U.S. patent application number 14/428073 was filed with the patent office on 2015-09-03 for multimeric oligonucleotide compounds.
This patent application is currently assigned to RaNA Therapeutics, Inc.. The applicant listed for this patent is RANA THERAPEUTICS, INC.. Invention is credited to Arthur M. Krieg, Romesh Subramanian, Eugen Uhlmann.
Application Number | 20150247141 14/428073 |
Document ID | / |
Family ID | 50278726 |
Filed Date | 2015-09-03 |
United States Patent
Application |
20150247141 |
Kind Code |
A1 |
Uhlmann; Eugen ; et
al. |
September 3, 2015 |
MULTIMERIC OLIGONUCLEOTIDE COMPOUNDS
Abstract
The disclosure provides multimeric oligonucleotide compounds,
comprising two or more target-specific oligonucleotides (e.g.,
antisense oligonucleotides (ASOs)), each being resistant to
cleavage, and linked together by a cleavable linker. In particular,
two or more linked target-specific oligonucleotides, each to a
different target, allows concomitant inhibition of multiple genes'
expression levels, while exhibiting favorable pharmacokinetic and
pharmacodynamic properties. Methods of making and uses of the
described compounds are also provided
Inventors: |
Uhlmann; Eugen; (Glashutten,
DE) ; Subramanian; Romesh; (Framingham, MA) ;
Krieg; Arthur M.; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RANA THERAPEUTICS, INC. |
Cambridge |
MA |
US |
|
|
Assignee: |
RaNA Therapeutics, Inc.
Cambridge
MA
|
Family ID: |
50278726 |
Appl. No.: |
14/428073 |
Filed: |
September 13, 2013 |
PCT Filed: |
September 13, 2013 |
PCT NO: |
PCT/US2013/059772 |
371 Date: |
March 13, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61783272 |
Mar 14, 2013 |
|
|
|
61701351 |
Sep 14, 2012 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 536/24.5 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/11 20130101; C12N 2330/30 20130101; C12N 2310/3231
20130101; C12N 2310/3341 20130101; C12N 2310/141 20130101; C12N
2310/341 20130101; C12N 2310/51 20130101; C12N 15/111 20130101;
C12N 2310/3519 20130101; C12N 2320/30 20130101; C12N 2310/315
20130101; C12N 2310/52 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A compound comprising the general formula: X-L-[X-L].sub.i-X,
wherein i is an integer from 0 to 9, the value of which indicates
the number of units of [X-L].sub.i present in the compound, wherein
each X is independently a targeting oligonucleotide of 8 to 50
nucleotides in length having a region of complementarity comprising
at least 7 contiguous nucleotides complementary to a target region
of a genomic target sequence, and each L is a linker that links at
least two Xs and that is more susceptible to cleavage in a
mammalian extract than each X, wherein when i=0, and wherein the
general formula is 5'X3'-L-5'X3' and when the target regions
complementary to the first X and second X do not overlap in the
genomic target sequence, the 5'-end of the target region
complementary to the first X and the 3'-end of the target region
complementary to the second X are not within a distance of 0 to 4
nucleotides in the genomic target sequence, wherein at least one L
does not comprise an oligonucleotide having a self-complementary
nucleotide sequence, and wherein at least one L does not comprise
an oligonucleotide having a nucleotide sequence that is
complementary to a region of the genomic target sequence that is
contiguous with the target regions complementary to two immediately
flanking Xs, and wherein at least one L does not comprise an
oligonucleotide and at least one L does not comprise a disulfide
bond.
2. (canceled)
3. The compound of claim 1, wherein for at least one L the linker
comprises an oligonucleotide that is more susceptible to cleavage
by an endonuclease in the mammalian extract than the targeting
oligonucleotides.
4. The compound of claim 1, wherein at least one L is a linker
having a nucleotide sequence comprising from 1 to 10 thymidines or
uridines.
5. The compound of claim 1, wherein at least one L is a linker
having a nucleotide sequence comprising deoxyribonucleotides linked
through phosphodiester internucleotide linkages.
6. The compound of claim 1, wherein at least one L is a linker
having a nucleotide sequence comprising from 1 to 10 thymidines
linked through phosphodiester internucleotide linkages.
7. (canceled)
8. The compound of claim 1, wherein at least one L is a linker
having the formula: ##STR00106## wherein Z is an
oligonucleotide.
9. The compound of claim 8, wherein Z has a nucleotide sequence
comprising from 1 to 10 thymidines or uridines.
10-16. (canceled)
17. The compound of claim 1, wherein at least one L is a linker
comprising the formula --(CH.sub.2).sub.nS--S(CH.sub.2).sub.m--,
wherein n and m are independently integers from 0 to 10.
18-29. (canceled)
30. A compound comprising at least two targeting oligonucleotides
of 8 to 50 nucleotides in length linked through a linker that is at
least 2-fold more sensitive to enzymatic cleavage in the presence
of a mammalian extract than the at least two targeting
oligonucleotides, wherein each targeting oligonucleotide has a
region of complementarity comprising at least 7 contiguous
nucleotides complementary to a target region of a genomic target
sequence, and wherein at least one L does not comprise an
oligonucleotide and at least one L does not comprise a disulfide
bond.
31. (canceled)
32. The compound of claim 30, wherein the linker is an
oligonucleotide.
33-64. (canceled)
65. A composition comprising a compound of claim 1 and a
carrier.
66-67. (canceled)
68. A pharmaceutical composition comprising a compound of claim 1
and a pharmaceutically acceptable carrier.
69. A kit comprising a container housing the composition of claim
65.
70. A method of increasing expression of a target gene in a cell,
the method comprising: contacting the cell with the compound of
claim 1, and maintaining the cell under conditions in which the
compound enters into the cell, wherein the genomic target sequence
of at least one targeting oligonucleotide of the compound is
present in the sense strand of an lncRNA gene, the product of which
inhibits expression of the target gene.
71. (canceled)
72. A method of increasing levels of a target gene in a subject,
the method comprising administering the compound of claim 1 to the
subject, wherein the genomic target sequence of at least one
targeting oligonucleotide of the compound is present in the sense
strand of an lncRNA gene, the product of which inhibits expression
of the target gene.
73. A method of treating a condition associated with decreased
levels of a target gene in a subject, the method comprising
administering the compound of claim 1 to the subject, wherein the
genomic target sequence of at least one targeting oligonucleotide
of the compound is present in the sense strand of an lncRNA gene,
the product of which inhibits expression of the target gene.
74. A method of modulating activity of a target gene in a cell, the
method comprising: contacting the cell with the compound of claim
1, and maintaining the cell under conditions in which the compound
enters into the cell, wherein the genomic target sequence of at
least one targeting oligonucleotide is present in the sense strand
of the target gene.
75. (canceled)
76. A method of modulating levels of a target gene in a subject,
the method comprising administering the compound of claim 1 to the
subject, wherein the genomic target sequence of at least one
targeting oligonucleotide is present in the sense strand of the
target gene.
77. (canceled)
Description
RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C.
.sctn.119(e) from U.S. provisional application Ser. No. 61/701,351,
filed Sep. 14, 2012 and U.S. provisional application Ser. No.
61/783,272, filed Mar. 14, 2013, the entire content of both of
which are incorporated by reference herein.
FIELD OF THE INVENTION
[0002] This invention relates to oligonucleotide reagents,
oligonucleotide therapeutics, and methods of making and using
thereof.
BACKGROUND OF THE INVENTION
[0003] The development of oligonucleotides into clinical medicines
and their use as basic research tools is an ongoing endeavor. For
example, the use of antisense oligonucleotides for gene silencing
was described as early as 1978. Since this time other
oligonucleotide based approaches have emerged for regulating gene
expression, including RNA interference, microRNAs, and, recently,
targeted inhibition or inactivation of long non-coding RNAs.
[0004] Although natural phosphodiester-backbone oligonucleotides
are taken up by cells efficiently, they are highly susceptible to
nuclease degradation in plasma, which limits their effectiveness as
therapeutics in some cases. In some instances, therefore, it is
advantageous to limit or control the extent to which
oligonucleotides are degraded by nucleases. In this regard, a
number of modified nucleotides (e.g., LNAs) and backbone
modifications (e.g., phosphorothioates, methylphosphonates) have
been reported that improve stability in some instances.
Nonetheless, it remains as current objective in oligonucleotide
based research and development to obtain oligonucleotides having
favorable pharmacokinetic and pharmacodynamic properties.
SUMMARY OF THE INVENTION
[0005] According to some aspects of the invention, multimeric
oligonucleotide compounds are provided that are useful for
regulating gene expression and function. Some aspects of the
invention are based on the discovery that relatively high levels of
a monomeric oligonucleotides can be achieved in a target tissue or
cell when monomeric units are connected by a cleavable linker
(e.g., an endonuclease-sensitive linker) and administered as a
multimer. In some embodiments, the properties of a linker are
selected to modulate the pharmacokinetic and pharmacodynamic
properties of the multimeric oligonucleotide compounds. For
example, in some embodiments, linker properties can be tuned to
control the extent to which monomeric units are released in a
particular tissue-type or cell-type to be targeted.
[0006] In some embodiments, an advantage of using multimers is that
it allows simultaneous knockdown of multiple targets, while
exploiting the pharmacokinetic and/or pharmacodynamic advantages of
the administered oligonucleotide. In some embodiments, a
sequence-specific concomitant knockdown of two or more targets may
be achieved with a heteromultimer containing targeting
oligonucleotides directed against several target gene
combinations.
[0007] In some embodiments, multimeric oligonucleotide compounds
provided herein comprise two or more targeting oligonucleotides
linked together by a cleavable linker. In some embodiments, each
targeting oligonucleotide has a region complementary to a target
region of a genomic target sequence. In some embodiments, the
targeting oligonucleotides hybridize to a target nucleic acid
encoded by a genomic target sequence and inhibit the function
and/or effect degradation of the target nucleic acid. The target
nucleic acid may be, for example, a long non-coding RNA (lncRNA),
microRNA, or mRNA.
[0008] In some embodiments, the targeting oligonucleotide is an
antisense oligonucleotide (ASO), siRNA (e.g., a single stranded
siRNA), miRNA sponge, or anti-microRNA antisense oligonucleotide
(AMO). In some embodiments, the targeting oligonucleotide binds
specifically to a target nucleic acid in a cell and brings about
degradation of the target nucleic acid. In some embodiments, the
degradation is mediated by RNAse H. In some embodiments, the
degradation is mediated by an RNAi pathway. In some embodiments,
the targeting oligonucleotide binds specifically to its target
nucleic acid in a cell and inhibits the function of the target
nucleic acid. For example, in some embodiments, the targeting
oligonucleotide binds to a target lncRNA and inhibits interaction
of the lncRNA with one or more interacting proteins (e.g., a
subunit of Polycomb Repressor Complex 2 (PRC2)).
[0009] According to some aspects of the invention, compounds are
provided that comprise the general formula: X-L-[X-L].sub.i-X, in
which i is an integer from 0 to 9, the value of which indicates the
number of units of [X-L].sub.i present in the compound, in which
each X is independently a targeting oligonucleotide having a region
of complementarity comprising at least 7 contiguous nucleotides
complementary to a target region of a genomic target sequence, and
each L is a linker that links at least two Xs and that is more
susceptible to cleavage in a mammalian extract than each X. In some
embodiments, at least one L does not comprise an oligonucleotide.
In some embodiments, at least one L is a linker derived from one or
more molecules in Table 2.1. In some embodiments, at least one L
does not comprise a disulfide bond. In some embodiments, when i=0,
and the general formula is 5'X3'-L-5'X3' and when the target
regions complementary to the first X and second X do not overlap in
the genomic target sequence, the 5'-end of the target region
complementary to the first X and the 3'-end of the target region
complementary to the second X are not within a distance of 0 to 4
nucleotides in the genomic target sequence. In some embodiments,
the 5'-end of the target region complementary to the first X and
the 3'-end of the target region complementary to the second X are
not within a distance of 0 to 1, 0 to 2, 0 to 3, 0 to 4, 0 to 5, 0
to 6, 0 to 7, 0 to 8, 0 to 9, 0 to 10, 0 to 15, 0 to 20, 0 to 25 or
more nucleotides in the genomic target sequence. In some
embodiments, the targeting oligonucleotides are 8 to 15, 10 to 16,
10 to 20, 10 to 25, 15 to 30, 8 to 50, 10 to 100 or more
nucleotides in length. In some embodiments, the targeting
oligonucleotides are 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more
nucleotides in length.
[0010] In some embodiments, at least one L does not comprise an
oligonucleotide having a self-complementary nucleotide sequence. In
some embodiments, all Ls do not comprise an oligonucleotide having
a self-complementary nucleotide sequence. In some embodiments, at
least one L does not comprise an oligonucleotide having a
nucleotide sequence that is complementary to a region of the
genomic target sequence that is contiguous with the target regions
complementary to two immediately flanking Xs of the at least one L.
In some embodiments, the compound does not comprise a ribozyme. In
some embodiments, all Ls do not comprise an oligonucleotide having
a nucleotide sequence that is complementary to a region of the
genomic target sequence that is contiguous with the target regions
complementary to two immediately flanking Xs.
[0011] In some embodiments, i is an integer from 0 to 3, 1 to 3, 1
to 5, 1 to 9, 1 to 15, 1 to 20. In some embodiments, i is 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20 or more. In some embodiments, the at
least one L linker comprises an oligonucleotide that is more
susceptible to cleavage by an endonuclease in the mammalian extract
than the targeting oligonucleotides. In certain embodiments, at
least one L is a linker having a nucleotide sequence comprising
from 1 to 10 thymidines or uridines. In some embodiments, at least
one L is a linker having a nucleotide sequence comprising
deoxyribonucleotides linked through phosphodiester intemucleotide
linkages. In certain embodiments, at least one L is a linker having
a nucleotide sequence comprising from 1 to 10 thymidines linked
through phosphodiester intemucleotide linkages. In some
embodiments, at least one L is a linker having a nucleotide
sequence comprising from 1 to 10 uridines linked through
phosphorothioate intemucleotide linkages. In certain embodiments,
at least one L is a linker having the formula:
##STR00001##
in which Z is an oligonucleotide. In some embodiments, Z has a
nucleotide sequence comprising from 1 to 10 thymidines or uridines.
In certain embodiments, at least one L does not comprise an
oligonucleotide having a self-complementary nucleotide sequence and
does not comprise an oligonucleotide having a nucleotide sequence
that is complementary to a region of the genomic target sequence
that is contiguous with two flanking target regions. In some
embodiments, at least one L is a linker that does not comprise an
oligonucleotide having an abasic site.
[0012] In certain embodiments, for at least one L, the linker
comprises a polypeptide that is more susceptible to cleavage by an
endopeptidase in the mammalian extract than the targeting
oligonucleotides. In some embodiments, the endopeptidase is
trypsin, chymotrypsin, elastase, thermolysin, pepsin, or
endopeptidase V8. In some embodiments, the endopeptidase is
cathepsin B, cathepsin D, cathepsin L, cathepsin C, papain,
cathepsin S or endosomal acidic insulinase. In certain embodiments,
at least one L is a linker comprising a peptide having an amino
acid sequence selected from: ALAL (SEQ ID NO: 125), APISFFELG (SEQ
ID NO: 126), FL, GFN, R/KXX, GRWHTVGLRWE (SEQ ID NO: 127), YL, GF,
and FF, in which X is any amino acid.
[0013] In some embodiments, at least one L is a linker comprising
the formula --(CH.sub.2).sub.nS--S(CH.sub.2).sub.m--, wherein n and
m are independently integers from 0 to 10. In certain embodiments,
at least one L the linker comprises a low pH-labile bond. In some
embodiments, the low pH-labile bond comprises an amine, an imine,
an ester, a benzoic imine, an amino ester, a diortho ester, a
polyphosphoester, a polyphosphazene, an acetal, a vinyl ether, a
hydrazone, an azidomethyl-methylmaleic anhydride, a thiopropionate,
a masked endosomolytic agent or a citraconyl group.
[0014] In some embodiments, at least one L is a branched linker. In
certain embodiments, the branched linker comprises a
phosphoramidite linkage. In certain embodiments, the compound is a
non-symmetrical branched trimer. In certain embodiments, the
compound is a symmetrical branched trimer. In some embodiments, at
least one L is a linker that is at least 2-fold more sensitive to
cleavage in the presence of a mammalian extract than the targeting
oligonucleotides.
[0015] In some embodiments, the compound may have the following
general formula:
##STR00002##
in which i is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, in which j
and k are independently 0 or 1, the value of which indicates,
respectively, the number of X.sub.j and X.sub.k present, and in
which l and m are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
more, the value of which indicates, respectively, the number of
units of [X-L].sub.l and [L-X].sub.m present in the compound. In
some embodiments, at least one of [X-L].sub.l and [L-X].sub.m are
present.
[0016] In some embodiments, the compound has the following general
formula: X-L-[X-L].sub.l-X. In some embodiments, the compound has
the following general formula:
##STR00003##
In some embodiments, the compound has the following general
formula:
##STR00004##
in which j and k are independently 0 or 1, the value of which
indicates, respectively, the number of X.sub.j and X.sub.k present
in the compound, and at least one of X.sub.j and X.sub.k are
present in the compound.
[0017] According to some aspects of the invention, compounds are
provided that comprise at least two targeting oligonucleotides
linked through a linker that is at least 2-fold more sensitive to
enzymatic cleavage in the presence of a mammalian extract than the
at least two targeting oligonucleotides, wherein each targeting
oligonucleotide has a region of complementarity comprising at least
7 contiguous nucleotides complementary to a target region of a
genomic target sequence. In some embodiments, the targeting
oligonucleotides are 8 to 15, 10 to 16, 12 to 16, 10 to 20, 10 to
25, 15 to 30, 8 to 50, 10 to 100 or more nucleotides in length. In
some embodiments, the targeting oligonucleotides are 8, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60,
70, 80, 90, 100 or more nucleotides in length.
[0018] In some embodiments, the linker is at least 5-fold, at least
6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least
10-fold or more sensitive to enzymatic cleavage in the presence of
a mammalian extract than the two targeting oligonucleotides. In
some embodiments, the linker is an oligonucleotide. In some
embodiments, the oligonucleotide has a sequence that is not
complementary to the genomic target sequence at a position
immediately adjacent to the target region. In certain embodiments,
the mammalian extract is an extract from kidney, liver, intestinal
or tumor tissue. In some embodiments, the mammalian extract is a
cell extract. In some embodiments, the mammalian extract is an
endosomal extract.
[0019] In certain embodiments, at least one targeting
oligonucleotide comprises at least one ribonucleotide, at least one
deoxyribonucleotide, or at least one bridged nucleotide. In some
embodiments, the bridged nucleotide is a LNA nucleotide, a cEt
nucleotide or a ENA modified nucleotide. In some embodiments, at
least one targeting oligonucleotide comprises at least one a
2'-fluoro-deoxyribonucleotide. In some embodiments, at least one
targeting oligonucleotide comprises deoxyribonucleotides flanked by
at least one bridged nucleotide on each of the 5' and 3' ends of
the deoxyribonucleotides. In some embodiments, at least one
targeting oligonucleotide comprises phosphorothioate
internucleotide linkages between at least two nucleotides. In
certain embodiments, at least one targeting oligonucleotide
comprises a 2' O-methyl. In some embodiments, at least one
targeting oligonucleotide comprises a G-clamp, 5-propynyl, or
5-octadienyl-pyrimidine. In certain embodiments, at least one
targeting oligonucleotide is a gapmer comprising RNase H recruiting
nucleotides. In some embodiments, at least one targeting
oligonucleotide is a single stranded siRNA.
[0020] In certain embodiments, the compound is linked to a
functional moiety (e.g., a lipophilic moiety or targeting moiety
that binds to a cell surface receptor). In some embodiments, the
functional moiety is linked to a targeting oligonucleotide. In some
embodiments, the functional moiety is linked to a linker.
[0021] In certain embodiments, at least two targeting
oligonucleotides are in the same 5' to 3' orientation relative to
the linker. In some embodiments, at least two targeting
oligonucleotides are in opposite 5' to 3' orientations relative to
the linker. In certain embodiments, at least one targeting
oligonucleotide is linked to the linker through a terminal
nucleotide. In certain embodiments, at least one targeting
oligonucleotide is linked to the linker through an internal
nucleotide. In some embodiments, at least one targeting
oligonucleotide is a single-stranded oligonucleotide.
[0022] In certain embodiments, the target region complementary to
at least one targeting oligonucleotide is present in the sense
strand of a gene. In some embodiments, the gene is an non-coding
RNA gene. In certain embodiments, the non-coding RNA gene is a long
non-coding RNA gene. In some embodiments, the non-coding RNA gene
is an miRNA gene. In some embodiments, the gene is a protein coding
gene. In certain embodiments, the genomic target sequence of at
least one targeting oligonucleotide is the sequence of a PRC-2
associated region. In certain embodiments, at least two target
regions are present in the sense strand of different genes. In
certain embodiments, at least two target regions are present in the
sense strand of the same gene. In some embodiments, at least two
target regions are different. In some embodiments, at least two
target regions are identical. In certain embodiments, the product
of the gene mediates gene expression through an epigenetic
mechanism.
[0023] According to some aspects of the invention, compositions are
provided that comprise any of the compounds disclosed herein and a
carrier. In some embodiments, the compositions comprise a buffered
solution. In some embodiments, the compound is conjugated to the
carrier. According to some aspects of the invention, pharmaceutical
compositions are provided that comprise any of the compounds
disclosed herein and a pharmaceutically acceptable carrier. In some
embodiments, kits are provided that comprise a container housing
any of the compounds or compositions disclosed herein.
[0024] According to some aspects of the invention, methods of
increasing expression of a target gene in a cell are provided. In
some embodiments, the methods comprise: contacting the cell with
any of the compounds disclosed herein, and maintaining the cell
under conditions in which the compound enters into the cell. In
some embodiments of the methods, the genomic target sequence of at
least one targeting oligonucleotide of the compound is present in
the sense strand of an lncRNA gene, the product of which is an
lncRNA that inhibits expression of the target gene. In some
embodiments, presence of the compound in the cell results in a
level of expression of the target gene that is at least 50%
greater, at least 60% greater, at least 70% greater, at least 80%,
or at least 90% greater than a level of expression of the target
gene in a control cell that does not contain the compound.
[0025] According to some aspects of the invention, methods of
increasing levels of a target gene in a subject are provided. In
some embodiments, the methods comprise administering any of the
compounds disclosed herein to the subject. In some embodiments, the
genomic target sequence of at least one targeting oligonucleotide
of the compound is present in the sense strand of an lncRNA gene,
the product of which inhibits expression of the target gene.
[0026] According to some aspects of the invention, methods of
treating a condition associated with altered levels of expression
of a target gene in a subject are provided. In some embodiments,
the condition is associated with decreased or increased levels of
expression of the target gene compared to a control subject who
does not have the condition. In some embodiments, the methods
comprise administering the compound to the subject. In some
embodiments, the genomic target sequence of at least one targeting
oligonucleotide of the compound is present in the sense strand of
an lncRNA gene, the product of which inhibits expression of the
target gene. Accordingly, in some embodiments, the at least one
targeting oligonucleotide hybridizes to the lncRNA and inhibits its
function or brings about its degradation.
[0027] According to some aspects of the invention, methods of
modulating activity of a target gene in a cell are provided. In
some embodiments, the methods comprise contacting the cell with any
of the compounds disclosed herein, and maintaining the cell under
conditions in which the compound enters into the cell. In some
embodiments, presence of the compound in the cell results in
reduced expression or activity of the target gene in the cell.
According to some aspects of the invention, methods of modulating
levels of a target gene in a subject are provided. In some
embodiments, the methods comprise administering any of the
compounds disclosed herein to the subject. In some embodiments the
genomic target sequence of at least one targeting oligonucleotide
is present in the sense strand of the target gene. In some
embodiments, the target gene is a protein coding gene or non-coding
gene.
[0028] In some embodiments, multimeric oligonucleotide compounds
are provided that comprise two or more targeting oligonucleotides
(e.g., ASOs), each having a nuclease-resistant modified backbone,
wherein the targeting oligonucleotides are linked to each other by
one or more degradable linkers. In some embodiments, the backbone
contains inter-nucleoside linkages. In some embodiments, the
individual linked targeting oligonucleotides, contained in a
compound, may be directed to the same target, or to multiple
targets. The multimeric compounds can be homodimers, homotrimers,
etc., heterodimers, heterotrimers, etc. They can be linear,
branched, or circular.
[0029] In some embodiments, the invention is based, in part, on the
discovery that multimeric oligonucleotide compounds (e.g., a 14-mer
ASO linked to another 14-mer ASO) show significantly higher levels
of the corresponding monomeric oligonucleotide compounds in the
liver when the monomer units are connected by a rapidly degradable
linker (e.g., a nuclease-sensitive linker or a disulfide linker),
as opposed to a linker that is nuclease-resistant and, therefore,
slowly degradable. Unexpectedly, the detected liver levels of the
dimer-derived monomeric units were five to ten times higher than
that of the corresponding monomers administered in the monomeric
form. The increased delivery to the liver was also associated with
a more effective target mRNA knockdown after 14 days of dosing in
mice. The invention is therefore, in part, based on the realization
that the type and properties of the linker can thus be used to
modulate the pharmacokinetic and pharmacodynamic properties of the
dimer antisense molecules. In some embodiments, rapidly degradable
linkers are referred as "cleavable" (such as, e.g., a
nuclease-sensitive, phosphodiester, linkage or a linker comprising
a disulfide bond), while more stable linkages, such as, e.g.,
nuclease-resistant phosphorothioates, as referred to as
"noncleavable."
[0030] In illustrative embodiments, the compounds are directed to
one or more hepatic targets ASOs are directed to hepatic targets,
including but not limited to ApoC3 and ApoB.
[0031] In some embodiments, targeting oligonucleotides (e.g., ASOs)
contain 12 to 16 nucleotide bases, wherein one or more targeting
oligonucleotides are gapmers. Targeting oligonucleotides (e.g.,
ASOs), including gapmers, can comprise a 2' modification in the
sugar residues (e.g., locked-nucleic acid (LNA) modification),
2'-O-methyl and 2'-fluoro modification, and/or a nucleotide
modification such as G-clamp, 5-propynyl, and
5-octadienyl-pyrimidine.
[0032] The invention further provides pharmaceutical compositions,
comprising compounds of the invention along with pharmaceutically
acceptable excipients. In certain embodiments, the pharmaceutical
composition is characterized by one or more of the following
properties when administered in vivo:
[0033] (a) increased concentration in the liver and reduced
clearance by kidneys as compared to respective monomeric targeting
oligonucleotides (e.g., ASOs);
[0034] (b) longer duration of target knockdown as compared to
respective monomeric targeting oligonucleotides (e.g., ASOs);
and
[0035] (c) lower effective concentrations as compared to respective
monomeric targeting oligonucleotides (e.g., ASOs) and/or the same
multimeric oligonucleotide compound, wherein the cleavable linker
is substituted with a noncleavable linker.
[0036] The invention further provides methods of inhibiting mRNA
levels of one or more targets, comprising administering to a cell
or a subject the compound of the invention in an amount effective
to inhibit the expression of the target(s). In some embodiments,
the methods provide a therapeutically effective knockdown of the
target(s) persists for two weeks or longer following the
administration. The method can be used with targets that are
associated with a metabolic disease, cancer, cardiovascular
disease, and other conditions.
[0037] The foregoing and following descriptions are illustrative
and explanatory only and are not restrictive of the invention, as
claimed in this text, the multimeric targeting oligonucleotides
(e.g., ASOs) may be referred to by the respective target names
only, e.g., "ApoC3-ApoC3 dimer" stands as a short hand for
"ApoC3-ApoC3 ASO dimer."
BRIEF DESCRIPTION OF THE FIGURES
[0038] FIG. 1A shows a schematic representation of an exemplary
construct, in which two 14-mer gapmers (e.g., 3LNA-8DNA-3LNA as
illustrated) are connected via a linker (represented light shaded
circles). FIG. 1B shows examples of various configurations of
dimers and multimers (homopolymers or heteropolymers). FIGS. 1C and
1D show details of the chemical structures of certain multimeric
ASOs.
[0039] FIG. 2 demonstrates in vitro stability of dimers in plasmas
and their degradation in liver homogenates, as determined by liquid
chromatography-mass spectrometry (LC-MS). FIGS. 2A and 2B
demonstrate slow degradation of both ApoC3 ASO monomer (SEQ ID NO:
1, designated as per Example 2(E)) and cleavable ApoC3-ApoC3 ASO
dimers (SEQ ID NO:2 and SEQ ID NO:4) in murine and monkey plasmas
respectively. FIG. 2C demonstrates efficient cleavage into monomers
of the cleavable ApoC3-ApoC3 ASO dimers (SEQ ID NO:2 and SEQ ID
NO:4) and the relative stability ApoC3 ASO monomer (SEQ ID NO: 1)
in mouse liver homogenate. FIG. 2D shows cleavable SEQ ID NO: 18)
and noncleavable SEQ ID NO: 19) ApoB-ApoB ASO homodimers incubated
in murine plasma or liver homogenate, demonstrating stability of
both types of molecules in plasma, and a more efficient cleavage
into monomers of the cleavable version in the liver homogenate.
[0040] FIG. 3 addresses various aspects of linker designs in
homodimers. For the results shown in FIGS. 3A, 3B and 3D, Hep3B
cells were treated at various concentrations (0.001, 0.006, 0.03,
0.2, 0.8, 4.0, 20 and 100 nM) of the indicated oligonucleotides
formulated with a lipotransfection agent. mRNA content and cell
viability was determined 48 hours after treatment. For the results
shown in FIGS. 3C and 3E-3K, Hep3B cells were treated at eight
concentrations (0.1, 0.6, 3.0, 20, 80, 400, 2000 and 10,000 nM) of
the indicated oligonucleotides without any transfection agent
("gymnotic delivery"). mRNA content and cell viability were
determined after 8 days of treatment. In all cases, the graphs
depict percentage effect relative to a non-specific oligonucleotide
(negative control).
[0041] FIG. 4 addresses various aspects of the design of various
heterodimers (di- and trimers). For the results shown in FIG. 4A,
Hep3B cells were treated at various concentrations (0.001, 0.006,
0.03, 0.2, 0.8, 4.0, 20 and 100 nM) of the indicated
oligonucleotides formulated with a lipotransfection agent. mRNA
content and cell viability were determined 48 hours after
treatment. For the results shown in FIGS. 4B-4M, Hep3B cells were
treated at eight concentrations (0.1, 0.6, 3.0, 20, 80, 400, 2000
and 10,000 nM) of the indicated oligonucleotides without any
transfection agent ("gymnotic delivery"). mRNA content and cell
viability were determined after 8 days of treatment. In all cases,
the graphs depict percentage effect relative to a non-specific
oligonucleotide (negative control).
[0042] FIGS. 5A-5C demonstrate that under the conditions tested,
the time course of knock-down depended on the type of linker used
to connect the two antisense moieties in the dimeric ASOs. Human
ApoC3 transgenic mice were administered a single subcutaneous dose
of homodimers SEQ ID NO:5 or 3 (which are disulphide-linked
homodimers of the same monomer) at 10 mg/kg, or vehicle. FIG. 5A
demonstrates an associated increased reduction of the liver ApoC3
mRNA levels in human ApoC3 transgenic mice following treatment with
the endonuclease-sensitive, phosphodiester-linked, homodimers (SEQ
ID NO:4 and SEQ ID NO:2). Homodimers SEQ ID NO:4 and 2 exhibited an
increased reduction of liver ApoC3 mRNA levels compared to the
monomer (SEQ ID NO: 1) after 14 days.
[0043] FIGS. 5B and 5C show ApoC3 protein knockdown 7 days (FIG.
5B) and 14 days (FIG. 5C) after a single 10 mg/kg dose of the SEQ
ID NO: 1 monomer and dimeric LNA gapmers SEQ ID NO:2-SEQ ID NO:5 in
human ApoC3 transgenic mice. The figures demonstrate increased
duration in the reduction of serum ApoC3 protein levels in human
ApoC3 transgenic mice following treatment with the
endonuclease-sensitive phosphodiester-linked homodimers, SEQ ID
NO:1, SEQ ID NO:4 and SEQ ID NO:2. Homodimers SEQ ID NO:4 and SEQ
ID NO:2 exhibited a reduction of serum ApoC3 levels similar to
monomer SEQ ID NO: 1 after 7 days, but in contrast to the monomer,
the reduction the reduction in target gene expression in cells
treated with the cleavable dimers (SEQ ID NO:2 or 4) was sustained
and, as a result, increased compared to SEQ ID NO: 1 after 14
days.
[0044] FIGS. 6A-6C show illustrative LC-MS results for samples
extracted from liver for the following ASOs respectively SEQ ID
NO:2 (FIG. 6A), SEQ ID NO:3 (FIG. 6B), and SEQ ID NO:4 (FIG. 6C).
"IS" designates an internal standard.
[0045] FIGS. 7A and 7B illustrate that SEQ ID NO: 21, an ApoC3/ApoB
heterodimer ASO with an endonuclease sensitive phosphodiester
linker, significantly down-regulated liver expression of both
target mRNAs [i.e, human APOC3 (FIG. 7A) and mouse ApoB (FIG.
7B)].
[0046] FIGS. 8A and 8B illustrate the effects of these treatments
on in vivo target mRNAs in the liver. Data in these figures are
plotted as % knockdown of the target mRNAs with knockdown of mouse
apoB mRNA plotted on the x axis and knockdown of human ApoC3 (i.e.,
the transgene) plotted on the y axis.
[0047] FIGS. 9A and 9B illustrate differences in concentrations of
ApoB monomer after overnight incubation at 37.degree. C. or under
frozen conditions of heterodimers and ApoB monomer ASOs in liver
and kidney homogenates. BLQ is "Beneath Limit of
Quantification."
[0048] FIG. 10 illustrate differences in concentrations of ApoB
monomer detected in plasma 3 days post-treatment with heterodimers
and ApoB monomer ASOs.
[0049] FIGS. 11A and 11B illustrate measured concentrations of ApoB
monomer metabolite in kidneys at Day3 and Day 14 following
administration of heterodimers and ApoB monomer ASOs.
[0050] FIGS. 12A and 12B illustrate measured concentrations of ApoB
monomer metabolite in liver at Day3 and Day 14 following
administration of heterodimers and ApoB monomer ASOs.
[0051] FIGS. 13A and 13B illustrate that dimer oligonucleotides
significantly decreased miR-122 (10 mg/kg dose, mouse liver).
[0052] FIGS. 14A and 14B illustrate that dimer oligonucleotides
significantly decreased miR-122 (50 mg/kg dose, mouse liver).
[0053] FIG. 15 illustrates that dimer oligonucleotides are
.about.5.times. more active than monomer (in vivo 7 d study).
[0054] FIGS. 16A, 16B, and 16C illustrate that dimer
oligonucleotides robustly decreased Malat-1 lncRNA expression.
[0055] FIGS. 17A, 17B, and 17C illustrate miR-122 mixmer monomer
and dimer oligos increased BCKDK expression.
[0056] FIGS. 18A, 18B, and 18C illustrate miR-122 8-mer monomer,
dimer, and trimer oligos increased BCKDK expression.
[0057] FIGS. 19A, 19B, and 19C illustrate miR-122 gapmer monomer
and dimer oligos increased BCKDK expression.
[0058] FIGS. 20A, 20B, and 20C illustrate miR-122 mixmer monomer
and dimer oligos increased ALDOA expression.
[0059] FIGS. 21A, 21B, and 21C illustrate miR-122 8-mer monomer,
dimer, and trimer oligos increased ALDOA1 expression.
[0060] FIGS. 22A, 22B, and 22C illustrate miR-122 gapmer monomer
and dimer oligos increased ALDOA expression.
[0061] FIGS. 23A, 23B, and 23C illustrate miR-122 mixmer monomer
and dimer oligos lowered cholesterol levels.
[0062] FIGS. 24A, 24B, and 24C illustrate miR-122 8-mer monomer,
dimer, and trimer oligos lowered cholesterol levels.
[0063] FIGS. 25A and 25B illustrate miR-122 gapmer oligos affected
cholesterol levels.
[0064] FIGS. 26A, 26B, and 26C illustrate miR-122 dimer gapmer
oligos increased BCKDK expression. 2045=IDO 192045, 2046=IDO
192046, 2047=IDO 192047, etc.
[0065] FIGS. 27A and 27B illustrate miR-122 dimer gapmer oligos
increased BCKDK expression but not controls.
[0066] FIGS. 28A, 28B, and 28C illustrate miR-122 dimer gapmer
oligos decreased ACC1 expression. 2045=IDO 192045, 2046=IDO 192046,
2047=IDO 192047, etc.
[0067] FIGS. 29A and 29B illustrate miR-122 dimer gapmer oligos
decreased ACC1 expression but not controls.
[0068] FIGS. 30A, 30B, and 30C illustrate miR-122 dimer gapmer
oligos decreased cholesterol. 2045=IDO 192045, 2046=IDO 192046,
2047=IDO 192047, etc.
[0069] FIGS. 31A and 31B illustrate miR-122 dimer gapmer oligos
decreased cholesterol but not controls.
[0070] FIGS. 32A, 32B, and 32C illustrate miR-122 dimer gapmer
oligos decreased LDL. 2045=IDO 192045, 2046=IDO 192046, 2047=IDO
192047, etc.
[0071] FIGS. 33A and 33B illustrate miR-122 dimer gapmer oligos
decreased LDL but not controls.
[0072] Unless otherwise stated, the numbers in the figures with
hash signs (such as #1, #50, etc.) correspond to the respective SEQ
ID NOs as per Table 1.
DETAILED DESCRIPTION OF THE INVENTION
[0073] Multimeric oligonucleotide compounds are provided that are
useful for regulating gene expression and/or function. In general,
the multimeric oligonucleotide compounds provided herein comprise
two or more targeting oligonucleotides linked together by a
cleavable linker. The multimeric oligonucleotides are useful for
regulating the expression or function of a wide range of target
nucleic acids including, for example, a long non-coding RNA
(lncRNA), microRNA, or mRNA. In some embodiments, the targeting
oligonucleotide of the multimer is an antisense oligonucleotide
(ASO), siRNA (e.g., a single stranded siRNA), miRNA sponge, or
anti-microRNA antisense oligonucleotide (AMO). However, other types
of targeting oligonucleotides may be used.
[0074] A. General Structure of Multimeric Oligonucleotides
[0075] Multimeric oligonucleotide compounds are provided that
comprise the general formula: X-L-[X-L].sub.i-X, in which i is an
integer, the value of which indicates the number of units of
[X-L].sub.i present in the compound, and in which each X is a
targeting oligonucleotide and each L is a linker that links at
least two Xs and that is more susceptible to cleavage in a
mammalian extract than each X. In some embodiments, i is 0, 1, 2,
3, 4, 5, 6, 7, 8, 9, 10 or more,
[0076] As used herein, the term "mammalian extract" refers to a
sample extracted from a mammalian tissue, cell or subcellular
compartment (e.g., an endosome). Generally, a mammalian extract
comprises one or more biomolecules (e.g., enzymes) from the tissue,
cell or subcellular compartment. In some embodiments, a mammalian
extract comprises one or more of a nuclease, peptidase, protease,
phosphatase, oxidase, and reductase. The mammalian extract may be
an extract from any tissue, including, for example, kidney, liver,
intestinal or tumor tissue. The mammalian extract may be a cell
extract or an extract from a subcellular component, such as a
nuclear extract, or an endosomal extract.
[0077] As used herein, the term "cleavage" refers to the breaking
of one or more chemical bonds in a relatively large molecule in a
manner that produces two or more relatively small molecules.
Cleavage in the mammalian extract may be mediated by a nuclease,
peptidase, protease, phosphatase, oxidase, or reductase, for
example. In some embodiments, the term "cleavable," as used herein,
refers to rapidly degradable linkers, such as, e.g., phosphodiester
and disulfides, while the term "noncleavable" refer to more stable
linkages, such as, e.g., nuclease-resistant phosphorothioates
(e.g., a racemic mixture of Sp and Rp diastereoisomers, as used in
the Examples below, or a backbone enriched in Sp form). The
properties of cleavable and noncleavable linkers are described in
further detail herein.
[0078] In one example, the compound has the following general
formula:
##STR00005##
In this formula, i is an integer indicating the number of units of
[X-L].sub.i present in the compound; j and k are independently 0 or
1, the value of which indicates, respectively, the number of
X.sub.j and X.sub.k present in the compound; and l and m are
integers the value of which indicate, respectively, the number of
units of [X-L].sub.l and [L-X].sub.m present in the compound. In
some embodiments, i is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or
more. In certain embodiments, l and m are independently 0, 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20 or more. In certain embodiments, at
least one of [X-L].sub.l and [L-X].sub.m are present in the
compound. In some embodiments, i, j, k, l, and m are 0. In some
embodiments, i is 1, and j, k, l, and m are 0.
[0079] In one example, the compound may have the following general
formula: X-L-[X-L].sub.i-X, in which i is 0, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10 or more.
[0080] In another example, the compound may have the following
general formula:
##STR00006##
in which i is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
[0081] In another example, the compound may have the following
general formula:
##STR00007##
in which j and k are independently 0 or 1, the value of which
indicates, respectively, the number of X.sub.j and X.sub.k present,
and at least one of X.sub.j and X.sub.k are present in the
compound.
[0082] Typically, the targeting oligonucleotide has a region of
complementarity comprising at least 4, at least 5, at least 6, at
least 7, at least 8, at least 9, at least 10, at least 15, or at
least 20 contiguous nucleotides complementary to a target region of
a genomic target sequence. The targeting oligonucleotide may have a
region of complementarity comprising 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, or 50 contiguous
nucleotides complementary to a target region of a genomic target
sequence. It should be appreciated that, in some embodiments, the
region of complementary may have one or more mismatches compared
with the nucleotide sequence of the target region provided that the
targeting oligonucleotide is still capable of hybridizing with the
target region. In some embodiments, the region of complementary has
no mismatches compared with the nucleotide sequence of the target
region. It should also be appreciated that a targeting
oligonucleotide may hybridize with a target region through
Watson-Crick base pairing, Hoogsteen base pairing,
reverse-Hoogsteen binding, or other binding mechanism. In some
embodiments, the targeting oligonucleotide is an aptamer, e.g., an
aptamer that binds to an intracellular or nuclear protein.
[0083] In some multimeric oligonucleotides, for two Xs, a first X
and a second X, that are separated by a single L, the 5'-end of the
target region complementary to the first X and the 3'-end of the
target region complementary to the second X are not within a
distance of 0 to 1, 0 to 2, 0 to 3, 0 to 4, 0 to 5, 0 to 10, 0 to
15, 0 to 20, 0 to 25, 0 to 50, nucleotides in the genomic target
sequence when the target regions complementary to the first X and
second X do not overlap in the genomic target sequence. In some
instances the different X's have complementarity to the same target
and in other instances to different target. When the X's have
complementarity to the same target the nucleic acid sequence of the
X's may be identical with one another or overlapping or completely
distinct.
[0084] In some embodiments, multimeric oligonucleotide compounds
comprises ASOs. The invention provides in some embodiments
multimeric oligonucleotide compounds, comprising two or more
target-specific antisense oligonucleotides (ASOs), each ASO having
a nuclease-resistant modified backbone, in which the targeting
oligonucleotides are linked to each other by one or more degradable
linkers. The term "monomeric" or "monomer," in the context of
targeting oligonucleotides (e.g., ASOs), refers to an targeting
oligonucleotide that (i) is directed to a single site or a single
contiguous stretch of nucleotides on a target and (ii) is not
covalently linked to the another targeting oligonucleotide directed
to the same or another site on the same or another target.
Multimeric oligonucleotide compounds are not monomeric because they
contain targeting oligonucleotides (e.g., ASOs) that are covalently
linked to each other.
[0085] The number of targeting oligonucleotides (e.g., ASOs) in a
multimeric oligonucleotide compound of the invention may be two or
more, three or more, four or more, etc. For example, a multimeric
oligonucleotide compound may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more individual Targeting oligonucleotides (e.g., ASOs) directed to
one or more targets. The individual Targeting oligonucleotides
(e.g., ASOs) can be specific to the same or different targets. For
example, as illustrated in FIG. 1A, in some embodiments, the
targeting oligonucleotide is a dimer comprising two targeting
oligonucleotides specific to the same target, or a dimer comprising
two targeting oligonucleotides specific to two different targets,
or alternatively, a trimer comprising three targeting
oligonucleotides specific to the same target, or a trimer
comprising three targeting oligonucleotides specific three
different targets, etc. In some cases, the individual targeting
oligonucleotides can be specific to the same target, yet directed
to distinct target sites on the target, such as two sites on the
target sequence that are separated by at least 10, 20, 50, 100, 300
or more nucleotides. In some embodiments, the target sites can be
directly adjacent to each other and not separated by any
intervening sequences.
[0086] As shown in FIG. 1B, the multimers can be linear or branched
or a combination thereof. For example, two ASO may be connected
head-to-tail (5'-to-3'-linear) (type A) or as in type B,
tail-to-tail (3'-to-3'-branched); the ASOs could also be connected
head-to-head (5'-to-5'-branched). Similarly, three or more
antisense molecules can be connected (examples C, D, E in FIG. 1B).
In an alternative embodiment, the multimer can be in the form of a
circular nucleic acid.
[0087] B. Targeting Oligonucleotides
[0088] In some embodiments, multimeric oligonucleotides provided
herein comprise two or more targeting oligonucleotides linked
together by a cleavable linker. In some embodiments, each targeting
oligonucleotide has a region complementary to a target region of a
genomic target sequence. In some embodiments, the targeting
oligonucleotide is an antisense oligonucleotide (ASO), siRNA (e.g.,
a single stranded siRNA), miRNA sponge, or anti-microRNA antisense
oligonucleotide (AMO). In some embodiments, the targeting
oligonucleotide binds specifically to a target RNA in a cell and
brings about degradation of the RNA. In some embodiments, the
degradation is mediated by RNAse H. In some embodiments, the
degradation is mediated by an RNAi pathway. It should be
appreciated that unless otherwise apparent from context "a
targeting oligonucleotide" or "the targeting oligonucleotide" as
referred to herein, generally means at least one of the targeting
oligonucleotides present in a multimeric compound. Similarly, it
should be appreciated that unless otherwise apparent from context
"a linker" or "the linker," as referred to herein, generally means
at least one of the linkers present in a multimeric compound.
[0089] In some embodiments, a targeting oligonucleotide may be a
single stranded siRNA. Single stranded siRNAs (ss-siRNAs) are a
viable therapeutic strategy for gene targeting (see, e.g., Lima et
al. Single-Stranded siRNAs Activate RNAi in Animals. Cell 150,
883-894. 2012 and Yu et al. Single-Stranded RNAs Use RNAi to
Potently and Allele-Selectively Inhibit Mutant Huntingtin
Expression. Cell 150, 895-908. 2012). Additionally, it has been
shown that chemical modifications such as, for example, inclusion
of one or more phosphorothioate intemucleotide linkages,
2'-fluoro-ribonucleotides, 2' O-methyl-ribonucleotides,
2'-methoxyethoxy-ribonucleotides, locked nucleic acids and/or 3'
terminal adenosine nucleotides increase the potency and/or
stability of ss-siRNA both in vitro and in vivo (Lima et al.
Single-Stranded siRNAs Activate RNAi in Animals. Cell 150, 883-894.
2012). Accordingly, in some embodiments, a targeting
oligonucleotide is a single stranded siRNA comprising at least one
of: phosphorothioate internucleotide linkages between at least two
nucleotides, a 2' O-methyl, a 2'-methoxyethoxy, a
2'-fluoro-deoxyribonucleotide, a locked nucleic acid and a 3'
terminal adenosine nucleotide or any other nucleotide modification
disclosed herein. A 5' phosphate group of an ss-siRNA may be
important, in some embodiments, for maintaining activity in vivo
and use of a 5'phosphate analog may help to protect the 5'
phosphate group from degradation in vivo (Lima et al.
Single-Stranded siRNAs Activate RNAi in Animals. Cell 150, 883-894.
2012). Accordingly, in some embodiments, a targeting
oligonucleotide is a single stranded siRNA comprising a 5'
phosphate analog. In some embodiments, the 5'phosphate analog is a
5'-methylenephosphonate or a 5'-(E)-vinylphosphate. Lipophilic
modifications, such as conjugation to a lipophilic moiety, have
also been shown to enhance ss-siRNA activity in vivo (Lima et al.
Single-Stranded siRNAs Activate RNAi in Animals. Cell 150, 883-894.
2012). Thus, in some embodiments, a targeting oligonucleotide is a
single stranded siRNA is linked to a lipophilic moiety. Exemplary
lipophilic modifications are described herein and include
##STR00008##
where R=--(CH.sub.2).sub.8--CH.sub.3 or
--(CH.sub.2).sub.14--CH.sub.3.
[0090] As used herein, the term "genomic target sequence" refers to
a nucleotide sequence of clinical, therapeutic or research interest
in a genome (e.g., a mammalian genome, e.g., a human or mouse
genome). Typically, a genomic target sequence is a sequence of a
genome that comprises a gene coding or regulatory region, or that
is present within a gene coding or regulatory region. In some
embodiments, a genomic target sequence is a sequence that encodes
at least a portion of a gene. The gene may be an non-coding RNA
gene or a protein coding gene. The non-coding RNA gene may be a
long non-coding RNA gene or an miRNA gene, for example. The product
of the gene may be an RNA or protein that mediates gene expression
through an epigenetic mechanism. In other embodiments, a genomic
target sequence is a sequence positioned in a regulatory region of
one or more genes, such as a promoter, enhancer, silencer region,
locus control region and other functional region of a genome.
[0091] In some embodiments, the genomic target sequence is present
in the sense strand of a gene. The sense strand or coding strand is
the segment of double stranded DNA running from 5'-3' that is
complementary to the antisense strand or template strand of a gene.
The sense strand is the strand of DNA that has the same sequence as
the RNA transcribed from the gene (e.g., mRNA, IncRNA, or miRNA),
which takes the antisense strand as its template during
transcription.
[0092] The "target region" of a genomic target sequence is a
sequence of nucleotides that constitutes a hybridization site of a
targeting oligonucleotide. The actual target oligonucleotide may
hybridize with the genomic target itself (e.g., a promoter element)
or an nucleic acid encoded by the genomic target sequence or
containing the genomic target sequence (e.g., an lncRNA, miRNA, or
mRNA). In some embodiments, the target region encodes a site on a
transcribed RNA, and hybridization of a targeting oligonucleotide
to the site results in inactivation or degradation of the
transcribed RNA. Accordingly, in some embodiments, the targeting
oligonucleotides hybridize to a transcribed RNA encoded by a
genomic target sequence and inhibit the function and/or effect
degradation of the transcribed RNA. The RNA may be, for example, a
long non-coding RNA (lncRNA), microRNA, or mRNA.
[0093] It should be appreciated that multimeric oligonucleotide
compounds provided herein may comprise two or more targeting
oligonucleotides that are each complementary to the same or
different genomic target sequences, and thus that may regulate the
same or different genes. In some embodiments, the genomic target
sequences is present in the sense strand of different genes. In
some embodiments, the genomic target sequences is present in the
sense strand of the same gene.
[0094] In some embodiments, the genomic target sequence of at least
one targeting oligonucleotide is or comprises the sequence of a
PRC-2 associated region. As used herein, the term "PRC2-associated
region" refers to a region of a nucleic acid that comprises or
encodes a sequence of nucleotides that interact directly or
indirectly with a component of PRC2. A PRC2-associated region may
be present in a RNA (e.g., a long non-coding RNA (lncRNA)) that
interacts with a PRC2. A PRC2-associated region may be present in a
DNA that encodes an RNA that interacts with PRC2.
[0095] In some embodiments, a PRC2-associated region is a region of
an RNA that crosslinks to a component of PRC2 in response to in
situ ultraviolet irradiation of a cell that expresses the RNA, or a
region of genomic DNA that encodes that RNA region. In some
embodiments, a PRC2-associated region is a region of an RNA that
immunoprecipitates with an antibody that targets a component of
PRC2, or a region of genomic DNA that encodes that RNA region. In
some embodiments, a PRC2-associated region is a region of an RNA
that immunoprecipitates with an antibody that binds specifically to
SUZ12, EED, EZH2 or RBBP4 (which as noted above are components of
PRC2), or a region of genomic DNA that encodes that RNA region.
[0096] In some embodiments, a PRC2-associated region is a region of
an RNA that is protected from nucleases (e.g., RNases) in an
RNA-immunoprecipitation assay that employs an antibody that targets
a component of PRC2, or a region of genomic DNA that encodes that
protected RNA region. In some embodiments, a PRC2-associated region
is a region of an RNA that is protected from nucleases (e.g.,
RNases) in an RNA-immunoprecipitation assay that employs an
antibody that targets SUZ12, EED, EZH2 or RBBP4, or a region of
genomic DNA that encodes that protected RNA region.
[0097] In some embodiments, a PRC2-associated region is a region of
an RNA within which occur a relatively high frequency of sequence
reads in a sequencing reaction of products of an
RNA-immunoprecipitation assay that employs an antibody that targets
a component of PRC2, or a region of genomic DNA that encodes that
RNA region. In some embodiments, a PRC2-associated region is a
region of an RNA within which occur a relatively high frequency of
sequence reads in a sequencing reaction of products of an
RNA-immunoprecipitation assay that employs an antibody that binds
specifically to SUZ12, EED, EZH2 or RBBP4, or a region of genomic
DNA that encodes that protected RNA region. In such embodiments,
the PRC2-associated region may be referred to as a "peak."
[0098] In some embodiments, a PRC2-associated region comprises a
sequence of 40 to 60 nucleotides that interact with PRC2 complex.
In some embodiments, a PRC2-associated region comprises a sequence
of 40 to 60 nucleotides that encode an RNA that interacts with
PRC2. In some embodiments, a PRC2-associated region comprises a
sequence of up to 5 kb in length that comprises a sequence (e.g.,
of 40 to 60 nucleotides) that interacts with PRC2. In some
embodiments, a PRC2-associated region comprises a sequence of up to
5 kb in length within which an RNA is encoded that has a sequence
(e.g., of 40 to 60 nucleotides) that is known to interact with
PRC2. In some embodiments, a PRC2-associated region comprises a
sequence of about 4 kb in length that comprise a sequence (e.g., of
40 to 60 nucleotides) that interacts with PRC2. In some
embodiments, a PRC2-associated region comprises a sequence of about
4 kb in length within which an RNA is encoded that includes a
sequence (e.g., of 40 to 60 nucleotides) that is known to interact
with PRC2.
[0099] In some embodiments, a PRC2-associated region has a sequence
as set forth in SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to
934,931 of International Patent Appl. Pub. No.: WO/2012/087983, or
SEQ ID NOS: 1 to 193,049 of International Patent Appl. Pub. No.:
WO/2012/065143, each of which is entitled, POLYCOMB-ASSOCIATED
NON-CODING RNAS, and the contents of each of which are incorporated
by reference herein in their entireties.
[0100] In some embodiments, the targeting oligonucleotides
interfere with the binding of and function of PRC2 by preventing
recruitment of PRC2 to a specific chromosomal locus through
lncRNAs. For example, in some embodiments, administration of
multimeric oligonucleotide compounds comprising targeting
oligonucleotides designed to specifically bind a PRC2-associated
region of a lncRNA can stably displace not only the lncRNA, but
also the PRC2 that binds to the lncRNA, from binding chromatin.
Further, lncRNA can recruit PRC2 in a cis fashion, repressing gene
expression at or near the specific chromosomal locus from which the
lncRNA was transcribed. Thus, in some embodiments, the compounds
disclosed herein may be used to inhibit cis mediated gene
repression by lncRNAs.
[0101] In some embodiments, targeting oligonucleotides may comprise
at least one ribonucleotide, at least one deoxyribonucleotide,
and/or at least one bridged nucleotide. In some embodiments, the
oligonucleotide may comprise a bridged nucleotide, such as a locked
nucleic acid (LNA) nucleotide, a constrained ethyl (cEt)
nucleotide, or an ethylene bridged nucleic acid (ENA) nucleotide.
Examples of such nucleotides are disclosed herein and known in the
art. In some embodiments, the oligonucleotide comprises a
nucleotide analog disclosed in one of the following United States
Patent or Patent Application Publications: U.S. Pat. No. 7,399,845,
U.S. Pat. No. 7,741,457, U.S. Pat. No. 8,022,193, U.S. Pat. No.
7,569,686, U.S. Pat. No. 7,335,765, U.S. Pat. No. 7,314,923, U.S.
Pat. No. 7,335,765, and U.S. Pat. No. 7,816,333, US 20110009471,
the entire contents of each of which are incorporated herein by
reference for all purposes. The targeting oligonucleotide may have
one or more 2' O-methyl nucleotides. The oligonucleotide may
consist entirely of 2' O-methyl nucleotides.
[0102] The targeting oligonucleotide may contain one or more
nucleotide analogues. For example, the targeting oligonucleotide
may have at least one nucleotide analogue that results in an
increase in T.sub.m of the oligonucleotide in a range of 1.degree.
C., 2.degree. C., 3.degree. C., 4.degree. C., or 5.degree. C.
compared with an oligonucleotide that does not have the at least
one nucleotide analogue. The targeting oligonucleotide may have a
plurality of nucleotide analogues that results in a total increase
in T.sub.m of the oligonucleotide in a range of 2.degree. C.,
3.degree. C., 4.degree. C., 5.degree. C., 6.degree. C., 7.degree.
C., 8.degree. C., 9.degree. C., 10.degree. C., 15.degree. C.,
20.degree. C., 25.degree. C., 30.degree. C., 35.degree. C.,
40.degree. C., 45.degree. C. or more compared with an
oligonucleotide that does not have the nucleotide analogue.
[0103] In some embodiments, the targeting oligonucleotide may be of
up to 50 nucleotides in length or up to 100 nucleotides in length,
in which 2 to 10, 2 to 15, 2 to 16, 2 to 17, 2 to 18, 2 to 19, 2 to
20, 2 to 25, 2 to 30, 2 to 40, 2 to 45, 2 to 75, 2 to 95, or more
nucleotides of the oligonucleotide are nucleotide analogues. The
oligonucleotide may be of 8 to 30 nucleotides in length in which 2
to 10, 2 to 15, 2 to 16, 2 to 17, 2 to 18, 2 to 19, 2 to 20, 2 to
25, 2 to 30 nucleotides of the oligonucleotide are nucleotide
analogues. The oligonucleotide may be of 8 to 15 nucleotides in
length in which 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2
to 10, 2 to 11, 2 to 12, 2 to 13, 2 to 14 nucleotides of the
oligonucleotide are nucleotide analogues. Optionally, the
oligonucleotides may have every nucleotide except 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10 nucleotides modified.
[0104] The targeting oligonucleotide may consist entirely of
bridged nucleotides (e.g., LNA nucleotides, cEt nucleotides, ENA
nucleotides). The oligonucleotide may comprise alternating
deoxyribonucleotides and 2'-fluoro-deoxyribonucleotides. The
oligonucleotide may comprise alternating deoxyribonucleotides and
2'-O-methyl nucleotides. The oligonucleotide may comprise
alternating deoxyribonucleotides and ENA nucleotide analogues. The
oligonucleotide may comprise alternating deoxyribonucleotides and
LNA nucleotides. The oligonucleotide may comprise alternating LNA
nucleotides and 2'-O-methyl nucleotides. The oligonucleotide may
have a 5' nucleotide that is a bridged nucleotide (e.g., a LNA
nucleotide, cEt nucleotide, ENA nucleotide). The oligonucleotide
may have a 5' nucleotide that is a deoxyribonucleotide.
[0105] The targeting oligonucleotide may comprise
deoxyribonucleotides flanked by at least one bridged nucleotide
(e.g., a LNA nucleotide, cEt nucleotide, ENA nucleotide) on each of
the 5' and 3' ends of the deoxyribonucleotides. The oligonucleotide
may comprise deoxyribonucleotides flanked by 1, 2, 3, 4, 5, 6, 7, 8
or more bridged nucleotides (e.g., LNA nucleotides, cEt
nucleotides, ENA nucleotides) on each of the 5' and 3' ends of the
deoxyribonucleotides. The 3' position of the oligonucleotide may
have a 3' hydroxyl group. The 3' position of the oligonucleotide
may have a 3' thiophosphate.
[0106] The targeting oligonucleotide may be conjugated with a
label. For example, the oligonucleotide may be conjugated with a
biotin moiety, cholesterol, Vitamin A, folate, sigma receptor
ligands, aptamers, peptides, such as CPP, hydrophobic molecules,
such as lipids, ASGPR or dynamic polyconjugates and variants
thereof at its 5' or 3' end.
[0107] The targeting oligonucleotide may comprise one or more
modifications comprising: a modified sugar moiety, and/or a
modified internucleoside linkage, and/or a modified nucleotide
and/or combinations thereof. It is not necessary for all positions
in a given oligonucleotide to be uniformly modified, and in fact
more than one of the modifications described herein may be
incorporated in a single oligonucleotide or even at within a single
nucleoside within an oligonucleotide.
[0108] In some embodiments, the targeting oligonucleotides are
chimeric oligonucleotides that contain two or more chemically
distinct regions, each made up of at least one nucleotide. These
oligonucleotides typically contain at least one region of modified
nucleotides that confers one or more beneficial properties (such
as, for example, increased nuclease resistance, increased uptake
into cells, increased binding affinity for the target) and a region
that is a substrate for enzymes capable of cleaving RNA:DNA or
RNA:RNA hybrids. Chimeric targeting oligonucleotides of the
invention may be formed as composite structures of two or more
oligonucleotides, modified oligonucleotides, oligonucleosides
and/or oligonucleotide mimetics as described above. Such compounds
have also been referred to in the art as hybrids or gapmers.
Representative United States patents that teach the preparation of
such hybrid structures comprise, but are not limited to, U.S. Pat.
Nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878;
5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356;
and 5,700,922, each of which is herein incorporated by
reference.
[0109] In some embodiments, the targeting oligonucleotide comprises
at least one nucleotide modified at the 2' position of the sugar,
most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or
2'-fluoro-modified nucleotide. In other preferred embodiments, RNA
modifications include 2'-fluoro, 2'-amino and 2' O-methyl
modifications on the ribose of pyrimidines, abasic residues or an
inverted base at the 3' end of the RNA. Such modifications are
routinely incorporated into oligonucleotides and these
oligonucleotides have been shown to have a higher Tm (i.e., higher
target binding affinity) than 2'-deoxyoligonucleotides against a
given target.
[0110] A number of nucleotide and nucleoside modifications have
been shown to make the oligonucleotide into which they are
incorporated more resistant to nuclease digestion than a native
oligodeoxynucleotide; these modified oligos survive intact for a
longer time than unmodified oligonucleotides, in some experimental
or therapeutics contexts. Specific examples of modified
oligonucleotides include those comprising modified backbones, for
example, phosphorothioates, phosphotriesters, methyl phosphonates,
short chain alkyl or cycloalkyl intersugar linkages or short chain
heteroatomic or heterocyclic intersugar linkages. Most preferred
are oligonucleotides with phosphorothioate backbones and those with
heteroatom backbones, particularly CH.sub.2--NH--O--CH.sub.2, CH,
.about.N(CH.sub.3).about.O.about.CH.sub.2 (known as a
methylene(methylimino) or MMI backbone,
CH.sub.2--O--N(CH.sub.3)--CH.sub.2,
CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 and
O--N(CH.sub.3)--CH.sub.2--CH.sub.2 backbones, wherein the native
phosphodiester backbone is represented as O--P--O--CH,); amide
backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995,
28:366-374); morpholino backbone structures (see Summerton and
Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA)
backbone (wherein the phosphodiester backbone of the
oligonucleotide is replaced with a polyamide backbone, the
nucleotides being bound directly or indirectly to the aza nitrogen
atoms of the polyamide backbone, see Nielsen et al., Science 1991,
254, 1497). Phosphorus-containing linkages include, but are not
limited to, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates comprising 3'alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates comprising 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563, 253; 5,571,799; 5,587,361; and 5,625,050.
[0111] Morpholino-based oligomeric compounds are described in
Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14),
4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev.
Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000,
26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97,
9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In
some embodiments, the morpholino-based oligomeric compound is a
phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in
Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al.,
J. Gene Med., 12:354-364, 2010; the disclosures of which are
incorporated herein by reference in their entireties).
[0112] Cyclohexenyl nucleic acid oligonucleotide mimetics are
described in Wang et al., J. Am. Chem. Soc., 2000, 122,
8595-8602.
[0113] Modified oligonucleotide backbones that do not include a
phosphorus atom therein have backbones that are formed by short
chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These comprise those having morpholino linkages (formed
in part from the sugar portion of a nucleoside); siloxane
backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH.sub.2 component parts; see U.S. Pat. Nos. 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562;
5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677;
5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and 5,677,439, each of which is herein incorporated by
reference.
[0114] Modified oligonucleotides are also known that include
oligonucleotides that are based on or constructed from
arabinonucleotide or modified arabinonucleotide residues.
Arabinonucleosides are stereoisomers of ribonucleosides, differing
only in the configuration at the 2'-position of the sugar ring. In
some embodiments, a 2'-arabino modification is 2'-F arabino. In
some embodiments, the modified oligonucleotide is
2'-fluoro-D-arabinonucleic acid (FANA) (as described in, for
example, Lon et al., Biochem., 41:3457-3467, 2002 and Min et al.,
Bioorg. Med. Chem. Lett., 12:2651-2654, 2002; the disclosures of
which are incorporated herein by reference in their entireties).
Similar modifications can also be made at other positions on the
sugar, particularly the 3' position of the sugar on a 3' terminal
nucleoside or in 2'-5' linked oligonucleotides and the 5' position
of 5' terminal nucleotide.
[0115] PCT Publication No. WO 99/67378 discloses arabinonucleic
acids (ANA) oligomers and their analogues for improved sequence
specific inhibition of gene expression via association to
complementary messenger RNA.
[0116] Other preferred modifications include ethylene-bridged
nucleic acids (ENAs) (e.g., International Patent Publication No. WO
2005/042777, Morita et al., Nucleic Acid Res., Suppl 1:241-242,
2001; Surono et al., Hum. Gene Ther., 15:749-757, 2004; Koizumi,
Curr. Opin. Mol. Ther., 8:144-149, 2006 and Horie et al., Nucleic
Acids Symp. Ser (Oxf), 49:171-172, 2005; the disclosures of which
are incorporated herein by reference in their entireties).
Preferred ENAs include, but are not limited to,
2'-O,4'-C-ethylene-bridged nucleic acids.
[0117] Examples of LNAs are described in WO/2008/043753 and include
compounds of the following general formula.
##STR00009##
in which X and Y are independently selected among the groups --O--,
--S--, --N(H)--, N(R)--, --CH.sub.2-- or --CH-- (if part of a
double bond), --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--N(H)--,
--CH.sub.2--N(R)--, --CH.sub.2--CH.sub.2-- or --CH.sub.2--CH-- (if
part of a double bond), --CH.dbd.CH--, where R is selected from
hydrogen and C.sub.1-4-alkyl; Z and Z* are independently selected
among an internucleoside linkage, a terminal group or a protecting
group; B constitutes a natural or non-natural nucleotide base
moiety; and the asymmetric groups may be found in either
orientation.
[0118] Preferably, the LNA used in the oligonucleotides described
herein comprises at least one LNA unit according any of the
formulas
##STR00010##
in which Y is --O--, --S--, --NH--, or N(R.sup.H); Z and Z* are
independently selected among an internucleoside linkage, a terminal
group or a protecting group; B constitutes a natural or non-natural
nucleotide base moiety, and RH is selected from hydrogen and
C.sub.1-4-alkyl.
[0119] Preferably, the Locked Nucleic Acid (LNA) used in the
oligonucleotides described herein comprises at least one nucleotide
comprises a Locked Nucleic Acid (LNA) unit according any of the
formulas shown in Scheme 2 of PCT/DK2006/000512.
[0120] Preferably, the LNA used in the oligomer of the invention
comprises internucleoside linkages selected from
-0-P(O).sub.2--O--, --O--P(O,S)--O--, -0-P(S).sub.2--O--,
--S--P(O).sub.2--O--, --S--P(O,S)--O--, --S--P(S).sub.2--O--,
-0-P(O).sub.2--S--, --O--P(O,S)--S--, --S--P(O).sub.2--S--,
-0-PO(R.sup.H)--O--, O--PO(OCH.sub.3)--O--, --O--PO(NR.sup.H)--O--,
-0-PO(OCH.sub.2CH.sub.2S--R)--O--, --O--PO(BH.sub.3)--O--,
--O--PO(NHR.sup.H)--O--, --O--P(O).sub.2--NR.sup.H--,
--NR.sup.H--P(O).sub.2--O--, --NR.sup.H--CO--O--, where R.sup.H is
selected from hydrogen and C.sub.1-4-alkyl.
[0121] Specifically preferred LNA units are shown in scheme 2:
##STR00011##
[0122] The term "thio-LNA" comprises a locked nucleotide in which
at least one of X or Y in the general formula above is selected
from S or --CH.sub.2--S--. Thio-LNA can be in both beta-D and
alpha-L-configuration.
[0123] The term "amino-LNA" comprises a locked nucleotide in which
at least one of X or Y in the general formula above is selected
from --N(H)--, N(R)--, CH.sub.2--N(H)--, and --CH.sub.2--N(R)--
where R is selected from hydrogen and C.sub.1-4-alkyl. Amino-LNA
can be in both beta-D and alpha-L-configuration.
[0124] The term "oxy-LNA" comprises a locked nucleotide in which at
least one of X or Y in the general formula above represents --O--
or --CH.sub.2--O--. Oxy-LNA can be in both beta-D and
alpha-L-configuration.
[0125] The term "ena-LNA" comprises a locked nucleotide in which Y
in the general formula above is --CH.sub.2--O-- (where the oxygen
atom of --CH.sub.2--O-- is attached to the 2'-position relative to
the base B).
[0126] LNAs are described in additional detail herein.
[0127] One or more substituted sugar moieties can also be included,
e.g., one of the following at the 2' position: OH, SH, SCH.sub.3,
F, OCN, OCH.sub.3OH.sub.3, OCH.sub.3O(CH.sub.2)n CH.sub.3,
O(CH.sub.2)n NH.sub.2 or O(CH.sub.2)n CH.sub.3 where n is from 1 to
about 10; Ci to C10 lower alkyl, alkoxyalkoxy, substituted lower
alkyl, alkaryl or aralkyl; Cl; Br; CN; CF.sub.3; OCF.sub.3; O-, S-,
or N-alkyl; O-, S-, or N-alkenyl; SOCH.sub.3; SO.sub.2CH.sub.3;
ONO.sub.2; NO.sub.2; N.sub.3; NH2; heterocycloalkyl;
heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted
silyl; an RNA cleaving group; a reporter group; an intercalator; a
group for improving the pharmacokinetic properties of an
oligonucleotide; or a group for improving the pharmacodynamic
properties of an oligonucleotide and other substituents having
similar properties. A preferred modification includes
2'-methoxyethoxy[2'-0-CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl)](Martin et al, HeIv. Chim. Acta, 1995, 78,
486). Other preferred modifications include 2'-methoxy
(2'-0-CH.sub.3), 2'-propoxy (2'-OCH.sub.2CH.sub.2CH.sub.3) and
2'-fluoro (2'-F). Similar modifications may also be made at other
positions on the oligonucleotide, particularly the 3' position of
the sugar on the 3' terminal nucleotide and the 5' position of 5'
terminal nucleotide. Oligonucleotides may also have sugar mimetics
such as cyclobutyls in place of the pentofuranosyl group.
[0128] Targeting oligonucleotides can also include, additionally or
alternatively, nucleobase (often referred to in the art simply as
"base") modifications or substitutions. As used herein,
"unmodified" or "natural" nucleobases include adenine (A), guanine
(G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include nucleobases found only infrequently or transiently in
natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me
pyrimidines, particularly 5-methylcytosine (also referred to as
5-methyl-2' deoxycytosine and often referred to in the art as
5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and
gentobiosyl HMC, isocytosine, pseudoisocytosine, as well as
synthetic nucleobases, e.g., 2-aminoadenine,
2-(methylamino)adenine, 2-(imidazolylalkyl)adenine,
2-(aminoalklyamino)adenine or other heterosubstituted
alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil,
5-hydroxymethyluracil, 5-propynyluracil, 8-azaguanine,
7-deazaguanine, N6 (6-aminohexyl)adenine, 6-aminopurine,
2-aminopurine, 2-chloro-6-aminopurine and 2,6-diaminopurine or
other diaminopurines. See, e.g., Kornberg, "DNA Replication," W. H.
Freeman & Co., San Francisco, 1980, pp 75-77; and Gebeyehu, G.,
et al. Nucl. Acids Res., 15:4513 (1987)). A "universal" base known
in the art, e.g., inosine, can also be included. 5-Me-C
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, in Crooke, and Lebleu,
eds., Antisense Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278) and may be used as base substitutions. It should
be appreciated that one or more modified bases may be present in a
region of complementarity of a targeting oligonucleotide.
[0129] It is not necessary for all positions in a given
oligonucleotide to be uniformly modified, and in fact more than one
of the modifications described herein may be incorporated in a
single oligonucleotide or even at within a single nucleoside within
an oligonucleotide.
[0130] In some embodiments, both a sugar and an internucleoside
linkage, i.e., the backbone, of the nucleotide units are replaced
with novel groups. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of
an oligonucleotide is replaced with an amide containing backbone,
for example, an aminoethylglycine backbone. The nucleobases are
retained and are bound directly or indirectly to aza nitrogen atoms
of the amide portion of the backbone. Representative United States
patents that teach the preparation of PNA compounds include, but
are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and
5,719,262, each of which is herein incorporated by reference.
Further teaching of PNA compounds can be found in Nielsen et al,
Science, 1991, 254, 1497-1500.
[0131] Further, nucleobases comprise those disclosed in U.S. Pat.
No. 3,687,808, those disclosed in "The Concise Encyclopedia of
Polymer Science And Engineering", pages 858-859, Kroschwitz, ed.
John Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandle Chemie, International Edition, 1991, 30, page 613, and
those disclosed by Sanghvi, Chapter 15, Antisense Research and
Applications," pages 289-302, Crooke, and Lebleu, eds., CRC Press,
1993. Certain of these nucleobases are particularly useful for
increasing the binding affinity of the oligomeric compounds of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
comprising 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2<0>C
(Sanghvi, et al., eds, "Antisense Research and Applications," CRC
Press, Boca Raton, 1993, pp. 276-278) and are presently preferred
base substitutions, even more particularly when combined with
2'-O-methoxyethyl sugar modifications. Modified nucleobases are
described in U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of
which is herein incorporated by reference.
[0132] In some embodiments, the targeting oligonucleotides are
chemically linked to one or more moieties or conjugates that
enhance the activity, cellular distribution, or cellular uptake of
the oligonucleotide. For example, one or more targeting
oligonucleotides, of the same or different types, can be conjugated
to targeting moieties with enhanced specificity for a cell type or
tissue type. Such moieties include, but are not limited to, lipid
moieties such as a cholesterol moiety (Letsinger et al., Proc.
Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan
et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether,
e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci.,
1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let.,
1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937). See also U.S. Pat. Nos.
4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730;
5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124;
5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;
5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;
4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;
5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667;
5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371;
5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of
which is herein incorporated by reference.
[0133] These moieties or conjugates can include conjugate groups
covalently bound to functional groups such as primary or secondary
hydroxyl groups. Conjugate groups of the invention include
intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance
the pharmacokinetic properties of oligomers. Typical conjugate
groups include cholesterols, lipids, phospholipids, biotin,
phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve uptake, enhance resistance to
degradation, and/or strengthen sequence-specific hybridization with
the target nucleic acid. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve uptake, distribution, metabolism or excretion of the
compounds of the present invention. Representative conjugate groups
are disclosed in International Patent Application No.
PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860,
which are incorporated herein by reference. Conjugate moieties
include, but are not limited to, lipid moieties such as a
cholesterol moiety, cholic acid, a thioether, e.g.,
hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g.,
dodecandiol or undecyl residues, a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a
polyethylene glycol chain, or adamantane acetic acid, a palmityl
moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol
moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941.
[0134] In some embodiments, targeting oligonucleotide modification
include modification of the 5' or 3' end of the oligonucleotide. In
some embodiments, the 3' end of the oligonucleotide comprises a
hydroxyl group or a thiophosphate. It should be appreciated that
additional molecules (e.g. a biotin moiety or a fluorophor) can be
conjugated to the 5' or 3' end of the targeting oligonucleotide. In
some embodiments, the targeting oligonucleotide comprises a biotin
moiety conjugated to the 5' nucleotide.
[0135] In some embodiments, the targeting oligonucleotide comprises
locked nucleic acids (LNA), ENA modified nucleotides, 2'-O-methyl
nucleotides, or 2'-fluoro-deoxyribonucleotides. In some
embodiments, the targeting oligonucleotide comprises alternating
deoxyribonucleotides and 2'-fluoro-deoxyribonucleotides. In some
embodiments, the targeting oligonucleotide comprises alternating
deoxyribonucleotides and 2'-O-methyl nucleotides. In some
embodiments, the targeting oligonucleotide comprises alternating
deoxyribonucleotides and ENA modified nucleotides. In some
embodiments, the targeting oligonucleotide comprises alternating
deoxyribonucleotides and locked nucleic acid nucleotides. In some
embodiments, the targeting oligonucleotide comprises alternating
locked nucleic acid nucleotides and 2'-O-methyl nucleotides.
[0136] In some embodiments, the 5' nucleotide of the
oligonucleotide is a deoxyribonucleotide. In some embodiments, the
5' nucleotide of the oligonucleotide is a locked nucleic acid
nucleotide. In some embodiments, the nucleotides of the
oligonucleotide comprise deoxyribonucleotides flanked by at least
one locked nucleic acid nucleotide on each of the 5' and 3' ends of
the deoxyribonucleotides. In some embodiments, the nucleotide at
the 3' position of the oligonucleotide has a 3' hydroxyl group or a
3' thiophosphate.
[0137] In some embodiments, the targeting oligonucleotide comprises
phosphorothioate internucleotide linkages. In some embodiments, the
targeting oligonucleotide comprises phosphorothioate
internucleotide linkages between at least two nucleotides. In some
embodiments, the targeting oligonucleotide comprises
phosphorothioate internucleotide linkages between all
nucleotides.
[0138] It should be appreciated that the targeting oligonucleotide
can have any combination of modifications as described herein.
[0139] It should also be appreciated that oligonucleotide based
linkers may also include any of the modifications disclosed
herein.
[0140] C. Antisense-Based Targeting Oligonucleotides
[0141] In illustrative embodiments, the targeting oligonucleotides
are targeting oligonucleotides that contain locked nucleic acid
3-8-3 gapmers which have a phosphorothioate backbone. However, in
general, the chemistry of the oligonucleotide is not limited to LNA
(2'-O,4'-C-methylene-bridged nucleic acids described, e.g., in PCT
patent application WO 98/39352), LNA gapmers, or the
phosphorothioate backbone, and can be expected to work with any
chemistry for which the target knock-down using a monomeric ASO is
effective. Such chemistries include, for instance,
2'-O,4'-C-ethylene-bridged nucleic acids (ENA; European patent No.
EP 1152009), hexitol nucleic acids (HNA; WO 93/25565 and WO
97/30064), fluoro-HNA, 2'-deoxy-2'-fluoro-13-D-arabino nucleic
acids (FANA; EP 1088066), 2'-modified analogs such as 2'-O-methyl
(2'-OMe) and 2'-O-(2-methoxyethyl) (MOE) modified nucleic acids,
CeNA (EP 1210347 and EP 1244667) as well as phosphate-modified
analogs such as phosphoroamidate, morpholinos, base-modified
analogs, such as G-clamps (WO 99/24452) and 5-alkynyl-pyrimidines.
Examples of LNA other gapmers are described in PCT patent
applications published as WO 01/25248, WO 01/48190, WO 2003/085110,
WO 2004/046160, WO 2008/113832, WO 2005/023825 and WO 2007/14651;
examples of FANA/DNA/FANA gapmers are described in EP 1315807;
examples of 2'-OMe/FANA/2'-OMe gapmers are described in U.S. Pat.
No. 6,673,611.
[0142] The backbone may be stabilized by other modifications, for
example, methylphosphonate or other chemistries. The antisense
oligonucleotides of this invention can work via an RNase H
mechanism, but can also work by steric blocking only, which also
includes transcriptional gene silencing and transcriptional gene
activation (see, e.g., Hawkins et al., 2009, Nucl. Acids Res.,
37(9):2984-2995 and Schwartz et al., 2008, Nature Struct. Mol.
Biol., 15:842-848). The dimer/multimer approach can also be
combined with any modification which increases the delivery into
cells, including lipophilic modifications, conjugates to cell
surface receptors or ligands (e.g., folate), aptamers, etc. For
example, to exploit the RNAse H mechanism, DNA:mRNA or gapmer:RNA
duplexes need to be formed to permit RNAse to bind to the
substrate. However, in the case of steric blocking, RNA:RNA,
RNA:2'-O-methyl-RNA, RNA:PNA or RNA:LNA duplexes (without a DNA
gap) may be used. Thus, the ASO chemistry may be adjusted based on
the intended use. Any chemistry suitable for the antisense
oligonucleotides should be applicable to the dimer/multimer
approach of the invention (for the state-of-the-art chemistries,
see, e.g., Bennett and Swaize, 2009, Ann. Rev. Pharmacol. Toxicol.,
50:259-293; Yokota at al., 2010, Arch. Neurol., 66:32-38;
Aboul-Fadl, 2005, Curr. Med. Chem., 12:2193-2214; Kurreck, 2003,
Eur. J. Biochem., 270:1628-1644).
[0143] In some illustrative embodiments, the targeting
oligonucleotides are 14-nucleotide long, but could be generally
longer or shorter. For example, the targeting oligonucleotide could
be 8-50-nucleotide long, or 10-40, 10-25, 8-20, 10-25, 12-25,
12-20, 12-16, 12-15, 12-14, 12-13, 13-16, 13-15, or 13-14
nucleotides long. In some embodiments, targeting oligonucleotides
are so-called tiny LNAs, containing as few as 8 or fewer
nucleotides (see, e.g., Obad et al. (2011) Nature Genetics,
43:371).
[0144] Further, in some embodiments, a targeting oligonucleotide
(e.g., ASO) comprises at least 7 contiguous nucleotides
complementary to the target sequence. In further embodiments,
targeting oligonucleotide (e.g., ASO) comprises at least 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35,
or 40 contiguous nucleotides complementary to a target sequence.
Due to specificities and isoform variations, ASO may additionally
comprise 1, 2, 3 or more non-complementary nucleotides, either
within the contiguous sequences or flanking them. In some
embodiments, at least one or all of the targeting oligonucleotides
are gapmers. In other embodiments, the targeting oligonucleotides
(e.g., ASOs) are X--N--Y gapmers, wherein at X or Y contains 0, 1,
2, 3, 4, 5 or more modified nucleotides, e.g., LNA, ENA, FANA,
G-clamp, and N is 3, 4, 5, 6, 7, 8, 9, or 10 deoxynucleotides with
non-modified sugars. For example, ASO can be a 3-8-3, 2-10-2,
3-9-2, 2-9-3, 2-8-2, 3-7-2, 2-7-3 gapmer or another type of gapmer
or mixmer.
[0145] D. Linkers
[0146] The term "linker" generally refers to a chemical moiety that
is capable of covalently linking two or more targeting
oligonucleotides, in which at least one bond comprised within the
linker is capable of being cleaved (e.g., in a biological context,
such as in a mammalian extract, such as an endosomal extract), such
that at least two targeting oligonucleotides are no longer
covalently linked to one another after bond cleavage. It will be
appreciated that a provided linker may include a region that is
non-cleavable, as long as the linker also comprises at least one
bond that is cleavable.
[0147] In some embodiments, the linker comprises a polypeptide that
is more susceptible to cleavage by an endopeptidase in the
mammalian extract than the targeting oligonucleotides. The
endopeptidase may be a trypsin, chymotrypsin, elastase,
thermolysin, pepsin, or endopeptidase V8. The endopeptidase may be
a cathepsin B, cathepsin D, cathepsin L, cathepsin C, papain,
cathepsin S or endosomal acidic insulinase. For example, the linker
comprise a peptide having an amino acid sequence selected from:
ALAL (SEQ ID NO: 125), APISFFELG (SEQ ID NO: 126), FL, GFN, R/KXX,
GRWHTVGLRWE (SEQ ID NO: 127), YL, GF, and FF, in which X is any
amino acid.
[0148] In some embodiments, the linker comprises the formula
--(CH.sub.2).sub.nS--S(CH.sub.2).sub.m--, wherein n and m are
independently integers from 0 to 10.
[0149] For example, the linker of a multimeric oligonucleotide may
comprise an oligonucleotide that is more susceptible to cleavage by
an endonuclease in the mammalian extract than the targeting
oligonucleotides. The linker may have a nucleotide sequence
comprising from 1 to 10 thymidines or uridines. The linker may have
a nucleotide sequence comprising deoxyribonucleotides linked
through phosphodiester internucleotide linkages. The linker may
have a nucleotide sequence comprising from 1 to 10 thymidines
linked through phosphodiester internucleotide linkages. The linker
may have a nucleotide sequence comprising from 1 to 10 uridines
linked through phosphorothioate internucleotide linkages. The
linker may have the formula:
##STR00012##
in which Z is an oligonucleotide. Z may have a nucleotide sequence
comprising from 1 to 10 thymidines or uridines.
[0150] In some embodiments, the linker does not comprise an
oligonucleotide having a self-complementary nucleotide sequence. In
some embodiments, the linker does not comprise an oligonucleotide
having a nucleotide sequence that is complementary to a region of
the genomic target sequence that is contiguous with two flanking
target regions. In some embodiments, the linker does not comprise
an oligonucleotide having a self-complementary nucleotide sequence
and does not comprise an oligonucleotide having a nucleotide
sequence that is complementary to a region of the genomic target
sequence that is contiguous with two flanking target regions of the
particular linker. In some embodiments, the at least one L is a
linker that does not comprise an oligonucleotide having an abasic
site.
[0151] In some embodiments, at least one L is a linker derived from
one or more molecules in Table 2.1.
[0152] In other embodiments, multimeric oligonucleotide compounds
are provided that comprise at least two targeting oligonucleotides
each of which is linked to one or two other targeting
oligonucleotides through a linker. In some embodiments, at least
one linker is 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more
sensitive to enzymatic cleavage in the presence of a mammalian
extract than at least two targeting oligonucleotides. It should be
appreciated that different linkers can be designed to be cleaved at
different rates and/or by different enzymes in compounds comprising
two or more linkers. Similarly different linkers can be designed to
be sensitive to cleavage in different tissues, cells or subcellular
compartments in compounds comprising two or more linkers. This can
advantageously permit compounds to have targeting oligonucleotides
that are released from compounds at different rates, by different
enzymes, or in different tissues, cells or subcellular compartments
thereby controlling release of the monomeric oligonucleotides to a
desired in vivo location or at a desired time following
administration.
[0153] In some embodiments, the invention also provides ASO
multimers comprising targeting oligonucleotides having
nuclease-resistant backbone (e.g., phosphorothioate), wherein the
targeting oligonucleotides are linked to each other by one or more
cleavable linkers.
[0154] In certain embodiments, linkers are stable in plasma, blood
or serum which are richer in exonucleases, and less stable in the
intracellular environments which are relatively rich in
endonucleases. The intracellular stability of linkers can be
assessed in vitro or in vivo as described in the Examples. In some
embodiments, a linker is considered "non-cleavable" if the linker's
half-life is at least 24, or 28, 32, 36, 48, 72, 96 hours or longer
under the conditions described here, such as in liver homogenates.
Conversely, in some embodiments, a linker is considered "cleavable"
if the half-life of the linker is at most 10, or 8, 6, 5 hours or
shorter.
[0155] In some embodiments, the linker is a nuclease-cleavable
oligonucleotide linker. In some embodiments, the nuclease-cleavable
linker contains one or more phosphodiester bonds in the
oligonucleotide backbone. For example, the linker may contain a
single phosphodiester bridge or 2, 3, 4, 5, 6, 7 or more
phosphodiester linkages, for example as a string of 1-10
deoxynucleotides, e.g., dT, or ribonucleotides, e.g., rU, in the
case of RNA linkers. In the case of dT or other DNA nucleotides dN
in the linker, in certain embodiments the cleavable linker contains
one or more phosphodiester linkages. In other embodiments, in the
case of rU or other RNA nucleotides rN, the cleavable linker may
consist of phosphorothioate linkages only. In contrast to
phosphorothioate-linked deoxynucleotides, which are only cleaved
slowly by nucleases (thus termed "noncleavable"),
phosphorothioate-linked rU undergoes relatively rapid cleavage by
ribonucleases and therefore is considered cleavable herein. It is
also possible to combine dN and rN into the linker region, which
are connected by phosphodiester or phosphorothioate linkages. In
other embodiments, the linker can also contain chemically modified
nucleotides, which are still cleavable by nucleases, such as, e.g.,
2'-O-modified analogs. In particular, 2'-O-methyl or 2'-fluoro
nucleotides can be combined with each other or with dN or rN
nucleotides. Generally, in the case of nucleotide linkers, the
linker is a part of the multimer that is usually not complementary
to a target, although it could be. This is because the linker is
generally cleaved prior to targeting oligonucleotides action on the
target, and therefore, the linker identity with respect to a target
is inconsequential. Accordingly, in some embodiments, a linker is
an (oligo)nucleotide linker that is not complementary to any of the
targets against which the targeting oligonucleotides are
designed.
[0156] In some embodiments, the cleavable linker is oligonucleotide
linker that contains a continuous stretch of deliberately
introduced Rp phosphorothioate stereoisomers (e.g., 4, 5, 6, 7 or
longer stretches). The Rp stereoisoform, unlike Sp isoform, is
known to be susceptible to nuclease cleavage (Krieg et al., 2003,
Oligonucleotides, 13:491-499). Such a linker would not include a
racemic mix of PS linkages oligonucleotides since the mixed
linkages are relatively stable and are not likely to contain long
stretches of the Rp stereoisomers, and therefore, considered
"non-cleavable" herein. Thus, in some embodiments, a linker
comprises a stretch of 4, 5, 6, 7 or more phosphorothioated
nucleotides, wherein the stretch does not contain a substantial
amount or any of the Sp stereoisoform. The amount could be
considered substantial if it exceeds 10% on per-mole basis.
[0157] In some embodiments, the linker is a non-nucleotide linker,
for example, a single phosphodiester bridge. Another example of
such cleavable linkers is a chemical group comprising a disulfide
bond, for example, --(CH.sub.2).sub.nS--S(CH.sub.2).sub.m--,
wherein n and m are integers from 0 to 10. In illustrative
embodiments, n=m=6. Additional example of non-nucleotide linkers
are described below.
[0158] The cleavable linkers may be present in other linear or
branched multimers. For example in some branched embodiments, the
cleavable linker comprises a "doubler," "trebler," or another
branching chemical group with multiple "arms" that link
phosphodiester linked nucleotides, as for example, illustrated in
FIGS. 1C and 1D and Formulas IV, V, and VIII. In some linear
embodiments, cleavable linkers can be incorporated as shown in
Formulas I and II.
[0159] The linker can be designed so as to undergo a chemical or
enzymatic cleavage reaction. Chemical reactions involve, for
example, cleavage in acidic environment (e.g., endosomes),
reductive cleavage (e.g., cytosolic cleavage) or oxidative cleavage
(e.g., in liver microsomes). The cleavage reaction can also be
initiated by a rearrangement reaction. Enzymatic reactions can
include reactions mediated by nucleases, peptidases, proteases,
phosphatases, oxidases, reductases, etc. For example, a linker can
be pH-sensitive, cathepsin-sensitive, or predominantly cleaved in
endosomes and/or cytosol.
[0160] In some embodiments, the linker comprises a peptide. In
certain embodiments, the linker comprises a peptide which includes
a sequence that is cleavable by an endopeptidase. In addition to
the cleavable peptide sequence, the linker may comprise additional
amino acid residues and/or non-peptide chemical moieties, such as
an alkyl chain. In certain embodiments, the linker comprises
Ala-Leu-Ala-Leu (SEQ ID NO.: 125), which is a substrate for
cathepsin B. See, for example, the
maleimidocaproyl-Arg-Arg-Ala-Leu-Ala-Leu (SEQ ID NO.: 136) linkers
described in Schmid et al, Bioconjugate Chem 2007, 18, 702-716. In
certain embodiments, a cathepsin B-cleavable linker is cleaved in
tumor cells. In certain embodiments, the linker comprises
Ala-Pro-Ile-Ser-Phe-Phe-Glu-Leu-Gly (SEQ ID NO.: 126), which is a
substrate for cathepsins D, L, and B (see, for example, Fischer et
al, Chembiochem 2006, 7, 1428-1434). In certain embodiments, a
cathepsin-cleavable linker is cleaved in HeLA cells. In some
embodiments, the linker comprises Phe-Lys, which is a substrate for
cathepsin B. For example, in certain embodiments, the linker
comprises Phe-Lys-p-aminobenzoic acid (PABA). See, e.g., the
maleimidocaproyl-Phe-Lys-PABA linker described in Walker et al,
Bioorg. Med. Chem. Lett. 2002, 12, 217-219. In certain embodiments,
the linker comprises Gly-Phe-2-naphthylamide, which is a substrate
for cathepsin C (see, for example, Berg et al. Biochem. J. 1994,
300, 229-235). In certain embodiments, a cathepsin C-cleavable
linker is cleaved in hepatocytes, In some embodiments, the linker
comprises a cathepsin S cleavage site. For example, in some
embodiments, the linker comprises
Gly-Arg-Trp-His-Thr-Val-Gly-Leu-Arg-Trp-Glu (SEQ ID NO.: 127),
Gly-Arg-Trp-Pro-Pro-Met-Gly-Leu-Pro-Trp-Glu (SEQ ID NO.: 137), or
Gly-Arg-Trp-His-Pro-Met-Gly-Ala-Pro-Trp-Glu (SEQ ID NO.: 138), for
example, as described in Lutzner et al, J. Biol. Chem. 2008, 283,
36185-36194. In certain embodiments, a cathepsin S-cleavable linker
is cleaved in antigen presenting cells. In some embodiments, the
linker comprises a papain cleavage site. Papain typically cleaves a
peptide having the sequence --R/K--X--X (see Chapman et al, Annu.
Rev. Physiol 1997, 59, 63-88). In certain embodiments, a
papain-cleavable linker is cleaved in endosomes. In some
embodiments, the linker comprises an endosomal acidic insulinase
cleavage site. For example, in some embodiments, the linker
comprises Tyr-Leu, Gly-Phe, or Phe-Phe (see, e.g., Authier et al,
FEBS Lett. 1996, 389, 55-60). In certain embodiments, an endosomal
acidic insulinase-cleavable linker is cleaved in hepatic cells.
[0161] In some embodiments, the linker is pH sensitive. In certain
embodiments, the linker comprises a low pH-labile bond. As used
herein, a low-pH labile bond is a bond that is selectively broken
under acidic conditions (pH<7). Such bonds may also be termed
endosomally labile bonds, because cell endosomes and lysosomes have
a pH less than 7. For example, in certain embodiments, the linker
comprises an amine, an imine, an ester, a benzoic imine, an amino
ester, a diortho ester, a polyphosphoester, a polyphosphazene, an
acetal, a vinyl ether, a hydrazone, an azidomethyl-methylmaleic
anhydride, a thiopropionate, a masked endosomolytic agent or a
citraconyl group.
[0162] In certain embodiments, the linker comprises a low pH-labile
bond selected from the following: ketals that are labile in acidic
environments (e.g., pH less than 7, greater than about 4) to form a
diol and a ketone; acetals that are labile in acidic environments
(e.g., pH less than 7, greater than about 4) to form a diol and an
aldehyde; imines or iminiums that are labile in acidic environments
(e.g., pH less than 7, greater than about 4) to form an amine and
an aldehyde or a ketone; silicon-oxygen-carbon linkages that are
labile under acidic condition; silicon-nitrogen (silazane)
linkages; silicon-carbon linkages (e.g., arylsilanes, vinylsilanes,
and allylsilanes); maleamates (amide bonds synthesized from maleic
anhydride derivatives and amines); ortho esters; hydrazones;
activated carboxylic acid derivatives (e.g., esters, amides)
designed to undergo acid catalyzed hydrolysis); or vinyl ethers.
Further examples may be found in International Patent Appln. Pub.
No. WO 2008/022309, entitled POLYCONJUGATES FOR IN VIVO DELIVERY OF
POLYNUCLEOTIDES, the contents of which are incorporated herein by
reference.
[0163] Organosilanes (e.g., silyl ethers, silyl enol ethers) are
used as oxygen protecting groups in organic synthesis.
Silicon-oxygen-carbon linkages are susceptible to hydrolysis under
acidic conditions to form silanols and an alcohol (or enol). The
substitution on both the silicon atom and the alcohol carbon can
affect the rate of hydrolysis due to steric and electronic effects.
This allows for the possibility of tuning the rate of hydrolysis of
the silicon-oxygen-carbon linkage by changing the substitution on
either the organosilane, the alcohol, or both the organosilane and
alcohol. In addition, charged or reactive groups, such as amines or
carboxylate, may be attached to the silicon atom, which confers the
labile compound with charge and/or reactivity.
[0164] Hydrolysis of a silazane leads to the formation of a silanol
and an amine. Silazanes are inherently more susceptible to
hydrolysis than is the silicon-oxygen-carbon linkage, however, the
rate of hydrolysis is increased under acidic conditions. The
substitution on both the silicon atom and the amine can affect the
rate of hydrolysis due to steric and electronic effects. This
allows for the possibility of tuning the rate of hydrolysis of the
silazane by changing the substitution on either the silicon or the
amine.
[0165] Another example of a pH labile bond is an acid labile enol
ether bond. The rate at which this labile bond is cleaved depends
on the structures of the carbonyl compound formed and the alcohol
released. For example analogs of ethyl isopropenyl ether, which may
be synthesized from .beta.-haloethers, generally have shorter half
lives than analogs of ethyl cyclohexenyl ether, which may be
synthesized from phenol ethers
[0166] Reaction of an anhydride with an amine forms an amide and an
acid. Typically, the reverse reaction (formation of an anhydride
and amine) is very slow and energetically unfavorable. However, if
the anhydride is a cyclic anhydride, reaction with an amine yields
a molecule in which the amide and the acid are in the same
molecule, an amide acid. The presence of both reactive groups (the
amide and the carboxylic acid) in the same molecule accelerates the
reverse reaction. In certain embodiments, the linker comprises
maleamic acid. Cleavage of the amide acid to form an amine and an
anhydride is pH-dependent, and is greatly accelerated at acidic pH.
This pH-dependent reactivity can be exploited to form reversible
pH-sensitive bonds and linkers. Cis-aconitic acid has been used as
such a pH-sensitive linker molecule. The .gamma.-carboxylate is
first coupled to a molecule. In a second step, either the .alpha.
or .beta. carboxylate is coupled to a second molecule to form a
pH-sensitive coupling of the two molecules.
[0167] In some embodiments, the linker comprises a benzoic imine as
a low-pH labile bond. See, for example, the conjugates described in
Zhu et al, Langmuir 2012, 28, 11988-96; Ding et al, Bioconjug.
Chem. 2009, 20, 1163-70.
[0168] In some embodiments, the linker comprises a low pH-labile
hydrazone bond. Such acid-labile bonds have been extensively used
in the field of conjugates, e.g., antibody-drug conjugates. See,
for example, Zhou et al, Biomacromolecules 2011, 12, 1460-7; Yuan
et al, Acta Biomater. 2008, 4, 1024-37; Zhang et al, Acta Biomater.
2007, 6, 838-50; Yang et al, J. Pharmacol. Exp. Ther. 2007, 321,
462-8; Reddy et al, Cancer Chemother. Pharmacol. 2006, 58, 229-36;
Doronina et al, Nature Biotechnol. 2003, 21, 778-84. In some
embodiments, the linker comprises a low pH-labile vinyl ether. See,
for example, Shin et al, J. Control. Release 2003, 91, 187-200. In
some embodiments, the linker comprises a low pH-labile phosphoamine
bond. In some embodiments, the linker comprises a low pH-labile
traceless click linker. For example, in certain embodiments, the
linker comprises azidomethyl-methylmaleic anhydride (see Maier et
al, J. Am. Chem. Soc. 2012 134, 10169-73. In some embodiments, the
linker comprises a low pH-labile 4-hydrazinosulfonyl benzoic acid
linker. See, for example, Kaminskas et al, Mol. Pharm. 2012 9,
422-32; Kaminskas et al, J. Control. Release 2011, 152, 241-8. In
some embodiments, the linker comprises a low pH-labile
para-phenylpropionic acid linker (see, e.g., Indira Chandran et al,
Cancer Lett. 2012 316, 151-6). In some embodiments, the linker
comprises a low pH-labile .beta.-thiopropionate linker (see, e.g.,
Dan et al, Langmuir 2011, 27, 612-7). In some embodiments, the
linker comprises a low pH-labile ester (see, for example, Zhu et
al, Bioconjug. Chem. 2010, 21, 2119-27). In some embodiments, the
linker comprises a low pH-labile ketal (see, e.g., Abraham et al,
J. Biomater. Sci. Polym. Ed. 2011, 22, 1001-22) or acetal (see,
e.g., Liu et al, J. Am. Chem. Soc. 2010, 132, 1500). In some
embodiments, the linker comprises a low pH-labile
4-(4'-acetylphenoxy)butanoic acid linker (see, e.g., DiJoseph et
al, Blood 2004, 103, 1807-14). In some embodiments, the linker
comprises a low pH-labile cis-aconityl linker (see, e.g., Haas et
al, J. Drug Target 2002, 10, 81-9; Ahmad et al, Anticancer Res.
1990, 10, 837-43; Dillman et al, Cancer Res. 1988, 48, 6097-102).
In some embodiments, the linker comprises a low pH-labile diortho
ester (see, e.g, Guo et al, Bioconjug. Chem. 2001, 12,
291-300).
[0169] In some embodiments, the linker comprises a masked
endosomolytic agent. Endosomolytic polymers are polymers that, in
response to a change in pH, are able to cause disruption or lysis
of an endosome or provide for escape of a normally
membrane-impermeable compound, such as a polynucleotide or protein,
from a cellular internal membrane-enclosed vesicle, such as an
endosome or lysosome. A subset of endosomolytic compounds is
fusogenic compounds, including fusogenic peptides. Fusogenic
peptides can facilitate endosomal release of agents such as
oligomeric compounds to the cytoplasm. See, for example, US Patent
Application Publication Nos. 20040198687, 20080281041, 20080152661,
and 20090023890, which are incorporated herein by reference.
[0170] The linker can also be designed to undergo an
organ/tissue-specific cleavage. For example, for certain targets,
which are expressed in multiple tissues, only the knock-down in
liver may be desirable, as knock-down in other organs may lead to
undesired side effects. Thus, linkers susceptible to liver-specific
enzymes, such as pyrrolase (TPO) and glucose-6-phosphatase
(G-6-Pase), can be engineered, so as to limit the antisense effect
to the liver mainly. Alternatively, linkers not susceptible to
liver enzymes but susceptible to kidney-specific enzymes, such as
gamma-glutamyltranspeptidase, can be engineered, so that the
antisense effect is limited to the kidneys mainly. Analogously,
intestine-specific peptidases cleaving Phe-Ala and Leu-Ala could be
considered for orally administered multimeric targeting
oligonucleotides. Similarly, by placing an enzyme recognition site
into the linker, which is recognized by an enzyme over-expressed in
tumors, such as plasmin (e.g., PHEA-D-Val-Leu-Lys recognition
site), tumor-specific knock-down should be feasible. By selecting
the right enzyme recognition site in the linker, specific cleavage
and knock-down should be achievable in many organs. In addition,
the linker can also contain a targeting signal, such as N-acetyl
galactosamine for liver targeting, or folate, vitamin A or
RGD-peptide in the case of tumor or activated macrophage targeting.
Accordingly, in some embodiments, the cleavable linker is organ- or
tissue-specific, for example, liver-specific, kidney-specific,
intestine-specific, etc.
[0171] The targeting oligonucleotides can be linked through any
part of the individual targeting oligonucleotide, e.g., via the
phosphate, the sugar (e.g., ribose, deoxyribose), or the
nucleobase. In certain embodiments, when linking two
oligonucleotides together, the linker can be attached e.g. to the
5'-end of the first oligonucleotide and the 3'-end of the second
nucleotide, to the 5'-end of the first oligonucleotide and the
5'end of the second nucleotide, to the 3'-end of the first
oligonucleotide and the 3'-end of the second nucleotide. In other
embodiments, when linking two oligonucleotides together, the linker
can attach internal residues of each oligonucleotides, e.g., via a
modified nucleobase. One of ordinary skill in the art will
understand that many such permutations are available for
multimers.
[0172] The linkers described herein can also be used to attach
other moieties to an oligonucleotide. Such moieties include
lipophilic moieties, targeting moieties (e.g., a ligand of a cell
surface receptor), and tags (e.g., a fluorescent moiety for imaging
or an affinity tag such as biotin). In some embodiments, the
linkers described herein may be used to attach targeting moieties
to an oligonucleotide. In some embodiments, the targeting moiety is
a carbohydrate. Carbohydrate targeting moieties are known in the
art and include, for example, monosaccharides, disaccharides,
trisaccharides, and polysaccharides (see, e.g., U.S. Pat. No.
8,106,022, which is incorporated herein by reference in its
entirety). Exemplary carbohydrate targeting moieties include
galactose, mannose, mannose-6-phosphate, N-Acetyl-Galactosylamine
(GalNAc), N-Acetyl-Glucosamine (GluNAc). Multiple copies, e.g.,
two, three, four, five, or more, of these carbohydrates are also
contemplated. Other targeting moieties, such as a ligand for a cell
surface receptor or an antibody or fragment thereof may also be
used, Exemplary ligands for cell surface receptors include EGF,
asialoglycoprotein, arginine-glycine-aspartic acid (RGD) peptide,
asparagine-glycine-arginine (NGR) peptide, folate, transferrin, and
GM-CSF (see, e.g., Allen. Ligand-targeted therapeutics in
anticancer therapy. Nature 750, 2002, Vol 2). Antibodies include
monoclonal and polyclonal antibodies, as well as fragments such as
Fab, F(ab').sub.2, Fab', scFv, and sdAb. Exemplary targeting
antibodies include anti-VEGFR, anti-ERBB2, anti-CD20, anti-CD22,
anti-CD19, anti-CD33, anti-CD25, anti-HLA-DR10beta, anti-tenascin,
anti-CEA, anti-MUC1, and anti-TAG72. Still other suitable targeting
moieties will be apparent to the skilled artisan.
[0173] In certain embodiments, the linker is attached to an
oligonucleotide via click chemistry (for a review of using click
chemistry with DNA, see El-Sagheer et al, Chem. Soc. Rev. 2010, 39,
1388-1405). The term "click chemistry" is used to describe any
facile reaction that occurs in high yields, under mild conditions,
and in the presence of diverse functional groups, but it is most
commonly used to refer to a [3+2]azide-alkyne cycloaddition
reaction. Such reactions are generally catalyzed by Cu.sup.I and
proceed in the presence of functional groups typically encountered
in biological molecules. In some embodiments, an unnatural base is
introduced into the oligonucleotide, wherein the base is modified
to comprise an alkyne or azide.
[0174] See below for exemplary base modifications:
##STR00013## ##STR00014## [0175] wherein R' is, for example,
hydrogen, a suitable protecting group or coupling moiety (e.g.,
4,4'-dimethoxytrityl (DMT), or a phosphoramidite group), a
triphosphate, or R' denotes the point of connection to the rest of
an oligonucleotide.
[0176] In some embodiments, an oligonucleotide is modified such
that the ribose moiety comprises an alkyne or azide for coupling
the linker. For example:
##STR00015##
[0177] In some embodiments, an oligonucleotide is modified on the
5' or 3' end with an alkyne or azide for coupling the linker via
click chemistry. For example, the nucleosides shown below can be
used to synthesize such oligonucleotides:
##STR00016##
[0178] Exemplary reagents which allow linking targeting
oligonucleotides through a nucleobase include protected amino
functionality at the base that can then be coupled to other
suitable functional groups. In certain embodiments, Fmoc
Amino-Modifier C6 dT (Glen Research catalog number 10-1536-xx) is
used as a starting material:
##STR00017##
[0179] Other exemplary reagents which allow linking targeting
oligonucleotides through a nucleobase include protected thiol
functionality at the base that can then be coupled to other
suitable functional groups or used to form a disulfide bond. In
certain embodiments, S-Bz-Thiol-Modifier C6 dT (Glen Research
catalog number 10-1039-xx) is used as a starting material:
##STR00018##
[0180] In other embodiments, Amino-Modifier Serinol Phosphoramidite
(Glen Research catalog number 10-1997-xx) or 3'-Amino-Modifier
Serinol CPG (Glen Research catalog number 20-2997-xx) is used to
introduce amino-functionalized linkers that can then be coupled
with other suitable functional groups:
##STR00019##
[0181] In other embodiments, Thiol-Modifier C6 S--S(Glen Research
catalog number 10-1936-xx), 3'-Thiol-Modifier C3 S--S CPG (Glen
Research catalog number 20-2933-xx), or 5'-Maleimide-Modifier
Phosphoramidite (Glen Research catalog number 10-1938-xx) is used
to introduce a linker:
##STR00020##
[0182] In some embodiments, Cholesteryl-TEG Phosphoramidite (Glen
Research catalog number 10-1975-xx) or .alpha.-Tocopherol-TEG
Phosphoramidite (Glen Research catalog number 10-1977-xx) is used
in phosphoramidite synthesis to add a lipophilic moiety to an
targeting oligonucleotide:
##STR00021##
[0183] In some embodiments, one or more of the following starting
materials are used in oligonucleotide synthesis to introduce an
alkyne into an targeting oligonucleotide that can be reacted via
click chemistry with an azide to attach another targeting
oligonucleotide or another moiety such as a lipophilic group or
targeting group:
##STR00022## ##STR00023##
[0184] In some embodiments, one or more of the following starting
materials are used to attach a lipophilic group or targeting group
via click chemistry to an targeting oligonucleotide functionalized
with an alkyne, such as the ones described above:
##STR00024##
[0185] E. Targets and Uses
[0186] The disclosure provides a method of inhibiting target
expression levels of one or more targets, comprising administering
to a cell or a subject the compounds of the invention in an amount
effective to inhibit the expression of the target(s). In certain
embodiments, the target is an mRNA. In other embodiments, the
target could be a microRNA, as described above. In such cases, the
individual targeting oligonucleotides may be referred to as
"antagomiRs." In other embodiments, the target can be a non-coding
RNA naturally expressed in the cells.
[0187] The subjects treated according to the methods of the
invention can be animals, including humans, primates, and rodents.
Cells can be present in vitro, or treated ex vivo. In some cases,
ex vivo treated cells are re-administered to the subject.
[0188] The invention also encompasses dual and multiple target
antisense inhibitors, in particular those to treat liver diseases,
metabolic diseases, cardiovascular diseases, inflammatory diseases,
neurological diseases, viral, bacterial, parasitic, or prion
infections and cancer. In particular, it includes the use of
dimeric antisense inhibitors to inhibit liver targets (also
referred to as "hepatic targets"), such as ApoB and ApoC3 dual
inhibition. Since knock-down of ApoB has been reported to lead to
undesired lipid deposition in the liver, the simultaneous
knock-down of ApoC3 can decrease this side effect.
[0189] In cancer, the simultaneous knock-down of two targets can
lead to synergistic anti-tumor effects. In particular, combination
of targets with different mechanisms of action and signaling
pathways should be of interest, e.g., a combination of cytostatic
mechanism with anti-metastatic mechanism.
[0190] By selecting appropriate sequences against various cancer or
tumor related targets, the present invention is also suitable for
cancer treatment. Thus, it is possible to use multimeric
oligonucleotide compounds of the invention that comprise targeting
oligonucleotides which are directed 1) against targets responsible
for the differentiation, development, or growth of cancers, such
as: oncoproteins or transcription factors, e.g., c-myc, N-myc,
c-myb, c-fos, c-fos/jun, PCNA, p120, EJ-ras, c-Ha-ras, N-ras, rrg,
bcl-2, bcl-x, bcl-w, cdc-2, c-raf-1, c-mos, c-src, c-abl, c-ets; 2)
against cellular receptors, such as EGF receptor, Her-2, c-erbA,
VEGF receptor (KDR-1), retinoid receptors; 3) against protein
kinases, c-fms, Tie-2, c-raf-1 kinase, PKC-alpha, protein kinase A
(R1 alpha); 4) against growth or angiogenic factors, such as bFGF,
VEGF, EGF, HB-EGF, PDGF and TGF-.beta.; 5) against cytokines, such
as IL-10, against cell cycle proteins, such as cyclin-E; 6) against
tumor proteins, such as MAT-8; or 7) against inhibitors of tumor
suppressor genes such as MDM-2. Also of use are antisense or
directed against 8) components of spindle formation, such as eg5
and PLK1, or 9) against targets to suppress metastasis, such as
CXCR4. Of use are antisense sequences directed against 10) factors
which suppress apoptosis, such as survivin, stat3 and hdm2, or
which suppress the expression of multiple drug resistance genes,
such as MDR1 (P-glycoprotein).
[0191] The dimer/multimer can also degrade or antagonize microRNA
(miRNA) which are single-stranded RNA molecules of about 21-23
nucleotides in length regulating gene expression. miRNAs are
encoded by genes that are transcribed from DNA but not translated
into protein (non-coding RNA); instead they are processed from
primary transcripts known as pri-miRNA to short stem-loop
structures called pre-miRNA and finally to functional miRNA. Mature
miRNA molecules are partially complementary to one or more
messenger RNA (mRNA) molecules, and their main function is to
down-regulate gene expression. It appears that many miRNA sequences
discovered in the human genome contribute to the development of
cancer. Some miRNAs are significantly deregulated in cancer.
Further, miRNA which is over-expressed (e.g., TGF-.beta.2 receptor,
RB1 and PLAG1) leading to tumor growth can be down-regulated using
antisense approaches as described before. An miRNA expression
signature of human solid tumors defining cancer gene targets was
reported, for example, by Volinia et al., PNAS, 2006, 103,
2257-61.
[0192] Further provided are pharmaceutical compositions, comprising
a compound of the invention and one or more pharmaceutically
acceptable excipients. Methods of formulating and administering
oligonucleotides to a cell or a subject are known in the art (see,
e.g., Hardee, Gregory E.; Tillman, Lloyd G.; Geary, Richard S.
Routes and Formulations For Delivery of Antisense Oligonucleotides.
Antisense Drug Technology (2nd Edition) 2008, 217-236. Publisher:
CRC Press LLC, Boca Raton, Fla.; Zhao et al., 2009, Expert Opin.
Drug Deliv., 6:673-686; Juliano et al., 2008, Nucleic Acids Res.,
36:4158-4171; Augner, 2006, J. Biomed. Biotechnol. 1-15; Wilson et
al., 2005, Advances Genetics, 54:21-41; Hassane et al., 2010, Cell.
Mol. Life Sci., 67:715-726; and Nakagawa et al., 2010, J. Am. Chem.
Soc., 132:8848-8849.
[0193] In some embodiments, the compound of the invention possesses
additional desirable properties such as a level of purity, a salt
concentration, and/or an endotoxin level. In some embodiments, the
level of purity is greater than 75% pure. In some embodiments, the
compound is provided in a lyophilized formulation in an amount of
10 mg to 100 mg (e.g., about 50 mg). In some embodiments, the
compound is provided in a formulation with a counter ion, such as,
for example, sodium. In some embodiments, the endotoxin level is at
or below 1000 entoxoin units (EU)/gram.
[0194] In some embodiments, the compounds of the invention possess
favorable pharmacokinetic and/or pharmacodynamic properties. For
example, in some case, a therapeutically effective knockdown of the
target(s) persists for two weeks or longer following the
administration. In some embodiments, the compositions of the
invention are characterized by one or more of the following
properties when administered in vivo:
[0195] (d) increased concentration in the liver (or other tissues)
and reduced clearance by kidneys as compared to respective
monomeric targeting oligonucleotides;
[0196] (e) longer duration of target knockdown as compared to
respective monomeric targeting oligonucleotides; and
[0197] (f) lower effective concentrations as compared to respective
monomeric targeting oligonucleotides and/or the same multimeric
oligonucleotide compound, wherein the cleavable linker is
substituted with a noncleavable linker.
[0198] F. Routes of Delivery
[0199] A composition that includes a multimeric oligonucleotide
compound can be delivered to a subject by a variety of routes.
Exemplary routes include: intravenous, intradermal, topical,
rectal, parenteral, anal, intravaginal, intranasal, pulmonary,
ocular. The term "therapeutically effective amount" is the amount
of multimeric oligonucleotide compound present in the composition
that is needed to provide the desired level of target gene
modulation (e.g., inhibition or activation) in the subject to be
treated to give the anticipated physiological response. The term
"physiologically effective amount" is that amount delivered to a
subject to give the desired palliative or curative effect. The term
"pharmaceutically acceptable carrier" means that the carrier can be
administered to a subject with no significant adverse toxicological
effects to the subject.
[0200] The multimeric oligonucleotide compound molecules of the
invention can be incorporated into pharmaceutical compositions
suitable for administration. Such compositions typically include
one or more species of multimeric oligonucleotide compounds and a
pharmaceutically acceptable carrier. As used herein the language
"pharmaceutically acceptable carrier" is intended to include any
and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like, compatible with pharmaceutical administration. The use of
such media and agents for pharmaceutically active substances is
well known in the art. Except insofar as any conventional media or
agent is incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0201] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, transdermal), oral or parenteral. Parenteral
administration includes intravenous drip, subcutaneous,
intraperitoneal or intramuscular injection, or intrathecal or
intraventricular administration.
[0202] The route and site of administration may be chosen to
enhance targeting. For example, to target muscle cells,
intramuscular injection into the muscles of interest would be a
logical choice. Lung cells might be targeted by administering the
multimeric oligonucleotide compound in aerosol form. The vascular
endothelial cells could be targeted by coating a balloon catheter
with the multimeric oligonucleotide compound and mechanically
introducing the oligonucleotide.
[0203] Topical administration refers to the delivery to a subject
by contacting the formulation directly to a surface of the subject.
The most common form of topical delivery is to the skin, but a
composition disclosed herein can also be directly applied to other
surfaces of the body, e.g., to the eye, a mucous membrane, to
surfaces of a body cavity or to an internal surface. As mentioned
above, the most common topical delivery is to the skin. The term
encompasses several routes of administration including, but not
limited to, topical and transdermal. These modes of administration
typically include penetration of the skin's permeability barrier
and efficient delivery to the target tissue or stratum. Topical
administration can be used as a means to penetrate the epidermis
and dermis and ultimately achieve systemic delivery of the
composition. Topical administration can also be used as a means to
selectively deliver oligonucleotides to the epidermis or dermis of
a subject, or to specific strata thereof, or to an underlying
tissue.
[0204] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0205] Transdermal delivery is a valuable route for the
administration of lipid soluble therapeutics. The dermis is more
permeable than the epidermis and therefore absorption is much more
rapid through abraded, burned or denuded skin. Inflammation and
other physiologic conditions that increase blood flow to the skin
also enhance transdermal adsorption. Absorption via this route may
be enhanced by the use of an oily vehicle (inunction) or through
the use of one or more penetration enhancers. Other effective ways
to deliver a composition disclosed herein via the transdermal route
include hydration of the skin and the use of controlled release
topical patches. The transdermal route provides a potentially
effective means to deliver a composition disclosed herein for
systemic and/or local therapy. In addition, iontophoresis (transfer
of ionic solutes through biological membranes under the influence
of an electric field), phonophoresis or sonophoresis (use of
ultrasound to enhance the absorption of various therapeutic agents
across biological membranes, notably the skin and the cornea), and
optimization of vehicle characteristics relative to dose position
and retention at the site of administration may be useful methods
for enhancing the transport of topically applied compositions
across skin and mucosal sites.
[0206] Both the oral and nasal membranes offer advantages over
other routes of administration. For example, oligonucleotides
administered through these membranes may have a rapid onset of
action, provide therapeutic plasma levels, avoid first pass effect
of hepatic metabolism, and avoid exposure of the oligonucleotides
to the hostile gastrointestinal (GI) environment. Additional
advantages include easy access to the membrane sites so that the
oligonucleotide can be applied, localized and removed easily.
[0207] In oral delivery, compositions can be targeted to a surface
of the oral cavity, e.g., to sublingual mucosa which includes the
membrane of ventral surface of the tongue and the floor of the
mouth or the buccal mucosa which constitutes the lining of the
cheek. The sublingual mucosa is relatively permeable thus giving
rapid absorption and acceptable bioavailability of many agents.
Further, the sublingual mucosa is convenient, acceptable and easily
accessible.
[0208] A pharmaceutical composition of multimeric oligonucleotide
compound may also be administered to the buccal cavity of a human
being by spraying into the cavity, without inhalation, from a
metered dose spray dispenser, a mixed micellar pharmaceutical
formulation as described above and a propellant. In one embodiment,
the dispenser is first shaken prior to spraying the pharmaceutical
formulation and propellant into the buccal cavity.
[0209] Compositions for oral administration include powders or
granules, suspensions or solutions in water, syrups, slurries,
emulsions, elixirs or non-aqueous media, tablets, capsules,
lozenges, or troches. In the case of tablets, carriers that can be
used include lactose, sodium citrate and salts of phosphoric acid.
Various disintegrants such as starch, and lubricating agents such
as magnesium stearate, sodium lauryl sulfate and talc, are commonly
used in tablets. For oral administration in capsule form, useful
diluents are lactose and high molecular weight polyethylene
glycols. When aqueous suspensions are required for oral use, the
nucleic acid compositions can be combined with emulsifying and
suspending agents. If desired, certain sweetening and/or flavoring
agents can be added.
[0210] Parenteral administration includes intravenous drip,
subcutaneous, intraperitoneal or intramuscular injection,
intrathecal or intraventricular administration. In some
embodiments, parental administration involves administration
directly to the site of disease (e.g. injection into a tumor).
[0211] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. Intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir. For intravenous use, the total concentration of
solutes should be controlled to render the preparation
isotonic.
[0212] Any of the multimeric oligonucleotide compounds described
herein can be administered to ocular tissue. For example, the
compositions can be applied to the surface of the eye or nearby
tissue, e.g., the inside of the eyelid. For ocular administration,
ointments or droppable liquids may be delivered by ocular delivery
systems known to the art such as applicators or eye droppers. Such
compositions can include mucomimetics such as hyaluronic acid,
chondroitin sulfate, hydroxypropyl methylcellulose or poly(vinyl
alcohol), preservatives such as sorbic acid, EDTA or benzylchronium
chloride, and the usual quantities of diluents and/or carriers. The
multimeric oligonucleotide compound can also be administered to the
interior of the eye, and can be introduced by a needle or other
delivery device which can introduce it to a selected area or
structure.
[0213] Pulmonary delivery compositions can be delivered by
inhalation by the patient of a dispersion so that the composition,
preferably multimeric oligonucleotide compounds, within the
dispersion can reach the lung where it can be readily absorbed
through the alveolar region directly into blood circulation.
Pulmonary delivery can be effective both for systemic delivery and
for localized delivery to treat diseases of the lungs.
[0214] Pulmonary delivery can be achieved by different approaches,
including the use of nebulized, aerosolized, micellular and dry
powder-based formulations. Delivery can be achieved with liquid
nebulizers, aerosol-based inhalers, and dry powder dispersion
devices. Metered-dose devices are preferred. One of the benefits of
using an atomizer or inhaler is that the potential for
contamination is minimized because the devices are self-contained.
Dry powder dispersion devices, for example, deliver agents that may
be readily formulated as dry powders. A multimeric oligonucleotide
compound may be stably stored as lyophilized or spray-dried powders
by itself or in combination with suitable powder carriers. The
delivery of a composition for inhalation can be mediated by a
dosing timing element which can include a timer, a dose counter,
time measuring device, or a time indicator which when incorporated
into the device enables dose tracking, compliance monitoring,
and/or dose triggering to a patient during administration of the
aerosol medicament.
[0215] The term "powder" means a composition that consists of
finely dispersed solid particles that are free flowing and capable
of being readily dispersed in an inhalation device and subsequently
inhaled by a subject so that the particles reach the lungs to
permit penetration into the alveoli. Thus, the powder is said to be
"respirable." Preferably the average particle size is less than
about 10 .mu.m in diameter preferably with a relatively uniform
spheroidal shape distribution. More preferably the diameter is less
than about 7.5 .mu.m and most preferably less than about 5.0 .mu.m.
Usually the particle size distribution is between about 0.1 .mu.m
and about 5 .mu.m in diameter, particularly about 0.3 .mu.m to
about 5 m.
[0216] The term "dry" means that the composition has a moisture
content below about 10% by weight (% w) water, usually below about
5% w and preferably less it than about 3% w. A dry composition can
be such that the particles are readily dispersible in an inhalation
device to form an aerosol.
[0217] The types of pharmaceutical excipients that are useful as
carrier include stabilizers such as human serum albumin (HSA),
bulking agents such as carbohydrates, amino acids and polypeptides;
pH adjusters or buffers; salts such as sodium chloride; and the
like. These carriers may be in a crystalline or amorphous form or
may be a mixture of the two.
[0218] Suitable pH adjusters or buffers include organic salts
prepared from organic acids and bases, such as sodium citrate,
sodium ascorbate, and the like; sodium citrate is preferred.
Pulmonary administration of a micellar multimeric oligonucleotide
compound formulation may be achieved through metered dose spray
devices with propellants such as tetrafluoroethane,
heptafluoroethane, dimethylfluoropropane, tetrafluoropropane,
butane, isobutane, dimethyl ether and other non-CFC and CFC
propellants.
[0219] Exemplary devices include devices which are introduced into
the vasculature, e.g., devices inserted into the lumen of a
vascular tissue, or which devices themselves form a part of the
vasculature, including stents, catheters, heart valves, and other
vascular devices. These devices, e.g., catheters or stents, can be
placed in the vasculature of the lung, heart, or leg.
[0220] Other devices include non-vascular devices, e.g., devices
implanted in the peritoneum, or in organ or glandular tissue, e.g.,
artificial organs. The device can release a therapeutic substance
in addition to a multimeric oligonucleotide compound, e.g., a
device can release insulin.
[0221] In one embodiment, unit doses or measured doses of a
composition that includes multimeric oligonucleotide compound are
dispensed by an implanted device. The device can include a sensor
that monitors a parameter within a subject. For example, the device
can include pump, e.g., and, optionally, associated
electronics.
[0222] Tissue, e.g., cells or organs can be treated with a
multimeric oligonucleotide compound, ex vivo and then administered
or implanted in a subject. The tissue can be autologous,
allogeneic, or xenogeneic tissue. E.g., tissue can be treated to
reduce graft v. host disease. In other embodiments, the tissue is
allogeneic and the tissue is treated to treat a disorder
characterized by unwanted gene expression in that tissue. E.g.,
tissue, e.g., hematopoietic cells, e.g., bone marrow hematopoietic
cells, can be treated to inhibit unwanted cell proliferation.
Introduction of treated tissue, whether autologous or transplant,
can be combined with other therapies. In some implementations, the
multimeric oligonucleotide compound treated cells are insulated
from other cells, e.g., by a semi-permeable porous barrier that
prevents the cells from leaving the implant, but enables molecules
from the body to reach the cells and molecules produced by the
cells to enter the body. In one embodiment, the porous barrier is
formed from alginate.
[0223] In one embodiment, a contraceptive device is coated with or
contains a multimeric oligonucleotide compound. Exemplary devices
include condoms, diaphragms, IUD (implantable uterine devices,
sponges, vaginal sheaths, and birth control devices.
[0224] G. Dosage
[0225] In one aspect, the invention features a method of
administering a multimeric oligonucleotide compound to a subject
(e.g., a human subject). In one embodiment, the unit dose is
between about 10 mg and 25 mg per kg of bodyweight. In one
embodiment, the unit dose is between about 1 mg and 100 mg per kg
of bodyweight. In one embodiment, the unit dose is between about
0.1 mg and 500 mg per kg of bodyweight. In some embodiments, the
unit dose is more than 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 2, 5,
10, 25, 50 or 100 mg per kg of bodyweight.
[0226] The defined amount can be an amount effective to treat or
prevent a disease or disorder, e.g., a disease or disorder
associated with a particular target gene. The unit dose, for
example, can be administered by injection (e.g., intravenous or
intramuscular), an inhaled dose, or a topical application.
[0227] In some embodiments, the unit dose is administered daily. In
some embodiments, less frequently than once a day, e.g., less than
every 2, 4, 8 or 30 days. In another embodiment, the unit dose is
not administered with a frequency (e.g., not a regular frequency).
For example, the unit dose may be administered a single time. In
some embodiments, the unit dose is administered more than once a
day, e.g., once an hour, two hours, four hours, eight hours, twelve
hours, etc.
[0228] In one embodiment, a subject is administered an initial dose
and one or more maintenance doses of a multimeric oligonucleotide
compound. The maintenance dose or doses are generally lower than
the initial dose, e.g., one-half less of the initial dose. A
maintenance regimen can include treating the subject with a dose or
doses ranging from 0.0001 to 100 mg/kg of body weight per day,
e.g., 100, 10, 1, 0.1, 0.01, 0.001, or 0.0001 mg per kg of
bodyweight per day. The maintenance doses may be administered no
more than once every 1, 5, 10, or 30 days. Further, the treatment
regimen may last for a period of time which will vary depending
upon the nature of the particular disease, its severity and the
overall condition of the patient. In some embodiments the dosage
may be delivered no more than once per day, e.g., no more than once
per 24, 36, 48, or more hours, e.g., no more than once for every 5
or 8 days. Following treatment, the patient can be monitored for
changes in his condition and for alleviation of the symptoms of the
disease state. The dosage of the oligonucleotide may either be
increased in the event the patient does not respond significantly
to current dosage levels, or the dose may be decreased if an
alleviation of the symptoms of the disease state is observed, if
the disease state has been ablated, or if undesired side-effects
are observed.
[0229] The effective dose can be administered in a single dose or
in two or more doses, as desired or considered appropriate under
the specific circumstances. If desired to facilitate repeated or
frequent infusions, implantation of a delivery device, e.g., a
pump, semi-permanent stent (e.g., intravenous, intraperitoneal,
intracisternal or intracapsular), or reservoir may be
advisable.
[0230] Following successful treatment, it may be desirable to have
the patient undergo maintenance therapy to prevent the recurrence
of the disease state, wherein the compound of the invention is
administered in maintenance doses, ranging from 0.0001 mg to 100 mg
per kg of body weight.
[0231] The concentration of the multimeric oligonucleotide compound
is an amount sufficient to be effective in treating or preventing a
disorder or to regulate a physiological condition in humans. The
concentration or amount of multimeric oligonucleotide compound
administered will depend on the parameters determined for the agent
and the method of administration, e.g. nasal, buccal, pulmonary.
For example, nasal formulations may tend to require much lower
concentrations of some ingredients in order to avoid irritation or
burning of the nasal passages. It is sometimes desirable to dilute
an oral formulation up to 10-100 times in order to provide a
suitable nasal formulation.
[0232] Certain factors may influence the dosage required to
effectively treat a subject, including but not limited to the
severity of the disease or disorder, previous treatments, the
general health and/or age of the subject, and other diseases
present. Moreover, treatment of a subject with a therapeutically
effective amount of a multimeric oligonucleotide compound can
include a single treatment or, preferably, can include a series of
treatments. It will also be appreciated that the effective dosage
of a multimeric oligonucleotide compound used for treatment may
increase or decrease over the course of a particular treatment. For
example, the subject can be monitored after administering a
multimeric oligonucleotide compound. Based on information from the
monitoring, an additional amount of the multimeric oligonucleotide
compound can be administered.
[0233] Dosing is dependent on severity and responsiveness of the
disease condition to be treated, with the course of treatment
lasting from several days to several months, or until a cure is
effected or a diminution of disease state is achieved. Optimal
dosing schedules can be calculated from measurements of target gene
expression levels in the body of the patient. Persons of ordinary
skill can easily determine optimum dosages, dosing methodologies
and repetition rates. Optimum dosages may vary depending on the
relative potency of individual compounds, and can generally be
estimated based on EC50s found to be effective in in vitro and in
vivo animal models. In some embodiments, the animal models include
transgenic animals that express a human target gene. In another
embodiment, the composition for testing includes a multimeric
oligonucleotide compound that is complementary, at least in an
internal region, to a sequence that is conserved between target
gene in the animal model and the target gene in a human.
[0234] In one embodiment, the administration of the multimeric
oligonucleotide compound is parenteral, e.g. intravenous (e.g., as
a bolus or as a diffusible infusion), intradermal, intraperitoneal,
intramuscular, intrathecal, intraventricular, intracranial,
subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal,
oral, vaginal, topical, pulmonary, intranasal, urethral or ocular.
Administration can be provided by the subject or by another person,
e.g., a health care provider. The composition can be provided in
measured doses or in a dispenser which delivers a metered dose.
Selected modes of delivery are discussed in more detail below.
[0235] H. Kits
[0236] In certain aspects of the invention, kits are provided,
comprising a container housing a composition comprising a
multimeric oligonucleotide compound. In some embodiments, the
composition is a pharmaceutical composition comprising a multimeric
oligonucleotide compound and a pharmaceutically acceptable carrier.
In some embodiments, the individual components of the
pharmaceutical composition may be provided in one container.
Alternatively, it may be desirable to provide the components of the
pharmaceutical composition separately in two or more containers,
e.g., one container for multimeric oligonucleotide compounds, and
at least another for a carrier compound. The kit may be packaged in
a number of different configurations such as one or more containers
in a single box. The different components can be combined, e.g.,
according to instructions provided with the kit. The components can
be combined according to a method described herein, e.g., to
prepare and administer a pharmaceutical composition. The kit can
also include a delivery device.
[0237] The following examples provide illustrative embodiments of
the invention. One of ordinary skill in the art will recognize the
numerous modifications and variations that may be performed without
altering the spirit or scope of the present invention. Such
modifications and variations are encompassed within the scope of
the invention. The Examples do not in any way limit the
invention.
EXAMPLES
Example 1
Design of Antisense Oligonucleotides
[0238] Antisense oligonucleotides against ApoC3, ApoB, Hif-1alpha,
survivin and B2M were either selected using a series of
bioinformatics filters and computational design algorithms or were
derived from the literature. They were selected to be 13, 14 or
more nucleotides in length and tested using one or multiple
chemical modification design patterns (for example,
3LNAs-8DNAs-3LNAs). The list of all targeting oligonucleotide
sequences is given in Table 1 and specific chemical modification
patterns are explicitly specified when data is presented. Factors
taken into account during the design include species homology,
alignment to multiple human transcripts, off-target matches, SNPs,
exon-exon boundaries, coverage of the transcript, and statistical
models of efficacy and polyA regions. For species homology human,
rat, mouse and macaque sequences were considered. For off-target
matches, putative sequences were searched against the human
transcriptome and perfect matches were identified along with
compounds that had only 1 or 2 mismatches. Preference was given to
compounds with no perfect off-target matches, but compounds were
selected with 1 or 2 mismatches if the compound met many of the
other criteria. Statistical classification models were derived from
existing in-house projects for other targeting oligonucleotide
projects. These models were applied to the potential ASOs and
preference given to those classified as active. Known SNPs,
exon-exon boundaries and polyA regions were also avoided in the
design when possible. Other ASO design features are also well known
in the art, such as avoidance of immune stimulatory sequences such
as CpG motifs, avoidance of poly G regions, and avoidance of toxic
sequences such as certain poly-pyrimidine motifs.
[0239] FIGS. 1A and 1B show schematic representation of exemplary
dimeric/multimeric constructs. Specifically, in FIG. 1A, two 14-mer
gapmers (e.g., 3LNA-8DNA-3LNA) are connected via a cleavable
linker, which can be cleaved by enzymes, such as nucleases,
peptidases or by reduction or oxidation. It could also be a linker
which is cleaved by a pH shift within the cells (e.g. acidic pH in
endosomes). The two antisense gapmers can be identical
(homo-dimer), which leads to suppression of a single target mRNA1.
However, the two antisense gapmers can also have different
sequences (hetero-dimer) which are complementary to two or more
different targets and which will lead to inhibition of two targets
(mRNA1 and mRNA2) or trimers or tetramers, etc., specific to 3, 4,
or more different targets.
Example 2
Synthesis of Antisense Oligonucleotides
(A) General Procedure for Oligomer Synthesis
[0240] All oligonucleotides were synthesized using standard
phosphoramidite protocols (Beaucage, S. L.; Caruthers, M. H.
"Deoxynucleoside phosphoramidites--A new class of key intermediates
for deoxypolynucleotide synthesis". Tetrahedron Lett., 1981,
22:1859) on a MerMade 192 oligonucleotide synthesizer
(BioAutomation) or Oligopilot 10 synthesizer (GE) at 200 to 1000
nmole scales employing standard CPG supports (BioSearch) or Glen
UnySupport (Glen Research). The DNA, 2'-OMe, 2'-F, and G-clamp
monomers were obtained from ChemGenes Corporation or Glen Research,
and the LNA monomers were obtained from other commercially
available sources. All phosphoramidites other than DNA were coupled
with extended coupling times (e.g. 8 to 15 min for RNA, LNA,
2'-O-Methyl, 2'-Fluoro, 5-Propynyl and G-Clamps). After the
synthesis, the oligonucleotides were cleaved from the support and
deprotected using AMA (a 50:50 mixture of ammonium hydroxide and
aqueous methylamine) at 65.degree. C. for one hour or using aqueous
ammonium hydroxide at 55.degree. C. for 8 hours. The crude DMTr-on
oligonucleotides were purified via DMTr-selective cartridge
purification techniques and if necessary further purified via RP
HPLC and desalted via cartridge-based methods. Alternatively, they
were purified using ion exchange chromatography. The final
oligonucleotides were characterized using LC-MS.
[0241] A C Technologies Solo VP Slope (Bridgewater, N.J.) reader
equipped with "Quick Slope" software was used to determine the
concentration of oligonucleotides. Fifty .mu.l of sample was
required for the measurement in a micro quartz vessel. The
instrument measured the change in absorbance at varying path
lengths, utilizing Beer's Law to determine final concentrations.
Extinction coefficients were calculated using the nearest neighbor
model.
(B) Synthesis of Linear Dimers and Trimers
[0242] The synthesis of linear dimers and trimers was completed by
linear addition of all monomers until the full length sequence was
obtained on solid support. First, ASO 1 was completely synthesized
followed by addition of the cleavable or noncleavable linker X
(e.g., tri-thymidyl, tetra-thymidyl, tetra-uridyl, disulfide, etc.)
and finally either ASO 1 ("homo"-dimer) or an ASO with another
sequence ASO 2 ("hetero"-dimer) and optionally directed against
another target mRNA was added. The ASO synthesized first is
connected to the linker X via its 5'-end whereas the finally
synthesized ASO is connected via 3'. This might lead to 3'- and
5'-modified metabolites after cleavage. Due to its linearity, a
trimer, tetramer, or other multimer could be synthesized by adding
a second, third, or more cleavable linker(s) followed by another
ASO (1, 2 or 3).
##STR00025##
[0243] As illustrated above, for example, SEQ ID NO:2 (ApoC3-ApoC3
homodimer ASO) contains ASO1
(lnaAs;lnaAs;lnaGs;dCs;dAs;dAs;dCs;dCs;dTs;dAs;dCs;lnaAs;lnaGs;lnaG-Sup
(SEQ ID NO: 1)), with X being dT-dT-dT (tri-thymidyl) and "*" is a
phosphorothioate linkage.
[0244] A general example for a linear trimer is given below:
##STR00026##
(C) Synthesis of 3'3'-Branched Dimers (Doubler Dimers)
[0245] For symmetric dimers, synthesis was performed using a
triethylene glycol (teg) derivatized solid support and a symmetric
doubler (brancher) phosphoramidite from Glen Research (catalog
number 10-1920) illustrated below
##STR00027##
[0246] After coupling of the brancher phosphoramidite (catalog No.
10-1920) to the triethylene glycol bound to the solid phase, the
DMT protecting groups were removed with acid and coupling of linker
X and ASO 1 was performed in parallel as illustrated in FIG. 1C.
For SEQ ID NO:4
((lnaAs;lnaAs;lnaGs;dCs;dAs;dAs;dCs;dCs;dTs;dAs;dCs;lnaAs;lnaGs;naG;dT;dT-
;dT;dT)2;2xS LBs;triEG-Sup),
linker X is dT-dT-dT-dT, Y is Oxygen, and "2xSLBs;triEG" stands for
the following substructure:
##STR00028##
[0247] For the synthesis of two identical strands in parallel a
double-coupling step was performed on the oligonucleotide
synthesizer to yield maximum coupling efficiency on both
strands.
[0248] With an asymmetric doubler phosphoramidite (Glen Research,
catalog number 10-1921) the synthesis of "hetero"-dimers is
possible. Thus, ASO 1 is connected first to the doubler and ASO 2
is connected second.
##STR00029##
[0249] The symmetrical doubler or branching strategy was also
performed with glycerol like CPG solid support from Chemgenes
(N-5216-05 and N-7170-05). Symmetrical branching doubler N-5216-05
is shown in Formula VI.
##STR00030##
[0250] The asymmetrical branching doubler N-7170-05 is shown in
Formula VII.
##STR00031##
[0251] Oligonucleotide dimers synthesized with this doubler
(brancher) have the following structure:
##STR00032##
(D) Synthesis of Branched Trimers
[0252] For the synthesis of trimers with two different ASO
molecules, the first ASO1 is synthesized by linear addition of all
monomers until the full length sequence of ASO1 was obtained on
solid support. Then, the cleavable (or noncleavable) linker X
(tetrathymidyl, tetrauridyl, disulfide etc.) is synthesized
followed by addition of the doubler using a symmetric doubler
phosphoramidite (Glen Research, 10-1920) the solid phase synthesis
of the linker X and ASO 1 was performed in parallel as indicated in
the figure below.
[0253] After removal of the DMT protecting groups of the symmetric
doubler, two ASO2 molecules are synthesized simultaneously from 3'
to 5' direction using standard phosphoramidite chemistry. This
results in a trimer consisting of two ASO2 molecules having two
free 5'-ends and one ASO1 molecule having one free 3'-end of the
structure shown in FIG. 1D.
[0254] For the synthesis of branched trimers consisting of three
different ASO1, ASO2 and ASO3 molecules, the non-symmetric brancher
phosphoramidite is coupled after first synthesis of ASO1, followed
by sequential synthesis of ASO2 and ASO3. The non-symmetrical
phosphoramidite structure is shown in Formula IX. The resulting
trimer has the structure show in FIG. 1D.
##STR00033##
[0255] It is also possible to use a "trebler" phosphoramidite (Glen
Research, 10-1922) shown in Formula X which results in symmetrical
homo trimers.
##STR00034##
(E) Sequences of Synthesized Oligonucleotides and Characterization
by Mass Spectrometry
[0256] All compounds were purified by IEX HPLC or IP-RP HPLC and
characterized using LC-MS methods. The following listing in Table 1
provides specific sequences and modification patterns with the
corresponding SEQ ID NOs on the left followed by a detailed
description.
TABLE-US-00001 TABLE 1 Reference Sequence Seq Description ID Gene
Name 1 103966 lnaAs; lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs;
dAs; dCs; lnaAs; lnaGs; lnaG-Sup 3LNA-8DNA-3LNA gapmer (monomeric),
fully phosphorothioated ApoC3 2 105360 lnaAs; lnaAs; lnaGs; dCs;
dAs; dAs; dCs; dCs; dTs; dAs; dCs; lnaAs; lnaGs; lnaG; dT; dT; dT;
lnaAs; lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs; dAs; dCs; lnaAs;
lnaGs; lnaG-Sup linear homodimer from SEQ ID NO: 1 with 3 nt
phosphodiester linker ApoC3 3 105361 lnaAs; lnaAs; lnaGs; dCs; dAs;
dAs; dCs; dCs; dTs; dAs; dCs; lnaAs; lnaGs; lnaGs; triEGs; dsC6s;
triEGs; lnaAs; lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs; dAs;
dCs; lnaAs; lnaG s; lnaG-Sup linear homodimer from SEQ ID NO: 1
with disulfide linker ApoC3 4 105362 (lnaAs; lnaAs; lnaGs; dCs;
dAs; dAs; dCs; dCs; dTs; dAs; dCs; lnaAs; lnaGs; lnaG; dT; dT; dT;
dT)2; 2xSLBs; triEG-Sup 3'3'-branched homodimer from SEQ ID NO: 1
with 2 .times. 4 nt phosphodiester linker ApoC3 5 105363 (lnaAs;
lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs; dAs; dCs; lnaAs; lnaGs;
lnaGs; triEGs; dsC6s)2; 2xSLBs; triEG-Sup 3'3'-branched homodimer
from SEQ ID NO: 1 with disulfide linker ApoC3 6 105395 lnaAs;
lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs; dTs; dCs; lnaAs; lnaGs;
lnaG; dT; dT; dT; lnaAs; lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs;
dTs; dTs; dCs; lnaAs; lnaGs; lnaG-Sup mouse ortholog of SEQ ID NO:
2 ApoC3 7 105513 lnaAs; lnaAs; lnaGs; dCs; dAs; dAs; dCs; dCs; dTs;
dTs; dCs; lnaAs; lnaGs; lnaG; dT; dT; dT; lnaGs; lna5mCs; dAs; dTs;
dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
heterodimer (from SEQ ID NOs: 13/14) with 3 nt
phosphodiester-linker ApoB/ApoC3 (mouse) 8 105514 lnaGs; lna5mCs;
dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA; dT;
dT; dT; lnaTs; lna5mCs; lna5mCs; dTs; dCs; dGs; dGs; dCs; dCs; dTs;
lna5mCs; lnaTs; lnaG-Sup linear heterodimer (from SEQ ID NOs:
13/10) with 3 nt phosphodiester-linker ApoB/ApoC3 9 104109 lna5mCs;
lna5mCs; lnaTs; dCs; dTs; dTs; dCs; dGs; dGs; dCs; dCs; lna5mCs;
lnaTs; lnaG-Sup 3LNA-8DNA-3LNA gapmer (monomeric), fully
phosphorothioated ApoB 10 104111 lnaTs; lna5mCs; lna5mCs; dTs; dCs;
dGs; dGs; dCs; dCs; dTs; lna5mCs; lnaTs; lnaG-Sup 3LNA-7DNA-3LNA
gapmer (monomeric), fully phosphorothioated ApoC3 11 104112 lnaTs;
lna5mCs; lnaTs; dTs; dCs; dGs; dGs; dCs; dCs; dCs; lnaTs; lnaG-Sup
3LNA-7DNA-2LNA gapmer (monomeric), fully phosphorothioated ApoB 12
105576 lnaTs; lna5mCs; lnaTs; dTs; d5mCs; dGs; dGs; dCs; dCs; dCs;
lnaTs; lnaG-Sup 5-methyl-dC (dZ) analog of SEQ ID NO: 11 ApoB 13
102102 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaA-Sup 2LNA-8DNA-3LNA gapmer (monomeric), fully
phosphorothioated ApoB 14 105515 lnaAs; lnaAs; lnaGs; dCs; dAs;
dAs; dCs; dCs; dTs; dTs; dCs; lnaAs; lnaGs; lnaG-Sup mouse ortholog
of SEQ ID NO: 1 ApoC3 15 106200 lnaGs; lna5mCs; dAs; dCs; dTs; dGs;
dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaT; dT; dT; dT; dT; lnaGs;
lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs;
lnaT-Sup linear homodimer from SEQ ID NO: 30 with 4 nt
phosphodiester DNA linker ApoC3 16 106201 lnaGs; lna5mCs; dAs; dCs;
dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaTs; dTs; dTs;
dTs; dTs; lnaGs; lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs;
dTs; dAs; lna5m Cs; lnaT-Sup linear homodimer from SEQ ID NO: 30
with 4 nt phosphorothioate DNA linker ApoC3 17 106202 (lnaGs;
lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs;
lnaT; dT; dT; dT-Sup dT-)2; 2xSLBs; triEG 3'3'-branched homodimer
from SEQ ID NO: 30, 2 .times. 4 nt phosphodiester DNA linker 18
106203 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaA; dT; dT; dT; dT; lnaGs; lna5mCs; dAs; dTs;
dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
homodimer from SEQ ID NO: 13 with phosphodiester DNA linker ApoB 19
106204 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaAs; dTs; dTs; dTs; dTs; lnaGs; lna5mCs; dAs;
dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
homodimer from SEQ ID NO: 13 with phosphorothioate DNA linker ApoB
20 106205 (lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaA; dT; dT; dT; dT)2; 2xSLBs; triEG-Sup
3'3'-branched homodimer from SEQ ID NO: 13, phosphodiester DNA
linker ApoB 21 106206 lnaGs; lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs;
dAs; dAs; dTs; dAs; lna5mCs; lnaT; dT; dT; dT; dT; lnaGs; lna5mCs;
dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup
linear heterodimer from SEQ ID NO: 30/13 with phosphodiester DNA
linker ApoC3/ApoB 22 106207 lnaGs; lna5mCs; dAs; dTs; dTs; dGs;
dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA; dT; dT; dT; dT; lnaGs;
lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs;
lnaT-Sup linear heterodimer from SEQ ID NO: 13/30 with
phosphodiester DNA linker ApoB/ApoC3 23 106413 lnaGs; lnaGs; dCs;
dAs; dAs; dGs; dCs; dAs; dTs; dCs; lna5mCs; lnaTs; lnaG; dT; dT;
dT; dT; lna5mCs; lnaAs; dAs; dTs; dCs; dCs; dAs; dTs; dGs; dGs;
lna5mCs; lnaAs; lnaG-Sup linear heterodimer from SEQ ID NO: 27/28
with phosphodiester DNA linker HIF-1 alpha/survivin 24 106414
lnaGs; lnaGs; dCs; dAs; dAs; dGs; dCs; dAs; dTs; dCs; lna5mCs;
lnaTs; lnaG; dT; dT; dT; dT; lnaGs; lna5mCs; lnaGs; dTs; dGs; dCs;
dAs; dTs; dAs; dAs; dAs; lnaTs; lnaTs; lnaG-Sup linear heterodimer
from SEQ ID NO: 27/29 with phosphodiester DNA linker HIF-1
alpha/B2M 25 106415 lnaGs; lnaGs; dCs; dAs; dAs; dGs; dCs; dAs;
dTs; dCs; lna5mCs; lnaTs; lnaG; dT; dT; dT; dT; lnaGs; lna5mCs;
dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup
linear heterodimer from SEQ ID NO: 27/13 with phosphodiester DNA
linker HIF-1 alpha/ApoB 26 106416 lnaGs; lna5mCs; dAs; dTs; dTs;
dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA; dT; dT; dT; dT;
lnaGs; lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs;
lna5mCs; lnaT; dT; dT; dT; dT; lnaGs; lnaGs; dCs; dAs; dAs; dGs;
dCs; dAs; dTs; dCs; lna5mCs; lnaTs; lnaG-Sup linear heterotrimer
from SEQ ID NO: 13/30/27 with two phosphodiester DNA linkers
ApoB/ApoC3/HIF-1alpha 27 101443 lnaGs; lnaGs; dCs; dAs; dAs; dGs;
dCs; dAs; dTs; dCs; lna5mCs; lnaTs; lnaG-Sup 2LNA-8DNA-3LNA gapmer
(monomeric), fully phosphorothioated HIF-1 alpha 28 101441 lna5mCs;
lnaAs; dAs; dTs; dCs; dCs; dAs; dTs; dGs; dGs; lna5mCs; lnaAs;
lnaG-Sup 2LNA-8DNA-3LNA gapmer (monomeric), fully phosphorothioated
Survivin 29 105758 lnaGs; lna5mCs; lnaGs; dTs; dGs; dCs; dAs; dTs;
dAs; dAs; dAs; lnaTs; lnaTs; lnaG-Sup 3LNA-8DNA-3LNA gapmer
(monomeric), fully phosphorothioated B2M 30 104975 lnaGs; lna5mCs;
dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaT-Sup
2LNA-10DNA-2LNA gapmer (monomeric), fully phosphorothioated ApoC3
31 102103 lna5mCs; lnaGs; dTs; dCs; dTs; dAs; dTs; dGs; dTs; dAs;
lnaTs; lnaAs; lnaG-Sup 2LNA-8DNA-3LNA gapmer (monomeric), fully
phosphorothioated ApoB negative control (mismatched) 32 104882
omeUs; omeUs; dGCls; dAs; dGs; dTs; dGs; dTs; dGs; dAs; dTs; omeGs;
omeAs; dGCl-Sup 2me-9DNA-2me gapmer with 2 G-clamps (APC), fully
phosphorothioated (monomeric), ApoC3 33 106417 lna5mCs; lna5mCs;
omeAs; dGs; dTs; dAs; dGs; dTs; dCs; dTs; dTs; omeUs; lna5mCs;
lnaA; dT; dT; dT; dT; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs;
dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear heterodimer from SEQ ID
NO: 55/13 with phosphodiester DNA linker ApoC3/ApoB 34 106418
lna5mCs; lna5mCs; omeAs; dGs; dTs; dAs; dGs; dTs; dCs; dTs; dTs;
omeUs; omeCs; omeA; dT; dT; dT; dT;; lnaGs; lna5mCs; dAs; dTs; dTs;
dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
heterodimer from SEQ ID NO: 56/13 with phosphodiester
DNA linker ApoC3/ApoB 35 106419 lna5mCs; lna5mCs; fluAs; dGs; dTs;
dAs; dGs; dTs; dCs; dTs; dTs; fluUs; fluCs; fluA; dT; dT; dT; dT;;
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear heterodimer from SEQ ID NO: 57/13 with
phosphodiester DNA linker ApoC3/ApoB 36 106420 lnaGs; lnaGs; lnaAs;
lnaAs; dCs; dTs; dGs; dAs; dAs; dGs; dCs; dCs; dAs; dT; dT; dT; dT;
dT;; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear heterodimer from SEQ ID NO: 58/13 with
phosphodiester DNA linker, (5' nucleotide can also be substitute
with a G) ApoC3/ApoB 37 106206 lnaGs; lna5mCs; dAs; dCs; dTs; dGs;
dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaT; dT; dT; dT; dT; lnaGs;
lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs;
lnaA-Sup linear heterodimer from SEQ ID NO: 30/13 with
phosphodiester DNA linker, (5' nucleotide can also be substitute
with a G) ApoC3/ApoB 38 106421 omeUs; omeUs; dGC1s; dAs; dGs; dTs;
dGs; dTs; dGs; dAs; dTs; omeGs; omeAs; dGCl; dT; dT; dT; dT; lnaGs;
lna5mCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs;
lnaT-Sup linear heterodimer from SEQ ID NO: 32/13 with
phosphodiester DNA linker ApoC3/ApoB 39 106422 lnaAs; lnaAs; lnaGs;
dCs; dAs; dAs; dCs; dCs; dTs; dAs; dCs; lnaAs; lnaGs; lnaG; dT; dT;
dT; dT; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaA-Sup linear heterodimer from SEQ ID NO: 1/13
with phosphodiester DNA linker ApoC3/ApoB 40 106423 (lnaGs; lnaGs;
lnaAs; lnaAs; dCs; dTs; dGs; dAs; dAs; dGs; dCs; dCs; dAs; dT; dT;
dT; dT; dT)2; 2xSLBs; triEG-Sup 3'3'-branched homodimer from SEQ ID
NO: 58, phosphodiester DNA linker ApoC3 41 106424 lnaGs; lna5mCs;
dAs; 5prydCs; dTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs;
lnaT; dT; dT; dT; dT; lnaGs; lna5mCs; dAs; 5prydCs; dTs; dGs; dAs;
dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaT-Sup linear homodimer with
5-propynyl-dC with phosphodiester DNA linker ApoC3 42 106425 lnaGs;
lna5mCs; dAs; 5prydCs; 5prydTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs;
lna5mCs; lnaT; dT; dT; dT; dT; lnaGs; lna5mCs; dAs; 5prydCs;
5prydTs; dGs; dAs; dGs; dAs; dAs; dTs; dAs; lna5mCs; lnaT-Sup
linear homodimer with 5-propynyl-dC/dU and with phosphodiester DNA
linker ApoC3 43 106426 lnaGs; lna5mCs; dAs; 5prydCs; 5prydTs; dGs;
dAs; dGs; dAs; dAs; 5prydTs; dAs; lna5mCs; lnaT; dT; dT; dT; dT;
lnaGs; lna5mCs; dAs; 5prydCs; 5prydTs; dGs; dAs; dGs; dAs; dAs;
SprydTs; dAs; lna5mCs; lnaT-Sup linear homodimer with
5-propynyl-dC/dU and with phosphodiester DNA linker ApoC3 44 106234
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA; dT; dT; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs;
dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear homodimer of SEQ ID
NO: 13 with 3 phosphodiester linkages in the 2 nt DNA linker ApoB
45 106235 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaA; dT; dT; dT; lnaGs; lna5mCs; dAs; dTs; dTs;
dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear homodimer
of SEQ ID NO: 13 with 4 phosphodiester linkages in the 3 nt DNA
linker ApoB 46 106236 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs;
dAs; dTs; lnaTs; lna5mCs; lnaA; dT; dT; dT; dT; lnaGs; lna5mCs;
dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup
linear homodimer of SEQ ID NO: 13 with 5 phosphodiester linkages in
the 4 nt DNA linker ApoB 47 106237 lnaGs; lna5mCs; dAs; dTs; dTs;
dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA; dT; dT; dT; dT; dT;
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear homodimer of SEQ ID NO: 13 with 6
phosphodiester linkages in the 5 nt DNA linker ApoB 48 106238
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA; dT; dT; dT; dT; dT; dT; lnaGs; lna5mCs; dAs; dTs;
dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
homodimer of SEQ ID NO: 13 with 7 phosphodiester linkages in the 6
nt DNA linker ApoB 49 106239 lnaGs; lna5mCs; dAs; dTs; dTs; dGs;
dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA; dT; dT; dT; dT; dT; dT;
dT; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear homodimer of SEQ ID NO: 13 with 8
phosphodiester linkages in the 7 nt DNA linker ApoB 50 106241
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaAs; dTs; dT; dT; dT; dT; dTs; dTs; lnaGs; lna5mCs; dAs;
dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
homodimer of SEQ ID NO: 13 with 4 phosphodiester/4 phosphorothioate
linkages in the 7 nt DNA linker ApoB 51 106242 lnaGs; lna5mCs; dAs;
dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaAs; rUs;
lnaGs; lna5mCs; dAs; dTs; dTs;dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear homodimer of SEQ ID NO: 13 with 2
phosphorothioate linkages in the 1 nt RNA linker ApoB 52 106243
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaAs; rUs; rUs; lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs;
dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear homodimer of SEQ ID
NO: 13 with 3 phosphorothioate linkages in the 2 nt RNA linker ApoB
53 106244 lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs;
lnaTs; lna5mCs; lnaAs; rUs; rUs; rUs; lnaGs; lna5mCs; dAs; dTs;
dTs; dGs; dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaA-Sup linear
homodimer of SEQ ID NO: 13 with 4 phosphorothioate linkages in the
3 nt RNA linker ApoB 54 106245 lnaGs; lna5mCs; dAs; dTs; dTs; dGs;
dGs; dTs; dAs; dTs; lnaTs; lna5mCs; lnaAs; rUs; rUs; rUs; rUs;
lnaGs; lna5mCs; dAs; dTs; dTs; dGs; dGs; dTs; dAs; dTs; lnaTs;
lna5mCs; lnaA-Sup linear homodimer of SEQ ID NO: 13 with 5
phosphorothioate linkages in the 4 nt RNA linker ApoB 55 105448
lna5mCs; lna5mCs; omeAs; dGs; dTs; dAs; dGs; dTs; dCs; dTs; dTs;
omeUs; lna5mCs; lnaA-Sup 2LNA-lme-8DNA-lme-2LNA gapmer (monomeric),
fully phosphorothioated ApoC3 56 105382 lna5mCs; lna5mCs; omeAs;
dGs; dTs; dAs; dGs; dTs; dCs; dTs; dTs; omeUs; omeCs; omeA-Sup
2LNA-lme-8DNA-3me gapmer (monomeric), fully phosphorothioated ApoC3
57 105390 lna5mCs; lna5mCs; fluAs; dGs; dTs; dAs; dGs; dTs; dCs;
dTs; dTs; fluUs; fluCs; fluA-Sup 2LNA- 1fluoro-8DNA-3fluoro gapmer
(monomeric), fully phosphorothioated ApoC3 58 105704 lnaGs; lnaGs;
lnaAs; lnaAs; dCs; dTs; dGs; dAs; dAs; dGs; dCs; dCs; dAs; dT-Sup
4LNA-10DNA antisense (monomeric), fully phosphorothioated ApoC3 139
192045 lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs;
dTs; lnaCs; lnaCs; lnaA; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup
MIR122-01 dimer with a 4 dT PO linker MIR122 140 192046 lnaCs;
lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs;
lnaCs; lnaA; dT; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs;
dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup MIR122-01
dimer with a 5 dT PO linker MIR122 141 192047 lnaCs; lnaAs; lnaTs;
dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA;
dT; dT; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs;
dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup MIR122-01 dimer
with a 6 dT PO linker MIR122 142 192048 lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaAs; dTs;
dTs; dTs; dTs; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs;
dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup MIR122-01 dimer with a 4 dT
PS linker MIR122 143 192049 lnaAs; lnaCs; lnaTs; dTs; dAs; dCs;
dTs; dAs; dCs; dCs; dTs; dAs; lnaGs; lnaCs; lnaC-Sup Universal
Negative Controls (unc); no exact sequence matches in human and
mouse RefSeq NA 144 192050 lnaAs; lnaCs; lnaTs; dTs; dAs; dCs; dTs;
dAs; dCs; dCs; dTs; dAs; lnaGs; lnaCs; lnaC; dT; dT; dT; dT; lnaAs;
lnaCs; lnaTs; dTs; dAs; dCs; dTs; dAs; dCs; dCs; dTs; dAs; lnaGs;
lnaCs; lnaC-Sup unc-01 dimer with a 4 dT PO linker; unc = Universal
Negative Controls; no exact sequence matches in human and mouse
RefSeq NA 145 192051 lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs;
dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Starting MIR122-01 m08
gapmer MIR122 146 192052
lnaCs; lnaTs; lnaAs; dGs; dTs; dTs; dCs; dAs; dCs; dTs; dGs; dAs;
lnaAs; lnaTs; lnaG-Sup Starting MALAT1-01 m08 gapmer MALAT1 147
192053 DTSSP; (aminoC6- dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA)2-Sup
Two identical MIR122-01 m08 oligos attached to a 4 dT PO 5' linker
and coupled through the DTSSP disulfide linker MIR122 148 192054
(lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs;
lnaCs; lnaCs; lnaA; dT; dT; dT; aminoC6-dT)2; DTSSP Two identical
MIR122-01 m08 oligos attached to a 4 dT PO 3' linker and coupled
through the DTSSP disulfide linker MIR122 149 192055 (lnaCs; lnaAs;
lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs;
lnaA; dT; dT; dT; dT)2; 2xSLB; triEG-Sup Two identical MIR122-01
m08 oligos attached to a 4 dT PO 3' linker and coupled through a
Symetrical Doubler B and a triEG-CPG MIR122 150 192056 lnaCs;
lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs;
lnaCs; lnaA; dT; dT; dT; dT; triEG; dT; dT; dT; dT; lnaCs; lnaAs;
lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs;
lnaA-Sup Two identical MIR122-01 m08 oligos attached to a 4 dT PO
3' and 5' linker (respectively) and coupled through an internal
Triethylene glycol (triEG) MIR122 151 192057 lnaCs; lnaAs; lnaTs;
dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA;
dT; dT; dT; dT; tegCHOL; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Two
identical MIR122-01 m08 oligos attached to a 4 dT PO 3' and 5'
linker (respectively) and coupled through an internal Tetraethylene
glycol (TEG) cholesterol MIR122 152 192058 lnaCs; lnaAs; lnaTs;
dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA;
dT; dT; dT; dT; tegTOCO; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Two
identical MIR122-01 m08 oligos attached to a 4 dT PO 3' and 5'
linker (respectively) and coupled through an internal Tetraethylene
glycol (TEG) tocopherol (Vitamin E) MIR122 153 192059 lnaCs; lnaAs;
lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs;
lnaA; dT; dT; dT; dT; dB; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Two
identical MIR122-01 m08 oligos attached to a 4 dT PO 3' and 5'
linker (respectively) and coupled through a deoxy abasic residue
(dB) MIR122 154 192060 (lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs;
dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT; dT; dT)2;
2xSLBs; tegCHOLs; triEG-Sup Two identical MIR122-01 m08 oligos
attached to a 4 dT PO 3' linker and coupled through a Symetrical
Doubler B, a TEG-cholesterol, and a triEG-CPG MIR122 155 192061
(lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs;
lnaCs; lnaCs; lnaAs; triEGs; dsoC6a)2; mpaL; Leu; Ala; Leu; Ala;
Leu; Ala; Lys; mpaL Two identical MIR122-01 m08 oligos attached to
either end of the peptide LALALAK via two maleimi- doproprionic
acid moieties coupled to Disulfide-oxo- C6 part a (Berry; dsoC6a)
through a triethoxy glycol MIR122 156 192062 lnaCs; lnaAs; lnaTs;
dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaAs;
triEGs; dsoC6; mpaL; Leu; Ala; Leu; Ala; Leu; Ala First half of IDO
192063.5; one MIR122-01 m08 oligo linked to the N-terminal end of
the peptide LALALA via maleimidoproprionic acid coupled to
Disulfide-oxo-C6 part a (Berry; dsoC6a) through a triethoxy glycol
MIR122 157 192063 aminoC6; lnaCs; lnaTs; lnaAs; dGs; dTs; dTs; dCs;
dAs; dCs; dTs; dGs; dAs; lnaAs; lnaTs; lnaG-Sup Second half of IDO
192063.5; one MIR122-01 m08 oligo linked to aminoC6 MALAT1 158
192063.5 lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; lnaCs; lnaCs; lnaAs; triEGs; dsoC6; mpaL; Leu; Ala; Leu;
Ala; Leu; Ala; aminoC6; lnaCs; lnaTs; lnaAs; dGs; dTs; dTs; dCs;
dAs; dCs; dTs; dGs; dAs; lnaAs; lnaTs; lnaG-Sup Combines IDO 192062
& 192063; Two MIR122-01 m08 oligos linked to the N-terminal end
of the peptide LALALA via maleimidoproprionic acid coupled to
Disulfide-oxo-C6 part a (Berry; dsoC6a) through a triethoxy glycol,
and to the C-terminal end via an amino C6 linker MIR122; MALAT1 159
192064 (lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT; dT; dT; dT; aminoC6-dT)2;
DTSSP-Sup Two MIR122-01 m08 oligos each with a 5 dT PO linker which
is in turn linked through an amino C6-dT to each end of a DTSSP
linker MIR122 160 192065 lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs;
dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT; dT; dT; dT;
aminoC6-dT; ABE The first half of IDO 192066.5; One MIR122-01 m08
oligo linked to 5 dT PO nucs then aminoC6-dT, with the ABE Click
chemistry moiety attached to the aminoC6 moiety MIR122 161 192066
odU; dT; dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs;
dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup The 2nd half of IDO
192066.5; One MIR122-01 m08 oligo linked to 5 dT PO nucs at the 5'
end,then to the odU Click chemistry nucleotide MIR122 162 192066.5
lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs;
lnaCs; lnaCs; lnaA; dT; dT; dT; dT; dT; aminoC6-dT; ABE; odU; dT;
dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs;
dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Combines IDO 192065 &
192066; Two MIR122-01 m08 oligos linked via 5 dT residues and the
ABE/odU Click chemistry MIR122 163 192067 lnaCs; lnaAs; lnaTs; dTs;
dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT;
dT; dT; prU-Sup The first half of IDO 192068.5; One MIR122-01 m08
oligo linked to 4 dT PO nucs at the 3' end, then to the prU Click
chemistry nucleotide MIR122 164 192068 ABE; aminoC6; dT; dT; dT;
dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; lnaCs; lnaCs; lnaA-Sup The 2nd half of IDO 192068.5; One
MIR122-01 m08 oligo linked to 5 dT PO nucs at the 5' end, then to
aminoC6 and the ABE Click chemistry nucleotide MIR122 165 192068.5
lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs;
lnaCs; lnaCs; lnaA; dT; dT; dT; dT; prU; ABE; aminoC6; dT; dT; dT;
dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; lnaCs; lnaCs; lnaA-Sup Combines IDO 192067 & 192068;
Two MIR122-01 m08 oligos linked via 4-5 dT residues and the prU/AZU
Click chemistry MIR122 166 192069 enaCs; enaAs; enaTs; dTs; dGs;
dTs; dCs; dAs; dCs; dAs; dCs; dTs; enaCs; enaCs; enaA; dT; dT; dT;
dT; enaCs; enaAs; enaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs;
dTs; enaCs; enaCs; enaA-Sup MIR122-01 ENA gapmer dimer with a 4 dT
PO linker MIR122 167 192070 enaCs; enaAs; enaTs; dTs; dGs; dTs;
dCs; dAs; dCs; dAs; dCs; dTs; enaCs; enaCs; enaA; dT; dT; dT; dT;
dT; enaCs; enaAs; enaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs;
dTs; enaCs; enaCs; enaA-Sup MIR122-01 ENA gapmer dimer with a 5 dT
PO linker MIR122 168 192071 enaCs; enaAs; enaTs; dTs; dGs; dTs;
dCs; dAs; dCs; dAs; dCs; dTs; enaCs; enaCs; enaA; dT; dT; dT; dT;
dT; dT; enaCs; enaAs; enaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; enaCs; enaCs; enaA-Sup MIR122-01 ENA gapmer dimer with a
6 dT PO linker MIR122 169 192072 enaCs; enaAs; enaTs; dTs; dGs;
dTs; dCs; dAs; dCs; dAs; dCs; dTs; enaCs; enaCs; enaAs; dTs; dTs;
dTs; dTs; enaCs; enaAs; enaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs;
dCs; dTs; enaCs; enaCs; enaA-Sup MIR122-01 ENA gapmer dimer with a
4 dT PS linker MIR122 170 192073 amiC6palm; lnaCs; lnaAs; lnaTs;
dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA;
dT; dT; dT; dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs;
dAs; dCs; dTs; lnaCs; lnaCs; lnaA-Sup Two MIR122-01 m08 oligos
linked via 4 dT residues and coupled to amino C6 palmitic acid on
the 5' end MIR122 171 192074 lnaCs; lnaAs; lnaTs; dTs; dGs; dTs;
dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT; dT; dT;
lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs; dTs;
lnaCs; lnaCs; lnaA; amiC6palm-Sup Two MIR122-01 m08 oligos linked
via 4 dT residues and coupled to amino C6 palmitic acid on the 3'
end MIR122 172 192075 amiC6palm; lnaCs; lnaAs; lnaTs; dTs; dGs;
dTs; dCs; dAs; dCs; dAs; dCs; dTs; lnaCs; lnaCs; lnaA; dT; dT; dT;
dT; lnaCs; lnaAs; lnaTs; dTs; dGs; dTs; dCs; dAs; dCs; dAs; dCs;
dTs; lnaCs; lnaCs; lnaA; amiC6palm-Sup Two MIR122-01 m08 oligos
linked via 4 dT residues and coupled to amino C6 palmitic acid on
both ends MIR122
173 183913 lnaGs; lnaCs; dAs; dCs; dTs; dGs; dAs; dGs; dAs; dAs;
dTs; dAs; lnaCs; lnaT; dT; dT; dT; dT; lnaGs; lnaCs; dAs; dTs; dTs;
dGs; dGs; dTs; dAs; dTs; lnaTs; lnaCs; lnaA-Sup Dimer with oligo dT
linker APOB; APOC3 174 183906 lnaTs; lnaGs; lnaAs; dAs; dGs; dGs;
dTs; dTs; dCs; dCs; dTs; dCs; lnaCs; lnaTs; lnaT; dT; dT; dT; dT;
lnaTs; lnaGs; lnaAs; dAs; dGs; dGs; dTs; dTs; dCs; dCs; dTs; dCs;
lnaCs; lnaTs; lnaT-Sup Dimer with oligo dT linker MIR122 175 186870
lnaTs; lnaGs; lnaAs; dAs; dGs; dGs; dTs; dTs; dCs; dCs; dTs; dCs;
lnaCs; lnaTs; lnaT; dT; dT; dT; dT; lnaTs; lnaGs; lnaAs; dAs; dGs;
dGs; dTs; dTs; dCs; dCs; dTs; dCs; lnaCs; lnaTs; lnaT-Sup Dimer
with oligo dT linker MIR122 176 186876 lnaCs; dCs; lnaAs; dTs; dTs;
lnaGs; lnaTs; dCs; dAs; lnaCs; dAs; lnaCs; dTs; lnaCs; lnaC; dT;
dT; dT; dT; lnaCs; dCs; lnaAs; dTs; dTs; lnaGs; lnaTs; dCs; dAs;
lnaCs; dAs; lnaCs; dTs; lnaCs; lnaC-Sup Dimer with oligo dT linker
MIR122 177 186878 lnaCs; dCs; lnaAs; dTs; dTs; lnaCs; lnaTs; dCs;
dAs; lnaCs; dAs; lnaCs; dTs; lnaGs; lnaC; dT; dT; dT; dT; lnaCs;
dCs; lnaAs; dTs; dTs; lnaCs; lnaTs; dCs; dAs; lnaCs; dAs; lnaCs;
dTs; lnaGs; lnaC-Sup Dimer with oligo dT linker MIR122 178 186880
lnaCs; lnaAs; lnaCs; lnaAs; lnaCs; lnaTs; lnaCs; lnaC; dT; dT; dT;
dT; lnaCs; lnaAs; lnaCs; lnaAs; lnaCs; lnaTs; lnaCs; lnaC-Sup Dimer
with oligo dT linker MIR122 179 186881 lnaCs; lnaAs; lnaCs; lnaAs;
lnaCs; lnaTs; lnaCs; lnaC; dT; dT; dT; dT; lnaCs; lnaAs; lnaCs;
lnaAs; lnaCs; lnaTs; lnaCs; lnaC; dT; dT; dT; dT; lnaCs; lnaAs;
lnaCs; lnaAs; lnaCs; lnaTs; lnaCs; lnaC-Sup Dimer with oligo dT
linker MIR122 180 186883 lnaCs; lnaGs; lnaCs; lnaAs; lnaCs; lnaCs;
lnaCs; lnaC; dT; dT; dT; dT; lnaCs; lnaGs; lnaCs; lnaAs; lnaCs;
lnaCs; lnaCs; lnaC-Sup Dimer with oligo dT linker MIR122 181 186884
lnaCs; lnaGs; lnaCs; lnaAs; lnaCs; lnaCs; lnaCs; lnaC; dT; dT; dT;
dT; lnaCs; lnaGs; lnaCs; lnaAs; lnaCs; lnaCs; lnaCs; lnaC; dT; dT;
dT; dT; lnaCs; lnaGs; lnaCs; lnaAs; lnaCs; lnaCs; lnaCs; lnaC-Sup
Dimer with oligo dT linker MIR122 182 189714 lnaCs; dTs; lnaTs;
dCs; dCs; lnaTs; lnaTs; dAs; dCs; lnaAs; dTs; lnaTs; dCs; lnaCs;
lnaA; omeT; omeT; omeT; omeT; lnaCs; dTs; lnaTs; dCs; dCs; lnaTs;
lnaTs; dAs; dCs; lnaAs; dTs; lnaTs; dCs; lnaCs; lnaA-Sup Dimer with
oligo dT linker MIR206 183 189717 lnaAs; lnaCs; lnaAs; lnaTs;
lnaTs; lnaCs; lnaCs; lnaA; omeT; omeT; omeT; omeT; lnaAs; lnaCs;
lnaAs; lnaTs; lnaTs; lnaCs; lnaCs; lnaA; omeT; omeT; omeT; omeT;
lnaAs; lnaCs; lnaAs; lnaTs; lnaTs; lnaCs; lnaCs; lnaA-Sup Trimer
with oligo dT linker MIR206 184 186885 lnaGs; omeCs; lnaTs; omeUs;
lnaTs; omeGs; lnaGs; omeGs; lnaAs; omeAs; lnaGs; omeUs; lnaAs;
omeUs; lnaG; dT; dT; dT; dT; lnaTs; omeCs; lnaAs; omeCs; lnaTs;
omeUs; lnaTs; omeCs; lnaAs; omeUs; lnaAs; omeAs; lnaTs; omeGs;
lnaCs; omeUs; lnaGs; omeG-Sup Dimer with oligo dT linker SMN1 185
186886 lnaCs; omeUs; lnaTs; omeUs; lnaGs; omeGs; lnaGs; omeAs;
lnaAs; omeGs; lnaTs; omeAs; lnaTs; omeGs; lnaT; dT; dT; dT; dT;
lnaTs; omeCs; lnaAs; omeCs; lnaTs; omeUs; lnaTs; omeCs; lnaAs;
omeUs; lnaAs; omeAs; lnaTs; omeGs; lnaCs; omeUs; lnaGs; omeG-Sup
Dimer with oligo dT linker SMN1 186 186887 lnaGs; omeGs; lnaTs;
omeAs; lnaCs; omeAs; lnaTs; omeGs; lnaAs; omeGs; lnaTs; omeGs;
lnaGs; omeCs; lnaT; dT; dT; dT; dT; lnaTs; omeCs; lnaAs; omeCs;
lnaTs; omeUs; lnaTs; omeCs; lnaAs; omeUs; lnaAs; omeAs; lnaTs;
omeGs; lnaCs; omeUs; lnaGs; omeG-Sup Dimer with oligo dT linker
SMN1 187 190179 lnaTs; omeGs; lnaAs; omeUs; lnaGs; omeCs; lnaTs;
omeGs; lnaAs; omeUs; lnaGs; omeCs; lnaTs; omeUs; lnaT; dT; dT; dT;
dT; lnaCs; omeUs; lnaAs; omeAs; lnaAs; omeAs; lnaTs; omeUs; lnaCs;
omeAs; lnaAs; omeUs; lnaGs; omeGs; lnaC-Sup Dimer with oligo dT
linker SMN1 188 190180 lnaCs; omeUs; lnaAs; omeAs; lnaAs; omeAs;
lnaTs; omeUs; lnaCs; omeAs; lnaAs; omeUs; lnaGs; omeGs; lnaC; dT;
dT; dT; dT; lnaCs; omeUs; lnaAs; omeAs; lnaAs; omeAs; lnaTs; omeUs;
lnaCs; omeAs; lnaAs; omeUs; lnaGs; omeGs; lnaC-Sup Dimer with oligo
dT linker SMN1 189 190181 lnaCs; omeUs; lnaGs; omeUs; lnaTs; omeAs;
lnaCs; omeCs; lnaCs; omeAs; lnaGs; omeAs; lnaTs; omeGs; lnaC; dT;
dT; dT; dT; lnaCs; omeUs; lnaAs; omeAs; lnaAs; omeAs; lnaTs; omeUs;
lnaCs; omeAs; lnaAs; omeUs; lnaGs; omeGs; lnaC-Sup Dimer with oligo
dT linker SMN1 190 190182 lnaCs; omeUs; lnaTs; omeCs; lnaAs; omeUs;
lnaAs; omeGs; lnaTs; omeGs; lnaGs; omeAs; lnaAs; omeCs; lnaA; dT;
dT; dT; dT; lnaCs; omeUs; lnaAs; omeAs; lnaAs; omeAs; lnaTs; omeUs;
lnaCs; omeAs; lnaAs; omeUs; lnaGs; omeGs; lnaC-Sup Dimer with oligo
dT linker SMN1 191 190183 lnaTs; omeCs; lnaAs; omeCs; lnaTs; omeUs;
lnaTs; omeCs; lnaAs; omeUs; lnaAs; omeAs; lnaTs; omeGs; lnaCs;
omeUs; lnaGs; omeG; dT; dT; dT; dT; lnaTs; omeCs; lnaAs; omeCs;
lnaTs; omeUs; lnaTs; omeCs; lnaAs; omeUs; lnaAs; omeAs; lnaTs;
omeGs; lnaCs; omeUs; lnaGs; omeG-Sup Dimer with oligo dT linker
SMN1 192 185864 lnaGs; omeCs; lnaTs; omeAs; lnaTs; omeUs; lnaAs;
omeCs; lnaCs; omeUs; lnaTs; omeAs; lnaAs; omeCs; lnaCs; omeCs;
lnaAs; omeG; dT; dT; dT; dT; lnaGs; omeCs; lnaTs; omeAs; lnaTs;
omeUs; lnaAs; omeCs; lnaCs; omeUs; lnaTs; omeAs; lnaAs; omeCs;
lnaCs; omeCs; lnaAs; omeG-Sup Dimer with oligo dT linker HBB 193
185867 lnaCs; omeCs; lnaTs; omeCs; lnaTs; omeUs; lnaAs; omeCs;
lnaCs; omeUs; lnaCs; omeAs; lnaGs; omeUs; lnaTs; omeAs; lnaCs;
omeA; dT; dT; dT; dT; lnaCs; omeCs; lnaTs; omeCs; lnaTs; omeUs;
lnaAs; omeCs; lnaCs; omeUs; lnaCs; omeAs; lnaGs; omeUs; lnaTs;
omeAs; lnaCs; omeA-Sup Dimer with oligo dT linker HBB 194 185865
lnaGs; omeCs; lnaTs; omeAs; lnaTs; omeUs; lnaAs; omeCs; lnaCs;
omeUs; lnaTs; omeAs; lnaAs; omeCs; lnaCs; omeCs; lnaAs; omeG; dT;
dT; dT; dT; lnaGs; omeCs; lnaTs; omeAs; lnaTs; omeUs; lnaAs; omeCs;
lnaCs; omeUs; lnaTs; omeAs; lnaAs; omeCs; lnaCs; omeCs; lnaAs;
omeG-Sup Dimer with oligo dT linker HBB 195 185868 lnaCs; omeCs;
lnaTs; omeCs; lnaTs; omeUs; lnaAs; omeCs; lnaCs; omeUs; lnaCs;
omeAs; lnaGs; omeUs; lnaTs; omeAs; lnaCs; omeA; dT; dT; dT; dT;
lnaCs; omeCs; lnaTs; omeCs; lnaTs; omeUs; lnaAs; omeCs; lnaCs;
omeUs; lnaCs; omeAs; lnaGs; omeUs; lnaTs; omeAs; lnaCs; omeA-Sup
Dimer with oligo dT linker HBB 196 183908 lnaCs; lnaTs; lnaAs; dGs;
dTs; dTs; dCs; dAs; dCs; dTs; dGs; dAs; lnaAs; lnaTs; lnaG; dT; dT;
dT; dT; lnaCs; lnaTs; lnaAs; dGs; dTs; dTs; dCs; dAs; dCs; dTs;
dGs; dAs; lnaAs; lnaTs; lnaG-Sup Dimer with oligo dT linker MALAT1
197 183910 lnaTs; lnaTs; lnaCs; dCs; dCs; dTs; dGs; dAs; dAs; dGs;
dGs; dTs; lnaTs; lnaCs; lnaC; dT; dT; dT; dT; lnaTs; lnaTs; lnaCs;
dCs; dCs; dTs; dGs; dAs; dAs; dGs; dGs; dTs; lnaTs; lnaCs; lnaC-Sup
Dimer with oligo dT linker MALAT1 198 186872 lnaCs; lnaTs; lnaAs;
dGs; dTs; dTs; dCs; dAs; dCs; dTs; dGs; dAs; lnaAs; lnaTs; lnaG;
dT; dT; dT; dT; lnaCs; lnaTs; lnaAs; dGs; dTs; dTs; dCs; dAs; dCs;
dTs; dGs; dAs; lnaAs; lnaTs; lnaG-Sup Dimer with oligo dT linker
MALAT1 199 186874 lnaTs; lnaTs; lnaCs; dCs; dCs; dTs; dGs; dAs;
dAs; dGs; dGs; dTs; lnaTs; lnaCs; lnaC; dT; dT; dT; dT; lnaTs;
lnaTs; lnaCs; dCs; dCs; dTs; dGs; dAs; dAs; dGs; dGs; dTs; lnaTs;
lnaCs; lnaC-Sup Dimer with oligo dT linker MALAT1
[0257] Table 2 provides a descriptive legend for chemical structure
designations used throughout the specification, including in Table
1. In some embodiments, the 3' end of any sequence recited herein
includes an --OH or --PO. PO=phosphate, PS=phosphorothioate, SUP=no
phosphate or phosphorothioate group. Exemplary molecules from which
linkers can be derived are also included.
TABLE-US-00002 TABLE 2 Designation Description Chemical Structure
dA dC dG dT 2'-deoxyadenosine, 3' PO 2'-deoxycytidine, 3' PO
2'-deoxyguanosine, 3' PO 2'-deoxythymidine, 3' PO ##STR00035## dAs
dCs dGs dTs 2'-deoxyadenosine, 3' PS 2'-deoxycytidine, 3' PS
2'-deoxyguanosine, 3' PS 2'-deoxythymidine, 3' PS ##STR00036##
dA-Sup dC-Sup dG-Sup dT-Sup 2'-deoxyadenosine 2'-deoxycytidine
2'-deoxyguanosine 2'-deoxythymidine ##STR00037## d5mCs
2'-deoxy-5-methylcytidine, 3' PS ##STR00038## omeA omeC omeG omeU
2'-O-methyl adenosine, 3' PO 2'-O-methyl cytidine, 3' PO
2'-O-methyl guanosine, 3' PO 2'-O-methyl uridine, 3' PO
##STR00039## omeAs omeCs omeGs omeUs 2'-O-methyl adenosine, 3' PS
2'-O-methyl cytidine, 3' PS 2'-O-methyl guanosine, 3' PS
2'-O-methyl uridine, 3' PS ##STR00040## omeA-Sup omeC-Sup omeG-Sup
omeU-Sup 2'-O-methyl adenosine 2'-O-methyl cytidine 2'-O-methyl
guanosine 2'-O-methyl uridine ##STR00041## InaA InaC InaG InaT LNA
adenosine, 3' PO LNA cytidine, 3' PO LNA guanosine, 3' PO LNA
thymidine, 3' PO ##STR00042## InaAs InaCs InaGs InaTs LNA
adenosine, 3' PS LNA cytidine, 3' PS LNA guanosine, 3' PS LNA
thymidine, 3' PS ##STR00043## InaA-Sup InaC-Sup InaG-Sup InaT-Sup
LNA adenosine LNA cytidine LNA guanosine LNA thymidine ##STR00044##
Ina5mCs LNA 5-methylcytidine, 3' PS ##STR00045## rUs
2'-ribouridine, 3' PS ##STR00046## enaA enaC enaG enaT ENA
adenosine, 3' PO ENA cytidine, 3' PO ENA guanosine, 3' PO ENA
thymidine, 3' PO ##STR00047## enaAs enaCs enaGs enaTs ENA
adenosine, 3' PS ENA cytidine, 3' PS ENA guanosine, 3' PS ENA
thymidine, 3' PS ##STR00048## enaA-Sup enaC-Sup enaG-Sup enaT-Sup
ENA adenosine ENA cytidine ENA guanosine ENA thymidine ##STR00049##
fluA fluC fluG fluU 2'-fluoro adenosine, 3' PO 2'-fluoro cytidine,
3' PO 2'-fluoro guanosine, 3' PO 2'-fluoro uridine, 3' PO
##STR00050## fluAs fluCs fluGs fluUs 2'-fluoro adenosine, 3' PS
2'-fluoro cytidine, 3' PS 2'-fluoro guanosine, 3' PS 2'-fluoro
uridine, 3' PS ##STR00051## fluA-Sup fluC-Sup fluG-Sup fluU-Sup
2'-fluoro adenosine 2'-fluoro cytidine 2'-fluoro guanosine
2'-fluoro uridine ##STR00052## 2xSLB 2xSLBs Symmetrical Doubler B,
3' PO Symmetrical Doubler B, 3' PS ##STR00053## Ala alanine
##STR00054## Leu leucine ##STR00055## Lys lysine ##STR00056##
5prydC 5prydCs 5-propynyl-2'- deoxycytidine, 3' PO 5-propynyl-2'-
deoxycytidine, 3' PS ##STR00057## 5prydT 5prydTs 5-propynyl-2'-
deoxythymidine, 3' PO 5-propynyl-2'- deoxythymidine, 3' PS
##STR00058## ABE 3-Azidobuteric acid ##STR00059## amiC6palm
Palmitoyl amino-C6, PO ##STR00060## aminoC6 Amino-C6 linker, PO
##STR00061## aminoC6-dT dT-C6-amine linker, 3' PO ##STR00062## dB
dSpacer 2'-deoxy apasic, 3' PO ##STR00063## dGCl dGCl-Sup dGCls
G-clamp deoxyphenoxazine, 3' PO G-clamp deoxyphenoxazine G-clamp
deoxyphenoxazine, 3' PS ##STR00064## dsC6 dsC6s Disulfide-C6, PO
Disulfide-C6, PS ##STR00065## dsoC6 dsoC6s Disulfide-oxo-C6, PO
Disulfide-oxo-C6, PS ##STR00066## dsoC6a Disulfide-oxo-C6 part a
2-(3- ##STR00067## mercaptopropoxy)ethanol DTSSP DTSSP linker
3,3'-Dithiobis [sulfosuccinimidylpropionate] ##STR00068## mpaL
Maleimidopropionic acid crosslinker ##STR00069## odU Octa-1,7
diynyl-2'- deoxyuridine, 3' PO ##STR00070## prU prU-Sup
2'-Propargyl uridine, 3' PO 2'-Propargyl uridine ##STR00071##
tegCHOL tegCHOLs Cholesterol TEG, PO Cholesterol TEG, PS TEG =
tetraethyleneglycol ##STR00072## tegTOCO Tocopherol TEG TEG =
tetraethyleneglycol ##STR00073## triEG triEG-Sup triEGs Triethyloxy
glycol, PO Triethyloxy glycol, no PO Triethyloxy glycol, PS
##STR00074## bioTEG bioTEG-Sup biotin-TEG, 3' PO biotin-TEG, no PO
##STR00075## biodT biotin-dT, 3' PO ##STR00076## amiCl2 5' amino
modifier C12, 3' PO ##STR00077## heg hexaethelene glycol; C18
spacer ##STR00078##
[0258] Exemplary molecules from which linkers can be derived are
shown in Table 2.1. PO=phosphate, PS=phosphorothioate, SUP=no
phosphate or phosphorothioate group. It should be appreciated that
a linker can be derived from one or more of the molecules in Table
2.1. For example, one or more amino acids can be combined to form a
peptide linker.
TABLE-US-00003 TABLE 2.1 Description Chemical Structure Symmetrical
Doubler B, 3' PO Symmetrical Doubler B, 3' PS ##STR00079## alanine
##STR00080## leucine ##STR00081## lysine ##STR00082##
5-propynyl-2'- deoxycytidine, 3' PO 5-propynyl-2 -deoxycytidine, 3'
PS ##STR00083## 5-propynyl-2'- deoxythymidine, 3' PO 5-propynyl-2'-
deoxythymidine, 3' PS ##STR00084## 3-Azidobuteric acid ##STR00085##
Palmitoyl amino- C6, PO ##STR00086## Amino-C6 linker, PO
##STR00087## dT-C6-amine linker, 3' PO ##STR00088## dSpacer
2'-deoxy apasic, 3' PO ##STR00089## G-clamp deoxyphenoxazine, 3' PO
G-clamp deoxy- phenoxazine G-clamp deoxyphenoxazine, 3' PS
##STR00090## Disulfide-C6, PO Disulfide-C6, PS ##STR00091##
Disulfide-oxo-C6, PO Disulfide-oxo-C6, PS ##STR00092##
Disulfide-oxo-C6 part a 2-(3- mercaptopropoxy) ethanol ##STR00093##
DTSSP linker 3,3'-Dithiobis [sulfosuccinimidyl- propionate]
##STR00094## Maleimidopropionic acid crosslinker ##STR00095##
Octa-1,7 diynyl-2'- deoxyuridine, 3' PO ##STR00096## 2'-Propargyl
uridine, 3' PO 2'-Propargyl uridine ##STR00097## Cholesterol TEG,
PO Cholesterol TEG, PS TEG = tetraethylene- glycol ##STR00098##
Tocopherol TEG TEG = tetraethylene- glycol ##STR00099## Triethyloxy
glycol PO Triethyloxy glycol, no PO Triethyloxy glycol, PS
##STR00100## biotin-TEG, 3' PO biotin-TEG, no PO ##STR00101##
biotin-dT, 3' PO ##STR00102## 5' amino modifier C12, 3' PO
##STR00103## hexaethelene glycol; C18 spacer ##STR00104##
[0259] The measured molecular weights of the oligonucleotides were
tested and found to be in agreement with the calculated values (see
Table 3).
TABLE-US-00004 TABLE 3 Ref. Calculated MW by SEQ ID NO: Number MW
LC-MS 1 103966 4642.7 4642.4 2 105360 10260.1 10259.9 3 105361
10164.0 10164.2 4 105362 12362.7 12361.7 5 105363 11105.6 11105.3 6
105395 10242.1 10241.9 7 105513 9933.9 9933.7 8 105514 9580.6
9580.3 9 104109 4585.7 4585.5 10 104111 4280.5 4280.1 11 104112
3913.2 3918 12 105576 4655.9 4655.6 13 102102 4325.5 4325.4 14
105515 4633.8 4633.5 15 10620 10520.3 10520.4 16 106201 10600.6
10600.4 17 106202 12317.7 12318.5 18 106203 9929.7 9929.8 19 106204
10010.1 10010.1 20 106205 11727.2 11727.0 21 106206 10225.0 10225.2
22 106207 10225.0 10225.1 23 106413 9889.7 9889.7 24 106414 10279.0
10279.2 25 106415 9910.7 9910.8 26 106416 15810.2 15810.6 27 101443
4306.5 4307.3 28 101441 4306.5 4304.5 29 105758 4693.8 4692.7 30
104975 4620.8 4620.0 31 102103 4311.5 4310.4 32 104882 4893.1 4893
33 106417 10227.0 10227.4 34 106418 10217.0 10217.2 35 106419
10168.9 10168.8 36 106420 10222.0 10222.3 37 106206 10225.0 10225.2
38 106421 10792.6 n.d. 39 106422 10247.0 10247.1 40 106423 12311.6
12311.5 41 106424 10596.4 10596.5 42 106425 10644.4 10644.6 43
106426 10692.57 n.d. 44 106234 9017.1 9017.1 45 106235 9321.3
9321.1 46 106236 9625.5 9626.1 47 106237 10233.9 10234.2 48 106238
10538.1 10538.6 49 106239 10842.3 10842.5 50 106241 10906.6 10906.8
51 106242 9051.2 9051.1 52 106243 9373.5 9373.2 53 106244 9695.7
9695.5 54 106245 10017.9 10017.5 55 105448 4622.8 4622.6 56 105382
4612.8 4612.6 57 105390 4564.7 4564.4 58 105704 4617.8 4617.5
[0260] Sequence correlation for the unmodified versions of the
sequences (except the linker/bridge) and the respective fully
modified sequences is shown in Table 4.
TABLE-US-00005 TABLE 4 SEQ ID SEQ ID NO:* Sequence NO:** 118
AAGCAACCTACAGG 1 61 AAGCAACCTACAGG-T-T-T-AAGCAACCTACAGG 2 62
AAGCAACCTACAGGtriEGs;dsC6s;triEGsAAGCAACC 3 TACAGG 63
(AAGCAACCTACAGG-T-T-T-T-).sub.22xSLBs-triEG 4 64
(AAGCAACCTACAGG-triEGs;dsC6s).sub.22xSLBs-triEG 5 65
AAGCAACCTTCAGG-T-T-T-AAGCAACCTTCAGG 6 66
AAGCAACCTTCAGG-T-T-T-GZATTGGTATTZA 7 67
GZATTGGTATTZA-T-T-T-TZZTCGGCCTZTG 8 68 ZZTCTTCGGCCZTG 9 69
TZZTCGGCCTZTG 10 70 TZTTCGGCCCTG 11 71 TZTTZGGCCCTG 12 72
GZATTGGTATTZA 13 73 AAGCAACCTTCAGG 14 74
GZACTGAGAATAZT-T-T-T-T-GZACTGAGAATAZT 15 75
GZACTGAGAATAZTTTTTGZACTGAGAATAZT 16 76
(GZACTGAGAATAZT-T-T-T-T-).sub.22xSLBs-triEG 17 77
GZATTGGTATTZA-T-T-T-T-GZATTGGTATTZA 18 78
GZATTGGTATTZATTTTGZATTGGTATTZA 19 79
(GZATTGGTATTZA-T-T-T-T-).sub.22xSLBs-triEG 20 80
GZACTGAGAATAZT-T-T-T-T-GZATTGGTATTZA 21 81
GZATTGGTATTZA-T-T-T-T-GZACTGAGAATAZT 22 82
GGCAAGCATCZTG-T-T-T-T-ZAATCCATGGZAG 23 83
GGCAAGCATCZTG-T-T-T-T-GZGTGCATAAATTG 24 84
GGCAAGCATCZTG-T-T-T-T-GZATTGGTATTZA 25 85
GZATTGGTATTZA-T-T-T-T-GZACTGAGAATAZT-T- 26 T-T-T-GGCAAGCATCZTG 86
GGCAAGCATCZTG 27 87 ZAATCCATGGZAG 28 88 GZGTGCATAAATTG 29 89
GZACTGAGAATAZT 30 90 ZGTCTATGTATAG 31 91 UU(APC)AGTGTGATGA(APC) 32
92 ZZAGTAGTCTTUZA-T-T-T-T-GZATTGGTATTZA 33 93
ZZAGTAGTCTTUCA-T-T-T-T-GZATTGGTATTZA 34 94
ZZAGTAGTCTTUCA-T-T-T-T-GZATTGGTATTZA 35 95
GGAACTGAAGCCAT-T-T-T-T-GZATTGGTATTZA 36 96
GZACTGAGAATAZT-T-T-T-T-GZATTGGTATTZA 37 97
UU(APC)AGTGTGATGA(APC)-T-T-T-T- 38 GZACTGAGAATAZT 98
AAGCAACCTACAGG-T-T-T-T-GZATTGGTATTZA 39 99
(GGAACTGAAGCCAT-T-T-T-T-).sub.22xSLBs-triEG 40 100
GZA(PC)TGAGAATAZT-T-T-T-T- 41 GZA(PC)TGAGAATAZT 101
GZA(PC)(PU)GAGAATAZT-T-T-T-T- 42 GZA(PC)(PU)GAGAATAZT 102
GZA(PC)(PU)GAGAA(PU)AZT-T-T-T-T- 43 GZA(PC)(PU)GAGAA(PU)AZT 103
GZATTGGTATTZA-T-T-GZATTGGTATTZA 44 104
GZATTGGTATTZA-T-T-T-GZATTGGTATTZA 45 105
GZATTGGTATTZA-T-T-T-T-GZATTGGTATTZA 46 106
GZATTGGTATTZA-T-T-T-T-T-GZATTGGTATTZA 47 107
GZATTGGTATTZA-T-T-T-T-T-T-GZATTGGTATTZA 48 108
GZATTGGTATTZA-T-T-T-T-T-T-GZATTGGTATTZA 49 109
GZATTGGTATTZATT-T-T-T-TTGZATTGGTATTZA 50 110
GZATTGGTATTZAUGZATTGGTATTZA 51 111 GZATTGGTATTZAUUGZATTGGTATTZA 52
112 GZATTGGTATTZAUUUGZATTGGTATTZA 53 113
GZATTGGTATTZAUUUUGZATTGGTATTZA 54 114 ZZAGTAGTCTTUZA 55 115
ZZAGTAGTCTTUCA 56 116 ZZAGTAGTCTTUCA 57 117 GGAACTGAAGCCAT 58 200
CATTGTCACACTCCATTTTCATTGTCACACTCCA 139 201
CATTGTCACACTCCATTTTTCATTGTCACACTCCA 140 202
CATTGTCACACTCCATTTTTTCATTGTCACACTCCA 141 203
CATTGTCACACTCCATTTTCATTGTCACACTCCA 142 204 ACTTACTACCTAGCC 143 205
ACTTACTACCTAGCCTTTTACTTACTACCTAGCC 144 206 CATTGTCACACTCCA 145 207
CTAGTTCACTGAATG 146 208 DTSSP(XTTTCATTGTCACACTCCA).sub.2 147 209
(CATTGTCACACTCCATTTX).sub.2DTSSP 148 210
(CATTGTCACACTCCATTTT).sub.2doubs-triEG 149 211
CATTGTCACACTCCATTTTtriEGTTTTCATTGTCACACTCCA 150 212
CATTGTCACACTCCATTTTtegCHOLTTTTCATTGTCACACTCCA 151 213
CATTGTCACACTCCATTTTtegTOCOTTTTCATTGTCACACTCCA 152 214
CATTGTCACACTCCATTTTdBTTTTCATTGTCACACTCCA 153 215
(CATTGTCACACTCCATTTT).sub.2doubs-tegCHOLs-triEG 154 216
(CATTGTCACACTCCA triEGs-S-OXA-C6)2-Maleimido- 155
propionyl-Leu-Ala-Leu-Ala-Leu-Ala-Lys-propionyl- Maleimido 217
CATTGTCACACTCCAtriEGs-dsoC6-mpaL-Leu-Ala-Leu-Ala- 156 Leu-Ala 218
XCTAGTTCACTGAATG 157 219 CATTGTCACACTCCA triEGs-S-OXA-C6-Maleimido-
158 propionyl-Leu-Ala-Leu-Ala-Leu-AlaXCTAGTTCACTGAATG 220
(CATTGTCACACTCCATTTTTX).sub.2DTSSP 159 221 CATTGTCACACTCCATTTTTXABE
160 222 UTTTTTCATTGTCACACTCCA 161 223
CATTGTCACACTCCATTTTTX-ABE-odU-TTTTTCATTGTCACACTCCA 162 224
CATTGTCACACTCCATTTTU 163 225 ABE-XTTTTTCATTGTCACACTCCA 164 226
CATTGTCACACTCCATTTTU-ABE-XTTTTTCATTGTCACACTCCA 165 227
CATTGTCACACTCCATTTTCATTGTCACACTCCA 166 228
CATTGTCACACTCCATTTTTCATTGTCACACTCCA 167 229
CATTGTCACACTCCATTTTTTCATTGTCACACTCCA 168 230
CATTGTCACACTCCATTTTCATTGTCACACTCCA 169 231
Palmitoyl-XCATTGTCACACTCCATTTTCATTGTCACACTCCA 170 232
CATTGTCACACTCCATTTTCATTGTCACACTCCA-Palmitoyl-X 171 233
Palmitoyl-XCATTGTCACACTCCATTTTCATTGTCACACTCCA- 172 Palmitoyl-X 234
GCACTGAGAATACTTTTTGCATTGGTATTCA 173 235
TGAAGGTTCCTCCTTTTTTTGAAGGTTCCTCCTT 174 236
TGAAGGTTCCTCCTTTTTTTGAAGGTTCCTCCTT 175 237
CCATTGTCACACTCCTTTTCCATTGTCACACTCC 176 238
CCATTCTCACACTGCTTTTCCATTCTCACACTGC 177 239 CACACTCCTTTTCACACTCC 178
240 CACACTCCTTTTCACACTCCTTTTCACACTCC 179 241 CGCACCCCTTTTCGCACCCC
180 242 CGCACCCCTTTTCGCACCCCTTTTCGCACCCC 181 243
CTTCCTTACATTCCATTTTCTTCCTTACATTCCA 182 244
ACATTCCATTTTACATTCCATTTTACATTCCA 183 245
GCTTTGGGAAGTATGTTTTTCACTTTCATAATGCTGG 184 246
CTTTGGGAAGTATGTTTTTTCACTTTCATAATGCTGG 185 247
GGTACATGAGTGGCTTTTTTCACTTTCATAATGCTGG 186 248
TGATGCTGATGCTTTTTTTCTAAAATTCAATGGC 187 249
CTAAAATTCAATGGCTTTTCTAAAATTCAATGGC 188 250
CTGTTACCCAGATGCTTTTCTAAAATTCAATGGC 189 251
CTTCATAGTGGAACATTTTCTAAAATTCAATGGC 190 252
TCACTTTCATAATGCTGGTTTTTCACTTTCATAATGCTGG 191 253
GCTATTACCTTAACCCAGTTTTGCTATTACCTTAACCCAG 192 254
CCTCTTACCTCAGTTACATTTTCCTCTTACCTCAGTTACA 193 255
GCTATTACCTTAACCCAGTTTTGCTATTACCTTAACCCAG 194 256
CCTCTTACCTCAGTTACATTTTCCTCTTACCTCAGTTACA 195 257
CTAGTTCACTGAATGTTTTCTAGTTCACTGAATG 196
258 TTCCCTGAAGGTTCCTTTTTTCCCTGAAGGTTCC 197 259
CTAGTTCACTGAATGTTTTCTAGTTCACTGAATG 198 260
TTCCCTGAAGGTTCCTTTTTTCCCTGAAGGTTCC 199 *Sequence without chemical
modifications (except bridge/linker) **The sequence of the fully
chemically modified sequence corresponding to SEQ ID NO:*
[0261] In Table 4,
[0262] A is adenosine
[0263] C is cytidine
[0264] G is guanosine
[0265] T is thymidine
[0266] U is uridine
[0267] Z is 5-methly-cytosine
[0268] X is aminoC6 or aminoC6-dT
[0269] APC is sGCls
[0270] PU is 5prydT
[0271] PC is 5prydC [0272] and
[0273] 2xSLBs-triEG is
##STR00105##
Example 3
Dimer Stability in Plasma and Cleavage in Liver Homogenates
[0274] Stability measurements were performed using 4 different
oligonucleotides (including dimers and the monomer, SEQ ID NOs: 1,
2, 3, 4).
[0275] Briefly, oligos were incubated in 95% plasma of mouse or
monkey and in 5% liver homogenate at a concentration of 30 .mu.M
and at 37.degree. C. Samples for measurement were taken after 0, 7,
24 and 48 h of incubation. Samples were subjected to a
phenol/chloroform extraction and analyzed using LC-MS.
[0276] In detail, stock solutions with a final concentration of 600
.mu.M and a final volume of 100 .mu.l have been prepared of all
oligonucleotides. Twelve pieces of approximately 50 mg of liver
from CD1 mouse (female, Charles River) were added to individual
Lysing matrix tubes. A calculated volume of 1.times.PBS to give a
final concentration of 5% liver (W/W) was added to each of the
twelve tubes. All samples were homogenized using a BioRad Fast prep
System. The resulting homogenate solutions were combined to give
about 12 ml of 5% liver homogenate in 1.times.PBS which was
subsequently used for incubation.
[0277] Plasmas used were a Na-Citrate plasma from female NMRI mice
(Charles River) and K-EDTA plasma from male Cynomolgous monkeys
(Seralab International).
[0278] Four samples of each oligo were prepared representing each
individual incubation time point (0, 7, 24 and 48 h) in mouse and
monkey plasma and in mouse liver homogenate, respectively. In
addition, a blank sample and a recovery sample were prepared of
each oligo and incubation matrix. Generally, plasma samples were
prepared by adding 5 .mu.l of the 600 .mu.M oligo stock solution to
95 .mu.l of mouse or monkey plasma, respectively, with a final
oligo concentration of 30 .mu.M. Recovery samples were prepared by
adding 5 .mu.l of water to 95 .mu.l of plasma. Blank samples are
oligo in water with a final concentration of 100 .mu.M. Liver
samples and recoveries were prepared in the same way except that
liver homogenate in PBS was used instead of plasma.
[0279] All samples and recoveries were incubated at 37.degree. C.
Samples were cooled to room temperature after 0, 7, 24 and 48 h and
was subjected to phenol/chloroform purification. To that end, 370
.mu.l of ammonium hydroxide (15%), 10 .mu.l dithiothreitol (DTT, 1
M, Sigma Cat. No. 43816) and 800 .mu.l premixed
phenol/chloroform/isoamyl alcohol (Sigma P2069) was added to each
sample. Samples were then vortexed for 10 min at a maximum vortex
speed and incubated at 4.degree. C. for 20 min. The samples were
then centrifuged at 3500 RFC for 20 min at 4.degree. C. and 400
.mu.l of the aqueous layer were removed and dried in a
lyophilizer.
[0280] The dried samples were dissolved in water (100 .mu.l). The
recovery samples were dissolved in water (95 .mu.l) and spiked with
5 .mu.l of the respective oligo stock solution (600 .mu.M).
[0281] Samples were analyzed by LC-MS (Agilent 1200, Bruker Esquire
3000) using a Waters Acquity UPLC OST C18 column (1.7 .mu.m,
2.1.times.50) with HFIP/TEA/water (385 mM
1,1,1,3,3,3-hexafluoroisopropanol, 14.4 mM triethylamine in water)
as buffer A and methanol as buffer B at a flow rate of 0.3 ml/min
and a column temperature of 60.degree. C. The following gradient
was used: 3 min at 5% B, 5-15% B in 2.5 min (10%/min), 15-23% B in
5.5 min, 23-30% B in 3 min, 30-100% B in 0.5 min, 5 min at 100% B,
100-5% B in 0.5 min, 5 min at 5% B.
[0282] Samples were analyzed in 96-well plate format. A standard
curve with 8 standards (5, 10, 15, 20, 50, 75, 90, 100 .mu.g/ml; 25
.mu.g/ml IS), standard 0 (0 .mu.g/ml; 25 .mu.g/ml IS) and three
recovery samples (20, 50, 100 .mu.g/ml; 25 .mu.g/ml IS) were
prepared for each oligo. Samples related to one oligo were analyzed
together on the same plate.
[0283] Standards were prepared as follows. A piece of approximately
50 mg of tissue was cut from the respective organ tissue, weighted
and placed into the respective well of a 2.2 ml 96-deepwell plate
(VWR 732-0585). Two steel balls (5 mm diameter, KGM Kugelfabrik
GmbH, part No. 1.3541) were placed into each well and 500 .mu.l
homogenization buffer (vide infra), 20 .mu.l DTT (1 M, Sigma
43816), 50 .mu.l of proteinase K solution (Qiagen, 19133) was
added. Furthermore, 10 .mu.l working solution analyte and 10 .mu.l
working solution internal standard was added into each well of the
standards to give the corresponding final concentrations of (5, 10,
15, 20, 50, 75, 90, 100 .mu.g/ml; 25 .mu.g/ml IS (Internal
Standard)). Standard 0 and recovered material were spiked with 10
.mu.l of working solution internal standards only; recoveries were
spiked with 10 .mu.l of working solution analyte after the entire
extraction process and prior to analysis.
[0284] Samples were processed as follows. A piece of approximately
50 mg of tissue was cut from the respective organ tissue, weighed
and placed into the respective well of a 96-deepwell plate. Two
steel balls were placed into each well and 500 .mu.l homogenization
buffer 20 .mu.l DTT (1 M), 50 .mu.l of proteinase K solution was
added. The plate was sealed with STAR lab foils (StarLab E 2796
3070) and samples were homogenized using a Qiagen Tissue Lyzer
3.times.30 s at 17 Hz. Subsequently, the plate was incubated in a
water bath for 2 hours at 55.degree. C. followed by transfer of the
samples to a new 96-deepwell plate using an automated
liquid-handling system (TomTec Quadra 3). After the addition of 200
.mu.l ammonium hydroxide (25%) and 500 .mu.l
phenol/chloroform/isoamyl alcohol (25:24:1) the plate was vortexed
using a Multitubevortex for 5 min. Subsequently, the plate was
incubated for 10 min at 4.degree. C. and centrifuged at 4.degree.
C. for another 10 min at 3500 RCF. The plate was then passed to the
TomTec system which was used to remove the aqueous layer. The
remaining organic layer was washed by adding 500 .mu.l water. The
aqueous phase was again removed using the TomTec system. The
aqueous phases were combined, 50 .mu.l HCl (1 N), 500 .mu.l SAX
Load High buffer (see below) and 300 .mu.l acetonitrile were added,
and the resulting solution was mixed thoroughly by up-and-down
pipetting using the TomTec system. The program "SPE extraction of
tissue samples 100416" was used for the subsequent solid-phase
extraction procedure.
[0285] VARIAN Bond Elut 96 square-well SAX 100 mg (Cat. No.:
A396081C) were equilibrated with acetonitrile, water and SAX load
buffer (see below), samples were loaded and washed with SAX load
buffer. The samples were eluted with SAX elute buffer (vide infra)
and subsequently diluted with SAX/RP dilution buffer (vide infra).
WATERS Oasis HLB LP 96-well Plate 60 .mu.m 60 mg (Part No.
186000679) were equilibrated with acetonitrile, water and SAX
dilution buffer (see below). The samples were loaded and the
cartridge washed with water. The samples were eluted with RP elute
buffer (vide infra). Freeze the elution plate for 1 hour at
-80.degree. C. and lyophilize to dryness. The dried samples were
reconstituted in 50 .mu.l water and dialyzed for 60 min against
water using Thermo Slide-A-Lyzer. The samples were then subjected
to CGE analysis on a Beckman Coulter PACE/MDQ system. The
conditions were: (i) Capillary: eCAP DNA, neutral, 21 cm, 100 .mu.m
I.D. (Beckman #477477); (ii) Capillary temperature: 20.degree. C.;
(iii) Sample storage temperature: 10.degree. C., (iv) Gel: ssDNA
100 R (Beckman #477621) (v) Buffer: Tris/boric acid/EDTA buffer
containing 7 M Urea (Beckman #338481) (vi) Detection wavelength:
260 nm; (vii) Separation voltage: 30 kV; (viii) Injection time: 60
s; (ix) Injection voltage: 10 kV; (x) Run time: 20 minutes; (xi)
Data acquisition rate: 4 pt/sec. Analysis was done using the Karat
7.0 software (Beckman).
[0286] In vitro dimer stability in murine and monkey plasmas and
liver homogenates was assessed using the assay described above.
Subsequently to the incubation, samples were extracted with the
phenol/chloroform extraction method and analyzed by LC-MS, as
described above. FIG. 2 illustrates in vitro dimer stability in
murine or monkey plasmas and degradation of dimer in liver
homogenates as determined by LC-MS. FIGS. 2A and 2B demonstrate
slow degradation of both ApoC3 ASO monomer (SEQ ID NO: 1,
designated as per Example 2(E)) and cleavable ApoC3-ApoC3 ASO
dimers (SEQ ID NO:2 and SEQ ID NO:4) in murine and monkey plasmas
respectively. FIG. 2C demonstrates efficient degradation of the
cleavable ApoC3-ApoC3 ASO dimers (SEQ ID NO:2 and SEQ ID NO:4) and
the relative stability ApoC3 ASO monomer (SEQ ID NO: 1) in mouse
liver homogenate. FIG. 2D shows cleavable SEQ ID NO: 18) and
noncleavable SEQ ID NO: 19) ApoB-ApoB ASO homodimers incubated in
murine plasma or liver homogenate, demonstrating stability of both
types of molecules in plasma, and a more efficient degradation of
the cleavable version in the liver homogenate.
Example 4
In Vitro Tests of Various Linker Designs with ApoC3 ASO Homodimers
(FIG. 3A)
Cell Culture Protocol
[0287] Human hepatocarcinoma cells (Hep3B) were acquired from the
"Deutsche Sammlung von Mirkoorganismen und Zellkulturen GmbH"
(DSMZ). For the KD studies, 3.000-10.000 cells/well were seeded
(1-3 days prior to treatment) into 96 multi-titer plates yielding
70-80% confluence on the day of treatment. For assays using
lipotransfection delivery techniques, cells were incubated with
indicated concentrations of ASO formulated with 0.3 .mu.l
Lipofectamine 2000 (L2k) for 48 hr in Earle's Balanced Salt
Solution (Lonza, Verviers, Belgium) with L-glutamine (2 mM).
Knock-Down Analysis Protocol
[0288] Following the treatment period mRNA levels of target and
reference (a housekeeping gene) mRNA was determined by the Quanti
Gene Assay (Affymetrix, Santa Clara, Calif., USA) according to the
manufactures standard protocol. Prior to lysis, cell viability was
analyzed by Cell Titer Blue Assay (Promega, Madison, Wis., USA).
Inactive, scrambled, ASO was used as negative control and reference
(SEQ ID NO:31). The QuantiGene 2.0 assay (Affymetrix, Santa Clara,
Calif.) was utilized to measure the expression level of target
genes in Hep3B cells before and after the incubation with the ASOs.
Human ApoB/ApoC3 probes and housekeeping gene PPIB probes were
purchased from Affymetrix. Standard assay procedures were carried
out according to the manufacturer's recommendations. On the day of
harvesting, 200 l/well of lysis buffer (with 1:100 protease K) was
added to the cells. A total of 60 .mu.l of lysate was used for
human ApoC3 probes, while 20 .mu.l lysate was used for human ApoB
and PPIB probes respectively. Assay plates were read on the
GloRunner Microplate Luminometer (Promega Corp, Sunnyvale, Calif.).
The data were normalized against housekeeping gene PPIB.
Transfection Protocol
[0289] Hep3B cells were treated with 8 consecutive concentrations
(0.001, 0.006, 0.03, 0.2, 0.8, 4.0, 20 and 100 nM) of
oligonucleotide were formulated with the Lipotransfection agent.
mRNA content and cell viability were determined after 48 hr of
treatment.
[0290] The results of the above experiments are presented in FIG.
3A. All homodimers derived from the human sequence show knockdown.
Homodimers with thiol (S--S) bridges (SEQ ID NOs:2 and 4) showed
increased cytotoxicity. At the same time, the homodimer made from
the murine ApoC3 ortholog (SEQ ID NO:6) was ineffective
Example 5
In Vitro Comparisons of Cleavable Vs. Noncleavable Linker Designs
with ApoC3 Homodimers (FIGS. 3B, 3C, 3J, 3K)
[0291] Cell were treated and analyzed as described in Example 4.
For "gymnotic delivery," the cells were not transfected with the
ASO, but instead were incubated with indicated concentrations of
unformulated ASO in MEM with high glucose (6 g/l; Invitrogen,
Carlsbad, Calif., USA) without L-glutamine for 8 days. The results
are presented in FIGS. 3B, 3C, 3J and 3K.
[0292] When using lipotransfection techniques, the ApoC3 homodimers
with more easily cleavable linkers (FIG. 3B, SEQ ID NOs: 15 and 17)
showed a higher knock-down activity than their less cleavable
counterpart (FIG. 3B, SEQ ID NO: 16). The same effect was seen with
gymnotic delivery (FIG. 3C). FIG. 3J shows that the knock-down
activity from the ApoC3 homodimer (SEQ ID NO: 15) is better
compared to the same sequence used as monomer (SEQ ID NO:30). FIG.
3K shows that the ApoC3 homodimer, if connected via a metabolically
unstable linker (SEQ ID NO: 15), is much more effective than its
counterpart connected by a stable linker (SEQ ID NO: 16).
Example 6
In Vitro Tests of Cleavable Vs. Noncleavable Linker Designs with
ApoB Homodimers (FIGS. 3D, 3E, 3H, 3I)
[0293] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The results
are presented in FIGS. 3D, 3E, 3H and 3I. In lipotransfection
assays, the ApoB homodimers with easily cleavable linkers (FIG. 3D,
SEQ ID NOs: 18, 20) showed a higher knock-down activity than their
metabolic more stable analog (FIG. 3D, SEQ ID NO: 19). The same
effect was seen with gymnotic delivery (FIG. 3E). FIG. 3H shows
that the knock-down activity from the ApoB homodimer (SEQ ID NO:18)
is better compared to the same sequence used as a monomer (SEQ ID
NO:13). FIG. 3I shows that the ApoB homodimer, if connected via a
metabolically unstable linker (SEQ ID NO: 18), is much more
effective than its counterpart connected by a stable linker (SEQ ID
NO:19).
Example 7
In Vitro Tests of Cleavable Linkers of Different Lengths with ApoB
Homodimers (FIG. 3F, 3G)
[0294] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The results
are presented in FIGS. 3F and 3G. For FIG. 3F, increasing numbers
of DNA-phosphodiester linkages (ranging from one (SEQ ID NO:44) to
eight (SEQ ID NO:49)) were used to link the ApoB ASO sequences. The
increasing the length of the linker did not have a significant
effect on the knockdown activity of the homodimer. FIG. 3G
demonstrates that using RNA-phosphorothioate linkers of different
lengths (from one (SEQ ID NO:51) to four (SEQ ID NO:54)) also did
not produce a significant impact on the knockdown activity of the
homodimer.
Example 8
In Vitro Activity Assessment of Knock-Down Activity of Cleavable
ApoB/ApoC3 ASO Heterodimers Using Lipotransfection and Gymnotic
Delivery (FIGS. 4A and 4B)
[0295] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The results
are presented in FIGS. 4A and 4B, wherein the monomers for ApoC3
(SEQ ID NO:30) and ApoB (SEQ ID NO: 13) show specific knock-down of
the target mRNA, the ApoC3/ApoB heterodimers (SEQ ID NOs:21 and 22)
show an intrinsic knock-down potential for both targets,
independent of the transfection method used (FIG.
4A--lipotransfection; FIG. 4B--gymnotic delivery).
Example 9
In Vitro Activity Assessment by Gymnotic Delivery for Knock-Down
Activity of Cleavable ApoB/ApoC3 Heterodimers with Various Chemical
Modifications (FIGS. 4C, 4D, 4E, 4F, 4G, 4H, 4I, and 4J)
[0296] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The results
are presented in FIGS. 4C and 4D. In FIG. 4C, all ApoC3/ApoB
heterodimers with different modifications (e.g., 2'-OMe, 2'F,
5-Prop.) showed a comparable knock-down activity toward both
targets. FIG. 4D shows that also 5-propynyl modifications (SEQ ID
NOs:41 and 42) and different amounts of LNA motifs (SEQ ID NO:40)
do not change the overall knock-down activity. However, using a
G-clamp modification for the ApoB ASO sequence (SEQ ID NO:38)
decreases the knock-down potential for ApoB mRNA. FIGS. 4F-J depict
the individual heterodimers versus the monomers used for the
design. In FIG. 4E, the heterodimer (SEQ ID NO:33) assembled from
SEQ ID NO: 13 and SEQ ID NO:55 increases in knock-down activity
toward both targets. In FIG. 4F, the heterodimer (SEQ ID NO:34)
assembled from SEQ ID NO: 13 and SEQ ID NO:56 increased in potency
in lower concentration only for the ApoB target. In FIG. 4G, the
heterodimer (SEQ ID NO:35) assembled from SEQ ID NO:13 and SEQ ID
NO:57 increased in potency in lower concentrations for ApoB, while
losing activity for ApoC3. In FIG. 4H, the heterodimer (SEQ ID
NO:36) assembled from SEQ ID NO:13 and SEQ ID NO:58 increased in
knock-down potency in lower concentrations for ApoB, while losing
activity for ApoC3. In FIG. 4I, the heterodimer (SEQ ID NO:39)
assembled from SEQ ID NO: 13 and SEQ ID NO: 1 increased in potency
in lower concentrations for ApoB, while showing a strong increase
in knock-down activity for ApoC3. In FIG. 4J, the heterodimer SEQ
ID NO:21 assembled from SEQ ID NO: 13 and SEQ ID NO:30 showed no
modification of knock-down for ApoB, while ApoC3 knock-down
activity decreased.
Example 10
Direct Comparison of Knock-Down Activity of a Cleavable
Hif-1Alpha/Survivin Heterodimer Versus its Parent Monomers Using
Gymnotic Delivery (FIG. 4K)
[0297] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The diagram in
FIG. 4K depicts that the assembled HiF-la/Survivin heterodimer (SEQ
ID NO:23) inherits the individual knock-down potentials of both
parent sequences (SEQ ID NOs:27 and 28).
Example 11
Direct Comparison of Knock-Down Activity of a Cleavable
HIF-1Alpha/ApoB Heterodimer Versus its Parent Monomers Using
Gymnotic Delivery (FIG. 4L)
[0298] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The diagram in
FIG. 4L depicts that the assembled HIF-1alpha/ApoB heterodimer (SEQ
ID NO:25) inherits the individual knock-down potentials of both
parent sequences (SEQ ID NOs:13 and 27).
Example 12
Direct Comparison Knock-Down Activity of a Cleavable
HIF-1Alpha/ApoB/ApoC3 Heterotrimers Versus its Parent Monomers by
Using Gymnotic Delivery (FIG. 4M)
[0299] Cell culture, knock-down analysis and transfection
procedures were performed as described in Example 5. The diagram in
FIG. 4M depicts that the assembled HIF-1alpha/ApoB/ApoC3
heterotrimer (SEQ ID NO:26) inherits the individual knock-down
potentials of all parent sequences (SEQ ID NO: 13, SEQ ID NO:27,
SEQ ID NO:30). A decrease in activity was observed for ApoC3 and
ApoB.
Example 13
Comparison of Dimer and Monomer Activity In Vivo
[0300] Acute in vivo activity assessments were performed in male
and female human ApoC3 transgenic mice (Jackson Labs Stock 905918,
B6; CBA Tg (APOC3) 3707Bres/J), which are on a C57BL/6 background
and express the human apoC3 gene including the human promoter. Male
(22-30 g) and female mice (20-25 g) employed in this study were 10
weeks old and fed regular chow diet.
[0301] ApoC3 ASO homodimers (SEQ ID NOs:4, 5, 2, or 3) or ApoC3 ASO
monomer SEQ ID NO: 1 were formulated in sterile PBS pH7.0 (Gibco)
for each dose immediately before subcutaneous (sc) injection.
Animals were administered equal volumes (100 .mu.l) of the
homodimers or monomer via sc route between the shoulder blades. A
control group was treated using equal volumes of PBS in parallel.
Each treatment group consisted of 3 male and 4 female transgenic
mice.
[0302] Mouse blood was collected at Day 0 and Day 7 via
submandibular puncture (50-75 .mu.l), as well as at study
termination (Day 14) by cardiac puncture, post-euthanasia. Blood
was collected in serum separator tubes at room temperature and
allowed to clot for 30 minutes. Tubes were spun at 1000 rpm for 5
min at room temperature and serum above separator layer was
collected and immediately aliquotted and frozen at -80.degree. C.
for future analysis. ApoC3 protein was determined using an ELISA
(Wang et al., J. Lipid Res., 2011, 52(6):1265-71).
[0303] Effects on ApoC3 expression in the liver were also assessed
at study termination (Day 14) and baseline ApoC3 mRNA levels were
determined from a group of mice euthanized on Day 0 of the study.
Liver lobes were excised immediately after euthanasia and snap
frozen in liquid nitrogen. RNA was subsequently isolated and ApoC3
mRNA expression was determined using the Affymetrix bDNA kit
(QuantiGene, Affymetrix). The ApoC3 mRNA expression was normalized
to mouse GAPDH, a housekeeper gene, and reported as percent ApoC3
knockdown (KD) when compared to a PBS-treated control group.
[0304] The results of the in vivo studies are shown in FIGS. 5A-C,
which demonstrate that under the conditions tested, the time course
of knock-down depended on the type of linker used to connect the
two antisense moieties in the dimeric antisense ODN. FIG. 5A
demonstrates an associated increased reduction of liver ApoC3 mRNA
levels in human ApoC3 transgenic mice following treatment with the
endonuclease-sensitive phosphodiester-linked homodimers (SEQ ID
NO:4 and SEQ ID NO:2). Human ApoC3 transgenic mice were
administered a single subcutaneous dose of homodimers SEQ ID NO:5
or 3, which are disulphide-linked homodimers of the same monomer
(each at 10 mg/kg), or vehicle. SEQ ID NO:4 and 2 exhibited an
increased reduction of liver ApoC3 mRNA levels compared to the
monomer (SEQ ID NO: 1) after 14 days. FIGS. 5B and 5C show ApoC3
protein knock-down 7 days (FIG. 5B) and 14 days (FIG. 5C) after a
single 10 mg/kg dose of the monomer and dimeric LNA gapmers (SEQ ID
NO:4 and 3) in human ApoC3 transgenic mice. The
3'3'-phosphodiester-linked dimer with a total of eight
phosphodiester linkages (SEQ ID NO:4) shows the fastest onset of
knockdown after a single 10 mg/kg dose. This demonstrates that the
pharmacokinetic/pharmacodynamic properties can be modulated by
selecting a desirable linker.
Example 14
Biodistribution of Dimers
[0305] In a separate in vivo experiment, the bio-distribution of
three dimers SEQ ID NOs:4, 2 and 3 was investigated in mice. The
cleavage products were analyzed by capillary gel electrophoresis
(CGE) which was performed on a PACE/MDQ system (Beckman Coulter)
equipped with the Karat 7.0 software (Beckman Coulter). Further
parts were: eCAP DNA capillary, neutral, 21 cm, 100 .mu.m I.D.
(Beckman #477477); ssDNA 100 R gel (Beckman #477621); buffer:
Tris/boric acid/EDTA buffer containing 7 M urea (Beckman #338481).
The cleavage products were further characterized using LC-ESI-TOF
experiments which were performed on a Bruker Esquire 6000 and an
Agilent 1200 HPLC system, together with Waters ACQUITY UPLC OST C18
1.7 .mu.m (part #186003949) column. Tissue homogenization was done
with a Multi-Tube Vortexer (VWR) and Lysing Matrix D (MP
Biomedicals). Plate shaking was done using a VarioMag monoshaker.
Deep-well plates were from VWR (2.2 ml, cat. No. 732-0585) and were
sealed with Clear seal diamond foil (Thermo, cat. No. 732-4890)
prior to tissue homogenization and were resealed for
phenol/chloroform-extraction using Re-Seal (3M Empore
98-0604-0472-4 adhesive). Acetonitrile was purchased from Merck.
Phenol/chloroform/isoamyl alcohol (25:24:1, P2069-100ML) and
dithiothreitol (DTT, cat. No. 43816) were from Sigma, Proteinase K
was from Qiagen (cat. No. 19133), Slide-A-lyzer (200 .mu.l, 10 kDa
cut-off) were purchased from Fisher Scientific. High-grade 18
MOhm.sup.-1 water (Millipore Milli-Q system) was used for reagent
and sample preparations. A TomTec Quadra3 system was used for all
liquid handling steps.
Plasma and Liver Homogenate Stability Experiments
[0306] Stock solutions with a final concentration of 600 .mu.M and
a final volume of 100 .mu.L have been prepared of all
oligonucleotides.
[0307] Twelve pieces of approximately 50 mg of liver from CD1 mouse
(female, Charles River) were added to individual Lysing matrix
tubes. A calculated volume of 1.times.PBS to give a final
concentration of 5% liver (W/W) was added to each of the twelve
tubes. All samples were homogenized using a Biorad Fast prep
System. The resulting homogenate solutions were combined to give
about 12 ml of 5% liver homogenate in 1.times.PBS which was
subsequently used for incubation.
[0308] Plasma was Na-Citrate plasma from female NMRI mouse (Charles
River) K-EDTA plasma from male Cynomolgous monkey (Seralab
International).
[0309] Four samples of each oligo were prepared representing each
individual incubation time point (0, 7, 24 and 48 h) in mouse and
monkey plasma and in mouse liver homogenate, respectively. In
addition, a blank sample and a recovery sample were prepared of
each oligo and incubation matrix. Generally, plasma samples were
prepared by adding 5 .mu.l of the 600 .mu.M oligo stock solution to
95 .mu.l of mouse or monkey plasma, respectively, with a final
oligo concentration of 30 .mu.M. Recovery samples were prepared by
adding 5 .mu.l of water to 95 .mu.l of plasma. Blank samples are
oligo in water with a final concentration of 100 .mu.M. Liver
samples and recoveries were prepared equally; apart from the fact
that liver homogenate in PBS was used instead of plasma.
Analysis of the Study Samples
[0310] Samples were analyzed in 96-well plate format. A standard
curve with 8 standards (5, 10, 15, 20, 50, 75, 90, 100 .mu.g/ml; 25
.mu.g/ml IS), a standard 0 (0 .mu.g/ml; 25 .mu.g/ml IS) and three
recovery samples (20, 50, 100 .mu.g/ml; 25 .mu.g/ml IS) has been
prepared for each oligo. Samples and standards of one particular
oligo were analyzed together on the same plate.
[0311] Standards were prepared as follows. A piece of approximately
50 mg of tissue was cut from the respective organ tissue, weighted
and placed into the respective well of a 2.2 ml 96-deepwell plate
(VWR 732-0585). Two steel balls (5 mm diameter, KGM Kugelfabrik
GmbH, part #1.3541) were placed into each well and 500 .mu.l
homogenization buffer (vide infra), 20 .mu.l DTT (1 M, Sigma
43816), 50 .mu.l of proteinase K solution (Qiagen, 19133) was
added. Furthermore, 10 .mu.l working solution analyte and 10 .mu.l
working solution internal standard was added into each well of the
standards to give the corresponding final concentrations of (5, 10,
15, 20, 50, 75, 90, 100 .mu.g/ml; 25 .mu.g/ml IS). Standard 0 and
recoveries were spiked with 10 .mu.l working solution internal
standards only; recoveries were spiked with 10 .mu.l working
solution analyte after the entire extraction process and prior to
analysis.
[0312] A piece of approximately 50 mg of tissue was cut from the
respective organ tissue, weighted and placed into the respective
well of a 96-deepwell plate. Two steel balls were placed into each
well and 500 .mu.l homogenization buffer 20 .mu.l DTT (1 M), 50
.mu.l of proteinase K solution was added. The plate was sealed with
STAR lab foils (StarLab E 2796 3070) and samples are homogenized
using a Qiagen Tissue Lyzer for 3.times.30 s at 17 Hz. Subsequently
the plate was incubated in a water bath for 2 h at 55.degree. C.
followed by transfer of the samples to a new 96-deepwell plate
using an automated liquid-handling system (TomTec Quadra 3). After
the addition of 200 .mu.l ammonium hydroxide (25%) and 500 .mu.l
Phenol/Chloroform/Isoamyl alcohol (25:24:1) the plate was vortexed
using a Multitubevortex for 5 min. Subsequently, the plate was
incubated for 10 min at 4.degree. C. and centrifuged at 4.degree.
C. for another 10 min at 3500 RCF. The plate was then handled to
the TomTec System which was used to remove the aqueous layer. The
remaining organic layer was washed by adding 500 .mu.l water. The
aqueous phase was again removed using the TomTec system. The
aqueous phases were combined, 50 .mu.l HCl (1 N), 500 .mu.l SAX
Load High buffer (vide infra) and 300 .mu.l acetonitrile was added
and the resulting solution was mixed thoroughly by up and down
pipetting using the TomTec system. (`The program "SPE extraction of
tissue samples 100416" was used for the subsequent solid-phase
extraction procedure).
[0313] Briefly: VARIAN Bond Elute 96 square-well SAX 100 mg (Cat.
No. A396081C) were equilibrated with acetonitrile, water and SAX
load buffer (see below), samples were load and washed with SAX load
buffer. The samples were eluted with SAX elute buffer (vide infra)
and subsequently diluted with SAX/RP dilution buffer (vide infra).
WATERS Oasis HLB LP 96-well Plate 60 .mu.m 60 mg (Part No.:
186000679) were equilibrated with acetonitrile, water and SAX
dilution buffer (vide infra). The samples were load and the
cartridge washed with water. The samples were eluted with RP elute
buffer (vide infra).
[0314] Freeze the elution plate for 1 h at -80.degree. C. and
lyophilize to dryness. The dried samples are reconstituted in 50
.mu.l water and dialyzed for 60 min against water using Thermo
Slide-A-Lyzer. The samples were then subjected to CGE analysis on a
Beckman Coulter PACE/MDQ system. The conditions were: (i)
Capillary: eCAP DNA, neutral, 21 cm, 100 .mu.m I.D. (Beckman
#477477); (ii) Capillary temperature: 20.degree. C.; (iii) Sample
storage temperature: 10.degree. C., (iv) Gel: ssDNA 100 R (Beckman
#477621) (v) Buffer: Tris/boric acid/EDTA buffer containing 7 M
Urea (Beckman #338481) (vi) Detection wavelength: 260 nm; (vii)
Separation voltage: 30 kV; (viii) Injection time: 60 s; (ix)
Injection voltage: 10 kV; (x) Run time: 20 minutes; (xi) Data
acquisition rate: 4 pt/sec. Analysis was done using the Karat 7.0
software (Beckman).
[0315] All samples and recoveries were incubated at 37.degree. C. A
sample of each oligo and type of matrix was cooled to room
temperature after 0, 7, 24 and 48 h and was subjected to
Phenol/Chloroform purification. To this end, 370 .mu.l of ammonium
hydroxide (15%), 10 .mu.l dithiothreitole (DTT, 1 M, Sigma 43816)
and 800 .mu.l premixed Phenol/Chloroform/Isoamyl alcohol (Sigma
P2069) was added to each sample. The sample was vortexed for 10 min
at maximum vortex speed and then incubated at 4.degree. C. for 20
min. Subsequently, the sample was centrifuged at 3500 RFC for 20
min at 4.degree. C. and 400 .mu.l of the aqueous layer were removed
and dried in a lyophilizer. The dried samples were dissolved in
water (100 .mu.l). The recovery samples were dissolved in water (95
.mu.l) and spiked with 5 .mu.l of the respective oligo stock
solution (600 .mu.M). Samples were analyzed by LC-MS (Agilent 1200,
Bruker Esquire 3000) using a Waters Acquity UPLC OST C18 column
(1.7 .mu.m, 2.1.times.50) with HFIP/TEA/water (385 mM
1,1,1,3,3,3-hexafluoroisopropanol, 14.4 mM triethylamine in water)
as buffer A and methanol as buffer B and a flow rate of 0.3 ml/min
at a column temperature of 60.degree. C. The following gradient was
used: 3 min at 5% B, 5-15% B in 2.5 min (10%/min), 15-23% B in 5.5
min, 23-30% B in 3 min, 30-100% B in 0.5 min, 5 min at 100% B,
100-5% B in 0.5 min, 5 min at 5% B.
[0316] Surprisingly, the levels of dimers in the liver (organ
target for ApoB and ApoC3) and kidney were dramatically increased
after a single i.v. bolus injection. It was found that about 10 to
16% monomeric metabolite of the total dose in liver 24 hours after
injection of the dimers (Table 5), while previously it was known
that only 2 to 5% of the total dose of the monomeric 14-mer (SEQ ID
NO: 1)) in mice or monkeys (Table 6) was detected in a separate
study. Accordingly, dimers exhibited significantly higher
biodistribution to liver and kidney as compared to the monomers.
Table 5 shows organ-distribution of antisense dimers SEQ ID NO:2, 3
and 4 as percent of total administered dose 24 hrs after a single
i.v. bolus injection into mice. (Peak 1 refers to the degradation
product, whereas Peak 2 is remaining dimer starting material. The
sum of both components represents the percentage of total dose in
the corresponding organ.) Organ-distribution of monomeric SEQ ID
NO: 1 as percent of total administered in mice and monkeys in
previous studies as compared to the dimers (last row) is shown
Table 6. Percent total dose calculation based on: 5 kg monkey, 135
g liver, 30 g kidney (Davies et al., Pharm. Res., 1993, 10
(7):1093).
TABLE-US-00006 TABLE 5 Linker Oligo Animal Peak 1 Peak 2 %
totaldose* Liver Diester SEQ ID NO: 2 1-3 8.1 .mu.g/g 9.1 .mu.g/g
14% SS SEQ ID NO: 3 4 & 6 20.8 .mu.g/g -- 16% Diester SEQ ID
NO: 4 7-9 12.2 .mu.g/g -- 10% doubler Kidney Diester SEQ ID NO: 2
1-3 16.7 .mu.g/g 58.1 .mu.g/g 15% SS SEQ ID NO: 3 4-6 29.9 .mu.g/g
47.4 .mu.g/g 15% Diester SEQ ID NO: 4 7 & 9 54.9 .mu.g/g 6.4
.mu.g/g 12% doubler *based on 25 g mouse, 2 g liver, 0.5 g
kidney
TABLE-US-00007 TABLE 6 Study Liver Kidney SEQ ID NO: 1 2.5-5%
1.2-3% Monkey tox 13 .mu.g/g (2 mpk) 60 .mu.g/g (2 mpk) 2, 10, 60
mpk 50 .mu.g/g/10 mpk) 300 .mu.g/g (10 mpk) Necrop @ day 25 300
.mu.g/g (60 mpk) 800 .mu.g/g (60 mpk) 4 doses @ day 1, 8, 15, 22
SEQ ID NO: 1 0.3% total dose 0.4% total dose Mouse tox 3.7 .mu.g/g
21 .mu.g/g Twice/week 25 mpk Necrop @ day 15 (100 mpk) SEQ ID NO: 1
4.1% (30 mpk) 6% (30 mpk) Monkey PK 3.6% (3 mpk) 16% (3 mpk) Single
bolus iv 45 .mu.g/g (30 mpk) 300 .mu.g/g (30 mpk) 3, 30 mpk 4
.mu.g/g (3 mpk) 80 .mu.g/g (3 mpk) Necrop @ 24 h SEQ ID NO: 2, 3
10-16% 12-15% or 4 (dimers) 16 .mu.g/g (10 mpk)* 70 .mu.g/g (10
mpk)* Mouse *mean over 3 *mean over 3 Single bolus iv 10 mpk Necrop
@t 48 h
[0317] The high levels of the monomeric equivalent (peak 1) were
very surprising, since most of the injected dimer was already
processed to a monomeric form (left peak 1 with shortest retention
time, as shown in FIG. 6). In the case of dimer of SEQ ID NO:2, the
intact dimer was detected at 6.458 min), as well as the monomer and
the monomer with an additional dT (SEQ ID NO: 1 plus dT) from the
incomplete cleavage of the linker. The internal standard (IS) is
poly-(dT).sub.30 phosphorothioate. The dimers SEQ ID NOs:4 and 2
were already completely converted to the monomeric forms comprising
the monomer (SEQ ID NO: 1) and the monomer plus dT. In case of
dimer SEQ ID NO:3 with a disulfide linker, the monomeric cleavage
product was slightly larger than monomer resulting from reductive
disulfide cleavage and is indicated as "#1 plus X" in the figure,
where X is a yet unidentified organic radical with the molecular
weight of less 100 Da. It could be hypothesized that that "#1 plus
X" results from oxidative cleavage rather than reductive cleavage
of the disulfide bond. If the dimers had been already cleaved in
the serum, the bio-distribution to liver and kidneys should not
have increased so dramatically as compared to monomers. Thus, the
stability of the dimers in plasma and in liver homogenates was
investigated. It was demonstrated in Example 3 that plasma
stability of the dimers is relatively high over 48 hours, while the
dimers are rapidly cleaved in liver homogenates. Further cleavage
product analysis of samples extracted from the liver homogenate
treatment showed that the dimer is completely converted to the
monomeric form. This observation is compatible with a
bio-distribution mechanism, in which dimers are relatively stable
after injection into animal. The dimers distributed more
efficiently to the organs like liver and kidney as opposed to the
corresponding monomer. In the organs (e.g., liver and kidney), the
dimer is cleaved to the monomer and can act as a normal antisense
oligonucleotide. Since the dimers are stable in serum (plasma), the
linkers can be designed to undergo an organ-specific cleavage by
using appropriate linker chemistry.
Example 15
In Vivo Activity Assessment of a Cleavable ApoC3/ApoB ASO
Heterodimer
[0318] In vivo activity of a heterodimer of a human ApoC3 ASO
linked to an ApoB ASO with a cleavable linker was assessed in male
and female human ApoC3 transgenic mice which were 14-18 weeks old
at termination.
[0319] The ApoC3/ApoB ASO heterodimer (SEQ ID NO: 21) or a
non-targeting ASO (SEQ ID NO: 119) were formulated in sterile
saline (pH7.0) immediately before intravenous (iv) injection via
the tail vein. Animals were administered heterodimer (0.3, 1, 3, or
10 mg/kg) or negative control ASO (10 mg/kg) or saline (0 mg/kg) as
a vehicle control in a volume of 5 ml/kg.
[0320] Groups of mice consisted of 2 male and 2 female transgenic
mice which were terminated on days 1, 3, 7, 14 and 29 after
treatment administration. After euthanasia by CO.sub.2 inhalation,
blood was obtained by cardiac puncture (0.5-1 ml). Livers were
dissected, weighed, and a fragment saved in a labeled histology
cassette snap frozen by immersion in liquid nitrogen. Liver samples
were maintained at -80.degree. C. for subsequent analyses.
[0321] Each blood sample was divided in half. Serum was prepared in
serum separator tubes which were allowed to clot for 4 hours on
ice. Plasma was prepared in EDTA-containing tubes which were
maintained on ice until processed. Tubes were spun at 10,000 rpm
for 5 min at 4.degree. C. and supernatants collected and frozen at
-80.degree. C. for future analyses.
Quantification of Target mRNAs
[0322] Total liver RNA was isolated in TRIzol reagent (Ambion) from
snap frozen tissue homogenized in Fastprep24 Lysing Matirx D tubes
(MP Biomedicals). Trizol-chloroform extraction was followed by
further purification using a column-based method (Qiagen, RNeasy)
as per manufacturer's instruction. Purification included treatment
with DNase I for 15 minutes at room temperature (Qiagen, Rnase-Free
Dnase). RNA quantity and purity were evaluated
spectophotometrically by readings at 260 nm and 280 nm (Nanodrop).
Liver fragments were lysed with RLT buffer and QIAshredder columns
(Qiagen), and then purified by RNeasy columns as indicated
above.
[0323] Samples were amplified as per manufacturer's instructions
(Qiagen, Quantitect Probe RT-PCR kit). Quantitative real-time PCR
(qRT-PCR) was performed in a 7900HT Fast Real-Time PCR System
(Applied Biosystems). All samples were analyzed in triplicate in
Microamp Optical 384 well reaction plates (Applied Biosystems) and
normalized with Gapdh signal as the internal control. Primers were
Apolipoprotein C-III (Applied Biosystems, Mm00445670_m1 and
Hs00163644_m1), Apolipoprotein B (Applied Biosystems, Mm01545156_m1
and Hs01071209_m1), and Mouse GAPDH (Applied Biosystems, 4352932E).
Results are expressed as fold induction relative to vehicle-treated
samples.
[0324] Data for each of the target mRNAs were analyzed by two-way
ANOVA using "time" and "treatment" as the variables in GraphPad
Prism software. Bonferroni post-hoc tests were conducted when
significant main effects (p.ltoreq.0.05) were observed.
[0325] The results of this in vivo experiment are shown in FIGS. 7A
and 7B. The data demonstrate that SEQ ID NO: 21, an ApoC3/ApoB
heterodimer ASO with an endonuclease sensitive phosphodiester
linker, significantly down-regulated liver expression of both
target mRNAs [i.e, human APOC3 (FIG. 7A) and mouse ApoB (FIG. 7B)].
Target mRNA knockdown was dependent on both administered dose and
time. That is, in animals which received more ASO construct, a
greater target knockdown was observed. The greatest degree of
knockdown for any dose level was observed during the first week
post-administration, with significant effects persisting until 29
days post-administration, the longest time point at which samples
were obtained.
Example 16
In Vivo Comparison of Heterodimer ASOs and Monomers: Effects on
Target mRNAs
[0326] In vivo activity of three heterodimers of a human ApoC3 ASO
linked to an ApoB ASO, the ApoC3 ASO monomer, the ApoB ASO monomer
and the physical combination of the two monomers was assessed in
male human ApoC3 transgenic mice which were 9-18 weeks old at
termination.
[0327] An ApoC3/ApoB ASO heterodimer linked with four diester bases
(cleavable; SEQ ID NO: 21), or an ApoC3/ApoB ASO heterodimer linked
with four phosphothioate bases (stable; SEQ ID NO: 59), or an
ApoC3/ApoB ASO heterodimer linked with PEG-6 (stable; SEQ ID NO:
60), or the ApoC3 monomer ASO (SEQ ID NO: 30), or the ApoB monomer
ASO (SEQ ID NO: 13), or the physical combination of the ApoC3 and
ApoB monomers (SEQ ID NO: 30 plus SEQ ID NO: 13), or a
non-targeting ASO (SEQ ID NO: 119) were formulated in sterile
SALINE (pH7.0) immediately before intravenous (iv) injection via
the tail vein. Animals were administered equal molar amounts of
heterodimer (0.3 .mu.Mol/kg.about.3 mg/kg), monomer (0.3
.mu.Mol/kg.about.1.3 mg/kg), co-formulated monomers (0.3 .mu.Mol/kg
each) or negative control ASO (0.3 .mu.Mol/kg.about.1.4 mg/kg) or
SALINE (0 mg/kg) as a vehicle control at a volume of 5 ml/kg.
[0328] Groups consisted of 6-7 male transgenic mice which were
terminated 3 or 14 days after treatment administration. After
euthanasia by CO.sub.2 inhalation, blood was obtained by cardiac
puncture (0.5-1 ml). Livers were dissected, weighed, and a fragment
put in a labeled histology cassette snap frozen by immersion in
liquid nitrogen. Whole kidneys were also stored in labeled
histology cassettes and snap frozen in liquid nitrogen. Liver and
kidney samples were maintained at -80.degree. C. for subsequent
analyses.
[0329] Each blood sample was divided in half. Serum was prepared in
serum separator tubes which were allowed to clot for 4 hours on
ice. Plasma was prepared in EDTA-containing tubes which were
maintained on ice until processed. Tubes were spun at 10,000 rpm
for 5 min at 4.degree. C. and supernatants collected and frozen at
-80.degree. C. for future analyses.
[0330] Data for each of the target mRNAs on either Day 3 or Day 14
were analyzed by one-way ANOVA followed by Dunnett's post-hoc test
to determine differences between treatments using GraphPad Prism
software.
[0331] The effects of these treatments on in vivo target mRNAs in
the liver are shown in FIGS. 8A and 8B. Data in these figures are
plotted as % knockdown of the target mRNAs with knockdown of mouse
apoB mRNA plotted on the x axis and knockdown of human ApoC3 (i.e.,
the transgene) plotted on the y axis. The data demonstrate that SEQ
ID NO: 21, an ApoC3/ApoB heterodimer ASO with an endonuclease
sensitive phosphodiester linker, was superior to all other
treatments on both day 3 (FIG. 8A) and day 14 (FIG. 8B) in the
extent to which it down-regulated liver expression of both target
mRNAs.
[0332] On day 3 (FIG. 8A), ApoB mRNA in the liver was significantly
decreased by all treatments, except the ApoC3-targeted ASO monomer
(SEQ ID NO: 30) and the negative control ASO (SEQ ID NO: 119). In
general, the effectiveness of constructs given on day 0 to suppress
target mRNAs was weaker 14 days after treatment administration than
observed 3 days post-treatment. Nevertheless, ApoB mRNA in the
liver (FIG. 8B) was suppressed by all treatments except the
ApoC3-targeted ASO monomer (SEQ ID NO: 30), the ApoC3/ApoB ASO
heterodimer linked with PEG-6 (stable; SEQ ID NO: 60, and the
negative control ASO (SEQ ID NO: 119). Importantly, treatment with
SEQ ID NO: 21, an ApoC3/ApoB heterodimer ASO with an endonuclease
sensitive phosphodiester linker resulted in significantly greater
knockdown of liver ApoB mRNA than any other treatment at each of
the times at which samples were taken (FIGS. 8A and 8B).
[0333] Qualitatively similar results were observed for knockdown of
human ApoC3 mRNA in these human ApoC3 transgenic mice. On Day 3
(FIG. 8A), the ApoC3 monomer (SEQ ID NO: 30), the physical
combination of the ApoC3 and Apo B monomers (SEQ ID NO: 30 plus SEQ
ID NO: 13), the ApoB monomer (SEQ ID NO: 13), and the ApoC3/ApoB
ASO heterodimer linked with four diester bases (cleavable; SEQ ID
NO: 21) significantly decreased expression of human ApoC3 mRNA. On
Day 14 (FIG. 8B), only the ApoC3/ApoB ASO heterodimer linked with
four diester bases (cleavable; SEQ ID NO: 21) significantly
suppressed expression of human ApoC3. Similar to its effectiveness
in suppressing ApoB, administration of SEQ ID NO: 21 resulted in
significantly greater knockdown of liver human ApoC3 mRNA
expression than any other treatment (FIGS. 8A and 8B).
Example 17
Tissue Stability of Heterodimer ASOs
[0334] Hybridization assays were developed (see below) to measure
the tissue concentrations of the ApoC3/ApoB ASO heterodimer linked
with four diester bases (cleavable; SEQ ID NO: 21), the ApoC3/ApoB
ASO heterodimer linked with four phosphothioate bases (stable; SEQ
ID NO: 59), and the ApoB monomer ASO (SEQ ID NO: 13) in plasma and
homogenates of liver and kidney. Samples from the experiment
described in Example 16 were measured.
Capture and Detection Probes:
[0335] Complementary hybridization probes to the hetero-dimeric
ASOs were designed and custom synthesized with LNA-modified
phosphodiester backbones (BioSpring GmbH). The capture probes
contained an amino linker (C12-amino) and Spacer-18s
(hexaethyleneglycole phosphate, PEG-282) at the 5'-end. The
detection probes contain Spacer-18s at the 3'-end of the specific
probe sequence and were biotin labeled at the 3'-end (Elfer et al.,
2005). The specific sequences of capture and detection probes used
in the assays are showed in table below.
TABLE-US-00008 TABLE 7 Capture and Detection Probes used in
Hybridization Assays SEQ ID Probe NO Sequences Dimer Capture 120
5'- Probes amiC12; heg; heg; lnaG; lnaC; lnaA; lnaA; lnaA; lnaA;
lnaA; lnaG-Sup-3' Detec- 122 5'- tion lnaT; lnaC; lnaA; lnaG; lnaT;
lnaG; lnaC; heg; heg; biodT; bioTEG-3' apoB Capture 124 5'-amiC12;
heg; heg; lnaT; lnaG; lnaA; lnaA; Probes lnaT; lnaA; lnaC-Sup-3'
Detec- 121 5'-lnaC; lnaA; lnaA; lnaT; lnaG; lnaC; heg; heg; tion
biodT; bioTEG-3'
Chemistry:
Synthesis of Oligonucleotide:
[0336] The procedure below covers the synthesis of two
oligonucleotides [SEQ ID NO: 59
(5'-lnaGs;lna5mCs;dAs;dCs;dTs;dGs;dAs;dGs;dAs;dAs;dTs;dAs;lna5mCs;lnaTs;d-
Ts;dTs;dTs;dTs;l
naGs;lna5mCs;dAs;dTs;dTs;dGs;dGs;dTs;dAs;dTs;lnaTs;lna5mCs;lnaA-Sup-3')
and SEQ ID NO: 60
(5'-lnaGs;lna5mCs;dAs;dCs;dTs;dGs;dAs;dGs;dAs;dAs;dTs;dAs;na5mCs;naT;heg;-
naGs;na5mC
s;dAs;dTs;dTs;dGs;dGs;dTs;dAs;dTs;lnaTs;lna5mCs;lnaA-Sup-3')]. The
synthesis was performed using a standard synthesis protocol on an
AKTA oligopilot 10 Plus synthesizer using the conditions summarized
in Table 8.
TABLE-US-00009 TABLE 8 Oligonucleotide Synthesis Conditions Column
size/scale 3.5 ml/63 .mu.mol Solid support; loading Nittophase
Universal Support; 100 .mu.mol/g Amidite concentration 0.1M Amidite
equivalents 4
[0337] The oligonucleotide was cleaved from solid support using a
solution of ammonium hydroxide and ethanol (3:1) at 55.degree. C.
for 17 hours. The crude oligonucleotides were purified in a
two-step IEX-purification procedure using a Source 30Q column and
buffer system containing sodium hydroxide. The mass spectrometer
analysis was done using ESI-MS and the purity was established using
HPLC and generic method. The endotoxin levels were measured using
LAL-test procedure.
Synthesis of Capture and Detection Probes:
[0338] This procedure covers the synthesis of both capture and
detection probes [SEQ ID NO: 120
(5'amiC12;heg;heg;lnaG;lnaC;lnaA;lnaA;lnaAnaA;lnaA;naG-Sup3'); SEQ
ID NO: 122
(5'-lnaT;lnaC;lnaA;lnaG;lnaT;lnaG;lnaC;heg;heg;biodT;bioTEG-3');
SEQ ID NO: 123
(5'-amiC12;heg;heg;lnaT;lnaG;lnaA;lnaA;lnaT;lnaA;lnaC-Sup-3') and
SEQ ID NO: 121
(5'-lnaC;lnaA;lnaA;lnaT;lnaG;lnaC;heg;heg;biodT;bioTEG-3')]. The
synthesis was performed using a standard synthesis protocol on an
AKTA oligopilot 10 Plus synthesizer using the conditions summarized
in Table 9.
TABLE-US-00010 TABLE 9 Conditions Used to Synthesize Capture and
Detection Probes Column size/scale 1.2 ml/22 .mu.mol or 17 .mu.mol
Solid support; loading Nittophase Universal Support; 100 .mu.mol/g
Amidite concentration 0.1M Amidite equivalents for LNA 5 Amidite
equivalents for 3 Spacer-18 and NH2-C12-amino
[0339] The oligonucleotide was cleaved from solid support using a
solution of ammonium hydroxide and ethanol (3:1) at 55.degree. C.
for 17 hours. The crude oligonucleotides were purified in a
two-step RP-/IEX-purification procedure. The RP-purification was by
applying a TEAA-containing buffer system, the IEX purification was
carried out at physiological conditions. The mass spectrometer
analysis was done using ESI-MS and the purity was established using
HPLC and generic method.
Tissue Sample Preparation:
[0340] Liver and kidney homogenate was prepared from animals
treated with heterodimeric or monomeric ASOs. Tissue samples
collected at specified time points were minced and weighed in
ready-to-use Lysing Matrix D tubes containing 1.4 mm ceramic
spheres beads (Catalogue#6913-100, MP Biomedicals). DNase/RNAse
free water (Catalogue #SH30538.02, Thermo) was added to the tube
with ratio of 5 or 10 mL per g of tissue. Each tissue sample was
mixed and homogenized using a MP Biomedicals Fast Prep-24 at
4.degree. C. for 20 seconds twice. The tissue homogenate was stored
in freezer or kept on ice before analyzed with the hybridization
assay.
Preparation of Standards and Controls:
[0341] Standards and assay quality controls (QCs) were prepared in
K2 EDTA plasma or control tissue matrix and diluted serially in
2-fold steps from 100 ng/mL to 0.098 ng/mL. The QCs were set at 50
ng/mL, 40 ng/mL, 10 ng/mL, 1 ng/mL and 0.4 ng/mL. The standards and
QCs were analyzed by the hybridization assay with the samples.
Hybridization methods with colorimetric detection:
[0342] DNA-Bind plates (96-well) (Catalogue #2505, Costar) were
coated overnight at 4.degree. C. with 100 .mu.L of 50 nM capture
probes in HEPES/1 mM Na.sub.2 EDTA buffer. The plates were then
washed three times with wash buffer (Tris Buffer/0.1% Tween 20) and
incubated in blocking buffer (PBS/3% BSA) for 1-2 hrs. 30 .mu.L of
Samples, Standards, and QCs were mixed with 270 .mu.L of 50 nM
detection probe in hybridization buffer (4.times.SSC/0.5% Sarkosyl)
in Costar cluster tubes and two 100 .mu.L aliquots from the mixture
were transferred into 96-well PCR plate and denatured on the
thermocycler for 12.5 minutes at 95.degree. C. After the samples
were cooled to 40.degree. C., they were transferred to DNA-Bind
plate already coated with capture probe. The plate was sealed and
incubated at 40.degree. C. for two hours. Following the
hybridization, Poly-HRP Streptavidin conjugate (Catalogue #N200,
Thermo) at 1:10,000 dilution in Poly-HRP dilution buffer (Catalogue
#N500, Thermo) was added. Color development was initiated by adding
SureBlue TMB substrate (Catalogue #52-00-00, KPL) and stopped with
stop reagent for TMB substrate (Catalogue #S5814, Sigma).
Results:
[0343] The ApoC3/ApoB ASO heterodimer linked with four diester
bases (cleavable; SEQ ID NO: 21) or the ApoC3/ApoB ASO heterodimer
linked with four phosphothioate bases (stable; SEQ ID NO: 59) were
spiked into liver or kidney (n=2 each) and homogenized as described
above. The homogenate was divided into two aliquots. One of the
aliquots was stored at -80.degree. C., the other aliquot was placed
at 37.degree. C. for 15 hours before storage at -80.degree. C. The
two aliquots were thawed and analyzed together for the
concentration of heterodimeric ASOs and apoB monomer with the
hybridization assay.
[0344] As shown in FIGS. 9A and 9B, concentrations of both
heterodimers were lower after overnight incubation at 37.degree.
C., suggesting degradation in tissue at physiological temperature.
The ApoB monomer ASO was detectable as a metabolite in both liver
and kidney samples spiked with the ApoC3/ApoB ASO heterodimer
linked with four diester bases (cleavable; SEQ ID NO: 21) and the
levels were more than 5 fold higher in samples incubated at
37.degree. C. After spiking with the ApoC3/ApoB ASO heterodimer
linked with four phosphothioate bases (stable; SEQ ID NO: 59), the
ApoB monomer ASO was only detectable in liver homogenates which had
been frozen. Taken together, the data suggest that SEQ ID NO: 21 is
degraded to active ApoB monomer (SEQ ID NO: 13) metabolite more
readily from the ApoC3/ApoB ASO heterodimer linked with four
diester bases (SEQ ID NO: 21) than from the ApoC3/ApoB ASO
heterodimer linked with four phosphothioate bases (stable; SEQ ID
NO: 59).
Example 18
In Vivo Distribution of Heterodimer ASOs and ApoB Monomer ASO
[0345] In plasma, heterodimer ASOs and the ApoB monomer were
measured using the methods above in 2 pools of 3 individuals each
after treatment with the ApoC3/ApoB ASO heterodimer linked with
four diester bases (cleavable; SEQ ID NO: 21), the ApoC3/ApoB ASO
heterodimer linked with four phosphothioate bases (stable; SEQ ID
NO: 59), the ApoB monomer ASO (SEQ ID NO: 13) or the physical
combination of the ApoC3 and ApoB monomer ASOs (SEQ ID NO: 30 plus
SEQ ID NO: 13). As shown in FIG. 10, both heterodimer ASOs were
detected in plasma 3 days post-treatment. ApoB monomer was also
detected 3 days after treatment with the ApoB monomer ASO alone or
in physical combination with the ApoC3 monomer. However, ApoB
monomer ASO was detected as a metabolite of the ApoC3/ApoB ASO
heterodimer linked with four diester bases (cleavable; SEQ ID NO:
21) 3 days after treatment, but not after administration of the
ApoC3/ApoB ASO heterodimer linked with four phosphothioate bases
(stable; SEQ ID NO: 59), demonstrating that the endonuclease
sensitive linker resulted in enhanced metabolism to active ASO
monomers. None of the analytes were detected in plasma pools taken
14 days after treatment.
[0346] Differences between heterodimer or monomer concentrations in
tissues were determined statistically by unpaired t-test
(heterodimers) or one-way ANOVA followed by Bonferroni post-hoc
comparisons (monomers) using GraphPad Prism.
[0347] In the kidney, measured concentrations of all administered
constructs and the ApoB monomer metabolite decrease significantly
between 3 and 14 days after administration. The decline in the
concentrations of the ApoC3/ApoB ASO heterodimer linked with four
diester bases (cleavable; SEQ ID NO: 21) is the most rapid/marked,
which is compatible with the hypothesis that the construct is most
vulnerable to metabolism via cleavage of the linker (see FIGS. 11A
and 11B). On both day 3 and day 14, levels of the ApoB monomer are
lowest after administration of the ApoC3/ApoB ASO heterodimer
linked with four phosphothioate bases (stable; SEQ ID NO: 59) while
the levels of intact SEQ ID NO: 59 are the highest of the
constructs measured. Taken together, these observations demonstrate
slower metabolism of the relatively stable phosphothioate
linker.
[0348] In liver, the ApoC3/ApoB ASO heterodimer linked with four
diester bases (cleavable; SEQ ID NO: 21) was present at lower
concentrations than the ApoC3/ApoB ASO heterodimer linked with four
phosphothioate bases (stable; SEQ ID NO: 59) after treatment with
the respective constructs (see FIGS. 12A and 12B), demonstrating
that SEQ ID NO: 21 is metabolized more quickly in liver. Monomer
levels that were measured on day 3 and 14 were significantly lower
after administration of the ApoB monomer (SEQ ID NO: 13) either
alone or in physical combination with the ApoC3 monomer than after
administration of with either of the measured heterodimer of
ApoC3/ApoB ASOs. On day 3, the concentration of ApoB monomer
present in the liver as a metabolite after heterodimer
administration was significantly higher after administration of the
ApoC3/ApoB ASO heterodimer linked with four diester bases
(cleavable; SEQ ID NO: 21) than the ApoC3/ApoB ASO heterodimer
linked with four phosphothioate bases (stable; SEQ ID NO: 59),
substantiating that the linker designed for cleavage by
endonucleases resulted in higher concentration of active monomeric
ASO metabolite within a few days of administration (see FIG. 12A).
On day 14, the reverse was observed (see FIG. 12B). The
concentration of ApoB monomer present in the liver as a metabolite
after heterodimer administration was significantly higher after
administration of the ApoC3/ApoB ASO heterodimer linked with four
phosphothioate bases (stable; SEQ ID NO: 59) than the ApoC3/ApoB
ASO heterodimer linked with four diester bases (cleavable; SEQ ID
NO: 21). Since the phosphothioate linked heterodimer also degrades
in tissue, albeit at a slower rate, relatively more monomer is
present at this time point. The levels of ApoB monomer, after its
administration or as a metabolite of administered ASO heterodimers
is related to target mRNA knockdown, e.g., the highest levels of
ApoB monomer are present after administration of the ApoC3/ApoB ASO
heterodimer linked with four diester bases (cleavable; SEQ ID NO:
21) and the highest level of target mRNA knockdown is also observed
in this treatment group (compare FIGS. 12A and 12B to FIGS. 8A and
8B)
Example 19
Oligo Sequences
[0349] 15-mer gapmer oligos were designed as single monomers or as
homodimers (30-mers) linked by an oligo-dT linker (4 bases) via
cleavable phosphodiester bonds. The oligos were designed to target
either miR-122 or MALAT-1 and consisted of three LNA-modified bases
at each end of the monomer with 9 unmodified DNA bases in the
center or gap region. The gapmer design facilitated cleavage of the
bound target mRNA by RNAseH resulting in a decrease in target mRNA
(either miR-122 or MALAT-1). The sequences of the following table
correspond, from top to bottom, to SEQ ID NOS: 128 to 135.
TABLE-US-00011 Oligo ID Oligo Sequence 122gap-mono
bCsbAsbTsTsGsTsCsAsCsAsCsTsbCsbCsbA 122gap-dimer
bCsbAsbTsTsGsTsCsAsCsAsCsTsbCsbCsbAoToToToTobCsbAsbTsTsGsTsCsAsCsAsCsTsbC-
sbCsbA 122gap-control-mono bTsbGsbAsAsGsGsTsTsCsCsTsCsbCsbTsbT
122gap-control-dimer
bTsbGsbAsAsGsGsTsTsCsCsTsCsbCsbTsbToToToToTobTsbGsbAsAsGsGsTsTsCsCsTsCsbC-
sbTsbT Malat1-gap-mono bCsbTsbAsGsTsTsCsAsCsTsGsAsbAsbTsbG
Malat1-gap-dimer
bCsbTsbAsGsTsTsCsAsCsTsGsAsbAsbTsbGoToToToTobCsbTsbAsGsTsTsCsAsCsTsGsAsbA-
sbTsbG Malat1-gap-control-mono bTsbTsbCsCsCsTsGsAsAsGsGsTsbTsbCsbC
Malat1-gap-control-dimer
bTsbTsbCsCsCsTsGsAsAsGsGsTsbTsbCsbCoToToToTobTsbTsbCsCsCsTsGsAsAsGsGsTsbT-
sbCsbC all bases are DNA b = LNA s = Phosphorothioate linkage o =
Phosphodiester linkage
Animal Care and Treatments:
[0350] Animal experiments were conducted in an Association for the
Assessment and Accreditation of Laboratory Animal Care (AAALAC)
facility under a constant light-dark cycle, maintained on a
standard mouse diet, and allowed ad libitum access to food and
water. Mice were euthanized by CO.sub.2 inhalation. All mouse
experiments were approved and conducted in compliance with the
guidelines of the Institutional Animal Care and Use Committee at
Vivisource Laboratories, Inc. Female C57BL6/J mice were obtained
from the Jackson Laboratories (Bar Harbor, Me.) and female Balb/C
mice obtained from the Charles River Laboratories. Oligonucleotides
were dissolved in phosphate buffered saline (PBS) and administered
to mice based on body weight by subcutaneous injection. Mice were
injected once per week (MALAT-1) at 50 mg/kg or twice per week
(MIR-122) at 10 mg/kg or 50 mg/kg. Mice were sacrificed after one
week and at study termination (four weeks) and liver, kidney and
plasma harvested for further analysis.
Triglycerides, HDL and Total Cholesterol Measurements.
[0351] Blood was collected by cardiac puncture and total plasma
harvested by centrifugation in Minicollect tubes (Thermo Fisher).
Plasma concentrations of Triglycerides, total cholesterol and LDL
cholesterol were determined by enzymatic assay (Bioo Scientific) on
a Molecular Devices SpectraMax M5 plate reader according to
manufacturer's recommendations.
RNA Extraction, Reverse Transcription and mRNA qPCR.
[0352] Tissue was disrupted using a FastPrep-24 tissue homogenizer
(MPBio) and total RNA isolated using Trizol (Invitrogen) and
miRNEasy columns (Qiagen). RNA concentration was assessed using
RIboGreen plates (Molecular Probes) and a Molecular Dynamics M5
multimodal plate reader. 250 ng of total RNA was reverse
transcribed with random hexamers in a 50 ml reaction using High
Capacity Multiscribe Reverse Transcriptase. qPCR was carried out
using the equivalent of 12.5 ng cDNA in 20 .mu.l reaction volumes
using MIR122 or MALAT-1 specific TaqMan primers and probes on a
Step-One Plus thermocycler. Relative qPCR expression of individual
genes was normalized to the expression of reference genes GusB
(accession#NM.sub.--010368), GAPDH (accession#NM.sub.--008084.2) or
SNO-135 (accession#AF357323) RNA using the .DELTA..DELTA.Ct
method.
miR-122 Study Results
[0353] Two separate cohorts of C57B16/J mice (short and long dosing
arm) were analyzed. The mice were females and, both cohorts were
maintained on regular chow. Both cohorts were dosed at 10 mg/kg and
50 mg/kg by subcutaneous injection twice a week (day 1 and 4).
Targeting oligonucleotides used were 15 base gapmers with LNA at
the ends (3-9-3) and full phosphorothioate linkage. Animals were
euthanized at day 7 (short arm) and day 28 (long arm). Dose Groups
were n=5. The following parameters were analyzed in an ex vivo
analysis: ALT, total cholesterol, triglycerides by ELISA.
[0354] As depicted in FIGS. 13A and 13B, oligonucleotides targeting
miR-122 decreased target miRNA in vivo by 75-90% compared to PBS
treated controls. Monomers exhibited 75% knockdown of miR-122;
whereas dimers caused 90% knockdown of miR-122.
[0355] As depicted in FIGS. 14A and 14B, 50 mg/kg dose of
oligonucleotides targeting miR-122 decreased target miRNA in vivo
by 90-95% compared to PBS treated controls. Monomers exhibited 90%
knockdown of miR-122; whereas dimers caused 95% knockdown of
miR-122. It was noted that monomer at 50 mg/kg is equivalent to
dimer at 10 mg/kg for % miR-122 knockdown.
[0356] As illustrated in FIG. 15, in vivo results show that dimers
at 10 mg/kg exhibits similar knockdown as monomer at 50 mg/kg.
Thus, dimer oligonucleotides are .about.5.times. more active than
monomer (in vivo 7 d study).
MALAT-1 Study Results
[0357] Female Balb/c mice which were 7 weeks at shipment were
evaluated (N=5). The mice were dosed at 50 mg/kg on Thursday, and
takedown was at 5 days post-dose. Sample obtained from the mice
included tserum, kidney, brain, and liver. Organs with high levels
of MALAT-1 are heart, kidney, brain and minimally found in spleen
and skeletal muscle. qRT-PCR was performed to evaluate Malat-1
knockdown. As depicted in FIGS. 16A-16C, dimer oligonucleotides
robustly decreased Malat-1 lncRNA expression; where the control
GusB gene was unaffected.
Example 20
Oligo Sequences
[0358] Oligos were designed as single monomers or as homodimers, or
as homotrimers linked by an oligo-dT linker (4 bases) via cleavable
phosphodiester bonds. Each monomer was either 15 oligonucleotides
long ("gapmers" and "mixmers" in the following table) or 8
oligonucleotides long ("tiny" in the following table). Gapmers
consisted of three LNA-modified bases at each end of the monomer
with 9 unmodified DNA bases in the center or gap region. Mixmers
consisted of mixtures of LNA-modified bases and unmodified DNA
bases. Tinies (8-mers) consisted of LNA-modified bases. The oligos
were designed to target miR-122. The sequences of the following
table correspond, from top to bottom, to SEQ ID NOS: 261-274.
TABLE-US-00012 Oligo ID Oligo Sequence 122gap-
bCsbAsbTsTsGsTsCsAsCsAsCsTsbCsbCsbA mono 122gap-
bCsbAsbTsTsGsTsCsAsCsAsCsTsbCsbCsbAoToToToTobCsbAsbTsTsGsTsCsAsCsA-
sCsTsbCsbCsbA dimer 122gap- bTsbGsbAsAsGsGsTsTsCsCsTsCsbCsbTsbT
control- mono 122gap-
bTsbGsbAsAsGsGsTsTsCsCsTsCsbCsbTsbToToToToTobTsbGsbAsAsGsGsTsTsCsC-
sTsCsbCsbTsbT control- dimer miR122-
bZsCsbAsTsTsbGsbTsCsAsbCsAsbCsTsbCsbC mixmer- monomer miR122-
bZsCsbAsTsTsbGsbTsCsAsbCsAsbCsTsbCsbCoToToToTobZsCsbAsTsTsbGsbTsCs-
AsbCsAsbCsTsbCsbC mixmer- dimer miR122-
bZsCsbAsTsTsbCsbTsCsAsbCsAsbCsTsbGsbC mixmer- monomer control
miR-122-
bZsCsbAsTsTsbCsbTsCsAsbCsAsbCsTsbGsbCoToToToTobZsCsbAsTsTsbCsbTsC-
sAsbCsAsbCsTsbGsbC mixmer- dimer control miR-122-
bCsbAsbCsbAsbCsbTsbCsbC tiny- monomer miR-122-
bCsbAsbCsbAsbCsbTsbCsbCoToToToTobCsbAsbCsbAsbCsbTsbCsbC tiny- dimer
miR-122-
bCsbAsbCsbAsbCsbTsbCsbCoToToToTobCsbAsbCsbAsbCsbTsbCsbCoToToToTob-
CsbAsbCsbAsbCsbTsbCsbC tiny- trimer miR-122-
bCsbGsbCsbAsbCsbCsbCsbC tiny- monomer control miR-122-
bCsbGsbCsbAsbCsbCsbCsbCoToToToTobCsbGsbCsbAsbCsbCsbCsbC tiny- dimer
control miR-122-
bCsbGsbCsbAsbCsbCsbCsbCoToToToTobCsbGsbCsbAsbCsbCsbCsbCoToToToTob-
CsbGsbCsbAsbCsbCsbCsbC tiny- trimer control All bases are DNA. b =
LNA, s = Phosphothioate linkage, o = Phosphodiester linkage, Z =
5-methyl-cytosine, gap = gapmer
Animal Care and Treatments:
[0359] Animal experiments were conducted in an Association for the
Assessment and Accreditation of Laboratory Animal Care (AAALAC)
facility under a constant light-dark cycle, maintained on a
standard mouse diet, and allowed ad libitum access to food and
water. Mice were euthanized by C02 inhalation. All mouse
experiments were approved and conducted in compliance with the
guidelines of the Institutional Animal Care and Use Committee at
Vivisource Laboratories, Inc. Female C57BL6/J mice were obtained
from the Jackson Laboratories (Bar Harbor, Me.). Oligonucleotides
were dissolved in phosphate buffered saline (PBS) and administered
to mice based on body weight by subcutaneous injection. Mice were
injected on days 1, 2, and 3 with each oligonucleotide at 1, 3 or
10 mg/kg. Mice were sacrificed after one week and liver and serum
were harvested for further analysis.
Cholesterol Measurements:
[0360] Blood was collected by cardiac puncture and serum harvested
by centrifugation in Minicollect tubes (Thermo Fisher). Serum
concentrations of cholesterol were determined by enzymatic assay
(Bio Scientific) on a Molecular Devices SpectraMax M5 plate reader
according to manufacturer's recommendations.
RNA Extraction, Reverse Transcription and mRNA qPCR:
[0361] Tissue was disrupted using a FastPrep-24 tissue homogenizer
(MPBio) and total RNA isolated using Trizol (Invitrogen) and
miRNEasy columns (Qiagen). RNA concentration was assessed using
RIboGreen plates (Molecular Probes) and a Molecular Dynamics M5
multimodal plate reader. 250 ng of total RNA was reverse
transcribed with random hexamers in a 50 ml reaction using High
Capacity Multiscribe Reverse Transcriptase. qPCR was carried out
using the equivalent of 12.5 ng cDNA in 20 .mu.l reaction volumes
using BCKDK and ALDOA1 specific TaqMan primers and probes on a
Step-One Plus thermocycler. Relative qPCR expression of individual
genes was normalized to the expression of reference genes GusB
(accession#NM.sub.--010368), GAPDH (accession#NM.sub.--008084.2) or
SNO-135 (accession#AF357323) RNA using the .DELTA..DELTA.Ct
method.
Study Results
[0362] Cohorts of C57B16/J mice (1 mg/kg, 3 mg/kg, and 10 mg/kg
dosing arms of gapmers, mixmers, or tinies) were analyzed. The mice
were females and all cohorts were maintained on regular chow. The
cohorts were dosed at 1 mg/kg, 3 mg/kg, or 10 mg/kg by subcutaneous
injection on days 1, 2, and 3. Animals were euthanized at day 7.
Dose Groups were n=5. The following parameters were analyzed in an
ex vivo analysis: cholesterol by ELISA and BCKDK and ALDOA1 levels
using qPCR.
[0363] BCKDK and ALDOA1 are targets of miR-122, and it was
hypothesized that targeting miR-122 using oligos would result in
increased mRNA levels of BCKDK and ALDOA1. As depicted in FIGS.
17-22, in general oligonucleotides targeting miR-122 increased
BCKDK and ALDOA1 mRNA levels in vivo compared to PBS treated
controls. In general, dimers and trimers increased BCKDK and ALDOA1
mRNA levels to the same extent or better than monomers.
[0364] miR-122 is a regulator of cholesterol, and decreasing levels
of miR-122 have been previously shown to decrease levels of
cholestorol. As depicted in FIGS. 23-25, in general
oligonucleotides targeting miR-122 decreased cholesterol levels in
vivo compared to PBS treated controls. In general, dimers and
trimers decreased cholesterol levels to the same extent or better
than monomers.
Example 21
Oligo Sequences
[0365] Oligos were designed as single monomers or as homodimers
linked by an oligo-dT linker (4, 5, or 6 bases) via cleavable
phosphodiester bonds, an oligo-dTs linker (4 bases) containing
phophorothioate linkages, or a symmetrical doubler B and a
triEG-CPG (branched linker). Each monomer was a15 oligonucleotide
long gapmers consisting of three LNA-modified or ENA-modified bases
at each end of the monomer with 9 unmodified DNA bases in the
center or gap region. The oligos were designed to target miR-122
and are shown in the table below.
TABLE-US-00013 SEQ ID Cmpd Gene NO ID IDO Name Organism Notes 139
2781 192045 miR122 Human miR-122-01 dimer with 4 dT PO linker 140
4379 192046 miR122 Human miR-122-01 dimer with 5 dT PO linker 141
4380 192047 miR122 Human miR-122-01 dimer with 6 dT PO linker 142
4381 192048 miR122 Human miR-122-01 dimer with 4 dT PS linker 143
3906 192049 NA Synthetic Universal negative control (unc); no exact
sequence matches in human and mouse RefSeq 144 3905 192050 NA
Synthetic Unc-01 with a 4 dT PO linker 275 2780 192051 miR122 Human
Starting miR122-01 m08 gapmer 149 4384 192055 miR122 Human Two
identical miR22-01 m08 oligos attached to a 4 dT PO 3' linker and
coupled through a synthetic doubler B and a triEG-CPG 166 4400
192069 miR122 Human miR122-01 ENA gapmer dimer with a 4 dT PO
linker 167 4401 192070 miR122 Human miR122-01 ENA gapmer dimer with
a 5 dT PO linker 168 4402 192071 miR122 Human miR122-01 ENA gapmer
dimer with a 4 dT PO linker 169 4403 192072 miR122 Human miR122-01
ENA gapmer dimer with a 6 dT PS linker
Animal Care and Treatments:
[0366] Animal experiments were conducted in an Association for the
Assessment and Accreditation of Laboratory Animal Care (AAALAC)
facility under a constant light-dark cycle, maintained on a
standard mouse diet, and allowed ad libitum access to food and
water. Mice were euthanized by CO2 inhalation. All mouse
experiments were approved and conducted in compliance with the
guidelines of the Institutional Animal Care and Use Committee at
Vivisource Laboratories, Inc. Female C57BL6/J mice were obtained
from the Jackson Laboratories (Bar Harbor, Me.). Oligonucleotides
were dissolved in phosphate buffered saline (PBS) and administered
to mice based on body weight by subcutaneous injection. Mice were
injected on days 1, 2, and 3 with each oligonucleotide at 3 or 10
mg/kg. Mice were sacrificed after one week and liver and serum were
harvested for further analysis.
LDL and Cholesterol Measurements:
[0367] Blood was collected by cardiac puncture and serum harvested
by centrifugation in Minicollect tubes (Thermo Fisher). Serum
concentrations of cholesterol and LDL were determined by enzymatic
assay (Bio Scientific) on a Molecular Devices SpectraMax M5 plate
reader according to manufacturer's recommendations.
RNA Extraction, Reverse Transcription and mRNA qPCR:
[0368] Tissue was disrupted using a FastPrep-24 tissue homogenizer
(MPBio) and total RNA isolated using Trizol (Invitrogen) and
miRNEasy columns (Qiagen). RNA concentration was assessed using
RIboGreen plates (Molecular Probes) and a Molecular Dynamics M5
multimodal plate reader. 250 ng of total RNA was reverse
transcribed with random hexamers in a 50 ml reaction using High
Capacity Multiscribe Reverse Transcriptase. qPCR was carried out
using the equivalent of 12.5 ng cDNA in 20 .mu.l reaction volumes
using BCKDK and ACC1 specific TaqMan primers and probes on a
Step-One Plus thermocycler. Relative qPCR expression of individual
genes was normalized to the expression of reference genes GusB
(accession#NM.sub.--010368), GAPDH (accession#NM.sub.--008084.2) or
SNO-135 (accession#AF357323) RNA using the .DELTA..DELTA.Ct
method.
Study Results
[0369] Cohorts of C57B16/J mice (3 mg/kg, and 10 mg/kg dosing arms
of gapmers) were analyzed. The mice were females and all cohorts
were maintained on regular chow. The cohorts were dosed at 3 mg/kg,
or 10 mg/kg by subcutaneous injection on days 1, 2, and 3. Animals
were euthanized at day 7. Dose Groups were n=10. The following
parameters were analyzed in an ex vivo analysis: LDL and
cholesterol by ELISA and BCKDK and ACC1 levels using qPCR.
[0370] BCKDK is a target of miR-122, and it was hypothesized that
targeting miR-122 using oligos would result in increased mRNA
levels of BCKDK and ACC1. As depicted in FIGS. 26 and 27, in
general oligonucleotides targeting miR-122 increased BCKDK mRNA
levels in vivo compared to PBS treated controls. LNA gapmers with
cleavable phosphodiester bonds showed increased efficacy compared
to monomers. ENA gapmers with cleavable phosphodiester bonds
increased BCKDK. Branched linker gapmers also increased BCKDK.
[0371] ACC1 is predicted to decrease when miR-122 is targeted using
oligos. As depicted in FIGS. 28 and 29, LNA gapmers with 5 or 6
cleavable phosphodiester bonds decreased ACC1. Branched linker
gapmers also decreased ACC1.
[0372] miR-122 is a regulator of cholesterol, and decreasing levels
of miR-122 have been previously shown to decrease levels of
cholestorol and LDL. As depicted in FIGS. 30-33, LNA gapmers with 4
or 5 cleavable phosphodiester bonds decreased LDL and cholesterol.
ENA gapmers with 4 or 6 cleavable phosphodiester bonds decreased
LDL and cholesterol.
[0373] Brief Description of the Sequence Listing:
[0374] The Sequencing Listing contains the identity of each
nucleotide in each sequence but does not contain the identity of
the type of bond between each nucleotide (e.g., phosphorothioate or
phosphate). Refer to Tables 1 and 2 for further details and
annotations for sequences listed in the sequence listing.
[0375] The specification is most thoroughly understood in light of
the teachings of the references cited within the specification. The
embodiments within the specification provide an illustration of
embodiments of the invention and should not be construed to limit
the scope of the invention. The skilled artisan readily recognizes
that many other embodiments are encompassed by the invention. Those
skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific
embodiments of the invention described herein. Such equivalents are
intended to be encompassed by the following claims.
Sequence CWU 1
1
275114DNAArtificial SequenceSynthetic polynucleotide 1nnncaaccta
cnnn 14231DNAArtificial SequenceSynthetic polynucleotide
2nnncaaccta cnnntttnnn caacctacnn n 31328DNAArtificial
SequenceSynthetic polynucleotide 3nnncaaccta cnnnnnnca acctacnnn
28417DNAArtificial SequenceSynthetic polynucleotide 4nnncaaccta
cnnnttt 17514DNAArtificial SequenceSynthetic polynucleotide
5nnncaaccta cnnn 14631DNAArtificial SequenceSynthetic
polynucleotide 6nnncaacctt cnnntttnnn caaccttcnn n
31730DNAArtificial SequenceSynthetic polynucleotide 7nnncaacctt
cnnntttnna ttggtatnnn 30829DNAArtificial SequenceSynthetic
polynucleotide 8nnattggtat nnntttnnnt cggcctnnn 29914DNAArtificial
SequenceSynthetic polynucleotide 9nnncttcggc cnnn
141013DNAArtificial SequenceSynthetic polynucleotide 10nnntcggcct
nnn 131112DNAArtificial SequenceSynthetic polynucleotide
11nnntcggccc nn 121212DNAArtificial SequenceSynthetic
polynucleotide 12nnntnggccc nn 121313DNAArtificial
SequenceSynthetic polynucleotide 13nnattggtat nnn
131414DNAArtificial SequenceSynthetic polynucleotide 14nnncaacctt
cnnn 141532DNAArtificial SequenceSynthetic polynucleotide
15nnactgagaa tannttttnn actgagaata nn 321632DNAArtificial
SequenceSynthetic polynucleotide 16nnactgagaa tannttttnn actgagaata
nn 321718DNAArtificial SequenceSynthetic polynucleotide
17nnactgagaa tanntttt 181830DNAArtificial SequenceSynthetic
polynucleotide 18nnattggtat nnnttttnna ttggtatnnn
301930DNAArtificial SequenceSynthetic polynucleotide 19nnattggtat
nnnttttnna ttggtatnnn 302017DNAArtificial SequenceSynthetic
polynucleotide 20nnattggtat nnntttt 172131DNAArtificial
SequenceSynthetic polynucleotide 21nnactgagaa tannttttnn attggtatnn
n 312231DNAArtificial SequenceSynthetic polynucleotide 22nnattggtat
nnnttttnna ctgagaatan n 312330DNAArtificial SequenceSynthetic
polynucleotide 23nncaagcatc nnnttttnna tccatggnnn
302431DNAArtificial SequenceSynthetic polynucleotide 24nncaagcatc
nnnttttnnn tgcataaann n 312530DNAArtificial SequenceSynthetic
polynucleotide 25nncaagcatc nnnttttnna ttggtatnnn
302648DNAArtificial SequenceSynthetic polynucleotide 26nnattggtat
nnnttttnna ctgagaatan nttttnncaa gcatcnnn 482713DNAArtificial
SequenceSynthetic polynucleotide 27nncaagcatc nnn
132813DNAArtificial SequenceSynthetic polynucleotide 28nnatccatgg
nnn 132914DNAArtificial SequenceSynthetic polynucleotide
29nnntgcataa annn 143014DNAArtificial SequenceSynthetic
polynucleotide 30nnactgagaa tann 143113DNAArtificial
SequenceSynthetic polynucleotide 31nntctatgta nnn
133212DNAArtificial SequenceSynthetic polynucleotide 32nnagtgtga
tnn 123331DNAArtificial SequenceSynthetic polynucleotide
33nnngtagtct tnnnttttnn attggtatnn n 313431DNAArtificial
SequenceSynthetic polynucleotide 34nnngtagtct tnnnttttnn attggtatnn
n 313531DNAArtificial SequenceSynthetic polynucleotide 35nnngtagtct
tnnnttttnn attggtatnn n 313631DNAArtificial SequenceSynthetic
polynucleotide 36gnnnctgaag ccatttttnn attggtatnn n
313731DNAArtificial SequenceSynthetic polynucleotide 37gnactgagaa
tannttttnn attggtatnn n 313830DNAArtificial SequenceSynthetic
polynucleotide 38nnagtgtga tnnttttnn actgagaata nn
303931DNAArtificial SequenceSynthetic polynucleotide 39nnncaaccta
cnnnttttnn attggtatnn n 314018DNAArtificial SequenceSynthetic
polynucleotide 40nnnnctgaag ccattttt 184132DNAArtificial
SequenceSynthetic polynucleotide 41nnantgagaa tannttttnn antgagaata
nn 324232DNAArtificial SequenceSynthetic polynucleotide
42nnanngagaa tannttttnn anngagaata nn 324332DNAArtificial
SequenceSynthetic polynucleotide 43nnanngagaa nannttttnn anngagaana
nn 324428DNAArtificial SequenceSynthetic polynucleotide
44nnattggtat nnnttnnatt ggtatnnn 284529DNAArtificial
SequenceSynthetic polynucleotide 45nnattggtat nnntttnnat tggtatnnn
294630DNAArtificial SequenceSynthetic polynucleotide 46nnattggtat
nnnttttnna ttggtatnnn 304731DNAArtificial SequenceSynthetic
polynucleotide 47nnattggtat nnntttttnn attggtatnn n
314832DNAArtificial SequenceSynthetic polynucleotide 48nnattggtat
nnnttttttn nattggtatn nn 324933DNAArtificial SequenceSynthetic
polynucleotide 49nnattggtat nnnttttttt nnattggtat nnn
335033DNAArtificial SequenceSynthetic polynucleotide 50nnattggtat
nnnttttttt nnattggtat nnn 335127DNAArtificial SequenceSynthetic
polynucleotide 51nnattggtat nnnunnattg gtatnnn 275228DNAArtificial
SequenceSynthetic polynucleotide 52nnattggtat nnnuunnatt ggtatnnn
285329DNAArtificial SequenceSynthetic polynucleotide 53nnattggtat
nnnuuunnat tggtatnnn 295430DNAArtificial SequenceSynthetic
polynucleotide 54nnattggtat nnnuuuunna ttggtatnnn
305514DNAArtificial SequenceSynthetic polynucleotide 55nnngtagtct
tnnn 145614DNAArtificial SequenceSynthetic polynucleotide
56nnngtagtct tnnn 145714DNAArtificial SequenceSynthetic
polynucleotide 57nnngtagtct tnnn 145814DNAArtificial
SequenceSynthetic polynucleotide 58nnnnctgaag ccat
145931DNAArtificial SequenceSynthetic polynucleotide 59nnactgagaa
tannttttnn attggtatnn n 316027DNAArtificial SequenceSynthetic
polynucleotide 60nnactgagaa tannnnatt ggtatnnn 276131DNAArtificial
SequenceSynthetic polynucleotide 61aagcaaccta caggtttaag caacctacag
g 316228DNAArtificial SequenceSynthetic polynucleotide 62aagcaaccta
caggaagca acctacagg 286318DNAArtificial SequenceSynthetic
polynucleotide 63aagcaaccta caggtttt 186414DNAArtificial
SequenceSynthetic polynucleotide 64aagcaaccta cagg
146531DNAArtificial SequenceSynthetic polynucleotide 65aagcaacctt
caggtttaag caaccttcag g 316630DNAArtificial SequenceSynthetic
polynucleotide 66aagcaacctt caggtttgna ttggtattna
306729DNAArtificial SequenceSynthetic polynucleotide 67gnattggtat
tnattttnnt cggcctntg 296814DNAArtificial SequenceSynthetic
polynucleotide 68nntcttcggc cntg 146913DNAArtificial
SequenceSynthetic polynucleotide 69tnntcggcct ntg
137012DNAArtificial SequenceSynthetic polynucleotide 70tnttcggccc
tg 127112DNAArtificial SequenceSynthetic polynucleotide
71tnttnggccc tg 127213DNAArtificial SequenceSynthetic
polynucleotide 72gnattggtat tna 137314DNAArtificial
SequenceSynthetic polynucleotide 73aagcaacctt cagg
147432DNAArtificial SequenceSynthetic polynucleotide 74gnactgagaa
tantttttgn actgagaata nt 327532DNAArtificial SequenceSynthetic
polynucleotide 75gnactgagaa tantttttgn actgagaata nt
327618DNAArtificial SequenceSynthetic polynucleotide 76gnactgagaa
tanttttt 187730DNAArtificial SequenceSynthetic polynucleotide
77gnattggtat tnattttgna ttggtattna 307830DNAArtificial
SequenceSynthetic polynucleotide 78gnattggtat tnattttgna ttggtattna
307917DNAArtificial SequenceSynthetic polynucleotide 79gnattggtat
tnatttt 178031DNAArtificial SequenceSynthetic polynucleotide
80gnactgagaa tantttttgn attggtattn a 318131DNAArtificial
SequenceSynthetic polynucleotide 81gnattggtat tnattttgna ctgagaatan
t 318230DNAArtificial SequenceSynthetic polynucleotide 82ggcaagcatc
ntgttttnaa tccatggnag 308331DNAArtificial SequenceSynthetic
polynucleotide 83ggcaagcatc ntgttttgng tgcataaatt g
318430DNAArtificial SequenceSynthetic polynucleotide 84ggcaagcatc
ntgttttgna ttggtattna 308548DNAArtificial SequenceSynthetic
polynucleotide 85gnattggtat tnattttgna ctgagaatan tttttggcaa
gcatcntg 488613DNAArtificial SequenceSynthetic polynucleotide
86ggcaagcatc ntg 138713DNAArtificial SequenceSynthetic
polynucleotide 87naatccatgg nag 138814DNAArtificial
SequenceSynthetic polynucleotide 88gngtgcataa attg
148914DNAArtificial SequenceSynthetic polynucleotide 89gnactgagaa
tant 149013DNAArtificial SequenceSynthetic polynucleotide
90ngtctatgta tag 139112DNAArtificial SequenceSynthetic
polynucleotide 91uuagtgtga tga 129231DNAArtificial
SequenceSynthetic polynucleotide 92nnagtagtct tunattttgn attggtattn
a 319331DNAArtificial SequenceSynthetic polynucleotide 93nnagtagtct
tucattttgn attggtattn a 319431DNAArtificial SequenceSynthetic
polynucleotide 94nnagtagtct tucattttgn attggtattn a
319531DNAArtificial SequenceSynthetic polynucleotide 95ggaactgaag
ccatttttgn attggtattn a 319631DNAArtificial SequenceSynthetic
polynucleotide 96gnactgagaa tantttttgn attggtattn a
319730DNAArtificial SequenceSynthetic polynucleotide 97uuagtgtga
tgattttgn actgagaata nt 309831DNAArtificial SequenceSynthetic
polynucleotide 98aagcaaccta caggttttgn attggtattn a
319918DNAArtificial SequenceSynthetic polynucleotide 99ggaactgaag
ccattttt 1810032DNAArtificial SequenceSynthetic polynucleotide
100gnantgagaa tantttttgn antgagaata nt 3210132DNAArtificial
SequenceSynthetic polynucleotide 101gnanngagaa tantttttgn
anngagaata nt 3210232DNAArtificial SequenceSynthetic polynucleotide
102gnanngagaa nantttttgn anngagaana nt 3210328DNAArtificial
SequenceSynthetic polynucleotide 103gnattggtat tnattgnatt ggtattna
2810429DNAArtificial SequenceSynthetic polynucleotide 104gnattggtat
tnatttgnat tggtattna 2910530DNAArtificial SequenceSynthetic
polynucleotide 105gnattggtat tnattttgna ttggtattna
3010631DNAArtificial SequenceSynthetic polynucleotide 106gnattggtat
tnatttttgn attggtattn a 3110732DNAArtificial SequenceSynthetic
polynucleotide 107gnattggtat tnattttttg nattggtatt na
3210833DNAArtificial SequenceSynthetic polynucleotide 108gnattggtat
tnattttttt gnattggtat tna 3310933DNAArtificial SequenceSynthetic
polynucleotide 109gnattggtat tnattttttt gnattggtat tna
3311027DNAArtificial SequenceSynthetic polynucleotide 110gnattggtat
tnaugnattg gtattna 2711128DNAArtificial SequenceSynthetic
polynucleotide 111gnattggtat tnauugnatt ggtattna
2811229DNAArtificial SequenceSynthetic polynucleotide 112gnattggtat
tnauuugnat tggtattna 2911330DNAArtificial SequenceSynthetic
polynucleotide 113gnattggtat tnauuuugna ttggtattna
3011414DNAArtificial SequenceSynthetic polynucleotide 114nnagtagtct
tuna 1411514DNAArtificial SequenceSynthetic polynucleotide
115nnagtagtct tuca 1411614DNAArtificial SequenceSynthetic
polynucleotide 116nnagtagtct tuca 1411714DNAArtificial
SequenceSynthetic polynucleotide 117ggaactgaag ccat
1411814DNAArtificial SequenceSynthetic polynucleotide 118aagcaaccta
cagg 1411914DNAArtificial SequenceSynthetic polynucleotide
119nnntngtnga tnnn 141208DNAArtificial SequenceSynthetic
polynucleotide 120nnnnnnn n 81216DNAArtificial SequenceSynthetic
polynucleotide 121nnnnnn 61227DNAArtificial SequenceSynthetic
polynucleotide 122nnnnnnn 71237DNAArtificial SequenceSynthetic
polynucleotide 123nnnnnnn 71247DNAArtificial SequenceSynthetic
polynucleotide 124nnnnnnn 71254PRTArtificial Sequencepeptide linker
125Ala Leu Ala Leu 1 1269PRTArtificial Sequencepeptide linker
126Ala Pro Ile Ser Phe Phe Glu Leu Gly 1 5 12711PRTArtificial
Sequencepeptide linker 127Gly Arg Trp His Thr Val Gly Leu Arg Trp
Glu 1 5 10 12815DNAArtificial SequenceSynthetic polynucleotide
128nnntgtcaca ctnnn 1512934DNAArtificial SequenceSynthetic
polynucleotide 129nnntgtcaca ctnnnttttn nntgtcacac tnnn
3413015DNAArtificial SequenceSynthetic polynucleotide 130nnnaggttcc
tcnnn 1513134DNAArtificial SequenceSynthetic polynucleotide
131nnnaggttcc tcnnnttttn nnaggttcct cnnn 3413215DNAArtificial
SequenceSynthetic polynucleotide 132nnngttcact gannn
1513334DNAArtificial SequenceSynthetic polynucleotide 133nnngttcact
gannnttttn nngttcactg annn 3413415DNAArtificial SequenceSynthetic
polynucleotide 134nnncctgaag gtnnn 1513534DNAArtificial
SequenceSynthetic polynucleotide 135nnncctgaag gtnnnttttn
nncctgaagg tnnn 341366PRTArtificial SequenceLinker 136Arg Arg Ala
Leu Ala Leu 1
5 13711PRTArtificial SequenceLinker 137Gly Arg Trp Pro Pro Met Gly
Leu Pro Trp Glu 1 5 10 13811PRTArtificial SequenceLinker 138Gly Arg
Trp His Pro Met Gly Ala Pro Trp Glu1 5 10 13934DNAArtificial
SequenceSynthetic polynucleotide 139nnntgtcaca ctnnnttttn
nntgtcacac tnnn 3414035DNAArtificial SequenceSynthetic
polynucleotide 140nnntgtcaca ctnnnttttt nnntgtcaca ctnnn
3514136DNAArtificial SequenceSynthetic polynucleotide 141nnntgtcaca
ctnnnttttt tnnntgtcac actnnn 3614234DNAArtificial SequenceSynthetic
polynucleotide 142nnntgtcaca ctnnnttttn nntgtcacac tnnn
3414315DNAArtificial SequenceSynthetic polynucleotide 143nnntactacc
tannn 1514434DNAArtificial SequenceSynthetic polynucleotide
144nnntactacc tannnttttn nntactacct annn 3414515DNAArtificial
SequenceSynthetic polynucleotide 145nnntgtcaca ctnnn
1514615DNAArtificial SequenceSynthetic polynucleotide 146nnngttcact
gannn 1514719DNAArtificial SequenceSynthetic polynucleotide
147ttttnnntg tcacactnnn 1914818DNAArtificial SequenceSynthetic
polynucleotide 148nnntgtcaca ctnnnttt 1814919DNAArtificial
SequenceSynthetic polynucleotide 149nnntgtcaca ctnnntttt
1915038DNAArtificial SequenceSynthetic polynucleotide 150nnntgtcaca
ctnnntttt ttttnnntgt cacactnnn 3815138DNAArtificial
SequenceSynthetic polynucleotide 151nnntgtcaca ctnnntttt ttttnnntgt
cacactnnn 3815238DNAArtificial SequenceSynthetic polynucleotide
152nnntgtcaca ctnnntttt ttttnnntgt cacactnnn 3815338DNAArtificial
SequenceSynthetic polynucleotide 153nnntgtcaca ctnnntttt ttttnnntgt
cacactnnn 3815419DNAArtificial SequenceSynthetic polynucleotide
154nnntgtcaca ctnnntttt 1915515DNAArtificial SequenceSynthetic
polynucleotide 155nnntgtcaca ctnnn 1515615DNAArtificial
SequenceSynthetic polynucleotide 156nnntgtcaca ctnnn
1515715DNAArtificial SequenceSynthetic polynucleotide 157nnngttcac
tgannn 1515830DNAArtificial SequenceSynthetic polynucleotide
158nnntgtcaca ctnnnnnng ttcactgann n 3015920DNAArtificial
SequenceSynthetic polynucleotide 159nnntgtcaca ctnnnttttt
2016020DNAArtificial SequenceSynthetic polynucleotide 160nnntgtcaca
ctnnnttttt 2016121DNAArtificial SequenceSynthetic polynucleotide
161ntttttnnnt gtcacactnn n 2116241DNAArtificial SequenceSynthetic
polynucleotide 162nnntgtcaca ctnnnttttt ntttttn nntgtcacac tnnn
4116320DNAArtificial SequenceSynthetic polynucleotide 163nnntgtcaca
ctnnnttttn 2016420DNAArtificial SequenceSynthetic polynucleotide
164tttttnnnt gtcacactnn n 2016540DNAArtificial SequenceSynthetic
polynucleotide 165nnntgtcaca ctnnnttttn tttttnnnt gtcacactnn n
4016634DNAArtificial SequenceSynthetic polynucleotide 166nnntgtcaca
ctnnnttttn nntgtcacac tnnn 3416735DNAArtificial SequenceSynthetic
polynucleotide 167nnntgtcaca ctnnnttttt nnntgtcaca ctnnn
3516836DNAArtificial SequenceSynthetic polynucleotide 168nnntgtcaca
ctnnnttttt tnnntgtcac actnnn 3616934DNAArtificial SequenceSynthetic
polynucleotide 169nnntgtcaca ctnnnttttn nntgtcacac tnnn
3417034DNAArtificial SequenceSynthetic polynucleotide 170nnntgtcac
actnnntttt nnntgtcaca ctnnn 3417134DNAArtificial SequenceSynthetic
polynucleotide 171nnntgtcaca ctnnnttttn nntgtcacac tnnn
3417234DNAArtificial SequenceSynthetic polynucleotide 172nnntgtcac
actnnntttt nnntgtcaca ctnnn 3417331DNAArtificial SequenceSynthetic
polynucleotide 173nnactgagaa tannttttnn attggtatnn n
3117434DNAArtificial SequenceSynthetic polynucleotide 174nnnaggttcc
tcnnnttttn nnaggttcct cnnn 3417534DNAArtificial SequenceSynthetic
polynucleotide 175nnnaggttcc tcnnnttttn nnaggttcct cnnn
3417634DNAArtificial SequenceSynthetic polynucleotide 176ncnttnncan
antnnttttn cnttnncana ntnn 3417734DNAArtificial SequenceSynthetic
polynucleotide 177ncnttnncan antnnttttn cnttnncana ntnn
3417820DNAArtificial SequenceSynthetic polynucleotide 178nnnnnnnntt
ttnnnnnnnn 2017932DNAArtificial SequenceSynthetic polynucleotide
179nnnnnnnntt ttnnnnnnnn ttttnnnnnn nn 3218020DNAArtificial
SequenceSynthetic polynucleotide 180nnnnnnnntt ttnnnnnnnn
2018132DNAArtificial SequenceSynthetic polynucleotide 181nnnnnnnntt
ttnnnnnnnn ttttnnnnnn nn 3218234DNAArtificial SequenceSynthetic
polynucleotide 182ntnccnnacn tncnnnnnnn tnccnnacnt ncnn
3418332DNAArtificial SequenceSynthetic polynucleotide 183nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nn 3218437DNAArtificial SequenceSynthetic
polynucleotide 184nnnnnnnnnn nnnnnttttn nnnnnnnnnn nnnnnnn
3718537DNAArtificial SequenceSynthetic polynucleotide 185nnnnnnnnnn
nnnnnttttn nnnnnnnnnn nnnnnnn 3718637DNAArtificial
SequenceSynthetic polynucleotide 186nnnnnnnnnn nnnnnttttn
nnnnnnnnnn nnnnnnn 3718734DNAArtificial SequenceSynthetic
polynucleotide 187nnnnnnnnnn nnnnnttttn nnnnnnnnnn nnnn
3418834DNAArtificial SequenceSynthetic polynucleotide 188nnnnnnnnnn
nnnnnttttn nnnnnnnnnn nnnn 3418934DNAArtificial SequenceSynthetic
polynucleotide 189nnnnnnnnnn nnnnnttttn nnnnnnnnnn nnnn
3419034DNAArtificial SequenceSynthetic polynucleotide 190nnnnnnnnnn
nnnnnttttn nnnnnnnnnn nnnn 3419140DNAArtificial SequenceSynthetic
polynucleotide 191nnnnnnnnnn nnnnnnnntt ttnnnnnnnn nnnnnnnnnn
4019240DNAArtificial SequenceSynthetic polynucleotide 192nnnnnnnnnn
nnnnnnnntt ttnnnnnnnn nnnnnnnnnn 4019340DNAArtificial
SequenceSynthetic polynucleotide 193nnnnnnnnnn nnnnnnnntt
ttnnnnnnnn nnnnnnnnnn 4019440DNAArtificial SequenceSynthetic
polynucleotide 194nnnnnnnnnn nnnnnnnntt ttnnnnnnnn nnnnnnnnnn
4019540DNAArtificial SequenceSynthetic polynucleotide 195nnnnnnnnnn
nnnnnnnntt ttnnnnnnnn nnnnnnnnnn 4019634DNAArtificial
SequenceSynthetic polynucleotide 196nnngttcact gannnttttn
nngttcactg annn 3419734DNAArtificial SequenceSynthetic
polynucleotide 197nnncctgaag gtnnnttttn nncctgaagg tnnn
3419835DNAArtificial SequenceSynthetic polynucleotide 198nnngttcact
gasnnntttt nnngttcact gannn 3519934DNAArtificial SequenceSynthetic
polynucleotide 199nnncctgaag gtnnnttttn nncctgaagg tnnn
3420034DNAArtificial SequenceSynthetic polynucleotide 200cattgtcaca
ctccattttc attgtcacac tcca 3420135DNAArtificial SequenceSynthetic
polynucleotide 201cattgtcaca ctccattttt cattgtcaca ctcca
3520236DNAArtificial SequenceSynthetic polynucleotide 202cattgtcaca
ctccattttt tcattgtcac actcca 3620334DNAArtificial SequenceSynthetic
polynucleotide 203cattgtcaca ctccattttc attgtcacac tcca
3420415DNAArtificial SequenceSynthetic polynucleotide 204acttactacc
tagcc 1520534DNAArtificial SequenceSynthetic polynucleotide
205acttactacc tagcctttta cttactacct agcc 3420615DNAArtificial
SequenceSynthetic polynucleotide 206cattgtcaca ctcca
1520715DNAArtificial SequenceSynthetic polynucleotide 207ctagttcact
gaatg 1520818DNAArtificial SequenceSynthetic polynucleotide
208tttcattg tcacactcca 1820918DNAArtificial SequenceSynthetic
polynucleotide 209cattgtcaca ctccattt 1821019DNAArtificial
SequenceSynthetic polynucleotide 210cattgtcaca ctccatttt
1921138DNAArtificial SequenceSynthetic polynucleotide 211cattgtcaca
ctccatttt ttttcattgt cacactcca 3821238DNAArtificial
SequenceSynthetic polynucleotide 212cattgtcaca ctccatttt ttttcattgt
cacactcca 3821338DNAArtificial SequenceSynthetic polynucleotide
213cattgtcaca ctccatttt ttttcattgt cacactcca 3821438DNAArtificial
SequenceSynthetic polynucleotide 214cattgtcaca ctccatttt ttttcattgt
cacactcca 3821519DNAArtificial SequenceSynthetic polynucleotide
215cattgtcaca ctccatttt 1921615DNAArtificial SequenceSynthetic
polynucleotide 216cattgtcaca ctcca 1521715DNAArtificial
SequenceSynthetic polynucleotide 217cattgtcaca ctcca
1521815DNAArtificial SequenceSynthetic polynucleotide 218ctagttcac
tgaatg 1521930DNAArtificial SequenceSynthetic polynucleotide
219cattgtcaca ctccacta gttcactgaa tg 3022020DNAArtificial
SequenceSynthetic polynucleotide 220cattgtcaca ctccattttt
2022120DNAArtificial SequenceSynthetic polynucleotide 221cattgtcaca
ctccattttt 2022221DNAArtificial SequenceSynthetic polynucleotide
222utttttcatt gtcacactcc a 2122340DNAArtificial SequenceSynthetic
polynucleotide 223cattgtcaca ctccattttt tttttcat tgtcacactc ca
4022420DNAArtificial SequenceSynthetic polynucleotide 224cattgtcaca
ctccattttu 2022520DNAArtificial SequenceSynthetic polynucleotide
225tttttcat tgtcacactc ca 2022639DNAArtificial SequenceSynthetic
polynucleotide 226cattgtcaca ctccatttttttttcatt gtcacactcc a
3922734DNAArtificial SequenceSynthetic polynucleotide 227cattgtcaca
ctccattttc attgtcacac tcca 3422835DNAArtificial SequenceSynthetic
polynucleotide 228cattgtcaca ctccattttt cattgtcaca ctcca
3522936DNAArtificial SequenceSynthetic polynucleotide 229cattgtcaca
ctccattttt tcattgtcac actcca 3623034DNAArtificial SequenceSynthetic
polynucleotide 230cattgtcaca ctccattttc attgtcacac tcca
3423134DNAArtificial SequenceSynthetic polynucleotide 231cattgtca
cactccattt tcattgtcac actcca 3423234DNAArtificial SequenceSynthetic
polynucleotide 232cattgtcaca ctccattttc attgtcacac tcca
3423334DNAArtificial SequenceSynthetic polynucleotide 233cattgtca
cactccattt tcattgtcac actcca 3423431DNAArtificial SequenceSynthetic
polynucleotide 234gcactgagaa tactttttgc attggtattc a
3123534DNAArtificial SequenceSynthetic polynucleotide 235tgaaggttcc
tccttttttt gaaggttcct cctt 3423634DNAArtificial SequenceSynthetic
polynucleotide 236tgaaggttcc tccttttttt gaaggttcct cctt
3423734DNAArtificial SequenceSynthetic polynucleotide 237ccattgtcac
actccttttc cattgtcaca ctcc 3423834DNAArtificial SequenceSynthetic
polynucleotide 238ccattctcac actgcttttc cattctcaca ctgc
3423920DNAArtificial SequenceSynthetic polynucleotide 239cacactcctt
ttcacactcc 2024032DNAArtificial SequenceSynthetic polynucleotide
240cacactcctt ttcacactcc ttttcacact cc 3224120DNAArtificial
SequenceSynthetic polynucleotide 241cgcacccctt ttcgcacccc
2024232DNAArtificial SequenceSynthetic polynucleotide 242cgcacccctt
ttcgcacccc ttttcgcacc cc 3224334DNAArtificial SequenceSynthetic
polynucleotide 243cttccttaca ttccattttc ttccttacat tcca
3424432DNAArtificial SequenceSynthetic polynucleotide 244acattccatt
ttacattcca ttttacattc ca 3224537DNAArtificial SequenceSynthetic
polynucleotide 245gctttgggaa gtatgttttt cactttcata atgctgg
3724637DNAArtificial SequenceSynthetic polynucleotide 246ctttgggaag
tatgtttttt cactttcata atgctgg 3724737DNAArtificial
SequenceSynthetic polynucleotide 247ggtacatgag tggctttttt
cactttcata atgctgg 3724834DNAArtificial SequenceSynthetic
polynucleotide 248tgatgctgat gctttttttc taaaattcaa tggc
3424934DNAArtificial SequenceSynthetic polynucleotide 249ctaaaattca
atggcttttc taaaattcaa tggc 3425034DNAArtificial SequenceSynthetic
polynucleotide 250ctgttaccca gatgcttttc taaaattcaa tggc
3425134DNAArtificial SequenceSynthetic polynucleotide 251cttcatagtg
gaacattttc taaaattcaa tggc 3425240DNAArtificial SequenceSynthetic
polynucleotide 252tcactttcat aatgctggtt tttcactttc ataatgctgg
4025340DNAArtificial SequenceSynthetic polynucleotide 253gctattacct
taacccagtt ttgctattac cttaacccag 4025440DNAArtificial
SequenceSynthetic polynucleotide 254cctcttacct cagttacatt
ttcctcttac ctcagttaca 4025540DNAArtificial SequenceSynthetic
polynucleotide 255gctattacct taacccagtt ttgctattac cttaacccag
4025640DNAArtificial SequenceSynthetic polynucleotide 256cctcttacct
cagttacatt ttcctcttac ctcagttaca 4025734DNAArtificial
SequenceSynthetic polynucleotide 257ctagttcact gaatgttttc
tagttcactg aatg 3425834DNAArtificial SequenceSynthetic
polynucleotide 258ttccctgaag gttccttttt tccctgaagg ttcc
3425934DNAArtificial SequenceSynthetic polynucleotide 259ctagttcact
gaatgttttc tagttcactg aatg 3426034DNAArtificial SequenceSynthetic
polynucleotide 260ttccctgaag gttccttttt tccctgaagg ttcc
3426116DNAArtificial SequenceSynthetic polynucleotide 261nnnttgtcac
actnnn 1626236DNAArtificial SequenceSynthetic polynucleotide
262nnnttgtcac acatnnnttt tnnnttgtca catnnn 3626315DNAArtificial
SequenceSynthetic polynucleotide 263nnnaggttcc tcnnn
1526434DNAArtificial SequenceSynthetic polynucleotide 264nnnaggttcc
tcnnnttttn nnaggttcct cnnn 3426515DNAArtificial
SequenceSynthetic
polynucleotide 265ncnttnncan antnn 1526634DNAArtificial
SequenceSynthetic polynucleotide 266ncnttnncan antnnttttn
cnttnncana ntnn 3426715DNAArtificial SequenceSynthetic
polynucleotide 267ncnttnncan antnn 1526834DNAArtificial
SequenceSynthetic polynucleotide 268ncnttnncan antnnttttn
cnttnncana ntnn 342698DNAArtificial SequenceSynthetic
polynucleotide 269nnnnnnnn 827020DNAArtificial SequenceSynthetic
polynucleotide 270nnnnnnnntt ttnnnnnnnn 2027132DNAArtificial
SequenceSynthetic polynucleotide 271nnnnnnnntt ttnnnnnnnn
ttttnnnnnn nn 322728DNAArtificial SequenceSynthetic polynucleotide
272nnnnnnnn 827320DNAArtificial SequenceSynthetic polynucleotide
273nnnnnnnntt ttnnnnnnnn 2027432DNAArtificial SequenceSynthetic
polynucleotide 274nnnnnnnntt ttnnnnnnnn ttttnnnnnn nn
3227515DNAArtificial SequenceSynthetic polynucleotide 275nnntgtcaca
ctnnn 15
* * * * *