U.S. patent number 10,385,410 [Application Number 15/314,357] was granted by the patent office on 2019-08-20 for in vitro method for the detection and quantification of hiv-2.
This patent grant is currently assigned to ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS, CHU DE ROUEN, INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE, UNIVERSITE DE ROUEN, UNIVERSITE PARIS DESCARTES, UNIVERSITE PARIS DIDEROT. The grantee listed for this patent is ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS, CHU DE ROUEN, INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE, UNIVERSITE DE ROUEN, UNIVERSITE PARIS DESCARTES, UNIVERSITE PARIS DIDEROT. Invention is credited to Veronique Avettand-Fenoel, Florence Damond, Diane Descamps, Marie Gueudin, Jean-Christophe Plantier, Christine Rouzioux.
![](/patent/grant/10385410/US10385410-20190820-D00001.png)
![](/patent/grant/10385410/US10385410-20190820-D00002.png)
United States Patent |
10,385,410 |
Rouzioux , et al. |
August 20, 2019 |
In vitro method for the detection and quantification of HIV-2
Abstract
The present invention relates to a method for detecting or
quantifying Human Immunodeficiency Virus-2 (HIV-2) nucleic acids in
a biological sample, comprising: a) performing a real-time
polymerase chain reaction (PCR) or a real-time reverse
transcriptase polymerase chain reaction (RT-PCR) on nucleic acids
of the biological sample with: (i) at least 4 primers respectively
comprising or consisting of: sequence SEQ ID NO: 1 or a sequence
having at least 90% identity to SEQ ID NO 1, and sequence SEQ ID
NO: 2 or a sequence having at least 90% identity to SEQ ID NO: 2,
and sequence SEQ ID NO: 4 or a sequence having at least 90%
identity to SEQ ID NO: 4, and sequence SEQ ID NO: 5 or a sequence
having at least 90% identity to SEQ ID NO: 5, and (ii) at least 2
labelled probes respectively comprising or consisting of: sequence
SEQ ID NO: 3, a sequence complementary to SEQ ID NO: 3, or a
sequence having at least 90% identity to SEQ ID NO: 3 or the
complementary thereof, and sequence SEQ ID NO: 6, a sequence
complementary to SEQ ID NO: 6, or a sequence having at least 90%
identity to SEQ ID NO: 6 or the complementary thereof, and b)
determining therefrom the presence or absence and/or the quantity
of HIV-2 nucleic acids in the biological sample.
Inventors: |
Rouzioux; Christine (Paris,
FR), Plantier; Jean-Christophe (Bois-Guillaume,
FR), Avettand-Fenoel; Veronique (Paris,
FR), Damond; Florence (Saint Mande, FR),
Gueudin; Marie (Rouen, FR), Descamps; Diane
(Paris, FR) |
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITE PARIS DESCARTES
ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS
CHU DE ROUEN
INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE
UNIVERSITE DE ROUEN
UNIVERSITE PARIS DIDEROT |
Paris
Paris
Rouen
Paris
Mont-Saint-Aignan
Paris |
N/A
N/A
N/A
N/A
N/A
N/A |
FR
FR
FR
FR
FR
FR |
|
|
Assignee: |
UNIVERSITE PARIS DESCARTES
(Paris, FR)
ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS (Paris, FR)
CHU DE ROUEN (Rouen, FR)
INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE
(Paris, FR)
UNIVERSITE DE ROUEN (Mont-Saint-Aignan, FR)
UNIVERSITE PARIS DIDEROT (Paris, FR)
|
Family
ID: |
50846785 |
Appl.
No.: |
15/314,357 |
Filed: |
May 27, 2015 |
PCT
Filed: |
May 27, 2015 |
PCT No.: |
PCT/IB2015/001191 |
371(c)(1),(2),(4) Date: |
November 28, 2016 |
PCT
Pub. No.: |
WO2015/181627 |
PCT
Pub. Date: |
December 03, 2015 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20170218467 A1 |
Aug 3, 2017 |
|
Foreign Application Priority Data
|
|
|
|
|
May 27, 2014 [EP] |
|
|
14169958 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q
1/68 (20130101); C12Q 1/703 (20130101); C12Q
2600/118 (20130101); C12Q 2600/158 (20130101) |
Current International
Class: |
C12Q
1/70 (20060101); C12Q 1/68 (20180101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
2882063 |
|
Aug 2006 |
|
FR |
|
WO 1991/08308 |
|
Jun 1991 |
|
WO |
|
WO 2012/168480 |
|
Dec 2012 |
|
WO |
|
WO-2012168480 |
|
Dec 2012 |
|
WO |
|
Other References
Matthews et al., 1987, AIDS Research and Human Retroviruses,
3(1):197-206. (Year: 1987). cited by examiner .
Damond et al. (Journal of Clinical Microbiology, 2002,
40(10):3654-3659 (Year: 2002). cited by examiner .
Charlotte Charpentier et al: "Genotypic resistance profiles of
HIV-2-treated patients in Cote d'Ivoire, West Africa", AIDS, Feb.
1, 2014(Feb. 1, 2014), p. 1, XP055139003, ISSN: 0269-9370, DOI:
10.1097/QAD.0000000000000244 abstract. cited by applicant .
F. Damond et al: "Plasma RNA Viral Load in Human Immunodeficiency
Virus Type 2 Subtype A and Subtype B Infections", Journal of
Clinical Microbiology, vol. 40, No. 10, Oct. 1, 2002(Oct. 1, 2002),
pp. 3654-3659, XP055139841, ISSN: 0095-1137, DOI:
10.1128/JCM.40.10.3654-3659.2002 abstract; figure 1. cited by
applicant .
F. Damond et al: "Improved Sensitivity of Human Immunodeficiency
Virus Type 2 Subtype B Plasma Viral Load Assay", Journal of
Clinical Microbiology, vol. 43, No. 8,Aug. 1, 2005(Aug. 1, 2005),
pp. 4234-4236, XP055139929, ISSN: 0095-1137, DOI:
10.1128/JCM.43.8.4234-4236.2005 cited in the application abstract
p. 4234, left-hand column--p. 4234, col. 2, line 1 p. 4235,
left-hand column. cited by applicant .
Schutten Martin et al: "Development of a real-time quantitative
RT-PCR for the detection of HIV-2 RNA in plasma", Journal of
Virological Methods, Elsevier BV, NL, vol. 88, No. 1, Jul. 1,
2000(Jul. 1, 2000), pp. 81-87, XP002349518, ISSN: 0166-0934, DOI:
10.1016/S0166-0934(00)00177-4 abstract p. 82; table 1. cited by
applicant .
Database EMBL [Online] Dec. 19, 2001 (Dec. 19, 2001), "Sequence 13
from patent U.S. Pat. No. 6,303,293.", XP002729720, retrieved from
EBI accession No. EM PAT:AR172157 Database accession No. AR172157
the whole document. cited by applicant .
Database Geneseq [Online] Mar. 11, 1999(Mar. 11, 1999), "HIV-2 long
terminal repeat(LTR) region probe.", XP002729721, retrieved from
EBI accession No. GSN:AAV63678 Database accession No. AAV63678 the
whole document. cited by applicant .
Database Geneseq [Online] Jan. 31, 2013(Jan. 31, 2013), "HIV-2 DNA
amplifying real-time-PCR primer hiv2-f2, SEQ ID:51.", XP002729722,
retrieved from EBI accession No. GSN:BAJ09419 Database accession
No. BAJ09419 the whole document. cited by applicant .
Severine Delarue et al: "Highly sensitive plasma RNA quantification
by real-time PCR in HIV-2 group A and group B infection", Journal
of Clinical Virology, vol. 58, No. 2, Oct. 1, 2013(Oct. 1, 2013),
pp. 461-467, XP055139001, ISSN: 1386-6532, DOI:
10.1016/j.jcv.2013.08.003 cited in the application abstract. cited
by applicant .
J.-C. Plantier et al: "Rapid Discrimination between Human
Immunodeficiency Virus Type 2 Groups A and B by Real-Time PCR",
Journal of Clinical Microbiology, vol. 42, No. 12, Dec. 1, 2004
(Dec. 1, 2004), pp. 5866-5870, XP055139940, ISSN: 0095-1137, DOI:
10.1128/JCM.42.12.5866-5870.2004 abstract. cited by applicant .
Linda M. Styer et al: "Validation and clinical use of a sensitive
HIV-2 viral load assay that uses a whole virus internal control",
Journal of Clinical Virology, vol. 58, Dec. 1, 2013(Dec. 1, 2013),
pp. e127-e133, XP055139004, ISSN: 1386-6532, DOI:
10.1016/j.jcv.2013.09.007 cited in the application. cited by
applicant .
Ming Chang et al: "Validation for clinical use of a novel HIV-2
plasma RNA viral load assay using the Abbott m2000 platform",
Journal of Clinical Virology, vol. 55, No. 2, Oct. 1, 2012(Oct. 1,
2012), pp. 128-133, XP055139007, ISSN: 1386-6532, DOI:
10.1016/j.jcv.2012.06.024 cited in the application abstract. cited
by applicant .
Avettand-Fenoel Veronique et al: "New sensitive one-step real-time
duplex PCR method for group A and B HIV-2 RNA load", Journal of
Clinical Microbiology, vol. 52, No. 8,Aug. 1, 2014(Aug. 1, 2014),
pp. 3017-3022, XP009180050, ISSN: 1098-660X the whole document.
cited by applicant .
International Search Report for PCT/IB2015/001191, dated Sep. 19,
2015. cited by applicant .
Notification of Transmittal of the International Search Report and
the Written Opinion of the International Searching Authority, or
the Declaration for PCT/IB2015/001191, dated Sep. 19, 2015. cited
by applicant .
Written Opinion of the International Searching Authority for
PCT/IB2015/001191, dated Sep. 19, 2015. cited by applicant .
Rouet et al., "Field Evaluation of a Rapid Human Immunodeficiency
Virus (HIV) Serial Serologic Testing Algorithm for Diagnosis and
Differentiation of HIV Type 1 (HIV-1), HIV-2, and Dual HIV-1-HIV-2
Infections in West African Pregnant Women", Sep. 2004, pp.
4147-4153, vol. 42, No. 9, Journal of Clinical Microbiology. cited
by applicant .
Damond, F. et al., "Evaluation of an Upgraded Version of the Roche
Cobas AmpliPrep/Cobas TaqMan HIV-1 Test for HIV-1 Load
Quantification", Apr. 2010, pp. 1413-1416, vol. 48, No. 4, American
Society for Microbiology. cited by applicant .
Francois Rouet, et al., "Transfer and Evaluation of an Automated,
Low-Cost Real-Time Reverse Transcription-PCR Test for Diagnosis and
Monitoring of Human Immunodeficiency Virus Type 1 Infection in a
West African Resource-Limited Setting", Jun. 2005, pp. 2709-2717,
vol. 43, No. 6, American Society for Microbiology. cited by
applicant .
Damond, F., et al., "Identification of a Highly Divergent HIV Type
2 and Proposal for a Change in HIV Type 2 Classification", Jun.
2004, 2 pages, vol. 20, No. 6, AIDS Res Hum Retroviruses Abstract.
cited by applicant .
Communication Pursuant to Article 94(3), European Patent Office,
dated Dec. 5, 2017. cited by applicant.
|
Primary Examiner: White; Nicole Kinsey
Attorney, Agent or Firm: Schulman, Esq.; B. Aaron Stites
& Harbison, PLLC
Claims
The invention claimed is:
1. A method for detecting or quantifying Human Immunodeficiency
Virus-2(HIV-2) nucleic acids in a biological sample, comprising: a)
performing a real-time polymerase chain reaction (PCR) or a
real-time reverse transcriptase polymerase chain reaction (RT-PCR)
on nucleic acids of the biological sample with: (i) at least 4
primers respectively consisting of: sequence SEQ ID NO: 1, sequence
SEQ ID NO: 2, sequence SEQ ID NO: 4, and sequence SEQ ID NO: 5, and
(ii) at least 2 labelled probes respectively consisting of:
sequence SEQ ID NO: 3, and sequence SEQ ID NO: 6, and b)
determining therefrom the presence or absence and/or the quantity
of HIV-2 nucleic acids in the biological sample.
2. The method according to claim 1, for detecting or quantifying
HIV-2 RNA.
3. The method according to claim 1, wherein the labelled probes are
labelled with 6-carboxyfluorescein (FAM) at their 5' end and with
Black Hole Quencher-1 (BHQ1) at their 3' end.
4. The method according to claim 1, wherein the PCR or RT-PCR
comprises the following thermocycling conditions: optionally 10 min
at 50.degree. C. for reverse transcription, followed by 5 min at
95.degree. C., followed by 50 cycles of 95.degree. C. for 15 s and
60.degree. C. for 1 min.
5. The method according to claim 1, further comprising determining
or quantifying HIV-1 nucleic acids in a biological sample.
6. A kit or a mix for detecting or quantifying HIV-2 nucleic acids,
comprising: a) at least 4 primers respectively consisting of:
sequence SEQ ID NO: 1, sequence SEQ ID NO: 2, sequence SEQ ID NO:
4, and sequence SEQ ID NO: 5, and b) at least 2 labelled probes
respectively consisting of: sequence SEQ ID NO: 3, and sequence SEQ
ID NO: 6, and c) optionally additional reagents for performing PCR
or RT-PCR.
7. The kit or the mix according to claim 6, wherein the labelled
probes are labelled with 6-carboxyfluorescein (FAM) at their 5' end
and with Black Hole Quencher-1 (BHQ1) at their 3' end.
8. The kit or the mix according to claim 6, further comprising
primers and labelled probes for detecting or quantifying HIV-1
nucleic acids.
9. An in vitro method for diagnosing HIV-2 infection, or
determining HIV-2 viral load, in an individual, comprising: (a)
performing the method for detecting or quantifying Human
Immunodeficiency Virus-2 (HIV-2) nucleic acids in a biological
sample taken from the individual as defined in claim 1; (b)
determining therefrom whether the individual is infected by HIV-2
or the HIV-2 viral load of the individual.
10. An in vitro method for diagnosing HIV-2 infection, or
determining HIV-2 viral load, in an individual, comprising the
steps of: (a) performing the method for detecting or quantifying
Human Immunodeficiency Virus-2 (HIV-2) nucleic acids in a
biological sample taken from the individual as defined in claim 3;
(b) determining therefrom whether the individual is infected by
HIV-2 or the HIV-2 viral load of the individual.
11. An in vitro method for diagnosing HIV-2 infection, or
determining HIV-2 viral load, in an individual, comprising the
steps of: (a) performing the method for detecting or quantifying
Human Immunodeficiency Virus-2 (HIV-2) nucleic acids in a
biological sample taken from the individual as defined in claim 4;
(b) determining therefrom whether the individual is infected by
HIV-2 or the HIV-2 viral load of the individual.
12. An in vitro method for diagnosing HIV-2 infection, or
determining HIV-2 viral load, in an individual, comprising the
steps of: (a) performing the method for detecting or quantifying
Human Immunodeficiency Virus-2 (HIV-2) nucleic acids in a
biological sample taken from the individual as defined in claim 5;
(b) determining therefrom whether the individual is infected by
HIV-2 or the HIV-2 viral load of the individual.
Description
FIELD OF THE INVENTION
The present invention relates to an in vitro method for the
detection and quantification of Human Immunodeficiency Virus (HIV)
2.
TECHNICAL BACKGROUND
HIV-2 is characterized by less efficient transmission through the
sexual and vertical routes than HIV-1, and by a slower natural
clinical course. Nevertheless, HIV-2 infection eventually leads to
AIDS. HIV-2 infection must be distinguished from HIV-1 infection,
as HIV-2 is naturally resistant to non-nucleoside reverse
transcriptase inhibitors, T20, and some protease inhibitors, and as
patient follow-up differs from that of HIV-1 infection.
Compared to HIV-1, HIV-2 is characterized by lower viral
replication. In the French ANRS cohort CO5 of HIV-2-infected
patients (1009 patients in January 2014), 61% of untreated patients
have plasma viral loads below 250 copies/mL (cp/mL). Likewise, in a
British study, only 8% of patients with CD4>500 cells/mm3 and
62% of patients with CD4<300 cells/mm3 had detectable viral
load, implying that 38% of patients had undetectable viral load in
an assay with a quantification limit of 100 copies/ml.
Clinical management of HIV-2 infection is hampered by the lack of
validated commercial RNA viral load assays. In-house assays are
therefore widely used, such as the assay described by Damond et al.
(2005) J. Clin. Microbiol. 43:4234-6 which is used for quantifying
the viral load in the French cohort CO5 of HIV-2-infected
patients.
However, the ACHIEV2E international collaboration on HIV-2
infection showed that plasma HIV-2 RNA values vary considerably
between laboratories. Besides, the high genetic diversity of HIV-2,
with 9 groups designated A to I, of which only groups A and B are
epidemic, also represents an obstacle to accurate viral load
quantification: previous studies have thus shown that group B
viruses are particularly difficult to quantify with the current
assays. In addition, the current HIV-2 assays also suffer from low
sensitivity and accuracy.
It is therefore an object of the invention to overcome these
limitations.
SUMMARY OF THE INVENTION
The present invention arises from the unexpected identification, by
the present inventors, of a combination of two specific target
sequences in HIV-2 RNA which duplex amplification by real-time
RT-PCR enables efficient detection of group B viruses and provide
for a detection limit below 40 copies/mL as well as a
quantification limit below 100 copies/ml.
The present invention thus relates to a method for detecting or
quantifying Human Immunodeficiency Virus-2 (HIV-2) nucleic acids in
a biological sample, comprising: a) performing a real-time
polymerase chain reaction (PCR) or a real-time reverse
transcriptase polymerase chain reaction (RT-PCR) on nucleic acids
of the biological sample with: (i) at least 4 primers respectively
comprising or consisting of: sequence SEQ ID NO: 1 or a sequence
having at least 90% identity to SEQ ID NO: 1, and sequence SEQ ID
NO: 2 or a sequence having at least 90% identity to SEQ ID NO: 2,
and sequence SEQ ID NO: 4 or a sequence having at least 90%
identity to SEQ ID NO: 4, and sequence SEQ ID NO: 5 or a sequence
having at least 90% identity to SEQ ID
NO: 5, and (ii) at least 2 labelled probes respectively comprising
or consisting of: sequence SEQ ID NO: 3, a sequence complementary
to SEQ ID NO: 3, or a sequence having at least 90% identity to SEQ
ID NO: 3 or the complementary thereof, and sequence SEQ ID NO: 6, a
sequence complementary to SEQ ID NO: 6, or a sequence having at
least 90% identity to SEQ ID NO: 6 or the complementary thereof,
and b) determining therefrom the presence or absence and/or the
quantity of HIV-2 nucleic acids in the biological sample.
In an embodiment of the invention, the above-defined method for
detecting or quantifying Human Immunodeficiency Virus-2 (HIV-2)
nucleic acids further comprises determining or quantifying HIV-1
nucleic acids in a biological sample.
The present invention also relates to a kit or a mix for detecting
or quantifying HIV-2 nucleic acids, comprising: a) at least 4
primers respectively comprising or consisting of: sequence SEQ ID
NO: 1 or a sequence having at least 90% identity to SEQ ID NO: 1,
and sequence SEQ ID NO: 2 or a sequence having at least 90%
identity to SEQ ID NO: 2, and sequence SEQ ID NO: 4 or a sequence
having at least 90% identity to SEQ ID NO: 4, and sequence SEQ ID
NO: 5 or a sequence having at least 90% identity to SEQ ID NO: 5,
and b) at least 2 labelled probes respectively comprising or
consisting of: sequence SEQ ID NO: 3, a sequence complementary to
SEQ ID NO: 3, or a sequence having at least 90% identity to SEQ ID
NO: 3 or the complementary thereof, and sequence SEQ ID NO: 6, a
sequence complementary to SEQ ID NO: 6, or a sequence having at
least 90% identity to SEQ ID NO: 6 or the complementary thereof,
and c) optionally additional reagents for performing PCR or
RT-PCR.
In an embodiment of the invention, the above-defined kit or mix
further comprises primers and labelled probes for detecting or
quantifying HIV-1 nucleic acids.
In another embodiment of the invention, the above-defined method
for detecting or quantifying Human Immunodeficiency Virus-2 (HIV-2)
nucleic acids in a biological sample, kit and mix further comprise
at least one primer comprising or consisting of sequence SEQ ID NO:
7 or a sequence having at least 90% identity to SEQ ID NO: 7.
The present invention also relates to the use of the kit or the mix
as defined above, for detecting or quantifying HIV-2 nucleic acids
of a biological sample.
The present invention also relates to a method, in particular an in
vitro method for diagnosing HIV-2 infection, or determining HIV-2
viral load, in an individual, comprising the steps of: (a)
performing the method for detecting or quantifying Human
Immunodeficiency Virus-2 (HIV-2) nucleic acids in a biological
sample taken from the individual as defined above; (b) determining
therefrom whether the individual is infected by HIV-2 or the HIV-2
viral load of the individual.
The present invention also relates to a method, in particular an in
vitro method, for determining whether an individual is liable to
benefit from a treatment with antiretroviral therapy (ART) or from
an adjustment of ART, comprising performing the method for
diagnosing HIV-2 infection, or determining HIV-2 viral load, as
defined above.
The present invention also relates to nucleotide reverse
transcriptase inhibitors (NRTIs), Protease inhibitors (PIs) and/or
Integrase inhibitors for use in the prevention or treatment of
HIV-2 infection in an individual, wherein the individual has been
determined to be liable to benefit from a treatment with ART or
from an adjustment of ART as defined above.
The present invention also relates to a probe, in particular a
labelled probe, comprising or consisting of sequence SEQ ID NO: 3,
a sequence complementary to SEQ ID NO: 3, or a sequence having at
least 90% identity to SEQ ID NO: 3 or the complementary
thereof.
The present invention also relates to a kit or a mix for detecting
or quantifying HIV-2 nucleic acids, comprising: a) at least 2
primers respectively comprising or consisting of: sequence SEQ ID
NO: 1 or a sequence having at least 90% identity to SEQ ID NO: 1,
and sequence SEQ ID NO: 2 or a sequence having at least 90%
identity to SEQ ID NO: 2, and b) at least one labelled probes
comprising or consisting of: sequence SEQ ID NO: 3, a sequence
complementary to SEQ ID NO: 3, or a sequence having at least 90%
identity to SEQ ID NO: 3 or the complementary thereof, and c)
optionally additional reagents for performing PCR or RT-PCR.
The present invention further relates to the use of the
above-defined probe, kit or mix for detecting or quantifying HIV-2
nucleic acids of a biological sample.
DETAILED DESCRIPTION OF THE INVENTION
HIV-2 Nucleic Acids
Human Immunodeficiency Virus 2 (HIV-2) which infection may lead to
Acquired Immune Deficiency Syndrome (AIDS) is well known to one of
skill in the art. HIV-2 is a member of the genus Lentivirus, part
of the Retroviridae family. Its replication cycle involves entry of
HIV-2 single-stranded RNA into a cell, reverse transcription to
yield a single-stranded DNA and then a double-stranded DNA which is
integrated in the host cell genome. Accordingly, as intended
herein, HIV-2 nucleic acids relate to nucleic acids of any type
which harbour the HIV-2 genome in totality or in part. HIV-2
nucleic acids to be detected or quantified according to the
invention may thus be RNA, in particular single stranded RNA, or
DNA, in particular single stranded or double stranded DNA.
Preferably, the above-defined method, kit or mix, or use for
detecting or quantifying Human Immunodeficiency Virus-2 (HIV-2)
nucleic acids is for detecting or quantifying HIV-2 RNA.
Real-Time PCR or RT-PCR
Real-time Polymerase Chain Reaction (PCR) and Reverse Transcriptase
Polymerase Chain Reaction (RT-PCR) are well-known to one of skill
in the art and are also known as quantitative PCR (qPCR) and
quantitative RT-PCR (RT-qPCR).
According to the invention, real-time PCR will be conducted for
detecting or quantifying HIV-2 DNA while RT-PCR will be conducted
for detecting or quantifying HIV-2 RNA.
One of skill in the in art can readily determine from a real-time
PCR or RT-PCR whether HIV-2 nucleic acids are present, i.e. detect
them, and/or quantify HIV-2 nucleic acids. Typically, in real-time
PCR or RT-PCR, a signal, generally a fluorescent signal, which
intensity is a consequence of the accumulation of amplified DNA is
measured by the thermal cycler which runs the PCR or RT-PCR. If, in
the course of the PCR or RT-PCR, the intensity of the measured
signal, in particular the fluorescent signal, is higher than a
signal threshold, generally background signal intensity, it is
deduced that amplification has occurred, i.e. that HIV-2 nucleic
acids are present in the biological sample. Conversely, if no
signal intensity higher than background signal intensity is
measured in the course of PCR or RT-PCR, it is deduced that no
nucleic acids or a quantity of nucleic acid below detection level
is present in the biological sample. Besides, the cycle of the PCR
or RT-PCR at which the signal higher than background signal
intensity is measured is named the threshold cycle (CT). It is well
known to one of skill in the art that CT values are proportional to
the log.sub.10 of the starting amounts of nucleic acids in the
biological sample Accordingly, the quantity of nucleic acids
present, i.e. the nucleic acid load of the biological sample, can
be readily determined, if necessary by reference to a standard
curve.
Numerous real-time PCR and RT-PCR techniques, generally differing
in the signal generation system and the labelled probes used, can
be used according to the invention, such as the so-called Taqman or
Molecular Beacons assays. However it is preferred that the
real-time PCR or RT-PCR according to the invention is of the Taqman
type. Taqman type real-time PCR or RT-PCR is well known to one of
skill in the art and has been originally described in 1991 by
Holland et al. (1991) Proc. Natl. Acad. Sci. USA 88:7276-7280.
Briefly, TaqMan probes consist of a fluorophore covalently attached
to the 5'-end of an oligonucleotide probe and a quencher at the
3'-end. The probe is such that the quencher molecule quenches the
fluorescence emitted by the fluorophore when excited by a
thermocycler's light source via FRET (Fluorescence Resonance Energy
Transfer). Thus, as long as the fluorophore and the quencher are in
proximity, i.e. are attached to the probe, quenching inhibits any
fluorescence signals. Besides, TaqMan probes are designed such that
they anneal to a target within amplified DNA region. As the
thermostable polymerase used for performing PCR or RT-PCR extends
the primer and synthesizes the nascent strand, its 5' to 3'
exonuclease activity degrades the probe that has annealed to the
template. Degradation of the probe releases the fluorophore from it
and breaks the close proximity to the quencher, thus relieving the
quenching effect and allowing fluorescence of the fluorophore.
Hence, fluorescence detected in the quantitative PCR thermal cycler
is directly proportional to the fluorophore released and the amount
of DNA template present in the PCR.
Preferably, the real-time PCR or RT-PCR according to the invention
comprise the following thermocycling conditions: optionally 10 min
at 50.degree. C. for reverse transcription, followed by 5 min at
95.degree. C., followed by 50 cycles of 95.degree. C. for 15 s and
60.degree. C. for 1 min.
Advantageously, the above-defined thermocycling conditions are
similar to that used by the real-time RT-PCR generic HIV-1 RNA
assay described by Rouet et al. (2005) J. Clin. Microbiol.
43:2709-17 and commercialized by Biocentric, which is currently
used with success in many resource-limited countries. Accordingly,
the method for detecting or quantifying Human Immunodeficiency
Virus-2 (HIV-2) nucleic acids in a biological sample according to
the invention can be used on the same thermocycler, with the same
software program and even, if necessary, in the same amplification
plate, as biological samples intended for HIV-1 nucleic acid
detection or quantification.
Primers and Probes
As intended herein a primer is an oligonucleotide, preferably a DNA
oligonucleotide, useful to prime replication by a DNA polymerase,
in particular a thermostable DNA polymerase, or reverse
transcription by a reverse transcriptase. Preferably, primers
according to the invention comprise no more than 50 nucleotides,
more preferably no more than 40 nucleotides, and most preferably no
more than 30 nucleotides.
As intended herein a probe is an oligonucleotide, preferably a DNA
oligonucleotide, which can anneal to DNA molecules amplified as a
result of the PCR or the RT-PCR according to the invention.
Preferably, probes according to the invention comprise no more than
50 nucleotides, more preferably no more than 40 nucleotides, and
most preferably no more than 30 nucleotides. The labelled probe is
such that a detectable signal, preferably fluorescence, is emitted
and increases in intensity as a consequence of the accumulation of
amplified DNA molecules. More preferably the probes according to
the invention are labelled, in particular covalently labelled, by a
flurophore and by a quencher, the fluorophore-quencher pair being
such that the quencher quenches fluorescence emission by the
fluorophore. In this frame, it is preferred that the fluorophore is
attached at or near the 5' end of the probe and that the quencher
is attached at or near the 3' end of the probe. Numerous suitable
fluorophore-quencher pairs according to the invention can be
devised by one of skill in the art. By way of example, the
fluorophore-quencher pairs 6-carboxyfluorescein
(FAM)-carboxytetramethylrhodamine (TAMRA) and 6-carboxyfluorescein
(FAM)-Black Hole Quencher-1 (BHQ1) are suitable for the labelled
probes according to the invention. A particularly preferred
fluorophore-quencher pair according to the invention is
6-carboxyfluorescein (FAM)-Black Hole Quencher-1 (BHQ1). Besides it
is also preferred that the 2 labelled probes according to the
invention are labelled by a same fluorophore-quencher pair. Thus,
it is particularly preferred that the 2 labelled probes are
labelled with 6-carboxyfluorescein (FAM) at their 5'end and with
Black Hole Quencher-1 (BHQ1) at their 3' end.
As intended herein, where a primer or a probe according to the
invention is said to "comprise" a particular sequence, the primer
or the probe may also comprise additional sequences extending from
the 5' end and/or 3' end of the particular sequence. In contrast,
where a primer or a probe according to the invention "consists of"
a particular sequence, the primer or the probe does not comprise
supplementary sequences in addition to the particular sequence.
Preferably, the at least 4 primers according to the invention
respectively consist of sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 4 and SEQ ID NO: 5, and the 2 labelled probes according to
the invention respectively consist of sequences SEQ ID NO: 3 and
SEQ ID NO: 6.
As intended herein, a "sequence having at least 90% identity to SEQ
ID NO: X", in particular differs from SEQ ID NO: X by the
insertion, the suppression or the substitution of at least one
nucleotide. Besides, the percentage of identity between two
nucleotide sequences is defined herein as the number of positions
for which the bases are identical when the two sequences are
optimally aligned, divided by the total number of bases of the
longest of the two sequences. Two sequences are said to be
optimally aligned when the percentage of identity is maximal.
Besides, as will be clear to one of skill in the art, it may be
necessary to add gaps in order to obtain an optimal alignment
between the two sequences.
Preferably, a sequence according to the invention having at least
90% identity to SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7 has respectively
at least 95%, more preferably at least 98% identity with SEQ ID NO:
1, 2, 3, 4, 5, 6 or 7.
The primers according to the invention comprising sequences SEQ ID
NO: 1 and SEQ ID NO: 2 or sequences having at least 90% identity to
SEQ ID NO: 1 and SEQ ID NO: 2 and the probe comprising or
consisting of sequence SEQ ID NO: 3, a sequence complementary to
SEQ ID NO: 3, or a sequence having at least 90% identity to SEQ ID
NO: 3 or the complementary thereof, are useful to detect a portion
of the LTR region of HIV-2 genome.
The primers according to the invention comprising sequences SEQ ID
NO: 4 and SEQ ID NO: 5 or sequences having at least 90% identity to
SEQ ID NO: 4 and SEQ ID NO: 5 and the probe comprising or
consisting of sequence SEQ ID NO: 6, a sequence complementary to
SEQ ID NO: 6, or a sequence having at least 90% identity to SEQ ID
NO: 6 or the complementary thereof, are useful to detect a portion
of the Gag region of HIV-2 genome.
The primer according to the invention comprising or consisting of
sequence SEQ ID NO: 7 or a sequence having at least 90% identity to
SEQ ID NO: 7 is useful to improve the detection and quantification
of subtype B HIV-2 nucleic acids.
As will be clear to one of skill in the art and by way of example,
the sequence complementary to a sequence 5' TAGGTTACGGCCCGGCGGAAAGA
3' (SEQ ID NO: 6) is 5' TCTTTCCGCCGGGCCGTAACCTA 3' (SEQ ID NO:
.9)
Besides, as will also be clear to one of skill in the art SEQ ID
NO: 3 (CTTGGCCGGYRCTGGGCAGA) is a so-called degenerated sequence
wherein Y represents C and T, and R represents A and G.
Advantageously, the use of primers and probes according to the
invention in real-time PCR and RT-PCR (i) provide for the specific
detection and quantification of HIV-2 nucleic acids over HIV-1
nucleic acids, (ii) lower the detection and quantification limit of
the prior art assays, and (iii) provide for an improved detection
and quantification of subtype B HIV-2 nucleic acids.
Biological Sample
As intended herein a "biological sample" relates to any sample
taken from a human individual liable to contain HIV-2 nucleic
acids, such as a blood sample, a plasma sample, or a seminal
sample. As will be clear to one of skill in the art the biological
sample may have been treated after having been taken from the
individual and before being submitted to a real-time PCR or RT-PCR
according to the invention. Such treatments notably encompass
centrifugation, treatment by an anticoagulant, such as EDTA, or
nucleic acid concentration, purification or extraction. Thus, by
way of example, a biological sample according to the invention may
be a nucleic acid solution extracted from a sample, such as plasma
sample, taken from a human individual.
Kit and Mix
As intended herein in a "kit" according to the invention, one or
more of the components of the kit may be packaged or compartmented
separately from the rest of the components.
As intended herein in a "mix" according to the invention, all the
components of the mix are in a single compartment. Preferably, the
mix according to the invention is a PCR mix or a RT-PCR mix.
Additional reagents to the primers and probes according to the
invention can be easily devised by one of skill in the art and
notably encompass a thermostable DNA polymerase, a reverse
transcriptase, dNTPs, salts, in particular Mn.sup.2+ and Mg.sup.2+
salts, and buffers.
The present invention will be further described by the following
non-limiting figures and example.
DESCRIPTION OF THE FIGURES
FIG. 1
FIG. 1 represents the standard curve of the HIV-2 RNA real-time
viral load assay according to the invention. The cycle threshold
(CT) (vertical axis) is the number of cycles at which fluorescence
passes a fixed limit (time to positivity) and the input log.sub.10
HIV-2 copy equivalents/ml (horizontal axis) represents the
standardization viral load present in the sample submitted to
real-time RT-PCR. Median values and 25% and 75% interquartile
ranges (box plot) of the CT are indicated. The vertical lines show
the ranges of the CT.
FIG. 2
FIG. 2 is a scatter diagram of the HIV-2 RNA load (expressed as
log.sub.10 copies/ml) as determined by the assay according to the
invention (vertical axis) vs. as determined by the prior art assay
(horizontal axis), according to the genetic group (A, B, H or non
genotypable (NA)) of the 78 detectable (0 to <40 cp/mL) or
quantifiable samples (r2=0.8812). An arbitrary value of 10 cp/ml
was attributed to samples undetectable in the current assay, and 20
cp/ml to those detectable in the new assay (0 to <40 cp/mL).
FIGS. 3 and 4
FIGS. 3 and 4 represent Bland and Altman curves for measuring the
degree of agreement in log.sub.10 cp/ml between the assay according
to the invention and the prior art assay; for group A (N=32) (FIG.
3) and group B (N=39) (FIG. 4) samples detectable (0 to 40 cp/mL)
and quantifiable (>40 cp/mL) with the assay according to the
invention. An arbitrary value of 10 cp/ml was attributed to samples
undetectable with the prior art assay, and 20 cp/ml to those
detectable with the assay according to the invention (between 0 and
40 cp/ml).
EXAMPLE
Materials and Methods
HIV-2 RNA Assay According to the Invention
The test is based on a one-step duplex Taqman PCR approach
targeting a conserved consensus region in the long terminal repeat
(LTR) region and the Gag region.
The forward and reverse primers for the LTR region are
5'-TCTTTAAGCAAGCAAGCGTGG-3' (SEQ ID NO: 1) and
5'-AGCAGGTAGAGCCTGGGTGTT-3' (SEQ ID NO: 2), respectively (Rouet et
al. (2004) J. Clin. Microbiol. 42:4147-53), with an internal probe
(5' FAM-CTTGGCCGGYRCTGGGCAGA-BHQ1 3', SEQ ID NO: 3) modified to
optimize efficiency for HIV-2 group B.
The forward and reverse primers for the Gag region are F3
5'-GCGCGAGAAACTCCGTCTTG-3' (SEQ ID NO: 4) and R1
5'-TTCGCTGCCCACACAATATGTT-3' (SEQ ID NO: 5), respectively (Damond
et al. (2005) J. Clin. Microbiol. 43:4234-6), and the internal
HIV-2 Taqman gag probe is S65GAG2 5'
FAM-TAGGTTACGGCCCGGCGGAAAGA-BHQ1 3' (SEQ ID NO:6) (Eurogentec,
Seraing, Belgium) (Damond et al. (2005) J. Clin. Microbiol.
43:4234-6).
TABLE-US-00001 TABLE 1 Primers and probes used for RT-PCR analysis
Primers & Probes LTR Gag Forward 5'-TCTTTAAGCAAGCAAGCGTGG-3'
5'-GCGCGAGAAACTCCGTCTTG-3' primer (SEQ ID NO: 1) (SEQ ID NO: 4)
Reverse 5'-AGCAGGTAGAGCCTGGGTGTT-3' 5'-TTCGCTGCCCACACAATATGTT-3'
primer (SEQ ID NO: 2) (SEQ ID NO: 5) Probe
5'-CTTGGCCGGYRCTGGGCAGA-3' 5'-TAGGTTACGGCCCGGCGGAAAGA-3' (SEQ ID
NO: 3) (SEQ ID NO: 6)
RNA was extracted from 200 .mu.l of plasma by using the QIAamp
viral RNA mini kit (Qiagen, Courtaboeuf, France), as in the
Biocentric generic HIV-1 charge virale assay, in laboratories A and
B (Necker Hospital, Paris, and Charles Nicolle Hospital, Rouen) or
from 1 ml with the Total NA large volume Magna Pure kit (Roche
Automated System, Meylan, France) in laboratory C (Bichat Claude
Bernard Hospital, Paris).
The reaction mix consists of a 20-.mu.L volume containing the RNA
extract (10 .mu.L), primers (500 nM each), probes (250 nM each),
and 1.times.PCR buffer (4X One-step mix, Invitrogen, Cergy
Pontoise, France).
The thermocycling conditions are those used for the Biocentric
HIV-1 assay: 10 min at 50.degree. C. and 5 min at 95.degree. C.,
followed by 50 cycles of 95.degree. C. for 15 s and 60.degree. C.
for 1 min. Amplification and data acquisition are carried out with
the TaqMan ABI realtime PCR system (Applied Biosystems,
Courtaboeuf, France). The log.sub.10 number of targets initially
present is proportional to the cycle threshold (CT) and is
determined from the standard curve.
A BIOQ HIV-2 RNA group A quantification panel (P0182; Rijswijk, The
Netherlands) was used as the external standard. The standard,
evaluated at 2.93.times.10.sup.6 cp/ml, was first diluted in RPMI
culture medium to a theoretical concentration of 1 000 000 cp/ml (2
400 000 IU/ml), followed by serial 10-fold dilution to
concentrations ranging from 1 000 000 (5 log.sub.10) to 100 cp/ml
(2 log.sub.10), and a final dilution to 40 cp/ml (1.6
log.sub.10).
Determination of the Analytic Performance of the Assay According to
the Invention
Specificity was determined by testing plasma samples from 49
HIV-negative subjects and 30 HIV-1 group M-positive patients with
viral loads ranging from >20 to <10 000 000 cp/mL. Nine HIV-1
group O coculture supernatants were also tested.
Linearity was assessed using the BIOQ external standard diluted in
RPMI to 1 000 000, 100 000, 10 000, 1000, 100 and 40 cp/ml (each
tested in 10 runs at Lab A).
Analytical sensitivity was determined by dilution in RPMI of the
BIOQ external standard to 100, 50, 40, 20 and 10 cp/mL (10
replicates each).
To determine within-run reproducibility, the BIOQ external standard
was tested at concentrations of 10 000 and 100 cp/mL in each of the
three laboratories (10 replicates for each dilution).
To determine between-run reproducibility, an HIV-2 positive control
was prepared by serial dilution in HIV-negative EDTA human plasma
of a coculture supernatant of an H1V-2 group A isolate (Genbank
accession number AY688870, SEQ ID NO: 8). This solution was diluted
to obtain aliquots with theoretical concentrations ranging from 10
000 to 100 000 cp/mL in the current assay. These aliquots were each
tested once in 7 separate runs with the Magna pure automated
extraction system (Lab C) and in respectively 18 and 7 separate
runs with Qiagen manual extraction at Lab A and Lab B.
Statistical Analysis
MedCalc software (Ostend, Belgium) was used for data analysis.
Bland and Altman curves were used to represent the degree of
agreement between the two techniques (Bland & Altman (1986)
Lancet 1:307-10). The X-axis bore the mean values for each sample
obtained with the two techniques, and the Y-axis the difference
between the values obtained with the two techniques.
Disagreement between the two techniques was defined as a difference
of more than 0.5 log.sub.10 for a given sample.
Clinical Samples
One hundred plasma samples from HIV-2-infected patients (n=100)
included in the French National HIV-2 Cohort (ANRS CO05) were
selected according to the viral genotype and the HIV-2 RNA
concentration, as determined with the technique described in Damond
et al. (2005) J. Clin. Microbiol. 43:4234-6. The HIV-2 group was
determined for 89 samples, as previously described (Damond et al.
(2004) AIDS Res Hum Retroviruses 20:666-672 and Plantier et al.
(2004) J. Clin. Microbiol. 42:5866-70): 38 samples were group A, 50
group B, and one group H. Genotyping was not available for the
remaining 11 samples, owing to the absence of detectable RNA and a
lack of whole blood or mononuclear cells for viral DNA assay.
The selected samples had the following characteristics: <100 (2
log.sub.10) cp/ml (n=39, 9 group A and 19 group B, 11 non
genotypable), 100 (2 log.sub.10)-1000 (3 log.sub.10) cp/ml (n=16, 5
A and 11 B), 1000 (3 log.sub.10)-10 000 (4 log.sub.10) (n=22, 12 A
and 10 B), 10 000 (4 log.sub.10)-100 000 (5 log.sub.10) (n=19, 11
A, 7 B and 1 H) and >100 000 (5 log.sub.10) (n=4, 1 A and
3B).
Results
Analytic Performances of the Assay According to the Invention
As expected, given the wide genomic divergence between HIV-1 and
HIV-2, the HIV-2 primers did not hybridize to HIV-1 genes: all
HIV-1-positive plasma samples and all HIV-negative samples were
negative in the new assay, giving a specificity of 100%.
The standard curve showed a strong linear relationship between the
CT values and log.sub.10 HIV-2 RNA cp/mL (FIG. 1). The median
correlation coefficient was 0.9947 (range, 0.9831 to 0.9997), and
the median slope was -3.37 (range, -3.16 to -3.62).
The analytical sensitivity of the assay was 100% at 40 cp/ml (1.6
log.sub.10 cp/mL) and 90% at 20 cp/mL (1.3 log.sub.10 cp/mL) after
Roche Magna pure automated extraction of 1 mL, and 100% at 50 cp/mL
(1.7 log.sub.10 cp/mL) after manual extraction of 200 .mu.L.
Optimization of the assay sensitivity after manual extraction was
evaluated using 1 mL of plasma: the sample was centrifuged at 17
000 rpm and the pellet was resuspended in 200 .mu.L of RPMI medium
prior to manual extraction, with elution in 60 .mu.L. This yielded
90% sensitivity at 10 cp/mL (1 log.sub.10 cp/mL).
Within-run reproducibility was evaluated in the three labs by using
the BIOQ external standard with theoretical virus concentrations of
10 000 and 100 cp/mL (4 and 2 log.sub.10 cp/mL): for the 4
log.sub.10 cp/mL value we obtained a mean of 3.91 log.sub.10 cp/mL
at Lab C, 4.1 log.sub.10 cp/mL at Lab A and 4.2 log.sub.10 cp/mL at
Lab B, with within-run coefficients of variation of 1.61%, 0.54%
and 1.10%, respectively. At the concentration of 2 log.sub.10
cp/mL, the inventors obtained mean values of 2.03 log.sub.10 cp/mL
at Lab B, 2.07 log.sub.10 cp/mL at Lab A, and 2.17 log.sub.10 cp/mL
at Lab C, with within-run coefficients of variation of 10.72%,
14.32% and 7.24%, respectively.
In between-run assays, the positive control with a theoretical
concentration between 10 000 (4 log.sub.10) and 100 000 cp/mL (5
log.sub.10) was evaluated at 4.61 log.sub.10 cp/mL in Lab C, 4.70
log.sub.10 cp/mL in Lab A, and 4.88 log.sub.10 cp/mL in Lab B, with
coefficients of variation of 2.28%, 6.43% and 3.03%,
respectively.
Clinical Performances
The clinical performances of the new assay were evaluated in Lab C.
Clinical samples of 1 ml were extracted with the automated
MagnaPure method then tested in parallel with the ABI device for
the assay according to the invention and the Light Cycler 1.5
device for the prior art assay described by Damond et al. (2005) J.
Clin. Microbiol. 43:4234-6. The results obtained with the assay
according to the invention were categorized into four groups (Table
2): undetectable (<40 cp/mL), detectable but not quantifiable (0
to <40 cp/mL), quantifiable between 40 and 100 cp/mL, and above
the lower limit of quantification of the current assay (100
cp/mL).
Of the 39 samples below the quantification limit of 100 cp/mL in
the current assay, 22 samples (56%) were also undetectable with the
assay according to the invention (Table 2), while 10 samples (26%;
3 A, 3 B and 4 non genotypable) were detected at values between 0
and 40 cp/mL (range: 1 to 36 cp/mL). Three samples (7.7%; 1 B, 2
non genotypable) were quantified between 40 and 100 cp/mL (range:
56 to 79 cp/mL), and four samples (10%; all B) were quantified
above 100 cp/mL (range: 102 to 970 cp/mL); the latter corresponded
to true false-negative samples, taking into account the 100 cp/mL
cut-off of the current assay.
These results showed that the test improved the detection or
quantification of 17/39 samples (43.6%), including eight group B
samples (Table 1).
All 61 plasma samples with values above 100 cp/mL in the prior art
assay were detectable with the test according to the invention. One
sample at 209 cp/mL (2.32 log.sub.10 cp/ml) in the current assay
gave a value of 46 cp/mL (1.69 log.sub.10 cp/ml) in the test
according to the invention (Table 1).
A scatter plot was constructed for the 78 samples that were
detectable or quantifiable with the assay according to the
invention and quantifiable with the prior art assay (FIG. 2). It
showed a wider dispersion of values for quantifiable group B
samples than for quantifiable group A samples, as well as better
detection or quantification of group B and non genotypable samples.
This was confirmed by scatter equations specific for group A
samples (n=32; y=0.8921x+0.2545, r2=03569) and group B samples
(n=39; y=0.7136x+1.0484, r2=0.8067), and also by Bland-Altman
representations (FIG. 3). Homogeneous quantification (+/-1.96 SD,
range from -0.35 to 0.6) and similar values (median difference of
-0.13) were obtained with the assay according to the invention and
the prior art assay for group A samples. The median difference
between the two assays for group B samples was +0.18, but with
greater heterogeneity (+/-136 SD, range -1.33 to 0.98).
The only HIV-2 group H sample gave very similar results with the
two assays (4.33 log.sub.10 and 4.34 login).
CONCLUSION
HIV-2 infection differs markedly from HIV-1 infection, notably by
its slower natural course, different therapeutic management, and
genetic diversity. Specific molecular methods are therefore
necessary for diagnosis and patient monitoring. Current assays,
mainly consisting of in-house methods or unvalidated derivatives of
commercial kits, suffer from major limitations in terms of their
sensitivity, accuracy, and coverage of HIV-2 genetic diversity.
The aim of this work was to develop a quantitative assay that takes
into account both the low viral load seen in most HIV-2-infected
patients and the broad genetic diversity of HIV-2, especially group
B. In addition, as most cases of HIV-2 infection occur in West
Africa, such a test must be affordable and easy to implement in
developing countries, as previously achieved with the generic HIV-1
viral load assay marketed by Biocentric.
The inventors improved the assay currently used to monitor the
French HIV-2 cohort, which is based on amplification of the HIV-2
Gag region and has a lower limit of quantification of 100 cp/ml
(Damond et al. (2005) J. Clin. Microbiol. 43:4234-6). The inventors
also used the same operating conditions as those of the Biocentric
HIV-1 assay kit, in order to facilitate its use either for HIV-2
alone or jointly for HIV-1 and HIV-2.
The new test exhibits good linearity (40 to 1 000 000 cp/ml) and
within-run reproducibility (<15%). Its inter-laboratory
reproducibility was validated by evaluation at three different
sites. Both manual and automated extraction methods were validated,
for compatibility with local practices in resource-limited
countries.
Relative to the prior art assay of Damond et al. (2005) J. Clin.
Microbiol. 43:4234-6, the test according to the invention has a
significantly better analytical limit of quantification, reaching
50 cp/ml with manual extraction of 200 .mu.l of plasma and 40 cp/ml
with automated extraction of 1 mL. Assuming a probit rate of 90%,
the detection limit with 1 ml of plasma would be 10 cp/ml and 20
cp/ml, respectively. This very good analytical sensitivity matches
that of recently published in-house methods (5, 11, 29) and is
compatible with virological monitoring of HIV-2 infection, as more
than 60% of untreated patients have viral loads below 250 cp/ml.
The new test was able to detect and/or quantify more than one-third
of samples that were undetectable with our current assay, which has
a quantification limit of 100 cp/ml. This excellent sensitivity
should prove useful both for pathophysiological studies and for
treatment monitoring.
The most difficult issue facing the development of HIV-2 viral load
assays is the genetic diversity of this virus (especially group B),
some variants being under-quantified or escaping detection with
current tests. Three teams recently reported improved sensitivity
for HIV-2, but they mainly used supernatants (Delarue et al. (2013)
J. Clin. Virol. 58:461-7) or a limited number of samples (Chang et
al. (2012) J. Clin. Virol. 55:128-33, Styer et al. (2013) J. Clin.
Virol. 58 Suppl 1:e127-33) or validated detection but not
quantification (Styer et al. (2013) J. Clin. Virol. 58 Suppl
1:e127-33), leaving questions as to their clinical performance,
especially for group B viruses.
The inventors evaluated the assay according to the invention on 100
clinical samples, 39% of which were undetectable with the
comparative prior art assay described in Damond et al. (2005) J.
Clin. Microbiol. 43:4234-6, representative of the molecular
epidemiology of groups A and B, plus the only one divergent sample
of group H. Half the samples corresponded to group B, and more than
one-third of them (n=19) were undetectable with the comparative
prior art assay. The inventors developed a duplex method capable of
simultaneously amplifying the LTR and Gag regions, which
unexpectedly resulted in a synergic improvement of the detection of
group B viruses by reducing the risk of mismatches. The new and
current HIV-2 assay methods gave similar results for the single
group H sample and for the group A samples (although 3 additional
group A samples were detectable with the new test), whereas the new
test developed by Delarue et al gave values nearly 0.5 log.sub.10
lower than their reference test (Delarue et al. (2013) J. Clin.
Virol. 58:461-7). Eight additional group B samples (42%) were
detected or quantified with our new test, four samples having
values of 102 to 970 cp/mL. This unexpected improvement is due to
the addition of primers in the LTR region and to changes in the LTR
probe. However, the wider dispersion of values and the larger
number of group B than group A samples with differences exceeding
0.5 log.sub.10 relative to the current assay illustrate the greater
difficulty of group B quantification. In addition, six
non-genotypable samples were better detected or quantified with our
new assay.
Advantageously, the test according to the invention can be used in
the same operating conditions as the generic HIV-1 RNA assay
currently used with success in many resource-limited countries
(Rouet et al. (2005) J. Clin. Microbiol. 43:2709-17) meaning it can
be used on the same machine, with the same software program and
even, if necessary, in the same amplification plate, as HIV-1
samples. This will reduce analytical costs by increasing the number
of samples per run.
The assay according to the invention has analytical performances at
least equal to that of other newly developed tests (Chang et al.
(2012) J. Clin. Virol. 55:128-33, Delarue et al. (2013) J. Clin.
Virol. 58:461-7 and Styer et al. (2013) J. Clin. Virol. 58 Suppl
1:e127-33) as the performances of these tests have not been as
thoroughly evaluated as the test according to the invention. Thus
the test described by Chang et al., adapted from the Abbott
platform (Abbott Molecular, Chicago, Ill.), was evaluated on few
group B samples and was not compared with other techniques. Styer
et al. recently compared their method with this "Abbott" technique
and observed a difference of -0.35 log10 Ul/mL, but they used a
limited panel of uncharacterized samples, ruling out any evaluation
of in terms of genetic diversity. Finally, Styer et al. and Delarue
et al. used a two-step method, whereas the assay according to the
invention is performed in a single step.
In conclusion, the inventors have developed and standardized an
assay with better analytical sensitivity than the technique
currently used to monitor HIV-2-infected patients in France. The
assay according to the invention also has improved clinical
sensitivity and has been validated on a broad, well-characterized
sample panel, in contrast to recently published tests. The
analytical performance of this new assay, which is easy to perform,
makes it suitable for use in resource-limited countries in which
multiple HIV-2 variants circulate. In addition, the assay according
to the invention can be used on the same analytical platforms and
in the same run as tests for HIV-1, thus improving its
cost-efficiency for monitorHing patients infected with HIV-1 and/or
HIV-2. This possibility of simultaneous analysis will facilitate
molecular diagnosis of mother-to-child transmission of HIV-1 and/or
HIV-2, and also diagnosis and follow-up of dual HIV-1/HIV-2
infection in the same sample. Finally, use of this assay for
virological monitoring will provide new insights into the natural
history of HIV-2 infection at different clinical stages.
SEQUENCE LISTINGS
1
9121DNAArtificialPCR primer 1tctttaagca agcaagcgtg g
21221DNAArtificialPCR primer 2agcaggtaga gcctgggtgt t
21320DNAArtificialProbe 3cttggccggy rctgggcaga
20420DNAArtificialPCR primer 4gcgcgagaaa ctccgtcttg
20522DNAArtificialPCR primer 5ttcgctgccc acacaatatg tt
22623DNAArtificialProbe 6taggttacgg cccggcggaa aga
23723DNAArtificialPCR primer 7tccaacaggc tctctgctaa tcc
238297DNAHuman immunodeficiency virus type 2 8cctcaattct ctctttggag
gagaccagta gtcwcagcac acattgaggg ccagccagta 60gaagttttac tagatacagg
ggccgacgac tcaatagtag caggggtaga gttaggaagc 120aattatagtc
caaaaatagt agggggaata gggggattca taaataccaa agaatataag
180gatgtagaga taaaagtact aaataaaaca gtaagggcca ctataatgac
aggtgaaacc 240ccaatcaaca tttttggcag aaacattttg acagcattag
gcatgtcatt aaatcta 297923DNAArtificialProbe 9tctttccgcc gggccgtaac
cta 23
* * * * *