U.S. patent number 10,385,340 [Application Number 14/937,439] was granted by the patent office on 2019-08-20 for autoimmune disease treatments.
This patent grant is currently assigned to LA JOLLA INSTITUTE FOR ALLERGY AND IMMUNOLOGY. The grantee listed for this patent is La Jolla Institute For Allergy and Immunology. Invention is credited to Nunzio Bottini, Stephanie Stanford.
![](/patent/grant/10385340/US10385340-20190820-D00001.png)
![](/patent/grant/10385340/US10385340-20190820-D00002.png)
![](/patent/grant/10385340/US10385340-20190820-D00003.png)
![](/patent/grant/10385340/US10385340-20190820-D00004.png)
![](/patent/grant/10385340/US10385340-20190820-D00005.png)
![](/patent/grant/10385340/US10385340-20190820-D00006.png)
![](/patent/grant/10385340/US10385340-20190820-D00007.png)
![](/patent/grant/10385340/US10385340-20190820-D00008.png)
![](/patent/grant/10385340/US10385340-20190820-D00009.png)
United States Patent |
10,385,340 |
Bottini , et al. |
August 20, 2019 |
Autoimmune disease treatments
Abstract
There are provided, inter alia, methods and compositions to
treat autoimmune disease including invasiveness of fibroblast-like
synoviocytes in rheumatoid arthritis.
Inventors: |
Bottini; Nunzio (San Diego,
CA), Stanford; Stephanie (La Jolla, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
La Jolla Institute For Allergy and Immunology |
La Jolla |
CA |
US |
|
|
Assignee: |
LA JOLLA INSTITUTE FOR ALLERGY AND
IMMUNOLOGY (La Jolla, CA)
|
Family
ID: |
51867779 |
Appl.
No.: |
14/937,439 |
Filed: |
November 10, 2015 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20160122768 A1 |
May 5, 2016 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
PCT/US2014/037539 |
May 9, 2014 |
|
|
|
|
61822155 |
May 10, 2013 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K
16/40 (20130101); A61K 38/00 (20130101); C12Y
301/03048 (20130101); A61P 19/02 (20180101); C12N
15/1137 (20130101); A61P 19/00 (20180101); C12N
2310/11 (20130101); C12N 2310/14 (20130101) |
Current International
Class: |
C12N
15/113 (20100101); A61K 38/00 (20060101); C07K
16/40 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO-94/24161 |
|
Oct 1994 |
|
WO |
|
WO-2012/120269 |
|
Sep 2012 |
|
WO |
|
Other References
Scott et al. (Lancet (2010) 376(9746):1094-1108). (Year: 2010).
cited by examiner .
Stanford et al. (Ann Rheum Dis (2016) 75(1):295-302). (Year: 2016).
cited by examiner .
Asano, A. et al. (Nov. 2007, e-published Oct. 2, 2007). "A deletion
mutation of the protein tyrosine phosphatase kappa (Ptprk) gene is
responsible for T-helper immunodeficiency (thid) in the LEC rat,"
Mamm Genome 18(11):779-786. cited by applicant .
Bottini, N. et al. (Jan. 2013, e-published Nov. 13, 2012). "Duality
of fibroblast-like synoviocytes in RA: passive responders and
imprinted aggressors," Nat Rev Rheumatol 9(1):24-33. cited by
applicant .
GenBank Accession No. NM_001135648.1 (Apr. 17, 2013), 7 pages.
cited by applicant .
GenBank Accession No. NM_001135648.2 (Apr. 17, 2013), 7 pages.
cited by applicant .
GenBank Accession No. NM_002844.3 (Apr. 17, 2013), 7 pages. cited
by applicant .
International Search Report dated Sep. 24, 2014, for PCT
Application No. PCT/US2014/037539, filed May 9, 2014, 5 pages.
cited by applicant .
Jiang, Y.P. et al. (May 1993). "Cloning and characterization of
R-PTP-kappa, a new member of the receptor protein tyrosine
phosphatase family with a proteolytically cleaved cellular adhesion
molecule-like extracellular region," Mol Cell Biol 13(5):2942-2951.
cited by applicant .
Novellino, L. et al. (May 2008, e-published Jan. 12, 2008). "PTPRK
negatively regulates transcriptional activity of wild type and
mutated oncogenic beta-catenin and affects membrane distribution of
beta-catenin/E-cadherin complexes in cancer cells," Cell Signal
20(5):872-883. cited by applicant .
Pohlers, D. et al. (2007). "Constitutive upregulation of the
transforming growth factor-beta pathway in rheumatoid arthritis
synovial fibroblasts," Arthritis Res Ther 9(3):R59. cited by
applicant .
Stanford, S.M. et al. (May 2013). "Protein tyrosine phosphatase
expression profile of rheumatoid arthritis fibroblast-like
synoviocytes: a novel role of SH2 domain-containing phosphatase 2
as a modulator of invasion and survival," Arthritis Rheum
65(5):1171-1180. cited by applicant .
Wang, S.E. et al. (Jun. 2005). "Transforming growth factor {beta}
(TGF-{beta})-Smad target gene protein tyrosine phosphatase receptor
type kappa is required for TGF-{beta} function," Mol Cell Biol
25(11):4703-4715. cited by applicant .
Written Opinion dated Sep. 24, 2014, for PCT Application No.
PCT/US2014/037539, filed May 9, 2014, 7 pages. cited by
applicant.
|
Primary Examiner: Angell; J. E.
Attorney, Agent or Firm: Mintz, Levin, Cohn, Ferris, Glovsky
and Popeo, P.C.
Parent Case Text
CROSS-REFERENCES TO RELATED APPLICATIONS
This application is a continuation of International Application No.
PCT/US2014/037539, filed May 9, 2014, which claims the benefit of
U.S. Provisional Application No. 61/822,155, filed May 10, 2013,
the content of each of which is incorporated herein by reference in
its entirety and for all purposes.
Claims
What is claimed is:
1. A method of decreasing inflammation in a synovium of a subject
in need thereof, the method comprising administering to the subject
an effective amount of a PTPRK antagonist, wherein the PTPRK
antagonist is an anti-PTPRK inhibitory nucleic acid capable of
inhibiting PTPRK expression and wherein the PTPRK antagonist is
delivered by contacting a fibroblast-like synoviocyte in the
subject.
2. The method of claim 1, wherein said subject comprises
fibroblast-like synoviocytes that express high levels of PTPRK
relative to a standard control.
3. The method of claim 2, wherein said subject has rheumatoid
arthritis.
4. The method of claim 1 wherein said anti-PTPRK inhibitory nucleic
acid has at least 90% sequence identity to an at least 10
nucleotide contiguous sequence of SEQ ID NO:1, SEQ ID NO:2 or a
complementary sequence thereof.
5. The method of claim 1, further comprising treating an autoimmune
disease in said subject.
6. The method of claim 5, wherein said autoimmune disease is a
fibroblast mediated disease, arthritis, rheumatoid arthritis,
psoriatic arthritis, juvenile idiopathic arthritis, multiple
sclerosis, systemic lupus erythematosus (SLE), myasthenia gravis,
juvenile onset diabetes, diabetes mellitus type 1, Guillain-Barre
syndrome, Hashimoto's encephalitis, Hashimoto's thyroiditis,
ankylosing spondylitis, psoriasis, Sjogren's syndrome, vasculitis,
glomerulonephritis, auto-immune thyroiditis, Behcet's disease,
Crohn's disease, ulcerative colitis, bullous pemphigoid,
sarcoidosis, psoriasis, ichthyosis, Graves ophthalmopathy,
inflammatory bowel disease, Addison's disease, Vitiligo, asthma,
scleroderma, systemic sclerosis, or allergic asthma.
7. The method of claim 2, wherein said PTPRK antagonist decreases
TNF activity, IL-1 activity or PDGF activity in said
fibroblast-like synoviocyte.
Description
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII FILE
The Sequence Listing written in file 48513-505C01US_ST25.TXT,
created Nov. 4, 2015, 17,270 bytes, machine format IBM-PC,
MS-Windows operating system, is hereby incorporated herein by
reference in its entirety and for all purposes.
BACKGROUND OF THE INVENTION
Invasiveness is a pathogenic phenotype of fibroblast-like
synoviocytes (FLS) in rheumatoid arthritis (RA). See e.g., Noss, E.
H., and Brenner, M. B., 2008. Immunological reviews, 223:252-270;
Bottini, N., & Firestein, G. S. 2013. Nat Rev Rheumatol,
9:24-33). FLS secrete components of synovial fluid and provide
structural and dynamic support to the joint. In rheumatoid
arthritis (RA) however, FLS assume intrinsic invasive features, and
mediate destruction of cartilage and bone. For example, FLS are an
abundant source of IL-6 in the joints of subjects suffering RA. FLS
obtained from patients with RA and cultured ex vivo or implanted
into immunodeficient mice display increased invasiveness compared
to FLS from healthy subjects or patients with osteoarthritis (OA).
See e.g., Bottini, N., & Firestein, G. S. 2013. Id. Targeting
of FLS is being considered as an option for development of new
therapies for RA. See e.g., Noss, E. H., and Brenner, M. B., 2008,
Id.
Key proteins expressed by FLS include surface proteins, e.g.,
integrins, ICAM-1, VCAM-1, Cadherin-11, CD55, and CD90,
intracellular proteins, e.g., vimentin, 6PGL, and collagen
proteins, e.g., Type IV collagen and Type V collagen, as known in
the art.
FLS behavior is controlled by a network of intracellular signaling
pathways, many of which rely upon reversible phosphorylation of
proteins on tyrosine residues. See e.g., Bottini, N., and
Firestein, G. S. 2013, Id. Tyrosine phosphorylation results from
the balanced action of protein tyrosine kinases (PTKs), which
catalyze addition of phosphates on tyrosine residues, and
phosphatases (PTPs), which counter that action by tyrosine
dephosphorylation. At least 50 PTPs are expressed in FLS (Stanford,
S. M. et al., 2013. Arthritis Rheum, 65:1171-1180), however little
is known about the involvement of PTPs in FLS functions. To
identify signaling mediators involved in promoting the unique
aggressive phenotype of RA FLS, we explored the role of a PTP
overexpressed in RA compared to OA FLS, PTPRK (receptor
tyrosine-protein phosphatase kappa).
There are provided herein, inter alia, methods and compositions for
treatment of autoimmune disease including invasiveness of FLS in
RA.
BRIEF SUMMARY OF THE INVENTION
In a first aspect, there is provided a method of treating an
autoimmune disease in a subject in need thereof, the method
including administering to the subject an effective amount of a
PTPRK antagonist.
In another aspect, there is provided a method of decreasing
inflammation in a synovium of a subject in need thereof, the method
including administering to the subject an effective amount of a
PTPRK antagonist.
In another aspect, there is provided a method of decreasing
expression of PTPRK in a fibroblast-like synoviocyte, the method
including contacting said fibroblast-like synoviocyte with an
effective amount of a PTPRK antagonist.
In another aspect, there is provided a decreasing TNF activity,
IL-1 activity or PDGF activity in a fibroblast-like synoviocyte,
the method including contacting the fibroblast-like synoviocyte
with an effective amount of a PTPRK antagonist.
In another aspect, there is provided a method of decreasing
invasiveness or migration of a fibroblast-like synoviocyte, the
method including contacting the fibroblast-like synoviocyte with an
effective amount of a PTPRK antagonist.
In another aspect, there is provided a pharmaceutical composition
including a PTPRK antagonist and a pharmaceutically acceptable
excipient.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1F. TGF.beta.1-responsive PTPRK is required for RA FLS
invasiveness. FIG. 1A: Histogram depicts results of PTPRK mRNA
expression in FLS measured by qPCR. Median.+-.interquartile range
(IQR) is shown. *, p<0.05, Mann-Whitney test. Legend (left to
right) OA FLS (n=12); RA FLS (n=13). FIG. 1B: Western blotting of
lysates from 3 RA and 3 OA FLS lines. FIG. 1C: Following treatment
with control (Ctl) or PTPRK ASO for 7 d, RA FLS invaded through
Matrigel-coated transwell chambers in response to 50 ng/ml PDGF-BB
for 24 hr. Graph shows median.+-.IQR % maximum number of cells per
field. *, p<0.05, Mann-Whitney test. Data from 4 independent
experiments in different FLS lines is shown. FIG. 1D: ASO-treated
RA FLS migrated through uncoated transwell chambers in response to
5% FBS for 24 hr. Graph shows median.+-.IQR % maximum number of
cells per field. Data from 5 independent experiments in different
FLS lines is shown. *, p<0.05, Mann-Whitney test. FIG. 1E:
ASO-treated RA FLS migrated out of a Matrigel sphere for 2 d in
response to 10 ng/ml PDGF or media alone. Left panel, graph shows
mean.+-.SD cells per field. Data from 3 independent experiments in
different FLS lines is shown. Significance was calculated using the
paired t-test. *, p<0.05. Right panel, representative image.
FIG. 1F: ASO-treated RA FLS were plated on fibronectin (FN)-coated
coverslips in the presence of 5% FBS. Graphs show median.+-.IQR
cell area after 15, 30 and 60 min. Data from 3 independent
experiments in different FLS lines is shown. *, p<0.05,
Mann-Whitney test.
FIGS. 2A-2B. RPTP.kappa. promotes RA FLS migration through
dephosphorylation of SRC. FIGS. 2A-2B: RA FLS migrated through
uncoated transwell chambers in response to 5% FBS in the presence
of the SRC family kinase inhibitor PP2 (FIG. 2A) or the
phospholipase C gamma 1 inhibitor U73122 (FIG. 2B). Dimethyl
sulfoxide (DMSO) is a control. Histograms depict median.+-.IQR %
maximum number of cells per field. Data from 2 independent
experiments in different FLS lines is shown. *, p<0.05,
Mann-Whitney test.
FIGS. 3A-3I. RPTP.kappa. is required for the pathogenic action of
RA FLS. FIGS. 3A-3E depict histograms of results of ASO-treated RA
FLS which were stimulated with 50 ng/ml TNF.alpha. for 24 hr or
left unstimulated. Graph shows mean.+-.SD relative mRNA expression
levels. *, p<0.05, paired t-test. For each of FIGS. 3A-3E, left
histogram group is unstimulated, and right histogram group is
TNF.alpha. stimulated; for each group, ordering is control ASO (Ctl
ASO) and PTPRK ASO, left to right. Legend: FIGS. 3A-3E: CXCL10
mRNA, VCAM1 mRNA, MMP2 mRNA, MMP8 mRNA and MMP13 mRNA,
respectively. FIG. 3F: ASO-treated RA FLS were intradermally
implanted into nude mice following subcutaneous injection of CFA.
After 5 d, FLS invasion towards the inflammation site was measured
by immunohistochemical staining of FLS in skin immediately adjacent
the CFA injection site. Graph shows median.+-.IQR cells per field.
Data from 3 independent experiments in different FLS lines is
shown. *, p<0.05, Mann-Whitney test. Legend: Left histogram
group (Ctl ASO); right histogram group (PTPRK ASO). FIG. 3G: Model
depicting role of TGF.beta.-dependent RPTP.kappa. in RA
pathogenesis. FIG. 3H-3I: To induce PTPRK expression, ASO-treated
RA FLS were prestimulated with 50 ng/ml TGF.beta.1 for 24 hr (or
left unstimulated) in the presence of ASO. Cells were then
stimulated with 50 ng/ml TGF.beta.1/PDGF/TNF.alpha., or 50 ng/ml
PDGF/TNF.alpha., or left unstimulated for 24 hr. Graph shows
mean.+-.SD relative mRNA expression levels for MMP13 mRNA (FIG. 3H)
and MMP14 mRNA (FIG. 3I). *, p<0.05, paired t-test. Legend:
FIGS. 3H-3I: left histogram group is unstimulated, middle histogram
group is PDGF/TNF.alpha. stimulated, and right histogram group is
TGF.beta.1/PDGF/TNF.alpha. stimulated. For each group, ordering is
control ASO (Ctl ASO) and PTPRK ASO, left to right.
FIG. 4. Following treatment with 2.5 .mu.M Ctl or PTPRK ASO for 7
days, RA FLS were stained with anti-beta-catenin antibody,
phalloidin and Hoechst and imaged by immunofluorescence microscopy.
Histogram FIG. 4 depicts proportions of beta-catenin in cytosolic
and nuclear fractions. Data from 3 independent experiments in
different FLS lines is shown. Significance was calculated using the
Mann-Whitney test. Legend: left group (cytosol); right group
(nucleus). Within each group the ASO employed was control ASO (Ctl
ASO) and PTPRK ASO, in order left to right.
FIG. 5. RPTP.kappa. is expressed in RA synovial lining. Panels show
representative immunohistochemical staining of RA synovial sections
using anti-RPTP.kappa. (left panels) or control IgG antibodies
(rights panels).
FIGS. 6A-6B. Knockdown of RPTP.kappa., but not RPTP.mu., reduces RA
FLS invasiveness. FIG. 6A: PTPRK_2 ASO enables efficient knockdown
of RPTP.kappa.. RA FLS were treated with 2.5 .mu.M Ctl or PTPRK_2
ASO for 7 days. PTPRK expression was assessed by qPCR, normalized
to the housekeeping gene RPII, and plotted relative to the PTPRK
expression in Ctl ASO-treated cells. Panel shows mean.+-.range.
Data from 2 independent experiments in different FLS lines is
shown. Legend (histogram, left to right): Control ASO (Ctl ASO)
(SEQ ID N0:6); PTPRK_2 ASO (SEQ ID N0:4). FIG. 6B: Following
treatment with 2.5 .mu.M Ctl or PTPRK_2 ASO for 7 d, RA FLS invaded
through Matrigel-coated transwell chambers in response to 50 ng/ml
PDGF-BB for 24 hr. Graph shows median.+-.IQR % maximum number of
cells per field. Data from 3 independent experiments in different
FLS lines is shown. Significance was calculated using the
Mann-Whitney test, *, p<0.05. 0.05. Legend: see FIG. 6A.
FIGS. 7A-7G. RPTP.kappa. promotes IL-1 signaling in RA FLS.
Following treatment with Ctl ASO or PTPRK ASO for 7 days, RA FLS
were stimulated with 50 ng/ml IL-1.beta. for 24 h or left
unstimulated. FIGS. 7A-7E depict histograms of data for CXC10 mRNA,
VCAM1 mRNA, MMP2 mRNA, MMP3 mRNA, and MMP13 mRNA, respectively.
These histograms depict mean.+-.SD relative mRNA expression levels.
For each of FIGS. 7A-7E, histogram entries are (left to right):
unstimulated FLS with Ctrl ASO, unstimulated FLS with PTPRK ASO,
IL-1 stimulated FLS with Ctl ASO, and IL-1 stimulated FLS with
PTPRK ASO. Significance was calculated using the paired t-test *,
p<0.05. FIGS. 7F-7G: Representative 40.times. images of mouse
skin samples from experiment described in Example 5 (e.g., FIG.
3C), showing results from administration of Ctl ASO (FIG. 7F) and
PTPRK ASO (FIG. 7G). Arrows indicate invading FLS stained with an
anti human Class I HLA antibody.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
The terms "PTPR," "RPTP," "rPTP" and the like refer, in the usual
and customary sense, to receptor-type protein tyrosine
phosphatases, which are found in nature as membrane bound protein
tyrosine phosphatases. In embodiments, the RPTP is a mammalian RPTP
(e.g. human, mouse, rat, or other mammal). In embodiments, the RPTP
is a human RPTP. In embodiments, the RPTP refers to the protein
encoded by the gene PTPRK. It is understood that the term "PTPRK"
in the context of a gene refers to the gene encoding receptor
tyrosine-protein phosphatase kappa. It is further understood that
the terms "PTPRK," "RPTP.kappa.," "RPTPk" and the like in the
context of a protein refer to receptor tyrosine-protein phosphatase
kappa. In embodiments, RPTP means the full length RPTP (e.g. the
protein translated from the complete coding region of the gene,
which may also include post-translational modifications). In
embodiments RPTP includes a fragment of the RPTP full length
protein or a functional fragment of the full length RPTP protein.
In embodiments this definition includes one or all splice variants
of an RPTP. An RPTP may include all homologs of the RPTP. In
embodiments, PTPRK refers to mammalian PTPRK. In embodiments, a
PTPRK refers to a human PTPRK. In embodiments, an RPTP includes all
splice variants of the RPTP. In embodiments, an RPTP may refer to
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants.
The terms "PTPR antagonist," "RPTP antagonist" and the like refer
to an agent which reduces the level of activity or a PTPR or the
level of expression of a PTPR, e.g., RPTPk. The term "PTPRK
antagonist" refers to an agent which reduces the level of activity
or the level of expression of RPTP.kappa.. A PTPR antagonist can be
a RPTP binding agent, a RPTP small molecule inhibitor, a RPTP
allosteric inhibitor, an anti-PTPR antibody, an anti-PTPR
inhibitory nucleic acid, an anti-PTPR RNAi molecule, or a PTPR
ligand mimetic, as disclosed herein. An "RPTP small molecule
inhibitor" is a small molecule which inhibits an RPTP. An "PTPRK
small molecule inhibitor" is a small molecule which inhibits PTPRK.
An "RPTP allosteric inhibitor" is a molecule which can bind an
allosteric site of an RPTP, thereby inhibiting the RPTP. An "PTPRK
allosteric inhibitor" is a molecule which can bind an allosteric
site of PTPRK, thereby inhibiting the PTPRK. RPTP allosteric
inhibitors (e.g., PTPRK allosteric inhibitors) can bind either to
the intracellular or extracellular regions of the RPTP (e.g.,
PTPRK) in regions of the protein that are not necessarily binding
sites for other ligands, as known in the art. In embodiments, these
agents do not directly compete for binding with a ligand, but could
cause a change in the conformation of the protein that would affect
either its binding to ligands, its activity, or other functions as
known in the art.
The terms "subject," "patient," "individual," etc. are not intended
to be limiting and can be generally interchanged. That is, an
individual described as a "patient" does not necessarily have a
given disease, but may be merely seeking medical advice.
A "standard control" refers to a sample, measurement, or value that
serves as a reference, usually a known reference, for comparison to
a test sample, measurement, or value. For example, a test sample
can be taken from a patient suspected of having a given disease
(e.g. an autoimmune disease, inflammatory autoimmune disease,
cancer, infectious disease, immune disease, or other disease) and
compared to a known normal (i.e., non-diseased) individual (e.g. a
standard control subject). A standard control can also represent an
average measurement or value gathered from a population of similar
individuals (e.g. standard control subjects) that do not have a
given disease (i.e. standard control population), e.g., healthy
individuals with a similar medical background, same age, weight,
etc. A standard control value can also be obtained from the same
individual, e.g. from an earlier-obtained sample from the patient
prior to disease onset. One of skill will recognize that standard
controls can be designed for assessment of any number of parameters
(e.g. RNA levels, protein levels, individual RPTP levels, specific
cell types, specific bodily fluids, specific tissues, synoviocytes,
synovial fluid, synovial tissue, fibroblast-like synoviocytes,
macrophage-like synoviocytes, and the like).
One of skill in the art will understand which standard controls are
most appropriate in a given situation and be able to analyze data
based on comparisons to standard control values. Standard controls
are also valuable for determining the significance (e.g.
statistical significance) of data, as known in the art.
The terms "dose" and "dosage" are used interchangeably herein. A
dose refers to the amount of active ingredient given to an
individual at each administration, or to an amount administered in
vitro or ex vivo. For the methods and compositions provided herein,
the dose may generally depend to the required treatment for the
disease (e.g. an autoimmune, inflammatory autoimmune, cancer,
infectious, immune, or other disease), and the biological activity
of the RPTP binding agent, RPTP antagonist, anti-PTPR antibody,
anti-PTPR inhibitory nucleic acid, anti-PTPR RNAi molecule, or PTPR
ligand mimetic. The dose will vary depending on a number of
factors, including the range of normal doses for a given therapy,
frequency of administration; size and tolerance of the individual;
severity of the condition; risk of side effects; and the route of
administration. One of skill will recognize that the dose can be
modified depending on the above factors or based on therapeutic
progress. The term "dosage form" refers to the particular format of
the pharmaceutical or pharmaceutical composition, and depends on
the route of administration. For example, a dosage form can be in a
liquid form for nebulization, e.g., for inhalants, in a tablet or
liquid, e.g., for oral delivery, or a saline solution, e.g., for
injection.
As used herein, the terms "treat" and "prevent" may refer to any
delay in onset, reduction in the frequency or severity of symptoms,
amelioration of symptoms, improvement in patient comfort or
function (e.g. joint function), decrease in severity of the disease
state, etc. The effect of treatment can be compared to an
individual or pool of individuals not receiving a given treatment,
or to the same patient prior to, or after cessation of, treatment.
The term "prevent" generally refers to a decrease in the occurrence
of a given disease (e.g. an autoimmune, inflammatory autoimmune,
cancer, infectious, immune, or other disease) or disease symptoms
in a patient. As indicated above, the prevention may be complete
(no detectable symptoms) or partial, such that fewer symptoms are
observed than would likely occur absent treatment.
By "effective amount," "therapeutically effective amount,"
"therapeutically effective dose or amount" and the like as used
herein is meant an amount (e.g., a dose) that produces effects for
which it is administered (e.g. treating or preventing a disease).
The exact dose and formulation will depend on the purpose of the
treatment, and will be ascertainable by one skilled in the art
using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage
Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of
Pharmaceutical Compounding (1999); Remington: The Science and
Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and
Pickar, Dosage Calculations (1999)). For example, for the given
parameter, a therapeutically effective amount will show an increase
or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%,
80%, 90%, or at least 100%. Therapeutic efficacy can also be
expressed as "-fold" increase or decrease. For example, a
therapeutically effective amount can have at least a 1.2-fold,
1.5-fold, 2-fold, 5-fold, or more effect over a standard control. A
therapeutically effective dose or amount may ameliorate one or more
symptoms of a disease. A therapeutically effective dose or amount
may prevent or delay the onset of a disease or one or more symptoms
of a disease when the effect for which it is being administered is
to treat a person who is at risk of developing the disease.
The term "diagnosis" refers to a relative probability that a
disease (e.g. an autoimmune, inflammatory autoimmune, cancer,
infectious, immune, or other disease) is present in the subject.
The term "prognosis" refers to a relative probability that a
certain future outcome may occur in the subject with respect to a
disease state. For example, in the present context, prognosis can
refer to the likelihood that an individual will develop a disease
(e.g. an autoimmune, inflammatory autoimmune, cancer, infectious,
immune, or other disease), or the likely severity of the disease
(e.g., extent of pathological effect and duration of disease). The
terms are not intended to be absolute, as will be appreciated by
any one of skill in the field of medical diagnostics.
"Nucleic acid" or "oligonucleotide" or "polynucleotide" or
grammatical equivalents used herein means at least two nucleotides
covalently linked together. The term "nucleic acid" includes
single-, double-, or multiple-stranded DNA, RNA and analogs
(derivatives) thereof. Oligonucleotides are typically from about 5,
6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50 or more nucleotides in
length, up to about 100 nucleotides in length. Nucleic acids and
polynucleotides are a polymers of any length, including longer
lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000,
or even longer. Nucleic acids containing one or more carbocyclic
sugars are also included within one definition of nucleic acids.
Modifications of the ribose-phosphate backbone may be done for a
variety of reasons, e.g., to increase the stability and half-life
of such molecules in physiological environments or as probes on a
biochip. Mixtures of naturally occurring nucleic acids and analogs
can be made; alternatively, mixtures of different nucleic acid
analogs, and mixtures of naturally occurring nucleic acids and
analogs may be made.
A particular nucleic acid sequence also encompasses "splice
variants." Similarly, a particular protein encoded by a nucleic
acid encompasses any protein encoded by a splice variant of that
nucleic acid. "Splice variants," as the name suggests, are products
of alternative splicing of a gene. After transcription, an initial
nucleic acid transcript may be spliced such that different
(alternate) nucleic acid splice products encode different
polypeptides. Mechanisms for the production of splice variants
vary, but include alternate splicing of exons. Alternate
polypeptides derived from the same nucleic acid by read-through
transcription are also encompassed by this definition. Any products
of a splicing reaction, including recombinant forms of the splice
products, are included in this definition. An example of potassium
channel splice variants is discussed in Leicher, et al., J. Biol.
Chem. 273(52):35095-35101 (1998).
Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are near each other, and, in the case of
a secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
The term "probe" or "primer", as used herein, is defined to be one
or more nucleic acid fragments whose specific hybridization to a
sample can be detected. A probe or primer can be of any length
depending on the particular technique it will be used for. For
example, PCR primers are generally between 10 and 40 nucleotides in
length, while nucleic acid probes for, e.g., a Southern blot, can
be more than a hundred nucleotides in length. The probe may be
unlabeled or labeled as described below so that its binding to the
target or sample can be detected. The probe can be produced from a
source of nucleic acids from one or more particular (preselected)
portions of a chromosome, e.g., one or more clones, an isolated
whole chromosome or chromosome fragment, or a collection of
polymerase chain reaction (PCR) amplification products. The length
and complexity of the nucleic acid fixed onto the target element is
not critical. One of skill can adjust these factors to provide
optimum hybridization and signal production for a given
hybridization procedure, and to provide the required resolution
among different genes or genomic locations.
The probe may also be isolated nucleic acids immobilized on a solid
surface (e.g., nitrocellulose, glass, quartz, fused silica slides),
as in an array. In embodiments, the probe may be a member of an
array of nucleic acids as described, for instance, in WO 96/17958.
Techniques capable of producing high density arrays can also be
used for this purpose (see, e.g., Fodor (1991) Science 767-773;
Johnston (1998) Curr. Biol. 8: R171-R174; Schummer (1997)
Biotechniques 23: 1087-1092; Kern (1997) Biotechniques 23: 120-124;
U.S. Pat. No. 5,143,854).
A "labeled nucleic acid probe or oligonucleotide" is one that is
bound, either covalently, through a linker or a chemical bond, or
noncovalently, through ionic, van der Waals, electrostatic, or
hydrogen bonds to a label such that the presence of the probe may
be detected by detecting the presence of the label bound to the
probe. Alternatively, a method using high affinity interactions may
achieve the same results where one of a pair of binding partners
binds to the other, e.g., biotin, streptavidin.
The terms "identical" or percent sequence "identity," in the
context of two or more nucleic acids or polypeptide sequences,
refer to two or more sequences or subsequences that are the same or
have a specified percentage of amino acid residues or nucleotides
that are the same (i.e., about 50% identity, preferably 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, or higher identity over a specified region, when compared
and aligned for maximum correspondence over a comparison window or
designated region) as measured using a BLAST or BLAST 2.0 sequence
comparison algorithms with default parameters described below, or
by manual alignment and visual inspection (see, e.g., NCBI web site
at ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then
said to be "substantially identical." This definition also refers
to, or may be applied to, the compliment of a test sequence. The
definition also includes sequences that have deletions and/or
additions, as well as those that have substitutions. Employed
algorithms can account for gaps and the like.
For sequence comparisons, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Preferably, default program parameters can be used,
or alternative parameters can be designated. The sequence
comparison algorithm then calculates the percent sequence
identities for the test sequences relative to the reference
sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a
segment of any one of the number of contiguous positions selected
from the group consisting of from 20 to 600, usually about 50 to
about 200, more usually about 100 to about 150 in which a sequence
may be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally aligned.
Methods of alignment of sequences for comparison are well-known in
the art. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection (see, e.g., Current Protocols in
Molecular Biology (Ausubel et al., eds. 1995 supplement)).
A preferred example of algorithm that is suitable for determining
percent sequence identity and sequence similarity are the BLAST and
BLAST 2.0 algorithms, which are described in Altschul et al., Nuc.
Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol.
215:403-410 (1990), respectively.
The phrase "selectively (or specifically) hybridizes to" refers to
the binding, duplexing, or hybridizing of a molecule only to a
particular nucleotide sequence with a higher affinity, e.g., under
more stringent conditions, than to other nucleotide sequences
(e.g., total cellular or library DNA or RNA).
The phrase "stringent hybridization conditions" refers to
conditions under which a nucleic acid will hybridize to its target
sequence, typically in a complex mixture of nucleic acids, but only
weakly to other (i.e., non-target) sequences (e.g., 10-fold less,
100-fold less, 1000-fold less, or even less affinity) or not at all
(i.e., no detectable hybridization to a sequence which is not a
target sequence). Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY--HYBRIDIZATION
WITH NUCLEIC PROBES, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
hybridization conditions are selected to be about 5-10.degree. C.
lower than the thermal melting point (T.sub.m) for the specific
sequence at a defined ionic strength pH. The T.sub.m is the
temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at T.sub.m, 50% of the
probes are occupied at equilibrium). Stringent hybridization
conditions may also be achieved with the addition of destabilizing
agents such as formamide. For selective or specific hybridization,
a positive signal is at least two times background, preferably 10
times background hybridization. Exemplary stringent hybridization
conditions can be as following: 50% formamide, 5.times.SSC, and 1%
SDS, incubating at 42.degree. C., or, 5.times.SSC, 1% SDS,
incubating at 65.degree. C., with wash in 0.2.times.SSC, and 0.1%
SDS at 65.degree. C. Exemplary "moderately stringent hybridization
conditions" include a hybridization in a buffer of 40% formamide, 1
M NaCl, 1% SDS at 37.degree. C., and a wash in 1.times.SSC at
45.degree. C. A positive hybridization is at least twice
background. Those of ordinary skill will readily recognize that
alternative hybridization and wash conditions can be utilized to
provide conditions of similar stringency. Additional guidelines for
determining hybridization parameters are provided in numerous
reference, e.g., and Current Protocols in Molecular Biology, ed.
Ausubel, et al., John Wiley & Sons.
Nucleic acids may be substantially identical if the polypeptides
which they encode are substantially identical. This occurs, for
example, when a copy of a nucleic acid is created using the maximum
codon degeneracy permitted by the genetic code. In such cases, the
nucleic acids typically hybridize under moderately stringent
hybridization conditions.
An "inhibitory nucleic acid" is a nucleic acid (e.g. DNA, RNA,
polymer of nucleotide analogs) that is capable of binding to a
target nucleic acid (e.g. an mRNA translatable into an RPTP) and
reducing transcription of the target nucleic acid (e.g. mRNA from
DNA) or reducing the translation of the target nucleic acid (e.g.,
mRNA) or altering transcript splicing (e.g. single stranded
morpholino oligo). A "morpholino oligo" may be alternatively
referred to as a "morpholino nucleic acid" and refers to
morpholine-containing nucleic acid nucleic acids commonly known in
the art (e.g. phosphoramidate morpholinio oligo or a "PMO"). See
Marcos, P., Biochemical and Biophysical Research Communications 358
(2007) 521-527. In embodiments, the "inhibitory nucleic acid" is a
nucleic acid that is capable of binding (e.g. hybridizing) to a
target nucleic acid (e.g. an mRNA translatable into an RPTP) and
reducing translation of the target nucleic acid. The target nucleic
acid is or includes one or more target nucleic acid sequences to
which the inhibitory nucleic acid binds (e.g. hybridizes). Thus, an
inhibitory nucleic acid typically is or includes a sequence (also
referred to herein as an "antisense nucleic acid sequence") that is
capable of hybridizing to at least a portion of a target nucleic
acid at a target nucleic acid sequence. An example of an inhibitory
nucleic acid is an antisense nucleic acid. Another example of an
inhibitory nucleic acid is siRNA or RNAi (including their
derivatives or pre-cursors, such as nucleotide analogs). Further
examples include shRNA, miRNA, shmiRNA, or certain of their
derivatives or pre-cursors. In embodiments, the inhibitory nucleic
acid is single stranded. In embodiments, the inhibitory nucleic
acid is double stranded.
An "antisense nucleic acid" is a nucleic acid (e.g. DNA, RNA or
analogs thereof) that is at least partially complementary to at
least a portion of a specific target nucleic acid (e.g. a target
nucleic acid sequence), such as an mRNA molecule (e.g. a target
mRNA molecule) (see, e.g., Weintraub, Scientific American, 262:40
(1990)), for example antisense, siRNA, shRNA, shmiRNA, miRNA
(microRNA). Thus, antisense nucleic acids are capable of
hybridizing to (e.g. selectively hybridizing to) a target nucleic
acid (e.g. target mRNA). In embodiments, the antisense nucleic acid
hybridizes to the target nucleic acid sequence (e.g. mRNA) under
stringent hybridization conditions. In embodiments, the antisense
nucleic acid hybridizes to the target nucleic acid (e.g. mRNA)
under moderately stringent hybridization conditions. Antisense
nucleic acids may comprise naturally occurring nucleotides or
modified nucleotides such as, e.g., phosphorothioate,
methylphosphonate, and -anomeric sugar-phosphate, backbone-modified
nucleotides. An "anti-PTPR antisense nucleic acid" is an antisense
nucleic acid that is at least partially complementary to at least a
portion of a target nucleic acid sequence, such as an mRNA
molecule, that codes at least a portion of the PTPR. An "PTPRK
antisense nucleic acid" is an antisense nucleic acid that is at
least partially complementary to at least a portion of a target
nucleic acid sequence, such as an mRNA molecule, that codes at
least a portion of RPTPk.
In embodiments, an antisense nucleic acid is a morpholino oligo. In
embodiments, a morpholino oligo is a single stranded antisense
nucleic acid, as is know in the art. In embodiments, a morpholino
oligo decreases protein expression of a target, reduces translation
of the target mRNA, reduces translation initiation of the target
mRNA, or modifies transcript splicing. In embodiments, the
morpholino oligo is conjugated to a cell permeable moiety (e.g.
peptide). Antisense nucleic acids may be single or double stranded
nucleic acids.
In the cell, the antisense nucleic acids may hybridize to the
target mRNA, forming a double-stranded molecule. The antisense
nucleic acids, interfere with the translation of the mRNA, since
the cell will not translate a mRNA that is double-stranded. The use
of antisense methods to inhibit the in vitro translation of genes
is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289,
(1988)). Antisense molecules which bind directly to the DNA may be
used.
Inhibitory nucleic acids can be delivered to the subject using any
appropriate means known in the art, including by injection,
inhalation, or oral ingestion. Another suitable delivery system is
a colloidal dispersion system such as, for example, macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-based
systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An example of a colloidal system is a liposome.
Liposomes are artificial membrane vesicles which are useful as
delivery vehicles in vitro and in vivo. Nucleic acids, including
RNA and DNA within liposomes and be delivered to cells in a
biologically active form (Fraley, et al., Trends Biochem. Sci.,
6:77, 1981). Liposomes can be targeted to specific cell types or
tissues using any means known in the art Inhibitory nucleic acids
(e.g. antisense nucleic acids, morpholino oligos) may be delivered
to a cell using cell permeable delivery systems (e.g. cell
permeable peptides). In embodiments, inhibitory nucleic acids are
delivered to specific cells or tissues using viral vectors or
viruses.
An "siRNA" refers to a nucleic acid that forms a double stranded
RNA, which double stranded RNA has the ability to reduce or inhibit
expression of a gene or target gene when the siRNA is present (e.g.
expressed) in the same cell as the gene or target gene. The siRNA
is typically about 5 to about 100 nucleotides in length, more
typically about 10 to about 50 nucleotides in length, more
typically about 15 to about 30 nucleotides in length, most
typically about 20-30 base nucleotides, or about 20-25 or about
24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleotides in length. siRNA molecules and methods of
generating them are described in, e.g., Bass, 2001, Nature, 411,
428-429; Elbashir et al., 2001, Nature, 411, 494-498; WO 00/44895;
WO 01/36646; WO 99/32619; WO 00/01846; WO 01/29058; WO 99/07409;
and WO 00/44914. A DNA molecule that transcribes dsRNA or siRNA
(for instance, as a hairpin duplex) also provides RNAi. DNA
molecules for transcribing dsRNA are disclosed in U.S. Pat. No.
6,573,099, and in U.S. Patent Application Publication Nos.
2002/0160393 and 2003/0027783, and Tuschl and Borkhardt, Molecular
Interventions, 2:158 (2002).
The siRNA can be administered directly or siRNA expression vectors
can be used to induce RNAi that have different design criteria. A
vector can have inserted two inverted repeats separated by a short
spacer sequence and ending with a string of T's which serve to
terminate transcription.
Construction of suitable vectors containing the desired therapeutic
gene coding and control sequences employs standard ligation and
restriction techniques, which are well understood in the art (see
Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, New York (1982)). Isolated plasmids, DNA
sequences, or synthesized oligonucleotides are cleaved, tailored,
and re-ligated in the form desired.
"Biological sample" or "sample" refer to materials obtained from or
derived from a subject or patient. A biological sample includes
sections of tissues such as biopsy and autopsy samples, and frozen
sections taken for histological purposes. Such samples include
bodily fluids such as blood and blood fractions or products (e.g.,
serum, plasma, platelets, red blood cells, and the like), sputum,
tissue, cultured cells (e.g., primary cultures, explants, and
transformed cells) stool, urine, synovial fluid, joint tissue,
synovial tissue, synoviocytes, fibroblast-like synoviocytes,
macrophage-like synoviocytes, immune cells, hematopoietic cells,
fibroblasts, macrophages, T cells, etc. A biological sample is
typically obtained from a eukaryotic organism, such as a mammal
such as a primate e.g., chimpanzee or human; cow; dog; cat; a
rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile;
or fish.
A "biopsy" refers to the process of removing a tissue sample for
diagnostic or prognostic evaluation, and to the tissue specimen
itself. Any biopsy technique known in the art can be applied to the
diagnostic and prognostic methods disclosed herein. The biopsy
technique applied will depend on the tissue type to be evaluated
(i.e., prostate, lymph node, liver, bone marrow, blood cell, joint
tissue, synovial tissue, synoviocytes, fibroblast-like
synoviocytes, macrophage-like synoviocytes, immune cells,
hematopoietic cells, fibroblasts, macrophages, T cells, etc.), the
size and type of a tumor (i.e., solid or suspended (i.e., blood or
ascites)), among other factors. Representative biopsy techniques
include excisional biopsy, incisional biopsy, needle biopsy,
surgical biopsy, and bone marrow biopsy. Biopsy techniques are
discussed, for example, in Harrison's Principles of Internal
Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and
throughout Part V.
The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer.
The term "amino acid" refers to naturally occurring and synthetic
amino acids, as well as amino acid analogs and amino acid mimetics
that function in a manner similar to the naturally occurring amino
acids. Naturally occurring amino acids are those encoded by the
genetic code, as well as those amino acids that are later modified,
e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an .alpha. carbon that is bound to a hydrogen, a
carboxyl group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
Amino acids may be referred to herein by either their commonly
known three letter symbols or by the one-letter symbols recommended
by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides,
likewise, may be referred to by their commonly accepted
single-letter codes.
"Conservatively modified variants" applies to both amino acid and
nucleic acid sequences. With respect to particular nucleic acid
sequences, conservatively modified variants refers to those nucleic
acids which encode identical or essentially identical amino acid
sequences, or where the nucleic acid does not encode an amino acid
sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid which encodes a polypeptide is implicit in each described
sequence with respect to the expression product, but not with
respect to actual probe sequences.
As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles disclosed herein.
The following eight groups each contain amino acids that are
conservative substitutions for one another: 1) Alanine (A), Glycine
(G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N),
Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I),
Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F),
Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8)
Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins
(1984)).
A "label" or a "detectable moiety" is a composition detectable by
spectroscopic, photochemical, biochemical, immunochemical,
chemical, or other physical means. For example, useful labels
include .sup.32P, fluorescent dyes, electron-dense reagents,
enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin,
or haptens and proteins or other entities which can be made
detectable, e.g., by incorporating a radiolabel into a peptide or
antibody specifically reactive with a target peptide. Any method
known in the art for conjugating an antibody to the label may be
employed, e.g., using methods described in Hermanson, BIOCONJUGATE
TECHNIQUES 1996, Academic Press, Inc., San Diego.
The term "recombinant" when used with reference, e.g., to a cell,
or nucleic acid, protein, or vector, indicates that the cell,
nucleic acid, protein or vector, has been modified by the
introduction of a heterologous nucleic acid or protein or the
alteration of a native nucleic acid or protein, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
The term "heterologous" when used with reference to portions of a
nucleic acid indicates that the nucleic acid comprises two or more
subsequences that are not found in the same relationship to each
other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged to make a new functional nucleic acid, e.g., a
promoter from one source and a coding region from another source.
Similarly, a heterologous protein indicates that the protein
comprises two or more subsequences that are not found in the same
relationship to each other in nature (e.g., a fusion protein).
"Antibody" refers to a polypeptide comprising a framework region
from an immunoglobulin gene or fragments thereof that specifically
binds and recognizes an antigen. The recognized immunoglobulin
genes include the kappa, lambda, alpha, gamma, delta, epsilon, and
mu constant region genes, as well as the myriad immunoglobulin
variable region genes. Light chains are classified as either kappa
or lambda. Heavy chains are classified as gamma, mu, alpha, delta,
or epsilon, which in turn define the immunoglobulin classes, IgG,
IgM, IgA, IgD and IgE, respectively. Typically, the antigen-binding
region of an antibody will be most critical in specificity and
affinity of binding. In embodiments, antibodies or fragments of
antibodies may be derived from different organisms, including
humans, mice, rats, hamsters, camels, etc. Antibodies disclosed
herein may include antibodies that have been modified or mutated at
one or more amino acid positions to improve or modulate a desired
function of the antibody (e.g. glycosylation, expression, antigen
recognition, effector functions, antigen binding, specificity,
etc.).
An exemplary immunoglobulin (antibody) structural unit comprises a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kD) and
one "heavy" chain (about 50-70 kD). The N-terminus of each chain
defines a variable region of about 100 to 110 or more amino acids
primarily responsible for antigen recognition. The terms variable
light chain (V.sub.L) and variable heavy chain (V.sub.H) refer to
these light and heavy chains respectively.
Antibodies exist, e.g., as intact immunoglobulins or as a number of
well-characterized fragments produced by digestion with various
peptidases. Thus, for example, pepsin digests an antibody below the
disulfide linkages in the hinge region to produce F(ab)'.sub.2, a
dimer of Fab which itself is a light chain joined to
V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be
reduced under mild conditions to break the disulfide linkage in the
hinge region, thereby converting the F(ab)'.sub.2 dimer into an
Fab' monomer. The Fab' monomer is essentially Fab with part of the
hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill will appreciate that
such fragments may be synthesized de novo either chemically or by
using recombinant DNA methodology. Thus, the term antibody, as used
herein, also includes antibody fragments either produced by the
modification of whole antibodies, or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv) or
those identified using phage display libraries (see, e.g.,
McCafferty et al., Nature 348:552-554 (1990)).
For preparation of suitable antibodies as disclosed herein and for
use according to the methods disclosed herein, e.g., recombinant,
monoclonal, or polyclonal antibodies, many techniques known in the
art can be used (see, e.g., Kohler & Milstein, Nature
256:495-497 (1975); Kozbor et al., Immunology Today 4:72 (1983);
Cole et al., pp. 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY,
Alan R. Liss, Inc. (1985); Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY
(1991); Harlow & Lane, ANTIBODIES, A LABORATORY MANUAL (1988);
and Goding, MONOCLONAL ANTIBODIES: PRINCIPLES AND PRACTICE (2d ed.
1986)). The genes encoding the heavy and light chains of an
antibody of interest can be cloned from a cell, e.g., the genes
encoding a monoclonal antibody can be cloned from a hybridoma and
used to produce a recombinant monoclonal antibody. Gene libraries
encoding heavy and light chains of monoclonal antibodies can also
be made from hybridoma or plasma cells. Random combinations of the
heavy and light chain gene products generate a large pool of
antibodies with different antigenic specificity (see, e.g., Kuby,
IMMUNOLOGY (3.sup.rd ed. 1997)). Techniques for the production of
single chain antibodies or recombinant antibodies (U.S. Pat. No.
4,946,778, U.S. Pat. No. 4,816,567) can be adapted to produce
antibodies to polypeptides as disclosed herein. Also, transgenic
mice, or other organisms such as other mammals, may be used to
express humanized or human antibodies (see, e.g., U.S. Pat. Nos.
5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016,
Marks et al., Bio/Technology 10:779-783 (1992); Lonberg et al.,
Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994);
Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger,
Nature Biotechnology 14:826 (1996); and Lonberg & Huszar,
Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage
display technology can be used to identify antibodies and
heteromeric Fab fragments that specifically bind to selected
antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990);
Marks et al., Biotechnology 10:779-783 (1992)). Antibodies can also
be made bispecific, i.e., able to recognize two different antigens
(see, e.g., WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659
(1991); and Suresh et al., Methods in Enzymology 121:210 (1986)).
Antibodies can also be heteroconjugates, e.g., two covalently
joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No.
4,676,980, WO 91/00360; WO 92/200373; and EP 03089).
Methods for humanizing or primatizing non-human antibodies are well
known in the art (e.g., U.S. Pat. Nos. 4,816,567; 5,530,101;
5,859,205; 5,585,089; 5,693,761; 5,693,762; 5,777,085; 6,180,370;
6,210,671; and 6,329,511; WO 87/02671; EP Patent Application
0173494; Jones et al. (1986) Nature 321:522; and Verhoyen et al.
(1988) Science 239:1534). Humanized antibodies are further
described in, e.g., Winter and Milstein (1991) Nature 349:293.
Generally, a humanized antibody has one or more amino acid residues
introduced into it from a source which is non-human. These
non-human amino acid residues are often referred to as import
residues, which are typically taken from an import variable domain.
Humanization can be essentially performed following the method of
Winter and co-workers (see, e.g., Morrison et al., PNAS USA,
81:6851-6855 (1984), Jones et al., Nature 321:522-525 (1986);
Riechmann et al., Nature 332:323-327 (1988); Morrison and Oi, Adv.
Immunol., 44:65-92 (1988), Verhoeyen et al., Science 239:1534-1536
(1988) and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992),
Padlan, Molec. Immun., 28:489-498 (1991); Padlan, Molec. Immun.,
31(3):169-217 (1994)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody. Accordingly,
such humanized antibodies are chimeric antibodies (U.S. Pat. No.
4,816,567), wherein substantially less than an intact human
variable domain has been substituted by the corresponding sequence
from a non-human species. In practice, humanized antibodies are
typically human antibodies in which some CDR residues and possibly
some FR residues are substituted by residues from analogous sites
in rodent antibodies. For example, polynucleotides comprising a
first sequence coding for humanized immunoglobulin framework
regions and a second sequence set coding for the desired
immunoglobulin complementarity determining regions can be produced
synthetically or by combining appropriate cDNA and genomic DNA
segments. Human constant region DNA sequences can be isolated in
accordance with well known procedures from a variety of human
cells.
A "chimeric antibody" is an antibody molecule in which (a) the
constant region, or a portion thereof, is altered, replaced or
exchanged so that the antigen binding site (variable region) is
linked to a constant region of a different or altered class,
effector function and/or species, or an entirely different molecule
which confers new properties to the chimeric antibody, e.g., an
enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the
variable region, or a portion thereof, is altered, replaced or
exchanged with a variable region having a different or altered
antigen specificity. The preferred antibodies of, and for use
according to the present disclosure include humanized and/or
chimeric monoclonal antibodies.
In embodiments, the antibody is conjugated to an "effector" moiety.
The effector moiety can be any number of molecules, including
labeling moieties such as radioactive labels or fluorescent labels,
or can be a therapeutic moiety. In one aspect the antibody
modulates the activity of the protein. Such effector moieties
include, but are not limited to, an anti-tumor drug, a toxin, a
radioactive agent, a cytokine, a second antibody or an enzyme.
The immunoconjugate can be used for targeting the effector moiety
to an RPTPk positive cell, i.e., cells which express RPTPk, assay
of which can be readily apparent when viewing the bands of gels
with approximately similarly loaded with test and controls samples.
Examples of cytotoxic agents include, but are not limited to ricin,
doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicine,
dihydroxy anthracin dione, actinomycin D, diphteria toxin,
Pseudomonas exotoxin (PE) A, PE40, abrin, and glucocorticoid and
other chemotherapeutic agents, as well as radioisotopes. Suitable
detectable markers include, but are not limited to, a radioisotope,
a fluorescent compound, a bioluminescent compound, chemiluminescent
compound, a metal chelator or an enzyme.
Additionally, the recombinant proteins disclosed herein including
the antigen-binding region of any of the antibodies disclosed
herein can be used to treat inflammation. In such a situation, the
antigen-binding region of the recombinant protein is joined to at
least a functionally active portion of a second protein having
therapeutic activity. The second protein can include, but is not
limited to, an enzyme, lymphokine, oncostatin or toxin. Suitable
toxins include doxorubicin, daunorubicin, taxol, ethidium bromide,
mitomycin, etoposide, tenoposide, vincristine, vinblastine,
colchicine, dihydroxy anthracin dione, actinomycin D, diphteria
toxin, Pseudomonas exotoxin (PE) A, PE40, ricin, abrin,
glucocorticoid and radioisotopes.
Techniques for conjugating therapeutic agents to antibodies are
well known (see, e.g., Amon et al., "Monoclonal Antibodies For
Immunotargeting Of Drugs In Cancer Therapy", in MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Reisfeld et al. (eds.), pp. 243-56
(Alan R. Liss, Inc. 1985); Hellstrom et al., ANTIBODIES FOR DRUG
DELIVERY IN CONTROLLED DRUG DELIVERY (2nd Ed.), Robinson et al.
(eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody
Carriers Of Cytotoxic Agents In Cancer Therapy: A Review" in
Monoclonal Antibodies '84: Biological And Clinical Applications,
Pinchera et al. (eds.), pp. 475-506 (1985); and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-58 (1982)).
The phrase "specifically (or selectively) binds" to an antibody or
"specifically (or selectively) immunoreactive with," when referring
to a protein or peptide, refers to a binding reaction that is
determinative of the presence of the protein, often in a
heterogeneous population of proteins and other biologics. Thus,
under designated immunoassay conditions, the specified antibodies
bind to a particular protein at least two times the background and
more typically more than 10 to 100 times background. Specific
binding to an antibody under such conditions requires an antibody
that is selected for its specificity for a particular protein. For
example, polyclonal antibodies can be selected to obtain only those
polyclonal antibodies that are specifically immunoreactive with the
selected antigen and not with other proteins. This selection may be
achieved by subtracting out antibodies that cross-react with other
molecules. A variety of immunoassay formats may be used to select
antibodies specifically immunoreactive with a particular protein.
For example, solid-phase ELISA immunoassays are routinely used to
select antibodies specifically immunoreactive with a protein (see,
e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual
(1998) for a description of immunoassay formats and conditions that
can be used to determine specific immunoreactivity).
As used herein, the term "pharmaceutically acceptable" is used
synonymously with "physiologically acceptable" and
"pharmacologically acceptable". A pharmaceutical composition will
generally include agents for buffering and preservation in storage,
and can include buffers and carriers for appropriate delivery,
depending on the route of administration.
"Pharmaceutically acceptable excipient" and "pharmaceutically
acceptable carrier" refer to a substance that aids the
administration of an active agent to and/or absorption by a subject
and can be included in the compositions disclosed herein without
causing a significant adverse toxicological effect on the patient.
Unless indicated to the contrary, the terms "active agent," "active
ingredient," "therapeutically active agent," "therapeutic agent"
and like are used synonymously. Non-limiting examples of
pharmaceutically acceptable excipients include water, NaCl, normal
saline solutions, lactated Ringer's, normal sucrose, normal
glucose, binders, fillers, disintegrants, lubricants, coatings,
sweeteners, flavors, salt solutions (such as Ringer's solution),
alcohols, oils, gelatins, carbohydrates such as lactose, amylose or
starch, fatty acid esters, hydroxymethycellulose, polyvinyl
pyrrolidine, polyethylene glycol, and colors, and the like. Such
preparations can be sterilized and, if desired, mixed with
auxiliary agents such as lubricants, preservatives, stabilizers,
wetting agents, emulsifiers, salts for influencing osmotic
pressure, buffers, coloring, and/or aromatic substances and the
like that do not deleteriously react with the compounds disclosed
herein. One of skill in the art will recognize that other
pharmaceutical excipients are useful in the methods and
compositions disclosed herein.
Certain compounds disclosed herein can exist in unsolvated forms as
well as solvated forms, including hydrated forms. In general, the
solvated forms are equivalent to unsolvated forms and are intended
to be encompassed within the scope of the present disclosure.
Certain compounds disclosed herein may exist in multiple
crystalline or amorphous forms. In general, all physical forms are
equivalent for the uses contemplated herein and are intended to be
within the scope of the present disclosure.
A "protein level of an RPTP" refers to an amount (relative or
absolute) of RPTP in its protein form (as distinguished from its
precursor RNA form). A protein of an RPTP may include a full-length
protein (e.g. the protein translated from the complete coding
region of the gene, which may also include post-translational
modifications), functional fragments of the full length protein
(e.g. sub-domains of the full length protein that possess an
activity or function in an assay), or protein fragments of the
RPTP, which may be any peptide or oligopeptide of the full length
protein.
An "RNA level of an RPTP" refers to an amount (relative or
absolute) of RNA present that may be translated to form an RPTP.
The RNA of an RPTP may be a full-length RNA sufficient to form a
full-length RPTP. The RNA of an RPTP may also be a fragment of the
full length RNA thereby forming a fragment of the full length RPTP.
The fragment of the full length RNA may form a functional fragment
of the RPTP. In embodiments, the RNA of an RPTP includes all splice
variants of an RPTPR gene.
An "autoimmune therapeutic agent" is a molecule (e.g. antibody,
nucleic acid, inhibitory nucleic acid, ligand mimetic, small
chemical molecule) that treats or prevents an autoimmune disease
when administered to a subject in a therapeutically effective dose
or amount. In embodiments, an autoimmune therapeutic agent is an
RPTP binding agent. In embodiments, the therapeutic agent can bind
to more than one RPTP.
An "IAD therapeutic agent" is a molecule that treats or prevents an
inflammatory autoimmune disease (IAD) when administered to a
subject in a therapeutically effective dose or amount where the
autoimmune disease is mediated by a PTPR. Some non-limiting
examples of an IAD therapeutic agent include an IAD PTPR binding
agent, anti-IAD PTPR antibody, anti-IAD PTPR inhibitory nucleic
acid, anti-PTPRK RNAi molecule, and an IAD PTPR ligand mimetic. In
embodiments, IAD therapeutic agents are useful in methods and
compositions described herein relating to any autoimmune disease.
In embodiments, the IAD therapeutic agent can bind to more than one
RPTP. In embodiments, the IAD therapeutic agent can bind to
RPTPk.
An "RPTP binding agent" is a molecule that binds (e.g.
preferentially binds) to one or more RPTPs, RNA that is
translatable to an RPTP, or DNA that is transcribable to an RNA
that is translatable to an RPTP. Where the molecule preferentially
binds, the binding is preferential as compared to other
macromolecular biomolecules present in an organism or cell. A
compound preferentially binds to as compared to other
macromolecular biomolecules present in an organism or cell, for
example, when the preferential binding is 1.1-fold, 1.2-fold,
1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold,
1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold,
9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold,
70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold,
500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold,
2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold,
8000-fold, 9000-fold, 10000 fold, 100,000-fold, 1,000,000-fold
greater. In embodiments, the RPTP binding agent preferentially
binds to one or more RPTPs. In embodiments, the RPTP binding agent
preferentially binds to one RPTP (e.g. RPTPk) in comparison to one
or more other RPTPs. In embodiments, the RPTP binding agent
preferentially binds to an RNA that is translatable to an RPTP
(e.g. RPTPk) compared to an RNA that is translatable to another
RPTP nucleic acids. In embodiments, the RNA is mRNA. In
embodiments, the RPTP binding agent is a protein, nucleic acid,
ligand, ligand mimetic, or a small chemical molecule. In
embodiments, an RPTP binding agent disrupts the interaction between
an RPTP and a physiological or natural ligand. In embodiments, an
RPTP binding agent binds a physiological or natural ligand of the
RPTP. In embodiments, an RPTP binding agent binds the complex of an
RPTP bound to a ligand. In embodiments, the binding agent can bind
to more than one RPTP. An "RPTPk binding agent" or "PTPRK binding
agent" is an RPTP binding agent that binds RPTPk.
An "anti-PTPR antibody" is an antibody, as disclosed herein and
well known in the art, directed to a PTPR. The term "anti-PTPRK
antibody" and the like refer to an antibody directed to RPTPk.
An "anti-PTPR inhibitory nucleic acid" is an inhibitory nucleic
acid that is capable of hybridizing to target nucleic acid sequence
(e.g. an mRNA sequence) that is translatable to a PTPR (e.g.,
RPTPk) or a target nucleic acid sequence (e.g. a DNA sequence) that
is transcribable to an RNA that is translatable to a PTPR. The
anti-PTPR inhibitory nucleic acid is typically capable of
decreasing the amount of PTPR that is translated in a cell. An
"anti-PTPRK inhibitory nucleic acid" is an inhibitory nucleic acid
that is capable of hybridizing to target nucleic acid sequence
(e.g. an mRNA sequence) that is translatable to RPTPk or a target
nucleic acid sequence (e.g. a DNA sequence) that is transcribable
to an RNA that is translatable to RPTPk.
An "anti-PTPR RNAi molecule" is an siRNA, shRNA, miRNA, shmiRNA, or
other nucleic acid, as well known in the art, that is capable of
inducing RNAi and hybridizing to an RNA that is translatable to a
PTPR. The anti-PTPR RNAi molecule is typically capable of
decreasing the amount of PTPR that is translated in a cell. An
"anti-PTPRK RNAi molecule" is an siRNA, shRNA, miRNA, shmiRNA, or
other nucleic acid, as well known in the art, that is capable of
inducing RNAi and hybridizing to an RNA that is translatable to a
RPTPk.
An "PTPR ligand mimetic" is a PTPR binding agent that is designed
to mimic, in structure or in binding mode, a PTPR ligand or is
capable of inhibiting the binding of a natural or physiological
ligand to an PTPR. In embodiments, a PTPR ligand mimetic is a
synthetic chemical compound, peptide, protein, fusion protein
(e.g., PTPR-Fc), peptidomimetic, or modified natural ligand. For
example, a PTPR ligand mimetic may bind the same amino acids or a
subset of the same amino acids on the PTPR that a natural ligand of
the PTPR binds during the physiological functioning of the PTPR.
PTPR ligand mimetics include biopolymers (e.g. proteins, nucleic
acids, or sugars), lipids, chemical molecules with molecular
weights less than five hundred (500) Daltons, one thousand (1000)
Daltons, five thousand (5000) Daltons, less than ten thousand
(10,000) Daltons, less than twenty five thousand (25,000) Daltons,
less than fifty thousand (50,000) Daltons, less than seventy five
thousand (75,000), less than one hundred thousand (100,000), or
less than two hundred fifty thousand (250,000) Daltons. In
embodiments, the synthetic chemical compound is greater than two
hundred fifty thousand (250,000) Daltons. In certain embodiments,
the PTPR binding agent is less than five hundred (500) Daltons. In
embodiments, a PTPR ligand mimetic is a protein. A "PTPRK ligand
mimetic" is a PTPRK binding agent that is designed to mimic, in
structure or in binding mode, a known RPTPk ligand or is capable of
inhibiting the binding of a physiological ligand to RPTPk. In
embodiments, the PTPR ligand mimetic is a PTPRK ligand mimetic and
inhibits the enzymatic activity of PTPRK. In embodiments, the PTPR
ligand mimetic is a PTPRK ligand mimetic which binds at an
allosteric site of PTPRK and inhibits the enzymatic activity of
PTPRK.
In embodiments, a PTPR ligand mimetic is a small chemical molecule.
The term "small chemical molecule" and the like, as used herein,
refers to a molecule that has a molecular weight of less than two
thousand (2000) Daltons. In embodiments, a small chemical molecule
is a molecule that has a molecular weight of less than one thousand
(1000) Daltons. In other embodiments, a small chemical molecule is
a molecule that has a molecular weight of less than five hundred
(500) Daltons. In other embodiments, a small chemical molecule is a
molecule that has a molecular weight of less than five hundred
(500) Daltons. In other embodiments, a small chemical molecule is a
molecule that has a molecular weight of less than one hundred (100)
Daltons. In embodiments, the PTPR ligand mimetic is a small
chemical molecule PTPRK ligand mimetic and inhibits the enzymatic
activity of PTPRK. In embodiments, the PTPR ligand mimetic is a
small chemical molecule PTPRK ligand mimetic which binds at an
allosteric site of PTPRK and inhibits the enzymatic activity of
PTPRK.
An agent may "target" an RPTP, a nucleic acid (e.g. RNA or DNA) of
an RPTP, or a protein of an RPTP, by binding (e.g. preferentially
binding) to the RPTP, nucleic acid (e.g. RNA or DNA) of an RPTP, or
protein of an RPTP. Where preferentially binding, the agent binds
preferentially compared to its binding to other molecules of a
similar form (e.g. other RPTPs if the agent targets an RPTP). An
agent preferentially binds to a molecule, for example, when the
binding to the targeted molecule is greater than the binding to
other molecules of a similar form. In embodiments, the preferential
binding is 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold,
1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold,
5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold,
40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold,
200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold,
800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold,
5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10000 fold,
100,000-fold, 1,000,000-fold greater. In embodiments, an agent
targets an RPTP, a nucleic acid (e.g. RNA or DNA) of an RPTP, or a
protein of an RPTP, when a binding assay or experiment (e.g. gel
electrophoresis, chromatography, immunoassay, radioactive or
non-radioactive labeling, immunoprecipitation, activity assay,
etc.) reveals only an interaction or primarily an interaction with
a single RPTP, a nucleic acid (e.g. RNA or DNA) of a single RPTP,
or a protein of a single RPTP. An agent may also "target" an RPTP,
a nucleic acid (e.g. RNA or DNA) of an RPTP, or a protein of an
RPTP by binding to the RPTP, nucleic acid (e.g. RNA or DNA) of an
RPTP, or protein of an RPTP, by decreasing or increasing the amount
of RPTP in a cell or organism relative to the absence of the agent,
or decreasing the interaction between the RPTP with a physiological
or natural ligand. A person having ordinary skill in the art, using
the guidance provided herein, may easily determine whether an agent
decreases or increases the amount of an RPTP in a cell or
organism.
II. Methods
In a first aspect, there is provided a method of treating an
autoimmune disease in a subject in need thereof, the method
including administering to the subject an effective amount of a
PTPRK antagonist.
In embodiments, the autoimmune disease is a fibroblast mediated
disease, arthritis, rheumatoid arthritis, psoriatic arthritis,
juvenile idiopathic arthritis, multiple sclerosis, systemic lupus
erythematosus (SLE), myasthenia gravis, juvenile onset diabetes,
diabetes mellitus type 1, Guillain-Barre syndrome, Hashimoto's
encephalitis, Hashimoto's thyroiditis, ankylosing spondylitis,
psoriasis, Sjogren's syndrome, vasculitis, glomerulonephritis,
auto-immune thyroiditis, Behcet's disease, Crohn's disease,
ulcerative colitis, bullous pemphigoid, sarcoidosis, psoriasis,
ichthyosis, Graves ophthalmopathy, inflammatory bowel disease,
Addison's disease, Vitiligo, asthma, scleroderma, systemic
sclerosis, or allergic asthma.
In embodiments, the autoimmune disease is arthritis. In
embodiments, the autoimmune disease is rheumatoid arthritis. In
embodiments, the autoimmune disease is psoriatic arthritis.
In embodiments, the disease is non-autoimmune arthritis. In
embodiments, the non-autoimmune arthritis is osteoarthritis.
In embodiments, the autoimmune disease is a fibroblast mediated
disease. The term "fibroblast mediated disease" and the like refer,
in the usual and customary sense, to a disease or disorder
involving the presence or action of a fibroblast, either directly
or via secretions from the fibroblast, as known in the art. In
embodiments, the fibroblast mediated disease is idiopathic
pulmonary fibrosis, fibrotic lung diseases, scleroderma, liver
fibrosis, liver sclerosis, advanced glomerulonephritis, or
nephrosclerosis.
In another aspect, there is provided a method of decreasing
inflammation in a synovium of a subject in need thereof, the method
including administering to the subject an effective amount of a
PTPRK antagonist.
Further to any aspect or embodiment of a method for treating an
autoimmune disease or a method for decreasing inflammation in a
synovium, in embodiments the subject presents with fibroblast-like
synoviocytes that express high levels of PTPRK relative to a
standard control as disclosed herein. In embodiments, the subject
has rheumatoid arthritis. In embodiments, the standard control is
obtained from a disease free subject. In embodiments, the standard
control is obtained from a subject not having rheumatoid
arthritis.
In another aspect, there is provided a method of decreasing
expression of PTPRK in a fibroblast-like synoviocyte, the method
including contacting the fibroblast-like synoviocyte (FLS) with an
effective amount of a PTPRK antagonist.
In embodiments, the method includes decreasing TNF activity, PDGF
activity or IL-1 activity. In embodiments, the method includes
decreasing TNF activity. In embodiments, the method includes
decreasing PDGF activity. In embodiments, the method including
decreasing IL-1 activity.
In embodiments, the method includes decreasing expression of TNF
activity, PDGF activity or IL-1 activity. In embodiments, the
method includes decreasing expression of TNF activity. In
embodiments, the method includes decreasing expression of PDGF
activity. In embodiments, the method including decreasing
expression of IL-1 activity.
In another aspect, there is provided a method of decreasing
invasiveness or migration of a fibroblast-like synoviocyte, the
method including contacting the fibroblast-like synoviocyte with an
effective amount of a PTPRK antagonist.
Further to any aspect or embodiment of a method for decreasing
expression of PTPRK in a fibroblast-like synoviocyte, decreasing
TNF activity, IL-1 activity or PDGF activity in a fibroblast-like
synoviocyte, or decreasing expression of TNF or ILL In embodiments,
the fibroblast-like synoviocyte is a rheumatoid arthritis
fibroblast-like synoviocyte. The term "rheumatoid arthritis
fibroblast-like synoviocyte" refers to an FLS constituted within or
obtained from a subject having rheumatoid arthritis or an FLS that
causes, extends or exacerbates RA or symptoms thereof. In
embodiments, the fibroblast-like synoviocyte expresses high levels
of PTPRK relative to a standard control (e.g., a non-rheumatoid
arthritis fibroblast-like synoviocyte).
Further to any aspect or embodiment disclosed above, in embodiments
the PTPRK antagonist is an anti-PTPRK antibody, an anti-PTPRK
inhibitory nucleic acid or a PTPRK ligand mimetic.
In embodiments, the anti-PTPRK antibody is an anti-PTPRK
extracellular antibody. The term "extracellular antibody" in this
context refers to an antibody which is directed to an extracellular
portion of a target molecule. For example, RPTP.kappa. is expressed
as a transmembrane precursor protein that undergoes proteolytic
cleavage to generate two non-covalently attached subunits, an
N-terminal extracellular subunit, and a C-terminal subunit
containing the intracellular and transmembrane regions and a small
extracellular region. Thus, an anti-PTPRK extracellular antibody is
directed to the extracellular portion of RPTPk.
In embodiments, the anti-PTPRK antibody is an anti-PTPRK dimer
inhibiting antibody or an anti-PTPRK dimerizing antibody. The term
"dimer inhibiting antibody" refers, in the usual and customary
sense, to an antibody which binds a target thereby inhibiting
dimerization of the target to form a dimer of target molecules. The
term "dimerizing antibody" refers, in the usual and customary
sense, to an antibody (e.g., a multivalent antibody, e.g., a
divalent antibody) which can bind a plurality (e.g., two) target
molecules, thereby forming a dimer of target molecules. In
embodiments, the anti-PTPRK antibody is an anti-PTPRK dimer
inhibiting antibody. In embodiments, the anti-PTPRK antibody is an
anti-PTPRK dimerizing antibody.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99% or even 100%) to a contiguous
sequence of SEQ ID NO:1 or SEQ ID NO:2 spanning at least 10
nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, or even greater).
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99% or even 100%) to a contiguous sequence of
SEQ ID NO:1 or SEQ ID NO:2 spanning at least 10 nucleotides (e.g.,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or even
greater).
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% or even 100%) to a contiguous sequence of SEQ ID NO:1
or SEQ ID NO:2 spanning at least 10 nucleotides (e.g., 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or even greater).
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%
or even 100%) to a contiguous sequence of SEQ ID NO:1 or SEQ ID
NO:2 spanning at least 10 nucleotides (e.g., 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, or even greater).
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 96%, 97%,
98%, 99% or even 100%) to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides (e.g., 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or even greater).
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 10 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 15 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 15 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 15 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 15 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 15 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 20 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 20 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 20 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 20 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 20 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 25 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 25 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 25 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 25 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 25 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
50% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 30 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
60% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 30 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
70% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 30 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
80% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 30 nucleotides.
In embodiments, the anti-PTPRK inhibitory nucleic acid has at least
90% sequence identity to a contiguous sequence of SEQ ID NO:1 or
SEQ ID NO:2 spanning at least 30 nucleotides.
In embodiments, the PTPRK antagonist is an anti-PTPRK inhibitory
nucleic acid, wherein the anti-PTPRK inhibitory nucleic acid has at
least 90% sequence identity to an at least 10 nucleotide contiguous
sequence of SEQ ID NO: 1, SEQ ID NO:2 or a complementary sequence
thereof
In embodiments, the PTPRK antagonist is a PTPRK ligand mimetic,
wherein the anti-PTPRK ligand mimetic is a peptide or a small
chemical molecule.
III. Pharmaceutical Compositions
In another aspect, there is provided a pharmaceutical composition
including a PTPRK antagonist and a pharmaceutically acceptable
excipient.
In embodiments, the pharmaceutical composition is for treating an
individual who has a disease by administering to the individual a
pharmaceutical composition including a therapeutically effective
amount of a PTPRK antagonist and a pharmaceutically acceptable
excipient. In embodiments, the pharmaceutical composition is for
treating an individual who may be at risk of developing a disease
by administering to the individual a pharmaceutical composition
including a therapeutically effective amount of a PTPRK antagonist
and a pharmaceutically acceptable excipient. In embodiments, the
disease is an autoimmune disease or disorder, cancer, an infectious
disease (e.g. viral, bacterial, parasitic, etc.), an obesity
associated disease, a metabolic disease or disorder, an
inflammatory disease, an immune disease or disorder, or a traumatic
injury. In embodiments, the disease is an inflammatory autoimmune
disease (IAD). In embodiments, the disease is a disease associated
with a patient's joints. In a certain embodiment, the inflammatory
autoimmune disease is rheumatoid arthritis. In embodiments,
increased expression of one or more RPTPs is associated with a
disease or a risk of developing the disease. In embodiments,
decreased expression of one or more RPTPs is associated with a
disease or a risk of developing the disease. In embodiments, the
increased expression of a first RPTP and the decreased expression
of a second RPTP is associated with a disease or a risk of
developing the disease.
The PTPRK antagonist may be an anti-PTPRK antibody. In embodiments,
the PTPRK antagonist is an anti-PTPR inhibitory nucleic acid. In
embodiments, the anti-PTPR inhibitory nucleic acid is an anti-PTPR
RNAi molecule. In embodiments, the anti-PTPR inhibitory nucleic
acid is an antisense nucleic acid such as anti-PTPR antisense
nucleic acid. In embodiments, the PTPRK antagonist is a PTPR ligand
mimetic. In embodiments, the PTPR ligand mimetic is a peptide or a
small chemical molecule. In embodiments, the PTPR ligand mimetic is
an allosteric inhibitor. In embodiments, the PTPRK antagonist is an
anti-PTPRK antisense nucleic acid. In embodiments, the PTPRK
antagonist is anti-PTPRK antisense nucleic acid.
In embodiments, the pharmaceutical composition is useful for
treating an individual who has or may be at risk of developing an
inflammatory autoimmune disease. In embodiments, the pharmaceutical
compositions are useful for treating an individual who has an
inflammatory autoimmune disease by administering to the individual
a pharmaceutical composition including a therapeutically effective
amount of a PTPRK antagonist and a pharmaceutically acceptable
excipient. In embodiments, the pharmaceutical compositions are for
treating an individual who may be at risk of developing an
autoimmune disease by administering to the individual a
pharmaceutical composition including a therapeutically effective
amount of a PTPRK antagonist and a pharmaceutically acceptable
excipient. In embodiments, the inflammatory autoimmune disease is
an arthritis. In embodiments, the autoimmune disease is fibroblast
mediated disease, arthritis, rheumatoid arthritis, psoriatic
arthritis, juvenile idiopathic arthritis, multiple sclerosis,
systemic lupus erythematosus (SLE), myasthenia gravis, juvenile
onset diabetes, diabetes mellitus type 1, Guillain-Barre syndrome,
Hashimoto's encephalitis, Hashimoto's thyroiditis, ankylosing
spondylitis, psoriasis, Sjogren's syndrome, vasculitis,
glomerulonephritis, auto-immune thyroiditis, Behcet's disease,
Crohn's disease, ulcerative colitis, bullous pemphigoid,
sarcoidosis, psoriasis, ichthyosis, Graves ophthalmopathy,
inflammatory bowel disease, Addison's disease, Vitiligo, asthma,
scleroderma, systemic sclerosis, or allergic asthma. In
embodiments, the autoimmune disease is rheumatoid arthritis.
The compositions disclosed herein can be administered by any means
known in the art. For example, compositions may include
administration to a subject intravenously, intradermally,
intraarterially, intraperitoneally, intralesionally,
intracranially, intraarticularly, intraprostaticaly,
intrapleurally, intratracheally, intranasally, intravitreally,
intravaginally, intrarectally, topically, intratumorally,
intramuscularly, intrathecally, subcutaneously, subconjunctival,
intravesicularlly, mucosally, intrapericardially, intraumbilically,
intraocularly, orally, locally, by inhalation, by injection, by
infusion, by continuous infusion, by localized perfusion, via a
catheter, via a lavage, in a creme, or in a lipid composition.
Administration can be local, e.g., to the joint or systemic.
Solutions of the active compounds as free base or pharmacologically
acceptable salt can be prepared in water suitably mixed with a
surfactant, such as hydroxypropylcellulose. Dispersions can also be
prepared in glycerol, liquid polyethylene glycols, and mixtures
thereof and in oils. Under ordinary conditions of storage and use,
these preparations can contain a preservative to prevent the growth
of microorganisms.
Pharmaceutical compositions can be delivered via intranasal or
inhalable solutions or sprays, aerosols or inhalants. Nasal
solutions can be aqueous solutions designed to be administered to
the nasal passages in drops or sprays. Nasal solutions can be
prepared so that they are similar in many respects to nasal
secretions. Thus, the aqueous nasal solutions usually are isotonic
and slightly buffered to maintain a pH of 5.5 to 6.5. In addition,
antimicrobial preservatives, similar to those used in ophthalmic
preparations, and appropriate drug stabilizers, if required, may be
included in the formulation. Various commercial nasal preparations
are known and can include, for example, antibiotics and
antihistamines.
Oral formulations can include excipients as, for example,
pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate, sodium saccharine, cellulose, magnesium carbonate and the
like. These compositions take the form of solutions, suspensions,
tablets, pills, capsules, sustained release formulations or
powders. In embodiments, oral pharmaceutical compositions will
comprise an inert diluent or assimilable edible carrier, or they
may be enclosed in hard or soft shell gelatin capsule, or they may
be compressed into tablets, or they may be incorporated directly
with the food of the diet. For oral therapeutic administration, the
active compounds may be incorporated with excipients and used in
the form of ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like. The percentage
of the compositions and preparations may, of course, be varied and
may conveniently be between about 2 to about 75% of the weight of
the unit, or preferably between 25-60%. The amount of active
compounds in such compositions is such that a suitable dosage can
be obtained
For parenteral administration in an aqueous solution, for example,
the solution should be suitably buffered and the liquid diluent
first rendered isotonic with sufficient saline or glucose. Aqueous
solutions, in particular, sterile aqueous media, are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. For example, one dosage could be
dissolved in 1 ml of isotonic NaCl solution and either added to
1000 ml of hypodermoclysis fluid or injected at the proposed site
of infusion
Sterile injectable solutions can be prepared by incorporating the
active compounds or constructs in the required amount in the
appropriate solvent followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium. Vacuum-drying and freeze-drying techniques,
which yield a powder of the active ingredient plus any additional
desired ingredients, can be used to prepare sterile powders for
reconstitution of sterile injectable solutions. The preparation of
more, or highly, concentrated solutions for direct injection is
also contemplated. DMSO can be used as solvent for extremely rapid
penetration, delivering high concentrations of the active agents to
a small area.
There are provided methods of treating, preventing, and/or
ameliorating an autoimmune disorder in a subject in need thereof,
optionally based on the diagnostic and predictive methods described
herein. The course of treatment is best determined on an individual
basis depending on the particular characteristics of the subject
and the type of treatment selected. The treatment, such as those
disclosed herein, can be administered to the subject on a daily,
twice daily, bi-weekly, monthly or any applicable basis that is
therapeutically effective. The treatment can be administered alone
or in combination with any other treatment disclosed herein or
known in the art. The additional treatment can be administered
simultaneously with the first treatment, at a different time, or on
an entirely different therapeutic schedule (e.g., the first
treatment can be daily, while the additional treatment is
weekly).
Administration of a composition for ameliorating the autoimmune
disease can be a systemic or localized administration. For example,
treating a subject having an autoimmune disorder can include
administering an oral or injectable form of PTPRK antagonist on a
daily basis or otherwise regular schedule. In embodiments, the
treatment is only on an as-needed basis, e.g., upon appearance of
autoimmune disease symptoms.
In embodiments, the PTPRK antagonist is an anti-PTPRK antibody, an
anti-PTPRK inhibitory nucleic acid or a PTPRK ligand mimetic. In
embodiments, the PTPRK antagonist is an anti-PTPRK antibody. In
embodiments, the PTPRK antagonist is an anti-PTPRK inhibitory
nucleic acid. In embodiments, the PTPRK antagonist is a PTPRK
ligand mimetic.
In embodiments, the PTPRK antagonist is an anti-PTPRK extracellular
antibody.
In embodiments, the anti-PTPRK antibody is an anti-PTPRK dimer
inhibiting antibody or an anti-PTPRK dimerizing antibody.
In embodiments, the PTPRK antagonist is an anti-PTPRK inhibitory
nucleic acid, wherein the anti-PTPRK inhibitory nucleic acid as set
forth above, including all embodiments thereof.
In embodiments, the PTPRK antagonist is a PTPRK ligand mimetic,
wherein the anti-PTPRK ligand mimetic is a peptide or a small
chemical molecule.
Any appropriate element disclosed in one aspect or embodiment of a
method or composition disclosed herein is equally applicable to any
other aspect or embodiment of a method or composition. For example,
the therapeutic agents set forth in the description of the
pharmaceutical compositions provided herein are equally applicable
to the methods of treatment and vice versa.
IV. EXAMPLES
Experimental Methods
Statistics. Two-tailed statistical analyses were performed using
GraphPad Prism software (GraphPad Software, La Jolla, Calif.).
Unless indicated otherwise, a comparison was considered significant
if p was less than 0.05.
Preparation of FLS. FLS lines were obtained from the UCSD Clinical
and Translational Research Institute (CTRI) Biorepository. Each FLS
line used in this study had been previously obtained from a
different patient with either RA or OA. Discarded synovial tissue
from patients with OA and RA had been obtained at the time of total
joint replacement or synovectomy, as previously described. See
e.g., Alvaro-Gracia, J. M. et al., 1991. Journal of immunology
146:3365-3371. The diagnosis of RA conformed to American College of
Rheumatology 1987 revised criteria. See e.g., Arnett, F. C. et al.,
1988. Arthritis and rheumatism 31:315-324. FLS were cultured in
DMEM (Mediatech, Manassas, Va.) with 10% fetal bovine serum (FBS,
Omega Scientific, Tarzana, Calif.), 2 mM L-glutamine, 50 .mu.g/mL
gentamicin, 100 units/ml of penicillin and 100 .mu.g/ml
streptomycin (Life Technologies, Carlsbad, Calif.) at 37.degree. C.
in a humidified 5% CO.sub.2 atmosphere. Cells in this study were
synchronized in 0.1% FBS (serum-starvation media) for 48 hr prior
to analysis or functional assays.
Antibodies and Other Reagents. The rabbit anti-RPTP.kappa. antibody
was a kind gift from Axel Ullrich (Max Planck Institute of
Biochemistry). The anti-cadherin-11 antibody was purchased from
Life Technologies. All other primary antibodies were purchased from
Cell Signaling Technology (Danvers, Mass.). Secondary antibodies
were purchased from GE Healthcare Life Sciences (Pittsburgh, Pa.).
TGF.beta.1, TNF.alpha., IL-1.beta. and PDGF-BB were purchased from
eBioscience (San Diego, Calif.). Control non-targeting, anti-PTPRK
and anti-PTPRM antisense oligonucleotides (ASO) were purchased from
Gene Tools, LLC (Philomath, Oreg.). Chemical inhibitors PP2 and
U73122 were purchased from EMD Millipore (Billerca, Mass.).
Horseradish peroxidase (HRP)-conjugated S protein was purchased
from EMD Millipore. Unless otherwise specified, chemicals and all
other reagents were purchased from Sigma-Aldrich.
Quantitative Real-Time RT-PCR (qPCR). PTPRK expression can be
assessed by qPCR normalized, e.g., to the housekeeping gene RPII,
and plotted relative to the PTPRK expression in a control, e.g.,
Ctl ASO-treated cells. Following treatment of RA FLS for a given
time, e.g., 7 days, with 2.5 .mu.M Ctl or PTPRK ASO, TGFB1
expression can be assessed by qPCR, normalized to the housekeeping
gene RPII, and plotted relative to the TGFB1 expression in Ctl
ASO-treated cells.
Following cell synchronization for 48 hr, cells were stimulated as
indicated for 24 hr or left unstimulated. RNA was extracted using
RNeasy.RTM. Kits (Qiagen, Valencia, Calif.). cDNA was synthesized
using the SuperScript.RTM. III First-Strand Synthesis SuperMix for
qRT-PCR (Life Technologies, Carlsbad, Calif.). qPCR was performed
using a Roche Lightcycler.RTM. 480 (Indianapolis, Ind.), with
individual primer assays and SYBR.RTM. Green qPCR Mastermix
purchased from SABiosciences/Qiagen. Efficiency of the primer
assays was guaranteed by the manufacturer to be greater than 90%.
Each reaction was measured in triplicate and data was normalized to
the expression levels of the house-keeping gene RNA Polymerase II
(RPII) (Radonic, A. et al., 2004. Biochemical and biophysical
research communications 313:856-862), also measured in triplicate.
Absence of genomic DNA contamination was confirmed using control
reactions lacking the reverse transcriptase enzyme during the cDNA
synthesis step.
Sequences of ASOs disclosed herein include:
TABLE-US-00001 (SEQ ID NO: 3) PTPRK ASO: TCTTAATCACAACCTACCACAAGGA;
(SEQ ID NO: 4) PTPRK_2 ASO: ACAGCAAAGTATGAGCATACCATCT; (SEQ ID NO:
5) PTPRM ASO: TAAAGACAACTTACTACATGGATGT; (SEQ ID NO: 6) Control
ASO: CCTCTTACCTCAGTTACAATTTATA
Cell Lysis for Western Blotting and RPTP.kappa.
Immunoprecipitation. RPTP.kappa. can be immunoprecipitated from RA
FLS using an anti-RPTP.kappa. antibody that recognizes the
juxtamembrane region of the protein. Both the full-length precursor
(210 kDa) and membrane-bound intracellular furin-cleavage product
(110 kDa) can be detectable. RPTP.kappa. is expressed in RA
synovial lining. The expression of PTPRK and a positive control
(e.g., IL6) can be measured by qPCR in RA and OA FLS lines
following cell stimulation with e.g., 50 ng/ml TNF or 2 ng/ml
interleukin 1 (IL-1.beta.) for 24 hr.
Cells were lysed in RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM
NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing 1 mM
phenylmethanesulfonyl fluoride, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, 10 .mu.g/ml soybean trypsin inhibitor, 1-10 mM sodium
orthovanadate, 5 mM sodium fluoride and 2 mM sodium pyrophosphate.
Protein concentration of cell lysates was determined using the
Pierce BCA Protein Assay Kit (Thermo Scientific, Rockford,
Ill.).
Immunohistochemistry of Synovial Tissue. Paraffin embedded slides
of human RA synovial tissue were obtained from the UCSD CTRI
Biorepository. Slides were pretreated for 10 min with boiling
citrate antigen retrieval buffer (1.9 mM citric acid, 10 mM
Tris-sodium citrate pH 6.0) before being treated with 3%
H.sub.2O.sub.2 for 10 min. Slides were then blocked with 5% goat
serum for 1 hr at room temperature. Rabbit anti-RPTP.kappa.
antibody or goat anti-rabbit IgG (1:100 in 5% bovine serum albumin
[BSA]) were incubated with the slides overnight at 4.degree. C. The
slides were then washed and incubated with peroxidase-linked goat
anti-rabbit IgG secondary antibody (Life Technologies, 1:300 in 5%
BSA) for 1 hr, and then incubated for 5 min with
3,3'-diaminobenzidine substrate (Sigma-Aldrich). Slide images were
obtained using an Eclipse 80i microscope (Nikon, Melville,
N.Y.).
FLS Treatment with ASO. Cells were treated with 2.5 .mu.M ASO for a
total of 7 days. ASO was replaced in fresh culture medium after 3 d
and replaced in cell synchronization medium after 5 days. After ASO
treatment, cells can be stimulated with additional agent, e.g., 50
ng/ml TGF.beta.1, or left unstimulated, in the presence of ASO for
24 hr.
FLS Transwell Invasion Assays. The in vitro invasion assays were
performed in transwell systems as previously described (Laragione,
T. et al., 2008. Arthritis and rheumatism 58:2296-2306; Tolboom, T.
C. et al., 2005. Arthritis and rheumatism 52:1999-2002). RA FLS
were pre-treated with ASO for 5 days, and synchronized in the
presence of ASO for an additional 2 days, and then subjected to the
invasion assays. FLS (2.5-5.times.10.sup.5) were resuspended in
assay media (DMEM with 0.5% BSA) and allowed to invade through BD
BioCoat.TM. GFR Matrigel.TM. Invasion Chambers (BD Biosciences) in
response to 50 ng/ml platelet-derived growth factor BB (PDGF-BB)
for 24 hr. For visualization, cells were either pre-stained with 2
.mu.M CellTracker Green.TM. (Life Technologies) or stained
post-invasion with 2 .mu.M Hoechst (Life Technologies) for 30 min
at room temperature. Fluorescence of invading cells on each
membrane was visualized using an Eclipse 80i microscope. Images
were acquired from 4 non-overlapping fields per membrane, and
invading cells in each field were counted using ImageJ software.
Each experiment included 3-4 membranes per sample.
FLS Transwell Migration Assays. The transwell migration assays were
performed similarly to the invasion assays. For experiments with
ASO, RA FLS were pre-treated with ASO for 5 days, and synchronized
in the presence of ASO for an additional 2 days. For experiments
with chemical inhibitors, cells were synchronized for 48 hr and
then pre-treated with compound or dimethylsulfoxide (DMSO) for 30
min. FLS were allowed to migrate through uncoated transwell
chambers in response to 5% FBS for the times indicated in the
figure legend. For visualization, cells were either pre-stained
with 2 .mu.M CellTracker Green.TM. or stained post-invasion with 2
.mu.M Hoechst for 30 in at room temperature. Fluorescence of
migrating cells on each membrane was visualized as above. Each
experiment included 3-4 membranes per sample.
FLS Modified Spheroid Migration Assay. The modified spheroid
migration assays were performed as in (Bartok, B. et al., 2014. J
Immunol 192:2063-2070). RA FLS were pre-treated with ASO for 5
days, and synchronized in the presence of ASO for an additional 2
days. Cells were resuspended at a concentration of 1.times.10.sup.6
cells/50 .mu.l in DMEM. Cells (2 .mu.l) were mixed at 1:1 in 4
mg/ml growth factor-reduced BD Matrigel Matrix (BD Biosciences),
pipetted as a spot in a 24-well tissue culture dish, and incubated
at 37.degree. C. for 15 min to gel. Serum-starvation medium with or
without PDGF-BB (10 ng/ml) was added. Cell movement concentrically
was monitored after 2 d. At the end of the experiment, cells were
fixed and stained using the Hemacolor staining kit (EMD Millipore).
Images were acquired from 4 fields per spot, and migrated cells
were counted using ImageJ software.
FLS Spreading and Adhesion Assays. RA FLS were pre-treated with ASO
for 5 days, and synchronized in the presence of ASO for an
additional 2 days. Equal cell numbers were then resuspended in FLS
medium containing 5% FBS and allowed to adhere onto circular
coverslips coated with 20 .mu.g/ml fibronectin (FN) at 37.degree.
C. for 15 min (adhesion assays) or 15, 30 and 60 min (spreading
assays). Following the incubation period, cells were fixed in 4%
para-formaldehyde for 5 min, permeabilized in 0.2% Triton X-100 for
2 min, and stained with 5 U/ml Alexa Fluor.RTM. 568 (AF
568)-conjugated phalloidin and 2 .mu.g/ml Hoechst for 20 min each
(Life Technologies). Samples were imaged with an Olympus FV10i
Laser Scanning Confocal microscope (Olympus, Center Valley, Pa.).
Using the FV10i acquisition software, each circular coverslip of
cells was separated into four nine-paneled mega-images. Each panel
(1024.times.1024) was optically acquired with a 10.times. objective
using the FV10i acquisition software and stitched together, through
a 10% overlap, with the Olympus FluoView.TM. 1000 imaging software.
Total cell number and cell areas for each panel were calculated
using Image Pro Analyzer software (Media Cybernetics, Rockville,
Md.).
FLS Survival and Apoptosis Assay. RA FLS were pre-treated with ASO
for 5 days, and synchronized in the presence of ASO for an
additional 2 days. Cells were washed and incubated for an
additional 24 h in serum-starvation media. Adherent and
non-adherent cells were collected and stained with Annexin V-Alexa
Fluor.RTM. 647 (AF 647) and propidium iodide according to the
manufacturer's instructions (Biolegend, San Diego, Calif.). Cell
fluorescence was assessed by FACS using a BD LSR-II (BD
Biosciences).
Synovial Micromass Organ Cultures. ASOs disclosed herein can enable
efficient knockdown of RPTP.kappa.. For example, RA FLS can be
treated with 2.5 .mu.M Ctl or PTPRK_2 ASO for 7 days. PTPRK
expression can be assessed by qPCR, normalized to the housekeeping
gene RPII, and plotted relative to the PTPRK expression in Ctl
ASO-treated cells. Following treatment with 2.5 .mu.M Ctl or
PTPRK_2 ASO for 7 d, RA FLS can be assayed for invasion through
Matrigel-coated transwell chambers in response to 50 ng/ml PDGF-BB
for 24 hr. PTPRM ASO enables efficient knockdown of PTPRM. RA FLS
can be treated with 2.5 .mu.M Ctl or PTPRM ASO for 7 days. PTPRM
expression can be assessed by qPCR, normalized to the housekeeping
gene RPII, and plotted relative to the PTPRM expression in Ctl
ASO-treated cells. Panel shows mean.+-.range. Following treatment
with 2.5 .mu.M Ctl or PTPRM ASO for 7 d, RA FLS can be assess for
invasion through Matrigel-coated transwell chambers in response to
50 ng/ml PDGF-BB for 24 hr. Following treatment with ASO (e.g., Ctl
ASO or PTPRK ASO) and cell synchronization, RA FLS can be
serum-starved (FLS medium with 0.1% FBS) for an additional 24 hr.
Cells can be collected and stained (e.g., with Annexin V and PI),
and cell fluorescence can be assessed by FACS.
Accordingly, synovial organ cultures were prepared as described in
(Kiener, H. P. et al., 2009. Arthritis and rheumatism
60:1305-1310). RA FLS were suspended in ice-cold Matrigel Matrix
(BD Biosciences) at 2.times.10.sup.6 cells/ml. Twenty-five-.mu.l
droplets of the suspension were placed onto culture dishes coated
with poly-2-hydroxyethyl-methacrylate (Aldrich Chemical Co.,
Milwaukee, Wis.) and allowed to gel for 30 minutes at 37.degree. C.
Gels were overlaid with FLS culture medium supplemented with
nonessential amino acid solution, ITS
(Insulin-Transferrin-Selenium, Life Technologies) and 0.1 mM
ascorbic acid. The floating three-dimensional culture was
maintained for 3 weeks, with the medium replaced twice per week.
After 2 weeks, 2.5 .mu.M Ctl or PTPRK ASO was added to the medium
to induce knockdown (KD) of PTPRK expression during the final week
of culture. Micromasses were fixed in 10% neutral buffered
formalin, embedded in paraffin, sectioned at 6 micron-thick
sections, and stained with hematoxylin and eosin.
Beta-Catenin and SMAD3 Subcellular Localization Assays. Following
treatment with ASO (e.g., Ctl ASO or PTPRK ASO over time (e.g., 5-7
days), RA FLS can be stimulated with 50 ng/ml TGF.beta.1 for 5, 15,
30 or 60 min, or left unstimulated. Assay by Western blotting of
cell lysates can be conducted with anti-phospho-SMAD3 and
anti-SMAD3 antibodies, phalloidin and Hoechst and can be imaged by
immunofluorescence microscopy.
Accordingly, RA FLS were plated on glass coverslips. Cells were
pre-treated with ASO for 5 days, and synchronized in the presence
of ASO for an additional 2 days. Cells were then stimulated with 50
ng/ml TGF.beta.1 for 30 min or 24 hr, or left unstimulated, and
then fixed in 4% para-formaldehyde for 5 min, permeabilized in 0.2%
Triton X-100 for 2 min, and stained for 1 hr each with anti-SMAD3
antibody (Cell Signaling Technology) and anti-beta-catenin antibody
(BD Biosciences), and AF 488 goat anti-rabbit secondary antibody
and AF 647 goat anti-mouse secondary antibody (Life Technologies).
Cells were then stained with 5 U/ml AF 568-conjugated phalloidin
and 2 .mu.g/ml Hoechst for 20 min each. Samples were imaged with an
Olympus FV10i Laser Scanning Confocal microscope (Olympus, Center
Valley, Pa.). Using the FV10i acquisition software, each circular
coverslip of cells was imaged by using 3 random fields of view and
acquiring a stitched nine paneled mega-image. Each panel
(1024.times.1024) was optically acquired with a 60.times. objective
using the FV10i acquisition software and stitched together, through
a 10% overlap, with the Olympus FluoView.TM. 1000 imaging software.
Each mega-image was then further processed, post stitching, using
Image Pro Analyzer software (Media Cybernetics, MD). Using Image
Pro, the original mega images were used to first automatically
define nuclear localization by masking the Hoechst nuclear signal
then isolating the fluorescence of either SMAD3 or beta-catenin
signal localized within the nucleus mask. Cytoplasmic signals were
defined by removing the masked nuclear signal from the images and
thus quantifying the remaining cytoplasmic signal of SMAD3 or
beta-catenin. Total area of nuclear and cytoplasmic fluorescence
label of either SMAD3 or beta-catenin were calculated.
COS-1 Transfection. cDNA encoding C-terminally HA-tagged wild type
(WT) or catalytically inactive (C1100S) RPTP.kappa. (NM 008983.2)
was cloned into the pcDNA3.1(+) vector. COS-1 cells were cultured
in DMEM with 10% FBS, 100 units/ml of penicillin and 100 .mu.g/ml
streptomycin. Cells were transfected with Lipofectamine 3000 (Life
Technologies) according to the manufacturer's protocol, and
harvested after 2 d for analysis.
In vitro Pull-Down Assay. HA-tagged WT RPTP.kappa. was
overexpressed in COS-1 cells. Cells were lysed in THE buffer (20 mM
Tris-HCl pH 7.5, 150 mM NaCl, 5 mM EDTA pH 8.0 and 1% NP-40)
containing 10 .mu.g/mL aprotinin, 10 .mu.g/mL leupeptin, 10
.mu.g/mL soybean trypsin inhibitor, and 1 mM phenylmethylsulfonyl
fluoride. RPTP.kappa. was immunoprecipitated using anti-HA antibody
(Covance, Princeton, N.J.). RA FLS were lysed in RIPA buffer
containing 10 .mu.g/mL aprotinin, 10 .mu.g/mL leupeptin, 10
.mu.g/mL soybean trypsin inhibitor, 1 mM phenylmethylsulfonyl
fluoride and 5 mM iodoacetamide. Lysates were treated with 10 mM
dithiothreitol for 10 min, and then diluted 10-fold in buffer
containing 25 mM Tris-HCl pH 7.6, 150 mM NaCl and 1 mM
ethylenediaminetetraacetic acid. Immunoprecipitates were incubated
with RA FLS lysates for 3 hr at 4.degree. C., washed in the
dilution buffer, and subjected to Western blotting.
Substrate-Trapping Pull-down Assay. Substrate-trapping is a
well-established technique to identify substrates of PTPs (Garton,
A. J. et al., 1996. Mol Cell Biol 16:6408-6418). PTP
substrate-trapping involves mutation of a residue, typically an
aspartic acid essential for catalysis, in the catalytic domain of
the PTP. Substrates can bind the catalytic cleft, but catalysis is
not completed, leading to formation of a complex in which the
substrate is "trapped" by the PTP. SRC is the substrate of
RPTP.kappa. in RA FLS. A substrate-trapping mutant of iPTP.kappa.
(D1051A) can trap SRC from RA FLS. Agarose-bound
S-tagged-iPTP.kappa.-D1051A can be incubated in vitro with RA FLS
lysates, and the pull-down can be subjected to Western blotting and
probed using HRP-conjugated S-protein. RA FLS can be stimulated
with 100 .mu.M pervanadate for 15 min immediately prior to lysis.
RPTP.kappa. dephosphorylates a SRC Y527 phospho-peptide.
Immunoprecipitated wild type (WT) or catalytically inactive C1100S
(C/S) HA-tagged RPTP.kappa. can be incubated in vitro with SRC
pY527 peptide for 30 min. The reaction can be stopped with addition
of Biomol Green.
Accordingly, cDNA (codon optimized for expression in E. coli
[Genscript, Piscataway, N.J.]) encoding a substrate-trapping mutant
of the catalytic domain of RPTP.kappa. (iPTPK-D1051A, aa865-1156 of
NP_002835.2) was cloned into the pET30c vector.
S-tagged-iPTPK-D1051A was isolated from E. coli using S-protein
agarose (EMD Millipore). RA FLS were lysed in RIPA buffer
containing 10 .mu.g/mL aprotinin, 10 .mu.g/mL leupeptin, 10
.mu.g/mL soybean trypsin inhibitor, 1 mM phenylmethylsulfonyl
fluoride and 5 mM iodoacetamide. Lysates were treated with 10 mM
dithiothreitol for 10 min, and then diluted 10-fold in buffer
containing 25 mM Tris-HCl pH 7.6, 150 mM NaCl and 1 mM
ethylenediaminetetraacetic acid. Agarose-bound
S-tagged-iPTP.kappa.-D1051A was incubated with RA FLS lysates for 3
hr at 4.degree. C., washed in the dilution buffer, and subjected to
Western blotting.
In vitro PTP Assay. HA-tagged WT and catalytically inactive mutant
C1100S (C/S) RPTP.kappa. were overexpressed in COS-1 cells. Cells
were lysed in HNE buffer (50 mM Hepes, pH 7.4, 150 mM NaCl, 5 mM
EDTA and 1% Triton-X) containing 10 .mu.g/mL aprotinin, 10 .mu.g/mL
leupeptin, 10 .mu.g/mL soybean trypsin inhibitor, 1 mM
phenylmethylsulfonyl fluoride. RPTP.kappa. was immunoprecipitated
using anti-HA antibody. Immunoprecipitates were washed extensively
in 50 mM Bis-Tris pH 6.0, and incubated with 50 mM Bis-Tris pH 6.0
and 5 mM DTT for 30 min at 4.degree. C. Immunoprecipitates were
divided into triplicate reactions and incubated with 0.2 mM
phospho-SRC Y527 peptide [H-TSTEPQ-pY-QPGENL-OH] (Anaspec, Fremont,
Calif.) in 50 mM Bis-Tris pH 6.0, 5 mM DTT and 0.005% Tween-20 at
37.degree. C. for 30 min. Reactions were stopped with the addition
of Biomol Green (Enzo Life Sciences, Plymouth Meeting, Pa.), and
absorbance of the solution was measured at 620 nm using a Tecan
M1000 plate-reader (Tecan Systems, San Jose, Calif.). PTP activity
was plotted as absorbance following subtraction of absorbance from
the blank reactions (control anti-HA immunoprecipitations from
lysates of cells transfected with empty vector), also measured in
triplicate.
In vivo Invasion Assay. The in vivo invasion assay was performed as
described in (You, S. et al., 2014. Proceedings of the National
Academy of Sciences of the United States of America 111:550-555)
Skin inflammation was induced in athymic nude mice by
subcutaneously injecting 120 .mu.g complete Freund's adjuvant (CFA)
in each flank. The next day, 5.times.10.sup.5 RA FLS pretreated
with Ctl or PTPRK ASO were intradermally implanted 1.2 cm distance
from the CFA injection sites (each mouse was injected with Ctl
ASO-treated cells in one flank and PTPRK ASO-treated cells in the
contralateral flank). After 5 days, the skin regions between the 2
injection sites was harvested, and FLS invasion from the
implantation site towards the inflammation site was assessed by
immunohistochemical staining with an anti-HLA Class I antibody
(Abcam, Cambridge, Mass.) Skin samples were frozen in optimal
cutting temperature compound (OCT), and 2 cryosections from
immediately adjacent the CFA injection site were obtained from each
skin sample. Cryosections were fixed in 4% para-formaldehyde for 10
min and pretreated for 10 min with boiling citrate antigen
retrieval buffer (1.9 mM citric acid, 10 mM Tris-sodium citrate, pH
6.0) before being treated with 3% H.sub.2O.sub.2 for 10 min. Slides
were blocked with 5% BSA overnight at 4.degree. C., then incubated
with anti-human HLA Class I antibody (1:200 in 5% BSA) for 1 hr at
room temperature. The slides were then washed and incubated with
peroxidase-conjugated anti-mouse IgG from Vector Laboratories for
30 min at room temperature, and then incubated for 5 minutes with
3,3'-diaminobenzidine substrate and stained with hematoxylin.
Samples were then imaged using a BZ-9000E microscope (Keyence,
Itasca, Ill.). The numbers of invaded FLS, recognized by staining
with the anti-human HLA Class I antibody, in each 20.times. field
were manually counted.
Experimental Results and Discussion
Example 1
PTPRK Expression is Upregulated in RA FLS
Comparison of PTP expression in FLS from 3 RA and 3 OA patients
revealed increased PTPRK mRNA in RA FLS. PTPRK encodes the receptor
PTP.kappa. (RPTP.kappa.), a transmembrane PTP reported to regulate
cell growth and migration through dephosphorylation of protein
tyrosine kinases, cadherin family proteins, and beta-catenin. See
e.g., Wang, S. E. et al., 2005. Mol Cell Biol, 25:4703-4715;
Novellino, L. et al., 2008. Cell Signal, 20:872-883; Xu, Y. et al.,
2009. J Cell Biochem, 107:873-880. RPTP.kappa. is expressed as a
transmembrane precursor protein that undergoes furin-mediated
proteolytic cleavage to generate two non-covalently attached
subunits, an N-terminal extracellular subunit, and a C-terminal
subunit containing the intracellular and transmembrane regions and
a small extracellular region. See e.g., Jiang, Y. P. et al., 1993.
Mol Cell Biol, 13:2942-2951. RPTP.kappa. belongs to a transmembrane
PTP subfamily, including RPTP.mu.(encoded by PTPRM), RPTP.rho.
(encoded by PTPRT) and RPTP.psi. (encoded by PTPRU), characterized
by an extracellular region of a Meprin-A5-protein PTP.mu. domain,
an Immunoglobulin-like domain, and 4 Fibronectin III-type repeats,
and an intracellular region containing a juxtamembrane region and
two tyrosine PTP domains, of which only the first has catalytic
activity. See e.g., Andersen, J. N. et al., 2001. Molecular and
cellular biology, 21:7117-7136. Although PTPRM is also highly
expressed in FLS (Stanford, S. M. et al., 2013. Arthritis Rheum,
65:1171-1180), we did not detect differential expression of this
gene, or any other transmembrane PTP, between RA and OA FLS.
The expression of PTPRK was retested in a further set of FLS lines
from 13 RA and 12 OA patients, confirming significantly increased
(1.86-fold) PTPRK expression in RA FLS (FIG. 1A). Using an antibody
recognizing the RPTP.kappa. intracellular juxtamembrane region, we
detected the presence of both the RPTP.kappa. precursor (210 kDa)
and C-terminal cleavage product in RA FLS, and importantly,
increased expression of RPTP.kappa. protein in RA compared to OA
FLS (FIG. 1B).
To verify RPTP.kappa. expression in the primary rheumatoid synovial
lining, we performed immunohistochemistry on synovial sections
obtained from biopsies of RA patients. RPTP.kappa. expression was
detected in the rheumatoid synovium, with prominent expression in
the synovial intimal lining. See FIG. 5.
Example 2
PTPRK Overexpression in RA FLS is TGFB1-dependent
It has been reported that RA FLS express higher levels of TGFB1
than OA FLS. See e.g., Pohlers, D. et al., 2007. Arthritis Res
Ther, 9:R59. As PTPRK is a reported TGF.beta./SMAD target gene
(Wang, S. E. et al., 2005, Id.), without wishing to be bound by any
theory we reasoned that the increased PTPRK expression in RA FLS
may be due to increased expression of TGFB1. Accordingly, PTPRK and
PTPRM mRNA expression in RA FLS were measured following cell
stimulation with 50 ng/ml recombinant TGF.beta.1 for 24 hr. The
expression of PTPRK, and as a positive control IL6, was measured by
qPCR in 8 RA and 8 OA FLS lines following cell stimulation with 50
ng/ml TNF or 2 ng/ml interleukin 1 (IL-1.beta.) for 24 hr. PTPRK,
but not PTPRM, expression was increased 1.90-fold in response to
treatment of cells with TGF.beta.1 but not in response to the
inflammatory cytokines tumor necrosis factor (TNF) or interleukin 1
(IL-1).
We next confirmed the trend of increased expression of TGFB1 in RA
FLS. See e.g., Pohlers, D. et al., 2007. Id. PTPRK and TGFB1 mRNA
expression in FLS was measured, which provided a significant
positive correlation between the expression levels of PTPRK and
TGFB1 in the RA FLS (Spearman r=0.5824, p<0.05), but not in the
OA FLS.
We then tested if this was due to TGFB1-mediated upregulation of
PTPRK, or to PTPRK-mediated potentiation of TGFB1 expression.
Cell-permeable antisense oligonucleotide (ASO) enables efficient
knockdown of PTPRK expression in RA FLS. RA FLS were treated with
2.5 .mu.M control (Ctl) or PTPRK ASO for 7 days. After 6 days of
ASO treatment, cells were stimulated with 50 ng/ml TGF.beta.1, or
left unstimulated, in the presence of ASO for 24 hr. Accordingly,
we subjected RA FLS to knockdown of PTPRK expression using
cell-permeable antisense oligonucleotide (ASO) targeted against
PTPRK (PTPRK ASO), and found TGFB1 expression was unaffected by
PTPRK deficiency. RA FLS were treated with 25 .mu.M SB505124 or
DMSO for 30 min, then stimulated with 10 ng/ml TGF.beta.1 or left
unstimulated for 24 hr, which showed that, in contrast, treatment
of RA FLS with the TGF.beta. type 1 receptor chemical inhibitor
SB505124 reduced the basal and TGF.beta.-stimulated levels of
PTPRK.
Example 3
RPTP.kappa. Promotes Invasiveness of RA FLS
We next tested if reduction in RPTP.kappa. expression could inhibit
the ex vivo invasiveness of RA FLS, a phenotype correlated with
radiographic damage in RA. See e.g., Tolboom, T. C. et al., 2005,
Id. We subjected the ASO-treated RA FLS to transwell invasion
assays through Matrigel matrix in response to platelet-derived
growth factor (PDGF), a prominent growth factor in the RA synovium
that promotes FLS invasiveness. See e.g., Bottini, N., &
Firestein, G. S. 2013. Id. Following treatment with control (Ctl)
or PTPRK ASO for 7 d, RA FLS invaded through Matrigel-coated
transwell chambers in response to 50 ng/ml PDGF-BB for 24 hr. RA
FLS treated with PTPRK ASO, compared to control non-targeting
ASO-treated cells, were significantly less invasive in response to
PDGF (FIG. 1C). The effect was replicated by treatment of RA FLS
with a second PTPRK-targeted ASO (PTPRK_2 ASO) (see e.g., FIG.
6A-6B), but not by treatment of cells with a PTPRM-targeted
ASO.
We next assessed the effect of PTPRK ASO on RA FLS migration. PTPRK
ASO-treated cells showed significantly reduced migration in a
transwell assay in response to 5% fetal bovine serum (FBS) (FIG.
1D), and out of a sphere of Matrigel in response to PDGF (FIG. 1E).
We hypothesized this effect was due to increased cell death or
reduced cytoskeletal reorganization following RPTP.kappa.
knockdown. Treatment of RA FLS did not increase cell apoptosis or
necrosis, but significantly reduced cell spreading (FIG. 1F).
Example 4
RPTP.kappa. Promotes RA FLS Migration Through Dephosphorylation of
SRC
We investigated the molecular mechanism by which RPTP.kappa.
knockdown impairs invasion and migration of RA FLS in response to
PDGF. We found no reduction in expression of the PDGF receptor
(PDGFR) upon PTPRK ASO treatment. We explored RPTP.kappa. candidate
substrates with a role in cell migration; e.g., RPTPk has been
proposed to interact with cadherin and catenin proteins. See e.g.,
Novellino, L. et al., 2008. Cell Signal, 20:872-883; Lilien, J.,
& Balsamo, J. 2005. Curr Opin Cell Biol, 17:459-465; Anders, L.
et al., 2006. Mol Cell Biol, 26:3917-3934. Cadherin-11 is highly
expressed in FLS and is critical for FLS invasiveness and for
formation and maintenance of the synovial lining. See e.g., Noss,
E. H., & Brenner, M. B., 2008. Immunological reviews,
223:252-270. We detected basal tyrosine phosphorylation of
cadherin-11 immunoprecipitated from RA FLS, which was unaffected by
RPTPk knockdown. Additionally, RPTPk knockdown had no effect on RA
FLS ability to form a synovial lining layer in an in vitro organ
culture. Tyrosine phosphorylation of beta-catenin has been proposed
to promote cell migration and regulate beta-catenin nuclear
recruitment and transcriptional activity. See e.g., Lilien, J.,
& Balsamo, J. 2005. Curr Opin Cell Biol, 17:459-465. However,
we found no increase in beta-catenin tyrosine phosphorylation, nor
alterations in the ratio of beta-catenin cytosolic/nuclear
localization, upon RPTP.kappa. knockdown (FIG. 4).
In mammary cells, RPTPk promotes receptor tyrosine kinase (RTK)
signaling pathways through dephosphorylation of the C-terminal
inhibitory tyrosine residue (Y527 of SRC) of SRC family kinases
(SFKs). See e.g., Wang, S. E. et al., 2005, Id. It is believed that
dephosphorylation of this site enhances SFK activity and promotes
signaling of downstream RTKs, including growth factor-induced
activation of mediators of cell motility and invasion,
phospholipase C-y 1 (PLCyl) and focal adhesion kinase (FAK). See
e.g., Mitra, S. K., Hanson, D. A., and Schlaepfer, D. D. 2005.
Molecular cell biology, 6:56-68; Yu, H. et al., 1998. Exp Cell Res,
243:113-122. We assessed by Western blotting if RPTP.kappa.
promotes RA FLS motility through SRC-dependent PDGFR signaling.
Western blotting was conducted on ASO-treated RA FLS lysates, and
ASO-treated RA FLS stimulated with 50 ng/ml PDGF-BB for 30 min or
left unstimulated. RA FLS treated with PTPRK ASO showed increased
basal phosphorylation of SRC Y527, and reduced PDGF-induced
phosphorylation of PLCyl (Y783) and FAK (Y925). The essential roles
of SFK and PLCyl activity in RA FLS motility were confirmed using
pharmacological inhibitors of these enzymes. Treatment with the SFK
inhibitor PP2 (Hanke, J. H. et al., 1996. J Biol Chem, 271:695-701)
or the PLCyl inhibitor U73122 (Smith, R. J. 1990. J Pharmacol Exp
Ther, 253:688-697) (FIGS. 2A-2B) abolished growth factor-induced
migration of RA FLS.
We next investigated if RPTPk directly interacts with and/or
dephosphorylates SFKs. HA-tagged RPTP.kappa. was immunoprecipitated
from COS-1 cells and incubated in vitro with RA FLS lysates, and
pull-down was subjected to Western blotting. Both full-length RPTPk
immunoprecipitated from COS-1 cells and a recombinant
substrate-trapping mutant of the RPTPk catalytic domain
(iPTPk-D1051A) precipitated SRC from RA FLS lysates in pull-down
assays, but not YES or FYN (SFKs also expressed in FLS).
Additionally, full-length RPTPk immunoprecipitated from COS-1 cells
in vitro dephosphorylated a SRC phospho-Y527 peptide, while a
catalytically inactive mutant (C1100S ) did not.
In line with previously reported data (Wang, S. E. et al., 2005,
Id.), we found no direct effect of RPTPk on TGF.beta.-mediated
signaling in FLS, as assessed by lack of effect of PTPRK ASO on
TGF.beta.1-induced phosphorylation and nuclear recruitment of
SMAD3, suggesting that the RA FLS phenotype induced by knockdown of
RPTPk is not due to direct inhibition of TGF.beta. signaling.
Example 5
RPTP.kappa. is Required for the Pathogenic Action of RA FLS
As the rheumatoid synovium is characterized by pathogenic
overexpression of TNF and IL-1 (Bottini, N., and Firestein, G. S.
2013, Id.), and SRC activation is known to promote signaling
through inflammatory cytokine receptors (Kant, S. et al., 2011.
Genes Dev, 25:2069-2078), we assessed the effect of PTPRK ASO on
TNF and IL-1-induced expression of genes encoding mediators of FLS
invasiveness. RPTP.kappa. deficiency significantly decreased TNF-
and IL-1-induced expression of several genes critical for FLS
invasion, CXCL10, VCAM1, MMP8 and MMP13 (FIGS. 3A-3E). See e.g.,
Noss, E. H., & Brenner, M. B., 2008. Immunological reviews,
223:252-270; Bottini, N., and Firestein, G. S. 2013, Id.;
Laragione, T. et al., 2011. Arthritis and rheumatism, 63:3274-3283;
Seemayer, C. A. et al., 2003. The American journal of pathology,
162:1549-1557. MMP2 expression was not induced by cytokine
stimulation but was constitutively decreased following RPTP.kappa.
knockdown (FIG. 3C). No effect was observed on the expression of
the inflammatory cytokines IL6, IL8, or MMP1 or MMP3.
We then assessed, via Western blotting of lysates from ASO-treated
RA FLS stimulated with 50 ng/ml TNF.alpha. for 15 min or left
stimulated, the effect of PTPRK ASO on TNF-induced activation of
mitogen-activated protein kinases (MAPKs) in RA FLS, and found
PTPRK ASO reduced basal and TNF-induced phosphorylation of c-Jun
N-terminal kinase (JNK), but not ERK or p38. Anti-GAPDH served as
control. This phenotype is consistent with a role for RPTP.kappa.
upstream the activation of FAK, as FAK promotes downstream
activation of JNK and production of MMPs. See e.g., Mitra, S. K.,
Hanson, D. A., and Schlaepfer, D. D. 2005. Molecular cell biology,
6:56-68.
We next examined whether PTPRK ASO inhibits the in vivo
invasiveness of RA FLS. We induced skin inflammation in athymic
nude mice by subcutaneously injecting complete Freund's adjuvant
(CFA), then intradermally implanted RA FLS pretreated with Ctl ASI
or PTPRK ASO. After 5 days, we monitored FLS invasion from the
implantation site towards the inflammation site. As shown in FIGS.
3F and 7F, PTPRK ASO treatment significantly reduced the in vivo
invasiveness of RA FLS.
Without wishing to be bound by any one theory, the data disclosed
herein point to a model (FIG. 3G) in which autocrine TGF.beta.
upregulates of RPTP.kappa. expression in RA FLS, in turn leading to
increased RA FLS invasiveness through activation of SRC and
cross-activation of PDGF and TNF- and IL-1 signaling.
Synergistic stimulation with TGF.beta. and PDGF strongly amplifies
FLS responsiveness to TNF. See e.g., Rosengren, S., Corr, M., and
Boyle, D. L. 2010. Arthritis Res Ther, 12:R65). We reasoned that if
our model is correct, the contribution of TGF.beta. to TNF
signaling in this system might be mediated through increased
expression of PTPRK. We stimulated ASO-treated RA FLS with
TGF.beta.1 for 24 hr to increase PTPRK expression. We then
co-stimulated cells with further TGF.beta.1, and TNF and PDGF for
an additional 24 hr. Co-stimulation with TGF.beta.1 dramatically
induced expression of key mediators of RA FLS invasiveness, MMP13
(FIG. 3H) and MMP14 (FIG. 3I), compared to cells lacking
stimulation with TGF.beta.1. Furthermore, treatment with PTPRK ASO
completely abolished the TGF.beta.1-mediated effect.
Conclusion.
In this study based entirely on human primary cells from RA
patients, we report the first characterization of the role of a
transmembrane PTP in RA FLS. We found that RPTP.kappa. is
overexpressed in FLS from RA patients compared to OA patients,
which results from increased production of TGF.beta. by these
cells. Through dephosphorylation of the inhibitory Y527 of SRC,
RPTP.kappa. promotes RA FLS aggressiveness by enhancing
responsiveness to PDGF, TNF and IL-1 stimulation.
RPTP.kappa.-deficient RA FLS display dramatically reduced
spreading, migration, invasiveness and chemokine production.
Furthermore, we found that RPTP.kappa. is required for the
cross-activation of growth factor and inflammatory cytokine
signaling by TGF.beta. that has been reported to occur in RA
FLS.
Our observation that RPTPk promotes RA FLS aggressiveness is
surprising compared to previous reports of RPTPk as a tumor
suppressor, suggesting that RPTPk controls signaling in RA FLS
cancer cells through different mechanisms. PTPRK has been reported
to inhibit proliferation of several types of cancer cells,
presumably through modulation of beta-catenin function or epidermal
growth factor receptor signaling. See e.g., Xu, Y. et al., 2009. J
Cell Biochem, 107:873-880; Julien, S. G., Dube, N., Hardy, S., and
Tremblay, M. L. 2011. Nat Rev Cancer, 11:35-49. However we found no
evidence of a role RPTPk in regulation of beta-catenin function;
neither RPTP.kappa. inhibited migration or survival induced by
growth factors in RA FLS.
Without further wishing to be bound by any theory, it is believed
that in the context of RA, inhibition of RPTPk in RA subjects
carrying high expression of PTPRK at the FLS level mitigates the
pathogenic effects of FLS. The transmembrane nature of RPTPk
suggests potential for modulation through its juxtamembrane or
extracellular domains. Indeed inhibition by dimerization has been
suggested for other transmembrane PTPs (Majeti, R., and Weiss, A.
2001. Chemical Reviews, 101:2441-2448) and an anti-RPTPk antibody
targeted against the extracellular domain was reported to modulate
RPTPk activity (Anders, L. et al., 2006. Mol Cell Biol,
26:3917-3934). Deletion of Ptprk in the Long-Evans Cinnamon rat
leads to immunodeficiency of T-helper cells (Asano, A. et al.,
2007. Mamm Genome, 18:779-786), suggesting inhibition of RPTPk
could provide a dual means of affecting RA, targeting both T cell-
and FLS-mediated pathogenesis.
V. Embodiments
Embodiments include embodiments P1 to P15 following.
Embodiment P1. A method of treating a subject who has or is at risk
of developing an autoimmune disease, the method comprising
administering to the subject a therapeutically effective amount of
an autoimmune therapeutic agent, wherein the autoimmune therapeutic
agent is an agonist or an antagonist of PTPRK.
Embodiment P2. The method of embodiment P1, wherein the autoimmune
disease is an inflammatory autoimmune disease and the autoimmune
therapeutic agent is an IAD therapeutic agent, the IAD therapeutic
agent selected from an anti-PTPRK antibody, an anti-PTPRK
inhibitory nucleic acid and a PTPRK ligand mimetic, wherein the IAD
therapeutic agent targets PTPRK, or a fragment, agonist or
antagonist thereof.
Embodiment P3. The method embodiment P1 or embodiment P2 wherein
the autoimmune therapeutic agent is an antagonist of PTPRK.
Embodiment P4. The method of embodiment P2, wherein the
inflammatory autoimmune disease is mediated by cells expressing
PTPRK.
Embodiment P5. The method of embodiment P4, wherein the cells are
fibroblast-like synoviocytes.
Embodiment P6. The method embodiment P2 or embodiment P3, wherein
the inflammatory autoimmune disease is arthritis, rheumatoid
arthritis, psoriatic arthritis, juvenile idiopathic arthritis,
multiple sclerosis, systemic lupus erythematosus (SLE), myasthenia
gravis, juvenile onset diabetes, diabetes mellitus type 1,
Guillain-Barre syndrome, Hashimoto's encephalitis, Hashimoto's
thyroiditis, ankylosing spondylitis, psoriasis, Sjogren's syndrome,
vasculitis, glomerulonephritis, auto-immune thyroiditis, Behcet's
disease, Crohn's disease, ulcerative colitis, bullous pemphigoid,
sarcoidosis, psoriasis, ichthyosis, Graves ophthalmopathy,
inflammatory bowel disease, Addison's disease, Vitiligo, asthma, or
allergic asthma.
Embodiment P7. The method of one of embodiments P2, P3, or P6,
wherein the inflammatory autoimmune disease is rheumatoid
arthritis.
Embodiment P8. The method of any one of embodiments P1 to P7
wherein the method comprises decreasing, reducing, inhibiting,
suppressing, limiting or controlling TNF and PDGF activity.
Embodiment P9. A pharmaceutical composition comprising an
autoimmune therapeutic agent and a pharmaceutically acceptable
excipient, wherein the autoimmune therapeutic agent is an agonist
or antagonist of PTRPK.
Embodiment P10. The pharmaceutical composition of embodiment P9
wherein the autoimmune therapeutic agent is an antagonist of
PTPRK.
Embodiment P11. The pharmaceutical composition of embodiment P9 or
embodiment P10, wherein the pharmaceutical composition comprises an
IAD therapeutic agent and a pharmaceutically acceptable excipient,
wherein the IAD therapeutic agent is an IAD therapeutic agent
selected from an anti-PTPRK antibody, an anti-PTPRK inhibitory
nucleic acid or PTPRK ligand mimetic.
Embodiment P12. The pharmaceutical composition of embodiment P11,
wherein the IAD therapeutic agent is an anti-PTPRK antibody.
Embodiment P13. The pharmaceutical composition of embodiment P11,
wherein the IAD therapeutic agent is an anti-PTPRK inhibitory
nucleic acid.
Embodiment P14. The pharmaceutical composition of embodiment P13,
wherein the anti-PTPRK inhibitory nucleic acid is an anti-PTPRK
antisense nucleic acid.
Embodiment P15. The pharmaceutical composition of embodiment P11,
wherein the PTPRK ligand mimetic is a peptide or a small chemical
molecule.
Further embodiments include the following:
Embodiment 1. A method of treating an autoimmune disease in a
subject in need thereof, the method comprising administering to the
subject an effective amount of a PTPRK antagonist.
Embodiment 2. The method of embodiment 1, wherein said autoimmune
disease is a fibroblast mediated disease, arthritis, rheumatoid
arthritis, psoriatic arthritis, juvenile idiopathic arthritis,
multiple sclerosis, systemic lupus erythematosus (SLE), myasthenia
gravis, juvenile onset diabetes, diabetes mellitus type 1,
Guillain-Barre syndrome, Hashimoto's encephalitis, Hashimoto's
thyroiditis, ankylosing spondylitis, psoriasis, Sjogren's syndrome,
vasculitis, glomerulonephritis, auto-immune thyroiditis, Behcet's
disease, Crohn's disease, ulcerative colitis, bullous pemphigoid,
sarcoidosis, psoriasis, ichthyosis, Graves ophthalmopathy,
inflammatory bowel disease, Addison's disease, Vitiligo, asthma,
scleroderma, systemic sclerosis, or allergic asthma.
Embodiment 3. A method of decreasing inflammation in a synovium of
a subject in need thereof, the method comprising administering to
the subject an effective amount of a PTPRK antagonist.
Embodiment 4. A method of treating osteoarthritis in a subject in
need thereof, the method comprising administering to the subject an
effective amount of a PTPRK antagonist.
Embodiment 5. The method of any one of embodiments 1, 2 or 3,
wherein said subject comprises fibroblast-like synoviocytes that
express high levels of PTPRK relative to a standard control.
Embodiment 6. The method of any one of embodiments 3 or 5, wherein
said subject has rheumatoid arthritis.
Embodiment 7. A method of decreasing expression of PTPRK in a
fibroblast-like synoviocyte, the method comprising contacting said
fibroblast-like synoviocyte with an effective amount of a PTPRK
antagonist.
Embodiment 8. A method of decreasing TNF activity, IL-1 activity or
PDGF activity in a fibroblast-like synoviocyte, the method
contacting said fibroblast-like synoviocyte with an effective
amount of a PTPRK antagonist.
Embodiment 9. The method of embodiment 8, consisting of decreasing
TNF activity or IL-1 activity.
Embodiment 10. The method of any one of embodiments 8 or 9, wherein
said decreasing comprises decreasing expression of TNF or IL-1.
Embodiment 11. A method of decreasing invasiveness or migration of
a fibroblast-like synoviocyte, the method comprising contacting
said fibroblast-like synoviocyte with an effective amount of a
PTPRK antagonist.
Embodiment 12. The method of any one embodiments 7 to 11, wherein
said fibroblast-like synoviocyte is a rheumatoid arthritis
fibroblast-like synoviocyte.
Embodiment 13. The method of any one embodiments 7 to 12, wherein
said fibroblast-like synoviocyte expresses high levels of PTPRK
relative to a standard control.
Embodiment 14. The method of one of embodiments 1 to 13, wherein
said PTPRK antagonist is an anti-PTPRK antibody, an anti-PTPRK
inhibitory nucleic acid, PTPRK allosteric inhibitor or a PTPRK
ligand mimetic.
Embodiment 15. The method of embodiment 14, wherein said anti-PTPRK
antibody is an anti-PTPRK extracellular antibody.
Embodiment 16. The method of embodiment 14, wherein said anti-PTPRK
antibody is an anti-PTPRK dimer inhibiting antibody or a anti-PTPRK
dimerizing antibody.
Embodiment 17. The method of embodiment 14, wherein said anti-PTPRK
inhibitory nucleic acid has at least 90% sequence identity to an at
least 10 nucleotide contiguous sequence of SEQ ID NO: 1, SEQ ID
NO:2 or a complementary sequence thereof.
Embodiment 18. The method of embodiment 14, wherein said anti-PTPRK
ligand mimetic is a peptide or a small chemical molecule.
Embodiment 19. A pharmaceutical composition comprising a PTPRK
antagonist and a pharmaceutically acceptable excipient.
Embodiment 20. The pharmaceutical composition of embodiment 19,
wherein said PTPRK antagonist is an anti-PTPRK antibody, an
anti-PTPRK inhibitory nucleic acid or a PTPRK ligand mimetic.
Embodiment 21. The pharmaceutical composition of embodiment 19,
wherein said anti-PTPRK antibody is an anti-PTPRK extracellular
antibody.
Embodiment 22. The pharmaceutical composition of embodiment 19,
wherein said anti-PTPRK antibody is an anti-PTPRK dimer inhibiting
antibody or an anti-PTPRK dimerizing antibody.
Embodiment 23. The pharmaceutical composition of embodiment 19,
wherein said anti-PTPRK inhibitory nucleic acid has at least 90%
sequence identity to an at least 10 nucleotide contiguous sequence
of SEQ ID NO: 1, SEQ ID NO:2 or a complementary sequence
thereof
Embodiment 24. The pharmaceutical composition of embodiment 19,
wherein said anti-PTPRK ligand mimetic is a peptide or a small
chemical molecule.
VI. Sequences
TABLE-US-00002 Homo sapiens protein tyrosine phosphatase, receptor
type, K (PTPRK), transcript variant 1 (NCBI Accession No.
NM_001135648.1): (SEQ ID NO: 1)
GTCTCTCCGGCAGGAGGCGGTGGCGGCGCCGCGCCCGAGCCCGCATTCCTCAGAAGCGCCCGGAGCCCGC
GGGGCGACGTCACCCCCGGCTCCGCCCCCGTCCCTCCCCGAGCAAAGTAACTCTTGACTAACAGGAGCAG
CCTCCGCCGAGCATGGAGAGCTGCCGCCGCGGCCGGCCGGCGACGCTGGCGACGCTTTCGCCCCTGAGGT
AGTTTGGCGACCGCGAAGAAGGAAAAAGGGCGGGCGGGCGGCTGTCCTCTCACCGTCCTCACCCCGCGAG
GCCCGGCCCGCTCCTCCGTCGTGGATTTCGCGGCGATCCCCCCGGCAGCTCTTTGCAAAGCTGCTTGAAA
CTTCTCCCAAACTCGGCATGGATACGACTGCGGCGGCGGCGCTGCCTGCTTTTGTGGCGCTCTTGCTCCT
CTCTCCTTGGCCTCTCCTGGGATCGGCCCAAGGCCAGTTCTCCGCAGGTGGCTGTACTTTTGATGATGGT
CCAGGGGCCTGTGATTACCACCAGGATCTGTATGATGACTTTGAATGGGTGCATGTTAGTGCTCAAGAGC
CTCATTATCTACCACCCGAGATGCCCCAAGGTTCCTATATGATAGTGGACTCTTCAGATCACGACCCTGG
AGAAAAAGCCAGACTTCAGCTGCCTACAATGAAGGAGAACGACACTCACTGCATTGATTTCAGTTACCTA
TTATATAGCCAGAAAGGACTGAATCCTGGCACTTTGAACATATTAGTTAGGGTGAATAAAGGACCTCTTG
CCAATCCAATTTGGAATGTGACTGGATTCACGGGTAGAGATTGGCTTCGGGCTGAGCTAGCAGTGAGCAC
CTTTTGGCCCAATGAATATCAGGTAATATTTGAAGCTGAAGTCTCAGGAGGGAGAAGTGGTTATATTGCC
ATTGATGACATCCAAGTACTGAGTTATCCTTGTGATAAATCTCCTCATTTCCTCCGTCTAGGGGATGTAG
AGGTGAATGCAGGGCAAAACGCTACATTTCAGTGCATTGCCACAGGGAGAGATGCTGTGCATAACAAGTT
ATGGCTCCAGAGACGAAATGGAGAAGATATACCAGTAGCCCAGACTAAGAACATCAATCATAGAAGGTTT
GCCGCTTCCTTCAGATTGCAAGAAGTGACAAAAACTGACCAGGATTTGTATCGCTGTGTAACTCAGTCAG
AACGAGGTTCCGGTGTGTCCAATTTTGCTCAACTTATTGTGAGAGAACCGCCAAGACCCATTGCTCCTCC
TCAGCTTCTTGGTGTTGGGCCTACATATTTGCTGATCCAACTAAATGCCAACTCGATCATTGGCGATGGT
CCTATCATCCTGAAAGAAGTAGAGTACCGAATGACATCAGGATCCTGGACAGAAACCCATGCAGTCAATG
CTCCAACTTACAAATTATGGCATTTAGATCCAGATACCGAATATGAGATCCGAGTTCTACTTACAAGACC
TGGTGAAGGTGGAACGGGGCTCCCAGGACCTCCACTAATCACCAGAACAAAATGTGCAGAACCTATGAGA
ACCCCAAAGACATTAAAGATTGCTGAAATACAGGCAAGACGGATTGCTGTGGACTGGGAATCCTTGGGTT
ACAACATTACGCGTTGCCACACTTTTAATGTCACTATCTGCTACCATTACTTCCGTGGTCACAACGAGAG
CAAGGCAGACTGTTTGGACATGGACCCCAAAGCCCCTCAGCATGTTGTGAACCATCTGCCACCTTATACA
AATGTCAGCCTCAAGATGATCCTAACCAATCCAGAGGGAAGGAAGGAGAGTGAAGAGACAATTATTCAAA
CTGATGAAGATGTGCCTGGTCCCGTACCAGTAAAATCTCTTCAAGGAACATCCTTTGAAAATAAGATCTT
CTTGAACTGGAAAGAACCTTTGGATCCAAATGGAATCATCACTCAATATGAGATCAGCTATAGCAGTATA
AGATCATTTGATCCTGCAGTTCCAGTGGCTGGACCTCCCCAGACTGTATCAAATTTATGGAACAGTACAC
ACCATGTCTTTATGCATCTCCACCCTGGAACCACGTACCAGTTTTTCATAAGAGCCAGCACGGTCAAAGG
CTTTGGTCCAGCCACAGCCATCAATGTCACCACCAATATCTCAGCTCCAACTTTACCTGACTATGAAGGA
GTTGATGCCTCTCTCAATGAAACTGCCACCACAATAACTGTATTGTTGAGACCAGCACAAGCCAAAGGTG
CTCCTATCAGTGCTTATCAGATTGTTGTGGAAGAACTGCACCCACACCGAACCAAGAGAGAAGCCGGAGC
CATGGAATGCTACCAGGTTCCTGTCACATACCAAAATGCCATGAGTGGGGGTGCACCGTATTACTTTGCT
GCAGAACTCCCCCCGGGAAACCTACCTGAGCCTGCCCCGTTCACTGTGGGTGACAATCGGACCTACCAAG
GCTTTTGGAACCCTCCTTTGGCTCCGCGCAAAGGATACAACATCTATTTCCAGGCGATGAGCAGTGTGGA
GAAGGAAACTAAAACCCAGTGCGTACGCATTGCTACAAAAGCAGCAGCAACAGAAGAACCAGAAGTGATC
CCAGATCCCGCCAAGCAGACAGACAGAGTGGTGAAAATAGCAGGAATTAGTGCTGGAATTTTGGTGTTCA
TCCTCCTTCTCCTAGTTGTCATATTAATTGTAAAAAAGAGCAAACTTGCTAAAAAACGCAAAGATGCCAT
GGGGAATACCCGGCAGGAGATGACTCACATGGTGAATGCAATGGATCGAAGTTATGCTGATCAGAGCACT
CTGCATGCAGAAGATCCTCTTTCCATCACCTTCATGGACCAACATAACTTTAGTCCAAGATATGAGAACC
ACAGTGCTACAGCAGAGTCCAGTCGCCTTCTAGACGTACCTCGCTACCTCTGTGAGGGGACGGAATCCCC
TTACCAGACAGGACAGCTGCATCCAGCCATCAGGGTAGCTGATTTACTGCAGCACATTAATCTCATGAAG
ACATCAGACAGCTATGGGTTCAAAGAGGAATATGAGAGCTTTTTTGAAGGACAGTCAGCATCTTGGGATG
TAGCTAAAAAAGATCAAAATAGAGCAAAAAACCGATATGGAAACATTATAGCATATGATCACTCCAGAGT
GATTTTGCAACCCGTAGAGGATGATCCTTCCTCAGATTATATTAATGCCAACTATATTGATATTTGGCTG
TACAGGGATGGCTACCAGAGACCAAGTCATTACATTGCAACCCAAGGTCCCGTTCATGAAACAGTGTATG
ATTTCTGGAGGATGATTTGGCAAGAACAATCTGCTTGCATTGTGATGGTTACAAATTTAGTTGAGGTTGG
CCGGGTTAAATGCTATAAATATTGGCCTGATGATACTGAAGTTTATGGTGACTTCAAAGTAACGTGTGTA
GAAATGGAACCACTTGCTGAATATGTAGTTAGGACATTCACCCTGGAAAGGAGGGGGTACAATGAAATCC
GTGAAGTTAAACAGTTCCATTTCACGGGCTGGCCTGACCATGGAGTGCCCTACCATGCTACAGGGCTGCT
TTCCTTTATCCGGCGAGTCAAGTTATCAAACCCTCCCAGTGCTGGCCCCATCGTTGTACATTGCAGTGCT
GGTGCTGGACGAACTGGCTGCTACATTGTGATTGACATCATGCTAGACATGGCTGAAAGAGAGGGTGTTG
TTGATATTTACAATTGTGTCAAAGCCTTAAGATCTCGGCGTATTAATATGGTCCAGACAGAGGAACAGTA
CATTTTTATTCATGATGCCATTTTAGAAGCCTGCTTATGTGGAGAAACTGCCATACCTGTCTGTGAATTT
AAAGCTGCATATTTTGATATGATTAGAATAGACTCCCAGACTAACTCTTCACATCTCAAGGATGAATTTC
AGACTCTGAATTCAGTCACCCCTCGACTACAAGCTGAAGACTGCAGTATAGCGTGCCTGCCAAGGAACCA
TGACAAGAACCGTTTCATGGACATGCTGCCACCTGACAGATGTCTGCCTTTTTTAATTACAATTGATGGG
GAGAGCAGTAACTACATCAATGCTGCTCTTATGGACAGCTACAGGCAACCAGCTGCTTTCATCGTCACAC
AATACCCTCTGCCAAACACTGTAAAAGACTTCTGGAGATTAGTGTATGATTATGGCTGTACCTCCATTGT
GATGTTAAACGAAGTCGACTTGTCCCAGGGCTGCCCTCAGTACTGGCCAGAGGAAGGGATGCTACGATAT
GGCCCCATCCAAGTGGAATGTATGTCTTGTTCAATGGACTGTGATGTGATCAACCGGATTTTTAGGATAT
GCAATCTAACAAGACCACAGGAAGGTTATCTGATGGTGCAACAGTTTCAGTACCTAGGATGGGCTTCTCA
TCGAGAAGTGCCTGGATCCAAAAGGTCATTCTTGAAACTGATACTTCAGGTGGAAAAGTGGCAGGAGGAA
TGCGAGGAAGGGGAAGGCCGGACGATTATCCACTGCCTAAATGGTGGCGGGCGAAGTGGCATGTTCTGTG
CTATAGGCATCGTTGTTGAAATGGTGAAACGGCAAAATGTTGTCGATGTTTTCCATGCAGTAAAGACACT
GAGGAACAGCAAGCCAAACATGGTGGAAGCCCCGGAGCAATACCGTTTCTGCTATGATGTAGCTTTGGAG
TACCTGGAATCATCTTAGTTGGGTGAGACTCTTTAAAGTGCATCCATGAAGAAACCTGTCCATCTATTGA
GCCAGCAGCTGTTGTACCTGTTACACTTGTGCAGAAAGATTTTAATGTGGGGGGTGGGAGACTTTTACAT
TTGAGAGGTAAAAGTATTTTTTTTATGAAGTTGTGTATCTTAATAAAAAGGACTGAATTAGTTTTTATTA
CTATATTAAAGCATCAACATTTCATGCCACATAAATTATATTTAATAAGAACCAGATTGAAATGAGAACG
TATTGGTGTTTGTACAGTGAACATGCCACCTTTTTTCTCATGGTTTCAGTAGAGCAGCTACCACATGTTG
CATGAGTTCATACTTTCTACGTGGCATTTTTCTCCCTTTCTAAAATGAAAGCTGATGAATCTTAAAAGGA
AGAAGAAAAGAAAAGCTGTGCAAATTCATAGTAAAGTTCGTTTTTTATATGTTTCCAGTGTAGCAGATCT
CTATATAAATATATAAATATATATAACTGGCTTATTTTCTTTTAATGTGCAATGATGGCTGGATCATTTA
AAGTTCTTTTTAGAAAATAACATAAGCCAAAGACTCAAGTGTAAATATGTCTATATGGAGAAAGCACATT
ATATTTATTGGTTACTTACATTCCTTTTTTGATGGCTAAAATACTACCACCACACAATCATCTTTTTTTT
CCTGAAGAAAGCTTTTTCTTTAGCTAAAATCAATTGTAAACGATTTTTGTAGATTATTTTTTGTATGTTT
TAGTGTAAGTAGAAGATAAACTTTTTATTCATAAACCAGGAAGCAATGTTCTTTATAGTGATTCTCTTGT
GTACATGCTTGTGAATTAAATTTGTGTAAAATCCCTTGGCAATTGGGTCTTTTAATATAGGACCAAATTA
AAACATTTTGCTGAATATGTATAGTTTTTCACAATTTCATTAGGTAAATAATGGTTTGGTGATCATACAT
GAGAAATGTACACATTAAAAGGCCTTGCTGACAACTTGCACAATGTTGAACATAGCCTTTAAGCATCATT
TAAATTTTAAAGGAATGGAGTTTTTCAGCCTGTGGCCCAGCACTGGTCAAGAAAACAAGATGGCAACATA
TATGCTTTCAGGGTCAAATTTGAGCAAACTGTAAACTGTCAGGGTGATAAAATGTTTCTCTTGATGTTTA
CATGCACAAGCTTTGCGTTCTGACTATAAAAAGTGTGAACAAATCAATGCCAGATTCCTGTTTTGCGCAT
TGTCATGGGATTCTTAAGTGAACCTTTCTAAATGTGGTCTTGTTCACATGCTCCACGTAGCTGTAACTTC
ACATCATCAGCTTGCAGTTTGTAATTGACTAAAGCATTCCAGTGTCCTCTTTCTAGATTGCCAGCTCATG
ACATGGTGCTTATAAAGATTTAATTAAAGTAAGAATGAAATAAAGTTTTTATAATTATAACAGTTAAAAA
AAAAAAAAAAAAA. Homo sapiens protein tyrosine phosphatase, receptor
type, K (PTPRK), transcript variant 2 (NCBI Accession NM_002844.3):
(SEQ ID NO: 2)
AGAAGCGCCCGGAGCCCGCGGGGCGACGTCACCCCCGGCTCCGCCCCCGTCCCTCCCCGAGCAAAGTAAC
TCTTGACTAACAGGAGCAGCCTCCGCCGAGCATGGAGAGCTGCCGCCGCGGCCGGCCGGCGACGCTGGCG
ACGCTTTCGCCCCTGAGGTAGTTTGGCGACCGCGAAGAAGGAAAAAGGGCGGGCGGGCGGCTGTCCTCTC
ACCGTCCTCACCCCGCGAGGCCCGGCCCGCTCCTCCGTCGTGGATTTCGCGGCGATCCCCCCGGCAGCTC
TTTGCAAAGCTGCTTGAAACTTCTCCCAAACTCGGCATGGATACGACTGCGGCGGCGGCGCTGCCTGCTT
TTGTGGCGCTCTTGCTCCTCTCTCCTTGGCCTCTCCTGGGATCGGCCCAAGGCCAGTTCTCCGCAGGTGG
CTGTACTTTTGATGATGGTCCAGGGGCCTGTGATTACCACCAGGATCTGTATGATGACTTTGAATGGGTG
CATGTTAGTGCTCAAGAGCCTCATTATCTACCACCCGAGATGCCCCAAGGTTCCTATATGATAGTGGACT
CTTCAGATCACGACCCTGGAGAAAAAGCCAGACTTCAGCTGCCTACAATGAAGGAGAACGACACTCACTG
CATTGATTTCAGTTACCTATTATATAGCCAGAAAGGACTGAATCCTGGCACTTTGAACATATTAGTTAGG
GTGAATAAAGGACCTCTTGCCAATCCAATTTGGAATGTGACTGGATTCACGGGTAGAGATTGGCTTCGGG
CTGAGCTAGCAGTGAGCACCTTTTGGCCCAATGAATATCAGGTAATATTTGAAGCTGAAGTCTCAGGAGG
GAGAAGTGGTTATATTGCCATTGATGACATCCAAGTACTGAGTTATCCTTGTGATAAATCTCCTCATTTC
CTCCGTCTAGGGGATGTAGAGGTGAATGCAGGGCAAAACGCTACATTTCAGTGCATTGCCACAGGGAGAG
ATGCTGTGCATAACAAGTTATGGCTCCAGAGACGAAATGGAGAAGATATACCAGTAGCCCAGACTAAGAA
CATCAATCATAGAAGGTTTGCCGCTTCCTTCAGATTGCAAGAAGTGACAAAAACTGACCAGGATTTGTAT
CGCTGTGTAACTCAGTCAGAACGAGGTTCCGGTGTGTCCAATTTTGCTCAACTTATTGTGAGAGAACCGC
CAAGACCCATTGCTCCTCCTCAGCTTCTTGGTGTTGGGCCTACATATTTGCTGATCCAACTAAATGCCAA
CTCGATCATTGGCGATGGTCCTATCATCCTGAAAGAAGTAGAGTACCGAATGACATCAGGATCCTGGACA
GAAACCCATGCAGTCAATGCTCCAACTTACAAATTATGGCATTTAGATCCAGATACCGAATATGAGATCC
GAGTTCTACTTACAAGACCTGGTGAAGGTGGAACGGGGCTCCCAGGACCTCCACTAATCACCAGAACAAA
ATGTGCAGAACCTATGAGAACCCCAAAGACATTAAAGATTGCTGAAATACAGGCAAGACGGATTGCTGTG
GACTGGGAATCCTTGGGTTACAACATTACGCGTTGCCACACTTTTAATGTCACTATCTGCTACCATTACT
TCCGTGGTCACAACGAGAGCAAGGCAGACTGTTTGGACATGGACCCCAAAGCCCCTCAGCATGTTGTGAA
CCATCTGCCACCTTATACAAATGTCAGCCTCAAGATGATCCTAACCAATCCAGAGGGAAGGAAGGAGAGT
GAAGAGACAATTATTCAAACTGATGAAGATGTGCCTGGTCCCGTACCAGTAAAATCTCTTCAAGGAACAT
CCTTTGAAAATAAGATCTTCTTGAACTGGAAAGAACCTTTGGATCCAAATGGAATCATCACTCAATATGA
GATCAGCTATAGCAGTATAAGATCATTTGATCCTGCAGTTCCAGTGGCTGGACCTCCCCAGACTGTATCA
AATTTATGGAACAGTACACACCATGTCTTTATGCATCTCCACCCTGGAACCACGTACCAGTTTTTCATAA
GAGCCAGCACGGTCAAAGGCTTTGGTCCAGCCACAGCCATCAATGTCACCACCAATATCTCAGCTCCAAC
TTTACCTGACTATGAAGGAGTTGATGCCTCTCTCAATGAAACTGCCACCACAATAACTGTATTGTTGAGA
CCAGCACAAGCCAAAGGTGCTCCTATCAGTGCTTATCAGATTGTTGTGGAAGAACTGCACCCACACCGAA
CCAAGAGAGAAGCCGGAGCCATGGAATGCTACCAGGTTCCTGTCACATACCAAAATGCCATGAGTGGGGG
TGCACCGTATTACTTTGCTGCAGAACTCCCCCCGGGAAACCTACCTGAGCCTGCCCCGTTCACTGTGGGT
GACAATCGGACCTACCAAGGCTTTTGGAACCCTCCTTTGGCTCCGCGCAAAGGATACAACATCTATTTCC
AGGCGATGAGCAGTGTGGAGAAGGAAACTAAAACCCAGTGCGTACGCATTGCTACAAAAGCAGCAGCAAC
AGAAGAACCAGAAGTGATCCCAGATCCCGCCAAGCAGACAGACAGAGTGGTGAAAATAGCAGGAATTAGT
GCTGGAATTTTGGTGTTCATCCTCCTTCTCCTAGTTGTCATATTAATTGTAAAAAAGAGCAAACTTGCTA
AAAAACGCAAAGATGCCATGGGGAATACCCGGCAGGAGATGACTCACATGGTGAATGCAATGGATCGAAG
TTATGCTGATCAGAGCACTCTGCATGCAGAAGATCCTCTTTCCATCACCTTCATGGACCAACATAACTTT
AGTCCAAGATATGAGAACCACAGTGCTACAGCAGAGTCCAGTCGCCTTCTAGACGTACCTCGCTACCTCT
GTGAGGGGACGGAATCCCCTTACCAGACAGGACAGCTGCATCCAGCCATCAGGGTAGCTGATTTACTGCA
GCACATTAATCTCATGAAGACATCAGACAGCTATGGGTTCAAAGAGGAATATGAGAGCTTTTTTGAAGGA
CAGTCAGCATCTTGGGATGTAGCTAAAAAAGATCAAAATAGAGCAAAAAACCGATATGGAAACATTATAG
CATATGATCACTCCAGAGTGATTTTGCAACCCGTAGAGGATGATCCTTCCTCAGATTATATTAATGCCAA
CTATATTGATGGCTACCAGAGACCAAGTCATTACATTGCAACCCAAGGTCCCGTTCATGAAACAGTGTAT
GATTTCTGGAGGATGATTTGGCAAGAACAATCTGCTTGCATTGTGATGGTTACAAATTTAGTTGAGGTTG
GCCGGGTTAAATGCTATAAATATTGGCCTGATGATACTGAAGTTTATGGTGACTTCAAAGTAACGTGTGT
AGAAATGGAACCACTTGCTGAATATGTAGTTAGGACATTCACCCTGGAAAGGAGGGGGTACAATGAAATC
CGTGAAGTTAAACAGTTCCATTTCACGGGCTGGCCTGACCATGGAGTGCCCTACCATGCTACAGGGCTGC
TTTCCTTTATCCGGCGAGTCAAGTTATCAAACCCTCCCAGTGCTGGCCCCATCGTTGTACATTGCAGTGC
TGGTGCTGGACGAACTGGCTGCTACATTGTGATTGACATCATGCTAGACATGGCTGAAAGAGAGGGTGTT
GTTGATATTTACAATTGTGTCAAAGCCTTAAGATCTCGGCGTATTAATATGGTCCAGACAGAGGAACAGT
ACATTTTTATTCATGATGCCATTTTAGAAGCCTGCTTATGTGGAGAAACTGCCATACCTGTCTGTGAATT
TAAAGCTGCATATTTTGATATGATTAGAATAGACTCCCAGACTAACTCTTCACATCTCAAGGATGAATTT
CAGACTCTGAATTCAGTCACCCCTCGACTACAAGCTGAAGACTGCAGTATAGCGTGCCTGCCAAGGAACC
ATGACAAGAACCGTTTCATGGACATGCTGCCACCTGACAGATGTCTGCCTTTTTTAATTACAATTGATGG
GGAGAGCAGTAACTACATCAATGCTGCTCTTATGGACAGCTACAGGCAACCAGCTGCTTTCATCGTCACA
CAATACCCTCTGCCAAACACTGTAAAAGACTTCTGGAGATTAGTGTATGATTATGGCTGTACCTCCATTG
TGATGTTAAACGAAGTCGACTTGTCCCAGGGCTGCCCTCAGTACTGGCCAGAGGAAGGGATGCTACGATA
TGGCCCCATCCAAGTGGAATGTATGTCTTGTTCAATGGACTGTGATGTGATCAACCGGATTTTTAGGATA
TGCAATCTAACAAGACCACAGGAAGGTTATCTGATGGTGCAACAGTTTCAGTACCTAGGATGGGCTTCTC
ATCGAGAAGTGCCTGGATCCAAAAGGTCATTCTTGAAACTGATACTTCAGGTGGAAAAGTGGCAGGAGGA
ATGCGAGGAAGGGGAAGGCCGGACGATTATCCACTGCCTAAATGGTGGCGGGCGAAGTGGCATGTTCTGT
GCTATAGGCATCGTTGTTGAAATGGTGAAACGGCAAAATGTTGTCGATGTTTTCCATGCAGTAAAGACAC
TGAGGAACAGCAAGCCAAACATGGTGGAAGCCCCGGAGCAATACCGTTTCTGCTATGATGTAGCTTTGGA
GTACCTGGAATCATCTTAGTTGGGTGAGACTCTTTAAAGTGCATCCATGAAGAAACCTGTCCATCTATTG
AGCCAGCAGCTGTTGTACCTGTTACACTTGTGCAGAAAGATTTTAATGTGGGGGGTGGGAGACTTTTACA
TTTGAGAGGTAAAAGTATTTTTTTTATGAAGTTGTGTATCTTAATAAAAAGGACTGAATTAGTTTTTATT
ACTATATTAAAGCATCAACATTTCATGCCACATAAATTATATTTAATAAGAACCAGATTGAAATGAGAAC
GTATTGGTGTTTGTACAGTGAACATGCCACCTTTTTTCTCATGGTTTCAGTAGAGCAGCTACCACATGTT
GCATGAGTTCATACTTTCTACGTGGCATTTTTCTCCCTTTCTAAAATGAAAGCTGATGAATCTTAAAAGG
AAGAAGAAAAGAAAAGCTGTGCAAATTCATAGTAAAGTTCGTTTTTTATATGTTTCCAGTGTAGCAGATC
TCTATATAAATATATAAATATATATAACTGGCTTATTTTCTTTTAATGTGCAATGATGGCTGGATCATTT
AAAGTTCTTTTTAGAAAATAACATAAGCCAAAGACTCAAGTGTAAATATGTCTATATGGAGAAAGCACAT
TATATTTATTGGTTACTTACATTCCTTTTTTGATGGCTAAAATACTACCACCACACAATCATCTTTTTTT
TCCTGAAGAAAGCTTTTTCTTTAGCTAAAATCAATTGTAAACGATTTTTGTAGATTATTTTTTGTATGTT
TTAGTGTAAGTAGAAGATAAACTTTTTATTCATAAACCAGGAAGCAATGTTCTTTATAGTGATTCTCTTG
TGTACATGCTTGTGAATTAAATTTGTGTAAAATCCCTTGGCAATTGGGTCTTTTAATATAGGACCAAATT
AAAACATTTTGCTGAATATGTATAGTTTTTCACAATTTCATTAGGTAAATAATGGTTTGGTGATCATACA
TGAGAAATGTACACATTAAAAGGCCTTGCTGACAACTTGCACAATGTTGAACATAGCCTTTAAGCATCAT
TTAAATTTTAAAGGAATGGAGTTTTTCAGCCTGTGGCCCAGCACTGGTCAAGAAAACAAGATGGCAACAT
ATATGCTTTCAGGGTCAAATTTGAGCAAACTGTAAACTGTCAGGGTGATAAAATGTTTCTCTTGATGTTT
ACATGCACAAGCTTTGCGTTCTGACTATAAAAAGTGTGAACAAATCAATGCCAGATTCCTGTTTTGCGCA
TTGTCATGGGATTCTTAAGTGAACCTTTCTAAATGTGGTCTTGTTCACATGCTCCACGTAGCTGTAACTT
CACATCATCAGCTTGCAGTTTGTAATTGACTAAAGCATTCCAGTGTCCTCTTTCTAGATTGCCAGCTCAT
GACATGGTGCTTATAAAGATTTAATTAAAGTAAGAATGAAATAAAGTTTTTATAATTATAACAGTTAAAA
AAAAAAAAAAAAAA. PTPRK ASO: (SEQ ID NO: 3)
TCTTAATCACAACCTACCACAAGGA. PTPRK_2 ASO: (SEQ ID NO: 4)
ACAGCAAAGTATGAGCATACCATCT. PTPRM ASO: (SEQ ID NO: 5)
TAAAGACAACTTACTACATGGATGT. Control ASO: (SEQ ID NO: 6)
CCTCTTACCTCAGTTACAATTTATA.
SEQUENCE LISTINGS
1
616173DNAHomo sapiens 1gtctctccgg caggaggcgg tggcggcgcc gcgcccgagc
ccgcattcct cagaagcgcc 60cggagcccgc ggggcgacgt cacccccggc tccgcccccg
tccctccccg agcaaagtaa 120ctcttgacta acaggagcag cctccgccga
gcatggagag ctgccgccgc ggccggccgg 180cgacgctggc gacgctttcg
cccctgaggt agtttggcga ccgcgaagaa ggaaaaaggg 240cgggcgggcg
gctgtcctct caccgtcctc accccgcgag gcccggcccg ctcctccgtc
300gtggatttcg cggcgatccc cccggcagct ctttgcaaag ctgcttgaaa
cttctcccaa 360actcggcatg gatacgactg cggcggcggc gctgcctgct
tttgtggcgc tcttgctcct 420ctctccttgg cctctcctgg gatcggccca
aggccagttc tccgcaggtg gctgtacttt 480tgatgatggt ccaggggcct
gtgattacca ccaggatctg tatgatgact ttgaatgggt 540gcatgttagt
gctcaagagc ctcattatct accacccgag atgccccaag gttcctatat
600gatagtggac tcttcagatc acgaccctgg agaaaaagcc agacttcagc
tgcctacaat 660gaaggagaac gacactcact gcattgattt cagttaccta
ttatatagcc agaaaggact 720gaatcctggc actttgaaca tattagttag
ggtgaataaa ggacctcttg ccaatccaat 780ttggaatgtg actggattca
cgggtagaga ttggcttcgg gctgagctag cagtgagcac 840cttttggccc
aatgaatatc aggtaatatt tgaagctgaa gtctcaggag ggagaagtgg
900ttatattgcc attgatgaca tccaagtact gagttatcct tgtgataaat
ctcctcattt 960cctccgtcta ggggatgtag aggtgaatgc agggcaaaac
gctacatttc agtgcattgc 1020cacagggaga gatgctgtgc ataacaagtt
atggctccag agacgaaatg gagaagatat 1080accagtagcc cagactaaga
acatcaatca tagaaggttt gccgcttcct tcagattgca 1140agaagtgaca
aaaactgacc aggatttgta tcgctgtgta actcagtcag aacgaggttc
1200cggtgtgtcc aattttgctc aacttattgt gagagaaccg ccaagaccca
ttgctcctcc 1260tcagcttctt ggtgttgggc ctacatattt gctgatccaa
ctaaatgcca actcgatcat 1320tggcgatggt cctatcatcc tgaaagaagt
agagtaccga atgacatcag gatcctggac 1380agaaacccat gcagtcaatg
ctccaactta caaattatgg catttagatc cagataccga 1440atatgagatc
cgagttctac ttacaagacc tggtgaaggt ggaacggggc tcccaggacc
1500tccactaatc accagaacaa aatgtgcaga acctatgaga accccaaaga
cattaaagat 1560tgctgaaata caggcaagac ggattgctgt ggactgggaa
tccttgggtt acaacattac 1620gcgttgccac acttttaatg tcactatctg
ctaccattac ttccgtggtc acaacgagag 1680caaggcagac tgtttggaca
tggaccccaa agcccctcag catgttgtga accatctgcc 1740accttataca
aatgtcagcc tcaagatgat cctaaccaat ccagagggaa ggaaggagag
1800tgaagagaca attattcaaa ctgatgaaga tgtgcctggt cccgtaccag
taaaatctct 1860tcaaggaaca tcctttgaaa ataagatctt cttgaactgg
aaagaacctt tggatccaaa 1920tggaatcatc actcaatatg agatcagcta
tagcagtata agatcatttg atcctgcagt 1980tccagtggct ggacctcccc
agactgtatc aaatttatgg aacagtacac accatgtctt 2040tatgcatctc
caccctggaa ccacgtacca gtttttcata agagccagca cggtcaaagg
2100ctttggtcca gccacagcca tcaatgtcac caccaatatc tcagctccaa
ctttacctga 2160ctatgaagga gttgatgcct ctctcaatga aactgccacc
acaataactg tattgttgag 2220accagcacaa gccaaaggtg ctcctatcag
tgcttatcag attgttgtgg aagaactgca 2280cccacaccga accaagagag
aagccggagc catggaatgc taccaggttc ctgtcacata 2340ccaaaatgcc
atgagtgggg gtgcaccgta ttactttgct gcagaactcc ccccgggaaa
2400cctacctgag cctgccccgt tcactgtggg tgacaatcgg acctaccaag
gcttttggaa 2460ccctcctttg gctccgcgca aaggatacaa catctatttc
caggcgatga gcagtgtgga 2520gaaggaaact aaaacccagt gcgtacgcat
tgctacaaaa gcagcagcaa cagaagaacc 2580agaagtgatc ccagatcccg
ccaagcagac agacagagtg gtgaaaatag caggaattag 2640tgctggaatt
ttggtgttca tcctccttct cctagttgtc atattaattg taaaaaagag
2700caaacttgct aaaaaacgca aagatgccat ggggaatacc cggcaggaga
tgactcacat 2760ggtgaatgca atggatcgaa gttatgctga tcagagcact
ctgcatgcag aagatcctct 2820ttccatcacc ttcatggacc aacataactt
tagtccaaga tatgagaacc acagtgctac 2880agcagagtcc agtcgccttc
tagacgtacc tcgctacctc tgtgagggga cggaatcccc 2940ttaccagaca
ggacagctgc atccagccat cagggtagct gatttactgc agcacattaa
3000tctcatgaag acatcagaca gctatgggtt caaagaggaa tatgagagct
tttttgaagg 3060acagtcagca tcttgggatg tagctaaaaa agatcaaaat
agagcaaaaa accgatatgg 3120aaacattata gcatatgatc actccagagt
gattttgcaa cccgtagagg atgatccttc 3180ctcagattat attaatgcca
actatattga tatttggctg tacagggatg gctaccagag 3240accaagtcat
tacattgcaa cccaaggtcc cgttcatgaa acagtgtatg atttctggag
3300gatgatttgg caagaacaat ctgcttgcat tgtgatggtt acaaatttag
ttgaggttgg 3360ccgggttaaa tgctataaat attggcctga tgatactgaa
gtttatggtg acttcaaagt 3420aacgtgtgta gaaatggaac cacttgctga
atatgtagtt aggacattca ccctggaaag 3480gagggggtac aatgaaatcc
gtgaagttaa acagttccat ttcacgggct ggcctgacca 3540tggagtgccc
taccatgcta cagggctgct ttcctttatc cggcgagtca agttatcaaa
3600ccctcccagt gctggcccca tcgttgtaca ttgcagtgct ggtgctggac
gaactggctg 3660ctacattgtg attgacatca tgctagacat ggctgaaaga
gagggtgttg ttgatattta 3720caattgtgtc aaagccttaa gatctcggcg
tattaatatg gtccagacag aggaacagta 3780catttttatt catgatgcca
ttttagaagc ctgcttatgt ggagaaactg ccatacctgt 3840ctgtgaattt
aaagctgcat attttgatat gattagaata gactcccaga ctaactcttc
3900acatctcaag gatgaatttc agactctgaa ttcagtcacc cctcgactac
aagctgaaga 3960ctgcagtata gcgtgcctgc caaggaacca tgacaagaac
cgtttcatgg acatgctgcc 4020acctgacaga tgtctgcctt ttttaattac
aattgatggg gagagcagta actacatcaa 4080tgctgctctt atggacagct
acaggcaacc agctgctttc atcgtcacac aataccctct 4140gccaaacact
gtaaaagact tctggagatt agtgtatgat tatggctgta cctccattgt
4200gatgttaaac gaagtcgact tgtcccaggg ctgccctcag tactggccag
aggaagggat 4260gctacgatat ggccccatcc aagtggaatg tatgtcttgt
tcaatggact gtgatgtgat 4320caaccggatt tttaggatat gcaatctaac
aagaccacag gaaggttatc tgatggtgca 4380acagtttcag tacctaggat
gggcttctca tcgagaagtg cctggatcca aaaggtcatt 4440cttgaaactg
atacttcagg tggaaaagtg gcaggaggaa tgcgaggaag gggaaggccg
4500gacgattatc cactgcctaa atggtggcgg gcgaagtggc atgttctgtg
ctataggcat 4560cgttgttgaa atggtgaaac ggcaaaatgt tgtcgatgtt
ttccatgcag taaagacact 4620gaggaacagc aagccaaaca tggtggaagc
cccggagcaa taccgtttct gctatgatgt 4680agctttggag tacctggaat
catcttagtt gggtgagact ctttaaagtg catccatgaa 4740gaaacctgtc
catctattga gccagcagct gttgtacctg ttacacttgt gcagaaagat
4800tttaatgtgg ggggtgggag acttttacat ttgagaggta aaagtatttt
ttttatgaag 4860ttgtgtatct taataaaaag gactgaatta gtttttatta
ctatattaaa gcatcaacat 4920ttcatgccac ataaattata tttaataaga
accagattga aatgagaacg tattggtgtt 4980tgtacagtga acatgccacc
ttttttctca tggtttcagt agagcagcta ccacatgttg 5040catgagttca
tactttctac gtggcatttt tctccctttc taaaatgaaa gctgatgaat
5100cttaaaagga agaagaaaag aaaagctgtg caaattcata gtaaagttcg
ttttttatat 5160gtttccagtg tagcagatct ctatataaat atataaatat
atataactgg cttattttct 5220tttaatgtgc aatgatggct ggatcattta
aagttctttt tagaaaataa cataagccaa 5280agactcaagt gtaaatatgt
ctatatggag aaagcacatt atatttattg gttacttaca 5340ttcctttttt
gatggctaaa atactaccac cacacaatca tctttttttt cctgaagaaa
5400gctttttctt tagctaaaat caattgtaaa cgatttttgt agattatttt
ttgtatgttt 5460tagtgtaagt agaagataaa ctttttattc ataaaccagg
aagcaatgtt ctttatagtg 5520attctcttgt gtacatgctt gtgaattaaa
tttgtgtaaa atcccttggc aattgggtct 5580tttaatatag gaccaaatta
aaacattttg ctgaatatgt atagtttttc acaatttcat 5640taggtaaata
atggtttggt gatcatacat gagaaatgta cacattaaaa ggccttgctg
5700acaacttgca caatgttgaa catagccttt aagcatcatt taaattttaa
aggaatggag 5760tttttcagcc tgtggcccag cactggtcaa gaaaacaaga
tggcaacata tatgctttca 5820gggtcaaatt tgagcaaact gtaaactgtc
agggtgataa aatgtttctc ttgatgttta 5880catgcacaag ctttgcgttc
tgactataaa aagtgtgaac aaatcaatgc cagattcctg 5940ttttgcgcat
tgtcatggga ttcttaagtg aacctttcta aatgtggtct tgttcacatg
6000ctccacgtag ctgtaacttc acatcatcag cttgcagttt gtaattgact
aaagcattcc 6060agtgtcctct ttctagattg ccagctcatg acatggtgct
tataaagatt taattaaagt 6120aagaatgaaa taaagttttt ataattataa
cagttaaaaa aaaaaaaaaa aaa 617326104DNAHomo sapiens 2agaagcgccc
ggagcccgcg gggcgacgtc acccccggct ccgcccccgt ccctccccga 60gcaaagtaac
tcttgactaa caggagcagc ctccgccgag catggagagc tgccgccgcg
120gccggccggc gacgctggcg acgctttcgc ccctgaggta gtttggcgac
cgcgaagaag 180gaaaaagggc gggcgggcgg ctgtcctctc accgtcctca
ccccgcgagg cccggcccgc 240tcctccgtcg tggatttcgc ggcgatcccc
ccggcagctc tttgcaaagc tgcttgaaac 300ttctcccaaa ctcggcatgg
atacgactgc ggcggcggcg ctgcctgctt ttgtggcgct 360cttgctcctc
tctccttggc ctctcctggg atcggcccaa ggccagttct ccgcaggtgg
420ctgtactttt gatgatggtc caggggcctg tgattaccac caggatctgt
atgatgactt 480tgaatgggtg catgttagtg ctcaagagcc tcattatcta
ccacccgaga tgccccaagg 540ttcctatatg atagtggact cttcagatca
cgaccctgga gaaaaagcca gacttcagct 600gcctacaatg aaggagaacg
acactcactg cattgatttc agttacctat tatatagcca 660gaaaggactg
aatcctggca ctttgaacat attagttagg gtgaataaag gacctcttgc
720caatccaatt tggaatgtga ctggattcac gggtagagat tggcttcggg
ctgagctagc 780agtgagcacc ttttggccca atgaatatca ggtaatattt
gaagctgaag tctcaggagg 840gagaagtggt tatattgcca ttgatgacat
ccaagtactg agttatcctt gtgataaatc 900tcctcatttc ctccgtctag
gggatgtaga ggtgaatgca gggcaaaacg ctacatttca 960gtgcattgcc
acagggagag atgctgtgca taacaagtta tggctccaga gacgaaatgg
1020agaagatata ccagtagccc agactaagaa catcaatcat agaaggtttg
ccgcttcctt 1080cagattgcaa gaagtgacaa aaactgacca ggatttgtat
cgctgtgtaa ctcagtcaga 1140acgaggttcc ggtgtgtcca attttgctca
acttattgtg agagaaccgc caagacccat 1200tgctcctcct cagcttcttg
gtgttgggcc tacatatttg ctgatccaac taaatgccaa 1260ctcgatcatt
ggcgatggtc ctatcatcct gaaagaagta gagtaccgaa tgacatcagg
1320atcctggaca gaaacccatg cagtcaatgc tccaacttac aaattatggc
atttagatcc 1380agataccgaa tatgagatcc gagttctact tacaagacct
ggtgaaggtg gaacggggct 1440cccaggacct ccactaatca ccagaacaaa
atgtgcagaa cctatgagaa ccccaaagac 1500attaaagatt gctgaaatac
aggcaagacg gattgctgtg gactgggaat ccttgggtta 1560caacattacg
cgttgccaca cttttaatgt cactatctgc taccattact tccgtggtca
1620caacgagagc aaggcagact gtttggacat ggaccccaaa gcccctcagc
atgttgtgaa 1680ccatctgcca ccttatacaa atgtcagcct caagatgatc
ctaaccaatc cagagggaag 1740gaaggagagt gaagagacaa ttattcaaac
tgatgaagat gtgcctggtc ccgtaccagt 1800aaaatctctt caaggaacat
cctttgaaaa taagatcttc ttgaactgga aagaaccttt 1860ggatccaaat
ggaatcatca ctcaatatga gatcagctat agcagtataa gatcatttga
1920tcctgcagtt ccagtggctg gacctcccca gactgtatca aatttatgga
acagtacaca 1980ccatgtcttt atgcatctcc accctggaac cacgtaccag
tttttcataa gagccagcac 2040ggtcaaaggc tttggtccag ccacagccat
caatgtcacc accaatatct cagctccaac 2100tttacctgac tatgaaggag
ttgatgcctc tctcaatgaa actgccacca caataactgt 2160attgttgaga
ccagcacaag ccaaaggtgc tcctatcagt gcttatcaga ttgttgtgga
2220agaactgcac ccacaccgaa ccaagagaga agccggagcc atggaatgct
accaggttcc 2280tgtcacatac caaaatgcca tgagtggggg tgcaccgtat
tactttgctg cagaactccc 2340cccgggaaac ctacctgagc ctgccccgtt
cactgtgggt gacaatcgga cctaccaagg 2400cttttggaac cctcctttgg
ctccgcgcaa aggatacaac atctatttcc aggcgatgag 2460cagtgtggag
aaggaaacta aaacccagtg cgtacgcatt gctacaaaag cagcagcaac
2520agaagaacca gaagtgatcc cagatcccgc caagcagaca gacagagtgg
tgaaaatagc 2580aggaattagt gctggaattt tggtgttcat cctccttctc
ctagttgtca tattaattgt 2640aaaaaagagc aaacttgcta aaaaacgcaa
agatgccatg gggaataccc ggcaggagat 2700gactcacatg gtgaatgcaa
tggatcgaag ttatgctgat cagagcactc tgcatgcaga 2760agatcctctt
tccatcacct tcatggacca acataacttt agtccaagat atgagaacca
2820cagtgctaca gcagagtcca gtcgccttct agacgtacct cgctacctct
gtgaggggac 2880ggaatcccct taccagacag gacagctgca tccagccatc
agggtagctg atttactgca 2940gcacattaat ctcatgaaga catcagacag
ctatgggttc aaagaggaat atgagagctt 3000ttttgaagga cagtcagcat
cttgggatgt agctaaaaaa gatcaaaata gagcaaaaaa 3060ccgatatgga
aacattatag catatgatca ctccagagtg attttgcaac ccgtagagga
3120tgatccttcc tcagattata ttaatgccaa ctatattgat ggctaccaga
gaccaagtca 3180ttacattgca acccaaggtc ccgttcatga aacagtgtat
gatttctgga ggatgatttg 3240gcaagaacaa tctgcttgca ttgtgatggt
tacaaattta gttgaggttg gccgggttaa 3300atgctataaa tattggcctg
atgatactga agtttatggt gacttcaaag taacgtgtgt 3360agaaatggaa
ccacttgctg aatatgtagt taggacattc accctggaaa ggagggggta
3420caatgaaatc cgtgaagtta aacagttcca tttcacgggc tggcctgacc
atggagtgcc 3480ctaccatgct acagggctgc tttcctttat ccggcgagtc
aagttatcaa accctcccag 3540tgctggcccc atcgttgtac attgcagtgc
tggtgctgga cgaactggct gctacattgt 3600gattgacatc atgctagaca
tggctgaaag agagggtgtt gttgatattt acaattgtgt 3660caaagcctta
agatctcggc gtattaatat ggtccagaca gaggaacagt acatttttat
3720tcatgatgcc attttagaag cctgcttatg tggagaaact gccatacctg
tctgtgaatt 3780taaagctgca tattttgata tgattagaat agactcccag
actaactctt cacatctcaa 3840ggatgaattt cagactctga attcagtcac
ccctcgacta caagctgaag actgcagtat 3900agcgtgcctg ccaaggaacc
atgacaagaa ccgtttcatg gacatgctgc cacctgacag 3960atgtctgcct
tttttaatta caattgatgg ggagagcagt aactacatca atgctgctct
4020tatggacagc tacaggcaac cagctgcttt catcgtcaca caataccctc
tgccaaacac 4080tgtaaaagac ttctggagat tagtgtatga ttatggctgt
acctccattg tgatgttaaa 4140cgaagtcgac ttgtcccagg gctgccctca
gtactggcca gaggaaggga tgctacgata 4200tggccccatc caagtggaat
gtatgtcttg ttcaatggac tgtgatgtga tcaaccggat 4260ttttaggata
tgcaatctaa caagaccaca ggaaggttat ctgatggtgc aacagtttca
4320gtacctagga tgggcttctc atcgagaagt gcctggatcc aaaaggtcat
tcttgaaact 4380gatacttcag gtggaaaagt ggcaggagga atgcgaggaa
ggggaaggcc ggacgattat 4440ccactgccta aatggtggcg ggcgaagtgg
catgttctgt gctataggca tcgttgttga 4500aatggtgaaa cggcaaaatg
ttgtcgatgt tttccatgca gtaaagacac tgaggaacag 4560caagccaaac
atggtggaag ccccggagca ataccgtttc tgctatgatg tagctttgga
4620gtacctggaa tcatcttagt tgggtgagac tctttaaagt gcatccatga
agaaacctgt 4680ccatctattg agccagcagc tgttgtacct gttacacttg
tgcagaaaga ttttaatgtg 4740gggggtggga gacttttaca tttgagaggt
aaaagtattt tttttatgaa gttgtgtatc 4800ttaataaaaa ggactgaatt
agtttttatt actatattaa agcatcaaca tttcatgcca 4860cataaattat
atttaataag aaccagattg aaatgagaac gtattggtgt ttgtacagtg
4920aacatgccac cttttttctc atggtttcag tagagcagct accacatgtt
gcatgagttc 4980atactttcta cgtggcattt ttctcccttt ctaaaatgaa
agctgatgaa tcttaaaagg 5040aagaagaaaa gaaaagctgt gcaaattcat
agtaaagttc gttttttata tgtttccagt 5100gtagcagatc tctatataaa
tatataaata tatataactg gcttattttc ttttaatgtg 5160caatgatggc
tggatcattt aaagttcttt ttagaaaata acataagcca aagactcaag
5220tgtaaatatg tctatatgga gaaagcacat tatatttatt ggttacttac
attccttttt 5280tgatggctaa aatactacca ccacacaatc atcttttttt
tcctgaagaa agctttttct 5340ttagctaaaa tcaattgtaa acgatttttg
tagattattt tttgtatgtt ttagtgtaag 5400tagaagataa actttttatt
cataaaccag gaagcaatgt tctttatagt gattctcttg 5460tgtacatgct
tgtgaattaa atttgtgtaa aatcccttgg caattgggtc ttttaatata
5520ggaccaaatt aaaacatttt gctgaatatg tatagttttt cacaatttca
ttaggtaaat 5580aatggtttgg tgatcataca tgagaaatgt acacattaaa
aggccttgct gacaacttgc 5640acaatgttga acatagcctt taagcatcat
ttaaatttta aaggaatgga gtttttcagc 5700ctgtggccca gcactggtca
agaaaacaag atggcaacat atatgctttc agggtcaaat 5760ttgagcaaac
tgtaaactgt cagggtgata aaatgtttct cttgatgttt acatgcacaa
5820gctttgcgtt ctgactataa aaagtgtgaa caaatcaatg ccagattcct
gttttgcgca 5880ttgtcatggg attcttaagt gaacctttct aaatgtggtc
ttgttcacat gctccacgta 5940gctgtaactt cacatcatca gcttgcagtt
tgtaattgac taaagcattc cagtgtcctc 6000tttctagatt gccagctcat
gacatggtgc ttataaagat ttaattaaag taagaatgaa 6060ataaagtttt
tataattata acagttaaaa aaaaaaaaaa aaaa 6104325DNAArtificial
SequenceSynthetic polynucleotide 3tcttaatcac aacctaccac aagga
25425DNAArtificial SequenceSynthetic polynucleotide 4acagcaaagt
atgagcatac catct 25525DNAArtificial SequenceSynthetic
polynucleotide 5taaagacaac ttactacatg gatgt 25625DNAArtificial
SequenceSynthetic polynucleotide 6cctcttacct cagttacaat ttata
25
* * * * *