Transformed Synechococcus elongatus strain having capability of producing squalene from carbon dioxide and method for producing squalene using the same

Abstract

The present specification discloses a transformed Synechococcus elongatus strain which may directly produce squalene from carbon dioxide, and a method for producing squalene and a method for removing carbon dioxide, using the same. In an aspect, the strain may produce squalene using carbon dioxide as a carbon source. The Synechococcus elongatus strain is economically efficient because a high-value added squalene is produced using light and carbon dioxide present in the atmosphere as a carbon source, and the method for producing squalene is eco-friendly because the strain may be utilized to remove or reduce carbon dioxide in the atmosphere by using microorganisms. The strain of the present disclosure may produce only squalene, which is a desired target material with high purity, and has an advantage in that squalene may be continuously mass-produced.

Description

CROSS-REFERENCE TO RELATED APPLICATION

This application claims priority to Korean Patent Application No. 10-2016-0041774, filed on Apr. 5, 2016, and all the benefits accruing therefrom under 35 U.S.C. .sctn. 119, the contents of which in its entirety are herein incorporated by reference.

BACKGROUND

1. Field

The present specification discloses a transformed Synechococcus elongatus strain which may mass-produce squalene from carbon dioxide, and a method for producing squalene and a method for removing carbon dioxide, using the same.

DESCRIPTION ABOUT NATIONAL SUPPORT RESEARCH AND DEVELOPMENT

This study is made by the support of KOREA CCS 2020 business of the Korean Ministry of Science, ICT and Future Planning under the supervision of the Korea Institute of Science and Technology, and the subject name thereof is Development of original technology of using recombinant cyanobacteria for continuous direct production of biodiesel (Subject Identification No.: 2015030270).

2. Description of the Related Art

Squalene is a triterpenoid-based unsaturated hydrocarbon in which 30 carbon atoms and 50 hydrogen atoms are linked by 6 double bonds, and is usually contained in the human body and animal and vegetable fats and oils. Squalene has been used for various uses in the industries, such as an acid-fast functional supplement food, a cosmetic raw material, a vaccine support raw material, and a feed raw material. According to a report (Global Trends & Forecasts to 2019), the market of squalene is expected to grow to 177.06 million dollars, the average annual growth rate of the market is 10.3%, and the market tends to grow every year. Squalene has been generally obtained by extraction from the liver of deep-water sharks, but this method is against animal protection policies, and squalene may be also extracted from vegetables, but the method for extracting squalene from vegetables is inefficient because wide lands are required for cultivation. Recently, starting from yeast strains, various attempts such as a method for producing squalene from microalgae, and the like have been continued, and methods using yeast need a lot of sugars during the production process, and thus are economically inefficient, and when microalgae are used, the limitation thereof is clear because other impurities in addition to squalene, which is a desired target material, are produced. Therefore, there is a need for studies on a method which may economically and stably mass-produce squalene.

SUMMARY

In an aspect, an object of the present disclosure is to produce squalene by an eco-friendly method using microorganisms.

In another aspect, an object of the present disclosure is to provide a Synechococcus elongatus strain having a capability of producing squalene.

In still another aspect, an object of the present disclosure is to continuously mass-produce squalene using the Synechococcus elongatus strain.

In yet another aspect, an object of the present disclosure is to produce squalene using carbon dioxide to be discarded as a carbon source.

In an exemplary embodiment, the present disclosure provides a Synechococcus elongatus strain including: a gene encoding an enzyme producing 1-deoxy-D-xylulose 5-phosphate from pyruvate and D-glyceraldehyde 3-phosphate; a gene encoding an enzyme producing dimethylallyl diphosphate from isopentenyl diphosphate; a gene encoding an enzyme producing dimethylallyl diphosphate from isopentenyl diphosphate; a gene encoding an enzyme producing farnesyl diphosphate from dimethylallyl diphosphate; and a gene encoding an enzyme producing squalene from farnesyl diphosphate.

In another exemplary embodiment, the present disclosure provides a method for preparing squalene, the method including: culturing the strain.

In another exemplary embodiment, the present disclosure provides a method for removing carbon dioxide, the method including: culturing the strain.

In an aspect of the present disclosure, a transformed Synechococcus elongatus strain may mass-produce squalene using carbon dioxide as a carbon source. The Synechococcus elongatus strain is economically efficient because a high-value added squalene is produced using light and carbon dioxide present in the atmosphere as a carbon source, and the method for producing squalene is eco-friendly because the strain may be utilized to remove or reduce carbon dioxide in the atmosphere by using microorganisms. The strain of the present disclosure may produce only squalene, which is a desired target material with high purity, and has an advantage in that squalene may be continuously mass-produced.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a view illustrating a production pathway for a transformed Synechococcus elongatus strain (CDP-ME is an acronym for 4-diphosphocytidyl-2-C-methyl-D-erythritol, CDP-MEP is an acronym for 4-diphosphocytidyl-2-C-methyl-D-erythritol-2-phosphate, ME-cPP is an acronym for 2-C-Methyl-D-erythritol-2,4-cyclopyrophosphate, and HMBPP is an acronym for 4-hydroxy-3-methyl-but-2-enyl pyrophosphate).

FIG. 2a is a schematic view of a first vector according to an exemplary embodiment.

FIG. 2b is a schematic view of a second vector according to an exemplary embodiment.

FIG. 3 is a view illustrating the growth of a wide-type strain and a transformed strain.

FIG. 4a is a view illustrating a gas chromatography result confirming that a material produced by the transformed strain is squalene.

FIG. 4b is a photograph confirming squalene produced by the transformed strain by the unaided eye.

FIG. 5 is a view illustrating a result confirming that the transformed strain has a capability of producing squalene.

In FIGS. 3 and 5, WT means a wild-type strain, SeSC33S means a mutant strain of a Synechococcus elongatus strain, in which a pSe1Bb1s-dxs-idi-ispA vector at an NSI site and a pSe2Bb1k-sqs vector (including a squalene synthase gene derived from Saccharomyces cerevisiae) at an NSII site are transformed, and SeSC34S means a mutant strain of a Synechococcus elongatus strain, which is transformed with a pSe1Bb1s-dxs-idi-ispA vector at an NSI site and a pSe2Bb1k-sqs vector (including a squalene synthase gene derived from Methylococcus capsulatus) at an NSII site. Further, SeSC41S means a mutant strain of a Synechococcus elongatus strain, which is transformed with a pSe1Bb1s-dxs-dxr-idi-ispA vector at an NSI site and a pSe2Bb1k-sqs vector (including a squalene synthase gene derived from Saccharomyces cerevisiae) at an NSII site, and SeSC42S means a mutant strain of a Synechococcus elongatus strain, in which a pSe1Bb1s-dxs-dxr-idi-ispA vector at an NSI site and a pSe2Bb1k-sqs vector (including a squalene synthase gene derived from Methylococcus capsulatus) at an NSII site are transformed.

DETAILED DESCRIPTION

Cyanobacteria are microorganisms which may produce energy through photosynthesis and fix carbon dioxide to produce metabolites. Cyanobacteria being prokaryotes are easy to be genetically modified compared to microalgae being eukaryotes, and thus are advantageous for altering metabolic pathways or artificially regulating metabolites. Recently, various biofuel substitutes or chemical products have been produced by introducing a synthetic biological/metabolic engineering technique based on the genetic modification technology to use metabolic pathways that have not existed.

The present inventors genetically modified a Synechococcus elongatus strain, one of cyanobacteria, thereby constructing a new mutant strain which may directly produce a squalene material from carbon dioxide.

Hereinafter, the present disclosure will be described in detail.

In an aspect, the present disclosure is a Synechococcus elongatus strain including: a gene encoding an enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P);

a gene encoding an enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); a gene encoding an enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP); and a gene encoding an enzyme producing squalene from farnesyl diphosphate (FPP).

The gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) may be a deoxyxylulose-5-phosphate synthase. Further, the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) may be an isopentenyl diphosphate delta isomerase. In addition, the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) may be a geranyl diphosphate synthase, and the enzyme producing squalene from farnesyl diphosphate (FPP) may be a squalene synthase.

The strain may mass-produce farnesyl diphosphate (FPP) which is a precursor of squalene, and thus may mass-produce squalene therefrom. The strain may synthesize squalene from two molecules of farnesyl diphosphate.

For example, the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) may be derived from E. coli. Furthermore, the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) may be derived from E. coli, and the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) may also be derived from E. coli. Meanwhile, the gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP) may be derived from Saccharomyces cerevisiae or may be derived from Methylococcus capsulatus.

In an exemplary embodiment, the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) may include a sequence of SEQ ID NO. 1.

Further, the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) may include a sequence of SEQ ID NO. 2. In addition, in an exemplary embodiment, the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) may include a sequence of SEQ ID NO. 3.

In an exemplary embodiment, the gene encoding an enzyme producing squalene from farnesyl diphosphate (FPP) may include a sequence of SEQ ID NO. 4 or 5. The sequence of SEQ ID NO. 4 includes a squalene synthase gene derived from Saccharomyces cerevisiae, and the sequence of SEQ ID NO. 5 includes a squalene synthase gene derived from Methylococcus capsulatus.

In an exemplary embodiment, the strain may further include a gene encoding an enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP). The gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) may be derived from E. coli. The gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) may be a 1-deoxy-D-xylulose-5-phosphate reductase. Meanwhile, in an exemplary embodiment, the gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) may include a sequence of SEQ ID NO. 6.

In the present specification, the gene encoding an enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) is referred to as `dxs gene`. Furthermore, in the present specification, the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) is referred to as `idi gene`, the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) is referred to as `ispA gene`, the gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP) is referred to as `sqs gene`, and the gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) is also referred to as `dxr gene`.

In an exemplary embodiment, the strain may be transformed with a first vector and/or a second vector. The expression `the first or the second` is used only to differentiate the type of vector, and does not limit the order or method of transformation.

The first vector may include: the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P);

the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); and the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP). The first vector may include a sequence of SEQ ID NO. 7.

Further, the first vector further include the gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP). The first vector may include a sequence of SEQ ID NO. 8.

In an exemplary embodiment, the strain may be transformed with only the first vector, and in this case, the strain mass-produces farnesyl diphosphate (FPP) which is a precursor of squalene, and thus may separately produce squalene by using the same.

In an exemplary embodiment, the second vector may include the gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP). The second vector may include a sequence of SEQ ID NO. 9 or 10. A second vector including the sequence of SEQ ID NO. 9 includes a squalene synthase gene derived from Saccharomyces cerevisiae, and a second including the sequence of SEQ ID NO. 10 includes a squalene synthase gene derived from Methylococcus capsulatus.

The first vector may be inserted into a neutral site I (NSI) of Synechococcus elongatus which is a parent strain.

In addition, the second vector may be inserted into a neutral site II (NSII) of Synechococcus elongatus which is a parent strain.

The first vector may sequentially include: a spectinomycin-resistant gene as selection marker; a lacI repressor; a trc promoter; and a target gene. The target gene may be the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P); the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); and the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP). The first vector may include a sequence of SEQ ID NO. 7.

Furthermore, the first vector may further include the gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) as the target gene. The first vector further including the gene encoding the enzyme producing 2-C-methyl-D-erythritol-4-phosphate (MEP) from 1-deoxy-D-xylulose 5-phosphate (DXP) may include a sequence of SEQ ID NO. 8.

The target genes to be inserted into the first vector may be each derived from E. coli.

In the present specification, the target gene may mean a gene which is expressed in a strain and inserted into a vector so as to exhibit the function of the corresponding gene.

The second vector may sequentially include: a kanamycin-resistant gene as selection marker;

a lacI repressor; a trc promoter; and a target gene. The target gene may be a gene encoding an enzyme producing squalene from farnesyl diphosphate (FPP). The gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP) may be derived from Saccharomyces cerevisiae or Methylococcus capsulatus. The second vector may include a sequence of SEQ ID NO. 9 or 10.

The target genes to be inserted into the first vector and the second vector may be located between the BglII site and the BamHI site, which are restriction enzyme sites.

In the vector disclosed in the present specification, all the genes are linked operably to each other. The term "operably" means that the target genes may be expressed normally.

The strain may be a strain in which the first vector and/or the second vector are/is transformed with Synechococcus elongatus PCC7942 (Accession number: ATCC 33912), which is a parent strain. Into the parent strain, only the first vector may be introduced, and both the first vector and the second vector may also be introduced.

The strain may be a strain belonging to accession number KCTC 12966BP. The accession number KCTC 12966BP strain may mean a strain of a Synechococcus elongatus strain, in which a pSe1Bb1s-dxs-idi-ispA vector at an NSI site and a pSe2Bb1k-sqs vector (including a squalene synthase gene derived from Saccharomyces cerevisiae) at an NSII site are transformed.

In another aspect, the present disclosure is a method for producing squalene, the method including: culturing the transformed Synechococcus elongatus strain.

The culturing may be performed under conditions of 0.1% to 10% CO.sub.2 and a temperature of 10.degree. C. to 40.degree. C. For example, the strain may be cultured under conditions of a 5% CO.sub.2 concentration and 30.degree. C.

Further, In another aspect, the present disclosure is a method for removing carbon dioxide, the method including: culturing the transformed Synechococcus elongatus strain.

EXAMPLES

Hereinafter, the present disclosure will be described in more detail through the Examples. However, the following Examples are provided only for illustrative purposes to facilitate the understanding of the present disclosure, and the purview and scope of the present disclosure is not limited thereto.

Example 1

Referring to a prior paper (Kim, S. W., Keasling, J. D., 2001. Metabolic engineering of the nonmevalonate isopentenyl diphosphate synthesis pathway in Escherichia coli enhances lycopene production. Biotechnol. Bioeng. 72, 408-415), a methylerythritol phosphate pathway (MEP pathway) and a metabolic pathway from pyruvic acid and D-glyceraldehyde 3-phosphate to farnesyl diphosphate were newly created. The DNA sequences of dxs gene, dxr gene, idi gene, and ispA gene of E. coli was subjected to codon optimization, and then the sequences were custom synthesized and constructed from Genescript.RTM..

Example 2 Construction of Four Squalene-Producing Strains Using SyneBrick Vectors pSe1Bb1s-GFP Vector and pSe2Bb1k-GFP Vector

A first vector was constructed by using a pSe1Bb1s-GFP vector. The pSe1Bb1s-GFP vector was constructed by using a pBbE1c-RFP vector (Lee T S, Krupa R A, Zhang F, Hajimorad M, Holtz W J, Prasad N, Lee S K, Keasling J D (2011b) BglBrick vectors and datasheets: a synthetic biology platform for gene expression. J Biol Eng 5:12) and a pSeBb1k-GFP vector (Lee T S, Krupa R A, Zhang F, Hajimorad M, Holtz W J, Prasad N, Lee S K, Keasling J D (2011b) BglBrick vectors and datasheets: a synthetic biology platform for gene expression. J Biol Eng 5:12).

The GFP portion of the SyneBrick vector pSe1Bb1s-GFP was removed by using the EcoRI-BglII restriction enzyme, and then a DNA sequence of the ispA gene treated with the custom synthesized EcoRI-BamHI restriction enzyme was inserted into the site. The pSe1Bb1s-ispA vector thus completed was treated with the EcoRI-BglII restriction enzyme, and then a DNA sequence of the idi gene treated with the EcoRI-BamHI restriction enzyme was inserted thereinto. In the same manner, the dxs gene or the dxs gene-dxr gene was sequentially inserted thereinto, thereby finally constructing `pSe1Bb1s-dxs gene-idi gene-ispA gene` and `pSe1Bb1s-dxs gene-dxr gene-idi gene-ispA gene` vectors (FIG. 2a). The completed vector was inserted into the Neutral Site-I of a wide-type S. elongatus PCC7942 strain. A transformed S. elongatus PCC7942 strain, in which the intermediate flow of the MEP metabolic pathway was increased, was constructed. Transformation was confirmed through PCR (5'.fwdarw.3' Primer Sequence: Forward: CCAGCAGCGGCTGCCTGCCCAAAAG (SEQ ID NO. 11))/Reverse: GAAAGCGTGACGAGCAGGGA (SEQ ID NO. 12). Meanwhile, the second vector was constructed by using pSe2Bb1k-GFP. Referring to the document information, the GFP portion of the SyneBrick vector pSe2Bb1k-GFP was removed by using the EcoRI-BamHI restriction enzyme, and then a custom synthesized DNA sequence of a squalene synthase gene of Methylococcus capsulatus or Saccharomyces cerevisiae was inserted thereinto. The completed pSe2Bb1k-sqs gene vector (FIG. 2b) was inserted into the Neutral Site-II of the transformed S. elongatus PCC7942 strain described above, in which the intermediate flow of the MEP metabolic pathway was increased. Transformation was confirmed through PCR (5'.fwdarw.3' Primer Sequence: Forward: GGCTACGGTTCGTAATGCCA (SEQ ID NO. 13))/Reverse: GAGATCAGGGCTGTACTTAC (SEQ ID NO. 14).

Example 3 Confirmation of Transformed Strain's Capability of Producing Squalene

The transformed strains prepared in Example 2 were cultured for a predetermined time to test whether squalene was produced from 5% carbon dioxide which was directly supplied. As a specific culturing condition, 100 ml of a BG-11 medium including a 10 mM MOPS buffer was put into a 100 ml-bottle, the constructed squalene producing strain was diluted at an O.D of 0.6 when initially cultured, and the diluted solution was put into the medium. Further, 10 ug/ml of a spectinomycin antibiotic and 5 ug/ml of kanamycin were put into the medium, and then the resulting medium was cultured under conditions continuously supplying 100 uE m-2 s-1 and 5% CO.sub.2 at 30.degree. C. in a stationary incubator. An inducer 1 mM IPTG required for expression of genes was put into the medium 1 day after the initiation of culturing, the optical density of cells was measured at a wavelength of 730 nm until 8 days after culturing, and the amount of squalene produced was also measured during the culturing for 8 days.

The growth curves of four transformed strains and the wild-type strain are as illustrated in FIG. 3. Further, through a gas chromatography analysis method, it was confirmed that the material produced from the strain was squalene (FIGS. 4a and 4b). The transformed strain into which `pSe1Bb1k-dxs gene-dxr gene-idi gene-ispA gene` was inserted produced up to 0.41 to 0.12 mg/L/OD730 of squalene for the culture time. Moreover, the strain into which the pSe1Bb1k-dxs gene-idi gene-ispA gene was inserted produced up to 4.98 to 1.36 mg/L/OD730 of squalene for the culture time (FIG. 5).

ACCESSION NUMBER

Depositary Institution: Korea Research Institute of Bioscience & Biotechnology

Accession number: KCTC12966BP

Commissioned date: 2015 Dec. 18

SEQUENCE LISTINGS

1

1411863DNAArtificial Sequencedxs gene 1atgagctttg atatcgccaa ataccccacc ctggccctgg tggatagcac ccaggaactg 60cgcctgctgc ccaaagaaag cctgcccaaa ctgtgcgatg aactgcgccg ctacctgctg 120gatagcgtga gccgcagcag cggccacttt gccagcggcc tgggcaccgt ggaactgacc 180gtggccctgc actacgtgta caacaccccc tttgatcagc tgatctggga tgtgggccac 240caggcctacc cccacaaaat cctgaccggc cgccgcgata aaatcggcac catccgccag 300aaaggcggcc tgcacccctt tccctggcgc ggcgaaagcg aatacgatgt gctgagcgtg 360ggccacagca gcaccagcat cagcgccggc atcggcatcg ccgtggccgc cgaaaaagaa 420ggcaaaaacc gccgcaccgt gtgcgtgatc ggcgatggcg ccatcaccgc cggcatggcc 480tttgaagcca tgaaccacgc cggcgatatc cgccccgata tgctggtgat cctgaacgat 540aacgaaatga gcatcagcga aaacgtgggc gccctgaaca accacctggc ccagctgctg 600agcggcaaac tgtacagcag cctgcgcgaa ggcggcaaaa aagtgtttag cggcgtgccc 660cccatcaaag aactgctgaa acgcaccgaa gaacacatca aaggcatggt ggtgcccggc 720accctgtttg aagaactggg ctttaactac atcggccccg tggatggcca cgatgtgctg 780ggcctgatca ccaccctgaa aaacatgcgc gatctgaaag gcccccagtt cctgcatatc 840atgaccaaaa aaggccgcgg ctacgaaccc gccgaaaaag atcccatcac ctttcacgcc 900gtgcccaaat ttgatcccag cagcggctgc ctgcccaaaa gcagcggcgg cctgcccagc 960tacagcaaaa tctttggcga ttggctgtgc gaaaccgccg ccaaagataa caaactgatg 1020gccatcaccc ccgccatgcg cgaaggcagc ggcatggtgg aatttagccg caaatttccc 1080gatcgctact ttgatgtggc catcgccgaa cagcacgccg tgacctttgc cgccggcctg 1140gccatcggcg gctacaaacc catcgtggcc atctacagca cctttctgca gcgcgcctac 1200gatcaggtgc tgcacgatgt ggccatccag aaactgcccg tgctgtttgc catcgatcgc 1260gccggcatcg tgggcgccga tggccagacc caccagggcg cctttgatct gagctacctg 1320cgctgcatcc ccgaaatggt gatcatgacc cccagcgatg aaaacgaatg ccgccagatg 1380ctgtacaccg gctaccacta caacgatggc cccagcgccg tgcgctaccc ccgcggcaac 1440gccgtgggcg tggaactgac ccccctggaa aaactgccca tcggcaaagg catcgtgaaa 1500cgccgcggcg aaaaactggc catcctgaac tttggcaccc tgatgcccga agccgccaaa 1560gtggccgaaa gcctgaacgc caccctggtg gatatgcgct ttgtgaaacc cctggatgaa 1620gccctgatcc tggaaatggc cgccagccac gaagccctgg tgaccgtgga agaaaacgcc 1680atcatgggcg gcgccggcag cggcgtgaac gaagtgctga tggcccaccg caaacccgtg 1740cccgtgctga acatcggcct gcccgatttt tttatccccc agggcaccca ggaagaaatg 1800cgcgccgaac tgggcctgga tgccgccggc atggaagcca aaatcaaagc ctggctggcc 1860tag 18632549DNAArtificial Sequenceidi gene 2atgcagaccg aacacgtgat cctgctgaac gcccagggcg tgcccaccgg caccctggaa 60aaatacgccg cccacaccgc cgatacccgc ctgcacctgg cctttagcag ctggctgttt 120aacgccaaag gccagctgct ggtgacccgc cgcgccctga gcaaaaaagc ctggcccggc 180gtgtggacca acagcgtgtg cggccacccc cagctgggcg aaagcaacga agatgccgtg 240atccgccgct gccgctacga actgggcgtg gaaatcaccc cccccgaaag catctacccc 300gattttcgct accgcgccac cgatcccagc ggcatcgtgg aaaacgaagt gtgccccgtg 360tttgccgccc gcaccaccag cgccctgcag atcaacgatg atgaagtgat ggattaccag 420tggtgcgatc tggccgatgt gctgcacggc atcgatgcca ccccctgggc ctttagcccc 480tggatggtga tgcaggccac caaccgcgaa gcccgcaaac gcctgagcgc ctttacccag 540ctgaaatag 5493900DNAArtificial SequenceispA gene 3atggattttc cccagcagct ggaagcctgc gtgaaacagg ccaaccaggc cctgagccgc 60tttatcgccc ccctgccctt tcagaacacc cccgtggtgg aaaccatgca gtacggcgcc 120ctgctgggcg gcaaacgcct gcgccccttt ctggtgtacg ccaccggcca catgtttggc 180gtgagcacca acaccctgga tgcccccgcc gccgccgtgg aatgcatcca cgcctacagc 240ctgatccacg atgatctgcc cgccatggat gatgatgatc tgcgccgcgg cctgcccacc 300tgccacgtga aatttggcga agccaacgcc atcctggccg gcgatgccct gcagaccctg 360gcctttagca tcctgagcga tgccgatatg cccgaagtga gcgatcgcga tcgcatcagc 420atgatcagcg aactggccag cgccagcggc atcgccggca tgtgcggcgg ccaggccctg 480gatctggatg ccgaaggcaa acacgtgccc ctggatgccc tggaacgcat ccaccgccac 540aaaaccggcg ccctgatccg cgccgccgtg cgcctgggcg ccctgagcgc cggcgataaa 600ggccgccgcg ccctgcccgt gctggataaa tacgccgaaa gcatcggcct ggcctttcag 660gtgcaggatg atatcctgga tgtggtgggc gataccgcca ccctgggcaa acgccagggc 720gccgatcagc agctgggcaa aagcacctac cccgccctgc tgggcctgga acaggcccgc 780aaaaaagccc gcgatctgat cgatgatgcc cgccagagcc tgaaacagct ggccgaacag 840agcctggata ccagcgccct ggaagccctg gccgattaca tcatccagcg caacaaatag 90041263DNAArtificial Sequencesqs gene derived from Saccharomyces cerevisiae 4atgggcaaac tgctgcagct ggccctgcac cccgtggaaa tgaaagccgc cctgaaactg 60aaattttgcc gcacccccct gtttagcatc tacgatcaga gcaccagccc ctacctgctg 120cactgctttg aactgctgaa cctgaccagc cgcagctttg ccgccgtgat ccgcgaactg 180caccccgaac tgcgcaactg cgtgaccctg ttttacctga tcctgcgcgc cctggatacc 240atcgaagatg atatgagcat cgaacacgat ctgaaaatcg atctgctgcg ccactttcac 300gaaaaactgc tgctgaccaa atggagcttt gatggcaacg cccccgatgt gaaagatcgc 360gccgtgctga ccgattttga aagcatcctg atcgaatttc acaaactgaa acccgaatac 420caggaagtga tcaaagaaat caccgaaaaa atgggcaacg gcatggccga ttacatcctg 480gatgaaaact acaacctgaa cggcctgcag accgtgcacg attacgatgt gtactgccac 540tacgtggccg gcctggtggg cgatggcctg acccgcctga tcgtgatcgc caaatttgcc 600aacgaaagcc tgtacagcaa cgaacagctg tacgaaagca tgggcctgtt tctgcagaaa 660accaacatca tccgcgatta caacgaggat ctggtggatg gccgcagctt ttggcccaaa 720gaaatctgga gccagtacgc cccccagctg aaagatttta tgaaacccga aaacgaacag 780ctgggcctgg attgcatcaa ccacctggtg ctgaacgccc tgagccacgt gatcgatgtg 840ctgacctacc tggccggcat ccacgaacag agcacctttc agttttgcgc catcccccag 900gtgatggcca tcgccaccct ggccctggtg tttaacaacc gcgaagtgct gcacggcaac 960gtgaaaatcc gcaaaggcac cacctgctac ctgatcctga aaagccgcac cctgcgcggc 1020tgcgtggaaa tctttgatta ctacctgcgc gatatcaaaa gcaaactggc cgtgcaagat 1080cccaactttc tgaaactgaa catccagatc agcaaaatcg aacagtttat ggaagaaatg 1140taccaggata aactgccccc caacgtgaaa cccaacgaaa cccccatctt tctgaaagtg 1200aaagaacgca gccgctacga tgatgaactg gtgcccaccc agcaggaaga agaatacaaa 1260tag 126351089DNAArtificial Sequencesqs gene derived from Methylococcus capsulatus 5atgagcggca ccccccccag ccagcccgcc cgccacgaac acctgagcga tgatgaattt 60caggcccact ttctggatgg cgtgagccgc acctttgccc tgaccatccc ccgcctgccc 120gaaggcctgg cccgccccgt gagcaacggc tacctgctgt gccgcatcgt ggataccatc 180gaagatgaag tggccctgac cagcacccag aaacgccgct actgcgaaca ctttgcccgc 240gtggtggccg gcaccgcccc cgccgccccc ctggccgatg aactgtttcc cctgctgagc 300gatcagaccc tggccgccga acgcgaactg atcgccgcca tcccccgcgt gatcagcatc 360acccacggct ttgccgcccc ccagcaggaa gccctggccg aatgcgtggc caccatgagc 420cgcggcatgg ccgaatttca ggataaggat ctgcgccacg gcctggagga tctgcgccag 480atgggcgatt actgctacta cgtggccggc gtggtgggcg aaatgctgac ccgcctgttt 540tgccactaca gccccgaaat cgccgcccac cgcagccgcc tgatggaact ggcctgcccc 600tttggccagg gcctgcagat gaccaacatc ctgaaggatc tgtgggatga tcacgcccgc 660ggcgtgtgct ggctgcccca ggaagtgttt accgaatgcg gctttagcct gaccgaactg 720cgcccccacc acgccaaccc cgattttgtg cgcggctttg aacgcctgat cggcgtggcc 780cacgcccacc tgcgcaacgc cctggaatac accctgctga tcccccgcca cgaaaccggc 840atccgcgaat tttgcctgtg ggccctgggc atggccgtgc tgaccctgcg caaaatccac 900cgccacccct actttagcga tagcgcccag gtgaaaatca cccgccaggc cgtgaaagcc 960accatcgtga ccagccgcct gacccgcggc agcgataccc tgctgaaagc cacctttcgc 1020ctggccggcc tgggcctgcc cgccgccgtg cccgccgccg tgctgcagcc ccgccccatc 1080gatatctag 108961197DNAArtificial Sequencedxr gene 6atgaaacagc tgaccatcct gggcagcacc ggcagcatcg gctgcagcac cctggatgtg 60gtgcgccaca accccgaaca cttccgcgtg gtggccctgg tggccggcaa aaacgtgacc 120cgcatggtgg aacagtgcct ggaatttagc ccccgctacg ccgtgatgga tgatgaagcc 180agcgccaaac tgctgaaaac catgctgcag cagcagggca gccgcaccga agtgctgagc 240ggccagcagg ccgcctgcga tatggccgcc ctggaagatg tggatcaggt gatggccgcc 300atcgtgggcg ccgccggcct gctgcccacc ctggccgcca tccgcgccgg caaaaccatc 360ctgctggcca acaaagaaag cctggtgacc tgcggccgcc tgtttatgga tgccgtgaaa 420cagagcaaag cccagctgct gcccgtggat agcgaacaca acgccatctt tcagagcctg 480ccccagccca tccagcacaa cctgggctac gccgatctgg aacagaacgg cgtggtgagc 540atcctgctga ccggcagcgg cggccccttt cgcgaaaccc ccctgcgcga tctggccacc 600atgacccccg atcaggcctg ccgccacccc aactggagca tgggccgcaa aatcagcgtg 660gatagcgcca ccatgatgaa caaaggcctg gaatacatcg aagcccgctg gctgtttaac 720gccagcgcca gccagatgga agtgctgatc cacccccaga gcgtgatcca cagcatggtg 780cgctaccagg atggcagcgt gctggcccag ctgggcgaac ccgatatgcg cacccccatc 840gcccacacca tggcctggcc caaccgcgtg aacagcggcg tgaaacccct ggatttttgc 900aaactgagcg ccctgacctt tgccgccccc gattacgatc gctacccctg cctgaaactg 960gccatggaag cctttgaaca gggccaggcc gccaccaccg ccctgaacgc cgccaacgaa 1020atcaccgtgg ccgcctttct ggcccagcag atccgcttta ccgatatcgc cgccctgaac 1080ctgagcgtgc tggaaaaaat ggatatgcgc gaaccccagt gcgtggatga tgtgctgagc 1140gtggatgcca acgcccgcga agtggcccgc aaagaagtga tgcgcctggc cagctag 119778790DNAArtificial SequencepSe1Bb1s-dxs-idi-ispA vector 7gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 60gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 120caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 180ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg 240tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 300ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 360tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 420cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 480gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 540ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 600gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 660agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 720tttgctcaca tgtgtgctgg gccccaatgc cttctccaag ggcggcattc ccctgactgt 780tgaaggcgtt gccaatatca agattgctgg ggaagaaccg accatccaca acgcgatcga 840gcggctgctt ggcaaaaacc gtaaggaaat cgagcaaatt gccaaggaga ccctcgaagg 900caacttgcgt ggtgttttag ccagcctcac gccggagcag atcaacgagg acaaaattgc 960ctttgccaaa agtctgctgg aagaggcgga ggatgacctt gagcagctgg gtcaagtcct 1020cgatacgctg caagtccaga acatttccga tgaggtcggt tatctctcgg ctagtggacg 1080caagcagcgg gctgatctgc agcgagatgc ccgaattgct gaagccgatg cccaggctgc 1140ctctgcgatc caaacggccg aaaatgacaa gatcacggcc ctgcgtcgga tcgatcgcga 1200tgtagcgatc gcccaagccg aggccgagcg ccggattcag gatgcgttga cgcggcgcga 1260agcggtggtg gccgaagctg aagcggacat tgctaccgaa gtcgctcgta gccaagcaga 1320actccctgtg cagcaggagc ggatcaaaca ggtgcagcag caacttcaag ccgatgtgat 1380cgccccagct gaggcagctt gtaaacgggc gatcgcggaa gcgcgggggg ccgccgcccg 1440tatcgtcgaa gatggaaaag ctcaagcgga agggacccaa cggctggcgg aggcttggca 1500gaccgctggt gctaatgccc gcgacatctt cctgctccag aagtctagac cagccaggac 1560agaaatgcct cgacttcgct gctacccaag gttgccgggt gacgcacacc gtggaaacgg 1620atgaaggcac gaacccagtg gacataagcc tgttcggttc gtaagctgta atgcaagtag 1680cgtatgcgct cacgcaactg gtccagaacc ttgaccgaac gcagcggtgg taacggcgca 1740gtggcggttt tcatggcttg ttatgactgt ttttttgggg tacagtctat gcctcgggca 1800tccaagcagc aagcgcgtta cgccgtgggt cgatgtttga tgttatggag cagcaacgat 1860gttacgcagc agggcagtcg ccctaaaaca aagttaaaca ttatgaggga agcggtgatc 1920gccgaagtat cgactcaact atcagaggta gttggcgtca tcgagcgcca tctcgaaccg 1980acgttgctgg ccgtacattt gtacggctcc gcagtggatg gcggcctgaa gccacacagt 2040gatattgatt tgctggttac ggtgaccgta aggcttgatg aaacaacgcg gcgagctttg 2100atcaacgacc ttttggaaac ttcggcttcc cctggagaga gcgagattct ccgcgctgta 2160gaagtcacca ttgttgtgca cgacgacatc attccgtggc gttatccagc taagcgcgaa 2220ctgcaatttg gagaatggca gcgcaatgac attcttgctg gtatcttcga gccagccacg 2280atcgacattg atctggctat cttgctgaca aaagcaagag aacatagcgt tgccttggta 2340ggtccagcgg cggaggaact ctttgatccg gttcctgaac aggatctatt tgaggcgcta 2400aatgaaacct taacgctatg gaactcgccg cccgactggg ctggcgatga gcgaaatgta 2460gtgcttacgt tgtcccgcat ttggtacagc gcagtaaccg gcaaaatcgc gccgaaggat 2520gtcgctgccg actgggcaat ggagcgcctg ccggcccagt atcagcccgt catacttgaa 2580gctagacagg cttatcttgg acaagaagaa gatcgcttgg cctcgcgcgc agatcagttg 2640gaagaatttg tccactacgt gaaaggcgag atcaccaagg tagtcggcaa ataacctcat 2700tttcgccaga tatcgacgtc gacaccatcg aatggtgcaa aacctttcgc ggtatggcat 2760gatagcgccc ggaagagagt caattcaggg tggtgaatgt gaaaccagta acgttatacg 2820atgtcgcaga gtatgccggt gtctcttatc agaccgtttc ccgcgtggtg aaccaggcca 2880gccacgtttc tgcgaaaacg cgggaaaaag tggaagcggc gatggcggag ctgaattaca 2940ttcccaaccg cgtggcacaa caactggcgg gcaaacagtc gttgctgatt ggcgttgcca 3000cctccagtct ggccctgcac gcgccgtcgc aaattgtcgc ggcgattaaa tctcgcgccg 3060atcaactggg tgccagcgtg gtggtgtcga tggtagaacg aagcggcgtc gaagcctgta 3120aagcggcggt gcacaatctt ctcgcgcaac gcgtcagtgg gctgatcatt aactatccgc 3180tggatgacca ggatgccatt gctgtggaag ctgcctgcac taatgttccg gcgttatttc 3240ttgatgtctc tgaccagaca cccatcaaca gtattatttt ctcccatgaa gacggtacgc 3300gactgggcgt ggagcatctg gtcgcattgg gtcaccagca aatcgcgctg ttagcgggcc 3360cattaagttc tgtctcggcg cgtctgcgtc tggctggctg gcataaatat ctcactcgca 3420atcaaattca gccgatagcg gaacgggaag gcgactggag tgccatgtcc ggttttcaac 3480aaaccatgca aatgctgaat gagggcatcg ttcccactgc gatgctggtt gccaacgatc 3540agatggcgct gggcgcaatg cgcgccatta ccgagtccgg gctgcgcgtt ggtgcggata 3600tctcggtagt gggatacgac gataccgaag acagctcatg ttatatcccg ccgttaacca 3660ccatcaaaca ggattttcgc ctgctggggc aaaccagcgt ggaccgcttg ctgcaactct 3720ctcagggcca ggcggtgaag ggcaatcagc tgttgcccgt ctcactggtg aaaagaaaaa 3780ccaccctggc gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc 3840agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgta 3900agttagcgcg aattgatctg gtttgacagc ttatcatcga ctgcacggtg caccaatgct 3960tctggcgtca ggcagccatc ggaagctgtg gtatggctgt gcaggtcgta aatcactgca 4020taattcgtgt cgctcaaggc gcactcccgt tctggataat gttttttgcg ccgacatcat 4080aacggttctg gcaaatattc tgaaatgagc tgttgacaat taatcatccg gctcgtataa 4140tgtgtggaat tgtgagcgga taacaatttc agaattcaaa agatctaaag aggagaaata 4200ctagatgagc tttgatatcg ccaaataccc caccctggcc ctggtggata gcacccagga 4260actgcgcctg ctgcccaaag aaagcctgcc caaactgtgc gatgaactgc gccgctacct 4320gctggatagc gtgagccgca gcagcggcca ctttgccagc ggcctgggca ccgtggaact 4380gaccgtggcc ctgcactacg tgtacaacac cccctttgat cagctgatct gggatgtggg 4440ccaccaggcc tacccccaca aaatcctgac cggccgccgc gataaaatcg gcaccatccg 4500ccagaaaggc ggcctgcacc cctttccctg gcgcggcgaa agcgaatacg atgtgctgag 4560cgtgggccac agcagcacca gcatcagcgc cggcatcggc atcgccgtgg ccgccgaaaa 4620agaaggcaaa aaccgccgca ccgtgtgcgt gatcggcgat ggcgccatca ccgccggcat 4680ggcctttgaa gccatgaacc acgccggcga tatccgcccc gatatgctgg tgatcctgaa 4740cgataacgaa atgagcatca gcgaaaacgt gggcgccctg aacaaccacc tggcccagct 4800gctgagcggc aaactgtaca gcagcctgcg cgaaggcggc aaaaaagtgt ttagcggcgt 4860gccccccatc aaagaactgc tgaaacgcac cgaagaacac atcaaaggca tggtggtgcc 4920cggcaccctg tttgaagaac tgggctttaa ctacatcggc cccgtggatg gccacgatgt 4980gctgggcctg atcaccaccc tgaaaaacat gcgcgatctg aaaggccccc agttcctgca 5040tatcatgacc aaaaaaggcc gcggctacga acccgccgaa aaagatccca tcacctttca 5100cgccgtgccc aaatttgatc ccagcagcgg ctgcctgccc aaaagcagcg gcggcctgcc 5160cagctacagc aaaatctttg gcgattggct gtgcgaaacc gccgccaaag ataacaaact 5220gatggccatc acccccgcca tgcgcgaagg cagcggcatg gtggaattta gccgcaaatt 5280tcccgatcgc tactttgatg tggccatcgc cgaacagcac gccgtgacct ttgccgccgg 5340cctggccatc ggcggctaca aacccatcgt ggccatctac agcacctttc tgcagcgcgc 5400ctacgatcag gtgctgcacg atgtggccat ccagaaactg cccgtgctgt ttgccatcga 5460tcgcgccggc atcgtgggcg ccgatggcca gacccaccag ggcgcctttg atctgagcta 5520cctgcgctgc atccccgaaa tggtgatcat gacccccagc gatgaaaacg aatgccgcca 5580gatgctgtac accggctacc actacaacga tggccccagc gccgtgcgct acccccgcgg 5640caacgccgtg ggcgtggaac tgacccccgt gaacttcccg atcgcagctg agtcgtccct 5700cccccaacgg aaagctgaac atctccaact ctgtcttgag gctggagtcg aaagccccga 5760ggtgacgacc gggttggagc gctatcgttt ccagcattgt gcgctgccaa atttgagtct 5820gcaggcgctg gacctaggga cgcagttctt ggggcgatcg ctgggggcac cgctgctgat 5880ctcgtcgatg accggcggaa ccgaaaccct ggaaaaactg cccatcggca aaggcatcgt 5940gaaacgccgc ggcgaaaaac tggccatcct gaactttggc accctgatgc ccgaagccgc 6000caaagtggcc gaaagcctga acgccaccct ggtggatatg cgctttgtga aacccctgga 6060tgaagccctg atcctggaaa tggccgccag ccacgaagcc ctggtgaccg tggaagaaaa 6120cgccatcatg ggcggcgccg gcagcggcgt gaacgaagtg ctgatggccc accgcaaacc 6180cgtgcccgtg ctgaacatcg gcctgcccga tttttttatc ccccagggca cccaggaaga 6240aatgcgcgcc gaactgggcc tggatgccgc cggcatggaa gccaaaatca aagcctggct 6300ggcctaggga tctaaagagg agaaatacta gatgcagacc gaacacgtga tcctgctgaa 6360cgcccagggc gtgcccaccg gcaccctgga aaaatacgcc gcccacaccg ccgatacccg 6420cctgcacctg gcctttagca gctggctgtt taacgccaaa ggccagctgc tggtgacccg 6480ccgcgccctg agcaaaaaag cctggcccgg cgtgtggacc aacagcgtgt gcggccaccc 6540ccagctgggc gaaagcaacg aagatgccgt gatccgccgc tgccgctacg aactgggcgt 6600ggaaatcacc ccccccgaaa gcatctaccc cgattttcgc taccgcgcca ccgatcccag 6660cggcatcgtg gaaaacgaag tgtgccccgt gtttgccgcc cgcaccacca gcgccctgca 6720gatcaacgat gatgaagtga tggattacca gtggtgcgat ctggccgatg tgctgcacgg 6780catcgatgcc accccctggg cctttagccc ctggatggtg atgcaggcca ccaaccgcga 6840agcccgcaaa cgcctgagcg cctttaccca gctgaaatag ggatctatta aagaggagaa 6900tactagatgg attttcccca gcagctggaa gcctgcgtga aacaggccaa ccaggccctg 6960agccgcttta tcgcccccct gccctttcag aacacccccg tggtggaaac catgcagtac 7020ggcgccctgc tgggcggcaa acgcctgcgc ccctttctgg tgtacgccac cggccacatg 7080tttggcgtga gcaccaacac cctggatgcc cccgccgccg ccgtggaatg catccacgcc 7140tacagcctga tccacgatga tctgcccgcc atggatgatg atgatctgcg ccgcggcctg 7200cccacctgcc acgtgaaatt tggcgaagcc aacgccatcc tggccggcga tgccctgcag 7260accctggcct ttagcatcct gagcgatgcc gatatgcccg aagtgagcga tcgcgatcgc 7320atcagcatga tcagcgaact ggccagcgcc agcggcatcg ccggcatgtg cggcggccag 7380gccctggatc tggatgccga aggcaaacac gtgcccctgg atgccctgga acgcatccac 7440cgccacaaaa ccggcgccct gatccgcgcc gccgtgcgcc tgggcgccct gagcgccggc 7500gataaaggcc gccgcgccct gcccgtgctg gataaatacg ccgaaagcat cggcctggcc 7560tttcaggtgc aggatgatat cctggatgtg gtgggcgata ccgccaccct gggcaaacgc 7620cagggcgccg atcagcagct gggcaaaagc

acctaccccg ccctgctggg cctggaacag 7680gcccgcaaaa aagcccgcga tctgatcgat gatgcccgcc agagcctgaa acagctggcc 7740gaacagagcc tggataccag cgccctggaa gccctggccg attacatcat ccagcgcaac 7800aaatagggat ccaaactcga gtaaggatct ccaggcatca aataaaacga aaggctcagt 7860cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc tactagagtc 7920acactggctc accttcgggt gggcctttct gcgtttatac ctagggcgtt cggctgcggc 7980gagcggtatc agctcactca aaggcggtaa tacgtccctg ctcgtcacgc tttcaggcac 8040cgtgccagat atcgacgtgg agtcgatcac tgtgattggc gaaggggaag gcagcgctac 8100ccaaatcgct agcttgctgg agaagctgaa acaaaccacg ggcattgatc tggcgaaatc 8160cctaccgggt caatccgact cgcccgctgc gaagtcctaa gagatagcga tgtgaccgcg 8220atcgcttgtc aagaatccca gtgatcccga accataggaa ggcaagctca atgcttgcct 8280cgtcttgagg actatctaga tgtctgtgga acgcacattt attgccatca agcccgatgg 8340cgttcagcgg ggtttggtcg gtacgatcat cggccgcttt gagcaaaaag gcttcaaact 8400ggtgggccta aagcagctga agcccagtcg cgagctggcc gaacagcact atgctgtcca 8460ccgcgagcgc cccttcttca atggcctcgt cgagttcatc acctctgggc cgatcgtggc 8520gatcgtcttg gaaggcgaag gcgttgtggc ggctgctcgc aagttgatcg gcgctaccaa 8580tccgctgacg gcagaaccgg gcaccatccg tggtgatttt ggtgtcaata ttggccgcaa 8640catcatccat ggctcggatg caatcgaaac agcacaacag gaaattgctc tctggtttag 8700cccagcagag ctaagtgatt ggacccccac gattcaaccc tggctgtacg aataaggtct 8760gcattccttc agagagacat tgccatgccg 879089773DNAArtificial SequencepSe1Bb1s-dxs-dxr-idi-ispA vector 8gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 60gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 120caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 180ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg 240tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 300ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 360tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 420cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 480gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 540ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 600gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 660agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 720tttgctcaca tgtgtgctgg gccccaatgc cttctccaag ggcggcattc ccctgactgt 780tgaaggcgtt gccaatatca agattgctgg ggaagaaccg accatccaca acgcgatcga 840gcggctgctt ggcaaaaacc gtaaggaaat cgagcaaatt gccaaggaga ccctcgaagg 900caacttgcgt ggtgttttag ccagcctcac gccggagcag atcaacgagg acaaaattgc 960ctttgccaaa agtctgctgg aagaggcgga ggatgacctt gagcagctgg gtcaagtcct 1020cgatacgctg caagtccaga acatttccga tgaggtcggt tatctctcgg ctagtggacg 1080caagcagcgg gctgatctgc agcgagatgc ccgaattgct gaagccgatg cccaggctgc 1140ctctgcgatc caaacggccg aaaatgacaa gatcacggcc ctgcgtcgga tcgatcgcga 1200tgtagcgatc gcccaagccg aggccgagcg ccggattcag gatgcgttga cgcggcgcga 1260agcggtggtg gccgaagctg aagcggacat tgctaccgaa gtcgctcgta gccaagcaga 1320actccctgtg cagcaggagc ggatcaaaca ggtgcagcag caacttcaag ccgatgtgat 1380cgccccagct gaggcagctt gtaaacgggc gatcgcggaa gcgcgggggg ccgccgcccg 1440tatcgtcgaa gatggaaaag ctcaagcgga agggacccaa cggctggcgg aggcttggca 1500gaccgctggt gctaatgccc gcgacatctt cctgctccag aagtctagac cagccaggac 1560agaaatgcct cgacttcgct gctacccaag gttgccgggt gacgcacacc gtggaaacgg 1620atgaaggcac gaacccagtg gacataagcc tgttcggttc gtaagctgta atgcaagtag 1680cgtatgcgct cacgcaactg gtccagaacc ttgaccgaac gcagcggtgg taacggcgca 1740gtggcggttt tcatggcttg ttatgactgt ttttttgggg tacagtctat gcctcgggca 1800tccaagcagc aagcgcgtta cgccgtgggt cgatgtttga tgttatggag cagcaacgat 1860gttacgcagc agggcagtcg ccctaaaaca aagttaaaca ttatgaggga agcggtgatc 1920gccgaagtat cgactcaact atcagaggta gttggcgtca tcgagcgcca tctcgaaccg 1980acgttgctgg ccgtacattt gtacggctcc gcagtggatg gcggcctgaa gccacacagt 2040gatattgatt tgctggttac ggtgaccgta aggcttgatg aaacaacgcg gcgagctttg 2100atcaacgacc ttttggaaac ttcggcttcc cctggagaga gcgagattct ccgcgctgta 2160gaagtcacca ttgttgtgca cgacgacatc attccgtggc gttatccagc taagcgcgaa 2220ctgcaatttg gagaatggca gcgcaatgac attcttgctg gtatcttcga gccagccacg 2280atcgacattg atctggctat cttgctgaca aaagcaagag aacatagcgt tgccttggta 2340ggtccagcgg cggaggaact ctttgatccg gttcctgaac aggatctatt tgaggcgcta 2400aatgaaacct taacgctatg gaactcgccg cccgactggg ctggcgatga gcgaaatgta 2460gtgcttacgt tgtcccgcat ttggtacagc gcagtaaccg gcaaaatcgc gccgaaggat 2520gtcgctgccg actgggcaat ggagcgcctg ccggcccagt atcagcccgt catacttgaa 2580gctagacagg cttatcttgg acaagaagaa gatcgcttgg cctcgcgcgc agatcagttg 2640gaagaatttg tccactacgt gaaaggcgag atcaccaagg tagtcggcaa ataacctcat 2700tttcgccaga tatcgacgtc gacaccatcg aatggtgcaa aacctttcgc ggtatggcat 2760gatagcgccc ggaagagagt caattcaggg tggtgaatgt gaaaccagta acgttatacg 2820atgtcgcaga gtatgccggt gtctcttatc agaccgtttc ccgcgtggtg aaccaggcca 2880gccacgtttc tgcgaaaacg cgggaaaaag tggaagcggc gatggcggag ctgaattaca 2940ttcccaaccg cgtggcacaa caactggcgg gcaaacagtc gttgctgatt ggcgttgcca 3000cctccagtct ggccctgcac gcgccgtcgc aaattgtcgc ggcgattaaa tctcgcgccg 3060atcaactggg tgccagcgtg gtggtgtcga tggtagaacg aagcggcgtc gaagcctgta 3120aagcggcggt gcacaatctt ctcgcgcaac gcgtcagtgg gctgatcatt aactatccgc 3180tggatgacca ggatgccatt gctgtggaag ctgcctgcac taatgttccg gcgttatttc 3240ttgatgtctc tgaccagaca cccatcaaca gtattatttt ctcccatgaa gacggtacgc 3300gactgggcgt ggagcatctg gtcgcattgg gtcaccagca aatcgcgctg ttagcgggcc 3360cattaagttc tgtctcggcg cgtctgcgtc tggctggctg gcataaatat ctcactcgca 3420atcaaattca gccgatagcg gaacgggaag gcgactggag tgccatgtcc ggttttcaac 3480aaaccatgca aatgctgaat gagggcatcg ttcccactgc gatgctggtt gccaacgatc 3540agatggcgct gggcgcaatg cgcgccatta ccgagtccgg gctgcgcgtt ggtgcggata 3600tctcggtagt gggatacgac gataccgaag acagctcatg ttatatcccg ccgttaacca 3660ccatcaaaca ggattttcgc ctgctggggc aaaccagcgt ggaccgcttg ctgcaactct 3720ctcagggcca ggcggtgaag ggcaatcagc tgttgcccgt ctcactggtg aaaagaaaaa 3780ccaccctggc gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc 3840agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgta 3900agttagcgcg aattgatctg gtttgacagc ttatcatcga ctgcacggtg caccaatgct 3960tctggcgtca ggcagccatc ggaagctgtg gtatggctgt gcaggtcgta aatcactgca 4020taattcgtgt cgctcaaggc gcactcccgt tctggataat gttttttgcg ccgacatcat 4080aacggttctg gcaaatattc tgaaatgagc tgttgacaat taatcatccg gctcgtataa 4140tgtgtggaat tgtgagcgga taacaatttc agaattcaaa agatctaaag aggagaaata 4200ctagatgagc tttgatatcg ccaaataccc caccctggcc ctggtggata gcacccagga 4260actgcgcctg ctgcccaaag aaagcctgcc caaactgtgc gatgaactgc gccgctacct 4320gctggatagc gtgagccgca gcagcggcca ctttgccagc ggcctgggca ccgtggaact 4380gaccgtggcc ctgcactacg tgtacaacac cccctttgat cagctgatct gggatgtggg 4440ccaccaggcc tacccccaca aaatcctgac cggccgccgc gataaaatcg gcaccatccg 4500ccagaaaggc ggcctgcacc cctttccctg gcgcggcgaa agcgaatacg atgtgctgag 4560cgtgggccac agcagcacca gcatcagcgc cggcatcggc atcgccgtgg ccgccgaaaa 4620agaaggcaaa aaccgccgca ccgtgtgcgt gatcggcgat ggcgccatca ccgccggcat 4680ggcctttgaa gccatgaacc acgccggcga tatccgcccc gatatgctgg tgatcctgaa 4740cgataacgaa atgagcatca gcgaaaacgt gggcgccctg aacaaccacc tggcccagct 4800gctgagcggc aaactgtaca gcagcctgcg cgaaggcggc aaaaaagtgt ttagcggcgt 4860gccccccatc aaagaactgc tgaaacgcac cgaagaacac atcaaaggca tggtggtgcc 4920cggcaccctg tttgaagaac tgggctttaa ctacatcggc cccgtggatg gccacgatgt 4980gctgggcctg atcaccaccc tgaaaaacat gcgcgatctg aaaggccccc agttcctgca 5040tatcatgacc aaaaaaggcc gcggctacga acccgccgaa aaagatccca tcacctttca 5100cgccgtgccc aaatttgatc ccagcagcgg ctgcctgccc aaaagcagcg gcggcctgcc 5160cagctacagc aaaatctttg gcgattggct gtgcgaaacc gccgccaaag ataacaaact 5220gatggccatc acccccgcca tgcgcgaagg cagcggcatg gtggaattta gccgcaaatt 5280tcccgatcgc tactttgatg tggccatcgc cgaacagcac gccgtgacct ttgccgccgg 5340cctggccatc ggcggctaca aacccatcgt ggccatctac agcacctttc tgcagcgcgc 5400ctacgatcag gtgctgcacg atgtggccat ccagaaactg cccgtgctgt ttgccatcga 5460tcgcgccggc atcgtgggcg ccgatggcca gacccaccag ggcgcctttg atctgagcta 5520cctgcgctgc atccccgaaa tggtgatcat gacccccagc gatgaaaacg aatgccgcca 5580gatgctgtac accggctacc actacaacga tggccccagc gccgtgcgct acccccgcgg 5640caacgccgtg ggcgtggaac tgacccccct ggaaaaactg cccatcggca aaggcatcgt 5700gaaacgccgc ggcgaaaaac tggccatcct gaactttggc accctgatgc ccgaagccgc 5760caaagtggcc gaaagcctga acgccaccct ggtggatatg cgctttgtga aacccctgga 5820tgaagccctg atcctggaaa tggccgccag ccacgaagcc ctggtgaccg tggaagaaaa 5880cgccatcatg ggcggcgccg gcagcggcgt gaacgaagtg ctgatggccc accgcaaacc 5940cgtgcccgtg ctgaacatcg gcctgcccga tttttttatc ccccagggca cccaggaaga 6000aatgcgcgcc gaactgggcc tggatgccgc cggcatggaa gccaaaatca aagcctggct 6060ggcctaggga tctattaaag aggagaatac tagatgaaac agctgaccat cctgggcagc 6120accggcagca tcggctgcag caccctggat gtggtgcgcc acaaccccga acacttccgc 6180gtggtggccc tggtggccgg caaaaacgtg acccgcatgg tggaacagtg cctggaattt 6240agcccccgct acgccgtgat ggatgatgaa gccagcgcca aactgctgaa aaccatgctg 6300cagcagcagg gcagccgcac cgaagtgctg agcggccagc aggccgcctg cgatatggcc 6360gccctggaag atgtggatca ggtgatggcc gccatcgtgg gcgccgccgg cctgctgccc 6420accctggccg ccatccgcgc cggcaaaacc atcctgctgg ccaacaaaga aagcctggtg 6480acctgcggcc gcctgtttat ggatgccgtg aaacagagca aagcccagct gctgcccgtg 6540gatagcgaac acaacgccat ctttcagagc ctgccccagc ccatccagca caacctgggc 6600tacgccgatc tggaacagaa cggcgtggtg agcatcctgc tgaccggcag cggcggcccc 6660tttcgcgaaa cccccctgcg cgatctggcc accatgaccc ccgatcaggc ctgccgccac 6720cccaactgga gcatgggccg caaaatcagc gtggatagcg ccaccatgat gaacaaaggc 6780ctggaataca tcgaagcccg ctggctgttt aacgccagcg ccagccagat ggaagtgctg 6840atccaccccc agagcgtgat ccacagcatg gtgcgctacc aggatggcag cgtgctggcc 6900cagctgggcg aacccgatat gcgcaccccc atcgcccaca ccatggcctg gcccaaccgc 6960gtgaacagcg gcgtgaaacc cctggatttt tgcaaactga gcgccctgac ctttgccgcc 7020cccgattacg atcgctaccc ctgcctgaaa ctggccatgg aagcctttga acagggccag 7080gccgccacca ccgccctgaa cgccgccaac gaaatcaccg tggccgcctt tctggcccag 7140cagatccgct ttaccgatat cgccgccctg aacctgagcg tgctggaaaa aatggatatg 7200cgcgaacccc agtgcgtgga tgatgtgctg agcgtggatg ccaacgcccg cgaagtggcc 7260cgcaaagaag tgatgcgcct ggccagctag ggatctaaag aggagaaata ctagatgcag 7320accgaacacg tgatcctgct gaacgcccag ggcgtgccca ccggcaccct ggaaaaatac 7380gccgcccaca ccgccgatac ccgcctgcac ctggccttta gcagctggct gtttaacgcc 7440aaaggccagc tgctggtgac ccgccgcgcc ctgagcaaaa aagcctggcc cggcgtgtgg 7500accaacagcg tgtgcggcca cccccagctg ggcgaaagca acgaagatgc cgtgatccgc 7560cgctgccgct acgaactggg cgtggaaatc accccccccg aaagcatcta ccccgatttt 7620cgctaccgcg ccaccgatcc cagcggcatc gtggaaaacg aagtgtgccc cgtgtttgcc 7680gcccgcacca ccagcgccct gcagatcaac gatgatgaag tgatggatta ccagtggtgc 7740gatctggccg atgtgctgca cggcatcgat gccaccccct gggcctttag cccctggatg 7800gtgatgcagg ccaccaaccg cgaagcccgc aaacgcctga gcgcctttac ccagctgaaa 7860tagggatcta ttaaagagga gaatactaga tggattttcc ccagcagctg gaagcctgcg 7920tgaaacaggc caaccaggcc ctgagccgct ttatcgcccc cctgcccttt cagaacaccc 7980ccgtggtgga aaccatgcag tacggcgccc tgctgggcgg caaacgcctg cgcccctttc 8040tggtgtacgc caccggccac atgtttggcg tgagcaccaa caccctggat gcccccgccg 8100ccgccgtgga atgcatccac gcctacagcc tgatccacga tgatctgccc gccatggatg 8160atgatgatct gcgccgcggc ctgcccacct gccacgtgaa atttggcgaa gccaacgcca 8220tcctggccgg cgatgccctg cagaccctgg cctttagcat cctgagcgat gccgatatgc 8280ccgaagtgag cgatcgcgat cgcatcagca tgatcagcga actggccagc gccagcggca 8340tcgccggcat gtgcggcggc caggccctgg atctggatgc cgaaggcaaa cacgtgcccc 8400tggatgccct ggaacgcatc caccgccaca aaaccggcgc cctgatccgc gccgccgtgc 8460gcctgggcgc cctgagcgcc ggcgataaag gccgccgcgc cctgcccgtg ctggataaat 8520acgccgaaag catcggcctg gcctttcagg tgcaggatga tatcctggat gtggtgggcg 8580ataccgccac cctgggcaaa cgccagggcg ccgatcagca gctgggcaaa agcacctacc 8640ccgccctgct gggcctggaa caggcccgca aaaaagcccg cgatctgatc gatgatgccc 8700gccagagcct gaaacagctg gccgaacaga gcctggatac cagcgccctg gaagccctgg 8760ccgattacat catccagcgc aacaaatagg gatccaaact cgagtaagga tctccaggca 8820tcaaataaaa cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc 8880ggtgaacgct ctctactaga gtcacactgg ctcaccttcg ggtgggcctt tctgcgttta 8940tacctagggc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacgtcc 9000ctgctcgtca cgctttcagg caccgtgcca gatatcgacg tggagtcgat cactgtgatt 9060ggcgaagggg aaggcagcgc tacccaaatc gctagcttgc tggagaagct gaaacaaacc 9120acgggcattg atctggcgaa atccctaccg ggtcaatccg actcgcccgc tgcgaagtcc 9180taagagatag cgatgtgacc gcgatcgctt gtcaagaatc ccagtgatcc cgaaccatag 9240gaaggcaagc tcaatgcttg cctcgtcttg aggactatct agatgtctgt ggaacgcaca 9300tttattgcca tcaagcccga tggcgttcag cggggtttgg tcggtacgat catcggccgc 9360tttgagcaaa aaggcttcaa actggtgggc ctaaagcagc tgaagcccag tcgcgagctg 9420gccgaacagc actatgctgt ccaccgcgag cgccccttct tcaatggcct cgtcgagttc 9480atcacctctg ggccgatcgt ggcgatcgtc ttggaaggcg aaggcgttgt ggcggctgct 9540cgcaagttga tcggcgctac caatccgctg acggcagaac cgggcaccat ccgtggtgat 9600tttggtgtca atattggccg caacatcatc catggctcgg atgcaatcga aacagcacaa 9660caggaaattg ctctctggtt tagcccagca gagctaagtg attggacccc cacgattcaa 9720ccctggctgt acgaataagg tctgcattcc ttcagagaga cattgccatg ccg 977397472DNAArtificial SequencepSe2Bb1k-sqs vector(sqs gene is drirved from Saccharomyces cerevisiae) 9gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 60gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 120caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 180ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg 240tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 300ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 360tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 420cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 480gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 540ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 600gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 660agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 720tttgctcaca tgtgtgctgg gcccccatca attcatcagc caaatgcccg atggctatga 780cacatgggtg ggagagcgcg gcgtcaacct ctccggcggt cagcggcagc ggctggcgat 840cgcccgcgcg gtcttgctgg atccacgcat tttaattctg gatgaggcga cttcggcgct 900tgattccgag tccgaaacct tggtgcaaga ggccctagaa cgggtgatgc agggacggac 960ggtctttatc attgctcacc gtctggctac ggttcgtaat gccagccgca tcttggtgat 1020ggagcgcggc cagattgttg aggcaggcaa tcacgatgcg ctgttggcag aggctggccg 1080ctatgcgcga tactacgcac agcaatttcg tgcctgatca ggattaatga aacggacgcc 1140ccagactgaa ttgccggact gggaagcgat cgcggatttg gatgcgatcg tggtcgataa 1200acgagctcgt aagcgggcca cggcagcgaa agggcgacgg cgcgatcgcc ggtatggaaa 1260acgcttgctg cagcatcaga tcgatgcgat cgccgaagac tgtgacctag atgaggaagc 1320atgagcgaac tgggcttgag tctgacggcg atcgcgattt ttaccacgac ggcattagct 1380ttggtgggac caatgctggg tagttctccg ctgctaccgg cgggattggg ttttagcctc 1440ttggtgctgt tcagtctgga tgcggtgact tggcaggggc ggggtgccac gttactgctc 1500gatggcattc agcagcgatc gcccgaatat cgtcagcgga ttttgcatca cgaagcgggt 1560cactacttgg tagcaaccgc gctggggtta cccgtgacgg gctacaccct ctcagcgtgg 1620gaagcgctgc gccaaggaca acctggtcgc gggggtgtgc agttccaagc agctgcgcta 1680gaagccgaag ccgcacaggg gcaactcagt cagcgatcgc tggaacagtg gtgtcaggtg 1740ttgatggccg gtgcagcggc agagcaactg gtctacggca acgtggaagg gggagctgac 1800gatcgcgccc agtggaaaca actgtggcgg caactcgatc gcaatcctgc cgaagcggat 1860ttacgcagtc gctggggatt gttacgggcg aagactttac tggagcaaca acgtcccgcc 1920tacgatgctt tggtggcggc gatggctgca gaggccagca ttgaagactg caatcaagcg 1980atcgccactg cttgggtaga agaacctgcg atcgccgctt agtgaagagt ccagaagatt 2040cccctcccct ctcgcccaat ggacaaggga aatgtgattc agcatgagtc aagtccccag 2100tgcatggatg ggtgtgcaat gagagctctc gaaccccaga gtcccgctca gaagaactcg 2160tcaagaaggc gatagaaggc gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg 2220aggaagcggt cagcccattc gccgccaagc tcttcagcaa tatcacgggt agccaacgct 2280atgtcctgat agcggtccgc cacacccagc cggccacagt cgatgaatcc agaaaagcgg 2340ccattttcca ccatgatatt cggcaagcag gcatcgccat gggtcacgac gagatcctcg 2400ccgtcgggca tgcgcgcctt gagcctggcg aacagttcgg ctggcgcgag cccctgatgc 2460tcttcgtcca gatcatcctg atcgacaaga ccggcttcca tccgagtacg tgctcgctcg 2520atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg gatcaagcgt atgcagccgc 2580cgcattgcat cagccatgat ggatactttc tcggcaggag caaggtgaga tgacaggaga 2640tcctgccccg gcacttcgcc caatagcagc cagtcccttc ccgcttcagt gacaacgtcg 2700agcacagctg cgcaaggaac gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc 2760tgcagttcat tcagggcacc ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc 2820gctgacagcc ggaacacggc ggcatcagag cagccgattg tctgttgtgc ccagtcatag 2880ccgaatagcc tctccaccca agcggccgga gaacctgcgt gcaatccatc ttgttcaatc 2940atgcgaaacg atcctcatcc tgtctcttga tcagatcatg atcccctgcg ccatcagatc 3000cttggcggca agaaagccat ccagtttact ttgcagggct tcccaacctt accagagggc 3060gccccagctg gcaattccga cgtcgacacc atcgaatggt gcaaaacctt tcgcggtatg 3120gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc agtaacgtta 3180tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt ggtgaaccag 3240gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc ggagctgaat 3300tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct gattggcgtt 3360gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat taaatctcgc 3420gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc 3480tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat cattaactat 3540ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt tccggcgtta 3600tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca tgaagacggt 3660acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc gctgttagcg 3720ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa atatctcact 3780cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat gtccggtttt 3840caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct ggttgccaac 3900gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg

cgttggtgcg 3960gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat cccgccgtta 4020accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa 4080ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact ggtgaaaaga 4140aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 4200atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 4260tgtaagttag cgcgaattga tctggtttga cagcttatca tcgactgcac ggtgcaccaa 4320tgcttctggc gtcaggcagc catcggaagc tgtggtatgg ctgtgcaggt cgtaaatcac 4380tgcataattc gtgtcgctca aggcgcactc ccgttctgga taatgttttt tgcgccgaca 4440tcataacggt tctggcaaat attctgaaat gagctgttga caattaatca tccggctcgt 4500ataatgtgtg gaattgtgag cggataacaa tttcagggga attcaaaaga tctataaaag 4560taaagaagga gaccataaat gggcaaactg ctgcagctgg ccctgcaccc cgtggaaatg 4620aaagccgccc tgaaactgaa attttgccgc acccccctgt ttagcatcta cgatcagagc 4680accagcccct acctgctgca ctgctttgaa ctgctgaacc tgaccagccg cagctttgcc 4740gccgtgatcc gcgaactgca ccccgaactg cgcaactgcg tgaccctgtt ttacctgatc 4800ctgcgcgccc tggataccat cgaagatgat atgagcatcg aacacgatct gaaaatcgat 4860ctgctgcgcc actttcacga aaaactgctg ctgaccaaat ggagctttga tggcaacgcc 4920cccgatgtga aagatcgcgc cgtgctgacc gattttgaaa gcatcctgat cgaatttcac 4980aaactgaaac ccgaatacca ggaagtgatc aaagaaatca ccgaaaaaat gggcaacggc 5040atggccgatt acatcctgga tgaaaactac aacctgaacg gcctgcagac cgtgcacgat 5100tacgatgtgt actgccacta cgtggccggc ctggtgggcg atggcctgac ccgcctgatc 5160gtgatcgcca aatttgccaa cgaaagcctg tacagcaacg aacagctgta cgaaagcatg 5220ggcctgtttc tgcagaaaac caacatcatc cgcgattaca acgaggatct ggtggatggc 5280cgcagctttt ggcccaaaga aatctggagc cagtacgccc cccagctgaa agattttatg 5340aaacccgaaa acgaacagct gggcctggat tgcatcaacc acctggtgct gaacgccctg 5400agccacgtga tcgatgtgct gacctacctg gccggcatcc acgaacagag cacctttcag 5460ttttgcgcca tcccccaggt gatggccatc gccaccctgg ccctggtgtt taacaaccgc 5520gaagtgctgc acggcaacgt gaaaatccgc aaaggcacca cctgctacct gatcctgaaa 5580agccgcaccc tgcgcggctg cgtggaaatc tttgattact acctgcgcga tatcaaaagc 5640aaactggccg tgcaagatcc caactttctg aaactgaaca tccagatcag caaaatcgaa 5700cagtttatgg aagaaatgta ccaggataaa ctgcccccca acgtgaaacc caacgaaacc 5760cccatctttc tgaaagtgaa agaacgcagc cgctacgatg atgaactggt gcccacccag 5820caggaagaag aatacaaata gggatccaaa ctcgagtaag gatctccagg catcaaataa 5880aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg 5940ctctctacta gagtcacact ggctcacctt cgggtgggcc tttctgcgtt tatacctagg 6000gcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg gcaattcaag 6060agcatccaaa gcctcttcaa ccccaggaac ggcttgtaga tgcgtttcta acgcgatacg 6120ggtacggcgt tgatagtgct gaacaaagtc agggggtgga ggattgccta accgtcgctc 6180aattagtttg agacagtcag ccatggaatg acccacaaac tgctcaaaca tgtcatccaa 6240agtcaccaac agacccagtt cattgagcat gtctgcaaag acgcgattag tgatgcgttc 6300gctatcaaca agcacaccat cacagtcgaa aatcaccagc tgaaacggtg aagtttgcat 6360tgtttttaag cacgagccat caacagtaag agcgatcgcg ctgggacgat gtaatcgcgc 6420cgtaggcagg gttttgcctc atccggcaga tgacaagctt caagattcgg cagtgaagta 6480tcgagcaagc gataccaaac gcggccgcga ggaggcctcg gcaactggaa gcgcaggtct 6540tcccagtaag cattaaaggc taggtaaagc cattcctgct ggcgaggatg gcagagactg 6600acggccagac tgtgggacca cagcgcccaa tcgggttgtt tgagtttgac gccatgccag 6660atggcatagg gacgacgcgg atggggttcg ttctgcagca gttcgttctg ttggaacatc 6720accagcgact gggaaagttc aatcaggcgg cgactgaaca ccaagaaatc ggcatggcga 6780tcgcacagcg accaatcaaa ccagctgatc tcattgtctt ggcagtaggc gttattgtta 6840ccctgctgac tgcgtttgac ctcatcgccc atcgtcagca tcggtgtgcc ctgggcgagg 6900aataacgtgg cgagcaaatt gcgctgctgc cgttcccgta agctcagaat cgtggggtca 6960tcggtctcgc cttcaatgcc gtagttccag ctgtagttgt cattggtccc gtcccgattg 7020ttctctccat tggcaaagtt gtgcttctgg ctatagctga ctagatctcg cagcgtaaag 7080ccgtcatggc aggtgatgaa gttaatggtg cgtccggcat accattggtc tgtgctgtag 7140acatcggggc tacccagcag gcgttgactg agggcgtaag tacagccctg atctccacgc 7200caaaaacgcc gaatatcgtc ccggaaggga ccgttccaag tcccaaagcg atcgccaata 7260aaggtaccaa cctgatataa gccggctgcg tcccaagctt cagcaatgag cttcgtaccg 7320gccaaaaccg gatcggaatc aatcgcccaa agcaagggcg gatccgatag ggggttgcca 7380ttggcatcac gactcagcac cgacgcaagg tcaaagcgga agccatcgac gtgcatttcc 7440gagacccaat aacgcaggca atcgagaatc ag 7472107298DNAArtificial SequencepSe2Bb1k-sqs vector(sqs gene is drirved from Methylococcus capsulatus) 10gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 60gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 120caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 180ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg 240tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 300ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 360tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 420cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 480gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 540ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 600gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 660agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 720tttgctcaca tgtgtgctgg gcccccatca attcatcagc caaatgcccg atggctatga 780cacatgggtg ggagagcgcg gcgtcaacct ctccggcggt cagcggcagc ggctggcgat 840cgcccgcgcg gtcttgctgg atccacgcat tttaattctg gatgaggcga cttcggcgct 900tgattccgag tccgaaacct tggtgcaaga ggccctagaa cgggtgatgc agggacggac 960ggtctttatc attgctcacc gtctggctac ggttcgtaat gccagccgca tcttggtgat 1020ggagcgcggc cagattgttg aggcaggcaa tcacgatgcg ctgttggcag aggctggccg 1080ctatgcgcga tactacgcac agcaatttcg tgcctgatca ggattaatga aacggacgcc 1140ccagactgaa ttgccggact gggaagcgat cgcggatttg gatgcgatcg tggtcgataa 1200acgagctcgt aagcgggcca cggcagcgaa agggcgacgg cgcgatcgcc ggtatggaaa 1260acgcttgctg cagcatcaga tcgatgcgat cgccgaagac tgtgacctag atgaggaagc 1320atgagcgaac tgggcttgag tctgacggcg atcgcgattt ttaccacgac ggcattagct 1380ttggtgggac caatgctggg tagttctccg ctgctaccgg cgggattggg ttttagcctc 1440ttggtgctgt tcagtctgga tgcggtgact tggcaggggc ggggtgccac gttactgctc 1500gatggcattc agcagcgatc gcccgaatat cgtcagcgga ttttgcatca cgaagcgggt 1560cactacttgg tagcaaccgc gctggggtta cccgtgacgg gctacaccct ctcagcgtgg 1620gaagcgctgc gccaaggaca acctggtcgc gggggtgtgc agttccaagc agctgcgcta 1680gaagccgaag ccgcacaggg gcaactcagt cagcgatcgc tggaacagtg gtgtcaggtg 1740ttgatggccg gtgcagcggc agagcaactg gtctacggca acgtggaagg gggagctgac 1800gatcgcgccc agtggaaaca actgtggcgg caactcgatc gcaatcctgc cgaagcggat 1860ttacgcagtc gctggggatt gttacgggcg aagactttac tggagcaaca acgtcccgcc 1920tacgatgctt tggtggcggc gatggctgca gaggccagca ttgaagactg caatcaagcg 1980atcgccactg cttgggtaga agaacctgcg atcgccgctt agtgaagagt ccagaagatt 2040cccctcccct ctcgcccaat ggacaaggga aatgtgattc agcatgagtc aagtccccag 2100tgcatggatg ggtgtgcaat gagagctctc gaaccccaga gtcccgctca gaagaactcg 2160tcaagaaggc gatagaaggc gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg 2220aggaagcggt cagcccattc gccgccaagc tcttcagcaa tatcacgggt agccaacgct 2280atgtcctgat agcggtccgc cacacccagc cggccacagt cgatgaatcc agaaaagcgg 2340ccattttcca ccatgatatt cggcaagcag gcatcgccat gggtcacgac gagatcctcg 2400ccgtcgggca tgcgcgcctt gagcctggcg aacagttcgg ctggcgcgag cccctgatgc 2460tcttcgtcca gatcatcctg atcgacaaga ccggcttcca tccgagtacg tgctcgctcg 2520atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg gatcaagcgt atgcagccgc 2580cgcattgcat cagccatgat ggatactttc tcggcaggag caaggtgaga tgacaggaga 2640tcctgccccg gcacttcgcc caatagcagc cagtcccttc ccgcttcagt gacaacgtcg 2700agcacagctg cgcaaggaac gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc 2760tgcagttcat tcagggcacc ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc 2820gctgacagcc ggaacacggc ggcatcagag cagccgattg tctgttgtgc ccagtcatag 2880ccgaatagcc tctccaccca agcggccgga gaacctgcgt gcaatccatc ttgttcaatc 2940atgcgaaacg atcctcatcc tgtctcttga tcagatcatg atcccctgcg ccatcagatc 3000cttggcggca agaaagccat ccagtttact ttgcagggct tcccaacctt accagagggc 3060gccccagctg gcaattccga cgtcgacacc atcgaatggt gcaaaacctt tcgcggtatg 3120gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc agtaacgtta 3180tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt ggtgaaccag 3240gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc ggagctgaat 3300tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct gattggcgtt 3360gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat taaatctcgc 3420gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc 3480tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat cattaactat 3540ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt tccggcgtta 3600tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca tgaagacggt 3660acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc gctgttagcg 3720ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa atatctcact 3780cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat gtccggtttt 3840caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct ggttgccaac 3900gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg cgttggtgcg 3960gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat cccgccgtta 4020accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa 4080ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact ggtgaaaaga 4140aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 4200atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 4260tgtaagttag cgcgaattga tctggtttga cagcttatca tcgactgcac ggtgcaccaa 4320tgcttctggc gtcaggcagc catcggaagc tgtggtatgg ctgtgcaggt cgtaaatcac 4380tgcataattc gtgtcgctca aggcgcactc ccgttctgga taatgttttt tgcgccgaca 4440tcataacggt tctggcaaat attctgaaat gagctgttga caattaatca tccggctcgt 4500ataatgtgtg gaattgtgag cggataacaa tttcaggaat tcaaaagatc taagattacg 4560taacgaagga gagaaaccat gagcggcacc ccccccagcc agcccgcccg ccacgaacac 4620ctgagcgatg atgaatttca ggcccacttt ctggatggcg tgagccgcac ctttgccctg 4680accatccccc gcctgcccga aggcctggcc cgccccgtga gcaacggcta cctgctgtgc 4740cgcatcgtgg ataccatcga agatgaagtg gccctgacca gcacccagaa acgccgctac 4800tgcgaacact ttgcccgcgt ggtggccggc accgcccccg ccgcccccct ggccgatgaa 4860ctgtttcccc tgctgagcga tcagaccctg gccgccgaac gcgaactgat cgccgccatc 4920ccccgcgtga tcagcatcac ccacggcttt gccgcccccc agcaggaagc cctggccgaa 4980tgcgtggcca ccatgagccg cggcatggcc gaatttcagg ataaggatct gcgccacggc 5040ctggaggatc tgcgccagat gggcgattac tgctactacg tggccggcgt ggtgggcgaa 5100atgctgaccc gcctgttttg ccactacagc cccgaaatcg ccgcccaccg cagccgcctg 5160atggaactgg cctgcccctt tggccagggc ctgcagatga ccaacatcct gaaggatctg 5220tgggatgatc acgcccgcgg cgtgtgctgg ctgccccagg aagtgtttac cgaatgcggc 5280tttagcctga ccgaactgcg cccccaccac gccaaccccg attttgtgcg cggctttgaa 5340cgcctgatcg gcgtggccca cgcccacctg cgcaacgccc tggaatacac cctgctgatc 5400ccccgccacg aaaccggcat ccgcgaattt tgcctgtggg ccctgggcat ggccgtgctg 5460accctgcgca aaatccaccg ccacccctac tttagcgata gcgcccaggt gaaaatcacc 5520cgccaggccg tgaaagccac catcgtgacc agccgcctga cccgcggcag cgataccctg 5580ctgaaagcca cctttcgcct ggccggcctg ggcctgcccg ccgccgtgcc cgccgccgtg 5640ctgcagcccc gccccatcga tatctaggga tccaaactcg agtaaggatc tccaggcatc 5700aaataaaacg aaaggctcag tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg 5760tgaacgctct ctactagagt cacactggct caccttcggg tgggcctttc tgcgtttata 5820cctagggcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacgggcaa 5880ttcaagagca tccaaagcct cttcaacccc aggaacggct tgtagatgcg tttctaacgc 5940gatacgggta cggcgttgat agtgctgaac aaagtcaggg ggtggaggat tgcctaaccg 6000tcgctcaatt agtttgagac agtcagccat ggaatgaccc acaaactgct caaacatgtc 6060atccaaagtc accaacagac ccagttcatt gagcatgtct gcaaagacgc gattagtgat 6120gcgttcgcta tcaacaagca caccatcaca gtcgaaaatc accagctgaa acggtgaagt 6180ttgcattgtt tttaagcacg agccatcaac agtaagagcg atcgcgctgg gacgatgtaa 6240tcgcgccgta ggcagggttt tgcctcatcc ggcagatgac aagcttcaag attcggcagt 6300gaagtatcga gcaagcgata ccaaacgcgg ccgcgaggag gcctcggcaa ctggaagcgc 6360aggtcttccc agtaagcatt aaaggctagg taaagccatt cctgctggcg aggatggcag 6420agactgacgg ccagactgtg ggaccacagc gcccaatcgg gttgtttgag tttgacgcca 6480tgccagatgg catagggacg acgcggatgg ggttcgttct gcagcagttc gttctgttgg 6540aacatcacca gcgactggga aagttcaatc aggcggcgac tgaacaccaa gaaatcggca 6600tggcgatcgc acagcgacca atcaaaccag ctgatctcat tgtcttggca gtaggcgtta 6660ttgttaccct gctgactgcg tttgacctca tcgcccatcg tcagcatcgg tgtgccctgg 6720gcgaggaata acgtggcgag caaattgcgc tgctgccgtt cccgtaagct cagaatcgtg 6780gggtcatcgg tctcgccttc aatgccgtag ttccagctgt agttgtcatt ggtcccgtcc 6840cgattgttct ctccattggc aaagttgtgc ttctggctat agctgactag atctcgcagc 6900gtaaagccgt catggcaggt gatgaagtta atggtgcgtc cggcatacca ttggtctgtg 6960ctgtagacat cggggctacc cagcaggcgt tgactgaggg cgtaagtaca gccctgatct 7020ccacgccaaa aacgccgaat atcgtcccgg aagggaccgt tccaagtccc aaagcgatcg 7080ccaataaagg taccaacctg atataagccg gctgcgtccc aagcttcagc aatgagcttc 7140gtaccggcca aaaccggatc ggaatcaatc gcccaaagca agggcggatc cgataggggg 7200ttgccattgg catcacgact cagcaccgac gcaaggtcaa agcggaagcc atcgacgtgc 7260atttccgaga cccaataacg caggcaatcg agaatcag 72981125DNAArtificial SequencePrimer(forward) 11ccagcagcgg ctgcctgccc aaaag 251220DNAArtificial SequencePrimer(reverse) 12gaaagcgtga cgagcaggga 201320DNAArtificial SequencePrimer(forward) 13ggctacggtt cgtaatgcca 201420DNAArtificial SequencePrimer(reverse) 14gagatcaggg ctgtacttac 20

Claims

What is claimed is:

1. A Synechococcus elongatus strain comprising: a gene encoding an enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) comprising a sequence of SEQ ID NO. 1; a gene encoding an enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) comprising a sequence of SEQ ID NO. 2; a gene encoding an enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) comprising a sequence of SEQ ID NO. 3; and a gene encoding an enzyme producing squalene from farnesyl diphosphate (FPP) comprising a sequence of SEQ ID NO. 4 or 5.

2. The Synechococcus elongatus strain according to claim 1, wherein the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P) is a deoxyxylulose-5-phosphate synthase, the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP) is an isopentenyl diphosphate delta isomerase, the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) is a geranyl diphosphate synthase, and the enzyme producing squalene from farnesyl diphosphate (FPP) is a squalene synthase.

3. The Synechococcus elongatus strain according to claim 1, wherein the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P); the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); and the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP) are each derived from E. coli, and the gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP) is derived from Saccharomyces cerevisiae or Methylococcus capsulatus.

4. The Synechococcus elongatus strain according to claim 1, wherein the strain is transformed with a first vector and a second vector, the first vector comprising: a gene encoding an enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P); a gene encoding an enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); and a gene encoding an enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP), and the second vector comprising: a gene encoding an enzyme producing squalene from farnesyl diphosphate (FPP).

5. The Synechococcus elongatus strain according to claim 4, wherein the first vector comprises a sequence of SEQ ID NO. 7.

6. The Synechococcus elongatus strain according to claim 4, wherein the second vector comprises a sequence of SEQ ID NO. 9, or a sequence of SEQ ID NO. 10.

7. The Synechococcus elongatus strain according to claim 4, wherein the first vector is inserted into a neutral site I (NSI) of Synechococcus elongatus which is a parent strain, and the second vector is inserted into a neutral site II (NSII) of Synechococcus elongatus which is a parent strain.

8. The Synechococcus elongatus strain according to claim 4, wherein the first vector sequentially comprises: a spectinomycin-resistant gene; a lacI repressor; a trc promoter; and a target gene(s), and wherein the target genes are the gene encoding the enzyme producing 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and D-glyceraldehyde 3-phosphate (G3P); the gene encoding the enzyme producing dimethylallyl diphosphate (DMAPP) from isopentenyl diphosphate (IPP); and the gene encoding the enzyme producing farnesyl diphosphate (FPP) from dimethylallyl diphosphate (DMAPP).

9. The Synechococcus elongatus strain according to claim 4, wherein the second vector sequentially comprises: a kanamycin-resistant gene; a lacI repressor; a trc promoter; and a target gene encoding the enzyme producing squalene from farnesyl diphosphate (FPP).

10. The Synechococcus elongatus strain according to claim 4, wherein the strain is a strain in which the vectors are transformed in Synechococcus elongatus PCC7942 (Accession number: ATCC 33912), which is a parent strain.

11. The Synechococcus elongatus strain according to claim 1, wherein the strain is a strain belonging to accession number KCTC 12966BP.