U.S. patent application number 14/625797 was filed with the patent office on 2015-06-11 for livestock with genetically modified prolactin receptor.
The applicant listed for this patent is Recombinetics, Inc.. Invention is credited to Daniel F. Carlson, Scott C. Fahrenkrug.
Application Number | 20150156996 14/625797 |
Document ID | / |
Family ID | 52585270 |
Filed Date | 2015-06-11 |
United States Patent
Application |
20150156996 |
Kind Code |
A1 |
Fahrenkrug; Scott C. ; et
al. |
June 11, 2015 |
LIVESTOCK WITH GENETICALLY MODIFIED PROLACTIN RECEPTOR
Abstract
Methods, uses, and animals for introgression of alleles between
animals, including SNPs. One embodiment involves introducing a
targeted targeting endonuclease system and a HDR template into a
cell with a mismatch in the binding of the targeting endonuclease
and the targeted site.
Inventors: |
Fahrenkrug; Scott C.;
(Minneapolis, MN) ; Carlson; Daniel F.; (Woodbury,
MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Recombinetics, Inc. |
Saint Paul |
MN |
US |
|
|
Family ID: |
52585270 |
Appl. No.: |
14/625797 |
Filed: |
February 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14263446 |
Apr 28, 2014 |
|
|
|
14625797 |
|
|
|
|
61870401 |
Aug 27, 2013 |
|
|
|
Current U.S.
Class: |
800/14 ; 435/325;
800/21 |
Current CPC
Class: |
C12N 15/8509 20130101;
C12N 15/907 20130101; C07K 14/47 20130101; C12N 2800/90 20130101;
C12N 15/85 20130101; A01K 67/0275 20130101; C07K 14/715 20130101;
C12N 15/8771 20130101; C12N 2800/30 20130101; C12N 15/8778
20130101; C12N 2750/14143 20130101 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C07K 14/47 20060101 C07K014/47; C12N 15/85 20060101
C12N015/85; C07K 14/715 20060101 C07K014/715 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] Aspects of the work described herein were supported by grant
1R43RR033149-01A1 from the National Institutes of Health and
Biotechnology Risk Assessment Program competitive grant number
2012-33522-19766 from the USDA--National Institute of Food and
Agriculture. The United States Government may have certain rights
in these inventions.
Claims
1. A genetically modified livestock animal from a first breed
comprising an exogenous allele of a gene from another species or a
second breed, said exogenous allele replacing a native allele of
the gene, wherein a genome of the first breed is free of meiotic
recombination with a genome of the other species or the second
breed and the exogenous allele is selected from the group
consisting of prolactin receptor (PRLR), and pleiomorphic adenoma
gene 1 (Plag1).
2. The animal of claim 1 wherein the animal of the first breed is
free of genetically engineered changes other than the replacement
of the native allele by the exogenous allele.
3. The animal of claim 1 wherein the livestock animal is an
artiodactyl.
4. The animal of claim 1 being homozygous for the exogenous
allele.
5. The animal of claim 1 wherein the exogenous allele differs from
the native allele by a number of bases, with the number ranging
from 1 to 20.
6. The animal of claim 1 wherein a difference between the exogenous
allele and the native allele differs comprises a single nucleotide
polymorphism (SNP).
7. The animal of claim 1 wherein the exogenous allele is prolactin
receptor Trunc461.
8. A livestock cell or embryo from a first breed comprising an
exogenous allele of a gene from another species or a second breed,
said exogenous allele replacing a native allele of the gene,
wherein a genome of the first breed is free of meiotic
recombination with a genome of the other species or the second
breed and the exogenous allele is selected from the group
consisting of prolactin receptor (PRLR), and pleiomorphic adenoma
gene 1 (Plag1).
9. The cell of claim 8 being selected from the group consisting of
a primary cell, a primary somatic cell, a zygote, a germ cell, a
stem cell, an oocyte, a sperm, and an embryo.
10. A method of making an improved livestock animal comprising
introgression of an exogenous allele into a native genome to
replace the native allele, with the allele being prolactin receptor
(PRLR) or pleiomorphic adenoma gene 1 (Plag1).
11. The method of claim 10 wherein the native allele of a cell is
replaced with the exogenous allele and the cell is used to make the
livestock animal, wherein the cell is selected from the group
consisting of a primary cell, a primary somatic cell, a zygote, a
germ cell, a stem cell, an oocyte, a sperm, and an embryo.
12. The method of claim 10 comprising introducing a targeted
endonuclease system and a HDR template into a cell, with the
targeted nuclease system comprising a DNA-binding member for
specifically binding an endogenous cognate sequence in the
chromosomal DNA, wherein the targeted nuclease system and the HDR
template operate to alter the chromosomal DNA to have identity to
the HDR template sequence to knockout the target gene, wherein the
target gene is selected from the group consisting of prolactin
receptor (PRLR) and pleiomorphic adenoma gene 1 (Plag1).
13. The method of claim 12 wherein the targeted endonuclease system
and/or HDR template comprising a feature to reduce specific binding
of the targeting endonuclease system to DNA.
14. The method of claim 12 wherein the targeted endonuclease system
comprises a plurality of TAL effector repeat sequences that are
fused to a nuclease (TALEN) or a Cas9 nuclease and a guide RNA,
with the mismatch being in the gRNA sequence relative to the
endogenous cognate sequence.
15. The method of claim 10 wherein, upon introgression of the
exogenous allele, the animal of the first breed is free of
genetically engineered changes other than the replacement of the
native allele by the exogenous allele.
16. The method of claim 10 wherein the livestock animal is an
artiodactyl.
17. The method of claim 10, with the animal being homozygous for
the exogenous allele.
18. The method of claim 10 wherein the exogenous allele differs
from the native allele by a number of bases, with the number
ranging from 1 to 20.
19. The method of claim 10 wherein a difference between the
exogenous allele and the native allele differs comprises a single
nucleotide polymorphism (SNP).
20. The method of claim 10 wherein the exogenous allele is
prolactin receptor Trunc461.
21. The method of claim 10 wherein the targeted endonuclease system
is introduced into the cell as an mRNA.
22. A genetically modified livestock animal comprising a knockout
of a beta-lactoglobulin gene.
23. The animal of claim 22 wherein the livestock animal is an
artiodactyl.
24. The animal of claim 22 being homozygous for the knockout of the
gene.
25. The animal of claim 22 wherein the knockout gene is knocked out
by deleting, inserting, or changing a number of nucleic acids in a
nucleic acid sequence of the target gene, with the number ranging
from 1 to 4.
26. The animal of claim 25 wherein the change to the gene comprises
a single nucleotide polymorphism (SNP).
27. A livestock cell or embryo comprising a knockout of a
beta-lactoglobulin gene.
28. The cell of claim 27 being selected from the group consisting
of a primary cell, a primary somatic cell, a zygote, a germ cell, a
stem cell, an oocyte, a sperm, and an embryo.
29. A method of making an improved livestock animal comprising
knocking out a beta-lactoglobulin gene.
30. The method of claim 29 comprising introducing a targeted
endonuclease system and a HDR template into the cell, with the
targeted nuclease system comprising a DNA-binding member for
specifically binding an endogenous cognate sequence in the
chromosomal DNA, wherein the targeted nuclease system and the HDR
template operate to alter the chromosomal DNA to have identity to
the HDR template sequence to knockout the beta-lactoglobulin
gene.
31. The method of claim 30 wherein the targeted endonuclease system
and/or HDR template comprising a feature to reduce specific binding
of the targeting endonuclease system to DNA.
32. The method of claim 30 wherein the targeted endonuclease system
comprises a plurality of TAL effector repeat sequences that are
fused to a nuclease (TALEN) or a Cas9 nuclease and a guide RNA,
with the mismatch being in the gRNA sequence relative to the
endogenous cognate sequence.
33. The method of claim 30 wherein the targeted endonuclease system
is introduced into the cell as an mRNA.
34. The method of claim 29 comprising knocking out the
beta-lactoglobulin gene with an insertion, a deletion, or a
substitution of a nucleic acid base.
35. The method of claim 34 wherein the insertion, deletion, or
substitution has a length from 1 to 20 residues.
36. The method of claim 29 comprising altering the
beta-lactoglobulin gene at only a single nucleic acid base
(SNP).
37. The method of claim 29 comprising altering the
beta-lactoglobulin gene with a plurality of single nucleotide
polymorphisms (SNP).
38. The method of claim 29 wherein the native allele of a cell is
replaced with the exogenous allele and the cell is used to make the
livestock animal, wherein the cell is selected from the group
consisting of a primary cell, a primary somatic cell, a zygote, a
germ cell, a stem cell, an oocyte, a sperm, and an embryo.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 14/263,446 filed Apr. 28, 2014 which claims
priority to U.S. Provisional Application No. 61/870,401 filed Aug.
27, 2013, which are hereby incorporated by reference herein.
TECHNICAL FIELD
[0003] The Technical Field is directed to materials and methods of
making genomically modified cells and animals, and research tools
for the same.
BACKGROUND
[0004] Since the first transgenic pig was created, more than 180
trials have been recorded to genetically engineer livestock in a
variety of ways. Animal genetic engineering has traditionally been
accomplished by random insertions of expression cassettes which
suffered from low efficiency and unpredictable expression, or
homologous recombination (efficiency lower than 1 in 10.sup.4) with
linked selection markers.
SUMMARY
[0005] Three recent targeted endonuclease technologies, zinc finger
nucleases (ZFNs), TAL effector nucleases (TALENs) and clustered
regularly interspaced short palindromic repeats/CRISPR associated
endonuclease cas9 (CRISPR/Cas9) have been utilized to disrupt
gene-function by introducing insertions and/or deletions (indels)
into genomes of species mediated by non-homologous end-joining
(NHEJ). Particularly, TALEN-induced gene disruption has been
demonstrated in various species ranging from model organisms to
crops farm animals and humans. However, indels introduced by NHEJ
are variable in size and sequence which makes screening for
functionally disrupted clones arduous and does not enable precise
alterations. TALEN or CRISPR/Cas9 mediated homology-directed repair
(HDR) has supported the introduction of defined nucleotide changes
in lower eukaryotic models including yeast, zebrafish and, very
recently, mice. These are models that allow for long-passage cells
or primordial germ cells to be modified to make transgenic
animals.
[0006] Demonstrated herein are precise, high frequency editing of a
variety of genes in about fifteen different working examples in
pig, goat, and cattle genomes. In some embodiments, the gene-edits
are indistinguishable from alleles that exist within a species or
clade and represent the first demonstration of marker-free,
non-meiotic allele introgression. High-efficiency and precise
gene-editing was achieved in certain commercially important loci in
the genomes of livestock that are useful for agriculture, for
research tools, or for biomedical purposes.
[0007] These processes have expanded the livestock gene-editing
toolbox to include TALEN and CRISPR/Cas9 stimulated
homology-directed repair (HDR) using plasmid, rAAV and
oligonucleotide templates. One of the examples shows that the
bovine POLLED allele was introgressed into homed Holstein
fibroblasts. This example demonstrates that various breeds of dairy
cattle can be created that do not have horns. And this change can
be made without disturbing other genes, or other parts of the
genome, of the animals. Single nucleotide alterations or small
indels (a term meaning a replacement, insertion and/or deletion)
were introduced into about fourteen other genes in pig, goat and
cattle fibroblasts using TALEN mRNA and oligonucleotide
transfection with efficiencies of 10-50% in populations. Several of
the chosen edits mimicked naturally occurring performance enhancing
or disease resistance alleles including, for the first time,
alteration of single base pairs (bp). Up to 70% of fibroblasts
colonies propagated without selection harbored the intended edits
of which over one half were homozygous. These efficiencies are so
high that these changes can be made without reporters and/or
without selection markers. Edited fibroblasts were used to generate
pigs with knockout alleles in the DAZL and APC genes to model
infertility and colon cancer, respectively. These methods
demonstrate meiosis-free intra- and inter-specific introgression of
select alleles in livestock cells, large mammals, and livestock for
research, agricultural and biomedical applications.
[0008] The following patent applications are hereby incorporated
herein by reference for all purposes; in case of conflict, the
instant specification is controlling: US 2010/0146655, US
2010/0105140, US 2011/0059160, US 2011/0197290, and US
2013/0117870.
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0009] FIG. 1 illustrates a general process of using a TAL-effector
endonuclease (TALEN).
[0010] FIG. 2 illustrates a general process of using a Cas9/CRISPR
endonuclease (an RNA-guided endonuclease).
[0011] FIG. 3 illustrates the theory of operation for TALENs that
explains why they are generally ineffective for making SNP changes;
similar processes apply to other targeted endonucleases.
[0012] FIG. 4 illustrates a general method of making and using
targeting endonucleases that is effective to make an SNP edit.
[0013] FIG. 5 illustrates another general method of making and
using targeting endonucleases that is effective to make an SNP
edit.
[0014] FIG. 6. TALEN-mediated introgression of POLLED. Panel a) A
schematic of the strategy to introgress the Polled allele into
Holstein (HORNED) cells. The POLLED allele, bottom, is a tandem
repeat of 212 bp (horizontal arrow) with a 10 bp deletion (not
shown). TALENs were developed to specifically target the HORNED
allele (vertical arrow) which could be repaired by homologous
recombination using the POLLED HDR plasmid. Panel b) Representative
images of colonies with homozygous or heterozygous introgression of
POLLED. Three primer sets were used for positive classification of
candidate colonies: F1+R1, F2+R2 and F1+P (POLLED specific).
Identity of the PCR products was confirmed by sequencing F1+R1
amplicons.
[0015] FIG. 7 is a plot of experimental data generated for
evaluation of transfected mRNA as a source of TALENs. TALENs were
introduced into fibroblasts encoded by either unmodified mRNA,
modified mRNA (mod mRNA) or plasmid DNA (pDNA). Two quantities of
each TALEN preparation were transfected into cells subsequently
cultured 3 days at 30.degree. C. or 37.degree. C. prior to analysis
of indels, reported as % NHEJ.
[0016] FIG. 8A is a plot showing that an mRNA source of TALENs
stimulated efficient and consistent HDR using an oligo donor. Each
chart displays results of targeting a specific locus in fibroblasts
(e.g., ssIL2RG; "ss" for Sus scrofa and "bt" for Bos taurus) using
oligo donor templates and TALENs delivered as plasmid DNA or mRNA.
(Insets) Diagrams of the oligo templates, in which the shaded boxes
represent the TALEN-binding site and the spacers are shown in
white. Each oligo contains either a 4-bp insertion (ins4) or
deletion (del4) that introduces a novel restriction site for RFLP
analysis. Presumptive BMs replace the conserved -1 thymidine
(relative to the TALEN-binding site) with the indicated nucleotide.
Fibroblasts were transfected with either TALEN-encoding plasmids (3
.mu.g) or mRNA (1 .mu.g) along with 3 .mu.M of their cognate
oligo-homologous template. Cells were then incubated at 37.degree.
C. or 30.degree. C. for 3 d before expansion at 37.degree. C. until
day 10. TALEN activity was measured by the Surveyor assay at day 3
(Day3 Surveyor), and HDR was measured at days 3 and 10 by RFLP
analysis (Day3% HDR and Day10% HDR). Each bar displays the average
and SEM from three replicates.
[0017] FIG. 8B is a plot of experimental data generated to evaluate
kinetics of TALEN induced HDR with oligonucleotide templates. Cells
were transfected with either TALEN-encoding mRNA or plasmid DNA and
oligos with 4 base pair insertions targeting LDLR or APC genes.
Panel a) RFLP analysis on cell populations at indicated time
points. Panel b) Results from panel a, were quantified by
densitometry and the averages were plotted as a function of time
with SEM (n=3). HDR signal first appears 12 hours post-transfection
and accumulates over time.
[0018] FIG. 9 is a plot of experimental data generated to evaluate
influence of mutation type on the frequency of HDR. Panel a) The
wildtype ssLDR (SEQ ID NO: 1) and sequence of five oligos used to
target ssLDLR: (from top to bottom: SEQ ID NOS: 2, 3, 4, 5, and 6).
TALEN binding sites are indicated in boxed text and the novel BamHI
site is underlined. SNPs including BMs and insertions are circled.
Panel b) Cells were transfected with LDLR2.1 TALEN mRNA (1 .mu.g)
and oligos (2 .mu.M final). HDR at day 3 was determined by RFLP
analysis and the average with SEM (n=3) was plotted. Panel c)
Cattle cells were transfected with btRosa1.2 TALEN mRNA and either
41_mloxP or 60_loxP oligos (2 .mu.M final). The numbers 41 and 60
refer to the number of homologous bases. Each oligo contains a 34
bp loxP site, either a modified (mloxP) or wild type (loxP)
version, in the center of the spacer.
[0019] FIG. 10 CRISPR/Cas9 mediated HDR to introgress the p65 S531P
mutation from warthogs into conventional swine. Panel a) The S531P
missense mutation is caused by a T-C transition at nucleotide 1591
of porcine p65. The S-P HDR template includes the causative TC
transition mutation (oversized text) which introduces a novel XmaI
site and enables RFLP screening. Panel b) Cells were transfected
with S-P-HDR oligos (2 .mu.M), two quantities of plasmid encoding
hCas9 (0.5 .mu.g or 2.0 .mu.g); and five quantities of the G2A
transcription plasmid (0.05 to 1.0 .mu.g). Cells from each
transfection were split 60:40 for culture at 30 and 37.degree. C.
respectively for 3 days before prolonged culture at 37.degree. C.
until day 10. Surveyor assay revealed activity ranging from 16-30%.
Panels c and d) RFLP analysis of cells sampled at days 3 and 10.
Expected cleavage products of 191 and 118 bp are indicated by black
arrows. The two gRNA sequences are P65_G1S (SEQ ID NO:7) and
P65_G2A (SEQ ID NO:8). The wild type porcine p65 is SEQ ID NO:9,
shown in alignment with the homology directed repair (HDR) template
S-P-HDR (SEQ ID NO:10). The left TALEN sequence and right TALEN
sequence to bind p65 DNA are SEQ ID NOs: 11 and 12,
respectively.
[0020] FIG. 11 shows experimental data for comparison of TALENs and
CRISPR/Cas9 mediated HDR. Panel a) APC14.2 TALENs (SEQ ID NOS:13
and 14) and the gRNA sequence APC14.2 G1a (SEQ ID NO: 15) are shown
relative to the wild type APC sequence (SEQ ID NO: 16). Below, the
HDR oligo (SEQ ID NO: 17) is shown which delivers a 4 bp insertion
(boxed text) resulting in a novel HindIII site. Cells were
transfected with HDR template, and TALEN mRNA, plasmid DNA encoding
hCas9 and the gRNA expression plasmid; or mRNA encoding hCas9 plus
the gRNA expression plasmid, cultured at either 30 or 37.degree. C.
for 3 days before expansion at 37.degree. C. until day 10. Panel b)
Charts displaying RFLP and Surveyor assay results
[0021] FIG. 12 shows experimental data for SNP introgression using
oligo donors. Panel a) is a plot of maintenance of HDR alleles with
or without blocking mutations (BMs) for pig LDLR and GDF8. Each
oligo had the same SNPs/restriction 313 site plus or minus BMs.
Average homologous recombination and SEM (n=3) is shown. Panel b)
shows results for introgression of myostatin C313Y into Wagyu
fibroblasts. The C313Y missense mutation is caused by a G-A
transition (indicated by oversized text) at nucleotide 938 of
bovine myostatin. The HDR template (labeled donor, SEQ ID NO:18),
also includes a T to C transition (circled) to introduce a novel
EcoRI site for RFLP screening. Two left TALENs were designed
against the locus, btGDF83.6-G (SEQ ID NO: 19), targeting the wild
type alelle (Wt) (SEQ ID NO:20), and btGDF83.6-A (SEQ ID NO:21),
targeting the mutant allele (C313Y); both share a common right
TALEN (SEQ ID NO:22). Transfection, culture and measurement were
conducted as above. The average and SEM for btGDF83.6-G (n=30) and
btGDF83.6-A (n=5) represent twelve and three biological replicates,
respectively. A two-sided student's t-test was used to compare
averages between groups; the p values are indicated.
[0022] FIG. 13 is a plot that shows results for sequence analysis
of TALEN stimulated HDR alleles. The count of perfect, intended HR
reads versus the wild type reads is plotted for insertion (panel a)
and SNP alleles (panel b). The target locus, time point and whether
or not BMs were included in the oligo are indicated. Panel c).
Reads from btGDF8 and p65 sorted for incorporation of the target
SNP and classified as intended (iSNP) versus those with an
additional mutation (iSNP+Mut) and plotted against the total number
of reads.
[0023] FIG. 14 shows results of sequence analysis of HDR alleles.
Sequencing reads containing the correct insertion (Panel a) or SNP
allele (Panel b) were analyzed for incorporation of BM. The target
locus, time point and whether or not BMs were included in the oligo
are indicated below each graph. Panel c). The data of FIG. 13 panel
c was further classified by mutation type and compared. Some reads
contained only the iSNP, others had a concomitant indel
(iSNP+indel), or a concomitant unintended SNP (iSNP+uSNP).
[0024] FIG. 15 shows experimental data for multiple SNPs placed in
the TALEN DNA-binding site to stabilize HDR alleles in the EIF4GI
gene. Panel a) shows a portion of wild type EIF4GI Wt-NL (SEQ ID
NO:23) and a pair of TALENs (SEQ ID NOS: 24 and 25) designed to cut
the wild type EIF4GI to stimulate homologous recombination. Also
aligned to the Wt sequence is the core sequence (SEQ ID NO:26) of
the donor oligo, DF-HDR, used to introduce three SNPs (underlined
oversized letters) into the genome. The third SNP creates a novel
EagI restriction site that was used for RFLP analysis. Pig
fibroblasts were transfected with EIF4GI14.1 TALEN mRNA (2 .mu.g)
and DF-HDR (2 .mu.M) and then cultured at 30.degree. C. for 3 days
prior to analysis and colony propagation. Panel b) shows RFLP
analysis on population three days post transfection. Expected
product sizes of 344, 177 and 167 bp are indicated by filled
triangles. Panel c) shows RFLP assay on isolated cellular clones.
Day 3 cells were used to derive monoclonal colonies through
dilution cloning. An example of colonies with heterozygous (open
triangles) or homozygous (filled triangles) HDR alleles are
indicated.
[0025] FIG. 16 is a plot of data for hypothermic treatment
maintenance of SNP HDR alleles. Pig fibroblasts were transfected
with TALEN mRNA (1 .mu.g) and oligos (3 .mu.M). Cells from two
independent transfections were pooled for each replicate and evenly
distributed into six wells of a 6-well plate and cultured at
30.degree. C. Samples were collected from these populations for
RFLP analysis on days 1-7 (minus day 6, 1 D to 7 D along X-axis)
post-transfection and the remaining cells were transferred to
37.degree. C. Samples for each condition were collected again at
day 12 for RFLP analysis. The average HDR and SEM (n=3) is shown at
the initial collection and once again at day 12.
[0026] FIG. 17 shows experimental results for TALENs made with
intentional RVD mismatches to improve frequency of correct alleles
when introducing a SNP. Panel a) shows a TALEN pair (caCLPG 1.1,
SEQ ID NOs: 27-29, top to bottom, left to right) designed to target
the caCLPG region. Oligo driven HDR was utilized to introduce the
desired Adenine to Guanine SNP (the targeted Adenine is boxed). The
desired SNP allowed genotyping by a loss of an AvaII restriction
site. Each TALEN monomer is indicated in shading above their
respective binding locations. Panel b) A caCLPG wildtype sequence
is shown (SEQ ID NO:31). Each allele of single-cell derived
colonies that were resistant to AvaII were sequenced (fourteen
sequences with SEQ ID NOS: 32-45, from top to bottom). All of the
alleles that contained the SNP of interest (boxed) also contained
deletions (marked with dashes in the AvaII Resistant Allele
sequences) or insertions (marked with dashes in the WT sequence).
In panel c), intentional mismatches (italicized circled text) were
introduced into the RVD sequence (represented as protein sequences
SEQ ID NOS:46 to 53, top to bottom). The desired SNP (boxed) was in
the right monomer of the TALEN. Panel d) shows TALEN activity as
measured via a CelI assay. The percent of non-homologous end
joining (% NHEJ) is indicated for each was measured. Panel e) shows
both an alignment of a caCLPG wildtype sequence is shown (SEQ ID
NO:60) with sequenced alleles of AvaII-resistant single-cell
derived colonies produced with caCLPG 1.1c (six sequences, with SEQ
ID NOS: 54 to 59, top to bottom). The desired SNP is boxed. Colony
37 and 78 were heterozygous for the desired SNP and showed no
additional indels. Colony 142 was homozygous for the desired SNP,
but contained a 4 bp insertion on one allele.
[0027] FIG. 18 shows results for experiments to introgress a SNP
with and without a mismatch in the targeting endonuclease. Panel a)
shows a schematic of the bovine DGAT sequence around K323A (SEQ ID
NOs: 61 and 62). The grey arrows represent the TALEN monomers where
they bind to the DGAT sequence. The left arm consists of 16 RVDs,
the right arm consists of 15 RVDs, and the spacer is 16 base pairs
long. The GC and gga gct, boxed, are the targeted base pairs. The
DGAT oligo converts the GC to an AA to create the desired DGAT
mutant. As a marker for HDR, the boxed GGGAGC is converted to
AAGCTT that creates a novel HindIII restriction site. Since this
change is in the spacer, it should not affect TALEN binding as to
not interfere with the intentional mismatch results. Panel b) DGAT
TALEN RVD sequences (from top to bottom: SEQ ID NOs:63 to 70).
btDGAT 14.2 contains no intentional mismatches in the RVDs. btDGAT
14.4, 14.5, and 14.6 each contain one intentional RVD mismatch at
either position 1, 3, or 5 of the left TALEN monomer (circled).
Panel c) Bovine fibroblasts were transfected with 1 ug of talen and
0.4 nmoles of oligo. Three days after transfection cells were
lysed, the DGAT sequence was amplified by PCR, digested with
HindIII and ran on an acrylamide gel. The percent efficiency of HDR
was determined by densitometry (HR). Panel d) Sequence analysis of
colonies produce with the original 14.2 TALENs. Of twelve colonies,
none that were positive for the HindIII RFLP contained the desired
mutation due to indels overlapping the site. (From top to bottom,
SEQ ID NOs: 71 to 79, 81). Panel e) Colonies derived from TALENs
14.5 and 14.6 produced the correct DGAT mutation and HindIII
restriction site. These two TALEN pairs produced a total of two
homozygous (HH) and three heterozygous (Hh) colonies. TALEN 14.4
did not produce any colonies with the correct DGAT mutation (data
not shown), from top to bottom, SEQ ID NOs: 82 to 87.
[0028] FIG. 19 sets forth the process of TALEN-HDR/RMCE. The floxed
cassette is transfected along with TALENs compatible with the
oligo, the loxP oligo and a source of Cre recombinase. The bar
graph shows the number of puromycin resistant colonies produced by
this method when YFC-Cre versus mCherry was included in the
transfection. To confirm targeting to the SRY locus, PCR was
conducted across the predicted junction (shown) will result in a
370 bp product. This product is apparent only when Cre is
included.
DETAILED DESCRIPTION
[0029] Gene editing tools such as targeting endonucleases are
useful for making genetically modified animals. Using these tools
to change a native allele at only one base is difficult or
impossible using conventional processes. New techniques are
described herein for making these edits at a single base, or a
plurality of single-base edits. These processes are useful for
introgression of an allele that differs only by a single nucleotide
polymorphism (SNP) or a plurality of SNPs. The ability to
introgress SNPs from one breed or species into another is believed
to create important new opportunities. The term SNP refers to a
difference of one base at the same relative site when two alleles
are aligned and compared; herein, the term is also used in some
contexts to mean a single base change.
[0030] FIG. 1 illustrates a general process of using a TAL-effector
endonuclease (TALEN). A TALEN pair is depicted; other processes use
a single TALEN. A target site is chosen in a dsDNA. A left and a
right TALEN are made with TAL-effector repeat sequences that
include Repeat Variable Diresidues (RVDs) chosen to match the
targeted site. The RVDs are designed to match their cognate
sequences. An endonuclease, such as Fok1, is attached with a spacer
to the TAL-effector portion. A left TALEN and a right TALEN are
designed in light of the homologous base pairing of dsDNA. The
TALENs are introduced into the cell and specifically bind at the
intended target sites. They are typically targeted to a gene,
although the actual binding site may be at a promoter, intron,
exon, or other site as appropriate to disrupt the gene or change
its sequence for other purposes. The TALENs make a double strand
break in the DNA, which is then repaired by DNA repair machinery in
the cell. When a DNA with substantial homology to DNA around the
site of the break is present, the cellular machinery can use that
DNA as a template to guide the repair process; this process is
homology directed repair and the guide is a HDR template. In the
absence of a template, the cell might repair itself successfully or
create an indel.
[0031] FIG. 2 illustrates a general process of using a Cas9/CRISPR
endonuclease. A target DNA is chosen that is near the protospacer
adjacent motif. A tracrRNA and spacer RNA can be combined into a
"single-guide RNA" molecule that complexes both with Cas9 and a
target sequence, in which it introduces a double stranded
sequence-specific break. Vectors to express Cas9 with a
gRNA-tracrRNA are known and readily available. As with TALENs,
cellular repair machinery might repair the dsDNA break perfectly or
with an indel. If a suitable HDR template is present, the template
can guide the repair and create changes in the native DNA.
[0032] FIG. 3 illustrates a theory of operation for targeted
endonucleases that explains why they are generally ineffective for
making SNP changes; similar processes apply to RNA-guided
endonucleases. A native double stranded DNA (dsDNA) is illustrated
that is being exposed to a TALENs pair and a homology directed
repair (HDR)_template. The TALENs have to bind at the targeted
gene. Then they can cut the native DNA and be released. After being
cut, the native DNA might be imperfectly repaired so that it has an
indel. Even indels of a few bases can be enough to greatly reduce
rebinding of the repaired DNA by the TALENs. Another possibility is
that the repair process will return the cut DNA to its native
sequence. Or there might be a successful HDR-driven change in the
sequence so it is the same as the HDR template. The altered DNA is,
however, subject to being rebound and recut by the TALENs. In fact,
the cut DNA is already uncoiled and available for cutting whereas
native DNA might not be as available. The kinetics of editing
require participation by the HDR template whereas repair of a break
by non homologus end joining (NHEJ) does not. Therefore it is
believed that the kinetics of modification drive the editing
process to unwanted outcomes when SNPs or other small changes to
the native gene are desired.
[0033] FIG. 4 illustrates a general process of making and using
targeting endonucleases that is effective to make an SNP edit. One
strategy that is effective is to design the targeting endonucleases
so that the desired SNPs (or other altered residues) are in the
cognate region of the DNA binding portion of the endonuclease
system. The HDR template guides a change in the SNPs so that the
desired SNPs are mismatches with the RVDs or other DNA-binding
portion.
[0034] Further, changes may optionally be added to the HDR template
to create further mismatches. An embodiment of designing the HDR
sequence to reduce specific binding of the DNA-binding member
comprises placing a mismatch in the HDR template sequence as
aligned with the endogenous chromosomal DNA. The mismatch may
include one or more of: an insertion, a deletion, a substitution,
an insertion of 1-6 residues and/or a deletion of 1-6 residues, a
substitution of 1-60 residues, only one SNP, one or more SNPs;
artisans will immediately appreciate that all values and ranges
within the expressly stated limits are contemplated. In the context
of introgression of a naturally-occurring allele, the mismatches
may be in addition to those that are present in the
naturally-occurring allele.
[0035] FIG. 5 illustrates another general process of making and
using targeting endonucleases that is effective to make an SNP
edit, or to make larger edits. The DNA-binding sequences of one
(and/or both if applicable) of the targeting endonucleases are made
with intentional mismatches with the endogenous DNA. In TALENs, the
RVDs are chosen to be mismatches. In CRISPR/Cas9 the guide sequence
has one or more mismatches. The desired SNPs, referring to the
changes that are the biological goal of the introgression process,
may be inside and/or outside of the DNA-binding domain. Creating a
reduction in binding seemed to be an improbable approach. But, in
fact, experiments showed that driving efficiency down at the
initial binding stage was helpful.
[0036] The embodiments of FIGS. 4 and 5 may be combined. The TALENs
or CRISPR/Cas9 can be designed with a mismatch to reduce binding to
endogenous DNA and/or the HDR template can introduce a mismatch to
reduce specific binding to the targeting endonucleases and/or the
site on the endogenous DNA can be chosen to create a mismatch in
the cognate binding sequences for the DNA-binding domains. In the
context of introgression of a naturally-occurring allele, the
mismatches may be in addition to those that are present in the
naturally-occurring allele. So the method would include selecting
an allele found in nature, making an HDR template that comprises at
least a portion of that allele, and making one or more of the
mismatches in the HDR template and/or in the DNA-binding
domain.
Introgression of POLLED Allele
[0037] To protect the welfare of dairy farm operators and cattle,
horns are routinely manually removed from the majority of dairy
cattle in the U.S., Europe, and in other regions. De-horning is
painful, elicits a temporary elevation in animal stress, adds
expense to animal production and, despite the intent of protecting
animals from subsequent injury, the practice is viewed by some as
inhumane. Some beef breeds are naturally horn-free (e.g., Angus), a
trait referred to as POLLED that is dominant. The techniques set
forth herein improve animal well-being by providing animals that do
not have to undergo dehorning. Two allelic variants conferring
polledness have recently been identified on chromosome 1. Dairy
cows with either of these mutations are rare and generally rank
much lower on the dairy genetic selection indices than their horned
counterparts. Meiotic introgression of the POLLED allele into homed
breeds can be accomplished by traditional crossbreeding, but the
genetic merit of crossbred animals would suffer and require many
lengthy generations of selective breeding to restore to
productivity.
[0038] It is possible, however, to create polledness in animals,
and to do so without disturbing the animals' genome. The
non-meiotic introgression of the Celtic POLLED allele (duplication
of 212 bp that replaces 10 bp) was achieved in fibroblasts derived
from horned dairy bulls. A plasmid HDR template containing a 1594
bp fragment including the Celtic POLLED allele was taken from the
Angus breed (FIG. 6 panel a). TALENs were designed such that they
could cleave the HORNED allele but leave the POLLED allele
unaffected. Surprisingly, this experiment showed that one pair of
TALENs delivered as mRNA had similar activity compared to plasmid
expression cassettes (FIG. 7), Accordingly, experiments were
performed that delivered TALENs as mRNA to eliminate the possible
genomic integration of TALEN expression plasmids. Five of 226
colonies (2%) passed each PCR test shown in FIG. 6 panel b to
confirm introgression of POLLED. Three of the five clones were
homozygous for POLLED introgression and confirmed by sequencing to
be 100% identical to the intended allele. U.S. Ser. No. 14/154,906
filed Jan. 14, 2014, which is hereby incorporated by reference
herein, provides additional information regarding polledness.
Allele Introgression in Pig, Goat and Cattle Genome
[0039] While plasmid templates were effective for introgression of
POLLED and GDF8, the inventors believe that many desirable alleles
correspond to SNPs. A first set of experiments used oligonucleotide
templates that had an overlap in their cognate TALEN-binding sites
and that also introduced a 4 bp indel into the spacer region for
restriction fragment length polymorphism (RFLP) analysis. Primary
fibroblasts were transfected with plasmid- or mRNA-encoded TALENs
plus oligo templates and incubated 3 days at either 30 or
37.degree. C. TALENs delivered as mRNA consistently outperformed
plasmid in cells incubated at 30.degree. C. (FIG. 8A). Despite
appreciable levels of TALEN activity measured by the SURVEYOR
assay, HDR was consistently higher (>2-fold) when TALENs were
delivered as mRNA compared to plasmids. This observation was
surprising, and it was speculated that could have been a result of
favorable kinetics; e.g., TALENs from mRNA were more rapidly
translated allowing utilization of the template prior to oligo
degradation. However, a time-course experiment showed little
difference in the onset of HDR between TALENs encoded by plasmid
versus mRNA (FIG. 8B). Among replicates using TALEN mRNA at
30.degree. C., the levels of cumulative mutation and total HDR were
similar, suggesting the majority of mutant alleles corresponded to
the intended introgression.
[0040] In previous studies, TALEN-induced indels declined 50-90%
after extended culture unless selection processes or markers were
used (Carlson, D. F. et al. Efficient TALEN-mediated gene knockout
in livestock, Proceedings of the National Academy of Sciences,
109:17382-17387 (2012), herein "Carlson 2012"). In other words,
even when indels could be made, they were often not stable and a
selection marker process had to be used to identify stable changes.
In contrast, it was observed herein that HDR levels at four loci
were roughly equivalent when measured at days 3 and 10 without
selective enrichment, indicating that these HDR indel alleles were
stable in culture (FIG. 8A). The consistently high rate (25-50%)
and stability of gene edits at all four loci suggested that edited
cells should be recoverable by dilution cloning without selective
enrichment, reporters or selection markers. Further experimental
work involving analysis of about 1,000 colonies for defined indel
alleles in eight separate loci revealed a recovery rate of 10-65%
(average 42%) where up to 32% of the colonies are homozygous for
the intended edit (Table 1). The data shows that introducing TALENs
as mRNA into the cell is helpful for efficiency and stability;
extended culture times at 30.degree. C. were also helpful.
[0041] The term reporter, as used herein, refers to genes or
transgenes that encode reporters and selection markers. The term
selection marker, as used herein, refers to a genetically expressed
biomolecule that confers a trait that permits isolation by either
positive or negative survival selection criteria. The reporter may
be, e.g., a fluorescent marker, e.g., green fluorescent protein and
yellow fluorescent protein. The reporter may be a selection marker,
e.g., puromycin, ganciclovir, adenosine deaminase (ADA),
aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate
reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase
(TK), or xanthin-guanine phosphoribosyltransferase (XGPRT).
Phenotypic markers are markers based on discernible physical traits
(e.g., epitopes or color), growth rate, and/or viability.
Differential Stability of Gene-Edits
[0042] It was not known if it was possible to have Introgression of
stable SNPs by NHEJ or HDR. As indicated in Table 1, both day-3
levels of HDR (7-18%) and the isolation of cellular clones with the
intended SNP alleles (3-15%) within cattle and swine GDF8 or pig
p65 was significantly lower than for indel alleles, where HDR
ranged from 10 to about 50%. This data suggested a hypothesis that
indels were more stable than SNP because the introduction or
elimination of at least 4 bp in the TALEN spacer region would be
expected to reduce re-cleavage of the locus, consistent with
constraints on TALEN spacer length. And even a 4 bp insertion
allele was more efficient than SNP alleles, based comparison of HDR
frequencies with oligo within the same locus suggested (FIG. 9).
This hypothesis also explained why sequence analysis revealed that
nearly half of the isolated SNP-positive colonies for GDF8 or pig
p65 harbored concomitant indels expected to change TALEN spacing.
Regardless, it was possible to recover colonies with homozygous
conversion of G938A in GDF8 (both pigs and cattle) and T1591C in
pig p65 at up to nearly a 5 percent level without any additional
changes to the locus (Table 1). It was also possible to introgress
small polymorphisms for the sheep FecB and Callipyge loci into the
goat genome. This ability to precisely alter a single nucleotide or
1-3 nucleotides is surprising as well as significant. As a
comparison, it was also possible to design CRISPR gRNAs that
overlapped the T1591C site of p65 and to compare introgression
using the two platforms. Despite efficient production of DSB at the
intended site, CRISPR/Cas9-mediated HDR was lower than 6 percent at
day-3 and below detection at day-10 (FIG. 10). Recovery of modified
clones with CRISPR-mediated HDR was also lower than with TALENs
even though the TALENcleavage site was 35 bp away from the SNP site
(Table 1). Analysis of CRISPR/Cas9 induced targeting at a second
locus, ssAPC14.2, was much more efficient, but still did not reach
the level of HDR induced by TALENs at this site, circa 30 versus
60% (FIG. 11).
Strategies for Introgression of Alleles and for Stabilizing
Introgressed SNP Alleles
[0043] Given the conservation of the 5'-thymidine nucleotide
immediately preceding TAL-binding sites, it was reasoned that
altering these bases in the oligo HDR template (referred to as
blocking mutations (BM)) would inhibit re-cleavage of edited
alleles. Surprisingly, the BMs had no significant impact on the
maintenance of SNP alleles at the pig LDLR or GDF8 loci (FIG. 12
panel a). This suggested that either the conversion tract for
oligo-templated HDR is quite short and does not incorporate the BM,
or that altering the 5'-thymidine does not completely abolish TALEN
activity.
[0044] ILLUMINA deep sequencing was conducted for 200-250 bp
amplicons flanking the target sites from populations of cells
transfected with oligos and TALEN mRNA. The results from five loci
in pigs and cattle showed that insertion alleles were in general
more prevalent and stable in the population (FIG. 13). Whereas BMs
had little influence on the preservation of intended alleles in
culture, there was a slight bias towards incorporation of BMs in
SNP edited alleles versus insertional edits (FIG. 14). with our
colony analysis, reads sorted on the basis of incorporating the
intended SNP (iSNP), G938A or T1591C conversion in btGDF8 and p65,
revealed that nearly half of reads with the iSNP had an additional
mutation (iSNP+Mut) (FIG. 13 panel b), the majority of which were
indels (FIG. 14). The majority of iSNP btGDF8 reads with indels in
the spacer also contained one or both BM (data not shown)
demonstrating that modification of the conserved 5'-thymidine was
not able to suppress re-cleavage and subsequent indel generation.
Thus, this base must be less critical to TALEN-binding than
suggested by conservation, and provides a molecular basis for the
inability of BMs to preserve alleles as described above.
[0045] Another strategy to reduce re-cutting of the SNP edits is to
design TALENs such that their binding sites overlap the target
SNPs. The influence of RVD/nucleotide mismatches within the
TALEN-binding site for introgression of G938A SNP into cattle GDF8
was evaluated. Two pairs of TALENs were generated, one that bound
the wildtype "G" allele (btGDF83.6-G) and another that bound the
intended "A" allele (btGDF83.6-A) (FIG. 12 panel b). HDR with each
TALEN pair was similar at day-3 whereas levels measured at day-12
were significantly higher using the TALENs that bound the wildtype
"G" allele, indicating that recleavage was more prevalent with
btGDF83.6-A which targets the repaired allele perfectly. Different
RVD/nucleotide mismatches may have greater influence on maintenance
of HDR alleles since the NN-RVD used for the wildtype "G" TALENs is
able to bind both G and A nucleotides. For modification of porcine
EIF4GI, it was found that three RVD/nucleotide mismatches were
sufficient for protection of the HDR-edit as nearly 70% of isolated
colonies contained an edited allele, greater than half of those
being homozygotes (Table 1 and FIG. 15). Thus, the intentional
alteration of the target locus to resist recleavage is an effective
strategy for preserving edits.
[0046] It was hypothesized that gene-editing is a dynamic process.
TALEN cleavage and re-cleavage are theorized to be in flux with
repair by NHEJ, HDR with oligo template, and HDR with the sister
chromatid as template. It was hypothesized that the observed loss
of SNP alleles might be reduced by extending the hypothermic
treatment, slowing cell proliferation long enough to outlast the
burst of TALEN activity from TALEN mRNA transfection. Indeed, and
surprisingly, this extension almost tripled the level of SNP
HDR-edited alleles recovered after extended culture (FIG. 16).
[0047] For biomedical applications, alterations of bases besides
the key bases that create the desired functionality is acceptable
so long as the desired phenotype is achieved and the other changes
are apparently without functional relevance. The inventors believe,
however, that it is desirable for animals used in agriculture, to
duplicate natural (native) alleles without further changes or to
make only the intended edits without further changes. In contrast
to the approaches where the mismatches are derived from successful
introgression of the HDR construct, mismatches can be derived from
changes in the RVD sequence. For TALENs, this process requires the
TALEN monomers to be constructed with RVDs that do not bind to
their corresponding nucleotides in the native alleles (FIG. 17
panel c). This concept of an intentional mismatch in the design of
the nuclease (in this case TALENs) to prevent re-cutting of a
desired is novel and operates under the following theory. TALENs
can only tolerate some mismatches in their binding regions before
their binding activity is essentially eliminated. Thus, it is
possible to develop TALENs that have intentional mismatches with
the native allele that will still cut, but as more mismatches are
created, binding will be abolished. The theory of intentional
mismatch is that after introgression of the desired allele, the new
mismatch will have an additive effect to the engineered mismatches
in the TALEN code to pass a critical tipping point to render the
TALEN inactive. Counterintuitively, decreasing nuclease affinity
for a target by intentional mismatching of RVDs provides a strategy
to introgress a specific mutation down to a single nucleotide
polymorphism (SNP), and reduce to undesired indels as a result of
re-cutting.
[0048] As an example, a TALEN pair (caCLPG 1.1) was designed with
zero mismatches to target the CLPG locus in the goat (Capra
aegagrus hircus) genome (FIG. 17 panel a). The desired mutation was
an adenine to guanine SNP, which has been linked to an increase in
hindquarter muscle hypertrophy. The SNP allowed easy genotyping of
colonies due to a loss of an AvaII restriction site. Initial
restriction digest assays showed several colonies with promising
results, however when the alleles of each colony were sequenced,
zero of fourteen were our intended product as each contained an
undesired indel in addition to the desired SNP (FIG. 17 panel b and
Table 2 labeled Success rate using intentional mismatches). To test
the intentional mismatch approach, an additional three TALEN pairs
were developed with different numbers and locations of intentional
mismatches (FIG. 17 panel c). These TALENs were able to cut the
wild-type allele at similar frequencies to the original caCLPG1.1
TALEN pair (FIG. 17 panel d). To observe the effect on HDR and
reducing of undesired indels, individual colonies were derived from
cells transfected with caCLPG 1.1c (two mismatches) and the HDR
template. In contrast to the results with the original caCLPG1.1
TALENs, three of fifteen (20%) of AvaII resistant colonies were
positive for the desired SNP and contained no additional mutations
(3/15=20%) (FIG. 17 panel e and Table 2). Thus, derivation of the
intended allele was dependent on intentional mismatch.
[0049] In a further example, the intention was to alter
specifically two bases in the bovine DGAT gene. As with the CLPG
locus, attempts to introgress the desired mutation without
intentional mismatch failed as 0/12 RFLP colonies that were
positive for the HindIII site were free of indels (FIG. 18 panel d
and Table 2). The intentional mismatch method was used, and found
overall rates of HDR on the population level (FIG. 18 panel c).
Sequencing from individual colonies however revealed that two of
three of the intentional mismatch designs were successful, giving
rise to 2/12 and 3/12 correct alleles for 14.5 and 14.6
respectively (FIG. 18 panel e and Table 2). As with the CLPG locus,
derivation of the intended allele was dependent on RVD-encoded
intentional mismatch. The data in Table 1 demonstrated that
combining mRNAs encoding TALENS plus oligonucleotides as templates
for directing HDR achieved several benchmarks for a genome-editing
strategy: 1) only target nucleotides were changed and mRNA
transfection avoided unintended integration of plasmid DNA, 2) gene
edits were efficient; from about 10% for SNPs to above 50% for some
larger alterations, and 3) the method was reliable; targeted
alteration of 16/16 sites (15 genes) was achieved. The efficiency
and precision reported here is very surprising.
[0050] Two concerns in gene editing are stabilizing the changes at
the targeted site and avoiding modification of unintended sites.
With regard to the first, evidence was found that HDR-edits
directing single basepair changes, i.e., SNPs, could be lost (FIG.
12 and FIG. 13 panel b). Based on the prediction that a thymidine
preceding the targeted DNA sequence influences TAL binding, it was
attempted to block re-cleavage of introgressed alleles by
introducing BMs. However, it was found that BMs did not prevent
TALEN activity and re-cleavage of edited alleles (FIG. 12 and FIGS.
14 and 15). In contrast, introduction of multiple SNPs or
additional sequence (FIG. 8A and FIG. 15) resulted in more stable
HDR226 edits. Surprisingly, it was found that extension of
hypothermic culture resulted in the stabilization of introgressed
SNP alleles. It is theorized that hypothermia slows cell
proliferation primarily by prolonging G1-phase of the cell cycle so
that this treatment differentially favors oligo-HDR versus sister
chromatid templated repair in a cell-cycle dependent manner.
Regardless of the mechanism, this approach offers a
straight-forward strategy for recovering cells with precise
introgression of SNP alleles.
[0051] A variety of objectives were achieved by precise gene
editing (Table 1). Knockout of genes of biomedical relevance was
accomplished by interrupting coding sequences with 4 bp indels.
This strategy was reliable and generally resulted in HDR-edits in
about 40% of the clones (range 26-60%), and of those, up to
one-third were homozygotes. At similar frequencies, a modified loxP
(mloxP) site was integrated into ROSA26 and SRY loci in cattle and
pigs that can be used as a landing pad (also referred to as a safe
harbour) for insertion of novel sequences in livestock via
recombinase-mediated cassette exchange. Previously, only NHEJ edits
had been demonstrated for the Y chromosome of livestock, however,
TALENs are suitable for direct stimulation of knockout/knock-in, at
least as demonstrated in mice. Also, there was an introgression of
native alleles between species/breeds, including the
double-muscling mutations of GDF8 (SNP G938A23, 25 or 821del1123-25
from Piedmontese and Belgian Blue cattle respectively) into the
genome of Wagyu cattle and Landrace pigs.
[0052] In some cases gene targeting with a standard plasmid vector
and homologous recombination cassette will not be suitable for
transgene delivery. Some cases could include when attempting to
place a transgene in a site surrounded by repetitive elements or
low complexity DNA. In these cases, the short homology required by
oligo HDR may be preferred to integrate a transgene into a small
region of unique sequence. However, the cargo capacity for oligo
HDR is not sufficient to deliver a transgene. To circumvent this
problem, we sought to combine the efficiency of oligo HDR for
delivery of small insertions (e.g., LoxP sites) and the large cargo
capacity of recombinase mediated cassette exchange (RMCE) for site
specific integration of transgenes. Recombinase-mediated cassette
exchange (RMCE) is a method based on the features of site-specific
recombination processes (SSRs). This process allows for systematic,
repeated modification of higher eukaryotic genomes by targeted
integration. This result is achieved with RMCE by the clean
exchange of a preexisting gene cassette for an analogous cassette
carrying the gene of interest (GOI).
[0053] There is are problems with using RMCE to make genetically
modified animals in the higher vertebrates, such as livestock. A
significant problem is that due to the short lifespan of primary
livestock cells prior to senescence, this process must occur in a
single treatment. It would be possible in some other types of cells
to perform the RMCE process serially wherein a cellular clone with
the inserted LoxP site is isolated prior to transfection with the
RCME machinery and isolation of clones to identify those with the
correct targeting event. Applicants attempted to perform this
process by simultaneously transfecting primary fibroblasts with
four components: 1) SRY TALENs 2) an oligo with homology to SRY
that includes two RMCE compatible loxP sites 3) a RMCE compatible
transgene and 4) a source of Cre recombinase. In FIG. 19, the RMCE
transgene was the puromycin resistance gene enabling selection for
integration events. The number of puromycin resistant colonies was
significantly increased when YFC-Cre was provided in contrast to
the control group that included a mCherry expression cassette in
place of YFC-Cre. Among puromycin resistant colonies (selected from
cells treated for 3 days at either 30.degree. C. or 37.degree. C.)
eight (n=95) and four percent (n=95) were positive for correct
targeting of the RMCE vector. These results showed that it was
possible to simultaneously provide the TALENS, HDR template
containing loxP site, a transgene of interest flanked by loxP, and
a Cre-recombinase mRNA resulting in RMCE mediated recombination
into a TALEN targeted locus.
[0054] Embodiments of the invention include a process of homology
dependent repair using an HDR template with a sequence that is
introduced into the host cell or embryo that is a landing pad,
e.g., for exogenous genes. The term landing pad is used according
to its customary meaning to refer to a site-specific recognition
sequence or a site-specific recombination site that is stably
integrated into the genome of a host cell. Presence in the host
genome of the heterologous site-specific recombination sequence
allows a recombinase to mediate site-specific insertion of a
heterologous polynucleotide or an exogenous into the host
genome.
[0055] Embodiments include, kits, uses, compositions, and a method
of creating a landing pad in a chromosomal DNA of a cell,
comprising introducing a targeted nuclease system and a HDR
template into the cell, with the targeted nuclease system
comprising a DNA-binding member for specifically binding an
endogenous cognate sequence in the chromosomal DNA, wherein the
targeted nuclease system and the HDR template operate to alter the
chromosomal DNA to have identity to the HDR template sequence,
wherein the HDR template sequence comprises a landing pad. The
method may be applied in a primary cell or embryo. Embodiments
include introducing the targeting nuclease, the HDR template
encoding the landing pad, the exogenous gene that is compatible
with the landing pad, and a source of recombinase compatible with
the same; all of these may be introduced simultaneously. The term
simultaneous is in contrast to a hypothetical process of treating
cells multiple times in seriatim; the term must be kept in context,
with an appreciation that it refers to a literally simultaneous
introduction or an introduction calculated to having all of the
factors bioactive at the same time. The landing site may be, e.g.,
RMCE compatible loxP sites, FRT, rox, VloxP, SloxP. The recombinase
may be, e.g., Cre, FLP, Dre.
[0056] In other experiments, for improvement of animal welfare, the
POLLED allele was transferred from a beef producing breed into
cells from horned dairy cattle. A candidate SNP allele for African
swine fever virus resilience (T1591C of p6539) was transferred from
warthog to the genome of conventional swine cells and introgressed
sheep SNPs responsible for elevated fecundity (FecB; BMPR-IB) and
parent-of-origin dependent muscle hypertrophy (Callipyge) into the
goat genome. Such introgression was previously impossible by
breeding and will enable the assessment of defined genetic effects
in related species. Non-meiotic allele introgression has not
conventionally been possible without selective enrichment, and
efficiencies reported herein are 10.sup.3-10.sup.4-fold higher than
results previously obtained WITH selection. Such high levels of
unselected single-allele introgression suggests it will be feasible
to alter multiple alleles in a single generation of farm animals,
decreasing the impact of long generation intervals on genetic
improvement. Furthermore, efficient editing to homozygosity will
greatly increase the rate of introgression per breeding
interval.
[0057] As further elaboration of inventions described here
customized endonucleases were used to generate live animals with
precise edits at two independent loci. Pigs edited to disrupt the
DAZL gene are useful as a model for studying the restoration of
human fertility by germ cell transplantation, or for the production
of genetically modified offspring by transfer of genetically
modified germline stem cells as demonstrated in pigs, goats, and
rodents. Gene edited alleles of APC provide a size-relevant model
of colon cancer for pre-clinical evaluation of therapeutics,
surgical intervention or detection modalities. These results
demonstrate an introduction of genetic modifications, including
polymorphisms, and including modifications that mimic natural
polymorphisms into livestock. Gene-editing technology is useful to
accelerate genetic improvement of agricultural products by intra-
and interspecific allele introgression to help meet the growing
global demand for animal protein. It also is useful for the
development of large animals with defined genetics for drug and
device testing, or for the development of therapeutic cells and
organs. Other uses include making cells that can be used in vitro
for research to understand the mechanisms of congenital and
infectious disease, and to improve the methods for gene editing and
control.
Gene Editing to Avoid Re-Binding by Nuclease Systems
[0058] Experimental results suggested that targeted (endo)nuclease
systems were effectively cutting dsDNA at the intended cognate
sites. Analysis of the data suggested that the nucleases would bind
to sites that had already been templated and re-cleave the site,
causing a reversion of the dsDNA to its original sequence. Targeted
nuclease systems include a motif that binds to the cognate DNA,
either by protein-to-DNA binding, or by nucleic acid-to-DNA
binding. Experiments demonstrated that templates that contain
polymorphisms can be selected to confound the re-binding or
re-cutting by the targeted nuclease, thereby increasing
significantly the number of precisely introgressed cellular
clones.
[0059] Embodiments for reducing re-binding include a method of
homology-directed repair (HDR) to introgress an exogenous allele
into chromosomal DNA of a cell, comprising introducing a targeted
nuclease system and a HDR template that comprises the exogenous
allele into the cell, with the targeted nuclease system comprising
a DNA-binding member for specifically binding an endogenous cognate
sequence in the chromosomal DNA, wherein the targeted nuclease
system and the HDR template operate to alter the chromosomal DNA to
have identity to the HDR template sequence and to introgress the
exogenous allele into the chromosomal DNA in place of an endogenous
allele. In one embodiment the HDR template sequence is designed to
introduce a polymorphism intended to reduce the specific binding of
the DNA-binding member to genomic sequence once introgressed.
Alternatively, the DNA-binding member of the targeted nuclease can
be designed to recognize nucleotide sequences that aren't present
in endogenous or exogenous sequence. Whereas the level of this
hobbled DNA-binding member is sufficient to enable cleavage of the
endogenous allele, the intended polymorphisms from the HDR template
further alter the target site and decreases re-cleavage of
precisely introgressed alleles. This results in a higher frequency
of cellular clones within a population that contain those precise
introgression events.
[0060] The term allele means one of two or more forms of a gene. A
population or species of organisms typically includes multiple
alleles at each locus among various individuals. Allelic variation
at a locus is measurable as the number of alleles (polymorphisms)
present, or the proportion of heterozygotes in the population. The
term natural allele as used herein means an allele found in nature
in the same species of organism that is being modified. The term
novel allele means a non-natural allele. A human allele placed into
a goat is a novel allele. The term synthetic allele means an allele
that has not yet been found in nature. An exogenous allele is one
that is introduced into an organism, and the endogenous allele is
the one that is already in the cell, usually the one that is in the
organism in its wild-type unmodified state. Animals that are
heterozygous have two alleles. In some cases, it is desirable to
introduce an exogenous allele to make an animal homozygous for an
allele that is already present in the heterozygous animal. Movement
of an allele interspecies means from one species of animal to
another and intraspecies means movement between animals of the same
species. The term exogenous allele is broad and includes DNA with,
e.g., native, novel or synthetic SNPs or indels, reporters,
endonuclease digestion sites, promoters, and vectors.
[0061] Homology directed repair (HDR) is a mechanism in cells to
repair ssDNA and double stranded DNA (dsDNA) lesions. This repair
mechanism can be used by the cell when there is an HDR template
present that has a sequence with significant homology to the lesion
site. Specific binding, as that term is commonly used in the
biological arts, refers to a molecule that binds to a target with a
relatively high affinity compared to non-target sequences, and
generally involves a plurality of non-covalent interactions, such
as electrostatic interactions, van der Waals interactions, hydrogen
bonding, and the like. Specific binding involves processes of
binding to a substrate and releasing from a substrate; as such it
can be affected by changes in the efficiency of binding and release
from a substrate as well as by a strength of the binding to the
substrate. Accordingly, a reduction in specific binding may result
from a lesser affinity to a substrate that reduces the number of
binding events, or it may result from a reduced strength of binding
to the substrate that reduces how long the binding is maintained.
In the context of targeted endonucleases, without being bound to a
particular theory, a change in specific binding of the endonuclease
or guide sequence to the DNA can affect not only that actual
binding but also be involved in an incompletely understood process
of forming complexes with targeted and/or template DNA or RNA.
Therefore specific binding can be measured relative to the actual
DNA-binding events and is a useful feature for manipulating those
processes, even if the actual events at the chromosomal level
involve more or less than actual DNA-binding. Specific
hybridization is a form of specific binding between nucleic acids
that have complementary sequences. Proteins can also specifically
bind to DNA, for instance, in TALENs or CRISPR/Cas9 systems or by
Gal4 motifs. Introgression of an allele refers to a process of
copying an exogenous allele over an endogenous allele with a
template-guided process. The endogenous allele might actually be
excised and replaced by an exogenous nucleic acid allele in some
situations but present theory is that the process is a copying
mechanism. Since alleles are gene pairs, there is significant
homology between them. The allele might be a gene that encodes a
protein, or it could have other functions such as encoding a
bioactive RNA chain or providing a site for receiving a regulatory
protein or RNA.
[0062] The HDR template is a nucleic acid that comprises the allele
that is being introgressed. The template may be a dsDNA or a
single-stranded DNA (ssDNA). ssDNA templates are preferably from
about 20 to about 5000 residues although other lengths can be used.
Artisans will immediately appreciate that all ranges and values
within the explicitly stated range are contemplated; e.g., from 500
to 1500 residues, from 20 to 100 residues, and so forth. The
template may further comprise flanking sequences that provide
homology to DNA adjacent to the endogenous allele. The template may
also comprise a sequence that is bound to a targeted nuclease
system, and is thus the cognate binding site for the system's
DNA-binding member. The term cognate refers to two biomolecules
that typically interact, for example, a receptor and its ligand. In
the context of HDR processes, one of the biomolecules may be
designed with a sequence to bind with an intended, i.e., cognate,
DNA site or protein site.
[0063] One embodiment for reducing specific binding to a targeted
nuclease system comprises making changes in the HDR template
relative to its alignment with the endogenous DNA. One type of
change is designed to create mismatches between the cognate
members. One change is an insertion or a deletion of one or more
residues. Another change is a substitution of one residue for
another residue that does not promote binding. The term residue
refers to a unit in a molecular chain, e.g., an amino acid in a
protein or a base in a nucleic acid. One place to make the change
is at the cognate binding site for the system's DNA-binding
member.
[0064] Another type of change is designed to interfere with
operation of the nucleases by making the change is in the spacer in
systems that operate with a spacer, e.g., TALENs pairs, the change
may be made in the spacer area. These changes are may include a
deletion, e.g., so that the nucleases are hindered from making
cuts. These various changes are generally referred to as mismatches
herein since they create mismatches when the sequences are aligned;
in this context, a deletion, insertion, or substitution is a
mismatch. Artisans routinely make alignments of sequences so that
mismatches are readily identified with specificity. Pairs of
nucleases require a spacing that provides a cooperativity; their
activity can be disrupted by additions or subtractions to the
spacer.
[0065] Further embodiments place a mismatch in the exogenous
allele. The system's DNA-binding member is designed to bind at a
site that at least partially overlaps with the endogenous allele.
Once it is introgressed to have identity with the exogenous allele,
the DNA-binding member has reduced binding. The DNA-binding
member's cognate site thus changes from a preferred endogenous
allele to a not-preferred exogenous allele. The cognate site may
encompass all of the allele, or just a part of it. It is surprising
that the introduction of a mismatch into the exogenous allele is
required to stabilize the introgression of the exogenous allele.
Apparently the problem of re-cleavage has a very large impact on
stability of introgressed alleles. The data that shows this impact
was not previously obtained by others because processes with a
comparable efficiency were not conventionally available.
[0066] Embodiments include creating, with an HDR templating
process, mismatches at these various places by insertion, deletion,
or substitution of a residue. For instance, from 1-60 residues may
be inserted, deleted, or substituted; artisans will immediately
appreciate that all ranges and values within the explicitly stated
range are contemplated; e.g., 1-3 residues, at least 10 residues, 4
residues, 4-20 residues, and so forth. One or more of these may be
combined, e.g., an insertion at one place, a deletion at another,
and a substitution at other places.
[0067] Embodiments include designing the DNA-binding member of the
targeting endonuclease to place a mismatch in the DNA-binding
member sequence as aligned with the endogenous chromosomal DNA. The
mismatch would typically also be a mismatch for the exogenous DNA.
These mismatches reduce targeted nuclease rebinding. Further
mismatches may be used in combination with this method as already
described, e.g., with the DNA-binding sites of the endonucleases
chosen at positions wherein introgression of the exogenous allele;
the HDR template having mismatches at the DNA-binding cognates; or
in the spacer region to change the spacing.
[0068] These various embodiments can be performed in a
reporter-free system and to make an SNP or an embodiment relating
to an SNP. The cells or animals may be, e.g., vertebrate,
livestock, primate, swine, cow, horse, sheep, goat, chicken,
rabbit, fish, dog, mouse, cat, rat, and laboratory animal.
SNPs
[0069] These experimental results provide a process for placing
single nucleotide polymorphisms (SNPs) into chromosomal DNA. The
SNPs can be placed at a predetermined position. This control over
placement is without precedent. For instance an SNP can be placed
into an endogenous allele without other SNPs or modifications at
other locations. Moreover, and crucially, an endogenous allele can
be replaced with an exogenous allele that differs by only one SNP.
And the replacements are made with minimal alterations to
chromosomal DNA at any location in genome of the cell. One or more
SNPs may be introgressed.
[0070] An embodiment is a method of creating a single nucleotide
polymorphism (SNP) in a chromosomal DNA of a cell, comprising
introducing a targeted nuclease system and a HDR template into the
cell, with the targeted nuclease system comprising a DNA-binding
member for specifically binding an endogenous cognate sequence in
the chromosomal DNA, wherein the targeted nuclease system and the
HDR template operate to alter the chromosomal DNA to have identity
to the HDR template sequence, wherein the HDR template sequence
comprises a SNP. The HDR template may have a plurality of SNPs or
only one. Other changes may be present, e.g., insertions,
deletions, or substitutions. Or the changes may be limited to a
single SNP, or one or a plurality of SNPs introgressed into the
endogenous allele. The HDR template sequence may comprise an
exogenous allele that replaces an endogenous allele, with the
exogenous allele comprising an SNP in a sequence alignment with the
endogenous allele.
[0071] Further embodiments include placing an SNP into a cognate
site for a DNA-binding member of a targeted nuclease system. The
SNP may be chosen to reduce binding to the DNA-binding member. One
SNP may be thusly placed, or a plurality. Further changes, SNPs, or
others, may be present in the allele, or not. The chromosomal DNA
may be free of all other changes.
[0072] Embodiments include a genetically modified animal, the
animal belonging to a breed of animals having an endogenous allele,
the animal comprising a genetic change at an SNP to change the
chromosomal DNA of the animal from the endogenous allele to an
exogenous allele found in another species or another breed of
animal. The animal may comprise one or more of: a plurality of SNPs
to change the chromosomal DNA of the animal from the endogenous
allele to an exogenous allele found in another species or another
breed of animal; further being free or reporters; being homozygous
for the polymorphism, SNP or SNPs; being a livestock, primate,
swine, cow, horse, sheep, goat, avian, chicken, rabbit, fish, dog,
mouse, cat, rat, and laboratory animal.
[0073] These various embodiments can be performed in a
reporter-free system and to make an SNP or an embodiment relating
to an SNP. The cells or animals may be, e.g., livestock, primate,
swine, cow, horse, sheep, goat, avian, chicken, rabbit, fish, dog,
mouse, cat, rat, and laboratory animal.
Targeted Nuclease Systems
[0074] Genome editing tools such as transcription activator-like
effector nucleases (TALENs) and zinc finger nucleases (ZFNs) have
impacted the fields of biotechnology, gene therapy and functional
genomic studies in many organisms. More recently, RNA-guided
endonucleases (RGENs) are directed to their target sites by a
complementary RNA molecule. The Cas9/CRISPR system is a RGEN.
tracrRNA is another such tool. These are examples of targeted
nuclease systems: these system have a DNA-binding member that
localizes the nuclease to a target site. The site is then cut by
the nuclease. TALENs and ZFNs have the nuclease fused to the
DNA-binding member. Cas9/CRISPR are cognates that find each other
on the target DNA. The DNA-binding member has a cognate sequence in
the chromosomal DNA. The DNA-binding member is typically designed
in light of the intended cognate sequence so as to obtain a
nucleolytic action at nor near an intended site. Certain
embodiments are applicable to all such systems without limitation;
including, embodiments that minimize nuclease re-cleavage,
embodiments for making SNPs with precision at an intended residue,
and placement of the allele that is being introgressed at the
DNA-binding site.
TALENs
[0075] The term TALEN, as used herein, is broad and includes a
monomeric TALEN that can cleave double stranded DNA without
assistance from another TALEN, e.g., as in Beurdeley, M. et al.
Compact designer TALENs for efficient genome engineering. Nat.
Commun. 4:1762 doi: 10.1038/ncomms2782 (2013). The term TALEN is
also used to refer to one or both members of a pair of TALENs that
are engineered to work together to cleave DNA at the same site.
TALENs that work together may be referred to as a left-TALEN and a
right-TALEN, which references the handedness of DNA or a
TALEN-pair.
[0076] The cipher for TALs has been reported (PCT Publication WO
2011/072246) wherein each DNA binding repeat is responsible for
recognizing one base pair in the target DNA sequence. The residues
may be assembled to target a DNA sequence. In brief, a target site
for binding of a TALEN is determined and a fusion molecule
comprising a nuclease and a series of RVDs that recognize the
target site is created. Upon binding, the nuclease cleaves the DNA
so that cellular repair machinery can operate to make a genetic
modification at the cut ends. The term TALEN means a protein
comprising a Transcription Activator-like (TAL) effector binding
domain and a nuclease domain and includes monomeric TALENs that are
functional per se as well as others that require dimerization with
another monomeric TALEN. The dimerization can result in a
homodimeric TALEN when both monomeric TALEN are identical or can
result in a heterodimeric TALEN when monomeric TALEN are
different.
[0077] In some embodiments, a monomeric TALEN can be used. TALEN
typically function as dimers across a bipartite recognition site
with a spacer, such that two TAL effector domains are each fused to
a catalytic domain of the FokI restriction enzyme, the
DNA-recognition sites for each resulting TALEN are separated by a
spacer sequence, and binding of each TALEN monomer to the
recognition site allows FokI to dimerize and create a double-strand
break within the spacer. Monomeric TALENs also can be constructed,
however, such that single TAL effectors are fused to a nuclease
that does not require dimerization to function. One such nuclease,
for example, is a single-chain variant of FokI in which the two
monomers are expressed as a single polypeptide. Other naturally
occurring or engineered monomeric nucleases also can serve this
role. The DNA recognition domain used for a monomeric TALEN can be
derived from a naturally occurring TAL effector. Alternatively, the
DNA recognition domain can be engineered to recognize a specific
DNA target. Engineered single-chain TALENs may be easier to
construct and deploy, as they require only one engineered DNA
recognition domain. A dimeric DNA sequence-specific nuclease can be
generated using two different DNA binding domains (e.g., one TAL
effector binding domain and one binding domain from another type of
molecule). TALENs may function as dimers across a bipartite
recognition site with a spacer. This nuclease architecture also can
be used for target-specific nucleases generated from, for example,
one TALEN monomer and one zinc finger nuclease monomer. In such
cases, the DNA recognition sites for the TALEN and zinc finger
nuclease monomers can be separated by a spacer of appropriate
length. Binding of the two monomers can allow FokI to dimerize and
create a double-strand break within the spacer sequence. DNA
binding domains other than zinc fingers, such as homeodomains, myb
repeats or leucine zippers, also can be fused to FokI and serve as
a partner with a TALEN monomer to create a functional nuclease.
[0078] The term nuclease includes exonucleases and endonucleases.
The term endonuclease refers to any wild-type or variant enzyme
capable of catalyzing the hydrolysis (cleavage) of bonds between
nucleic acids within a DNA or RNA molecule, preferably a DNA
molecule. Non-limiting examples of endonucleases include type II
restriction endonucleases such as FokI, HhaI, HindIII, NotI, BbvCI,
EcoRI, BglII, and AlwI. Endonucleases comprise also rare-cutting
endonucleases when having typically a polynucleotide recognition
site of about 12-45 basepairs (bp) in length, more preferably of
14-45 bp. Rare-cutting endonucleases induce DNA double-strand
breaks (DSBs) at a defined locus. Rare-cutting endonucleases can
for example be a homing endonuclease, a chimeric Zinc-Finger
nuclease (ZFN) resulting from the fusion of engineered zinc-finger
domains with the catalytic domain of a restriction enzyme such as
FokI or a chemical endonuclease. In chemical endonucleases, a
chemical or peptidic cleaver is conjugated either to a polymer of
nucleic acids or to another DNA recognizing a specific target
sequence, thereby targeting the cleavage activity to a specific
sequence. Chemical endonucleases also encompass synthetic nucleases
like conjugates of orthophenanthroline, a DNA cleaving molecule,
and triplex-forming oligonucleotides (TFOs), known to bind specific
DNA sequences. Such chemical endonucleases are comprised in the
term "endonuclease" according to the present invention. Examples of
such endonuclease include I-See I, I-Chu L I-Cre I, I-Csm I, PI-See
L PI-Tti L PI-Mtu I, I-Ceu I, I-See IL 1-See III, HO, PI-Civ I,
PI-Ctr L PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra L PI-Mav L PI-Meh I,
PI-Mfu L PI-Mfl I, PI-Mga L PI-Mgo I, PI-Min L PI-Mka L PI-Mle I,
PI-Mma I, PI-30 Msh L PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I,
PI-Npu I, PI-Pfu L PI-Rma I, PI-Spb I, PI-Ssp L PI-Fae L PI-Mja I,
PI-Pho L PI-Tag L PI-Thy I, PI-Tko I, PI-Tsp I, I-MsoI.
Extended Hypothermia for Template-Directed Repair
[0079] Experiments surprisingly showed that an extended period of
hypothermic culture could enhance the efficiency of templating
processes. Hypothermic cell cultures are known to be useful for up
to about three days to introduce double-stranded DNA breaks.
Conventional theories for this effect revolve around the idea that
the active enzymes are being diluted or the DNA is stabilized by
inhibiting division.
[0080] The data herein, however, are not consistent with these
other theories. Instead, it is believed that hypothermia minimizes
re-repair of altered chromosomes as guided by the sister chromatid.
In other words, even if there is successful integration, the cell
may use the sister chromatid at the altered site to undo the
changed allele. Moreover, these data are the first to show that
hypothermia could be used to impact templating processes. A
surprising aspect of the experiments was that the extended
hypothermic culture did not improve the efficiency of copying the
template into the cellular DNA. What it improved was the stability
of the exogenous allele after it had been copied. In fact, this
process almost tripled the level of SNP HDR-edited alleles. The
theories of operation for this phenomenon are discussed, above.
[0081] An embodiment is a hypothermic method of template-directed
repair to change a chromosomal DNA of a cell, comprising
introducing into a living cell a targeted nuclease system and a
nucleic acid template, wherein the targeted nuclease system and the
template operate to alter the chromosomal DNA to have identity to
the template sequence wherein the living cell is maintained at a
hypothermic culturing temperature below a physiological temperature
for a time period. The length of the culture can be varied as
appropriate, e.g., more than 3 days to 31 days or 72 to 800 hours;
artisans will immediately appreciate that all ranges and values
within the explicitly stated range are contemplated; e.g., 80 to
600 hours, 4 days to 15 days, 3.1 days to two weeks, and so forth.
Extended culture times at about 20.degree. C. have been successful
(data not shown). The hypothermic culture temperature ranges from
20 to 34.degree. C.; artisans will immediately appreciate that all
ranges and values within the explicitly stated range are
contemplated; e.g., 21 to 30.degree. C. Moreover embodiments
include maintaining the culture at a specific temperature within
the range as well as allowing the culture temperature to change
while remaining within the range. The term "kept within a range" in
this context includes both these embodiments. Embodiments include
culturing to provide a stability of an allele introduced into a
cell; for example, with the stability being for more than 5 cell
divisions, or at least 3 cell divisions, or a value between 3 and
10 cell divisions; artisans will immediately appreciate that all
ranges and values within the explicitly stated range are
contemplated.
Production of Biomedical Model Animals with Gene-Edited Alleles
[0082] Two gene-edited loci in the porcine genome were selected to
carry through to live animals--APC and DAZL. Mutations in the
adenomatous polyposis coli (APC) gene are not only responsible for
familial adenomatous polyposis (FAP), but also play a rate-limiting
role in a majority of sporadic colorectal cancers. Dazl (deleted in
azoospermia-like) is an RNA binding protein that is important for
germ cell differentiation in vertebrates. The DAZL gene is
connected to fertility, and is useful for infertility models as
well as spermatogenesis arrest. Colonies with HDR-edited alleles of
DAZL or APC for were pooled for cloning by chromatin transfer. Each
pool yielded two pregnancies from three transfers, of which one
pregnancy each was carried to term. A total of eight piglets were
born from DAZL modified cells, each of which reflected genotypes of
the chosen colonies consistent with either the HDR allele or
deletions resulting from NHEJ. Three of the DAZL piglets were
stillborn. Of the six piglets from APC modified cells, one was
stillborn, three died within one week, and another died after 3
weeks, all for unknown reasons likely related to cloning. All six
APC piglets were heterozygous for the intended HDR-edited allele
and all but one either had an in-frame insertion or deletion of 3
bp on the second allele. Remaining animals are being raised for
phenotypic analyses of spermatogenesis arrest (DAZL-/- founders) or
development of colon cancer (APC+/- founders).
[0083] Template-driven introgression methods are detailed herein.
Embodiments of the invention include template-driven introgression,
e.g., by HDR templates, to place an APC or a DAZL allele into a
non-human animal, or a cell of any species.
[0084] This method, and methods generally herein, refer to cells
and animals. These may be chosen from the group consisting of
vertebrate, livestock, an artiodactyl, a primate, cattle, a swine,
a sheep, a goat, a bird, a chicken, a rabbit, fish, dog, mice, rat,
cat or laboratory animal. The term livestock means domesticated
animals that are raised as commodities for food or biological
material. The term artiodactyl means a hoofed mammal of the order
Artiodactyla, which includes cattle, deer, camels, hippopotamuses,
sheep, pigs and goats that have an even number of toes, usually two
or sometimes four, on each foot.
Recombinases
[0085] Embodiments of the invention include administration of a
targeted nuclease system with a recombinase (e.g., a RecA protein,
a Rad51) or other DNA-binding protein associated with DNA
recombination. A recombinase forms a filament with a nucleic acid
fragment and, in effect, searches cellular DNA to find a DNA
sequence substantially homologous to the sequence. For instance a
recombinase may be combined with a nucleic acid sequence that
serves as a template for HDR. The recombinase is then combined with
the HDR template to form a filament and placed into the cell. The
recombinase and/or HDR template that combines with the recombinase
may be placed in the cell or embryo as a protein, an mRNA, or with
a vector that encodes the recombinase. The disclosure of US Pub
2011/0059160 (U.S. Ser. No. 12/869,232) is hereby incorporated
herein by reference for all purposes; in case of conflict, the
specification is controlling. The term recombinase refers to a
genetic recombination enzyme that enzymatically catalyzes, in a
cell, the joining of relatively short pieces of DNA between two
relatively longer DNA strands. Recombinases include Cre
recombinase, Hin recombinase, RecA, RAD51, Cre, and FLP. Cre
recombinase is a Type I topoisomerase from P1 bacteriophage that
catalyzes site-specific recombination of DNA between loxP sites.
Hin recombinase is a 21 kD protein composed of 198 amino acids that
is found in the bacteria Salmonella. Hin belongs to the serine
recombinase family of DNA invertases in which it relies on the
active site serine to initiate DNA cleavage and recombination.
RAD51 is a human gene. The protein encoded by this gene is a member
of the RAD51 protein family which assist in repair of DNA double
strand breaks. RAD51 family members are homologous to the bacterial
RecA and yeast Rad51. genes. Cre recombinase is an enzyme that is
used in experiments to delete specific sequences that are flanked
by loxP sites. FLP refers to Flippase recombination enzyme (FLP or
Flp) derived from the 24 plasmid of the baker's yeast Saccharomyces
cerevisiae.
[0086] Herein, "RecA" or "RecA protein" refers to a family of
RecA-like recombination proteins having essentially all or most of
the same functions, particularly: (i) the ability to position
properly oligonucleotides or polynucleotides on their homologous
targets for subsequent extension by DNA polymerases; (ii) the
ability topologically to prepare duplex nucleic acid for DNA
synthesis; and, (iii) the ability of RecA/oligonucleotide or
RecA/polynucleotide complexes efficiently to find and bind to
complementary sequences. The best characterized RecA protein is
from E. coli; in addition to the original allelic form of the
protein a number of mutant RecA-like proteins have been identified,
for example, RecA803. Further, many organisms have RecA-like
strand-transfer proteins including, for example, yeast, Drosophila,
mammals including humans, and plants. These proteins include, for
example, Rec1, Rec2, Rad51, Rad51B, Rad51C, Rad51D, Rad51E, XRCC2
and DMC1. An embodiment of the recombination protein is the RecA
protein of E. coli. Alternatively, the RecA protein can be the
mutant RecA-803 protein of E. coli, a RecA protein from another
bacterial source or a homologous recombination protein from another
organism.
Alleles for Introgression
[0087] Allele introgression has many important applications. The
Allelic Introgression Table, below, and Table 1 (Frequencies for
recovery of colonies with HDR alelles) describe certain genes and
their applications. Artisans reading this application will be able
to make and use the introgressions and resultant cells and animals.
Artisans can readily apply the processes set forth herein for the
use of these alleles as templates or targets for disruption.
Embodiments include making a genetically modified cell or animal
(for instance, a lab animal, an F0 founder, or animal line) whose
genome has received a gene from Table 1 or the Allelic
introgression Table, e.g., by insertion or template-driven allele
introgression that replaces the endogenous allele with an allele
from Table 1 or the Allelic introgression Table. Alleles for some
genes are reported to provide livestock production advantages, but
are at very low frequencies or are absent in some breeds or species
(see items 1-9). Introgression of these alleles can be of
significant value for production traits. For example, the Polled
allele (item 1) from beef breeds results in animals that do not
have horns, whereas dairy breeds do not have this allele so have
horns and need to be dehorned as a production practice. Allele
introgression from beef breeds into horned (dairy) breeds will lead
to hornless dairy cattle which is has value for both production and
animal welfare. Other examples relate to alleles that can increase
or enhance characteristics of agricultural products such as meat
(items 4-6) and milk (items 7-8). Item 9 is useful for disease
resistance.
[0088] Many commercial and commonly used animal breeds have been
carefully bred to establish desirable traits but, in the process of
that breeding, have accumulated genetic errors that reduce their
reproductive success because of losses in fertility or by
increasing miscarriages. Deleterious alleles for some genes are
present in animal populations. As explained elsewhere herein, the
inventive techniques provide for changing alleles only at an
intended location in a target animal, without other modifications
resulting from genetic tools or from meiotic recombinations.
Therefore, for the first time, it is possible to clean-up the
genetic errors that have accumulated in livestock and animal breeds
without disrupting the genome of the animals and, consequently,
disrupting traits or causing unintended consequences. Alleles for
some genes can be used to control animal fertility for genetic
control of breeding stock (items 2-3). The term breed is a term of
art that refers to domestic animals that, through selection and
breeding, have come to resemble one another and pass those traits
uniformly to their offspring.
[0089] Many useful animal models can be made. Certain alleles are
useful, see Allelic introgression Table items 10-39. Some of these
are established in animals. Others of the genes are known to cause
human disease, so introgressing these alleles into livestock, lab
animals, or other animals is useful to create biomedical models of
human disease.
[0090] Embodiments of the invention include a method of making a
genetically modified animal, said method comprising exposing
embryos or cells to an mRNA encoding a TALEN, with the TALEN
specifically binding to a target chromosomal site in the embryos or
cells, cloning the cells in a surrogate mother or implanting the
embryos in a surrogate mother, with the surrogate mother thereby
gestating an animal that is genetically modified without a reporter
gene and only at the TALEN targeted chromosomal site wherein the
allele is a member of the group consisting of (a) horn polled locus
(b) a gene recessive for fertility defects, e.g., CWC15 and/or
ApaF1 (c) genes for enhancing a livestock trait, e.g., meat
production (GDF8, IGF2, SOCS2, or a combination thereof) and/or
milk production (DGAT1 and/or ABCG2) (d) a gene for resistance to
African swine fever (P65/RELA) (e) a gene for changing animal size
(PLAG1, GHRHR) (f) genes that potential tumor growth (e.g., TP53,
APC, PTEN, RB1, Smad4, BUB1B, BRCA1, BRCA2, ST14 or a combination
thereof) (g) human oncogenes for animal models of cancer (e.g.,
AKT1, EGF, EGFR, KRAS, PDGFRA/B or a combination thereof) (h) genes
in animal models for hypercholesterolemia (to induce
atherosclerosis, stroke, and Alzheimer's disease models), e.g.,
LDLR, ApoE, ApoB or a combination thereof (i) Inflammatory Bowel
disease, e.g., NOD2 (j) spina bifida, e.g., VANGL1 and/or VANGL2
(k) pulmonary hypertension, e.g., miR-145 (l) genes for cardiac
defects, e.g., BMP10, SOS 1, PTPN11, Nrg1, Kir6.2, GATA4, Hand2, or
a combination thereof and (l) celiac disease genes, e.g.,
HLA-DQA1.
TABLE-US-00001 Allelic introgression Table Genes; Species Item
[Gene Reference Identification] Application 1 Horn-Polled Locus;
Bovine Transfer allele into cows of various breeds to make
[UMD3.1:1:1705490:1706389:1] bovine lines of those species without
horns; see Medugorac, I., D. Seichter, et al., (2012). "Bovine
polledness - an autosomal dominant trait with allelic
heterogeneity." PloS one, 7(6): e39477. 2 CWC15 (JH1) Use natural
allele as template to restore wildtype [hs Gene ID: 51503] sequence
to animal lines and breeds with defective 3 ApaF1 (HH1) alleles;
see VanRaden, P. M., K. M. Olson, et al., [hs Gene ID: 317] (2011).
"Harmful recessive effects on fertility detected by absence of
homozygous haplotypes." J Dairy Sci., 94(12): 6153-6161. 4 GDF8
Enhancement of growth for meat production. [hs Gene ID: 2660] 5
IGF2 [hs Gene ID: 3481] 6 SOCS2 [hs Gene ID: 8835] 7 DGAT1 Alleles
of these genes are known to influence the [hs Gene ID: 8694] amount
and composition of milk. 8 ABCG2 Hs Gene ID: 9429] 9 P65/RELA
Transfer of the warthog p65 allele to commercial [hs Gene ID: 5970]
swine breeds for resistance to African swine fever. Palgrave, C.
J., L. Gilmour, et al., (2011). "Species- specific variation in
RELA underlies differences in NF-kappaB activity: a potential role
in African swine fever pathogenesis." Journal of virology, 85(12):
6008-6014. 10 GHRHR Size reduction of animals for Biomedical
modeling. [hs Gene ID: 2692] 11 TP53 Tumor suppressor genes;
heterozygous knockout to [hs Gene ID: 7157] potentiate tumor
growth. 12 APC [hs Gene ID: 324] 13 PTEN [hs Gene ID: 5728] 14 RB1
[hs Gene ID: 5925] 15 Smad4 [hs Gene Id: 4089] 16 BUB1B [hs Gene
ID: 701] 17 BRCA1 [hs Gene ID: 672] 18 BRCA2 [hs Gene ID: 675] 19
ST14 [hs Gene ID: 6768] 20 AKT1 Oncogenes. Activated human alleles
will be [hs Gene ID: 207] introgressed into pigs to model cancers.
21 EGF [hs Gene ID: 1950] 22 EGFR [hs Gene ID: 1956] 23 KRAS [hs
Gene ID: 3845] 24 PDGFRA/B [hs Gene IDs: 5156/5159] 25 LDLR
Hypercholesterolemia to induce atherosclerosis, [hs Gene ID: 3949]
stroke and Alzheimer's disease models. 26 ApoE [hs Gene ID: 348] 27
ApoB [hs Gene ID: 338] 28 NOD2 Inflammatory Bowel disease for
animal models. [hs Gene ID: 64127] 29 VANGL1 Spina Bifida is
associated with alleles of these [hs Gene ID: 81839] genes.
Transfer of these alleles in livestock will 30 VANGL2 generate
models for biomedical research. [hs Gene ID: 57216] 31 miR-145
Pulmonary hypertension is associated with alleles of [hs Gene ID:
611795] these genes. Transfer of these alleles in swine will
generate models for biomedical research. 32 BMP10 Cardiac defects
associated with alleles of these [hs Gene ID: 27302] genes.
Transfer of these alleles will generate 33 SOS1 models for
biomedical research. [hs Gene ID: 6654] 34 PTPN11 [hs Gene ID:
5781] 35 Nrg1 [hs Gene ID: 3084] 36 Kir6.2 [hs Gene ID: 3767] 37
GATA4 [hs Gene ID: 2626] 38 Hand2 [hs Gene ID: 9464] 39 HLA-DQA1
Alleles associated with celiac disease will be [hs Gene ID: 3117]
transferred to livestock to create an animal model.
Animals Genetically Modified without any Reporters; Certain TALENs
Techniques; Allelic Introgressions
[0091] Certain embodiments of the invention are directed to
processes of modifying cells or embryos without the use of
reporters and/or selection markers. In general, it was observed
that TALENs and CRISPR/Cas9 modifications were unstable over a time
frame of several days. Accordingly, processes described herein for
stabilizing changes may be used, as well as other processes
described in US 2013/0117870: for instance, direct mRNA
introduction and/or use of ssDNA templates. The term direct
introduction, e.g., direct mRNA introduction, refers to
introduction of mRNA material. In contrast, introduction by means
of a vector encoding the mRNA is termed indirect introduction. Many
processes of direct introduction are known, e.g., electroporation,
transfection, lipofection, liposome, nucleofection, biolistic
particles, nanoparticles, lipid transfection, electrofusion, and
direct injection.
[0092] Founder animals can be immediately created from modified
cells or embryos without the need to create initially modified
animals that are subsequently bred to create the basis for a new
transgenic line. The term founder or founder animal is used to
refer to a first-generation ("F0") transgenic animal that develops
directly from the cloned cell or treated/injected embryo that is
modified. Methods reported herein provide for creation of founders
genetically modified only at the chromosomal target site, and
without intermediate steps of breeding and/or inbreeding. Moreover,
embodiments include founders that are homozygous for the
modification. The founders may be prepared without ever exposing
cells and/or embryos to reporter genes (and/or selection marker
genes).
[0093] A method of making a genetically modified animal comprises
introducing TALENs and/or vectors into cultured cells, e.g.,
primary livestock cells. The TALENs are directed to specific
chromosomal sites and cause a genetic alteration at the site. An
HDR template may also be introduced into the cell, e.g., as a
double stranded vector, single stranded DNA, or directly as an ss
nucleotide. The cultured cells are subsequently cultured to form
colonies of clonal cells. The colonies are tested by PCR and/or
sequenced, or otherwise assayed for a genetic modification,
preferably without a reporter gene and/or without a selection
marker. Cells are taken from colonies that are genetically modified
at the intended site and used in cloning. For example, from 10 to
50,000 cells are used to make from 10 to 50,000 embryos that are
implanted into surrogates, e.g., in sets of 1-500 embryos per
surrogate; artisans will immediately appreciate that all the ranges
and values within the explicitly stated ranges are contemplated.
Embodiments comprise exposing the cells to the TALEN without a
reporter gene, creating colonies of clonal cells, and testing a
subset of members of the colonies to identify colonies
incorporating the modification at the chromosomal target site.
Genetically Modified Animals
[0094] Various techniques known in the art can be used to introduce
nucleic acid constructs into non-human animals to produce founder
animals, in which the nucleic acid construct is integrated into the
genome. Such techniques include, without limitation, pronuclear
microinjection (U.S. Pat. No. 4,873,191), retrovirus mediated gene
transfer into germ, gene targeting into embryonic stem cells,
electroporation of embryos, sperm-mediated gene transfer (Lavitrano
et al., (2002) Proc. Natl. Acad. Sci. USA, 99:14230-14235;
Lavitrano et al., (2006) Reprod. Fert. Develop., 18:19-23), and in
vitro transformation of somatic cells, such as cumulus or mammary
cells, or adult, fetal, or embryonic stem cells, followed by
nuclear transplantation. Pronuclear microinjection, sperm mediated
gene transfer, and somatic cell nuclear transfer are particularly
useful techniques, as well as cytoplasmic injection, primordial
germ cell transplantation, and blastocyst chimera production
whereby a germ cell is propagated in an embryo.
[0095] Typically, in pronuclear microinjection, a nucleic acid
construct is introduced into a fertilized egg; 1 or 2 cell
fertilized eggs are used as the pronuclei containing the genetic
material from the sperm head and the egg are visible within the
protoplasm. Pronuclear staged fertilized eggs can be obtained in
vitro or in vivo (i.e., surgically recovered from the oviduct of
donor animals) and In vitro fertilized eggs can be produced. For
example, in swine, mature oocytes can be fertilized in 500 .mu.l
Minitube PORCPRO IVF MEDIUM SYSTEM (Minitube, Verona, Wis.) in
Minitube 5-well fertilization dishes. In preparation for in vitro
fertilization (IVF), freshly-collected or frozen boar semen can be
washed and resuspended in PORCPRO IVF Medium to 4.times.10.sup.5
sperm. Sperm concentrations can be analyzed by computer assisted
semen analysis (SPERMVISION, Minitube, Verona, Wis.). Final in
vitro insemination can be performed in a 10 .mu.l volume at a final
concentration of approximately 40 motile sperm/oocyte, depending on
boar. Incubate all fertilizing oocytes at 38.7.degree. C. in 5.0%
CO.sub.2 atmosphere for 6 hours. Six hours post-insemination,
presumptive zygotes can be washed twice in NCSU-23 and moved to 0.5
mL of the same medium. This system can produce 20-30% blastocysts
routinely across most boars with a 10-30% polyspermic insemination
rate.
[0096] In somatic cell nuclear transfer, a genetically modified
cell or blastomere, e.g., an embryonic blastomere, fetal
fibroblast, adult ear fibroblast, or granulosa cell, can be
introduced into an enucleated oocyte to establish a combined cell.
In some conventions, oocytes arrested at meiosis-2 are termed
"eggs". After producing an embryo (e.g., by fusing and activating
the oocyte), the embryo is transferred to the oviducts of a
recipient female, about 20 to 24 hours after activation. Standard
breeding techniques can be used to create animals that are
homozygous for the target nucleic acid from initial heterozygous
founder animals.
Vectors and Nucleic Acids
[0097] A variety of nucleic acids may be introduced into cells. As
used herein, the term nucleic acid includes DNA, RNA, and nucleic
acid analogs, and nucleic acids that are double-stranded or
single-stranded (i.e., a sense or an antisense single strand).
Nucleic acid analogs can be modified at the base moiety, sugar
moiety, or phosphate backbone to improve, for example, stability,
hybridization, or solubility of the nucleic acid. The deoxyribose
phosphate backbone can be modified to produce morpholino nucleic
acids. In addition, the deoxyphosphate backbone can be replaced
with, for example, a phosphorothioate or phosphorodithioate
backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.
A nucleic acid sequence can be operably linked to a regulatory
region such as a promoter for expression. As used herein, operably
linked refers to positioning of a regulatory region relative to a
nucleic acid sequence in such a way as to permit or facilitate
transcription of the target nucleic acid. Any type of promoter can
be operably linked to a target nucleic acid sequence. Examples of
promoters include, without limitation, tissue-specific promoters,
constitutive promoters, and promoters responsive or unresponsive to
a particular stimulus.
[0098] Nucleic acid constructs can be methylated using an SssI CpG
methylase (New England Biolabs, Ipswich, Mass.). In general, the
nucleic acid construct can be incubated with S-adenosylmethionine
and SssI CpG-methylase in buffer at 37.degree. C. Hypermethylation
can be confirmed by incubating the construct with one unit of
HinPll endonuclease for 1 hour at 37.degree. C. and assaying by
agarose gel electrophoresis.
[0099] Nucleic acid constructs can be introduced into embryonic,
fetal, or adult artiodactyl cells of any type, including, for
example, germ cells such as an oocyte or an egg, a progenitor cell,
an adult or embryonic stem cell, a primordial germ cell, a kidney
cell such as a PK-15 cell, an islet cell, a beta cell, a liver
cell, or a fibroblast such as a dermal fibroblast, using a variety
of techniques. Non-limiting examples of techniques include the use
of transposon systems, recombinant viruses that can infect cells,
or liposomes or other non-viral methods such as electroporation,
microinjection, or calcium phosphate precipitation, that are
capable of delivering nucleic acids to cells. In transposon
systems, the transcriptional unit of a nucleic acid construct,
i.e., the regulatory region operably linked to a target nucleic
acid sequence, is flanked by an inverted repeat of a transposon.
Several transposon systems, including, for example, Sleeping Beauty
(see, U.S. Pat. No. 6,613,752 and U.S. Publication No.
2005/0003542); Frog Prince (Miskey et al., (2003) Nucleic Acids
Res., 31:6873); Tol2 (Kawakami (2007) Genome Biology,
8(Suppl.1):S7; Minos (Pavlopoulos et al., (2007) Genome Biology,
8(Suppl.1):S2); Hsmar1 (Miskey et al., (2007)) Mol. Cell Biol.,
27:4589); and Passport have been developed to introduce nucleic
acids into cells, including mice, human, and pig cells. The
Sleeping Beauty and Passport transposon is particularly useful. A
transposase can be delivered as a protein, encoded on the same
nucleic acid construct as the target nucleic acid, can be
introduced on a separate nucleic acid construct, or provided as an
mRNA (e.g., an in vitro-transcribed and capped mRNA).
[0100] Nucleic acids can be incorporated into vectors. A vector is
a broad term that includes any specific DNA segment that is
designed to move from a carrier into a target DNA. A vector may be
referred to as an expression vector, or a vector system, which is a
set of components needed to bring about DNA insertion into a genome
or other targeted DNA sequence such as an episome, plasmid, or even
virus/phage DNA segment. Vector systems such as viral vectors
(e.g., retroviruses, adeno-associated virus and integrating phage
viruses), and non-viral vectors (e.g., transposons) used for gene
delivery in animals have two basic components: 1) a vector
comprised of DNA (or RNA that is reverse transcribed into a cDNA)
and 2) a transposase, recombinase, or other integrase enzyme that
recognizes both the vector and a DNA target sequence and inserts
the vector into the target DNA sequence. Vectors most often contain
one or more expression cassettes that comprise one or more
expression control sequences, wherein an expression control
sequence is a DNA sequence that controls and regulates the
transcription and/or translation of another DNA sequence or mRNA,
respectively.
[0101] Many different types of vectors are known. For example,
plasmids and viral vectors, e.g., retroviral vectors, are known.
Mammalian expression plasmids typically have an origin of
replication, a suitable promoter and optional enhancer, and also
any necessary ribosome binding sites, a polyadenylation site,
splice donor and acceptor sites, transcriptional termination
sequences, and 5' flanking non-transcribed sequences. Examples of
vectors include: plasmids (which may also be a carrier of another
type of vector), adenovirus, adeno-associated virus (AAV),
lentivirus (e.g., HIV-1, SIV or FIV), retrovirus (e.g., ASV, ALV or
MoMLV), and transposons (e.g., Sleeping Beauty, P-elements, Tol-2,
Frog Prince, piggyBac).
[0102] As used herein, the term nucleic acid refers to both RNA and
DNA, including, for example, cDNA, genomic DNA, synthetic (e.g.,
chemically synthesized) DNA, as well as naturally occurring and
chemically modified nucleic acids, e.g., synthetic bases or
alternative backbones. A nucleic acid molecule can be
double-stranded or single-stranded (i.e., a sense or an antisense
single strand). The term transgenic is used broadly herein and
refers to a genetically modified organism or genetically engineered
organism whose genetic material has been altered using genetic
engineering techniques. A knockout artiodactyl is thus transgenic
regardless of whether or not exogenous genes or nucleic acids are
expressed in the animal or its progeny.
[0103] The nucleic acid sequences set forth herein are intended to
represent both DNA and RNA sequences, according to the conventional
practice of allowing the abbreviation "T" stand for "T" or for "U",
as the case may be, for DNA or RNA. Polynucleotides are nucleic
acid molecules of at least three nucleotide subunits.
Polynucleotide analogues or polynucleic acids are chemically
modified polynucleotides or polynucleic acids. In some embodiments,
polynucleotide analogues can be generated by replacing portions of
the sugar-phosphate backbone of a polynucleotide with alternative
functional groups. Morpholino-modified polynucleotides, referred to
herein as "morpholinos," are polynucleotide analogues in which the
bases are linked by a morpholino-phosphorodiamidate backbone (see,
e.g., U.S. Pat. Nos. 5,142,047 and 5,185,444). In addition to
morpholinos, other examples of polynucleotide analogues include
analogues in which the bases are linked by a polyvinyl backbone,
peptide nucleic acids (PNAs) in which the bases are linked by amide
bonds formed by pseudopeptide 2-aminoethyl-glycine groups,
analogues in which the nucleoside subunits are linked by
methylphosphonate groups, analogues in which the phosphate residues
linking nucleoside subunits are replaced by phosphoroamidate
groups, and phosphorothioated DNAs, analogues containing sugar
moieties that have 2' O-methyl group). Polynucleotides of the
invention can be produced through the well-known and routinely used
technique of solid phase synthesis. Alternatively, other suitable
methods for such synthesis can be used (e.g., common molecular
cloning and chemical nucleic acid synthesis techniques). Similar
techniques also can be used to prepare polynucleotide analogues
such as morpholinos or phosphorothioate derivatives. In addition,
polynucleotides and polynucleotide analogues can be obtained
commercially. For oligonucleotides, examples of pharmaceutically
acceptable compositions are salts that include, e.g., (a) salts
formed with cations such as sodium, potassium, ammonium, etc.; (b)
acid addition salts formed with inorganic acids, for example,
hydrochloric acid, hydrobromic acid (c) salts formed with organic
acids e.g., for example, acetic acid, oxalic acid, tartaric acid;
and (d) salts formed from elemental anions e.g., chlorine, bromine,
and iodine.
[0104] A sequence alignment is a way of arranging the sequences of
DNA, RNA, or protein to identify regions of similarity. Aligned
sequences of nucleotide or amino acid residues are typically
represented as rows within a matrix, with gaps are inserted between
the residues so that identical or similar characters are aligned in
successive columns.
EXAMPLES
Example 1
TALEN Designing and Production
[0105] Candidate TALEN target DNA sequences and RVD sequences were
identified using the online tool "TAL EFFECTOR NUCLEOTIDE
TARGETER". Plasmids for TALEN DNA transfection or in vitro TALEN
mRNA transcription were then constructed by following the Golden
Gate Assembly protocol using pCGOLDYTALEN (Addgene ID 38143) and
RCIscript-GOLDYTALEN (Addgene ID 38143) as final destination
vectors (Carlson 2012). The final pC-GoldyTALEN vectors were
prepared by using PureLink.RTM. HIPURE PLASMID MIDIPREP Kit (Life
Technologies) and sequenced before usage. Assembled RCIscript
vectors prepared using the QIAPREP SPIN MINIPREP kit (Qiagen) were
linearized by SacI to be used as templates for in vitro TALEN mRNA
transcription using the mMESSAGE mMACHINE.RTM. T3 Kit (Ambion) as
indicated previously elsewhere. Modified mRNA was synthesized from
RCIScript-GOLDYTALEN vectors as previously described (Carlson 2012)
substituting a ribonucleotide cocktail consisting of
3'-0-Mem7G(5')ppp(5')G RNA cap analog (New England Biolabs),
5-methylcytidine triphosphate pseudouridine triphosphate (TriLink
Biotechnologies, San Diego, Calif.) and adenosine triphosphate
guanosine triphosphate. Final nucleotide reaction concentrations
are 6 mM for the cap analog, 1.5 mM for guanosine triphosphate, and
7.5 mM for the other nucleotides. Resulting mRNA was DNAse treated
prior to purification using the MEGACLEAR REACTION CLEANUP kit
(Applied Biosciences).
Example 2
CRISPR/Cas9 Design and Production
[0106] Gene specific gRNA sequences were cloned into the Church lab
gRNA vector (Addgene ID: 41824) according their methods. The Cas9
nuclease was provided either by co-transfection of the hCas9
plasmid (Addgene ID: 41815) or mRNA synthesized from
RCIScript-hCas9. This RCIScript-hCas9 was constructed by
sub-cloning the XbaI-AgeI fragment from the hCas9 plasmid
(encompassing the hCas9 cDNA) into the RCIScript plasmid. Synthesis
of mRNA was conducted as above except that linearization was
performed using KpnI.
Example 3
Donor Repair Template Preparation
[0107] A) BB-HDR (1,623 bp) plasmid. A 1,695 bp fragment
encompassing the Belgian Blue allele was PCR amplified (btGDF8 BB
5-1: 5'-CAAAGTTGGTGACGTGACAGAGGTC (SEQ ID NO:88); btGDF8 BB 3-1:
5'-GTGTGCCATCCCTACTTTGTGGAA (SEQ ID NO:89)) from Belgian Blue
genomic DNA and TOPO cloned into the PCR 2.1 vector (Life
Technologies). This plasmid was used as positive control template
for analytical primer sets and for derivation of the 1,623 bp
BB-HDR template by PCR with following primers (BB del HR 1623 5-1:
5'-GATGTATTCCTCAGACTTTTCC (SEQ ID NO:90); BB del HR 1623 3-1:
5'-GTGGAATCTCATCTTACCAA, SEQ ID NO:91) and TOPO cloned as before.
Each plasmid was sequence verified prior to use. Transfection grade
plasmid was prepared using the Fast-Ion MIDI PLASMID ENDO-FREE kit
(IBI Scientific). rAAV packaging. BB-HDR was cloned into pAAV-MCS
and packaged into using the ADENO-ASSOCIATED VIRUS HELPER-FREE
system (Agilent). Briefly, a 10 cm dish AAV-293 cells was
transfected with 5 .mu.g each: pAAV-Helper, pAAV-RC and the
AAV-BB-HDR plasmid. Two days post transfection, the cells were
removed from the plate by scraping into 1 ml of growth media. Viral
particles were released by 3 freeze-thaw cycles prior to
centrifugation at maximum speed in a microcentrifuge for 5 minutes.
The supernatant was aspirated and used directly for infection of
target cells.
[0108] B) Polled 1592 template. A 1,784 bp fragment encompassing
383 the POLLED allele was PCR amplified (F1:
5'-GGGCAAGTTGCTCAGCTGTTTTTG (SEQ ID NO:92);
R1-5'-TCCGCATGGTTTAGCAGGATTCA, SEQ ID NO:93) from angus genomic DNA
and TOPO cloned into the PCR 2.1 vector (Life Technologies). This
plasmid was used as positive the control template for analytical
primer sets and for derivation of the 1,592 bp HDR template by PCR
with following primers (1594 F: 5'-ATCGAACCTGGGTCTTCTGCATTG SEQ ID
NO:94; R1: 5'-TCCGCATGGTTTAGCAGGATTCA, SEQ ID NO:95) and TOPO
cloned as before. Each plasmid was sequence verified prior to use.
Transfection grade plasmid was prepared using the Fast-Ion MIDI
Plasmid Endo-Free kit (IBI Scientific) and 5 .mu.g or 10 .mu.g was
transfected along with 2 .mu.g HP1.3 TALEN mRNA. Oligonucleotide
templates. All oligonucleotide templates were synthesized by
Integrated DNA Technologies, 100 nmole synthesis purified by
standard desalting, and resuspended to 400 .mu.M in TE.
Example 4
Tissue Culture and Transfection
[0109] Pig or cattle fibroblasts were maintained at 37 or
30.degree. C. (as indicated) at 5% CO2 in DMEM supplemented with
10% fetal bovine serum, 100 I.U./ml penicillin and streptomycin,
and 2 mM L-Glutamine. For transfection, all TALENs and HDR
templates were delivered through transfection using the Neon
Transfection system (Life Technologies) unless otherwise stated.
Briefly, low passage Ossabaw, Landrace, Wagyu, or Holstein
fibroblasts reaching 100% confluence were split 1:2 and harvested
the next day at 70-80% confluence. Each transfection was comprised
of 500,000-600,000 cells resuspended in buffer "R" mixed with
plasmid DNA or mRNA and oligos and electroporated using the 100
.mu.l tips by the following parameters: input Voltage; 1800V; Pulse
Width; 20 ms; and Pulse Number; 1. Typically, 2-4 .mu.g of TALEN
expression plasmid or 1-2 .mu.g of TALEN mRNA and 2-3 .mu.M of
oligos specific for the gene of interest were included in each
transfection. Deviation from those amounts is indicated in the
figure legends. After transfection, cells were divided 60:40 into
two separate wells of a 6-well dish for three days' culture at
either 30 or 37.degree. C. respectively. After three days, cell
populations were expanded and at 37.degree. C. until at least day
10 to assess stability of edits.
Example 5
Dilution Isolation of Cellular Clones
[0110] Three days post transfection, 50 to 250 cells were seeded
onto 10 cm dishes and cultured until individual colonies reached
about 5 mm in diameter. At this point, 6 ml of TrypLE (Life
Technologies) 1:5 (vol/vol) diluted in PBS was added and colonies
were aspirated, transferred into wells of a 24-well dish well and
cultured under the same 420 conditions. Colonies reaching
confluence were collected and divided for cryopreservation and
genotyping. Sample preparation: Transfected cells populations at
day 3 and 10 were collected from a well of a 6-well dish and 10-30%
were resuspended in 50 .mu.l of 1.times.PCR compatible lysis
buffer: 10 mM Tris-Cl pH 8.0, 2 mM EDTA, 0.45% Tryton X-100
(vol/vol), 0.45% Tween-20 (vol/vol) freshly supplemented with 200
.mu.g/ml Proteinase K. The lysates were processed in a thermal
cycler using the following program: 55.degree. C. for 60 minutes,
95.degree. C. for 15 minutes. Colony samples from dilution cloning
were treated as above using 20-30 .mu.l of lysis buffer.
Example 6
Plasmid and rAAV HDR in Wagyu Fibroblasts
[0111] Low passage Wagyu fibroblasts were cultured to 70-90%
confluence and transfected by NUCLEOFECTION (Lonza) with 2 .mu.g
each TALEN expression plasmid (btGDF83.1L+NR) along with 750 ng of
SLEEPING BEAUTY transposon components as previously described,
Carlson 2012. For conditions where plasmid HDR template was used, 2
.mu.g of BB-HDR plasmid was also included in the transfection.
Transfected cells were split between two wells of a 6-well plate
for culture at 30 or 37.degree. C. For conditions using rAAV HDR
template, 150 .mu.l of viral lysate was added to each well 2 hours
post transfection. After incubation for three days, cells were
harvested by trypsinization, a portion of which were lysed for
analysis of HDR at day 3, and the remainder were plated for colony
isolation as previously described, Carlson 2012.
Example 7
Mutation Detection and RFLP Analysis
[0112] PCR flanking the intended sites was conducted using PLATINUM
TAQ DNA POLYMERASE HIFI (Life Technologies) with 1 .mu.l of the
cell lysate according to the manufacturer's recommendations. The
frequency of mutation in a population was analysed with the
SURVEYOR MUTATION DETECTION Kit (Transgenomic) according to the
manufacturer's recommendations using 10 ul of the PCR product as
described above. RFLP analysis was performed on 10 .mu.l of the
above PCR reaction using the indicated restriction enzyme. SURVEYOR
and RFLP reactions were resolved on a 10% TBE polyacrylamide gels
and visualized by ethidium bromide staining. Densitometry
measurements of the bands were performed using ImageJ; and mutation
rate of SURVEYOR reactions was calculated as described in Guschin
et al., 201049. Percent HDR was calculated via dividing the sum
intensity of RFLP fragments by the sum intensity of the parental
band+RFLP fragments. For analysis of mloxP insertion, small PCR
products spanning the insertion site were resolved on 10%
polyacrylamide gels and the insert versus wild type alleles could
be distinguished by size and quantified. RFLP analysis of colonies
was treated similarly except that the PCR products were amplified
by 1.times.MYTAQ RED Mix (Bioline) and resolved on 2.5% agarose
gels. For analysis of clones for introgression of the GDF8
G938A-only (oligos lacked a novel RFLP), colonies were initially
screened by a three primer assay that could distinguish between
heterozygous ad homozygous introgression. Briefly, lysates from pig
or cattle colonies were analysed by PCR using 1.times.MYTAQ RED MIX
(Bioline) using the following primers and programs. Cattle GDF8
(Outside F1: 5'-CCTTGAGGTAGGAGAGTGTTTTGGG, SEQ ID NO:96, Outside
R1: 5'-TTCACCAGAAGACAAGGAGAATTGC, SEQ ID NO:97, Inside F1:
5'-TAAGGCCAATTACTGCTCTGGAGACTA, SEQ ID NO:98; and 35 cycles of
(95.degree. C., 20 s; 62.degree. C., 20 s; 72.degree. C., 60 s).
Pig GDF8: Outside F1: 5'-CCTTTTTAGAAGTCAAGGTAACAGACAC, SEQ ID
NO:99, Outside R1: 5'-TTGATTGGAGACATCTTTGTGGGAG, SEQ ID NO:100
Inside F1: 5'-TAAGGCCAATTACTGCTCTGGAGATTA, SEQ ID NO:101; and 35
cycles of (95.degree. C., 20 s; 58.degree. C., 20 s; 72.degree. C.,
60 s). Amplicons from candidates were sequenced directly and/or
TOPO cloned (Life Technologies) and sequenced by Sanger sequencing.
To detect TALEN-mediated HDR at with the BB-HDR template, either 1
.mu.l or 1 .mu.l of a 1:10 dilution of PCR-lysate (1,000 cells/ul)
was added to a PCR reaction with PCR primers bt GDF8 BB 5-1 (primer
"c") and primer "c" (BB-Detect 3-1-5'-GCATCGAGATTCTGTCACAATCAA, SEQ
ID NO:102) and subjected to PCR with using 1.times.MYTAQ RED MIX
(Bioline) for 40 cycles (9 459 5.degree. C., 20 s; 66.degree. C.,
20 s; 72.degree. C., 60 s). To confirm HDR in colonies identified
by the above PCR, amplification of the entire locus was performed
with primers bt GDF8 BB 5-1 and bt GDF8 BB 3-1 followed by TOPO
cloning (Life Technologies) and sequencing.
Example 8
[0113] Detection of POLLED introgression was performed by PCR using
the F1 primer (see above) and the "P" primer
(5'-ACGTACTCTTCATTTCACAGCCTAC, SEQ ID NO:103) using 1.times. MyTaq
Red mix (Bioline) for 38 cycles (95.degree. C., 25 s; 62.degree.
C., 25 s; 72.degree. C., 60 s). A second PCR assay was performed
using (F2: 5'-GTCTGGGGTGAGATAGTTTTCTTGG, SEQ ID NO:104;
R2-5'-GGCAGAGATGTTGGTCTTGGGTGT, SEQ ID NO:105). Candidates passing
both tests were analysed by PCR using the flanking F1 and R1
primers followed by TOPO cloning and sequencing. Detection of FecB
introgression was performed as previously described for sheep.
Callipyge introgression was detected by an AVAII RFLP assay. See
results in FIG. 6.
Example 9
Amplicon Sequencing and Analysis
[0114] DNA was isolated from transfected populations and 100-250 ng
was added to a 50 .mu.l PLATINUM TAQ DNA POLYMERASE HIGH FIDELITY
(Life Technologies) assembled per the manufacturer's
recommendations. Each sample was assigned a primer set with a
unique barcode to enable multiplex sequencing. A portion of the PCR
product was resolved on a 2.5% agarose gel to confirm size prior to
PCR cleanup using the MINELUTE PCR PURIFICATION Kit (Qiagen).
Samples were quantified and pooled into a single sample for
sequencing. The single combined sample was spiked with 25% PhiX
(for sequence diversity) and sequenced on an Illumina MISEQ
sequencer generating 150 base-pair paired-end reads. Read quality
was assessed using FASTQC Read-pairs with overlapping ends were
joined using FASTQ-JOIN from the EA-UTILS package. A custom PERL
script was used to demultiplex the joined reads and count insert
types. Exact matches to the forward and reverse primers were
required in the demultiplexing step. Cloned animals were genotyped
by RFLP assay and sequencing. Pigs, in this example and others,
were cloned under contract with Minitube of America
Example 10
Evaluation of Transfected mRNA as a Source of TALENs
[0115] Referring to FIG. 7, p65.sub.--11.1 TALENs were introduced
into pig fibroblasts encoded by either unmodified mRNA, modified
mRNA (mod mRNA) or plasmid DNA (pDNA). Two quantities of each TALEN
preparation were transfected into cells by nucleofection (Lonza),
cultured 3 days at 30.degree. C. or 37.degree. C. prior to analysis
of indels. Percent NHEJ was similar for all mRNA transfections
incubated at 30.degree. C., while a dosage response could be
observed for transfected cells incubated at 37.degree. C. Notably,
mRNA transfection in all groups incubated at 30.degree. C.
significantly outperformed the TALENs transfected as plasmid DNA
under the same conditions. There was little difference between
modified and unmodified mRNA in this test. P65 11.1 TALENs:
TABLE-US-00002 (SEQ ID NO: 106)
CTCCTCCATTGCGGACATGGACTTCTCAGCCCTTCTGAGTCAGATC,
underlines indicate TALENs binding sites.
Example 11
Kinetics of TALEN Induced HDR with Oligonucleotide Templates
[0116] Referring to FIG. 8A, an mRNA source of TALENs stimulated
efficient and consistent HDR using an oligo donor. Each chart
displays results of targeting a specific locus in fibroblasts
(e.g., ssIL2RG; "ss" for Sus scrofa and "bt" for Bos taurus) using
oligo donor templates and TALENs delivered as plasmid DNA or mRNA.
(Insets) Diagrams of the oligo templates, in which the shaded boxes
represent the TALEN-binding site and the spacers are shown in
white. Each oligo contains either a 4-bp insertion (ins4) or
deletion (del4) that introduces a novel restriction site for RFLP
analysis. Presumptive BMs replace the conserved -1 thymidine
(relative to the TALEN-binding site) with the indicated nucleotide.
Fibroblasts were transfected with either TALEN-encoding plasmids (3
.mu.g) or mRNA (1 .mu.g) along with 3 .mu.M of their cognate
oligo-homologous template. Cells were then incubated at 37.degree.
C. or 30.degree. C. for 3 d before expansion at 37.degree. C. until
day 10. TALEN activity was measured by the Surveyor assay at day 3
(Day3 Surveyor), and HDR was measured at days 3 and 10 by RFLP
analysis (Day3% HDR and Day10% HDR). Each bar displays the average
and SEM from three replicates.
[0117] Referring to FIG. 8B, porcine fibroblasts were transfected
with either TALEN-encoding mRNA or plasmid DNA and oligos with 4
base pair insertions targeting LDLR or APC genes. Cells from each
transfection were then evenly split into seven 24-well plate wells,
cultured at 30.degree. C. and assayed by RFLP at the indicated time
points. Panel a) RFLP analysis on cell populations at indicated
time points. Panel b) Results from panel a were quantified by
densitometry and the averages were plotted as a function of time
with SEM (n=3). HDR signal first appears 12 hours post-transfection
and accumulates over time. The onset of HDR at LDLR was independent
of TALEN source, but the rate of HDR between 24 and 72 hours was
much higher when mRNA was used compared to plasmid DNA.
Example 12
Influence of Mutation Type on the Frequency of HDR
[0118] Referring to FIG. 9, panel a) The sequence of five oligos
used to target ssLDLR. Oligos vary in length and type of mutation.
TALEN binding sites are indicated in boxed text and the novel BamHI
site is underlined. SNPs including BMs and insertions are circled.
Panel b) Cells were transfected with LDLR2.1 TALEN mRNA (1 .mu.g)
and oligos (2 .mu.M final). HDR at day 3 was determined by RFLP
analysis and the average with SEM (n=3) was plotted. The results
suggest that insertion alleles are more efficiently incorporated
than SNPs or deletions, but that homology length from 46-90 bp has
negligible influence on HDR efficiency. c) Cattle cells were
transfected with btRosa1.2 TALEN mRNA and either 41_mloxP or
60_loxP oligos (2 .mu.M final). The numbers 41 and 60 refer to the
number of homologous bases. Each oligo contains a 34 bp loxP site,
either a modified (mloxP) or wild type (loxP) version, in the
center of the spacer. Densitometry at day 3 and 15 show that
insertion of loxP sites is both efficient and stable.
Example 13
CRISPR/Cas9 Mediated HDR to Introgress the p65 S531P Mutation from
Warthogs into Conventional Swine
[0119] Referring to FIG. 10, panel a) The S531P missense mutation
is caused by a T-C transition at nucleotide 1591 of porcine p65.
The S-P HDR template includes the causative TC transition mutation
(oversized text) which introduces a novel XmaI site and enables
RFLP screening. Two gRNA sequences (P65_G1S and P65_G2A) are shown
along with the p65.8 TALENs used in previous experiments. Panel b)
Landrace fibroblasts were transfected with S-P-HDR oligos (2
.mu.M), two quantities of plasmid encoding hCas9 (0.5 .mu.g or 2.0
.mu.g); and five quantities of the G2A transcription plasmid (0.05
to 1.0 .mu.g). Cells from each transfection were split 60:40 for
culture at 30 and 37.degree. C. respectively for 3 days before
prolonged culture at 37.degree. C. until day 10. Surveyor assay
revealed activity ranging from 16-30%. Panels c and d) RFLP
analysis of cells sampled at days 3 and 10. Expected cleavage
products of 191 and 118 bp are indicated by black arrows. Despite
close proximity of the double stranded break (DSB) to the target
SNP, CRISPR/Cas9 mediated HDR was less efficient than TALENs for
introgression of S531P. Individual colonies were also analyzed
using each gRNA sequence (data not shown).
[0120] Referring to FIG. 11, experiments were made for comparison
of TALENs and CRISPR/Cas9 mediated HDR at porcine APC. Panel a)
APC14.2 TALENs and the gRNA sequence APC14.2 G1a are shown relative
to the wild type APC sequence. Below, the HDR oligo is shown which
delivers a 4 bp insertion (orange text) resulting in a novel
HindIII site. Pig fibroblasts transfected with 2 .mu.M of oligo HDR
template, and either 1 .mu.g TALEN mRNA, 1 .mu.g each plasmid DNA
encoding hCas9 and the gRNA expression plasmid; or 1 .mu.g mRNA
encoding hCas9 and 0.5 .mu.g of gRNA expression plasmid, were then
split and cultured at either 30 or 37.degree. C. for 3 days before
expansion at 37.degree. C. until day 10. Panel b) Charts displaying
RFLP and Surveyor assay results. As previously determined TALEN
stimulated HDR was most efficient at 30.degree. C., while
CRISPR/Cas9 mediated HDR was most effective at 37.degree. C. For
this locus, TALENs were more effective than the CRISPR/Cas9 system
for stimulation of HDR despite similar DNA cutting frequency
measured by Surveyor assay. In contrast to TALENs, there was little
difference in HDR when hCas9 was delivered as mRNA versus
plasmid.
Example 14
SNP Introgression Using Oligo Donors
[0121] Referring to FIG. 12, panel a) The influence of blocking
mutations (BM) on maintenance of HDR alleles was evaluated in pig
LDLR and GDF8. Each oligo was designed to introduce the same
SNPs/restriction 313 site plus or minus blocking mutations. HR was
quantified in transfected populations initially cultured at
30.degree. C. for three days and further maintained at 37.degree.
C. until day 12 by RFLP assay. The average and SEM (n=3) is shown.
Panel b) Introgression of myostatin C313Y into Wagyu fibroblasts.
The C313Y missense mutation is caused by a G-A transition
(indicated by oversized text) at nucleotide 938 of bovine myostatin
The HDR template also includes a T to C transition (circled) to
introduce a novel EcoRI site for RFLP screening. Two left TALENs
were designed against the locus, btGDF83.6-G, targeting the wild
type alelle (Wt), and btGDF83.6-A targeting the mutant allele
(C313Y); both share a common right TALEN. Transfection, culture and
measurement were conducted as above. The average and SEM for
btGDF83.6-G (n=30) and btGDF83.6-A (n=5) represent twelve and three
biological replicates, respectively. A two-sided student's t-test
was used to compare averages between groups; the p values are
indicated.
Example 15
SNPs
[0122] FIG. 13 is a plot that shows results for sequence analysis
of TALEN stimulated HDR alleles. PCR amplicons flanking the target
site (200-250 bp total) derived from TALEN mRNA and oligo
transfected cell populations were sequenced by ILLUMINA sequencing.
Total read count ranged from 10,000 328 to 400,000 per sample. The
count of perfect, intended HR reads versus the wild type reads is
plotted for insertion (panel a) and SNP alleles (panel b). The
target locus, time point and whether or not BMs were included in
the oligo are indicated below. Panel c). Reads from btGDF8 and p65
were sorted for incorporation of the target SNP and then classified
intended (iSNP) versus those with an additional mutation (iSNP+Mut)
and plotted against the total number of reads.
Example 16
Sequence Analysis of HDR Alleles
[0123] Referring to FIG. 14, sequencing reads containing the
correct insertion (Panel a) or SNP allele (Panel b) were analyzed
for incorporation of BM. The target locus, time point and whether
or not BMs were included in the oligo are indicated below each
graph. In general, the 5' BM was incorporated most frequently into
the HDR conversion tract, followed by inclusion of both BMs, or the
3' BM only. The distribution of BM is somewhat skewed towards
incorporation of both BM when the intended mutation to LDLR is a
SNP versus a 4 bp insertion allele. It is also interesting to note
that the majority of intended reads for btGDF8 have incorporated at
least one BM, but seldom have the 3' BM alone. Thus, while BM did
not have a significant impact on the frequency of maintaining the
intended SNP (iSNP) allele in culture, their enrichment relative to
other loci suggests that they might have offered some protection
from TALEN re-cleavage. c). The data of FIG. 13 panel c was further
classified by mutation type and compared. Some reads contained only
the iSNP, others had a concomitant indel (iSNP+indel), or a
concomitant unintended SNP (iSNP+uSNP). There appears to be some
elevation in the frequency of iSNP+indel when BMs were not included
in the template, and the majority of indels were located in the
spacer region so are likely to be the result of re-cutting of
already converted alleles.
Example 17
Multiple SNPs in the TALEN DNA-Binding Site Stabilize HDR
Alleles
[0124] Referring to FIG. 15, the EIF4GI gene was stabilized with
multiple SNPs in the TALEN DNA binding site. Panel a) A portion of
wild type EIF4GI Wt-NL is shown. One pair of TALENs was designed to
cut the wild type EIF4GI to stimulate homologous recombination.
Also aligned to the Wt sequence is the core sequence of the donor
oligo, DF-HDR, used to introduce three SNPs (red oversized letters)
into the genome. The third SNP creates a novel EagI restriction
site that was used for RFLP analysis. Pig fibroblasts were
transfected with EIF4GI14.1 TALEN mRNA (2 .mu.g) and DF-HDR (2
.mu.M) and then cultured at 30.degree. C. for 3 days prior to
analysis and colony propagation. Panel b) RFLP analysis on
population three days post transfection. Expected product sizes of
344, 177 and 167 bp are indicated by filled triangles. Panel c)
RFLP assay on isolated cellular clones. Day 3 cells were used to
derive monoclonal colonies through dilution cloning. An example of
colonies with heterozygous (open triangles) or homozygous (filled
triangles) HDR alleles are indicated.
Example 18
Hypothermic Treatment for Maintenance of SNP HDR Alleles
[0125] Referring to FIG. 16, pig fibroblasts were transfected with
TALEN mRNA (1 .mu.g) and oligos (3 .mu.M). Cells from two
independent transfections were pooled for each replicate and evenly
distributed into six wells of a 6-well plate and cultured at
30.degree. C. Samples were collected from these populations for
RFLP analysis on days 1-7 (minus day 6, 1D to 7D along X-axis)
post-transfection and the remaining cells were transferred to
37.degree. C. Samples for each condition were collected again at
day 12 for RFLP analysis. The average HDR and SEM (n=3) is shown at
the initial collection and once again at day 12.
TABLE-US-00003 TABLE 2 Success rate using intentional mismatches
Allele Number of RVD RFLP Locus Species desired mismatches TALEN ID
pos. Confirmed CLPG Goat A to G 0 caCLPG1.1 NA 0/14 CLPG Goat A to
G 2 caCLPG1.1c NA 3/15 DGAT Cow K232A 0 btDGAT 19/96 0/12 14.2 DGAT
Cow K232A 1 btDGAT 15/96 0/12 14.4 DGAT Cow K232A 1 btDGAT 16/96
2/12 14.5 DGAT Cow K232A 1 btDGAT 15/96 3/12 14.6 PRLR Cow Trunc461
0 btPRLR 9.1 NA 3/11 SOCS2 Pig Trunc 0 ssSocs 2.1 75%.sup.b SLC35A3
Cow V180F.sup.a 0 SLC35A3 18%.sup.b 8.3 .sup.aRepair of the
missense allele that results in complex vertebral malformation
(Thomsen, B; Genome Res.; 2006 Jan; 16(1): 97-105.)
.sup.bPercentage of HDR on the population level
Example 19
Intentional RVD Mismatches for Introgression of SNPs
[0126] Referring to FIG. 17, panel a) A TALEN pair (caCLPG 1.1) was
designed to target the caCLPG region. Oligo driven HDR was utilized
to introduce the desired Adenine to Guanine SNP (the targeted
Adenine is boxed). The desired SNP allowed genotyping by a loss of
an AvaII restriction site. Each TALEN monomer is indicated in
shading above their respective binding locations. The N- and
C-termini are indicated with N and C, respectively. b) Each allele
of single-cell derived colonies that were resistant to AvaII were
sequenced (only AvaII resistant alleles are shown). All of the
alleles that contained our SNP or interest (boxed) also contained
deletions (marked with dashes in the AvaII Resistant Allele
sequences) or insertions (marked with dashes in the WT sequence).
c) To reduce the possibility of re-binding, and subsequently
re-cutting, intentional mismatches (italicized circled text) were
introduced into the RVD sequence. The mismatches were placed in the
RVDs directly before and/or after the RVD that would bind to the
desired SNP (boxed) in right monomer of the TALEN. d) TALEN
activity was measured via a CelI assay. The percent of
non-homologous end joining (% NHEJ) was equivalent for 1.1 and 1.1b
(28%), but was greater than 1.1 for 1.1a and 1.1c (30% and 31%
respectively). The no-RNA negative control showed no TALEN activity
(0%). e) Both alleles of AvaII-resistant single-cell derived
colonies produced with caCLPG 1. c were sequenced. The desired SNP
is boxed. Colony 37 and 78 were heterozygous for the desired SNP
and showed no additional indels. Colony 142 was homozygous for the
desired SNP, but contained a 4 bp insertion on one allele.
Example 20
Mismatch Required for SNP Introgression
[0127] Referring to FIG. 18, a mismatch was required for SNP
introgression. A schematic of the bovine DGAT sequence around
K323A. The grey arrows represent the TALEN monomers where they bind
to the DGAT sequence. The left arm consists of 16 RVDs, the right
arm consists of 15 RVDs, and the spacer is 16 base pairs long. The
GC and ggagct, boxed, are the targeted base pairs. The DGAT oligo
converts the GC to an AA to create the desired DGAT mutant. As a
marker for HDR, the boxed GGGAGC is converted to AAGCTT that
creates a novel HindIII restriction site. Since this change is in
the spacer, it should not affect TALEN binding as to not interfere
with the intentional mismatch results. b) DGAT TALEN RVD sequences.
btDGAT 14.2 contains no intentional mismatches in the RVDs. btDGAT
14.4, 14.5, and 14.6 each contain one intentional RVD mismatch at
either position 1, 3, or 5 of the left TALEN monomer (circled). c)
Bovine fibroblasts were transfected with lug of talen and 0.4
nmoles of oligo. Three days after transfection cells were lysed,
the DGAT sequence was amplified by PCR, digested with HindIII and
ran on an acrylamide gel. The percent efficiency of HDR was
determined by densitometry (HR). d) Sequence analysis of colonies
produce with the original 14.2 TALENs. Of twelve colonies, none
that were positive for the HindIII RFLP contained the desired
mutation due to indels overlapping the site. e) Colonies derived
from TALENs 14.5 and 14.6 produced the correct DGAT mutation and
HindIII restriction site. These two TALEN pairs produced a total of
two homozygous (HH) and three heterozygous (Hh) colonies. TALEN
14.4 did not produce any colonies with the correct DGAT mutation
(data not shown).
Example 21
All-in-One TALEN-HDR/Cre-RMCE
[0128] FIG. 19 depicts a process of TALEN-HDR/RMCE. The floxed
cassette is transfected along with TALENs compatible with the
oligo, the loxP oligo and a source of Cre recombinase. For this
process to work, TALENs must cut the target loci followed by repair
with the loxP oligo prior to Cre-mediated RMCE into the repaired
site. The bar graph shows the number of puromycin resistant
colonies produced by this method when YFC-Cre versus mCherry was
included in the transfection. To confirm targeting to the SRY
locus, PCR was conducted across the predicted junction (as
indicated) will result in a 370 bp product. This product is
apparent only when Cre is included. For this set of experiments,
the following conditions were used: 600,000 cells transfected with
1 ug SRY TALENs+0.3 nMol of SSCY_LoxP oligo+CLP-YFP-Cre (0.5
ug)+Floxed PTK (2 ug). The negative control had 0.5 ug of mCherry
plasmid in place of CLP-YFP-Cre. SSCY_LoxP oligo:
TABLE-US-00004 (SEQ ID NO: 80)
TTTTATATACATTTTACACACATATATATGAAACATAACTTCGTATAGGA
GACTTTATACGAAGTTATGGATCCAAGCTTATAACTTCGTATAATGTATG
CTATACGAAGTTATTGACAGTATTAATGGCCTGAACCTAGCCAGAACT
Further Disclosure
[0129] All patents, patent applications, references, and
publications set forth herein are hereby incorporated by reference
herein; in case of conflict, the instant specification is
controlling. The following are examples of embodiments of
inventions set forth herein.
[0130] Certain embodiments are directed to hypothermic conditions
for use of targeting endonucleases. For instance; 1. a hypothermic
method of template-directed repair to change a chromosomal DNA of a
cell, comprising introducing into a living cell a targeted nuclease
system and a nucleic acid template, wherein the targeted nuclease
system and the template operate to alter the chromosomal DNA to
have identity to the template sequence wherein the living cell is
maintained at a hypothermic culturing temperature below a
physiological temperature for a time period of more than three days
measured from the time of the introduction. 2. The method of 1 with
the hypothermic culturing increasing a stable incorporation of the
template sequence into the chromosomal DNA. 3. The method of 1
wherein the culturing temperature is kept within a range from 20 to
34.degree. C. 4. The method of 1 wherein the time period is more
than three days. 5. The method of 1 wherein the time period ranges
from more than three days to about two weeks. 6. The method of 1
further comprising testing the cell for the template sequence. 7.
The method of 1 wherein targeted nuclease system comprises Cas9 and
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
or a plurality of TAL effector repeat sequences that are fused to
the nuclease (TALEN). 8. The method of 6 wherein the nucleic acid
guide is an ssDNA. 9. The method of 1 wherein one or more of the
nuclease, the nucleic acid guide, and the nucleic acid template are
introduced into the cell as an mRNA. 10. The method of 1 wherein
the cell is selected from the group consisting of a primary cell, a
primary somatic cell, n egg, a sperm, a zygote, a germ cell, a stem
cell, an oocyte, a sperm, and an embryo. 11. The method of 1
wherein the animal is homozygous for the template sequence. 12. A
cell made by the method of 1.
[0131] And, for instance, 1. A method of template-directed repair
to change a chromosomal DNA of a cell, comprising introducing into
a living cell a targeted nuclease system, a nucleic acid template,
and a cold-factor for inhibiting cell growth, wherein the targeted
nuclease system and the template operate to alter the chromosomal
DNA to have identity to the template sequence. 2. The method of 1
wherein the cold-factor for inhibiting cell growth, comprises
Cold-inducible RNA-binding protein (CIRP). See Nishiyama et al., J.
Cell Biol., (1997):137(4):899-908. 3. The method of 1 wherein the
cell-cycle inhibitor is introduced by placement into a culture that
comprises the cell. 4. The method of 1 wherein the cell-cycle
inhibitor is introduced as a protein, as RNA, as an mRNA, or
through a vector encoding the cell-cycle inhibitor. 5. The method
of 4 wherein the template is a HDR template. 6. The method of 1
wherein template is an ssDNA. 7. The method of 1 wherein one or
more of the nuclease system and the nucleic acid template are
introduced into the cell as an mRNA. 8. The method of 1 wherein the
cell is selected from the group consisting of a primary cell, a
primary somatic cell, a zygote, a germ cell, a stem cell, and an
embryo. 9. A genetically modified animal prepared according to the
method of any of 1-8. 10. A founder animal made by the method of
any of 1-9. 11. A cell made by the method of any of 1-10.
[0132] As is plainly evident, the various allelic and genetic
modifications set forth herein are contemplated. Embodiments of
these include, for example, 1. A nonhuman animal comprising a
heritable exogenous allele that provides elevated fecundity and/or
a heritable exogenous allele that provides parent-of-origin
dependent muscle hypertrophy. 2. The animal of 1 being a goat. 3.
The animal of 1 being a chosen from the group consisting of
livestock, primate, swine, cattle, horse, sheep, goat, chicken,
rabbit, fish, dog, mouse, cat, rat, and laboratory animal. 4. The
animal of 1 being free of fluorescent markers, selectable markers,
and expressible markers. 5. The animal of 1 wherein the elevated
fecundity allele is FecB; BMPR-IB. 6. The animal of 1 wherein the
muscle hypertrophy allele is Callipyge. 7. The animal of 1 wherein
the animal is homozygous for the exogenous allele.
[0133] And, for example, 1. A non-human animal comprising an
exogenous allele for APC. 2. The animal of 1 wherein the allele is
directed to a cancerous phenotype. 3. The animal of 1 wherein the
exogenous allele is a human allele. 4. The animal of 1 being a
laboratory animal model. 5. The animal of 1 being selected from the
group consisting of pig, miniature pig, Ossabow pig, rabbit, dog,
sheep, and goat. 6. The animal of 1 being a founder. 7. The animal
of 1 being free of chromosomal changes other than introgression of
the exogenous allele. 8. A method of making the animal of 1
comprising an HDR templated introgression of the exogenous allele
with a targeted nuclease system. 9. The method of 8 wherein the
exogenous allele is chosen to be a human allele that is associated
with a cancerous phenotype.
[0134] And, for example, 1. An animal comprising an exogenous
allele of selected from Table 1 entitled "Frequencies for recovery
of colonies with HDR alleles". 2. A method comprising introgressing
an allele into an animal, the allele being chosen from the group
listed on said Table 1 or as follows. 3. The animal of 1 or method
of 2, wherein the allele: is LDLR, e.g., for cholesterol modeling;
is DAZL, e.g., for sterility; is APC, e.g., for cancer modeling; is
p53; is RAG2, e.g., knocked-out for immunosuppression; is IL-2,
e.g., knocked-out for immunosuppression (not in Table); is a double
knock-out of RAG2 and 11-2 for immunosuppression (not in Table); is
ROSA, e.g., for a safe harbor; is SRY, e.g., for modifications to a
Y chromosome, for sex selection; --is KISS OR KISSR, e.g., for
maturation or prevention thereof, e.g., knockout; --is GDF8, e.g.,
for increasing muscling in animals; --is EIF4G, e.g., for
resistance to foot and mouth diseases (FMDV); --is p65 for
resistance to African Swine Fever; --is caFecB for twinning,
including interspecies introgression; --is Diglyceride
acyltransferase (DGAT) knockout for increased dairy merit; --is
ATP-binding cassette sub-family G member 2 (ABCG2) for increased
dairy merit; is pleiomorphic adenoma gene 1 (PLAG1) for influencing
age at puberty, stature and body weight; is Beta lactoglobulin for
reducing allergenicity of milk, is ovomucoid, ovalbumin,
ovotransferrin, or lysozyme for reducing allergenicity of avian
eggs. 4. A use of the animal of 1 or 3 as indicated. 5. A pig,
sheep, goat, or cow with the introgressed allele of 3. 6. A cell or
animal of any of 1-5. 7. The cell or animal of 6 being vertebrate,
livestock, primate, swine, cattle, horse, sheep, goat, chicken,
rabbit, fish, dog, mouse, cat, rat, or laboratory animal.
[0135] And, for example, 1. A method of creating a single
nucleotide polymorphism (SNP) in a chromosomal DNA of a cell,
comprising introducing a targeted nuclease system and a HDR
template into the cell, with the targeted nuclease system
comprising a DNA-binding member for specifically binding an
endogenous cognate sequence in the chromosomal DNA, wherein the
targeted nuclease system and the HDR template operate to alter the
chromosomal DNA to have identity to the HDR template sequence,
wherein the HDR template sequence comprises a SNP. 2. The method of
1 wherein the HDR template sequence comprises a plurality of SNPs.
3. The method of 1 or 2 wherein the HDR template sequence comprises
an exogenous allele that replaces an endogenous allele, with the
exogenous allele comprising an SNP in a sequence alignment with the
endogenous allele. 4. The method of any of 1-3 being free of SNPs
outside of the exogenous allele. 5. The method of 4 with the HDR
template sequence being identical to the chromosomal DNA except for
one or more SNPs in the exogenous allele. 6. The method of 5
wherein there is only one SNP. 7. The method of any of 1-6 wherein
the HDR template is designed to reduce specific binding of the
DNA-binding member to the HDR template sequence and the HDR
template sequence comprises a SNP, as aligned with the chromosomal
DNA.
[0136] For example: A genetically modified animal from a first
breed comprising an allele of a gene selected from another species
or another breed; wherein the animal of the first breed is free of
genetic changes other than the allele; methods of making the animal
as set forth herein.
[0137] For example: 1. A method of homology-directed repair (HDR)
to introgress an exogenous allele into chromosomal DNA of a cell,
comprising introducing a targeted endonuclease system and a HDR
template that comprises the exogenous allele into the cell, with
the targeted nuclease system comprising a DNA-binding member for
specifically binding an endogenous cognate sequence in the
chromosomal DNA, wherein the targeted nuclease system and the HDR
template operate to alter the chromosomal DNA to have identity to
the HDR template sequence to introgress the exogenous allele into
the chromosomal DNA in place of an endogenous allele, with the
targeting endonuclease system and/or HDR template comprising a
feature to reduce specific binding of the targeting endonuclease
system to DNA. 2. The method of 1 wherein the feature to reduce
specific binding comprises a mismatch in the DNA-binding member
sequence relative to the endogenous cognate sequence and/or a
mismatch in the DNA-binding member sequence relative to the HDR
template sequence. 3. The method of 2 wherein the targeted
endonuclease system comprises a plurality of TAL effector repeat
sequences that are fused to a nuclease (TALEN), with the TALEN
comprising a sequence of Repeat Variable Diresidues (RVDs) and the
mismatch is in the sequence of RVDs relative to the endogenous
cognate sequence. 4. The method of 2-3 wherein the targeted
nuclease system comprises a Cas9 nuclease and a guide RNA, with the
mismatch being in the gRNA sequence relative to the endogenous
cognate sequence. 5. The method of 2-4 wherein the targeted
endonuclease system comprises a plurality of TAL effector repeat
sequences that are fused to a nuclease (TALEN), with the TALEN
comprising a sequence of Repeat Variable Diresidues (RVDs) and the
mismatch is in the sequence of RVDs relative to the HDR template
sequence. 6. The method of 2-5 wherein the targeted nuclease system
comprises a Cas9 nuclease and a guide RNA, with the mismatch being
in the gRNA relative to the HDR template sequence. 7. The method of
2-6 wherein the exogenous allele is a natural allele and the HDR
template comprises the mismatch, with the mismatch creating a
sequence that is not found in nature. 8. The method of 2-7 wherein
the exogenous allele is free of mismatches and comprises DNA
expressed by the cell. 9. The method of 2-8 wherein the exogenous
allele is comprises the mismatch and comprises DNA expressed by the
cell. 10. The method of 2-9 comprising selecting the DNA-binding
member sequence and the endogenous cognate sequence so that
altering the chromosomal DNA to have identity to the HDR template
sequence creates the mismatch in the DNA-binding member sequence
relative to the altered chromosomal DNA sequence. 11. The method of
1-8 wherein the exogenous allele is a natural allele and the HDR
template consists of the natural allele and DNA that has an
identity with the chromosomal DNA sequence. 12. The method of 1-8
wherein selecting the DNA-binding member sequence and the
endogenous cognate sequence further comprises placing a second
mismatch in the endogenous cognate sequence that is not changed
when the chromosomal DNA is altered to have identity to the HDR
template. 13. The method of 2-11 comprising selecting the
DNA-binding member sequence and the endogenous cognate sequence to
place the mismatch in the endogenous cognate sequence relative to
the DNA-binding sequence, and altering the chromosomal DNA to have
identity to the HDR template sequence does not remove the mismatch.
14. The method of 2-13 wherein the mismatch comprises an insertion,
a deletion, or a substitution. 15. The method of 1-12 wherein the
insertion, deletion, or substitution has a length from 1 to 20
residues. 16. The method of 1-14 wherein the insertion, deletion,
or substitution has a length from 1 to 20 residues. 17. The method
of 2 wherein the mismatch is one SNP. 18. The method of 2
comprising a plurality of mismatches. 19. The method of 1-16
wherein the targeting endonuclease system comprises a pair of
TALENs that localize to the chromosomal DNA with a spacer sequence
between the pair, wherein the feature comprises selecting the HDR
template to create a change in a length of the spacer sequence to
block cleavage of the DNA by the TALENs pair. 20. The method of 17
wherein the spacer length is decreased by a deletion or increased
by an insertion. 21. The method of 17 wherein the spacer length is
increased or decreased by a number of residues in a range from 1 to
60. 22. The method of any of 1-19 wherein the cell is selected from
the group consisting of a primary cell, a primary somatic cell, a
zygote, a germ cell, a stem cell, an oocyte, a sperm, and an
embryo. 23. The method of any of 1-20 wherein the HDR template is
an ssDNA. 24. The method of any of 1-21 wherein the nuclease system
is introduced into the cell as an mRNA. 25. The method of any of
1-22 wherein the targeted nuclease system specifically binds the
endogenous cognate sequence with a binding protein. 26. The method
of any of 1-23 wherein the exogenous allele comprises an APC
allele. 27. The method of any of 1-24 being free of reporters,
fluorescent markers, selectable markers, and expressible markers.
28. The method of any of 1-25 wherein the cell is a livestock cell.
29. The method of any of 1-25 wherein the cell is from vertebrate,
livestock, primate, swine, cattle, horse, sheep, goat, chicken,
rabbit, fish, dog, mouse, cat, rat, and laboratory animal. 30. The
method of any of 1-28 wherein the animal is homozygous for the
exogenous allele. 31. A method of making a genetically modified
animal comprising cloning a cell modified by the method of any of
1-30. 32. The method of any of 1-30 wherein the animal is a
founder. 33. A genetically modified animal prepared according to
the method of any of 1-32. 34. A founder animal made by the method
of any of 1-33. 35. A cell made by the method of any of 1-30. 36. A
kit comprising the targeted nuclease system and the HDR template of
any of 1-34. 37. A use of any of 1-35 comprising preparing a cell
for research in vitro, or preparing a cell for use in making an
animal. 38. A genetically modified animal, the animal belonging to
a breed having an endogenous allele in the chromosomal DNA of the
animal, the animal comprising a change at an SNP, the SNP being in
the endogenous allele relative to an exogenous allele found in
another species or another breed of animal. Similarly, 2 A
genetically modified animal, the animal belonging to a breed having
an endogenous allele in the chromosomal DNA of the animal, the
animal comprising an exogenous allele found in another species or
another breed of animal, with the exogenous allele having a change
at an SNP relative to the endogenous allele. In other words, the
modified animal has an SNP so that it now has an allele that is not
normally found in its breed, with that allele being from some other
breed or species. The change could be only that SNP or there could
be other changes, with the SNP being necessary to mirror the
desired allele. The SNP is not a result of random processes, but is
an intended result. 39. The animal of 38 comprising a plurality of
the SNPs. 40. The animal of 38 comprising further changes in the
chromosomal DNA of the animal relative to the exogenous allele. 41.
The animal of any of 38-40 being free or reporters. 42. The animal
of any of 38-41 being homozygous for the SNP and/or the SNPs. 43.
The animal of any of 38-42 being from vertebrate, livestock,
primate, swine, cattle, horse, sheep, goat, chicken, rabbit, fish,
dog, mouse, cat, rat, and laboratory animal. 44. A method of
creating a landing pad in a chromosomal DNA of a cell, comprising
introducing a targeted nuclease system and a HDR template into the
cell, with the targeted nuclease system comprising a DNA-binding
member for specifically binding an endogenous cognate sequence in
the chromosomal DNA, wherein the targeted nuclease system and the
HDR template operate to alter the chromosomal DNA to have identity
to the HDR template sequence, wherein the HDR template sequence
comprises a landing pad.
Sequence CWU 1
1
106190DNAsus scrofa 1tgccgagacg ggaaatgaat ctcctacaag tggatttgtg
atgggaacac cgagtgcaag 60gacgggtccg atgagtccct ggagacgtgc
90246DNAArtificial SequenceHDR template 2cctacaagtg gatttgtggg
atccacaccg agtgtaagga cgggtc 46360DNAArtificial SequenceHDR
template 3tgcacctcct acaagtggat ttgtgggatc cacaccgagt gcaaggacgg
gtccgctgag 60490DNAArtificial SequenceHDR template 4tgccgagacg
ggaaatgcat ctcctacaag tggatttgtg ggatccacac cgagtgcaag 60gacgggtccg
atgagtccct ggagacgtgc 90589DNAArtificial SequenceHDR template
5ccgagacggg aaatgcacct cctacaagtg gatttgtgat ggatccgaac accgagtgca
60aggacgggtc cgctgagtcc ctggagacg 89686DNAArtificial SequenceHDR
template 6tgccgagacg ggaaatgcac ctcctacaag tggatttggg atccaccgag
tgcaaggacg 60ggtccgctga gtccctggag acgtgc 86723DNAArtificial
SequenceGuide sequence 7gctcaccaac ggtctcctct cgg
23822DNAArtificial SequenceGuide Sequence 8gttgccagag gagagccccc tg
22992DNAsus scrofa 9gggcctctgg gctcaccaac ggtctcctct cgggggacga
agacttctcc tccattgcgg 60acatggactt ctcagccctt ctgagtcaga tc
921090DNAArtificial SequenceHDR template 10gggcctctgg gctcaccaac
ggtctcctcc cgggggacga agacttctcc tccattgcgg 60acatggactt ctcagccctt
ctgagtcaga 901115DNAArtificial sequenceTALENs 11ctcctccatt gcgga
151215DNAArtificial SequenceTALENs 12cttctgagtc agatc
151318DNAArtificial SequenceTALENs 13ggaagaagta tcagccat
181415DNAArtificial SequenceTALENs 14acagaaattc tgggt
151523DNAArtificial Sequenceguide sequence 15gggagggtcc ttctgtcttt
aag 231686DNAsus scrofa 16ccagatcgcc aaatgcatgg aagaagtatc
agccattcat ccctcccagg aagacagaaa 60ttctgggtca accacggagt tgcact
861789DNAArtificial SequenceHDR template 17ccagatcgcc aaagtcacgg
aagaagtatc agccattcat ccctcccagt gaacttacag 60aaattctggg tcgaccacgg
agttgcact 891858DNAArtificial SequenceHDR template 18aaggccaatt
actgctctgg agaatatgaa ttcgtatttt tgcaaaagta tcctcata
581914DNAArtificial SequenceHDR template 19gctctggaga atgt
142058DNAsus scrofa 20aaggccaatt actgctctgg agaatgtgaa tttgtatttt
tgcaaaagta tcctcata 582114DNAArtificial SequenceTALEN 21gctctggaga
atat 142214DNAArtificial SequenceTALEN 22aaaagtatcc tcat
142353DNABos taurus 23tccgtccttt gccaaccttg gccgaccagc ccttagcaac
cgtgggcccc caa 532418DNAArtificial SequenceTALENs 24ccgtcctttg
ccaacctt 182518DNAArtificial SequenceTALENs 25agcaaccgtg ggccccca
182653DNAArtificial SequenceTALENs 26tccgtccttt gccgacttcg
gccgaccagc ccttagcaac cgtgggcccc caa 532722DNAOvis aries
27gctgagagcg caggaatcca gg 222822DNAOvis aries 28cgactctcgc
gtccttaggt cc 222921DNAOvis aries 29gctgggacca cctgtcagat c
213021DNAOvis aries 30cgaccctggt ggacagtcta g 213158DNAOvies aries
31gctgagagcg caggaatcca ggcgcagggg cccgagggct gggaccacct gtcagatc
583230DNAArtificial SequenceArtificial allele of caCLPG
32gctgagagcg ctggggccac ctgtcaggtc 303350DNAArtificial
SequenceArtificial allele of caCLPG 33gctgagagcg caggaatcca
ggcgcgaggg ctggggccac ctgtcagatc 503439DNAArtificial
SequenceArtificial allele of caCLPG 34gctgagagcg caggaatcct
gcgggccacc tgtcagatc 393532DNAArtificial SequenceArtificial allele
of caCLPG 35gctgaccgag ggctggggcc acctgtcaga tc 323654DNAArtificial
SequenceArtificial allele of caCLPG 36ctgagagcgc aggaatccag
gcgcagggcg agggctgggg ccacctgtca gatc 543759DNAArtificial
SequenceArtificial allele of caCLPG 37gctgagagcg ctggaatcca
ggcgcagggg ccccgagggc tggggccacc agtcagatc 593861DNAArtificial
SequenceArtificial allele of caCLPG 38gctgagagcg caggaatcca
ggcgcagggg gggcccgagg gctggggcca cctgtcagat 60c 613955DNAArtificial
SequenceArtificial allele of caCLPG 39gctgagagcg caggaatcca
ggcgcagggc gagggctggg gccacctgtc agatc 554054DNAArtificial
SequenceArtificial allele of caCLPG 40ctgagagcgc aggaatccag
gcgcgatccg agggctgggg ccacctgtca gatc 544150DNAArtificial
SequenceArtificial allele of caCLPG 41gctgagagcg caggaatcca
ggcgcgaggg ctggggccac ccgtcagatc 504255DNAArtificial
SequenceArtificial allele of caCLPG 42gctgagagcg caggaatcca
ggcgcgatcc gagggctggg gccacctgtc agatc 554345DNAArtificial
SequenceArtificial allele of caCLPG 43gctgagagcg caggaatcca
ggcgcagggg cccacctgtc agatc 454430DNAArtificial SequenceArtificial
allele of caCLPG 44gctgagagcg ctggggccac ctgtcagatc
304555DNAArtificial SequenceArtificial allele of caCLPG
45gctgagagcg caggaatcca cgcgcagggc gagggctggg gccacctgtc agatc
554638PRTArtificial SequenceTALENs repeat variable di-residues
46Asn Asn Asn Ile Asn Asn Asn Ile Asn Asn His Asp Asn Asn His Asp 1
5 10 15 Asn Ile Asn Asn Asn Asn Asn Ile Asn Ile Asn Gly His Asp His
Asp 20 25 30 Asn Ile Asn Asn Asn Asn 35 4738PRTArtificial
SequenceTALENs reapeat variable di-residues 47Asn Asn Asn Ile Asn
Asn Asn Ile Asn Asn His Asp Asn Asn His Asp 1 5 10 15 Asn Ile Asn
Asn Asn Asn Asn Ile Asn Ile Asn Gly His Asp His Asp 20 25 30 Asn
Ile Asn Asn Asn Asn 35 4838PRTArtificial SequenceTALENs repeat
variable di-residues 48Asn Asn Asn Ile Asn Asn Asn Ile Asn Asn His
Asp Asn Asn His Asp 1 5 10 15 Asn Ile Asn Asn Asn Asn Asn Ile Asn
Ile Asn Gly His Asp His Asp 20 25 30 Asn Ile Asn Asn Asn Asn 35
4938PRTArtificial SequenceTALENs repeat variable di-residues 49Asn
Asn Asn Ile Asn Asn Asn Ile Asn Asn His Asp Asn Asn His Asp 1 5 10
15 Asn Ile Asn Asn Asn Asn Asn Ile Asn Ile Asn Gly His Asp His Asp
20 25 30 Asn Ile Asn Asn Asn Asn 35 5036PRTArtificial
SequenceTALENs repeat variable di-residues 50His Asp Asn Gly Asn
Asn Asn Ile His Asp Asn Ile Asn Asn Asn Asn 1 5 10 15 Asn Gly Asn
Asn Asn Asn Asn Gly His Asp His Asp His Asp Asn Ile 20 25 30 Asn
Asn His Asp 35 5136PRTArtificial SequenceTALENs repeat variable
di-residues 51His Asp Asn Gly Asn Asn Asn Ile His Asp Asn Ile Asn
Asn Asn Asn 1 5 10 15 Asn Gly Asn Asn Asn Asn Asn Gly Asn Ile His
Asp His Asp Asn Ile 20 25 30 Asn Asn His Asp 35 5236PRTArtificial
SequenceTALENs repeat variable di-residues 52His Asp Asn Gly Asn
Asn Asn Ile His Asp Asn Ile Asn Asn Asn Asn 1 5 10 15 Asn Gly Asn
Asn Asn Ile Asn Gly His Asp His Asp His Asp Asn Ile 20 25 30 Asn
Asn His Asp 35 5336PRTArtificial SequenceTALENs repeat variable
di-residues 53His Asp Asn Gly Asn Asn Asn Ile His Asp Asn Ile Asn
Asn Asn Asn 1 5 10 15 Asn Gly Asn Asn Asn Ile Asn Gly Asn Ile His
Asp His Asp Asn Ile 20 25 30 Asn Asn His Asp 35 5458DNAArtificial
SequenceArtificial allele 54gctgagagcg caggaatcca ggcgcagggg
cccgagggct gggaccacct gtcagatc 585558DNAArtificial
SequenceArtificial Allele 55gctgagagcg caggaatcca ggcgcagggg
cccgagggct ggggccacct gtcagatc 585658DNAArtificial
SequenceArtifical Allele 56gctgagagcg caggaatccg ggcgcagggg
cccgagggct gggaccacct gtcagatc 585758DNAArtificial
SequenceArtificial Allele 57gctgagagcg caggaatcca ggcgcagggg
cccgagggct ggggccacct gtcagatc 585858DNAArtificial
SequenceArtificial Allele 58gctgagagcg caggaatcca ggcgcagggg
cccgagggct gggaccacct gtcagatc 585958DNAArtificial
SequenceArtificial Allele 59gctgagagcg caggaatcca ggcgcagggg
cccgagggct ggggccacct gtcagatc 586062DNAOvis aries 60gctgagagcg
caggaatcca ggcgcagggg cgggcccgag ggctggggcc acctgtcaga 60tc
626148DNABos taurus 61tggcaggtaa ggcggccaac gggggagctg cccagcgcac
cgtgagct 486248DNABos taurus 62accgtccatt ccgccggttg ccccctcgac
gggtcgcgtg gcactcga 486332PRTArtificial SequenceTALENs repeat
variable di-residues 63Asn Asn Asn Asn His Asp Asn Ile Asn Asn Asn
Asn Asn Gly Asn Ile 1 5 10 15 Asn Ile Asn Asn Asn Asn His Asp Asn
Asn Asn Asn His Asp His Asp 20 25 30 6430PRTArtificial
SequenceTALENs repeat variable di-residues 64Asn Ile Asn Asn His
Asp Asn Gly His Asp Asn Ile His Asp Asn Asn 1 5 10 15 Asn Asn Asn
Gly Asn Asn His Asp Asn Asn His Asp Asn Gly 20 25 30
6532PRTArtificial SequenceTALENs repeat variable di-residues 65His
Asp Asn Asn His Asp Asn Ile Asn Asn Asn Asn Asn Gly Asn Ile 1 5 10
15 Asn Ile Asn Asn Asn Asn His Asp Asn Asn Asn Asn His Asp His Asp
20 25 30 6630PRTArtificial SequenceTALENs repeat variable
di-residue 66Asn Ile Asn Asn His Asp Asn Gly His Asp Asn Ile His
Asp Asn Asn 1 5 10 15 Asn Asn Asn Gly Asn Asn His Asp Asn Asn His
Asp Asn Gly 20 25 30 6732PRTArtificial SequenceTALENs repeate
variable di-residue 67Asn Asn Asn Asn Asn Ile Asn Ile Asn Asn Asn
Asn Asn Gly Asn Ile 1 5 10 15 Asn Ile Asn Asn Asn Asn His Asp Asn
Asn Asn Asn His Asp His Asp 20 25 30 6830PRTArtificial
SequenceTALENs repeat variable di-residue 68Asn Ile Asn Asn His Asp
Asn Gly His Asp Asn Ile His Asp Asn Asn 1 5 10 15 Asn Asn Asn Gly
Asn Asn His Asp Asn Asn His Asp Asn Gly 20 25 30 6932PRTArtificial
SequenceTALENs repeat variable di-residue 69Asn Asn Asn Asn His Asp
Asn Ile His Asp Asn Asn Asn Gly Asn Ile 1 5 10 15 Asn Ile Asn Asn
Asn Asn His Asp Asn Asn Asn Asn His Asp His Asp 20 25 30
7030PRTArtificial SequenceTALENs repeat variable di-residue 70Asn
Ile Asn Asn His Asp Asn Gly His Asp Asn Ile His Asp Asn Asn 1 5 10
15 Asn Asn Asn Gly Asn Asn His Asp Asn Asn His Asp Asn Gly 20 25 30
7147DNAArtificial SequenceArtificial Allele 71gcaggtaaga aggccaacgg
aagctttgcc cagcgcaccg tgagcta 477244DNAArtificial
SequenceArtificial Allele 72gcaggttagg cagccaaccg agctgtacac
cgccccctga gctt 447342DNAArtificial SequenceArtificial Allele
73gcaggtaagg cggccaacgc taccccaccc acccggggct ta
427444DNAArtificial SequenceArtificial Allele 74gcaggtaagg
cggccaacgg gacttcccat tggaccgtga gcta 447545DNAArtificial
SequenceArtificial Allele 75gcaggtaagg cggccaacgg ggtctgccca
gcacaacggg agcta 457643DNAArtificial SequenceArtificial Allele
76gcaggtaagg cggccaacct gctccccaca ccacgagcta cta
437743DNAArtificial SequenceArtificial Allele 77gcaggtaagg
cggccaacga ggtgcccccg ggagctaccc cta 437842DNAArtificial
SequenceArtificial Allele 78gcaggtaagg cggccaactg ccgcccacac
caccagctac cc 427935DNAArtificial SequenceArtificial Allele
79gcaggtaagg cggccgccca gctgcccgtg agcta 3580148DNAArtificial
SequenceHDR template 80ttttatatac attttacaca catatatatg aaacataact
tcgtatagga gactttatac 60gaagttatgg atccaagctt ataacttcgt ataatgtatg
ctatacgaag ttattgacag 120tattaatggc ctgaacctag ccagaact
1488147DNAArtificial SequenceArtificial Allele 81gcaggtaagg
gggacaggtt acaaggaacc catggcaccg tgagcta 478234DNAArtificial
SequenceArtificial Allele 82caggtaagaa ggccaacgga agctttgccc agcg
348334DNAArtificial SequenceArtificial Allele 83caggtaagaa
ggccaacgga agctttgccc agcg 348434DNAArtificial SequenceArtificial
Allele 84caggtaagaa ggccaacgga agctttgccc agcg 348534DNAArtificial
SequenceArtificial Allele 85caggtaagaa ggccaacgga agctttgccc agcg
348634DNAArtificial SequenceArtificial Allele 86caggtaagaa
ggccaacgga agctttgccc agcg 348734DNAArtificial SequenceArtificial
Allele 87caggtaagaa ggccaacgga agctttgccc agcg 348825DNABos taurus
88caaagttggt gacgtgacag aggtc 258924DNABos taurus 89gtgtgccatc
cctactttgt ggaa 249022DNAArtificial SequencePCR primer 90gatgtattcc
tcagactttt cc 229120DNAArtificial SequencePCR primer 91gtggaatctc
atcttaccaa 209223DNAArtificial SequencePCR Primer 92ggcaagttgc
tcagctgttt ttg 239322DNAArtificial SequencePCR primer 93tccgcatggt
ttagcaggat tc 229424DNAArtificial SequencePCR Primer 94atcgaacctg
ggtcttctgc attg 249523DNAArtificial SequencePCR Primer 95tccgcatggt
ttagcaggat tca 239625DNAArtificial SequencePCR primer 96ccttgaggta
ggagagtgtt ttggg 259725DNAArtificial SequencePCR primer
97ttcaccagaa gacaaggaga attgc 259827DNAArtificial SequencePCR
primer 98taaggccaat tactgctctg gagacta 279928DNAArtificial
SequencePCR primer 99cctttttaga agtcaaggta acagacac
2810024DNAArtificial SequencePCR Primer 100tgattggaga catctttgtg
ggag 2410127DNAArtificial SequencePCR primer 101taaggccaat
tactgctctg gagatta 2710224DNAArtificial SequencePCR primer
102gcatcgagat tctgtcacaa tcaa 2410325DNAArtificial SequencePCR
primer 103acgtactctt catttcacag cctac 2510425DNAArtificial
SequencePCR Primer 104gtctggggtg agatagtttt cttgg
2510524DNAArtificial SequencePCR Primer 105ggcagagatg ttggtcttgg
gtgt 2410646DNAArtificial SequenceTALENs 106ctcctccatt gcggacatgg
acttctcagc ccttctgagt cagatc 46
* * * * *