U.S. patent number 10,494,676 [Application Number 15/101,237] was granted by the patent office on 2019-12-03 for process for the diagnosis of cancer by using exosomes.
This patent grant is currently assigned to Albert-Ludwigs-Universitaet Freiburg, Karlsruher Institut Fur Technologie. The grantee listed for this patent is Albert-Ludwigs-Universitaet Freiburg, Karlsruher Institut fur Technologie. Invention is credited to Stefanie Bormann, Andrew Cato, Benjamin Haenselmann, Simon Hefele, Malte Kroenig, Arkadiusz Miernik, Irina Nazarenko, Antje Neeb, Martin Schoenthaler, Konrad Wilhelm.
View All Diagrams
United States Patent |
10,494,676 |
Nazarenko , et al. |
December 3, 2019 |
Process for the diagnosis of cancer by using exosomes
Abstract
The present invention relates to an in vitro process for the
diagnosis of prostate cancer and other tumor types in exosomes
obtained from a body fluid which comprises a) concentrating the
exosomes and other extracellular vesicles from a body fluid of a
patient, b) extraction of total RNA from the exosomes obtained in
step a), c) conversion of the RNA obtained in step b) to cDNA, d)
amplification of the cDNA obtained in step c) with a polymerase
chain reaction whereby primers derived from the AGR2 nucleotide
sequence or the complement thereof are used, and e) determining
whether in the amplification product variants of the AGR2 gene can
be identified.
Inventors: |
Nazarenko; Irina (Teningen
Nimburg, DE), Cato; Andrew (Eggenstein-Leopoldshafen,
DE), Neeb; Antje (Steinmauern, DE),
Bormann; Stefanie (Cologne, DE), Schoenthaler;
Martin (Freiburg, DE), Miernik; Arkadiusz
(Freiburg, DE), Kroenig; Malte (Freiburg,
DE), Wilhelm; Konrad (Freiburg, DE),
Haenselmann; Benjamin (Freiburg im Breisgau, DE),
Hefele; Simon (Freiburg, DE) |
Applicant: |
Name |
City |
State |
Country |
Type |
Albert-Ludwigs-Universitaet Freiburg
Karlsruher Institut fur Technologie |
Freiburg
Karlsruhe |
N/A
N/A |
DE
DE |
|
|
Assignee: |
Albert-Ludwigs-Universitaet
Freiburg (Freiburg, DE)
Karlsruher Institut Fur Technologie (Karlsruhe,
DE)
|
Family
ID: |
49674239 |
Appl.
No.: |
15/101,237 |
Filed: |
December 1, 2014 |
PCT
Filed: |
December 01, 2014 |
PCT No.: |
PCT/EP2014/076044 |
371(c)(1),(2),(4) Date: |
June 02, 2016 |
PCT
Pub. No.: |
WO2015/082372 |
PCT
Pub. Date: |
June 11, 2015 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20160298200 A1 |
Oct 13, 2016 |
|
Foreign Application Priority Data
|
|
|
|
|
Dec 2, 2013 [EP] |
|
|
13195330 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q
1/6886 (20130101); C12Q 1/6804 (20130101); C12Q
2600/158 (20130101); C12Q 2600/118 (20130101); C12Q
2600/112 (20130101); C12Q 1/6844 (20130101) |
Current International
Class: |
C12Q
1/68 (20180101); C12Q 1/6886 (20180101); C12Q
1/6804 (20180101); C12Q 1/6844 (20180101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 2004/031239 |
|
Apr 2004 |
|
WO |
|
WO 2012/115885 |
|
Aug 2012 |
|
WO |
|
WO 2013/090620 |
|
Jun 2013 |
|
WO |
|
WO 2013/134786 |
|
Sep 2013 |
|
WO |
|
Other References
Kani, K. et al. Anterior gradient 2 (AGR2): blood-based biomarker
elevated in matastatic prostate cancer associated with the
neuroendocrine phenotype (The Prostate, vol. 73, p. 306-315, 2013,
published online Aug. 2012. cited by examiner .
Lowe er al. A computer program for selection of oligonucleotide
primers for polymerase chain reactions. Nucleic Aicids Res., Vo. 18
(7), p. 1757-1761, 1990. cited by examiner .
Nilsson, J. et al. Prostate cancer-derived urine exosomes: a novel
approach to biomarkers for prostate cancer. British Journal of
Cancer, vol. 100, p. 1603-1607, 2009. cited by examiner .
Bu, H. et al. The anterior gradient 2 (AGR2) gene is overexpressed
in prostate cancer and may be useful as a urine sediment marker for
prostate cancer detection. The Prostate, Vo. 71, p. 575-587, 2011.
cited by examiner .
Huajie, Bu et al., "The Anterior Gradient 2 (AGR2) Gene is
Overexpressed in Prostate Cancer and may be Useful as a Urine
Sediment Marker for Prostate Cancer Detection", The Prostate, vol.
71. No. 6, pp. 575-587 (Oct. 2010). cited by applicant .
Kani, Kian et al., "Anterior Gradient 2 (AGR2): Blood-Based
Biomarker Elevated in Metastatic Prostate Cancer Associated with
the Neuroendocrine Phenotype", The Prostate, vol. 73. No. 3, pp.
306-315 (Aug. 2012). cited by applicant .
Nilsson J. et al., "Prostate Cancer-Derived Urine Exosomes: A Novel
Approach to Biomarkers for Prostate Cancer", British Journal of
Cancer, vol. 100, No. 10, pp. 1603-1607 (May 2009). cited by
applicant .
Diederick, Duijvesz et al., "Exosomes as Biomarker Treasure Chests
for Prostate Cancer", European Urology, vol. 59, No. 5, pp. 823-831
(Dec. 2010). cited by applicant .
Brychtova, Veronika et al., "Anterior Gradient 2: A Novel Player in
Tumor Cell Biology", Cancer Letters, vol. 304, No. 1, pp. 1-7 (Dec.
2010). cited by applicant .
Vivekanandan, P. et al., Anterior Gradient-2 is Overexpressed by
Fibrolamellar Carcinomas, Human Pathology, vol. 40, No. 3, pp.
293-299 (Mar. 2009). cited by applicant .
Pizzi, Marco et al., "Anterior Gradient 2 Overexpression in Lung
Adenocarcinoma", Applied Immunohistochemical & Molecular
Morphology, vol. 20, No. 1, pp. 31-36 (Jan. 2012). cited by
applicant .
Neeb, Antje et al., "Splice Variant Transcripts of the Anterior
Gradient 2 Gene as a Marker for Prostate Cancer", Oncotarget, vol.
5, No. 18., pp. 8681-8689 ( Sep. 2014). cited by applicant .
Ringsrud, Karen M., "Cells in the Urine Sediment", Laboratory
Medicine, vol. 32, No. 3, pp. 153-155(Mar. 2001). cited by
applicant .
Karen M. Ringsrud, MT (ASCP), "Cells in the Urine Sediment",
Laboratory Medicine, Mar. 2001, vol. 32, No. 3, pp. 153-155. cited
by applicant.
|
Primary Examiner: Chunduru; Suryaprabha
Attorney, Agent or Firm: Smith; Chalin A. Smith Patent,
LLC
Claims
The invention claimed is:
1. An in vitro process for the diagnosis of prostate cancer using
exosomes obtained from a body fluid of a patient, said process
comprising the steps of: a) concentrating exosomes from the body
fluid of the patient, wherein the body fluid is urine, b)
extracting the total RNA from the exosomes obtained in step a), c)
converting the RNA obtained in step b) to cDNA, d) amplifying the
cDNA obtained in step c) with a polymerase chain reaction (PCR)
using primers derived from the anterior gradient 2 (AGR2)
nucleotide sequence or the complement thereof, and e) detecting and
measuring splice variants of the AGR2 gene selected from the group
consisting of AGR2 SV-C, AGR2 SV-E, AGR2 SV-F, AGR2 SV-G and AGR2
SV-H.
2. The process according to claim 1, wherein the step of
concentrating said exosomes according to step a) is performed via
ultracentrifugation of the body fluid in a buffer at G-force
.gtoreq.100,000 for at least 30 minutes.
3. The process according to claim 1, wherein the step of
concentrating said exosomes according to step a) includes the steps
of: a1) centrifuging the body fluid at low speed in order to remove
cells and debris, a2) filtering the supernatant through a filtering
means, a3) ultracentrifuging the supernatant, and a4) harvesting a
fraction containing the exosomes.
4. The process according to claim 1, wherein the RNA is extracted
from the exosomes in step b) by treatment with DNAse and at least
one protease.
5. The process according to claim 1, further comprising the
additional step of determining the concentration of RNA in the
sample and adjusting said concentration to between 10 to 50 ng
RNA.
6. The process according to claim 1, wherein the RNA is converted
to cDNA in step c) by reverse transcription.
7. The process according to claim 1, whereby step d) further
includes the step of amplifying a housekeeping gene.
8. The process according to claim 7 wherein the housekeeping gene
is glyceraldehyde 3-phosphate dehydrogenase (GapDH) and/or
prostatic specific antigen (PSA).
9. The process according to claim 1, wherein the primers utilized
in step d) comprise a forward and reverse primer pair selected from
the group consisting of SEQ ID NO:3 and SEQ ID NO:7, SEQ ID NO: 4
and SEQ ID NO:7, SEQ ID NO:5 and SEQ ID NO:7, SEQ ID NO:6 and SEQ
ID NO:7, and SEQ ID NO:8 and SEQ ID NO:9.
10. The process according to claim 1, wherein the PCR is a
quantitative PCR.
11. The process according to claim 1, wherein the exosomes obtained
in step a) are further purified from the body fluid by a
chromatography step.
12. The process according to claim 1, wherein the exosomes obtained
in step a) are further purified from the body fluid by a
precipitation step.
13. The process according to claim 1, further comprising the
additional step of determining the concentration of RNA in the
sample and adjusting said concentration to 30 ng RNA.
Description
PRIORITY
This application corresponds to the U.S. national phase of
International Application No. PCT/EP2013/076044, filed Dec. 1,
2014, which, in turn, claims priority to European Patent
Application No. 13.195330.9 filed Dec. 2, 2013, the contents of
which are incorporated by reference herein in their entirety.
SEQUENCE LISTING
The instant application contains a Sequence Listing that has been
submitted in ASCII format via EFS-Web and is hereby incorporated by
reference in its entirety. Said ASCII copy, created on Jun. 2,
2016, is named LNK_176US_SequenceListing_ST25.txt and is 5,699
bytes in size.
BACKGROUND OF THE INVENTION
Prostate cancer has become a major public health problem. In many
developed countries it is not only the most commonly diagnosed
malignancy but it is the second leading cause of cancer related
deaths in males.
Since its discovery more than 20 years ago, prostate specific
antigen (PSA) has been the most valuable tool in the detection,
staging and monitoring of prostate cancer. Although widely accepted
as a prostate tumour marker, PSA is known to be prostate
tissue--but not prostate cancer-specific. PSA levels have been
reported to increase in men with benign prostatic hyperplasia (BPH)
and prostatitis. This substantial overlap in serum PSA values
between men with non-malignant prostatic diseases and prostate
cancer is the limitation of PSA as a prostate tumour marker.
Moreover, a single reading of PSA cannot be used to differentiate
the aggressive tumours from the indolent ones. Thus, (non-invasive)
molecular tests that can accurately identify those men who have
early stage, clinically localized prostate cancer, and who would
gain prolonged survival and quality of life from early radical
intervention are urgently needed.
Looking for new diagnostic, prognostic markers as well as
understanding the molecular mechanisms underlying the disease
progress and progression process and identify new treatment targets
is the main focus for current prostate cancer research. For the
identification of new candidate markers for prostate cancer it is
necessary to study expression patterns in malignant as well as
non-malignant prostate tissues. One of the genes identified to be
overexpressed in prostate cancer is the anterior gradient 2 (AGR2)
gene (Bu et al., The Prostate (2011), 575-587). The authors
describe long and short transcripts of AGR2 (anterior gradient-2)
being up-regulated in prostate cancer cells and tissues. RNAs were
isolated from microdissected frozen prostate tissue samples
obtained from radical prostatectomy specimens. Total RNA was
amplified, reverse transcribed into cDNA and subjected to
quantitative real-time PGR. Two transcript variants of the AGR2
gene were detected. Expression of short AGR2 transcript was
up-regulated in tumors. Although AGR2 short transcript mRNA level
showed slightly higher sensitivity and specificity as compared to
the PSA serum level, no significant differences could be observed.
Therefore, mRNA level of the AGR2 short transcript in tissue or in
the urine sediment are considered as not applicable for a reliable
detection of prostate carcinoma.
Nilsson et al., British Journal of Cancer (2009) 100, 1603-1607
analyze prostate cancer-derived urine exosomes as novel approach to
biomarkers for prostate cancer. The authors describe the
application of urine exosomes as a source for prostate cancer
biomarkers. Thereby, mRNA levels of two known prostate cancer
biomarkers designated as PCA-3 and TMPRSS2:ERG were tested in
several patients. For the detection of corresponding mRNA a
prostate massage was applied prior to urine harvesting which is not
applicable in routine daily praxis. The article does, however, not
provide data about the status of the tumor markers in tumor
tissues. Consequently it is not possible to evaluate the diagnostic
and/or prognostic values of the suggested biomarkers. A potential
enrichment of the two biomarkers PCA-3 and TMPRSS2:ERG in urine
exosomes seems to be at least questionable. Since the article shows
only slightly higher specificity and sensitivity for prostate
cancer detection as compared to the frequently used PSA serum level
the test described in this article does not seem promising for the
implementation into daily clinical routine.
SUMMARY OF THE INVENTION
The present invention as defined in more detail in the claims shows
significantly better sensitivity and specificity of AGR2 splice
variants as compared to the serum PSA. This makes the AGR2 splice
variants as described herein highly specific and promising
diagnostic markers.
AGR2 was first described in Xenopus laevis embryos where it induces
the formation of the forebrain and the cement gland. In humans, it
is predominantly found in mucus-secreting tissues or in endocrine
cells. It is a member of the protein disulfide isomerase family of
endoplasmic reticulum-resident proteins that has been implicated in
the folding of proteins. It became of interest in cancer research,
when it was found to be differential expressed in estrogen receptor
(ER)-positive breast cancer cell lines. Since then, elevated AGR2
has been reported in subsets of breast, prostate, non-small cell
lung, pancreatic, and hepatic adenocarcinomas. In some cases its
increased expression has been shown to be of prognostic value.
Furthermore elevated AGR2 RNA levels have been shown to correlate
with decreased efficacy of tamoxifen treatment. AGR2 transcript
level is therefore postulated to serve as a potential predictive
biomarker for selection of optical algorithm for adjuvant hormonal
therapy in postmenopausal ER-positive breast cancer patients.
The AGR2 gene has been deposited at the Genebank and is available
under accession number AF038451. The nucleotide sequence (SEQ ID
NO:1) can be downloaded from the gene bank as well as the protein
sequence (SEQ ID NO:2).
With the use of transcript-specific primers the expression of AGR2
transcript variants in microdissected prostate tissues was
investigated. A real-time reverse transcription polymerase chain
reaction (PGR) method to detect AGR2 in exosomes was established in
order to test its potential as a predictive marker for prostate
cancer and potentially in other tumors. AGR2 is highly expressed in
prostate cancer especially in low-grade tumors and PIN lesions
compared to benign tissue. AGR2 transcripts were also detected in
urine sediments of patients undergoing prostate biopsy with
significantly higher levels in tumor patients. The urine AGR2/PSA
transcript ratio allowed much better discrimination between cancer
and benign patients than serum total PSA or % free PSA suggesting
that urine AGR2 transcripts could be a better marker for the
detection of prostate cancer.
In the course of the present invention several new splice variants
were cloned and sequenced. The AGR2 transcript variants are shown
schematically in FIG. 5. The AGR2 gene comprises 8 exons.
Variants of the AGR2 gene differ from the wild-type AGR2 gene
insofar as either complete exons or parts of some exons are
deleted. The new splice transcript variants were termed AGR2 SV-C,
AGR2 SV-E, AGR2 SV-F, AGR2 SV-G and AGR2 SV-H. The variants are
shown schematically in FIG. 5 wherein as wild-type AGR2 the variant
B containing shorter part of the untranslated region of the first
exon, is designated. In variants C exon 1 is shortened. Variant E
comprises exons 1, 5, 7 and 8. Variant F comprises exons 1, 7 and
8. Variant G comprises part of exon 1 and part of exon 7 and exon
8. Variant H comprises exon 2, part of exon 3 and part of exon
8.
BRIEF DESCRIPTION OF THE FIGURES
The present invention is summarized in the Figures and further
illustrated in the following examples:
FIGS. 1A and 1B: Characterization of extracellular vesicles (EV)
isolated from the plasma and urine of patients with colorectal
carcinoma
EVs isolated from the blood plasma (A) and urine (B) by
differential centrifugation were characterized by transmission
electron microscopy (upper panels) and dynamic light scattering
analysis (Zetasizer, Malvern Instruments, Germany). To detect
different population of vesicles, three main parameter were
applied: distribution by intensity (left panel), allowing to
visualize vesicles according to the intensity of their fluorescence
independent on number; distribution by mass (right panel) according
to which the amount of vesicles with certain mass can be measured,
and distribution by number (table below), showing the relative
amount of vesicles of certain size.
(FIG. 1A) Three populations of vesicles were detected in the blood
plasma (left panel). According to the distribution by intensity
first population (15% of total amount) consists of EVs with the
radius 4.5 nm; second population (43%) consists of EVs with the
radius of 23.6 nm which be the size corresponding to exosomes; 41%
of total EVs comprise a third population of EVs with the mean
radius of about. 254.2 nm and might contain bigger vesicles or
agglomerates. The analysis of the distribution of EVs by mass
clearly shows that the majority of EVs (95%) is represented by the
population of vesicles with the radius of 4.7 nm which might
correspond to liposomes. Only a minor part of EVs (4.6%) consists
of EVs with the radius of 43 nm, which might correspond to
exosomes. Analysis of the distribution by number show that the
vesicles with the radius of 4.7 nm represent 99.9%, and the
vesicles with the radius of 23.6 nm, which correspond the size of
the exosomes, represent 0.09%, and the vesicles with the radius of
254.2 nm comprise about 0.01% of the whole amount.
(FIG. 1B) Vesicles isolated from the urine represented a homogenous
population with the average radius of about 74 nm, which as contain
EVs with the size, corresponding exosomes, and bigger vesicles as
it is shown by electron microscopy (upper panel).
FIGS. 2A-2C: Comparative analysis of the AGR2wt and the splice
variants svC, svE, svF, svG, svH mRNA levels in different
components of the blood plasma and urine of patients with prostate
cancer.
(FIG. 2A) For this analysis 5 patients with prostate adenocarcinoma
were chosen. RNA was isolated either from the total blood plasma or
from the EVs isolated from the blood plasma.
(FIG. 2B) As a second source of AGR2 and its splice variants, urine
sediment and urine EVS were examined. RNA was isolated from these
four sources and subjected to the quantitative RT-PCR. GAPDH was
used as a reference gene for the normalization of signal intensity.
The expression of AGR2 and the splice variants differ between total
plasma and plasma vesicles. It is likely that the splice variant
AGR2 SV-E might be specifically enriched in the plasma EVs of
patients with the prostate cancer. However the analysis of urine
EVs delivers more consistent results, supporting application of
urine EVs for further analysis.
(FIG. 2C) First, it was verified if the population of urine EVs
isolated by differential centrifugation contains exosomes. Urine
from the patients 1, 2, and 3 was used for the isolation of
proteins from the cell sediment, designated as Se; and from the
vesicles, designated as EV. As exosome markers Tsg101, CD9 and
Hsp70 were used. GAPDH served as a loading control. Additionally,
the presence of prostate specific proteins PSMA was analyzed. In
all three patients analyzed PSMA was present on the vesicles
isolated from the urine, supporting their origin from the
prostate.
FIGS. 3A-3C: mRNA levels of AGR2 wt and the splice variants in the
urine EVs can serve as an independent diagnostic marker for
prostate cancer. 39 patients (24 tumors; 15 BPH) with 15 benign and
24 malign adenocarcinoma were included into analysis. EVs were
isolated from the urine and were directly used for RNA preparation.
30 ng of RNA were used for the followed quantitative RT-PCR
analysis.
(FIG. 3A) AGR2 and all splice variants can serve as potential
diagnostic markers allowing to differentiate between benign (BPH)
and adenocarcinomas. Additionally, potential predictive value of
AGR2 and its splice variants was controlled.
(FIG. 3B) Additionally, The AGR2 svF was demonstrated to show a
difference between high and low Gleason scores. Further analysis of
a bigger cohort of patients will verify this correlation.
(FIG. 3C) ROC (receiver operator characteristic) plots of the AGR2
variants on the exosomes and PSA on the exosome and protein level
in serum (analysis regularly used in the diagnostics) was performed
with 27 patients (12 tumor and 9 benign) and revealed significant
differences between AGR2 svG and PSA level in serum (p 0.044); AGR2
svG and PSA mRNA in the exosomes (p 0.0195), AGR2svH and PSA in
serum (p 0.0269) and AGR2svH and PSA level in the vesicles (0.0274)
confirming that the exosome AGR2 can serve as an additional
independent diagnostic marker for the prostate cancer allowing to
differ between benign disease and prostate cancer with the higher
specificity as common markers (e.g. PSA).
FIG. 4: mRNA of AGR2 wt and the splice variants are most probably
enclosed in the EVs and are resistant to the RNase treatment.
To verify if detected mRNAs of AGR2 and its splice variants are
indeed enclosed into vesicles, the vesicles from 2 independent
samples were treated with RNase. After treatment the RNase was
inactivated and the samples were subjected to the RNA isolation
followed by the Q RT-PCR. The results showed that the AGR2 and
splice variants mRNAs are resistant to the RNase treatment, which
support their localization within the EVs.
FIG. 5: structural schematic of different splice variants of the
AGR2 gene.
The AGR2 gene comprises 8 exons. The exons are shown schematically
and the different variants are designated as B-H. A (upper line)
corresponds to wild type. It is shown which exon or which part of
an exon is deleted in splice variants B to H.
FIG. 6: Comparative analysis of the AGR2 SVs mRNA levels in the
breast cancer cells and in exosomes
mRNA levels of AGR2 wild type and of splice variants were analyzed
in three breast cancer cell lines: MCF7, MDA-MB-361 and MDA-MB-231.
The cells were routinely cultured at 37.degree. C. by 95% humidity
and 5% CO2. The cellular RNA was isolated using RNeasy Qiagen kit
according to the manufacture of the supplier. Exosomes were
isolated from the supernatants of the cells grown in serum-free
medium for at least 48 hours. Serum-free medium was used to avoid
contaminations with the bovine exosomes. Three hundred fifty ml of
cell culture supernatant was used from each cell line for the
exosome isolation. Exosomes were isolated by differential
ultracentrifugation as described elsewhere (Nazarenko et al., 2010
Cancer Research). After sedimentation by ultracentrifugation,
exosomes were directly re-suspended in RLT lysis buffer, supplied
with the RNeasy Qiagen Kit. Then RNA was isolated according to the
manufacture of the supplied. For the production of cDNA, 500 ng of
cellular RNA and 30 ng of exosomal RNA were used. Quantitative PCR,
using GAPDH and AGR2-specific primers was performed as described
above.
Splice variants B, C, G and H were detected in both, cells and
exosomes, whereas only splice variant G was strongly enriched on
the exosomes. Splice variants A, E and F were detectable only in
the cells but not in the exosomes, which differed from the data
obtained by the analysis of exosomes derived from the prostate
cancer cells. These data suggest a difference in the recruitment of
AGR2 splice variants mRNAs to exosomes in different tumor types,
which may potentially be used for the diagnosis.
FIG. 7: AGR2 SVs mRNA levels in the exosomes isolated from the
urine of 4 patients with urothelial carcinoma.
EVs were isolated from the urine of 4 patients diagnosed with
urothelial carcinoma using protocol applied for the isolation of
EVs from the urine of the patient with prostate carcinoma.
Following differences were observed as compared to the prostate and
breast cancer EVs: SV-A is present in EVs isolated from the urine
of the patients with urothelial and prostate cancer, but is absent
in breast cancer EVs (FIG. 6); The SVs-E, -F, -G shown to be
enriched in the EVs of prostate cancer patients, were detectable at
low levels only in one out of four patients with urothelial
carcinoma.
FIG. 8: AGR2 SVs mRNA levels in the exosomes isolated from the
urine of 4 patients with renal cell carcinoma.
EVs were isolated from the urine of 4 patients diagnosed with renal
cell carcinoma using protocol applied for the isolation of EVs from
the urine of the patient with prostate carcinoma. Following
differences were observed as compared to the prostate, breast and
urothelial cancer: only SV-A, B, C were detectable in 2 from 4
samples. SV-E, F, G seems to be prostate cancer specific and could
not be detected in the EVs derived from the urine of patients with
renal cell carcinoma.
FIGS. 9A and 9B: AGR2 SVs mRNA levels in the exosomes isolated from
the blood (serum or plasma) of patients with different tumor
types.
To assess if blood can be used as a source of EVs for the
AGR2-based diagnosis of other different tumor types, blood samples
from patients with urothelial and renal cell carcinoma, melanoma,
breast and colorectal cancer were used for the isolation of EVS.
The GAPDH mRNA was analyzed as a control; additionally, breast
cancer cell lines T47D was used as a positive control for the AGR2
wt and splice variants. No AGR2-specific signal could be detected
in the EVs isolated from the blood samples of these tumor entities,
suggesting that only a very low proportion of EVs, derived from the
tumor cells were present in the blood and supporting that urine may
be a better source for EV for the diagnosis of prostate,
urothelial, renal carcinomas.
DETAILED DESCRIPTION OF THE INVENTION
As shown in the examples below, exosomes isolated from the urine or
from the blood of patients can be used as a source for the
detection of the biomarkers (ARG2 transcript variants), which
allows the application of a non-invasive or only minimally invasive
diagnostic routine method. When exosomes are isolated from the
urine of patients, the diagnostic method can be performed without
any treatment performed by a medical doctor.
Surprisingly, it has been found that distinct ARG2 splice variants
recovered from the exosomes can be used as specific diagnostic
and/or prognostic markers for different tumor entities. Such tumors
comprise not only the preferred prostate tumor but also breast
cancer or cancer of colon, lung, pancreas or small intestine to
name only a few.
Splice variants E and G (compare with FIG. 5) are enriched in the
exosomes isolated from the blood of patients with prostate cancer
but not in the cells isolated from the blood. This can be seen from
FIG. 2A.
Splice variants E, F, G and H (compare with FIG. 5) are enriched in
the exosomes isolated from urine or patients with prostate cancer
compared to the urine sediment. This confirms the superior results
obtainable by the method of the present invention.
A pilot clinical study confirmed that splice variants G and H are
enriched in the exosomes isolated from urine of prostate cancer
patients and are significantly better diagnostic markers as
compared to the serum PSA. This can be seen from FIGS. 3A and 3C of
the present application.
In the present invention the following primers were preferred:
TABLE-US-00001 SV C: Forward: (SEQ ID NO: 3) 5' CAC AAG GCA GAG TTG
CCA TGG 3' SV E: Forward: (SEQ ID NO: 4) 5' ATC TGG TCA CCC ATC TCT
GA 3' SV F: Forward: (SEQ ID NO: 5) 5' GGA AAT CCA GAC CCA TCT CTG
3' SV G: Forward: (SEQ ID NO: 6) 5' AAG GCA GGT ACA GCT CTG 3'
Reverse SV C, E, F G: (SEQ ID NO: 7) 5' TCC ACA CTA GCC AGT CTT CTC
A 3' SV H Forward: (SEQ ID NO: 8) 5' ATG GAG AAA ATT CCA GTG TCA
GCA 3 Reverse: (SEQ ID NO: 9) 5'-ACT TGA GAG CTT TCT TCA TAT GTC
TG-3' AGR2 long transcript: A (was not detected in the exosomes)
AGR2Lt Forward (SEQ ID NO: 10) GCCAACAGACAACCCAAAGT AGR2Lt Reverse
(SEQ ID NO: 11) GCAAGAATGCTGACACTGGA AGR2 short transcript: B (also
designated as a wt AGR2) AGR2St Forward (SEQ ID NO: 12)
-CGACTCACACAAGGCAGGT- AGR2St Reverse (SEQ ID NO: 13)
-GCAAGAATGCTGACACTGGA PSA: PSA Forward (SEQ ID NO: 14)
ACCAGAGGAGTTCTTGACCCCA PSA Reverse (SEQ ID NO: 15)
CCCCAGAATCACCCGAGCAG
By selection of appropriate forward and reverse primers specific
variants could be amplified. The person skilled in the art can,
however, easily design alternative primers since the splice
variants are described herein and the complete sequence of the gene
to be analyzed is known.
Exosomes (extracellular vesicles, EV) are specialized nanovesicles
(30-100 nm) that are actively secreted by a variety of normal and
tumor cells. Elevated exosome amount has been found in malignancy
effusions, serum and urine from cancer patients. Certain RNA
transcripts are enriched several 100-fold in the exosomes compared
with the donor cells and in particular exosomes are enriched in
unique transcripts specific to tumor cells that may be below
detection limit even in the tumor cells themselves. Therefore, the
mRNA levels of svB, svC, svE, svF, svG and svH (shown in FIG. 5)
variant of AGR2 in urine exosomes was analyzed, in order to define
the most reliable source of the AGR2 variant as biomarkers for
prostate cancer.
The present invention provides an in vitro process for the
diagnosis of prostate cancer in exosomes. The term "exosome" is
used as a term for "extracellular vesicles". The term "diagnosis"
means to obtain more insight in the specific forms of cancer and
whether the patient suffers from an aggressive form of prostate
cancer or whether possibly other diagnostic markers speak for a
benign form which does not require surgery or treatment with strong
chemostatic agents. It is an advantage of the present invention
that the diagnosis can be performed in a sample obtained from the
patient without the action of a doctor. The sample which is used
for the diagnostic process is preferably urine. The exosomes can,
however, also be obtained from other sources like from bloods serum
or plasma. In general the diagnostic method can be performed with
fluids obtained from the human body. Body fluids comprise urine,
semen, blood (serum of plasma), saliva and any other fluid which
can be obtained from the human body.
The diagnostic method of the present invention is performed on
exosomes. Therefore, it is essential that the exosomes are enriched
and the other components or the fluid containing the exosomes are
at least partially removed. Since the detection step is based on
the amplification of nucleic acids it is essential that nucleic
acids which might interfere with the test results are efficiently
removed. Protein components may strongly interfere with the test
results when such components inhibit the enrichment of exosomes.
Such proteins may for example entrap the exosomes and the nucleic
acids contained therein cannot be made accessible to the
amplification reaction.
In the following a preferred process for the diagnosis of prostate
cancer is described when the body fluid is urine. One of the
advantages of using as starting material for diagnosis urine is
that the sample can be obtained from the patient without any
invasive interaction of a doctor. Moreover, in some cases it may be
difficult to obtain a sufficient amount of serum or plasma from a
patient. To obtain a sample via biopsy from patients may be even
more difficult and may increase the risk to cause metastases by
circulating tumor cells or activation of dormant tumor cells.
In the first step of the diagnostic process the exosomes are
concentrated from the body fluid, in particular urine of the
patient. In a preferred embodiment the urine is first centrifuged
at a low speed (preferably up to 4,000 G) at a low temperature
(2-15.degree. C.) for 5 to 30 minutes in order to remove remaining
cells and debris.
Preferably the supernatant obtained from the first centrifugation
step is filtered through suitable filtering means in order to
remove remaining large particles from the supernatant. The filter
pores preferably have a diameter of about 1 .mu.m to about 150
.mu.m, more preferred about 5 .mu.m to 100 .mu.m.
The urine which has been treated by a low speed centrifugation and
possibly an additional filtration step is then preferably
ultracentrifuged. In a particularly preferred embodiment the method
of the present invention comprises the step of ultracentrifugation.
This purification step results in superior test results. The
ultracentrifugation can take place either in the presence of a
commonly used buffering agent. The ultracentrifugation is usually
performed at +4.degree. C. and at G.gtoreq.100,000 for 20 minutes,
preferably from one hour to two hours. As an alternative the
samples can be purified by chromatography- or precipitation-based
approaches. It is important to enrich the extracellular vesicles
with suitable purification steps from the body fluids.
The sediment obtained in the ultracentrifugation step is then
further treated to extract the RNA from the exosomes. It is
preferred to treat the sediment with proteases and DNAses or other
suitable chemicals in order to extract the RNA from the sediment as
efficiently as possible.
For the analysis of the RNA fractions obtained from this step the
RNA is first transcribed into cDNA with the help of a reverse
transcription.
The cDNA obtained in this manner is amplified with a polymerase
chain reaction whereby specific primers developed in the course of
the present invention are preferably used. From the nucleotide
sequence of AGR2 (SEQ ID NO:1) and the complement thereof suitable
parts are selected. Then it has to be checked whether said primers
do potentially amplify other sequences which may result in
false-positive reactions. In the course of the present invention
the following primers are especially preferred: SEQ ID NO:3 to SEQ
ID NO:13 which allow the amplification of variants of distinct
splice variants of AGR2. To avoid artifacts, for a PCR reaction
usage of 2 different primer pairs or preferably 3 primer pairs is
more preferred.
After having performed the PCR reaction the amplification products
are analyzed. It is well-known in the art, how such analysis can be
performed. In a preferred embodiment the nucleic acid is amplified
in a quantitative PCR.
Depending on the results the diagnosis can be performed. The
presence or absence of specific variants of the AGR2 gene allows a
diagnosis whether the patient suffers from a malignant prostatic
cancer or whether the clinical symptoms are benign.
The experimental results show that mRNAs coding for isoforms B, E,
G and H are significantly elevated in tumor patients compared with
samples obtained from patients with benign forms according to the
student-t test. The isoforms G and H demonstrated significantly
higher specificity and sensitivity compared to the currently
applied standard PSA test. Therefore, it is preferred to detect the
presence and/or absence of the isoforms G, H, B and E either alone
or in combination.
Since the diagnostic process of the present invention is also based
on the observation whether certain variants are overly expressed or
expressed only to a very low level it is preferred to standardize
the test method. This can be done for example by using always the
same concentration of RNA in the test. It is preferred to
standardize the RNA level to 10-50 ng, preferably to 30 ng per
sample to be amplified.
Another alternative to improve the reliability of the diagnostic
result is to amplify together with the AGR2 variants also a
housekeeping gene. A so-called "housekeeping gene" may serve as
internal standard which allows a comparison of results obtained in
different experiments. Such as housekeeping gene is preferably the
gene GAPDH which is present in all samples. Of course other
housekeeping genes, recruited to the exosomes can also be used. In
case PSA is amplified, suitable primers are SEQ ID NO:14 and SEQ ID
NO:15.
It is one object of the present invention to determine whether
splice variants of the AGR2 gene can be amplified and thereafter be
assigned to certain types of diseases, in particular different
tumors, and furthermore whether nucleic acid coding for certain
splice variants can be detected in exosomes obtained from the urine
of patients.
AGR2 has also been shown to be expressed in several human tissues
rich in epithelial cells, like prostate, breast, small intestine,
colon, lung, and pancreas. Its protein level was found increased in
prostate tumor tissue and its expression level was associated with
poor survival of prostate cancer patients. Therefore, the method of
the present invention may serve as means for a prediction of the
further development of the disease and as means for differentiating
one type of tumor from another.
In breast and prostate adenocarcinoma, AGR2 seems to be under the
control of ER or androgen receptor expression. Up-regulation of
AGR2 enhances classical hallmarks of cancer, such as metastasis,
invasion, colony formation, and proliferation.
The present invention is further illustrated in the following
examples whereby the results are shown in the enclosed figures.
Important aspects of the present invention can be summarized as
follows:
Splice variants E and G are enriched in exosomes isolated from the
blood of patients suffering from prostate cancer. Such splice
variants were, however, not detected in cells isolated from blood
(compare with FIG. 2A).
Splice variants E, F, G and H are enriched in exosomes isolated
from urine of patients suffering from prostate cancer as compared
to the urine sediment. The result that the exosomes allow superior
diagnostic results could not have been expected. This can be seen
from FIG. 2B.
Clinical pilot studies confirmed that splice variants G and H are
enriched in the exosomes isolated from urine of patients suffering
from prostate cancer patients. Those splice variants are
significantly better diagnostic markers as compared to serum PSA.
This can be seen from FIG. 3A or 3C, respectively.
The analysis of ARG2 splice variants from the exosomes obtained
from blood and/or urine is tumor type specific. FIG. 6 for example
shows the enrichment of AGR2 splice variants in breast cancer
exosomes which may allow the distinction between breast and
prostate cancer.
Splice variant C is present in breast cancer exosomes but absent in
prostate cancer whereas variant A is present in the exosomes
derived from patients suffering from prostate cancer but absent in
exosomes obtained from patients suffering from breast cancer. Even
if prostate cancer and breast cancer are highly specific to gender
such distinction may also be useful in the molecular diagnostic of
other cancer types.
The present invention is summarized in the Figures above and
further illustrated in the following examples:
Example 1: Clinical Samples
The use of clinical samples for the study was approved by the
ethics committee of the Innsbruck Medical University. Frozen
prostate tissue samples from previously untreated patients who had
undergone radical prostatectomy after tumor diagnosis in a
PSA-based prostate cancer early detection program were obtained
from the prostate center of the Department of Urology of the
Innsbruck Medical University. Frozen tissue samples were processed
and microdissected and RNA was isolated. Tumor samples were
obtained from a cohort of Gleason score (GSC) 8 tumors (Gleason
pattern 3) and a group of GSC 8-10 tumors (Gleason patterns 4 and
5). Benign epithelial cell samples were isolated from the same
specimens apart from tumor loci.
Example 2: Patients with Clinical Diagnosis
This example included 30 patients, with prostate cancer and with
benign prostate hyperplasia. Analysed were in each case a urine
sample and a blood sample (serum).
The cancer cases were all detected by biopsy. Before prostatic
specific antigen (PSA) was measured and patients with a high
PSA-level were advised to undergo a transrectal guided biopsy.
Their age was in between 28 and 78. As regards the histologic
classification only patients with a gleason score from 6 to 9 were
chosen.
All patients with prostate cancer were treated by radical
prostatectomy and pelvic lymphadenectomy.
The patients with benign prostate hyperplasia with a low PSA-level
(<4 ng/ml) were treated by transurethral resection. If the
PSA-level of these patients was high prostate cancer was obviated
by transrectal guided biopsy following by transurethral
resection.
Example 3: Splice Variants of AGR2
AGR2 has a fairly broad expression pattern in human tissues.
However splice variants of AGR2 (e.g. the long form, .DELTA.6 and
.DELTA.4-6) are reported to provide some selectivity by being
predominantly expressed in certain tissues or in distinct
hepatocellular neoplasms. It was therefore investigated whether
further splice variants of AGR2 exist and whether they would be a
better predictor of prostate cancer development.
In PCR amplification reactions which were carried out with primers
in exon I and 8, and 6 new splice transcripts were identified which
were termed sv C, E, F, G,H in addition to transcripts A and B that
have already been reported as long and short transcripts of AGR2
(compare with FIG. 5). The transcripts C-H most likely arose from
alternative splicing as they lack partial or complete exons. In
contrasts to transcripts A and B that are known to encode the full
length AGR2 protein, no protein products for transcripts C, E, F, G
and H have been detected so far.
Example 4
As a further characterization of the splice variants, their
expression pattern was examined in different cells lines to find
out whether they would differentiate between cells of prostate from
cells of non-prostate origin. For prostate cells, VCaP, LNCaP, PNT2
and 22Rv.1 cell lines were used whereas the non-prostate cells
which were analyzed consisted of breast tumor (T47D, MCF7),
endometrial tumor (Ishikawa), cervical tumor (HeLa), kidney tumor
(Hek 293), liver tumor (HepG2) and choriocarcinoma cells (JEG-3).
AGR2 (short form transcript; svB) was expressed in several cell
lines in agreement with reports on its widespread expression. In
contrast, it was found that the AGR2 long isoform (sv A) which was
previously reported to be expressed in predominantly prostate
tissue, was not only expressed in the prostate tumor cell lines but
also in mammary (MCF7 and T47D) and endometrial cell lines
(Ishikawa). The sv C, E, F, G and H showed varying levels of
expression among the different cell lines with sv C being mainly
expressed in prostate tumor cell lines. This differential
expression pattern of the splice variants and their levels can be
used to differentiate in the progression of prostate cancer from
the benign to the more advanced stages of the tumor.
Example 5: AGR2 Splice Variants in Prostate Cancer Progression
A real-time qPCR was performed for the different AGR2 transcripts
on prostate biopsies which consisted of 32 benign biopsies and 32
tumor samples (16 from Gleason pattern 3 and 16 from Gleason
pattern 4). In the quantitative RT-PCR the splice variant sv B
(short transcript) again showed a significant difference (p=0.0406)
between benign and prostate tumor. In addition sv H was also
identified as a predictive discriminator of benign and prostate
tumor (p=0.0476). All the other splice variants did not show any
significant difference in the two sample pools. Since non-invasive
diagnostics (using urine or saliva samples) are superior
alternatives to traditional needle or excision biopsies due to the
reduced patient pain and inconvenience, and greater speed and lower
cost of analysis, it was decided to examine the expression of the
splice variants in urine sediments.
Example 6: Urine Exosomes for Studying AGR2 Expression
AGR2 (svB) splice variant is present in urine sediments of patients
with prostate cancer and their levels correlate with the tumor
aggressiveness allowing discrimination between benign and malignant
neoplasm outperforming markers currently used for the diagnostic of
prostate cancer. It was tested whether newly identified splice
variants are also present in urine sediments and these studies were
extended to determine whether they are also present in urine
exosomes.
Urine extracellular membrane vesicles were isolated by differential
centrifugation and characterized by dynamic light scattering. This
showed that the urine exosomes are of sizes 74.0.+-.85.9 nm. The
expression of the AGR2 splice variants in urine sediments and urine
exosomes in 5 patients diagnosed with prostate carcinoma was
compared to find out whether the spliced variants are indeed
enriched in exosomes. In all 5 samples, the level of expression of
the splice variants was higher in the urine exosomes than in the
sediments suggesting that these transcripts are enriched in the
exosomes and are most likely a more appropriate source for AGR2 as
a non-invasive diagnostic marker.
As exosomes are somewhat unique in their protein composition, the
level of a few markers was analyzed as additional traits for the
identity of the exosomes in the urine sediments and exosome
preparation of 3 of the isolated samples. It could be shown that
TSG191, CD9, Hsp70 are all overexpressed in the exosome preparation
compared to the urine sediments of the 3 samples. Furthermore we
could show that PSMA is enriched in the exosomal vesicle fraction
indicating the prostate origin of these samples.
For that purpose AGR2 wt and sv mRNA levels were examined in urine
sediments and in exosomes isolated from 5 patients diagnosed with
prostate carcinoma. The urine extracellular membrane vesicles were
isolated by differential centrifugation and characterized by
dynamic light scattering using Zetasizer instrument (Malvern
Instruments GmbH).
Example 7: The AGR2 wt and Splice Variants mRNA is Enriched in the
Urine Exosomes
The previous work showed that AGR2 wt mRNA and the transcripts of
splice variants (sv) were present in urine sediments of patients
with prostate cancer. Statistical analysis revealed that the AGR2
mRNA levels correlate with the tumor aggressiveness and allows
discriminating between malign and benign tumors, outperforming
markers currently used for the diagnostic of prostate cancer. Based
on these findings the mRNA levels of AGR2 wt and svC, svE, svF,
svG, svH were compared in different physiological fluids and tested
if these mRNA is available as a circulation cell-free component or
as an entire part of the extracellular membrane vesicles, e.g.
exosomes, in order to define the most reliable source of the AGR2wt
or sv mRNA as biomarkers for prostate cancer.
For that purpose AGR2 wt and sv mRNA levels were examined in blood
plasma and in the extracellular membrane vesicles isolated form the
plasma in 4 patients diagnosed with prostate carcinoma.
Exosome-depleted plasma did not contain detectable levels of RNA
and therefore was not included into analysis. Additionally, urine
sediments and urine exosomes from the same patients were examined.
Prostate specific gene PSA and GAPDH mRNA were analyzed as
controls.
The plasma and urine extracellular membrane vesicles were isolated
by differential centrifugation and characterized by dynamic light
scattering using Zetasizer instrument (Malvern Instruments
GmbH).
The analysis shows three distinct vesicles population in the blood:
population1 with radius 4.7 nm, population 2 with radius 23.6 nm,
which might correspond exosomes, and the population 3 with radius
254.2 nm, which might contain either bigger vesicles or the
agglomerates of vesicles.
Example 8: AGR2 Splice Variants Obtained from Exosomes are Tumor
Type Specific
By using the methods as described in the previous examples the
presence or absence of ARG2 splice variants was analyzed in samples
obtained from patients suffering from other tumor types or in the
exosomes derived from cancer cells lines. The results are shown in
FIGS. 6-8B.
In the experiments leading to the results shown in FIG. 6, ARG2
splice variants were analyzed in breast cancer cell lines and in
the exosomes derived from these cell lines.
The experiments leading to the results shown in FIG. 6 allow to
speculate that the recruitment of AGR2 splice variants is tumor
type-specific and will for instance allow a discrimination between
breast cancer and prostate cancer. Splice variant C is present in
breast cancer exosome but absent in prostate cancer. On the other
side splice variant A is present in the exosomes derived from a
patient suffering from prostate cancer but absent in samples
obtained from breast cancer cells. Consequently the combinational
application of translated and non-translated AGR2 splice variants
offers a unique possibility for the diagnosis and prognosis of
different tumor entities.
SEQUENCE LISTINGS
1
1511077DNAhomo sapiens 1accgcatcct agccgccgac tcacacaagg caggtgggtg
aggaaatcca gagttgccat 60ggagaaaatt ccagtgtcag cattcttgct ccttgtggcc
ctctcctaca ctctggccag 120agataccaca gtcaaacctg gagccaaaaa
ggacacaaag gactctcgac ccaaactgcc 180ccagaccctc tccagaggtt
ggggtgacca actcatctgg actcagacat atgaagaagc 240tctatataaa
tccaagacaa gcaacaaacc cttgatgatt attcatcact tggatgagtg
300cccacacagt caagctttaa agaaagtgtt tgctgaaaat aaagaaatcc
agaaattggc 360agagcagttt gtcctcctca atctggttta tgaaacaact
gacaaacacc tttctcctga 420tggccagtat gtccccagga ttatgtttgt
tgacccatct ctgacagtta gagccgatat 480cactggaaga tattcaaatc
gtctctatgc ttacgaacct gcagatacag ctctgttgct 540tgacaacatg
aagaaagctc tcaagttgct gaagactgaa ttgtaaagaa aaaaaatctc
600caagcccttc tgtctgtcag gccttgagac ttgaaaccag aagaagtgtg
agaagactgg 660ctagtgtgga agcatagtga acacactgat taggttatgg
tttaatgtta caacaactat 720tttttaagaa aaacatgttt tagaaatttg
gtttcaagtg tacatgtgtg aaaacaatat 780tgtatactac catagtgagc
catgattttc taaaaaaaaa ataaatgttt tgggggtgtt 840ctgttttctc
caacttggtc tttcacagtg gttcgtttac caaataggat taaacacaca
900caaaatgctc aaggaaggga caagacaaaa ccaaaactag ttcaaatgat
gaagaccaaa 960gaccaagtta tcatctcacc acaccacagg ttctcactag
atgactgtaa gtagacacga 1020gcttaatcaa cagaagtatc aagccatgtg
ctttagcata aaaaaaaaaa aaaaaaa 10772175PRThomo sapiens 2Met Glu Lys
Ile Pro Val Ser Ala Phe Leu Leu Leu Val Ala Leu Ser1 5 10 15Tyr Thr
Leu Ala Arg Asp Thr Thr Val Lys Pro Gly Ala Lys Lys Asp 20 25 30Thr
Lys Asp Ser Arg Pro Lys Leu Pro Gln Thr Leu Ser Arg Gly Trp 35 40
45Gly Asp Gln Leu Ile Trp Thr Gln Thr Tyr Glu Glu Ala Leu Tyr Lys
50 55 60Ser Lys Thr Ser Asn Lys Pro Leu Met Ile Ile His His Leu Asp
Glu65 70 75 80Cys Pro His Ser Gln Ala Leu Lys Lys Val Phe Ala Glu
Asn Lys Glu 85 90 95Ile Gln Lys Leu Ala Glu Gln Phe Val Leu Leu Asn
Leu Val Tyr Glu 100 105 110Thr Thr Asp Lys His Leu Ser Pro Asp Gly
Gln Tyr Val Pro Arg Ile 115 120 125Met Phe Val Asp Pro Ser Leu Thr
Val Arg Ala Asp Ile Thr Gly Arg 130 135 140Tyr Ser Asn Arg Leu Tyr
Ala Tyr Glu Pro Ala Asp Thr Ala Leu Leu145 150 155 160Leu Asp Asn
Met Lys Lys Ala Leu Lys Leu Leu Lys Thr Glu Leu 165 170
175321DNAartificial sequenceSV C Forward 3cacaaggcag agttgccatg g
21420DNAartificial sequenceSV E Forward 4atctggtcac ccatctctga
20521DNAartificial sequenceSV F Forward 5ggaaatccag acccatctct g
21618DNAartificial sequenceSV G Forward 6aaggcaggta cagctctg
18722DNAartificial sequenceReverse SV C, E, F G 7tccacactag
ccagtcttct ca 22824DNAartificial sequenceSV H Forward 8atggagaaaa
ttccagtgtc agca 24924DNAartificial sequenceSV H Reverse 9agacatatga
agaacctctc aagt 241020DNAartificial sequenceGR2LtForward
10gccaacagac aacccaaagt 201120DNAartificial sequenceAGR2LtReverse
11gcaagaatgc tgacactgga 201219DNAartificial sequenceAGR2St forward
short transkript 12cgactcacac aaggcaggt 191320DNAartificial
sequenceAGR2St reverse short transcript 13gcaagaatgc tgacactgga
201422DNAartificial sequencePSA Foward 14accagaggag ttcttgaccc ca
221520DNAartificial sequencePSA Reverse 15ccccagaatc acccgagcag
20
* * * * *