stable messenger RNA, which can then be
translated into protein. The expression of protein may be tightly
controlled and protein is only produced in significant quantity
when necessary through the use of an inducer, in some systems
however the protein may be expressed constitutively. Escherichia
coli is commonly used as the host for protein production, but other
cell types may also be used.
An expression vector must have elements necessary for gene
expression. These may include a strong promoter, the correct
translation initiation sequence such as a ribosomal binding site
and start codon, a strong termination codon, and a transcription
termination sequence. There are differences in the machinery for
protein synthesis between prokaryotes and eukaryotes, therefore the
expression vectors must have the elements for expression that is
appropriate for the chosen host. For example, prokaryotes
expression vectors would have a Shine-Dalgarno sequence at its
translation initiation site for the binding of ribosomes, while
eukaryotes expression vectors would contain the Kozak consensus
sequence
The promoter initiates the transcription and is therefore the point
of control for the expression of the cloned gene. The promoters
used in expression vector are normally inducible, meaning that
protein synthesis is only initiated when required by the
introduction of an inducer such as IPTG. Gene expression however
may also be constitutive (i.e. protein is constantly expressed) in
some expression vectors. Low level of constitutive protein
synthesis may occur even in expression vectors with tightly
controlled promoters.
A 7275-base pair-plasmid pSEC10-wzzB is provided in certain
embodiments described herein (FIG. 2). pSEC10-wzzB is a
non-transmissible low copy number expression plasmid which encodes
resistance to the antibiotic kanamycin. pSEC10-wzzB carries the
984-bp-gene wzzB that encodes a 36.3 kDa (327 amino acid) WzzB
protein that controls O-polysaccharide chain length. Overexpression
of a wzz family protein (e.g., wzzB) may occur from a high copy
number plasmid (i.e., pSE280, pUCP19) or from a low copy plasmid
(i.e., pSEC10) in certain embodiments. In other embodiments,
overexpression of a wzz gene (e.g., wzzB or any wzzB homolog) may
occur from the chromosome. In such cases, the endogenous wzz gene
is or is not deleted. Methods for site-specific insertion of
transgenes into chromosomes are described in McKenzie and Craig,
"Fast, easy and efficient: site-specific insertion of transgenes
into Enterobacterial chromosomes using Tn7 without need for
selection of the insertion event," BMC Microbiology 2006, 6: 39
pp.1-7. For example, the wzzB gene may first be cloned into a high
copy number, ampicillin-resistant plasmid pSE280. wzzB is amplified
from S. Typhimurium 177 using primers. The 1 kb-PCR product was
purified and then digested with BamHI and PstI. The digested
product was ligated to similarly digest pSE280 and electroporated
into E. coli DH5alpha. pSE280-wzzB plasmid DNA was isolated and the
plasmid was subsequently electroporated into bacterial strains of
interest. In other embodiments, wzzB was cloned from pSE280-wzzB
into pSEC10, a non-transmissible low copy number expression plasmid
which encodes resistance to kanamycin. A 984-bp-fragment encoding
wzzB was inserted as a BamHI-NheI fragment into pSEC10 cleaved with
BamHI and NheI. The resultant plasmid pSEC10-wzzB is 7275 base
pairs (bp).
In summary, it has been discovered that overexpression of different
Wzz proteins (e.g., WzzB) allows for a tunable method for control
of oligosaccharide size. This approach as described herein may be
used to generate OPS haptens for several important GNB pathogens
that use the Wzy system (e.g., Acinetobacter, Burkholderia,
Bordetella, Campylobacter, Escherichia coli, Francisella,
Haemophilus, Helicobacter, Pseudomonas, Salmonella enterica,
Shigella, Vibrio, and Yersinia species.) More preferably, the
Gram-negative bacterial strain is selected from the group
consisting of Salmonella enterica serotype Enteritidis CVD 1943,
Salmonella enterica serotype Typhimurium CVD 1925, Salmonella
enterica serotype Paratyphi A CVD 1902, and Shigella flexneri CVD
1208S. This novel genetic approach towards vaccine hapten
production provides an important advance towards enabling efficient
production of O-polysaccharide and core-O-polysaccharide molecules
as vaccine components.
Recombinant Gram-Negative Bacterial Strains Overexpressing Wzz
Family Proteins
Recombinant Gram-negative bacterial strains that constitutively
express a Wzz family protein and produce increased amounts of
long-chain O-polysaccharide for use in conjugates are provided.
Preferable Gram-negative bacterial strains are provided and
discussed in the Examples herein. It is desirable to have any
Gram-negative bacterial strain that overexpresses a Wzz family
protein (e.g., Acinetobacter, Burkholderia, Bordetella,
Campylobacter, Escherichia coli, Francisella, Haemophilus,
Helicobacter, Pseudomonas, Salmonella, Shigella, Vibrio, and
Yersinia). In certain embodiments, overexpression of wzzB from
Salmonella Typhimurium CVD 1925 (177 .DELTA.guaBA .DELTA.clpP
.DELTA.fliD .DELTA.fljB) creates a shift towards the intermediate
(long) LPS phenotype, with approximately tenfold more long-chain
LPS produced relative to CVD 1925 without plasmid, or containing
the empty plasmid vector. Comparable results were found when wzzB
was expressed from high-copy (pSE280) and low-copy (pSEC10)
plasmids. In other embodiments, plasmids expressing wzzB from
Salmonella enterica serotype Typhimurium were used to transform a
heterologous Salmonella serovar (Salmonella enterica serotype
Paratyphi A), as well as a heterologous bacterial species (Shigella
flexneri 2a). When the Salmonella enterica serotype Typhimurium
wzzB was expressed in Salmonella enterica serotype Paratyphi A, the
O-polysaccharide produced was similarly shifted almost entirely
from low-molecular weight to a long modal length. When wzzB from
Salmonella enterica serotype Typhimurium was expressed in Shigella
flexneri 2a CVD 1208S, a modal shift was seen from short and very
long repeat containing OPS, to a uniform high molecular weight
species that was intermediate between the short and very long
O-polysaccharide length.
Lipopolysaccharides Isolated from Gram-Negative Bacterial Strains
Overexpressing Wzz Proteins
In certain embodiments, lipopolysaccharides from Gram-negative
bacteria (e.g., Salmonella Typhimurium) overexpressing a Wzz family
protein in Gram-negative bacterial strains including but not
limited to those in Table 1 are provided. Overexpression of a wzz
family protein may shift lipopolysaccharides from one modal length
to another. For example, those lipopolysaccharides containing
intermediate chain length O-polysaccharides may shift to
lipopolysaccharides containing long chain length O-polysaccharides.
For example, in certain embodiments, overexpression of wzzB from
Salmonella Typhimurium CVD 1925 generates a shift from a low number
of O-polysaccharide repeat units toward the intermediate (long)
lipopolysaccharide. In other embodiments, plasmids expressing a wzz
family protein (e.g., wzzB) can be used to transform a heterologous
Salmonella serovar (i.e., Salmonella Paratyphi A), as well as a
heterologous bacterial species (Shigella flexneri 2a). In certain
embodiments, when expression of Salmonella Typhimurium wzz family
protein (e.g., wzzB) is expressed in Salmonella Paratyphi A, the
O-polysaccharide produced similarly shifts almost entirely from a
low-molecular weight to a long modal length. In other embodiments,
when a wzz family protein (e.g., wzzB) was expressed in Salmonella
flexneri 2a CVD 1208S, a modal shift was seen from short and very
long repeat containing O-polysaccharides, to a uniform high
molecular weight species that was intermediate between the short
and very long O-polysaccharide chain length. A high yield of large
molecular weight lipopolysaccharides containing intermediate or
long O-polysaccharides is preferred. A desired chain length is the
one which produces maximal immunogenicity in the context of a given
vaccine construct.
The main problem with LPS purification protocols that is common in
the art is the contamination of the end product with nucleic acids
and proteins in variable proportions which could potentially
interfere with other applications. In order to eliminate
contaminating protein and nucleic acids, those of skill in the art
have found that treatment with proteinase K, DNase and RNase prior
to extraction step yields a pure product. Isolated LPS samples can
be electrophoresed on 15% SDS-polyacrylamide gels for 13 to 14
hours at 12 mA. Purity of extracted LPS may be evaluated by silver
staining of SDS-PAGE gels and HPLC analysis. The genes may be
stained with silver nitrate and developed with formaldehyde. Sliver
staining is a highly sensitive method capable of detecting as low
as 1 ng LPS and is routinely used for visualization of the band
pattern of purified LPS.
Core-O-Polysaccharide Purification
Purification can be employed to remove unreacted polysaccharide,
protein, or small molecule reaction byproducts. Purification
methods include ultrafiltration, size exclusion chromatography,
density gradient centrifugation, hydrophobic interaction
chromatography, ammonium sulfate fractionation, ion exchange
chromatography, ligand exchange chromatography, immuno-affinity
chromatography, polymyxin-b chromatography, and the like, as are
known in the art. In some embodiments, the conjugation reactions
proceed with higher yield, and generate fewer undesirable small
molecule reaction byproducts. Accordingly, in some embodiments no
purification may be necessary, or only a minor degree of
purification can be desirable.
Methods of purification of core-O-polysaccharides from LPS are
known in the art. After purification of LPS, purified LPS may be
hydrolyzed by heating in 1% (v/v) acetic acid for 90 minutes at 100
degrees Celsius, followed by ultracentrifugation at 142,000.times.g
for 5 hours at 4 degrees Celsius. The supernatant containing the
core-O-polysaccharide is freeze-dried and stored at 4 degrees
Celsius. In certain embodiments, deletion of capsule synthesis
genes to enable simple purification of core-O-polysaccharide is
described. For example, purification of core-O-polysaccharide from
Salmonella Enteritidis CVD 1943 .DELTA.guaBA .DELTA.clpPX
.DELTA.fliD fermentation culture includes the steps of: (i) OPS
extraction via 1% HOAc/100 degrees Celsius; (iii) removal of
bacteria, insoluble lipid A and precipitated protein with
centrifugation and filtration; (iv) concentrate and remove low
molecular weight contaminants by tangential flow filtration; (v)
remove free lipid A, nucleic acid and protein by anion exchange
chromatography; (vi) remove protein in ammonium sulfate
precipitation; (vii) concentrate and buffer exchange with
tangential flow filtration.
The core-O-polysaccharide hapten can be isolated by methods
including, but not limited to mild acid hydrolysis to remove lipid
A from LPS. Other embodiments may include use of hydrazine as an
agent for COPS preparation. Preparation of LPS can be accomplished
by known methods in the art. In some embodiments, LPS is prepared
according to methods of Darveau et al. J. Bacteriol.,
155(2):831-838 (1983), or Westphal et al. Methods in Carbohydrate
Chemistry. 5:83-91 (1965) which are incorporated by reference
herein. LPS may be purified by a modification of the methods of
Darveau et al., supra, followed by mild acid hydrolysis to remove
lipid A.
In certain embodiments, core-O-polysaccharides purified from
wild-type, modified, or attenuated Gram-negative bacterial strains
including but limited to those described in Table 1 (e.g.,
Salmonella Typhimurium CVD 1925, Salmonella Paratyphi A CVD 1902,
and Shigella flexneri CVD 1208S) that overexpress a Wzz family
protein (e.g., wzzB) are provided for use as haptens in conjugate
vaccines. In preferred embodiments, the core-O-polysaccharide chain
is purified from the Gram-negative bacterial strain overexpressing
wzz protein for use as a vaccine antigen either as a conjugate or
complexed vaccine.
O-Polysaccharide Purification
Purification methods are known in the art that maximize recovery of
O-polysaccharides are known in the art and are described in Kim, et
al., "Purification of O-specific polysaccharide from
lipopolysaccharide produced by Salmonella enterica serovar
Paratyphi A," Vaccine. 2014 May 1; 32(21):2457-62. Epub 2014 Mar.
12. After fermentation, bacterial cells are concentrated and
washed, the permeate containing the free LPS processed separately
from the cells. The free LPS is then concentrated and washed on a
100 kD ultrafiltration membrane to remove low molecular weight
impurities. The LPS is detoxified by separation of the lipid A from
the O-polysaccharide using acid hydrolysis at 100.degree. C., the
precipitated lipid A was removed by 0.2 m membrane filtration.
Contaminants were then removed by acid precipitation in the
presence of sodium deoxycholate. The O-polysaccharide was then
concentrated and washed with 1M NaCl then water using a 10 kD
ultrafiltration membrane then sterile filtered through a 0.2 m
membrane filter. The cells were treated by acid hydrolysis at
100.degree. C., the remaining cells, cell debris and precipitate
was removed by centrifugation. The filtrate is then treated in the
same way as described above for the free LPS. O-polysaccharide
chains purified from a Gram-negative bacterial strain
overexpressing a wzz family protein for use as a vaccine antigen
either as a conjugate or complexed vaccine are provided. In certain
embodiments, the wzz family protein is wzzB.
Carrier Proteins
Conjugate or complexed vaccines in certain embodiments may contain
the core-O-polysaccharide hapten covalently linked or complexed to
a carrier protein as described in Table 4, which is intended to be
non-limiting. In preferred embodiments, the carrier protein is a
flagellin molecule.
TABLE-US-00003 TABLE 4 Representative Examples of Carrier Proteins
Carrier Protein Flagellin A Flagellin B Phase 1 flagella protein
Phase 2 flagella protein Diptheria toxin or toxoid Genetically
detoxified Diphtheria toxins Cross-reacting material 197 (CRM197)
Tetanus toxin or toxoid Pseudomonas exotoxin A Cholera toxin or
toxoid Group A streptococcal toxins Pneumolysin of Streptococcus
pnneumoniae Pneumococcal surface protein A (PSPA) of Streptococcus
pneumoniae Flimantous haemagglutinin (FHA) FHA fragments of
Bordetella pertussis pili or pilins of Neisseria gonorrhoeae pili
or pilins of Neisseria meningitidis outer membrane proteins of
Neisseria meningitidis, outer membrane proteins of Neisseria
gonorrhoeae C5A peptidase of Streptococcus and surface protein of
Moraxella catarrhalis. Recombinant exoprotein A of Pseudomonas
aeruginosa (rEPA) Haemophilus influenzae protein D
Core-O-polysaccharides and carrier proteins can be conjugated using
known techniques and methods. Certain embodiments are provided
where the core-O-polysaccharide and the carrier protein are
chemically conjugated or complexed using a cross-linker or polymer.
The carrier protein may be from a homologous bacterial strain or a
heterologous bacterial strain. For example, techniques to conjugate
the core-O-polysaccharide and the Phase 1 flagella protein can
include, in part, coupling through available functional groups
(such as amino, carboxyl, thio and aldehyde groups). See, e.g.,
Hermanson, Bioconjugate Techniques (Academic Press; 1992); Aslam
and Dent, eds. Bioconjugation: Protein coupling Techniques for the
Biomedical Sciences (MacMillan: 1998); S. S. Wong, Chemistry of
Protein Conjugate and Crosslinking CRC Press (1991); and Brenkeley
et al., Brief Survey of Methods for Preparing Protein Conjugates
With Dyes, Haptens and Cross-Linking Agents, Bioconjugate Chemistry
3:1 (January 1992).
The core-O-polysaccharide hapten and carrier of the conjugate can
be chemically conjugated using conventional crosslinking agents
such as carbodiimides. Examples of conjugation chemistry used to
achieve efficient synthesis of the hapten-carrier conjugates are
disclosed in Lees, A. et al. 1996, Vaccine 14(3):190-198, and
Shafer, D E et al. 2000, Vaccine 18(13):1273-81; which are
incorporated by reference herein. Linkers and coupling reagents
known to those of ordinary skill in the art are also suitable for
use. Such compounds are discussed in detail by Dick et al.,
Conjugate Vaccines, J. M. Cruse and R. E. Lewis, Jr., eds., Karger,
New York, pp. 48-114, hereby incorporated by reference.
Conjugation may be conducted at a temperature of from about
0.degree. Celsius to about 5.degree. Celsius for about 36 to about
48 hours. In one embodiment, conjugation is conducted at about
4.degree. Celsius for about 36 hours, followed by about an
additional 18 to 24 hours at a temperature of from about 20.degree.
Celsius to about 25.degree. Celsius. In another embodiment,
conjugation is conducted for about 18 hours at about 20.degree. to
240 Celsius such that the residual cyanate groups react with water
and decompose. Longer or shorter conjugation times and/or higher or
lower conjugation temperatures can be employed, as desired. In some
embodiments, it is desirable, however, to conduct the conjugation
reaction, at least initially, at low temperatures, for example,
from about 0.degree. Celsius to about 5.degree. Celsius, such as
about 4.degree. Celsius, so as to reduce the degree of
precipitation of the conjugate.
Pharmaceutical Compositions
In some embodiments, the conjugate or complexed vaccine is
administered to a subject as a pharmaceutical composition. This
pharmaceutical composition may contain salts, buffers, adjuvants,
or other compounds that are desirable for improvement of efficacy.
In some embodiments, adjuvants are used in an effort to induce or
improve a specific immune response. Descriptions of adjuvants are
described in Warren et al. (Ann. Rev. Biochem., 4:369-388, 1986),
the entire disclosure of which is hereby incorporated by reference.
Examples of materials suitable for use in conjugate vaccine
compositions are known to those of skill in the art and are
described in Remington's Pharmaceutical Sciences (Osol, A, Ed, Mack
Publishing Co, Easton, Pa., pp. 1324-1341 (1980), which disclosure
is incorporated herein by reference).
In some embodiments, the conjugate vaccine can be formulated into
liquid gaseous, or solid preparations (including tablets and
capsules, solutions, suspensions, emulsions, vapors, powders, and
the like) for, e.g., nasal, rectal, buccal, vaginal, peroral,
intragastric, mucosal, perlinqual, alveolar, gingival, olfactory,
or respiratory mucosa administration. Suitable forms for such
administration include solutions, suspensions, emulsions, syrups,
and elixirs. The conjugate vaccines can also be formulated for
parenteral, subcutaneous, intradermal, intramuscular,
intraperitoneal or intravenous administration, injectable
administration, sustained release from implants, or administration
by eye drops. Suitable forms for such administration include
sterile suspensions and emulsions. Such conjugate vaccines can be
in admixture with a suitable carrier, diluent, or excipient such as
sterile water, physiological saline, glucose, and the like. The
conjugate vaccines can also be lyophilized. The conjugate vaccines
can contain auxiliary substances such as wetting or emulsifying
agents, pH buffering agents, gelling or viscosity enhancing
additives, preservatives, flavoring agents, colors, fillers, and
the like, depending upon the route of administration and the
preparation desired
A person of ordinary skill in the art may prepare suitable
preparations consulting references such as Remington: The Science
and Practice of Pharmacy (22nd edition, 2012; 21st edition, 2005),
Pharmaceutical Press; Remington: The Science and Practice of
Pharmacy (20th edition, 2003; 19th edition, 1995), Lippincott
Williams & Wilkins; and Remington's Pharmaceutical Sciences
(18th edition, 1990), Mack Printing Co.; which are incorporated
herein by reference in their entirety.
Administration
In some embodiments, the conjugate vaccine is administered
parenterally. Parenteral vehicles include sodium chloride solution,
Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's
or fixed oils and other vehicle known to one of skill in the art.
Intravenous vehicles may include fluid and nutrient replenishers,
electrolyte replenishers (such as those based on Ringer's
dextrose). In some embodiments, the conjugate vaccines for
parenteral administration may be in the form of a sterile
injectable preparation, such as a sterile injectable aqueous or
nonaqueous solutions, suspensions, and emulsions. Examples of
nonaqueous solvents are propylene glycol, polyethylene glycol,
vegetable oils such as olive oil, and injectable organic esters
such as ethyl oleate. Carriers or occlusive dressings can be used
to increase skin permeability and enhance antigen absorption.
Suspensions may be formulated according to methods well known in
the art using suitable dispersing or wetting agents and suspending
agents. The sterile injectable preparation may also be a sterile
injectable solution or suspension in a parenterally acceptable
diluent or solvent, such as a solution in 1, 3-butanediol. Suitable
diluents include, for example, water, Ringer's solution and
isotonic sodium chloride solution. In addition, sterile fixed oils
may be employed conventionally as a solvent or suspending medium.
For this purpose, any bland fixed oil may be employed including
synthetic mono- or diglycerides. In addition, fatty acids such as
oleic acid may likewise be used in the preparation of injectable
preparations.
Liquid dosage forms for oral administration may generally comprise
a liposome solution containing the liquid dosage form. Suitable
forms for suspending liposomes include emulsions, suspensions,
solutions, syrups, and elixirs containing inert diluents commonly
used in the art, such as purified water. Besides the inert
diluents, such compositions can also include adjuvants, wetting
agents, emulsifying and suspending agents, or sweetening,
flavoring, or perfuming agents.
In some embodiments, the conjugate vaccine is provided as a liquid
suspension or as a freeze-dried product. Suitable liquid
preparations include, e.g., isotonic aqueous solutions,
suspensions, emulsions, or viscous compositions that are buffered
to a selected pH. Transdermal preparations include lotions, gels,
sprays, ointments or other suitable techniques. If nasal or
respiratory (mucosal) administration is desired (e.g., aerosol
inhalation or insufflation), compositions can be in a form and
dispensed by a squeeze spray dispenser, pump dispenser or aerosol
dispenser. Aerosols are usually under pressure by means of a
hydrocarbon. Pump dispensers can preferably dispense a metered dose
or a dose having a particular particle size, as discussed
below.
In certain embodiments, the conjugate vaccine may be provided in
the form of a solution, suspension and gel. In other embodiments,
formulation of the conjugate vaccine may contain a major amount of
water that may be purified in addition to the active ingredient.
Minor amounts of other ingredients such as pH adjusters,
emulsifiers, dispersing agents, buffering agents, preservatives,
wetting agents, jelling agents, colors, and the like can also be
present.
Pharmaceutical compositions may be administered in a number of ways
either alone or in combination with other treatments, either
simultaneously or sequentially depending on the condition to be
treated and whether local or systemic treatment is desired.
Administration may be by direct injection, or by intrathecal
injection, or intravenously, or by stereotaxic injection. The route
of administration can be selected based on the disease or
condition, the effect desired, and the nature of the cells being
used. Actual methods of preparing dosage forms are known, or will
be apparent, to those skilled in the art. (See Remington: The
Science and Practice of Pharmacy, 22nd edition, 2012,
Pharmaceutical Press.) Where a composition as described herein is
to be administered to an individual, administration is preferably
in a "prophylactically effective amount" or a "therapeutically
effective amount," this being sufficient to show benefit to the
individual.
The number of administrations can vary. Alternatively,
administration may be, for example, daily, weekly, or monthly. The
actual amount administered, and rate and time-course of
administration, will depend on the age, sex, weight, of the
subject, the stage of the disease, and severity of what is being
treated (including prophylactic treatment). Prescription of
treatment, e.g., decisions on dosage is within the responsibility
of general practitioners and other medical doctors.
Kits
In some embodiments, kits comprise one or more vaccines of the
invention. The materials described herein as well as other
materials can be packaged together in any suitable combination as a
kit useful for performing, or aiding in the performance of, the
disclosed method. It is useful if the kit components in a given kit
are designed and adapted for use together in the disclosed
method.
In some embodiments, the kit is a package which houses one or more
containers that comprises one or more pharmaceutical compositions.
The pharmaceutical compositions may be placed within containers, or
kits, along with packaging material which provides instructions
regarding the use of such pharmaceutical compositions. Generally,
such instructions will include a tangible expression describing the
reagent concentration, as well as within certain embodiments,
relative amounts of excipient ingredients or diluents (e.g., water,
saline or PBS) which may be necessary to reconstitute the
pharmaceutical composition. In some embodiments, the kit may
comprise one or more therapeutic agents or diagnostic tool.
In some embodiments, the kit may comprise a schedule for
immunization of the pharmaceutical composition. In some
embodiments, a cocktail containing two or more conjugate vaccines
can be included, or separate pharmaceutical compositions containing
different conjugate vaccines or therapeutic agents. The kit may
contain separate doses of the conjugate vaccine for serial or
sequential administration. The kit also can comprise one or more
pharmaceutical compositions comprising the attenuated bacterial
strains as described herein for use as a conjugate vaccine, or for
use as a vaccine as a prime or boost in conjunction with a
conjugate vaccine described herein.
In some embodiments, the kit further comprises a device or devices
suitable for delivery. For example, the kit may further comprise
syringes another device (e.g., inhaler) for administration of the
conjugate vaccine or other therapeutic agents with instructions for
administration, storage, reconstitution, and administration of any
or all conjugate vaccine or other therapeutic agents included. A
plurality of containers reflecting the number of administrations to
the subject may be included.
Methods of Enhancing Immune Response
Methods are provided for inducing an immune response in a subject
comprising administering to a subject a conjugate vaccine or
complexed vaccine comprising a core-O-polysaccharide hapten
covalently linked or complexed to a carrier protein in an amount
sufficient to induce an immune response in the subject. All strains
do not have to be administered within the same inoculum, but may be
divided into separate doses administered on sequential days to
achieve complete coverage.
In some embodiments, methods are provided for inducing an immune
response, comprising administering to a subject in need thereof an
immunologically-effective amount of a conjugate Salmonella enterica
serovar Typhimurium vaccine, comprising conjugates from bacterial
strains described herein overexpressing wZZ (e.g., wzzB) and/or
repressing wZZ, wherein the conjugates comprise a
core-O-polysaccharide hapten and a carrier antigen, wherein at
least one of the hapten antigens or carrier antigens is from the
Salmonella enterica serovar Typhimurium overexpressing wzz (e.g.,
wzzB). In some embodiments, the hapten antigen is a
core-O-polysaccharide (COPS) from the Salmonella enterica serovar
Typhimurium overexpressing wZZ and the carrier is a phase 1
flagella protein (FliC) or an antigenic fragment or derivative
thereof from the Salmonella enterica serovar Typhimurium.
Immunogenicity of the conjugates of the invention is greater than
the immunogenicity of at least one of the carriers alone. Methods
of measuring immunogenicity are well known to those in the art and
primarily include measurement of serum antibody including
measurement of amount, avidity, and isotype distribution at various
times after injection of the conjugate vaccine. Greater
immunogenicity may be reflected by a higher titer and/or increased
life span of the antibodies. Immunogenicity may also be measured by
the ability to induce protection to challenge with noxious
substances or virulent organisms. Immunogenicity may also be
measured by the ability to immunize neonatal and/or immune
deficient mice. Immunogenicity may be measured in the patient
population to be treated or in a population that mimics the immune
response of the patient population.
The conjugate vaccine is administered alone in a single dose or
administered in sequential doses. In other embodiments, the
conjugate vaccine is administered as a component of a homologous or
heterologous prime/boost regimen in conjunction with one or more
vaccines, such as a subunit vaccine or one or more attenuated
Gram-negative bacterial strains as described herein. In some
embodiments, a single boost is used. In other embodiments, multiple
boost immunizations are performed. In particular embodiments drawn
to a heterologous prime/boost, a mucosal bacterial prime/parenteral
conjugate boost immunization strategy is used. For example, one or
more (or all) of the live (or killed) attenuated Gram-negative
bacterial strains as taught herein can be administered orally to a
subject and the subject can be subsequently boosted parentally with
a multivalent conjugate vaccine as described herein.
The time interval between the first and second vaccinations is 1
week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5
months, 6 months, 7 months, 8 months, 9 months, 10 months, 11
months, 1 year, 1.5 years and 2 years. Immunization schedules have
been scheduled and administered at 1-month intervals, with a
priming immunization followed by two sequential booster
immunizations.
The particular dosage depends upon the age, weight, sex and medical
condition of the subject to be treated, as well as on the method of
administration. Suitable doses can be readily determined by those
of skill in the art.
The conjugate vaccine of the invention can be administered by
either single or multiple doses of an effective amount. In some
embodiments, an effective amount of the compositions of the
invention can vary from 0.01-5,000 .mu.g/ml per dose. In other
embodiments, an effective amount of the composition of certain
embodiments can vary from 0.1-500 .mu.g/ml per dose, and in other
embodiments, it can vary from 10-300 .mu.g/ml per dose. In one
embodiment, the dosage of the conjugate administered will range
from about 10 .mu.g to about 1000 .mu.g. In another embodiment, the
amount administered will be between about 20 .mu.g and about 500
.mu.g. In some embodiments, the amount administered will be between
about 75 g and 250 .mu.g. Greater doses may be administered on the
basis of body weight. The exact dosage can be determined by routine
dose/response protocols known to one of ordinary skill in the
art.
The conjugate vaccine may confer resistance to Gram-negative
bacterial infections by either passive immunization or active
immunization. In one embodiment of passive immunization, the
conjugate vaccine is provided to a subject (i.e. a human or
mammal), and the elicited antisera is recovered and directly
provided to a recipient suspected of having an infection as
described herein.
The administration of the conjugate vaccine (or the antisera which
it elicits) may be for either a "prophylactic" or "therapeutic"
purpose. When provided prophylactically, the vaccine is provided in
advance of any symptom of bacterial infection. The prophylactic
administration of the vaccine serves to prevent or attenuate any
subsequent infection. When provided therapeutically, the vaccine is
provided upon the detection of a symptom of actual infection. The
therapeutic administration of the vaccine serves to attenuate any
actual infection.
4. Summary of Experimental Results
The following is a summary of results of experiments described in
the Examples of this application: Constitutive high-level
expression of Wzz protein alters the proportion of a defined modal
length population of OPS. Overexpression of wzzB from Salmonella
enterica serovar Typhimurium CVD 1925 resulted in a shift from low
OPS toward an intermediate (long) LPS phenotype, with about 10-fold
more long-chain LPA produced relative to CVD 1925 without plasmid,
or containing the empty plasmid vector. Salmonella enterica serovar
Typhimurium wzzB expressed in Salmonella enterica serovar Paratyphi
A resulted in OPS production shifted from low-molecular weight to a
long-modal length. Salmonella enterica serovar Typhimurium wzzB
expressed in Shigella flexneri 2a CVD 1208S resulted in OPS
produced shifted from a short and very long repeat unit to a
uniform high molecular weight species that intermediate between the
short and very long O chain length.
5. Examples
The invention is illustrated herein by the experiments described by
the following examples, which should not be construed as limiting.
The contents of all references, pending patent applications and
published patents, cited throughout this application are hereby
expressly incorporated by reference. Those skilled in the art will
understand that this invention may be embodied in many different
forms and should not be construed as limited to the embodiments set
forth herein. Rather, these embodiments are provided so that this
disclosure will fully convey the invention to those skilled in the
art. Many modifications and other embodiments of the invention will
come to mind in one skilled in the art to which this invention
pertains having the benefit of the teachings presented in the
foregoing description. Although specific terms are employed, they
are used as in the art unless otherwise indicated.
Example 1: Materials and Methods
Construction of Safe Attenuated Gram-Negative Bacterial Strains
One aspect of certain embodiments is the construction of clinically
well tolerated attenuated strains of Salmonella enterica serovar
Typhimurium and Salmonella enterica serovar Paratyphi A for use as
live oral vaccines for safer and more economical manufacture as
well as using these strains in a heterologous mucosal
prime/parenteral boost immunization strategy to broaden both the
immunogenicity and protective capacity of the conjugate vaccine.
For example, both the guaBA and clpP genes from Salmonella enterica
serovar Typhimurium strain 177 and both the guaBA and clpX genes
were deleted from Salmonella enterica serovar Paratyphi strain CVD
1902, using a highly efficient site-directed mutagenesis strategy.
Deletion of guaBA, clpP or clpX and fljB was achieved by Lambda
Red-mediated mutagenesis and was performed as described by Datsenko
et al. 2000 (Proc. Natl. Acad. Sci. U.S.A. 97:6640-6645), with
modifications (as described by S. Tennant, et al. Infect Immun 2011
79:4175-85 incorporated herein). Deletion regions in the
chromosomes of each of the resulting attenuated strains were
sequenced to confirm that only the intended genes and DNA sequences
had been removed. Further mutations were introduced into fliD to
secrete FliC monomers, as well as deleting the fljBA locus encoding
phase 2 flagellin FljB and the FliC repressor protein FljA from
Salmonella enterica serovar Typhimurium. For Shigella flexneri CVD
1208S, deletions in guaBA, set and sen were created using
homologous recombination as described by Kotloff et al 2007 (Human
Vaccines 3:628-275). Deletions in guaBA and clpX were introduced in
Salmonella enterica serovar Newport Chile 361 by homologous
recombination using the method of Datsenko and Wanner to obtain
Salmonella enterica serovar Newport CVD 1962. Detailed discussion
of the preparation of safe attenuated Gram-negative bacterial
strains shown, but not limited to those in Table 1, for use as
reagent strains is also described in U.S. Patent Application Pub.
No. 2013/0129776 A1.
Bacterial Strains, Plasmids, and Culture Conditions
Plasmids as described herein in Table 3 were used for chromosomal
deletions. (Datsenko et al., 2000 (Proc. Natl. Acad. Sci. U.S.A.
97:6640-6645). Plasmid pCR-Blunt II-TOPO (Invitrogen, Carlsbad,
Calif.) was used to clone blunt-ended polymerase chain reaction
(PCR) products. Salmonella strains were maintained on animal
product-free Lennox media (Athena Environmental Sciences,
Baltimore, Md.) at 370 Celsius. All bacterial strains were
maintained in Hi-Soy (HS) bacteriological media (5 g/L sodium
chloride, 10 g/L soytone [Teknova, Hollister, Calif.], 5 g/L
Hy-yest [Sigma Aldrich, St. Louis, Mo.]) at 37.degree. C. Growth
media for all guaBA mutants were supplemented with guanine (0.001%
weight [w]/volume [v]). When required, antibiotics were used at a
final concentration of 50 .mu.g/ml kanamycin. Chemically defined
medium (Rondin et al., 2011, Clin. Vaccine Immunol. 18:460-468) was
prepared by combining 5 ml 1 M MgSO.sub.4, 130 .mu.l 0.1 M thiamine
hydrochloride, 25 ml 20% glycerol, 5 ml trace salts solution (0.2 g
5H.sub.2O, 0.08 sodium iodide, 3.00 g MnSO.sub.4.H.sub.2O), 0.20
grams Na2MoO.sub.4.2H.sub.2O, 0.02 g boric acid, 0.50 g
CoCl.sub.2.6H.sub.2O, 0.50 g CaSO.sub.4.2H.sub.2O, 7.00 g
ZnCl.sub.2, 22.0 g FeSO.sub.4.7H.sub.2O per liter) with 1 L base
solution (13.3 g KH.sub.2PO.sub.4, 1.7 g citric acid).
DNA Methods
Plasmid extraction and gel purification of DNA fragments was
performed using Wizard (Promega, Madison, Wis.) and QIAquick Gel
Extraction (QIAGEN, Valencia, Calif.) kits, respectively, as
directed by the manufacturer. All restriction enzymes were
purchased from New England Biolabs (Ipswich, Mass.).
PCR amplifications were routinely performed with 1-2.5 U Taq DNA
polymerase (Denville Scientific, Metuchen, N.J., or Genscript,
Piscataway, N.J.), 1.times.PCR Buffer containing 1.5 mM MgCl.sub.2,
200 .mu.M each dNTP and 1 .mu.M of each primer in a reaction volume
of 20 to 50 .mu.l in an Eppendorf Mastercycler. For PCRs using long
primers (>25 bp) the amount of MgCl.sub.2 was increased as
necessary. When error-free and/or blunt end PCR products were
required, Vent.sub.R.sup.TM DNA polymerase (New England Biolabs,
Ipswich, Mass.) was used according to the manufacturer's
instructions.
LPS Isolation and Visualization
Samples were prepared from cultures grown in media without shaking
at 37 degrees Celsius. After overnight growth, bacterial cultures
were adjusted to an OD.sub.600 of 1.0 and then 2 ml of culture was
centrifuged at maximum speed for 2 minutes at 4.degree. C. The
supernatant was removed and the pellet re-suspended in 100 .mu.l
lysis buffer (0.1 M Tris-HCl, pH6.8, 2% SDS, 10% Glycerol, 4%
2-mercapthoethanol). The sample was boiled at 95-100.degree. C. for
10 minutes to lyse the cells. Proteins were digested by adding 25
.mu.g Proteinase K. The sample was incubated at 60.degree. C. for 1
hour. The sample was boiled for 10 minutes and then allowed to cool
on ice. Twenty microliters of the sample was electrophoresed on
4-15% Mini Protean TGX stain free gels (BioRad Laboratories) with
the CandyCane Glycoprotein ladder (Life Technologies). LPS was
stained using Pro-Q Emerald 300 LPS Gel Stain (Life Technologies)
as per the manufacturer's instructions.
Example 2: Generation of Strains that Overexpress wzzB
Expression of wzzB from a High Copy Number Plasmid
The wzzB gene was first cloned into a high copy number,
ampicillin-resistant plasmid pSE280. wzzB was amplified from
Salmonella enterica serovar Typhimurium 177 using primers
TABLE-US-00004 wzzBF-BamHI: (SEQ ID NO. 1) 5'
AAAGGATCCATGACAGTGGATAGTTATACG 3' and wzzB-PstI: (SEQ ID. NO. 2) 5'
AAACTGCAGTTACAAGGCTTTTGGCTTATAG 3'.
The 1 kb-PCR product was purified using a QIAQUICK PCR Purification
Kit (Qiagen) and then digested with BamHI and PstI. The digested
product was ligated to similarly digest pSE280 and electroporated
into E. coli DH5alpha. pSE280-wzzB plasmid DNA was isolated and the
plasmid was subsequently electroporated into bacterial strains of
interest. Expression of wzzB from a Low Copy Number Plasmid
wzzB was cloned from pSE280-wzzB into pSEC10, a non-transmissible
low copy number expression plasmid which encodes resistance to
kanamycin. A 984-bp-fragment encoding wzzB was inserted as a
BamHI-NheI fragment into pSEC10 cleaved with BamHI and NheI. The
resultant plasmid pSEC10-wzzB is 7275 base pairs (bp).
Example 4: Plasmid Construction
The 7275-base pair (bp)-plasmid pSEC10-wzzB is a non-transmissible
low copy number expression plasmid which encodes resistance to
kanamycin. pSEC10-wzzB also carries the 984-bp-gene wzzB that
encodes a 36.3 kDa (327 amino acid) WzzB protein which controls the
chain length of O-polysaccharide. pSEC10-wzzB was constructed using
the original expression plasmid pSEC10 (Stokes et al. 2007.
Infection and Immunity. 75(4): 1827-34). To construct pSEC10-wzzB,
a 984-bp-fragment encoding wzzB was inserted as a BamHI-NheI
fragment into pSEC10 cleaved with BamHI and NheI (FIG. 2),
Example 5: Overexpression of wzzB in the Homologous Organism
In order to assess whether constitutive high-level expression of a
homologous Wzz protein could alter the proportion of a defined
modal length population, the WzzB protein from Salmonella
Typhimurium was expressed in a strain of Salmonella Typhimurium
that was demonstrated to produce predominantly low OPS repeats.
Expression of wzzB from Salmonella Typhimurium CVD 1925 (177
.DELTA.guaBA .DELTA.clpP .DELTA.fliD .DELTA.fljB) resulted in a
shift towards the intermediate (long) LPS phenotype, with about
10-fold more long-chain LPS produced relative to CVD 1925 without
plasmid, or containing the empty plasmid vector (FIG. 3).
Comparable results were found when wzzB was expressed from
high-copy (pSE280) and low-copy (pSEC10) plasmids.
Example 6: Heterologous Expression in Other Serovars of the Same
Species and Other Species Using the Wzy System
In order to test whether expression of a Wzz protein could confer
similar modal length changes in other bacteria that use the Wzy
system and express varying modal length LPS, the plasmids
expressing wzzB from Salmonella enterica serovar Typhimurium were
used to transform a heterologous Salmonella serovar (Salmonella
Paratyphi A), as well as a heterologous bacterial species (Shigella
flexneri 2a). When the Salmonella enterica serovar Typhimurium wzzB
was expressed in Salmonella enterica serovar Paratyphi A, the OPS
produced was similarly shifted almost entirely from low-molecular
weight to a long modal length (FIG. 4). When wzzB from Salmonella
enterica serovar Typhimurium was expressed in Shigella flexneri 2a
CVD 1208S, a modal shift was seen from short and very long repeat
containing OPS, to a uniform high molecular weight species that was
intermediate between the short and very long O chain length (FIG.
5).
Example 7: Overexpression of wzzB in Salmonella Newport CVD
1962
When wzzB from Salmonella enterica serovar Typhimurium was
expressed in Salmonella enterica serovar Newport CVD 1962 (harbors
mutations in guaBA and clpX), using plasmid pSEC10, we observed an
increase in O antigen length. Purified native COPS from Salmonella
enterica serovar Newport CVD 1962 was characterized as shown in
FIG. 6. A comparison was conducted between purified native COPS
from Salmonella enterica serovar Newport CVD 1962 (very-long+long
chain length) vs. COPS from Salmonella enterica serovar Newport
wzzB CVD 1966 (possesses mutations in guaBA and htrA and expresses
long-chain O antigen only). Salmonella enterica serovar Typhimurium
wzzB (long-chain length OPS) overexpressed in Salmonella enterica
serovar Newport generated a >98% production of long-chain length
COPS (FIG. 7).
Example 8. Purification and Characterization of COPS from
Salmonella enterica Serovar Typhimurium
Salmonella enterica serovar Typhimurium COPS for use as vaccine
antigen and for ELISA analyses was purified from reagent strain CVD
1925 wzzB, an attenuated vaccine strain that was engineered to
express long-chain OPS (16-35 repeating units) due to
overexpression of wzzB, a member of the polysaccharide
co-polymerase family. COPS purified from CVD 1925 wzzB (STm COPS)
demonstrated a single, sharply-defined population that was
determined to be 19.8 kDa by SEC-MALS analysis. HPAEC-PAD analysis
confirmed the presence of expected O12 monosaccharides, and
glucosylation at .about.21% of OPS repeats based on the ratio with
rhamnose. Purified STm COPS was recognized by monoclonal antibodies
against the O4 and O5 epitopes. 1H and 13C NMR indicated variable
O-acetylation at abequose C2 and C2/3 of rhamnose. A comparable
pattern of glucosylation and O-acetylation was found for the OPS of
Salmonella enterica serovar Typhimurium strain D65, a previously
described Malian Salmonella enterica serovar Typhimurium ST313
clinical isolate that was used herein for challenge studies in
mice. D65 COPS demonstrated a bimodal size distribution with a
population that was equivalent in size to CVD 1925 wzzB COPS, as
well as a higher molecular weight species. Polysaccharide O-acetyl
groups are stable at neutral pH, but labile under alkaline
conditions. In order to assess the site-specific susceptibility of
the O-acetyl groups to base treatment, residual O-acetylation at
these positions was assessed after exposure to different pH
conditions. It was found that O-acetylation was maintained at pH 7
and pH 8, but that O-acetyl groups were removed at approximately
equivalent levels from abequose and rhamnose at pH levels greater
than 9. ELISA analyses with anti-O4 and O5 monoclonal antibodies
confirmed that pH 10 treatment resulted in marked loss of the O5
epitope while maintaining O4 antigenicity.
Example 9. Immunogenicity and Protective Activity of S. Typhimurium
COPS: Flagellin Glyconjugates Synthesized with Different
Chemistries
Conjugates of purified STm COPS and Salmonella enterica serovar
Typhimurium phase 1 flagellin (FliC) were generated by different
strategies. Lattice conjugates were initially generated by
multipoint conjugation between random STm COPS polysaccharide
hydroxyls and amino groups on ADH-derivatized flagellin proteins
using CDAP cyanylation chemistry (STm COPS.sup.Lat:FliC).
Accordingly, while efficient formation of high molecular weight
conjugates was observed it was found that there was a marked loss
of polysaccharide O-acetyls after conjugation. Mice immunized with
this conjugate generated significant levels of anti-COPS IgG
compared to controls administered PBS; however the geometric mean
titers (GMTs) were low and no difference was seen when the sera
were assessed with STm dOAc-COPS. Infection with 1.times.10.sup.5
or 5.times.10.sup.5 CFU of Salmonella enterica serovar Typhimurium
D65 produced 70% and 100% mortality respectively in unimmunized
controls whereas immunization with the STm COPS.sup.Lat:FliC
conjugate provided 43% (P=0.11) and 30% (P=0.0202) protection
against these challenge levels.
In order to produce a conjugate formulation that retained OPS
O-acetyls, sun-type conjugates were generated by functionalization
of the STm COPS reducing end KDO carbonyl by oximation with an
aminooxy thiol reagent to form a free thiol that was then coupled
to maleimide derivatized protein lysines (STm COPS.sup.KDO:FliC).
This approach allowed the entire conjugation to be performed at
approximately neutral pH. Conjugates generated by this method
maintained levels of O-acetylation comparable with the native
polysaccharide. Mice immunized with STm COPS.sup.KDO:FliC
manifested robust anti-STm COPS IgG titers for which the GMT was
.about.1,000-fold higher than that achieved with the lattice
conjugate. Titers to native STm COPS were .about.10-fold higher
than those directed against dOAc STm COPS, and thus similar to the
profile found for sera from mice immunized with CVD 1931.
Immunization with this conjugate also induced high anti-flagellin
titers in all mice that were comparable to those achieved after
immunization with unconjugated flagellin. Mice immunized with STm
COPS.sup.KDO:FliC were markedly protected against fatal challenge
with Salmonella enterica serovar Typhimurium D65. Infection at the
high (5.times.10.sup.5 CFU) and low (1.times.10.sup.5 CFU) D65
challenge doses in this experiment were sufficient to cause >90%
mortality in unimmunized controls, with mice that received the
higher dose succumbing more rapidly. Mice immunized with STm
COPS.sup.KDO:FliC were fully (100% vaccine efficacy, P<0.0001)
or partially (95% vaccine efficacy, P<0.0001) protected against
fatal infection at these low and high challenge doses
respectively.
REFERENCES
All references cited herein are hereby incorporated by reference in
their entirety. 1. Simon R, Tennant S M, Wang J Y, Schmidlein P J,
Lees A, et al. (2011) Salmonella enterica serovar enteritidis core
O-polysaccharide conjugated to H:g,m flagellin as a candidate
vaccine for protection against invasive infection with S.
enteritidis. Infect Immun 79: 4240-4249. 2. Watson D C, Robbins J
B, Szu S C (1992) Protection of mice against Salmonella typhimurium
with an O-specific polysaccharide-protein conjugate vaccine. Infect
Immun 60: 4679-4686. 3. Cohen D, Ashkenazi S, Green M S, Gdalevich
M, Robin G, et al. (1997) Double-blind vaccine-controlled
randomised efficacy trial of an investigational Shigella sonnei
conjugate vaccine in young adults. Lancet 349: 155-159. 4. Bardotti
A, Averani G, Berti F, Berti S, Carinci V, et al. (2008)
Physicochemical characterisation of glycoconjugate vaccines for
prevention of meningococcal diseases.
Vaccine 26: 2284-2296. 5. Svenson S B, Lindberg A A (1981)
Artificial Salmonella vaccines: Salmonella typhimurium
O-antigen-specific oligosaccharide-protein conjugates elicit
protective antibodies in rabbits and mice. Infect Immun 32:
490-496. 6. Robbins J B, Kubler-Kielb J, Vinogradov E, Mocca C,
Pozsgay V, et al. (2009) Synthesis, characterization, and
immunogenicity in mice of Shigella sonnei O-specific
oligosaccharide-core-protein conjugates. Proc Natl Acad Sci USA
106: 7974-7978. 7. Kubler-Kielb J, Vinogradov E, Mocca C, Pozsgay
V, Coxon B, et al. (2010) Immunochemical studies of Shigella
flexneri 2a and 6, and Shigella dysenteriae type 1 O-specific
polysaccharide-core fragments and their protein conjugates as
vaccine candidates. Carbohydr Res 345: 1600-1608. 8. Lindberg A A,
Le Minor L (1984) Serology of Salmonella. In: Bergan T, editor.
Methods in Microbiology: Academic Press. pp. 1-141. 9. Carter J A,
Jimenez J C, Zaldivar M, Alvarez S A, Marolda C L, et al. (2009)
The cellular level of O-antigen polymerase Wzy determines chain
length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.
Microbiology 155: 3260-3269. 10. Islam S T, Lam J S (2014)
Synthesis of bacterial polysaccharides via the Wzx/Wzy-dependent
pathway. Can J Microbiol 60: 697-716
SEQUENCE LISTINGS
1
2130DNAArtificial SequenceSynthetic primer wzzBF-BamHI 1aaaggatcca
tgacagtgga tagttatacg 30231DNAArtificial SequenceSynthetic primer
wzzB-PstI 2aaactgcagt tacaaggctt ttggcttata g 31
* * * * *
References