U.S. patent application number 14/636118 was filed with the patent office on 2015-06-18 for soluble tnf receptors and their use in treatment of disease.
The applicant listed for this patent is Roche Innovation Center Copenhagen A/S. Invention is credited to Henrik Orum, Peter L. Sazani.
Application Number | 20150166634 14/636118 |
Document ID | / |
Family ID | 56290955 |
Filed Date | 2015-06-18 |
United States Patent
Application |
20150166634 |
Kind Code |
A1 |
Orum; Henrik ; et
al. |
June 18, 2015 |
Soluble TNF Receptors and Their Use in Treatment of Disease
Abstract
The present invention relates to tumor necrosis factor (TNF)
antagonists and corresponding nucleic acids derived from tumor
necrosis factor receptors (TNFRs) and their use in the treatment of
inflammatory diseases. These proteins are soluble secreted decoy
receptors that bind to TNF and prevent TNF from signaling to cells.
In particular, the proteins are mammalian TNFRs that lack exon 7
and which can bind TNF and can act as a TNF antagonist.
Inventors: |
Orum; Henrik; (Vaerlose,
DK) ; Sazani; Peter L.; (Chapel Hill, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Roche Innovation Center Copenhagen A/S |
Horsholm |
|
DK |
|
|
Family ID: |
56290955 |
Appl. No.: |
14/636118 |
Filed: |
March 2, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13731999 |
Dec 31, 2012 |
|
|
|
14636118 |
|
|
|
|
12871625 |
Aug 30, 2010 |
|
|
|
13731999 |
|
|
|
|
11799117 |
May 1, 2007 |
7785834 |
|
|
12871625 |
|
|
|
|
11595485 |
Nov 10, 2006 |
|
|
|
11799117 |
|
|
|
|
60862350 |
Oct 20, 2006 |
|
|
|
60735429 |
Nov 10, 2005 |
|
|
|
Current U.S.
Class: |
514/21.2 ;
435/243; 435/320.1; 435/325; 435/348; 435/69.1; 514/44R; 530/350;
536/23.5; 536/24.1 |
Current CPC
Class: |
A61P 29/00 20180101;
A61K 38/00 20130101; C12N 2310/315 20130101; C12N 2310/3231
20130101; C12N 2320/33 20130101; A61K 48/00 20130101; C12N 2310/346
20130101; C12N 2310/321 20130101; C12N 15/113 20130101; C07K
14/7151 20130101; C12N 15/1138 20130101; C07H 21/04 20130101; Y02A
50/30 20180101; C12N 15/111 20130101; Y02A 50/463 20180101; C07K
14/70578 20130101; C12N 2310/11 20130101; C12N 2310/321 20130101;
C12N 2310/3521 20130101 |
International
Class: |
C07K 14/715 20060101
C07K014/715; C12N 15/113 20060101 C12N015/113 |
Claims
1. An isolated protein capable of binding tumor necrosis factor
(TNF), said protein having a sequence comprising the amino acids
encoded by a cDNA derived from a mammalian tumor necrosis factor
receptor (TNFR) gene, wherein the cDNA comprises in 5' to 3'
contiguous order, the codon encoding the first amino acid after the
cleavage point of the signal sequence of said gene through exon 6
of said gene and exon 8 of said gene through exon 10 of said gene;
or the codon encoding the first amino acid of the open reading
frame of said gene through exon 6 of said gene and exon 8 of said
gene through exon 10 of said gene.
2. The protein of claim 1, wherein said TNF is TNF-.alpha..
3. The protein of claim 1, wherein said protein contains at least
one processing, chemical, or post-translational modification, and
wherein said modification is selected from the group consisting of
acetylation, acylation, amidation, ADP-ribosylation, glycosylation,
methylation, pegylation, prenylation, phosphorylation, or
cholesterol conjugation.
4. The protein of claim 1, wherein said receptor is TNFR1.
5. The protein of claim 4, wherein said receptor is human
TNFR1.
6. The protein of claim 1, wherein said receptor is TNFR2.
7. The protein of claim 6, wherein said receptor is human
TNFR2.
8. The protein of claim 1, wherein the sequence of said protein
comprises a sequence selected from the group consisting of SEQ ID
No: 6, amino acids 30-417 of SEQ ID No: 6, SEQ ID No: 8, amino
acids 30-416 of SEQ ID No: 8, SEQ ID No: 10, amino acids 23-435 of
SEQ ID No: 10, SEQ ID No: 12, and amino acids 23-448 of SEQ ID No:
12.
9. A pharmaceutical composition comprising the protein of any one
of claim 1 or 7, in admixture with a pharmaceutically acceptable
carrier.
10. A composition comprising the purified protein of claim 1.
11. A method of treating an inflammatory disease or condition which
comprises administering the pharmaceutical composition of claim 9
to a subject for a time and in an amount effective to reduce the
activity of TNF.
12. The method of claim 11, wherein said disease or condition is
selected from the group consisting of rheumatoid arthritis,
juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis,
ankylosing spondylitis, inflammatory bowel disease (Crohn's disease
or ulcerative colitis), hepatitis associated with hepatitis A
virus, hepatitis associated with hepatitis B virus, hepatitis
associated with hepatitis C virus, hepatitis associated with
ischemia/reperfusion, sepsis, alcoholic liver disease, and
non-alcoholic steatosis.
13. An isolated nucleic acid derived from a mammalian tumor
necrosis factor receptor (TNFR) gene and encoding a protein capable
of binding tumor necrosis factor (TNF), wherein the cDNA of said
protein comprises in 5' to 3' contiguous order, the codon encoding
the first amino acid after the cleavage point of the signal
sequence of said gene through exon 6 of said gene and exon 8 of
said gene through exon 10 of said gene; or the codon encoding the
first amino acid of the open reading frame of said gene through
exon 6 of said gene and axon 8 of said gene through axon 10 of said
gene.
14. The nucleic acid of claim 13, wherein said receptor is
TNFR1.
15. The nucleic acid of claim 14, wherein said receptor is human
TNFR1.
16. The nucleic acid of claim 13, wherein said receptor is
TNFR2.
17. The nucleic acid of claim 16, wherein said receptor is human
TNFR2.
18. The nucleic acid of claim 13, wherein the sequence of said
protein comprises a sequence selected from the group consisting of
SEQ ID No: 6, amino acids 30-417 of SEQ ID No: 6, SEQ ID No: 8,
amino acids 30-416 of SEQ ID No: 8, SEQ ID No: 10, amino acids
23-435 of SEQ ID No: 10, SEQ ID No: 12, and amino acids 23-448 of
SEQ ID No: 12.
19. The nucleic acid of claim 16, wherein the sequence of said
nucleic acid comprises a sequence selected from the group
consisting of nucleotides 1-1251 of SEQ ID No: 5, nucleotides
88-1251 of SEQ ID No: 5, nucleotides 1-1248 of SEQ ID No: 7,
nucleotides 88-1248 of SEQ ID No: 7, nucleotides 1-1305 of SEQ ID
No: 9, nucleotides 67-1305 of SEQ ID No: 9, nucleotides 1-1344 of
SEQ ID No: 11, and nucleotides 67-1344 of SEQ ID No: 11.
20. An expression vector comprising the nucleic acid of any one of
claim 13 or 17 operably linked to a regulatory sequence.
21. A method of increasing the level of a TNF antagonist in a
mammal which comprises transforming cells of said mammal with the
expression vector of claim 20 to thereby express said TNF
antagonist, wherein said vector drives expression of said TNFR.
22. The method of claim 21, wherein said mammal is a human.
23. The method of claim 22, wherein said human is an individual
having an inflammatory disease or condition.
24. The method of claim 21, wherein said expression vector is a
plasmid, or a virus.
25. The method of claim 21, wherein said cells are transformed in
vivo.
26. The method of claim 21, wherein said cells are transformed ex
vivo.
27. The method of claim 21, wherein said expression vector
comprises a tissue specific promoter.
28. The method of claim 27, wherein said tissue specific promoter
is derived from a hepatocyte or a macrophage.
29. The method of claim 21, wherein said cells are selected from
the group consisting of hepatocytes, hematopoietic cells, spleen
cells, and muscle cells.
30. A cell transformed with the expression vector of claim 20.
31. The cell of claim 30, wherein said cell is a mammalian cell, an
insect cell, or a microbial cell.
32. A process for producing a protein capable of binding tumor
necrosis factor (TNF) which comprises culturing the cell of claim
30 under conditions suitable to express said protein, and
recovering said protein.
33. The process of claim 32, wherein said cell is a mammalian cell,
an insect cell, or a microbial cell.
34. A pharmaceutical composition comprising the nucleic acid of
claim 13, in admixture with a pharmaceutically acceptable
carrier.
35. A method of treating an inflammatory disease or condition which
comprises administering the expression vector of claim 20 to a
subject for a time and in an amount sufficient to reduce TNF
activity.
36. The method of claim 35, wherein said TNF activity is
TNF-.alpha. activity.
37. The method of claim 35, wherein said disease or condition is
selected from the group consisting of rheumatoid arthritis,
juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis,
ankylosing spondylitis, inflammatory bowel disease (Crohn's disease
or ulcerative colitis), hepatitis associated with hepatitis A
virus, hepatitis associated with hepatitis B virus, hepatitis
associated with hepatitis C virus, hepatitis associated with
ischemia/reperfusion, sepsis, alcoholic liver disease, and
non-alcoholic steatosis.
38. A method of treating an inflammatory disease or condition which
comprises administering one or more splice switching oligomers
(SSOs) to a subject for a time and in an amount to reduce the
activity of TNF, wherein said one or more SSOs are capable of
altering the splicing of a pre-mRNA encoding a mammalian tumor
necrosis factor receptor 2 (TNFR2) to increase production of a
protein capable of binding tumor necrosis factor (TNF), wherein
said protein has a sequence comprising the amino acids encoded by a
cDNA derived from a gene for said receptor, wherein the cDNA
comprises in 5' to 3' contiguous order, the codon encoding the
first amino acid after the cleavage point of the signal sequence of
said gene through exon 6 of said gene and exon 8 of said gene
through exon 10 of said gene; or the codon encoding the first amino
acid of the open reading frame of said gene through exon 6 of said
gene and exon 8 of said gene through exon 10 of said gene.
39. The method of claim 38, wherein said receptor is a human
TNFR2.
40. The method of claim 38, wherein said disease or condition is
selected from the group consisting of rheumatoid arthritis,
juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis,
ankylosing spondylitis, inflammatory bowel disease (Crohn's disease
or ulcerative colitis), hepatitis associated with hepatitis A
virus, hepatitis associated with hepatitis B virus, hepatitis
associated with hepatitis C virus, hepatitis associated with
ischemia/reperfusion, sepsis, alcoholic liver disease, and
non-alcoholic steatosis.
41. The method of claim 39, wherein the sequence of said SSO
comprises at least 8 nucleotides which are complementary to a
contiguous sequence from SEQ ID No: 13.
42. The method of claim 41 wherein the sequence of said SSO
comprises a sequence selected from the group consisting of SEQ ID
Nos: 14, 30, 46, 70, 71, 72, and 73, and subsequences thereof at
least 8 nucleotides.
43. The method of claim 42, wherein the sequence of said SSO
comprises a sequence selected from the group consisting of SEQ ID
Nos: 14-61.
44. The method of claim 38, wherein said administration is
parenteral, topical, oral, rectal, or pulmonary.
45. A method of increasing the production of a protein capable of
binding tumor necrosis factor (TNF), in a cell, which comprises
administering one or more splice switching oligomers (SSOs) to said
cell, wherein said protein has a sequence comprising the amino
acids encoded by a cDNA derived from a mammalian tumor necrosis
factor receptor 2 (TNFR2) gene, wherein the cDNA comprises in 5' to
3' contiguous order, the codon encoding the first amino acid after
the cleavage point of the signal sequence of said gene through exon
6 of said gene and exon 8 of said gene through exon 10 of said
gene; or the codon encoding the first amino acid of the open
reading frame of said gene through exon 6 of said gene and exon 8
of said gene through exon 10 of said gene, and wherein said one or
more SSOs are capable of altering the splicing of a pre-mRNA
encoding said receptor to increase production of said protein.
46. The method of claim 45, wherein said method is performed in
vivo.
47. The method of claim 45, wherein said receptor is a human
TNFR2.
48. The method of claim 47, wherein said SSO comprises at least 8
nucleotides which are complementary to a contiguous sequence from
SEQ ID No: 13.
49. The method of claim 48, wherein the sequence of said SSO
comprises a sequence selected from the group consisting of SEQ ID
Nos: 14, 30, 46, 70, 71, 72, and 73, and subsequences thereof at
least 8 nucleotides.
50. The method of claim 49, wherein the sequence of said SSO
comprises a sequence selected from the group consisting of SEQ ID
Nos: 14-61.
51. A splice switching oligomer (SSO) comprising at least 8
nucleotides, said SSO capable of altering the splicing of a
pre-mRNA encoding a mammalian tumor necrosis factor receptor 2
(TNFR2) to produce a protein capable of binding tumor necrosis
factor (TNF), wherein said protein has a sequence comprising the
amino acids encoded by a cDNA derived from a gene for said
receptor, wherein the cDNA comprises in 5' to 3' contiguous order,
the codon encoding the first amino acid after the cleavage point of
the signal sequence of said gene through exon 6 of said gene and
exon 8 of said gene through exon 10 of said gene; or the codon
encoding the first amino acid of the open reading frame of said
gene through exon 6 of said gene and exon 8 of said gene through
exon 10 of said gene.
52. The SSO of claim 51, wherein said receptor is a human
TNFR2.
53. The SSO of claim 52, which comprises at least 8 nucleotides
which are complementary to a contiguous sequence from SEQ ID No:
13.
54. The SSO of claim 53, wherein the sequence of said SSO comprises
a sequence selected from the group consisting of SEQ ID Nos: 14,
30, 46, 70, 71, 72, and 73, and subsequences thereof at least 8
nucleotides.
55. The SSO of claim 54, wherein the sequence of said SSO comprises
a sequence selected from the group consisting of SEQ ID Nos:
14-61.
56. A pharmaceutical composition comprising the SSO of claim 51 and
a pharmaceutically acceptable carrier.
Description
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 11/595,485, filed Nov. 10, 2006 which claims
priority to U.S. Provisional application Ser. No. 60/862,350, filed
Oct. 20, 2006, and U.S. Provisional application Ser. No.
60/735,429, filed Nov. 10, 2005, all of which are incorporated by
reference herein in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to tumor necrosis factor (TNF)
antagonists and corresponding nucleic acids derived from TNF
receptors and their use in the treatment of inflammatory diseases.
These proteins are soluble secreted decoy receptors that bind to
TNF-.alpha. and prevent TNF-.alpha. from signaling to cells.
BACKGROUND OF THE INVENTION
[0003] TNF-.alpha. is a pro-inflammatory cytokine that exists as a
membrane-bound homotrimer and is released as a homotrimer into the
circulation by the protease TNF-.alpha. converting enzyme (TACE).
TNF-.alpha. is introduced into the circulation as a mediator of the
inflammatory response to injury and infection. TNF-.alpha. activity
is implicated in the progression of inflammatory diseases such as
rheumatoid arthritis, Crohn's disease, ulcerative colitis,
psoriasis and psoriatic arthritis (Palladino, M. A., et al., 2003,
Nat. Rev. Drug Discov. 2:736-46). Acute exposure to high
TNF-.alpha. levels, as experienced during a massive infection,
results in sepsis. Its symptoms include shock, hypoxia, multiple
organ failure, and death. Chronic low-level release of TNF-.alpha.
is associated with malignancies and leads to cachexia, a disease
characterized by weight loss, dehydration and fat loss.
[0004] TNF-.alpha. activity is mediated primarily through two
receptors coded by two different genes, TNF-.alpha. receptor type I
(hereafter "TNFR1", exemplified by GenBank accession number X55313
for human TNFR1) and TNF-.alpha. receptor type II (hereafter
"TNFR2", exemplified by GenBank accession number NM 001066 for
human TNFR2). TNFR1 is a membrane-bound protein with a molecular
weight of approximately 55 kilodaltons (kDal), while TNFR2 is a
membrane-bound protein with a molecular weight of approximately 75
kDal. TNFR1 and TNFR2 belong to a family of receptors known as the
TNF receptor (TNFR) superfamily. The TNFR superfamily is a group of
type I transmembrane proteins, with a carboxy-terminal
intracellular domain and an amino-terminal extracellular domain
characterized by a common cysteine rich domain (CRD). TNFR1 and
TNFR2 have a unique domain in common, called the pre-ligand-binding
assembly domain (PLAD) that is required for assembly of multiple
receptor subunits and subsequent binding to TNF-.alpha..
[0005] TNFR1 and TNFR2 also share a common gene structure, in which
the coding sequence of each extends over 10 exons separated by 9
introns (Fuchs, et al., 1992, Genomics 13:219; Santee, et al.,
1996, J. Biol. Chem. 35:21151). Most of the transmembrane domain
sequence is encoded by the seventh exon ("exon 7") (See FIG.
1).
[0006] Experiments in knockout mice lacking both TNFR1 and TNFR2
demonstrated that the injury-induced immune response to brain
injury was suppressed, suggesting that drugs that target the TNF
signaling pathways may be beneficial in treating stroke or
traumatic brain injury (Bruce, et al., 1996, Nat. Med. 2:788).
TNFR2 knockout mice, but not TNFR1 knockout mice, were resistant to
experimentally-induced cerebral malaria (Lucas, R., et al., 199-7,
Eur. J. Immunol. 27:1719); whereas TNFR1 knockout mice were
resistant to autoimmune encephalomyelitis (Suvannavejh, G. C., et
al., 2000, Cell. Immunol., 205:24). These knockout mice are models
for human cerebral malaria and multiple sclerosis,
respectively.
[0007] TNFR2 is present at high density on T cells of patients with
interstitial lung disease, suggesting a role for TNFR2 in the
immune responses that lead to alveolitis (Agostini, C., et al.,
1996, Am. J. Respir. Crit. Care Med., 153:1359). TNFR2 is also
implicated in human disorders of lipid metabolism. TNFR2
polymorphism is associated with obesity and insulin resistance
(Fernandez-Real, et al., 2000, Diabetes Care, 23:831), familial
combined hyperlipidemia (Geurts, et al., 2000, Hum. Mol. Genet
9:2067), hypertension and hypercholesterolemia (Glenn, et al.,
2000, Hum. Mol. Genet., 9:1943). In addition, TNFR2 polymorphism is
associated with susceptibility to human narcolepsy (Hohjoh, H., et
al., 2000, Tissue Antigens, 56:446) and to systemic lupus
erythematosus (Komata, T., et al., 1999, Tissue Antigens,
53:527).
[0008] To simplify further analysis and comparison, the human TNFR2
461 amino acid sequence provided in SEQ ID No: 4, GenBank accession
number NP 001057, is used as a reference unless stated otherwise
(FIG. 1). Amino acid 1 is the first amino acid of the full length
protein human TNFR2, which includes the signal sequence. Amino acid
23 located in exon 1 is the first amino acid of the mature protein,
which is the protein after cleavage of the signal sequence. The
transmembrane region spans amino acids 258-287. The exon 6/7
junction is located within the codon that encodes residue 263,
while the exon 7/8 junction is located within the codon that
encodes residue 289.
[0009] Physiological, soluble fragments of both TNFR1 and TNFR2
have been identified. For example, soluble extracellular domains of
these receptors are shed to some extent from the cell membrane by
the action of metalloproteases (Palladino, M. A., et al., 2003,
Nat. Rev. Drug Discov. 2:736-46). Additionally, the pre-mRNA of
TNFR2 undergoes alternative splicing, creating either a full
length, active membrane-bound receptor, or a secreted receptor that
lacks exons 7 and 8 (Lainez et al., 2004, Int. Immunol., 16:169)
("Lainez"). The secreted protein binds TNF-.alpha. but does not
elicit a physiological response, hence reducing overall TNF-.alpha.
activity. Although an endogenous, secreted splice variant of TNFR1
has not yet been identified, the similar genomic structure of the
two receptors suggests that a TNFR1 splice variant can be
produced.
[0010] The cDNA for the splice variant identified by Lainez
contains the 113 bp deletion of exons 7 and 8. This deletion gives
rise to a stop codon 17 bp after the end of exon 6. Consequently,
the protein has the sequence encoded by the first six exons of the
TNFR2 gene (residues 1-262) followed by a 6 amino acid tail of
Ala-Ser-Leu-Ala-Cys-Arg.
[0011] Additional soluble fragments of recombinantly-engineered TNF
receptors are known. In particular, truncated forms of TNFR1 or
TNFR2 have been produced which have (1) all or part of the
extracellular domain or (2) a TNFR extracellular domain fused to
another protein.
[0012] Smith discloses truncated human TNFR2s, including a protein
with residues 23-257, which terminates immediately before the
transmembrane region, and a protein with residues 23-185 (U.S. Pat.
No. 5,945,397). Both TNFR2 fragments are soluble and capable of
binding TNF-.alpha..
[0013] Craig discloses that an extracellular domain of human TNFR2
with residues 23-257 fused to the Fc region of human IgG.sub.1
(TNFR:Fc) is a TNF-.alpha. antagonist capable of reducing
inflammation in rat and mice arthritis models (U.S. Pat. No.
5,605,690). TNFR:Fc is an FDA-approved treatment for certain forms
of arthritis, ankylosing spondylitis, and psoriasis and is sold
under the name etanercept (Enbrel.RTM.).
[0014] Moosmayer demonstrated that soluble human TNFR2 proteins
containing the entire intracellular domain are more active TNF
antagonists than the extracellular domain alone (Moosmayer et al.,
1996, J. Interferon Cytokine Res., 16:471). In those experiments,
Moosmayer compared the activities of solubilized full length TNFR2
(1-461), with TNFR2 lacking all but the three C-terminal amino
acids of the transmembrane region (ATM) (1-258 joined to 283-461),
TNFR extracellular domain (1-258), and TNFR:Fc. The inhibition of
TNF-mediated cytotoxicity by the ATM protein and solubilized full
length TNFR2 are comparable. However, their activities are
approximately 60-fold higher than the TNFR2 extracellular domain
alone, but approximately seven-fold less than TNFR:Fc.
[0015] Since excess TNF-.alpha. activity is associated with disease
pathogenesis, particularly for inflammatory conditions, there is a
need for TNF-.alpha. antagonists and methods for their use in the
treatment of inflammatory diseases. Concerns have been raised
regarding the side effects of currently approved protein-based
TNF-.alpha. antagonists, including TNFR:Fc; these concerns include
exacerbation of latent tuberculosis, worsening of congestive heart
failure, and increased risk of lymphoma (Palladino, M. A., et al.,
2003, Nat. Rev. Drug Discov. 2:736-46). Furthermore, there are
patients who do not respond to currently approved TNF-.alpha.
antagonists. Therefore, there is a continuing need to identify new
TNF-.alpha. antagonists.
[0016] To that end, Sazani et al. have shown, inter alia, that by
using splice switching oligonucleotides (SSOs) it is possible to
generate alternatively spliced mRNA coding for variant TNFR1 or
TNFR2 proteins using the naturally-occurring exon and intron
structure (U.S. application Ser. No. 11/595,485). In particular,
the SSOs lead the cell to produce mRNAs that encode novel TNFR
proteins that lack only exon 7, which encodes most of the
transmembrane region of these proteins. Further characterization of
the TNFR2 protein lacking only exon 7 surprisingly showed that it
is a particularly stable, soluble decoy receptor that binds to and
inactivates extracellular TNF-.alpha.. This protein unexpectedly
has anti-TNF-.alpha. activity that is at least equivalent to
TNFR:Fc.
SUMMARY OF THE INVENTION
[0017] One embodiment of the invention is a protein, either full
length or mature, which can bind TNF, is encoded by a cDNA derived
from a mammalian TNFR gene, and in the cDNA exon 6 is followed
directly by exon 8 and as a result lacks exon 7 ("TNFR .DELTA.7").
In another embodiment, the invention is a pharmaceutical
composition comprising a TNFR .DELTA.7. In a further embodiment,
the invention is a method of treating an inflammatory disease or
condition by administering a pharmaceutical composition comprising
a TNFR .DELTA.7.
[0018] In yet another embodiment, the invention is a nucleic acid
that encodes a TNFR .DELTA.7. In a further embodiment, the
invention is a pharmaceutical composition comprising a nucleic acid
that encodes a TNFR .DELTA.7.
[0019] In another embodiment, the invention is an expression vector
comprising a nucleic acid that encodes a TNFR .DELTA.7. In a
further embodiment, the invention is a method of increasing the
level of a soluble TNFR in the serum of a mammal by transforming
cells of the mammal with an expression vector comprising a nucleic
acid that encodes a TNFR .DELTA.7.
[0020] In another embodiment, the invention is a cell transformed
with an expression vector comprising a nucleic acid that encodes a
TNFR .DELTA.7. In a further embodiment, the invention is a method
of producing a TNFR .DELTA.7 by culturing, under conditions
suitable to express the TNFR .DELTA.7, a cell transformed with an
expression vector comprising a nucleic acid that encodes a TNFR
.DELTA.7. In yet another embodiment, the invention is a method of
treating an inflammatory disease or condition by administering an
expression vector comprising a nucleic acid that encodes a TNFR
.DELTA.7.
[0021] In yet another embodiment, splice-switching oligomers (SSOs)
are disclosed that alter the splicing of a mammalian TNFR2 pre-mRNA
to produce a mammalian TNFR2 protein, which can bind TNF and where
exon 6 is followed directly by exon 8 and as a result lacks exon 7
("TNFR2 .DELTA.7"). One embodiment of the invention is a method of
treating an inflammatory disease or condition by administering SSOs
to a patient or a live subject. The SSOs that are administered
alter the splicing of a mammalian TNFR2 pre-mRNA to produce a TNFR2
.DELTA.7. In another embodiment, the invention is a method of
producing a TNFR2 .DELTA.7 in a cell by administering SSOs to the
cell.
[0022] The foregoing and other objects and aspects of the present
invention are discussed in detail in the drawings herein and the
specification set forth below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 schematically depicts the human TNFR2 structure.
Relevant exons and introns are represented by boxes and lines,
respectively. The signal sequence and the transmembrane region are
shaded. Residues that form the boundaries of the signal sequence,
the transmembrane region, and the final residue are indicated below
the diagram. Exon boundaries are indicated above the diagram; if
the 3' end of an exon and the 5' end of the following exon have the
same residue number, then the splice junction is located within the
codon encoding that residue.
[0024] FIG. 2A graphically illustrates the amount of soluble TNFR2
from SSO treated primary human hepatocytes. The indicated SSO was
transfected into primary human hepatocytes at 50 nM. After
.about.48 hrs, the extracellular media was analyzed by enzyme
linked immunosorbant assay (ELISA) for soluble TNFR2 using the
Quantikine.RTM. Human sTNF RII ELISA kit from R&D Systems
(Minneapolis, Minn.). Error bars represent the standard deviation
for 3 independent experiments.
[0025] FIG. 2B: Total RNA was analyzed for TNFR2 splice switching
by RT-PCR using primers specific for human TNFR2. SSOs targeted to
exon seven led to shifting from full length TNFR2 mRNA (FL) to
TNFR2 .DELTA.7 mRNA (.DELTA.7). SSO 3083 is a control SSO with no
TNFR2 splice switching ability.
[0026] FIG. 3 shows the splicing products of L929 cells treated
with SSO 10-mers targeted to mouse TNFR2 exon 7. L929 cells were
transfected with the indicated SSO concentration (50 or 100 nM),
and evaluated for splice switching of TNFR2 by RT-PCR 24 his later.
PCR primers were used to amplify from Exon 5 to Exon 9, so that
"Full Length" (FL) TNFR2 is represented by a 486 bp band.
Transcripts lacking exon 7 (.DELTA.7) is represented by a 408 bp
band.
[0027] FIGS. 4A and 4B show the splicing products of mice treated
with SSO 10-mers targeted to mouse TNFR2 exon 7. The indicated SSOs
were resuspended in saline, and injected i.p. into mice at 25
mg/kg/day for 5 days. Mice were prebled before SSO injection, and
10 days after the final SSO injection and sacrificed. At the time
of sacrifice, total RNA from livers was analyzed for TNFR2 splice
switching by RT-PCR. FL--full length TNFR2; .DELTA.7--TNFR2
.DELTA.7 (FIG. 4A). The concentration of TNFR2 .DELTA.7 in the
serum taken before (Pre) and after (Post) SSO injection was
determined by ELISA using the Quantikine.RTM. Mouse sTNF RII ELISA
kit from R&D Systems (Minneapolis, Minn.) (FIG. 4B). Error bars
represent the standard error from 3 independent readings of the
same sample.
[0028] FIG. 5 depicts the splice switching ability of SSOs of
different lengths. Primary human hepatocytes were transfected with
the indicated SSO and TNFR2 expression analyzed by RT-PCR (top
panel) and ELISA (bottom panel) as in FIG. 2. Error bars represent
the standard deviation from 2 independent experiments.
[0029] FIGS. 6A and 6B illustrate TNFR2 .DELTA.7 mRNA induction in
the livers of SSO treated mice. FIG. 6A: Total RNA from the livers
of SSO 3274 treated mice were subjected to RT-PCR, and the products
visualized on a 1.5% agarose gel. The sequence of the exon 6-exon 8
junction is shown in FIG. 6B.
[0030] FIGS. 7A and 7B illustrate TNFR2 .DELTA.7 mRNA induction in
SSO treated primary human hepatocytes. FIG. 7A: Total RNA from SSO
3379 treated cells were subjected to RT-PCR, and the products
visualized on a 1.5% agarose gel. The sequence of the exon 6-exon 8
junction is shown in FIG. 7B.
[0031] FIGS. 8A and 8B illustrate the dose dependence of TNFR2
pre-mRNA splicing shifting by SSO 3378, 3379 and 3384. Primary
human hepatocytes were transfected with 1-150 nM of the indicated
SSO. After .about.48 hrs, the cells were harvested for total RNA,
and the extracellular media was collected. FIG. 8A: Total RNA was
analyzed for TNFR2 splice switching by RT-PCR using primers
specific for human TNFR2. For each SSO, amount of splice switching
is plotted as a function of SSO concentration. FIG. 8B: The
concentration of soluble TNFR2 in the extracellular media was
determined by ELISA and plotted as a function of SSO. Error bars
represent the standard deviation for at least 2 independent
experiments.
[0032] FIG. 9 graphically illustrates detection of secreted TNFR2
splice variants from L929 cells. Cells were transfected with the
indicated SSOs. After 72 hrs, the extracellular media was removed
and analyzed by ELISA. The data are expressed as pg soluble TNFR2
per mL.
[0033] FIG. 10 shows the splicing products for intraperitoneal
(i.p.) injection of SSO 3274 (top) and 3305 (bottom) in mice. SSO
3274 was injected i.p. at 25 mg/kg/day for either 4 days (4/1 and
4/10) or 10 days (10/1). Mice were sacrificed either 1 day (4/1 and
10/1) or 10 days (4/10) after the last injection and total RNA from
liver was analyzed by RT-PCR for TNFR2 splice switching as
described in FIG. 3. SSO 3305 was injected at the indicated dose
per day for 4 days. Mice were sacrificed the next day and the
livers analyzed as with 3274 treated animals.
[0034] FIG. 11A graphically illustrates the amount of soluble TNFR2
in mouse serum 10 days after SSO treatment. Mice were injected i.p.
with the indicated SSO or saline (n=5 per group) at 25 mg/kg/day
for 10 days. Serum was collected 4 days before injections began and
on the indicated days after the last injection. Sera was analyzed
by ELISA as described in FIG. 2. At day 10, mice were sacrificed
and livers were analyzed for TNFR2 splice switching by RT-PCR (FIG.
11B) as described in FIG. 10.
[0035] FIG. 12A graphically illustrates the amount of soluble TNFR2
in mouse serum 27 days after SSO treatment. Mice were treated as
described in FIG. 11, except that serum samples were collected
until day 27 after the last injection. SSOs 3083 and 3272 are
control SSOs with no TNFR2 splice switching ability. At day 27,
mice were sacrificed and livers were analyzed for TNFR2 splice
switching by RT-PCR (FIG. 12B) as described in FIG. 11.
[0036] FIGS. 13A and 13B graphically depict the anti-TNF-.alpha.
activity in a cell-based assay using serum from 550 treated mice,
where serum samples were collected 5 days (FIG. 6A) and 27 days
(FIG. 6B) after 550 treatment. L929 cells were treated with either
0.1 ng/mL TNF-.alpha., or TNF-.alpha. plus 10% serum from mice
treated with the indicated SSO. Cell viability was measured 24 hrs
later and normalized to untreated cells.
[0037] FIG. 14 graphically compares the anti-TNF-.alpha. activity
of serum from the indicated SSO oligonucleotide-treated mice to
recombinant soluble TNFR2 (rsTNFR2) extracellular domain from
Sigma.RTM. and to Enbrel.RTM. using the cell survival assay
described in FIG. 13.
[0038] FIGS. 15A and 15B compare the stability of muTNFR2 .DELTA.7
protein (FIG. 15A) and mRNA (FIG. 15B). Mice were injected at 25
mg/kg/day daily with either SSO 3272, SSO 3274 or SSO 3305 (n=5).
Mice were bled on the indicated day after the last injection and
the serum TNFR2 concentration was measured. Total RNA from mice
sacrificed on the indicated day after the last injection of SSO was
subjected to RT-PCR as described in FIG. 10.
[0039] FIG. 16 plots TNFR2 .DELTA.7 protein (dashed line) and mRNA
(solid line) levels over time, as a percentage of the amount of
protein or mRNA, respectively, 10 days after the last
injection.
[0040] FIG. 17 graphically illustrates the dose dependant
anti-TNF-.alpha. activity of TNFR2 .DELTA.7 expressed in HeLa cells
after transfection with TNFR2 .DELTA.7 mammalian expression
plasmids. HeLa cells were transfected with the indicated mouse or
human TNFR2 .DELTA.7 plasmid and extracellular media was collected
after 48 hrs. The TNFR2 .DELTA.7 concentration in the media was
determined by ELISA and serial dilutions were prepared. These
dilutions were assayed for anti-TNF-.alpha. activity by the L929
cytoxicity assay as in FIG. 14.
[0041] FIG. 18 shows expressed mouse (A) and human (B) TNFR2
.DELTA.7 protein isolated by polyacrylamide gel electrophoresis
(PAGE). HeLa cells were transfected with the indicated plasmid.
After .about.48 hrs, the extracellular media was collected and
concentrated, and cells were collected in RIPA lysis buffer. The
proteins in the samples were separated by PAGE and a western blot
was performed using a C-terminal TNFR2 primary antibody (Abeam)
that recognizes both the human and mouse TNFR2 .DELTA.7 proteins.
Media, extracellular media samples from HeLa cells transfected with
the indicated plasmid; Lysate, cell lysate from Hela cells
transfected with the indicated plasmid. CM, control media from
untransfected HeLa cells; CL, control cell lysates from
untransfected HeLa cells. +, molecular weight markers (kDal).
[0042] FIG. 19 shows purified His-tagged human and mouse TNFR2
.DELTA.7. Unconcentrated extracellular media containing the
indicated TNFR2 .DELTA.7 protein was prepared as in FIG. 18.
Approximately 32 mL of the media was applied to a 1 mL HisPur
cobalt spin column (Pierce), and bound proteins were eluted in 1 mL
buffer containing 150 mM imidazole. Samples of each were analyzed
by PAGE and western blot was performed as in FIG. 18. The multiple
bands in lanes 1144-4 and 1319-1 represent variably glycosylated
forms of TNFR2 .DELTA.7.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0043] As used herein, the terms "tumor necrosis factor receptor",
"TNF receptor", and "TNFR" refer to proteins having amino acid
sequences of or which are substantially similar to native mammalian
TNF receptor sequences, and which are capable of binding TNF
molecules. In this context, a "native" receptor or gene for such a
receptor, means a receptor or gene that occurs in nature, as well
as the naturally-occurring allelic variations of such receptors and
genes.
[0044] The term "mature" as used in connection with a TNFR means a
protein expressed in a form lacking a leader or signal sequence as
may be present in full-length transcripts of a native gene.
[0045] The nomenclature for TNFR proteins as used herein follows
the convention of naming the protein (e.g., TNFR2) preceded by a
species designation, e.g., hu (for human) or mu (for murine),
followed by a .DELTA. (to designate a deletion) and the number of
the exon(s) deleted. For example, huTNFR2 .DELTA.7 refers to human
TNFR2 lacking exon 7. In the absence of any species designation,
TNFR refers generically to mammalian TNFR.
[0046] The term "secreted" means that the protein is soluble, i.e.,
that it is not bound to the cell membrane. In this context, a form
will be soluble if using conventional assays known to one of skill
in the art most of this form can be detected in fractions that are
not associated with the membrane, e.g., in cellular supernatants or
serum.
[0047] The term "stable" means that the secreted TNFR form is
detectable using conventional assays by one of skill in the art,
such as, western blots, ELISA assays in harvested cells, cellular
supernatants, or serum.
[0048] As used herein, the terms "tumor necrosis factor" and "TNF"
refer to the naturally-occurring protein ligands that bind to TNF
receptors. TNF includes, but is not limited to, TNF-.alpha. and
TNF-.beta..
[0049] As used herein, the term "an inflammatory disease or
condition" refers to a disease, disorder, or other medical
condition that at least in part results from or is aggravated by
the binding of TNF to its receptor. Such diseases or conditions
include, but are not limited to, those associated with increased
levels of TNF, increased levels of TNF receptor; or increased
sensitization or deregulation of the corresponding signaling
pathway. The term also encompasses diseases and conditions for
which known TNF antagonists have been shown useful. Examples of
inflammatory diseases or conditions include, but are not limited
to, rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis,
psoriatic arthritis, ankylosing spondylitis, inflammatory bowel
disease (including Crohn's disease and ulcerative colitis),
hepatitis, sepsis, alcoholic liver disease, and non-alcoholic
steatosis.
[0050] As used herein, the term "hepatitis" refers to a
gastroenterological disease, condition, or disorder that is
characterized, at least in part, by inflammation of the liver.
Examples of hepatitis include, but are not limited to, hepatitis
associated with hepatitis A virus, hepatitis B virus, hepatitis C
virus, or liver inflammation associated with
ischemia/reperfusion.
[0051] As used herein, the term "TNF antagonist" means that the
protein is capable of measurable inhibition of TNF-mediated
cytotoxicity using standard assays as are well known in the art.
(See, e.g., Example 1 below, L929 cytotoxicity assay).
[0052] The term "binds TNF" means that the protein can bind
detectable levels of TNF, preferably TNF-.alpha., as measured by
standard binding assays as are well known in the art (See, e.g.,
U.S. Pat. No. 5,945,397 to Smith, cols. 16-17). Preferably,
receptors of the present invention are capable of binding greater
than 0.1 nmoles TNF-.alpha./nmole receptor, and more preferably,
greater than 0.5 nmoles TNF-.alpha./nmole receptor using standard
binding assays.
[0053] As used herein, the term "regulatory element" refers to a
nucleotide sequence involved in an interaction of molecules that
contributes to the functional regulation of a nucleic acid,
including but not limited to, replication, duplication,
transcription, splicing, translation, or degradation of the nucleic
acid. The regulation may be enhancing or inhibitory in nature.
Regulatory elements known in the art include, for example,
transcriptional regulatory sequences such as promoters and
enhancers. A promoter is a DNA region that is capable under certain
conditions of aiding the initiation of transcription of a coding
region usually located downstream (in the 3' direction) from the
promoter.
[0054] As used herein, the term "operably linked" refers to a
juxtaposition of genetic elements, wherein the elements are in a
relationship permitting them to operate in the expected manner. For
example, a promoter is operably linked to a coding region if the
promoter helps initiate transcription of the coding sequence. As
long as this functional relationship is maintained, there can be
intervening residues between the promoter and the coding
region.
[0055] As used herein, the terms "transformation" or "transfection"
refer to the insertion of an exogenous nucleic acid into a cell,
irrespective of the method used for the insertion, for example,
lipofection, transduction, infection or electroporation. The
exogenous nucleic acid can be maintained as a non-integrated
vector, for example, a plasmid, or alternatively, can be integrated
into the cell's genome.
[0056] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector,
wherein additional DNA segments can be ligated into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g., bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g., non-episomal mammalian vectors) are
integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors, expression vectors, are capable
of directing the expression of genes to which they are operably
linked. In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids or viral vectors
(e.g., replication defective retroviruses, adenoviruses and
adeno-associated viruses).
[0057] As used herein, the term "isolated protein" refers to a
protein or polypeptide that is not naturally-occurring and/or is
separated from one or more components that are naturally associated
with it.
[0058] As used herein, the term "isolated nucleic acid" refers to a
nucleic acid that is not naturally-occurring and/or is in the form
of a separate fragment or as a component of a larger construct,
which has been derived from a nucleic acid isolated at least once
in substantially pure form, i.e., free of contaminating endogenous
materials, and in a quantity or concentration enabling
identification and manipulation by standard biochemical methods,
for example, using a cloning vector.
[0059] As used herein the term "purified protein" refers to a
protein that is present in the substantial absence of other
protein. However, such purified proteins can contain other proteins
added as stabilizers, carriers, excipients, or co-therapeutics. The
tuna "purified" as used herein preferably means at least 80% by dry
weight, more preferably in the range of 95-99% by weight, and most
preferably at least 99.8% by weight, of protein present, excluding
proteins added as stabilizers, carriers, excipients, or
co-therapeutics.
[0060] As used herein, the term "altering the splicing of a
pre-mRNA" refers to altering the splicing of a cellular pre-mRNA
target resulting in an altered ratio of splice products. Such an
alteration of splicing can be detected by a variety of techniques
well known to one of skill in the art. For example, RT-PCR on total
cellular RNA can be used to detect the ratio of splice products in
the presence and the absence of an SSO.
[0061] As used herein, the term "complementary" is used to indicate
a sufficient degree of complementarity or precise pairing such that
stable and specific binding occurs between an oligonucleotide and a
DNA or RNA containing the target sequence. It is understood in the
art that the sequence of an oligonucleotide need not be 100%
complementary to that of its target. For example, for an SSO there
is a sufficient degree of complementarity when, under conditions
which permit splicing, binding to the target will occur and
non-specific binding will be avoided.
[0062] Proteins:
[0063] One embodiment of the present invention is a protein, either
full length or mature, which is encoded by a cDNA derived from a
mammalian TNFR gene, and in the cDNA exon 6 is followed directly by
exon 8 and as a result lacks exon 7. Furthermore the protein can
bind TNF, preferably TNF-.alpha., and can act as a TNF, preferably
TNF-.alpha., antagonist. Preferably, TNFR of the present invention
is capable of inhibition of TNF-mediated cytotoxicity to a greater
extent than the soluble extracellular domain alone, and more
preferably, to an extent comparable to or greater than TNFR:Fc.
Mammalian TNFR according to the present disclosure includes, but is
not limited to, human, primate, murine, canine, feline, bovine,
ovine, equine, and porcine TNFR. Furthermore, mammalian TNFR
according to the present disclosure includes, but is not limited
to, a protein sequence that results from one or more single
nucleotide polymorphisms, such as for example those disclosed in EP
Pat. Appl. 1,172,444, as long as the protein retains a comparable
biological activity to the reference sequence with which it is
being compared.
[0064] In one embodiment, the mammalian TNFR is a mammalian TNFR1,
preferably a human TNFR1. For human TNFR1 two non-limiting examples
of this embodiment are given by huTNFR1 .DELTA.7 which includes the
signal sequence as shown in SEQ ID No: 6 and mature huTNFR1
.DELTA.7 (amino acids 30-417 of SEQ ID No: 6) which lacks the
signal sequence. The sequences of these huTNFR1 .DELTA.7 proteins
are either amino acids 1-208 of wild type human TNFR1 (SEQ ID No:
2) which includes the signal sequence or 30-208 of wild type human
TNFR1 for mature huTNFR1 .DELTA.7 which lacks the signal sequence,
and in either case is followed immediately by amino acids 247-455
of wild type human TNFR1.
[0065] In another preferred embodiment, the mammalian TNFR is a
mammalian TNFR2, most preferably a human TNFR2. For human TNFR2 two
non-limiting examples of this embodiment are given by huTNFR2
.DELTA.7 which includes the signal sequence as shown in SEQ ID No:
10 or mature huTNFR2 .DELTA.7 (amino acids 23-435 of SEQ ID No: 10)
which lacks the signal sequence. The sequences of these huTNFR2
.DELTA.7 proteins are either amino acids 1-262 of wild type human
TNFR2 (SEQ ID No: 4) which includes the signal sequence or 23-262
of wild type human TNFR2 for mature huTNFR2 .DELTA.7 which lacks
the signal sequence, followed in either case by the amino acid
glutamate, because of the creation of a unique codon at the exon
6-8 junction, which is followed by amino acids 290-461 of wild type
human TNFR2.
[0066] The proteins of the present invention also include those
proteins that are chemically modified. Chemical modification of a
protein refers to a protein where at least one of its amino acid
residues is modified by either natural processes, such as
processing or other post-translational modifications, or by
chemical modification techniques known in the art. Such
modifications include, but are not limited to, acetylation,
acylation, amidation, ADP-ribosylation, glycosylation, methylation,
pegylation, prenylation, phosphorylation, or cholesterol
conjugation.
[0067] Nucleic Acids:
[0068] One embodiment of the present invention is a nucleic acid
that encodes a protein, either full length or mature, which is
encoded by a cDNA derived from a mammalian TNFR gene, and in the
cDNA exon 6 is followed directly by exon 8 and as a result lacks
exon 7.
[0069] Such sequences are preferably provided in the form of an
open reading frame uninterrupted by internal nontranslated
sequences, or introns, which are typically present in eukaryotic
genes. Genomic DNA containing the relevant sequences can also be
used. In one embodiment, the nucleic acid is either an mRNA or a
cDNA. In another embodiment, it is genomic DNA.
[0070] In one embodiment, the mammalian TNFR is a mammalian TNFR1.
For this embodiment, the mammalian TNFR1 is preferably a human
TNFR1. For human TNFR1, two non-limiting examples of this
embodiment are nucleic acids which encode the huTNFR1 .DELTA.7
which includes the signal sequence as shown in SEQ ID No: 6 and
mature huTNFR1 .DELTA.7 (amino acids 30-417 of SEQ ID No: 6) which
lacks the signal sequence. Preferably, the sequences of these
huTNFR1 .DELTA.7 nucleic acids are nucleotides 1-1251 of SEQ ID No:
5, which includes the signal sequence and nucleotides 88-1251 of
SEQ ID No: 5 which lacks the signal sequence. The sequences of
these huTNFR1 .DELTA.7 nucleic acids are either nucleotides 1-625
of wild type human TNFR1 (SEQ ID No: 1) which includes the signal
sequence or 88-625 of wild type human TNFR1 for mature huTNFR2
.DELTA.7 which lacks the signal sequence, and in either case is
followed immediately by amino acids 740-1368 of wild type human
TNFR1.
[0071] In another preferred embodiment, the mammalian TNFR is a
mammalian TNFR2, most preferably a human TNFR2. For, human TNFR2,
two non-limiting examples of this embodiment are nucleic acids
which encode the huTNFR2 .DELTA.7 which includes the signal
sequence as shown in SEQ ID No: 10 or mature huTNFR2 .DELTA.7
(amino acids 23-435 of SEQ ID No: 10) which lacks the signal
sequence. Preferably, the sequences of these huTNFR2 .DELTA.7
nucleic acids are nucleotides 1-1305 of SEQ ID No: 9 which includes
the signal sequence and nucleotides 67-1305 of SEQ ID No: 9 which
lacks the signal sequence. The sequences of these huTNFR2 .DELTA.7
nucleic acids are either nucleotides 1-787 of wild type human TNFR2
(SEQ ID No: 3) which includes the signal sequence or 67-787 of wild
type human TNFR2 for mature huTNFR2 .DELTA.7 which lacks the signal
sequence, and in either case is followed immediately by amino acids
866-1386 of wild type human TNFR2.
[0072] The bases of the nucleic acids of the present invention can
be the conventional bases cytosine, guanine, adenine and uracil or
thymidine. Alternatively, modified bases can be used. Other
suitable bases include, but are not limited to, 5-methylcytosine
(.sup.MeC), isocytosine, pseudoisocytosine, 5-bromouracil,
5-propynyluracil, 5-propyny-6, 5-methylthiazoleuracil,
6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine,
7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine,
2-chloro-6-aminopurine and 9-(aminoethoxy)phenoxazine.
[0073] Suitable nucleic acids of the present invention include
numerous alternative chemistries. For example, suitable nucleic
acids of the present invention include, but are not limited to,
those wherein at least one of the internucleotide bridging
phosphate residues is a modified phosphate, such as
phosphorothioate, methyl phosphonate, methyl phosphonothioate,
phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate.
In another non-limiting example, suitable nucleic acids of the
present invention include those wherein at least one of the
nucleotides contain a 2' lower alkyl moiety (e.g., C.sub.1-C.sub.4,
linear or branched, saturated or unsaturated alkyl, such as methyl,
ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl).
[0074] Nucleic acids of the present invention also include, but are
not limited to, those wherein at least one, of the nucleotides is a
nucleic acid analogue. Examples of such analogues include, but are
not limited to, hexitol (HNA) nucleotides, 2'O-4'C-linked bicyclic
ribofuranosyl (LNA) nucleotides, peptide nucleic acid (PNA)
analogues, N3'.fwdarw.P5' phosphoramidate analogues,
phosphorodiamidate morpholino nucleotide analogues, and
combinations thereof.
[0075] Nucleic acids of the present invention include, but are not
limited to, modifications of the nucleic acids involving chemically
linking to the nucleic acids one or more moieties or conjugates.
Such moieties include, but are not limited to, lipid moieties such
as a cholesterol moiety, cholic acid, a thioether, e.g.
hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g.,
dodecandiol or undecyl residues, a phospholipids, e.g.,
di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a
polyethylene glycol chain, an adamantane acetic acid, a palmityl
moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol
moiety.
[0076] Pharmaceutical Compositions and Preparations:
[0077] Other embodiments of the invention are pharmaceutical
compositions comprising the foregoing proteins and nucleic
acids.
[0078] The nucleic acids and proteins of the present invention may
be admixed, encapsulated, conjugated, or otherwise associated with
other molecules, molecule structures, or mixtures of compounds, as
for example liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution, and/or absorption.
[0079] Formulations of the present invention comprise nucleic acids
and proteins in a physiologically or pharmaceutically acceptable
carrier, such as an aqueous carrier. Thus formulations for use in
the present invention include, but are not limited to, those
suitable for parenteral administration including intra-articular,
intraperitoneal, intravenous, intraarterial, subcutaneous, or
intramuscular injection or infusion, as well as those suitable for
topical, ophthalmic, vaginal, oral, rectal or pulmonary
administration (including inhalation or insufflation of powders or
aerosols, including by nebulizer, intratracheal, and intranasal
delivery). The formulations may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art. The most suitable route of administration in any given
case may depend upon the subject, the nature and severity of the
condition being treated, and the particular active compound which
is being used.
[0080] Pharmaceutical compositions of the present invention
include, but are not limited to, physiologically and
pharmaceutically acceptable salts, i.e., salts that retain the
desired biological activity of the parent compound and do not
impart undesired toxicological properties. Examples of such salts
are (a) salts formed with cations such as sodium, potassium,
NH.sub.4.sup.+, magnesium, calcium, polyamines such as spermine and
spermidine, etc.; (b) acid addition salts formed with inorganic
acids, for example, hydrochloric acid, hydrobromic acid, sulfuric
acid, phosphoric acid, nitric acid and the like; and (c) salts
formed with organic acids such as, for example, acetic acid, oxalic
acid, tartaric acid, succinic acid, maleic acid, fumaric acid,
gluconic acid, citric acid, malic acid, ascorbic acid, benzoic
acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid,
napthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic
acid, napthalenedisulfonic acid, polygalacturonic acid, and the
like.
[0081] The present invention provides for the use of proteins and
nucleic acids as set forth above for the preparation of a
medicament for treating a patient afflicted with an inflammatory
disorder involving excessive activity of TNF, as discussed below.
In the manufacture of a medicament according to the invention, the
nucleic acids and proteins of the present invention are typically
admixed with, inter alia, an acceptable carrier. The carrier must,
of course, be acceptable in the sense of being compatible with
other ingredients in the formulation and must not be deleterious to
the patient. The carrier may be a solid or liquid. Nucleic acids
and proteins of the present invention are incorporated in
formulations, which may be prepared by any of the well known
techniques of pharmacy consisting essentially of admixing the
components, optionally including one or more accessory therapeutic
ingredients.
[0082] Formulations of the present invention may comprise sterile
aqueous and non-aqueous injection solutions of the active
compounds, which preparations are preferably isotonic with the
blood of the intended recipient and essentially pyrogen free. These
preparations may contain anti-oxidants, buffers, bacteriostats, and
solutes which render the formulation isotonic with the blood of the
intended recipient. Aqueous and non-aqueous sterile suspensions can
include, but are not limited to, suspending agents and thickening
agents. The formulations may be presented in unit dose or
multi-dose containers, for example, sealed ampoules and vials, and
may be stuffed in freeze-dried (lyophilized) condition requiring
only the addition of the sterile liquid carrier, for example,
saline or water-for-injection immediately prior to use.
[0083] In the formulation the nucleic acids and proteins of the
present invention may be contained within a particle or vesicle,
such as a liposome or microcrystal, which may be suitable for
parenteral administration. The particles may be of any suitable
structure, such as unilamellar or plurilameller, so long as the
nucleic acids and proteins of the present invention are contained
therein. Positively charged lipids such as
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammoniummethylsulfa-
te, or "DOTAP," are particularly preferred for such particles and
vesicles. The preparation of such lipid particles is well known
(See references in U.S. Pat. No. 5,976,879 col. 6).
[0084] Expression Vectors and Host Cells:
[0085] The present invention provides expression vectors to amplify
or express DNA encoding mammalian TNFR of the current invention.
The present invention also provides host cells transformed with the
foregoing expression vectors. Expression vectors are replicable DNA
constructs which have synthetic or cDNA-derived DNA fragments
encoding mammalian TNFR or bioequivalent analogues operably linked
to suitable transcriptional or translational regulatory elements
derived from mammalian, microbial, viral, or insect genes. A
transcriptional unit generally comprises an assembly of (a) a
genetic element or elements having a regulatory role in gene
expression, such as, transcriptional promoters or enhancers, (b) a
structural or coding sequence which is transcribed into mRNA and
translated into protein, and (c) appropriate transcription and
translation initiation and termination sequences. Such regulatory
elements can include an operator sequence to control transcription,
and a sequence encoding suitable mRNA ribosomal binding sites. The
ability to replicate in a host, usually conferred by an origin of
replication, and a selection gene to facilitate recognition of
transformants, can additionally be incorporated.
[0086] DNA regions are operably linked when they are functionally
related to each other. For example, DNA for a signal peptide
(secretory leader) is operably linked to DNA for a polypeptide if
it is expressed as a precursor which participates in the secretion
of the polypeptide; a promoter is operably linked to a coding
sequence if it controls the transcription of the sequence; or a
ribosome binding site is operably linked to a coding sequence if it
is positioned so as to permit translation. Generally, operably
linked means contiguous and, in the case of secretory leaders,
contiguous and in reading frame. Structural elements intended for
use in yeast expression systems preferably include a leader
sequence enabling extracellular secretion of translated protein by
a host cell. Alternatively, where recombinant protein is expressed
without a leader or transport sequence, it may include an
N-terminal methionine residue. This residue may optionally be
subsequently cleaved from the expressed protein to provide a final
product.
[0087] Mammalian TNFR DNA is expressed or amplified in a
recombinant expression system comprising a substantially
homogeneous monoculture of suitable host microorganisms, for
example, bacteria such as E. coli or yeast such as S. cerevisiae,
which have stably integrated (by transformation or transfection) a
recombinant transcriptional unit into chromosomal DNA or carry the
recombinant transcriptional unit as a component of a resident
plasmid. Recombinant expression systems as defined herein will
express heterologous protein either constitutively or upon
induction of the regulatory elements linked to the DNA sequence or
synthetic gene to be expressed.
[0088] Transformed host cells are cells which have been transformed
or transfected with mammalian TNFR vectors constructed using
recombinant DNA techniques. Transformed host cells ordinarily
express TNFR, but host cells transformed for purposes' of cloning
or amplifying TNFR DNA do not need to express TNFR. Suitable host
cells for expression of mammalian TNFR include prokaryotes, yeast,
fungi, or higher eukaryotic cells. Prokaryotes include gram
negative or gram positive organisms, for example E. coli or
bacilli. Higher eukaryotic cells include, but are not limited to,
established insect and mammalian cell lines. Cell-free translation
systems can also be employed to produce mammalian TNFR using RNAs
derived from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with bacterial,
fungal, yeast, and mammalian cellular hosts are well known in the
art.
[0089] Prokaryotic expression hosts may be used for expression of
TNFR that do not require extensive proteolytic and disulfide
processing. Prokaryotic expression vectors generally comprise one
or more phenotypic selectable markers, for example a gene encoding
proteins conferring antibiotic resistance or supplying an
autotrophic requirement, and an origin of replication recognized by
the host to ensure amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium, and various species within the
genera Pseudomonas, Streptomyces, and Staphyolococcus, although
others can also be employed as a matter of choice.
[0090] Useful expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). These pBR322
"backbone" sections are combined with an appropriate promoter and
the structural sequence to be expressed. pBR322 contains genes for
ampicillin and tetracycline resistance and thus provides simple
means for identifying transformed cells. Such commercial vectors
include, for example, the series of Novagen.RTM. pET vectors (EMD
Biosciences, Inc., Madison, Wis.).
[0091] Promoters commonly used in recombinant microbial expression
vectors include the lactose promoter system, and the .lamda.
P.sub.L promoter, the T7 promoter, and the T7 lac promoter. A
particularly useful bacterial expression system, Novagen.RTM. pET
system (EMD Biosciences, Inc., Madison, Wis.) employs a T7 or T7
lac promoter and E. coli strain, such as BL21(DE3) which contain a
chromosomal copy of the T7 RNA polymerase gene.
[0092] TNFR proteins can also be expressed in yeast and fungal
hosts, preferably from the genus Saccharomyces, such as S.
cerevisiae. Yeast of other genera, such as Pichia or Kluyveromyces
can also be employed. Yeast vectors will generally contain an
origin of replication from the 2.mu. yeast plasmid or an
autonomously replicating sequence (ARS), promoter, DNA encoding
TNFR, sequences for polyadenylation and transcription termination
and a selection gene. Preferably, yeast vectors will include an
origin of replication and selectable marker permitting
transformation of both yeast and E. coli, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 or URA3 gene,
which provides a selection marker for a mutant strain of yeast
lacking the ability to grow in tryptophan or uracil, respectively,
and a promoter derived from a highly expressed yeast gene to induce
transcription of a structural sequence downstream. The presence of
the TRP1 or URA3 lesion in the yeast host cell genome then provides
an effective environment for detecting transformation by growth in
the absence of tryptophan or uracil, respectively.
[0093] Suitable promoter sequences in yeast vectors include the
promoters for metallothionein, 3-phosphoglycerate kinase or other
glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. Suitable
vectors and promoters for use in yeast expression are well known in
the art.
[0094] Preferred yeast vectors can be assembled using DNA sequences
from pUC18 for selection and replication in E. coli (Amp.sup.r gene
and origin of replication) and yeast DNA sequences including a
glucose-repressible ADH2 promoter and .alpha.-factor secretion
leader. The yeast .alpha.-factor leader, which directs secretion of
heterologous proteins, can be inserted between the promoter and the
structural gene to be expressed. The leader sequence can be
modified to contain, near its 3' end, one or more useful
restriction sites to facilitate fusion of the leader sequence to
foreign genes. Suitable yeast transformation protocols are known to
those of skill in the art.
[0095] Host strains transformed by vectors comprising the ADH2
promoter may be grown for expression in a rich medium consisting of
1% yeast extract, 2% peptone, and 1% or 4% glucose supplemented
with 80 .mu.g/ml adenine and 80 .mu.g/ml uracil. Derepression of
the ADH2 promoter occurs upon exhaustion of medium glucose. Crude
yeast supernatants are harvested by filtration and held at
4.degree. C. prior to further purification.
[0096] Various mammalian or insect cell culture systems are also
advantageously employed to express TNFR protein. Expression of
recombinant proteins in mammalian cells is particularly preferred
because such proteins are generally correctly folded, appropriately
modified and completely functional. Examples of suitable mammalian
host cell lines include the COS-7 lines of monkey kidney cells, and
other cell lines capable of expressing an appropriate vector
including, for example, L cells, such as L929, C127, 3T3, Chinese
hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression
vectors can comprise nontranscribed elements such as an origin of
replication, a suitable promoter, for example, the CMVie promoter,
the chicken beta-actin promoter, or the composite hEF1-HTLV
promoter, and enhancer linked to the gene to be expressed, and
other 5' or 3' flanking nontranscribed sequences, and 5' or 3'
nontranslated sequences, such as necessary ribosome binding sites,
a polyadenylation site, splice donor and acceptor sites, and
transcriptional termination sequences. Baculovirus systems for
production of heterologous proteins in insect cells are known to
those of skill in the art.
[0097] The transcriptional and translational control sequences in
expression vectors to be used in transforming vertebrate cells can
be provided by viral sources. For example, commonly used promoters
and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus
40 (SV40), human cytomegalovirus, such as the CMVie promoter, HTLV;
such as the composite hEF1-HTLV promoter. DNA sequences derived
from the SV40 viral genome, for example, SV40 origin, early and
late promoter, enhancer, splice, and polyadenylation sites can be
used to provide the other genetic elements required for expression
of a heterologous DNA sequence.
[0098] Further, mammalian genomic TNFR promoter, such as control
and/or signal sequences can be utilized, provided such control
sequences are compatible with the host cell chosen.
[0099] In preferred aspects of the present invention, recombinant
expression vectors comprising TNFR cDNAs are stably integrated into
a host cell's DNA.
[0100] Accordingly one embodiment of the invention is a method of
treating an inflammatory disease or condition by administering a
stable, secreted, ligand-binding form of a TNF receptor, thereby
decreasing the activity of TNF for the receptor. In another
embodiment, the invention is a method of treating an inflammatory
disease or condition by administering an oligonucleotide that
encodes a stable, secreted, ligand-binding form of a TNF receptor,
thereby decreasing the activity of TNF for the receptor. In another
embodiment, the invention is a method of producing a stable,
secreted, ligand-binding form of a TNF receptor.
[0101] The following aspects of the present invention discussed
below apply to the foregoing embodiments.
[0102] The methods, nucleic acids, proteins, and formulations of
the present invention are also useful as in vitro or in vivo
tools.
[0103] Embodiments of the invention can be used to treat any
condition in which the medical practitioner intends to limit the
effect of TNF or a signalling pathway activated by it. In
particular, the invention can be used to treat an inflammatory
disease. In one embodiment, the condition is an inflammatory
systemic disease, e.g., rheumatoid arthritis or psoriatic
arthritis. In another embodiment, the disease is an inflammatory
liver disease. Examples of inflammatory liver diseases include, but
are not limited to, hepatitis associated with the hepatitis A, B,
or C viruses, alcoholic liver disease, and non-alcoholic steatosis.
In yet another embodiment, the inflammatory disease is a skin
condition such as psoriasis.
[0104] The uses of the present invention include, but are not
limited to, treatment of diseases for which known TNF antagonists
have been shown useful. Three specific TNF antagonists are
currently FDA-approved. The drugs are etanercept (Enbrel.RTM.),
infliximab (Remicade.RTM.) and adalimumab (Humira.RTM.). One or
more of these drugs is approved for the treatment of rheumatoid
arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic
arthritis, ankylosing spondylitis, and inflammatory bowel disease
(Crohn's disease or ulcerative colitis).
[0105] Protein Expression and Purification:
[0106] When mammalian or insect cells are used, properly expressed
TNFR protein will be secreted into the extracellular media. The
protein is recovered from the media, and is concentrated and is
purified using standard biochemical techniques. After expression in
mammalian cells by lentiviral or AAV transduction, plasmid
transfection, or any similar procedure, or in insect cells after
baculoviral transduction, the extracellular media of these cells is
concentrated using concentration filters with an appropriate
molecular weight cutoff, such as Amicon.RTM. filtration units. To
avoid loss of TNFR protein, the filter should allow proteins to
flow through that are at or below 50 kDal.
[0107] When TNFR protein is expressed in bacterial culture it can
be purified by standard biochemical techniques. Bacteria are lysed,
and the cellular extract containing the TNFR is desalted and is
concentrated.
[0108] In either case, the TNFR protein is preferably purified by
affinity chromatography. The use of column chromatography with an
affinity matrix comprising TNF-.alpha. is preferred. Alternatively,
an affinity purification tag can be added to either the N- or the
C-terminus of the TNFR protein. For example, a polyhistidine-tag
(His-tag), which is an amino acid motif with at least six
histidines, can be used for this purpose (Hengen, P., 1995, Trends
Biochem. Sci. 20:285-86). The addition of a His-tag can be achieved
by the in-frame addition of a nucleotide sequence encoding the
His-tag directly to either the 5' or 3' end of the TNFR open
reading frame in an expression vector. One such nucleotide sequence
for the addition of a C-terminal His-tag is given in SEQ ID No:
126. When a His-tag is incorporated into the protein, a nickel or
cobalt affinity column is employed to purify the tagged TNFR, and
the His-tag can optionally then be cleaved. Other suitable affinity
purification tags and methods of purification of proteins with
those tags are well known in the art.
[0109] Alternatively, a non-affinity based purification scheme can
be used, involving fractionation of the TNFR extracts on a series
of columns that separate the protein based on size (size exclusion
chromatography), charge (anion and cation exchange chromatography)
and hydrophobicity (reverse phase chromatography). High performance
liquid chromatography can be used to facilitate these steps.
[0110] Other methods for the expression and purification of TNFR
proteins are well known (See, e.g., U.S. Pat. No. 5,605,690 to
Jacobs).
[0111] Use of Proteins for the Treatment of Inflammatory
Diseases:
[0112] For therapeutic use, purified TNFR proteins of the present
invention are administered to a patient, preferably a human, for
treating TNF-dependent inflammatory diseases, such as arthritis. In
the treatment of humans, the use of huTNFRs is preferred. The TNFR
proteins of the present invention can be administered by bolus
injection, continuous infusion, sustained release from implants, or
other suitable techniques. Typically, TNFR therapeutic proteins
will be administered in the form of a composition comprising
purified protein in conjunction with physiologically acceptable
carriers, excipients or diluents. Such carriers will be nontoxic to
recipients at the dosages and concentrations employed. Ordinarily,
the preparation of such compositions entails combining the TNFR
with buffers, antioxidants such as ascorbic acid, polypeptides,
proteins, amino acids, carbohydrates including glucose, sucrose or
dextrins, chelating agents such as EDTA, glutathione and other
stabilizers and excipients. Neutral buffered saline or saline mixed
with conspecific serum albumin are exemplary appropriate diluents.
Preferably, product is formulated as a lyophilizate using
appropriate excipient solutions, for example, sucrose, as diluents.
Preservatives, such as benzyl alcohol may also be added. The amount
and frequency of administration will depend of course, on such
factors as the nature and the severity of the indication being
treated, the desired response, the condition of the patient and so
forth.
[0113] TNFR proteins of the present invention are administered
systemically in therapeutically effective amounts preferably
ranging from about 0.1 mg/kg/week to about 100 mg/kg/week. In
preferred embodiments, TNFR is administered in amounts ranging from
about 0.5 mg/kg/week to about 50 mg/kg/week. For local
administration, dosages preferably range from about 0.01 mg/kg to
about 1.0 mg/kg per injection.
[0114] Use of Expression Vectors to Increase the Levels of a TNF
Antagonist in a Mammal:
[0115] The present invention provides a process of increasing the
levels of a TNF antagonist in a mammal. The process includes the
step of transforming cells of the mammal with an expression vector
described herein, which drives expression of a TNFR as described
herein.
[0116] The process is particularly useful in large mammals such as
domestic pets, those used for food production, and primates.
Exemplary large mammals are dogs, cats, horses cows, sheep, deer,
and pigs. Exemplary primates are monkeys, apes, and humans.
[0117] The mammalian cells can be transformed either in vivo or ex
vivo. When transformed in vivo, the expression vector are
administered directly to the mammal, such as by injection. Means
for transforming cells in vivo are well known in the art. When
transformed ex vivo, cells are removed from the mammal, transformed
ex vivo, and the transformed cells are reimplanted into the
mammal.
[0118] Splice-Switching Oligomers (SSOs):
[0119] In another aspect, the present invention employs splice
switching oligonucleotides or splice switching oligomers (SSOs) to
control the alternative splicing of TNFR2 so that the amount of a
soluble, ligand-binding form that lacks exon 7 is increased and the
amount of the integral membrane form is decreased. The methods and
compositions of the present invention can be used in the treatment
of diseases associated with excessive TNF activity.
[0120] Accordingly, one embodiment of the invention is a method of
treating an inflammatory disease or condition by administering SSOs
to a patient. The SSOs that are administered alter the splicing of
a pre-mRNA to produce a mammalian TNFR2 protein that lacks exon 7.
In another embodiment, the invention is a method of producing a
mammalian TNFR2 protein that lacks exon 7 in a cell by
administering SSOs to the cell.
[0121] The length of the SSO (i.e. the number of monomers in the
oligomer) is similar to an antisense oligonucleotide (ASON),
typically between about 8 and 30 nucleotides. In preferred
embodiments, the SSO will be between about 10 to 16 nucleotides.
The invention can be practiced with SSOs of several chemistries
that hybridize to RNA, but that do not activate the destruction of
the RNA by RNase H, as do conventional antisense 2'-deoxy
oligonucleotides. The invention can be practiced using 2'O modified
nucleic acid oligomers, such as where the 2'O is replaced with
--O--CH.sub.3, --O--CH.sub.2--CH.sub.2--O--CH.sub.3,
--O--CH.sub.2--CH.sub.2--CH.sub.2--NH.sub.2,
--O--CH.sub.2--CH.sub.2--CH.sub.2--OH or --F, where 2'O-methyl or
2'O-methyloxyethyl is preferred. The nucteobases do not need to be
linked to sugars; so-called peptide nucleic acid oligomers or
morpholine-based oligomers can be used. A comparison of these
different linking chemistries is found in Sazani, P. et al., 2001,
Nucleic Acids Res. 29:3695. The term splice-switching
oligonucleotide is intended to cover the above forms. Those skilled
in the art will appreciate the relationship between antisense
oligonucleotide gapmers and SSOs. Gapmers are ASON that contain an
RNase H activating region (typically a 2'-deoxyribonucleoside
phosphorothioate) which is flanked by non-activating nuclease
resistant oligomers. In general, any chemistry suitable for the
flanking sequences in a gapmer ASON can be used in an SSO.
[0122] The SSOs of this invention may be made through the
well-known technique of solid phase synthesis. Any other means for
such synthesis known in the art may additionally or alternatively
be used. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0123] The bases of the SSO may be the conventional cytosine,
guanine, adenine and uracil or thymidine. Alternatively, modified
bases can be used. Of particular interest are modified bases that
increase binding affinity. One non-limiting example of preferred
modified bases are the so-called G-clamp or
9-(aminoethoxy)phenoxazine nucleotides, cytosine analogues that
form 4 hydrogen bonds with guanosine. (Flanagan, W. M., et al.,
1999, Proc. Natl. Acad. Sci. 96:3513; Holmes, S. C., 2003, Nucleic
Acids Res. 31:2759). Specific examples of other bases include, but
are not limited to, 5-methylcytosine (.sup.MeC), isocytosine,
pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6,
5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine,
2,6-diaminopurine, 7-propyne-7-deazaadenine,
7-propyne-7-deazaguanine and 2-chloro-6-aminopurine.
[0124] A particularly preferred chemistry is provided by locked
nucleic acids (LNA) (Koshkin, A. A., et al., 1998, Tetrahedron
54:3607; Obika, S., et al., 1998, Tetrahedron Left. 39:5401). As
used herein, the terms "LNA unit", "LNA monomer", "LNA residue",
"locked nucleic acid unit", "locked nucleic acid monomer" or
"locked nucleic acid residue", refer to a bicyclic nucleoside
analogue. LNA units and methods of their synthesis are described in
inter alia WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO
02/28875, WO 03/006475 and WO 03/095467. The LNA unit may also be
defined with respect to its chemical formula. Thus, an "LNA unit",
as used herein, has the chemical structure shown in Formula 1
below:
##STR00001##
[0125] wherein,
[0126] X is selected from the group consisting of O, S and NRH,
where R is H or C.sub.1-C.sub.4 alkyl;
[0127] Y is (--CH.sub.2).sub.r, where r is an integer of 1-4;
and
[0128] B is a base of natural or non-natural origin as described
above.
[0129] In a preferred embodiment, r is 1 or 2, and in a more
preferred embodiment r is 1.
[0130] When LNA nucleotides are employed in an SSO it is preferred
that non-LNA nucleotides also be present. LNA nucleotides have such
high affinities of hybridization that there can be significant
non-specific binding, which may reduce the effective concentration
of the free-SSO. When LNA nucleotides are used they may be
alternated conveniently with 2'-deoxynucleotides. The pattern of
alternation is not critical. Alternating nucleotides, alternating
dinucleotides or mixed patterns, e.g., LDLDLD or LLDLLD or LDDLDD
can be used. For example in one embodiment, contains a sequence of
nucleotides selected from the group consisting of: LdLddLLddLdLdLL,
LdLdLLLddLLLdLL, LMLMMLLMMLMLMLL, LMLMLLLMMLLLMLL, LFLFFLLFFLFLFLL,
LFLFLLLFFLLLFLL, LddLddLddL, dLddLddLdd, ddLddLddLd, LMMLMMLMML,
MLMMLMMLMM, MMLMMLMMLM, LFFLFFLFFL, FLFFLFFLFF, FFLFFLFFLF,
dLdLdLdLdL, LdLdLdLdL, MLMLMLMLML, LMLMLMLML, FLFLFLFLFL,
LFLFLFLFL, where L is a LNA unit, d is a DNA unit, M is 2'MOE, F is
2'Fluoro.
[0131] When 2'-deoxynucleotides or 2'-deoxynucleoside
phosphorothioates are mixed with LNA nucleotides it is important to
avoid RNase H activation. It is expected that between about one
third and two thirds of the LNA nucleotides of an SSO will be
suitable. When affinity-enhancing modifications are used, including
but not limited to LNA or G-clamp nucleotides, the skilled person
recognizes it can be necessary to increase the proportion of such
affinity-enhancing modifications.
[0132] Numerous alternative chemistries which do not activate RNase
H are available. For example, suitable SSOs can be oligonucleotides
wherein at least one of the internucleotide bridging phosphate
residues is a modified phosphate, such as methyl phosphonate,
methyl phosphonothioate, phosphoromorpholidate,
phosphoropiperazidate, and phosphoroamidate. For example, every
other one of the internucleotide bridging phosphate residues may be
modified as described. In another non-limiting example, such SSO
are oligonucleotides wherein at least one of the nucleotides
contains a 2' lower alkyl moiety (e.g., C.sub.1-C.sub.4, linear or
branched, saturated or unsaturated alkyl, such as methyl, ethyl,
ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For
example, every other one of the nucleotides may be modified as
described. (See references in U.S. Pat. No. 5,976,879 col. 4). For
in vivo use, phosphorothioate linkages are preferred.
[0133] The length of the SSO will be from about 8 to about 30 bases
in length. Those skilled in the art appreciate that when
affinity-increasing chemical modifications are used, the SSO can be
shorter and still retain specificity. Those skilled in the art will
further appreciate that an upper limit on the size of the SSO is
imposed by the need to maintain specific recognition of the target
sequence, and to avoid secondary-structure forming self
hybridization of the SSO and by the limitations of gaining cell
entry. These limitations imply that an SSO of increasing length
(above and beyond a certain length which will depend on the
affinity of the SSO) will be more frequently found to be less
specific, inactive or poorly active.
[0134] SSOs of the invention include, but are not limited to,
modifications of the SSO involving chemically linking to the SSO
one or more moieties or conjugates which enhance the activity,
cellular distribution or cellular uptake of the SSO. Such moieties
include, but are not limited to, lipid moieties such as a
cholesterol moiety, cholic acid, a thioether, e.g.
hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g.,
dodecandiol or undecyl residues, a phospholipids, e.g.,
di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a
polyethylene glycol chain, an adamantane acetic acid, a palmityl
moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol
moiety.
[0135] It is not necessary for all positions in a given SSO to be
uniformly modified, and in fact more than one of the aforementioned
modifications may be incorporated in a single compound or even at a
single nucleoside within an SSO.
[0136] The SSOs may be admixed, encapsulated, conjugated, or
otherwise associated with other molecules, molecule structures, or
mixtures of compounds, as for example liposomes, receptor targeted
molecules, oral, rectal, topical or other formulation, for
assisting in uptake, distribution, and/or absorption.
[0137] Those skilled in the art appreciate that cellular
differentiation includes, but is not limited to, differentiation of
the spliceosome. Accordingly, the activity of any particular SSO
can depend upon the cell type into which they are introduced. For
example, SSOs which are effective in one cell type may be
ineffective in another cell type.
[0138] The methods, oligonucleotides, and formulations of the
present invention are also useful as in vitro or in vivo tools to
examine splicing in human or animal genes. Such methods can be
carried out by the procedures described herein, or modifications
thereof which will be apparent to skilled persons.
[0139] The SSOs disclosed herein can be used to treat any condition
in which the medical practitioner intends to limit the effect of
TNF or the signalling pathway activated by TNF. In particular, the
invention can be used to treat an inflammatory disease. In one
embodiment, the condition is an inflammatory systemic disease,
e.g., rheumatoid arthritis or psoriatic arthritis. In another
embodiment, the disease is an inflammatory liver disease. Examples
of inflammatory liver diseases include, but are not limited to,
hepatitis associated with the hepatitis A, B, or C viruses,
alcoholic liver disease, and non-alcoholic steatosis. In yet
another embodiment, the inflammatory disease is a skin condition
such as psoriasis.
[0140] The uses of the present invention include, but are not
limited to, treatment of diseases for which known TNF antagonists
have been shown useful. Three specific TNF antagonists are
currently FDA-approved. The drugs are etanercept (Enbrel.RTM.),
infliximab (Remicade.RTM.) and adalimumab (Humira.RTM.). One or
more of these drugs is approved for the treatment of rheumatoid
arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic
arthritis, ankylosing spondylitis, and inflammatory bowel disease
(Crohn's disease or ulcerative colitis).
[0141] The administration of the SSO to subjects can be
accomplished using procedures developed for ASON. ASON have been
successfully administered to experimental animals and human
subjects by intravenous administration in saline in doses as high
as 6 mg/kg three times a week (Yacysyhn, et al., 2002, Out 51:30
(anti-ICAM-1 ASON for treatment of Crohn's disease); Stevenson, J.,
et al., 1999, J. Clinical Oncology 17:2227 (anti-RAF-1 ASON
targeted to PBMC)). The pharmacokinetics of 2'O-MOE
phosphorothioate ASON, directed towards TNF-.alpha. has been
reported (Geary, R. S., et al., 2003, Drug Metabolism and
Disposition 31:1419). The systemic efficacy of mixed LNA/DNA
molecules has also been reported (Fluiter, K., et al., 2003,
Nucleic Acids Res. 31:953).
[0142] The systemic activity of SSO in a mouse model system was
investigated using 2'O-MOE phosphorothioates and PNA chemistries.
Significant activity was observed in all tissues investigated
except brain, stomach and dermis (Sazani, P., et al., 2002, Nature
Biotechnology 20, 1228).
[0143] In general any method of administration that is useful in
conventional antisense treatments can be used to administer the SSO
of the invention. For testing of the SSO in cultured cells, any of
the techniques that have been developed to test ASON or SSO may be
used.
[0144] Formulations of the present invention comprise SSOs in a
physiologically or pharmaceutically acceptable carrier, such as an
aqueous carrier. Thus formulations for use in the present invention
include, but are not limited to, those suitable for parenteral
administration including intraperitoneal, intraarticular,
intravenous, intraarterial, subcutaneous, or intramuscular
injection or infusion, as well as those suitable for topical,
ophthalmic, vaginal, oral, rectal or pulmonary (including
inhalation or insufflation of powders or aerosols, including by
nebulizer, intratracheal, intranasal delivery) administration. The
formulations may conveniently be presented in unit dosage form and
may be prepared by any of the methods well known in the art. The
most suitable route of administration in any given case may depend
upon the subject, the nature and severity of the condition being
treated, and the particular active compound which is being
used.
[0145] Pharmaceutical compositions of the present invention
include, but are not limited to, physiologically and
pharmaceutically acceptable salts, i.e, salts that retain the
desired biological activity of the parent compound and do not
impart undesired toxicological properties. Examples of such salts
are (a) salts formed with cations such as sodium, potassium,
NH.sub.4.sup.+, magnesium, calcium, polyamines such as spermine and
spermidine, etc.; (b) acid addition salts formed with inorganic
acids, for example, hydrochloric acid, hydrobromic acid, sulfuric
acid, phosphoric acid, nitric acid and the like; and (c) salts
formed with organic acids such as, for example, acetic acid, oxalic
acid, tartaric acid, succinic acid, maleic acid, fumaric acid,
gluconic acid, citric acid, malic acid, ascorbic acid, benzoic
acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid,
napthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic
acid, napthalenedisulfonic acid, polygalacturonic acid, and the
like.
[0146] The present invention provides for the use of SSOs having
the characteristics set forth above for the preparation of a
medicament for increasing the ratio of a mammalian TNFR2 protein
that lacks exon 7 to its corresponding membrane bound form, in a
patient afflicted with an inflammatory disorder involving
TNF-.alpha., as discussed above. In the manufacture of a medicament
according to the invention, the SSOs are typically admixed with,
inter alia, an acceptable carrier. The carrier must, of course, be
acceptable in the sense of being compatible with any other
ingredients in the formulation and must not be deleterious to the
patient. The carrier may be a solid or liquid. SSOs are
incorporated in the formulations of the invention, which may be
prepared by any of the well known techniques of pharmacy consisting
essentially of admixing the components, optionally including one or
more accessory therapeutic ingredients.
[0147] Formulations of the present invention may comprise sterile
aqueous and non-aqueous injection solutions of the active
compounds, which preparations are preferably isotonic with the
blood of the intended recipient and essentially pyrogen free. These
preparations may contain anti-oxidants, buffers, bacteriostats, and
solutes which render the formulation isotonic with the blood of the
intended recipient. Aqueous and non-aqueous sterile suspensions can
include, but are not limited to, suspending agents and thickening
agents. The formulations may be presented in unit dose or
multi-dose containers, for example, sealed ampoules and vials, and
may be stored in freeze-dried (lyophilized) condition requiring
only the addition of the sterile liquid carrier, for example,
saline or water-for-injection immediately prior to use.
[0148] In the formulation the SSOs may be contained within a
particle or vesicle, such as a liposome, or microcrystal, which may
be suitable for parenteral administration. The particles may be of
any suitable structure, such as unilamellar or plurilameller, so
long as the SSOs are contained therein. Positively charged lipids
such as
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammoniummethylsulfate,
or "DOTAP," are particularly preferred for such particles and
vesicles. The preparation of such lipid particles is well known.
[See references in U.S. Pat. No. 5,976,879 col. 6]
[0149] The SSO can be targeted to any element or combination of
elements that regulate splicing, including the 3'splice site, the
5' splice site, the branch point, the polypyrimidine tract, exonic
splicing enhancers, exonic splicing silencers, intronic splicing
enhancers, and intronic splicing silencers.
[0150] Those skilled in the art can appreciate that the invention
as directed toward human TNFR2 can be practiced using SSO having a
sequence that is complementary to at least 8, to at least 9, to at
least 10, to at least 11, to at least 12, to at least 13, to at
least 14, to at least 15, preferably between 10 and 16 nucleotides
of the portions of the TNFR2 gene comprising exons 7 and its
adjacent introns. SEQ ID No: 13 contains the sequence of exon 7 of
TNFR2 and 50 adjacent nucleotides of the flanking introns. For
example, SSO targeted to human TNFR2 can have a sequence selected
from the sequences listed in Table 1. When affinity-enhancing
modifications are used, including but not limited to LNA or G-clamp
nucleotides, the skilled person recognizes the length of the SSO
can be correspondingly reduced. The pattern of alternation of LNA
and conventional nucleotides is not important.
TABLE-US-00001 TABLE 1 SSOs Targeted to Human TNFR2 SEQ ID. Name
Sequence 5' to 3' 14 3378 CCA CAA TCA GTC CTA G 15 SK101 A CAA TCA
GTC CTA G 16 SK102 AA TCA GTC CTA G 17 SK103 TCA GTC CTA G 18 SK104
CCA CAA TCA GTC CT 19 SK105 CCA CAA TCA GTC 20 SK106 CCA CAA TCA G
21 SK107 CA CAA TCA GTC CTA 22 SK108 CA CAA TCA GTC C 23 SK109 A
CAA TCA GTC CT 24 SK110 CAA TCA GTC CTA 25 SK111 CA CAA TCA GT 26
SK112 A CAA TCA GTC 27 SK113 CAA TCA GTC C 28 SK114 AA TCA GTC CT
29 SK115 A TCA GTC CTA 30 3379 CAG TCC TAG AAA GAA A 31 SK117 G TCC
TAG AAA GAA A 32 SK118 CC TAG AAA GAA A 33 SK119 TAG AAA GAA A 34
SK120 CAG TCC TAG AAA GA 35 SK121 CAG TCC TAG AAA 36 SK122 CAG TCC
TAG A 37 SK123 AG TCC TAG AAA GAA 38 SK124 AG TCC TAG AAA G 39
SK125 G TCC TAG AAA GA 40 SK126 TCC TAG AAA GAA 41 SK127 AG TCC TAG
AA 42 SK128 G TCC TAG AAA 43 SK129 TCC TAG AAA G 44 SK130 CC TAG
AAA GA 45 SK131 C TAG AAA GAA 46 3384 ACT TTT CAC.CTG GGT C 47
SK133 T TTT CAC CTG GGT C 48 SK134 TT CAC CTG GGT C 49 SK135 CAC
CTG GGT C 50 SK136 ACT TTT CAC CTG GG 51 SK137 ACT TTT CAC CTG 52
SK138 ACT TTT CAC C 53 SK139 CT TTT CAC CTG GGT 54 SK140 CT TTT CAC
CTG G 55 SK141 T TTT CAC CTG GG 56 SK142 TTT CAC CTG GGT 57 SK143
CT TTT CAC CT 58 SK144 T TTT CAC CTG 59 SK145 TTT CAC CTG G 60
SK146 TT CAC CTG GG 61 SK147 T CAC CTG GGT
[0151] Those skilled in the art will also recognize that the
selection of SSO sequences must be made with care to avoid a
self-complementary SSO, which may lead to the formation of partial
"hairpin" duplex structures. In addition, high GC content should be
avoided to minimize the possibility of non-specific base pairing.
Furthermore, SSOs matching off-target genes, as revealed for
example by BLAST, should also be avoided.
[0152] In some situations, it may be preferred to select an SSO
sequence that can target a human and at least one other species.
These SSOs can be used to test and to optimize the invention in
said other species before being used in humans, thereby being
useful for regulatory approval and drug development purposes. For
example, SSOs with sequences selected from SEQ ID Nos: 14, 30, 46,
70 and 71 which target human TNFR2 are also 100% complementary to
the corresponding Macaca Mullata sequences. As a result these
sequences can be used to test treatments in monkeys, before being
used in humans.
[0153] It will be appreciated by those skilled in the art that
various omissions, additions and modifications may be made to the
invention described above without departing from the scope of the
invention, and all such modifications and changes are intended to
fall within the scope of the invention, as defined by the appended
claims. All sequence citations, references, patents, patent
applications or other documents cited referred to herein are
incorporated by reference.
Example 1
Materials and Methods
[0154] Oligonucleotides.
[0155] Table 3 lists chimeric locked nucleic acid (LNA) SSOs with
alternating 2'deoxy- and
2'O-4'-(methylene)-bicyclic-ribonucleoside-phosphorothioates and
having sequences as described in U.S. application Ser. No.
11/595,485. These were synthesized by Santaris Pharma, Denmark. For
each SSO, the 5'-terminal nucleoside was a
2'O-4'-methylene-ribonucleoside and the 3'-terminal nucleoside was
a 2'deoxy-ribonucleoside. Table 4 shows the sequences of chimeric
LNA SSOs with alternating
2'-O-methyl-ribonucleoside-phosphorothioates (2'-OMe) and
2'O-4'-(methylene)-bicyclic-ribonucleoside phosphorothioates. These
were synthesized by Santaris Pharma, Denmark. The LNA is shown in
capital letters and the 2'-OME is shown in lower case letters.
[0156] Cell Culture and Transfections.
[0157] L929 cells were maintained in minimal essential media
supplemented with 10% fetal bovine serum and antibiotic (37.degree.
C., 5% CO.sub.2). For transfection, L929 cells were seeded in
24-well plates at 10.sup.5 cells per well and transfected 24 hrs
later. Oligonucleotides were complexed, at the indicated
concentrations, with 2 .mu.L of Lipofectamine.TM. 2000 transfection
reagent (Invitrogen) as per the manufacturer's directions. The
nucleotide/lipid complexes were then applied to the cells and
incubated for 24 hrs. The media was then aspirated and cells
harvested with TRI-Reagent.TM. (MRC, Cincinnati, Ohio).
[0158] RT-PCR.
[0159] Total RNA was isolated with TRI-Reagent (MRC, Cincinnati,
Ohio) and TNFR1 or TNFR2 mRNA was amplified by GeneAmp.RTM. RT-PCR
using rTth polymerase (Applied Biosystems) following supplier
directions. Approximately 200 ng of RNA was used per reaction.
Primers used in the examples described herein are included in Table
2. Cycles of PCR proceeded: 95.degree. C., 60 sec; 56.degree. C.,
30 sec; 72.degree. C., 60 sec for 22-30 cycles total.
[0160] In some instances a Cy5-labeled dCTP (GE Healthcare) was
included in the PCR step for visualization (0.1 .mu.L per 50 .mu.L
PCR reaction). The PCR products were separated on a 10%
non-denaturing polyacrylamide gel, and Cy5-labeled bands were
visualized with a Typhoon.TM. 9400 Scanner (GE Healthcare). Scans
were quantified with ImageQuant.TM. (GE Healthcare) software.
Alternatively, in the absence of the inclusion of Cy5-labeled dCTP,
the PCR products were separated on a 1.5% agarose gel containing
trace amounts of ethidium bromide for visualization.
[0161] PCR.
[0162] PCR was performed with Platinum.RTM. Taq DNA Polymerase
(Invitrogen) according to the manufacturer's directions. For each
50 reaction, approximately 30 pmol of both forward and reverse
primers were used. Primers used in the examples described herein
are included in Table 2. The thermocycling reaction proceeded,
unless otherwise stated, as follows: 94.degree. C., 3 minutes; then
30-40 cycles of 94.degree. C., 30 sec; 55.degree. C., 30 sec; and
72.degree. C.; 105 sec; followed by 72.degree. C., 3 minutes. The
PCR products were analyzed on 1.5% agarose gels and visualized with
ethidium bromide.
TABLE-US-00002 TABLE 2 RT-PCR and PCR Primers SEQ ID. Name Sequence
5' to 3') Human TNFR2 74 TR001 ACT GGG CTT CAT CCC AGC ATC 75 TR002
CAC CAT GGC GCC CGT CGC CGT CTG G 76 TR003 CGA CTT CGC TCT TCC AGT
TGA GAA GCC CTT GTG CCT GCA G 77 TR004 TTA ACT GGG CTT CAT CCC AGC
ATC 78 TR005 CTG CAG GCA CAA GGG CTT CTC AAC TGG AAG AGC GAA GTC G
79 TR026 TTA ACT GGG CTT CAT CCC AGC 80 TR027 CGA TAG AAT TCA TGG
CGC CCG TCG CCG TCT GG 81 TR028 CCT AAC TCG AGT TAA CTG GGC TTC ATC
CCA GC 82 TR029 GAC TGA GCG GCC GCC ACC ATG GCG CCC GTC GCC GTC TGG
83 TR030 CTA AGC GCG GCC GCT TAA CTG GGC TTC ATC CCA GCA TC 84
TR047 CGT TCT CCA ACA CGA CTT CA 85 TR048 CTTATC GGC AGG CAA GTG
AGG 86 TR049 ACT GAA ACA TCA GAC GTG GTG TGC 87 TR050 CCT TAT CGG
CAG GCA AGT GAG Human TNFR1 88 TR006 CCT CAT CTG AGA AGA CTG GGC G
89 TR007 GCC ACC ATG GGC CTC TCC ACC GTG C 90 TR008 GGG CAC TGA GGA
CTC AGT TTG TGG GAA ATC GAC ACC TG 91 TR009 CAG GTG TCG ATT TCC CAC
AAA CTG AGT CCT CAG TGC CC 92 TR010 CAC CAT GGG CCT CTC CAC CGT GC
93 TR011 TCT GAG AAG ACT GGG CG 94 TP031 CGA TAG GAT CCA TGG GCC
TCT CCA CCG TGC 95 TR032 CCT Am TCG AGT CAT CTG AGA AGA CTG GGC G
96 TR033 GAC TGA GCG GCC GCC ACC ATG GGC CTC TCC ACC GTG C 97 TR034
CTA AGC GCG GCC GCT CAT CTG AGA AGA CTG GGC G Mouse TNFR2 98 TR012
GGT CAG GCC ACT TTG ACT GC 99 TR013 CAC CGC TGC CCC TAT GGC G 100
TR014 CAC CGC TGC CAC TAT GGC G 101 TR015 GGT CAG GCC ACT TTG ACT
GCA ATC 102 TR016 GCC ACC ATG GCG CCC GCC GCC CTC TGG 103 TR017 GGC
ATC TCT CTT CCA ATT GAG AAG CCC TCC TGC CTA CAA AG 104 TR018 CTT
TGT AGG CAG GAG GGC TTC TCA ATT GGA AGA GAG ATG CC 105 TR019 GGC
CAC TTT GAC TGC AAT CTG 106 TR035 CAC CAT GGC GCC CGC CGC CCT CTG G
107 TR036 TCA.GGC CAC TTT GAC TGC AAT C 108 TR037 CGA TAG AAT TCA
TGG CGC CCG CCG CCC TCT GG 109 TR038 CCT AAC TCG AGT CAG GCC ACT
TTG ACT GCA ATC 110 TR039 GAC TGA GCG GCC GCC ACC ATG GCG CCC GCC
GCC CTC TGG 111 TR040 CTA AGC GCG GCC GCT CAG GCC ACT TTG ACT GCA
ATC 112 TR045 GAG CCC CAA ATG GAA ATG TGC 113 TR046 GCT CAA GGC CTA
CTG CAT CC Mouse TNFR1 114 TR020 GGT TAT CGC GGG AGG CGG GTC G 115
TR021 GCC ACC ATG GGT CTC CCC ACC GTG CC 116 TR022 CAC AAA CCC CCA
GGA CTC AGT TTG TAG GGA TCC CGT GCC T 117 TR023 AGG CAC GGG ATC CCT
ACA AAC TGA GTC CTG GGG GTT TGT G 118 TR024 CAC CAT GGG TCT CCC CAC
CGT GCC 119 TR025 TCG CGG GAG GCG GGT CGT GG 120 TR041 CGA TAG TCG
ACA TGG GTC TCC CCA CCG TGC C 121 TR042 CCT AAG AAT TCT TAT CGC GGG
AGG CGG GTC G 122 TR043 GAC TGA GCG GCC GCC ACC ATG GGT CTC CCC ACC
GTG CC 123 TR044 CTA AGC GCG GCC GCT TAT CGC GGG AGG CGG GTC G
[0163] Human Hepatocyte Cultures.
[0164] Human hepatocytes were obtained in suspension either from
ADMET technologies, or from The UNC Cellular Metabolism and
Transport Core at UNC-Chapel Hill. Cells were washed and suspended
in RPMI 1640 supplemented with 10% FBS, 1 .mu.g/mL human insulin,
and 13 nM Dexamethasone. Hepatocytes were plated in 6-well plates
at 0.5.times.10.sup.6 cells per plate in 3 mL media. After 1-1.5
hrs, non-adherent cells were removed, and the media was replaced
with RPMI 1640 without PBS, supplemented with 1 .mu.g/mL human
insulin, and 130 nM Dexamethasone.
[0165] For delivery of SSOs to hepatocytes in 6-well plates, 10
.mu.L of a 5 .mu.M SSO stock was diluted into 100 .mu.L of
OPTI-MEM.TM., and 4 .mu.L of Lipofectamine.TM. 2000 was diluted
into 100 .mu.L of OPTI-MEM.TM.. The 200 .mu.L complex solution was
then applied to the cells in the 6-well plate containing 2800 .mu.L
of media, for a total of 3000 .mu.L. The final SSO concentration
was 17 nM. After 24 hrs, cells were harvested in TRI-Reagent.TM..
Total RNA was isolated per the manufacturer's directions.
Approximately 200 ng of total RNA was subjected to reverse
transcription-PCR (RT-PCR).
[0166] ELISA.
[0167] To determine the levels of soluble TNFR2 in cell culture
media or sera, the Quantikine.RTM. Mouse sTNF RII ELISA kit from
R&D Systems (Minneapolis, Minn.) or Quantikine.RTM. Human sTNF
RII ELISA kit from R&D Systems (Minneapolis, Minn.) were used.
The antibodies used for detection also detect the protease cleavage
forms of the receptor. ELISA plates were read using a microplate
reader set at 450 nm, with wavelength correction set at 570 nm.
[0168] For mouse in vivo studies, blood from the animals was
clotted for 1 hour at 37.degree. C. and centrifuged for 10 min at
14,000 rpm (Jouan BRA4i centrifuge) at 4.degree. C. Sera was
collected and assayed according to the manufacturer's guide, using
50 .mu.L of mouse sera diluted 1:10.
[0169] L929 Cytotoxicity Assay.
[0170] L929 cells plated in 96-well plates at 10.sup.4 cells per
well were treated with 0.1 ng/mL TNF-.alpha. and 1 .mu.g/mL
actinomycin D in the presence of 10% serum from mice treated with
the indicated oligonucleotide in 100 .mu.L total of complete MEM
media (containing 10% regular FBS) and allowed to grow for
.about.24 hrs at 37.degree. C. Control lanes were plated in 10%
serum from untreated mice. Cell viability was measured 24 hrs later
by adding 20 JAL CellTiter 96.RTM. AQ.sub.ueous One Solution
Reagent (Promega) and measuring absorbance at 490 nm with a
microplate reader. Cell viability was normalized to untreated
cells.
[0171] Western Blots.
[0172] Twenty .mu.L of media or 20 .mu.g of lysate were loaded in
each well of a 4-12% NuPAGE.RTM. polyacrylamide gel (Invitrogen).
The gel was run 40 min at 200V. The protein was transferred, for 1
hr at 30V, to an Invitrolon.TM. PVDF membrane (Invitrogen), which
was then blocked with StartingBlock.RTM. Blocking Buffer (Pierce)
for 1 hr at room temperature. The membrane was incubated for 3 hrs
at room temperature with a rabbit polyclonal antibody that
recognizes the C-terminus of human and mouse TNFR2 (Abeam).
Following three washes in PBS-T buffer (1.times.PBS, 0.1%
Tween-20), the membrane was incubated for one hour at room
temperature with secondary goat anti-rabbit antibody (Abeam) and
again washed three times with PBS-T buffer. The protein was then
detected with ECL Plus.TM. (GE Healthcare), according to the
manufacturer's recommendations and then photographed.
Example 2
SSO Splice Switching Activity with TNFR mRNA
[0173] Table 3 shows the splice switching activities of SSOs having
sequences as described in U.S. application Ser. No. 11/595,485 and
targeted to mouse and human TNFRs. Of SSOs targeted to mouse TNFR2
exon 7, at least 8 generated some muTNFR2 .DELTA.7 mRNA. In
particular, SSO 3312, 3274 and 3305 induced at least 50% skipping
of exon 7; SSO 3305 treatment resulted in almost complete skipping.
Of SSOs transfected into primary human hepatocytes, and targeted to
human TNFR2 exon 7, at least 7 SSOs generated some huTNFR2 .DELTA.7
mRNA. In particular, SSOs 3378, 3379, 3384 and 3459 induced at
least 75% skipping of exon 7 (FIG. 2B), and significant induction
of huTNFR2 .DELTA.7 into the extracellular media (FIG. 2A).
TABLE-US-00003 TABLE 3 SSO Splice Switching Activity SEQ ID. Name
Activity Mouse TNFR2 3272 - 3304 - 3305 + 3306 + 3307 + 3308 + 3309
+ 3310 - 3311 + 62 3274 + 3312 + 3273 - Mouse TNFR1 3333 + Human
TNFR2 14 3378 + 30 3379 + 3380 - 70 3381 + 71 3382 + 3383 - 46 3384
+ 72 3459 + 3460 - 73 3461 + Control 3083 -
[0174] Table 4 contains the sequences of 10 nucleotide chimeric
SSOs with alternating 2'-O-methyl-ribonucleoside-phosphorothioates
(2'-OMe) and 2'O-4'-(methylene)-bicyclic-ribonucleoside
phosphorothioates. These SSOs are targeted to exon 7 of mouse
TNFR2.
TABLE-US-00004 TABLE 4 LNA/2'-OMe-ribonucleosidephosphorothioate
chimeric mouse targeted SSO SEQ ID. Name Sequence 5' to 3'* 62 3274
AgAgCaGaAcCtT a Ct 63 3837 gAaCcTuAcT 64 3838 aGaGcAgAaC 65 3839
gAgCaGaAcC 66 3840 aGcAgAaCcT 67 3841 gCaGaAcCuT 68 3842 cAgAaCcTuA
69 3843 aGaAcCuTaC *Capital letters are
2'O-4'-(methylene)-bicyclic- ribonucleosides; lowercase letters are
2'-OMe
[0175] To analyze the in vitro splice-switching activity of the
SSOs listed in Table 4, L929 cells were cultured and seeded as
described in Example 1. For delivery of each of the SSOs in Table 4
to the L929 cells, SSOs were diluted into 504 of OPTI-MEM.TM., and
then 50 .mu.L -Lipofectamine.TM. 2000 mix (1 part Lipofectamine.TM.
2000 to 25 parts OPTI-MEM.TM.) was added and incubated for 20
minutes. Then 400 .mu.L of serum free media was added to the SSOs
and applied to the cells in the 24-well plates. The final SSO
concentration was either 50 or 100 nM. After 24 hrs, cells were
harvested in 800 .mu.L TRI-Reagent.TM.. Total RNA was isolated per
the manufacturer's directions and analyzed by RT-PCR (FIG. 3) using
the forward primer TR045 (SEQ ID No: 112) and the reverse primer
TR046 (SEQ ID No: 113).
[0176] To analyze the in vivo splice-switching activity of the SSOs
listed in Table 4, mice were injected with the SSOs listed in Table
4 intraperitoneal (i.p.) at 25 mg/kg/day for 5 days. Mice were bled
before injection and again 1, 5 and 10 days after the Last
injection. The concentration of soluble TNFR2 .DELTA.7 in the sera
taken before the first injection and 10 days after the last
injection were measured by ELISA (FIG. 4B). The mice were
sacrificed on day 10 and total RNA from 5-10 mg of the liver was
analyzed by RT-PCR (FIG. 4A) using the forward primer TR045 (SEQ ID
No: 112) and the reverse primer TR046 (SEQ ID No: 113).
[0177] Of the 10 nucleotide SSOs subsequences of HO 3274 tested in
vitro, all of them generated at least some muTNFR2 .DELTA.7 mRNA
(FIG. 3). In particular, SSO 3839, 3840 and 3841 displayed greater
splice-switching activity than the longer 16 nucleotide SSO 3274
from which they are derived. The three 10 nucleotide SSOs, 3839,
3840, 3841, that demonstrated the greatest activity in vitro also
were able to generate significant amounts of muTNFR2 .DELTA.7 mRNA
(FIG. 4A) and soluble muTNFR2 .DELTA.7 protein (FIG. 4B) in mice in
vivo.
[0178] To assess the effect of SSO length on splice switching
activity in human TNFR2, cells were treated with SSOs of different
lengths. Primary human hepatocytes were transfected with the
indicated SSOs selected from Table 1. These SSOs were synthesized
by Santaris Pharma, Denmark with alternating 2'deoxy- and
2'O-4'-(methylene)-bicyclic-ribonucleoside phosphorothioates. For
each SSO, the 5'-terminal nucleoside was a
2'O-4'-methylene-ribonucleoside and the 3'-terminal nucleoside was
a 2'deoxy-ribonucleoside. These SSOs were either 10-, 12-, 14- or
16-mers. The concentration of soluble TNFR2 .DELTA.7 was measured
by ELISA (FIG. 5, top panel). Total RNA was analyzed by RT-PCR for
splice switching activity (FIG. 5, bottom panel).
Example 3
Analysis of the Splice Junction of SSO-Induced TNFR2 Splice
Variants
[0179] To confirm that the SSO splice switching, both in mice and
in human cells, leads to the expected TNFR2 .DELTA.7 mRNA,
SSO-induced TNFR2 .DELTA.7 mRNA was analyzed by RT-PCR and was
sequenced.
[0180] Mice.
[0181] Mice were injected with SSO 3274 intraperitoneal (i.p.) at
25 mg/kg/day for 10 days. The mice were then sacrificed and total
RNA from the liver was analyzed by RT-PCR using the forward primer
TR045 (SEQ ID No: 112) and the reverse primer TR046 (SEQ ID No:
113). The products were analyzed on a 1.5% agarose gel (FIG. 6A)
and the product for the TNFR2 .DELTA.7 was isolated using standard
molecular biology techniques. The isolated TNFR2 .DELTA.7 product
was amplified by PCR using the same primers and then sequenced
(FIG. 6B). The sequence data contained the sequence
CTCTCTTCCAATTGAGAAGCCCTCCTGC (nucleotides 777-804 of SEQ ID No:
11), which confirms that the SSO-induced TNFR2 .DELTA.7 mRNA lacks
exon 7 and that exon 6 is joined directly to exon 8.
[0182] Human Hepatocytes.
[0183] Primary human hepatocytes were transfected with SSO 3379 as
described in Example 1. Total RNA was isolated 48 hrs after
transfection. The RNA was converted to cDNA with the
Superscript.TM. II Reverse Transcriptase (Invitrogen) using random
hexamer primers according to the manufacturer's directions. PCR was
performed on the cDNA using the forward primer TR049 (SEQ ID No:
86) and the reverse primer TR050 (SEQ ID No: 87). The products were
analyzed on a 1.5% agarose gel (FIG. 7A). The band corresponding to
TNFR2 .DELTA.7 was isolated using standard molecular biology
techniques and then sequenced (FIG. 7B). The sequence data
contained the sequence CGCTCTTCCAGTTGAGAAGCCCTTGTGC (nucleotides
774-801 of SEQ ID No: 9), which confirms that the SSO-induced TNFR2
.DELTA.7 mRNA lacks exon 7 and that exon 6 is joined directly to
exon 8.
Example 4
SSO Dose-Dependent Production of TNFR2 .DELTA.7 Protein in Primary
Human Hepatocytes
[0184] The dose response of splice-switching activity of SSOs in
primary human hepatocytes was tested. Human hepatocytes were
obtained in suspension from ADMET technologies. Cells were washed
three times and suspended in seeding media (RPMI 1640 supplemented
with L-Glut, with 10% FBS, penicillin, streptomycin, and 12 nM
Dexamethasone). Hepatocytes were evaluated for viability and plated
in 24-well, collagen-coated plates at 1.0.times.10.sup.5 cells per
well. Typically, cell viability was 85-93%. After approximately 24
hrs, the media was replaced with maintenance media (seeding media
without FBS).
[0185] For delivery of each of the SSOs to the hepatocytes, SSOs
were diluted into 50 .mu.L of OPTI-MEM.TM., and then 50 .mu.L
Lipofectamine.TM. 2000 mix (1 part Lipofectamine.TM. 2000 to 25
parts OPTI-MEM.TM.) was added and incubated for 20 minutes. The
SSOs were then applied to the cells in the 24-well plates. The
final SSO concentration ranged from 1 to 150 nM. After 48 hrs,
cells were harvested in 800 .mu.L TRI-Reagent.TM..
[0186] Total RNA from the cells was analyzed by RT-PCR using the
forward primer TR047 (SEQ ID No: 84) and the reverse primer TR048
(SEQ ID No: 85) (FIG. 8A). The concentration of soluble TNFR2
.DELTA.7 in the serum was measured by ELISA (FIG. 8B). Both huTNFR2
.DELTA.7 mRNA (FIG. 8A) and secreted huTNFR2 .DELTA.7 protein (FIG.
8B) displayed dose dependent increases.
Example 5
Secretion of TNFR2 Splice Variants from Murine Cells
[0187] The ability of SSOs to induce soluble TNFR2 protein
production and secretion into the extracellular media was tested.
L929 cells were treated with SSOs as described in Example 1, and
extracellular media samples were collected .about.48 hrs after
transfection. The concentration of soluble TNFR2 in the samples was
measured by ELISA (FIG. 9). SSOs that best induced shifts in RNA
splicing, also secreted the most protein into the extracellular
media. In particular, SSOs 3305, 3312, and 3274 increased soluble
TNFR2 at least 3.5-fold over background. Consequently, induction of
the splice variant mRNA correlated with production and secretion of
the soluble TNFR2.
Example 6
In Vivo Injection of SSOs Generated muTNFR2 .DELTA.7 mRNA in
Mice
[0188] SSO 3305 in saline was injected intraperitoneal (i.p.) daily
for 4 days into mice at doses from 3 mg/kg to 25 mg/kg. The mice
were sacrificed on day 5 and total RNA from the liver was analyzed
by RT-PCR. The data show splice switching efficacy similar to that
found in cell culture. At the maximum dose of 25 mg/kg, SSO 3305
treatment induced almost full conversion to .DELTA.7 mRNA (FIG. 10,
bottom panel).
[0189] A similar experiment with SSO 3274 induced about 20%
conversion to .DELTA.7 mRNA. To optimize SSO 3274 induction of
.DELTA.7 mRNA, both the dose regimen and the time from the last
injection to the sacrifice of the animal were varied. SSO 3274 was
injected (i.p.) into mice daily for 4 days. SSO treatment induced
about 30% conversion to .DELTA.7 mRNA in mice analyzed on day 15,
whereas a 20% shift was observed in mice analyzed on day five (FIG.
10, top panel). Furthermore, mice given injections for 10 days, and
sacrificed on day 11 showed a 50% induction of .DELTA.7 mRNA (FIG.
10, top). These in viva data suggest that TNFR2 SSOs can produce
muTNFR2 .DELTA.7 mRNA for at least 10 days after
administration.
Example 7
Circulatory TNFR2 .DELTA.7
[0190] Mice were injected with SSO 3274, 3305, or the control 3083
intraperitoneal (i.p.) at 25 mg/kg/day for 10 days. Mice were bled
before injection and again 1, 5 and 10 days after the last
injection. The concentration of soluble TNFR2 .DELTA.7 in the serum
was measured. SSO treatment induced soluble TNFR2 .DELTA.7 protein
levels over background for at least 10 days (FIG. 11).
[0191] To test the effects at longer time points, the experiment
was repeated, except that serum samples were collected until day 27
after the last injection. The results show only a slight decrease
in soluble TNFR2 .DELTA.7 levels 27 days after the last SSO
injection (MG. 12).
Example 8
Anti-TNF-.alpha. Activity in Mice Serum
[0192] The anti-TNF-.alpha. activity of serum from SSO 3274 treated
mice was tested in an L929 cytotoxicity assay. In this assay, serum
is assessed for its ability to protect cultured L929 cells from the
cytotoxic effects of a fixed concentration of TNF-.alpha. as
described in Example 1. Serum from mice treated with SSO 3274 but
not control SSOs (3083 or 3272) increased viability of the L929
cells exposed to 0.1 ng/mL TNF-.alpha. (FIG. 13). Hence, the SSO
3274 serum contained TNF-.alpha. antagonist sufficient to bind and
to inactivate TNF-.alpha., and thereby protect the cells from the
cytotoxic effects of TNF-.alpha.. This anti-TNF-.alpha. activity
was present in the serum of animals 5 and 27 days after the last
injection of SSO 3274.
Example 9
Comparison of SSO Generated TNFR2 .DELTA.7 to Other
Anti-TNF-.alpha. Antagonists
[0193] L929 cells were seeded as in Example 8. Samples were
prepared containing 904 of serum-free MEM, 0.1 ng/ml TNF-.alpha.
and 1 .mu.g/ml of actinomycin D, with either (i) recombinant
soluble protein (0.01-3 .mu.g/mL)) from Sigma.RTM. having the 236
amino acid residue extracellular domain of mouse TNFR2, (ii) serum
from SSO 3274 or SSO 3305 treated mice (1.25-10%, diluted in serum
from untreated mice; the concentration of TNFR2 .DELTA.7 was
determined by ELISA) or (iii) Enbrel.RTM.; (0.45-1.50 pg/ml) to a
final volume of 100 .mu.l with a final mouse serum concentration of
10%. The samples were incubated at room temperature for 30 minutes.
Subsequently, the samples were applied to the plated cells and
incubated for .about.24 hrs at 37.degree. C. in a 5% CO.sub.2
humidified atmosphere. Cell viability was measured by adding 20
.mu.L CellTiter 96.RTM. AQ.sub.ueous One Solution Reagent (Promega)
and measuring absorbance at 490 nm with a microplate reader. Cell
viability was normalized to untreated cells and plotted as a
function of TNF antagonist concentration (FIG. 14).
Example 10
Stability of TNFR2 .DELTA.7 mRNA and Protein
[0194] Mice were treated with either SSO 3274 or 3272 (control)
(n=5) by i.p. injection at a dose of 25 mg/kg/day daily for five
days. Mice were bled before injection and again 5, 15, 22, 27, and
35 days after the last injection. The concentration of soluble
TNFR2 .DELTA.7 in the serum was measured (FIG. 15A). Splice
shifting of TNFR2 in the liver was also determined at the time of
sacrifice by RT-PCR of total RNA from the liver (FIG. 15B).
Combined with data from Example 7, a time course of TNFR2 mRNA
levels after SSO treatment was constructed, and compared with the
time course of TNFR2 .DELTA.7 protein in serum (FIG. 16). The data
show that TNFR2 .DELTA.7 mRNA in vivo decays at a rate
approximately 4 times faster than that of TNFR2 .DELTA.7 protein in
serum. On day 35, TNFR2 .DELTA.7 mRNA was only detectable in trace
amounts, whereas TNFR2 .DELTA.7 protein had only decreased by 20%
from its peak concentration.
Example 11
Generation of Human TNFR2 .DELTA.7 cDNA
[0195] A plasmid containing the full length human TNFR2 cDNA was
obtained commercially from OriGene (Cat. No: TC119459,
NM.sub.--001066.2). The cDNA was obtained by performing PCR on the
plasmid using reverse primer TR001 (SEQ ID No: 74) and forward
primer TR002 (SEQ ID No: 75). The PCR product was isolated and was
purified using standard molecular biology techniques, and contains
the 1383 bp TNFR2 open reading frame without a stop codon.
[0196] Alternatively, full length human TNFR2 cDNA is obtained by
performing RT-PCR on total RNA from human mononuclear cells using
the TR001 reverse primer and the TR002 forward primer. The PCR
product is isolated and is purified using standard molecular
biology techniques.
[0197] To generate human TNFR2 .DELTA.7 cDNA, two separate PCR
reactions were performed on the full length human TNFR2 cDNA,
thereby creating overlapping segments of the TNFR2 .DELTA.7 cDNA.
In one reaction, PCR was performed on full length TNFR2 cDNA using
the forward primer TR003 (SEQ ID No: 76) and the reverse primer
TR004 (SEQ ID No: 77). In the other reaction, PCR was performed on
full length TNFR2 cDNA using the reverse primer TR005 (SEQ ID No:
78) and the TR002 forward primer. Finally, the 2 overlapping
segments were combined, and PCR was performed using the TR002
forward primer and the TR004 reverse primer. The PCR product was
isolated and was purified using standard molecular biology
techniques, and was expected to contain the 1308 bp TNFR2 .DELTA.7
open reading frame with a stop codon (SEQ ID No: 9).
[0198] Similarly, by using the TR001 reverse primer instead of the
TR004 reverse primer in these PCR reactions the 1305 bp human TNFR2
.DELTA.7 open reading frame without a stop codon was generated.
This allows for the addition of in-frame C-terminal affinity
purification tags, such as His-tag, when the final PCR product is
inserted into an appropriate vector.
Example 12
Generation of Human TNFR1 .DELTA.7 cDNA
[0199] A plasmid containing the full length human TNFR2 cDNA is
obtained commercially from OriGene (Cat. No: TC127913,
NM.sub.--001065.2). The cDNA is obtained by performing PCR on the
plasmid using the TR006 reverse primer (SEQ ID No: 88) and the
TR007 forward primer (SEQ ID No: 89). The full length human TNFR1
cDNA PCR product is isolated and is purified using standard
molecular biology techniques.
[0200] Alternatively, full length human TNFR1 cDNA is obtained by
performing RT-PCR on total RNA from human mononuclear cells using
the TR006 reverse primer and the TR007 forward primer. The full
length human TNFR1 cDNA PCR product is isolated and is purified
using standard molecular biology techniques.
[0201] To generate human TNFR1 .DELTA.7 cDNA, two separate PCR
reactions are performed on the full length human TNFR1 cDNA,
thereby creating overlapping segments of the TNFR1 .DELTA.7 cDNA.
In one reaction, PCR is performed on full length TNFR1 cDNA using
the TR008 forward primer (SEQ ID No: 90) and the TR006 reverse
primer. In the other reaction, PCR is performed on full length
TNFR1 cDNA using the TR009 reverse primer (SEQ ID No: 91) and the
TR010 forward primer (SEQ ID No 92). Finally, the 2 overlapping
segments are combined, and PCR is performed using the TR010 forward
primer and the TR006 reverse primer. The PCR product is isolated
and is purified using standard molecular biology techniques, and
contains the 1254 bp human TNFR1 .DELTA.7 open reading frame with a
stop codon (SEQ ID No: 5).
[0202] Alternatively, by using the TRW 1 reverse primer (SEQ ID No:
93) instead of the TR006 reverse primer in these PCR reactions the
1251 bp human TNFR1 .DELTA.7 open reading frame without a stop
codon is generated. This allows for the addition of in-frame
C-terminal affinity purification tags, such as His-tag, when the
final PCR product is inserted into an appropriate vector.
Example 13
Generation of Murine TNFR2 .DELTA.7 cDNA
[0203] To generate full length murine TNFR2 cDNA, PCR was performed
on the commercially available FirstChoice.TM. PCR-Ready Mouse Liver
cDNA (Ambion, Cat. No: AM3300) using the TR012 reverse primer (SEQ
ID No: 98) and the TR013 forward primer (SEQ ID No: 99). The full
length murine TNFR2 cDNA PCR product is isolated and is purified
using standard molecular biology techniques. Then by performing PCR
on the resulting product using the TR014 forward primer (SEQ ID No:
100) and the TR012 reverse primer the proper Kozak sequence was
introduced.
[0204] Alternatively, full length murine TNFR2 cDNA is obtained by
performing RT-PCR on total RNA from Mouse mononuclear cells or
mouse hepatocytes using the TR015 reverse primer (SEQ ID No: 101)
and the TR016 forward primer (SEQ ID No: 102). The full length
murine TNFR2 cDNA PCR product is isolated and is purified using
standard molecular biology techniques.
[0205] To generate murine TNFR2 .DELTA.7 cDNA, two separate PCR
reactions were performed on the full length murine TNFR2 cDNA,
thereby creating overlapping segments of the TNFR2 .DELTA.7 cDNA.
In one reaction, PCR was performed on full length TNFR2 cDNA using
the TR017 forward primer (SEQ ID No: 103) and the TR015 reverse
primer. In the other reaction, PCR was performed on full length
TNFR2 cDNA using the TR018 reverse primer (SEQ ID No: 104) and the
TR016 forward primer. Finally, the 2 overlapping segments were
combined, and PCR was performed using the TR016 forward primer and
the TR015 reverse primer. The PCR product was isolated and was
purified using standard molecular biology techniques, and was
expected to contain the 1348 bp murine TNFR2 .DELTA.7-open reading
frame with a stop codon (SEQ ID No: 11).
[0206] Alternatively, by using the TR019 reverse primer (SEQ ID No:
105) instead of the TR015 reverse primer in these PCR reactions the
1345 bp murine TNFR2 .DELTA.7 open reading frame without a stop
codon was generated. This allows for the addition of in-frame
C-terminal affinity purification tags, such as His-tag, when the
final PCR product is inserted into an appropriate vector.
Example 14
Generation of Murine TNFR1 .DELTA.7 cDNA
[0207] To generate full length murine TNFR1 cDNA, PCR is performed
on the commercially available FirstChoice.TM. PCR-Ready Mouse Liver
cDNA (Ambion, Cat. No: AM3300) using the TR020 reverse primer (SEQ
ID No: 114) and the TR021 forward primer (SEQ ID No: 115). The full
length murine TNFR1 cDNA PCR product is isolated and is purified
using standard molecular biology techniques.
[0208] Alternatively, full length murine TNFR1 cDNA is obtained by
performing RT-PCR on total RNA from mouse mononuclear cells using
the TR020 reverse primer and the TR021 forward primer. The full
length murine TNFR1 cDNA PCR product is isolated and is purified
using standard molecular biology techniques.
[0209] To generate murine TNFR1 .DELTA.7 cDNA, two separate PCR
reactions are performed on the full length human TNFR1 cDNA,
thereby creating overlapping segments of the TNFR1 .DELTA.7 cDNA.
In one reaction, PCR is performed on full length TNFR1 cDNA using
the TR022 forward primer (SEQ ID No: 116) and the TR020 reverse
primer. In the other reaction, PCR is performed on full length
TNFR1 cDNA using the TR023 reverse primer (SEQ ID No: 117) and the
TR024 forward primer (SEQ ID No: 118). Finally, the 2 overlapping
segments are combined, and PCR is performed using TR024 forward
primer and the TR020 reverse primer. The 1259 bp PCR product is
isolated and is purified using standard molecular biology
techniques, and contains the 1251 bp murine TNFR1 .DELTA.7 open
reading frame with a stop codon (SEQ ID No: 7).
[0210] Alternatively, by using the TR025 reverse primer (SEQ ID No:
119) instead of the TR020 reverse primer in these PCR reactions the
1248 bp murine TNFR1 .DELTA.7 open reading frame without a stop
codon is generated. This allows for the addition of in-frame
C-terminal affinity purification tags, such as His-tag, when the
final PCR product is inserted into an appropriate vector.
Example 15
Construction of Vectors for the Expression of Human TNFR2 .DELTA.7
in Mammalian Cells
[0211] For expression of the human TNFR2 .DELTA.7 protein in
mammalian cells, a human TNFR2 .DELTA.7 cDNA PCR product from
Example 11 was incorporated into an appropriate mammalian
expression vector. The TNFR2 .DELTA.7 cDNA PCR product from Example
11, both with and without a stop codon, and the pcDNA.TM.
3.1D/V5-His TOPO.RTM. expression vector (Invitrogen) were blunt-end
ligated and isolated according to the manufacturer's directions.
Plasmids containing inserts encoding human TNFR2 .DELTA.7 were
transformed into OneShot.RTM. Top10 competent cells (Invitrogen),
according to the supplier's directions. Fifty .mu.L of the
transformation mix were plated on LB media with 100 .mu.g/mL of
ampicillin and incubated overnight at 37.degree. C. Single colonies
were used to inoculate 5 mL cultures of LB media with 100 .mu.g/mL
ampicillin and incubated overnight at 37.degree. C. The cultures
were then used to inoculate 200 mL of LB media with 100 .mu.g/mL of
ampicillin and grown overnight at 37.degree. C. The plasmids were
isolated using GenElute.TM. Plasmid Maxiprep kit (Sigma) according
to manufacturer's directions. Purification efficiency ranged from
0.5 to 1.5 mg of plasmid per preparation.
[0212] Three human TNFR2 .DELTA.7 clones (1319-1, 1138-5 and
1230-1) were generated and sequenced. Clone 1319-1 contains the
human TNFR2 .DELTA.7 open reading frame without a stop codon
followed directly by an in-frame His-tag from the plasmid; while
clones 1138-5 and 1230-1 contain the TNFR2 .DELTA.7 open reading
frame followed immediately by a stop codon. The sequence of the
His-tag from the plasmid is given in SEQ ID No: 126. The sequences
of the TNFR2 .DELTA.7 open reading frames of clones 1230-1 and
1319-1 were identical to SEQ ID No: 9 with and without the stop
codon, respectively. However relative to SEQ ID No: 9, the sequence
(SEQ ID No: 125) of the TNFR2 .DELTA.7 open reading frames of clone
1138-5 differed by a single nucleotide at position 1055 in exon 10,
with an A in the former and a G in the later. This single
nucleotide change causes the amino acid 352 to change from a
glutamine to an arginine.
Example 16
Expression of Human TNFR2 .DELTA.7 in E. coli
[0213] For expression of the human TNFR2 .DELTA.7 protein in
bacteria, a human TNFR2 .DELTA.7 cDNA from Example 11 is
incorporated into an appropriate expression vector, such as a pET
Directional TOPO.RTM. expression vector (Invitrogen). PCR is
performed on the PCR fragment from Example 11 using forward (TR002)
(SEQ ID No: 75) and reverse (TR026) (SEQ ID NO: 79) primers to
incorporate a homologous recombination site for the vector. The
resulting PCR fragment is incubated with the pET101/D-TOPO.RTM.
vector (Invitrogen) according to the manufacturer's directions, to
create the human TNFR2 .DELTA.7 bacterial expression vector. The
resulting vector is transformed into the E. coli strain BL21(DE3).
The human TNFR2 .DELTA.7 is then expressed from the bacterial cells
according to the manufacturer's instructions.
Example 17
Expression of Human TNFR2 .DELTA.7 in Insect Cells
[0214] For expression of the human TNFR2 .DELTA.7 protein in insect
cells, a human TNFR2 .DELTA.7 cDNA from Example 11 is incorporated
into a baculoviral vector. PCR is performed on a human TNFR2
.DELTA.7 cDNA from Example 11 using forward (TR027) (SEQ ID No: 80)
and reverse (TR028) (SEQ ID No: 81) primers. The resulting PCR
product is digested with the restriction enzymes EcoRI and XhoI.
The digested PCR product is ligated with a EcoRI and XhoI digested
pENTR.TM. Vector (Invitrogen), such as any one of the pENTR.TM. 1A,
pENTR.TM. 2B, pENTR.TM. 3C, pENTR.TM. 4, or pENTR.TM. 11 Vectors,
to yield an entry vector. The product is then isolated, amplified,
and purified using standard molecular biology techniques.
[0215] A baculoviral vector containing the human TNFR2 .DELTA.7
cDNA is generated by homologous recombination of the entry vector
with BaculoDirect.TM. Linear DNA (Invitrogen) using LR Clonase.TM.
(Invitrogen) according to the manufacturer's directions. The
reaction mixture is then used to infect Sf9 cells to generate
recombinant baculovirus. After harvesting the recombinant
baculovirus, expression of human TNFR2 .DELTA.7 is confirmed.
Amplification of the recombinant baculovirus yields a high-titer
viral stock. The high-titer viral stock is used to infect Sf9
cells, thereby expressing human TNFR2 .DELTA.7 protein.
Example 18
Generation of Adeno-Associated Viral Vectors for the Expression of
Human TNFR2 .DELTA.7
[0216] For in vitro or in vivo delivery to mammalian cells of the
human TNFR2 .DELTA.7 gene for expression in those mammalian cells,
a recombinant adeno-associated virus (rAAV) vector is generated
using a three plasmid transfection system as described in Grieger,
J., et al., 2006, Nature Protocols 1:1412. PCR is performed on a
purified human TNFR2 .DELTA.7 PCR product of Example 11, using
forward (TR029) (SEQ ID No: 82) and reverse (TR030) (SEQ ID No: 83)
primers to introduce unique flanking NotI restriction sites. The
resulting PCR product is digested with the NotI restriction enzyme,
and isolated by standard molecular biology techniques. The
NotI-digested fragment is then ligated to NotI-digested pTR-UF2
(University of North Carolina (UNC) Vector Core Facility), to
create a plasmid that contains the human TNFR2 .DELTA.7 open
reading frame, operably linked to the CMVie promoter, flanked by
inverted terminal repeats. The resulting plasmid is then
transfected with the plasmids pXX680 and pHelper (UNC Vector Core
Facility) into HEK-293 cells, as described in Grieger, J., et al.,
to produce rAAV particles containing the human TNFR2 .DELTA.7 gene
where expression is driven by the strong constitutive CMVie
promoter. The virus particles are harvested and purified, as
described in Grieger, J., et al., to provide an rAAV stock suitable
for transducing mammalian cells.
Example 19
Expression of Human TNFR1 .DELTA.7 in E. coli
[0217] For expression of the human TNFR1 .DELTA.7 protein in
bacteria, the cDNA from Example 12 is incorporated into an
appropriate expression vector, such as a pET Directional TOPO.RTM.
expression vector (Invitrogen). PCR is performed on the cDNA from
Example 12 using forward (TR010) (SEQ ID No: 92) and reverse
(TR006) (SEQ ID No: 88) primers to incorporate a homologous
recombination site for the vector. The resulting PCR fragment is
incubated with the pET101/D-TOPO.RTM. vector (Invitrogen) according
to the manufacturer's directions, to create the human TNFR1
.DELTA.7 bacterial expression vector. The resulting vector is
transformed into the E. coli strain BL21(DE3). The human TNFR1
.DELTA.7 is then expressed from the bacterial cells according to
the manufacturer's instructions.
Example 20
Expression of Human TNFR1 .DELTA.7 in Mammalian Cells
[0218] For expression of the human TNFR1 .DELTA.7 protein in
mammalian cells, a human TNFR1 .DELTA.7 cDNA PCR product from
Example 12 is incorporated into an appropriate mammalian expression
vector. human TNFR1 .DELTA.7 cDNA PCR product from Example 12 and
the pcDNA.TM. 3.1D/V5-His TOPO.RTM. expression vector (Invitrogen)
are blunt-end ligated according to the manufacturer's directions.
The product is then isolated, amplified, and purified using
standard molecular biology techniques to yield the mammalian
expression vector. The vector is then transfected into a mammalian
cell, where expression of the human TNFR1 .DELTA.7 protein is
driven by the strong constitutive CMVie promoter.
Example 21
Expression of Human TNFR1 .DELTA.7 in Insect Cells
[0219] For expression of the human TNFR1 .DELTA.7 protein in insect
cells, the cDNA from Example 12 is incorporated into a baculoviral
vector. PCR is performed on the cDNA from Example 12 using forward
(TR031) (SEQ ID No: 94) and reverse (TR032) (SEQ ID No: 95)
primers. The resulting PCR product is digested with the restriction
enzymes EcoRI and XhoI. The digested PCR product is ligated with a
EcoRI and XhoI digested pENTR.TM. Vector (Invitrogen), such as any
one of the pENTR.TM. 1A, pENTR.TM. 2B, pENTR.TM. 3C, pENTR.TM. 4,
or pENTR.TM. 11 Vectors, to yield an entry vector. The product is
then isolated, amplified, and purified using standard molecular
biology techniques.
[0220] A baculoviral vector containing the human TNFR1 .DELTA.7
cDNA is generated by homologous recombination of the entry vector
with BaculoDirect.TM. Linear DNA (Invitrogen) using LR Clonase.TM.
(Invitrogen) according to the manufacturer's directions. The
reaction mixture is then used to infect Sf9 cells to generate
recombinant baculovirus. After harvesting the recombinant
baculovirus, expression of human TNFR1 .DELTA.7 is confirmed.
Amplification of the recombinant baculovirus yields a high-titer
viral stock. The high-titer viral stock is used to infect Sf9
cells, thereby expressing human TNFR1 .DELTA.7 protein.
Example 22
Generation of Adeno-Associated Viral Vectors for the Expression of
Human TNFR1 .DELTA.7
[0221] For in vitro or in vivo delivery to mammalian cells of the
human TNFR1 .DELTA.7 gene for expression in those mammalian cells,
a recombinant adeno-associated virus (rAAV) vector is generated
using a three plasmid transfection system as described in Grieger,
J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the
purified human TNFR1 .DELTA.7 PCR product of Example 12, using
forward (TR033) (SEQ ID No: 96) and reverse (TR034) (SEQ ID No: 97)
primers to introduce unique flanking NotI restriction sites. The
resulting PCR product is digested with the NotI restriction enzyme,
and isolated by standard molecular biology techniques. The
Nod-digested fragment is then ligated to NotI-digested pTR-UF2
(University of North Carolina (UNC) Vector Core Facility), to
create a plasmid that contains the human TNFR1 .DELTA.7 open
reading frame, operably linked to the CMVie promoter, flanked by
inverted terminal repeats. The resulting plasmid is then
transfected with the plasmids pXX680 and pHelper (UNC Vector Core
Facility) into HEK-293 cells, as described in Grieger, J., et al.,
to produce rAAV particles containing the human TNFR1 .DELTA.7 gene
where expression is driven by the strong constitutive CMVie
promoter. The virus particles are harvested and purified, as
described in Grieger, J., et al., to provide an rAAV stock suitable
for transducing mammalian cells.
Example 23
Construction of Vectors for the Expression of Mouse TNFR2 .DELTA.7
in Mammalian Cells
[0222] For expression of the murine TNFR2 .DELTA.7 protein in
mammalian cells, a murine TNFR2 M cDNA PCR product from Example 13
was incorporated into an appropriate mammalian expression vector.
The TNFR2 .DELTA.7 cDNA PCR product from Example 13, both with and
without a stop codon, and the pcDNA.TM. 3.1D/V5-His TOPO.RTM.
expression vector (Invitrogen) was blunt-end ligated and isolated
according to the manufacturer's directions. Plasmids containing
inserts encoding murine .DELTA.7 TNFR2 were transformed into
OneShot.RTM. Top10 competent cells (Invitrogen), according to the
supplier's directions. Fifty .mu.L of the transformation mix were
plated on LB media with 100 .mu.g/mL of ampicillin and incubated
overnight at 37.degree. C. Single colonies were used to inoculate 5
mL cultures of LB media with 100 .mu.g/mL ampicillin and incubated
overnight at 37.degree. C. The cultures were then used to inoculate
200 mL of LB media with 100 .mu.g/mL of ampicillin and grown
overnight at 37.degree. C. The plasmids were isolated using
GenElute.TM. Plasmid Maxiprep kit (Sigma) according to
manufacturer's directions. Purification efficiency ranged from 0.5
to 1.5 mg of plasmid per preparation.
[0223] Two murine TNFR2 .DELTA.7 clones (1144-4 and 1145-3) were
generated and sequenced. Clone 1144-4 contains the murine TNFR2
.DELTA.7 open reading frame without a stop codon followed directly
by an in-frame His-tag from the plasmid; while clone 1145-3
contains the TNFR2 .DELTA.7 open reading frame followed immediately
by a stop codon. The sequence of the His-tag from the plasmid is
given in SEQ ID No: 126. Relative to SEQ ID No: 11, the sequence
(SEQ ID No: 124) of the TNFR2 .DELTA.7 open reading frames of the
two clones, 1144-4 and 1145-3, differed by a single nucleotide at
eleven positions. As a result of these single nucleotide changes
there are four amino acid differences relative to SEQ ID No:
12.
Example 24
Expression of Murine TNFR2 .DELTA.7 in E. Con
[0224] For expression of the mouse TNFR2 .DELTA.7 protein in
bacteria, a murine TNFR2 .DELTA.7 cDNA from Example 13 is
incorporated into an appropriate expression vector, such as a pET
Directional TOPO.RTM. expression vector (Invitrogen). PCR is
performed on the PCR fragment from Example 13 using forward (TR035)
(SEQ ID No: 106) and reverse (TR036) (SEQ ID No: 107) primers to
incorporate a homologous recombination site for the vector. The
resulting PCR fragment is incubated with the pET101/D-TOPO.RTM.
vector (Invitrogen) according to the manufacturer's directions, to
create the marine TNFR2 .DELTA.7 bacterial expression vector. The
resulting vector is transformed into the E. coli strain BL21(DE3).
The murine TNFR2 .DELTA.7 is then expressed from the bacterial
cells according to the manufacturer's instructions.
Example 25
Expression of Mouse TNFR2 .DELTA.7 in Insect Cells
[0225] For expression of the murine TNFR2 .DELTA.7 protein in
insect cells, the cDNA from Example 13 is incorporated into a
baculoviral vector. PCR is performed on the cDNA from Example 13
using forward (TR037) (SEQ ID No: 108) and reverse (TR038) (SEQ ID
No: 109) primers. The resulting PCR product is digested with the
restriction enzymes EcoRI and XhoI. The digested PCR product is
ligated with a EcoRI and XhoI digested pENTR.TM. Vector
(Invitrogen), such as any one of the pENTR.TM. 1A, pENTR.TM. 2B,
pENTR.TM. 3C, pENTR.TM. 4, or pENTR.TM. 11 Vectors, to yield an
entry vector. The product is then isolated, amplified, and purified
using standard molecular biology techniques.
[0226] A baculoviral vector containing the marine TNFR2 .DELTA.7
cDNA is generated by homologous recombination of the entry vector
with BaculoDirect.TM. Linear DNA (Invitrogen) using LR Clonase.TM.
(Invitrogen) according to the manufacturer's directions. The
reaction mixture is then used to infect Sf9 cells to generate
recombinant baculovirus. After harvesting the recombinant
baculovirus, expression of murine TNFR2 .DELTA.7 is confirmed.
Amplification of the recombinant baculovirus yields a high-titer
viral stock. The high-titer viral stock is used to infect Sf9
cells, thereby expressing murine TNFR2 .DELTA.7 protein.
Example 26
Generation of Adeno-Associated Viral Vectors for the Expression of
Murine TNFR2 .DELTA.7
[0227] For in vitro or in vivo delivery to mammalian cells of the
murine TNFR2 .DELTA.7 gene for expression in those mammalian cells,
a recombinant adeno-associated virus (rAAV) vector is generated
using a three plasmid transfection system as described in Grieger,
J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the
purified murine TNFR2 .DELTA.7 PCR product of Example 13, using
forward (TR039)(SEQ ID No: 110) and reverse (TR040)(SEQ ID No: 111)
primers to introduce unique flanking NotI restriction sites. The
resulting PCR product is digested with the NotI restriction enzyme,
and isolated by standard molecular biology techniques. The
NotI-digested fragment is then ligated to NotI-digested pTR-UF2
(University of North Carolina (UNC) Vector Core Facility), to
create a plasmid that contains the murine TNFR2 .DELTA.7 open
reading frame, operably linked to the CMVie promoter; flanked by
inverted terminal repeats. The resulting plasmid is then
transfected with the plasmids pXX680 and pHelper (UNC Vector Core
Facility) into HEK-293 cells, as described in Grieger, J., et al.,
to produce rAAV particles containing the murine TNFR2 .DELTA.7 gene
where expression is driven by the strong constitutive CMVie
promoter. The virus particles are harvested and purified, as
described in Grieger, J., et al., to provide an rAAV stock suitable
for transducing mammalian cells.
Example 27
Expression of Murine TNFR1 .DELTA.7 in E. coli
[0228] For expression of the mouse TNFR1 .DELTA.7 protein in
bacteria, the cDNA from Example 14 is incorporated into an
appropriate expression vector, such as a pET Directional TOPO.RTM.
expression vector (Invitrogen). PCR is performed on the cDNA from
Example 14 using forward (TR024)(SEQ ID No: 118) and reverse
(TR020)(SEQ ID No: 114) primers to incorporate a homologous
recombination site for the vector. The resulting PCR fragment is
incubated with the pET101/D-TOPO.RTM. vector (Invitrogen) according
to the manufacturer's directions, to create the murine TNFR1
.DELTA.7 bacterial expression vector. The resulting vector is
transformed into the E. coli strain BL21(DE3). The murine TNFR1
.DELTA.7 is then expressed from the bacterial cells according to
the manufacturer's instructions.
Example 28
Expression of Mouse TNFR1 .DELTA.7 in Mammalian Cells
[0229] For expression of the murine TNFR1 .DELTA.7 protein in
mammalian cells, a murine TNFR1 .DELTA.7 cDNA PCR product from
Example 14 is incorporated into an appropriate mammalian expression
vector. The murine TNFR1 .DELTA.7 cDNA PCR product from Example 14
and the pcDNA.TM.3.1D/V5-His TOPO.RTM. expression vector
(Invitrogen) are blunt-end ligated according to the manufacturer's
directions. The product is then isolated, amplified, and purified
using standard molecular biology techniques to yield the mammalian
expression vector. The vector is then transfected into a mammalian
cell, where expression of the murine TNFR1 .DELTA.7 protein is
driven by the strong constitutive CMVie promoter.
Example 29
Expression of Mouse TNFR1 .DELTA.7 in Insect Cells
[0230] For expression of the murine TNFR1 .DELTA.7 protein in
insect cells, the cDNA from Example 14 is incorporated into a
baculoviral vector. PCR is performed on the cDNA from Example 14
using forward (TR041)(SEQ ID No: 120) and reverse (TR042) (SEQ ID
No: 121) primers. The resulting PCR product is digested with the
restriction enzymes EcoRI and XhoI. The digested PCR product is
ligated with a EcoRI and XhoI digested pENTR.TM. Vector
(Invitrogen), such as any one of the pENTR.TM. 1A, pENTR.TM. 2B,
pENTR.TM. 3C, pENTR.TM. 4, or pENTR.TM. 11 Vectors, to yield an
entry vector. The product is then isolated, amplified, and purified
using standard molecular biology techniques.
[0231] A baculoviral vector containing the murine TNFR1 .DELTA.7
cDNA is generated by homologous recombination of the entry vector
with BaculoDirect.TM. Linear DNA (Invitrogen) using LR Clonase.TM.
(Invitrogen) according to the manufacturer's directions. The
reaction mixture is then used to infect Sf9 cells to generate
recombinant baculovirus. After harvesting the recombinant
baculovirus, expression of murine TNFR1 .DELTA.7 is confirmed.
Amplification of the recombinant baculovirus yields a high-titer
viral stock. The high-titer viral stock is used to infect Sf9
cells, thereby expressing murine TNFR1 .DELTA.7 protein.
Example 30
Generation of Adeno-Associated Viral Vectors for the Expression of
Murine TNFR1 .DELTA.7
[0232] For in vitro or in vivo delivery to mammalian cells of the
murine TNFR1 .DELTA.7 gene for expression in those mammalian cells,
a recombinant adeno-associated virus (rAAV) vector is generated
using a three plasmid transfection system as described in Grieger,
J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the
purified murine TNFR1 .DELTA.7 PCR product of Example 13, using
forward (TR043)(SEQ ID No: 122) and reverse (TR044)(SEQ ID No: 123)
primers to introduce unique flanking NotI restriction sites. The
resulting PCR product is digested with the NotI restriction enzyme,
and isolated by standard molecular biology techniques. The
NotI-digested fragment is then ligated to NotI-digested pTR-UF2
(University of North Carolina (UNC) Vector Core Facility), to
create a plasmid that contains the murine TNFR1 .DELTA.7 open
reading frame, operably linked to the CMVie promoter, flanked by
inverted terminal repeats. The resulting plasmid is then
transfected with the plasmids pXX680 and pHelper (UNC Vector Core
Facility) into HEK-293 cells, as described in Grieger, J., et al.,
to produce rAAV particles containing the murine TNFR1 .DELTA.7 gene
where expression is driven by the strong constitutive CMVie
promoter. The virus particles are harvested and purified, as
described in Grieger, J., et al., to provide an rAAV stock suitable
for transducing mammalian cells.
Example 31
Generation of Lentiviral Vectors for the Expression of TNFR
.DELTA.7
[0233] For in vitro or in vivo delivery to mammalian cells of a
TNFR .DELTA.7 gene for expression in those mammalian cells, a
replication-incompetent lentivirus vector is generated. A PCR
product from Example 16, Example 19, Example 24 or Example 27 and
the pLenti6/V5-D-TOPO.RTM. vector (Invitrogen) are blunt-end
ligated according to the manufacturer's directions. The resulting
plasmid is transformed into E. coli, amplified, and purified using
standard molecular biology techniques. This plasmid is transfected
into 293FT cells (Invitrogen) according to the manufacturer's
directions to produce lentivirus particles containing the TNFR
.DELTA.7 gene where expression is driven by the strong constitutive
CMVie promoter. The virus particles are harvested and purified, as
described in Tiscornia, G., et al., 2006, Nature Protocols 1:241,
to provide a lentiviral stock suitable for transducing mammalian
cells.
Example 32
Expression of TNFR2 .DELTA.7 in Mammalian Cells
[0234] The plasmids generated in Example 15 and Example 23 were
used to express active protein in mammalian HeLa cells, and the
resulting proteins were tested for anti-TNF-.alpha. activity. HeLa
cells were seeded in at 1.0.times.10.sup.5 cells per well in
24-well plates in SMEM media containing L-glutamine, gentamicin,
kanamycin, 5% FBS and 5% HS. Cells were grown overnight at
37.degree. C. in a 5% CO.sub.2 humidified atmosphere. Approximately
250 ng of plasmid DNA was added to 504 of OPTI-MEM.TM., and then 50
.mu.L Lipofectamine.TM. 2000 mix (1 part Lipofectamine.TM. 2000 to
25 parts OPTI-MEM.TM.) was added and incubated for 20 minutes. Then
400 .mu.L of serum free media was added and then applied to the
cells in the 24-well plates. After incubation for .about.48 hrs at
37.degree. C. in a 5% CO.sub.2 humidified atmosphere, the media was
collected and the cells were harvested in 800 .mu.L
TRI-Reagent.TM.. Total RNA was isolated from the cells per the
manufacturer's directions and analyzed by RT-PCR using the forward
primer TR047 (SEQ ID No: 84) and the reverse primer TR048 (SEQ ID
No: 85) for human TNFR2 or the forward primer TR045 (SEQ ID No:
112) and the reverse primer TR046 (SEQ ID No: 113) for mouse TNFR2
.DELTA.7. The concentration of soluble TNFR2 in the media was
measured by ELISA.
[0235] The anti-TNF-.alpha. activity of the above media was tested
in an L929 cytotoxicity assay. L929 cells were plated in 96-well
plates at 2.times.10.sup.4 cells per well in MEM media containing
10% regular FBS, penicillin and streptomycin and grown overnight at
37.degree. C. in a 5% CO.sub.2 humidified atmosphere. The media
samples were diluted 1, 2, 4, 8 and 16 fold with media from
non-transfected HeLa cells. Ninety .mu.L of each of these samples
was added to 10 .RTM.L of serum-free media, containing 1.0 ng/ml
TNF-.alpha. and 1 .mu.g/ml of actinomycin D. The media from the
cells were removed and replaced with these 100 .mu.L samples. The
cells were then grown overnight at 37.degree. C. in a 5% CO.sub.2
humidified atmosphere. Twenty .mu.L CellTiter 96.RTM. AQ.sub.ueous
One Solution Reagent (Promega) was then added to each well. Cell
viability was measured 4 hrs later by measuring absorbance at 490
nm with a microplate reader. Cell viability was normalized to
untreated cells and plotted as a function of TNF antagonist
concentration (FIG. 17).
[0236] The data from this example and from Example 9 were analyzed
using the GraphPad Prism.RTM. software to determine the EC.sub.50
value for each antagonist. For each antagonist from these examples
a sigmoidal dose-response curve was fit by non-linear regression
with the maximum and minimum responses held fixed to 100% and 0%,
respectively. The EC.sub.50 values shown in Table 5 correspond to a
95% confidence level, and each curve had an r.sup.2 value ranging
from 0.7 to 0.9.
TABLE-US-00005 TABLE 5 Activity of TNF-.alpha. antagonists
TNF-.alpha. Antagonist EC.sub.50 (ng/mL) Etanercept 1.1 .+-. 0.5
Recombinant soluble TNFR2 (rsTNFR2) 698 .+-. 180 SSO 3305 treated
mice serum (mouse TNFR2 .DELTA.7) 0.6 .+-. 0.2 SSO 3274 treated
mice serum (mouse TNFR2 .DELTA.7) 0.8 .+-. 0.3 Extracellular media
from 1144-4 transfected HeLa cells (mouse TNFR2 .DELTA.7) 2.4 .+-.
1.4 Extracellular media from 1145-3 transfected HeLa cells (mouse
TNFR2 .DELTA.7) 2.4 .+-. 0.8 Extracellular media from 1230-1
transfected HeLa cells (mouse TNFR2 .DELTA.7) 1.4 .+-. 1.1
Extracellular media from 1319-1 transfected HeLa cells (mouse TNFR2
.DELTA.7) 1.7 .+-. 1.0 Extracellular media from 1138-5 transfected
HeLa cells (mouse TNFR2 .DELTA.7) 1.8 .+-. 1.1
Example 33
Expression and Purification of TNFR2 .DELTA.7 in Mammalian
Cells
[0237] The plasmids generated in Example 15 and Example 23 were
used to express and purify TNFR2 .DELTA.7 from mammalian HeLa
cells. HeLa cells were plated in 6-well plates at 5.times.10.sup.5
cells per well, and grown overnight at 37.degree. C., 5% CO.sub.2,
in humidified atmosphere. Each well was then transfected with 1.5
.mu.g of plasmid DNA using either 1144-4 (mouse TNFR2 .DELTA.7 with
His-tag), 1145-1 (mouse TNFR2 .DELTA.7, no His-tag), 1230-1 (human
TNFR2 .DELTA.7, no His-tag) or 1319-1 (human TNFR2 .DELTA.7 with
His-tag) plasmids. Media was collected .about.48 hrs after
transfection and concentrated approximately 40-fold using Amicon
MWCO 30,000 filters. The cells were lysed in 120 .mu.L of RIM lysis
buffer (Invitrogen) with protease inhibitors (Sigma-aldrich) for 5
minutes on ice. Protein concentration was determined by the
Bradford assay. Proteins were then isolated from aliquots of the
cell lysates and the extracellular media and analyzed by western
blot for TNFR2 as described in Example 1 (FIG. 18).
[0238] Human and mouse TNFR2 .DELTA.7 with a His-tag (clones 1319-1
and 1144-4, respectively) were purified from the above media by
affinity chromatography. HisPur.TM. cobalt spin columns (Pierce)
were used to purify mouse and human TNFR2 .DELTA.7 containing a
His-tag from the above media. Approximately 32 mL of media were
applied to a 1 mL HisPur.TM. column equilibrated with 50 mM sodium
phosphate, 300 mM sodium chloride, 10 mM imidazole buffer (pH 7.4)
as recommended by the manufacturer. The column was then washed with
two column volumes of the same buffer and protein was eluted with 1
mL of 50 mM sodium phosphate, 300 mM sodium chloride, 150 mM
imidazole buffer (pH 7.4). Five .mu.L of each eluate were analyzed
by Western blot as described above (FIG. 19). TNFR2 .DELTA.7
appears in the eluate and the multiple bands represent variably
glycosylated forms of TNFR2 .DELTA.7. As negative controls, the
TNFR2 .DELTA.7 proteins expressed from plasmids 1230-1 or 1145-1
which do not contain a His-tag where subjected to the above
purification procedure. These proteins do not bind the affinity
column and do not appear in the eluate (FIG. 19).
Sequence CWU 1
1
12611368DNAHomo sapiens 1atgggcctct ccaccgtgcc tgacctgctg
ctgccactgg tgctcctgga gctgttggtg 60ggaatatacc cctcaggggt tattggactg
gtccctcacc taggggacag ggagaagaga 120gatagtgtgt gtccccaagg
aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180aagtgccaca
aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac
240tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag
acactgcctc 300agctgctcca aatgccgaaa ggaaatgggt caggtggaga
tctcttcttg cacagtggac 360cgggacaccg tgtgtggctg caggaagaac
cagtaccggc attattggag tgaaaacctt 420ttccagtgct tcaattgcag
cctctgcctc aatgggaccg tgcacctctc ctgccaggag 480aaacagaaca
ccgtgtgcac ctgccatgca ggtttctttc taagagaaaa cgagtgtgtc
540tcctgtagta actgtaagaa aagcctggag tgcacgaagt tgtgcctacc
ccagattgag 600aatgttaagg gcactgagga ctcaggcacc acagtgctgt
tgcccctggt cattttcttt 660ggtctttgcc ttttatccct cctcttcatt
ggtttaatgt atcgctacca acggtggaag 720tccaagctct actccattgt
ttgtgggaaa tcgacacctg aaaaagaggg ggagcttgaa 780ggaactacta
ctaagcccct ggccccaaac ccaagcttca gtcccactcc aggcttcacc
840cccaccctgg gcttcagtcc cgtgcccagt tccaccttca cctccagctc
cacctatacc 900cccggtgact gtcccaactt tgcggctccc cgcagagagg
tggcaccacc ctatcagggg 960gctgacccca tccttgcgac agccctcgcc
tccgacccca tccccaaccc ccttcagaag 1020tgggaggaca gcgcccacaa
gccacagagc ctagacactg atgaccccgc gacgctgtac 1080gccgtggtgg
agaacgtgcc cccgttgcgc tggaaggaat tcgtgcggcg cctagggctg
1140agcgaccacg agatcgatcg gctggagctg cagaacgggc gctgcctgcg
cgaggcgcaa 1200tacagcatgc tggcgacctg gaggcggcgc acgccgcggc
gcgaggccac gctggagctg 1260ctgggacgcg tgctccgcga catggacctg
ctgggctgcc tggaggacat cgaggaggcg 1320ctttgcggcc ccgccgccct
cccgcccgcg cccagtcttc tcagatga 13682455PRTHomo sapiens 2Met Gly Leu
Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu 1 5 10 15 Glu
Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro 20 25
30 His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys
35 40 45 Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys
His Lys 50 55 60 Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly
Gln Asp Thr Asp 65 70 75 80 Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr
Ala Ser Glu Asn His Leu 85 90 95 Arg His Cys Leu Ser Cys Ser Lys
Cys Arg Lys Glu Met Gly Gln Val 100 105 110 Glu Ile Ser Ser Cys Thr
Val Asp Arg Asp Thr Val Cys Gly Cys Arg 115 120 125 Lys Asn Gln Tyr
Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe 130 135 140 Asn Cys
Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu 145 150 155
160 Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu
165 170 175 Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu
Cys Thr 180 185 190 Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly
Thr Glu Asp Ser 195 200 205 Gly Thr Thr Val Leu Leu Pro Leu Val Ile
Phe Phe Gly Leu Cys Leu 210 215 220 Leu Ser Leu Leu Phe Ile Gly Leu
Met Tyr Arg Tyr Gln Arg Trp Lys 225 230 235 240 Ser Lys Leu Tyr Ser
Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu 245 250 255 Gly Glu Leu
Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser 260 265 270 Phe
Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro Val 275 280
285 Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys
290 295 300 Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr
Gln Gly 305 310 315 320 Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser
Asp Pro Ile Pro Asn 325 330 335 Pro Leu Gln Lys Trp Glu Asp Ser Ala
His Lys Pro Gln Ser Leu Asp 340 345 350 Thr Asp Asp Pro Ala Thr Leu
Tyr Ala Val Val Glu Asn Val Pro Pro 355 360 365 Leu Arg Trp Lys Glu
Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu 370 375 380 Ile Asp Arg
Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln 385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala 405
410 415 Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu
Gly 420 425 430 Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala
Ala Leu Pro 435 440 445 Pro Ala Pro Ser Leu Leu Arg 450 455
31386DNAHomo sapiens 3atggcgcccg tcgccgtctg ggccgcgctg gccgtcggac
tggagctctg ggctgcggcg 60cacgccttgc ccgcccaggt ggcatttaca ccctacgccc
cggagcccgg gagcacatgc 120cggctcagag aatactatga ccagacagct
cagatgtgct gcagcaaatg ctcgccgggc 180caacatgcaa aagtcttctg
taccaagacc tcggacaccg tgtgtgactc ctgtgaggac 240agcacataca
cccagctctg gaactgggtt cccgagtgct tgagctgtgg ctcccgctgt
300agctctgacc aggtggaaac tcaagcctgc actcgggaac agaaccgcat
ctgcacctgc 360aggcccggct ggtactgcgc gctgagcaag caggaggggt
gccggctgtg cgcgccgctg 420cgcaagtgcc gcccgggctt cggcgtggcc
agaccaggaa ctgaaacatc agacgtggtg 480tgcaagccct gtgccccggg
gacgttctcc aacacgactt catccacgga tatttgcagg 540ccccaccaga
tctgtaacgt ggtggccatc cctgggaatg caagcatgga tgcagtctgc
600acgtccacgt cccccacccg gagtatggcc ccaggggcag tacacttacc
ccagccagtg 660tccacacgat cccaacacac gcagccaact ccagaaccca
gcactgctcc aagcacctcc 720ttcctgctcc caatgggccc cagcccccca
gctgaaggga gcactggcga cttcgctctt 780ccagttggac tgattgtggg
tgtgacagcc ttgggtctac taataatagg agtggtgaac 840tgtgtcatca
tgacccaggt gaaaaagaag cccttgtgcc tgcagagaga agccaaggtg
900cctcacttgc ctgccgataa ggcccggggt acacagggcc ccgagcagca
gcacctgctg 960atcacagcgc cgagctccag cagcagctcc ctggagagct
cggccagtgc gttggacaga 1020agggcgccca ctcggaacca gccacaggca
ccaggcgtgg aggccagtgg ggccggggag 1080gcccgggcca gcaccgggag
ctcagattct tcccctggtg gccatgggac ccaggtcaat 1140gtcacctgca
tcgtgaacgt ctgtagcagc tctgaccaca gctcacagtg ctcctcccaa
1200gccagctcca caatgggaga cacagattcc agcccctcgg agtccccgaa
ggacgagcag 1260gtccccttct ccaaggagga atgtgccttt cggtcacagc
tggagacgcc agagaccctg 1320ctggggagca ccgaagagaa gcccctgccc
cttggagtgc ctgatgctgg gatgaagccc 1380agttaa 13864461PRTHomo sapiens
4Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu 1
5 10 15 Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro
Tyr 20 25 30 Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr
Tyr Asp Gln 35 40 45 Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro
Gly Gln His Ala Lys 50 55 60 Val Phe Cys Thr Lys Thr Ser Asp Thr
Val Cys Asp Ser Cys Glu Asp 65 70 75 80 Ser Thr Tyr Thr Gln Leu Trp
Asn Trp Val Pro Glu Cys Leu Ser Cys 85 90 95 Gly Ser Arg Cys Ser
Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110 Glu Gln Asn
Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125 Ser
Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135
140 Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val
145 150 155 160 Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr
Ser Ser Thr 165 170 175 Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val
Val Ala Ile Pro Gly 180 185 190 Asn Ala Ser Met Asp Ala Val Cys Thr
Ser Thr Ser Pro Thr Arg Ser 195 200 205 Met Ala Pro Gly Ala Val His
Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220 Gln His Thr Gln Pro
Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser 225 230 235 240 Phe Leu
Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255
Asp Phe Ala Leu Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly 260
265 270 Leu Leu Ile Ile Gly Val Val Asn Cys Val Ile Met Thr Gln Val
Lys 275 280 285 Lys Lys Pro Leu Cys Leu Gln Arg Glu Ala Lys Val Pro
His Leu Pro 290 295 300 Ala Asp Lys Ala Arg Gly Thr Gln Gly Pro Glu
Gln Gln His Leu Leu 305 310 315 320 Ile Thr Ala Pro Ser Ser Ser Ser
Ser Ser Leu Glu Ser Ser Ala Ser 325 330 335 Ala Leu Asp Arg Arg Ala
Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly 340 345 350 Val Glu Ala Ser
Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser 355 360 365 Asp Ser
Ser Pro Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile 370 375 380
Val Asn Val Cys Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln 385
390 395 400 Ala Ser Ser Thr Met Gly Asp Thr Asp Ser Ser Pro Ser Glu
Ser Pro 405 410 415 Lys Asp Glu Gln Val Pro Phe Ser Lys Glu Glu Cys
Ala Phe Arg Ser 420 425 430 Gln Leu Glu Thr Pro Glu Thr Leu Leu Gly
Ser Thr Glu Glu Lys Pro 435 440 445 Leu Pro Leu Gly Val Pro Asp Ala
Gly Met Lys Pro Ser 450 455 460 51254DNAHomo sapiens 5atgggcctct
ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60ggaatatacc
cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga
120gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat
ttgctgtacc 180aagtgccaca aaggaaccta cttgtacaat gactgtccag
gcccggggca ggatacggac 240tgcagggagt gtgagagcgg ctccttcacc
gcttcagaaa accacctcag acactgcctc 300agctgctcca aatgccgaaa
ggaaatgggt caggtggaga tctcttcttg cacagtggac 360cgggacaccg
tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt
420ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc
ctgccaggag 480aaacagaaca ccgtgtgcac ctgccatgca ggtttctttc
taagagaaaa cgagtgtgtc 540tcctgtagta actgtaagaa aagcctggag
tgcacgaagt tgtgcctacc ccagattgag 600aatgttaagg gcactgagga
ctcagtttgt gggaaatcga cacctgaaaa agagggggag 660cttgaaggaa
ctactactaa gcccctggcc ccaaacccaa gcttcagtcc cactccaggc
720ttcaccccca ccctgggctt cagtcccgtg cccagttcca ccttcacctc
cagctccacc 780tatacccccg gtgactgtcc caactttgcg gctccccgca
gagaggtggc accaccctat 840cagggggctg accccatcct tgcgacagcc
ctcgcctccg accccatccc caaccccctt 900cagaagtggg aggacagcgc
ccacaagcca cagagcctag acactgatga ccccgcgacg 960ctgtacgccg
tggtggagaa cgtgcccccg ttgcgctgga aggaattcgt gcggcgccta
1020gggctgagcg accacgagat cgatcggctg gagctgcaga acgggcgctg
cctgcgcgag 1080gcgcaataca gcatgctggc gacctggagg cggcgcacgc
cgcggcgcga ggccacgctg 1140gagctgctgg gacgcgtgct ccgcgacatg
gacctgctgg gctgcctgga ggacatcgag 1200gaggcgcttt gcggccccgc
cgccctcccg cccgcgccca gtcttctcag atga 12546417PRTHomo sapiens 6Met
Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu 1 5 10
15 Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro
20 25 30 His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln
Gly Lys 35 40 45 Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr
Lys Cys His Lys 50 55 60 Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly
Pro Gly Gln Asp Thr Asp 65 70 75 80 Cys Arg Glu Cys Glu Ser Gly Ser
Phe Thr Ala Ser Glu Asn His Leu 85 90 95 Arg His Cys Leu Ser Cys
Ser Lys Cys Arg Lys Glu Met Gly Gln Val 100 105 110 Glu Ile Ser Ser
Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg 115 120 125 Lys Asn
Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe 130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu 145
150 155 160 Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu
Arg Glu 165 170 175 Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser
Leu Glu Cys Thr 180 185 190 Lys Leu Cys Leu Pro Gln Ile Glu Asn Val
Lys Gly Thr Glu Asp Ser 195 200 205 Val Cys Gly Lys Ser Thr Pro Glu
Lys Glu Gly Glu Leu Glu Gly Thr 210 215 220 Thr Thr Lys Pro Leu Ala
Pro Asn Pro Ser Phe Ser Pro Thr Pro Gly 225 230 235 240 Phe Thr Pro
Thr Leu Gly Phe Ser Pro Val Pro Ser Ser Thr Phe Thr 245 250 255 Ser
Ser Ser Thr Tyr Thr Pro Gly Asp Cys Pro Asn Phe Ala Ala Pro 260 265
270 Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly Ala Asp Pro Ile Leu Ala
275 280 285 Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn Pro Leu Gln Lys
Trp Glu 290 295 300 Asp Ser Ala His Lys Pro Gln Ser Leu Asp Thr Asp
Asp Pro Ala Thr 305 310 315 320 Leu Tyr Ala Val Val Glu Asn Val Pro
Pro Leu Arg Trp Lys Glu Phe 325 330 335 Val Arg Arg Leu Gly Leu Ser
Asp His Glu Ile Asp Arg Leu Glu Leu 340 345 350 Gln Asn Gly Arg Cys
Leu Arg Glu Ala Gln Tyr Ser Met Leu Ala Thr 355 360 365 Trp Arg Arg
Arg Thr Pro Arg Arg Glu Ala Thr Leu Glu Leu Leu Gly 370 375 380 Arg
Val Leu Arg Asp Met Asp Leu Leu Gly Cys Leu Glu Asp Ile Glu 385 390
395 400 Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro Pro Ala Pro Ser Leu
Leu 405 410 415 Arg 71251DNAMus sp. 7atgggtctcc ccaccgtgcc
tggcctgctg ctgtcactgg tgctcctggc tctgctgatg 60gggatacatc catcaggggt
cactggacta gtcccttctc ttggtgaccg ggagaagagg 120gatagcttgt
gtccccaagg aaagtatgtc cattctaaga acaattccat ctgctgcacc
180aagtgccaca aaggaaccta cttggtgagt gactgtccga gcccagggcg
ggatacagtc 240tgcagggagt gtgaaaaggg cacctttacg gcttcccaga
attacctcag gcagtgtctc 300agttgcaaga catgtcggaa agaaatgtcc
caggtggaga tctctccttg ccaagctgac 360aaggacacgg tgtgtggctg
taaggagaac cagttccaac gctacctgag tgagacacac 420ttccagtgcg
tggactgcag cccctgcttc aacggcaccg tgacaatccc ctgtaaggag
480actcagaaca ccgtgtgtaa ctgccatgca gggttctttc tgagagaaag
tgagtgcgtc 540ccttgcagcc actgcaagaa aaatgaggag tgtatgaagt
tgtgcctacc tcctccgctt 600gcaaatgtca caaaccccca ggactcagtt
tgtagggatc ccgtgcctgt caaagaggag 660aaggctggaa agcccctaac
tccagccccc tccccagcct tcagccccac ctccggcttc 720aaccccactc
tgggcttcag caccccaggc tttagttctc ctgtctccag tacccccatc
780agccccatct tcggtcctag taactggcac ttcatgccac ctgtcagtga
ggtagtccca 840acccagggag ctgaccctct gctctacgaa tcactctgct
ccgtgccagc ccccacctct 900gttcagaaat gggaagactc cgcccacccg
caacgtcctg acaatgcaga ccttgcgatt 960ctgtatgctg tggtggatgg
cgtgcctcca gcgcgctgga aggagttcat gcgtttcatg 1020gggctgagcg
agcacgagat cgagaggctg gagatgcaga acgggcgctg cctgcgcgag
1080gctcagtaca gcatgctgga agcctggcgg cgccgcacgc cgcgccacga
ggacacgctg 1140gaagtagtgg gcctcgtgct ttccaagatg aacctggctg
ggtgcctgga gaatatcctc 1200gaggctctga gaaatcccgc cccctcgtcc
acgacccgcc tcccgcgata a 12518416PRTMus sp. 8Met Gly Leu Pro Thr Val
Pro Gly Leu Leu Leu Ser Leu Val Leu Leu 1 5 10 15 Ala Leu Leu Met
Gly Ile His Pro Ser Gly Val Thr Gly Leu Val Pro 20 25 30 Ser Leu
Gly Asp Arg Glu Lys Arg Asp Ser Leu Cys Pro Gln Gly Lys 35 40 45
Tyr Val His Ser Lys Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys 50
55 60 Gly Thr Tyr Leu Val Ser Asp Cys Pro Ser Pro Gly Arg Asp Thr
Val 65 70 75 80 Cys Arg Glu Cys Glu Lys Gly Thr Phe Thr Ala Ser Gln
Asn Tyr Leu 85 90 95 Arg Gln Cys Leu Ser Cys Lys Thr Cys Arg Lys
Glu Met Ser Gln Val 100 105 110 Glu Ile Ser Pro Cys Gln Ala Asp Lys
Asp Thr Val Cys Gly Cys Lys 115 120 125 Glu Asn Gln Phe Gln Arg Tyr
Leu Ser Glu Thr His
Phe Gln Cys Val 130 135 140 Asp Cys Ser Pro Cys Phe Asn Gly Thr Val
Thr Ile Pro Cys Lys Glu 145 150 155 160 Thr Gln Asn Thr Val Cys Asn
Cys His Ala Gly Phe Phe Leu Arg Glu 165 170 175 Ser Glu Cys Val Pro
Cys Ser His Cys Lys Lys Asn Glu Glu Cys Met 180 185 190 Lys Leu Cys
Leu Pro Pro Pro Leu Ala Asn Val Thr Asn Pro Gln Asp 195 200 205 Ser
Val Cys Arg Asp Pro Val Pro Val Lys Glu Glu Lys Ala Gly Lys 210 215
220 Pro Leu Thr Pro Ala Pro Ser Pro Ala Phe Ser Pro Thr Ser Gly Phe
225 230 235 240 Asn Pro Thr Leu Gly Phe Ser Thr Pro Gly Phe Ser Ser
Pro Val Ser 245 250 255 Ser Thr Pro Ile Ser Pro Ile Phe Gly Pro Ser
Asn Trp His Phe Met 260 265 270 Pro Pro Val Ser Glu Val Val Pro Thr
Gln Gly Ala Asp Pro Leu Leu 275 280 285 Tyr Glu Ser Leu Cys Ser Val
Pro Ala Pro Thr Ser Val Gln Lys Trp 290 295 300 Glu Asp Ser Ala His
Pro Gln Arg Pro Asp Asn Ala Asp Leu Ala Ile 305 310 315 320 Leu Tyr
Ala Val Val Asp Gly Val Pro Pro Ala Arg Trp Lys Glu Phe 325 330 335
Met Arg Phe Met Gly Leu Ser Glu His Glu Ile Glu Arg Leu Glu Met 340
345 350 Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln Tyr Ser Met Leu Glu
Ala 355 360 365 Trp Arg Arg Arg Thr Pro Arg His Glu Asp Thr Leu Glu
Val Val Gly 370 375 380 Leu Val Leu Ser Lys Met Asn Leu Ala Gly Cys
Leu Glu Asn Ile Leu 385 390 395 400 Glu Ala Leu Arg Asn Pro Ala Pro
Ser Ser Thr Thr Arg Leu Pro Arg 405 410 415 91308DNAHomo sapiens
9atggcgcccg tcgccgtctg ggccgcgctg gccgtcggac tggagctctg ggctgcggcg
60cacgccttgc ccgcccaggt ggcatttaca ccctacgccc cggagcccgg gagcacatgc
120cggctcagag aatactatga ccagacagct cagatgtgct gcagcaaatg
ctcgccgggc 180caacatgcaa aagtcttctg taccaagacc tcggacaccg
tgtgtgactc ctgtgaggac 240agcacataca cccagctctg gaactgggtt
cccgagtgct tgagctgtgg ctcccgctgt 300agctctgacc aggtggaaac
tcaagcctgc actcgggaac agaaccgcat ctgcacctgc 360aggcccggct
ggtactgcgc gctgagcaag caggaggggt gccggctgtg cgcgccgctg
420cgcaagtgcc gcccgggctt cggcgtggcc agaccaggaa ctgaaacatc
agacgtggtg 480tgcaagccct gtgccccggg gacgttctcc aacacgactt
catccacgga tatttgcagg 540ccccaccaga tctgtaacgt ggtggccatc
cctgggaatg caagcatgga tgcagtctgc 600acgtccacgt cccccacccg
gagtatggcc ccaggggcag tacacttacc ccagccagtg 660tccacacgat
cccaacacac gcagccaact ccagaaccca gcactgctcc aagcacctcc
720ttcctgctcc caatgggccc cagcccccca gctgaaggga gcactggcga
cttcgctctt 780ccagttgaga agcccttgtg cctgcagaga gaagccaagg
tgcctcactt gcctgccgat 840aaggcccggg gtacacaggg ccccgagcag
cagcacctgc tgatcacagc gccgagctcc 900agcagcagct ccctggagag
ctcggccagt gcgttggaca gaagggcgcc cactcggaac 960cagccacagg
caccaggcgt ggaggccagt ggggccgggg aggcccgggc cagcaccggg
1020agctcagatt cttcccctgg tggccatggg acccaggtca atgtcacctg
catcgtgaac 1080gtctgtagca gctctgacca cagctcacag tgctcctccc
aagccagctc cacaatggga 1140gacacagatt ccagcccctc ggagtccccg
aaggacgagc aggtcccctt ctccaaggag 1200gaatgtgcct ttcggtcaca
gctggagacg ccagagaccc tgctggggag caccgaagag 1260aagcccctgc
cccttggagt gcctgatgct gggatgaagc ccagttaa 130810435PRTHomo sapiens
10Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu 1
5 10 15 Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro
Tyr 20 25 30 Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr
Tyr Asp Gln 35 40 45 Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro
Gly Gln His Ala Lys 50 55 60 Val Phe Cys Thr Lys Thr Ser Asp Thr
Val Cys Asp Ser Cys Glu Asp 65 70 75 80 Ser Thr Tyr Thr Gln Leu Trp
Asn Trp Val Pro Glu Cys Leu Ser Cys 85 90 95 Gly Ser Arg Cys Ser
Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110 Glu Gln Asn
Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125 Ser
Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135
140 Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val
145 150 155 160 Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr
Ser Ser Thr 165 170 175 Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val
Val Ala Ile Pro Gly 180 185 190 Asn Ala Ser Met Asp Ala Val Cys Thr
Ser Thr Ser Pro Thr Arg Ser 195 200 205 Met Ala Pro Gly Ala Val His
Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220 Gln His Thr Gln Pro
Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser 225 230 235 240 Phe Leu
Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255
Asp Phe Ala Leu Pro Val Glu Lys Pro Leu Cys Leu Gln Arg Glu Ala 260
265 270 Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly Thr Gln Gly
Pro 275 280 285 Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser Ser
Ser Ser Ser 290 295 300 Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg Arg
Ala Pro Thr Arg Asn 305 310 315 320 Gln Pro Gln Ala Pro Gly Val Glu
Ala Ser Gly Ala Gly Glu Ala Arg 325 330 335 Ala Ser Thr Gly Ser Ser
Asp Ser Ser Pro Gly Gly His Gly Thr Gln 340 345 350 Val Asn Val Thr
Cys Ile Val Asn Val Cys Ser Ser Ser Asp His Ser 355 360 365 Ser Gln
Cys Ser Ser Gln Ala Ser Ser Thr Met Gly Asp Thr Asp Ser 370 375 380
Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val Pro Phe Ser Lys Glu 385
390 395 400 Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr Pro Glu Thr Leu
Leu Gly 405 410 415 Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly Val Pro
Asp Ala Gly Met 420 425 430 Lys Pro Ser 435 111347DNAMus sp.
11atggcgcccg ccgccctctg ggtcgcgctg gtcttcgaac tgcagctgtg ggccaccggg
60cacacagtgc ccgcccaggt tgtcttgaca ccctacaaac cggaacctgg gtacgagtgc
120cagatctcac aggaatacta tgacaggaag gctcagatgt gctgtgctaa
gtgtcctcct 180ggccaatatg tgaaacattt ctgcaacaag acctcggaca
ccgtgtgtgc ggactgtgag 240gcaagcatgt atacccaggt ctggaaccag
tttcgtacat gtttgagctg cagttcttcc 300tgtaccactg accaggtgga
gatccgcgcc tgcactaaac agcagaaccg agtgtgtgct 360tgcgaagctg
gcaggtactg cgccttgaaa acccattctg gcagctgtcg acagtgcatg
420aggctgagca agtgcggccc tggcttcgga gtggccagtt caagagcccc
aaatggaaat 480gtgctatgca aggcctgtgc cccagggacg ttctctgaca
ccacatcatc cactgatgtg 540tgcaggcccc accgcatctg tagcatcctg
gctattcccg gaaatgcaag cacagatgca 600gtctgtgcgc ccgagtcccc
aactctaagt gccatcccaa ggacactcta cgtatctcag 660ccagagccca
caagatccca acccctggat caagagccag ggcccagcca aactccaagc
720atccttacat cgttgggttc aacccccatt attgaacaaa gtaccaaggg
tggcatctct 780cttccaattg agaagccctc ctgcctacaa agagatgcca
aggtgcctca tgtgcctgat 840gagaaatccc aggatgcagt aggccttgag
cagcagcacc tgttgaccac agcacccagt 900tccagcagca gctccctaga
gagctcagcc agcgctgggg accgaagggc gccccctggg 960ggccatcccc
aagcaagagt catggcggag gcccaagggt ttcaggaggc ccgtgccagc
1020tccaggattt cagattcttc ccacggaagc cacgggaccc acgtcaacgt
cacctgcatc 1080gtgaacgtct gtagcagctc tgaccacagt tctcagtgct
cttcccaagc cagcgccaca 1140gtgggagacc cagatgccaa gccctcagcg
tccccaaagg atgagcaggt ccccttctct 1200caggaggagt gtccgtctca
gtccccgtgt gagactacag agacactgca gagccatgag 1260aagcccttgc
cccttggtgt gccggatatg ggcatgaagc ccagccaagc tggctggttt
1320gatcagattg cagtcaaagt ggcctga 134712448PRTMus sp. 12Met Ala Pro
Ala Ala Leu Trp Val Ala Leu Val Phe Glu Leu Gln Leu 1 5 10 15 Trp
Ala Thr Gly His Thr Val Pro Ala Gln Val Val Leu Thr Pro Tyr 20 25
30 Lys Pro Glu Pro Gly Tyr Glu Cys Gln Ile Ser Gln Glu Tyr Tyr Asp
35 40 45 Arg Lys Ala Gln Met Cys Cys Ala Lys Cys Pro Pro Gly Gln
Tyr Val 50 55 60 Lys His Phe Cys Asn Lys Thr Ser Asp Thr Val Cys
Ala Asp Cys Glu 65 70 75 80 Ala Ser Met Tyr Thr Gln Val Trp Asn Gln
Phe Arg Thr Cys Leu Ser 85 90 95 Cys Ser Ser Ser Cys Thr Thr Asp
Gln Val Glu Ile Arg Ala Cys Thr 100 105 110 Lys Gln Gln Asn Arg Val
Cys Ala Cys Glu Ala Gly Arg Tyr Cys Ala 115 120 125 Leu Lys Thr His
Ser Gly Ser Cys Arg Gln Cys Met Arg Leu Ser Lys 130 135 140 Cys Gly
Pro Gly Phe Gly Val Ala Ser Ser Arg Ala Pro Asn Gly Asn 145 150 155
160 Val Leu Cys Lys Ala Cys Ala Pro Gly Thr Phe Ser Asp Thr Thr Ser
165 170 175 Ser Thr Asp Val Cys Arg Pro His Arg Ile Cys Ser Ile Leu
Ala Ile 180 185 190 Pro Gly Asn Ala Ser Thr Asp Ala Val Cys Ala Pro
Glu Ser Pro Thr 195 200 205 Leu Ser Ala Ile Pro Arg Thr Leu Tyr Val
Ser Gln Pro Glu Pro Thr 210 215 220 Arg Ser Gln Pro Leu Asp Gln Glu
Pro Gly Pro Ser Gln Thr Pro Ser 225 230 235 240 Ile Leu Thr Ser Leu
Gly Ser Thr Pro Ile Ile Glu Gln Ser Thr Lys 245 250 255 Gly Gly Ile
Ser Leu Pro Ile Glu Lys Pro Ser Cys Leu Gln Arg Asp 260 265 270 Ala
Lys Val Pro His Val Pro Asp Glu Lys Ser Gln Asp Ala Val Gly 275 280
285 Leu Glu Gln Gln His Leu Leu Thr Thr Ala Pro Ser Ser Ser Ser Ser
290 295 300 Ser Leu Glu Ser Ser Ala Ser Ala Gly Asp Arg Arg Ala Pro
Pro Gly 305 310 315 320 Gly His Pro Gln Ala Arg Val Met Ala Glu Ala
Gln Gly Phe Gln Glu 325 330 335 Ala Arg Ala Ser Ser Arg Ile Ser Asp
Ser Ser His Gly Ser His Gly 340 345 350 Thr His Val Asn Val Thr Cys
Ile Val Asn Val Cys Ser Ser Ser Asp 355 360 365 His Ser Ser Gln Cys
Ser Ser Gln Ala Ser Ala Thr Val Gly Asp Pro 370 375 380 Asp Ala Lys
Pro Ser Ala Ser Pro Lys Asp Glu Gln Val Pro Phe Ser 385 390 395 400
Gln Glu Glu Cys Pro Ser Gln Ser Pro Cys Glu Thr Thr Glu Thr Leu 405
410 415 Gln Ser His Glu Lys Pro Leu Pro Leu Gly Val Pro Asp Met Gly
Met 420 425 430 Lys Pro Ser Gln Ala Gly Trp Phe Asp Gln Ile Ala Val
Lys Val Ala 435 440 445 13178DNAHomo sapiens 13acatttgagt
ttgttttctg tagctgtctg agcttctctt ttctttctag gactgattgt 60gggtgtgaca
gccttgggtc tactaataat aggagtggtg aactgtgtca tcatgaccca
120ggtgaaaagt aagagtccat ccttccttcc ttcatccact tgttcaggaa gcttttgt
1781416DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14ccacaatcag tcctag 161514DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15acaatcagtc ctag 141612DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16aatcagtcct ag 121710DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17tcagtcctag 101814DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18ccacaatcag tcct 141912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 19ccacaatcag tc 122010DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20ccacaatcag 102114DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 21cacaatcagt ccta 142212DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 22cacaatcagt cc 122312DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23acaatcagtc ct 122412DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 24caatcagtcc ta 122510DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25cacaatcagt 102610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26acaatcagtc 102710DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27caatcagtcc 102810DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 28aatcagtcct 102910DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 29atcagtccta 103016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30cagtcctaga aagaaa 163114DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 31gtcctagaaa gaaa 143212DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32cctagaaaga aa 123310DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33tagaaagaaa 103414DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34cagtcctaga aaga 143512DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 35cagtcctaga aa 123610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36cagtcctaga 103714DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37agtcctagaa agaa 143812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38agtcctagaa ag 123912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 39gtcctagaaa ga 124012DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 40tcctagaaag aa 124110DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41agtcctagaa 104210DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 42gtcctagaaa 104310DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 43tcctagaaag 104410DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 44cctagaaaga 104510DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 45ctagaaagaa
104616DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46acttttcacc tgggtc 164714DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 47ttttcacctg ggtc 144812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 48ttcacctggg tc 124910DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 49cacctgggtc 105014DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 50acttttcacc tggg 145112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 51acttttcacc tg 125210DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52acttttcacc 105314DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 53cttttcacct gggt 145412DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 54cttttcacct gg 125512DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 55ttttcacctg gg 125612DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56tttcacctgg gt 125710DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 57cttttcacct 105810DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 58ttttcacctg 105910DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 59tttcacctgg 106010DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 60ttcacctggg 106110DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 61tcacctgggt 106216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 62agagcagaac cttact 166310DNAArtificial
SequenceDescription of DNA/RNA hybrid Synthetic oligonculeotide
63gaacctuact 106410DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 64agagcagaac 106510DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 65gagcagaacc 106610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 66agcagaacct 106710DNAArtificial
SequenceDescription of DNA/RNA hybrid Synthetic oligonculeotide
67gcagaaccut 106810DNAArtificial SequenceDescription of DNA/RNA
hybrid Synthetic oligonculeotide 68cagaacctua 106910DNAArtificial
SequenceDescription of DNA/RNA hybrid Synthetic oligonculeotide
69agaaccutac 107016DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 70ccactcctat tattag
167116DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 71caccactcct attatt 167216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72tggactctta cttttc 167316DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73aaggatggac tcttac 167421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74actgggcttc atcccagcat c 217525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75caccatggcg cccgtcgccg tctgg 257640DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76cgacttcgct cttccagttg agaagccctt gtgcctgcag
407724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 77ttaactgggc ttcatcccag catc
247840DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 78ctgcaggcac aagggcttct caactggaag
agcgaagtcg 407921DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 79ttaactgggc ttcatcccag c
218032DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 80cgatagaatt catggcgccc gtcgccgtct gg
328132DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 81cctaactcga gttaactggg cttcatccca gc
328239DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 82gactgagcgg ccgccaccat ggcgcccgtc
gccgtctgg 398338DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 83ctaagcgcgg ccgcttaact
gggcttcatc ccagcatc 388420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 84cgttctccaa
cacgacttca 208521DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 85cttatcggca ggcaagtgag g
218624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 86actgaaacat cagacgtggt gtgc
248721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 87ccttatcggc aggcaagtga g
218822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 88cctcatctga gaagactggg cg
228925DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 89gccaccatgg gcctctccac cgtgc
259038DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 90gggcactgag gactcagttt gtgggaaatc
gacacctg 389138DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 91caggtgtcga tttcccacaa
actgagtcct cagtgccc 389223DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 92caccatgggc
ctctccaccg tgc 239317DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 93tctgagaaga ctgggcg
179430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 94cgataggatc catgggcctc tccaccgtgc
309531DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 95cctaactcga gtcatctgag aagactgggc g
319637DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 96gactgagcgg ccgccaccat gggcctctcc
accgtgc 379734DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 97ctaagcgcgg ccgctcatct
gagaagactg ggcg 349820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 98ggtcaggcca
ctttgactgc 209919DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 99caccgctgcc cctatggcg
1910019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 100caccgctgcc actatggcg
1910124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 101ggtcaggcca ctttgactgc aatc
2410227DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 102gccaccatgg cgcccgccgc cctctgg
2710341DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 103ggcatctctc ttccaattga gaagccctcc
tgcctacaaa g 4110441DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 104ctttgtaggc aggagggctt
ctcaattgga agagagatgc c 4110521DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 105ggccactttg
actgcaatct g 2110625DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 106caccatggcg cccgccgccc tctgg
2510722DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 107tcaggccact ttgactgcaa tc
2210832DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108cgatagaatt catggcgccc gccgccctct gg
3210933DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 109cctaactcga gtcaggccac tttgactgca atc
3311039DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 110gactgagcgg ccgccaccat ggcgcccgcc
gccctctgg 3911136DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 111ctaagcgcgg ccgctcaggc
cactttgact gcaatc 3611221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 112gagccccaaa
tggaaatgtg c 2111320DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 113gctcaaggcc tactgcatcc
2011422DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114ggttatcgcg ggaggcgggt cg
2211526DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115gccaccatgg gtctccccac cgtgcc
2611640DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116cacaaacccc caggactcag tttgtaggga
tcccgtgcct 4011740DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 117aggcacggga tccctacaaa
ctgagtcctg ggggtttgtg 4011824DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 118caccatgggt
ctccccaccg tgcc 2411920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 119tcgcgggagg
cgggtcgtgg 2012031DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 120cgatagtcga catgggtctc
cccaccgtgc c 3112131DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 121cctaagaatt cttatcgcgg
gaggcgggtc g 3112238DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 122gactgagcgg ccgccaccat
gggtctcccc accgtgcc 3812334DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 123ctaagcgcgg
ccgcttatcg cgggaggcgg gtcg 341241347DNAMus sp. 124atggcgcccg
ccgccctctg ggtcgcgctg gtcttcgaac tgcagctgtg ggccaccggg 60cacacagtgc
ccgcccaggt tgtcttgaca ccctacaaac cggaacctgg gtacgagtgc
120cagatctcac aggaatacta tgacaggaag gctcagatgt gctgtgctaa
gtgtcctcct 180ggccaatatg tgaaacattt ctgcaacaag acctcggaca
ccgtgtgtgc ggactgtgag 240gcaagcatgt atacccaggt ctggaaccag
tttcgtacat gtttgagctg cagttcttcc 300tgtagcactg accaggtgga
gacccgcgcc tgcactaaac agcagaaccg agtgtgtgct 360tgcgaagctg
gcaggtactg cgccttgaaa acccattctg gcagctgtcg acagtgcatg
420aggctgagca agtgcggccc tggcttcgga gtggccagtt caagagcccc
aaatggaaat 480gtgctatgca aggcctgtgc cccagggacg ttctctgaca
ccacatcatc cacagatgtg 540tgcaggcccc accgcatctg tagcatcctg
gctattcccg gaaatgcaag cacagatgca 600gtctgtgcgc ccgagtcccc
aactctaagt gccatcccaa ggacactcta cgtatctcag 660ccagagccca
caagatccca acccctggat caagagccag ggcccagcca aactccaagc
720atccttacat cgttgggttc aacccccatt attgaacaaa gtaccaaggg
tggcatctct 780cttccaattg agaagccctc ctgcctacaa agagatgcca
aggtgcctca tgtgcctgat 840gagaaatccc aggatgcagt aggccttgag
cagcagcacc tgttgactac agcacccagt 900tccagcagca gctccctaga
gagctcagcc agcgctgggg atcgaagggc gccccctggg 960ggccatcccc
aagcaagagt catggcggag gcccaagggt ctcaggaggc ccgcgccagc
1020tccaggattt cagattcttc ccacggaagc cacgggaccc acgtcaacgt
cacctgcatc 1080gtgaacgtct gtagcagctc tgaccacagc tctcagtgct
cttcccaagc cagcgccacg 1140gtgggagacc cagatgccaa gccctcagcg
tccccaaagg atgagcaggt ccccttctct 1200caggaggagt gtccgtctca
gtccccgtat gagactacag agacactgca gagccatgag 1260aagcccttgc
cccttggtgt gccagatatg ggcatgaagc ccagccaagc tggctggttt
1320gatcagattg cagtcaaagt ggcctga 13471251308DNAHomo sapiens
125atggcgcccg tcgccgtctg ggccgcgctg gccgtcggac tggagctctg
ggctgcggcg 60cacgccttgc ccgcccaggt ggcatttaca ccctacgccc cggagcccgg
gagcacatgc 120cggctcagag aatactatga ccagacagct cagatgtgct
gcagcaaatg ctcgccgggc 180caacatgcaa aagtcttctg taccaagacc
tcggacaccg tgtgtgactc ctgtgaggac 240agcacataca cccagctctg
gaactgggtt cccgagtgct tgagctgtgg ctcccgctgt 300agctctgacc
aggtggaaac tcaagcctgc actcgggaac agaaccgcat ctgcacctgc
360aggcccggct ggtactgcgc gctgagcaag caggaggggt gccggctgtg
cgcgccgctg 420cgcaagtgcc gcccgggctt cggcgtggcc agaccaggaa
ctgaaacatc agacgtggtg 480tgcaagccct gtgccccggg gacgttctcc
aacacgactt catccacgga tatttgcagg 540ccccaccaga tctgtaacgt
ggtggccatc cctgggaatg caagcatgga tgcagtctgc 600acgtccacgt
cccccacccg gagtatggcc ccaggggcag tacacttacc ccagccagtg
660tccacacgat cccaacacac gcagccaact ccagaaccca gcactgctcc
aagcacctcc 720ttcctgctcc caatgggccc cagcccccca gctgaaggga
gcactggcga cttcgctctt 780ccagttgaga agcccttgtg cctgcagaga
gaagccaagg tgcctcactt gcctgccgat 840aaggcccggg gtacacaggg
ccccgagcag cagcacctgc tgatcacagc gccgagctcc 900agcagcagct
ccctggagag ctcggccagt gcgttggaca gaagggcgcc cactcggaac
960cagccacagg caccaggcgt ggaggccagt ggggccgggg aggcccgggc
cagcaccggg 1020agctcagatt cttcccctgg tggccatggg acccgggtca
atgtcacctg catcgtgaac 1080gtctgtagca gctctgacca cagctcacag
tgctcctccc aagccagctc cacaatggga 1140gacacagatt ccagcccctc
ggagtccccg aaggacgagc aggtcccctt ctccaaggag 1200gaatgtgcct
ttcggtcaca gctggagacg ccagagaccc tgctggggag caccgaagag
1260aagcccctgc cccttggagt gcctgatgct gggatgaagc ccagttaa
1308126144DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide 126aagggtcaag acaattctgc agatatccag cacagtggcg
gccgctcgag tctagagggc 60ccgcggttcg aaggtaagcc tatccctaac cctctcctcg
gtctcgattc tacgcgtacc 120ggtcatcatc accatcacca ttga 144
* * * * *