U.S. patent application number 17/155419 was filed with the patent office on 2021-05-20 for recombinant polypeptides and methods of use thereof.
The applicant listed for this patent is Imunami Laboratories Pte. Ltd.. Invention is credited to YA-Huei CHEN, Ting-long LIN.
Application Number | 20210147494 17/155419 |
Document ID | / |
Family ID | 1000005360819 |
Filed Date | 2021-05-20 |
![](/patent/app/20210147494/US20210147494A1-20210520-D00001.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00002.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00003.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00004.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00005.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00006.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00007.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00008.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00009.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00010.png)
![](/patent/app/20210147494/US20210147494A1-20210520-D00011.png)
View All Diagrams
United States Patent
Application |
20210147494 |
Kind Code |
A1 |
CHEN; YA-Huei ; et
al. |
May 20, 2021 |
RECOMBINANT POLYPEPTIDES AND METHODS OF USE THEREOF
Abstract
The present disclosure provides recombinant polypeptides,
nucleic acids encoding the recombinant polypeptides and methods for
using these polypeptides and/or nucleic acids in enhancing or
inducing an immune response in a subject in need thereof. The
present disclosure also provides methods of treating a cell
proliferative disorder, such as cancer, by administering the
disclosed polypeptides and/or nucleic acids to a subject in need
thereof.
Inventors: |
CHEN; YA-Huei; (Singapore,
SG) ; LIN; Ting-long; (Singapore, SG) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Imunami Laboratories Pte. Ltd. |
Singapore |
|
SG |
|
|
Family ID: |
1000005360819 |
Appl. No.: |
17/155419 |
Filed: |
January 22, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16903856 |
Jun 17, 2020 |
|
|
|
17155419 |
|
|
|
|
16443517 |
Jun 17, 2019 |
|
|
|
16903856 |
|
|
|
|
16138224 |
Sep 21, 2018 |
10370421 |
|
|
16443517 |
|
|
|
|
15854906 |
Dec 27, 2017 |
10150801 |
|
|
16138224 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 35/00 20180101; C07K 14/465 20130101 |
International
Class: |
C07K 14/465 20060101
C07K014/465; A61P 35/00 20060101 A61P035/00 |
Claims
1. A nucleic acid encoding a recombinant polypeptide comprising an
amino acid sequence having at least 99% sequence identity to the
recombinant polypeptide of SEQ ID NO: 9.
2. An expression vector comprising the nucleic acid of claim 1.
3. A recombinant polypeptide comprising an amino acid sequence
having at least 99% sequence identity to the recombinant
polypeptide of SEQ ID NO: 9.
4. The pharmaceutical composition comprising the recombinant
polypeptide of claim 3 and a pharmaceutically acceptable
carrier.
5. The pharmaceutical composition of claim 4, wherein the final
NaCl concentration is 0.4M-1.0M and the pharmaceutically acceptable
carrier comprises a buffer solution of pH 7.5-9.0.
6. A method of enhancing or inducing an immune response against a
cancer cell in a subject in need thereof comprising administering
to said subject the nucleic acid of claim 1.
7. A method of enhancing or inducing an immune response against a
cancer cell in a subject in need thereof comprising administering
to said subject the recombinant peptide of claim 3.
8. A method of enhancing or inducing the endogenous presentation of
disease associated antigens on the surface of a cancer cell in a
subject in need thereof, comprising administering to said subject
the nucleic acid of claim 1.
9. A method of enhancing or inducing the endogenous presentation of
disease associated antigens on the surface of a cancer cell in a
subject in need thereof, comprising administering to said subject
the recombinant peptide of claim 3.
10. A method of treating, preventing or alleviating at least one of
the symptoms of cancer in a subject in need thereof comprising
administering to said subject the nucleic acid of claim 1.
11. A method of treating, preventing or alleviating at least one of
the symptoms of cancer in a subject in need thereof comprising
administering to said subject the recombinant peptide of claim 3.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S. Ser.
No. 16/903,856, filed on Jun. 17, 2020, which is a continuation
application of U.S. Ser. No. 16/443,517, filed on Jun. 17, 2019,
which is a continuation application of U.S. Ser. No. 16/138,224,
filed on Sep. 21, 2018, now U.S. Pat. No. 10,370,421, which is a
divisional application of U.S. Ser. No. 15/854,906, filed on Dec.
27, 2017, now U.S. Pat. No. 10,150,801. The contents of each of
these applications are incorporated by reference in their
entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jan. 19, 2021, is named "IMHC_001_C03US_SeqListing_ST25.txt" and
is 42 KB in size.
BACKGROUND OF THE INVENTION
[0003] Immunogenic cell death is a form of cell death or apoptosis.
Unlike traditional apoptosis, which is mostly non-immunogenic,
immunogenic cell death in cancer cells can induce an effective
anti-tumor immune response through the activation of dendritic
cells. The pre-apoptotic state is defined as the state before the
activation of Caspase 3/7, the manifestation of cell apoptosis.
Immunogenic cell death is characterized by the expression of
pre-apoptotic damage-associated-molecular-patterns (DAMPs) on the
surface of a dying cell. There are three important pre-apoptotic
DAMPs which are exposed to the cell surface during immunogenic cell
death: calreticulin (CRT), HSP70 and HSP90. These three
pre-apoptotic DAMP signals play an important role in dendritic cell
recruitment and cell phagocytosis by CRT and dendritic cell
maturation/activation by HSP70 and HSP90, resulting in effective
anti-tumor immune response. Selected forms of chemotherapy and
radiotherapy can induce collateral immunogenic cell death. While
these therapies can induce one or two of the three pre-apoptotic
DAMP signals, they do not induce the expression of all three
pre-apoptotic DAMP signals. Furthermore, chemotherapy and
radiotherapy are immunosuppressive therapies, which reduce numbers
of lymphocytes and also cause collateral damages to surrounding
non-tumor cells, resulting in poor anti-tumor immune responses and
also adverse events respectively.
[0004] There is a need for compositions that induce immunogenic
cell death with increased efficiency and potency by inducing the
expression of all three pre-apoptotic DAMP signals, while
minimizing adverse effects. The present disclosure addresses this
need.
SUMMARY OF THE INVENTION
[0005] The present disclosure provides acidic recombinant
polypeptides.
[0006] The present disclosure provides recombinant polypeptides
comprising, consisting essentially of, or consisting of, an amino
acid sequence selected from the group consisting of SEQ ID NO: 1-16
or an amino acid sequence that is at least about 50%, about 55%,
about 60%, about 65%, about 70%, about 75%, about 80%, about 85%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98% or about 99% identical to any of
the amino acid sequences of SEQ ID NO: 1-16. In one aspect, the
recombinant polypeptides comprise, consist essentially of, or
consist of an amino acid sequence selected from the group
consisting of SEQ ID NO: 1-8 or an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to any of the amino acid sequences of SEQ ID NO: 1-8.
In one aspect, the recombinant polypeptides comprise, consist
essentially of, or consist of an amino acid sequence selected from
the group consisting of SEQ ID NO: 9-16 or an amino acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to any of the amino acid sequences of
SEQ ID NO: 9-16. In a preferred aspect, the recombinant polypeptide
comprises, consists essentially of, or consists of an amino acid
sequence of SEQ ID NO: 9 or amino acid sequence that is at least
about 50%, about 55%, about 60%, about 65%, about 70%, about 75%,
about 80%, about 85%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to any of the amino acid sequences of SEQ ID NO: 9.
[0007] In one aspect, the recombinant polypeptides comprise,
consist essentially of, or consist of an amino acid sequence
selected from the group consisting of SEQ ID NO: 1-16 or amino acid
sequence that is at least about 50%, about 55%, about 60%, about
65%, about 70%, about 75%, about 80%, about 85%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98% or about 99% identical to any of the amino acid
sequences of SEQ ID NO: 1-16 that are acidic recombinant
polypeptides as determined by pI. In one aspect, the pI of the
recombinant polypeptide is lower than the pI of SEQ ID NO: 1-16. In
one aspect, aspartic acid (D), glutamic acid (E) and leucine (L)
are each independently present in an amount greater than, or equal
to, the amount of any other amino acid residue present within the
recombinant polypeptide sequence. In one aspect, the amino acid
sequence of the acidic recombinant polypeptides comprise aspartic
acid (D), glutamic acid (E) and leucine (L) as the three most
abundant residues within the amino acid sequence or as greater than
or equal to in abundance to the next most abundant amino acid
residue of the acidic recombinant polypeptide.
[0008] The present disclosure also provides nucleic acid molecules
encoding any of the recombinant polypeptides disclosed herein. In
one aspect, the nucleic acid molecules encode the recombinant
polypeptides of SEQ ID NO: 1-16. In one aspect, the nucleic acid
molecule comprises, consists essentially of, or consists of a
nucleic acid sequence of SEQ ID NO: 17-32 or a nucleic acid
sequence that is at least about 50%, about 55%, about 60%, about
65%, about 70%, about 75%, about 80%, about 85%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98% or about 99% identical to any of the nucleic acid
sequence of SEQ ID NO: 17-32.
[0009] The present disclosure also provides expression vectors or
plasmids comprising any of the nucleic acids disclosed herein. The
present disclosure also provides host cells comprising any of the
recombinant polypeptides and/or nucleic acids disclosed herein. The
present disclosure also provides pharmaceutical compositions
comprising any of the recombinant polypeptides and/or nucleic acids
disclosed herein, and a pharmaceutically acceptable carrier. In one
aspect, the pharmaceutically acceptable carrier comprises a buffer
solution comprising a NaCl concentration from about 0.4M to about
1.0M at a pH of about 7.5 to about 9.0.
[0010] The present disclosure provides a method of enhancing or
inducing an immune response in a subject in need thereof comprising
administering to the subject any of the recombinant polypeptides
and/or nucleic acids disclosed herein. The present invention
provides a method of enhancing or inducing an immune response in a
subject in need thereof comprising administering to the subject a
pharmaceutical composition comprising any of the recombinant
polypeptides and/or nucleic acids disclosed herein
[0011] In one aspect, the immune response is by immunogenic cell
death. In one aspect, the immunogenic cell death comprises
endogenous dendritic cell activation. In one aspect, the cells have
increased expression of pre-apoptotic
Damage-Associated-Molecular-Pattern (DAMP) signals comprising of
calreticulin (CRT), Heat Shock Protein 70 (HSP70), Heat Shock
Protein 90 (HSP90), or a combination thereof In one aspect, the
cell is a cancer cell. In one aspect, the cancer cell is selected
from a group comprising of lung cancer, colon cancer or breast
cancer cells.
[0012] The present disclosure provides a method of enhancing or
inducing the endogenous presentation of disease-associated antigens
on a cell surface in a subject in need thereof, comprising
administering to the subject any of the recombinant polypeptides
and/or nucleic acids disclosed herein. The present disclosure
provides a method of enhancing or inducing the endogenous
presentation of disease-associated antigens on a cell surface in a
subject in need thereof, comprising administering to the subject a
pharmaceutical composition comprising any of the recombinant
polypeptides and/or nucleic acids disclosed herein. In one aspect,
the cell is a cancer cell. In one aspect, the cancer cell is
selected from a group comprising of lung cancer, colon cancer or
breast cancer cells.
[0013] The present disclosure provides a method of treating,
preventing or alleviating at least one of the symptoms of a cell
proliferative disorder in a subject in need thereof comprising
administering to said subject a therapeutically effective amount of
any of the recombinant polypeptides and/or nucleic acids disclosed
herein. The present disclosure provides a method of treating,
preventing or alleviating at least one of the symptoms of a cell
proliferative disorder in a subject in need thereof comprising
administering to said subject a therapeutically effective amount of
a pharmaceutical composition comprising any of the recombinant
polypeptides and/or nucleic acids disclosed herein. In one aspect,
the cell proliferative disorder is a cancer. In one aspect, the
cancer is selected from a group comprising of lung cancer, colon
cancer or breast cancer.
[0014] The present disclosure also provides a kit comprising the
compositions disclosed herein for performing any of the methods
disclosed herein.
[0015] Any of the above aspects can be combined with any other
aspect.
[0016] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs.
[0017] As used herein, the singular forms of a word also include
the plural form of the word, unless the context clearly dictates
otherwise; as examples, the terms "a," "an," and "the" are
understood to be singular or plural and the term "or" is understood
to be inclusive. By way of example, "an element" means one or more
element.
[0018] Throughout the specification the word "comprising," or
variations such as "comprises," will be understood to imply the
inclusion of a stated element, integer or step, or group of
elements, integers or steps, but not the exclusion of any other
element, integer or step, or group of elements, integers or steps.
Throughout the specification the word "consisting of" or variations
such as "consists of," will be understood to imply the inclusion of
a stated element, integer or step, or group of elements, integers
or steps, and the exclusion of any other element, integer or step,
or group of elements, integers or steps. Throughout the
specification the word "consisting essentially of" or variations
such as "consists essentially of" will be understood to imply the
inclusion of a stated element, integer or step, or group of
elements, integers or steps, and any other element, integer or
step, or group of elements, integers or steps that do not
materially affect the basic and novel characteristics of the
claimed invention.
[0019] About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%,
4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value.
Unless otherwise clear from the context, all numerical values
provided herein are modified by the term "about."
[0020] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present disclosure, suitable methods and materials are
described below. All publications, patent applications, patents,
and other references mentioned herein are incorporated by reference
in their entirety. The references cited herein are not admitted to
be prior art to the claimed disclosure. In the case of conflict,
the present Specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and are not intended to be limiting. Other features and
advantages of the disclosure will be apparent from the following
detailed description and claim.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a schematic depiction of some characteristics of
immunogenic cell death. Tumor cells marked for cell death have cell
surface expression of pre-apoptotic
Damage-Associated-Molecular-Pattern (DAMP) signals such as
calreticulin (CRT), HSP70 and HSP90. Dendritic cells are activated
upon the recognition of DAMP signals. Mature dendritic cells
migrate to lymph nodes and can in turn prime CD4+ and CD8+ T-cells,
which are important for mediating immunogenic cell death.
[0022] FIG. 2 shows a graph depicting the molecular weight of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) of about 20 kDa as
determined by mass spectrometry.
[0023] FIG. 3A shows a bar graph quantifying the percentage of
cells that express CRT(Caltreticulin) following treatment of H441
human lung cancer cell lines (HTB-174, ATCC) with various
concentrations of CRYA_1B recombinant polypeptide (SEQ ID NO: 9).
The stock CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was
diluted to the final concentration of 35, 50, 75 .mu.g/ml and the
H441 cells were incubated for 1 hour at 37.degree. C. The
CRT-expressing H441 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using CRT mAb (Abcam). FIG. 3B shows
the flow cytometry profiles used for quantification.
[0024] FIG. 4A shows a bar graph quantifying the percentage of
cells that express CRT following treatment of H460 human lung
cancer cell lines (HTB-177, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 0.1, 1, 10, 25, 35, 50 .mu.g/ml and the H460 cells
were incubated for 30 minutes at 37.degree. C. The CRT-expressing
H460 cells were determined by FACSCalibur (BD Biosciences) flow
cytometry using CRT mAb (Abcam). FIG. 4B shows the flow cytometry
profiles used for quantification.
[0025] FIG. 5A shows a bar graph quantifying the percentage of
cells that express CRT following treatment of HCT15 human colon
cancer cell lines (CCL-225, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the HCT15 cells were
incubated for 55 minutes at 37.degree. C. The CRT-expressing HCT15
cells were determined by FACSCalibur (BD Biosciences) flow
cytometry using CRT mAb (Abcam). FIG. 5B shows the flow cytometry
profiles used for quantification.
[0026] FIG. 6A shows a bar graph quantifying the percentage of
cells that express CRT following treatment of MCF7 human breast
cancer cell lines (HTB-22, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the MCF7 cells were
incubated for 1 hour and 10 minutes at 37.degree. C. The
CRT-expressing MCF7 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using CRT mAb (Abeam). FIG. 6B shows
the flow cytometry profiles used for quantification.
[0027] FIG. 7A shows a bar graph quantifying the percentage of
cells that express HSP70 (70 kDa heat shock protein) following
treatment of H441 human lung cancer cell lines (HTB-174, ATCC) with
various concentrations of CRYA_1B recombinant polypeptide (SEQ ID
NO: 9). The stock CRYA_1B recombinant polypeptide (SEQ ID NO: 9)
was diluted to the final concentration of 35, 50, 75 .mu.g/ml and
the H441 cells were incubated for 1 hour and 50 minutes at
37.degree. C. The Hsp70-expressing H441 cells were determined by
FACSCalibur (BD Biosciences) flow cytometry using Hsp70 mAb (Enzo
Life Sciences). FIG. 7B shows the flow cytometry profiles used for
quantification.
[0028] FIG. 8A shows a bar graph quantifying the percentage of
cells that express HSP70 following treatment of H460 human lung
cancer cell lines (HTB-177, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 0.1, 1, 10, 25, 35, 50 .mu.g/ml and the H460 cells
were incubated for 1 hour and 15 minutes at 37.degree. C. The
Hsp70-expressing H460 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp70 mAb (Enzo Life Sciences).
FIG. 8B shows the flow cytometry profiles used for
quantification.
[0029] FIG. 9A shows a bar graph quantifying the percentage of
cells that express HSP70 following treatment of HCT15 human colon
cancer cell lines (CCL-225, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the HCT15 cells were
incubated for 1 hour and 50 minutes at 37.degree. C. The
Hsp70-expressing HCT15 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp70 mAb (Enzo Life Sciences).
FIG. 9B shows the flow cytometry profiles used for
quantification.
[0030] FIG. 10A shows a bar graph quantifying the percentage of
cells that express HSP70 following treatment of MCF7 human breast
cancer cell lines (HTB-22, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the MCF7 cells were
incubated for 1 hour and 40 minutes at 37.degree. C. The
Hsp70-expressing MCF7 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp70 mAb (Enzo Life Sciences).
FIG. 10B shows the flow cytometry profiles used for
quantification.
[0031] FIG. 11A shows a bar graph quantifying the percentage of
cells that express HSP90 (90 kDa heat shock protein) following
treatment of H441 human lung cancer cell lines (HTB-174, ATCC) with
various concentrations of CRYA_1B recombinant polypeptide (SEQ ID
NO: 9). The stock CRYA_1B recombinant polypeptide (SEQ ID NO: 9)
was diluted to the final concentration of 35, 50, 75 .mu.g/ml and
the H441 cells were incubated for 1 hour and 40 minutes at
37.degree. C. The Hsp90-expressing H441 cells were determined by
FACSCalibur (BD Biosciences) flow cytometry using Hsp90 mAb (Enzo
Life Sciences). FIG. 11B shows the flow cytometry profiles used for
quantification.
[0032] FIG. 12A shows a bar graph quantifying the percentage of
cells that express HSP90 following treatment of H460 human lung
cancer cell lines (HTB-177, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 0.1, 1, 10, 25, 35, 50 .mu.g/ml and the H460 cells
were incubated for 1 hour and 5 minutes at 37.degree. C. The
Hsp90-expressing H460 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp90 mAb (Enzo Life Sciences).
FIG. 12B shows the flow cytometry profiles used for
quantification.
[0033] FIG. 13A shows a bar graph quantifying the percentage of
cells that express HSP90 following treatment of HCT15 human colon
cancer cell lines (CCL-225, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the HCT15 cells were
incubated for 1 hour and 30 minutes at 37.degree. C. The
Hsp90-expressing HCT15 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp90 mAb (Enzo Life Sciences).
FIG. 13B shows the flow cytometry profiles used for
quantification.
[0034] FIG. 14A shows a bar graph quantifying the percentage of
cells that express HSP90 following treatment of MCF7 human breast
cancer cell lines (HTB-22, ATCC) with various concentrations of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was diluted to the final
concentration of 35, 50, 75 .mu.g/ml and the MCF7 cells were
incubated for 1 hour and 45 minutes at 37.degree. C. The
Hsp90-expressing MCF7 cells were determined by FACSCalibur (BD
Biosciences) flow cytometry using Hsp90 mAb (Enzo Life Sciences).
FIG. 14B shows the flow cytometry profiles used for
quantification.
[0035] FIG. 15A shows a bar graph quantifying the percentage of
cells that express Caspase 3/7 following treatment of H441 human
lung cancer cell lines (HTB-174, ATCC) with various concentrations
of CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was diluted to the
final concentration of 35, 50 and 75 .mu.g/ml and the H441 cells
were incubated for 2 hours and 45 minutes at 37.degree. C. The H441
cells were determined by FACSCalibur (BD Biosciences) flow
cytometry using Caspase 3/7 (Invitrogen) assay. FIG. 15B shows the
flow cytometry profiles used for quantification.
[0036] FIG. 16A shows a bar graph quantifying the percentage of
cells that express Caspase 3/7 following treatment of H460 human
lung cancer cell lines (HTB-177, ATCC) with various concentrations
of CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was diluted to the
final concentration of 0.1, 1, 10, 25, 35 and 50 .mu.g/ml and the
H460 cells were incubated for 2 hours and 45 minutes at 37.degree.
C. The H460 cells were determined by FACSCalibur (BD Biosciences)
flow cytometry using Caspase 3/7 (Invitrogen) assay. FIG. 16B shows
the flow cytometry profiles used for quantification.
[0037] FIG. 17A shows a bar graph quantifying the percentage of
cells that express Caspase 3/7 following treatment of HCT15 human
colon cancer cell lines (CCL-225, ATCC) with various concentrations
of CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was diluted to the
final concentration of 35, 50, 75 .mu.g/ml and the HCT15 cells were
incubated for 2 hours and 30 minutes at 37.degree. C. The HCT15
cells were determined by FACSCalibur (BD Biosciences) flow
cytometry using Caspase 3/7 (Invitrogen) assay. FIG. 17B shows the
flow cytometry profiles used for quantification.
[0038] FIG. 18A shows a bar graph quantifying the percentage of
cells that express Caspase 3/7 following treatment of MCF7 human
breast cancer cell lines (HTB-22, ATCC) with various concentrations
of CRYA_1B recombinant polypeptide (SEQ ID NO: 9). The stock
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was diluted to the
final concentration of 35, 50, 75 .mu.g/ml and the MCF7 cells were
incubated for 2 hours and 45 minutes at 37.degree. C. The MCF7
cells were determined by FACSCalibur (BD Biosciences) flow
cytometry using Caspase 3/7 (Invitrogen) assay. FIG. 18B shows the
flow cytometry profiles used for quantification.
DETAILED DESCRIPTION OF THE INVENTION
[0039] The present disclosure provides recombinant polypeptides,
and the nucleic acids encoding these polypeptides, pharmaceutical
compositions comprising these polypeptides and/or nucleic acids,
and methods for using these polypeptides and/or nucleic acids to
enhance or induce an immune response in a subject in need
thereof
Compositions of the Present Disclosure
[0040] The present disclosure provides recombinant polypeptides
that comprise, consist essentially of, or consist of, any of the
amino acid sequences shown in Table 1A. The present disclosure also
provides recombinant polypeptides comprising, consisting
essentially of, or consisting of, an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to any of the amino acid sequences shown in Table
1A.
[0041] The present disclosure also provides acidic recombinant
polypeptide variants that comprise, consist essentially of, or
consist of, any of the amino acid sequences shown in Table 1A,
wherein the recombinant polypeptide variant is acidic as determined
by isoelectric point (pI). The present disclosure also provides
acidic recombinant polypeptide variants comprising, consisting
essentially of, or consisting of, an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to any of the amino acid sequences shown in Table
1A.
[0042] An "acidic variant" is a variant of a polypeptide of
interest which is more acidic (e.g., as determined by calculation
of pI) than the parent or original polypeptide of interest. The
"pI" or "isoelectric point" of a polypeptide refers to the pH at
which the polypeptide's positive charge balances its negative
charge. pI can be calculated by any means known in the art, for
example, from the net charge of the amino acid residues of the
polypeptide or can be determined by isoelectric focusing.
[0043] In some aspects, an acidic variant is derived from the
original parent sequence by making amino acid substitutions. A
first mutational substitution is made by substituting any basic
amino acid (K, R or H), neutral non-polar amino acid (G, A, V, L,
I, M, F, W or P) or neutral polar amino acid (S, T, C, Y, N or Q)
of the original parent sequence with an acidic amino acid (D or E).
A second mutational substitution is made by making the inverse
mutational substitution of the first mutational substitution. For
example, all serine (S) residues from original parent sequence are
substituted with glutamic acid (E) residues (first substitution).
In addition, all glutamic acid (E) residues from the original
parent sequence are substituted with serine (S) residues (second
substitution). In one aspect, the inverse substitutions comprise,
consist essentially of or consist of the mutation of all serine (S)
residues of the original parent sequence to glutamic acid (E) and
the mutation of all glutamic acid (E) residues of original parent
sequence to serine (S) residues; the mutation of all serine (S)
residues of the original parent sequence to aspartic acid (D) and
the mutation of all aspartic acid (D) residues of the original
parent sequence to serine (S) residues; the mutation of all valine
(V) residues of the original parent sequence to aspartic acid (D)
and the mutation of all aspartic acid (D) of the original parent
sequence to valine (V) residues; or the mutation of all serine (S)
residues of the original parent sequence to leucine (L) residues
and the mutation of all leucine (L) residues of the original parent
sequence to serine (S) residues. In a preferred aspect, the amino
acid substitutions result in a recombinant polypeptide where
aspartic acid (D), glutamic acid (E) and leucine (L) are each
independently present in an amount greater than, or equal to, the
amount of any other amino acid residue present within the
recombinant polypeptide sequence. In a preferred aspect, the amino
acid substitutions result in a recombinant polypeptide with leucine
(L), aspartic acid (D) and glutamic acid (E) as the three most
abundant amino acid residues of the acidic variant or as greater
than or equal to in abundance to the next most abundant amino acid
residue of the acidic variant. In some aspects, multiple inverse
mutational substitutions of amino acids can be made.
[0044] The present disclosure also provides acidic recombinant
polypeptide variants that comprise, consist essentially of, or
consist of, any of the amino acid sequences shown in Table 1A,
wherein the recombinant polypeptide variant is acidic as determined
by isoelectric point (pI), wherein the pI of the recombinant
peptide variant is lower than the pI of peptide sequence from which
the recombinant peptide was derived, and wherein leucine (L),
aspartic acid (D) and glutamic acid (E) are each independently
present in an amount greater than, or equal to, the amount of any
other amino acid residue present within the recombinant polypeptide
sequence. The present disclosure also provides acidic recombinant
polypeptide variants that comprise, consist essentially of, or
consist of, any of the amino acid sequences shown in Table 1A,
wherein the recombinant polypeptide variant is acidic as determined
by isoelectric point (pI) and wherein leucine (L), aspartic acid
(D) and glutamic acid (E) are the three most abundant amino acid
residues of the acidic variant or are greater than or equal to in
abundance to the next most abundant amino acid residue of the
acidic variant. The present disclosure also provides acidic
recombinant polypeptide variants comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to any of the amino acid sequences shown in Table 1A.
TABLE-US-00001 TABLE 1A Recombinant Polypeptide Sequences SEQ ID
Name Amino Acid Sequence NO: Anser cygnoides MDITIQHPWFKRALGPLIPS 1
domesticus RLFDQFFGEGLLEYDLLPLF CRYAA SSTISPYYRQSLFRSVLESG
ISEVRSDRDKFTIMLDVKHF SPEDLSVKIIDDFVEIHGKH SERQDDHGYISREFHRRYRL
PANVDQSAITCSLSGDGMLT FSGPKVPSNMDPTHSERPIP VSREEKPTSAPSS Rhea
americana MDITIQHPWFKRALGPLIPS 2 CRYAA RLFDQFFGEGLLEYDLLPLF
SSTISPYYRQSLFRSVLESG ISEVRSDREKFTIMLDVKHF SPEDLSVKIIDDFVEIHGKH
SERQDDHGYISREFHRRYRL PSNVDQSAITCSLSSDGMLT FSGPKVQANMDPSHSERPIP
VSREEKPTSAPSS Anas platyrhynchos RALGPLIPSRLFDQFFGEGL 3 CRYAA
LEYDLLPLFSSTISPYYRQS LFRSVLESGISEVRSDRDKF TIMLDVKHFSPEDLSVKIID
DFVEIHGKHSERQDDHGYIS REFHRRYRLPANVDQSAITC SLSGDGMLTFSGPKVPSNMD
PTHSERPIP Anas platyrhynchos MDITIHNPLIRRPLFSWLAP 4 CRYAB
SRIFDQIFGEHLQESELLPA SPSLSPFLMRSPIFRMPSWL ETGLSEMRLEKDKFSVNLDV
KHFSPEELKVKVLGDMVEIH GKHEERQDEHGFIAREFNRK YRIPADVDPLTITSSLSLDG
VLTVSAPRKQSDVPERSIPI TREEKPAIAGAQRK Homo sapiens
MDVTIQHPWFKRTLGPFYPS 5 CRYAA RLFDQFFGEGLFEYDLLPFL
SSTISPYYRQSLFRTVLDSG ISEVRSDRDKFVIFLDVKHF SPEDLTVKVQDDFVEIHGKH
NERQDDHGYISREFHRRYRL PSNVDQSALSCSLSADGMLT FCGPKIQTGLDATHAERAIP
VSREEKPTSAPSS Drosophila MANIPLLLSLADDLGRMSMV 6 melanogaster
PFYEPYYCQRQRNPYLALVG HSP23 PMEQQLRQLEKQVGASSGSS
GAVSKIGKDGFQVCMDVSHF KPSELVVKVQDNSVLVEGNH EEREDDHGFITRHFVRRYAL
PPGYEADKVASTLSSDGVLT IKVPKPPAIEDKGNERIVQI QQVGPAHLNVKENPKEAVEQ
DNGNDK Drosophila MRSLPMFWRMAEEMARMPRL 7 melanogaster
SSPFHAFFHEPPVWSVALPR HSP22 NWQHIARWQEQELAPPATVN
KDGYKLTLDVKDYSELKVKV LDESVVLVEAKSEQQEAEQG GYSSRHFLGRYVLPDGYEAD
KVSSSLSDDGVLTISVPNPP GVQETLKEREVTIEQTGEPA KKSAEEPKDKTASQ Anser
cygnoides MDITIHNPLIRRPLFSWLAP 8 domesticus SRIFDQIFGEHLQESELLPA
CRYAB SPSLSPFLMRSPIFRMPSWL ETGLSEMRLEKDKFSVNLDV
KHFSPEELKVKVLGDMVEIH GKHEERQDEHGFIAREFNRK YRIPADVDPLTITSSLSLDG
VLTVSAPRKQSDVPERSIPI TREEKPAIAGAQRK
[0045] In a preferred aspect, the present disclosure provides
recombinant polypeptides that comprise, consist essentially of, or
consist of, any of the amino acid sequences shown in Table 1B. The
present disclosure also provides recombinant polypeptides that have
an amino acid sequence that is at least about 50%, about 55%, about
60%, about 65%, about 70%, about 75%, about 80%, about 85%, about
90%, about 91%, about 92%, about 93%, about 94%, about 95%, about
96%, about 97%, about 98% or about 99% identical to any of the
amino acid sequences shown in Table 1B.
TABLE-US-00002 TABLE 1B Recombinant Polypeptide Sequences SEQ ID
Name Amino Acid Sequence NO: CRYA_1B MDITIQHPWFKRALGPLIPE 9 Anser
cygnoides RLFDQFFGSGLLSYDLLPLF domesticus EETIEPYYRQELFREVLSEG
CRYAA IESVREDRDKFTIMLDVKHF EPSDLEVKIIDDFVSIHGKH
ESRQDDHGYIERSFHRRYRL PANVDQEAITCELEGDGMLT FEGPKVPENMDPTHESRPIP
VERSSKPTEAPEE Rhea americana MDITIQHPWFKRALGPLIPE 10 CRYAA
RLFDQFFGSGLLSYDLLPLF EETIEPYYRQELFREVLSEG IESVREDRSKFTIMLDVKHF
EPSDLEVKIIDDFVSIHGKH ESRQDDHGYIERSFHRRYRL PENVDQEAITCELEEDGMLT
FEGPKVQANMDPEHESRPIP VERSSKPTEAPEE Anas platyrhynchos
RALGPLIPERLFDQFFGSGL 11 CRYAA LSYDLLPLFEETIEPYYRQE
LFREVLSEGIESVREDRDKF TIMLDVKHFEPSDLEVKIID DFVSIHGKHESRQDDHGYIE
RSFHRRYRLPANVDQEAITC ELEGDGMLTFEGPKVPENMD PTHESRPIP Anas
platyrhynchos MSITIHNPLIRRPLFDWLAP 12 CRYAB DRIFSQIFGEHLQEDELLPA
DPDLDPFLMRDPIFRMPDWL ETGLDEMRLEKSKFDVNLSV KHFDPEELKVKVLGSMVEIH
GKHEERQSEHGFIAREFNRK YRIPASVSPLTITDDLDLSG VLTVDAPRKQDSVPERDIPI
TREEKPAIAGAQRK Homo sapiens MDVTIQHPWFKRTLGPFYPE 13 CRYAA
RLFDQFFGSGLFSYDLLPFL EETIEPYYRQELFRTVLDEG IESVREDRDKFVIFLDVKHF
EPSDLTVKVQDDFVSIHGKH NSRQDDHGYIERSFHRRYRL PENVDQEALECELEADGMLT
FCGPKIQTGLDATHASRAIP VERSSKPTEAPEE Drosophila MANIPLLLSLAVVLGRMSMD
14 melanogaster PFYEPYYCQRQRNPYLALDG HSP23 PMEQQLRQLEKQDGASSGSS
GADSKIGKVGFQDCMVDSHF KPSELDDKDQVNSDLDEGNH EEREVVHGFITRHFDRRYAL
PPGYEAVKDASTLSSVGDLT IKDPKPPAIEVKGNERIDQI QQDGPAHLNDKENPKEADEQ
VNGNVK Drosophila MRLSPMFWRMAEEMARMPRS 15 melanogaster
LLPFHAFFHEPPDWLDASPR HSP22 NWQHIARWQEQESAPPATDN
KVGYKSTSVDKVYLESKDKD SVELDDSDEAKLEQQEAEQG GYLLRHFSGRYDSPVGYEAV
KDLLLSLVVGDSTILDPNPP GDQETSKEREDTIEQTGEPA KKLAEEPKVKTALQ Anser
cygnoides MSITIHNPLIRRPLFDWLAP 16 domesticus DRIFSQIFGEHLQEDELLPA
CRYAB DPDLDPFLMRDPIFRMPDWL ETGLDEMRLEKSKFDVNLSV
KHFDPEELKVKVLGSMVEIH GKHEERQSEHGFIAREFNRK YRIPASVSPLTITDDLDLSG
VLTVDAPRKQDSVPERDIPI TREEKPAIAGAQRK
[0046] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Anser cygnoides domesticus alpha-A-crystallin (CRYAA) (GenBank
# XP_013036875.1) comprising, consisting essentially of, or
consisting of, the amino acid sequence of SEQ ID NO: 1 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 1.
[0047] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Anser cygnoides domesticus alpha-A-crystallin (CRYAA)
(GenBank # XP_013036875.1) comprising, consisting essentially of,
or consisting of, the amino acid sequence of SEQ ID NO: 1, wherein
the alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 1, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 1.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0048] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Anser cygnoides domesticus
alpha-A-crystallin (CRYAA) (GenBank # XP_013036875.1) comprising,
consisting essentially of, or consisting of, the amino acid
sequence of SEQ ID NO: 9 or a recombinant polypeptide comprising,
consisting essentially of, or consisting of, an amino acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to the amino acid sequence of SEQ ID NO:
9. For example, SEQ ID NO:9 has at least 80% sequence identity to
the polypeptide of SEQ ID NO:1, SEQ ID NO:9 is acidic as determined
by pI, the pI of SEQ ID NO:9 is lower than the pI of SEQ ID NO:1,
and aspartic acid (D), glutamic acid (E) and leucine (L) are each
independently present in an amount greater than, or equal to, the
amount of any other amino acid residue present within SED ID NO:9
(that is, glutamic acid (E) is 23 residues, leucine (L) is 15
residues, and aspartic acid (D) is 14 residues of the 173 amino
acid sequence of SEQ ID NO:9, with proline (P) (14 residues) being
the next most present amino acid residue within SEQ ID NO:9).
[0049] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Rhea Americana alpha-A-crystallin (CRYAA) (GenBank # P02505.1)
comprising, consisting essentially of, or consisting of, the amino
acid sequence of SEQ ID NO: 2 or a recombinant polypeptide
comprising, consisting essentially of, or consisting of, an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to the amino acid
sequence of SEQ ID NO: 2.
[0050] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Rhea Americana alpha-A-crystallin (CRYAA) (GenBank #
P02505.1) comprising, consisting essentially of, or consisting of,
the amino acid sequence of SEQ ID NO: 2, wherein the alpha
crystallin recombinant polypeptide variant is acidic as determined
by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 2, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 2.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0051] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Rhea Americana alpha-A-crystallin
(CRYAA) (GenBank # P02505.1) comprising, consisting essentially of,
or consisting of, the amino acid sequence of SEQ ID NO: 10 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 10. For example, SEQ ID
NO:10 has at least 75% sequence identity to the polypeptide of SEQ
ID NO:2, SEQ ID NO:10 is acidic as determined by pI, the pI of SEQ
ID NO:10 is lower than the pI of SEQ ID NO:2, and aspartic acid
(D), glutamic acid (E) and leucine (L) are each independently
present in an amount greater than, or equal to, the amount of any
other amino acid residue present within SED ID NO:10.
[0052] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Anas platyrhynchos alpha-A-crystallin (CRYAA) (GenBank #
012984.1) comprising, consisting essentially of, consisting of, the
amino acid sequence of SEQ ID NO: 3 or a recombinant polypeptide
comprising, consisting essentially of, consisting of, an amino acid
sequence that is at least about 50%, about 55%, about 60%, about
65%, about 70%, about 75%, about 80%, about 85%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98% or about 99% identical to the amino acid sequence of
SEQ ID NO: 3.
[0053] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Anas platyrhynchos alpha-A-crystallin (CRYAA) (GenBank
# O12984.1) comprising, consisting essentially of, or consisting
of, the amino acid sequence of SEQ ID NO: 3, wherein the alpha
crystallin recombinant polypeptide variant is acidic as determined
by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 3, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 3.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0054] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Anas platyrhynchos alpha-A-crystallin
(CRYAA) (GenBank # O12984.1) comprising, consisting essentially of,
or consisting of, the amino acid sequence of SEQ ID NO: 11 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 11. For example, SEQ ID
NO:11 has at least 80% sequence identity to the polypeptide of SEQ
ID NO:3, SEQ ID NO:11 is acidic as determined by pI, the pI of SEQ
ID NO:11 is lower than the pI of SEQ ID NO:3, and aspartic acid
(D), glutamic acid (E) and leucine (L) are each independently
present in an amount greater than, or equal to, the amount of any
other amino acid residue present within SED ID NO:11.
[0055] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Anas platyrhynchos alpha-B-crystallin (CRYAB) (GenBank #
Q05557.1) comprising, consisting essentially of, consisting of, the
amino acid sequence of SEQ ID NO: 4 or a recombinant polypeptide
comprising, consisting essentially of, consisting of, an amino acid
sequence that is at least about 50%, about 55%, about 60%, about
65%, about 70%, about 75%, about 80%, about 85%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98% or about 99% identical to the amino acid sequence of
SEQ ID NO: 4.
[0056] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Anas platyrhynchos alpha-B-crystallin (CRYAB) (GenBank
# Q05557.1) comprising, consisting essentially of, or consisting
of, the amino acid sequence of SEQ ID NO: 4, wherein the alpha
crystallin recombinant polypeptide variant is acidic as determined
by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 4, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 4.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0057] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Anas platyrhynchos alpha-B-crystallin
(CRYAB) (GenBank # Q05557.1) comprising, consisting essentially of,
or consisting of, the amino acid sequence of SEQ ID NO: 12 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 12. For example, SEQ ID
NO:12 has at least 80% sequence identity to the polypeptide of SEQ
ID NO:4, SEQ ID NO:12 is acidic as determined by pI, the pI of SEQ
ID NO:12 is lower than the pI of SEQ ID NO:4, and aspartic acid
(D), glutamic acid (E) and leucine (L) are each independently
present in an amount greater than, or equal to, the amount of any
other amino acid residue present within SED ID NO:12.
[0058] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Homo sapiens alpha-A-crystallin (CRYAA) (GenBank # AAH69528.1)
comprising, consisting essentially of, or consisting of, the amino
acid sequence of SEQ ID NO: 5 or a recombinant polypeptide
comprising, consisting essentially of, or consisting of, an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to the amino acid
sequence of SEQ ID NO: 5.
[0059] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Homo sapiens alpha-A-crystallin (CRYAA) (GenBank #
AAH69528.1) comprising, consisting essentially of, or consisting
of, the amino acid sequence of SEQ ID NO: 5, wherein the alpha
crystallin recombinant polypeptide variant is acidic as determined
by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 5, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 5.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0060] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Homo sapiens alpha-A-crystallin (CRYAA)
(GenBank # AAH69528.1) comprising, consisting essentially of, or
consisting of, the amino acid sequence of SEQ ID NO: 13 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 13. For example, SEQ ID
NO:13 has at least 80% sequence identity to the polypeptide of SEQ
ID NO:5, SEQ ID NO:13 is acidic as determined by pI, the pI of SEQ
ID NO:13 is lower than the pI of SEQ ID NO:5, and aspartic acid
(D), glutamic acid (E) and leucine (L) are each independently
present in an amount greater than, or equal to, the amount of any
other amino acid residue present within SED ID NO:13.
[0061] The present disclosure provides an HSP23 recombinant
polypeptide sequence or amino acid sequence derived from Drosophila
melanogaster HSP23 (GenBank # AAA28637.1) comprising, consisting
essentially of, or consisting of, the amino acid sequence of SEQ ID
NO: 6 or a recombinant polypeptide comprising, consisting
essentially of, or consisting of, an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to the amino acid sequence of SEQ ID NO: 6.
[0062] The present disclosure provides an HSP23 recombinant
polypeptide variant sequence or amino acid sequence derived from
Drosophila melanogaster HSP23 (GenBank # AAA28637.1) comprising,
consisting essentially of, or consisting of, the amino acid
sequence of SEQ ID NO: 6, wherein the HSP23 recombinant polypeptide
variant is acidic as determined by isoelectric point (pI), or an
acidic HSP23 recombinant polypeptide variant comprising, consisting
essentially of, or consisting of, an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to the amino acid sequence of SEQ ID NO: 6, wherein
the HSP23 recombinant polypeptide variant is acidic as determined
by isoelectric point (pI). In some aspects, the pI of the
recombinant polypeptide is lower than the pI of SEQ ID NO: 6. In
some aspects, leucine (L), aspartic acid (D) and glutamic acid (E)
are each independently present in an amount greater than, or equal
to, the amount of any other amino acid residue present within the
recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic HSP23 recombinant polypeptide
variant or are greater than or equal to in abundance to the next
most abundant amino acid residue of the acidic HSP23 recombinant
polypeptide variant.
[0063] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Drosophila melanogaster HSP23 (GenBank
# AAA28637.1) comprising, consisting essentially of, or consisting
of, the amino acid sequence of SEQ ID NO: 14 or a recombinant
polypeptide comprising, consisting essentially of, or consisting
of, an amino acid sequence that is at least about 50%, about 55%,
about 60%, about 65%, about 70%, about 75%, about 80%, about 85%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98% or about 99% identical to the amino
acid sequence of SEQ ID NO: 14. For example, SEQ ID NO:14 has at
least 80% sequence identity to the polypeptide of SEQ ID NO:6, SEQ
ID NO:14 is acidic as determined by pI, the pI of SEQ ID NO:14 is
lower than the pI of SEQ ID NO:6, and aspartic acid (D), glutamic
acid (E) and leucine (L) are each independently present in an
amount greater than, or equal to, the amount of any other amino
acid residue present within SED ID NO:14.
[0064] The present disclosure provides an HSP22 recombinant
polypeptide sequence or amino acid sequence derived from Drosophila
melanogaster HSP22 (GenBank # AAA28635.1) comprising, consisting
essentially of, or consisting of, the amino acid sequence of SEQ ID
NO: 7 or a recombinant polypeptide having an amino acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to the amino acid sequence of SEQ ID NO:
7.
[0065] The present disclosure provides an acidic HSP22 recombinant
polypeptide variant sequence or amino acid sequence derived from
Drosophila melanogaster HSP22 (GenBank # AAA28635.1) comprising,
consisting essentially of, or consisting of, the amino acid
sequence of SEQ ID NO: 7, wherein the HSP22 recombinant polypeptide
variant is acidic as determined by isoelectric point (pI), or an
acidic HSP22 recombinant polypeptide variant comprising, consisting
essentially of, or consisting of, an amino acid sequence that is at
least about 50%, about 55%, about 60%, about 65%, about 70%, about
75%, about 80%, about 85%, about 90%, about 91%, about 92%, about
93%, about 94%, about 95%, about 96%, about 97%, about 98% or about
99% identical to the amino acid sequence of SEQ ID NO: 7, wherein
the HSP22 recombinant polypeptide variant is acidic as determined
by isoelectric point (pI). In some aspects, the pI of the
recombinant polypeptide is lower than the pI of SEQ ID NO: 7. In
some aspects, leucine (L), aspartic acid (D) and glutamic acid (E)
are each independently present in an amount greater than, or equal
to, the amount of any other amino acid residue present within the
recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic HSP22 recombinant polypeptide
variant or are greater than or equal to in abundance to the next
most abundant amino acid residue of the acidic HSP22 recombinant
polypeptide variant.
[0066] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Drosophila melanogaster HSP22 (GenBank
# AAA28635.1) comprising, consisting essentially of, or consisting
of, the amino acid sequence of SEQ ID NO: 15 or a recombinant
polypeptide comprising, consisting essentially of, or consisting
of, an amino acid sequence that is at least about 50%, about 55%,
about 60%, about 65%, about 70%, about 75%, about 80%, about 85%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98% or about 99% identical to the amino
acid sequence of SEQ ID NO: 15. For example, SEQ ID NO:15 has at
least 65% sequence identity to the polypeptide of SEQ ID NO:7, SEQ
ID NO:15 is acidic as determined by pI, the pI of SEQ ID NO:15 is
lower than the pI of SEQ ID NO:7, and aspartic acid (D), glutamic
acid (E) and leucine (L) are each independently present in an
amount greater than, or equal to, the amount of any other amino
acid residue present within SED ID NO:15.
[0067] The present disclosure provides an alpha crystallin
recombinant polypeptide sequence or amino acid sequence derived
from Anser cygnoides domesticus alpha-B-crystallin (CRYAB) (GenBank
# XP_013042703.1) comprising, consisting essentially of, or
consisting of, the amino acid sequence of SEQ ID NO: 8 or a
recombinant polypeptide comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to the amino acid sequence of SEQ ID NO: 8.
[0068] The present disclosure provides an acidic alpha crystallin
recombinant polypeptide variant sequence or amino acid sequence
derived from Anser cygnoides domesticus alpha-B-crystallin (CRYAB)
(GenBank # XP_013042703.1) comprising, consisting essentially of,
or consisting of, the amino acid sequence of SEQ ID NO: 8, wherein
the alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI), or an acidic alpha crystallin
recombinant polypeptide variant comprising, consisting essentially
of, or consisting of, an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to the amino acid sequence of SEQ ID NO: 8, wherein the
alpha crystallin recombinant polypeptide variant is acidic as
determined by isoelectric point (pI). In some aspects, the pI of
the recombinant polypeptide is lower than the pI of SEQ ID NO: 8.
In some aspects, leucine (L), aspartic acid (D) and glutamic acid
(E) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
the recombinant polypeptide sequence. In some aspects, leucine (L),
aspartic acid (D) and glutamic acid (E) are the three most abundant
amino acid residues in the acidic alpha crystallin recombinant
polypeptide variant or are greater than or equal to in abundance to
the next most abundant amino acid residue of the acidic alpha
crystallin recombinant polypeptide variant.
[0069] In a preferred aspect, the recombinant polypeptide is an
acidic variant derived from Anser cygnoides domesticus
alpha-B-crystallin (CRYAB) (GenBank # XP 013042703.1) comprising,
consisting essentially of, or consisting of, the amino acid
sequence of SEQ ID NO: 16 or a recombinant polypeptide comprising,
consisting essentially of, or consisting of, an amino acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to the amino acid sequence of SEQ ID NO:
16. For example, SEQ ID NO:16 has at least 80% sequence identity to
the polypeptide of SEQ ID NO:8, SEQ ID NO:16 is acidic as
determined by pI, the pI of SEQ ID NO:16 is lower than the pI of
SEQ ID NO:8, and aspartic acid (D), glutamic acid (E) and leucine
(L) are each independently present in an amount greater than, or
equal to, the amount of any other amino acid residue present within
SED ID NO:16.
[0070] The present disclosure provides an isolated nucleic acid
molecule encoding a recombinant polypeptide that comprises,
consists essentially of, or consists of, any of the amino acid
sequences shown in Table 1A. The present disclosure also provides
isolated nucleic acid molecules encoding recombinant polypeptides
comprising, consisting essentially of, or consisting of, an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to any of the amino
acid sequences shown in Table 1A.
[0071] The present disclosure also provides an isolated nucleic
acid molecule encoding a recombinant polypeptide variant that
comprises, consists essentially of, or consists of, any of the
amino acid sequences shown in Table 1A, wherein the recombinant
polypeptide variant is acidic as determined by isoelectric point
(pI). The present disclosure also provides isolated nucleic acid
molecules encoding a recombinant polypeptide variants comprising,
consisting essentially of, or consisting of, an amino acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to any of the amino acid sequences shown
in Table 1A.
[0072] The present disclosure also provides isolated nucleic acid
molecules encoding acidic recombinant polypeptide variants that
comprise, consist essentially of, or consist of, any of the amino
acid sequences shown in Table 1A, wherein the recombinant
polypeptide variant is acidic as determined by isoelectric point
(pI), wherein the pI of the recombinant peptide variant is lower
than the pI of peptide sequence from which the recombinant peptide
was derived, and wherein leucine (L), aspartic acid (D) and
glutamic acid (E) are each independently present in an amount
greater than, or equal to, the amount of any other amino acid
residue present within the recombinant polypeptide sequence. The
present disclosure also provides isolated nucleic acid molecules
encoding acidic recombinant polypeptide variants that comprise,
consist essentially of, or consist of, any of the amino acid
sequences shown in Table 1A, wherein the recombinant polypeptide
variant is acidic as determined by isoelectric point (pI) and
wherein leucine (L), aspartic acid (D) and glutamic acid (E) are
the three most abundant amino acid sequences of the acidic variant
or are greater than or equal to in abundance to the next most
abundant amino acid residue of the acidic alpha crystallin
recombinant polypeptide variant. The present disclosure also
provides isolated nucleic acid molecules encoding acid recombinant
polypeptide variants comprising, consisting essentially of, or
consisting of, an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to any of the amino acid sequences shown in Table 1A.
[0073] The present disclosure also provides isolated nucleic acid
molecules that comprise, consist essentially of, or consist of, any
of the nucleic acid sequences shown in Table 2A. The present
disclosure also provides nucleic acid molecules comprising,
consisting essentially of, or consisting of, a nucleic acid
sequence that is at least about 50%, about 55%, about 60%, about
65%, about 70%, about 75%, about 80%, about 85%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98% or about 99% identical to any of the nucleic acid
sequences shown in Table 2A.
TABLE-US-00003 TABLE 2A Nucleic Acid Sequences SEQ ID Name Nucleic
Acid Sequence NO: Anser cygnoides ATGGATATTACCATTCAGCA 17
domesticus TCCGTGGTTTAAACGCGCGC CRYAA TGGGCCCGCTGATTCCGAGC
CGCCTGTTTGATCAGTTTTT TGGCGAAGGCCTGCTGGAAT ATGATCTGCTGCCGCTGTTT
AGCAGCACCATTAGCCCGTA TTATCGCCAGAGCCTGTTTC GCAGCGTGCTGGAAAGCGGC
ATTAGCGAAGTGCGCAGCGA TCGCGATAAATTTACCATTA TGCTGGATGTGAAACATTTT
AGCCCGGAAGATCTGAGCGT GAAAATTATTGATGATTTTG TGGAAATTCATGGCAAACAT
AGCGAACGCCAGGATGATCA TGGCTATATTAGCCGCGAAT TTCATCGCCGCTATCGCCTG
CCGGCGAACGTGGATCAGAG CGCGATTACCTGCAGCCTGA GCGGCGATGGCATGCTGACC
TTTAGCGGCCCGAAAGTGCC GAGCAACATGGATCCGACCC ATAGCGAACGCCCGATTCCG
GTGAGCCGCGAAGAAAAACC GACCAGCGCGCCGAGCAGC Rhea americana
ATGGATATTACCATTCAGCA 18 CRYAA TCCGTGGTTTAAACGCGCGC
TGGGCCCGCTGATTCCGAGC CGCCTGTTTGATCAGTTTTT TGGCGAAGGCCTGCTGGAAT
ATGATCTGCTGCCGCTGTTT AGCAGCACCATTAGCCCGTA TTATCGCCAGAGCCTGTTTC
GCAGCGTGCTGGAAAGCGGC ATTAGCGAAGTGCGCAGCGA TCGCGAAAAATTTACCATTA
TGCTGGATGTGAAACATTTT AGCCCGGAAGATCTGAGCGT GAAAATTATTGATGATTTTG
TGGAAATTCATGGCAAACAT AGCGAACGCCAGGATGATCA TGGCTATATTAGCCGCGAAT
TTCATCGCCGCTATCGCCTG CCGAGCAACGTGGATCAGAG CGCGATTACCTGCAGCCTGA
GCAGCGATGGCATGCTGACC TTTAGCGGCCCGAAAGTGCA GGCGAACATGGATCCGAGCC
ATAGCGAACGCCCGATTCCG GTGAGCCGCGAAGAAAAACC GACCAGCGCGCCGAGCAGC Anas
platyrhynchos CGCGCGCTGGGCCCGCTGAT 19 CRYAA TCCGAGCCGCCTGTTTGATC
AGTTTTTTGGCGAAGGCCTG CTGGAATATGATCTGCTGCC GCTGTTTAGCAGCACCATTA
GCCCGTATTATCGCCAGAGC CTGTTTCGCAGCGTGCTGGA AAGCGGCATTAGCGAAGTGC
GCAGCGATCGCGATAAATTT ACCATTATGCTGGATGTGAA ACATTTTAGCCCGGAAGATC
TGAGCGTGAAAATTATTGAT GATTTTGTGGAAATTCATGG CAAACATAGCGAACGCCAGG
ATGATCATGGCTATATTAGC CGCGAATTTCATCGCCGCTA TCGCCTGCCGGCGAACGTGG
ATCAGAGCGCGATTACCTGC AGCCTGAGCGGCGATGGCAT GCTGACCTTTAGCGGCCCGA
AAGTGCCGAGCAACATGGAT CCGACCCATAGCGAACGCCC GATTCCG Anas
platyrhynchos ATGGATATTACCATTCATAA 20 CRYAB CCCGCTGATTCGCCGCCCGC
TGTTTAGCTGGCTGGCGCCG AGCCGCATTTTTGATCAGAT TTTTGGCGAACATCTGCAGG
AAAGCGAACTGCTGCCGGCG AGCCCGAGCCTGAGCCCGTT TCTGATGCGCAGCCCGATTT
TTCGCATGCCGAGCTGGCTG GAAACCGGCCTGAGCGAAAT GCGCCTGGAAAAAGATAAAT
TTAGCGTGAACCTGGATGTG AAACATTTTAGCCCGGAAGA ACTGAAAGTGAAAGTGCTGG
GCGATATGGTGGAAATTCAT GGCAAACATGAAGAACGCCA GGATGAACATGGCTTTATTG
CGCGCGAATTTAACCGCAAA TATCGCATTCCGGCGGATGT GGATCCGCTGACCATTACCA
GCAGCCTGAGCCTGGATGGC GTGCTGACCGTGAGCGCGCC GCGCAAACAGAGCGATGTGC
CGGAACGCAGCATTCCGATT ACCCGCGAAGAAAAACCGGC GATTGCGGGCGCGCAGCGCA AA
Homo sapiens ATGGATGTGACCATTCAGCA 21 CRYAA TCCGTGGTTTAAACGCACCC
TGGGCCCGTTTTATCCGAGC CGCCTGTTTGATCAGTTTTT TGGCGAAGGCCTGTTTGAAT
ATGATCTGCTGCCGTTTCTG AGCAGCACCATTAGCCCGTA TTATCGCCAGAGCCTGTTTC
GCACCGTGCTGGATAGCGGC ATTAGCGAAGTGCGCAGCGA TCGCGATAAATTTGTGATTT
TTCTGGATGTGAAACATTTT AGCCCGGAAGATCTGACCGT GAAAGTGCAGGATGATTTTG
TGGAAATTCATGGCAAACAT AACGAACGCCAGGATGATCA TGGCTATATTAGCCGCGAAT
TTCATCGCCGCTATCGCCTG CCGAGCAACGTGGATCAGAG CGCGCTGAGCTGCAGCCTGA
GCGCGGATGGCATGCTGACC TTTTGCGGCCCGAAAATTCA GACCGGCCTGGATGCGACCC
ATGCGGAACGCGCGATTCCG GTGAGCCGCGAAGAAAAACC GACCAGCGCGCCGAGCAGC
Drosophila ATGGCGAACATTCCGCTGCT 22 melanogaster
GCTGAGCCTGGCGGATGATC HSP23 TGGGCCGCATGAGCATGGTG
CCGTTTTATGAACCGTATTA TTGCCAGCGCCAGCGCAACC CGTATCTGGCGCTGGTGGGC
CCGATGGAACAGCAGCTGCG CCAGCTGGAAAAACAGGTGG GCGCGAGCAGCGGCAGCAGC
GGCGCGGTGAGCAAAATTGG CAAAGATGGCTTTCAGGTGT GCATGGATGTGAGCCATTTT
AAACCGAGCGAACTGGTGGT GAAAGTGCAGGATAACAGCG TGCTGGTGGAAGGCAACCAT
GAAGAACGCGAAGATGATCA TGGCTTTATTACCCGCCATT TTGTGCGCCGCTATGCGCTG
CCGCCGGGCTATGAAGCGGA TAAAGTGGCGAGCACCCTGA GCAGCGATGGCGTGCTGACC
ATTAAAGTGCCGAAACCGCC GGCGATTGAAGATAAAGGCA ACGAACGCATTGTGCAGATT
CAGCAGGTGGGCCCGGCGCA TCTGAACGTGAAAGAAAACC CGAAAGAAGCGGTGGAACAG
GATAACGGCAACGATAAA Drosophila ATGCGCAGCCTGCCGATGTT 23 melanogaster
TTGGCGCATGGCGGAAGAAA HSP22 TGGCGCGCATGCCGCGCCTG
AGCAGCCCGTTTCATGCGTT TTTTCATGAACCGCCGGTGT GGAGCGTGGCGCTGCCGCGC
AACTGGCAGCATATTGCGCG CTGGCAGGAACAGGAACTGG CGCCGCCGGCGACCGTGAAC
AAAGATGGCTATAAACTGAC CCTGGATGTGAAAGATTATA GCGAACTGAAAGTGAAAGTG
CTGGATGAAAGCGTGGTGCT GGTGGAAGCGAAAAGCGAAC AGCAGGAAGCGGAACAGGGC
GGCTATAGCAGCCGCCATTT TCTGGGCCGCTATGTGCTGC CGGATGGCTATGAAGCGGAT
AAAGTGAGCAGCAGCCTGAG CGATGATGGCGTGCTGACCA TTAGCGTGCCGAACCCGCCG
GGCGTGCAGGAAACCCTGAA AGAACGCGAAGTGACCATTG AACAGACCGGCGAACCGGCG
AAAAAAAGCGCGGAAGAACC GAAAGATAAAACCGCGAGCCAG Anser cygnoides
ATGGATATTACCATTCATAA 24 domesticus CCCGCTGATTCGCCGCCCGC CRYAB
TGTTTAGCTGGCTGGCGCCG AGCCGCATTTTTGATCAGAT TTTTGGCGAACATCTGCAGG
AAAGCGAACTGCTGCCGGCG AGCCCGAGCCTGAGCCCGTT TCTGATGCGCAGCCCGATTT
TTCGCATGCCGAGCTGGCTG GAAACCGGCCTGAGCGAAAT GCGCCTGGAAAAAGATAAAT
TTAGCGTGAACCTGGATGTG AAACATTTTAGCCCGGAAGA ACTGAAAGTGAAAGTGCTGG
GCGATATGGTGGAAATTCAT GGCAAACATGAAGAACGCCA GGATGAACATGGCTTTATTG
CGCGCGAATTTAACCGCAAA TATCGCATTCCGGCGGATGT GGATCCGCTGACCATTACCA
GCAGCCTGAGCCTGGATGGC GTGCTGACCGTGAGCGCGCC GCGCAAACAGAGCGATGTGC
CGGAACGCAGCATTCCGATT ACCCGCGAAGAAAAACCGGC GATTGCGGGCGCGCAGCGCA
AA
[0074] In a preferred aspect, the present disclosure provides
isolated nucleic acid molecules that comprise, consist essentially
of, or consist of, any of the nucleic acid sequences shown in Table
2B. The present disclosure also provides nucleic acid molecules
comprising, consisting essentially of, or consisting of, a nucleic
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to any of the nucleic
acid sequences shown in Table 2B.
TABLE-US-00004 TABLE 2B Nucleic Acid Sequences SEQ ID Name Nucleic
Acid Sequence NO: CRYA_1B ATGGATATTACCATTCAGCA 25 Anser cygnoides
TCCGTGGTTTAAACGCGCGC domesticus TGGGCCCGCTGATTCCGGAA CRYAA
CGCCTGTTTGATCAGTTTTT TGGCAGCGGCCTGCTGAGCT ATGATCTGCTGCCGCTGTTT
GAAGAAACCATTGAACCGTA TTATCGCCAGGAACTGTTTC GCGAAGTGCTGAGCGAAGGC
ATTGAAAGCGTGCGCGAAGA TCGCGATAAATTTACCATTA TGCTGGATGTGAAACATTTT
GAACCGAGCGATCTGGAAGT GAAAATTATTGATGATTTTG TGAGCATTCATGGCAAACAT
GAAAGCCGCCAGGATGATCA TGGCTATATTGAACGCAGCT TTCATCGCCGCTATCGCCTG
CCGGCGAACGTGGATCAGGA AGCGATTACCTGCGAACTGG AAGGCGATGGCATGCTGACC
TTTGAAGGCCCGAAAGTGCC GGAAAACATGGATCCGACCC ATGAAAGCCGCCCGATTCCG
GTGGAACGCAGCAGCAAACC GACCGAAGCGCCGGAAGAA Rhea americana
ATGGATATTACCATTCAGCA 26 CRYAA TCCGTGGTTTAAACGCGCGC
TGGGCCCGCTGATTCCGGAA CGCCTGTTTGATCAGTTTTT TGGCAGCGGCCTGCTGAGCT
ATGATCTGCTGCCGCTGTTT GAAGAAACCATTGAACCGTA TTATCGCCAGGAACTGTTTC
GCGAAGTGCTGAGCGAAGGC ATTGAAAGCGTGCGCGAAGA TCGCAGCAAATTTACCATTA
TGCTGGATGTGAAACATTTT GAACCGAGCGATCTGGAAGT GAAAATTATTGATGATTTTG
TGAGCATTCATGGCAAACAT GAAAGCCGCCAGGATGATCA TGGCTATATTGAACGCAGCT
TTCATCGCCGCTATCGCCTG CCGGAAAACGTGGATCAGGA AGCGATTACCTGCGAACTGG
AAGAAGATGGCATGCTGACC TTTGAAGGCCCGAAAGTGCA GGCGAACATGGATCCGGAAC
ATGAAAGCCGCCCGATTCCG GTGGAACGCAGCAGCAAACC GACCGAAGCGCCGGAAGAA Anas
platyrhynchos CGCGCGCTGGGCCCGCTGAT 27 CRYAA TCCGGAACGCCTGTTTGATC
AGTTTTTTGGCAGCGGCCTG CTGAGCTATGATCTGCTGCC GCTGTTTGAAGAAACCATTG
AACCGTATTATCGCCAGGAA CTGTTTCGCGAAGTGCTGAG CGAAGGCATTGAAAGCGTGC
GCGAAGATCGCGATAAATTT ACCATTATGCTGGATGTGAA ACATTTTGAACCGAGCGATC
TGGAAGTGAAAATTATTGAT GATTTTGTGAGCATTCATGG CAAACATGAAAGCCGCCAGG
ATGATCATGGCTATATTGAA CGCAGCTTTCATCGCCGCTA TCGCCTGCCGGCGAACGTGG
ATCAGGAAGCGATTACCTGC GAACTGGAAGGCGATGGCAT GCTGACCTTTGAAGGCCCGA
AAGTGCCGGAAAACATGGAT CCGACCCATGAAAGCCGCCC GATTCCG Anas
platyrhynchos ATGAGCATTACCATTCATAA 28 CRYAB CCCGCTGATTCGCCGCCCGC
TGTTTGATTGGCTGGCGCCG GATCGCATTTTTAGCCAGAT TTTTGGCGAACATCTGCAGG
AAGATGAACTGCTGCCGGCG GATCCGGATCTGGATCCGTT TCTGATGCGCGATCCGATTT
TTCGCATGCCGGATTGGCTG GAAACCGGCCTGGATGAAAT GCGCCTGGAAAAAAGCAAAT
TTGATGTGAACCTGAGCGTG AAACATTTTGATCCGGAAGA ACTGAAAGTGAAAGTGCTGG
GCAGCATGGTGGAAATTCAT GGCAAACATGAAGAACGCCA GAGCGAACATGGCTTTATTG
CGCGCGAATTTAACCGCAAA TATCGCATTCCGGCGAGCGT GAGCCCGCTGACCATTACCG
ATGATCTGGATCTGAGCGGC GTGCTGACCGTGGATGCGCC GCGCAAACAGGATAGCGTGC
CGGAACGCGATATTCCGATT ACCCGCGAAGAAAAACCGGC GATTGCGGGCGCGCAGCGCA AA
Homo sapiens ATGGATGTGACCATTCAGCA 29 CRYAA TCCGTGGTTTAAACGCACCC
TGGGCCCGTTTTATCCGGAA CGCCTGTTTGATCAGTTTTT TGGCAGCGGCCTGTTTAGCT
ATGATCTGCTGCCGTTTCTG GAAGAAACCATTGAACCGTA TTATCGCCAGGAACTGTTTC
GCACCGTGCTGGATGAAGGC ATTGAAAGCGTGCGCGAAGA TCGCGATAAATTTGTGATTT
TTCTGGATGTGAAACATTTT GAACCGAGCGATCTGACCGT GAAAGTGCAGGATGATTTTG
TGAGCATTCATGGCAAACAT AACAGCCGCCAGGATGATCA TGGCTATATTGAACGCAGCT
TTCATCGCCGCTATCGCCTG CCGGAAAACGTGGATCAGGA AGCGCTGGAATGCGAACTGG
AAGCGGATGGCATGCTGACC TTTTGCGGCCCGAAAATTCA GACCGGCCTGGATGCGACCC
ATGCGAGCCGCGCGATTCCG GTGGAACGCAGCAGCAAACC GACCGAAGCGCCGGAAGAA
Drosophila ATGGCGAACATTCCGCTGCT 30 melanogaster
GCTGAGCCTGGCGGTGGTGC HSP23 TGGGCCGCATGAGCATGGAT
CCGTTTTATGAACCGTATTA TTGCCAGCGCCAGCGCAACC CGTATCTGGCGCTGGATGGC
CCGATGGAACAGCAGCTGCG CCAGCTGGAAAAACAGGATG GCGCGAGCAGCGGCAGCAGC
GGCGCGGATAGCAAAATTGG CAAAGTGGGCTTTCAGGATT GCATGGTGGATAGCCATTTT
AAACCGAGCGAACTGGATGA TAAAGATCAGGTGAACAGCG ATCTGGATGAAGGCAACCAT
GAAGAACGCGAAGTGGTGCA TGGCTTTATTACCCGCCATT TTGATCGCCGCTATGCGCTG
CCGCCGGGCTATGAAGCGGT GAAAGATGCGAGCACCCTGA GCAGCGTGGGCGATCTGACC
ATTAAAGATCCGAAACCGCC GGCGATTGAAGTGAAAGGCA ACGAACGCATTGATCAGATT
CAGCAGGATGGCCCGGCGCA TCTGAACGATAAAGAAAACC CGAAAGAAGCGGATGAACAG
GTGAACGGCAACGTGAAA Drosophila ATGCGCCTGAGCCCGATGTT 31 melanogaster
TTGGCGCATGGCGGAAGAAA HSP22 TGGCGCGCATGCCGCGCAGC
CTGCTGCCGTTTCATGCGTT TTTTCATGAACCGCCGGATT GGCTGGATGCGAGCCCGCGC
AACTGGCAGCATATTGCGCG CTGGCAGGAACAGGAAAGCG CGCCGCCGGCGACCGATAAC
AAAGTGGGCTATAAAAGCAC CAGCGTGGATAAAGTGTATC TGGAAAGCAAAGATAAAGAT
AGCGTGGAACTGGATGATAG CGATGAAGCGAAACTGGAAC AGCAGGAAGCGGAACAGGGC
GGCTATCTGCTGCGCCATTT TAGCGGCCGCTATGATAGCC CGGTGGGCTATGAAGCGGTG
AAAGATCTGCTGCTGAGCCT GGTGGTGGGCGATAGCACCA TTCTGGATCCGAACCCGCCG
GGCGATCAGGAAACCAGCAA AGAACGCGAAGATACCATTG AACAGACCGGCGAACCGGCG
AAAAAACTGGCGGAAGAACC GAAAGTGAAAACCGCGCTGCAG Anser cygnoides
ATGAGCATTACCATTCATAA 32 domesticus CCCGCTGATTCGCCGCCCGC CRYAB
TGTTTGATTGGCTGGCGCCG GATCGCATTTTTAGCCAGAT TTTTGGCGAACATCTGCAGG
AAGATGAACTGCTGCCGGCG GATCCGGATCTGGATCCGTT TCTGATGCGCGATCCGATTT
TTCGCATGCCGGATTGGCTG GAAACCGGCCTGGATGAAAT GCGCCTGGAAAAAAGCAAAT
TTGATGTGAACCTGAGCGTG AAACATTTTGATCCGGAAGA ACTGAAAGTGAAAGTGCTGG
GCAGCATGGTGGAAATTCAT GGCAAACATGAAGAACGCCA GAGCGAACATGGCTTTATTG
CGCGCGAATTTAACCGCAAA TATCGCATTCCGGCGAGCGT GAGCCCGCTGACCATTACCG
ATGATCTGGATCTGAGCGGC GTGCTGACCGTGGATGCGCC GCGCAAACAGGATAGCGTGC
CGGAACGCGATATTCCGATT ACCCGCGAAGAAAAACCGGC
GATTGCGGGCGCGCAGCGCAAA
[0075] The present disclosure also provides pharmaceutical
compositions comprising the recombinant polypeptides or nucleic
acids disclosed herein.
[0076] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (topical), and transmucosal administration. Solutions
or suspensions used for parenteral, intradermal, or subcutaneous
application can include the following components: a sterile diluent
such as water for injection, saline solution, fixed oils,
polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfate; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates, and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
The pH can be adjusted with acids or bases, such as hydrochloric
acid or sodium hydroxide. The parenteral preparation can be
enclosed in ampoules, disposable syringes or multiple dose vials
made of glass or plastic.
[0077] In one aspect, the pharmaceutical composition can comprise,
consist essentially of, or consist of any one of the recombinant
polypeptides disclosed herein in a pharmaceutically acceptable
carrier. In some aspects, the pharmaceutical composition is
formulated as an aqueous formulation. The aqueous formulation can
comprise, consist essentially of, or consist of a salt buffer that
may be selected from, but is not limited to, NaCl, KCl, and NaOAc.
In a preferred aspect, the salt buffer comprises NaCl. In a more
preferred aspect, the NaCl is at a concentration from about 0.4M to
about 1.0M. In one aspect, the pH of the buffer solution is between
about 7.5 and about 9.0.
[0078] A compound or pharmaceutical composition of the invention
can be administered to a subject in many of the well-known methods
currently used for chemotherapeutic treatment. For example, for the
treatment of cancer, a compound of the invention may be injected
directly into tumors, injected into the blood stream or body
cavities, taken orally or applied through the skin with
patches.
[0079] The term "therapeutically effective amount," as used herein,
refers to an amount of a pharmaceutical agent to treat, ameliorate,
or prevent an identified disease or condition, or to exhibit a
detectable therapeutic or inhibitory effect. The effect can be
detected by any assay method known in the art. The precise
effective amount for a subject will depend upon the subject's body
weight, size, and health; the nature and extent of the condition;
and the therapeutic or combination of therapeutics selected for
administration. Therapeutically effective amounts for a given
situation can be determined by routine experimentation that is
within the skill and judgment of the clinician. In one aspect, the
disease or condition to be treated is a cell proliferative
disorder. In a preferred aspect, the disease or condition to be
treated is cancer.
[0080] For any compound, the therapeutically effective amount can
be estimated initially either in cell culture assays, e.g., of
neoplastic cells, or in animal models, usually rats, mice, rabbits,
dogs, or pigs. The animal model may also be used to determine the
appropriate concentration range and route of administration. Such
information can then be used to determine useful doses and routes
for administration in humans. Therapeutic/prophylactic efficacy and
toxicity may be determined by standard pharmaceutical procedures in
cell cultures or experimental animals, e.g., ED.sub.50 (the dose
therapeutically effective in 50% of the population) and LD.sub.50
(the dose lethal to 50% of the population). The dose ratio between
toxic and therapeutic effects is the therapeutic index, and it can
be expressed as the ratio, LD.sub.50/ED.sub.50. Pharmaceutical
compositions that exhibit large therapeutic indices are preferred.
The dosage may vary within this range depending upon the dosage
form employed, sensitivity of the patient, and the route of
administration.
[0081] Dosage and administration are adjusted to provide sufficient
levels of the active agent(s) or to maintain the desired effect.
Factors which may be taken into account include the severity of the
disease state, general health of the subject, age, weight, and
gender of the subject, diet, time and frequency of administration,
drug combination(s), reaction sensitivities, and tolerance/response
to therapy.
[0082] The pharmaceutical compositions containing active compounds
of the present invention may be manufactured in a manner that is
generally known, e.g., by means of conventional mixing, dissolving,
granulating, dragee-making, levigating, emulsifying, encapsulating,
entrapping, or lyophilizing processes. Pharmaceutical compositions
may be formulated in a conventional manner using one or more
pharmaceutically acceptable carriers comprising excipients and/or
auxiliaries that facilitate processing of the active compounds into
preparations that can be used pharmaceutically. Of course, the
appropriate formulation is dependent upon the route of
administration chosen.
[0083] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringeability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof. The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0084] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, methods of preparation are vacuum
drying and freezedrying that yields a powder of the active
ingredient plus any additional desired ingredient from a previously
sterilefiltered solution thereof.
[0085] Oral compositions generally include an inert diluent or an
edible pharmaceutically acceptable carrier. They can be enclosed in
gelatin capsules or compressed into tablets. For the purpose of
oral therapeutic administration, the active compound can be
incorporated with excipients and used in the form of tablets,
troches, or capsules. Oral compositions can also be prepared using
a fluid carrier for use as a mouthwash, wherein the compound in the
fluid carrier is applied orally and swished and expectorated or
swallowed. Pharmaceutically compatible binding agents, and/or
adjuvant materials can be included as part of the composition. The
tablets, pills, capsules, troches and the like can contain any of
the following ingredients, or compounds of a similar nature: a
binder such as microcrystalline cellulose, gum tragacanth or
gelatin; an excipient such as starch or lactose, a disintegrating
agent such as alginic acid, Primogel, or corn starch; a lubricant
such as magnesium stearate or Sterotes; a glidant such as colloidal
silicon dioxide; a sweetening agent such as sucrose or saccharin;
or a flavoring agent such as peppermint, methyl salicylate, or
orange flavoring.
[0086] The pharmaceutical compositions can include co-formulations
of any of the recombinant polypeptides and nucleic acids described
herein.
[0087] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0088] The present disclosure also provides plasmids, expression
vectors and host cells comprising the recombinant polypeptides
disclosed herein and the nucleic acid molecules encoding the
recombinant polypeptides disclosed herein. In one aspect, the
disclosure provides a plasmid or an expression vector comprising a
nucleic acid molecule, the molecule comprising a nucleotide
sequence of any one of SEQ ID NO: 17-32, or a nucleic acid sequence
that is at least about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98% or about 99% identical to any of the nucleic acid sequence of
SEQ ID NO: 17-32, or a fragment thereof. In one aspect, the
disclosure provides a host cell comprising a recombinant
polypeptide comprising an amino acid sequence of any one of SEQ ID
NO: 1-16, or an amino acid sequence that is at least about 50%,
about 55%, about 60%, about 65%, about 70%, about 75%, about 80%,
about 85%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%, about 96%, about 97%, about 98% or about 99% identical
to any of the amino acid sequences of SEQ ID NO: 1-16, or a
fragment thereof, or a host cell comprising a nucleic acid molecule
comprising a nucleic acid sequence of any one of SEQ ID NO: 17-32,
or a nucleic acid sequence that is at least about 50%, about 55%,
about 60%, about 65%, about 70%, about 75%, about 80%, about 85%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98% or about 99% identical to any of
the nucleic acid sequence of SEQ ID NO: 17-32, or a fragment
thereof.
[0089] As used herein, the term "transformation," "transfection,"
and "transduction" refer to the transfer of nucleic acid (i.e., a
nucleotide polymer) into a cell. As used herein, the term "genetic
transformation" refers to the transfer and incorporation of DNA,
especially recombinant DNA, into a cell. The transferred nucleic
acid can be introduced into a cell via an expression vector.
[0090] Polynucleotide molecules comprising a desired polynucleotide
sequence are propagated by placing the molecule in a vector. Viral
and non-viral vectors can be used, including plasmids. The choice
of plasmid will depend on the type of cell in which propagation is
desired and the purpose of propagation. Certain vectors are useful
for amplifying and making large amounts of the desired DNA
sequence. Other vectors are suitable for expression in cells in
culture. Still other vectors are suitable for transfer and
expression in cells in a whole animal or person. The choice of
appropriate vector is well within the skill of the art. Many such
vectors are available commercially. The partial or full-length
polynucleotide is inserted into a vector typically by means of DNA
ligase attachment to a cleaved restriction enzyme site in the
vector. Alternatively, the desired nucleotide sequence can be
inserted by homologous recombination in vivo. Typically this is
accomplished by attaching regions of homology to the vector on the
flanks of the desired nucleotide sequence. Regions of homology are
added by ligation of oligonucleotides, or by polymerase chain
reaction using primers comprising both the region of homology and a
portion of the desired nucleotide sequence, for example.
[0091] For expression, an expression cassette or system may be
employed. To express a nucleic acid encoding a polypeptide
disclosed herein, a nucleic acid molecule encoding the polypeptide,
operably linked to regulatory sequences that control
transcriptional expression in an expression vector, is introduced
into a host cell. In addition to transcriptional regulatory
sequences, such as promoters and enhancers, expression vectors can
include translational regulatory sequences and a marker gene which
is suitable for selection of cells that carry the expression
vector. The gene product encoded by a polynucleotide of the
disclosure is expressed in any convenient expression system,
including, for example, bacterial, yeast, insect, amphibian and
mammalian systems. In the expression vector, the
polypeptide-encoding polynucleotide is linked to a regulatory
sequence as appropriate to obtain the desired expression
properties. These can include promoters, enhancers, terminators,
operators, repressors, and inducers. The promoters can be regulated
(e.g., the promoter from the steroid inducible pIND vector
(Invitrogen)) or constitutive (e.g., promoters from CMV, SV40,
Elongation Factor, or LTR sequences). These are linked to the
desired nucleotide sequence using the techniques described above
for linkage to vectors. Any techniques known in the art can be
used. Accordingly, the expression vector will generally provide a
transcriptional and translational initiation region, which can be
inducible or constitutive, where the coding region is operably
linked under the transcriptional control of the transcriptional
initiation region, and a transcriptional and translational
termination region.
[0092] An expression cassette ("expression unit") can be introduced
into a variety of vectors, e.g., plasmid, BAC, YAC, bacteriophage
such as lambda, P1, M13, etc., plant or animal viral vectors (e.g.,
retroviral-based vectors, adenovirus vectors), and the like, where
the vectors are normally characterized by the ability to provide
selection of cells comprising the expression vectors. The vectors
can provide for extrachromosomal maintenance, particularly as
plasmids or viruses, or for integration into the host chromosome.
Where extrachromosomal maintenance is desired, an origin sequence
is provided for the replication of the plasmid, which can be low or
high copy-number. A wide variety of markers are available for
selection, particularly those which protect against toxins, more
particularly against antibiotics. The particular marker that is
chosen is selected in accordance with the nature of the host,
where, in some cases, complementation can be employed with
auxotrophic hosts. Introduction of the DNA construct can use any
convenient method, including, e.g., conjugation, bacterial
transformation, calcium-precipitated DNA, electroporation, fusion,
transfection, infection with viral vectors, biolistics, and the
like.
[0093] Accordingly, polypeptides for use within the present
disclosure can be produced in genetically engineered host cells
according to conventional techniques. Suitable host cells are those
cell types that can be transformed or transfected with exogenous
DNA and grown in culture, and include bacteria, fungal cells, and
cultured higher eukaryotic cells (including cultured cells of
multicellular organisms), particularly cultured mammalian cells.
Techniques for manipulating cloned DNA molecules and introducing
exogenous DNA into a variety of host cells are disclosed by
Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3rd
ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
2001), and Ausubel et al., Short Protocols in Molecular Biology
(4th ed., John Wiley & Sons, 1999). For example, the
recombinant polypeptides of the disclosure can be expressed from
bacterial Escherichia coli cells.
[0094] To direct a recombinant polypeptide into the secretory
pathway of a host cell, a secretory signal sequence (also known as
a leader sequence) can be provided in the expression vector. The
secretory signal sequence can be that of the native form of the
recombinant protein, or can be derived from another secreted
protein or synthesized de novo. The secretory signal sequence is
operably linked to the polypeptide-encoding DNA sequence, i.e., the
two sequences are joined in the correct reading frame and
positioned to direct the newly synthesized polypeptide into the
secretory pathway of the host cell. Secretory signal sequences are
commonly positioned 5' to the DNA sequence encoding the polypeptide
of interest, although certain signal sequences can be positioned
elsewhere in the DNA sequence of interest (see, e.g., Welch et al.,
U.S. Pat. No. 5,037,743; Holland et al., U.S. Pat. No.
5,143,830).
[0095] Cultured mammalian cells can be suitable hosts for
production of recombinant polypeptides for use within the present
disclosure. Methods for introducing exogenous DNA into mammalian
host cells include calcium phosphate-mediated transfection (Wigler
et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell
Genetics 7:603, 1981: Graham and Van der Eb, Virology 52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-845, 1982),
DEAE-dextran mediated transfection (Ausubel et al., supra), and
liposome-mediated transfection (Hawley-Nelson et al., Focus 15:73,
1993; Ciccarone et al., Focus 15:80, 1993). The production of
recombinant polypeptides in cultured mammalian cells is disclosed
by, for example, Levinson et al., U.S. Pat. No. 4,713,339; Hagen et
al., U.S. Pat. No. 4,784,950; Palmiter et al., U.S. Pat. No.
4,579,821; and Ringold, U.S. Pat. No. 4,656,134. Examples of
suitable mammalian host cells include African green monkey kidney
cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293-HEK;
ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK-570; ATCC
CRL 8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34),
Chinese hamster ovary cells (CHO-K1; ATCC CCL61; CHO DG44; CHO
DXB11 (Hyclone, Logan, Utah); see also, e.g., Chasin et al., Som.
Cell. Molec. Genet. 12:555, 1986)), rat pituitary cells (GH1; ATCC
CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E;
ATCC CRL 1548) SV40-transformed monkey kidney cells (COS-1; ATCC
CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
Additional suitable cell lines are known in the art and available
from public depositories such as the American Type Culture
Collection, Manassas, Va. Strong transcription promoters can be
used, such as promoters from SV-40 or cytomegalovirus. See, e.g.,
U.S. Pat. No. 4,956,288. Other suitable promoters include those
from metallothionein genes (U.S. Pat. Nos. 4,579,821 and 4,601,978)
and the adenovirus major late promoter.
[0096] Drug selection is generally used to select for cultured
mammalian cells into which foreign DNA has been inserted. Such
cells are commonly referred to as "transfectants." Cells that have
been cultured in the presence of the selective agent and are able
to pass the gene of interest to their progeny are referred to as
"stable transfectants." Exemplary selectable markers include a gene
encoding resistance to the antibiotic neomycin, which allows
selection to be carried out in the presence of a neomycin-type
drug, such as G-418 or the like; the gpt gene for xanthine-guanine
phosphoribosyl transferase, which permits host cell growth in the
presence of mycophenolic acid/xanthine; and markers that provide
resistance to zeocin, bleomycin, blastocidin, and hygromycin (see,
e.g., Gatignol et al., Mol. Gen. Genet. 207:342, 1987; Drocourt et
al., Nucl. Acids Res. 18:4009, 1990). Selection systems can also be
used to increase the expression level of the gene of interest, a
process referred to as "amplification." Amplification is carried
out by culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of selective
agent to select for cells that produce high levels of the products
of the introduced genes. An exemplary amplifiable selectable marker
is dihydrofolate reductase, which confers resistance to
methotrexate. Other drug resistance genes (e.g., hygromycin
resistance, multi-drug resistance, puromycin acetyltransferase) can
also be used.
[0097] Other higher eukaryotic cells can also be used as hosts,
including insect cells, plant cells and avian cells. The use of
Agrobacterium rhizogenes as a vector for expressing genes in plant
cells has been reviewed by Sinkar et al., J. Biosci. (Bangalore)
11:47-58, 1987. Transformation of insect cells and production of
foreign polypeptides therein is disclosed by Guarino et al., U.S.
Pat. No. 5,162,222 and WO 94/06463.
[0098] Insect cells can be infected with recombinant baculovirus,
commonly derived from Autographa californica nuclear polyhedrosis
virus (AcNPV). See King and Possee, The Baculovirus Expression
System: A Laboratory Guide (Chapman & Hall, London); O'Reilly
et al., Baculovirus Expression Vectors: A Laboratory Manual (Oxford
University Press., New York 1994); and Baculovirus Expression
Protocols. Methods in Molecular Biology (Richardson ed., Humana
Press, Totowa, N.J., 1995). Recombinant baculovirus can also be
produced through the use of a transposon-based system described by
Luckow et al. (J. Virol. 67:4566-4579, 1993). This system, which
utilizes transfer vectors, is commercially available in kit form
(BAC-TO-BAC kit; Life Technologies, Gaithersburg, Md.). The
transfer vector (e.g., PFASTBAC1; Life Technologies) contains a Tn7
transposon to move the DNA encoding the protein of interest into a
baculovirus genome maintained in E. coli as a large plasmid called
a "bacmid." See Hill-Perkins and Possee, J. Gen. Virol. 71:971-976,
1990; Bonning et al., J. Gen. Virol. 75:1551-1556, 1994; and
Chazenbalk and Rapoport, J. Biol. Chem. 270:1543-1549, 1995. In
addition, transfer vectors can include an in-frame fusion with DNA
encoding a polypeptide extension or affinity tag as disclosed
above. Using techniques known in the art, a transfer vector
containing a protein-encoding DNA sequence is transformed into E.
coli host cells, and the cells are screened for bacmids which
contain an interrupted lacZ gene indicative of recombinant
baculovirus. The bacmid DNA containing the recombinant baculovirus
genome is isolated, using common techniques, and used to transfect
Spodoptera frugiperda cells, such as Sf9 cells. Recombinant virus
that expresses the protein or interest is subsequently produced.
Recombinant viral stocks are made by methods commonly used in the
art.
[0099] For protein production, a recombinant virus can be used to
infect host cells, typically a cell line derived from the fall
armyworm, Spodoptera frugiperda (e.g., Sf9 or Sf21 cells) or
Trichoplusia ni (e.g., HIGH FIVE cells; Invitrogen, Carlsbad,
Calif.). See generally Glick and Pasternak, Molecular
Biotechnology, Principles & Applications of Recombinant DNA
(ASM Press, Washington, D.C., 1994). See also U.S. Pat. No.
5,300,435. Serum-free media are used to grow and maintain the
cells. Suitable media formulations are known in the art and can be
obtained from commercial suppliers. The cells are grown up from an
inoculation density of approximately 2-5.times.10.sup.5 cells to a
density of 1-2.times.10.sup.6 cells, at which time a recombinant
viral stock is added at a multiplicity of infection (MOI) of 0.1 to
10, more typically near 3. Procedures used are generally described
in available laboratory manuals (see, e.g., King and Possee, supra;
O'Reilly et al., supra; Richardson, supra).
[0100] Fungal cells, including yeast cells, can also be used within
the present disclosure. Yeast species of in this regard include,
e.g., Saccharomyces cerevisiae, Pichia pastoris, and Pichia
methanolica. Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides therefrom are
disclosed by, for example, Kawasaki, U.S. Pat. No. 4,599,311;
Kawasaki et al., U.S. Pat. No. 4,931,373; Brake, U.S. Pat. No.
4,870,008; Welch et al., U.S. Pat. No. 5,037,743; and Murray et
al., U.S. Pat. No. 4,845,075. Transformed cells are selected by
phenotype determined by the selectable marker, commonly drug
resistance or the ability to grow in the absence of a particular
nutrient (e.g., leucine). An exemplary vector system for use in
Saccharomyces cerevisiae is the POT1 vector system disclosed by
Kawasaki et al. (U.S. Pat. No. 4,931,373), which allows transformed
cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Pat. No.
4,599,311; Kingsman et al., U.S. Pat. No. 4,615,974; and Bitter,
U.S. Pat. No. 4,977,092) and alcohol dehydrogenase genes. See also
U.S. Pat. Nos. 4,990,446; 5,063,154; 5,139,936; and 4,661,454.
Transformation systems for other yeasts, including Hansenula
polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis,
Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia
methanolica, Pichia guillermondii, and Candida maltosa are known in
the art. See, e.g., Gleeson et al., J. Gen. Microbiol.
132:3459-3465, 1986; Cregg, U.S. Pat. No. 4,882,279; and Raymond et
al., Yeast 14:11-23, 1998. Aspergillus cells can be utilized
according to the methods of McKnight et al., U.S. Pat. No.
4,935,349. Methods for transforming Acremonium chrysogenum are
disclosed by Sumino et al., U.S. Pat. No. 5,162,228. Methods for
transforming Neurospora are disclosed by Lambowitz, U.S. Pat. No.
4,486,533. Production of recombinant proteins in Pichia methanolica
is disclosed in U.S. Pat. Nos. 5,716,808; 5,736,383; 5,854,039; and
5,888,768.
[0101] Prokaryotic host cells, including strains of the bacteria
Escherichia coli, Bacillus, and other genera are also useful host
cells within the present disclosure. Techniques for transforming
these hosts and expressing foreign DNA sequences cloned therein are
well-known in the art (see, e.g., Sambrook and Russell, supra).
When expressing a recombinant protein in bacteria such as E. coli,
the protein can be retained in the cytoplasm, typically as
insoluble granules, or can be directed to the periplasmic space by
a bacterial secretion sequence. In the former case, the cells are
lysed, and the granules are recovered and denatured using, for
example, guanidine isothiocyanate or urea. The denatured protein
can then be refolded and dimerized by diluting the denaturant, such
as by dialysis against a solution of urea and a combination of
reduced and oxidized glutathione, followed by dialysis against a
buffered saline solution. In the alternative, the protein can be
recovered from the cytoplasm in soluble form and isolated without
the use of denaturants. The protein is recovered from the cell as
an aqueous extract in, for example, phosphate buffered saline. To
capture the protein of interest, the extract is applied directly to
a chromatographic medium, such as an immobilized antibody or
heparin-Sepharose column. Secreted proteins can be recovered from
the periplasmic space in a soluble and functional form by
disrupting the cells (by, for example, sonication or osmotic shock)
to release the contents of the periplasmic space and recovering the
protein, thereby obviating the need for denaturation and
refolding.
[0102] Transformed or transfected host cells are cultured according
to conventional procedures in a culture medium containing nutrients
and other components required for the growth of the chosen host
cells. A variety of suitable media, including defined media and
complex media, are known in the art and generally include a carbon
source, a nitrogen source, essential amino acids, vitamins and
minerals. Media can also contain such components as growth factors
or serum, as required. The growth medium will generally select for
cells containing the exogenously added DNA by, for example, drug
selection or deficiency in an essential nutrient which is
complemented by the selectable marker carried on the expression
vector or co-transfected into the host cell.
[0103] The recombinant polypeptides can be purified by conventional
protein purification methods, typically by a combination of
chromatographic techniques. See generally Affinity Chromatography:
Principles & Methods (Pharmacia LKB Biotechnology, Uppsala,
Sweden, 1988); Scopes, Protein Purification: Principles and
Practice (Springer-Verlag, New York 1994). Additional purification
steps, such as gel filtration, can be used to obtain the desired
level of purity or to provide for desalting, buffer exchange, and
the like.
Methods of the Present Disclosure
[0104] The present disclosure provides methods for enhancing or
inducing an immune response in a subject in need thereof. The
subject in need thereof can be a subject with a cell proliferation
disorder. In one aspect, the subject has cancer and the cell is a
cancer cell. In a preferred aspect, the subject has lung cancer,
colon cancer or breast cancer. In a preferred aspect, the cancer
cells can be lung cancer cells, colon cancer cells or breast cancer
cells.
[0105] In one aspect, the methods for enhancing or inducing an
immune response in a subject in need thereof comprise administering
at least one recombinant polypeptide of the present disclosure, or
a nucleic acid encoding a recombinant polypeptide of the present
disclosure. In one aspect, the at least one recombinant polypeptide
of the present disclosure comprises a recombinant polypeptide of
SEQ ID NO: 1-8 or an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to any of the amino acid sequences of SEQ ID NO: 1-8 or
an acidic variant thereof as described herein. In one aspect, the
at least one recombinant polypeptide of the present disclosure
comprises a recombinant polypeptide of SEQ ID NO: 9-16 or an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to any of the amino
acid sequences of SEQ ID NO: 9-16. In a preferred aspect, the at
least one recombinant polypeptide of the present disclosure
comprises a recombinant polypeptide of SEQ ID NO: 9.
[0106] The present disclosure also provides methods for enhancing
or inducing the endogenous presentation of disease associated
antigens on a cell surface in a subject in need thereof. The
subject in need thereof can be a subject with a cell proliferation
disorder. In one aspect, the subject has cancer and the cell is a
cancer cell. In a preferred aspect, the subject has lung cancer,
colon cancer or breast cancer. In a preferred aspect, the cancer
cells can be lung cancer cells, colon cancer cells or breast cancer
cells.
[0107] In one aspect, the methods for enhancing or inducing the
endogenous presentation of disease associated antigens on a cell
surface in a subject in need thereof comprise administering at
least one recombinant polypeptide of the present disclosure, or a
nucleic acid encoding a recombinant polypeptide of the present
disclosure. In one aspect, the at least one recombinant polypeptide
of the present disclosure comprises a recombinant polypeptide of
SEQ ID NO: 1-8 or an amino acid sequence that is at least about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 91%, about 92%, about 93%, about
94%, about 95%, about 96%, about 97%, about 98% or about 99%
identical to any of the amino acid sequences of SEQ ID NO: 1-8 or
an acidic variant thereof as described herein. In one aspect, the
at least one recombinant polypeptide of the present disclosure
comprises a recombinant polypeptide of SEQ ID NO: 9-16 or an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to any of the amino
acid sequences of SEQ ID NO: 9-16. In a preferred aspect, the at
least one recombinant polypeptide of the present disclosure
comprises a recombinant polypeptide of SEQ ID NO: 9.
[0108] In one aspect, enhancing or inducing an "immune response"
can be, for example, a cytokine release response or a humoral
(antigen-specific) immune response. The immune response to be
enhanced for example, can be an innate immune response, a local
immune response, a mucosal immune response or a systemic immune
response. As used herein, the terms "enhance" or "enhancing" refer
to strengthening (augmenting) of an existing immune response. The
term "inducing" refers to the initiation of an immune response.
[0109] In one aspect, "immune response" refers to "immunogenic cell
death" or "immunogenic apoptosis", which is characterized by a
robust immune response against antigens expressed by dying cells
(FIG. 1). Dying cells, such as cancer cells, can have an increased
expression of pre-apoptotic Damage-Associated-Molecular-Pattern
(DAMP) signals comprising calreticulin (CRT), HSP70, HSP90, or a
combination thereof. In a preferred aspect, the cells have
increased expression of each of CRT, HSP70 and HSP90. Techniques
known to one skilled in the art can be used to assess the
expression of these cell surface markers. For example, the
expression of the cell surface markers can be assessed using
standard techniques such as flow cytometry, immunocytochemistry
(e.g., staining with tissue specific or cell-marker specific
antibodies), fluorescence activated cell sorting (FACS), magnetic
activated cell sorting (MACS) or other similar methods known in the
art. Fluorescence activated cell sorting (FACS) is a well-known
method for separating particles, including cells, based on the
fluorescent properties of the particles (Kamarch, 1987, Methods
Enzymol, 151:150-165). Laser excitation of fluorescent moieties in
the individual particles results in a small electrical charge
allowing electromagnetic separation of positive and negative
particles from a mixture. In one aspect, cell surface
marker-specific antibodies or ligands are labeled with distinct
fluorescent labels. Cells are processed through the flow cytometer,
allowing separation of cells based on their ability to bind to the
antibodies used. In one aspect, the method of the present
disclosure induces the expression of pre-apoptotic HSP70, HSP90 or
calreticulin on a cell surface, such as a cancer cell surface.
[0110] In one aspect, "immunogenic cell death" or "immunogenic
apoptosis" involves the interaction of dendritic cells with a cell,
such as a cancer cell, leading to a more rapid rate of endogenous
dendritic cell activation, dendritic cell maturation and
phagocytosis. The recognition of pre-apoptotic DAMP signals
comprising calreticulin (CRT), HSP70, HSP90, or a combination
thereof, by the dendritic cells triggers "endogenous dendritic cell
activation". This leads to "dendritic cell maturation", which
comprises a redistribution of major histocompatibility complex
(MHC) molecules from intracellular endocytic compartments to the
dendritic cell surface, down-regulation of antigen internalization,
an increase of surface expression of co-stimulatory molecules
(including CD80 and CD86), cytoskeleton re-organization, secretion
of chemokines, cytokines and proteases, surface expression of
adhesion molecules and surface expression of chemokine receptors.
Mature dendritic cells that have been exposed to cancer cells dying
by immunogenic cell death can migrate to lymph nodes and induce
high numbers of tumor-specific T lymphocytes (including CD4+ and
CD8+ T cells). This triggers a targeted T-cell mediated response
towards the cancer cell. The process of "immunogenic cell death" or
"immunogenic apoptosis" is shown in FIG. 1. A person skilled in the
art will appreciate that not all techniques known to induce cell
death will necessarily induce immunogenic cell death. Only agents
inducing immunogenic cell death will elicit efficient endogenous
dendritic cell activation. In one aspect an "immune response"
refers to endogenous dendritic cell activation, dendritic cell
maturation or T-cell mediated response or a combination
thereof.
[0111] In one aspect, "apoptosis" is the term used to describe the
cell signaling cascade known as programmed cell death. Various
therapeutic indications exist for molecules that induce apoptosis
(e.g. cancer). Apoptosis can be monitored by any of a number of
available techniques known and available in the art including, for
example, assays that measure fragmentation of DNA, alterations in
membrane asymmetry, activation of apoptotic caspases and/or release
of cytochrome C and AIF. In one aspect, apoptosis is measured by
the activation and expression of Caspase 3/7.
[0112] The present disclosure also provides methods for treating,
preventing or alleviating at least one symptom of a cell
proliferative disorder in a subject in need thereof. In one aspect,
the method is alleviating at least one symptom of a cell
proliferative disorder in a subject in need thereof. In one aspect
the cell proliferative disorder is cancer. In a preferred aspect,
the cancer is lung cancer, colon cancer or breast cancer.
[0113] In one aspect, the methods for treating, preventing or
alleviating at least one symptom of a cell proliferative disorder
in a subject in need thereof comprise administering at least one
recombinant polypeptide of the present disclosure, or a nucleic
acid encoding a recombinant polypeptide of the present disclosure.
In one aspect, the at least one recombinant polypeptide of the
present disclosure comprises a recombinant polypeptide of SEQ ID
NO: 1-8 or an amino acid sequence that is at least about 50%, about
55%, about 60%, about 65%, about 70%, about 75%, about 80%, about
85%, about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98% or about 99% identical to any
of the amino acid sequences of SEQ ID NO: 1-8 or an acidic variant
thereof as described herein. In one aspect, the at least one
recombinant polypeptide of the present disclosure comprises a
recombinant polypeptide of SEQ ID NO: 9-16. In a preferred aspect,
the at least one recombinant polypeptide of the present disclosure
comprises a recombinant polypeptide of SEQ ID NO: 9 or an amino
acid sequence that is at least about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98% or about 99% identical to any of the amino
acid sequences of SEQ ID NO: 9-16.
[0114] As used herein, a "subject" can be any mammal, e.g., a
human, a primate, mouse, rat, dog, cat, cow, horse, pig, sheep,
goat, camel. In a preferred aspect, the subject is a human. In one
aspect, a "subject in need thereof" is a subject having a cell
proliferative disorder, or a subject having an increased risk of
developing a cell proliferative disorder relative to the population
at large. In one aspect, a subject in need thereof has a
precancerous condition. In a preferred aspect, a subject in need
thereof has cancer.
[0115] As used herein, "treating" describes the management and care
of a patient for the purpose of combating a disease, condition, or
disorder and includes decreasing or alleviating the symptoms or
complications, or eliminating the disease, condition or disorder.
As used herein, "preventing" describes stopping the onset of the
symptoms or complications of the disease, condition or disorder. As
used herein, "alleviating" describes reducing the symptoms or
complications of disease, condition or disorder.
[0116] As used herein, the term "cell proliferative disorder"
refers to conditions in which unregulated or abnormal growth, or
both, of cells can lead to the development of an unwanted condition
or disease, which may or may not be cancerous. Exemplary cell
proliferative disorders of the disclosure encompass a variety of
conditions wherein cell division is deregulated. Exemplary cell
proliferative disorder include, but are not limited to, neoplasms,
benign tumors, malignant tumors, pre-cancerous conditions, in situ
tumors, encapsulated tumors, metastatic tumors, liquid tumors,
solid tumors, immunological tumors, hematological tumors, cancers,
carcinomas, leukemias, lymphomas, sarcomas, and rapidly dividing
cells. The term "rapidly dividing cell" as used herein is defined
as any cell that divides at a rate that exceeds or is greater than
what is expected or observed among neighboring or juxtaposed cells
within the same tissue. A cell proliferative disorder includes a
precancer or a precancerous condition. A cell proliferative
disorder includes cancer. Preferably, the methods provided herein
are used to treat or alleviate a symptom of cancer. The term
"cancer" includes solid tumors, as well as, hematologic tumors
and/or malignancies. A "precancer cell" or "precancerous cell" is a
cell manifesting a cell proliferative disorder that is a precancer
or a precancerous condition. A "cancer cell" or "cancerous cell" is
a cell manifesting a cell proliferative disorder that is a cancer.
Any reproducible means of measurement may be used to identify
cancer cells or precancerous cells. Cancer cells or precancerous
cells can be identified by histological typing or grading of a
tissue sample (e.g., a biopsy sample). Cancer cells or precancerous
cells can be identified through the use of appropriate molecular
markers.
[0117] Exemplary non-cancerous conditions or disorders include, but
are not limited to, rheumatoid arthritis; inflammation; autoimmune
disease; lymphoproliferative conditions; acromegaly; rheumatoid
spondylitis; osteoarthritis; gout, other arthritic conditions;
sepsis; septic shock; endotoxic shock; gram-negative sepsis; toxic
shock syndrome; asthma; adult respiratory distress syndrome;
chronic obstructive pulmonary disease; chronic pulmonary
inflammation; inflammatory bowel disease; Crohn's disease;
psoriasis; eczema; ulcerative colitis; pancreatic fibrosis; hepatic
fibrosis; acute and chronic renal disease; irritable bowel
syndrome; pyresis; restenosis; cerebral malaria; stroke and
ischemic injury; neural trauma; Alzheimer's disease; Huntington's
disease; Parkinson's disease; acute and chronic pain; allergic
rhinitis; allergic conjunctivitis; chronic heart failure; acute
coronary syndrome; cachexia; malaria; leprosy; leishmaniasis; Lyme
disease; Reiter's syndrome; acute synovitis; muscle degeneration,
bursitis; tendonitis; tenosynovitis; herniated, ruptures, or
prolapsed intervertebral disk syndrome; osteopetrosis; thrombosis;
restenosis; silicosis; pulmonary sarcosis; bone resorption
diseases, such as osteoporosis; graft-versus-host reaction;
Multiple Sclerosis; lupus; fibromyalgia; AIDS and other viral
diseases such as Herpes Zoster, Herpes Simplex I or II, influenza
virus and cytomegalovirus; and diabetes mellitus.
[0118] Exemplary cancers include, but are not limited to,
adrenocortical carcinoma, AIDS-related cancers, AIDS-related
lymphoma, anal cancer, anorectal cancer, cancer of the anal canal,
appendix cancer, childhood cerebellar astrocytoma, childhood
cerebral astrocytoma, basal cell carcinoma, skin cancer
(non-melanoma), biliary cancer, extrahepatic bile duct cancer,
intrahepatic bile duct cancer, bladder cancer, uringary bladder
cancer, bone and joint cancer, osteosarcoma and malignant fibrous
histiocytoma, brain cancer, brain tumor, brain stem glioma,
cerebellar astrocytoma, cerebral astrocytoma/malignant glioma,
ependymoma, medulloblastoma, supratentorial primitive
neuroectodeimal tumors, visual pathway and hypothalamic glioma,
breast cancer, bronchial adenomas/carcinoids, carcinoid tumor,
gastrointestinal, nervous system cancer, nervous system lymphoma,
central nervous system cancer, central nervous system lymphoma,
cervical cancer, childhood cancers, chronic lymphocytic leukemia,
chronic myelogenous leukemia, chronic myeloproliferative disorders,
colon cancer, colorectal cancer, cutaneous T-cell lymphoma,
lymphoid neoplasm, mycosis fungoides, Seziary Syndrome, endometrial
cancer, esophageal cancer, extracranial germ cell tumor,
extragonadal germ cell tumor, extrahepatic bile duct cancer, eye
cancer, intraocular melanoma, retinoblastoma, gallbladder cancer,
gastric (stomach) cancer, gastrointestinal carcinoid tumor,
gastrointestinal stromal tumor (GIST), germ cell tumor, ovarian
germ cell tumor, gestational trophoblastic tumor glioma, head and
neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma,
hypopharyngeal cancer, intraocular melanoma, ocular cancer, islet
cell tumors (endocrine pancreas), Kaposi's sarcoma, kidney cancer,
renal cancer, laryngeal cancer, acute lymphoblastic leukemia, acute
myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous
leukemia, hairy cell leukemia, lip and oral cavity cancer, liver
cancer, lung cancer, non-small cell lung cancer, small cell lung
cancer, AIDS-related lymphoma, non-Hodgkin lymphoma, primary
central nervous system lymphoma, Waldenstram macroglobulinemia,
medulloblastoma, melanoma, intraocular (eye) melanoma, merkel cell
carcinoma, mesothelioma malignant, mesothelioma, metastatic
squamous neck cancer, mouth cancer, cancer of the tongue, multiple
endocrine neoplasia syndrome, mycosis fungoides, myelodysplastic
syndromes, myelodysplastic/myeloproliferative diseases, chronic
myelogenous leukemia, acute myeloid leukemia, multiple myeloma,
chronic myeloproliferative disorders, nasopharyngeal cancer,
neuroblastoma, oral cancer, oral cavity cancer, oropharyngeal
cancer, ovarian cancer, ovarian epithelial cancer, ovarian low
malignant potential tumor, pancreatic cancer, islet cell pancreatic
cancer, paranasal sinus and nasal cavity cancer, parathyroid
cancer, penile cancer, pharyngeal cancer, pheochromocytoma,
pineoblastoma and supratentorial primitive neuroectodermal tumors,
pituitary tumor, plasma cell neoplasm/multiple myeloma,
pleuropulmonary blastoma, prostate cancer, rectal cancer, renal
pelvis and ureter, transitional cell cancer, retinoblastoma,
rhabdomyosarcoma, salivary gland cancer, ewing family of sarcoma
tumors, Kaposi Sarcoma, uterine cancer, uterine sarcoma, skin
cancer (non-melanoma), skin cancer (melanoma), merkel cell skin
carcinoma, small intestine cancer, soft tissue sarcoma, squamous
cell carcinoma, stomach (gastric) cancer, supratentorial primitive
neuroectodermal tumors, testicular cancer, throat cancer, thymoma,
thymoma and thymic carcinoma, thyroid cancer, transitional cell
cancer of the renal pelvis and ureter and other urinary organs,
gestational trophoblastic tumor, urethral cancer, endometrial
uterine cancer, uterine sarcoma, uterine corpus cancer, vaginal
cancer, vulvar cancer, and Wilm's Tumor.
[0119] A "lung cancer" is a cell proliferative disorder involving
cells of the lung. In one aspect, lung cancer include all forms of
cell proliferative disorders affecting lung cells. In one aspect,
lung cancer include lung cancer, a precancer or precancerous
condition of the lung, benign growths or lesions of the lung, and
malignant growths or lesions of the lung, and metastatic lesions in
tissue and organs in the body other than the lung. In a preferred
aspect, the method of the present disclosure may be used to treat
lung cancer or cell proliferative disorders of the lung. In one
aspect, lung cancer includes all forms of cancer of the lung. In
another aspect, lung cancer includes malignant lung neoplasms,
carcinoma in situ, typical carcinoid tumors, and atypical carcinoid
tumors. In another aspect, lung cancer includes small cell lung
cancer ("SCLC"), non-small cell lung cancer ("NSCLC"), squamous
cell carcinoma, adenocarcinoma, small cell carcinoma, large cell
carcinoma, adenosquamous cell carcinoma, and mesothelioma. In
another aspect, lung cancer includes "scar carcinoma,"
bronchioalveolar carcinoma, giant cell carcinoma, spindle cell
carcinoma, and large cell neuroendocrine carcinoma. In one aspect
lung cancer includes stage 0, IA, IB, IIA, IIB, IIIA, IIIB and IV
lung cancer. In another aspect, lung cancer includes lung neoplasms
having histologic and ultrastructual heterogeneity (e.g., mixed
cell types).
[0120] In one aspect, lung cancer include all forms of cell
proliferative disorders affecting lung cells. In one aspect, cell
proliferative disorders of the lung include lung cancer,
precancerous conditions of the lung. In one aspect, cell
proliferative disorders of the lung include hyperplasia,
metaplasia, and dysplasia of the lung. In another aspect, lung
cancer include asbestos-induced hyperplasia, squamous metaplasia,
and benign reactive mesothelial metaplasia. In another aspect, cell
proliferative disorders of the lung include replacement of columnar
epithelium with stratified squamous epithelium, and mucosal
dysplasia. In another aspect, individuals exposed to inhaled
injurious environmental agents such as cigarette smoke and asbestos
may be at increased risk for developing cell proliferative
disorders of the lung. In another aspect, prior lung diseases that
may predispose individuals to development of cell proliferative
disorders of the lung include chronic interstitial lung disease,
necrotizing pulmonary disease, scleroderma, rheumatoid disease,
sarcoidosis, interstitial pneumonitis, tuberculosis, repeated
pneumonias, idiopathic pulmonary fibrosis, granulomata, asbestosis,
fibrosing alveolitis, and Hodgkin's disease.
[0121] A "colon cancer" is a cell proliferative disorder involving
cells of the colon. In a preferred aspect, the method of the
present disclosure may be used to treat colon cancer or cell
proliferative disorders of the colon. In one aspect, colon cancer
includes all forms of cancer of the colon. In another aspect, colon
cancer includes sporadic and hereditary colon cancers. In another
aspect, colon cancer includes malignant colon neoplasms, carcinoma
in situ, typical carcinoid tumors, and atypical carcinoid tumors.
In another aspect, colon cancer includes adenocarcinoma, squamous
cell carcinoma, and adenosquamous cell carcinoma. In another
aspect, colon cancer is associated with a hereditary syndrome
selected from the group consisting of hereditary nonpolyposis
colorectal cancer, familial adenomatous polyposis, Gardner's
syndrome, Peutz-Jeghers syndrome, Turcot's syndrome and juvenile
polyposis. In another aspect, colon cancer is caused by a
hereditary syndrome selected from the group consisting of
hereditary nonpolyposis colorectal cancer, familial adenomatous
polyposis, Gardner's syndrome, Peutz-Jeghers syndrome, Turcot's
syndrome and juvenile polyposis.
[0122] In one aspect, colon cancer include all forms of cell
proliferative disorders affecting colon cells. In one aspect, colon
cancer include colon cancer, precancerous conditions of the colon,
adenomatous polyps of the colon and metachronous lesions of the
colon. In one aspect colon cancer includes stage 0, I, IIA, IIB,
IIC, IIIA, IIIB, IIIC, IVA, IVB and IVC colon cancer. In one
aspect, a colon cancer includes adenoma. In one aspect, colon
cancer is characterized by hyperplasia, metaplasia or dysplasia of
the colon. In another aspect, prior colon diseases that may
predispose individuals to development of cell proliferative
disorders of the colon include prior colon cancer. In another
aspect, current disease that may predispose individuals to
development of cell proliferative disorders of the colon include
Crohn's disease and ulcerative colitis. In one aspect, a cell
proliferative disorder of the colon is associated with a mutation
in a gene selected from the group consisting of p53, ras, FAP and
DCC. In another aspect, an individual has an elevated risk of
developing a cell proliferative disorder of the colon due to the
presence of a mutation in a gene selected from the group consisting
of p53, ras, FAP and DCC.
[0123] A "breast cancer" is a cell proliferative disorder involving
cells of the breast. In a preferred aspect, breast cancer include
all forms of cell proliferative disorders affecting breast cells.
In one aspect, breast cancer include breast cancer, a precancer or
precancerous condition of the breast, benign growths or lesions of
the breast, and malignant growths or lesions of the breast, and
metastatic lesions in tissue and organs in the body other than the
breast. In another aspect, breast cancer include hyperplasia,
metaplasia, and dysplasia of the breast.
[0124] In one aspect, breast cancer is a precancerous condition of
the breast. In one aspect, the method of the present disclosure may
be used to treat a precancerous condition of the breast. In one
aspect, a precancerous condition of the breast includes atypical
hyperplasia of the breast, ductal carcinoma in situ (DCIS),
intraductal carcinoma, lobular carcinoma in situ (LCIS), lobular
neoplasia, and stage 0 or grade 0 growth or lesion of the breast
(e.g., stage 0 or grade 0 breast cancer, or carcinoma in situ). In
another aspect, a precancerous condition of the breast has been
staged according to the TNM classification scheme as accepted by
the American Joint Committee on Cancer (AJCC), where the primary
tumor (T) has been assigned a stage of T0 or Tis; and where the
regional lymph nodes (N) have been assigned a stage of N0; and
where distant metastasis (M) has been assigned a stage of M0.
[0125] In one aspect, the method of the present disclosure may be
used to treat breast cancer. In one aspect, breast cancer includes
all forms of cancer of the breast. In one aspect, breast cancer
includes primary epithelial breast cancers. In another aspect,
breast cancer includes cancers in which the breast is involved by
other tumors such as lymphoma, sarcoma or melanoma. In another
aspect, breast cancer includes carcinoma of the breast, ductal
carcinoma of the breast, lobular carcinoma of the breast,
undifferentiated carcinoma of the breast, cystosarcoma phyllodes of
the breast, angiosarcoma of the breast, and primary lymphoma of the
breast. In one aspect, breast cancer includes Stage I, II, IIIA,
IIIB, IIIC and IV breast cancer. In one aspect, ductal carcinoma of
the breast includes invasive carcinoma, invasive carcinoma in situ
with predominant intraductal component, inflammatory breast cancer,
and a ductal carcinoma of the breast with a histologic type
selected from the group consisting of comedo, mucinous (colloid),
medullary, medullary with lymphcytic infiltrate, papillary,
scirrhous, and tubular. In one aspect, lobular carcinoma of the
breast includes invasive lobular carcinoma with predominant in situ
component, invasive lobular carcinoma, and infiltrating lobular
carcinoma. In one aspect, breast cancer includes Paget's disease,
Paget's disease with intraductal carcinoma, and Paget's disease
with invasive ductal carcinoma. In another aspect, breast cancer
includes breast neoplasms having histologic and ultrastructual
heterogeneity (e.g., mixed cell types).
[0126] In one aspect, treating cancer results in a reduction in
size of a tumor. A reduction in size of a tumor may also be
referred to as "tumor regression." Preferably, after treatment,
tumor size is reduced by 5% or greater relative to its size prior
to treatment; more preferably, tumor size is reduced by 10% or
greater; more preferably, reduced by 20% or greater; more
preferably, reduced by 30% or greater; more preferably, reduced by
40% or greater; even more preferably, reduced by 50% or greater;
and most preferably, reduced by greater than 75% or greater. Size
of a tumor may be measured by any reproducible means of
measurement. In a preferred aspect, size of a tumor may be measured
as a diameter of the tumor.
[0127] In another aspect, treating cancer results in a reduction in
tumor volume. Preferably, after treatment, tumor volume is reduced
by 5% or greater relative to its size prior to treatment; more
preferably, tumor volume is reduced by 10% or greater; more
preferably, reduced by 20% or greater; more preferably, reduced by
30% or greater; more preferably, reduced by 40% or greater; even
more preferably, reduced by 50% or greater; and most preferably,
reduced by greater than 75% or greater. Tumor volume may be
measured by any reproducible means of measurement.
[0128] In another aspect, treating cancer results in a decrease in
number of tumors. Preferably, after treatment, tumor number is
reduced by 5% or greater relative to number prior to treatment;
more preferably, tumor number is reduced by 10% or greater; more
preferably, reduced by 20% or greater; more preferably, reduced by
30% or greater; more preferably, reduced by 40% or greater; even
more preferably, reduced by 50% or greater; and most preferably,
reduced by greater than 75%. Number of tumors may be measured by
any reproducible means of measurement. In a preferred aspect,
number of tumors may be measured by counting tumors visible to the
naked eye or at a specified magnification. In a preferred aspect,
the specified magnification is 2.times., 3.times., 4.times.,
5.times., 10.times., or 50.times..
[0129] In another aspect, treating cancer results in a decrease in
number of metastatic lesions in other tissues or organs distant
from the primary tumor site. Preferably, after treatment, the
number of metastatic lesions is reduced by 5% or greater relative
to number prior to treatment; more preferably, the number of
metastatic lesions is reduced by 10% or greater; more preferably,
reduced by 20% or greater; more preferably, reduced by 30% or
greater; more preferably, reduced by 40% or greater; even more
preferably, reduced by 50% or greater; and most preferably, reduced
by greater than 75%. The number of metastatic lesions may be
measured by any reproducible means of measurement. In a preferred
aspect, the number of metastatic lesions may be measured by
counting metastatic lesions visible to the naked eye or at a
specified magnification. In a preferred aspect, the specified
magnification is 2.times., 3.times., 4.times., 5.times., 10.times.,
or 50.times..
[0130] In another aspect, treating cancer results in an increase in
average survival time of a population of treated subjects in
comparison to a population receiving carrier alone. Preferably, the
average survival time is increased by more than 30 days; more
preferably, by more than 60 days; more preferably, by more than 90
days; and most preferably, by more than 120 days. An increase in
average survival time of a population may be measured by any
reproducible means. In a preferred aspect, an increase in average
survival time of a population may be measured, for example, by
calculating for a population the average length of survival
following initiation of treatment with an active compound. In
another preferred aspect, an increase in average survival time of a
population may also be measured, for example, by calculating for a
population the average length of survival following completion of a
first round of treatment with an active compound.
[0131] In another aspect, treating cancer results in an increase in
average survival time of a population of treated subjects in
comparison to a population of untreated subjects. Preferably, the
average survival time is increased by more than 30 days; more
preferably, by more than 60 days; more preferably, by more than 90
days; and most preferably, by more than 120 days. An increase in
average survival time of a population may be measured by any
reproducible means. In a preferred aspect, an increase in average
survival time of a population may be measured, for example, by
calculating for a population the average length of survival
following initiation of treatment with an active compound. In
another preferred aspect, an increase in average survival time of a
population may also be measured, for example, by calculating for a
population the average length of survival following completion of a
first round of treatment with an active compound.
[0132] In another aspect, treating cancer results in increase in
average survival time of a population of treated subjects in
comparison to a population receiving a therapy that is not a
recombinant polypeptide of the present disclosure. Preferably, the
average survival time is increased by more than 30 days; more
preferably, by more than 60 days; more preferably, by more than 90
days; and most preferably, by more than 120 days. An increase in
average survival time of a population may be measured by any
reproducible means. In a preferred aspect, an increase in average
survival time of a population may be measured, for example, by
calculating for a population the average length of survival
following initiation of treatment with an active compound. In
another preferred aspect, an increase in average survival time of a
population may also be measured, for example, by calculating for a
population the average length of survival following completion of a
first round of treatment with an active compound.
[0133] In another aspect, treating cancer results in a decrease in
the mortality rate of a population of treated subjects in
comparison to a population receiving carrier alone. In another
aspect, treating cancer results in a decrease in the mortality rate
of a population of treated subjects in comparison to an untreated
population. In a further aspect, treating cancer results in a
decrease in the mortality rate of a population of treated subjects
in comparison to a population receiving monotherapy with a drug
that is not a recombinant polypeptide of the present disclosure.
Preferably, the mortality rate is decreased by more than 2%; more
preferably, by more than 5%; more preferably, by more than 10%; and
most preferably, by more than 25%. In a preferred aspect, a
decrease in the mortality rate of a population of treated subjects
may be measured by any reproducible means. In another preferred
aspect, a decrease in the mortality rate of a population may be
measured, for example, by calculating for a population the average
number of disease-related deaths per unit time following initiation
of treatment with an active compound. In another preferred aspect,
a decrease in the mortality rate of a population may also be
measured, for example, by calculating for a population the average
number of disease-related deaths per unit time following completion
of a first round of treatment with an active compound.
[0134] In another aspect, treating cancer results in a decrease in
tumor growth rate. Preferably, after treatment, tumor growth rate
is reduced by at least 5% relative to number prior to treatment;
more preferably, tumor growth rate is reduced by at least 10%; more
preferably, reduced by at least 20%; more preferably, reduced by at
least 30%; more preferably, reduced by at least 40%; more
preferably, reduced by at least 50%; even more preferably, reduced
by at least 50%; and most preferably, reduced by at least 75%.
Tumor growth rate may be measured by any reproducible means of
measurement. In a preferred aspect, tumor growth rate is measured
according to a change in tumor diameter per unit time.
[0135] In another aspect, treating cancer results in a decrease in
tumor regrowth. Preferably, after treatment, tumor regrowth is less
than 5%; more preferably, tumor regrowth is less than 10%; more
preferably, less than 20%; more preferably, less than 30%; more
preferably, less than 40%; more preferably, less than 50%; even
more preferably, less than 50%; and most preferably, less than 75%.
Tumor regrowth may be measured by any reproducible means of
measurement. In a preferred aspect, tumor regrowth is measured, for
example, by measuring an increase in the diameter of a tumor after
a prior tumor shrinkage that followed treatment. In another
preferred aspect, a decrease in tumor regrowth is indicated by
failure of tumors to reoccur after treatment has stopped.
[0136] In another aspect, treating, preventing, or alleviating a
cancer results in a reduction in the rate of cellular
proliferation. Preferably, after treatment, the rate of cellular
proliferation is reduced by at least 5%; more preferably, by at
least 10%; more preferably, by at least 20%; more preferably, by at
least 30%; more preferably, by at least 40%; more preferably, by at
least 50%; even more preferably, by at least 50%; and most
preferably, by at least 75%. The rate of cellular proliferation may
be measured by any reproducible means of measurement. In a
preferred aspect, the rate of cellular proliferation is measured,
for example, by measuring the number of dividing cells in a tissue
sample per unit time.
[0137] In another aspect, treating, preventing, or alleviating a
cancer results in a reduction in the proportion of proliferating
cells. Preferably, after treatment, the proportion of proliferating
cells is reduced by at least 5%; more preferably, by at least 10%;
more preferably, by at least 20%; more preferably, by at least 30%;
more preferably, by at least 40%; more preferably, by at least 50%;
even more preferably, by at least 50%; and most preferably, by at
least 75%. The proportion of proliferating cells may be measured by
any reproducible means of measurement. In a preferred aspect, the
proportion of proliferating cells is measured, for example, by
quantifying the number of dividing cells relative to the number of
nondividing cells in a tissue sample. In another preferred aspect,
the proportion of proliferating cells is equivalent to the mitotic
index.
[0138] In another aspect, treating, preventing, or alleviating a
cancer results in a decrease in size of an area or zone of cellular
proliferation. Preferably, after treatment, size of an area or zone
of cellular proliferation is reduced by at least 5% relative to its
size prior to treatment; more preferably, reduced by at least 10%;
more preferably, reduced by at least 20%; more preferably, reduced
by at least 30%; more preferably, reduced by at least 40%; more
preferably, reduced by at least 50%; even more preferably, reduced
by at least 50%; and most preferably, reduced by at least 75%. Size
of an area or zone of cellular proliferation may be measured by any
reproducible means of measurement. In a preferred aspect, size of
an area or zone of cellular proliferation may be measured as a
diameter or width of an area or zone of cellular proliferation.
[0139] In another aspect, treating, preventing, or alleviating a
cancer results in a decrease in the number or proportion of cells
having an abnormal appearance or morphology. Preferably, after
treatment, the number of cells having an abnormal morphology is
reduced by at least 5% relative to its size prior to treatment;
more preferably, reduced by at least 10%; more preferably, reduced
by at least 20%; more preferably, reduced by at least 30%; more
preferably, reduced by at least 40%; more preferably, reduced by at
least 50%; even more preferably, reduced by at least 50%; and most
preferably, reduced by at least 75%. An abnormal cellular
appearance or morphology may be measured by any reproducible means
of measurement. In one aspect, an abnormal cellular morphology is
measured by microscopy, e.g., using an inverted tissue culture
microscope. In one aspect, an abnormal cellular morphology takes
the form of nuclear pleiomorphism.
[0140] In one aspect, treating cancer or a cell proliferative
disorder results in cell death, and preferably, cell death results
in a decrease of at least 10% in number of cells in a population.
More preferably, cell death means a decrease of at least 20%; more
preferably, a decrease of at least 30%; more preferably, a decrease
of at least 40%; more preferably, a decrease of at least 50%; most
preferably, a decrease of at least 75%. Number of cells in a
population may be measured by any reproducible means. In one
aspect, number of cells in a population is measured by fluorescence
activated cell sorting (FACS). In another aspect, number of cells
in a population is measured by immunofluorescence microscopy. In
another aspect, number of cells in a population is measured by
light microscopy. In another aspect, methods of measuring cell
death are as shown in Li et al., (2003) Proc Natl Acad Sci USA.
100(5): 2674-8. In a preferred aspect, cell death occurs by
immunogenic cell death.
[0141] Any of the above aspects can be combined with any other
aspect as disclosed herein.
EXAMPLE 1: Methods of Producing Recombinant Polypeptides
Materials and Methods
[0142] The methods of producing the recombinant polypeptides of the
present disclosure utilized the PCR primers disclosed in Table
3.
TABLE-US-00005 TABLE 3 Primer Sequences Primer Nucleotide Sequence
(5' to 3') SEQ ID NO: A1
GGGGGGCATATGGACATTACCATCCAGCACCCCTGGTTCAAGCGCGCTC 33 T A2
GGGGGGAAGCTTTTACTCCTCAGGCGCCTCGGTGGGCTT 34 ioE1
CCTCTGTTCGAGGAGACTATCGAGCCCTACTA 35 ioE2
TAGTAGGGCTCGATAGTCTCCTCGAACAGAGG 36 ioE3
ACCGGCAGGAGCTGTTCCGCGAGGTGCTGTCGGAGGGCATTGAGTCGG 37
TGAGGGAGGACCGGGA ioE4
TCCCGGTCCTCCCTCACCGACTCAATGCCCTCCGACAGCACCTCGCGGA 38
ACAGCTCCTGCCGGT ioE5
ACTATGCTGGACGTAAAACACTTTGAGCCTTCGGACCTGGAGGTGAAG 39 ATTA ioE6
TAATCTTCACCTCCAGGTCCGAAGGCTCAAAGTGTTTTACGTCCAGCAT 40 GAT ioE7
AAGATTATCGACGACTTTGTGTCGATCCATGGC 41 ioE8
GCCATGGATCGACACAAAGTCGTCGATAATCTT 42 ioE9
GGCAAGCACGAGTCGAGACAGGACGACCACGGCTACATCGAGCGGTC 43 GTTTCACCGC ioE10
GCGGTGAAACGACCGCTCGATGTAGCCGTGGTCGTCCTGTCTCGACTCG 44 TGCTTGCC ioE11
GCGGACCAGGAGGCCATCACCTGCGAGCTGGAGGGCGACGG 45 ioE12
CCGTCGCCCTCCAGCTCGCAGGTGATGGCCTCCTGGTCCAC 46 ioE13
TTCGACCAGTTTTTCGGATCGGGTCTGCTGTCGTATGACCTGCTGCCTCT 47 GTTC ioE14
GGGGACCTTGGGGCCCTCGAAGGTCAGCATGCCGTCGCC 48 ioE15
TTCAAGCGCGCTCTGGGACCCCTGATTCCAGAGCGTCTGTTCGACCAGT 49 TTTTCGGA ioE16
CACGGGGATGGGCCTCGACTCGTGGGTGGGGTCCATGTTCTCGGGGAC 50 CTTGGGG ioE17
ATGGACATTACCATCCAG 51 ioE18
AAGCTTTTACTCCTCAGGCGCCTCGGTGGGCTTCGACGACCGCTCCACG 52
GGGATGGGCCT
Preparation of Template DNA
[0143] The full length CRYAA sequence from Anser cygnoides
domesticus (SEQ ID NO: 17) was amplified in a PCR reaction using
Pfu polymerase. A1 primer (SEQ ID NO: 33) and A2 primer (SEQ ID NO:
34) were used in the PCR reaction. The gene was cloned into NdeI
and HindIII sites in a pET24a vector (Novagen) using the
manufacturer's protocol. The ligation mixture was transformed into
Escherichia coli DH5alpha cells and transformants were selected on
LB ampicillin plates. Plasmid DNA was isolated from several
transformants and screened by restriction digestion of NdeI and
HindIII sites. A sequence verified clone containing Anser cygnoides
domesticus CRYAA (SEQ ID NO: 17) was identified and used as
template.
Cloning of Plasmid Containing the CRYA_1B Recombinant Polypeptide
Sequence
[0144] The recombinant plasmid containing CRYA_1B (SEQ ID NO: 25)
was prepared in the following manner. PCR was performed using the
template DNA described above, forward primer IoE1 (SEQ ID NO: 35)
and reverse primer IoE2 (SEQ ID NO: 36). PCR temperature and time
were programmed as follows: denaturing at 95.degree. C. for 5
minutes; followed by 30 cycles of PCR reactions with denaturation
at 95.degree. C. for 30 sec, annealing at 60.degree. C. for 30 sec,
and elongation at 72.degree. C. for 1 minute; final elongation at
72.degree. C. for 10 minutes. All PCR amplifications were performed
with Pfu Ultra polymerase (Stratagene). PCR products were separated
electrophoretically using 1.0% agarose gel, and stained with
ethidium bromide. The DNA fragment was extracted from the gel using
GFX.TM. PCR DNA and Gel Bind Purification Kit (GE Healthcare) and
ligated into a pET24a (Novagen) vector. The ligation mixture was
transformed into the DH5alpha Escherichia coli strain and
transformants were selected on LB plates containing ampicillin.
Plasmid DNA was isolated from transformants. A sequence verified
clone, Plasmid_1, was used as a template for a subsequent round of
PCR amplification.
[0145] PCR amplification was performed using Plasmid_1, forward
primer IoE3 (SEQ ID NO: 37) and reverse primer IoE4 (SEQ ID NO:
38). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, 32 cycles of (95.degree. C. for 30
seconds, 65.degree. C. for 30 seconds, 72.degree. C. for 1 minute),
followed by 5 minutes at 72.degree. C. The PCR product was purified
and cloned into a pET24a plasmid using NdeI and HindIII restriction
sites. A sequence verified clone, Plasmid_2, was used as a template
for a subsequent round of PCR amplification.
[0146] PCR amplification was performed using Plasmid_2, forward
primer IoE5 (SEQ ID NO: 39) and reverse primer IoE6 (SEQ ID NO:
40). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 58.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 35 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid_3, was used as a template for a
subsequent round of PCR amplification.
[0147] PCR amplification was performed using Plasmid_3, forward
primer IoE7 (SEQ ID NO: 41) and reverse primer IoE8 (SEQ ID NO:
42). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 55.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 28 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid_4, was used as a template for a
subsequent round of PCR amplification.
[0148] PCR amplification was performed using Plasmid_4, forward
primer IoE9 (SEQ ID NO: 43) and reverse primer IoE10 (SEQ ID NO:
44). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 53.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 33 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid_5, was used as a template for a
subsequent round of PCR amplification.
[0149] PCR amplification was performed using Plasmid_5, forward
primer IoE11 (SEQ ID NO: 45) and reverse primer IoE12 (SEQ ID NO:
46). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 57.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 30 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid_6, was used as a template for a
subsequent round of PCR amplification.
[0150] PCR amplification was performed using Plasmid_6, forward
primer IoE13 (SEQ ID NO: 47) and reverse primer IoE14 (SEQ ID NO:
48). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 51.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 32 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid_7, was used as a template for a
subsequent round of PCR amplification.
[0151] PCR amplification was performed using Plasmid_7, forward
primer IoE15 (SEQ ID NO: 49) and reverse primer IoE16 (SEQ ID NO:
50). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 54.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 32 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. A
sequence verified clone, Plasmid 8, was used as a template for a
subsequent round of PCR amplification.
[0152] PCR amplification was performed using Plasmid 8, forward
primer IoE17 (SEQ ID NO: 51) and reverse primer IoE18 (SEQ ID NO:
52). PCR amplification and cloning were performed using the
procedure described above and the following PCR conditions:
95.degree. C. for 5 minutes, followed by 95.degree. C. for 30
seconds, 52.degree. C. for 30 seconds, 72.degree. C. for 1 minute
in 32 cycles, with a final 5 minute extension at 72.degree. C. PCR
products were separated electrophoretically using 1.0% agarose gel,
and stained with ethidium bromide. The DNA fragment was excised
from the gel, extracted and cloned into a pET24a plasmid. The
ligation mixture was transformed into DH5alpha strain of
Escherichia coli cells and transformants were selected on LB plates
containing ampicillin. A sequence verified clone, Plasmid_9
contains the CRYA_1B (SEQ ID NO: 25) in the correct reading
frame.
Expression of Recombinant Polypeptide CRYA_1B
[0153] Plasmid_9 was transformed into the expression Escherichia
coli strain BL21, and the ampicillin-resistant colonies were
selected. The expected molecular weight for CRYA_1B recombinant
polypeptide was 20 kDa (FIG. 2). A single colony from Luria-Betani
(LB)-agar plate supplemented with 100 .mu.g/ml ampicillin was
selected. In this preparation, a 50 ml conical tube containing 3 ml
of LB medium (10 g tryptone, 10 g NaCl and 5 g yeast extract per L)
and 100 .mu.g/ml of ampicillin was inoculated with a single colony
and grown overnight in a shaking incubator set at 37.degree. C. and
200 RPM. The culture was further expanded by adding 3 ml of the
culture into a sterile 500 ml Erlenmeyer flask containing 100 ml of
2YT medium (16 g tryptone, 15 g yeast extract and 8 g NaCl per L)
and 100 .mu.g/ml of ampicillin and grown overnight in a shaking
incubator set at 37.degree. C. and 200 RPM. This resulted in a seed
culture.
[0154] A 6 L bioreactor was used to further expand the seed
culture. 4 L of 2YT medium containing 100 .mu.g/ml of ampicillin
was inoculated with 100 ml of seed culture grown overnight in a
shaking incubator set at 37.degree. C. and 200 RPM. In the
bioreactor, cultures were incubated at 37.degree. C., airflow and
agitation of 2 SLPM (standard liners per minute) and 200 RPM. When
the OD600 reached 0.65 to 0.75, protein overexpression was induced
with 1.0 mM Isoropyl-.beta.-D-thiogalactopyranoside (IPTG). The
cells were allowed to grow for 7 to 8 hours and the agitation
speed, temperature and air flow were set to 400 RPM, 28.degree. C.
and 4 SLPM, respectively. To control foaming, Polyglycol P-2000
antifoam was added as required. After 7 to 8 hours of induction,
the cells were harvested by centrifugation at 8000 rpm for 15
minutes at 4.degree. C. The cell pellets were frozen and stored at
-80.degree. C.
Purification of Recombinant Polypeptide CRYA_1B
[0155] In this preparation, the pellets, equivalent to 6 g of
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was resuspended in
40 ml of Buffer A (50 mM Tris-HCl buffer) and disrupted by
sonication on ice (28 cycles of 10-s pulses with 30-s intervals,
30% amplitude using an ultrasonic cell disruptor Misonix Ultrasonic
Liquid Processors S-4000, USA) to obtain the total protein extract
for solubility analysis. The total protein extract was centrifuged
at 14,000 rpm for 45 min at 4.degree. C. using a Sorvall RCSC Plus
(USA) ultracentrifuge using a type SS-34 rotor. The supernatant was
filtered through a 0.45 .mu.m filter (Millipore) and loaded onto a
Q-Sepharose anion exchange column equilibrated in the same buffer.
Q-Sepharose was packed into a C 26/40 Column (GE Healthcare) to a
bed height of 20 cm. A 40 mL volume of supernatant containing
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was loaded onto the
column using AKTA FPLC (GE Healthcare) at a flow rate of 5 ml/min.
CRYA_1B recombinant polypeptide (SEQ ID NO: 9) was eluted by a
concentration gradient by using an equilibrium buffer containing 50
mM Tris-HCl, NaCl buffer and collected in a single peak based on
A.sub.280 absorbance for further application on the hydrophobic
interaction column. The eluents collected were analyzed by 15%
SDS-polyacrylamide gel electrophoresis.
Hydrophobic Interaction Chromatography
[0156] After ion exchange chromatography, the eluted CRYA_1B
recombinant polypeptide (SEQ ID NO: 9) was pooled together,
concentrated by Amicon Ultra 15 ml Centrifugal Filter (Merck), and
subsequently added to the saturated ammonium sulphate buffer (50 mM
Tris-HCl, 3.8 M ammonium sulphate, 1 mM DTT and 1 mM EDTA),
resulting in a final concentration of 1.2 M ammonium sulphate. The
concentrated product with adding ammonium sulphate was filtered
using a 0.45 .mu.m syringe filter (Millipore) and loaded to
Hydrophobic Interaction Chromatography column (C 10/20 column, Ge
Healthcare) at a flow rate of 2 ml/min. Source 15PHE (GE
Healthcare) was packed into C 10/20 column (GE Healthcare) to a bed
height of 10 cm and pre-equilibrated with buffer A (50 mM Tris-HCl,
1.2 M ammonium sulphate, 10% glycerol, 1 mM DTT and 1 mM EDTA). The
column was washed with buffer A and the protein elution using
buffer B (50 mM Tris-HCl, 10% glycerol, 1 mM DTT and 1 mM EDTA) was
achieved with a linear gradient with decreasing ammonium sulphate
and increasing glycerol. The eluted protein was analyzed by 15%
SDS-PAGE. The fractions were further concentrated by Amicon Ultra
15 ml Centrifugal Filter (Merck).
Buffer Exchange Using Gel Filtration
[0157] The purified recombinant polypeptide was further exchanged
into PBS buffer by using a Sephadex G-25 column. Sephadex G-25 was
packed into a C 26/100 column (GE Healthcare) to a bed height of 85
cm and pre-equilibrated with PBS buffer at a flow rate of 1 ml/min.
The concentrated protein was eluted after 2.5 hours and analyzed by
15% SDS-PAGE. The resulting eluates were then concentrated by
Amicon Ultra 15 ml Centrifugal Filter (Merck).
EXAMPLE 2: Methods of Inducing or Enhancing an Immune Response
[0158] Cancer cell lines were treated with CRYA_1B recombinant
polypeptide (SEQ ID NO: 9), CRYA_1B recombinant polypeptide was
diluted to various concentrations and incubated with human cancer
cell lines H441 (lung cancer, HTB-174, ATCC), H460 (lung cancer,
HTB-177, ATCC), HCT15 (colon cancer, CCL-225, ATCC) and MCF7
(breast cancer, HTB-22, ATCC) all at 37.degree. C. As of CRT,
HSP70, HSP90, and Caspase 3/7 assay, the recombinant polypeptide
incubation time for H441 is 60 min, 1 hr50 min, 1 hr40 min, and 2
hr45 min respectively, for H460 is 30 min, 1 hr15 min, 1 hr5 min,
and 2 hr30 min respectively, for HCT15 is 55 min, 1 hr50 min, 1
hr30 min, and 2 hr30 min respectively, and for MCF7 is 1 hr10 min,
1 hr40 min, 1 hr45 min, and 2 hr45 min respectively. Flow cytometry
was used to assess the cell surface expression of calreticulin
(CRT) (FIGS. 3-6), HSP70 (FIGS. 7-10), HSP90 (FIGS. 11-14) and
Caspase 3/7 (FIGS. 15-18) in cells treated with CRYA_1B recombinant
polypeptide and in untreated control cells. This was performed
using a FACSCalibur (BD Biosciences) using CRT mAb (Abcam), HSP70
mAb (Enzo Life Sciences), HSP90 mAb (Enzo Life Sciences) and
Caspase 3/7 (Invitrogen assay), respectively.
Sequence CWU 1
1
521173PRTAnser cygnoides 1Met Asp Ile Thr Ile Gln His Pro Trp Phe
Lys Arg Ala Leu Gly Pro1 5 10 15Leu Ile Pro Ser Arg Leu Phe Asp Gln
Phe Phe Gly Glu Gly Leu Leu 20 25 30Glu Tyr Asp Leu Leu Pro Leu Phe
Ser Ser Thr Ile Ser Pro Tyr Tyr 35 40 45Arg Gln Ser Leu Phe Arg Ser
Val Leu Glu Ser Gly Ile Ser Glu Val 50 55 60Arg Ser Asp Arg Asp Lys
Phe Thr Ile Met Leu Asp Val Lys His Phe65 70 75 80Ser Pro Glu Asp
Leu Ser Val Lys Ile Ile Asp Asp Phe Val Glu Ile 85 90 95His Gly Lys
His Ser Glu Arg Gln Asp Asp His Gly Tyr Ile Ser Arg 100 105 110Glu
Phe His Arg Arg Tyr Arg Leu Pro Ala Asn Val Asp Gln Ser Ala 115 120
125Ile Thr Cys Ser Leu Ser Gly Asp Gly Met Leu Thr Phe Ser Gly Pro
130 135 140Lys Val Pro Ser Asn Met Asp Pro Thr His Ser Glu Arg Pro
Ile Pro145 150 155 160Val Ser Arg Glu Glu Lys Pro Thr Ser Ala Pro
Ser Ser 165 1702173PRTRhea americana 2Met Asp Ile Thr Ile Gln His
Pro Trp Phe Lys Arg Ala Leu Gly Pro1 5 10 15Leu Ile Pro Ser Arg Leu
Phe Asp Gln Phe Phe Gly Glu Gly Leu Leu 20 25 30Glu Tyr Asp Leu Leu
Pro Leu Phe Ser Ser Thr Ile Ser Pro Tyr Tyr 35 40 45Arg Gln Ser Leu
Phe Arg Ser Val Leu Glu Ser Gly Ile Ser Glu Val 50 55 60Arg Ser Asp
Arg Glu Lys Phe Thr Ile Met Leu Asp Val Lys His Phe65 70 75 80Ser
Pro Glu Asp Leu Ser Val Lys Ile Ile Asp Asp Phe Val Glu Ile 85 90
95His Gly Lys His Ser Glu Arg Gln Asp Asp His Gly Tyr Ile Ser Arg
100 105 110Glu Phe His Arg Arg Tyr Arg Leu Pro Ser Asn Val Asp Gln
Ser Ala 115 120 125Ile Thr Cys Ser Leu Ser Ser Asp Gly Met Leu Thr
Phe Ser Gly Pro 130 135 140Lys Val Gln Ala Asn Met Asp Pro Ser His
Ser Glu Arg Pro Ile Pro145 150 155 160Val Ser Arg Glu Glu Lys Pro
Thr Ser Ala Pro Ser Ser 165 1703149PRTAnas platyrhynchos 3Arg Ala
Leu Gly Pro Leu Ile Pro Ser Arg Leu Phe Asp Gln Phe Phe1 5 10 15Gly
Glu Gly Leu Leu Glu Tyr Asp Leu Leu Pro Leu Phe Ser Ser Thr 20 25
30Ile Ser Pro Tyr Tyr Arg Gln Ser Leu Phe Arg Ser Val Leu Glu Ser
35 40 45Gly Ile Ser Glu Val Arg Ser Asp Arg Asp Lys Phe Thr Ile Met
Leu 50 55 60Asp Val Lys His Phe Ser Pro Glu Asp Leu Ser Val Lys Ile
Ile Asp65 70 75 80Asp Phe Val Glu Ile His Gly Lys His Ser Glu Arg
Gln Asp Asp His 85 90 95Gly Tyr Ile Ser Arg Glu Phe His Arg Arg Tyr
Arg Leu Pro Ala Asn 100 105 110Val Asp Gln Ser Ala Ile Thr Cys Ser
Leu Ser Gly Asp Gly Met Leu 115 120 125Thr Phe Ser Gly Pro Lys Val
Pro Ser Asn Met Asp Pro Thr His Ser 130 135 140Glu Arg Pro Ile
Pro1454174PRTAnas platyrhynchos 4Met Asp Ile Thr Ile His Asn Pro
Leu Ile Arg Arg Pro Leu Phe Ser1 5 10 15Trp Leu Ala Pro Ser Arg Ile
Phe Asp Gln Ile Phe Gly Glu His Leu 20 25 30Gln Glu Ser Glu Leu Leu
Pro Ala Ser Pro Ser Leu Ser Pro Phe Leu 35 40 45Met Arg Ser Pro Ile
Phe Arg Met Pro Ser Trp Leu Glu Thr Gly Leu 50 55 60Ser Glu Met Arg
Leu Glu Lys Asp Lys Phe Ser Val Asn Leu Asp Val65 70 75 80Lys His
Phe Ser Pro Glu Glu Leu Lys Val Lys Val Leu Gly Asp Met 85 90 95Val
Glu Ile His Gly Lys His Glu Glu Arg Gln Asp Glu His Gly Phe 100 105
110Ile Ala Arg Glu Phe Asn Arg Lys Tyr Arg Ile Pro Ala Asp Val Asp
115 120 125Pro Leu Thr Ile Thr Ser Ser Leu Ser Leu Asp Gly Val Leu
Thr Val 130 135 140Ser Ala Pro Arg Lys Gln Ser Asp Val Pro Glu Arg
Ser Ile Pro Ile145 150 155 160Thr Arg Glu Glu Lys Pro Ala Ile Ala
Gly Ala Gln Arg Lys 165 1705173PRTHomo sapiens 5Met Asp Val Thr Ile
Gln His Pro Trp Phe Lys Arg Thr Leu Gly Pro1 5 10 15Phe Tyr Pro Ser
Arg Leu Phe Asp Gln Phe Phe Gly Glu Gly Leu Phe 20 25 30Glu Tyr Asp
Leu Leu Pro Phe Leu Ser Ser Thr Ile Ser Pro Tyr Tyr 35 40 45Arg Gln
Ser Leu Phe Arg Thr Val Leu Asp Ser Gly Ile Ser Glu Val 50 55 60Arg
Ser Asp Arg Asp Lys Phe Val Ile Phe Leu Asp Val Lys His Phe65 70 75
80Ser Pro Glu Asp Leu Thr Val Lys Val Gln Asp Asp Phe Val Glu Ile
85 90 95His Gly Lys His Asn Glu Arg Gln Asp Asp His Gly Tyr Ile Ser
Arg 100 105 110Glu Phe His Arg Arg Tyr Arg Leu Pro Ser Asn Val Asp
Gln Ser Ala 115 120 125Leu Ser Cys Ser Leu Ser Ala Asp Gly Met Leu
Thr Phe Cys Gly Pro 130 135 140Lys Ile Gln Thr Gly Leu Asp Ala Thr
His Ala Glu Arg Ala Ile Pro145 150 155 160Val Ser Arg Glu Glu Lys
Pro Thr Ser Ala Pro Ser Ser 165 1706186PRTDrosophila melanogaster
6Met Ala Asn Ile Pro Leu Leu Leu Ser Leu Ala Asp Asp Leu Gly Arg1 5
10 15Met Ser Met Val Pro Phe Tyr Glu Pro Tyr Tyr Cys Gln Arg Gln
Arg 20 25 30Asn Pro Tyr Leu Ala Leu Val Gly Pro Met Glu Gln Gln Leu
Arg Gln 35 40 45Leu Glu Lys Gln Val Gly Ala Ser Ser Gly Ser Ser Gly
Ala Val Ser 50 55 60Lys Ile Gly Lys Asp Gly Phe Gln Val Cys Met Asp
Val Ser His Phe65 70 75 80Lys Pro Ser Glu Leu Val Val Lys Val Gln
Asp Asn Ser Val Leu Val 85 90 95Glu Gly Asn His Glu Glu Arg Glu Asp
Asp His Gly Phe Ile Thr Arg 100 105 110His Phe Val Arg Arg Tyr Ala
Leu Pro Pro Gly Tyr Glu Ala Asp Lys 115 120 125Val Ala Ser Thr Leu
Ser Ser Asp Gly Val Leu Thr Ile Lys Val Pro 130 135 140Lys Pro Pro
Ala Ile Glu Asp Lys Gly Asn Glu Arg Ile Val Gln Ile145 150 155
160Gln Gln Val Gly Pro Ala His Leu Asn Val Lys Glu Asn Pro Lys Glu
165 170 175Ala Val Glu Gln Asp Asn Gly Asn Asp Lys 180
1857174PRTDrosophila melanogaster 7Met Arg Ser Leu Pro Met Phe Trp
Arg Met Ala Glu Glu Met Ala Arg1 5 10 15Met Pro Arg Leu Ser Ser Pro
Phe His Ala Phe Phe His Glu Pro Pro 20 25 30Val Trp Ser Val Ala Leu
Pro Arg Asn Trp Gln His Ile Ala Arg Trp 35 40 45Gln Glu Gln Glu Leu
Ala Pro Pro Ala Thr Val Asn Lys Asp Gly Tyr 50 55 60Lys Leu Thr Leu
Asp Val Lys Asp Tyr Ser Glu Leu Lys Val Lys Val65 70 75 80Leu Asp
Glu Ser Val Val Leu Val Glu Ala Lys Ser Glu Gln Gln Glu 85 90 95Ala
Glu Gln Gly Gly Tyr Ser Ser Arg His Phe Leu Gly Arg Tyr Val 100 105
110Leu Pro Asp Gly Tyr Glu Ala Asp Lys Val Ser Ser Ser Leu Ser Asp
115 120 125Asp Gly Val Leu Thr Ile Ser Val Pro Asn Pro Pro Gly Val
Gln Glu 130 135 140Thr Leu Lys Glu Arg Glu Val Thr Ile Glu Gln Thr
Gly Glu Pro Ala145 150 155 160Lys Lys Ser Ala Glu Glu Pro Lys Asp
Lys Thr Ala Ser Gln 165 1708174PRTAnser cygnoides 8Met Asp Ile Thr
Ile His Asn Pro Leu Ile Arg Arg Pro Leu Phe Ser1 5 10 15Trp Leu Ala
Pro Ser Arg Ile Phe Asp Gln Ile Phe Gly Glu His Leu 20 25 30Gln Glu
Ser Glu Leu Leu Pro Ala Ser Pro Ser Leu Ser Pro Phe Leu 35 40 45Met
Arg Ser Pro Ile Phe Arg Met Pro Ser Trp Leu Glu Thr Gly Leu 50 55
60Ser Glu Met Arg Leu Glu Lys Asp Lys Phe Ser Val Asn Leu Asp Val65
70 75 80Lys His Phe Ser Pro Glu Glu Leu Lys Val Lys Val Leu Gly Asp
Met 85 90 95Val Glu Ile His Gly Lys His Glu Glu Arg Gln Asp Glu His
Gly Phe 100 105 110Ile Ala Arg Glu Phe Asn Arg Lys Tyr Arg Ile Pro
Ala Asp Val Asp 115 120 125Pro Leu Thr Ile Thr Ser Ser Leu Ser Leu
Asp Gly Val Leu Thr Val 130 135 140Ser Ala Pro Arg Lys Gln Ser Asp
Val Pro Glu Arg Ser Ile Pro Ile145 150 155 160Thr Arg Glu Glu Lys
Pro Ala Ile Ala Gly Ala Gln Arg Lys 165 1709173PRTArtificial
Sequenceartificial polypeptide 9Met Asp Ile Thr Ile Gln His Pro Trp
Phe Lys Arg Ala Leu Gly Pro1 5 10 15Leu Ile Pro Glu Arg Leu Phe Asp
Gln Phe Phe Gly Ser Gly Leu Leu 20 25 30Ser Tyr Asp Leu Leu Pro Leu
Phe Glu Glu Thr Ile Glu Pro Tyr Tyr 35 40 45Arg Gln Glu Leu Phe Arg
Glu Val Leu Ser Glu Gly Ile Glu Ser Val 50 55 60Arg Glu Asp Arg Asp
Lys Phe Thr Ile Met Leu Asp Val Lys His Phe65 70 75 80Glu Pro Ser
Asp Leu Glu Val Lys Ile Ile Asp Asp Phe Val Ser Ile 85 90 95His Gly
Lys His Glu Ser Arg Gln Asp Asp His Gly Tyr Ile Glu Arg 100 105
110Ser Phe His Arg Arg Tyr Arg Leu Pro Ala Asn Val Asp Gln Glu Ala
115 120 125Ile Thr Cys Glu Leu Glu Gly Asp Gly Met Leu Thr Phe Glu
Gly Pro 130 135 140Lys Val Pro Glu Asn Met Asp Pro Thr His Glu Ser
Arg Pro Ile Pro145 150 155 160Val Glu Arg Ser Ser Lys Pro Thr Glu
Ala Pro Glu Glu 165 17010173PRTArtificial Sequenceartificial
polypeptide 10Met Asp Ile Thr Ile Gln His Pro Trp Phe Lys Arg Ala
Leu Gly Pro1 5 10 15Leu Ile Pro Glu Arg Leu Phe Asp Gln Phe Phe Gly
Ser Gly Leu Leu 20 25 30Ser Tyr Asp Leu Leu Pro Leu Phe Glu Glu Thr
Ile Glu Pro Tyr Tyr 35 40 45Arg Gln Glu Leu Phe Arg Glu Val Leu Ser
Glu Gly Ile Glu Ser Val 50 55 60Arg Glu Asp Arg Ser Lys Phe Thr Ile
Met Leu Asp Val Lys His Phe65 70 75 80Glu Pro Ser Asp Leu Glu Val
Lys Ile Ile Asp Asp Phe Val Ser Ile 85 90 95His Gly Lys His Glu Ser
Arg Gln Asp Asp His Gly Tyr Ile Glu Arg 100 105 110Ser Phe His Arg
Arg Tyr Arg Leu Pro Glu Asn Val Asp Gln Glu Ala 115 120 125Ile Thr
Cys Glu Leu Glu Glu Asp Gly Met Leu Thr Phe Glu Gly Pro 130 135
140Lys Val Gln Ala Asn Met Asp Pro Glu His Glu Ser Arg Pro Ile
Pro145 150 155 160Val Glu Arg Ser Ser Lys Pro Thr Glu Ala Pro Glu
Glu 165 17011149PRTArtificial Sequenceartificial polypeptide 11Arg
Ala Leu Gly Pro Leu Ile Pro Glu Arg Leu Phe Asp Gln Phe Phe1 5 10
15Gly Ser Gly Leu Leu Ser Tyr Asp Leu Leu Pro Leu Phe Glu Glu Thr
20 25 30Ile Glu Pro Tyr Tyr Arg Gln Glu Leu Phe Arg Glu Val Leu Ser
Glu 35 40 45Gly Ile Glu Ser Val Arg Glu Asp Arg Asp Lys Phe Thr Ile
Met Leu 50 55 60Asp Val Lys His Phe Glu Pro Ser Asp Leu Glu Val Lys
Ile Ile Asp65 70 75 80Asp Phe Val Ser Ile His Gly Lys His Glu Ser
Arg Gln Asp Asp His 85 90 95Gly Tyr Ile Glu Arg Ser Phe His Arg Arg
Tyr Arg Leu Pro Ala Asn 100 105 110Val Asp Gln Glu Ala Ile Thr Cys
Glu Leu Glu Gly Asp Gly Met Leu 115 120 125Thr Phe Glu Gly Pro Lys
Val Pro Glu Asn Met Asp Pro Thr His Glu 130 135 140Ser Arg Pro Ile
Pro14512174PRTArtificial Sequenceartificial polypeptide 12Met Ser
Ile Thr Ile His Asn Pro Leu Ile Arg Arg Pro Leu Phe Asp1 5 10 15Trp
Leu Ala Pro Asp Arg Ile Phe Ser Gln Ile Phe Gly Glu His Leu 20 25
30Gln Glu Asp Glu Leu Leu Pro Ala Asp Pro Asp Leu Asp Pro Phe Leu
35 40 45Met Arg Asp Pro Ile Phe Arg Met Pro Asp Trp Leu Glu Thr Gly
Leu 50 55 60Asp Glu Met Arg Leu Glu Lys Ser Lys Phe Asp Val Asn Leu
Ser Val65 70 75 80Lys His Phe Asp Pro Glu Glu Leu Lys Val Lys Val
Leu Gly Ser Met 85 90 95Val Glu Ile His Gly Lys His Glu Glu Arg Gln
Ser Glu His Gly Phe 100 105 110Ile Ala Arg Glu Phe Asn Arg Lys Tyr
Arg Ile Pro Ala Ser Val Ser 115 120 125Pro Leu Thr Ile Thr Asp Asp
Leu Asp Leu Ser Gly Val Leu Thr Val 130 135 140Asp Ala Pro Arg Lys
Gln Asp Ser Val Pro Glu Arg Asp Ile Pro Ile145 150 155 160Thr Arg
Glu Glu Lys Pro Ala Ile Ala Gly Ala Gln Arg Lys 165
17013173PRTArtificial Sequenceartificial polypeptide 13Met Asp Val
Thr Ile Gln His Pro Trp Phe Lys Arg Thr Leu Gly Pro1 5 10 15Phe Tyr
Pro Glu Arg Leu Phe Asp Gln Phe Phe Gly Ser Gly Leu Phe 20 25 30Ser
Tyr Asp Leu Leu Pro Phe Leu Glu Glu Thr Ile Glu Pro Tyr Tyr 35 40
45Arg Gln Glu Leu Phe Arg Thr Val Leu Asp Glu Gly Ile Glu Ser Val
50 55 60Arg Glu Asp Arg Asp Lys Phe Val Ile Phe Leu Asp Val Lys His
Phe65 70 75 80Glu Pro Ser Asp Leu Thr Val Lys Val Gln Asp Asp Phe
Val Ser Ile 85 90 95His Gly Lys His Asn Ser Arg Gln Asp Asp His Gly
Tyr Ile Glu Arg 100 105 110Ser Phe His Arg Arg Tyr Arg Leu Pro Glu
Asn Val Asp Gln Glu Ala 115 120 125Leu Glu Cys Glu Leu Glu Ala Asp
Gly Met Leu Thr Phe Cys Gly Pro 130 135 140Lys Ile Gln Thr Gly Leu
Asp Ala Thr His Ala Ser Arg Ala Ile Pro145 150 155 160Val Glu Arg
Ser Ser Lys Pro Thr Glu Ala Pro Glu Glu 165 17014186PRTArtificial
Sequenceartificial polypeptide 14Met Ala Asn Ile Pro Leu Leu Leu
Ser Leu Ala Val Val Leu Gly Arg1 5 10 15Met Ser Met Asp Pro Phe Tyr
Glu Pro Tyr Tyr Cys Gln Arg Gln Arg 20 25 30Asn Pro Tyr Leu Ala Leu
Asp Gly Pro Met Glu Gln Gln Leu Arg Gln 35 40 45Leu Glu Lys Gln Asp
Gly Ala Ser Ser Gly Ser Ser Gly Ala Asp Ser 50 55 60Lys Ile Gly Lys
Val Gly Phe Gln Asp Cys Met Val Asp Ser His Phe65 70 75 80Lys Pro
Ser Glu Leu Asp Asp Lys Asp Gln Val Asn Ser Asp Leu Asp 85 90 95Glu
Gly Asn His Glu Glu Arg Glu Val Val His Gly Phe Ile Thr Arg 100 105
110His Phe Asp Arg Arg Tyr Ala Leu Pro Pro Gly Tyr Glu Ala Val Lys
115 120 125Asp Ala Ser Thr Leu Ser Ser Val Gly Asp Leu Thr Ile Lys
Asp Pro 130 135 140Lys Pro Pro Ala Ile Glu Val Lys Gly Asn Glu Arg
Ile Asp Gln Ile145 150 155 160Gln Gln Asp Gly Pro Ala His Leu Asn
Asp Lys Glu Asn Pro Lys Glu 165 170 175Ala Asp Glu Gln Val Asn Gly
Asn Val Lys 180 18515174PRTArtificial Sequenceartificial
polypeptide 15Met Arg Leu Ser Pro Met Phe Trp Arg Met Ala Glu Glu
Met Ala Arg1 5 10
15Met Pro Arg Ser Leu Leu Pro Phe His Ala Phe Phe His Glu Pro Pro
20 25 30Asp Trp Leu Asp Ala Ser Pro Arg Asn Trp Gln His Ile Ala Arg
Trp 35 40 45Gln Glu Gln Glu Ser Ala Pro Pro Ala Thr Asp Asn Lys Val
Gly Tyr 50 55 60Lys Ser Thr Ser Val Asp Lys Val Tyr Leu Glu Ser Lys
Asp Lys Asp65 70 75 80Ser Val Glu Leu Asp Asp Ser Asp Glu Ala Lys
Leu Glu Gln Gln Glu 85 90 95Ala Glu Gln Gly Gly Tyr Leu Leu Arg His
Phe Ser Gly Arg Tyr Asp 100 105 110Ser Pro Val Gly Tyr Glu Ala Val
Lys Asp Leu Leu Leu Ser Leu Val 115 120 125Val Gly Asp Ser Thr Ile
Leu Asp Pro Asn Pro Pro Gly Asp Gln Glu 130 135 140Thr Ser Lys Glu
Arg Glu Asp Thr Ile Glu Gln Thr Gly Glu Pro Ala145 150 155 160Lys
Lys Leu Ala Glu Glu Pro Lys Val Lys Thr Ala Leu Gln 165
17016174PRTArtificial Sequenceartificial polypeptide 16Met Ser Ile
Thr Ile His Asn Pro Leu Ile Arg Arg Pro Leu Phe Asp1 5 10 15Trp Leu
Ala Pro Asp Arg Ile Phe Ser Gln Ile Phe Gly Glu His Leu 20 25 30Gln
Glu Asp Glu Leu Leu Pro Ala Asp Pro Asp Leu Asp Pro Phe Leu 35 40
45Met Arg Asp Pro Ile Phe Arg Met Pro Asp Trp Leu Glu Thr Gly Leu
50 55 60Asp Glu Met Arg Leu Glu Lys Ser Lys Phe Asp Val Asn Leu Ser
Val65 70 75 80Lys His Phe Asp Pro Glu Glu Leu Lys Val Lys Val Leu
Gly Ser Met 85 90 95Val Glu Ile His Gly Lys His Glu Glu Arg Gln Ser
Glu His Gly Phe 100 105 110Ile Ala Arg Glu Phe Asn Arg Lys Tyr Arg
Ile Pro Ala Ser Val Ser 115 120 125Pro Leu Thr Ile Thr Asp Asp Leu
Asp Leu Ser Gly Val Leu Thr Val 130 135 140Asp Ala Pro Arg Lys Gln
Asp Ser Val Pro Glu Arg Asp Ile Pro Ile145 150 155 160Thr Arg Glu
Glu Lys Pro Ala Ile Ala Gly Ala Gln Arg Lys 165 17017519DNAAnser
cygnoides 17atggatatta ccattcagca tccgtggttt aaacgcgcgc tgggcccgct
gattccgagc 60cgcctgtttg atcagttttt tggcgaaggc ctgctggaat atgatctgct
gccgctgttt 120agcagcacca ttagcccgta ttatcgccag agcctgtttc
gcagcgtgct ggaaagcggc 180attagcgaag tgcgcagcga tcgcgataaa
tttaccatta tgctggatgt gaaacatttt 240agcccggaag atctgagcgt
gaaaattatt gatgattttg tggaaattca tggcaaacat 300agcgaacgcc
aggatgatca tggctatatt agccgcgaat ttcatcgccg ctatcgcctg
360ccggcgaacg tggatcagag cgcgattacc tgcagcctga gcggcgatgg
catgctgacc 420tttagcggcc cgaaagtgcc gagcaacatg gatccgaccc
atagcgaacg cccgattccg 480gtgagccgcg aagaaaaacc gaccagcgcg ccgagcagc
51918519DNARhea americana 18atggatatta ccattcagca tccgtggttt
aaacgcgcgc tgggcccgct gattccgagc 60cgcctgtttg atcagttttt tggcgaaggc
ctgctggaat atgatctgct gccgctgttt 120agcagcacca ttagcccgta
ttatcgccag agcctgtttc gcagcgtgct ggaaagcggc 180attagcgaag
tgcgcagcga tcgcgaaaaa tttaccatta tgctggatgt gaaacatttt
240agcccggaag atctgagcgt gaaaattatt gatgattttg tggaaattca
tggcaaacat 300agcgaacgcc aggatgatca tggctatatt agccgcgaat
ttcatcgccg ctatcgcctg 360ccgagcaacg tggatcagag cgcgattacc
tgcagcctga gcagcgatgg catgctgacc 420tttagcggcc cgaaagtgca
ggcgaacatg gatccgagcc atagcgaacg cccgattccg 480gtgagccgcg
aagaaaaacc gaccagcgcg ccgagcagc 51919447DNAAnas platyrhynchos
19cgcgcgctgg gcccgctgat tccgagccgc ctgtttgatc agttttttgg cgaaggcctg
60ctggaatatg atctgctgcc gctgtttagc agcaccatta gcccgtatta tcgccagagc
120ctgtttcgca gcgtgctgga aagcggcatt agcgaagtgc gcagcgatcg
cgataaattt 180accattatgc tggatgtgaa acattttagc ccggaagatc
tgagcgtgaa aattattgat 240gattttgtgg aaattcatgg caaacatagc
gaacgccagg atgatcatgg ctatattagc 300cgcgaatttc atcgccgcta
tcgcctgccg gcgaacgtgg atcagagcgc gattacctgc 360agcctgagcg
gcgatggcat gctgaccttt agcggcccga aagtgccgag caacatggat
420ccgacccata gcgaacgccc gattccg 44720522DNAAnas platyrhynchos
20atggatatta ccattcataa cccgctgatt cgccgcccgc tgtttagctg gctggcgccg
60agccgcattt ttgatcagat ttttggcgaa catctgcagg aaagcgaact gctgccggcg
120agcccgagcc tgagcccgtt tctgatgcgc agcccgattt ttcgcatgcc
gagctggctg 180gaaaccggcc tgagcgaaat gcgcctggaa aaagataaat
ttagcgtgaa cctggatgtg 240aaacatttta gcccggaaga actgaaagtg
aaagtgctgg gcgatatggt ggaaattcat 300ggcaaacatg aagaacgcca
ggatgaacat ggctttattg cgcgcgaatt taaccgcaaa 360tatcgcattc
cggcggatgt ggatccgctg accattacca gcagcctgag cctggatggc
420gtgctgaccg tgagcgcgcc gcgcaaacag agcgatgtgc cggaacgcag
cattccgatt 480acccgcgaag aaaaaccggc gattgcgggc gcgcagcgca aa
52221519DNAHomo sapiens 21atggatgtga ccattcagca tccgtggttt
aaacgcaccc tgggcccgtt ttatccgagc 60cgcctgtttg atcagttttt tggcgaaggc
ctgtttgaat atgatctgct gccgtttctg 120agcagcacca ttagcccgta
ttatcgccag agcctgtttc gcaccgtgct ggatagcggc 180attagcgaag
tgcgcagcga tcgcgataaa tttgtgattt ttctggatgt gaaacatttt
240agcccggaag atctgaccgt gaaagtgcag gatgattttg tggaaattca
tggcaaacat 300aacgaacgcc aggatgatca tggctatatt agccgcgaat
ttcatcgccg ctatcgcctg 360ccgagcaacg tggatcagag cgcgctgagc
tgcagcctga gcgcggatgg catgctgacc 420ttttgcggcc cgaaaattca
gaccggcctg gatgcgaccc atgcggaacg cgcgattccg 480gtgagccgcg
aagaaaaacc gaccagcgcg ccgagcagc 51922558DNADrosophila melanogaster
22atggcgaaca ttccgctgct gctgagcctg gcggatgatc tgggccgcat gagcatggtg
60ccgttttatg aaccgtatta ttgccagcgc cagcgcaacc cgtatctggc gctggtgggc
120ccgatggaac agcagctgcg ccagctggaa aaacaggtgg gcgcgagcag
cggcagcagc 180ggcgcggtga gcaaaattgg caaagatggc tttcaggtgt
gcatggatgt gagccatttt 240aaaccgagcg aactggtggt gaaagtgcag
gataacagcg tgctggtgga aggcaaccat 300gaagaacgcg aagatgatca
tggctttatt acccgccatt ttgtgcgccg ctatgcgctg 360ccgccgggct
atgaagcgga taaagtggcg agcaccctga gcagcgatgg cgtgctgacc
420attaaagtgc cgaaaccgcc ggcgattgaa gataaaggca acgaacgcat
tgtgcagatt 480cagcaggtgg gcccggcgca tctgaacgtg aaagaaaacc
cgaaagaagc ggtggaacag 540gataacggca acgataaa 55823522DNADrosophila
melanogaster 23atgcgcagcc tgccgatgtt ttggcgcatg gcggaagaaa
tggcgcgcat gccgcgcctg 60agcagcccgt ttcatgcgtt ttttcatgaa ccgccggtgt
ggagcgtggc gctgccgcgc 120aactggcagc atattgcgcg ctggcaggaa
caggaactgg cgccgccggc gaccgtgaac 180aaagatggct ataaactgac
cctggatgtg aaagattata gcgaactgaa agtgaaagtg 240ctggatgaaa
gcgtggtgct ggtggaagcg aaaagcgaac agcaggaagc ggaacagggc
300ggctatagca gccgccattt tctgggccgc tatgtgctgc cggatggcta
tgaagcggat 360aaagtgagca gcagcctgag cgatgatggc gtgctgacca
ttagcgtgcc gaacccgccg 420ggcgtgcagg aaaccctgaa agaacgcgaa
gtgaccattg aacagaccgg cgaaccggcg 480aaaaaaagcg cggaagaacc
gaaagataaa accgcgagcc ag 52224522DNAAnser cygnoides 24atggatatta
ccattcataa cccgctgatt cgccgcccgc tgtttagctg gctggcgccg 60agccgcattt
ttgatcagat ttttggcgaa catctgcagg aaagcgaact gctgccggcg
120agcccgagcc tgagcccgtt tctgatgcgc agcccgattt ttcgcatgcc
gagctggctg 180gaaaccggcc tgagcgaaat gcgcctggaa aaagataaat
ttagcgtgaa cctggatgtg 240aaacatttta gcccggaaga actgaaagtg
aaagtgctgg gcgatatggt ggaaattcat 300ggcaaacatg aagaacgcca
ggatgaacat ggctttattg cgcgcgaatt taaccgcaaa 360tatcgcattc
cggcggatgt ggatccgctg accattacca gcagcctgag cctggatggc
420gtgctgaccg tgagcgcgcc gcgcaaacag agcgatgtgc cggaacgcag
cattccgatt 480acccgcgaag aaaaaccggc gattgcgggc gcgcagcgca aa
52225519DNAArtificial Sequenceartificial polynucleotide
25atggatatta ccattcagca tccgtggttt aaacgcgcgc tgggcccgct gattccggaa
60cgcctgtttg atcagttttt tggcagcggc ctgctgagct atgatctgct gccgctgttt
120gaagaaacca ttgaaccgta ttatcgccag gaactgtttc gcgaagtgct
gagcgaaggc 180attgaaagcg tgcgcgaaga tcgcgataaa tttaccatta
tgctggatgt gaaacatttt 240gaaccgagcg atctggaagt gaaaattatt
gatgattttg tgagcattca tggcaaacat 300gaaagccgcc aggatgatca
tggctatatt gaacgcagct ttcatcgccg ctatcgcctg 360ccggcgaacg
tggatcagga agcgattacc tgcgaactgg aaggcgatgg catgctgacc
420tttgaaggcc cgaaagtgcc ggaaaacatg gatccgaccc atgaaagccg
cccgattccg 480gtggaacgca gcagcaaacc gaccgaagcg ccggaagaa
51926519DNAArtificial Sequenceartificial polynucleotide
26atggatatta ccattcagca tccgtggttt aaacgcgcgc tgggcccgct gattccggaa
60cgcctgtttg atcagttttt tggcagcggc ctgctgagct atgatctgct gccgctgttt
120gaagaaacca ttgaaccgta ttatcgccag gaactgtttc gcgaagtgct
gagcgaaggc 180attgaaagcg tgcgcgaaga tcgcagcaaa tttaccatta
tgctggatgt gaaacatttt 240gaaccgagcg atctggaagt gaaaattatt
gatgattttg tgagcattca tggcaaacat 300gaaagccgcc aggatgatca
tggctatatt gaacgcagct ttcatcgccg ctatcgcctg 360ccggaaaacg
tggatcagga agcgattacc tgcgaactgg aagaagatgg catgctgacc
420tttgaaggcc cgaaagtgca ggcgaacatg gatccggaac atgaaagccg
cccgattccg 480gtggaacgca gcagcaaacc gaccgaagcg ccggaagaa
51927447DNAArtificial Sequenceartificial polynucleotide
27cgcgcgctgg gcccgctgat tccggaacgc ctgtttgatc agttttttgg cagcggcctg
60ctgagctatg atctgctgcc gctgtttgaa gaaaccattg aaccgtatta tcgccaggaa
120ctgtttcgcg aagtgctgag cgaaggcatt gaaagcgtgc gcgaagatcg
cgataaattt 180accattatgc tggatgtgaa acattttgaa ccgagcgatc
tggaagtgaa aattattgat 240gattttgtga gcattcatgg caaacatgaa
agccgccagg atgatcatgg ctatattgaa 300cgcagctttc atcgccgcta
tcgcctgccg gcgaacgtgg atcaggaagc gattacctgc 360gaactggaag
gcgatggcat gctgaccttt gaaggcccga aagtgccgga aaacatggat
420ccgacccatg aaagccgccc gattccg 44728522DNAArtificial
Sequenceartificial polynucleotide 28atgagcatta ccattcataa
cccgctgatt cgccgcccgc tgtttgattg gctggcgccg 60gatcgcattt ttagccagat
ttttggcgaa catctgcagg aagatgaact gctgccggcg 120gatccggatc
tggatccgtt tctgatgcgc gatccgattt ttcgcatgcc ggattggctg
180gaaaccggcc tggatgaaat gcgcctggaa aaaagcaaat ttgatgtgaa
cctgagcgtg 240aaacattttg atccggaaga actgaaagtg aaagtgctgg
gcagcatggt ggaaattcat 300ggcaaacatg aagaacgcca gagcgaacat
ggctttattg cgcgcgaatt taaccgcaaa 360tatcgcattc cggcgagcgt
gagcccgctg accattaccg atgatctgga tctgagcggc 420gtgctgaccg
tggatgcgcc gcgcaaacag gatagcgtgc cggaacgcga tattccgatt
480acccgcgaag aaaaaccggc gattgcgggc gcgcagcgca aa
52229519DNAArtificial Sequenceartificial polynucleotide
29atggatgtga ccattcagca tccgtggttt aaacgcaccc tgggcccgtt ttatccggaa
60cgcctgtttg atcagttttt tggcagcggc ctgtttagct atgatctgct gccgtttctg
120gaagaaacca ttgaaccgta ttatcgccag gaactgtttc gcaccgtgct
ggatgaaggc 180attgaaagcg tgcgcgaaga tcgcgataaa tttgtgattt
ttctggatgt gaaacatttt 240gaaccgagcg atctgaccgt gaaagtgcag
gatgattttg tgagcattca tggcaaacat 300aacagccgcc aggatgatca
tggctatatt gaacgcagct ttcatcgccg ctatcgcctg 360ccggaaaacg
tggatcagga agcgctggaa tgcgaactgg aagcggatgg catgctgacc
420ttttgcggcc cgaaaattca gaccggcctg gatgcgaccc atgcgagccg
cgcgattccg 480gtggaacgca gcagcaaacc gaccgaagcg ccggaagaa
51930558DNAArtificial Sequenceartificial polynucleotide
30atggcgaaca ttccgctgct gctgagcctg gcggtggtgc tgggccgcat gagcatggat
60ccgttttatg aaccgtatta ttgccagcgc cagcgcaacc cgtatctggc gctggatggc
120ccgatggaac agcagctgcg ccagctggaa aaacaggatg gcgcgagcag
cggcagcagc 180ggcgcggata gcaaaattgg caaagtgggc tttcaggatt
gcatggtgga tagccatttt 240aaaccgagcg aactggatga taaagatcag
gtgaacagcg atctggatga aggcaaccat 300gaagaacgcg aagtggtgca
tggctttatt acccgccatt ttgatcgccg ctatgcgctg 360ccgccgggct
atgaagcggt gaaagatgcg agcaccctga gcagcgtggg cgatctgacc
420attaaagatc cgaaaccgcc ggcgattgaa gtgaaaggca acgaacgcat
tgatcagatt 480cagcaggatg gcccggcgca tctgaacgat aaagaaaacc
cgaaagaagc ggatgaacag 540gtgaacggca acgtgaaa 55831522DNAArtificial
Sequenceartificial polynucleotide 31atgcgcctga gcccgatgtt
ttggcgcatg gcggaagaaa tggcgcgcat gccgcgcagc 60ctgctgccgt ttcatgcgtt
ttttcatgaa ccgccggatt ggctggatgc gagcccgcgc 120aactggcagc
atattgcgcg ctggcaggaa caggaaagcg cgccgccggc gaccgataac
180aaagtgggct ataaaagcac cagcgtggat aaagtgtatc tggaaagcaa
agataaagat 240agcgtggaac tggatgatag cgatgaagcg aaactggaac
agcaggaagc ggaacagggc 300ggctatctgc tgcgccattt tagcggccgc
tatgatagcc cggtgggcta tgaagcggtg 360aaagatctgc tgctgagcct
ggtggtgggc gatagcacca ttctggatcc gaacccgccg 420ggcgatcagg
aaaccagcaa agaacgcgaa gataccattg aacagaccgg cgaaccggcg
480aaaaaactgg cggaagaacc gaaagtgaaa accgcgctgc ag
52232522DNAArtificial Sequenceartificial polynucleotide
32atgagcatta ccattcataa cccgctgatt cgccgcccgc tgtttgattg gctggcgccg
60gatcgcattt ttagccagat ttttggcgaa catctgcagg aagatgaact gctgccggcg
120gatccggatc tggatccgtt tctgatgcgc gatccgattt ttcgcatgcc
ggattggctg 180gaaaccggcc tggatgaaat gcgcctggaa aaaagcaaat
ttgatgtgaa cctgagcgtg 240aaacattttg atccggaaga actgaaagtg
aaagtgctgg gcagcatggt ggaaattcat 300ggcaaacatg aagaacgcca
gagcgaacat ggctttattg cgcgcgaatt taaccgcaaa 360tatcgcattc
cggcgagcgt gagcccgctg accattaccg atgatctgga tctgagcggc
420gtgctgaccg tggatgcgcc gcgcaaacag gatagcgtgc cggaacgcga
tattccgatt 480acccgcgaag aaaaaccggc gattgcgggc gcgcagcgca aa
5223350DNAAnser cygnoides 33ggggggcata tggacattac catccagcac
ccctggttca agcgcgctct 503439DNAAnser cygnoides 34ggggggaagc
ttttactcct caggcgcctc ggtgggctt 393532DNAArtificial
Sequenceartificial polynucleotide 35cctctgttcg aggagactat
cgagccctac ta 323632DNAArtificial Sequenceartificial polynucleotide
36tagtagggct cgatagtctc ctcgaacaga gg 323764DNAArtificial
Sequenceartificial polynucleotide 37accggcagga gctgttccgc
gaggtgctgt cggagggcat tgagtcggtg agggaggacc 60ggga
643864DNAArtificial Sequenceartificial polynucleotide 38tcccggtcct
ccctcaccga ctcaatgccc tccgacagca cctcgcggaa cagctcctgc 60cggt
643952DNAArtificial Sequenceartificial polynucleotide 39actatgctgg
acgtaaaaca ctttgagcct tcggacctgg aggtgaagat ta 524052DNAArtificial
Sequenceartificial polynucleotide 40taatcttcac ctccaggtcc
gaaggctcaa agtgttttac gtccagcatg at 524133DNAArtificial
Sequenceartificial polynucleotide 41aagattatcg acgactttgt
gtcgatccat ggc 334233DNAArtificial Sequenceartificial
polynucleotide 42gccatggatc gacacaaagt cgtcgataat ctt
334357DNAArtificial Sequenceartificial polynucleotide 43ggcaagcacg
agtcgagaca ggacgaccac ggctacatcg agcggtcgtt tcaccgc
574457DNAArtificial Sequenceartificial polynucleotide 44gcggtgaaac
gaccgctcga tgtagccgtg gtcgtcctgt ctcgactcgt gcttgcc
574541DNAArtificial Sequenceartificial polynucleotide 45gcggaccagg
aggccatcac ctgcgagctg gagggcgacg g 414641DNAArtificial
Sequenceartificial polynucleotide 46ccgtcgccct ccagctcgca
ggtgatggcc tcctggtcca c 414754DNAArtificial Sequenceartificial
polynucleotide 47ttcgaccagt ttttcggatc gggtctgctg tcgtatgacc
tgctgcctct gttc 544839DNAArtificial Sequenceartificial
polynucleotide 48ggggaccttg gggccctcga aggtcagcat gccgtcgcc
394957DNAArtificial Sequenceartificial polynucleotide 49ttcaagcgcg
ctctgggacc cctgattcca gagcgtctgt tcgaccagtt tttcgga
575055DNAArtificial Sequenceartificial polynucleotide 50cacggggatg
ggcctcgact cgtgggtggg gtccatgttc tcggggacct tgggg
555118DNAArtificial Sequenceartificial polynucleotide 51atggacatta
ccatccag 185260DNAArtificial Sequenceartificial polynucleotide
52aagcttttac tcctcaggcg cctcggtggg cttcgacgac cgctccacgg ggatgggcct
60
* * * * *