U.S. patent number 10,550,421 [Application Number 15/606,045] was granted by the patent office on 2020-02-04 for oligonucleotide-mediated quantitative multiplexed immunoassays.
This patent grant is currently assigned to The University of Chicago. The grantee listed for this patent is The University of Chicago. Invention is credited to Ryan Duggan, Amy Flor, Stephen Kron.
![](/patent/grant/10550421/US10550421-20200204-D00000.png)
![](/patent/grant/10550421/US10550421-20200204-D00001.png)
![](/patent/grant/10550421/US10550421-20200204-D00002.png)
![](/patent/grant/10550421/US10550421-20200204-D00003.png)
![](/patent/grant/10550421/US10550421-20200204-D00004.png)
![](/patent/grant/10550421/US10550421-20200204-D00005.png)
![](/patent/grant/10550421/US10550421-20200204-D00006.png)
![](/patent/grant/10550421/US10550421-20200204-D00007.png)
![](/patent/grant/10550421/US10550421-20200204-D00008.png)
![](/patent/grant/10550421/US10550421-20200204-D00009.png)
![](/patent/grant/10550421/US10550421-20200204-D00010.png)
View All Diagrams
United States Patent |
10,550,421 |
Flor , et al. |
February 4, 2020 |
Oligonucleotide-mediated quantitative multiplexed immunoassays
Abstract
Methods and compositions for quantitative immunoassays are
provided, in which ligand-conjugated probes are used to label
samples and ligand-surfaced microspheres are used as quantitative
reference standards. Certain embodiments provide a method of
quantitative flow cytometry where ligands are oligonucleotides, and
a sample comprising one or more cells is contacted with a
hybridized antibody::fluorophore labeled targeting construct to
label the cells, and the labeled cells are analyzed. In some
embodiments, a population of quantitative labeled oligospheres
labeled with the same fluorescent label as the cells is analyzed
using the flow cytometer and used to create a quantitative standard
curve of cytometer intensity versus molecules fluorescent label per
oligosphere event. A standard curve trendline is established and
used to determine the molecules of fluorescent label per cellular
event for the antigen-positive cell populations. Based on molecules
of fluorescent label per cell, the amount of Antibody Binding per
Cell (ABC) is quantified.
Inventors: |
Flor; Amy (Chicago, IL),
Duggan; Ryan (Chicago, IL), Kron; Stephen (Chicago,
IL) |
Applicant: |
Name |
City |
State |
Country |
Type |
The University of Chicago |
Chicago |
IL |
US |
|
|
Assignee: |
The University of Chicago
(Chicago, IL)
|
Family
ID: |
49758747 |
Appl.
No.: |
15/606,045 |
Filed: |
May 26, 2017 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20170268036 A1 |
Sep 21, 2017 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
14408065 |
|
9663818 |
|
|
|
PCT/US2013/045872 |
Jun 14, 2013 |
|
|
|
|
61660261 |
Jun 15, 2012 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N
33/6854 (20130101); G01N 33/54333 (20130101); G01N
21/6486 (20130101); G01N 15/14 (20130101); C12Q
1/6811 (20130101); G01N 33/56972 (20130101); G01N
33/54326 (20130101); G01N 33/56966 (20130101); C12Q
1/6804 (20130101); G01N 2015/0065 (20130101); G01N
2015/1402 (20130101); G01N 2015/1006 (20130101); G01N
2015/008 (20130101); G01N 2458/10 (20130101) |
Current International
Class: |
C12Q
1/6804 (20180101); C12Q 1/6811 (20180101); G01N
15/14 (20060101); G01N 33/543 (20060101); G01N
33/569 (20060101); G01N 21/64 (20060101); G01N
33/68 (20060101); G01N 15/00 (20060101); G01N
15/10 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 9926067 |
|
May 1999 |
|
WO |
|
WO 03042695 |
|
May 2003 |
|
WO |
|
WO 2005040429 |
|
Aug 2005 |
|
WO |
|
WO 2007024840 |
|
Mar 2007 |
|
WO |
|
WO 2008060713 |
|
Apr 2009 |
|
WO |
|
WO 2012071428 |
|
May 2012 |
|
WO |
|
Other References
Abdelrahman, A. I. et al. Metal-containing polystyrene beads as
standards for mass cytometry. Journal of Analytical Atomic
Spectrometry 25:260 (2010). cited by applicant .
Bailey et al., "DNA-Encoded Antibody Libraries: A Unified Platform
for Multiplexed Cell Sorting and Detection of Genes and Proteins,"
Journal of the American Chemical Society 129:1959-1967, 2007. cited
by applicant .
Bendall et al., "Single-Cell Mass Cytometry of Differential Immune
and Drug Responses Across a Human Hematopoietic Continuum," Science
332(6030):687-696, 2011. cited by applicant .
Feldkamp et al., "CANADA: Designing nucleic acid sequences for
nanobiotechnology applications," Journal of Computational Chemistry
31(3):660-663, 2010. cited by applicant .
Feldkamp et al., "DNASequenceGenerator: A Program for the
Construction of DNA Sequences," DNA Computing 2340:23-32, 2002.
cited by applicant .
Feldkamp et al., "Microarray-Based in vitro Evaluation of DNA
Oligomer Libraries Designed in silico," ChemPhysChem 5(3):367-372,
2004. cited by applicant .
International Search Report and Written Opinion issued in
PCT/US2013/045872, dated Nov. 22, 2013. cited by applicant .
Lim, S. H., Bestvater, F., Buchy, P., Mardy, S. & Yu, A. D. C.
Quantitative analysis of nucleic acid hybridization on magnetic
particles and quantum dot-based probes. Sensors 9:5590-5599 (2009).
cited by applicant .
Rossmann, E. D., Lenkei, R., Lundin, J., Mellstedt, H. &
Osterborg, A. Performance of calibration standards for antigen
quantitation with flow cytometry in chronic lymphocytic leukemia.
Cytom. Part B--Clin. Cytom. 72:450-457 (2007). cited by applicant
.
Smith, R. A. & Giorgio, T. D. Quantitative measurement of
multifunctional quantum dot binding to cellular targets using flow
cytometry. Cytometry. 75A:465-474 (2009). cited by applicant .
Wang, L., Gaigalas, A. K. & Yan, M. Quantitative fluorescence
measurements with multicolor flow cytometry. Methods Mol. Biol.
699:53-65 (2011). cited by applicant .
Wu, Y. et al. The development of quantum dot calibration beads and
quantitative multicolor bioassays in flow cytometry and microscopy.
Anal. Biochem. 364:180-192 (2007). cited by applicant.
|
Primary Examiner: Gabel; Gailene
Attorney, Agent or Firm: Norton Rose Fulbright US LLP
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation of U.S. patent application Ser.
No. 14/408,065 filed Dec. 15, 2014, which is a national phase
application under 35 U.S.C. .sctn. 371 of International Application
No. PCT/US2013/045872, filed Jun. 14, 2013, which claims the
benefit of priority to U.S. Provisional Patent Application Ser. No.
61/660,261, filed Jun. 15, 2012. The entire contents of each of the
above-referenced disclosures are specifically incorporated herein
by reference without disclaimer.
Claims
The invention claimed is:
1. A method of quantitative flow cytometry comprising: (a)
providing a labeled sample by contacting a sample comprising one or
more cells with a labeled targeting construct under conditions
suitable for binding of the labeled targeting construct to an
antigen on the cells; wherein the labeled targeting construct
comprises a targeting moiety:ligand complex and a bioconjugate;
wherein the bioconjugate comprises a biomolecule attached to a
labeling moiety; and wherein the biomolecule of the bioconjugate
binds to the ligand of the targeting moiety:ligand complex; (b)
contacting the labeled sample with a population of quantitative
labeled ligand-surfaced microspheres, wherein the population of
quantitative labeled ligand-surfaced microspheres is labeled with
the same bioconjugate as the labeled targeting construct; (c)
analyzing the population of quantitative labeled ligand-surfaced
microspheres and the cells that bind the labeled targeting
construct in the sample using a flow cytometer; (d) determining a
Geometric Mean Fluorescent Intensity (GMFI) versus Label Per Event
(LPE) trendline from the GMFIs of the population of quantitative
labeled ligand-surfaced microspheres; (e) determining the LPE for
one or more cell populations that bind the labeled targeting
construct from the GMFI versus LPE trendline; and (f) quantifying
the amount of labeled targeting construct binding per cell, wherein
the biomolecule of the bioconjugate binds to the ligand of the
ligand-surfaced microsphere; wherein the target is a cellular
target on or within cells; and wherein the ligands of the
ligand-surfaced microsphere and targeting moiety:ligand complex are
peptides or haptens.
2. The method of claim 1 further comprising: (a) providing a
labeled sample by contacting the sample with at least a first and a
second labeled targeting construct, wherein the first labeled
targeting construct comprises a targeting moiety:ligand complex and
a bioconjugate that differs from the targeting moiety:ligand
complex and bioconjugate of the second labeled targeting construct,
under conditions suitable for binding of the first and the second
labeled targeting constructs to their respective targets on or in
the cells; and (b) contacting the labeled sample with at least a
first and a second population of quantitative labeled
ligand-surfaced microspheres, wherein the bioconjugates of the
first and the second populations of quantitative labeled
ligand-surfaced microspheres differ from each other, but are the
same as the bioconjugates utilized in the labeled targeting
construct of either the first or the second labeled targeting
constructs; (c) analyzing the populations of quantitative labeled
ligand-surfaced microspheres and the cells that bind the labeled
targeting construct in the sample using a flow cytometer; (d)
determining the GMFI versus LPE trendline from the GMFIs of at
least two different populations of quantitative labeled
ligand-surfaced microspheres; (e) determining the LPE for the one
or more cell populations that bind the first and/or second labeled
targeting construct from the GMFI versus LPE trendlines; and (f)
quantifying the amount of labeled targeting construct binding per
cell.
3. The method of claim 2, wherein the first labeled targeting
construct comprises an antibody that binds to CD4 and the second
labeled targeting construct comprises an antibody that binds to
CD8.
4. The method of claim 2, further comprising contacting the sample
with at least a third and a fourth different labeled targeting
construct under conditions suitable for binding of the third and
the fourth labeled targeting constructs to their respective targets
on the cells.
5. The method of claim 4, wherein the first labeled targeting
construct comprises an antibody that binds to CD4, the second
labeled targeting construct comprises an antibody that binds to
CD8, the third labeled targeting construct comprises an antibody
that binds to CD43, and the fourth labeled targeting construct
comprises an antibody that binds to CD62L.
6. The method of claim 2, wherein the sample is a whole blood
sample or a buffy coat sample.
7. The method of claim 1, wherein the sample is a cultured
preparation of mammalian cells, a biopsy cell aspirate, a tissue
sample, or an environmental sample.
8. The method of claim 1, wherein the cells are immune cells.
9. The method of claim 8, wherein the immune cells are T cells, B
cells, NK cells, granulocytes, or monocytes.
10. The method of claim 1, wherein the cells are tumor cells, stem
cells or immortalized cells.
11. The method of claim 1, wherein the cells are rodent, plant,
bacterial, fungi, protozoan, or metazoan cells.
12. The method of claim 1, wherein the labeled targeting construct
comprises an antibody that specifically binds to CD4, CD8, CD43, or
CD62L.
13. The method of claim 1, wherein the targeting moiety is an
antibody and wherein the antibody is a monoclonal antibody, an
antibody fragment, a polyclonal antibody, a recombinant antibody, a
synthetic antibody, or a chimeric antibody.
14. The method of claim 1, wherein the labeling moiety comprises a
fluorescent label and wherein the fluorescent label is Dy490,
Dy549, Dy649, or Dy405.
15. The method of claim 1, wherein the population of quantitative
labeled ligand-surfaced microspheres comprises at least four
subpopulations of different ligand-surfaced microspheres bound with
at least four different concentrations of bioconjugates.
16. The method of claim 15, wherein the labeling moiety comprises a
fluorescent label and wherein the fluorescent label is Dy490,
Dy549, Dy649, or Dy405.
17. The method of claim 1, wherein the labeled targeting construct
is contacted with the sample before or after the population of
quantitative labeled ligand-surfaced microspheres is contacted with
the sample.
18. The method of claim 1, wherein the biomolecule is an antibody.
Description
BACKGROUND
1. Field of the Invention
The present invention relates generally to the fields of
immunology, molecular biology, and cellular biology. More
particularly, it relates to quantitative multiplexed cellular
analysis using flow cytometry, microscopy, and/or fluorimetry.
2. Description of Related Art
Multiplexed target labeling and analysis are principal strategies
applied in molecular biology research. In general, surface or
intracellular antigens indicative of cell status are detected by
multiplexed labeling with targeting reagents (e.g., antibodies),
followed by visualization of the targeting reagents by specific
labeling probes (e.g., fluorophores). In some instances, targets in
solution are analyzed using a similar approach. The sample is
analyzed by flow cytometry, microscopy, fluorimetry, or other
instrumentation equipped to measure labeling probe signal.
Multiplexed targeting assays have been facilitated in the last
several decades by an increasing variety of commercially available
antibodies biochemically conjugated to labeling reagents.
Fluorescent reagents are the most common type of label used in the
laboratory, although other labels may be utilized for specific
applications (enzymes, radioisotopes, heavy metals, etc). Despite
the growing availability of directly-labeled targeting reagents,
the majority of reagents are only available conjugated to a limited
number of labels, often in the same standard fluorophore such as
FITC. This is particularly true of reagents targeting novel or
niche markers.
A variety of parameters must be considered in order to determine an
optimal multiplexed detection strategy, including cell type(s),
target densities, labeling reagent characteristics, and instrument
specifications. Limitations placed on label-target choice by
commercial availability, coupled with reliance on qualitative
analysis parameters, can cause variation in results and subsequent
interpretation of data across experiments, researchers, and
laboratories.
The prevalence of qualitative, rather than quantitative, analysis
in many immunoassays is a result of several factors. Qualitative
analysis is almost universally practiced with flow cytometric and
microscopy assays, due to the nature of instrumentation, which are
configured to provide a measure of adjustable, relative intensity,
rather than units of absolute intensity. While some quantitative
technologies exist, such as dyed fluorescent microspheres, at
present these technologies require an additional investment of cost
and preparation time that may deter many researchers, and even when
utilized may not produce reliable and accurate quantitative
measures. Although immunoanalysis procedures are, by and large,
executed by researchers with considerable experience and expertise,
there is no question that a streamlined method of accurate,
quantitative analysis would represent a significant asset to the
field--notably, for flow cytometric applications which are
particularly subject to variation and error incurred by the
qualitative approach.
As existing technologies are often time-consuming, cumbersome, and
inaccurate, it is understandable that the quantitative analysis
endeavor is not usually pursued by the research laboratory.
SUMMARY OF THE INVENTION
Various embodiments address challenges presented by conventional
qualitative immunoassay methods by utilizing DNA-directed assembly
or other means by which complementary ligands pair to form a
one-to-one complex for quantitative target labeling. In certain
embodiments, antibodies are used as the targeting reagent, and
oligonucleotides are used as the ligand. Antibody:oligonucleotide
targeting constructs are hybridized to complementary
oligonucleotide:label constructs to create a labeled targeting
hybrid. The hybrid is then used to label antigens and provide a
signal for analysis. Alternatively, targeting constructs are first
applied to a sample and then the labeling construct is applied,
providing a signal for analysis. Labeled quantitative oligospheres
are added to the analysis and used to convert relative units of
signal intensity provided by the label to absolute measures of
Label Per Event (LPE). In certain embodiments, an event may
comprise a single cell, a volume of solution, a concentration or
volume of analyte, or a unit of surface area.
LPE is then used to quantify the number of targeting reagent
molecules within a sample based on known label-target ratio, which
is established during ligation of targeting construct to labeling
construct. In certain embodiments in which the targeting reagent is
an antibody, and the sample comprises a cellular preparation, the
quantitative measure is noted as Antibodies Bound per Cell
(ABC).
As used herein, a ligand-surfaced microsphere refers to a
microsphere to which a ligand is conjugated. Non-limiting examples
of ligands may include oligonucleotides, peptides, or haptens.
Specifically, an "oligosphere" refers to a microsphere to which
oligonucleotides are conjugated for surface ligation.
Several techniques are known for conjugating ligands to
microspheres. The ligand-microsphere conjugation procedure may
involve modification of amine, carboxyl, hydroxyl or other reactive
groups on oligonucleotides and microsphere surfaces in order to
incorporate linker moieties for subsequent conjugation reaction.
Linker chemistry may include HyNic/4FB (hydrazone),
(strept)avidin/biotin, phosphoramidite, octadinyl dU, and other
chemistries. Alternatively, the microspheres may be
pre-manufactured to present surface reactive groups to which
reactive-group bearing oligo may be conjugated (e.g., amino- or
streptavidin-modified microspheres). In certain aspects, a linker
sequence is placed between the microsphere and the operative region
of the oligonucleotide. Such linkers may, for example, facilitate
conjugation to the microsphere and/or reduce steric hindrance of
the oligonucleotide.
Microspheres are generally spherical particles with diameters in
the micrometer range (i.e., 1 .mu.m to 1,000 .mu.m). For flow
cytometer applications, oligospheres with diameters between about
1-10 .mu.m, 3-8 .mu.m, or 3-6 .mu.m, are preferred. Microspheres
may be made from various materials including, polymers (e.g.,
polyethylene or polystyrene), glass, or ceramic.
In certain aspects, the microspheres are magnetic. As used herein,
"magnetic" includes paramagnetic and super paramagnetic. The
microspheres may also be encoded. The size of the microspheres in a
subpopulation may also be used to distinguish one subpopulation
from another. Another method of encoding microspheres is to
incorporate a magnetically responsive substance, such as
Fe.sub.3O.sub.4, into the structure. Paramagnetic and
superparamagnetic microspheres have negligible magnetism in the
absence of a magnetic field, but application of a magnetic field
induces alignment of the magnetic domains in the microspheres,
resulting in attraction of the microspheres to the field source.
Combining fluorescent dyes, microsphere size, and/or magnetically
responsive substances into the microspheres can further increase
the number of different subpopulations of ligand-conjugated
microspheres that can be created.
As used herein a "labeled oligosphere" refers to an oligosphere and
a labeling construct, in which the respective oligonucleotides have
annealed to form a hybrid. As discussed, labeling constructs
contain a labeling moiety and are designed to hybridize to the
oligonucleotide sequences on the oligospheres. A number of
techniques are known for attaching labeling moieties to nucleic
acids. These techniques include the use of a dextran scaffold
bearing oligonucleotides and fluorophores, as well as the direct
conjugation of the fluorophore conjugated to the
oligonucleotide.
Compositions comprising a population of quantitative labeled
oligospheres prepared according to the methods disclosed herein
also are provided.
As used herein a "targeting oligosphere" refers to an oligosphere
and a targeting construct to which the respective oligonucleotides
have annealed to form a hybrid.
Certain embodiments provide a method of preparing a population of
quantitative labeled oligospheres comprising: (a) separately
combining at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more
subpopulations of oligospheres with at least 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, or 12 or more different concentrations of labeling
constructs under conditions suitable for the hybridization of the
oligospheres to the probes to obtain at least 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, or 12 or more subpopulations of labeled oligospheres;
and (b) combining the subpopulations of labeled oligospheres to
obtain a titrated population of quantitative oligospheres bearing
known numbers of labeling molecules at discrete and increasing
saturations, providing a standard curve against which an unknown
sample can be evaluated. The titrated population of labeled
oligospheres will, therefore, comprise at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, or 12 or more subpopulations of labeled oligospheres
having different amounts of labeling moiety. In some embodiments,
at most or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more
subpopulations of oligospheres (or any range derivable therein) are
combined with at least or at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
or 12 or more different concentrations of labeling construct (or
any range derivable therein) under conditions suitable for the
hybridization of the oligospheres to the labeling construct to
obtain at least or at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or
more subpopulations of labeled oligospheres (or any range derivable
therein). As used herein "quantitative oligospheres" means a
population of labeled oligospheres containing at least two
different subpopulations of labeled oligospheres, as described
herein.
Methods of preparing a population of quantitative oligospheres may
further comprise individually analyzing the subpopulations of
quantitative oligospheres by flow cytometry prior to combining the
subpopulations of quantitative oligospheres to obtain the titrated
population of quantitative oligospheres. This analysis may comprise
analyzing one or more parameters including, but not limited to,
peak intensity, bandwidth, or peak separation of the subpopulations
of the labeled oligospheres. In embodiments where encoded
microspheres are used, parameters relating to the encoding moieties
(e.g., internal fluorescent dyes) may also be analyzed. In certain
aspects relating to flow cytometry, the labeled oligospheres are
gated on singlets and then the singlets are visualized as
histograms. The histograms of the subpopulations of labeled
oligospheres may be overlayed.
Methods of preparing a population of labeled oligospheres may
further comprise quantifying a Label-signal Per oligosphere Event
(LPE) using a microplate fluorimeter to measure sample intensity
versus a standard curve. In some embodiments, the label-signal is a
fluorescent signal, and intensity is converted to LPE using a
linear trendline equation provided by a fluorescent standard curve.
In certain aspects, methods of preparing a population of labeled
oligospheres may further comprise determining the number of labeled
oligospheres in a sample using a handheld particle counter or other
counting devices known to those in the art.
The ligand-conjugated microspheres and antibody:ligand targeting
constructs disclosed herein may be used in numerous applications
including, for example, Quantitative Flow Cytometry (QFC), spectral
compensation for polychromatic flow cytometry, reference standards
for Quality Control (QC) of cytometric instrumentation (i.e.
alignment or calibration), single cell mass cytometry (CyTOF),
microscopy, and Enzyme-Linked ImmunoSorbent Assays (ELISA).
Microscopy applications include, for example, singleplex or
multiplex Quantitative ImmunoCytoChemistry (Q-ICC) or
ImmunoHistoChemistry (Q-IHC).
A variety of labeling moieties may be employed in the methods and
compositions disclosed herein. Non-limiting examples of labeling
moieties include biofluors (e.g., phycoerythrin (PE),
allophycocyanin (APC), small molecule fluorophores (FITC, Alexa
dyes, DyLight dyes, eFluor dyes, etc.), fluorescent proteins (GFP,
CFP, YFP, mCherry, dsRed, etc.), or quantum dots. For CyTOF
applications heavy metal or isotope labeling moieties are
preferred. For ELISA or ICC/IHC, enzymatic labeling moieties may be
used (e.g., horseradish peroxidase, alkaline phosphatase, etc),
followed by a tertiary detection reagent (e.g., fluorescent,
colorimetric, or luminescent enzyme substrate). In some
embodiments, radioisotopes may be used as a label.
Non-limiting examples of fluorophores include Alexa Fluor (e.g.
Alexa Fluor 488, 532, or 647), BODIPY.RTM. (e.g.
BODIPY.RTM.-630/650, -650/665, -FL, R6G, -TMR, or -TRX) CyDye.TM.
(e.g. Cy2.TM., Cy3.TM., or Cy5.TM.), DyLight.TM. (e.g. Dy490,
Dy549, Dy649, and Dy405), acridine orange, coumarin, cyanine,
fluorescein, resorufin, and rhodamine dyes. Other non-limiting
examples of fluorescent dyes include an orange fluorescent squarine
dye such as 2,4-Bis [3,5-dimethyl-2-pyrrolyl]
cyclobutenediylium-1,3-diololate, a red fluorescent squarine dye
such as 2,4-Bis [1,3,3-trimethyl-2-indolinylidenemethyl]
cyclobutenediylium-1,3-dioxolate, or an infrared dye such as 2,4
Bis [3,3-dimethyl-2-(1H-benz[e]indolinylidenemethyl)]
cyclobutenediylium-1,3-dioxolate. Further examples of fluorescent
dyes include quantum dots, AMCA, Cascade Blue.RTM., 6-FAM.TM.,
HEX.TM., 6-JOE, Oregon Green.RTM., Pacific Blue.TM., REG, Rhodamine
Green.TM., Rhodamine Red.TM., ROX.TM., TAMRA.TM., TET.TM.,
Tetramethylrhodamine (TMR), or Texas Red.RTM.. Fluorophores may
include phycobilliproteins including, but not limited to,
phycoerythrin (PE) and allophycocyanin (APC), or tandem-dye
preparations of phycobiliproteins (e.g. PE-Cy5 or APC-Cy7).
The sequences of the oligonucleotides used in the in the methods
and compositions disclosed herein are not limited to any particular
sequence. Those of ordinary skill in the art will be able to
determine appropriate sequences based on the assay conditions,
particularly hybridization conditions and the potential for
undesirable cross-hybridization with other probes or sequences in
the sample. It is generally desirable to use oligonucleotides that
have low reactivity with unmatched oligo sequences, high melting
temperature, and stable and robust hybridization activity. It may
also be desirable to use oligonucleotides that form hairpin
structures. Preferably, oligos will not hybridize to other nucleic
acids in the sample during a reaction. The proper selection of
non-cross hybridizing sequences is useful in assays, particularly
assays in a highly parallel hybridization environment, that require
stringent non-cross hybridizing behavior. In certain embodiments,
the sequences are between 6 to 60, 8 to 50, 10 to 40, 10 to 20, 12
to 24, or 20 to 30 nucleotides in length. Non-limiting examples of
such sequences include the sequences of SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, and their
respective complementary sequences. The oligonucleotides may
comprise natural bases (A, T/U, G, and C) and/or non-natural bases
(e.g., peptide nucleic acids (PNAs), locked nucleic acids (LNAs),
iso-nucleotides).
Other embodiments provide an interchangeable labeling system
comprising: (a) an antibody:oligonucleotide targeting construct
comprising an antibody region and a first universal nucleic acid
region; and (b) a plurality of different labeling constructs
comprising a label and a second universal nucleic acid region that
is complementary to the first universal nucleic acid region,
wherein each of the plurality of different labeling constructs has
a different label, but comprises the same second universal nucleic
acid region.
Further embodiments provide an antibody:oligonucleotide targeting
construct comprising a first oligonucleotide, an oligosphere
conjugated to a second oligonucleotide comprising a sequence
identical to the sequence of the first oligonucleotide, and a
labeling construct comprising a third sequence that is
complementary to the first and the second oligonucleotides. In some
embodiments, the first oligonucleotide comprises a sequence
selected from the group consisting of the sequence of, or a
sequence complementary to the sequence of, SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. In some
embodiments, the second oligonucleotide comprises a sequence
selected from the group consisting of the sequence of, or a
sequence complementary to the sequence of, SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.
Other embodiments provide a composition comprising a titrated
population of labeled oligospheres, wherein the titrated population
of labeled oligospheres comprises at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, or 12 subpopulations of labeled oligospheres, wherein each
of the subpopulations of labeled oligospheres is hybridized to a
different amount of labeling construct.
Certain embodiments provide a method of quantitative flow cytometry
comprising: (a) contacting a sample comprising one or more cells
with a labeled targeting hybrid under conditions suitable for
binding of the labeled targeting hybrid construct to an antigen on
the cells; (b) analyzing the cells bound to a labeled targeting
hybrid in the sample using a flow cytometer; (c) analyzing a
population of quantitative labeled oligospheres, wherein the
population of quantitative labeled oligospheres is labeled with the
same fluorescent label as the labeled targeting hybrid construct;
(d) determining a median, mean, or Geometric Mean Fluorescent
Intensity (GMFI) for each population of quantitative labeled
oligospheres; (e) creating a standard curve for quantitation of
labeled targeting hybrid by plotting GMFI vs known molecules of
label per microsphere event (LPE or FPE), LPE or FPE having been
previously quantified fluorometrically; (f) determining the LPE or
FPE for one or more cell populations which bind the labeled
targeting hybrid's targeting moiety from the median, mean or GMFI
of cellular event(s); (g) using the LPE or FPE to quantify the
amount of labeled targeting hybrid per cell (i.e., ABC).
In certain aspects, the population of quantitative labeled
oligospheres and the cells bound to the labeled targeting hybrid
are combined in the sample prior to analyzing the mixed population
of quantitative labeled oligospheres and cells bound to the labeled
targeting hybrid in the flow cytometer. In some aspects, the
population of quantitative labeled oligospheres are analyzed in the
flow cytometer before or after the cells bound to the labeled
targeting hybrid are analyzed in the flow cytometer. In other
aspects, cells bound to an unhybridized targeting construct and
unhybridized oligospheres bearing increasing titrations of free
oligonucleotide are combined in the presence of an excess of
labeling construct comprising a complementary oligonucleotide to
the targeting construct and hybridization is allowed to proceed,
followed by flow cytometric analysis of the mixed sample of cells
bound to new labeled targeting hybrid and oligospheres.
In one embodiment, a method of quantitative flow cytometry is
provided comprising: (a) contacting a sample comprising one or more
cells with a labeled targeting hybrid under conditions suitable for
binding of the labeled targeting hybrid construct to an antigen on
the cells; (b) contacting the sample with a population of
quantitative oligospheres wherein the population of quantitative
oligospheres is labeled with the same labeling moiety as the
labeled targeting hybrid; (c) analyzing a population of
quantitative labeled oligospheres and the cells bound to the
labeled targeting hybrid in the sample in a cytometer; (d)
determining a median, mean, or Geometric Mean Fluorescent Intensity
(GMFI) for each population of quantitative labeled oligospheres;
(e) creating a standard curve for quantitation of labeled targeting
hybrid by plotting GMFI vs known molecules of label per microsphere
event (LPE or FPE), the LPE or FPE having been previously
quantified fluorometrically; (f) determining the LPE or FPE for one
or more cell populations which bind the labeled targeting hybrid's
targeting moiety from the median, mean or GMFI of cellular
event(s); and (g) using the LPE or FPE to quantify the amount of
labeled targeting hybrid per cell (i.e., ABC).
In another embodiment, a method of quantitative flow cytometry is
provided comprising: (a) contacting a sample comprising one or more
cells with an unlabeled targeting construct under conditions
suitable for binding of the targeting construct to an antigen on
the cells; (b) contacting the sample with a population of unlabeled
oligospheres; (c) contacting the mixed sample of cells and
oligospheres with sufficient labeling construct to hybridize to
oligospheres and targeting constructs, thereby creating
quantitative oligospheres labeled with the same labeling moiety as
the targeting construct bound to antigen on the cells; (d)
analyzing a population of quantitative labeled oligospheres and
labeled cells in the sample in a cytometer; (e) determining a
median, mean, or Geometric Mean Fluorescent Intensity (GMFI) for
each population of quantitative labeled oligospheres; (f) creating
a standard curve for quantitation of labeled targeting hybrid by
plotting GMFI vs known molecules of label per microsphere event
(LPE or FPE), LPE or FPE having been previously quantified
fluorometrically; (g) determining the LPE or FPE for one or more
cell populations which bind the labeled targeting hybrid's
targeting moiety from the median, mean or GMFI of cellular
event(s); (g) using the LPE or FPE to quantify the amount of
labeled targeting hybrid per cell (i.e., ABC).
Another embodiment provides a method of flow cytometric spectral
compensation comprising: (a) analyzing at least two populations of
quantitative labeled oligospheres in the flow cytometer bearing a
single label in each population; (b) obtaining cytometric data in
at least two cytometric detector channels for all labeled
oligospheres being analyzed; (c) utilizing cytometric data
acquisition and/or analysis software to determine spectral
compensation parameters using labeled oligosphere data; and (d)
applying compensation parameters to cells labeled with at least two
label-target hybrids bearing the same labels as the labeled
oligospheres used to determine compensation parameters.
Other embodiments provide a method of calibration of cytometric
instrumentation comprising: (a) analyzing at least one population
of quantitative labeled oligospheres in a flow cytometer; (b)
obtaining cytometric data in at least one cytometric detector
channel; (c) utilizing known degree-of-labeling data of
quantitative oligospheres to evaluate sensitivity and resolution of
the instrument; and (d) performing calibration and alignment
procedures based on observed signaling of labeled oligospheres.
A further embodiment provides a method of quantitative
immunocytochemistry comprising: (a) contacting a sample comprising
one or more cells with a labeled targeting hybrid under conditions
suitable for binding of the labeled targeting hybrid to a cellular
target; (b) contacting the labeled cell sample with a population of
quantitative labeled oligospheres bearing the same label as the
labeled targeting hybrids applied to the cells; (c) analyzing the
sample using a microscope equipped with an appropriate fluorescent
filter to observe the fluorescent signal of the labeled cells and
microspheres, using a camera and imaging software to obtain
representative images of the sample; (d) utilizing image-analysis
software to create a signal-to-noise threshold and intensity
standard curve using fluorescent oligospheres; (e) utilizing the
signal intensity data provided by the labeled oligospheres to
quantitate signal intensity of labeled cells; and (f) converting
cell signal intensity units to hybrid-per-cell units by (signal
intensity/label-target DOL).
One embodiment provides a method of quantitative
immunocytochemistry comprising: (a) contacting a sample comprising
one or more cells with at least a first and a second labeled
targeting hybrid under conditions suitable for binding of the
hybrid to a cellular target; (b) contacting the labeled cell sample
with a population of at least a first and a second population of
quantitative labeled oligospheres bearing the same label as the
labeled targeting hybrids applied to the cells; (c) analyzing the
sample using a microscope equipped with an appropriate fluorescent
filter to observe the fluorescent signal of the labeled cells and
microspheres, using a camera and imaging software to obtain
representative images of the sample; (d) utilizing image-analysis
software to create a signal-to-noise threshold and intensity
standard curve using fluorescent oligospheres; (e) utilizing the
signal intensity data provided by the labeled oligospheres to
quantitate signal intensity of labeled cells; and (f) converting
cell signal intensity units to hybrid-per-cell units for each
label-target hybrid applied by (signal intensity/label-target
DOL).
Another embodiment provides a method of quantitative
immunocytochemistry comprising: (a) contacting a sample comprising
a tissue sample with a labeled targeting hybrid under conditions
suitable for binding of the hybrid to a target on or within the
tissue; (b) contacting the labeled tissue sample with a population
of quantitative labeled oligospheres bearing the same label as the
labeled targeting hybrids applied to the tissue; (c) analyzing the
sample using a microscope equipped with an appropriate fluorescent
filter to observe the fluorescent signal of the labeled tissue and
microspheres, using a camera and imaging software to obtain
representative images of the sample; (d) utilizing image-analysis
software to create a signal-to-noise threshold and intensity
standard curve using fluorescent oligospheres; (c) utilizing the
signal intensity data provided by the labeled oligospheres to
quantitate signal intensity of labeled tissue; (f) converting
tissue signal intensity units to hybrid-per-area units by (signal
intensity/label-target DOL).
In one embodiment, there is provided a method of quantitative
immunohistochemistry comprising: (a) contacting a sample comprising
a tissue sample with at least a first and a second labeled
targeting hybrid under conditions suitable for binding of the
hybrid to a target on or within the tissue; (b) contacting the
labeled tissue sample with a population of at least a first and a
second population of quantitative labeled oligospheres bearing the
same label as the labeled targeting hybrids applied to the tissue;
(c) analyzing the sample using a microscope equipped with an
appropriate fluorescent filter to observe the fluorescent signal of
the labeled cells and microspheres, using a camera and imaging
software to obtain representative images of the sample; (d)
utilizing image-analysis software to create a signal-to-noise
threshold and intensity standard curve using fluorescent
oligospheres; (c) utilizing the signal intensity data provided by
the labeled oligospheres to quantitate signal intensity of labeled
tissue; (f) converting tissue signal intensity units to
hybrid-per-area units for each label-target hybrid applied by
(signal intensity/label-target Label Per Event (LPE)). The
microscope may be, for example, a conventional inverted fluorescent
microscope, a high-content scanning microscope, or a cytometric
microscope.
Other embodiments provide methods of quantitative Enzyme-Linked
ImmunoSorbent Assay (ELISA) comprising: (a) contacting a sample
with a labeled targeting hybrid in a microplate under conditions
suitable for binding of the hybrid to a target presented by the
sample; (b) introducing quantitative labeled oligospheres to the
microplate; (c) analyzing the microplate using a fluorimeter,
luminometer, or spectrophotometer to determine labeling intensity
of the sample and the oligospheres; and (d) utilizing the signal
intensity data provided by the labeled oligospheres to convert
sample labeling intensity to known number of targets per cell based
on oligosphere Label Per Event (LPE). The method may further
comprise applying a detection reagent to the samples to visualize
the label. The detection reagent may be, for example, a
fluorescent, luminescent, or colorimetric enzymatic substrate.
In other aspects, the targeting agent may be attached to the
microsphere. For example, one embodiment provides a method of
quantitative microsphere-based targeting assay comprising: (a)
contacting a population of unlabeled oligospheres with increasing
titrations of a labeling construct; (b) introducing quantitative
targeting oligospheres to a sample under conditions suitable for
binding of the labeling construct to a target on or within the
sample; (c) applying a detection reagent to all samples to
visualize the binding of the target to the oligospheres; (d)
analyzing the oligospheres using a cytometer or particle analyzer;
(e) analyzing a population of quantitative oligospheres using the
cytometer or particle analyzer; and (e) utilizing the signal
intensity data provided by the quantitative oligospheres to convert
intensity of labeled targeting oligospheres to known number of
targets per sphere. The detection reagent may comprise, for
example, a fluorescent antibody reactive with the target, or a
first antibody reactive with the target and a fluorescent second
antibody reactive with the first antibody.
The method may be multiplexed by using additional (e.g., 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25 or more) labeled targeting
hybrids and labeled oligospheres. For example, the method of
quantitative flow cytometry may comprise: (a) contacting the sample
with at least a first and a second labeled targeting hybrid,
wherein the first labeled targeting hybrid comprises an antibody
and a fluorescent label that differ from the antibody and the
fluorescent label of the second labeled targeting hybrid, under
conditions suitable for binding of the first and the second labeled
targeting hybrid to their respective binding sites on the cells;
(b) analyzing the cells bound to labeled targeting hybrid in the
sample in the flow cytometer; (c) analyzing at least a first and a
second population of quantitative oligospheres, wherein the
fluorescent labels of the first and the second populations of
quantitative oligospheres differ from each other, but are the same
as the fluorescent label of either the first or the second labeled
targeting hybrid, in a flow cytometer; (d) determining the
Geometric Mean Fluorescent Intensity (GMFI) versus LPE trendline
from the GMFIs of at least two different populations of
quantitative oligospheres; (e) determining the LPE for the one or
more cell populations bound to either the first or the second
labeled targeting hybrid from the GMFI versus LPE trendlines; and
(f) quantifying the amount of the first or the second labeled
targeting hybrid bound per cell. In some embodiments, the first or
the second labeled targeting hybrid comprise an
antibody:oligonucleotide targeting construct, and bind an antigen
on the cells.
Any of the compositions disclosed herein may be provided in a kit.
In certain embodiments, the kit comprises a composition comprising
a titrated population of labeled oligospheres, wherein the titrated
population of labeled oligospheres comprises at least 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, or 12 subpopulations of labeled oligospheres,
wherein each of the subpopulations of labeled oligospheres is
hybridized to a different amount of labeling construct. In certain
aspects, the titrated population of labeled oligospheres are
combined in a single container in the kit. In other aspects, the
subpopulations are provided of labeled oligospheres are provided in
separate containers in the kit. In some embodiments, the kit
comprises an antibody:oligonucleotide targeting construct and/or a
labeling construct.
The sample may be any sample that is suspected of containing an
analyte of interest. In certain aspects the sample may be obtained
from a subject who is being screened for the presence or absence of
an antigen of interest. In another aspect, the sample may be from a
subject who is being tested for the presence or absence of a
pathogen. Where the sample is obtained from a subject, it may be
obtained by methods known to those in the art such as aspiration,
biopsy, swabbing, venipuncture, spinal tap, fecal sample, or urine
sample. In some aspects of the invention, the sample is an
environmental sample such as a water, soil, or air sample. In other
aspects of the invention, the sample is from a plant, bacteria,
virus, fungi, protozoan, or metazoan. In certain embodiments, the
sample is a blood sample. The blood sample may be a whole blood
sample or it may be separated into various blood components. In
certain embodiments, the sample is from the buffy coat.
The samples may contain cells that express antigens recognized by
one or more antibody:ligand targeting constructs. In certain
embodiments, the cells are immune cells. The immune cells may be
myeloid cells, such as monocytes, macrophages, and dendritic cells
(DC), or lymphoid cells, such as T cells, NK cells, B cells, and
lymphoid DC. In other embodiments the cells are cancer cells.
The antibody in the antibody:ligand targeting construct may
comprise an antibody that specifically binds to any antigen of
interest. In certain embodiments, the antigen of interest is an
antigen that is characteristic of immune cells or cancer cells.
Non-limiting examples of antigens characteristic of immune cells
are CD4, CD8, CD28, CD43, CD56, and CD62L. In particular
embodiments, combinations of antibody:ligand targeting constructs
are employed. For example, in one aspect a first
antibody:oligonucleotide targeting construct comprises an antibody
that binds to CD4 and the second antibody:oligo targeting construct
comprises an antibody that binds to CD8. Additional antibody:ligand
targeting constructs may be employed, such as at least a third and
a fourth different antibody:ligand targeting construct under
conditions suitable for binding of the third and the fourth
antibody:ligand targeting constructs to their respective antigens
on the cells. Thus, for example, the first antibody:oligonucleotide
targeting construct comprises an antibody that binds to CD4, the
second antibody:oligonucleotide targeting construct comprises an
antibody that binds to CD8, the third antibody:oligonucleotide
targeting construct comprises an antibody that binds to CD43, and
the fourth antibody:oligonucleotide targeting construct comprises
an antibody that binds to CD62L.
As used herein, the term "bioconjugate" means a construct in which
at least one biomolecule is attached to another moiety. In certain
embodiments, bioconjugates may be proteins attached to ligands,
including oligonucleotides. In other embodiments, bioconjugates may
be ligands attached to a labeling moiety. Attachment may occur by
any of the linker chemistries discussed herein. Bioconjugates
include, for example, targeting constructs and labeling
constructs.
As used herein, the term "targeting construct" means a construct in
which a targeting moiety is attached to a ligand. In certain
embodiments, the targeting construct is an antibody attached to an
oligonucleotide. In other embodiments, the targeting construct is a
non-antibody protein with the desired affinity for a particular
binding target attached to an oligonucleotide. As used herein, an
"[X]:[Y] targeting construct" refers to a targeting construct in
which a targeting moiety of type [X] is attached to a ligand of
type [Y].
As used herein, the term "labeling construct" means a construct in
which a labeling moiety is attached to a ligand. In certain
embodiments, the labeling construct is a small molecule fluorophore
attached to an oligonucleotide, optionally via a dextran or other
scaffold. In other embodiments, the labeling construct is a
radionucleotide attached to an oligonucleotide, optionally via a
dextran or other scaffold. As used herein, an "[U]:[V] labeling
construct" refers to a labeling construct in which a labeling
moiety of type [U] is attached to an oligonucleotide of type [V].
Where [V] is stated as oligonucleotide, any sequence of
oligonucleotide is contemplated.
As used herein, the term "labeled targeting hybrid" means a
targeting construct and a labeling construct, in which the ligands
are oligonucleotides, and in which the respective oligonucleotides
have annealed to form a hybrid. In certain embodiments, this is an
antibody:oligonucleotide targeting construct hybridized to a
complementary oligo:fluorophore labeling construct. As used herein,
an "[M]::[N] labeled targeting hybrid" refers to a labeled
targeting hybrid in which a targeting construct containing a
targeting moiety of type [M] is hybridized to a labeling construct
containing a labeling moiety of type [N]. As used herein, the term
"antibody" is intended to refer broadly to any immunologic binding
agent, such as IgY, IgG, IgM, IgA, IgD and IgE, and includes
monoclonal antibodies, polyclonal antibodies, antibody fragments
(Fab', Fab, F(ab').sub.2, single domain antibodies (DABs), Fv, scFv
(single chain Fv), and the like, and chimeric antibodies.
Any of the methods disclosed herein may be automated in whole or in
part. In some embodiments, computer executable instructions or a
computer readable medium comprising computer executable
instructions, are provided for carrying out the steps of the
methods disclosed herein. In certain aspects, the computer
executable instructions comprise all or part of one or more of the
algorithms in FIGS. 11A-11B.
It is contemplated that any method or composition described herein
can be implemented with respect to any other method or composition
described herein.
The terms "comprise" (and any form of comprise, such as "comprises"
and "comprising"), "have" (and any form of have, such as "has" and
"having"), "contain" (and any form of contain, such as "contains"
and "containing"), and "include" (and any form of include, such as
"includes" and "including") are open-ended linking verbs. As a
result, a method, composition, kit, or system that "comprises,"
"has," "contains," or "includes" one or more recited steps or
elements possesses those recited steps or elements, but is not
limited to possessing only those steps or elements; it may possess
(i.e., cover) elements or steps that are not recited. Likewise, an
element of a method, composition, kit, or system that "comprises,"
"has," "contains," or "includes" one or more recited features
possesses those features, but is not limited to possessing only
those features; it may possess features that are not recited.
Any embodiment of any of the present methods, composition, kit, and
systems may consist of or consist essentially of--rather than
comprise/include/contain/have--the described steps and/or features.
Thus, in any of the claims, the term "consisting of" or "consisting
essentially of" may be substituted for any of the open-ended
linking verbs recited above, in order to change the scope of a
given claim from what it would otherwise be using the open-ended
linking verb.
The use of the term "or" in the claims is used to mean "and/or"
unless explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or."
Throughout this application, the term "about" is used to indicate
that a value includes the standard deviation of error for the
device or method being employed to determine the value.
Following long-standing patent law, the words "a" and "an," when
used in conjunction with the word "comprising" in the claims or
specification, denotes one or more, unless specifically noted.
Other objects, features and advantages of the present invention
will become apparent from the following detailed description. It
should be understood, however, that the detailed description and
the specific examples, while indicating specific embodiments of the
invention, are given by way of illustration only, since various
changes and modifications within the spirit and scope of the
invention will become apparent to those skilled in the art from
this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and
are included to further demonstrate certain aspects of the present
invention. The invention may be better understood by reference to
one or more of these drawings in combination with the detailed
description of specific embodiments presented herein.
FIGS. 1A-1C. (FIG. 1A) shows the antibody-oligonucleotide
conjugation by HyNic-4FB chemistry: (i)
Succinimidyl-6-hydrazinonicotinamide acetone hydrazone (S-HyNic) is
added to purified antibody (Ig), allowing succinimydyl groups to
react with free amino sites on lysine groups at the antibody hinge
region to form Ig-HyNic (iii). Similarly,
succinimidyl-4-formylbenzamide (S-4FB) reacts with amino-modified
oligonucleotide (ii) resulting in 4FB-oligo (iv). The HyNic- and
4FB-modified biomolecules are then combined in the presence of
aniline, which catalyzes the HyNic-4FB reaction, resulting in
formation of a covalent hydrazone bond (v) and a stable
antibody-oligonucleotide bioconjugate. (FIG. 1B) shows a scheme for
the preparation of an oligo:fluorophore labeling construct. To
prepare a 1:1 oligo:dextran conjugate (i), a 70 kDa amino-dextran
bearing approximately 20 amino groups per dextran is first reacted
with an amount of S-HyNic sufficient to create 3-4 HyNic moieties
per dextran, leaving >10 amino groups available for downstream
NHS-fluorophore labeling. In order to limit the final average
oligo-per-dextran to <1, a stoichiometrically-limiting amount of
4FB-modified oligonucleotide is then added to the HyNic-dextran, in
a pH 5.0 buffer containing 10% aniline catalyst (v/v). Following
the 4FB/HyNic reaction, the oligo-conjugated amino-dextran is
purified first by size exclusion chromatography (SEC) to remove
excess oligo, and then by ion exchange column (IEC) to remove
unconjugated dextran. To the amino-dextran-oligo is then added a
molar excess of NHS-ester fluorophore (ii). Excess fluorophore is
removed by dialysis, and the final oligo-dextran-fluorophore
product is characterized by A260 assay to confirm oligo-dextran
ratio and fluorophore degree of labeling (DOL). (FIG. 1C)
illustrates multiplexed cell labeling using labeled targeting
hybrids. Antibody:oligonucleotide targeting constructs are briefly
hybridized in solution to complementary fluorophore:oligonucleotide
labeling constructs (i) to form individual antibody::fluorophore
labeled targeting hybrids (ii). The labeled targeting hybrids may
then be used to label cells for a single antigen, or as shown here,
combined and used for multiplexed cell labeling (iii).
FIGS. 2A-2E Optimization of hybridization labeling conditions.
(FIG. 2A) To determine optimal oligo/oligo ratio for hybridization
of labeled targeting hybrids, a titration of oligo:fluorophore
labeling construct was performed by adding 0.5-10 molar equivalents
of oligo-1':Dy490 labeling construct to a fixed amount (6 pmol) of
antibody:oligo targeting construct, .alpha.CD4:oligo-1, in a small
volume of Phosphate Buffered Saline (PBS). The labeled targeting
hybrids were then added to viable splenocytes to label CD4 antigen,
and the labeled cells were analyzed by flow cytometry. Results
showed the population of CD4+ cells to be similar for all
titrations; however, nonspecific background caused by addition of
excess fluorophore increased above 1.0 oligo/oligo equivalents. A
titration of 0.5 molar equivalents oligo:fluorophore labeling
construct was used for subsequent assays. (FIG. 2B) Hybridization
was conducted either in solution, by combining antibody:oligo and
oligo:fluor in a small volume of PBS and then using the construct
to label cells, or in situ by first cell-labeling with
antibody:oligo and then introducing oligo:fluors for hybridization.
Results showed very similar positive labeling percentages for
hybridization in solution (dark green histogram) vs in situ (light
green tinted histogram). Unstained cells are shown as a background
control. (FIG. 2C) Blocking hybridization using an unmatched oligo
sequence (blue histogram) was successful, an indication that
antigen labeling is highly specific using hybridized labeling
constructs (green histogram). Blocking was conducted using a 5-fold
molar excess of oligo:fluor as shown in panel (A). The blocking
oligo did not prevent nonspecific binding of the oligo:fluor, as
evidenced by similar levels of dye background. (FIG. 2D) Time and
temperature conditions for hybridization were investigated, using
15-60 minute hybridization at 4.degree. C. (blue histograms),
24.degree. C. (gray histograms), or 37.degree. C. (pink
histograms). Results indicate that hybridization occurs with little
variation over this range of time and temperature conditions. (FIG.
2E) Adjusting signal intensity by increasing fluorophore degree of
labeling (DOL) from 3-15 fluors per oligo:fluorophore labeling
construct shows optimal signal to background at DOL.about.7, with
decreasing positive peak resolution at DOL<7 and marked
decreased in median fluorescence intensity (GMFI) at DOL>10,
most likely due to fluorescence self-quenching.
FIGS. 3A-3B (FIG. 3A) Antigen detection by antibody::fluorophore
labeled targeting hybrids. Labeled targeting hybrids (i)
xCD4::Dy490, (ii) xCD8::Dy549, (iii) xCD43::Dy649, and (iv)
xCD62L::Dy405 were prehybridized, mixed, and used to label cells
(tinted histograms). Single-construct stains (untinted histograms),
oligo:fluorophore-only stains (gray histograms), and unstained
cells (black histograms) were also analyzed as controls.
Percentages shown are for the 4-plex stained cell sample. Results
show effective antigen staining, comparable in single-stained
samples to multiplexed stained cells. Antigen-positive population
values were within expected ranges. (FIG. 3B) Multiplexed cell
labeling data. 2-color dot plots depict multi-antigen labeling data
for cells stained with four antibody::fluorophore labeled targeting
hybrids as previously described. The staining distributions seen
here provide evidence that the system is specific and sensitive,
allowing for accurate gating and analysis of immune cell
phenotypes. (I) CD4+ and CD8+ T-cell populations within the gated
lymphocyte population were clearly defined. (ii) The majority
(.about.74%) of lymphocytes are CD43+, and nearly all CD4+ cells
were CD43+. Two CD43high populations were evident, either CD4-
(34%) or CD4+ (7%). (iii) Most lymphocytes were CD62L+
(.about.75%). (iv) Gating of CD4+ lymphocytes and display of
CD4+/CD43 vs CD4+/CD62L distribution reveals that 30% of CD4+
T-lymphocytes were CD4+/CD43+/CD62L-, while 64% were
triple-positive for all 3 antigens. Only a small minority of CD4+
cells were negative for CD43 (6%) or were double-negative for CD43
and CD62L (2%). (v) A defined population of CD8+/CD43+ cells was
visible, as well as a CD8- population of CD43+ lymphocytes, either
CD43low (29%) or CD43high (15%). (vi) A distinct population of
CD8+/CD62L+ cells are visible (26%). (vii) Most CD43+ lymphocytes
are CD62L+; a distinct population of CD43high CD62L+ cells was
evident (33%). (viii) Gating of CD8+ lymphocytes and display of
CD4+/CD43 vs CD4+/CD62L distribution reveals that the majority
(93%) of CD8+ lymphocytes were CD43+/CD62L+.
FIGS. 4A-4C. Interchangeable fluorophore hybridization using the
universal oligo sequence pair. (FIG. 4A) Schematic showing
interchangeable hybridization principle. Antibody:oligo targeting
construct (Ig:oligo-A) can be hybridized to any
oligo-A':fluorophore labeling construct, resulting in
antibody::fluorophore labeled targeting hybrid in a variety of
spectra. (FIG. 4B) Universal-oligo constructs were used to label
cells for control antigen CD4 in four distinct spectra. Results
show that labeling percentages were very similar across fluorescent
channels for both antigens, indicating that antibodies can be
effectively labeled in a variety of spectra using the
universal-oligo approach. (FIG. 4C) CD4:oligonucleotide and
CD8:oligonucleotide targeting constructs were combined for
double-staining of cells in two fluorophore combinations: (i)
xCD4::Dy490+xCD8::Dy649; (ii) xCD4::Dy405+xCD8::Dy549. In order to
block oligo-mediated exchange of oligo:fluorophores when constructs
were mixed, an excess of unmodified oligo-A was added to each
construct immediately following hybridization in solution. While
exchange was observed to be low (.about.1%) without blocking oligo
at typical staining conditions (data not shown), with the addition
of blocking oligo the exchange dropped to a negligible
.about.0.5%.
FIG. 5A-5D. Preparation and analysis of quantitative oligospheres.
(FIG. 5A) Method I, parallel labeling of quantitative oligospheres
alongside cells. First, oligonucleotide-saturated microspheres
(.mu.) are hybridized to discrete, known amounts of complementary
oligo:fluorophore labeling construct at increasing titrations
(1-4). Amount of oligo-fluorophore label per microsphere event
(LPE) is separately confirmed by fluorimetry. The labeled
oligospheres are then added to cells which have been labeled with
antibody-fluorophore targeting hybrids. The labeled oligospheres
and cells are then cytometrically analyzed. (FIG. 5B) Method II,
combined labeling of quantitative oligospheres in solution with
cells. First, oligonucleotides are conjugated to microspheres
(.mu.) at increasing, known surface saturations (1-4). The
oligospheres are added to cells which have been incubated with
antibody-oligo targeting constructs. The combined oligospheres and
cells are then labeled in solution followed by cytometric analysis.
(FIG. 5C) Fluorometric analysis of four oligosphere populations
hybridized with increasing titrations of labeling construct (1-4,
labeled low-high) as in FIG. 5A. Labeling construct Per oligosphere
Event (LPE) is determined by measuring oligosphere fluorescence for
a sample of oligospheres vs a standard curve of labeling construct
in solution (not shown). The oligospheres are then counted (not
shown). LPE=[(mol labeling construct per sample.times.6E23
molecules per mol)/number oligospheres per sample]. (FIG. 5D)
Cytometric analysis of four oligospheres populations shown in FIG.
5C, 1-4, labeled low-high (solid filled histograms). Increasing LPE
translates to increasing fluorescence when cytometer fluorescence
data are visualized by analysis software. Oligosphere singlets were
gated (not shown) and data histograms were overlaid with a
histogram showing unlabeled microsphere signal (autofluorescence,
dashed open histogram).
FIGS. 6A-6D. Multiplexed Quantitative Flow Cytometry. Viable murine
splenocytes (filled histograms) were probed using four distinct
labeling hybrids: anti-CD4::Dy490 (FIG. 6A), anti-CD8::Dy549 (FIG.
6B), anti-CD43::Dy649 (FIG. 6C), and anti-CD62L::Dy405 (FIG. 6D).
Quantitative fluorophore-hybridized oligospheres (open histograms)
were labeled and analyzed with cells to quantify multiple surface
antigens.
FIGS. 7A-7D. ABC Calculations. Geometric Mean Fluorescence
Intensities (GMFIs) were determined for quantitative oligospheres
(circles) in each fluorescent channel using cytometric data
analysis software. Log 10 GMFIs were plotted vs log known
fluorescent Label Per oligosphere Event (LPE), which were
previously determined fluorimetrically (not shown). Cellular
populations of interest (stars) were gated and GMFIs were
determined using cytometric data analysis software. Antibody
Binding per Cell (ABC) A 1:1 label:antibody ratio is assumed in
this system; therefore, LPE=ABC, and thus ABC can then be
determined from GMFI using the equations shown. Cellular data
points shown represent geometric mean ABC for populations of
interest (CD4+, CD8+, CD43.sup.LO, CD43.sup.HI, CD62L+).
FIG. 8. Single-cell ABC. Determination of single-cell ABC for 1,000
lymphocytes was conducted as shown in FIG. 7 and results are
presented in 2-channel dot plots showing distribution of cellular
populations. As expected, quantitative ABC cellular distribution is
similar to qualitative 2D plots shown in FIG. 3B, yet quantitative
data yields improved information regarding the antigenicity of
cells.
FIGS. 9A-9C. Oligospheres and Cells Labeled in Combination.
Quantitative oligospheres (open histograms) and cells (filled
histograms) were labeled in combination as shown in FIG. 5B.
Results show that labeling in combination is feasible and produces
distinctly labeled cellular and oligosphere populations. (FIG. 9A)
Distinct populations of oligospheres and lymphocytes shown in a FSC
vs SSC scatter plot. (FIG. 9B) Fluorescent (Alexa Fluor 488)
lymphocytes displaying CD4- and CD4+ populations. (FIG. 9C)
Histogram overlay of oligosphere (black) and cellular (gray)
data.
FIGS. 10A-10B. Quantitation of ABC.sub.CD4 Using Commercial
Reagents. Commercial quantitative fluorescent microspheres (BD
QuantiBrite PE) were used to quantify ABC.sub.CD4 using similar
methodology and the same monoclonal antibody (GK1.5) used for
ABC.sub.CD4 quantitation using novel quantitative oligospheres.
(FIG. 10A) Commercial microspheres and anti-CD4:PE stained cells
were cytometrically analyzed to obtain GMFI data. (FIG. 10B)
Microsphere Log 10 GMFI plotted vs Log 10 PE molecules per
microsphere (lot-specific data provided by manufacturer). The
equation generated by the microsphere standard curve was then used
to quantify mean CD4+ according to the manufacturer protocol.
ABC.sub.CD4 data were very similar for commercial vs novel method
(29741 vs 28824 CD4 antibody per cell).
FIGS. 11A-11B. Flowcharts for Software Algorithms. (FIG. 11A)
Flowchart for Algorithm I (calculation of standard curve from
oligosphere data). (FIG. 11B) Flowchart for Algorithm II
(calculation of Antibody Binding per Cell, ABC).
FIGS. 12A-12C. Spectral Compensation. Fluorophore-hybridized
oligospheres were used to spectrally separate two adjacent
fluorescent channels (FL1, FL2) using a conventional cytometer (BD
LSRII) and commonly used analysis software (FlowJo). (FIG. 12A)
Oligospheres are recognized by FlowJo Compensation Wizard software
function, which auto-gated the oligospheres for singlets, FL1/FL2
positive and FL1/FL2 negative populations according to common
methodology. The Compensation Wizard created a compensation
correction matrix (not shown) which was then applied to correct the
mixed two-color oligosphere sample shown below. (FIG. 12B)
Uncompensated mixed sample of FL1+ or FL2+ oligospheres.
Uncompensated data indicate 2 populations of FL1+ FL2+ oligospheres
rather than separate, single-fluorophore spheres. (FIG. 12C).
Compensated mixed sample of FL1+ or FL2+ oligospheres. The
compensated data correctly show two separate, single-fluorophore
oligosphere populations (either FL1+ or FL2+, not FL1+FL2+).
FIGS. 13A-13B. Cytometer Alignment. Fluorophore-hybridized
oligospheres of a single color and intensity (FIG. 13A) were
compared to commercial fluorescent microspheres (FIG. 13B) in terms
of CV (%) to evaluate whether oligospheres may be used for
instrument alignment. CVs were similar for oligospheres and
commercialized microspheres. The inventors plan to reduce CVs for
oligospheres in the future by utilizing alternative
amino-functionalized microspheres as a starting point, that may
enable CV reduction of resulting fluorescent signal.
FIGS. 14A-14B. Cytometer Calibration. Fluorophore-hybridized
oligospheres of a single color and multiple intensities (FIG. 14A)
were compared to commercial fluorescent microspheres (FIG. 14B) in
terms of fluorescent peak resolution and distribution to evaluate
whether oligospheres may be used for instrument calibration.
Oligosphere peaks were well distributed, but resolution was
somewhat lower than commercialized microspheres. As noted in FIG.
13, the inventors plan to improve resolution for oligospheres in
the future by utilizing alternative amino-functionalized
microspheres as a starting point, that may improve resolution of
resulting fluorescent signals.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Methods and composition for quantitative flow cytometry and
quantitative CyTOF are provided herein. Particular embodiments
utilize a DNA-directed assembly strategy for cellular labeling. In
certain aspects, antibody:oligonucleotide targeting constructs are
hybridized to complementary oligonucleotide:fluorophores labeling
constructs in solution to create a labeled targeting hybrid. The
antibody::fluorophore labeled targeting hybrid is then used to
label cellular antigens. Fluorophore-hybridized oligospheres
utilizing the same fluorophore used to label the hybridized
antibody::fluorophore labeled targeting hybrid are added to the
cytometric analysis in order to convert relative units of
fluorescence to quantitative measures of Label Per Event (LPE). LPE
is then used to calculate the number of Antibodies Bound per Cell
(ABC) based on the known label-target ratio established during the
construct ligation step.
A. Flow Cytometry
Various embodiments described herein provide a quantitative
approach to flow cytometry. Flow cytometry is an optical technique
that analyzes particles in a fluid mixture based on the particles'
optical characteristics using an instrument known as a flow
cytometer. Flow cytometers hydrodynamically focus a fluid
suspension of particles into a thin stream so that the particles
flow down the stream in substantially single file and pass through
an examination zone. A focused light beam, such as a laser beam
illuminates the particles as they flow through the examination
zone. Optical detectors within the flow cytometer measure certain
characteristics of the light as it interacts with the particles.
Commonly used flow cytometers can measure forward light scatter
(generally correlated with the refractive index and size of the
particle being illuminated), side light scatter (generally
correlated with the particle's internal complexity and
granularity), and particle fluorescence at one or more
wavelengths.
The types of "particles" that may be analyzed by a flow cytometer
include cells as well as man-made microspheres or beads.
Fluorescent microspheres for use as calibrants for
semi-quantitative flow cytometry are generally known in the art and
may be obtained from manufacturers such as Becton Dickinson (BD),
Spherotech, and Bangs Laboratories. Protein-binding microspheres
may also be analyzed via flow cytometry and are available from
manufacturers such as Life Technologies (Invitrogen) and
EMD-Millipore (Luminex).
Conventional methods of multiplexed flow cytometry are invaluable
to clinical and research laboratories, and are used for a wide
range of applications from studies of cellular biology to disease
diagnosis. However, due to existing constraints placed by
conventional methods and reagents, flow cytometry has almost
universally been practiced using subjective analysis parameters.
The quantitative approach to flow cytometry described herein
provide researchers more flexibility in experimental design and a
streamlined approach to quantitation; thus, this is an important
development in the field that addresses many of the current
challenges to conventional flow cytometry.
B. Single-Cell Mass Cytometry
Embodiments described herein may also be used to provide a
quantitative approach to single-cell mass cytometry (CyTOF). CyTOF
is another platform that can be used to simultaneously analyze
multiple parameters of individual cells in a sample (Bendall et
al., Science, 332:687-696 (2011)). The work flow is comparable to
that of fluorescence flow cytometery. In general, antibodies
labeled with heavy metals or transition element isotopes are used
to bind target epitopes on or within cells. The antibody-bound
cells are then vaporized, such as by spraying single-cell droplets
into an inductively coupled argon plasma at approximately 5500 K.
Vaporization induces ionization of the cells atomic constituents.
The elemental ions are then sampled by a Time-Of-Flight (TOF) mass
spectrometer and quantified. The signal for each metal/isotope that
labeled a particular cell are thereby detected.
C. Antibody:Oligonucleotide Targeting Constructs
As discussed above, labeled antibodies are employed in both flow
cytometry and CyTOF platforms. Although there are a variety of
commercially available antibodies biochemically conjugated to
fluorochromes, the majority of clones are only available in a
limited number of colors, often in the same standard fluorochrome
such as fluorescein. The interchangeable "Mix and Match"
hybridization strategy of the antibody:oligonucleotide targeting
constructs disclosed herein, offers a significant improvement over
existing methods. In particular, antibody:ligand targeting
constructs facilitate greater interchangeability than afforded
using direct antibody-fluorophore conjugates, and provide a more
convenient solution for multiplexed labeling that indirect labeling
techniques based on biotin-streptavidin chemistry.
Antibodies are glycoproteins belonging to the immunoglobulin
superfamily. Antibodies typically are made of two large heavy
chains and two small light chains. There are several different
types of antibody heavy chains, and several different kinds of
antibodies, which are grouped into different isotypes (IgA, IgD,
IgE, IgG and IgM in mammals) based on which heavy chain they
possess. Though the general structure of all antibodies is very
similar, a small region known as the hypervariable region at the
tip of the protein is extremely variable. This allows for enormous
diversity of antibodies to recognize a wide variety of
antigens.
The antibody portion of the antibody:ligand targeting construct may
comprise any immunologic binding agent, such as IgG, IgM, IgA, IgD
and IgE or Fab', Fab, F(ab').sub.2, single domain antibodies
(DABs), Fv, and scFv (single chain Fv) fragments thereof. In
certain aspects the antibody is a monoclonal antibody. Monoclonal
antibodies (MAbs) may be readily prepared through use of well-known
techniques, such as those exemplified in U.S. Pat. No. 4,196,265,
incorporated herein by reference. Typically, this technique
involves immunizing a suitable animal with a selected immunogen
composition, e.g., a purified or partially purified protein,
polypeptide, peptide or domain, be it a wild-type or mutant
composition. The immunizing composition is administered in a manner
effective to stimulate antibody producing cells. Following
immunization, somatic cells with the potential for producing
antibodies, specifically B lymphocytes (B cells), are selected for
use in the MAb generating protocol. These cells may be obtained
from biopsied spleens, tonsils or lymph nodes, or from a peripheral
blood sample. The antibody-producing B lymphocytes from the
immunized animal are then fused with cells of an immortal myeloma
cell, generally one of the same species as the animal that was
immunized. Myeloma cell lines suited for use in hybridoma-producing
fusion procedures preferably are non-antibody-producing, have high
fusion efficiency, and enzyme deficiencies that render then
incapable of growing in certain selective media which support the
growth of only the desired fused cells (hybridomas). Typically,
selection of hybridomas is performed by culturing the cells by
single-clone dilution in microtiter plates, followed by testing the
individual clonal supernatants (after about two to three weeks) for
the desired reactivity. The assay should be sensitive, simple and
rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity
assays, plaque assays, dot immunobinding assays, and the like.
Fragments of monoclonal antibodies can be obtained by enzymatic
digestion, cleavage, or chemical reduction of monoclonal
antibodies. Alternatively, monoclonal antibody fragments may be
synthesized using an automated peptide synthesizer or produced
recombinantly.
The antibody may be conjugated to a ligand using a variety of
techniques. One approach is the use of HyNic-4FB. Briefly,
succinimidyl-6-hydrazinonicotinamide acetone hydrazone (S-HyNic) is
added to purified antibody, converting free amino groups on lysines
near the antibody hinge region to HyNic moieties. Similarly,
succinimidyl-4-formylbenzamide (S-4FB) added to amino-modified
oligo converts amino groups to 4-FB moieties. When combined in the
presence of aniline catalyst, the HyNic and 4-FB sites on modified
biomolecules react to produce a stable, covalent hydrazone bond and
forming the antibody:oligo conjugate. Following purification using
a nickel column, this process results in >95% yield of
antibody:oligo conjugate.
The antibody may alternatively be conjugated to a ligand according
to a variety of bioconjugation techniques known to those in the
art. These include modification of amine, carbonyl, hydroxyl,
sulfhydryl, or other available groups on biomolecules to
incorporate linker moieties, with subsequent reaction of the linker
moieties to form a conjugate. Linker pairs may include
(strept)avidin-biotin, azide-acrylamide, thiol-maleimide, and
others (Hermanson, Bioconjugate Techniques, Academic Press 1996).
However, modification and linkage of biomolecules may affect
biological activity of either the antibody and/or the
oligonucleotide, so milder reactions proceeding at neutral pH,
temperature and salt conditions (e.g., hydrazone chemistry) are
preferable to reactions requiring harsh conjugation conditions
(e.g., sulfhydryl reduction followed by thiol-maleimide
modification).
Herein, a ligand generally comprises an oligonucleotide linked to
an antibody, although alternative ligands (e.g. peptides or
haptens) may be used. Oligonucleotides conjugated to the antibodies
are designed to hybridize to complementary, labeled
oligonucleotides. As used herein, "hybridization," "hybridizes" or
"capable of hybridizing" is understood to mean the forming of a
double- or occasionally triple-stranded molecules, or a molecule
with partial double or triple stranded nature. The term "anneal" as
used herein is synonymous with "hybridize." An important parameter
for describing oligonucleotides and their interaction with
complementary sequences is the so-called T.sub.m, the temperature
at which 50% of the nucleic acid duplex formed by hybridization of
complementary sequences is dissociated. The T.sub.m varies
according to a number of sequence dependent properties including
the hydrogen bonding energies of the canonical pairs A/U-T and G-C
(often measured as the GC percentage or base composition), the
stacking free energy and, to a lesser extent, nearest neighbor
interactions. These energies vary widely among oligonucleotides
that are typically used in hybridization assays. For example,
hybridization of two probe sequences composed of 24 nucleotides,
one with a 40% GC content and the other with a 60% GC content, with
its complementary target under standard conditions theoretically
may have a 10.degree. C. difference in melting temperature.
In multiplex assays, problems in hybridization occur when the
hybrids are allowed to form under hybridization conditions that
include a single hybridization temperature that is not optimal for
correct hybridization of all oligonucleotide sequences of a set.
Mismatch hybridization of non-complementary probes can occur,
forming duplexes with measurable mismatch stability. Mismatching of
duplexes in a particular set of oligonucleotides can occur under
hybridization conditions where the mismatch results in a decrease
in duplex stability that results in a higher Tm than the least
stable correct duplex of that particular set. For example, if
hybridization is carried out under conditions that favor the
AT-rich perfect match duplex sequence, the possibility exists for
hybridizing a GC-rich duplex sequence that contains a mismatched
base having a melting temperature that is still above the correctly
formed AT-rich duplex. Accordingly, methods of Tm normalization
have been employed in an effort to maintain equivalent
hybridization stringency between nucleic acids having disparate
Tms. Some of these methods include the use of non-natural nucleic
acid backbones (LNA for example) or the use of hairpin probes.
Typically, it will be desirable that the oligonucleotides
conjugated to the antibody are not cross-reactive with other
nucleic acids that may be present in a sample. And, in multiplexed
application, it will also be desirable that an oligonucleotide
conjugated to one antibody is not cross-reactive with the labeled
oligonucleotide probe for another antibody:oligonucleotide
conjugate. There are a number of different approaches for selecting
complementary oligonucleotide sequences for use in multiplexed
hybridization assays. The selection of sequences that can be used
as zip codes or tags in an addressable array has been described in
the patent literature in an approach taken by Brenner and
co-workers (U.S. Pat. No. 5,654,413, incorporated herein by
reference). In addition, U.S. Pat. No. 7,226,737, incorporated
herein by reference, describes a set of 210 non-cross hybridizing
tags and anti-tags. U.S. Published Application No. 2005/0191625,
incorporated herein by reference, discloses a family of 1168 tag
sequences with a demonstrated ability to correctly hybridize to
their complementary sequences with minimal cross hybridization.
The nucleic acids disclosed herein may be prepared by any technique
known to one of ordinary skill in the art, such as for example,
chemical synthesis, enzymatic production, or biological production.
Non-limiting examples of a synthetic nucleic acid (e.g., a
synthetic oligonucleotide), include a nucleic acid made by in vitro
chemical synthesis using phosphotriester, phosphite or
phosphoramidite chemistry and solid phase techniques such as
described in EP 266,032, incorporated herein by reference, or via
deoxynucleoside H-phosphonate intermediates as described by U.S.
Pat. No. 5,705,629, incorporated herein by reference. Various
different mechanisms of oligonucleotide synthesis have been
disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571,
5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146,
5,602,244, each of which is incorporated herein by reference.
A non-limiting example of an enzymatically produced nucleic acid
include one produced by enzymes in amplification reactions such as
Polymerase Chain Reaction (PCR) (see for example, U.S. Pat. Nos.
4,683,202 and 4,682,195, each incorporated herein by reference), or
the synthesis of an oligonucleotide described in U.S. Pat. No.
5,645,897, incorporated herein by reference. A non-limiting example
of a biologically produced nucleic acid includes a recombinant
nucleic acid produced (i.e., replicated) in a living cell, such as
a recombinant DNA vector replicated in bacteria (see for example,
Sambrook et al., 2001).
The oligonucleotides may include nucleotide isomers or base
analogs. A nucleic acid sequence may comprise, or be composed
entirely of, an analog of a naturally occurring nucleotide.
Nucleotide analogs are well known in the art. A non-limiting
example is a "Peptide Nucleic Acid," also known as a "PNA,"
"peptide-based nucleic acid analog," or "PENAM," described in U.S.
Pat. Nos. 5,786,461, 5,891,625, 5,773,571, 5,766,855, 5,736,336,
5,719,262, 5,714,331, 5,539,082, and WO 92/20702, each of which is
incorporated herein by reference. PNAs generally have enhanced
sequence specificity, binding properties, and resistance to
enzymatic degradation in comparison to molecules such as DNA and
RNA (Egholm et al., 1993; PCT/EP/01219). Another non-limiting
example is a Locked Nucleic Acid or "LNA." An LNA monomer is a
bi-cyclic compound that is structurally similar to RNA nucleosides.
LNAs have a furanose conformation that is restricted by a methylene
linker that connects the 2'-O position to the 4'-C position. Yet
another non-limiting example is a "polyether nucleic acid,"
described in U.S. Pat. No. 5,908,845, incorporated herein by
reference. In a polyether nucleic acid, one or more nucleobases are
linked to chiral carbon atoms in a polyether backbone.
D. Oligospheres
Methods described herein can be applied to create quantitative
ligand-surfaced microspheres using any type of ligand (e.g.
oligospheres, peptides, haptens). However, various embodiments
disclosed herein use oligospheres as quantitative reference
standards. Oligospheres comprise microspheres conjugated to
oligonucleotides. In some embodiments, the oligonucleotides will be
conjugated substantially uniformly to the entire surface of the
oligosphere (as in FIG. 5A). In other embodiments, the
oligonucleotides will be conjugated at increasing titrations to the
surface of the oligosphere (as in FIG. 5B).
The oligonucleotides may be conjugated to the microspheres
according to a variety of techniques known to those in the art.
Similar to antibody-oligo conjugation, the
oligonucleotide-microsphere conjugation procedure may involve
modification of amine, carboxyl, hydroxyl or other reactive groups
on oligonucleotides and microsphere surfaces in order to
incorporate linker moieties for subsequent conjugation reactions;
linker chemistry may include HyNic/4FB (hydrazone),
(strept)avidin/biotin, phosphoramidite, octadinyl dU, and other
chemistries. Alternatively, the microspheres may be
pre-manufactured to present surface reactive groups to which
reactive-group bearing oligo may be conjugated (e.g., amino- or
streptavidin-modified microspheres). Typically, the
oligonucleotides will be conjugated substantially uniformly to the
entire surface of the oligosphere. In certain aspects, a
non-reactive spacer sequence is placed between the microsphere and
the region of the oligonucleotide that is complementary to the
probe. Such non-reactive spacers may, for example, facilitate
conjugation to the microsphere and/or reduce steric hindrance of
the oligonucleotide. Examples of non-reactive spacers include Poly
Ethylene Glycols (PEGs) or oligonucleotide domains designed for
minimal cross-reactivity (e.g. poly-Thymine, "PolyT").
In certain embodiments, the oligospheres are hybridized to the same
labeled oligonucleotide probe that is used to hybridize to the
antibody:oligonucleotide targeting construct. Thus, the
oligospheres and the cells in the assay are labeled with the same
label. FIGS. 5A-5B illustrate two methods for preparation of a
titrated population of quantitative oligospheres. As shown in FIG.
5A, oligonucleotides are conjugated to microspheres at surface
saturation. A complementary oligo:fluorophore labeling construct is
then added at increasing levels of titration, creating populations
of fluorescent microspheres of increasing signal intensity.
Following oligo:fluorophore hybridization, remaining (free) surface
oligonucleotide may be passivated by the addition of unmodified
complementary oligonucleotide to reduce nonspecific reactivity of
free oligo (data not shown). The populations of
fluorophore-hybridized microspheres are then mixed, and can then be
added to cells stained with antibody::fluorophore labeled targeting
hybrid. As shown in FIG. 5B, oligonucleotides are conjugated to
microspheres at increasing surface saturations, but are not yet
labeled with complementary oligo:fluorophore. They are first
combined with cells bearing targeting construct (i.e.
antibody:oligo). Complementary oligo:fluorophore labeling construct
is then added in sufficient amount to label both cells and
oligospheres.
Using either preparation method allows the mixed sample of cells
and quantitative oligospheres to be analyzed by flow cytometry,
with the oligospheres providing an internal standard curve for
quantitation of cellular ABC. Accordingly, the oligosphere data can
be immediately and easily used for straightforward ABC calculation
as described herein.
E. Analysis of Cells
Flow cytometry and CyTOF are valuable tools for study of cells. In
particular, multiplexed cellular phenotyping is a principal
strategy applied in immunology research. Surface antigens
indicative of immune cell status are detected by multiplexed
antibody labeling, the sample is analyzed by flow cytometry or
CyTOF, and phenotypic subset identification is conducted. Using
data analysis software, subsets are gated for inclusion in or
exclusion from further analysis.
Various embodiments disclosed herein, address various challenges
presented by conventional fluorescence flow cytometric methods by
utilizing a DNA-Directed Assembly (DDA) strategy for cellular
labeling. Antibody:oligonucleotide targeting constructs are
hybridized to complementary oligo:fluorophore labeling constructs
in solution to create a labeled targeting hybrid. The
antibody::fluorophore labeled targeting hybrid is then used to
probe cellular antigens. Fluorophore-hybridized microspheres added
to the cytometric analysis are used to convert relative units of
fluorescence to quantitative measures of Labeling construct Per
Event (LPE). LPE is then used to calculate the number of Antibodies
Bound per Cell (ABC). This approach can also be adapted to CyTOF
analysis by replacing the fluorophore with a metal/isotope
label.
Antibody:oligonucleotide targeting constructs comprising antibodies
specific to various immune cell surface antigens can be used in
multiplexed cellular phenotyping. Peripheral Blood Mononuclear
Cells (PBMC) are comprised of cells of myeloid and lymphoid
lineages. Myeloid cells include monocytes, macrophages, and
dendritic cells. Lymphoid cells include T cells, NK cells, B cells,
and lymphoid dendritic cells. The expression patterns of surface
antigens in different immune cell types are known to those in the
art. A description of some of these expression patterns is provided
below.
Natural Killer cells (NK cells) are a type of cytotoxic lymphocyte.
NK cells are activated in response to interferons or
macrophage-derived cytokines, and they play a major role in the
rejection of tumors and cells infected by viruses. NK cells are
characterized by their lack of the T cell receptor (CD3) and their
expression of CD56 on their surface. Accordingly, these
characteristics may be used to separate NK cells from other cell
types.
T cells play a role in cell-mediated immunity. One way in which T
cells can be distinguished from other lymphocytes, such as B cells
and NK cells, is by the presence on their cell surface of the T
cell receptor. Activation of CD8+ T cells and CD4+ T cells occurs
through the engagement of both the T cell receptor and CD28 on the
T cell by the Major Histocompatibility Complex (MHC) peptide and B7
family members on an antigen presenting cell. Activation-associated
surface antigen CD43 is expressed at distinct low and high levels,
and lymphocyte homing molecule CD62L is expressed at a range of
levels as it is degraded upon cellular activation. Monocytes also
express CD4, but they can be distinguished from CD4+ lymphocytes,
because monocytes also express CD14 on their surface.
In some aspects of the invention, the cells are mammalian cells,
including cultured mammalian cells (e.g., murine or human tumor,
stem, or immortalized cell lines), cells derived from laboratory
rodents, or cells derived from human patient samples such as whole
blood, fine-needle cellular aspirates, or biopsy tissue. In certain
embodiments, the cell sample is derived from an environmental
sample such as a water, soil, or air. In other embodiments, the
sample is from a plant, bacteria, virus, fungi, protozoan, or
metazoan.
F. Kits
The present invention also provides kits. Any of the components
disclosed herein may be combined in a kit. In certain embodiments
the kits comprise one or more of an targeting construct, a labeling
construct, and/or ligand-surfaced microspheres.
In certain embodiments, the kit comprises a composition comprising
a titrated population of labeled oligospheres, wherein the titrated
population of labeled oligospheres comprises at least 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, or 12 subpopulations of labeled oligospheres,
wherein each of the subpopulations of labeled oligospheres is
hybridized to a different amount of labeling construct. In certain
aspects, the titrated population of labeled oligospheres are
combined in a single container in the kit. In other aspects, the
subpopulations are provided of labeled oligospheres are provided in
separate containers in the kit. In some embodiments, the kit
comprises an antibody:oligonucleotide targeting construct and/or a
fluorophore:oligonucleotide labeling construct. In certain
embodiments, the oligonucleotide in the fluorophore:oligonucleotide
labeling construct is complementary to the oligonucleotides on the
oligosphere and the antibody:oligonucleotide targeting
construct.
The kits will generally include at least one vial, test tube,
flask, bottle, syringe or other container, into which a component
may be placed, and preferably, suitably aliquoted. Where there is
more than one component in the kit, the kit also will generally
contain a second, third or other additional containers into which
the additional components may be separately placed. However,
various combinations of components may be comprised in a container.
In some embodiments, all of the oligosphere subpopulations in a
series are combined in a single container. In other embodiments,
some or all of the oligosphere subpopulations in a series are
provided in separate containers.
The kits of the present invention also will typically include
packaging for containing the various containers in close
confinement for commercial sale. Such packaging may include
cardboard or injection or blow molded plastic packaging into which
the desired containers are retained. A kit may also include
instructions for employing the kit components. Instructions may
include variations that can be implemented.
G. Examples
The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
1. Selection of oligonucleotide sequences, antibodies, and
fluorophores
Oligonucleotide sequences are shown in Table 1. Oligo pairs 1/1',
2/2', 3/3', and 4/4' were designed and validated by Feldkamp et al
[7] to have low reactivity with unmatched oligo sequences, high
melting temperature, stable and robust hybridization activity, and
desirable hairpin formation characteristics (i.e., retain hairpins
at higher temperatures, reducing oligo crosstalk between unmatched
sequences). Oligo crosstalk was tested for pairs 1-4 by staining
cells with a matrix of matched and unmatched
antibody:oligo::oligo:fluor pairs, and observed undesirable
crosstalk to be <2% in all cases. This has implications for
multiplexed cell labeling (i.e., any number of antibody:oligos can
be mixed together with oligo:fluors in solution without assay
interference by crosstalk via oligo exchange).
TABLE-US-00001 TABLE 1 Oligonucleotide Sequences Tm Oligo Sequence
Bases (.degree. C.) oligo-1 CCTGCGTCGTTTAAGGAAGTAC 22 62.2 oligo-1'
GTACTTCCTTAAACGACGCAGG 22 62.2 oligo-2 GGTCCGGTCATAAAGCGATAAG 22
62.2 oligo-2' CTTATCGCTTTATGACCGGACC 22 62.2 oligo-3
GCTGACATAGAGTGCGATAC 20 62.2 oligo-3' GTATCGCACTCTATGTCAGC 20 62.2
oligo-4 TGTGCTCGTCTCTGCATACT 20 63.5 oligo-4' AGTATGCAGAGACGAGCACA
20 63.5 oligo-A GGAAGCGGTGCTATCCATCT 20 71.1 oligo-A'
AGATGGATAGCACCGCTTCC 20 71.1 oligo-1 (SEQ ID NO: 1), oligo-1' (SEQ
ID NO: 2), oligo-2 (SEQ ID NO: 3), oligo-2' (SEQ ID NO: 4), oligo-3
(SEQ ID NO: 5), oligo-3' (SEQ ID NO: 6), oligo-4 (SEQ ID NO: 7),
oligo-4' (SEQ ID NO: 8), oligo-A (SEQ ID NO: 9), oligo-A' (SEQ ID
NO: 10)
In addition to oligo pairs 1/1'-4/4', novel oligo pair A/A' was
designed to have similar desirable qualities to the Feldkamp oligos
using CANADA DNA sequence generating software (Feldkamp, et al.,
2002; Feldkamp, et al., 2010) to simulate hybridization, melting
and folding activity. Oligo-A/A' was used as a "universal" oligo
sequence (see discussion following).
Antibodies were selected targeting commonly-probed T-cell markers
CD4 and CD8, as well as activation-associated surface antigen CD43,
which is expressed at distinct low and high levels, and lymphocyte
homing molecule CD62L, which expresses at a range of levels as it
is degraded upon cellular activation. Antibody clones were chosen
based on previously validated activity for .alpha.CD4 (clone
GK1.5), .alpha.CD8 (2.43.1), .alpha.CD43 (S7) and .alpha.CD62L
(MEL-14) (activity confirmed by personal communication). As a
panel, these four antibody targets allow for phenotypic delineation
of several subsets of murine T-lymphocytes. Antibody-oligo
conjugates are listed in Table 2.
TABLE-US-00002 TABLE 2 Oligonucleotide conjugates Ig:oligo
conjugate Clone Oligos per Ig Conjugate DOL .alpha.CD4:oligo-1
GK1.5 2.1 oligo-1':Dy490 4.7 .alpha.CD8:oligo-2 2.43.1 2.4
oligo-2':Dy549 6.4 .alpha.CD43:oligo-3 S7 3.1 oligo-3':Dy649 8.1
.alpha.CD62L:oligo-4 MEL-14 2.6 oligo-4':Dy405 10.4
.alpha.CD4:oligo-A GK1.5 4.6 oligo-A':Dy490 7.6 .alpha.CD8:oligo-A
2.43.1 2.8 oligo-A':Dy549 6.5
Oligo:fluorophores labeling constructs used for this study are also
described in Table 2. DyLight fluorophores were chosen due to their
suitability for 4-laser flow cytometry, relatively narrow
excitation/emission spectra which reduces or eliminates the need
for spectral compensation of multiplexed staining data, and
availability in NHS-ester modified format for conjugation to
oligo-dextran scaffolds (see below).
2. Oligonucleotide Conjugate Preparation
Antibody:oligonucleotides targeting constructs were prepared as
shown in FIG. 1A. Briefly, succinimidyl-6-hydrazinonicotinamide
acetone hydrazone (S-HyNic) was added to purified antibody,
converting free amino groups on lysines near the antibody hinge
region to HyNic moieties. Similarly, succinimidyl-4-formylbenzamide
(S-4FB) was added to amino-modified oligo converts amino groups to
4FB moieties. When combined in the presence of aniline catalyst,
the HyNic and 4-FB sites on modified biomolecules react to produce
a stable, covalent hydrazone bond and forming the antibody:oligo
conjugate. Following purification using a nickel column, this
process resulted in >95% yield of antibody:oligo targeting
constructs.
The preparation of oligo:fluorophore labeling constructs is shown
in FIG. 1B. Amino-dextran bearing .about.20 amino groups per
dextran was first HyNic-modified using a limited amount of S-HyNic
to result in 3-4 HyNic moieties per dextran. To the
HyNic-amino-dextran was added a stoichiometrically limiting amount
of 4-FB-oligo such that the number of oligos per dextran in the
final product was limited to .ltoreq.1, an important factor
necessary to restrict oligo hybridization at a 1:1 ratio of
antibody:oligo targeting construct to oligo:fluor labeling
construct. Multiple-oligo hybridization would result in more than
one antibody per dextran conjugate, which could produce unwanted
double-hybridization and aggregation of conjugates.
Following oligo-coupling to the dextran scaffold, free amino groups
on the dextran remain available for reaction with NHS ester
fluorophore (here, NHS-DyLight fluors were used). A molar excess of
NHS-fluor was added to oligo-dextran, allowed to react and the
final conjugate was characterized after desalting by dialysis.
Characterization by A260 assay allowed calculation of fluorophore
Degree Of Labeling (DOL) of the conjugate. Oligo:fluorophore
labeling constructs having DOL from approximately 3-15 fluors per
dextran were prepared, with a final conjugate yield of 15-20%.
Oligo-conjugates were utilized for cellular antigen labeling as
illustrated in FIG. 1C. First, antibody:oligo targeting constructs
were hybridized to complementary oligo:fluorophore labeling
constructs briefly in solution. The prepared antibody::fluorophore
labeled targeting hybrid was then used to label cells in the manner
of a conventionally prepared antibody-fluorophore conjugate.
Hybridized labeling constructs can be used to label cells for a
single antigen, or (as shown in the figure), combined into a
labeling cocktail for multiplexed cell labeling.
3. Optimization of Hybridization and Cell Labeling Conditions
A model system including freshly prepared normal B6 murine
splenocytes, commonly used control and validation T-cell marker
antibody CD4, and DyLight 490 (Dy490) fluorophore was used to
determine optimal assay conditions for labeling-construct
hybridization and viable cell staining Antibodies and
dextran-coupled fluorophores were oligo-modified as previously
described. Cells were stained with antibody::fluorophore labeled
targeting hybrids in a conventional manner (e.g., added to Fc
receptor-blocked cells for 30 minutes at 4.degree. C.), washed and
analyzed by flow cytometry; CD4 staining was visualized for the
gated lymphocyte population.
It was first investigated whether antibody:oligo targeting
constructs could be hybridized to complementary oligo:fluorophore
labeling constructs briefly in solution, and the resulting solution
of labeled targeting hybrids then used to label cells. To this end,
it was hypothesized that the ratio of oligo:fluorophore labeling
construct added to antibody:oligo targeting construct would affect
hybridization in solution, and subsequently alter cytometric
staining distribution of labeled cells. In order to test this, a
titration of increasing molar equivalents of oligo:fluorophore
labeling construct was added to a fixed amount (6 pmol) of
antibody:oligo targeting construct, from 0.5-10 molar equivalents
(FIG. 2A). For antibody:oligo targeting construct having an MSR of
.about.2 oligos per Ig molecule, 0.5 molar equivalents oligo:fluor
labeling construct represents the addition of 1 oligo:fluor
labeling construct per Ig:oligo targeting construct. Results showed
the population of CD4+ cells to be similar for all titrations;
however, nonspecific background staining caused by addition of
excess fluorophore increased with addition of >1 molar
equivalent oligo:fluor labeling construct. A titration of 0.5 molar
equivalents oligo:fluor labeling construct was used for subsequent
CD4 staining, and for antibodies having varying degrees of
oligo-modification, equivalents were added limiting hybridization
to one oligo:fluor labeling construct per Ig:oligo targeting
construct (i.e., if Ig:oligo MSR.about.4, then 0.25 equivalents
oligo:fluor were added).
It also was investigated whether cells could be first labeled with
antibody:oligo targeting construct, and then hybridized with
oligo:fluor labeling construct in situ (FIG. 2B). Equal amounts of
antibody and fluorophore oligo-conjugates were used for the two
approaches, and cell staining and analysis conditions were
identical. Results showed cell labeling via in situ hybridization
to be effective, and very similar to labeling via hybridization in
solution.
To confirm that CD4+ staining was indeed antigen-positive labeling
and not an artifact of nonspecific oligo binding, hybridization of
oligo:fluor labeling construct was blocked by hybridizing CD4
antibody:oligo targeting construct to a "blocking" oligo sequence
complementary to the anti-CD4-oligo at the 5' end, with a sequence
(oligo-4) unmatched to oligo:Dy490 at the 3' end. Following
hybridization of the blocking oligo, oligo:Dy490 was applied. The
blocked construct was applied to cells, and the cells were analyzed
vs cells stained with unblocked, prehybridized xCD4::Dy490 labeled
targeting hybrid (FIG. 2C). Results showed the blocking oligo (blue
histogram) effectively prevented hybridization of the oligo:Dy490
labeling construct; no CD4+ population was evident, whereas cell
labeling with the unblocked construct clearly resulted in a
distinct CD4+ peak. The high background level in both samples was
due to the experimental conditions, in which a 5-fold molar excess
of oligo:Dy490 labeling construct was applied in order to fully
test the ability of the blocking oligo at saturating conditions.
The blocking oligo did not prevent nonspecific binding of the
oligo:Dy490 labeling construct at this level of saturation, leading
us to conclude that it is the dextran:fluor that is responsible for
the nonspecific signal. However, this issue can typically be
avoided by hybridizing at the optimized titration of 0.5 molar
equivalents.
Hybridization has been well-described to be both time and
temperature-dependent. A range of hybridization times from 15-60
minutes with incubation at 4.degree. C., room temperature
(24.degree. C.), or 37.degree. C. (FIG. 2D) were tested. Results
showed a clear CD4+ signal at all time and temperature conditions
tested, with negligible variance. The sequences selected for this
study were designed to have high melting temperatures (Tm) and
specific and stable hybridization activity, as previously reported
by Feldkamp et al.
A further optimization test was designed to determine whether the
number of fluorophores per dextran scaffold (Degree Of Labeling,
DOL) affected signaling of labeled cells (FIG. 2E).
Oligo-dextran-Dy490 conjugates having approximately 3-15 Dy490 per
dextran were prepared. These conjugates were hybridized to
anti-CD4:oligo targeting construct as previously described. Results
showed optimal signaling distribution at DOL.about.7, with a
decrease in positive-peak resolution at DOL<7 and a marked
decrease in positive-peak median fluorescence intensity (GMFI) at
DOL>7, most likely due to fluorescence self-quenching occurring
as a result of spatial proximity of fluorophores added in excess to
the dextran scaffold. Testing of additional fluorophores indicated
that for dimmer fluors (e.g., Dy405), a higher degree of labeling
is optimal (DOL.about.10; data not shown).
In summary, the hybridization-labeling assay is relatively robust.
Molar equivalents of oligo:fluor labeling construct are preferably
limited to .ltoreq.1.times. relative to the amount of
antibody:oligo targeting construct. Oligo-conjugates can be
hybridized either in solution or in situ for specific and effective
labeling of cells. With these particular oligo sequences, a wide
range of time and temperature conditions can be employed without
significant variation in construct activity. Target DOL should be
approximately 7 fluors per dextran, but a range of DOL's provide
adequate labeling of antigen-positive cell populations.
4. Multiplexed Antigen Labeling
Using optimized assay conditions, four labeled targeting constructs
were then prepared and used to label cells for a single antigen, or
combined into a multiplexed labeling cocktail to label a single
cell sample for four antigens at once (FIG. 3A). For these tests, a
panel of oligo-conjugated antibodies against T-cell markers CD4 and
CD8, activation-associated antigen CD43, and lymphocyte homing
molecule CD62L was used. Each antibody:oligo targeting construct
was hybridized to complementary oligo:fluorophore labeling
construct in solution, using the Dylight fluors Dy490, Dy549,
Dy649, or Dy405. The antibody::fluor labeled targeting hybrids were
then used to label normal B6 murine splenocytes and the stained
cells were analyzed by flow cytometry. All antibody-labeled cell
samples displayed clearly evident antigen-positive populations.
Positive-labeled cell populations were within expected ranges
[10-14]. Multiplexed staining was comparable to single-antigen
staining; cells stained with fluorophore-only exhibited varying
degrees of nonspecific staining when compared to unstained
controls, from negligible (Dy490) to moderately high (Dy649).
Multiplexed staining results displayed as 2-channel, 2D dot plots
allowed for phenotypic delineation of the cell population (FIG.
3B). Lymphocytes are displayed as CD4 vs CD8 (panel i), CD43 (panel
ii), CD62L (panel iii), or gated on the CD4+ population and
displayed on a CD43 vs CD62L 2D plot (panel iv). In each panel,
cellular subsets are distinctly evident; for example, CD4+ and CD8+
T-lymphocytes are clearly defined (30% and 27% respectively);
populations of CD43.sup.HIGH lymphocytes are visible for CD4- and
CD4+ cells (34%, 7%); and two distinct CD62L+ groups are evident,
either CD4- (55%) or CD4+ (20%). Lymphocytes displayed as CD8 vs
CD43 (panel v) or CD62L (panel vi) show clear double-stained
populations in both plots. CD43 vs CD62L (panel vii) also shows
double-stained cells (58%), with CD43.sup.HIGH CD62L+ cells
representing 33% of total lymphocytes. Finally, gated CD8+
lymphocytes are almost entirely (93%) triple-positive for CD8+
CD43+ CD62L+. These results provide substantial evidence that the
oligo-conjugates can be used for specific and sensitive
multiparameter cellular phenotyping.
5. Interchangeable Fluorophore Hybridization Using the Universal
Oligo Sequence
For experiments discussed thus far, the oligo sequences 1/1'-4/4'
were used to hybridize antibodies with fluorophores. However, by
utilizing a single oligo pair (A/A') conjugated to either
antibodies (e.g., an Ig:oligo-A targeting construct) or
dextran:fluors (e.g., an oligo-A':fluor labeling construct), any
antibody may easily be hybridized to any fluorophore. This "mix and
match" approach is illustrated in FIG. 4A. Cytometric data obtained
using CD4 and CD8 antibodies hybridized to four fluorophores
validated this approach, as antigen-positive staining was very
similar across fluorescent channels for both antibodies (FIG.
4B).
However, utilizing one oligo pair for all constructs potentially
posed a problem for multiplexing, i.e when constructs are combined,
free oligo:fluor labeling constructs could hybridize to any
antibody:oligo targeting construct, or oligo:fluor labeling
constructs could dehybridize and exchange. To test this, CD4/CD8
double staining was performed using no blocking methods to evaluate
unwanted crosstalk. Indeed, crosstalk was observed at 1-5%, with
the highest levels measured after the double-staining solution was
left overnight at room temperature. The inventors hypothesized that
a saturating amount of unmodified oligo would successfully
outcompete free oligo:fluor labeling construct for binding sites,
thus preventing crosstalk. To test this, the inventors added
unmodified oligo-A at increasing saturations to prehybridized
antibody::fluorophore labeled targeting hybrid from 0-100 molar
equivalents blocking oligo-A. The `blocked` constructs were then
mixed and used to stain cells. Results indicated that crosstalk,
which would be evident in the double-positive quadrants, was
reduced to .about.0.5% by the addition of 40.times. equivalents
blocking oligo (FIG. 4C). CD4+ and CD8+ populations are clearly
seen in both plots, either CD4::Dy490 (FIG. 4C(i), lower right
cluster) vs CD8::Dy649 (FIG. 4C(i), upper left cluster), or
CD4::Dy405 (FIG. 4C(ii), lower right cluster) vs CD8::Dy549 (FIG.
4C(ii), upper left cluster).
6. Quantitation Using Oligonucleotide-Coated Particles
Two methods of preparation of quantitative fluorophore-hybridized
oligospheres are illustrated in FIG. 5A-5B: Method I, "parallel
labeling" and Method II, "combined labeling".
In Method I (FIG. 5A, "parallel labeling"), linker-modified
paramagnetic microspheres are conjugated with a saturating amount
of linker-reactive oligonucleotide, resulting in oligo-conjugated
microspheres. The oligospheres are then hybridized to complementary
oligo:polyfluor labeling constructs at several levels of surface
saturation, and the labeled fluorophore-hybridized oligospheres are
added to cells previously stained with the same labeling probe(s)
for quantitation of Antibody Binding per Cell (ABC). Thus,
oligospheres and cells are labeled separately, hence the term
"parallel labeling".
In Method II (FIG. 5B, "combined labeling"), linker-modified
paramagnetic microspheres are conjugated with increasing titrations
of linker-reactive oligonucleotide, resulting in oligo-conjugated
microspheres of increasing oligo surface saturation. The
oligo-surfaced microspheres are then combined with cells that have
been labeled with antibody-oligo targeting construct that bears the
same oligo sequence as the oligospheres. To the cell-sphere mixture
is then added an amount of labeling construct sufficient to label
both cells and oligospheres. Thus, oligospheres and cells are
labeled together, hence the term "combined labeling". Following
combined labeling, the cell-sphere mixture is analyzed for
quantitation of ABC.
After preparation of fluorophore-labeled oligospheres using either
Method, the number of Labeling construct Per oligosphere Event
(LPE) for each saturation level must be determined by fluorimetric
analysis (FIG. 5C). LPE is a critical value for determination of
Antibody Binding per Cell (ABC). LPE is determined by measuring
fluorescence of a populations of oligospheres in wells of a
microplate vs a standard curve of labeling construct in solution in
the same microplate. Then, the precise number of microspheres per
sample is counted using a handheld particle analyzer. These two
measurements allow determination of LPE by [(mol label per
sample.times.(6.times.1023) molecules per mol)/number of
oligospheres per sample]. The fluorometrically-determined LPE
values of the quantitative oligospheres are recorded and later used
to determine ABC following cytometric analysis (example cytometric
data shown in FIG. 5D).
The ABC quantitation method was testing using four
antibody-fluorophore pairs (CD4/Dy490; CD8/Dy549; CD43/Dy649; and
CD62L/Dy405), with matching fluorophore-hybridized
oligospheres.
For quantitation by cytometric analysis, the quantitative
microspheres were added to an equal volume of viable murine
splenocytes multi-stained with a panel of the same oligo:polyfluor
labeling constructs (Method I, parallel labeling). The
heterogeneous samples of cells and microspheres were cytometrically
analyzed (FIGS. 6A-6D). Cytometric analysis of labeled cells and
oligospheres results in cytometric fluorescence data for
antibody-stained cells along with an internal quantitative standard
curve provided by the oligospheres. The standard curve generated by
the oligospheres is used to calculate quantitative ABC from
arbitrary units of cytometric Geometric Mean Fluorescence Intensity
(GMFI).
To create quantitative plots for each antibody/fluorophore pair,
log GMFI values for each microsphere peak in each channel (see
FIGS. 6A-6D) were calculated using FlowJo analysis software. As
shown in graphs (FIGS. 7A-7D), log GMFIs were plotted against log
LPE for each label (Dy490, Dy549, Dy649, Dy405), which had been
determined by fluorimetric assay as described above. An exponential
trendline was fit to microsphere data as shown.
Determination of ABC in the system is based on the assumption that
one oligo-polyfluor labeling construct is hybridized per antibody
when a limiting amount of labeling construct is applied during
antibody::fluorophore oligo-construct hybridization. In other
words, a 1:1 ratio of label to antibody is assumed; therefore, the
number of oligo-polyfluor Label Per Event (LPE) is equal to number
of Antibodies Bound per Cell (ABC). That is, [LPE=ABC]; and so ABC
for cellular events can thus be calculated using the trendline
equations shown in FIG. 7. Mean ABC can be calculated using the
GMFI of a population of cellular events (as noted in FIG. 7), or
single-cell ABC can be calculated using fluorescence intensity
signal of any single cell recorded by the cytometer (FIG. 8).
Method II (combined labeling) was also conducted using CD4
antibody:oligo targeting construct with a complementary oligo:Alexa
Fluor 488 labeling construct. (FIG. 9). Oligospheres at increasing
surface oligo saturation (0-100%) were combined with murine
splenocytes bearing CD4 antibody:oligo targeting construct.
Labeling construct was then applied at 2-fold excess to targeting
construct (mol oligo/oligo) and the combined cell-oligosphere
labeled sample was cytometrically analyzed. Oligospheres and
lymphocytes were scatter gated (FIG. 9A) and CD4+ lymphocytes were
gated using FL1 (Alexa 488) vs SSC (FIG. 9B). The gated
oligospheres and CD4+ lymphocytes were displayed on a histogram
showing fluorescence signal distribution of each population.
Because quantitation of ABCCD4 using these data would proceed
exactly according to the methodology described above, the inventors
did not recapitulate quantitation using these data.
ABC quantitation as described above was validated by head-to-head
quantitation of ABC.sub.CD4 with commercially available
PE-conjugated CD4 antibody and PE quantitation microspheres (BD
QuantiBrite PE, FIG. 10A). A specific monoclonal antibody was
chosen for quantitation using both systems (clone GK1.5).
Commercial quantitation was performed according to manufacturer
protocol resulting in the graph and ABC trendline equation shown in
FIG. 10B. The commercial quantitation method was very similar to
that performed using the oligosphere method described above, i.e.,
analyzing fluorescent microspheres and stained cells, plotting log
fluorescence units vs known LPE, and converting fluorescence units
to ABC based on trendline using an assumption of 1:1 label:protein
ratio. Results show oligosphere-based quantitation of ABC.sub.CD4
was very similar to ABC.sub.CD4 obtained using commercial
microspheres (28.8.times.103 vs 29.7.times.103 per cell).
Flowchart algorithms (FIGS. 11A-11B) depict a workflow for planned
computer analysis software that will be used to simplify and
automate the ABC quantitation methods described above. The software
will utilize instrument-generated cytometer raw data (e.g., .fcs
listmode files) to streamline the various ABC quantitation
procedures described above, using two Algorithms.
Algorithm I (FIG. 11A) accomplishes gating of oligospheres,
calculation of gate GMFIs, and plots ABC quantitation standard
curve with fluorescence-to-ABC conversion trendline. Algorithm II
(FIG. 11B) then analyzes user-defined cellular events using the ABC
quantitation curve(s) generated by Algorithm I to convert arbitrary
cellular fluorescence data to quantitative ABC data. ABC data for
large cellular populations (thousands to millions of single events)
can then be statistically analyzed and/or displayed graphically by
the user. In early versions the software will likely be
spreadsheet-based, followed by increasingly advanced, user-friendly
platforms as software development progresses.
7. Spectral Compensation Using Fluorophore-Hybridized
Oligospheres
Spectral compensation, a common practice in multicolor cytometric
analysis, refers to the unmixing of overlapping fluorescent
emission spectra in effort to separate each color during analysis,
thus enabling accurate signal analysis in each antibody-specific
fluorescent channel.
To validate oligospheres for use in spectral compensation (FIGS.
12A-12C), oligospheres were hybridized to fluorescent oligo
labeling constructs having similar excitation and emission spectra
(FL1, Alexa Fluor 488; and FL2, Alexa Fluor 532). Oligospheres were
prepared as described and fluorescent oligo labeling constructs
were commercially obtained (Integrated DNA Technologies).
Single-fluorophore-hybridized oligospheres were analyzed separately
as compensation controls, and then mixed .about.1:1 into a
two-colored sample to which compensation controls were applied for
spectral unmixing. Nonfluorescent microspheres were included in the
analysis as a negative control. A cytometer with somewhat limited
spectral capabilities (BD LSRII, 488 nm blue laser with FL1 &
FL2 detectors on shared laser line) was used for the analysis in
order to provide maximum necessity for spectral compensation.
Compensation was accomplished using typical methodology and
analysis software (TreeStar's FlowJo Compensation Wizard).
Single-color oligosphere controls were recognized by software and
auto-gated appropriately (FIG. 12A; shown are singlet gates,
positive gates, negative gates). An algebraic compensation matrix
was calculated by the software (not shown), and the matrix algebra
was then applied by the software to correct the two-color sample.
The uncompensated two-color sample (FIG. 12B) appeared to contain
two populations both positive for FL1 and FL2, which was not the
case; each sample was labeled with only one type of fluorophore,
either FL1 or FL2. The compensated sample (FIG. 12C) correctly
depicts the distinct single-color FL1+ and FL2+ populations, as
well as the negative population. The low-level signaling
(0-10.sup.3) of the negative population is caused by
autofluorescence of the microspheres.
8. Fluorophore-Hybridized Oligospheres for Cytometer Alignment and
Calibration
A common application for fluorescent microspheres is the routine
alignment and calibration of cytometer optical components.
Fluorophore-hybridized oligospheres were evaluated for alignment
and calibration purposes as compared to commercially available
fluorescent microspheres (FIGS. 13-14).
To evaluate whether oligospheres could potentially be used for
instrument alignment (FIG. 13), fluorophore-hybridized oligospheres
were prepared in a method resulting in single-fluorophore
microspheres in a variety of spectral `colors` (similar in concept
to commercially prepared alignment microspheres, e.g., Spherotech
Fluorescence Alignment Particles). Oligospheres were hybridized
with a saturating amount of complementary oligo:fluorophore
labeling constructs in distinct spectra (Alexa Fluor 488, 532, and
647). A single type of fluorophore was hybridized to each sample of
oligospheres.
The oligospheres (FIG. 13A) and commercial microspheres (FIG. 13B)
were then analyzed on a conventional cytometer to determine size
distribution (scatter plots) and fluorescent signal (single-peak
histograms). Post-acquisition, singlets were gated and CVs were
determined for fluorescent signal histograms using analysis
software. CVs were compared for oligospheres vs commercial
microspheres in three fluorescent channels (FL1, FL2, FL3).
Lower CVs are desirable for properly evaluating instrument
alignment. Commercial microspheres had slightly lower CVs. The
inventors hypothesize that the higher CVs seen with oligospheres is
a result of greater size and granularity (FSC and SSC) distribution
of the particular microspheres used for this test (see scatter
plots FIG. 13A vs 13B). A wide variety of microspheres can be used
to prepare oligospheres; by adjusting the type of microsphere used,
the inventors hope to reduce scatter variation, thereby reducing
oligosphere CVs to a level competitive with (or better than)
current state-of-the-art alignment aids.
To evaluate whether oligospheres could potentially be used for
instrument calibration (FIG. 14), fluorophore-hybridized
oligospheres were prepared in a method resulting in microspheres in
a variety of increasing intensities (similar in concept to
commercially prepared alignment microspheres, e.g., Spherotech
Calibration Particles). Oligospheres were hybridized with titrated
amounts of complementary oligo:fluorophore labeling construct
(Alexa Fluor 488). A specific titration was hybridized to each
sample of oligospheres and then the oligospheres were mixed into a
single batch for analysis (FIG. 14A). The oligospheres were
compared to commercially prepared microspheres (FIG. 14B). Results
showed distinct peak formation with a dynamic range of signaling
comparable to commercial microspheres. For future development,
additional peaks can be included in the oligosphere mixture, (e.g.,
6-8 peaks) and additional fluorophores can be used to test
signaling across multiple fluorescent channels (e.g., FL2, FL3,
etc).
9. Discussion
Microsphere-based methods for flow cytometry enable both instrument
Quality Control (QC) via alignment and calibration, and cellular
analysis via Quantitative Flow Cytometry (QFC).
The novel oligosphere-based method enables cost-effective,
spectrally-matched QC using oligospheres and labeling probes. The
inventors envision QC reagents will be provided with multiplexed
antibody labeling kits, or as standalone QC products, either of
which the inventors hope will encourage and improve routine QC
across academic, clinical, and industrial research
laboratories.
Variation in the number of antigens per cell can indicate cellular
phenotype, differentiation, and activation state, which makes
microsphere-enabled quantitative flow cytometry useful as a
research tool and as a clinical diagnostic test (Hultin, et al.,
1998; Lin, et al., 1998; Schlenke, et al., 1998). There are a
variety of commercial calibrants presently available to aid in QFC,
yet there remain significant challenges. (as reviewed in Gratama,
et al., 1998; Maher, et al., 2005 and discussed further below).
In addition to improved QC and QFC, the system offers more
chromatic flexibility for day-to-day cytometry applications. The
chromatically interchangeable "Mix and Match" hybridization
strategy (FIGS. 4A-4C) offers a significant improvement over
existing methods, and the fluorophore-hybridized oligospheres
enable fast and accurate spectral compensation (FIGS. 12A-12C).
The "Mix and Match" strategy enables antibodies to quickly
(minutes) be labeled with any fluorophore desired, a functionality
that is extremely limited in today's laboratories which often rely
entirely on prelabeled fluorescent antibodies. In contrast to
existing methods, the inventors have shown that the system can be
multiplexed using at least four targets, with the potential
limiting factors being imposed only by the fluorophore-resolving
capabilities of the cytometer being used (a limitation which
similarly constrains conventional multiplexing).
The inventors envision software to be designed for automated, rapid
QC, QFC, compensation, and cellular analysis using the system.
Software will be designed to incorporate techniques and on-screen
tools familiar to those of ordinary skill in the art. An example of
an algorithm for QFC is shown in FIGS. 11A-11B, and other
algorithms are envisioned to be similarly designed. Software may be
designed to be used with on-board acquisition software (e.g., BD
FACSDiva), post-data analysis software (e.g., TreeStar FlowJo), or
for in-depth statistical analysis of quantitative data, be
spreadsheet-based.
In summary, the inventors envision the oligonucleotide-based system
to be an all-in-one solution to many of the challenges presented by
current flow cytometry methodologies, from day-to-day instrument
maintenance to advanced, quantitative cellular analysis.
10. Methods
a. Antibodies
Purified monoclonal antibodies for oligo-conjugation against murine
CD4 (clone GK1.5) or CD8 (clone 2.43.1) were obtained from the
Frank W. Fitch Monoclonal Antibody Bank at University of Chicago
(Chicago, Ill.). Monoclonal murine anti-CD43 (clone S7) was a gift
from Dr. John Kemp at University of Iowa School of Medicine (Iowa
City, Iowa). Anti-CD62L (clone MEL-14) was obtained from American
Type Culture Collection (ATCC; Manassas, Va.). Commercially
prepared anti-CD4 (clone GK1.5, phycoerythin conjugate) was
obtained from Becton Dickinson (BD; San Jose, Calif.).
b. Fluorophores
For oligo:polyfluor labeling constructs, four NHS-ester `DyLight`
fluorophores (Dyomics, Germany) were selected for poly-conjugation
to oligo-dextran scaffolds, including Dy490 (ex/em 490/516 nm;
similar to Fluorescein/FITC); Dy549 (ex/em 560/575; similar to
R-Phycoerythrin/PE); and Dy649 (ex/em 655/676 nm; similar to
allophycocyanin/APC); and Dy405 (ex/em 400/420 nm; similar to
Pacific Blue). For oligo:unifluor labeling constructs, three Alexa
Fluor fluorophores (488, 532, 647) were selected and commercially
conjugated (IDT, Coralville, Iowa) to oligonucleotide
sequences.
c. Oligonucleotides
Four trial oligonucleotide pairs were selected from a previously
validated sequence library developed by Feldkamp, et al., 2004;
Feldkamp, et al, 2002. A unique "universal" oligonucleotide pair
was generated using DNA sequence generation and evaluation
software. Oligonucleotides used for conjugation to antibodies or
dextran-fluorochrome scaffolds (polyfluors) were commercially
synthesized with an amino-C6 group at the 5' end (Eurogentec, San
Diego, Calif.). Oligonucleotides having single fluorophore
molecules (unifluors) were commercially synthesized conjugated to
fluorophores (IDT, Coralville, Iowa)
d. Microspheres
Commercialized fluorescent microspheres were used for ABC
quantitation (BD, San Jose, Calif.) and for alignment and
calibration examples (Spherotech, Glen Ellyn, Ill.) Microspheres
used for oligo-conjugation were 4FB-functionalized 3 .mu.m
paramagnetic particles (Solulink, San Diego, Calif.).
e. Conversion of Amino-Oligonucleotides to 4FB-Oligonucleotides
5'-(C6-amino) oligonucleotides were dissolved in 500 .mu.L
Modification Buffer (MB; 100 mM sodium phosphate, 150 mM sodium
chloride, pH 7.4) and transferred to 3 kDa MWCO VivaSpin 500
diafiltration devices (Sartorius Stedim Biotech, France). The oligo
samples were centrifuged at 14,000.times.g for approximately 15
minutes until the retentate volume was reduced to 50 .mu.L. Fresh
MB (450 .mu.L) was added to each sample and thoroughly mixed by
pipet. This process was repeated a total of 4 times to completely
remove amine-containing salts carried over from oligonucleotide
synthesis. Finally, oligonucleotide samples were adjusted to
approximately 0.5 OD260/.mu.L in preparation for modification.
A solution of Succinimidyl 4-FormylBenzoate (S-4FB; Solulink, San
Diego, Calif.) was prepared at 50 mg/mL in anhydrous
DiMethylFormamide (DMF) and added to each oligo sample at a 20-fold
excess (mol) to ensure complete reaction. Reactions proceeded at
room temperature (.about.24.degree. C.) for 2 hours before being
diluted to 500 .mu.L with Conjugation Buffer (CB; 100 mM sodium
phosphate, 150 mM sodium chloride, pH 6.0). Excess S-4FB was
removed via 4 rounds of diafiltration as described previously using
CB. Post-modification oligo concentrations were adjusted to
approximately 0.3 OD260/.mu.L.
f. Preparation of Antibody-Oligonucleotide Targeting Constructs
Antibodies were supplied in PBS at approximately 1 mg/mL based on
NanoDrop A280 readings using an E1% value of 14.0. Antibodies were
gently concentrated to 3-4 mg/mL using 30 kDa MWCO VivaSpin 500
diafiltration devices. Antibodies were buffer exchanged into MB via
2 mL `Zeba` desalting columns (Thermo Scientific, Rockford, Ill.)
and protein concentration determined by A280. Proteins were
subsequently modified with the chemical crosslinker Succinimidyl
6-HydraziNicotinate acetone hydrazone (S-HyNic; Solulink, San
Diego, Calif.) at a 20-fold excess of linker to protein (mol).
Following incubation for 2 hours at 24.degree. C., the antibodies
were liberated of unreacted linker by desalting with 2 mL Zeba
columns equilibrated in CB. Molar Substitution Ratios (MSRs) of
incorporated HyNic to antibody were determined via
2-SulfoBenzaldehyde (2-SB) assay using a molar extinction
coefficient of 28,500 L mol-1 cm-1 for the hydrazone at
.lamda.max=350 nm. MSR values ranged from 6-8 HyNic per antibody
molecule.
To the HyNic-modified antibodies in conjugation buffer were added 4
equivalents (mol) of 5'-4FB-modified oligonucleotide followed by
10% (v/v) of TurboLink catalyst (100 mM aniline, 100 mM sodium
phosphate, 150 mM sodium chloride, pH 6.0; Solulink, San Diego,
Calif.). The antibody-oligo conjugation reaction was allowed to
proceed overnight at 4.degree. C. Excess oligonucleotide was
removed from the conjugated product by size exclusion
chromatography using an HR-10/30 Superdex 200 PG column (GE
Healthcare, Piscataway, N.J.). Removal of free oligonucleotide from
the conjugated product was complete as evidenced by baseline
resolution of the two A260 peaks. MSR values for oligos/antibody
were determined by the ratio of the area under the A260 curves.
Final protein concentration of the conjugates was determined by BCA
protein assay (Thermo Scientific, Rockford, Ill.).
g. Preparation of Dextran-Oligonucleotide Heterodimers
A 1:1 oligo:dextran conjugate was prepared using the following
procedure: 70 kDa amino-dextran containing approximately 20
amines/dextran (Invitrogen, Carlsbad, Calif.) was dissolved in
modification buffer at 11.5 mg/mL and desalted into the same buffer
via a 5 mL Zeba column to remove traces of amine-containing
contaminants. The dextran solution was treated with 5-fold excess
(mol) of HyNic which had been dissolved in anhydrous DMF at 25
mg/mL. Following a 2.5 hour incubation at 24.degree. C., excess
linker was removed via desalting/buffer exchange over a 5 mL Zeba
column into CB. A 2-SB A350 assay performed as described above
indicated an MSR of 3.4.
To the HyNic-dextran solution was added a
stoichiometrically-limiting amount of 5'-4FB-oligonucleotide (0.5
mol-equivalents) to limit the average number of oligos per dextran
to <1. Conjugation was allowed to proceed overnight at 4.degree.
C. before removal of free oligonucleotide by size exclusion
chromatography over an HR-10/30 Superdex 200 PG column. Mobile
phase for the purification was Loading Buffer (20 mM HEPES, 25 mM
sodium chloride, pH 7.0) at 1 mL/minute flow rate.
Unconjugated dextran was removed from the conjugated product using
Vivapure Q Mini-H ion-exchange devices (Sartorius Stedim Biotech,
France). Crude conjugate was loaded onto the devices in loading
buffer and washed with 2.times.400 .mu.L of the same to remove free
dextran. The oligonucleotide-dextran conjugates were eluted from
the support with increasing salt concentrations of 90 mM, 450 mM,
and 750 mM sodium chloride in loading buffer. Most of the conjugate
eluted in the 450 mM and 750 mM fractions, and was pooled to afford
the purified product. The amino-dextran-oligo heterodimer was
desalted and exchanged into modification buffer using a 5 mL Zeba
column in preparation for dye labeling.
h. Dye-Labeling of Amino-Dextran-Oligo Heterodimers
To oligo-dextran-amino heterodimer at 6 mg/mL in Modification
Buffer was added a 10.7-fold excess (mol) of DyLight dye NHS ester
(Dyomics, Germany) with rapid mixing at pH 7.4. Dye labeling of the
amino-dextran was achieved over a 3 hour incubation at 24.degree.
C., at which time the reaction was placed into dialysis vs. several
changes of PBS. Degree Of Labeling (DOL) was determined by dividing
the concentration of dye by the concentration of oligo (mol/mol),
as determined spectrophotometrically at A260 after correcting for
the UV contribution of the dyes themselves.
i. Cell Preparation and Labeling
C57BL/6 mice were bred and housed in a specific pathogen-free
facility maintained by the University of Chicago Animal Resources
Center (Chicago, Ill.), and used under the guidelines of the
Institutional Animal Care and Use Committee (IACUC). Spleens were
isolated and processed into single cell suspensions by pressing
minced tissue through a fine mesh nylon filter, followed by washing
with culture medium consisting of DMEM supplemented with HEPES,
non-essential amino acids, penicillin/streptomycin and
.beta.-mercaptoethanol. Erythrocytes were lysed by brief incubation
in a buffered ammonia chloride solution. Leukocytes were suspended
in DMEM supplemented with 5% fetal calf serum and briefly stored at
4.degree. C. until being counted for the number of live cells.
To prepare cells for antibody staining, splenic leukocytes were
aliquoted at a density of 0.5-1.0.times.10.sup.6 cells/sample in a
buffer consisting of 1.times.PBS with 1% BSA. Non-specific binding
of IgG to cellular Fc receptor was blocked by incubation in 50
.mu.L of anti-FcR (clone 2.4G2 hybridoma supernatant) for 20
minutes at 24.degree. C.
Antibody-fluorophore labeled targeting hybrids were prepared in
solution prior to staining the cells by mixing antibody:oligo
targeting constructs (0.1-1 .mu.g) with complementary
oligo:fluorophore labeling constructs in 1% BSA-PBS for 15-30
minutes at 24.degree. C. Hybrids were then added to prepared,
FcR-blocked murine splenocytes for 1 hour at 4.degree. C. with slow
rotation. Cells were washed once in 500 .mu.L PBS to remove excess
hybrid, and analyzed by flow cytometry.
j. Preparation and Analysis of Quantitative Microspheres
4FB-modified 3 .mu.m paramagnetic particles (SoluLink Biosciences,
San Diego Calif.) were conjugated to HyNic-oligonucleotide at 0-20
nmol per mg by 2 hour incubation in CB to result in oligo-surfaced
microspheres (oligospheres). Oligospheres were washed in PBS to
remove free oligo and stored in PBS at 4.degree. C.
To prepare fluorophore-hybridized oligospheres, complementary
oligo:polyfluor was added to 6.25-50 .mu.g microspheres
(.about.50-400.times.10.sup.3 particles) in desired titrations
(0-40 pmol/.mu.g). Hybridization proceeded in PBS for 15-30 minutes
with gentle vortexing, spheres were washed to remove unbound
fluorophore, and then were loaded into a black 96-well plate for
fluorimeter analysis (Tecan Safire 2, Switzerland). Oligosphere
fluorescence was evaluated in the microplate vs a standard curve of
oligo:polyfluor labeling construct ranging from 0.0-1.0 pmol per
microwell. Microspheres and labeling construct standards were each
diluted in 100 .mu.L total volume of dilution buffer (1.times.PBS)
per microwell. Fluorimeter readings were normalized by using PBS
dilution buffer as a blank for the standard curve, and unhybridized
oligospheres to correct for autofluorescence of the oligospheres.
Standard curves for each of four DyLight fluorophores (Dy490, 549,
649, 405) were plotted using graphing software with X=fluorimeter
intensity and Y=pmol labeling construct per sample. R.sup.2 values
were >0.98 for all four standard curves.
Following fluorimeter analysis, the number of microspheres per
microwell was enumerated using a handheld particle counter (Scepter
Counting Device; Millipore, Billerica, Mass.). Labeling construct
per microwell (pmol) was converted to molecules labeling construct
and divided by the number of particles per microwell to determine
Label Per (microsphere) Event (LPE).
k. Flow Cytometric Instrumentation and Analysis
Most analyses were performed using a 4-laser, 12-detector BD LSRII
flow cytometer (Becton Dickinson, San Jose Calif.) which is
routinely aligned and calibrated for PMT linearity by the
University of Chicago Flow Cytometry Core Facility. Instrument
layout includes one octagonal and three trigonal optical arrays,
each equipped with a single laser. For analysis of oligospheres for
spectral compensation, a 3-laser, 8-detector BD LSRII flow
cytometer was used. For all analyses, cytometer acquisition
settings were initiated prior to each experiment, and were
unchanged for the duration of analysis. Single-event data were
acquired using FACSDiva software (BD, San Jose Calif.). Data were
saved as list-mode data files (.fcs) and analyzed using FlowJo
software (TreeStar, Ashland, Oreg.).
Each leukocyte sample, consisting of a minimum of 10,000 events,
was scatter-gated on the lymphocyte population according to
standard methods [24] using an unstained control sample prior to
interpretation of results. Microspheres were also scatter-gated to
define single events (doublet exclusion).
l. Pseudocode for Quantitative Flow Software Algorithms
TABLE-US-00003 Main Program: Ask User to input the Number of
Channels: Store value Number_of_Channels Ask User to upload
Control_LPE Lot and Intensity Numbers (*.csv): Store in Control_LPE
CALL subroutine Zero_LPE (Number_of_Channels) return
Zero_GMFI.Channel Array CALL subroutine Standard_Curve
(Number_of_Channels, Zero_GMFI.Channel Array) return
Standard_Curve.Channel Array FOR Channel equals 1 to
Number_of_Channels DO Set Exp_ABC.Channel equal to 0 // Antibody
Binding per Cell Set Exp_GMFI.Channel equal to 0 Set
Exp_LPE.Channel equal to 0 Set Zero_Flag equal to FALSE REPEAT Ask
User to Gate Experiment Cells Load Geometric Mean Fluorescence
Intensity (GMFI) IF GMFI is between 10.sup.2 and 10.sup.5 DO Set
Exp_GMFI.Channel equal to GMFI Set Zero_Flag equal to TRUE UNTIL
Zero_Flag equals True Plot Standard_Curve.Channel Set
Exp_LPE.Channel equal to y=mx.sup.n where X equals Exp_GMFI.Channel
Set Exp_ABC.Channel equal to Exp_LPE.Channel Output
Standard_Curve.Channel Plot and Exp_ABC.Channel to User Zero_FPE
subroutine: FOR Channel equals 1 to Number_of_Channels DO Set
Zero_GMFI.Channel equal to 0 Set Zero_Flag equal to FALSE REPEAT
Ask User to Gate Unstained Cells (Zero reading) Load Median
Fluorescence Intensity (GMFI) IF GMFI is between 0 and 10.sup.2 DO
Set Zero_GMFI.Channel equal to GMFI Set Zero_Flag equal to TRUE
UNTIL Zero_Flag equals True Standard_Curve subroutine: FOR Channel
equals 1 to Number_of_Channels DO Set Cell_GMFI.Channel equal to 0
Set Zero_Flag equal to FALSE REPEAT Ask User to Gate Control Cells
Load Geometric Mean Fluorescence Intensity (GMFI) IF GMFI is
between 10.sup.2 and 10.sup.5 DO Set Control_GMFI.Channel equal to
GMFI Set Zero_Flag equal to TRUE UNTIL Zero_Flag equals True Ask
User if they want to Compensate? (Yes/No) IF Yes DO Have FlowJo
software Discard Peak Option Plot GMFI versus LPE Set
Standard_Curve.Channel equal to y=mx.sup.n where X equals
Cell_GMFI.Channel
REFERENCES
The following references, to the extent that they provide exemplary
procedural or other details supplementary to those set forth
herein, are specifically incorporated herein by reference.
Autissier, et al., Cytometry Part A. 77A(5): 410-419, 2010.
Baumgarth & Roederer. Journal of Immunological Methods.
243(12): 77-97, 2000. Bendall, et al., Science. 332:687-696, 2011
Buller, et al., Nature. 328(6125): 77-79, 1987. Chattopadhyay, et
al., Immunology. 125(4): 441-449, 2008. Davis, et al., Cytometry.
33(2): 197-205, 1998. De Rosa, et al., Nature Medicine. 7(2):
245-248, 2001. Dialynas, et al., Journal of Immunology. 131(5):
2445-2451, 1983. Egholm et al., Nature. 365(6446): 566-8, 1993 EP
266,032 Feldkamp, et al., ChemPhysChem. 5(3): 367-372, 2004.
Feldkamp, et al., DNA Computing. 2340: 23-32, 2002. Feldkamp,
Journal of Computational Chemistry. 31(3): 660-663, 2010. Fu, et
al., American Journal of Transplantation. 4(1): 65-78, 2004. Givan,
Flow Cytometry: First Principles. First ed: John Wiley and Sons.
273, 2001. Gratama, et al., Cytometry. 33(2): 166-178, 1998.
Gulley, et al., The Journal of Immunology. 140(11): 3751-3757,
1988. Hultin, et al., Cytometry. 33(2): 123-132, 1998. Lee, et al.,
The Journal of Experimental Medicine. 175(4): 1013-1025, 1992. Lin,
et al., Pediatr Res. 43(S4): 151-151, 1998. Maher & Fletcher,
Clinical and Applied Immunology Reviews. 5(6): 353-372, 2005.
McLaughlin, et al., Cytometry Part A. 73A(5): 400-410, 2008.
Roederer, et al., Cytometry. 29(4): 328-339, 1997. Schlenke, et
al., Cytometry. 33(3): 310-317, 1998. Schwartz, et al., Cytometry
Part B: Clinical Cytometry. 57B(1): 1-6, 2004. Schwartz, et al.,
Cytometry. 33(2): 106-114, 1998. U.S. Pat. No. 4,196,265 U.S. Pat.
No. 4,659,774 U.S. Pat. No. 4,682,195 U.S. Pat. No. 4,683,202 U.S.
Pat. No. 4,816,571 U.S. Pat. No. 4,959,463 U.S. Pat. No. 5,141,813
U.S. Pat. No. 5,264,566 U.S. Pat. No. 5,428,148 U.S. Pat. No.
5,539,082 U.S. Pat. No. 5,554,744 U.S. Pat. No. 5,574,146 U.S. Pat.
No. 5,602,244 U.S. Pat. No. 5,645,897 U.S. Pat. No. 5,654,413 U.S.
Pat. No. 5,705,629 U.S. Pat. No. 5,714,331 U.S. Pat. No. 5,719,262
U.S. Pat. No. 5,736,330 U.S. Pat. No. 5,736,336 U.S. Pat. No.
5,766,855 U.S. Pat. No. 5,773,571 U.S. Pat. No. 5,786,461 U.S. Pat.
No. 5,891,625 U.S. Pat. No. 5,908,845 U.S. Pat. No. 6,057,107 U.S.
Pat. No. 7,226,737 U.S. Pat. No. 7,645,868 Wang, et al., Cytometry
Part A. 73A(4): 279-288, 2008. WO 92/20702
SEQUENCE LISTINGS
1
10122DNAArtificial SequenceSynthetic Primer 1cctgcgtcgt ttaaggaagt
ac 22222DNAArtificial SequenceSynthetic Primer 2gtacttcctt
aaacgacgca gg 22322DNAArtificial SequenceSynthetic Primer
3ggtccggtca taaagcgata ag 22422DNAArtificial SequenceSynthetic
Primer 4cttatcgctt tatgaccgga cc 22520DNAArtificial
SequenceSynthetic Primer 5gctgacatag agtgcgatac 20620DNAArtificial
SequenceSynthetic Primer 6gtatcgcact ctatgtcagc 20720DNAArtificial
SequenceSynthetic Primer 7tgtgctcgtc tctgcatact 20820DNAArtificial
SequenceSynthetic Primer 8agtatgcaga gacgagcaca 20920DNAArtificial
SequenceSynthetic Primer 9ggaagcggtg ctatccatct 201020DNAArtificial
SequenceSynthetic Primer 10agatggatag caccgcttcc 20
* * * * *