U.S. patent number 10,251,912 [Application Number 15/241,996] was granted by the patent office on 2019-04-09 for mhc class ii restricted t cell epitopes from the cancer antigen, ny eso-1.
This patent grant is currently assigned to The United States of America, as represented by the Secretary, Department of Health and Human Services. The grantee listed for this patent is The United States of America, as represented by the Secretary, Department of Health and Human Services, The United States of America, as represented by the Secretary, Department of Health and Human Services. Invention is credited to Steven A. Rosenberg, Rong-Fu Wang, Gang Zeng.
![](/patent/grant/10251912/US10251912-20190409-D00001.png)
![](/patent/grant/10251912/US10251912-20190409-D00002.png)
![](/patent/grant/10251912/US10251912-20190409-D00003.png)
![](/patent/grant/10251912/US10251912-20190409-D00004.png)
![](/patent/grant/10251912/US10251912-20190409-D00005.png)
![](/patent/grant/10251912/US10251912-20190409-D00006.png)
![](/patent/grant/10251912/US10251912-20190409-D00007.png)
![](/patent/grant/10251912/US10251912-20190409-D00008.png)
![](/patent/grant/10251912/US10251912-20190409-D00009.png)
![](/patent/grant/10251912/US10251912-20190409-D00010.png)
![](/patent/grant/10251912/US10251912-20190409-D00011.png)
View All Diagrams
United States Patent |
10,251,912 |
Wang , et al. |
April 9, 2019 |
MHC class II restricted T cell epitopes from the cancer antigen, NY
ESO-1
Abstract
The present invention discloses the identification and isolation
of novel MHC class II epitopes derived from the cancer antigen, NY
ESO-1. The novel MHC class II epitopes from NY-EsO-1 are recognized
by CD4.sup.+ T lymphocytes in an HLA class II restricted manner, in
particular HLA-DR or HLA-DP restricted. The products of the gene
are promising candidates for immunotherapeutic strategies for the
prevention, treatment and diagnosis of patients with cancer.
Inventors: |
Wang; Rong-Fu (Houston, TX),
Rosenberg; Steven A. (Potomac, MD), Zeng; Gang
(Germantown, MD) |
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary,
Department of Health and Human Services |
Washington |
DC |
US |
|
|
Assignee: |
The United States of America, as
represented by the Secretary, Department of Health and Human
Services (Washington, DC)
|
Family
ID: |
26874905 |
Appl.
No.: |
15/241,996 |
Filed: |
August 19, 2016 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20160354409 A1 |
Dec 8, 2016 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
14284971 |
May 22, 2014 |
9447144 |
|
|
|
12568134 |
Jun 17, 2014 |
8754046 |
|
|
|
10182506 |
Nov 17, 2009 |
7619057 |
|
|
|
PCT/US01/02765 |
Jan 26, 2001 |
|
|
|
|
60237107 |
Sep 29, 2000 |
|
|
|
|
60179004 |
Jan 28, 2000 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K
45/06 (20130101); A61K 38/08 (20130101); C07K
16/30 (20130101); A61K 35/17 (20130101); A61P
35/00 (20180101); C07K 7/06 (20130101); C07K
14/4748 (20130101); A61K 38/00 (20130101); Y02A
50/30 (20180101); A61K 2039/53 (20130101); A01K
2217/05 (20130101); A61K 39/00 (20130101); A61K
48/00 (20130101); C07K 2319/00 (20130101); C12N
2799/021 (20130101) |
Current International
Class: |
A61K
39/395 (20060101); C07K 7/06 (20060101); A61K
45/06 (20060101); A61K 38/08 (20190101); C07K
16/30 (20060101); C07K 14/47 (20060101); A61K
35/17 (20150101); A61K 39/00 (20060101); A61K
48/00 (20060101); A61K 38/00 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 99/18206 |
|
Apr 1999 |
|
WO |
|
WO 99/47641 |
|
Sep 1999 |
|
WO |
|
WO 99/53938 |
|
Oct 1999 |
|
WO |
|
WO 00/00824 |
|
Jun 2000 |
|
WO |
|
WO 01/23560 |
|
Apr 2001 |
|
WO |
|
WO 01/36453 |
|
May 2001 |
|
WO |
|
Other References
Granziero et al., Eur. J. Immunol. , 29:1127-1138, 1999. cited by
examiner .
Byers, T., CA Journal, vol. 49, No. 6, Nov./Dec. 1999. cited by
examiner .
Acsadi et al., "Human dystrophin expression in mdx mice after
intramuscular injection of DNA constructs," Nature, 352 (6338),
815-818 (1991). cited by applicant .
Ben-Efraim, "One hundred years of cancer immunotherapy: a critical
appraisal," Tumour Biol., 20 (1), 1-24 (1999). cited by applicant
.
Bloom et al., "Identification of tyrosinase-related protein 2 as a
tumor rejection antigen for the B16 melanoma," J. Exp. Med., 185
(3), 453-460 (1997). cited by applicant .
Boon, "Toward a genetic analysis of tumor rejection antigens," Adv.
Can. Res., 58, 177-210 (1992). cited by applicant .
Bouwer et al., "Elimination of the Listeriolysin O-Directed Immune
Response by Conservative Alteration of the Immunodominant
Listeriolysin O Amino Acid 91 to 99 Epitope," Infection and
Immunity, 64(9), 3728-3735 (Sep. 1996). cited by applicant .
Bowne et al., "Coupling and uncoupling of tumor immunity and
autoimmunity," J. Exp. Med., 190 (11), 1717-1722 (1999). cited by
applicant .
Chaux et al., "Estimation of the frequencies of anti-MAGE-3
cytolytic T-lymphocyte precursors in blood from individuals without
cancer," Int. J. Cancer, 77 (4), 538-542 (1998). cited by applicant
.
Chaux et al., "Identification of MAGE-3 epitopes presented by
HLA-DR molecules to CD4(+) T lymphocytes," J. Exp. Med., 189 (5),
767-778 (1999). cited by applicant .
Chen et al., "A testicular antigen aberrantly expressed in human
cancers detected by autologous antibody screening," Proc. Natl.
Acad. Sci., USA, 94 (5), 1914-1918 (1997). cited by applicant .
Chen et al., "Cancer-testis antigens: targets for cancer
immunotherapy," Cancer J. Sci. Am., 5 (1), 16-17 (1999). cited by
applicant .
Cooney et al., "Safety of and immunological response to a
recombinant vaccinia virus vaccine expressing HIV envelope
glycoprotein," Lancet, 337 (8741), 567-572 (1991). cited by
applicant .
Davis et al., "Direct gene transfer into skeletal muscle in vivo:
factors affecting efficiency of transfer and stability of
expression," Hum. Gene Ther., 4 (2), 151-159 (1993). cited by
applicant .
Dong et al., "Characterization of T cell epitopes restricted by
HLA-DP9 in streptococcal M12 protein," J. Immunol., 154 (9),
4536-4545 (1995). cited by applicant .
Dong et al., "An HLA-B35-restricted epitope modified at an anchor
residue results in an antagonist peptide," Eur. J. Immunol., 26,
335-339 (1996). cited by applicant .
Eisenbraum et al., "Examination of parameters affecting the
elicitation of humoral immune responses by particle
bombardment-mediated genetic immunization," DNA and Cell Biol., 12
(9), 791-797 (1993). cited by applicant .
European Patent Office: European Search Report in European Patent
Application No. 10010353.0 (dated Mar. 2, 2011). cited by applicant
.
European Patent Office: European Search Report in European Patent
Application No. 10010389.4 (dated Mar. 3, 2011). cited by applicant
.
European Patent Office: European Search Report in European Patent
Application No. 10010354.8 (dated Apr. 14, 2011). cited by
applicant .
Excerpt from Janeway's Immunobiology, "The major histocompatibility
complex and its functions," 7.sup.th Edition, 201 (2008). cited by
applicant .
Ezzell, "Cancer "Vaccines": An Idea Whose Time Has Come?" J. NIH
Res., 7, 46-49 (1995). cited by applicant .
Frazer, "Is vaccine therapy the future in cancer prevention?,"
Expert. Opin. Pharmacother., 5 (12), 2427-2434 (2004). cited by
applicant .
Fuller et al., "A qualitative progression in HIV type 1
glycoprotein 120-specific cytotoxic cellular and humoral immune
responses in mice receiving a DNA-based glycoprotein 120 vaccine,"
AIDS Res. Hum. Retroviruses, 10 (11), 1433-1441 (1994). cited by
applicant .
Futaki et al., "Naturally processed HLA-DR9/DR53
(DRB1*0901/DRB4*0101)- bound peptides," Immunogenetics, 42 (4),
299-301 (1995). cited by applicant .
Fynan et al., "DNA vaccines: protective immunizations by
parenteral, mucosal, and gene-gun inoculations," Proc. Natl. Acad.
Sci., USA, 90 (24), 11478-11482 (1995). cited by applicant .
Gebe et al., "HLA class II peptide-binding and autoimmunity,"
Tissue Antigens, 59 (2), 78-87 (2002). cited by applicant .
Genbank Accession No. AF038567, Homo sapiens cancer antigen-3 and
cancer antigen-3-ORF2 mRNA (Jan. 16, 1999). cited by applicant
.
Genbank Accession No. AJ223040, Homo sapiens mRNA for LAGE-1 b
protein (Oct. 7, 2008). cited by applicant .
Genbank Accession No. AJ223041, Homo sapiens mRNA for LAGE-1a
protein (Oct. 7, 2008). cited by applicant .
Genbank Accession No. AJ223093, Homo sapiens LAGE-1 gene (Nov. 14,
2006). cited by applicant .
Genbank Accession No. AAB49693, gi: 1890099, autoimmunogenic
cancer/testis antigen NY-ESO-1 [Home sapiens] (Dec. 22, 1999).
cited by applicant .
Gjertson et al., Population Studies, P. Teraskai and D.W. Gjertson,
editors; UCLA Tissue Typing Laboratory, LA, CA, 174-427 (1997).
cited by applicant .
Haas et al., "Distribution of human leukocyte antigen-ABC and -D/DR
antigens in the unfixed human testis," Am. J. Reprod. Immunuol.
Microbiol., 18 (2), 47-51 (1988). cited by applicant .
Hara et al., "Implicating a role for immune recognition of self in
tumor rejection: passive immunization against the brown locus
protein," J. Exp. Med., 182 (5), 1609-1614 (1995). cited by
applicant .
Houghton, "Cancer antigens: immune recognition of self and altered
self," J. Exp. Med, 180 (1), 1-4 (1994). cited by applicant .
Hunder et al., "Treatment of Metastatic Melanoma with Autologous
CD4+ T Cells against NY-ESO-1," N. Engl. J. Med., 358 (25),
2698-2703 (2008). cited by applicant .
Hung, "The central role of CD4(+) T cells in the antitumor immune
response," J. Exp. Med., 188 (12), 2357-2368 (1998). cited by
applicant .
Ito et al., "HLA-DR4-IE chimeric class II transgenic, murine class
II-deficient mice are susceptible to experimental allergic
encephalomyelitis," J. Exp. Med., 183 (6), 2635-2644 (1996). cited
by applicant .
Jager et al., "Simultaneous humoral and cellular immune response
against cancer-testis antigen NY-ESO-1: definition of human
histocompatibility leukocyte antigen (HLA)-A2-binding peptide
epitopes," J. Exp. Med., 187 (2), 265-270 (1998). cited by
applicant .
Jager et al., "Humoral immune responses of cancer patients against
"Cancer-Testis" antigen NY-ESO-1: correlation with clinical
events," Int. J. Cancer, 84 (5), 506-510 (1999). cited by applicant
.
Jager et al., "Identification of NY-ESO-1 epitopes presented by
human histocompatibility antigen (HLA)-DRB4*0101-0103 and
recognized by CD4(+) T lymphocytes of patients with
NY-ESO-1-expressing melanoma," J. Exp. Med., 191 (4), 625-630
(2000). cited by applicant .
Johnstone and Thorpe, Immunochemistry in Practice, 2.sup.nd Ed.
1987, Blackwell Scientific Publications, Oxford, p. 30 and pp.
49-50. cited by applicant .
Kawakami et al., "Interleukin 4 promotes the growth of
tumor-infiltrating lymphocytes cytotoxic for human autologous
melanoma," J. Exp. Med., 168 (6), 2183-2191 (1988). cited by
applicant .
Kawakami et al., "Cloning of the gene coding for a shared human
melanoma antigen recognized by autologous T cells infiltrating into
tumor," Proc. Natl. Acad. Sci., USA, 91 (9), 3515-3519 (1994).
cited by applicant .
Kawakami et al., "Identification of a human melanoma antigen
recognized by tumor-infiltrating lymphocytes associated with in
vivo tumor rejection," Proc. Natl., Acad. Sci., USA, 91 (14),
6458-6462 (1994). cited by applicant .
Kawakami et al., "Identification of tumor-regression antigens in
melanoma," Important Adv. Oncol., 3-21 (1996). cited by applicant
.
Khong et al., "Immunization of HLA-A*0201 and/or HLA-DPbetal*04
patients with metastatic melanoma using epitopes from the NY-ESO-1
antigen," J. Immunother. 27 (6), 472-477 (2004). cited by applicant
.
Kirkin et al., "Melanoma-associated antigens recognized by
cytotoxic T lymphocytes," APMIS, 106 (7), 665-679 (1998). cited by
applicant .
Lee et al., "NY-ESO-1 may be a potential target for lung cancer
immunotherapy," Cancer J. Sci. Am., 5 (1), 20-25 (1999). cited by
applicant .
Lethe et al., "LAGE-1, a new gene with tumor specificity," Int. J.
Cancer, 76, 903-908 (1998). cited by applicant .
Li et al., "Tumour-specific MHC-class-II-restricted responses after
in vitro sensitization to synthetic peptides corresponding to gp100
and Annexin II eluted from melanoma cells," Cancer Immunol.
Immunother., 47 (1), 32-38 (1998). cited by applicant .
Manici et al., "Melanoma cells present a MAGE-3 epitope to CD4(+)
cytotoxic T cells in association with histocompatibility leukocyte
antigen DR11," J. Exp. Med., 189 (5), 871-876 (1999). cited by
applicant .
Marchand et al., "Tumor regressions observed in patients with
metastatic melanoma treated with an antigenic peptide encoded by
gene MAGE-3 and presented by HLA-A1," Int. J. Cancer, 80 (2),
219-230 (1999). cited by applicant .
Marincola et al., "Tumors as elusive targets of T-cell-based active
immunotherapy," Trends in Immunology, 24 (6), 334-341 (2003). cited
by applicant .
Mumberg et al., "CD4(+) T cells eliminate MHC class II-negative
cancer cells in vivo by indirect effects of IFN-gamma," Proc. Natl.
Acad. Sci., USA, 96 (15), 8633-8638 (1999). cited by applicant
.
Nestle et al., "Vaccination of melanoma patients with peptide- or
tumor lysate-pulsed dendritic cells," Nat. Med., 4 (3), 328-332
(1998). cited by applicant .
Odunsi et al., "Vaccination with an NY-ESO-1 peptide of HLA class
I/II specificities induces integrated humoral and T cell responses
in ovarian cancer," PNAS, 104(31), 12837-12842 (2007). cited by
applicant .
Old et al., "New paths in human cancer serology," J. Exp. Med, 187
(8), 1163-1167 (1998). cited by applicant .
Ossendorp et al., "Specific T helper cell requirement for optimal
induction of cytotoxic T lymphocytes against major
histocompatibility complex class II negative tumor," J. Exp. Med.,
187 (5), 693-702 (1998). cited by applicant .
Overwijk et al., "Vaccination with a recombinant vaccinia virus
encoding a "self" antigen induces autoimmune vitiligo and tumor
cell destruction in mice: requirement for CD4(+) T lymphocytes,"
Proc. Natl. Acad. Sci., USA, 96 (6), 2982-2987 (1999). cited by
applicant .
Pardoll et al., "The role of CD4+ T cell responses in antitumor
immunity," Curr. Opin. Immunol., 10 (5), 588-594 (1998). cited by
applicant .
Pieper et al., "Biochemical identification of a mutated human
melanoma antigen recognized by CD4(+) T cells," J. Exp. Med., 189
(5), 757-766 (1999). cited by applicant .
Rammensee et al., "MHC ligands and peptide motifs: first listing,"
Immunogenetics, 41 (4), 178-228 (1995). cited by applicant .
Riley et al., "Activation of class II MHC genes requires both the X
box region and the class II transactivator (CIITA)," Immunity, 2
(5), 533-543 (1995). cited by applicant .
Robbins et al., "A mutated beta-catenin gene encodes a
melanoma-specific antigen recognized by tumor infiltrating
lymphocytes," J. Exp. Med., 183 (3), 1185-1192 (1995). cited by
applicant .
Roitt et al., Immunology, 4.sup.th Ed., Mosby, p. 7-9. 7-10, and
7-11 (1996). cited by applicant .
Rosenberg et al., "Vitiligo in patients with melanoma: normal
tissue antigens can be targets for cancer immunotherapy," J.
Immunother. Emphasis Tumor Immunol., 19 (1), 81-84 (1996). cited by
applicant .
Rosenberg et al., "A new era for cancer immunotherapy based on the
genes that encode cancer antigens," Immunity., 10 (3), 281-287
(1999). cited by applicant .
Rosenberg et al., "Immunologic and therapeutic evaluation of a
synthetic peptide vaccine for the treatment of patients with
metastatic melanoma," Nat. Med., 4 (3), 321-327 (1998). cited by
applicant .
Soderstrup et al., "Identification of autoantigen epitopes in MHC
class II transgenic mice," Immunol. Rev, 164, 129-138 (1998). cited
by applicant .
Southwood et al., "Several common HLA-DR types share largely
overlapping peptide binding repertoires," J. Immunol., 160 (7),
3363-3373 (1998). cited by applicant .
Smith, "Cancer and the immune system," Pediatr. Clin. North Am., 41
(4), 841-850 (1994). cited by applicant .
Spitler, "Cancer vaccines: the interferon analogy," Cancer
Biother., 10 (1), 1-3 (1995). cited by applicant .
Stockert et al., "A survey of the humoral immune response of cancer
patients to a panel of human tumor antigens," J. Exp. Med., 187
(8), 1349-1354 (1998). cited by applicant .
Thurner et al., "Vaccination with mage-3A1 peptide-pulsed mature,
monocyte-derived dendritic cells expands specific cytotoxic T cells
and induces regression of some metastases in advanced stage IV
melanoma," J. Exp. Med., 190 (11), 1669-1678 (1999). cited by
applicant .
Toes et al., "CD4 T cells and their role in antitumor immune
responses," J. Exp. Med., 189 95), 753-756 (1999). cited by
applicant .
Topalian et al., "Melanoma-specific CD4+ T cells recognize
nonmutated HLA-DR-restricted tyrosinase epitopes," J. Exp. Med.,
183 (5), 1965-1971 (1996). cited by applicant .
Touloukian et al., "Identification of a MHC class II-restricted
human gp100 epitope using DR4-IE transgenic mice," J. Immunol., 164
(7), 3535-3542 (2000). cited by applicant .
Van Der Bruggen et al., "A gene encoding an antigen recognized by
cytolytic T lymphocytes on a human melanoma," Science, 254 (5038),
1643-1647 (1991). cited by applicant .
Walter et al., "Reconstitution of cellular immunity against
cytomegalovirus in recipients of allogeneic bone marrow by transfer
of T-cell clones from the donor," N. Engl. J. Med., 333 (16),
1038-1044 (1995). cited by applicant .
Wang et al., "Mammalian cell/vaccinia virus expression vectors with
increased stability of retroviral sequences in Escherichia coli:
production of feline immunodeficiency virus envelope protein,"
Gene, 153 (2), 197-202 (1995). cited by applicant .
Wang et al., "Identification of a gene encoding a melanoma tumor
antigen recognized by HLA-A31-restricted tumor-infiltrating
lymphocytes," J. Exp. Med., 181 (2), 799-804 (1995). cited by
applicant .
Wang et al., "Identification of TRP-2 as a human tumor antigen
recognized by cytotoxic T lymphocytes," J. Exp. Med., 184 (6),
2207-2216 (1996). cited by applicant .
Wang, "Tumor antigens discovery: perspectives for cancer therapy,"
Mol. Med., 3 (1), 716-731 (1997). cited by applicant .
Wang et al., "A breast and melanoma-shared tumor antigen: T cell
responses to antigenic peptides translated from different open
reading frames," J. Immunol., 161, 3596-3606 (1998). cited by
applicant .
Wang et al., "Human tumor antigens for cancer vaccine development,"
Immunol. Rev., 170, 85-100 (1999). cited by applicant .
Wang et al., "Identification of a novel major histocompatibility
complex class II-restricted tumor antigen resulting from a
chromosomal rearrangement recognized by CD4(+) T cells," J. Exp.
Med., 189 (10), 1659-1667 (1999). cited by applicant .
Wang et al., "Cloning genes encoding MHC class II-restricted
antigens: mutated CDC27 as a tumor antigen," Science, 284 (5418),
1351-1354 (1999). cited by applicant .
Wang et al., "The role of MHC class II-restricted tumor antigens
and CD4+ T cells in antitumor immunity," Trends in Immunology, 22
(5), 269-276 (2001). cited by applicant .
Weber et al., "Tumor immunity and autoimmunity induced by
immunization with homologous DNA," J. Clin. Invest., 102 (6),
1258-1264 (1998). cited by applicant .
Williams et al., "Introduction of foreign genes into tissues of
living mice by DNA-coated microprojectiles," Proc. Natl. Acad.
Sci,. USA, 88 (7), 2726-2730 (1991). cited by applicant .
Wolff et al., "Direct gene transfer into mouse muscle in vivo,"
Science, 247 (4949, Pt. 1), 1465-1468 (1990). cited by applicant
.
Yang et al., "In vivo and in vitro gene transfer to mammalian
somatic cells by particle bombardment," Proc. Natl. Acad. Sci, USA,
87 (24), 9568-9572 (1990). cited by applicant .
Zeng et al., "Identification of CD4+ T cell epitopes from NY-ESO-1
presented by HLA-DR molecules," J. Immunol, 165 (2), 1153-1159
(2000). cited by applicant .
Zeng et al., "CD4(+) T cell recognition of MHC class II-restricted
epitopes from NY-ESO-1 presented by a prevalent HLA DP4 allele:
association with NY-ESO-1 antibody production," Proc. Natl. Acad.
Sci., USA, 98 (7), 3964-3969 (2001). cited by applicant .
Zeng et al., "Generation of NY-ESO-1-specific CD4+ and CD8+ T cells
by a single peptide with dual MHC class I and class II
specificities: a new strategy for vaccine design," Cancer Res., 62
(3), 3630-3635 (2002). cited by applicant.
|
Primary Examiner: Halvorson; Mark
Attorney, Agent or Firm: Leydig, Voit & Mayer, Ltd.
Government Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND
DEVELOPMENT
This invention was made with Government support under project
number Z01SC003811 by the National Institutes of Health, National
Cancer Institute. The Government has certain rights in the
invention
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This patent application is a continuation of U.S. patent
application Ser. No. 14/234,971, filed May 22, 2014, which is a
divisional Application of U.S. patent application Ser. No.
12/568,134, filed Sep. 28, 2009, now U.S. Pat. No. 8,754,046, which
is a divisional Application of U.S. patent application Ser. No.
10/182,506, filed Oct. 28, 2002, now U.S. Pat. No. 7,619,057, which
is a U.S. National Phase of International Patent Application No.
PCT/US01/02765, filed Jan. 26, 2001, which claims the benefit of
U.S. Provisional Patent Application No. 60/179,004, filed Jan. 28,
2000, and U.S. Provisional Patent Application No. 60/237,107, filed
Sep. 29, 2000, each of which is incorporated by reference herein in
its entirety.
Claims
We claim:
1. A method of treating cancer in a mammal, the method comprising
administering one or more cells to the mammal in an amount
effective to treat cancer in the mammal, wherein the cell is an
isolated or purified cancer antigen specific human CD4+ T
lymphocyte immunoreactive with an HLA-DP restricted NY-ESO-1
peptide comprising Xaa.sub.1ITQXaa.sub.2FXaa.sub.3PXaa.sub.4 (SEQ
ID NO: 51), wherein Xaa.sub.1 is Trp, Xaa.sub.2 is Cys, Xaa.sub.3
is Leu, Xaa.sub.4 represents at least one amino acid, and wherein
the peptide consists of 9-30 amino acid residues and is
immunologically recognized by HLA-DP restricted CD4+ T
lymphocytes.
2. The method of claim 1, wherein the NY-ESO-1 peptide consists of
9-30 amino acid residues and comprises an amino acid sequence
selected from the group consisting of SEQ ID NOs: 53-64 and
X.sub.0-WITQCFLPVF-X.sub.5 (SEQ ID NO: 52), wherein X.sub.0 and
X.sub.5 each represent one or more naturally occurring amino
acids.
3. The method of claim 1, wherein the NY-ESO-1 peptide consists of
the amino acid sequence of SEQ ID NO: 54.
4. The method of claim 1, wherein the cancer expresses
NY-ESO-1.
5. The method of claim 1, wherein the cancer is thymoma, lymphoma
or sarcoma.
6. The method of claim 1, wherein the cancer is lung cancer, liver
cancer, or non-Hodgkin's lymphoma.
7. The method of claim 1, wherein the cancer is Hodgkins lymphoma,
leukemia, or uterine cancer.
8. The method of claim 1, wherein the cancer is cervical cancer,
bladder cancer, or kidney cancer.
9. The method of claim 1, wherein the cancer is head and neck
cancer, neuroblastoma, or adenocarcinoma.
10. The method of claim 1, wherein the cancer is breast cancer,
prostate cancer, or ovarian cancer.
11. The method of claim 1, wherein the cancer is pancreatic cancer
or thyroid cancer.
12. The method of claim 1, wherein the cancer is melanoma.
13. The method of claim 12, wherein the melanoma is primary
melanoma.
14. The method of claim 12, wherein the melanoma is metastatic
melanoma.
15. The method of claim 12, wherein the melanoma is
melanocarcinoma.
16. The method of claim 12, wherein the melanoma is
melanoepithelioma.
17. The method of claim 12, wherein the melanoma is
melanosarcoma.
18. The method of claim 12, wherein the melanoma is melanoma in
situ.
19. The method of claim 12, wherein the melanoma is superficial
spreading melanoma.
20. The method of claim 12, wherein the melanoma is nodular
melanoma, lentigo maligna melanoma, or acral lentiginous melanoma.
Description
INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY FILED
Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 25,029 Byte
ASCII (Text) file named "726223ST25. TXT," dated Aug. 18, 2016.
FIELD OF THE INVENTION
The present invention relates to the area of cancer diagnostics and
therapeutics including a cancer vaccine. More specifically, the
invention relates to the isolation and purification of a novel
human MHC class II restricted T cell epitope derived from the
cancer peptide, NY ESO-1 and analogs thereof and DNA sequence
encoding the MHC class II restricted T cell epitope or portion
thereof. In particular, the invention relates to HLA-DR and HLA-DP
restricted T cell epitopes from NY ESO-1. The invention further
relates to methods of detecting, diagnosing and treating cancer and
precancer in an individual.
BACKGROUND OF THE INVENTION
T cells play an important role in controlling tumor growth and
mediating tumor regression. To understand the molecular basis of T
cell-mediated antitumor immunity, a number of tumor antigens
recognized by CD8.sup.+ T cells have been identified in melanoma as
well as in other types of cancers (1-3). These studies have led to
several clinical trials using peptides derived from the molecularly
defined tumor antigens (4-7). Although the clinical trial using a
modified peptide derived from gp100 provided some evidence of
therapeutic efficacy for the treatment of patients with metastatic
melanoma (4), these studies mainly focused on the use of CD8.sup.+
T cells. Increasing evidence from both human and animal studies has
indicated that optimal cancer vaccines require the participation of
both CD4.sup.+ and CD8.sup.+ T cells (8, 9). Moreover,
tumor-specific CD4.sup.+ T cells are required for generating
protective immunity against MHC class II-negative tumor cells (10,
11). Identification of such antigens is thus important for the
development of cancer vaccines as well as for our understanding of
the mechanism by which CD4.sup.+ T cells regulate host immune
responses.
Thus far, only a limited number of MHC class II-restricted tumor
antigens have been identified. Several known MHC class I-restricted
tumor antigens such as tyrosinase, gp100 and MAGE-3 were
demonstrated to contain MHC class II-restricted epitopes recognized
by CD4.sup.+ T cells (12-15). Recently, a genetic approach was
developed to identify unknown MHC class II-restricted tumor
antigens by using tumor-specific CD4.sup.+ T cells (16). This has
led to the identification of several mutated tumor antigens
including CDC27, TPI and LDFP (16, 17). Among them, TPI is a
mutated antigen that was independently identified by a biochemical
approach (18).
The NY-ESO-1 gene was previously identified by antibody screening
(19), and was recently identified as an MHC class I-restricted
tumor antigen as well (20, 21). High titers of antibodies against
NY-ESO-1 were also detected from patients with cancer (22). The
NY-ESO-1 cDNA encoded two gene products from two overlapping open
reading frames (20). Because of its strict tumor-specific
expression pattern with the exception of expression in normal
testis as well as its high frequency of expression in many tumors
including melanoma, breast, prostate, lung and other cancers (18,
20, 23), NY-ESO-1 is potentially an important immune target for the
development of immunotherapies for a variety of cancer types
(24).
Although both CTL and antibody immune responses against NY-ESO-1
were demonstrated in patients with cancer, no MHC class
II-restricted T cell epitopes in the NY-ESO-1 protein have been
reported.
The present invention is the identification and isolation of novel
MHC class II restricted T cell epitopes from NY-ESO-1 which are
recognized by CD4.sup.+ T cells. The cancer epitopes of the
invention are useful as an immunogen and vaccine to inhibit or
prevent cancer in a mammal and as a diagnostic agent to detect
cancer or precancer.
SUMMARY OF THE INVENTION
One object of the present invention is to provide a novel peptide
and portions thereof recognized as a MHC class II restricted T cell
epitope by CD4.sup.+ T lymphocytes. The antigenic cancer peptides
of the present invention are encoded within or by a portion of the
NY ESO-1 (term used interchangeably herein with CAG-3) gene (SEQ ID
NO:1) (Genbank Accession No. AF038567; 8:9), or variants or
homologs thereof such as LAGE gene (Genbank Accession No. AJ223040,
AJ223041, and AJ223093).
One aspect of the invention are MHC class II restricted T cell
epitopes encoded by the NY-ESO-1 gene, or variants thereof, which
are useful as a cancer vaccine capable of eliciting CD4.sup.+ T
lymphocytes which results in protection of the recipient from
development of cancer and protection from metastasis. The present
invention also relates to a method of administering the cancer
vaccine in an effective amount to inhibit or prevent cancers or
inhibit the growth of cells expressing the NY-ESO-1 gene
product.
One aspect of the invention are HLA-DR and HLA-DP restricted T cell
epitopes encoded by the NY-ESO-1 gene, or variants and homologs
thereof, which are useful as an immunogen and as a cancer vaccine
capable of eliciting CD4.sup.+ T lymphocytes and an anti-NY-ESO-1
antibody response and in turn offering protection and/or
therapeutic benefits to the recipient from development of cancer
and protection from metastasis. The present invention also relates
to a method of administering the cancer vaccine in an effective
amount to inhibit or prevent cancers, inhibit the growth of cells
expressing the NY-ESO-1 gene product and inhibit metastasis.
Another aspect of the present invention is a pharmaceutical
composition comprising an MHC class II restricted T cell epitope
derived from NY-ESO-1 or variant thereof alone or in combination
with one or more immunostimulatory molecules. The pharmaceutical
composition comprising at least one NY-ESO-1 MHC class II
restricted T cell epitope, or combination of epitopes which
stimulate NY-ESO-1 antigen specific CD4.sup.+ T-cells to elicit an
immunogenic response against tumors and cancers. The pharmaceutical
composition may additionally comprise one or more MHC class I
restricted T cell epitopes derived from NY-ESO-1 for generation of
CD8.sup.+ T lymphocytes. The NY-ESO-1 MHC class II restricted T
cell epitope and the NY-ESO-1 MHC class I restricted T cell epitope
may each be provided as a discrete epitope or linked together and
may be provided in the form of multimers. The cancer epitope or
variant thereof may be provided as an immunogen or as a vaccine for
prevention or treatment of cancer. The pharmaceutical composition
is useful in methods of treating or preventing cancer in a mammal.
In the method of treatment, the pharmaceutical composition is
administered to the mammal in an amount effective in preventing or
inhibiting the cancer in the mammal.
Another aspect of the present invention is a pharmaceutical
composition comprising an HLA-DR restricted and/or an HLA-DP
restricted T cell epitope derived from NY-ESO-1 or variant thereof
alone or in combination with one or more immunostimulatory
molecules. The pharmaceutical composition comprising at least one
NY-ESO-1 HLA-DR restricted T cell epitope or at least one NY-ESO-1
HLA-DP restricted T cell epitope, or combination of MHC class II
restricted T cell epitopes which stimulate NY-ESO-1 antigen
specific CD4.sup.+ T-cells to elicit an immunogenic response
against tumors and cancers. The pharmaceutical composition may
additionally comprise one or more MHC class I restricted T cell
epitopes derived from NY-ESO-1 for generation of CD8.sup.+ T
lymphocytes. The NY-ESO-1 HLA-DR restricted T cell epitope or
NY-ESO-1 HLA-DP restricted T cell epitope and the NY-ESO-1 MHC
class I restricted T cell epitope may each be provided as a
discrete epitope or linked together. The cancer epitope or variant
thereof may be provided as an immunogen or as a vaccine for
prevention or treatment of cancer. The pharmaceutical composition
is useful in methods of treating or preventing cancer in a mammal.
In a method of treatment, the pharmaceutical composition is
administered to the mammal in an amount effective in eliciting
CD4.sup.+ T cell and/or anti-NY-ESO-1 antibody response for
preventing or inhibiting cancer in the mammal.
Another object of the present invention is a method of generating
MHC class II restricted T cell epitopes of NY-ESO-1 or variants
thereof by translation of DNA sequence encoding same from a
NY-ESO-1 gene, portion or homolog thereof.
Another object of the present invention is a method of generating
HLA-DR restricted T cell epitopes or HLA-DP restricted T cell
epitopes of NY ESO-1 or variants or derivatives thereof by
translation of DNA sequence encoding same from a NY-ESO-1 gene or
portion or homolog thereof.
A further aspect of the invention is the isolated DNA or RNA
sequence that encodes at least one MHC class II restricted T cell
epitope of NY-ESO-1 or variant thereof, and complementary sequence
thereof and the use of the DNA or RNA sequence as vaccines and in
methods of producing the MHC class II restricted T cell epitopes of
NY-ESO-1 or variants thereof. The invention further provides
oligonucleotides of the DNA or RNA sequence for use as probes,
primers or antisense.
A further aspect of the invention is the isolated DNA or RNA
sequence that encodes HLA-DR restricted T cell epitopes, HLA-DP
restricted T cell epitopes of NY-ESO-1 or variant and combinations
thereof and the use of the DNA or RNA sequence in methods of
producing the HLA-DR restricted T cell epitopes, the HLA-DP
restricted T cell epitopes of NY-ESO-1 or variants and combinations
thereof. The invention further provides oligonucleotides of the DNA
or RNA sequence for use as probes, primers or antisense.
The present invention further provides vectors comprising nucleic
acid sequences encoding at least one MHC class II restricted cell
epitope of NY-ESO-1 or variant thereof alone or in combination with
a second DNA sequence encoding at least one immunostimulatory
molecule.
The present invention further provides vectors comprising nucleic
acid sequences encoding at least one HLA-DR restricted T cell
epitope or at least one HLA-DP restricted T cell epitope of
NY-ESO-1 or variant or combination thereof alone or in combination
with a second DNA sequence encoding at least one immunostimulatory
molecule.
The invention also provides host cells transfected or transduced
with a vector comprising DNA sequence encoding at least one MHC
class II restricted T cell epitope of NY-ESO-1 or variant thereof
alone or in combination with a second DNA sequence encoding at
least one immunostimulatory molecule. The vectors and host cells
may serve as vaccines in which expression of the MHC class II
restricted T cell epitope results in the stimulation of tumor
antigen specific CD4.sup.+ T lymphocytes in a mammal immunized with
the vaccine.
The invention also provides host cells transfected or transduced
with a vector comprising DNA sequence encoding at least one HLA-DR
restricted T cell epitope or at least one HLA-DP restricted T cell
epitope of NY-ESO-1 or variant or combination thereof alone or in
combination with a second DNA sequence encoding at least one
immunostimulatory molecule. The vectors and host cells may serve as
vaccines in which expression of the HLA-DR restricted T cell
epitope and/or the HLA-DP restricted T cell epitope results in the
stimulation of tumor antigen specific CD4.sup.+ T lymphocytes in a
mammal immunized with the vaccine.
The invention provides a method of diagnosis of cancer or precancer
in a mammal by detection of a MHC class II restricted T cell
epitope of NY-ESO-1 or variant thereof.
The invention provides a method of diagnosis of cancer or precancer
in a mammal by detection of an HLA-DR restricted T cell epitope
and/or an HLA-DP restricted T cell epitope of NY-ESO-1 or variant
thereof.
It is yet another object of the invention to provide a method for
diagnosing human preneoplastic and neoplastic cells and tissues. In
accordance with the invention, the method comprises isolating
cells, tissues or extracts thereof from a human and detecting the
DNA sequence, RNA sequence or portion thereof encoding a MHC class
II restricted T cell epitope of NY-ESO-1 or variant thereof or
detecting the epitope or variant thereof expressed by the DNA
sequence or RNA sequence, wherein detection of/or increase in the
DNA sequence, RNA sequence or expression product is indicative of
preneoplasia and neoplasia.
It is still another object of the invention to provide a method for
diagnosing human preneoplastic and neoplastic cells and tissues. In
accordance with the invention, the method comprises isolating
cells, tissues or extracts thereof from a human and detecting the
DNA sequence, RNA sequence or portion thereof encoding an HLA-DR
restricted T cell epitope or HLA-DP restricted T cell epitope of
NY-ESO-1 or variant thereof or detecting the epitope or variant or
combination thereof expressed by the DNA sequence or RNA sequence,
wherein detection of/or increase in the DNA sequence, RNA sequence
or expression product is indicative of preneoplasia and
neoplasia.
Another object of the invention is to provide a transgenic animal
which has incorporated into its genome one or more copies of the
DNA sequence encoding at least one MHC class II restricted T cell
epitope of NY-ESO-1 or variant thereof. The incorporation of the
DNA sequence results in expression or overexpression of the
epitope. Such transgenic animals are useful for screening of
therapeutic agents useful in treating cancer.
Still another object of the invention is to provide a transgenic
animal which has incorporated into its genome one or more copies of
the DNA sequence encoding at least one HLA-DR restricted T cell
epitope, or at least one HLA-DP restricted T cell epitope of
NY-ESO-1 or variant or combination thereof. The incorporation of
the DNA sequence results in expression or overexpression of the
epitope. Such transgenic animals are useful for screening of
therapeutic agents useful in treating cancer.
Still another aspect of the invention are monoclonal, polyclonal
and recombinant antibodies reactive with the MHC class II
restricted T cell epitope of NY-ESO-1 or variant thereof, for use
as a therapeutic and in diagnostic and detection assays. The
monoclonal and polyclonal antibodies may be provided in the form of
a kit alone, or along with other reagents commonly used in
diagnostic and detection assays.
Yet another aspect of the invention are monoclonal, polyclonal and
recombinant antibodies reactive with the HLA-DR restricted T cell
epitope or HLA-DP restricted T cell epitope of NY-ESO-1, or
reactive with the HLA-DP epitope in combination with the HLA-DP
molecule or react with the HLA-DR epitope in combination with the
HLA-DR molecule, or variant thereof, for use as a therapeutic and
in diagnostic and detection assays. The monoclonal and polyclonal
antibodies may be provided in the form of a kit alone, or along
with other reagents commonly used in diagnostic and detection
assays.
BRIEF DESCRIPTION OF THE FIGURES
These and other objects, features, and many of the attendant
advantages of the invention will be better understood upon a
reading of the following detailed description when considered in
connection with the accompanying drawings wherein:
FIGS. 1A and 1B. Nucleotide and amino acid sequence of NY-ESO-1.
Numbering of nucleotide sequence of NY-ESO-1 starts from the first
nucleotide in the 5' untranslated region.
FIG. 2A-2C: 2 (A) Purification of full-length NY-ESO-1 protein
using a Ni.sup.2+ chromatography column. SDS polyacrylamide gel
showed the crude extract from E. coli strain BL21(DE3) bearing
pET28 vector (lane 1), pNY-ESO-1 (lane 2), the purified NY-ESO-1
protein (lane 3), bacterial extract encoding the truncated NY-ESO-1
(lane 4), and the purified truncated NY-ESO-1 protein, ESO1-74
(lane 5). (2B) Western blot to confirm the specificity of
antibodies against NY-ESO-1. Sera at 1 to 2000 dilution from two
representative patients, one with (lanes 1, 2, and 3) and one
without (lanes 4, 5, and 6) detectable NY-ESO-1 antibodies by ELISA
were used against bacterial extract encoding the vector only (lanes
1 and 4), encoding NY-ESO-1 (lanes 2 and 5), and the purified
NY-ESO-1 protein (lanes 3 and 6). (2C) Patient TE was among the
melanoma patients who had antibodies against NY-ESO-1 protein.
ELISA was performed using sera from 88 patients for the presence of
antibodies against NY-ESO-1 (BSA as control protein). Values of
O.D. 450 at 1:25, 1:250, and 1:2500 of sera dilutions were plotted.
Sera from normal donors were used as controls, and their mean OD
value was also plotted (ND).
FIG. 3. Testing of putative NY-ESO-1 epitopes using HLA-DR4-Tg mice
immunized with NY-ESO-1 protein. Eight peptides based on the
predicted binding affinity to HLA-DR4 were used for in vitro
sensitization of lymphocytes from immunized mice. Murine
lymphocytes were tested for IFN-production against either medium
alone, 1359EBV B (HLA DR4.sup.+) cells alone or 1359EBV B cells
pulsed with the peptide used for in vitro stimulation.
FIG. 4A-4E. Characterization of the TE4-1 CD4.sup.+ T cell line.
(4A) TE4-1 specifically recognized 1088 EBV B cells (HLA-DR')
pulsed with ESO p116-135 peptide or purified NY-ESO-1 protein, but
not ESO1-74 protein which lacked the putative epitope. (4B) HLA
DR-restriction was required for the recognition of NY-ESO-1 by
TE4-1. Two overlapping peptides ESO p111-130 and p116-135 were
recognized when pulsed onto 293IMDR cells. 1.times.10.sup.5 target
cells were co-cultured with 4.times.10.sup.4 TE4-1 cells overnight
before GM-CSF secretion was measured. (4C) Recognition of 293IMDR
pulsed with ESO p116-135 peptide was specifically inhibited by the
anti-HLA-DR antibody (HB55), but not by the anti-class I antibody
(HB95). The amount of GM-CSF secreted by TE4-1 in the absence of
antibodies was used as the reference, against which the percent
GM-CSF release in the presence of antibodies was calculated.
Inhibition by the control (mouse IgG2a) and the anti-MHC-class I
antibodies (HB95) had little effect. CTL C3G1 (courtesy of C.
Macalli) was a gp100 specific CD8.sup.+ T cell line that recognized
624.38 mel, and was used as a control for the activity of HB95
(FIG. 4D). T3-80 was a CD4.sup.+ T cell line that recognized 1362
mel and was used as the control for the activity of HB55 (FIG.
4E).
FIG. 5. Recognition of tumor cells by the CD4.sup.+ T cell line
TE4-1. All melanoma lines used as targets for TE4-1 were analyzed
for the expression of HLA-DR4 and NY-ESO-1 by FACS and RT-PCR,
respectively. TE4-1 was able to recognize NY-ESO-1.sup.+ tumor
lines constitutively expressing the HLA-DR4 molecule (1359 mel and
F049 mel). F050 mel expressing DR1 and NY-ESO-1 was also recognized
by T cells. There was no reactivity against control targets 526 mel
(DR4 positive and NY-ESO-1 negative), 397 mel, 624.38 mel (DR
negative and NY-ESO-1 positive), nor 1300 mel (DR1 positive and
NY-ESO-1 weakly positive).
FIG. 6A-6B. Characterization of the NY-ESO-1 peptide epitope
recognized by TE4-1. (6A) Determination of the anchor positions for
the HLA DR-restricted NY-ESO-1 epitope. 1088 EBV B cells were
pulsed with 20 M of the indicated peptides. TE4-1 cells were
cocultured with the target cells for overnight before GM-CSF was
measured. (6B) Peptide titration experiment using ESO p119-130. ESO
p119-130 was chosen based on its recognition shown in FIG. 6 (A).
ESO p119-130 diluted at the indicated concentrations were pulsed
onto 1088 EBV B cells, which were used as targets for recognition
by TE4-1. Recognition of a control peptide, ESO p91-110 was
measured only at the highest concentration of 33 M.
FIGS. 7A and 7B. 7A. Recognition of NY-ESO-1 protein and ESO
p116-135 by TE4-1 using DR1+EBVB as APC. NY-ESO-1 protein (5
.mu.g/ml) and peptides (33 .mu.M) were pulsed onto 586EBV B(DR1+)
cells and washed twice. TE4-1 T cells were then added and
cocultured overnight before GM-CSF was assayed. FIG. 7B. 586EBV B
pulsed with ESOp116-135 (33 .mu.M) was used to stimulate TE4-1 with
and without the blocking antibodies. IID95 (anti-class I antibody),
IIB55 (anti-DR antibody), and isotype control antibodies were
used.
FIG. 8A-C. Generation of CD4.sup.+ T cells from PBMC after in vitro
stimulation with synthetic peptides. (FIG. 8A) Specific peptide
reactivity was detected in multiple wells after three in vitro
stimulations. A total of 24 wells each containing
2.5.times.10.sup.5 PBMC in a 96-well plate were stimulated weekly
for three weeks. Fifteen of 24 wells showed marked growth and
tested for specific activity. T cells from each well were incubated
with 1088 EBVB cells and 1088 EBVB cells pulsed with the ESO
p161-180 peptide, respectively. GM-CSF release was measured from
supernatants. (FIG. 8B). TE4-2 T cells specifically reacted with
NY-ESO-1 peptides and protein. Overlapping peptides ESO p161-180
and ESO p156-175 were pulsed onto 1088 (DR4.sup.+) and 586 EBVB
(DR1.sup.+) cells at 20 micro g/ml for 90 minutes. ESO p91-110 was
used as an irrelevant peptide for pulsing. Purified NY-ESO-1 and
ESO1-75 proteins were pulsed overnight at 5 micro g/ml and 2 micro
g/ml respectively to maintain the same molar ratio. After three
washes, TE4-2 T cells were added and incubated overnight. GM-CSF
release was measured. (FIG. 8C). A panel of EBVB cells pulsed with
ESO p161-180 were used as targets for TE4-2 CD4.sup.+ T cells.
These EBVB lines were known to express different HLA DR and DQ
alleles. Their HLA DP alleles were molecularly typed in this study
(Table 2).
FIG. 9A-9C. Blocking of T cell recognition of NY-ESO-1 epitopes by
an anti-DP antibody. 1088 EBVB cells pulsed with 20 micro g/ml ESO
p161-180 peptide were used as target cells in the presence of
different blocking antibodies. Specificity of antibodies used was
as follows: anti-MHC class I (HLA A, B, C) antibody (W6/32),
anti-MHC class II (HLA DP, DQ, DR) antibody (IVA12), anti-HLA DP
antibody (B4/21), anti-HLA DR antibody (L243), and anti-HLA DQ
antibodies (mixture of Genox 3.53 (anti-DQw1) and IVD12
(anti-DQw3)). All antibodies were used at a final concentration of
20 micro g/ml each. (FIG. 9A) CK3H6 T cells specifically recognized
gp100 p209-218 peptide in the context of HLA A2 and was used as the
specificity control for anti-MHC class I antibody (FIG. 9B). 1088
EBVB (A2.sup.+) pulsed with gp100 p209-218 peptide was used as
targets. A CD4.sup.+ T cell line (T3-80) recognized 1362 mel in an
HLA-DR restricted fashion and was used as the specificity control
for anti-MHC class II and anti-DR antibodies (FIG. 9C).
FIG. 10A-10B. Recognition of tumor cells and 293CIITA/NY-ESO-1 by
TE4-2 CD4.sup.+ T cells. (FIG. 10A). TE4-2 recognized melanoma
lines expressing both NY-ESO-1 and DP4. Melanoma lines with known
NY-ESO-1 expression (by RT-PCR) and HLA DP types (determined by
RT-PCR and sequencing) were used as targets. An overnight IFN-gamma
treatment (500 units/ml) was conducted for F026 mel, 526 mel, and
397 mel to up-regulate their MHC class II expression in this
experiment. TE4-2 T cells were co-cultured with tumor cells
overnight before cytokine release was measured. (FIG. 10B). TE4-2
CD4.sup.+ T cell line recognized 293CIITA transfected with NY-ESO-1
with or without the invariant chain (Ii) targeting sequence.
Parental 293 cells and 293CIITA cells were transfected with plasmid
encoding NY-ESO-1 (pESO), Ii-NY-ESO-1 (pIi-ESO), or GFP (pGFP),
respectively. TE4-2 T cells were co-cultured with the transfectants
overnight before cytokine release was assayed.
FIG. 11A-11C. Characterization of T cell epitopes recognized by
TE4-2. (FIG. 11A). Determination of the anchor residues and minimal
length of the NY-ESO-1 epitope for T cell recognition. Synthetic
peptides with amino acid deletions at the N- or C-terminus were
used to pulse 1088 EBVB cells at 40 micro g/ml. EBVB cells were
then thoroughly washed and used as target cells to stimulate TE4-2
T cells. Two separate experiments were conducted and presented as
the top and bottom panel in this figure. (FIG. 11B). Determination
of the minimal peptide concentration required for T cell
recognition. The ESO p157-170 peptide was used to pulse 1088 EBVB
cells at various concentrations. The peptide pulsed cells were then
washed and used as targets to stimulate TE4-2 line. A control
peptide ESO p91-110 was used only at the highest concentration, 33
micromoles. (FIG. 11C). Recognition of the DPB1*0401-restricted
CD4.sup.+ T cell epitope by the NY-ESO-1 specific CD8.sup.+ T
cells. TE8-1 cell line was generated from PBMC of patient TE by in
vitro stimulation with the ESO p157-167 peptide. L023 EBVB cells
(HLA-A2.sup.+, DP4.sup.-) were pulsed with peptides covering the
DPB1*0401 epitope region in a serum-free medium, washed, and used
to stimulate TE8-1 T cells.
FIGS. 12A and 12B. Titration of peptides for recognition by TE4-2
CD4+ T cells and TE8-1 CD8+ T cells. FIG. 12A. 586 EBVB cells (A2-,
DP4+) were used as antigen-presenting cells to pulse with indicated
peptides at various concentrations. Cells were washed and then
incubated with TE4-2 CD4+ T cells before cytokine release was
assayed. FIG. 12B. L023 EBVB cells (A2+, DP4-) were used as
antigen-presenting cells to pulse with indicated peptides at
various concentrations. Cells were washed and then incubated with
TE4-2 CD4+ T cells before cytokine release was assayed.
DETAILED DESCRIPTION OF THE INVENTION
The present invention encompasses cancer epitopes, portion,
derivatives or variants thereof of NY-ESO-1 which are
immunologically recognized by MHC class II restricted CD4.sup.+ T
lymphocytes of the immune system. The cancer epitopes of the
present invention specifically causes a humoral-mediated immune
response by interaction with CD4.sup.+ T cells of the immune
system. This interaction between the antigenic cancer epitope and
the CD4.sup.+ T cells causes the CD4.sup.- T cells to respond
against, and recruit other cells in the immune system in the
prevention, elimination or reduction of cancer in a mammal,
including humans.
The NY-ESO-1 MHC class II restricted T cell epitopes of the present
invention form part of or are derived from, cancers including but
not limited to primary or metastatic melanoma, thymoma, lymphoma,
sarcoma, lung cancer, liver cancer, non-Hodgkin's lymphoma,
Hodgkins lymphoma, leukemias, uterine cancer, cervical cancer,
bladder cancer, kidney cancer, head and neck cancer, neuroblastoma
and adenocarcinomas such as breast cancer, prostate cancer, ovarian
cancer, pancreatic cancer, thyroid cancer and the like.
The term melanoma includes, but is not limited to, melanomas,
metastatic melanomas, melanomas derived from either melanocytes or
melanocyte related nevus cells, melanocarcinomas,
melanoepitheliomas, melanosarcomas, melanoma in situ, superficial
spreading melanoma, nodular melanoma, lentigo maligna melanoma,
acral lentiginous melanoma, invasive melanoma or familial atypical
mole and melanoma (FAM-M) syndrome.
Of particular interest are cancer epitopes or derivatives thereof
recognized by autologous CD4.sup.+ T lymphocytes in patients with
cancer, in particular melanoma. Of further interest are cancer
epitopes or derivatives thereof recognized by MHC (or HLA) class II
restricted CD4.sup.+ T lymphocytes, in particular HLA-DR restricted
T lymphocytes and/or HLA DP restricted T lymphocytes. In one
embodiment, the NY-ESO cancer epitope is recognized by CD4+ T
lymphocytes in context of HLA-DR molecule. In another embodiment,
the NY-ESO cancer epitope is recognized by CD4+ T lymphocytes in
context of an HLA-DP molecule.
The "cancer epitope" of the present invention encompasses a portion
or variant portion of NY-ESO-1 protein that elicites MHC class II
restricted T lymphocytes, such as HLA-DR restricted and HLA-DP
restricted T lymphocytes. Such lymphocytes may specifically react
with the full length NY-ESO-1 protein, the MHC class II restricted
T cell epitope and with naturally processed antigen from tumor
cells.
The MHC class II restricted T cell epitope of NY-ESO-1 of the
present invention may vary in size from about 9 amino acids to
about 30 amino acids, preferably about 10 to about 15 amino acids
in length.
In a particular embodiment, the MHC class II restricted T cell
epitope of NY-ESO-1 of the present invention is about 9 to 10 amino
acids in length.
In one embodiment, the MHC class II restricted T cell epitope of
NY-ESO-1 is a peptide of at least about 10 amino acids in length
that comprises the amino acid sequence:
Xaa.sub.1KEFTVSXaa.sub.2 (SEQ ID NO: 4) and variants or derivatives
thereof. The amino acid at Xaa.sub.1 and Xaa.sub.2 and the number
of amino acids at these positions at the N-terminus and C-terminus
may vary as long as the epitope retains its ability to bind to/and
stimulate CD4.sup.+ T lymphocytes. The epitope may comprise about
10 to about 30 amino acids, preferably less than 20 amino acids,
more preferably about 10 to about 15 amino acids.
In another embodiment of the present inventing the MHC class II
restricted T cell epitope of NY-ESO-1 may be represented by the
formula:
Xaa.sub.1VLLKEFTVSGXaa.sub.2 (SEQ ID NO: 5), wherein Xaa.sub.1 is
no amino acid or one to about 10 naturally occurring amino acids,
preferably one to about 5 amino acids; and Xaa.sub.2 is no amino
acid or one to about seven amino acids in length.
In another embodiment of the present invention, the MHC class II
restricted T cell epitope of NY-ESO-1 comprises the amino acid
sequence:
QDAPPLPVPG VLLKEFTVSGNILTIRL (SEQ ID NO: 6), or fragments, or
derivatives thereof.
Also encompassed in the ambit of the invention are cancer peptides
or portions thereof that share partial sequence homology with SEQ.
ID NO: 4, 5 or 6. By partial amino acid sequence homology is meant
a peptide having at least 85% sequence homology with SEQ. ID NO: 4,
5 or 6 preferably at least 95% sequence homology or greater and has
the biological function of stimulating NY-ESO-1 MHC class II
restricted specific CD4.sup.+ T lymphocytes. Mammalian homologs are
included in the ambit of the invention including but not limited to
primate and murine homologs.
In one embodiment the MHC class II restricted T cell epitope of
NY-ESO-1 comprises the amino acid sequence:
TABLE-US-00001 (SEQ ID NO: 7) APPLPVPGVLLKEFTVSGNILTIRL; (SEQ ID
NO: 8) APPLPVPGVLLKEFTVS; (SEQ ID NO: 9) APPLPVPGVLLKEFTV; (SEQ ID
NO: 10) LPVPGVLLKEFTVSG; (SEQ ID NO: 11) PVPGVLLKEFTVSG; (SEQ ID
NO: 12) VPGVLLKEFTVSG: (SEQ ID NO: 13) PGVLLKEFTVSG; (SEQ ID NO:
14) GVLLKEFTVSG; (SEQ ID NO: 15) LLKEFTVSGNILTIR (SEQ ID NO: 16)
LKEFTVSGNILTIRL; (SEQ ID NO: 17) KEFTVSGNILTIRL; (SEQ ID NO: 18)
LPVPGVLLKEFTVSGNILTI;
or variant or derivatives thereof.
In a preferred embodiment of the MHC class II restricted T cell
epitope of NY-ESO-1 comprises the amino acid sequence:
TABLE-US-00002 (SEQ ID NO: 19) VLLKEFTVSG, | | || 1 4 67
and variants or derivatives thereof.
Epitopes having substitutions within the above sequence are
encompassed by the present invention. A substitution of a naturally
occurring amino acid may be at one or more anchor positions,
provided the substituted amino acid(s) results in equivalent or
enhanced binding compared to SEQ ID NO: 19. It is predicted that
the anchor positions of SEQ ID NO: 19 are at position 1-Leu,
position 4-Glu, position 6-Thr, and position 7-Val. In one
embodiment alanine is substituted for leucine at position 1.
In another embodiment of the present invention the MHC class II
restricted T cell epitope of NY-ESO-1 comprises the amino acid
sequence:
DHRQLQLSIS SCLQQLSLLM (SEQ ID NO: 20), portion, variants and
derivatives thereof. In one embodiment, the portion of SEQ ID NO:
20 comprises the amino acid sequence:
DHRQLQLSIS SCLQQLS (SEQ ID NO: 29);
DHRQLQLSIS SCLQ (SEQ ID NO: 30);
QLQLSIS SCLQQL (SEQ ID NO: 31) or variants and derivatives
thereof.
In another embodiment of the present invention the MHC class II
restricted T cell epitope of NY-ESO-1 comprises the amino acid
sequence:
WITQCFLPVF LAQPPSGQRR (SEQ ID NO: 21) portion, variants and
derivatives thereof. In one embodiment, the portion of SEQ ID NO:
21 comprises the amino acid sequence:
QCFLPVF LAQPPSGQRR (SEQ ID NO: 32);
LPVF LAQPPSGQRR (SEQ ID NO: 33);
CFLPVF LAQPPSGQ (SEQ ID NO: 34); or variants and derivatives
thereof.
The NY-ESO-1 cancer epitopes and derivatives thereof are recognized
by MHC class II restricted CD4.sup.+ T lymphocytes. The class II
molecules recognized in combination with the NY-ESO-1 epitope
includes but are not limited to at least one HLA-DR, such as
HLA-DR1, HLA-DR3, HLA-DR4 and other class II molecules which
function due to degeneracy of class II peptide binding. In one
embodiment, an HLA subtype recognized by the cancer peptides is the
HLA-DR4 subtype. In another embodiment, the NY-ESO-1 cancer epitope
binds HLA-DR1 and HLA-DR4.
In another embodiment, the epitope is an HLA-DP restricted T cell
epitope of NY-ESO-1, comprising the general amino acid motif
of:
Xaa.sub.1I TQ Xaa.sub.2FXaa.sub.3P Xaa.sub.4 (SEQ ID NO: 51),
wherein Xaa.sub.1 is at least one naturally occurring amino acid;
preferably an amino acid selected from the group consisting of Trp,
Phe, Tyr, Met, Ile, Val, Ala; and combinations thereof,
Xaa.sub.2 is at least one naturally occurring amino acid,
preferably an amino acid selected from the group consisting of Cys,
Ser, Val, Ala, Thr; and combinations thereof,
Xaa.sub.3 is at least one naturally occurring amino acid,
preferably an amino acid selected from the group consisting of Leu,
Phe, Tyr, Met, Ile, Val, Ala; and combinations thereof, and
Xaa.sub.4 is at least one naturally occurring amino acid,
preferably an amino acid selected from the group consisting of Val,
Tyr, Ile, Ala, Leu, Pro and combinations thereof.
Also encompassed in the ambit of the invention are cancer peptides
or portions thereof that share partial sequence homology with SEQ.
ID NO: 51. By partial amino acid sequence homology is meant a
peptide having at least 85% sequence homology with SEQ. ID NO: 51
preferably at least 95% sequence homology or greater and has the
biological function of stimulating NY-ESO-1 MHC class II restricted
specific CD4.sup.+ T lymphocytes, preferably HLA-DP restricted T
lymphocytes. Mammalian homologs are included in the ambit of the
invention including but not limited to primate and murine homologs.
Homologs also include peptides having sequence homology with SEQ ID
NO: 51 which may be encoded by a gene other than the NY-ESO-1 gene,
such as the LAGE gene.
Epitopes having substitutions within the above sequence are
encompassed by the present invention. A substitution of a naturally
occurring amino acid may be at one or more anchor positions,
provided the substituted amino acid(s) results in equivalent or
enhanced binding compared to SEQ ID NO: 51. It is predicted that
the anchor positions of SEQ ID NO: 51 are at position 1, 7, and 9,
i.e., the W, L, and V residues, respectively. Substitutions of
these anchor residues can be but not limited to F, Y, M, I, V, and
A for the "W" residue; F, Y, M, V, I, and A for the "L" residue;
and Y, I, A, L, and P for the "V" residue. Another substitution may
involve the C residue as position 5 of SEQ ID NO: 1, which can be
but not limited to residues S, V, A, and T.
In one embodiment, the MHC class II restricted T cell epitope of
NY-ESO-1 is a peptide of at least about 10 amino acids in length
that comprises the amino acid sequence:
Xaa.sub.1 WITQCFLPVFXaa.sub.2 (SEQ ID NO: 52) and variants or
derivatives thereof. Xaa.sub.1 and Xaa.sub.2 may be no amino acid
or one or more of the same or a variety of naturally occurring
amino acids. The number of amino acids at these positions at the
N-terminus and C-terminus may vary as long as the epitope retains
its ability to bind to/and stimulate CD4.sup.+ T lymphocytes, in
particular HLA-DP restricted CD4.sup.+ T lymphocytes. The epitope
may comprise about 10 to about 30 amino acids, preferably less than
20 amino acids, more preferably about 10 to about 15 amino
acids.
In one embodiment, the HLA-DP restricted T cell epitope of NY-ESO-1
comprises the amino acid sequence:
TABLE-US-00003 (SEQ. ID NO. 53)
151-SCLQQLSLLMWITQCFLPVFLAQPPSG-177; (SEQ. ID NO. 54)
SLLMWITQCFLPVF; (SEQ. ID NO. 55) LLMWITQCFLPVFL; (SEQ. ID NO. 56)
LMWITWCFLPVFLA; (SEQ. ID NO. 57) MWITQCFLPVFLAQ; (SEQ. ID NO. 58)
WITQCFLPVFLAQP; (SEQ. ID NO. 59) ITQCFLPVFLAQPP; (SEQ. ID NO. 60)
QQLSLLMWITQCFL; (SEQ. ID NO. 61) QLSLLMWITQCFLP; (SEQ. ID NO. 62)
LSLLMWITQCFLPV;
and derivatives thereof.
The NY-ESO-1 cancer epitopes and derivatives thereof are recognized
by HLA-DP restricted CD4.sup.+ T lymphocytes, and derivatives
thereof, preferably HLA-DP4 restricted CD4.sup.+ T lymphocytes. The
class II molecules recognized in combination with the NY-ESO-1
epitope includes HLA-DP and class II molecules which function due
to degeneracy of class II peptide binding. A preferred HLA subtype
recognized by the cancer peptides is the HLA-DPB1*0401-0402 allele
and other alleles that may bind to the peptides due to function
degeneracy.
Another embodiment of the present invention encompasses derivatives
and variants of the MHC class II restricted T cell epitopes of
NY-ESO-1 having sufficient homology to the epitopes thereof to
effectively act to elicite MHC class II restricted CD4.sup.+ T
lymphocytes. Such peptides may have conservative amino acid changes
at one or more positions, in particular in the anchor positions. By
conservative amino acid changes is meant, an amino acid change at a
particular position which is of the same type as originally
present; i.e. a hydrophobic amino acid exchanged for a hydrophobic
amino acid, a basic amino acid for a basic amino acid, etc. Such
amino acid changes do not significantly alter the overall charge
and configuration of the peptide and therefore such variants
maintain or enhance the anti-cancer activity of a cancer peptide.
Examples of such conservative changes are well-known to the skilled
artisan and are within the scope of the present invention.
The present invention also relates to functionally equivalent
variants of the NY-ESO-1 MHC class II restricted T cell epitopes.
"Functionally equivalent variants" includes peptides with partial
sequence homology, peptides having one or more specific
conservative and/or non-conservative amino acid changes, peptide
conjugates, chimeric proteins, fusion proteins and peptides.
Another aspect of the invention are NY-ESO-1 peptides that function
as epitopes for both HLA-DP restricted T cells and HLA class I
restricted CD8.sup.+ T lymphocytes, in particular for HLA-A
restricted T lymphocytes, preferably HLA-A2 restricted T
lymphocytes. In one embodiment, the HLA-DP restricted and HLA class
I restricted epitope of NY-ESO-1 comprise the amino acid sequence:
SLLMWITQCFLPVF (SEQ ID NO: 54), as well as variants and homologs
thereof. Variants include but are not limited to peptides having
one or more substitutions in SLLMWITQCFLPVF (SEQ ID NO: 54)
including but not limited to ESOp156R-169 comprising:
RSLLMWITQCFLPV (SEQ ID NO: 63) and ESOp157-170R comprising:
SLLMWITQCFLPVR (SEQ ID NO: 64). Such substitutions render the
peptide more soluble in aqueous solution while retaining the
immunologic functional activity of the native sequences. The highly
water soluble peptides may be easily purified to more than 90%
purity.
The NY-ESO-1 MHC class II restricted T cell epitopes may be
purified and isolated from natural sources such as from primary
clinical isolates, cell lines and the like. The NY-ESO-1 MHC class
II restricted T cell epitopes thereof are at least 90% pure,
preferably at least 95% pure and as pure as 100%. The epitopes may
also be obtained by chemical synthesis or by recombinant DNA
techniques known in the arts. Techniques for chemical synthesis are
described in J. M. Steward and J. D. Young, "Solid Phase Peptide
Synthesis", W.H. Freeman & Co., San Francisco, 1969; M.
Bodansky et al "Peptide Synthesis", John Wiley & Sons, Second
Edition, 1976, and J. Meienhofer, "Hormonal Proteins and Peptides",
Vol. 2, p. 46, Academic Press, New York, 1983 and E. Schroder and
K. Kubke, "The Peptides", Vol. 1, Academic Press, New York,
1965.
The NY-ESO-1 class II restricted T cell epitopes may be formulated
with pharmaceutically acceptable carriers into pharmaceutical
compositions by methods known in the art. The composition is useful
as an immunogen to elicit NY-ESO-1 specific CD4+ T lymphocytes and
may be useful in eliciting anti-NY-ESO-1 antibody. The composition
is also useful as a vaccine to prevent or treat cancer. The
composition may further comprise at least one immunostimulatory
molecule. Immunostimulatory molecules to be used in conjunction
with the cancer epitope or portion thereof for stimulating MHC
class II specific T cell responses include but are not limited to
one or more major histocompatibility complex (MHC) class II
molecules or cells expressing MHC class II molecules. The
composition may further comprise other stimulator molecules
including B7.1, B7.2, ICAM-1, ICAM-2, LFA-1, LFA-3, CD72 and the
like, and cytokines which include but are not limited to IL-1
through IL-15, TNF.alpha., IFN.gamma., RANTES, G-CSF, M-CSF,
IFN.alpha., CTAP III, ENA-78, GRO, I-309, PF-4, IP-10, LD-78, MGSA,
MIP-1.alpha., MIP-1.beta., or combination thereof, and the like for
immunopotentiation.
The stimulatory molecule may be provided as a physically separate
entity or it may be provided in the membrane of an antigen
presenting cell such as B-cell, macrophage or dendritic cell, in
the membrane of a liposome, or expressed on the surface of a
transduced or transfected cell. DNA sequences of MHC class II
immunostimulatory molecules are available from GenBank and the
like. DNA sequences of HLA-DP immunostimulatory molecules are
available from the GenBank/EMBL/DNA Data Bank of Japan (DDBJ) at
GenBank, National Center for Biotechnology Information, 8600
Rockville Pike, Bethesda, Md. 20894 USA or from its web sites.
The pharmaceutical composition of the present invention may
comprise several distinct MHC class II restricted T cell epitopes
from NY-ESO-1 in addition to the NY-ESO-1 HLA-DR or HLA-DP
restricted T cell cancer peptide thereof. These include but are not
limited to the HLA-DR restricted epitopes and variants thereof,
such as LPVPGVLLKEFTVSG (SEQ ID NO: 10), VLLKEFTVSGNILTIRLT (SEQ ID
NO: 65), AADHRQLQLSISSCLQQL (SEQ ID NO: 66), and combinations
thereof.
The pharmaceutical composition of the present invention may
optionally comprise an MHC class I restricted NY-ESO-1 cancer
peptide for eliciting MHC class I restricted cytotoxic T
lymphocytes in addition to eliciting MHC class II restricted
CD4.sup.+ T lymphocytes. MHC class I restricted NY-ESO-1 cancer
peptide include but are not limited to a cancer peptide represented
by the formula:
Xaa.sub.1 Xaa.sub.2 Xaa.sub.3 GP GGG AP Xaa.sub.4 (SEQ ID NO:
22),
wherein Xaa.sub.1 is no amino acid or one to about 20 naturally
occurring amino acids, preferably one to about 5 amino acids,
Xaa.sub.2 is Ala, Thr, Val, Leu or Arg, Xaa.sub.3 is Ser or a
conservative substitution such as Ala, Val, Ile, Leu, Thr and the
like, Xaa.sub.4 is Arg, Lys, preferably Arg, and fragments and
derivatives thereof. In one embodiment, the MHC class I restricted
NY-ESO-1 cancer peptide for use in the pharmaceutical composition
comprises the amino acid sequence: ASGPGGGAPR (SEQ ID NO: 23).
The NY-ESO-1 MHC class H restricted T cell epitope and the NY-ESO-1
MHC class I restricted T cell epitope may each be provided as a
discrete epitope or linked together as a single peptide. The
epitopes may be linked together or chemically synthesized by
methods known in the art. A chemical linker, a peptide linker, a
peptide bond and the like may be used for linking epitopes. In one
embodiment, the C-terminus of the MHC class II epitope is directly
linked to the N-terminus of the MHC class I epitope via a peptide
bond.
The NY-ESO-1 MHC class II restricted T cell epitopes are useful in
methods of preventing or treating cancer and useful in diagnostic
assay for detecting cancer or precancer in a mammal, including
humans. In a diagnostic assay, the NY-ESO-1 HLA class II restricted
T cell epitope peptides, variants and derivatives thereof of the
present invention are useful in the detection of helper immune
response against the tumor antigen, NY-ESO-1. Since NY-ESO-1 is
exclusively expressed in tumor cells (except normal testis, which
is an immune privileged site), the immune response against the
protein may be used as an indicator for early cancer detection in
patients. As the development of helper T cell responses may be an
earlier event than the development of detectable antibodies against
the protein, detection of helper T cell responses against the
NY-ESO-1 HLA class II restricted T cell epitope peptides are useful
in early cancer detection. In a method of detecting helper T cells
responses to NY-ESO-1, NY-ESO-1 HLA class II restricted T cell
epitope peptides are applied to a substrate or solid support.
Lymphocytes from a patient are grown in the presence of the
NY-ESO-1 MHC class II restricted T cell epitope peptides in
parallel with a control peptide such as a peptide from the flu
virus. Specific cytokine release is then measured using such
techniques such as ELISPOT and ELISA. Detection of an enhanced
helper T cell immune response in comparison to the negative
controls is indicative of precancer or early cancer in the
patient.
The NY-ESO-1 MHC class II restricted binding peptides of the
present invention may be used to enhance the generation of antibody
and/or CD8+ T cell responses against any given target antigen
and/or hapten. Specifically, these peptides may be conjugated or
covalently linked to a target antigen peptide, protein or any other
hapten against which an antibody and/or CD8+ T cell response is
intended. The linkage of the NY-ESO-1 MHC class II restricted
epitope peptide to any target hapten or protein should act as a
immunologic T cell carrier peptide in enhancing the immunogenicity
of any target antigen, hapten or protein in a manner similar to
conventional T cell cancer proteins such as tetanus toxoid, albumin
and the like. The enhancement may be manifest in higher titer
antibody to the target hapten or protein, immunoglobulin class
switching form an IgM to an IgG or IgA antibody, and/or elicitation
of CD8+ T cell responses. Examples of such target antigen, hapten
or protein include but are not limited to TRP2, GP100, TRP1, gp120
and other HIV antigens, malaria antigens, epitopes thereof and the
like. Similarly, the nucleic acid sequences encoding the NY-ESO-1
MHC class II restricted epitope may be incorporated into an
engineered vaccine construct along with a nucleic acid sequence
encoding a target antigen or epitope thereof for enhancement of the
immunogenicity to the target antigen or epitope thereof. Examples
regarding this aspect include to incorporate the nucleic acid
sequence of Class II epitopes into any vaccine construct in the
form of naked DNA or RNA, vaccinia virus, adenovirus, fowlpox virus
and the like in frame with the target gene. For example, to enhance
the immunogenicity of TRP2 antigen in the form of a plasmid
vaccine, the nucleic acid sequence of the NY-ESO-1 class H epitope
can be fused in the same open reading frame with the TRP2 gene. The
hybrid plasmid is then used to immunize patients instead of using
the plasmid encoding only the TRP2.
The cancer epitopes or variants thereof may be in the form of a
derivative in which other constituents are attached thereto such as
radiolabels, biotin, fluorescein. A targeting agent may also be
attached to the epitope that allow for specific targeting to a
specific organ, tumor or cell types. Such targeting agents may be
hormones, cytokines, cellular receptors and the like. The epitope
may be prepared in the form of a kit, alone or in combination with
other reagents.
Another aspect of the invention is an immunogen or vaccine useful
in inducing tumor-specific humoral-mediated immunity against cancer
using the NY-ESO-1 MHC class II restricted epitopes of the present
invention. The immunogen and vaccine elicit NY-ESO-1 specific CD4+
T lymphocytes and anti-NY-ESO-1 antibody. Optionally, the immunogen
and vaccine may comprise an NY-ESO-1 MHC class I restricted epitope
for eliciting CD8.sup.+ T lymphocytes.
Approaches to cancer immunotherapy can be divided into active or
passive categories. Active immunotherapy involves the direct
immunization of cancer patients with cancer antigens in an attempt
to boost immune responses against the tumor. Passive immunotherapy
refers to the administration of immune reagents, such as immune
cells or antibodies with antitumor reactivity with the goal of
directly mediating antitumor responses.
Most prior attempts at active immunotherapy utilized either intact
cancer cells or cancer cell extracts with the expectation that
these materials contained tumor antigens in an amount and form
capable of stimulating immune responses. The molecular
identification of cancer antigens and epitopes however, has open
new possibilities for developing immunotherapies for the treatment
of human cancer. A summary of some of these approaches is presented
in Table 1.
TABLE-US-00004 TABLE 1 Cancer Therapies Based on the Molecular
Identification of Cancer Antigens 1. Active immunotherapy with: a.
Immunodominant peptides or epitopes 1) alone 2) combined with
adjuvants 3) linked to helper peptides, lipids or liposomes 4)
pulsed onto antigen presenting cells b. Immunodominant peptides
with amino acids substitutions to increase binding to MHC molecules
c. Proteins alone or combined with adjuvants d. "Naked" DNA
encoding cancer antigens 1) "gene gun" for intradermal injection 2)
intramuscular injection 3) linked to lipids e. Recombinant viruses
such as vaccinia, fowlpox or adenovirus encoding 1) cancer antigens
or epitopes alone 2) cancer antigens or epitopes plus genes
encoding cytokines, costimulatory molecules, or other genes to
enhance the immune response f. Recombinant bacteria such as BCG,
Salmonella or Listeria encoding cancer antigens alone or in
combination with immunostimulatory molecules 2. Active
immunotherapy (above) followed by the administration of
immunostimulatory cytokines. 1. IL-2 2. IL-6 3. IL-10 4. IL-12 5.
IL-15, and the like. 3. Passive immunotherapy with anti-tumor
lymphocytes raised by in vitro sensitization of TIL or PBL to 1.
immunodominant peptides pulsed onto antigen presenting cells (raise
CD8.sup.+ cells) 2. antigenic proteins coincubated with antigen
presenting cells (exogenous antigen presenting pathway to raise
CD4.sup.+ cells).
The insertion of the gene encoding at least one NY-ESO-1 MHC class
II specific T cell epitope into high efficiency expression systems
such as E. coli, yeast or baculovirus and the like provides the
opportunity to obtain large amounts of purified tumor epitopes for
use in immunization. Alternatively, the immunodominant epitopes may
be readily be synthesized in vitro and purified in large amounts
for immunization alone or in a form intended to improve their
immunogenicity such as in combination with adjuvant, linkage to
lipids/liposomes or helper peptides, or pulsed onto antigen
presenting cells. Modification of individual amino acids of the
immunodominant peptides to improve binding efficiency to MHC class
II antigens can potentially increase immunogenicity compared to the
native peptide.
Recent techniques utilizing "naked" DNA injected directly into
muscle or into the skin have been shown to raise both cellular and
humoral immune reactions to encoded antigens (Cooney, E. L., A. C.
Collier, P. D. Greenberg, R. W. Coombs, J. Zarling, D. E. Arditti,
M. C. Hoffman, S. L. Hu and L. Correy, 1991, Lancet 337:567; Wolff,
J. A., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and
P. L. Feigner, 1990, Science 247:1465; Davis, H. L., R. G. Whalen,
and B. A. Demeniex, 1993, Hum. Gene Ther. 4:151; Yang, N. S., J.
Burkholder, B. Roberts, B. Martinelli, and D. McCabe, 1990, Proc.
Natl. Acad. Sci. USA 87:9568; Williams, R. S., S. A. Johnston, M.
Riedy, M. J. DeVit, S. G. McElligott, and J. C. Sanford, 1991,
Proc. Natl. Acad. Sci. USA 88:2726; Fynan, E. R., Webster, D. H.
Fuller, J. R, Haynes, J. C. Santoro, and H. L. Robinson, 1995,
Proc. Natl. Acad. Sci. USA 90:11478; Eisenbraum, M. D., D. H.
Fuller, and J. R. Haynes, 1993, DNA and Cell Bio. 12:791; Fuller,
D. H. and J. R. Haynes, 1994, AIDS Res. Hum. Retrovir. 10(11):1433;
Acsadi, G., G. Dickson, D. R. Love, A. Jani, F. S. Walsh, A.
Gurusinghe, J. A. Wolff, and K. E. Davies, 1991, Nature 352:815).
Techniques using nonviable DNA vectors have the advantage of ease
of preparation and safety of administration. The nucleic acid
sequence of the present invention is useful as an immunogen and as
a DNA vaccine against cancer. The nucleic acid sequence of the
present invention of the NY-ESO-1 MHC class II specific T cell
epitopes or a nucleic acid sequence encoding a full length NY-ESO-1
protein having one or more variant NY-ESO-1 MHC class II restricted
T cell epitopes thereof may be administered using a gene gun in
amounts to elicit a humoral response against a cancer cell.
Nanogram quantities are useful for such purposes.
An effective form of immunization involves the incorporation of
genes encoding immunogenic molecules into recombinant bacteria such
as BCG, Salmonella or Listeria or into recombinant viruses such as
vaccinea, fowlpox or adenovirus and the like. The genes encoding
the NY-ESO-1 MHC class II specific T cell epitope can be expressed
either alone or in combination with genes encoding
immunostimulatory molecules or other genes which can enhance the
immune response following infection. The construct may additionally
comprise a gene encoding an additional NY-ESO-1 MHC class II
restricted T cell epitope and/or at least one NY-ESO-1 MHC class I
specific T cell epitope.
Studies with model tumor antigens in murine models have shown that
incorporation of the gene for interleukin-2 (IL-2) or B7.1 can
increase the immunogenicity of model tumor epitopes and even
mediate the regression of established lung metastases bearing these
epitopes. Active immunotherapy followed by the exogenous
administration of immunostimulatory cytokines such as IL-2, IL-6,
IL-10, IL-12, or IL-15 may also be used to improve immune
responses.
Passive immunotherapy with genetically modified immune cells
(commonly referred to as adoptive immunotherapy) capable of
recognizing human tumor antigens is effective in mediating the
regression of cancer in selected patients with metastatic melanoma.
In vitro techniques have been developed in which human lymphocytes
are sensitized in vitro to tumor antigen immunodominant epitopes
presented on antigen presenting cells. By repetitive in vitro
stimulation cells can be derived with a far greater capacity to
recognize human tumor antigens than the TIL that were used to clone
the genes encoding these antigens. Thus by repeated in vitro
sensitization with the cancer peptides, lymphocytes could be
derived with 50 to 100 times more potency of TIL. The adoptive
transfer of these cells may be more effective in mediating tumor
regression in vivo than are conventionally grown TIL.
In one embodiment, peripheral blood mononuclear cells (PBMC) were
stimulated with several candidate DRB1*0401 peptides identified
following immunization of DR4-IE transgenic mice. NY-ESO-1 specific
CD4.sup.+ T cells were generated by in vitro sensitization with a
synthetic peptide, ESO p161-180. This CD4.sup.+ T cell line
recognized NY-ESO-1 peptides presented by HLA DP4, a prevalent MHC
class II allele present in approximately 43-70% of Caucasians (52).
Moreover, the HLA DP4 haplotype was shared by 91% (10 out of 11) of
the melanoma patients who produced high titer Ab against NY-ESO-1,
but was not expressed in any of three patients with NY-ESO-1
positive tumors and possessing no detectable Ab. The results of in
vitro stimulation demonstrated that the HLA DP4-restricted T cells
could be generated from 5 out of 6 patients with NY-ESO-1 Ab. These
results suggested that recognition of NY-ESO-1 by CD4.sup.+ T cells
in the context of DP4 could be connected with the ability of these
patients to mount an antibody response against this antigen.
In the methods of preventing or inhibiting cancer, the NY-ESO-1 MHC
class H restricted T cell epitopes may be administered via one of
several routes including but not limited to intravenous,
intramuscular, subcutaneous, intradermal, intraperitoneal,
intrathecal, intrapleural, intrauterine, rectal, vaginal, topical,
intratumor and the like.
Administration may be by transmucosal or transdermal means. For
transmucosal or transdermal administration, penetrants appropriate
to the barrier to be permeated are used in the formulation. Such
penetrants are generally known in the art, and include, for
example, for transmucosal administration bile salts and fusidic
acid derivatives. In addition, detergents may be used to facilitate
permeation. Transmucosal administration may be by nasal sprays, for
example, or suppositories. For oral administration, the cancer
peptide, tumor antigen, portion or variant thereof is formulated
into conventional oral administration form such as capsules,
tablets and tonics.
In general, it is desirable to provide the recipient with a dosage
of NY-ESO-1 MHC class II restricted T cell epitopes of at least
about 1 ng per Kg bodyweight, preferably at least about 1 mg per Kg
bodyweight, more preferably at least about 10 mg or greater per Kg
bodyweight of the recipient. A range of from about 1 mg per Kg
bodyweight to about 100 mg per Kg bodyweight is preferred although
a lower or higher dose may be administered. The dose is effective
to prime, stimulate and/or cause the clonal expansion of NY-ESO-1
MHC class II specific CD4.sup.+ T lymphocytes, which in turn are
capable of preventing or inhibiting cancer in the recipient.
The dose is administered at least once and may be provided as a
bolus or a continuous administration. Multiple administrations of
the dose over a period of several weeks to months may be
preferable. Subsequent doses may be administered as indicated.
In a method of treatment, a vaccine comprising the NY-ESO-1 class
II restricted T cell epitope is administered to a mammal in an
amount effective to prevent cancer in the mammals or to prevent
metastasis in a mammal bearing a localized cancer. Optionally, the
vaccine may include multiple distinct NY-ESO-1 MHC class II
restricted T cell epitopes and/or an NY-ESO-1 MHC class I
restricted cancer peptide or epitope to stimulate cytotoxic T
lymphocytes.
In a method of reducing tumor burden in animals having tumors the
method comprises administration of an effective amount of a
NY-ESO-1 MHC class II restricted T cell epitope at a site of tumor
burden, said amount is effective to reduce the size of the tumor at
the site and may inhibit metastasis from the tumor site.
In another embodiment of a method of treatment, an immunogen
comprising the NY-ESO-1 HLA-DP restricted T cell epitope is
administered to a mammal in an amount effective to elicit NY-ESO-1
HLA-DP restricted CD4.sup.+ T lymphocytes and anti-NY-ESO-1
antibody. The immunogen may be provided alone or in combination
with an adjuvant, immunomodulators, and the like.
In another method of treatment, autologous lymphocytes or tumor
infiltrating lymphocytes may be obtained from a patient with
cancer. The lymphocytes are grown in culture and cancer epitope
specific CD4.sup.+ lymphocytes expanded by culturing in the
presence of NY-ESO-1 MHC class II restricted T cell epitopes alone
or in combination with at least one immunostimulatory molecule with
cytokines. The epitope specific CD4.sup.+ lymphocytes are then
infused back into the patient, alone or in combination with the
epitope, in an amount effective to reduce or eliminate the tumors
in the patient.
After immunization the efficacy of the vaccine can be assessed by
production of immune cells that recognize the NY-ESO-1 MHC class II
T cell epitope, as assessed by antibody titer, specific lytic
activity, specific cytokine production, tumor regression or
combination of these. If the mammal to be immunized is already
afflicted with cancer or metastasis cancer the vaccine can be
administered in conjunction with other therapeutic treatments such
as immunomodulators, for example, IL-2, IL-6, IL-10, IL-12, IL-15,
interferon, tumor necrosis factor and the like, chemotherapeutic
drugs such as cisplatinum, antiviral such as gancyclovir,
amphotericin B, antibiotics and the like.
Another aspect of the invention is a DNA sequence of the NY-ESO-1
gene encoding a MHC class II restricted T cell epitope thereof.
In one embodiment, the DNA sequence comprises a portion of SEQ. ID
NO.: 1 or 2 and functionally equivalent sequence variants thereof
that encode a MHC class II restricted T cell epitope recognized by
CD4.sup.+ T lymphocytes. Also encompassed by the present invention
are nucleic acid sequences complementary, as well as
anticomplementary to the portion of SEQ. ID NO: 1 or 2 encoding the
MHC class II restricted T cell epitope.
In an embodiment, the DNA sequence encodes an MHC class II
restricted T cell epitope comprising at least one of SEQ ID NOS: 4
through 21 or 29-34.
In another embodiment, the DNA sequence encoding an MHC class II
restricted T cell epitope comprises:
CAG GAT GCC CCA CCG CTT CCC GTG
CCA GGG GTG CTT CTG AAG GAG TTC
ACT GTG TCC GGC AAC ATA CTG ACT
ATC CGA CTC (SEQ. ID NO: 24) or functional portion or variant
thereof.
In another embodiment, the DNA sequence encoding an MHC class II
restricted T cell epitope comprises:
AGA CCA CCG CCA ACT GCA GCT
CTC CAT CAG CTC CTG TCT CCA GCA
GCT TTC CCT GTT GAT (SEQ ID NO: 25) or functional portion or
variant thereof.
In another embodiment, the DNA sequence comprises:
TGG ATC ACG CAG TGC TTT CTG CCC
GTG TTT TTG GCT CAG CCT CCC
TCA GGG CAG AGG CGC (SEQ ID NO: 26), or functional portion or
variant thereof.
Another aspect of the invention is a DNA sequence of the NY-ESO-1
gene encoding a HLA-DP restricted CD4.sup.+ T cell epitope
thereof.
In one embodiment, the DNA sequence comprises a nucleic acid
sequence encoding one or more SEQ. ID NOS.: 51 through 64 and
functionally equivalent sequence variants thereof that encode an
HLA-DP restricted T cell epitope recognized by CD4.sup.+ T
lymphocytes. Also encompassed by the present invention are nucleic
acid sequences complementary, as well as anticomplementary to the
nucleic acid sequence encoding the HLA-DP restricted T cell
epitope.
Due to degeneracy in the generic code, variations in the DNA
sequence will result in translation of an equivalent NY-ESO-1
epitope. As a result, substitutions are included in the ambit of
the invention as long as the substitution results in expression of
an NY-ESO-1 epitope that is recognized by NY-ESO-1 cancer antigen
HLA-class II restricted CD4.sup.+ T cells.
All or part of an open reading frame DNA sequence from the NY-ESO-1
gene may be used as probes to identify and isolate the homologs of
the NY-ESO-1 MHC class II restricted T cell epitope in other
mammalian species. In one embodiment, a human cDNA sequence is used
to screen a mammalian cDNA library for a murine homolog nucleic
acid sequence. Positive clones are selected and sequenced. Examples
of tissue sources from which the cDNA library can be synthesized
include but are not limited to dermis, epidermis, solid tumors,
melanomas, melanocytes, and the like. One skilled in the art will
understand the appropriate hybridization conditions to be used to
detect the homologs. Conventional methods for nucleic acid
hybridization construction of libraries and cloning techniques are
described in Sambrook et al, (eds) (1989) in "Molecular Cloning. A
Laboratory Manual" Cold Spring Harbor Press, Plainview, N.Y. and
Ausubel et al (eds) in "Current Protocols in Molecular Biology"
(1987), John Wiley and Sons, New York, N.Y.
Another aspect of the invention are nucleic acid probes for the
detection and quantification of RNA that transcribes the NY-ESO-1
MHC class II restricted T cell epitopes of the present invention in
biologic samples isolated from a mammal with cancer. Alterations in
the level of RNA relative to a control RNA sample is useful in
diagnosis and prognosis of the disease in the mammal.
In one embodiment, mRNA is derived from tissue of a patient
suspected of having cancer or precancer and compared with mRNA
derived from a healthy control subject. A quantitative and/or
qualitative increase of the mRNA encoding a NY-ESO-1 MHC class II
restricted T cell epitope of the present invention in the patient,
as compared to the control, is indicative of cancer or precancer in
the patient. The mRNA may be detected using oligonucleotide probes
hybridizable with the mRNA.
Combinations of oligonucleotides pairs based on the sequence
encoding the NY-ESO-1 MHC class II restricted T cell epitopes of
the present invention may be used as PCR primers to detect mRNA in
biological samples using the reverse transcriptase polymerase chain
reaction (RT-PCR) process for amplifying selected RNA sequences.
The present invention also encompasses in situ PCR and in situ
RT-PCR for detection of DNA and RNA encoding the NY-ESO-1 MHC class
II restricted T cell epitopes. The technique is preferred when the
copy number of a target nucleic acid is very low, or when different
forms of nucleic acids must be distinguished. The method is
especially useful in detecting and differentiating precancer and
cancer cells from normal cells.
The present invention also encompasses antisense oligonucleotides
which bind to certain complementary (`sense`) regions on mRNA
resulting in inhibition of synthesis of NY-ESO-1. Such antisense
oligonucleotides are single stranded nucleic acid of about 12 to
about 25 mononucleotides and are antisense to the sequence encoding
the NY-ESO-1 MHC class II restricted T cell epitopes of the present
invention. Such antisense oligonucleotides may be made by methods
known in the art as described by Uhlmann, E. et al. Antisense
oligonucleotides, structure and function of In: Molecular Biology
and Biotechnology Ed. R. A. Meyers, VCH Publishers, Inc., New York,
N.Y., 1995, pp. 38-44.
The present invention also encompasses a vector comprising the DNA
sequence encoding at least one or more NY-ESO-1 MHC class II
restricted T cell epitopes. The vector may comprise a DNA sequence
encoding a full length NY-ESO-1 protein having one or more variant
NY-ESO-1 MHC class II restricted T cell epitopes. Optionally the
vector may also comprise a DNA sequence encoding at least one
immunostimulatory molecule. The vector may also comprise a DNA
sequence encoding at least one or more NY-ESO-1 MHC class I
restricted T cell epitopes. The vector may also contain a gene
encoding green fluorescent protein for use in detecting
localization of NY-ESO-1 MHC class II restricted T cell epitopes in
cells and tissues.
Eukaryotic expression vectors include but are not limited to
retroviral vectors, vaccinia virus vectors, adenovirus vectors,
herpes virus vectors, fowlpox virus vectors, baculovirus vectors,
human papillomavirus vectors, equine encephalitis vectors,
influenza virus vectors and the like.
The present invention encompasses novel recombinant virus
expressing at least one NY-ESO-1 MHC class II restricted T cell
epitope encoded by an open reading frame nucleic acid sequence of a
gene, fragments or variants thereof. The recombinant virus may also
express at least one immunostimulatory molecule. The recombinant
virus is capable of eliciting or upregulating a humoral immune
response in a mammal for the purpose of preventing or treating
cancer in the mammal, particularly humans.
A host cell infected with the recombinant virus expresses one or
more NY-ESO-1 MHC class II restricted T cell epitopes, alone or in
combination with at least one immunostimulatory molecule. The host
cell may also be infected with a recombinant virus expressing an
HLA class II molecule.
Methods for constructing and expressing exogenous gene products
from recombinant vaccinia virus vectors are disclosed by Perkus et
al Science 229:981-984, 1985, Kaufman et al Int. J. Cancer
48:900-907, 1991, Moss Science 252:1662, 1991, Smith and Moss
BioTechniques November/December, p. 306-312, 1984, and U.S. Pat.
No. 4,738,846. Sutter and Moss (Proc. Nat'l Acad. Sci. U.S.A.
89:10847-10851, 1992) and Sutter et al (Virology 1994) disclose the
construction and use as a vector, the non-replicating recombinant
Ankara virus (MVA, modified vaccinia Ankara) which may be used as a
viral vector in the present invention. Baxby and Paoletti (Vaccine
10:8-9, 1992) disclose the construction and use as a vector, a
non-replicating poxvirus, including canarypox virus, fowlpox virus
and other avian species for use as a viral vector in the present
invention.
The vectors of the present invention may be placed in an
appropriate host cell for the expression of the NY-ESO-1 MHC class
II restricted T cell epitope. Eukaryotic host cell lines include,
but are not limited to COS cells, CHO cells, Hela cells, NIH/3T3
cells, insect cells, antigen presenting cells such as dendritic
cells and the like. Optionally the host cell may also express a
stimulatory molecule. In the case where the host cells express both
the NY-ESO-1 MHC class II restricted T cell epitope in combination
with at least one MHC (or HLA) class II molecule, it is preferable
that a eukaryotic expression system be used to allow for proper
glycosylation. The expression of both the cancer epitope and the
immunostimulatory molecule by the host cell provides the necessary
MHC class II restricted peptide to specific T cells and the
appropriate signal to the T cell to aid in antigen recognition and
proliferation or clonal expansion of antigen specific T cells. The
overall result is an upregulation of the immune system. The
upregulation of the immune response is manifest by an increase in
cancer antigen specific CD4.sup.+ lymphocytes and other effector
cells of humoral immunity for inhibition of the growth of cancer or
precancer cells.
The DNA may be inserted into the host cell by transfection,
transduction, liposomes and the like by methods known in the art.
(Sambrook et al, 1989, in: "Molecular Cloning A Laboratory Manual",
Cold Spring Harbor press, Plainview, N.Y.). For liposomes, cationic
lipids are preferred, for example, polycationic lipid,
dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium (DMRIE)
complexed with the neutral phospholipid dioleoyl
phosphatidyl-ethanolamine (DOPE) as disclosed by Nabel, E. G. et
al, 1992, Hum. Gene. Ther. 3:367-275; Nabel, G. J. et al, 1992,
Hum. Gene Ther. 3:649-656; Stewart, M. J. et al 1992 Hum. Gene
Ther. 3:399-410; Nabel, G. J. et al 1993 Proc. Natl. Acad. Sci. USA
90:11307-11311; and Harrison, G. S. et al 1995 Bio Techniques
19:816-823.
The recombinant NY-ESO-1 MHC class II restricted T cell epitopes
expressed by the host cells may be purified from cell lysates or
cell supernatants by standard protein purification procedures known
in the art. These include but are not limited to molecular sieve
chromatography, ion-exchange chromatography, isoelectric focusing,
gel electrophoresis, affinity chromatography, HPLC, reverse phase
HPLC and the like. (Ausubel et al, 1987, in Current Protocols in
Molecular Biology, John Wiley and Sons, New York, N.Y.).
Immunoaffinity chromatography may also be used for purification
using anti-cancer protein antibodies or antigen binding fragments
thereof as described herein, as the immunoaffinity agent.
The recombinant virus may also be used as a therapeutic or vaccine.
In such uses it is desirable to provide the recipient with a dosage
of recombinant virus in the range of from about 10.sup.5 to about
10.sup.10 plaque forming units/mg mammal, although a lower or
higher dose may be administered.
The recombinant viral vector may be introduced into a mammal either
prior to any evidence of cancer such as melanoma or to mediate
regression of the disease in a mammal afflicted with a cancer such
as melanoma. Examples of methods for administering the viral vector
into mammals include, but are not limited to, exposure of cells to
the recombinant virus ex vivo, or injection of the recombinant
virus into the affected tissue or intravenous, subcutaneous,
intradermal, intramuscular and the like administration of the
virus. Alternatively, the recombinant viral vector or combination
of recombinant viral vectors may be administered locally by direct
injection into the cancerous lesion or topical application in a
suitable pharmaceutically acceptable carrier. The quantity of
recombinant viral vector, carrying the nucleic acid sequence of
interest is based on the titer of virus particles. A preferred
range for immunization is about 10.sup.5 to 10.sup.10 virus
particles per mammal, preferably a human.
The invention provides a transgenic animal which has incorporated
into its genome one or more copies of the DNA sequence encoding at
least one NY-ESO-1 MHC class II restricted T cell epitope. The
general method of producing transgenic animals is described in
Krimpenfort et al U.S. Pat. No. 5,175,384, Leder et al U.S. Pat.
No. 5,175,383, Wagner et al U.S. Pat. No. 5,175,385, Evans et al
U.S. Pat. No. 4,870,009 and Berns U.S. Pat. No. 5,174,986. The
incorporation of the gene results in overexpression, altered
expression or expression of multiple forms or variants of the
NY-ESO-1 MHC class II restricted T cell epitope. The resulting
transgenic animal are useful in studies of the development of
cancer or tumor antigen of the present invention. The animal model
is useful in screening vaccines and chemotherapeutic drugs for
cancer treatment. The transgenic animal is also useful in studies
of the development of cancer.
This invention further comprises an antibody or antigen binding
portion thereof elicited by immunization with the NY-ESO-1 MHC
class II restricted T cell epitope of the present invention. In the
case where the NY-ESO-1 MHC class II restricted T cell epitope is
comprised of only a few amino acids, the epitope may be conjugated
to a carrier protein in order to elicit an antibody response.
Carrier proteins such as KLH, tetanus toxoid, albumin and the like
and methods of conjugation are known in the art. The antibody has
specificity for and reacts or binds with the NY-ESO-1 MHC class II
restricted T cell epitope of the present invention, as well as with
the intact NY-ESO-1 protein, and naturally processed forms of the
NY-ESO-1 protein.
Exemplary antibody molecules are intact immunoglobulin molecules,
substantially intact immunoglobulin molecules or these portions of
an immunoglobulin molecule that contain the antigen binding site,
including those portions of immunoglobulin molecules known in the
art as F (ab), F (ab'), F (ab').sub.2, humanized chimeric antibody,
and F (v). Polyclonal or monoclonal antibodies may be produced by
methods known in the art. (Kohler and Milstein (1975) Nature 256,
495-497; Campbell "Monoclonal Antibody Technology, the Production
and Characterization of Rodent and Human Hybridomas" in Burdon et
al (eds.) (1985) "Laboratory Techniques in Biochemistry and
Molecular Biology", Vol. 13, Elsevier Science Publishers,
Amsterdam). The antibodies or antigen binding fragments may also be
produced by genetic engineering. The technology for expression of
both heavy and light chain genes is the subject of the PCT patent
applications: publication number WO 901443, WO 9014424, Huse et al
(1989) Science 246:1275-1281, and U.S. Pat. No. 4,946,778.
Humanized immunoglobulins having one or more complementary
determining regions and methods of making the antibodies are
disclosed in U.S. Pat. Nos. 5,585,089 and 5,530,101.
In one embodiment, the antibodies of the invention are used in
immunoassays to detect NY-ESO-1 peptides or portions containing the
MHC class II restricted T cell epitope in biological samples. The
antibodies or antigen binding fragments thereof may be used to
detect cancer peptides in tissue biopsy samples from a mammal
afflicted with cancer. Assessment of the NY-ESO-1 MHC class II
restricted T cell epitope in a diseased tissue can be used to
prognose the progression of the disease in a mammal or may diagnose
the efficacy of a treatment. The immunoassay may be a
radioimmunoassay, Western blot assay, immunofluorescent assay,
enzyme immunoassay, chemiluminescent assay, immunohistochemical
assay and the like and may be performed in vitro, in vivo or in
situ. Standard techniques known in the art for ELISA are described
in "Methods in Immunodiagnosis", 2nd Edition, Rose and Bigazzi,
eds. John Wiley & Sons, 1980; Campbell et al "Methods and
Immunology", W.A. Benjamin, Inc., 1964; and Oellerich, M. 1984, J.
Clin. Chem. Clin. Biochem. 22:895-904. Conventional methods for
immunohistochemistry are described in Harlow and Lane (eds) (1988)
In "Antibodies A Laboratory Manual", Cold Spring Harbor Press, Cold
Spring Harbor, N.Y.; Ausbel et al (eds) (1987) In Current Protocols
In Molecular Biology, John Wiley and Sons (New York, N.Y.).
Biological samples appropriate for such detection assays include
but are not limited to cells, tissue biopsy, whole blood, plasma,
serum, sputum, cerebrospinal fluid, pleural fluid, urine and the
like.
The antibodies or antigen binding fragments of the present
invention may also be used in immunotherapy. The antibodies or
antigen binding fragment thereof is provided to a mammal in an
amount sufficient to prevent, lessen or attenuate the severity,
extent or duration of the cancer.
All articles and patents referred to are incorporated herein by
reference.
While the invention is described above in relation to certain
specific embodiments, it will be understood that many variations
are possible, and that alternative materials and reagents can be
used without departing from the invention. In some cases such
variations and substitutions may require some experimentation, but
will only involve routine testing.
The foregoing description of the specific embodiments will so fully
reveal the general nature of the invention and others can, by
applying current knowledge, readily modify and/or adopt for various
applications such specific embodiments without departing from the
generic concept, and therefore such adaptations and modifications
are intended to be comprehended within the meaning and range of
equivalents of the disclosed embodiments.
EXAMPLE 1
Materials and Methods
Purification and Analysis of Recombinant NY-ESO-1 Protein: To
construct a bacterial expression vector encoding the full-length
NY-ESO-1 gene, we generated a PCR fragment by using a pair of
primers, ESO-5p (5'GCTCCGGACATATGCAGGCCG AAGGCCGGGG) (SEQ ID NO:
35) containing an NdeI site and ESO-3p (5'AAGGGGCTCGAGGCT
GGGCTTAGCGCCTCT) (SEQ ID NO: 36) containing an XhoI site. After
digestion with restriction enzymes and gel purification of the PCR
product, a DNA fragment encoding NY-ESO-1 was fused to DNA encoding
a poly-histidine peptide in frame in pET-28(+) (Novagen, Madison,
Wis.). A similar strategy was also used to construct an expression
vector for a truncated NY-ESO-1, ESO1-74, which contained only the
first 74 amino acid residues. E. coli strain BL21(DE3) bearing the
correct plasmid construct was grown at 37.degree. C. to log phase,
then induced for protein production by adding
isopropyl-d-thiogalactoside (IPTG) to a final concentration of 0.5
mM and shaking for 3 hours. Soluble fractions of bacterial extract
were obtained; and NY-ESO-1 was purified by Ni.sup.2+ affinity
chromatography. SDS-PAGE analysis of the purified protein was
performed as previously reported (25). The N terminal sequence of
the purified protein was determined by automatic Edman
degradation.
Serum and PBMC: Sera from patients with metastatic melanoma were
stored at -80.degree. C. Sera of normal donors were obtained from
the Blood Bank at the Clinical Center of NIH. The MHC class II
genotype of patient TE with metastatic melanoma was HLA-DR1*0401,
1*1501. The patient was treated with the gp100:209-217(210M)
peptide plus high does of IL-2, and experienced an objective tumor
regression.
Detection of Antibodies against NY-ESO-1 Protein: About 50 ng of
purified NY-ESO-1 protein diluted in 50 l PBST (phosphate-buffered
saline with 0.1% Tween 20) was adsorbed to each well of a 96-well
MaxiSorp plate (Nunc, Denmark) overnight at room temperature.
Control plates were coated with 150 ng BSA/well. Plates were
blocked with 5% dry milk in PBST for at least 2 hours, washed, and
were loaded with 100 l of diluted serum samples. All serum samples
were diluted at 1:25, 1:250, and 1:2500 with 3% dry milk in PBST.
Each sample at the three different dilutions was loaded onto
NY-ESO-1-coated plates as well as BSA-coated plates. After one hour
incubation at room temperature, plates were washed, and loaded with
secondary antibody (goat antihuman IgG conjugated with horseradish
peroxidase, Sigma Co., St. Louis, Mo.) diluted with 1% dry milk in
PBST. Plates were developed after a 0.5-hour incubation, and
absorbance at 450 nm was read by using an ELISA reader (Dynatech,
Chantilly, Va.). A positive reaction was defined as an O.D. value
against NY-ESO-1 that exceeded the mean O.D. value plus 3 times
standard derivations of normal donors at serum dilutions of both
1:25 and 1:250. Western blot was performed as described (24) to
confirm the specificity of the antibody in a few representative
sera samples.
Cell Lines and Antibodies: Melanoma lines F049 and F050 were early
cultures of fine needle asparate samples, provided by Adam Riker at
the Surgery Branch of NCI. All other melanoma lines and EBV B lines
were generated and maintained in RPMI 1640 (Life Technologies,
Rockville, Md.) supplemented with 10% fetal calf serum (Biofiuid,
Inc., Gaithersburg, Md.). 293IMDR1 and 293IMDR4 were genetically
engineered to express human invariant chain, DMA, DMB and DR
molecules, and were cultured in RPMI 1640 supplemented with 10%
fetal calf serum (15). Culture medium for murine lymphocytes was
RPMI 1640 with 0.05 mM-mercaptoethanol, 5 CU/ml IL-2 plus 10% fetal
calf serum provided by Hyclone Inc. (Logan, Utah). Medium used for
human T cell culture was RPMI 1640 with 0.05 mM-mercaptoethanol, 50
CU/ml IL-2 plus 10% human AB serum provided by Sigma Co. (St.
Louis, Mo.). Antibody blocking experiments were performed as
previously described (15). Hybridoma HB55 and HB95 were obtained
from American Type of Cell Culture (ATCC, Manassas, Va.). Control
antibody was purchased from Pharmingen Int. (San Diego,
Calif.).
Transgenic Animals and Immunization Procedures: HLA-DR4 transgenic
(DR4-Tg) mice were murine class II-deficient, and expressed
HLA-DR-IE- and HLA-DR1*0401-IE-chimeric molecules (26). Founder
mice were obtained through Paul Lehmann at Case Western Reserve
University. Mice were inbred and maintained at Biocon Inc.
(Rockville, Md.). Female mice aged between 6 and 10 weeks were
immunized with the full-length recombinant NY-ESO-1 protein. About
50 microgram of purified protein were emulsified in complete
Freund's adjuvant (CFA), divided evenly and given to each mouse via
subcutaneous injection into rear foot pads and the base of tail.
Eleven days after the injection, mice were sacrificed and the
bilateral hindlimb popliteal and the inguinal lymph nodes were
harvested. Single cell suspensions were obtained from the lymph
nodes of two immunized animals, and followed by in vitro
stimulation.
Peptide Synthesis: Synthetic peptides used in this study were made
using a solid phase method on a peptide synthesizer (Gilson Co.
Inc., Worthington, Ohio) at the Surgery Brach of NCI. The purity of
each peptide was evaluated by mass spectrometry (Bio-synthesis,
Inc., Lewisville, Tex.).
In Vitro Sensitization (IVS) Procedure and Cytokine Release Assays:
Peptides at a final concentration of 10 M were mixed with
2.5.times.10.sup.5 mouse lymphocytes for a week before cytokine
release assays were conducted. For IVS of human PBMC,
2.5.times.10.sup.5 cells were pulsed with peptides at 10 M
concentration and incubated in each well of a flat-bottomed 96-well
plate. After two in vitro stimulations, cells were tested against
various targets and supernatants were harvested for cytokine
release assays. Rapid expansion and cloning of human T cells were
performed as described (20).
Peptide at a final concentration of 10 M or protein at a final
concentration of 5 g/ml were pulsed onto target cells. After 4 hr
incubation, cells were washed in serum-free RPMI medium, and
approximately 3.times.10.sup.4 target cells were incubated with the
same number of TE4-1 cells overnight, and cytokine release was
measured using GM-CSF ELISA kits (R&D Systems, Minneapolis,
Minn.) for human or IFN-kits (Endogen, Inc. Woburn, Mass.) for
mouse. Other cytokines such as human IFN-, IL-10, TNF-, and IL-4
were measured using ELISA kits from Endogen Inc. or R&D Systems
according to the manufacturer's instructions.
EXAMPLE 2
Recombinant NY-ESO-1 Protein and Detection of NY-ESO-1 Reactive
Antibody
NY-ESO-1 reactive antibodies and CTL have been reported in patients
with cancer (19-22). It thus appeared that NY-ESO-1 specific
CD4.sup.+ T cells might play a role in orchestrating the
development of antibodies as well as CTLs against the NY-ESO-1
antigen. However, no CD4.sup.+ T cell epitopes from NY-ESO-1 have
been reported thus far. In order to identify MHC class
II-restricted CD4.sup.+ T cell epitopes, we began by purifying
NY-ESO-1 protein from a bacterial expression system as the starting
material. To facilitate NY-ESO-1 expression and protein
purification, a cDNA fragment encoding NY-ESO-1 was fused to a
polyhistidine tag in frame located at the N-terminus in the pET28
expression vector and a high-level production of recombinant
protein was obtained. Several milligrams of the NY-ESO-1 protein
were purified by using a Ni.sup.2+-charged affinity chromatography
column. The purified protein showed an apparent molecular weight of
approximately 26 kDa on an SDS polyacrylamide gel (FIG. 2A). To
confirm the identity of the purified protein, N terminal
microsequencing of protein was performed by automatic Edman
degradation. All 25 amino acid residues obtained by Edman
degradation matched the predicted amino acid sequences (data not
shown). A short version of NY-ESO-1 containing the first 74 amino
acid residues, ESO1-74, was also purified by the same approach
(FIG. 2A).
To determine whether melanoma patients developed antibodies against
the NY-ESO-1 protein, sera from 88 metastatic melanoma patients
enrolled in cancer vaccine treatment protocols in the Surgery
Branch, NCI were screened. Sera from 8 normal donors were used as
controls for screening. Eleven of 88 patients (13%) were found to
have high titers of antibodies against NY-ESO-1 (FIG. 2C). This
data was consistent with results obtained by other groups (22). To
exclude the possibility that patients' sera reacted with a minor
contaminant present in the purified NY-ESO-1 protein, Western blot
was performed using representative sera samples. FIG. 2B showed
that the NY-ESO-1 reactive sera from a patient reacted only with
cell lysates from NY-ESO-1 expressing bacteria and the purified
NY-ESO-1 protein, but not with extracts from bacteria containing
the control vector. Anon-reactive serum sample was also tested
(FIG. 2B, lanes 4, 5, 6).
EXAMPLE 3
Identification of Putative MHC Class II-restricted Epitopes from
HLA-DR4-Transgenic Mice
To identify CD4.sup.+ T cell epitopes, DR4-transgenic mice were
immunized in the tail base and rear foot pads with approximately 50
g of full-length NY-ESO-1 protein in CFA. Eleven days after the
injection, single cell suspensions obtained from bilateral hindlimb
popliteal and inguinal lymph nodes of two immunized mice were
prepared and used for in vitro sensitization with synthetic
peptides derived from the NY-ESO-1 protein based on the predicted
peptide binding properties of the HLA-DR4 molecules (27).
Eight high-binding peptides containing amino acid sequence segments
predicted to bind to HLA-DR4 were used for the in vitro
sensitization experiments. Six days after the initial in vitro
sensitization, murine lymphocytes were tested for cytokine release
against human HLA-DR4 positive 1359EBV B cells alone and 1359EBV B
pulsed with the corresponding peptide used for stimulation. Three
peptides were recognized by murine T cells based on cytokine
secretion from T cells while other 5 peptides showed no recognition
(FIG. 3). The ESO p116-135 showed the strongest activity among the
positive peptides, suggesting that this peptide might contain an
epitope presented by the HLA-DR4 molecule for T cell recognition.
This peptide was thus chosen for further analysis.
EXAMPLE 4
Generation of Human CD4.sup.+ T Cells Specific for NY-ESO-1
PBMCs from patient TE, who had high-titered antibodies against
NY-ESO-1 (FIG. 2C), were used for in vitro stimulation with the ESO
p116-135 peptide. After one week of in vitro stimulation, PBMC from
patient TE showed marked expansion. IL-2 was added in the second
week of stimulation. The cell line thus established was named
TE4-1, which continued growth for more than two weeks in the
presence of 20 CU/ml IL-2. The TE4-1 T cells were 90% CD4.sup.+ T
cells based on FACS analysis. TE4-1 contained Th1-type CD4.sup.+ T
cells as they secreted GM-CSF, IFN- and TNF, but not IL-10 or IL-4
(data not shown). After depletion of a few percent of CD8 T cells,
the purified population of CD4.sup.+ T cells still retained its
reactivity. Some T cell clones derived from TE4-1 cell line were
also shown to recognize the ESO p116-135 peptide (data not
shown).
TE4-1 recognized EBV B cells pulsed with the full-length NY-ESO-1
protein as well as the ESO p116-135 peptide in the context of
HLA-DR4, but not with the truncated NY-ESO-1 protein containing the
first 74 amino acids (FIG. 4A). The TE4-1 cell line was also
reactive specifically with DR4 positive-dendritic cells infected
with adenovirus encoding NY-ESO-1, but not adenovirus encoding the
green fluorescence protein (data not shown).
To test whether T cell recognition by TE4-1 was restricted by
HLA-DR4, two overlapping peptides (ESO p116-135 and ESO p111-130)
and a control peptide (ESO p91-110) were pulsed onto 293IMDR1 and
293IMDR4 cells in serum-free medium. Cells were washed and
subsequently incubated with TE4-1 cells overnight. As shown in FIG.
4B, both peptide 116-135 and peptide 111-130 were recognized by
TE4-1 in the context of HLA-DR4. Interestingly, peptide 116-135 was
also capable of stimulating cytokine secretion from T cells when
pulsed onto 293IMDR1 cells. No activity was detected with 293IMDR4
pulsed with the control ESO p91-110 peptide (FIG. 4B). The
recognition of ESO-p116-135-pulsed 293IMDR4 was completely
inhibited by an anti-HLA-DR antibody (HB55), but not by the control
and anti-HLA-class I antibodies (HB95) (FIG. 4C). A gp100-specific
CD8.sup.+ T cell line (CTL-C3G1) and an HLA-DR1-restricted
CD4.sup.+ T cell line (T3-80) were used as specificity controls for
the antibody blocking.
EXAMPLE 5
Recognition of Tumor Cells by TE4-1
Although peptide-specific CD4.sup.+ and CD8.sup.+ T cell activities
can often be generated against a putative tumor antigen, in many
cases tumor reactivity could not be demonstrated due to either the
low affinity of the T cells or the failure of presentation of
naturally processed peptides on the tumor cell surface (3). To test
whether TE4-1 could recognize NY-ESO-1 epitopes naturally processed
and presented by tumor cells, several melanoma lines were used as
targets. The expression of NY-ESO-1 in each line was determined by
RT-PCR, while the expression of HLA-DR alleles was determined by
FACS analysis (data not shown). As shown in FIG. 5, TE4-1 was
capable of recognizing NY-ESO-1/HLA-DR4 positive tumors (1359 mel
and F049 mel), but failed to recognize tumor cell lines 397 mel and
624.38 mel (NY-ESO-1.sup.+/HLA-DR.sup.-), nor 526 mel
(NY-ESO-1.sup.-/HLA-DR4.sup.+). Interestingly, TE4-1 also
recognized F050 mel (DR1.sup.+/NY-ESO-1.sup.+), but did not
recognize 1300 mel expressing DR1 and a low level of NY-ESO-1. One
possible explanation is that CD4.sup.+ T cells may recognize the
same peptide presented by different DR molecules. The recognition
of F049 mel could be specifically blocked in the presence of
anti-HLA-DR antibody, but not the anti-MHC-class I antibody (data
not shown). These studies suggested that the TE4-1 cell line
recognized a naturally processed peptide on the tumor cell
surface.
EXAMPLE 6
Characterization of the NY-ESO-1 Epitope Recognized by TE4-1
Since the two reactive peptides shared 15 amino acids
(LPVPGVLLKEFTVSG) (SEQ ID NO: 10), the minimal length of peptide
was determined by testing a series of N- and C-terminal truncated
peptides. Peptides were pulsed onto DR4.sup.+ 1088 EBV B cells and
tested for their ability to stimulate TE4-1 cells. The Valine
residue at position 128 was found to be critical for T cell
recognition (FIG. 6A). The peptides with the N-terminal deletions
up to Leucine residue at position 123 did not affect T cell
recognition, but the peptide with further deletions partially lost
its ability to stimulate T cells. The Leucine residue at position
123 may be a P1 anchor residue since the P1, P4, P6 and P7 residues
contributed to the peptide binding to MHC class II molecules.
Further deletions are required to determine the critical residues
for binding to MHC class II molecules.
Based on the deletion experiments, we used a short version of
peptide ESO p119-130 to determine the binding affinity of the
peptide recognized by TE4-1. Peptides were pulsed onto 1088EBV B
cells (HLA-DR4.sup.+) as targets at different peptide
concentrations. As shown in FIG. 5B, no or little T cell activity
was observed at 33 nM or lower concentrations of the ESO p119-130
peptide; high activities were detected at 0.33 M peptide
concentration and the T cell activity did not reached a plateau at
a 33 M peptide concentration. The control peptide was not
recognized by TE4-1 even at a 33 M peptide concentration.
EXAMPLE 7
We have shown that T4-1 CD4+ T cell line recognize ESO p116-135 in
the context of DR4 and maybe DR1 as well. Here it is shown that
TE4-1 can recognize not only the peptide but also the protein in
the context of HLA-DR1. The recognition is blocked by anti-DR
antibodies (FIGS. 7A and 7B). This result shows evidence that ESO
p116-135 may be a promiscuous peptide and can bind to DR4 as well
as DR1. Thus, the applicable population of this peptide vaccine is
quite large.
EXAMPLE 8
Materials and Methods for HLA-DP Studies
Cell Lines, Tissue Culture Reagents, and Antibodies Used in the
Study
293CIITA is a cell line generated by transduction of 293 cells with
a retrovirus encoding the MHC class II transactivator (53) (The
retroviral plasmid is a courtesy of Dr. George Blanc at the
University of South Florida, Tampa, Fla.). All melanoma lines and
EBVB lines were generated and maintained in RPMI 1640 (Life
Technologies, Rockville, Md.) supplemented with 10% fetal calf
serum (Biofluid, Inc., Gaithersburg, Md.). Culture medium for
lymphocytes was RPMI 1640 with 0.05 mM beta-mercaptoethanol, 50
CU/ml IL-2 plus 10% human male AB serum provided by Valley
Biochemicals Inc. (Winchester, Va.). Antibodies used in blocking
assays were obtained from the following sources: W6/32 (HLA class
I) and L243 (HLA DR) were hybridoma supernatant purified by
Loftstrand Labs Lt. (Gaithersburg, Md.); Antibody clones IVA12 (HLA
class II), B7/21 (HLA DP), Genox 3.53, and IVD12 (both HLA DQ) were
purchased from Beckton Dickinson Immunocytometry Systems (San Jose,
Calif.).
Construction of Plasmids
The pESO plasmid was an expression vector containing the NY-ESO-1
cDNA driven by a CMV promoter as described before (45). The pIi-ESO
plasmid was constructed by inserting an NheI and NotI-digested PCR
product of the whole NY-ESO-1 cDNA into the pTi80 vector digested
with the same enzymes (54). The NY-ESO-1 cDNA was fused in frame
with the first 80 amino acid residues of invariant chain (Ii)
leader sequence at its N terminus. PCR primers used to amplify
NY-ESO-1 were as follows: forward primer 5' cattgctagcATG CAG GCC
GAA GGC CGG GGC A3' (SEQ. ID NO. 73) containing an NheI site and
the reverse primer 5' aaggctacattGC GGC CGC TTA GCG CCT CTG CCC TGA
G3' (SEQ. ID NO. 74) containing an NotI site.
Peptides and Generation of CD4.sup.+ T Cells
Synthetic peptides used in this study were made using a solid phase
method on a peptide synthesizer (Gilson Co. Inc., Worthington,
Ohio) at the Surgery Branch, National Cancer Institute, Bethesda,
Md. After deprotecting, the purity of each peptide was evaluated by
mass spectrometry (Bio-synthesis, Inc., Lewisville, Tex.).
Synthetic peptides were lyophilized and reconstituted in DMSO at 20
mg/ml and diluted to the indicated concentrations.
The in vitro sensitization procedure was carried out as previously
described (50). Briefly, approximately 2.5.times.10.sup.5 PBMC were
plated in a 96-well flat-bottom plate in the presence of 20 micro
g/ml peptide. On days 7 and 14, 1.times.10.sup.5 non-irradiated
PBMC were pulsed with 20 micro g/ml peptide, washed twice, and
added to each well, and IL-2 at 20 CU/ad was added on day 8, day
11, day 15, and day 18. On day 21, cells were harvested and
incubated with target cells overnight before the supernatants were
taken for cytokine release assays.
T cells from those wells with specific activities were pooled and
expanded using the OKT-3 rapid expansion method (55). After
expansion, CD8.sup.- T cells were depleted from cultures using
magnetic beads selection (Dynal Inc, Lake Success, N.Y.); and the
cell lines were subsequently analyzed for CD4.sup.+ and CD8.sup.+
expression by flow cytometry.
Cytokine Release Assays
To prepare protein or peptide pulsed targets, peptides were used at
a final concentration of 20 micro g/ml, and proteins were used at a
final concentration of 10 micro mg/ml. Cells were washed in
serum-free RPMI medium, pulsed at 37 C in the absence of serum for
4 hours, followed by 2.times. washes. Unless specified,
approximately 3.times.10.sup.4 target cells were incubated with the
same number of T cells for at least 16 hours before a cytokine
release assay was carried out. Cytokine secretion was measured
using a GM-CSF ELISA kit (R&D Systems, Minneapolis, Minn.).
Quantitation of the levels of human IL-4, TNF-alfa, and TGF-beta
was carried out using cytokine kits obtained from the R&D
Systems; and an IFN-gamma ELISA kit was purchased from Endogen Inc
(Woburn, Mass.). Assays were carried out according to the
manufacturer's instruction.
Molecular Typing of HLA DP Molecules
Total RNA was obtained from EBVB cells, CD40 ligand-stimulated B
cells, CD4.sup.+ T cells, or MHC class II positive melanoma lines
for typing. Total RNA was purified using an RNeasy kit (Qiagen,
Germany), and between 100 ng and 1 micro g of RNA was used for
oligo dT-primed first strand cDNA synthesis. One tenth of the cDNA
product was used to carry out PCR amplification with the advantage
PCR system from Clontech (Palo Alto, Calif). The following primer
pairs were used for HLA DP-A and DP BPCR DPA forward primer 5' ATG
CGC CCT GAA GAC AGA ATG T 3' (SEQ. ID NO. 75), DPA reverse primer
5'TCA CAG GGT CCC CTG GGC CCG GGG GA3' (SEQ. ID NO. 76), DPB
forward primer 5'ATG ATG GTT CTG CAG GTT TCT G3' (SEQ. ID NO. 77),
and DPB reverse primer 5'TTA TGC AGA TCC TCG TTG AAC TTT C3' (SEQ.
ED NO. 78). The PCR product was subsequently purified and sequenced
using the identical primers that were used to carry out the PCR. A
number of patients appeared to be homozygous for the highly
prevalent HLA DPB1*0401 gene product, as a single sequence was
obtained from the PCR product. In the case of heterozygous
patients, the PCR product was first cloned into a pCR4 vector
vitrogen, Carlsbad, Calif.) and sequenced using 5' and 3' primers
complementary to the vector sequence. The final sequence was
searched against the IMGT-HLA database to confirm HLA DP identity
(3.ebi.ac.uk/Services/imgt/hla).
EXAMPLE 9
Generation of a CD4.sup.+ T Cell Line TE4-2 Against NY-ESO-1
Initial studies were carried out to identify NY-ESO-1 epitopes
restricted by the HLA DR4 alleles. Eight 20-mer peptides which
contained predicted 9-mer DR4 binding motifs were examined for
recognition by lymphocytes from HLA-DR4-IE transgenic mice
immunized with the NY-ESO-1 recombinant protein and stimulated in
vitro (50). Three 20-mer peptides were found to be positive in
these experiments. One of them was characterized as a promiscuous
epitope of both DRB1*0401 and DRB1*0101 (50). To further
characterize two other peptides, ESO p161-180 and ESO p141-160, we
used them to stimulate PBMC from a DRB1*0401 patient (TE) who had
high titer antibodies as well as CD4.sup.- and CD8.sup.+ T cells
against NY-ESO-1 (50). A total of 24 micro-culture wells were used
for each peptide. After three rounds of weekly stimulation, 15 out
of 24 wells showed marked growth from PBMC that were stimulated
with ESO p161-180. Nine of the 15 growth positive wells tested
showed specific cytokine release against peptide pulsed
DRB1*0401-expressing 1088 EBVB cells (FIG. 8A). Specific CD4.sup.+
T cells were also generated from the PBMC stimulated with ESO
p141-160, but were not discussed in this study (data not
shown).
T cells from cultures that specifically responded to the ESO
p161-180 peptide stimulation were then combined and expanded using
a protocol described previously (55). Following the depletion of
CD8.sup.+ T cells, this culture, designated TE4-2, contained
greater than 95% CD4.sup.- T cells as assessed by FACS analysis
(data not shown).
Analysis of the cytokine secretion profile of TE4-2 demonstrated
that this T cell line secreted IFN-gamma, TNF-alfa, IL-4 and
GM-CSF, but not TGF-beta in response to peptide pulsed targets
(data not shown). Thus, both Th1 and Th2 types of CD4.sup.+ T cells
may be present in this cell line. Alternatively, cells with a Th0
phenotype may be present in this culture.
EXAMPLE 10
Recognition of NY-ESO-1 by TE4-2 in the Context of HLA
DPB1*0401-0402
TE4-2 T cells was examined to respond to DR4 expressing target
cells pulsed with ESO p161-180, an overlapping peptide, ESO
p156-175, as well as the full-length NY-ESO-1 protein,
respectively. 586 EBVB cells, which expressed DR1 but not DR4, were
also used as APC. An irrelevant peptide, ESO p91-110, and a
purified truncated recombinant protein, ESO1-74, comprising amino
acid 1-74 (50) were used as controls. TE4-2 T cells specifically
recognized a DR4.sup.+1088 EBVB line, when pulsed with the
full-length NY-ESO-1 protein, but not the truncated ESO1-74 protein
(FIG. 8B). Both the ESO p161-180 and p156-175 were recognized by
TE4-2, indicating that the minimal peptide epitope resided between
amino acid 161 and 175. In contrast, the initially predicted
DR4-binding motif resided between amino acid 167 and 175.
Unexpectedly, the TE4-2 T cell line appeared to respond equally
well to peptides and proteins pulsed on 586 EBVB cells, which
expressed DRB1*0101 but not DRB1*0401. This result suggested that
either similar peptides were presented by multiple MHC class II
restriction elements, or 1088 and 586 EBVB cell lines shared an MHC
class II restriction element that presented the peptides to TE4-2 T
cells. To test these possibilities, a number of other EBVB cells
with known HLA DR and DQ types were also used as APC in an attempt
to identify the restriction element utilized by TE4-2 T cells. All
but one of the EBVB cell lines tested were able to present the ESO
p161-180 peptide to TE4-2 (FIG. 8C).
T cell recognition of peptides was then carried out in the presence
of specific antibodies that blocked the recognition of peptides
restricted by different MHC restriction elements. The results in
FIG. 9A through 9C demonstrated that an antibody which blocked all
MHC class II alleles (IVA12) and an antibody with a specificity for
blocking all HLA DP alleles (B4/21), abolished the ability of TE4-2
T cells to recognize ESO p161-180. Antibodies directed against
HLA-A, B, and C alleles (W6/32) as well as antibodies against the
MHC class II DR (L243) and DQ (a mix of Genox 3.53 and IVD12)
alleles, had little or no effect on the stimulation of TE4-2 T
cells. Thus, these results suggested that the TE4-2 T cells
recognized ESO p161-180 in the context of a highly prevalent HLA DP
allele shared by EBVB cell lines used in this study.
The HLA-DP alleles were then molecularly cloned and sequenced for
cell lines used in FIG. 8C. These studies showed that 1088 and 586
EBVB lines were both homozygous for the HLA DPB1*0401 gene product,
and patient TE expressed DPB1*0401 as well as an unknown DP allele
(Table 2). L023 EBVB cell line, which did not present the ESO
p161-180 peptide to TE4-2 was typed as homozygous for the HLA DP
allele, which was distinct from DPB1*0401 and 0402. The 1363, 1088,
836, and L007 EBVB cell lines all expressed DPB1*0401, whereas L041
EBVB cell line expressed DPB1*0402, which was different from the
DPB1*0401 molecule by two amino acid residues at position 84 and
85. Thus, it appeared that both the DPB1*0401 and DPB1*0402 were
able to present the ESO p161-180 epitope to TE4-2 CD4 T cells.
TABLE-US-00005 TABLE 2 HLA (DP, DQ, and DR alleles) typing of
patients used in this study. HLA-DP HLA-DQ HLA-DR Patients with
NY-ESO-1 antibodies: TE B1*0401, nd 0302, 06** B1*0401, 1501;
B4*0101, B5*0101 BE B1*0401 0301, 0302 B1*0401, 1102; B3*0202,
B4*01** AC B1*04 negative 0603, 0604 B1*1301, 1302; B3*0202,
B3*0301 FJ B1*0401 0502, 0601 B1*1502, 1601; B5*0102, B5*02** LD
B1*0401 0303, 0603 B1*0901, 1301; B3*0101, B4*01** CJ B1*0401, nd
0201, 0301 B1*0701, 1101; B3*0202, B4*01** BFE B1*0402, nd 0303,
0602 B1*0701, 1501; B4*01**, B5*0101 KF B1*0401, 0402 0301, 0603
B1*0401, 1301; B3*0101, B4*0101 CT B1*0401, 0402 0301, 0603
B1*1101, 1502; B3*0202, B5*0102 DA B1*0401 06** B1*08**, 15**; nd
BL B1*0401, nd 0201, 0602 B1*0301, 1501; B3*0101, B3*0202 Patients
with NY-ESO-1 expressing tumor but no detectable Ab: FS B1*04
negative 0301, 0501 B1*0101, 1101; B3*0202 BFJ B1*04 negative 0201,
05** B1*0701, 1601; B3*0101, B3*0202 MJ B1*04 negative 0501
B1*1501; B5*0101 EBVB lines used for antigen presentation: L007
EBVB B1*0401 0602 B1*1501 B5*0101 L023 EBVB B1*04 negative 0301
B1*1201 B3*0202 L041 EBVB B1*0402, nd 0402 B1*0822 nd 836 EBVB
B1*0401, nd 02** B1*0701; B4*01** 1363 EBVB B1*0401 0501 B1*0101;
nd 1088 EBVB B1*0401 0201, 0301 B1*0301, 04**; B3*0101, B4*01** 586
EBVB B1*0401 0501, 0201 B1*0101, 07**; B4*01** "nd": not
determined. **subtypes unknown. The detection of the presence of
NY-ESO-1 antibodies in melanoma patients was previously described
(50).
To determine whether it required a specific DPA chain to present
the epitope to TE4-2 T cells, the HLA DPA molecules in
DPB1*0401-0402 expressing EBVB cells were also analyzed.
DPB1*0401-0402 expressing EBVB cells as used in FIG. 8C had more
than one type of HLA DPA molecule (data not shown); however, all
were able to present the NY-ESO-1 epitope to TE4-2 T cells equally
well.
EXAMPLE 11
Recognition of a Naturally Processed NY-ESO-1 Epitope on Tumor
Cells by TE4-2
To investigate whether the T cell epitope recognized by TE4-2 was
naturally processed and presented on the surface of tumor cells,
tumor lines that expressed NY-ESO-1 as well as DPB1*0401 were used
as targets. TE4-2 T cells recognized multiple tumor lines
expressing both NY-ESO-1 and DPB1*0401, but failed to recognize a
tumor line that expressed NY-ESO-1, but did not express any of the
HLA DPB1*0401 and 0402 alleles (1362 mel) (FIG. 10A). In addition,
TE4-2 T cells failed to recognize DPB1*0401 negative and NY-ESO-1
negative tumors (526 mel). One melanoma line, 1102 mel, which
expressed HLA DPB1*0401 but did not express NY-ESO-1, was also
recognized by TE4-2 T cells. The results of RT-PCR analysis
demonstrated that 1102 mel expressed the LAGE-1 gene, a
cancer/testis antigen possessing approximately 90% amino acid
similarity to NY-ESO-1 (57). A sequence identical to ESO p161-175
was also present in the LAGE-1 protein. These results suggested
that epitopes recognized by TE4-2 were present on the surface of
tumor cells, and that it is shared between NY-ESO-1 and the closely
related tumor antigen LAGE-1.
In addition to NY-ESO-1 expressing melanoma lines, TE4-2 T cells
were also tested for recognition of NY-ESO-1 transfected 293CIITA
cells. 293CIITA cell line was generated by transducing 293 cells
with a retrovirus expressing the MHC class II transactivator gene
(CIITA) (53). The 293CIITA cells but not the parental 293 cells
expressed homozygous HLA DPB1*0401 molecule as determined by RT-PCR
(data not shown). TE4-2 T cells reacted specifically with NY-ESO-1
transfected 293CIITA cells (FIG. 10B). In contrast, TE4-2 T cells
failed to recognize either 293CIITA cells transfected with the pGFP
plasmid or parental 293 cells transfected with Ii-NY-ESO-1. An Ii
targeting sequence was not required for the processing and
recognition of NY-ESO-1, but slightly enhanced T cell recognition
(FIG. 10B). These results further demonstrated that TE4-2 T cells
recognized a naturally processed NY-ESO-1 epitope.
EXAMPLE 12
HLA DP4-restricted Epitopes Overlapping with an HLA-A2 Restricted
Epitope
Target cells pulsed with the two overlapping peptides, ESO p161-180
and p156-175 were recognized equally well by TE4-2 T cells,
indicating that the minimal T cell epitope was located in the
region ranging from amino acids 161 to 175 (FIG. 8B).
In an attempt to identify the anchor residues present between amino
acid 161 and 175, a series of overlapping 13 mer peptides were used
to pulse 1088 EBVB cells and tested for their abilities to
stimulate TE4-2 T cells. As shown in FIG. 11A, a partial loss of
activity was observed when the W residue at position 161 was
removed; and a complete loss of activity was observed when the I
residue at position 162 was removed. The deletion of a C-terminal L
residue at position 167 also abolished the recognition of the
peptide by TE4-2 T cells. Moreover, the residue V at position 169
also appeared to be important, as deletion of this residue resulted
in a two-fold decrease in the peptide's stimulatory activity. These
results indicated that the W residue at position 161 may be a P1
anchor, and the L residue at position 167 represented the P7
anchor. The V residue at position 169 also appeared to contribute
to the stimulatory capacity of the peptide epitope, indicating that
it may represent the P9 anchor residue. These putative anchor
residues closely matched the previously described consensus HLA
DPB1*0401 binding motif (57).
The ESO p157-170 peptide, which contained all three anchor
residues, was used in the titration experiment to determine the
minimal stimulatory concentration for the peptide. The results
demonstrated that ESO p157-170 was able to stimulate significant
cytokine releases from TE4-2 T cells at a minimum concentration
between 3 and 33 nM (FIG. 11B). These results indicated that TE4-2
T cells recognized ESO p157-170 with a high affinity. This apparent
affinity is superior to most known MHC class II binding epitopes
from non-mutated peptides, such as those from gp100 (58),
tyrosinase (59), and CDC-27 (54). Other peptides spanning the same
region such as the ESO p161-180 and p156-175 also had similar
minimal stimulatory concentrations for TE4-2 T cells (data not
shown).
Interestingly, a previously identified HLA-A2 epitope, ESO p157-167
(47) was contained within the DPB1*0401-0402 epitope, ESO p157-170.
To assess whether the HLA-DP epitope may be presented by HLA-A2 and
cross-react with CD8.sup.+ T cells, ESO p157-170 was tested for
recognition by TE8-1, a CD8.sup.+ T cell line specifically
recognizing the HLA-A2 epitope ESO p157-167. ESO p157-170 was able
to stimulate significant cytokine releases from TE8-1 T cells when
pulsed onto L023 EBVB cells, which expressed HLA-A2 but not the
DPB1*0401-0402 allele (FIG. 11C). This experiment demonstrated that
the ESO p157-170 epitope had dual MHC class I and class II
specificity and could stimulate both CD4.sup.+ and CD8.sup.+ T
cells recognizing the NY-ESO-1 protein. Therefore, ESO p157-170
might be an attractive candidate for cancer vaccines aimed at
eliciting both CD4.sup.+ and CD8.sup.+ T cells specifically
recognizing tumor cells.
EXAMPLE 13
Association of the NY-ESO-1 Antibody Production with HLA
DPB1*0401-0402
HLA DPB1*0401-0402 is a dominant MHC class II allele present in a
large portion of Caucasians, ranging between 43% and 70% in
population studies involving different ethnic groups (52). Previous
studies (48, 50) have shown that normal donors as well as cancer
patients without NY-ESO-1 expressing tumors do not develop
antibodies against NY-ESO-1. In contrast, 50% of patients with
NY-ESO-1 expressing tumors developed NY-ESO-1 specific Ab. In a
panel of 88 melanoma patients whose serum samples were tested, 11
patients were found to have high titers of NY-ESO-1 antibodies
(50). The previously identified DR4-restricted CD4.sup.+ T cell
peptides cannot account for the production of NY-ESO-1 specific Ab
since many patients did not express DR4 alleles at all (Table 2).
To further investigate whether NY-ESO-1 specific DP4-restricted
CD4.sup.+ T cells were associated with the production of NY-ESO-1
specific Ab in these melanoma patients, we first analyzed their HLA
DP subtypes. Ten out of the 11 patients with NY-ESO-1 antibodies
expressed DPB1*0401 and/or 0402, whereas no dominant DQ or DR
restriction elements could be identified in this group of patients
(Table 2). Three patients from this panel with known NY-ESO-1
expressing tumors but with no detectable antibodies did not express
the DPB1*0401-0402 alleles. Since tumor cell lines from the
remaining 74 patients were not available to assess the NY-ESO-1
expression from these patients, further studies were not carried
out to identify their HLA DP types. A p-value of 0.011 was obtained
from a Fisher's exact test, indicating the significance of the
association between antibody responses and the HLA-DPB1*0401-0402
expression. Since NY-ESO-1 is expressed in 25-30% of tumor cell
lines and DP4 is expressed in 43-70% of the population, the
percentage of patients expressing both NY-ESO-1 and DP4 and with
the potential to develop antibody responses is in the range of
10-21%. This hypothetical prediction is very close to the observed
10-13% frequency of patients with NY-ESO-1 antibodies.
In order to obtain additional evidence as to the association
between NY-ESO-1 antibody responses and the DPB1*0401-0402
expression, PBMC from 6 of the 11 patients with NY-ESO-1 antibodies
were used for in vitro stimulation with the ESO p161-180 peptide.
In vitro sensitization was also carried out with PBMC from two
DPB1*0401.sup.+ patients with no detectable NY-ESO-1 antibodies. T
cells were examined for their response to 293CIITA cells pulsed
with the ESO p161-180 peptide after two or three rounds of in vitro
stimulation. T cells from 5 out of the 6 patients (including TE)
with NY-ESO-1 antibodies showed a specific recognition of the ESO
p161-180 epitope presented by 293CIITA cells (DP4.sup.+ and
HLA-A2.sup.-) (Table 3). Multiple wells from patient CT and BL
appeared to react with peptide pulsed targets. Sensitized PBMC from
these two patients also showed significant tumor recognition of
DPB1*0401.sup.+ and NY-ESO-1.sup.+ melanoma lines without further
enrichment of the CD4.sup.+ T cells (data not shown). In contrast,
NY-ESO-1 reactive T cells were not generated using PBMC from two
patients (WC and EW) with no detectable NY-ESO-1 antibodies after
three stimulations. These results suggested that patients who
developed anti-NY-ESO-1 antibodies also contained relatively high
precursor frequency of T cells reactive with the
DPB1*0401-restricted epitope. These NY-ESO-1 specific CD4.sup.+ T
cells may have contributed to the development of antibody responses
against the NY-ESO-1 cancer/testis antigen.
TABLE-US-00006 TABLE 3 Recognition of DPB1*0401-restricted ESO
p161-180 by CD4.sup.+ T cells generated from patients with and
without specific antibody responses. T Cell Reactivity (pg/ml
IFN-gamma secretion) Irrelevant Antibody Patients peptide.sup.@ ESO
p161-180 Responses DPB1*0401 BE 0 0 + + FJ 0 160 + + CJ 150 475 + +
CT 150 2350 + + BL 180 1089 + + TE 90 207 + + WC.sup.% 0 0 - +
EW.sup.% 0 0 - + .sup.@293CIITA cells (DPB1*0401 positive and
HLA-A2 negative) were pulsed with the indicated peptides and used
as targets. Cultures showing more than 100 pg/ml IFN- production in
response to ESO p161-180 pulsed targets and at least two-fold above
the background were defined as positive. Values of cytokine
secretion were from representative positive wells.
.sup.%Anti-NY-ESO-1 antibody titers as well as the HLA DP types of
patients WC and EW were determined in this study (data not shown).
Expression of NY-ESO-1 in tumors from these two patients was not
known since their tumor specimens were not available.
EXAMPLE 14
Modifications were made to one of the wild type HLA DP4 peptides.
The modification was designed to make the peptide more soluble so
that it could be purified to more than 90% homogeneity, which is
required by FDA for peptide clinical trials. The wild type as well
as the modified peptides are as follows:
TABLE-US-00007 Wild type ESOp157-170; (SEQ ID NO: 54)
SLLMWITQCFLPVF; Wild type ESOp157-167; (SEQ ID NO: 79) SLLMWITQCFL;
ESOp156R-169; (SEQ ID NO: 63) RSLLMWITQCFLPV; and ESOp157-170R;
(SEQ ID NO: 64) SLLMWITQCFLPVR.
Experiments were carried out to test whether these modified
peptides were equality well recognized by T cells. Since ESO
p157-170 showed dual HLA-A2 and HLA-DP4 binding specifications, the
recognition in both DP4 (FIG. 12A) and A2 (FIG. 12B) restricted
fashion by TE4-2 CD4+ T cells and TE8-1 CD8+ T cells, respectively
was determined.
Results indicated that these modified peptides were equally well
recognized as the wild type by CD4+ T cells as well as CD8+ T
cells.
EXAMPLE 15
NY-ESO-1 Epitope Specific CD4.sup.+ T Lymphocytes Immunotherapy
T-lymphocytes presensitized to a melanoma antigen may be effective
in therapeutically treating mammals afflicted with a melanoma.
T-lymphocytes are isolated from peripheral blood or melanoma tumor
suspensions and cultured in vitro (Kawakami, Y. et al, 1988, J.
Exp. Med. 168:2183-2191).
The T lymphocytes are exposed to the epitope VLLKEFTVSG (SEQ ID NO:
19) or the epitope WITQCFLPVF (SEQ ID NO: 80) at a concentration of
1 .mu.g/ml alone or in the presence of IL-2, resensitized and
expanded in culture. CD4.sup.+ T-lymphocytes exposed to the epitope
are administered to a mammal at about 10.sup.9 to 10.sup.12
lymphocytes per mammal. The lymphocytes are administered either
intravenously, intraperitoneally or intralesionally. The treatment
may be administered concurrently with other therapeutic treatments
such as cytokines, surgical excision of melanoma lesions and
chemotherapeutic drugs. NY-ESO-1 specific CD8.sup.+ T lymphocytes
may be administered concurrently with CD4.sup.+ T lymphocytes.
EXAMPLE 16
Treatment of Patients with Metastatic Melanoma
In this protocol, patients with advanced melanoma are immunized
with an antigenic cancer epitope.
Patients eligible for the trial must have evidence of measurable or
evaluable metastatic melanoma that has failed standard effective
therapy. Patients must have tumors that express the NY-ESO-1
antigen as evidenced by PCR or Northern Blot analysis of tumor cell
RNA.
Patients receive either 1 ng, 1 .mu.g or 500 mg/kg body weight of a
MHC class II restricted T cell epitope via intravenously at day
zero, day 7 and day 14 alone or in combination with IL2 and/or an
immunostimulatory molecule. Patients are evaluated for toxicity,
immunologic effects and therapeutic efficacy. Patients may
additionally receive an NY-ESO-1 class I restricted T cell
epitope.
Lymphocytes taken from the treated patients are tested for specific
response to the NY-ESO-1 cancer antigen or MHC class II restricted
T cell epitope.
A complete response is defined as the disappearance of all clinical
evidence of disease that lasts at least four weeks. A partial
response is a 50% or greater decrease in the sum of the products of
the perpendicular diameter of all measurable lesions for at least
four weeks with no appearance of new lesions or increase in any
lesions. Minor responses are defined as 25-49% decrease in the sum
of the products of the perpendicular diameters of all measurable
lesions with no appearance of new lesions and no increase in any
lesions. Any patient with less than a partial response is
considered a non-responder. The appearance of new lesions or
greater than 25% increase in the product of perpendicular diameters
of prior lesions following a partial or complete response is
considered as a relapse.
Discussion
NY-ESO-1 is an important immune target because it gives rise to
both humoral and cellular immune responses (19-21). Although its
expression pattern is similar to antigens in the MAGE gene family,
NY-ESO-1 is more frequently expressed in breast, prostate and lung
cancers than any member of the MAGE family (19, 20, 23). More
interestingly, high titered NY-ESO-1 reactive antibodies were
frequently detected in patients with cancer (FIGS. 2B and 2C) while
a very low percentage of patients developed high titers of
antibodies against the MAGE antigens or differentiation antigens
such as tyrosinase, gp100, TRP-1 and TRP-2 (data not shown and
(22). These studies strongly suggest that NY-ESO-1 reactive
CD4.sup.+ T cells may be involved in antibody production and CTL
proliferation. In this study, we identified the HLA-DR4-restricted
T cell epitope derived from NY-ESO-1 by the use of
HLA-DR4-transgenic mice and in vitro stimulation of human PBMC with
candidate peptides. To our knowledge, this is the first
demonstration that T cell epitopes from NY-ESO-1 were shown to be
presented by MHC class II molecules to CD4.sup.+ T cells. Since
NY-ESO-1-specific antibodies and CTL were detected in patients with
different HLA genotypes, other CD4.sup.+ T cell epitopes presented
by HLA class II molecules other than HLA-DR4 were identified in the
present invention.
Recently, two groups reported the identification of MHC class
II-restricted T cell epitopes from the known MHC class I-restricted
tumor antigen, MAGE-3. CD4.sup.+ T cell clones generated from PBMC
stimulated with DC pulsed with purified MAGE-3 protein recognized
peptide or protein pulsed on HLA-DR13-matched EBV B cells, but not
MAGE-3.sup.+/DR13.sup.+ tumor cells (14). However, in another
study, CD4.sup.+ T cells generated from PMBC stimulated with
peptides predicted by a computer-assisted algorithm were capable of
recognizing both peptide pulsed on EBV B cells and
MAGE-3.sup.-/DR11.sup.+ tumor cells (15). In the case of NY-ESO-1,
we here show that CD4.sup.+ T cells can recognize the NY-ESO-1
protein or peptide pulsed on DR4-matched EBV B cells as well as
tumor cells expressing NY-ESO-1 (FIGS. 4 and 5). Utilization of
HLA-DR transgenic mice may have advantages in identifying putative
peptides since immunized transgenic mice presumably have a high
precursor frequency of specifically reactive T cells. Once
candidate peptides were identified, CD4.sup.+ T cells could be
generated from PBMC stimulated with synthetic candidate peptides.
Therefore, the combined use of transgenic mice immunized with the
whole protein and stimulated with the peptides predicted by a
computer-assisted algorithm may avoid the need to stimulate human
PBMC with a large number of peptides and several rounds of in vitro
stimulation. Furthermore, candidate peptides identified by using
the immunized transgenic mice are likely to be peptides that are
naturally processed and presented on the cell surface. This may
increase the likelihood that peptide-specific CD4.sup.+ T cells can
recognize tumor cells as well. Finally, the use of PBMC from a
patient (TE), who developed a high titer of antibody and a high
precursor frequency of CTL against NY-ESO-1, may make it easier to
generate tumor-specific CD4.sup.+ T cells since both antibody
production and CTL require the help of CD4.sup.+ T cells. This
approach has been used to identify a number of MHC class
II-restricted T cell epitopes from known autoantigens involved in
autoimmune diseases (28). Therefore, the strategy used in this
study may be applicable to many other known MHC class I-restricted
tumor antigens while other strategies such as a direct gene cloning
approach may facilitate the identification of unknown MHC class
II-restricted tumor antigens.
Clinical trials using peptides derived from tissue-specific
differentiation antigens such as gp100 showed some evidence of
therapeutic efficacy in the treatment of patients with melanoma
(4). Although no significant toxic side effects were observed in
the patients treated with the modified gp100 peptides, vitiligo or
depigmentation was often found in patients who responded to therapy
(29), suggesting that antitumor immunity induced by immunization
with self-antigens may cause autoimmunity. In animal studies using
TRP-1 as an immune target, similar results (antitumor immunity and
coat depigmentation) were also obtained (30-32). Interestingly,
antitumor immunity and autoimmunity mediated by gp75/TRP-1 appeared
to involve CD4.sup.+ T cells and antibodies (33). Immunization of
mice with hTRP-2 (34), but not mTRP-2 (35), broke tolerance to the
self-antigen and the antitumor immunity required the participation
of both CD4.sup.+ and CD8.sup.+ T cells (33). These studies
suggested that antitumor immunity could be mediated by either
antibodies or CD8.sup.+ T cells, but both require the critical help
of CD4.sup.+ T cells (24, 33).
The MHC class II-restricted NY-ESO-1 peptides identified in this
study may be useful in clinical applications since CTL and
antibodies against NY-ESO-1 were detected in patients with cancer.
Immunization with both MHC class I and II-restricted peptides or
with a purified NY-ESO-1 protein may induce NY-ESO-1 specific
CD4.sup.+, CD8.sup.+ T cells as well as antibodies. Alternatively,
patients could be immunized with dendritic cells loaded with both
class I and II peptides or infected with recombinant viruses
encoding the NY-ESO-1 gene. Because testicular germ cells do not
express MHC class I and II molecules (36), immune responses against
NY-ESO-1 should be specific for tumor cells, and thus generate
little or no autoimmune responses. Similar studies using MHC class
I-restricted peptides of MAGE-3 or peptides pulsed on dendritic
cells indicated that while antitumor immunity (CTL responses) and
slow tumor regression was demonstrated, no depigmentation/vitiligo
or other significant side effects were observed (6, 7). Antitumor
immunity may be enhanced by providing tumor-specific CD4.sup.+ T
cell help.
REFERENCES
1. Houghton A N. (1994) Commentary: Cancer antigens: Immune
recognition of self and alterted self. J.Exp.Med. 180: 1-4. 2. Wang
R-F. (1997) Tumor antigens discovery: perspectives for cancer
therapy. Mol.Med. 3: 716-31. 3. Wang R-F, Rosenberg S A. (1999)
Human tumor antigens for cancer vaccine development. Immunological
Reviews 170: 85-100. 4. Rosenberg S A, Yang J C, Schwartzentruber D
J, et al. (1998) Immunologic and therapeutic evaluation of a
synthetic tumor-associated peptide vaccine for the treatment of
patients with metastatic melanoma. Nat. Med. 4: 321-327. 5. Nestle
F O, Alijagic S, Gilliet M, et al. (1998) Vaccination of melanoma
patients with peptide- or tumor lysate-pulsed dendritic cells. Nat.
Med. 4: 328-32. 6. Marchand M, van Baren N, Weynants P, et al.
(1999) Tumor regressions observed in patients with metastatic
melanoma treated with an antigenic peptide encoded by gene MAGE-3
and presented by HLA-A1. Int. J. Cancer 80: 219-30. 7. Thumer B,
Haendle R, Dieckmann P, et al. (1999) Vaccination with Mage-3A1
peptide pulsed mature, monocyte-derived dendritic cells expands
specific cytotoxic T cells and induces regression of some
metastases in advanced stage IV melanoma. J. Exp. Med. 190:
1669-1678. 8. Hung K, Hayashi R, Lafond-Walker A, Lowenstein C,
Pardoll D, Levitsky H. (1998) The Central Role of CD4(+) T Cells in
the Antitumor Immune Response. J. Exp. Med. 188: 2357-2368. 9. Toes
R E, Ossendorp F, Offringa R, Melief C J. (1999) CD4 T Cells and
their role in antitumor immune responses. J. Exp. Med. 189:
753-756. 10. Ossendorp F, Mengede E, Camps M, Filius R, Melief C J.
(1998) Specific T helper cell requirement for optimal induction of
cytotoxic T lymphocytes against major histocompatibility complex
class II negative tumors. J. Exp. Med. 187: 693-702. 11. Mumberg D,
Monach P A, Wanderling S, et al. (1999) CD4(+) T cells eliminate
MHC class II-negative cancer cells in vivo by indirect effects of
IFN-gamma. Proc. Natl. Acad. Sci. U.S.A 96: 8633-8. 12. Topalian S
L, Gonzales M I, Parkhurst M, et al. (1996) Melanoma-specific CD4+
T cells recognize nonmutated HLA-DR-restricted tyrosinase epitopes.
J.Exp.Med. 183: 1965-1971. 13. Li K, Adibzadeh M, Halder T, et al.
(1998) Tumour-specific MHC-class-II-restricted responses after in
vitro sensitization to synthetic peptides corresponding to gp100
and annexin II eluted from melanoma cells. Cancer Immunol.
Immunother. 47: 32-8. 14. Chaux P, Vantomme V, Stroobant V, et al.
(1999) Identification of MAGE-3 epitopes presented by HLA-DR
molecules to CD4(+) T lymphocytes. J. Exp. Med. 189: 767-778. 15.
Manici S, Sturniolo T, Imro M A, et al. (1999) Melanoma cells
present a MAGE-3 epitope to CD4(+) cytotoxic T cells in association
with histocompatibility leukocyte antigen DR11. J. Exp. Med. 189:
871-876. 16. Wang R-F, Wang X, Atwood A C, Topalian S L, Rosenberg
S A. (1999) Cloning genes encoding MHC class II-restricted
antigens: mutated CDC27 as a tumor antigen. Science 284: 1351-1354.
17. Wang R-F, Wang X, Rosenberg S A. (1999) Identification of a
novel MHC class II-restricted tumor antigen resulting from a
chromosomal rearrangement recognized by CD4+ T cells. J. Exp. Med.
189: 1659-1667. 18. Pieper R, Christian R E, Gonzales M I, et al.
(1999) Biochemical identification of a mutated human melanoma
antigen recognized by CD4(+) T cells. J. Exp. Med. 189: 757-766.
19. Chen Y T, Scanlan M J, Sahin U, et al. (1997) A testicular
antigen aberrantly expressed in human cancers detected by
autologous antibody screening. Proc. Natl. Acad. Sci. U.S.A. 94:
1914-1918. 20. Wang R-F, Johnston S L, Zeng G, Schwartzentruber D
J, Rosenberg S A. (1998) A breast and melanoma-shared tumor
antigen: T cell responses to antigenic peptides translated from
different open reading frames. J. Immunol. 161: 3596-3606. 21.
Jager E, Chen Y T, Drijfhout J W, et al. (1998) Simultaneous
humoral and cellular immune response against cancer-testis antigen
NY-ESO-1: definition of human histocompatibility leukocyte antigen
(HLA)-A2-binding peptide epitopes. J. Exp. Med. 187: 265-70. 22.
Stockert E, Jager E, Chen Y T, et al. (1998) A survey of the
humoral immune response of cancer patients to a panel of human
tumor antigens. J. Exp. Med. 187: 1349-54. 23. Lee L, Wang R-F,
Wang X, et al. (1998) NY-ESO-1 may be a potential target for lung
cancer immunotherapy. Cancer J. Sci. Am. 5: 20-25. 24. Old L J,
Chen Y T. (1998) New paths in human cancer serology. J. Exp. Med.
187: 1163-7. 25. Wang R F, Mullins J I. (1995) Mammalian
cell/vaccinia virus expression vectors with increased stability of
retroviral sequences in Escherichia coli: production of feline
immunodeficiency virus envelope protein. Gene 153: 197-202. 26. Ito
K, Bian H J, Molina M, et al. (1996) HLA-DR4-IE chimeric class II
transgenic, murine class II-deficient mice are susceptible to
experimental allergic encephalomyelitis. J. Exp. Med. 183: 2635-44.
27. Southwood S, Sidney J, Kondo A, et al. (1998) Several common
HLA-DR types share largely overlapping peptide binding repertoires.
J. Immunol. 160: 3363-73. 28. Sonderstrup G, McDevitt H. (1998)
Identification of autoantigen epitopes in MHC class II transgenic
mice [In Process Citation]. Immunol. Rev. 164: 129-38. 29.
Rosenberg S A, White D E. (1996) Vitiligo in patients with
melanoma: normal tissue antigens can be targeted for cancer
immunotherapy. J.Immunother. 19: 81-84. 30. Hara I, Takechi Y,
Houghton A N. (1995) Implicating a role for immune recognition of
self in tumor rejection: passive immunization against the Brown
locus protein. J.Exp.Med. 182: 1609-1614. 31. Weber L W, Bowne W B,
Wolchok J D, et al. (1998) Tumor immunity and autoimmunity induced
by immunization with homologous DNA. J. Clin. Invest. 102: 1258-64.
32. Overwijk W W, Lee D S, Surman D R, et al. (1999) Vaccination
with a recombinant vaccinia virus encoding a "self" antigen induces
autoimmune vitiligo and tumor cell destruction in mice: Requirement
for CD4(+) T lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 96:
2982-2987. 33. Bowne W B, Srinivasan R, Wolchok J D, et al. (1999)
Coupling and Uncoupling of tumor immunity and autoimmunity. J. Exp.
Med 190: 1717-1722. 34. Wang R-F, Appella E, Kawakami Y, Kang X,
Rosenberg S A. (1996) Identification of TRP-2 as a human tumor
antigen recognized by cytotoxic T lymphocytes. J. Exp. Med. 184:
2207-2216. 35. Bloom M B, Perry-Lalley D, Robbins P F, et al.
(1997) Identification of tyrosinase-related protein 2 as a tumor
rejection antigen for the B16 melanoma. J.Exp.Med. 185: 453-460.
36. Haas G G J, D'Cruz O J, Bault L E D. (1988) Distribution of
human leukocyte antigen-ABC and -D/DR antigens in the unfixed human
testis. Am. J. Reprod. Immunuol. Microbiol. 18: 47-51. 37.
Rosenberg, S. A. 1998. A new era for cancer immunotherapy based on
the genes that encode cancer antigens. Immunity. 10:281-287. 38.
Wang, R. F. and S. A. Rosenberg. 1999. Human tumor antigens for
cancer vaccine development. Immunol.Rev. 170:85-100. 39. Kawakami,
Y.; Eliyahu, S.; Delgado, C. H.; Robbins, P. F.; Rivoltini, L.;
Topalian, S. L.; Miki, T.; Rosenberg, S. A. 1994. Cloning of the
gene coding for a shared human melanoma antigen recognized by
autologous T cells infiltrating into tumor.
Proc.Natl.Acad.Sci.U.S.A. 91:3515-3519. 40. Wang, R. F., P. F.
Robbins, Y. Kawakami, X. Q. Kang, and S. A. Rosenberg. 1995.
Identification of a gene encoding a melanoma tumor antigen
recognized by HLA-A31-restricted tumor-infiltrating lymphocytes.
J.Exp.Med. 181:799-804. 41. Wang, R. F., E. Appella, Y. Kawakami,
X. Kang, and S. A. Rosenberg. 1996. Identification of TRP-2 as a
human tumor antigen recognized by cytotoxic T lymphocytes.
J.Exp.Med. 184:2207-2216. 42. Kawakami, Y., S. Eliyahu, C. H.
Delgado, P. F. Robbins, K. Sakaguchi, E. Appella, J. R. Yannelli,
G. J. Adema, T. Miki, and S. A. Rosenberg. 1994. Identification of
a human melanoma antigen recognized by tumor-infiltrating
lymphocytes associated with in vivo tumor rejection.
Proc.Natl.Acad.Sci.U.S.A. 91:6458-6462. 43. van der Bruggen, P., C.
Traversari, P. Chomez, C. Lurquin, E. De Plaen, B. Van den Eynde,
A. Knuth, and T. Boon. 1991. A gene encoding an antigen recognized
by cytolytic T lymphocytes on a human melanoma. Science
254:1643-1647. 44. Chen, Y. T. M. J. Scanlan, U. Sahin, O. Tureci,
A. O. Gure, B. Tsang, E. Williamson, E. Stockert, M. Pfreundschuh,
L. J. Old. 1997. A testicular antigen aberrantly expressed in human
cancers detected by autologous antibody screening.
Proc.Natl.Acad.Sci.U.S.A. 94:1914-1918. 45. Wang, R. F., S. L.
Johnston, G. Zeng, S. L. Topalian, D. J. Schwartzentruber, and S.
A. Rosenberg. 1998. A breast and melanoma-shared tumor antigen: T
cell responses to antigenic peptides translated from different open
reading frames. J.Immunol. 161:3596-3606. 46. Robbins, P. P., M.
El-Gamil, Y. F. Li, Y. Kawakami, D. Loftus, E. Appella, and S. A.
Rosenberg. 1995. A mutated beta-catenin gene encodes a
melanoma-specific antigen recognized by tumor infiltrating
lymphocytes. J.Exp.Med. 183:1185-1192. 47. Jager, E., Y. T. Chen,
J. W. Drijfhout, J. Karbach, M. Ringhoffer, D. Jager, M. Arand, H.
Wada, Y. Noguchi, E. Stockert, L. J. Old, and A. Knuth. 1998.
Simultaneous humoral and cellular immune response against
cancer-testis antigen NY-ESO-1: definition of human
histocompatibility leukocyte antigen (HLA)-A2-binding peptide
epitopes. J.Exp.Med. 187:265-270. 48. Stockert, E., E. Jager, Y. T.
Chen, M. J. Scanlan, I. Gout, J. Karbach, M. Arand, A. Knuth, and
L. J. Old. 1998. A survey of the humoral immune response of cancer
patients to a panel of human tumor antigens. J.Exp.Med.
187:1349-1354. 49. Pardoll, D. M. and S. L. Topalian. 1998. The
role of CD4+ T cell responses in antitumor immunity.
Curr.Opin.Immunol. 10:588-594. 50. Zeng, G., C. E. Touloukian, X.
Wang, N. P. Restifo, S. A. Rosenberg, and R. F. Wang. 2000.
Identification of CD4+ T Cell Epitopes from NY-ESO-1 Presented by
HLA-DR Molecules. J.Immunol. 165:1153-1159. 51. Jager, E., D.
Jager, J. Karbach, Y. T. Chen, G. Ritter, Y. Nagata, S. Gnjatic, E.
Stockert, M. Arand, L. J. Old, and A. Knuth. 2000. Identification
of NY-ESO-1 epitopes presented by human histocompatibility antigen
(HLA)-DRB4*0101-0103 and recognized by CD4(+) T lymphocytes of
patients with NY-ESO-1-expressing melanoma. J.Exp.Med. 191:625-630.
52. Gjertson, D. W., L. Geer, S-H. Lee, J. Kawata, and R. Sutrisno.
1997. Population Studies. In HLA 1997. P. Terasaki and D. W.
Gjertson, editors. UCLA Tissue Typing Laboratory, Los Angeles,
Calif. 174-427. 53. Riley, J. L., S. D. Westerheide, J. A. Price,
J. A. Brown, and J. M. Boss. 1995. Activation of class II MHC genes
requires both the X box region and the class II transactivator
(CIITA). Immunity 2:533-543. 54. Wang, R. F., X. Wang, A. C.
Atwood, Si. Topalian, and S. A. Rosenberg. 1999. Cloning genes
encoding MHC class II-restricted antigens: mutated CDC27 as a tumor
antigen. Science 284:1351-1354. 55. Walter, E. A., P. D. Greenberg,
M. J. Gilbert, R. J. Finch, K. S. Watanabe, E. D. Thomas, and S. R.
Riddell. 1995. Reconstitution of cellular immunity against
cytomegalovirus in recipients of allogeneic bone marrow by transfer
of T-cell clones from the donor. N.Engl.J.Med. 333:1038-1044. 56.
Lethe, B., S. Lucas, L. Michaux, C. De Smet, D. Godelaine, A.
Serrano, E. De Plaen, T. Boon. 1998. LAGE-1, a new gene with tumor
specificity. Int.J.Cancer. 76:903-908. 57. Rammensee, H. G., T.
Friede, and S. Stevanoviic. 1995. MHC ligands and peptide motifs:
first listing. Immunogenetics 41:178-228. 58. Touloukian, C. E., W.
W. Lcitner, S. L. Topalian, Y. F. Li, P. F. Robbins, S. A.
Rosenberg, and N. P. Restifo. 2000. Identification of a MHC class
II-restricted human gp100 epitope using DR4-IE transgenic mice.
J.Immunol. 164:3535-3542. 59. Topalian, S. L., M. I. Gonzales, M.
Parkhurst, Y. F. Li, S. Southwood, A. Sette, S. A. Rosenberg, and
P. F. Robbins. 1996. Melanoma-specific CD4+ T cells recognize
nonmutated HLA-DR-restricted tyrosinase epitopes. J.Exp.Med.
183:1965-1971.
SEQUENCE LISTINGS
1
881805DNAHomo sapiens 1agcagggggc gctgtgtgta ccgagaatac gagaatacct
cgtgggccct gaccttctct 60ctgagagccg ggcagaggct ccggagccat gcaggccgaa
ggccggggca cagggggttc 120gacgggcgat gctgatggcc caggaggccc
tggcattcct gatggcccag ggggcaatgc 180tggcggccca ggagaggcgg
gtgccacggg cggcagaggt ccccggggcg caggggcagc 240aagggcctcg
gggccgggag gaggcgcccc gcggggtccg catggcggcg cggcttcagg
300gctgaatgga tgctgcagat gcggggccag ggggccggag agccgcctgc
ttgagttcta 360cctcgccatg cctttcgcga cacccatgga agcagagctg
gcccgcagga gcctggccca 420ggatgcccca ccgcttcccg tgccaggggt
gcttctgaag gagttcactg tgtccggcaa 480catactgact atccgactca
ctgctgcaga ccaccgccaa ctgcagctct ccatcagctc 540ctgtctccag
cagctttccc tgttgatgtg gatcacgcag tgctttctgc ccgtgttttt
600ggctcagcct ccctcagggc agaggcgcta agcccagcct ggcgcccctt
cctaggtcat 660gcctcctccc ctagggaatg gtcccagcac gagtggccag
ttcattgtgg gggcctgatt 720gtttgtcgct ggaggaggac ggcttacatg
tttgtttctg tagaaaataa aactgagcta 780cgaaaaaaaa aaaaaaaaaa aaaaa
8052540DNAHomo sapiens 2atgcaggccg aaggccgggg cacagggggt tcgacgggcg
atgctgatgg cccaggaggc 60cctggcattc ctgatggccc agggggcaat gctggcggcc
caggagaggc gggtgccacg 120ggcggcagag gtcccggggc gcaggggcag
caagggcctc ggggccggga ggaggcgccc 180cgcggggtcc gcatggcggc
gcggcttcag ggctgaatgg atgctgcaga tgcggggcca 240gggggccgga
gagccgcctg cttgagttct acctcgccat gcctttcgcg acacccatgg
300aagcagagct ggcccgcagg agcctggccc aggatgcccc accgcttccc
gtgccagggg 360tgcttctgaa ggagttcact gtgtccggca acatactgac
tatccgactc actgctgcag 420accaccgcca actgcagctc tccatcagct
cctgtctcca gcagctttcc ctgttgatgt 480ggatcacgca gtgctttctg
cccgtgtttt tggctcagcc tccctcaggg cagaggcgct 5403180PRTHomo sapiens
3Met Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp 1
5 10 15 Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala
Gly 20 25 30 Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro
Arg Gly Ala 35 40 45 Gly Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly
Ala Pro Arg Gly Pro 50 55 60 His Gly Gly Ala Ala Ser Gly Leu Asn
Gly Cys Cys Arg Cys Gly Ala 65 70 75 80 Arg Gly Pro Glu Ser Arg Leu
Leu Glu Phe Tyr Leu Ala Met Pro Phe 85 90 95 Ala Thr Pro Met Glu
Ala Glu Leu Ala Arg Arg Ser Leu Ala Gln Asp 100 105 110 Ala Pro Pro
Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val 115 120 125 Ser
Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala Ala Asp His Arg Gln 130 135
140 Leu Gln Leu Ser Ile Ser Ser Cys Leu Gln Gln Leu Ser Leu Leu Met
145 150 155 160 Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu Ala Gln
Pro Pro Ser 165 170 175 Gly Gln Arg Arg 180 48PRTArtificial
SequenceSyntheticMISC_FEATURE(1)..(1)Xaa is
variableMISC_FEATURE(8)..(8)Xaa is variable 4Xaa Lys Glu Phe Thr
Val Ser Xaa 1 5 512PRTArtificial
SequenceSyntheticMISC_FEATURE(1)..(1)Xaa is no amino acid or
variableMISC_FEATURE(12)..(12)Xaa is no amino acid or variable 5Xaa
Val Leu Leu Lys Glu Phe Thr Val Ser Gly Xaa 1 5 10 627PRTArtificial
SequenceSynthetic 6Gln Asp Ala Pro Pro Leu Pro Val Pro Gly Val Leu
Leu Lys Glu Phe 1 5 10 15 Thr Val Ser Gly Asn Ile Leu Thr Ile Arg
Leu 20 25 725PRTArtificial SequenceSynthetic 7Ala Pro Pro Leu Pro
Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val 1 5 10 15 Ser Gly Asn
Ile Leu Thr Ile Arg Leu 20 25 817PRTArtificial SequenceSynthetic
8Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val 1
5 10 15 Ser 916PRTArtificial SequenceSynthetic 9Ala Pro Pro Leu Pro
Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val 1 5 10 15
1015PRTArtificial SequenceSynthetic 10Leu Pro Val Pro Gly Val Leu
Leu Lys Glu Phe Thr Val Ser Gly 1 5 10 15 1114PRTArtificial
SequenceSynthetic 11Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val
Ser Gly 1 5 10 1213PRTArtificial SequenceSynthetic 12Val Pro Gly
Val Leu Leu Lys Glu Phe Thr Val Ser Gly 1 5 10 1312PRTArtificial
SequenceSynthetic 13Pro Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly
1 5 10 1411PRTArtificial SequenceSynthetic 14Gly Val Leu Leu Lys
Glu Phe Thr Val Ser Gly 1 5 10 1515PRTArtificial SequenceSynthetic
15Leu Leu Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile Arg 1 5
10 15 1615PRTArtificial SequenceSynthetic 16Leu Lys Glu Phe Thr Val
Ser Gly Asn Ile Leu Thr Ile Arg Leu 1 5 10 15 1714PRTArtificial
SequenceSynthetic 17Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile
Arg Leu 1 5 10 1820PRTArtificial SequenceSynthetic 18Leu Pro Val
Pro Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly Asn 1 5 10 15 Ile
Leu Thr Ile 20 1910PRTArtificial SequenceSynthetic 19Val Leu Leu
Lys Glu Phe Thr Val Ser Gly 1 5 10 2020PRTArtificial
SequenceSynthetic 20Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser Cys
Leu Gln Gln Leu 1 5 10 15 Ser Leu Leu Met 20 2120PRTArtificial
SequenceSynthetic 21Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu Ala
Gln Pro Pro Ser 1 5 10 15 Gly Gln Arg Arg 20 2211PRTArtificial
SequenceSyntheticMISC_FEATURE(1)..(1)Xaa is no amino acid or
variableMISC_FEATURE(2)..(2)Xaa is Ala, Thr, Val, Leu or
ArgMISC_FEATURE(3)..(3)Xaa is Ser, Ala, Val, Ile, Leu,
ThrMISC_FEATURE(11)..(11)Xaa is Arg or Lys 22Xaa Xaa Xaa Gly Pro
Gly Gly Gly Ala Pro Xaa 1 5 10 2310PRTArtificial SequenceSynthetic
23Ala Ser Gly Pro Gly Gly Gly Ala Pro Arg 1 5 10 2480DNAArtificial
SequenceSynthetic 24caggatgccc caccgcttcc cgtgccaggg gtgcttctga
aggagttcac tgtgtccggc 60aacatactga ctatcgactc 802560DNAArtificial
SequenceSynthetic 25agaccaccgc caactgcagc tctccatcag ctcctgtctc
cagcagcttt ccctgttgat 602660DNAArtificial SequenceSynthetic
26tggatcacgc agtgctttct gcccgtgttt ttggctcagc ctccctcagg gcagaggcgc
6027211DNAArtificial SequenceSynthetic 27caggatgccc caccgcttcc
cgtgccaggg gtgcttctga aggagttcac tgtgtccggc 60aacatactga ctatccgact
cactgctgca gaccaccgcc aactgcagct ctccatcagc 120tcctgtctcc
agcagctttc cctgttgatg tggatcacgc agtgctttct gcccgtgttt
180ttggctcagc ctccctcagg gcagaggcgc t 2112818DNAArtificial
SequenceSynthetic 28aaggagttca ctgtctcc 182917PRTArtificial
SequenceSynthetic 29Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser Cys
Leu Gln Gln Leu 1 5 10 15 Ser 3014PRTArtificial SequenceSynthetic
30Asp His Arg Gln Leu Gln Leu Ser Ile Ser Ser Cys Leu Gln 1 5 10
3113PRTArtificial SequenceSynthetic 31Gln Leu Gln Leu Ser Ile Ser
Ser Cys Leu Gln Gln Leu 1 5 10 3217PRTArtificial SequenceSynthetic
32Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln Arg 1
5 10 15 Arg 3314PRTArtificial SequenceSynthetic 33Leu Pro Val Phe
Leu Ala Gln Pro Pro Ser Gly Gln Arg Arg 1 5 10 3414PRTArtificial
SequenceSynthetic 34Cys Phe Leu Pro Val Phe Leu Ala Gln Pro Pro Ser
Gly Gln 1 5 10 3531DNAHomo sapiens 35gctccggaca tatgcaggcc
gaaggccggg g 313630DNAArtificial SequenceSynthetic 36aaggggctcg
aggctgggct tagcgcctct 303720PRTArtificial SequenceSynthetic 37Arg
Gly Pro Glu Ser Arg Leu Leu Glu Phe Tyr Leu Ala Met Pro Phe 1 5 10
15 Ala Thr Pro Met 20 3820PRTArtificial SequenceSynthetic 38Phe Thr
Val Ser Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala Ala Asp 1 5 10 15
His Arg Gln Leu 20 3920PRTArtificial SequenceSynthetic 39Asn Ile
Leu Thr Ile Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln 1 5 10 15
Leu Ser Ile Ser 20 4020PRTArtificial SequenceSynthetic 40Leu Ser
Leu Leu Met Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu 1 5 10 15
Ala Gln Pro Pro 20 4120PRTArtificial SequenceSynthetic 41Gln Leu
Ser Ile Ser Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp 1 5 10 15
Ile Thr Gln Cys 20 4220PRTArtificial SequenceSynthetic 42Gln Asp
Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe 1 5 10 15
Thr Val Ser Gly 20 4320PRTArtificial SequenceSynthetic 43Tyr Leu
Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu Leu Ala Arg 1 5 10 15
Arg Ser Leu Ala 20 4415PRTArtificial SequenceSynthetic 44Ala Pro
Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr 1 5 10 15
4514PRTArtificial SequenceSynthetic 45Ala Pro Pro Leu Pro Val Pro
Gly Val Leu Leu Lys Glu Phe 1 5 10 4613PRTArtificial
SequenceSynthetic 46Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu Lys
Glu 1 5 10 4712PRTArtificial SequenceSynthetic 47Ala Pro Pro Leu
Pro Val Pro Gly Val Leu Leu Lys 1 5 10 4811PRTArtificial
SequenceSynthetic 48Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu 1 5
10 4917PRTArtificial SequenceSynthetic 49Pro Pro Leu Pro Val Pro
Gly Val Leu Leu Lys Glu Phe Thr Val Ser 1 5 10 15 Gly
5016PRTArtificial SequenceSynthetic 50Pro Ile Pro Val Pro Gly Val
Leu Leu Lys Glu Phe Thr Val Ser Gly 1 5 10 15 519PRTArtificial
SequenceSyntheticMISC_FEATURE(1)..(1)Xaa is variable or Trp, Phe,
Tyr, Met, Ile, Val, or Ala or a combination
thereof.MISC_FEATURE(5)..(5)Xaa is variable or Cys, Ser, Val, Ala,
or Thr or a combination thereof.MISC_FEATURE(7)..(7)Xaa is variable
or Leu, Phe, Tyr, Met, Ile, Val, or Ala or a combination
thereof.MISC_FEATURE(9)..(9)Xaa is variable or Val, Tyr, Ile, Ala,
Leu, or Pro or a combination thereof. 51Xaa Ile Thr Gln Xaa Phe Xaa
Pro Xaa 1 5 5212PRTArtificial
SequenceSyntheticMISC_FEATURE(1)..(1)Xaa is no amino acid or
variable amino acids.MISC_FEATURE(12)..(12)Xaa is no amino acid or
variable amino acids. 52Xaa Trp Ile Thr Gln Cys Phe Leu Pro Val Phe
Xaa 1 5 10 5327PRTArtificial SequenceSynthetic 53Ser Cys Leu Gln
Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe 1 5 10 15 Leu Pro
Val Phe Leu Ala Gln Pro Pro Ser Gly 20 25 5414PRTArtificial
SequenceSynthetic 54Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu Pro
Val Phe 1 5 10 5514PRTArtificial SequenceSynthetic 55Leu Leu Met
Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu 1 5 10
5614PRTArtificial SequenceSynthetic 56Leu Met Trp Ile Thr Trp Cys
Phe Leu Pro Val Phe Leu Ala 1 5 10 5714PRTArtificial
SequenceSynthetic 57Met Trp Ile Thr Gln Cys Phe Leu Pro Val Phe Leu
Ala Gln 1 5 10 5814PRTArtificial SequenceSynthetic 58Trp Ile Thr
Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro 1 5 10
5914PRTArtificial SequenceSynthetic 59Ile Thr Gln Cys Phe Leu Pro
Val Phe Leu Ala Gln Pro Pro 1 5 10 6014PRTArtificial
SequenceSynthetic 60Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys
Phe Leu 1 5 10 6114PRTArtificial SequenceSynthetic 61Gln Leu Ser
Leu Leu Met Trp Ile Thr Gln Cys Phe Leu Pro 1 5 10
6214PRTArtificial SequenceSynthetic 62Leu Ser Leu Leu Met Trp Ile
Thr Gln Cys Phe Leu Pro Val 1 5 10 6314PRTArtificial
SequenceSynthetic 63Arg Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu
Pro Val 1 5 10 6414PRTArtificial SequenceSynthetic 64Ser Leu Leu
Met Trp Ile Thr Gln Cys Phe Leu Pro Val Arg 1 5 10
6518PRTArtificial SequenceSynthetic 65Val Leu Leu Lys Glu Phe Thr
Val Ser Gly Asn Ile Leu Thr Ile Arg 1 5 10 15 Leu Thr
6618PRTArtificial SequenceSynthetic 66Ala Ala Asp His Arg Gln Leu
Gln Leu Ser Ile Ser Ser Cys Leu Gln 1 5 10 15 Gln Leu
6714PRTArtificial SequenceSynthetic 67Thr Gln Cys Phe Leu Pro Val
Phe Leu Ala Gln Pro Pro Ser 1 5 10 6814PRTArtificial
SequenceSynthetic 68Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro Pro
Ser Gly 1 5 10 6914PRTArtificial SequenceSynthetic 69Leu Gln Gln
Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe 1 5 10
7014PRTArtificial SequenceSynthetic 70Cys Leu Gln Gln Leu Ser Leu
Leu Met Trp Ile Thr Gln Cys 1 5 10 7114PRTArtificial
SequenceSynthetic 71Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile
Thr Gln 1 5 10 7213PRTArtificial SequenceSynthetic 72Ser Cys Leu
Gln Gln Leu Ser Leu Leu Met Trp Ile Thr 1 5 10 7332DNAArtificial
SequenceSynthetic 73cattgctagc atgcaggccg aaggccgggg ca
327438DNAArtificial SequenceSynthetic 74aaggctacat tgcggccgct
tagcgcctct gccctgag 387522DNAArtificial SequenceSynthetic
75atgcgccctg aacacagaat gt 227626DNAArtificial SequenceSynthetic
76tcacagggtc ccctgggccc ggggga 267722DNAArtificial
SequenceSynthetic 77atgatggttc tgcaggtttc tg 227825DNAArtificial
SequenceSynthetic 78ttatgcagat cctcgttgaa ctttc 257911PRTArtificial
SequenceSynthetic 79Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu 1 5
10 8010PRTArtificial SequenceSynthetic 80Trp Ile Thr Gln Cys Phe
Leu Pro Val Phe 1 5 10 8116PRTArtificialSynthetic 81Pro Leu Pro Val
Pro Gly Val Leu Leu Lys Glu Phe Thr Val Ser Gly 1 5 10 15
8214PRTArtificialSynthetic 82Thr Gln Cys Phe Leu Pro Val Phe Leu
Ala Gln Pro Pro Ser 1 5 10 8314PRTArtificialSynthetic 83Gln Cys Phe
Leu Pro Val Phe Leu Ala Gln Pro Pro Ser Gly 1 5 10
8414PRTArtificialSynthetic 84Gln Gln Leu Ser Leu Leu Met Trp Ile
Thr Gln Cys Phe Leu 1 5 10 8514PRTArtificialSynthetic 85Leu Gln Gln
Leu Ser Leu Leu Met Trp Ile Thr Gln Cys Phe 1 5 10
8614PRTArtificialSynthetic 86Cys Leu Gln Gln Leu Ser Leu Leu Met
Trp Ile Thr Gln Cys 1 5 10 8714PRTArtificialSynthetic 87Ser Cys Leu
Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln 1 5 10
8813PRTArtificialSynthetic 88Ser Cys Leu Gln Gln Leu Ser Leu Leu
Met Trp Ile Thr 1 5 10
* * * * *