U.S. patent application number 14/105563 was filed with the patent office on 2014-06-19 for precision gene targeting to a particular locus in maize.
The applicant listed for this patent is Dow AgroSciences LLC. Invention is credited to W. Michael AINLEY, James W. BING, David H. CORBIN, Steven L. EVANS, Joseph F. PETOLINO, Lakshmi SASTRY-DENT, Steven A. THOMPSON, Steven R. WEBB, Mary E. WELTER, Ning ZHOU.
Application Number | 20140173783 14/105563 |
Document ID | / |
Family ID | 49883309 |
Filed Date | 2014-06-19 |
United States Patent
Application |
20140173783 |
Kind Code |
A1 |
AINLEY; W. Michael ; et
al. |
June 19, 2014 |
PRECISION GENE TARGETING TO A PARTICULAR LOCUS IN MAIZE
Abstract
The present invention claims methods for the stable integration
of exogenous DNA into a specific locus, E32, in the maize genome
through the use of zinc finger nucleases. Maize plants and plant
parts that were transformed by the methods of the invention are
claimed. The invention is useful for creating desirable traits such
as herbicide resistance, herbicide tolerance, insect resistance,
insect tolerance, disease resistance, disease tolerance, stress
tolerance, and stress resistance in maize The E32 locus represents
a superior site for inserting foreign genes because native
agronomic phenotypes are not disturbed.
Inventors: |
AINLEY; W. Michael; (Carmel,
IN) ; BING; James W.; (Zionsville, IN) ;
CORBIN; David H.; (Carmel, IN) ; EVANS; Steven
L.; (Zionsville, IN) ; PETOLINO; Joseph F.;
(Zionsville, IN) ; SASTRY-DENT; Lakshmi; (Avon,
IN) ; THOMPSON; Steven A.; (Carmel, IN) ;
WEBB; Steven R.; (Westfield, IN) ; WELTER; Mary
E.; (Westfield, IN) ; ZHOU; Ning; (Zionsville,
IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dow AgroSciences LLC |
Indianapolis |
IN |
US |
|
|
Family ID: |
49883309 |
Appl. No.: |
14/105563 |
Filed: |
December 13, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61820231 |
May 7, 2013 |
|
|
|
61736856 |
Dec 13, 2012 |
|
|
|
Current U.S.
Class: |
800/320.1 ;
435/468 |
Current CPC
Class: |
C12N 9/1241 20130101;
C12N 15/8213 20130101; C12Y 207/07047 20130101 |
Class at
Publication: |
800/320.1 ;
435/468 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1. A method for integrating one or more exogenous nucleic acid
sequences into the genome of a maize cell having an E32 locus, said
method comprising: making a double-stranded cleavage in the E32
locus using a site specific nuclease, ligating into the cleavage a
polynucleotide comprising the one or more exogenous sequences into
the genome of the maize cell within the E32 locus.
2. The method of claim 1 wherein the site specific nuclease
comprises one or more zinc finger nuclease selected from the group
shown in Table 1A.
3. The method of claim 1, further comprising the step of expressing
a product of the one or more exogenous sequences.
4. The method of claim 2, further comprising the step of expressing
a product of the one or more exogenous sequences.
5. The method of claim 1, wherein the one or more exogenous nucleic
acid sequences comprise a coding sequence, a regulatory sequence,
or a target site for a DNA-binding domain.
6. The method of claim 2, wherein the one or more exogenous nucleic
acid sequences comprise a coding sequence, a regulatory sequence,
or a target site for a DNA-binding domain.
7. The method of claim 3, wherein the one or more exogenous nucleic
acid sequences comprise a coding sequence, a regulatory sequence,
or a target site for a DNA-binding domain.
8. The method of claim 4, wherein the one or more exogenous nucleic
acid sequences comprise a coding sequence, a regulatory sequence,
or a target site for a DNA-binding domain.
9. The method of claim 5, wherein the coding sequence encodes for a
product that confers: herbicide resistance; herbicide tolerance;
insect resistance; insect tolerance; disease resistance; disease
tolerance; stress tolerance; stress resistance; a change in
oxidative stress; increased yields of oil; a change in food content
and makeup; a change in physical appearance; male sterility;
drydown; standability; prolificacy; a change in starch quantity or
quality; a change in oil quality; a change in protein quality or
quantity; a change in amino acid composition or combinations
thereof.
10. The method of claim 6, wherein the coding sequence encodes for
a product that confers: herbicide resistance; herbicide tolerance;
insect resistance; insect tolerance; disease resistance; disease
tolerance; stress tolerance; stress resistance; a change in
oxidative stress; increased yields of oil; a change in food content
and makeup; a change in physical appearance; male sterility;
drydown; standability; prolificacy; a change in starch quantity or
quality; a change in oil quality; a change in protein quality or
quantity; a change in amino acid composition or combinations
thereof.
11. The method of claim 7, wherein the coding sequence encodes for
a product that confers: herbicide resistance; herbicide tolerance;
insect resistance; insect tolerance; disease resistance; disease
tolerance; stress tolerance; stress resistance; a change in
oxidative stress; increased yields of oil; a change in food content
and makeup; a change in physical appearance; male sterility;
drydown; standability; prolificacy; a change in starch quantity or
quality; a change in oil quality; a change in protein quality or
quantity; a change in amino acid composition or combinations
thereof.
12. The method of claim 8, wherein the coding sequence encodes for
a product that confers: herbicide resistance; herbicide tolerance;
insect resistance; insect tolerance; disease resistance; disease
tolerance; stress tolerance; stress resistance; a change in
oxidative stress; increased yields of oil; a change in food content
and makeup; a change in physical appearance; male sterility;
drydown; standability; prolificacy; a change in starch quantity or
quality; a change in oil quality; a change in protein quality or
quantity; a change in amino acid composition or combinations
thereof.
13. The method of claim 3 wherein the exogenous sequence is chose
from the group consisting of the PAT gene and the AAD-1 gene.
14. The method of claim 4 wherein the exogenous sequence is chose
from the group consisting of the PAT gene and the AAD-1 gene.
15. The method of claim 1, wherein the polynucleotide further
comprises nucleotide sequences that are homologous to sequences in
the E32 locus.
16. The method according to claim 15, wherein the homologous
nucleotide sequences flank the exogenous sequence.
17. The method of claim 1, wherein the polynucleotide further
comprises a promoter.
18. The method of claim 1, wherein one or more of the integrated
exogenous nucleic acid sequences are transmitted to progeny in
subsequent generations.
19. A maize plant or maize plant part, comprising one or more
exogenous sequences integrated into the E32 locus according to the
method of claim 1.
20. A maize seed comprising one or more exogenous sequences
integrated into the E32 locus according to the method of claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 61/736856, filed Dec. 13, 2012 and to U.S.
Provisional Patent Application No. 61/820231 filed on May 7, 2013.
The contents of the entirety of each of the foregoing are hereby
incorporated in their entireties herein by this reference.
TECHNICAL FIELD
[0002] This disclosure relates to the targeted stable integration
of foreign polynucleotides into one particular locus of the maize
genome through the use of zinc finger nucleases.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0003] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named "74381_ST25.txt", created on Nov. 26, 2013, and
having a size of 23.7 kilobytes and is filed concurrently with the
specification. The sequence listing contained in this ASCII
formatted document is part of the specification and is herein
incorporated by reference in its entirety.
BACKGROUND
[0004] The genomic locus of Corn Event DAS-59132 is described in
U.S. Pat. No. 8,273,535, METHODS FOR DETECTION OF CORN EVENT
DAS-59132. The transgene expression cassette integrated into
chromosome 8 of the B73 maize genome derived region of Hi-II maize
germplasm (D. D. Songstad, W. L. Petersen, C. L. Armstrong,
American Journal of Botany, Vol. 79, pp. 761-764, 1992) as a full
length T-strand insert. In addition, the genomic DNA surrounding
the transgenic locus lacked any large deletions relative to the
native B73 sequence, and was generally devoid of repetitive
elements except for a single, small repetitive element. Extensive
field studies revealed that the presence of the event did not
adversely affect normal growth and development of plants that
carried the event. Moreover, corn lines bearing the event retained
the agronomic and breeding characteristics comparable in agronomic
performance to non-transformed isolines. Hence the genomic locus in
which Corn Event DAS-59132 integrated represents an excellent
endogenous genomic locus in maize for the targeted integration of
other transgenic constructs and hereinafter is referred to as the
E32 or Event32 locus.
[0005] Targeted genome modification of plants has been a
long-standing and elusive goal of both applied and basic research.
Methods and compositions to target and cleave genomic DNA by site
specific nucleases are being developed to reach this goal. Site
specific nucleases include but are not limited to (Zinc Finger
Nucleases (ZFNs), Meganucleases, TALENS and CRISPR/Cas with an
engineered crRNA/tracr RNA, see Burgess; et al; Nature Reviews
Genetics 14, 80-81 (February 2013)). The site specific cleavage of
genomic loci by ZFNs can be used, for example, to induce targeted
mutagenesis, induce targeted deletions of cellular DNA sequences,
and facilitate targeted recombination of an exogenous donor DNA
polynucleotide within a predetermined genomic locus. See, for
example, U.S. Patent Publication No. 20030232410; 20050208489;
20050026157; 20050064474; and 20060188987, and International Patent
Publication No. WO 2007/014275, the disclosures of which are
incorporated by reference in their entireties for all purposes.
U.S. Patent Publication No. 20080182332 describes use of
non-canonical zinc finger nucleases (ZFNs) for targeted
modification of plant genomes and U.S. Patent Publication No.
20090205083 describes ZFN-mediated targeted modification of a plant
EPSPs genomic locus. In addition, Moehle et al. (2007) Proc. Natl.
Acad. Sci. USA 104(9): 3055-3060 describe using designed ZFNs for
targeted gene addition at a specified genomic locus. Current
methods of targeting typically involve co-transformation of plant
tissue with a donor DNA polynucleotide containing at least one
transgene and a site specific nuclease which is designed to bind
and cleave a specific genomic locus. This causes the donor DNA
polynucleotide to stably insert within the cleaved genomic locus
resulting in targeted gene addition at a specified genomic
locus.
BRIEF SUMMARY OF THE INVENTION
[0006] The presently claimed invention is a method for integrating
one or more functional exogenous nucleic acid sequences into the
genome of a maize cell having an E32 locus. The method comprises
making a double-stranded cleavage in the E32 locus using one or
more zinc finger nucleases comprising a zinc finger binding domain
that binds to a target site selected from the group shown in Table
1B. This results in the integration of a functional polynucleotide
comprising the one or more exogenous sequences into the genome of
the maize cell within the E32 locus. The method optionally includes
expressing a gene product encoded and controlled by the one or more
exogenous sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 depicts the relation of the ZFNs designed to bind the
E32 locus of. Six ZFNs (E32 ZFN1-6) were indentified from the yeast
assay and four ZFNs were advanced for evaluation in plants.
[0008] FIG. 2 is a plasmid map of pDAB105906.
[0009] FIG. 3 is a plasmid map of pDAB111809.
[0010] FIG. 4 is a plasmid map of pDAB100655 and represents a
typical donor construct in which other desirable coding sequences,
including but not limited to PAT can be substituted for the AAD-1
region.
[0011] FIG. 5 is a ZFN locus disruption graph of the E32 locus with
arrows indicating a disrupted genomic locus.
[0012] FIG. 6 is a plasmid map for pDAB108688 (control vector).
[0013] FIG. 7 is a plasmid map for pDAB108690 (targeting
vector).
[0014] FIG. 8 shows the primer and probe location for the ZFN
disruption qPCR.
[0015] FIG. 9 is a ZFN disruption assay graph (upper brackets
indicate non-disrupted events and lower brackets show disrupted
events).
[0016] FIG. 10 is a plasmid map of pDAB104179.
[0017] FIG. 11 shows the primer and probe location for the ZFN
disruption qPCR.
[0018] FIG. 12 is a ZFN disruption assay graph (upper brackets
indicate non-disrupted events negative and lower brackets show
disrupted events).
[0019] FIG. 13 shows the primer location for in/out PCR.
[0020] FIG. 14 is a Southern analysis strategy showing the location
of enzyme cut sites and primers for probe generation.
[0021] FIG. 15 is a plasmid map of pDAB107855.
DETAILED DESCRIPTION OF THE INVENTION
[0022] The full length DNA molecule (PHI17662A) used to transform
Corn Event DAS-59132, the 3' end of the genomic flanking sequence,
and the PHI17662A/3' maize genome junction are described in the
disclosure of U.S. Pat. No. 8,273,535. The E32 locus is described
by SEQ ID NO:1 and relates to the genomic flanking regions of Corn
Event DAS-59132 that were used to identify genomic target sequences
for designing zinc finger protein binding domains for exogenous
gene insertion. These target sites include but are not limited to
those described in Table 1B. After having identified the E32 locus
as a highly desirable location for inserting exogenous genes which
is one embodiment of this invention, it is well within the skilled
artisans purview to identify and use other target sites within the
E32 locus.
[0023] SEQ ID NO:1 is provided as the following sequence;
TABLE-US-00001
agttgggaaggcaaaacgaatataagtgcattcggattactgtttagtcgagtcatatttaaggaattcattg-
taaatgttctaacctaacctaagtat
taggcagctatggctgatatggatctgattggacttgatttatccatgataagtttaagagcaactcaaagagg-
ttaggtatatatggttttgtaaag
gtaaatttagttaatattagaaaaaaaaagtgtatccaataggctctataaacaactcttcaaatttagtggct-
ttctatccatccacctttgctctctatt
tttggatagcctgatttactctctattcagtccgtaggtttaatgagtctgttggattagcctacactttttct-
gtaaaatctattttagatagtagctaaat
cagtaaatttggctagtatttttagctattctcttggagtttgctataagaccagaacatgtaaattggaagtt-
tgtggacccggacgagaatgcatg
acaaatccagagtattgatgatggaattcacctattttacccgactcttccattgtgtccatttctcatcatcc-
ccgggcgctttctgcatccggtaca
gctgacatgacacgttcacgcgttacatggctgatggctcacaagtcacccccacatgtctagtgttcgcccag-
gcagatcgtcctcggcctgc
gctgccgtgctcttgccgccgcttgcttgggccctgctggcgcccgctgccgatcacacggcctacgcggtgca-
ggcagcgccaccgaacc
cgcagtcttgttgtgccgataggtggcagtggcagtggcactggcacggcacgcgatcgatcgctccgctcatc-
tgctgacagtggatagag
cagcgttggccgttggggccggatctccgtgaagcggtcgtccctgctgtactgtgccgctatggcgtgtcgct-
ttcgccatgttttcttttctttttt
ttttctttttctttttgctagggcggtttctcgttcgctggtaacagggaccacttcggttgatccgttgaatt-
tactgaaagagatgggaatggtcgct
gtgcccgggacattgaatgagatgttgtgtaagtgaatatggctttagccttttgcgagtggggcggcaatgca-
cggcatgaactataatttccg
gtcaaacttttgtgtggaaatggatgctaaacgaacacaaaccgggtttaaaccagaggccgacacggcacaca-
cggcgacattcaccgccg
gcttcctccgtcgccactcggcacaaggctcatcagtcgccgatgcccgatgcgatcaacggaagcggatggcc-
cgcttctttagaattggca
caggaacactggccactgcccttgatgtgcaattatgcctgcgaaagcctaggcaacacacgcgaataaacgag-
cgaatgacacggaaagc
tgatgtggtatgaattatacaacattatgggccaaaatattattctatccaccattgtgtagccacagcatcgg-
tatttgagttgtgcgaggacaaat
ccctcgtgaggtcaaaaacagcaaataataaacccatctcctgaagacaccaaaaaaaaggagcagctcctcgt-
gtcaatgaacaagcgtca
caagaaaagggagcacgtaaataacctcttcaattgcttcagcatgaaaagaacgggaagaaatgcaagtctac-
agaggaaagtgcagctgt
ttcggctgccatggcaagttcctacatgggcgaggaaaagctgaactggattccagtcttcgcgctgtcatgct-
cagcttgctttaggatgcggc
aatagttcacctggatgaaaaagatacaagttagtcttgaagcagtcgagtggacatccaaagtatcaaaatcg-
aaagcttgtaaatggggaag
gaaatatacctctacccggaaaagtttggtaggcaaaataatcccaacgccagcagagctccggaacgtttgcc-
gaaattcagaagccgaaa
agttcttgtactcaccctccgacagtttcgcaaggtttccagcagtaaggaatgcgtggccatggattccagcg-
tctctgaatatcttgaggggca
gatcaaaagaaaggtcagcgaaggcagacacggccagatcacctcccaagtaatcccttccagggtcagccgag-
ccactctccgagttatta
aggacatgcctccgcgcctctgttgggccaactccccttaatctgaaacccagcagagatgacggtccgcccaa-
gctgcacactggagaaga
attacctccaagataaaacctctctggcactgatgaagtcgaattcatgaatccccctgcaagcggtaaaatga-
cacccgctcctacaccaacgt
tgagagcagcactataaaatcccaaaggcacagcaccacgtacatcgaactcctgagagcaaacccaacggcaa-
tatttttgtaatagtgatg
gtcagaactgagaagatcagataaaattatacactgatgcaattatttcatagtttcgcccatgaactgtaagg-
gctagacaaagcaaaaagtaa
gacatgaagggcaagagaataacctgccggaaatatctcaatcctttgctattccatagaccaccaacttgaga-
agttgactgaaacgcatatcc
tttcgttggcctaagatgtgaatccctcttatcaatcttgtatgtgtacttcaatgcagaaagaaggttatgcc-
ctaactgcctccttatggcctttgat
gagacacgtgatggatcagttaaggtacgccacgcaaggttgtatgacaagtcatggttccttgttgacagcaa-
accaaatgaaaggccaagt
aggcgctccttgtatgatgaaaacttcagccaatcttgtgatgacaaagatgcccgagccatcaatggtgttgg-
tattgatttaaacctcggtagg
cagactccaacaccaacctctgttgtttggtcccaaccaaaggatcctgatgcatcccagatgtcaccatagcc-
aaacaagttcttcaacttaagt
gacccttccagcgaccaagatcttgcctacaagagtggcaagcacagtca
[0024] The present disclosure further relates to methods and
compositions for targeted integration into the maize E32 locus
using ZFNs and a gene donor construct. Practice of the methods, as
well as preparation and use of the compositions disclosed herein
employ, unless otherwise indicated, conventional techniques in
molecular biology, biochemistry, chromatin structure and analysis,
computational chemistry, cell culture, recombinant DNA and related
fields as are within the skill of the art. These techniques are
fully explained in the literature. See, for example, Sambrook et
al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold
Spring Harbor Laboratory Press, 1989 and Third edition, 2001;
Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley
& Sons, New York, 1987 and periodic updates; the series METHODS
IN ENZYMOLOGY, Academic Press, San Diego; Wolfe, CHROMATIN
STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego,
1998; METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (P. M. Wassarman
and A. P. Wolfe, eds.), Academic Press, San Diego, 1999; and
METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P.
B. Becker, ed.) Humana Press, Totowa, 1999.
[0025] The terms "polypeptide," "peptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues. The
term also applies to amino acid polymers in which one or more amino
acids are chemical analogues or modified derivatives of
corresponding naturally-occurring amino acids.
[0026] "Binding" refers to a sequence-specific, non-covalent
interaction between macromolecules (e.g., between a protein and a
nucleic acid). Not all components of a binding interaction need be
sequence-specific (e.g., contacts with phosphate residues in a DNA
backbone), as long as the interaction as a whole is
sequence-specific. Such interactions are generally characterized by
a dissociation constant (Kd) of 10.sup.-6 M or lower. "Affinity"
refers to the strength of binding: increased binding affinity being
correlated with a lower binding constant (Kd).
[0027] A "binding protein" is a protein that is able to bind
non-covalently to another molecule. A binding protein can bind to,
for example, a DNA molecule (a DNA-binding protein), a RNA molecule
(an RNA-binding protein) and/or a protein molecule (a
protein-binding protein). In the case of a protein-binding protein,
it can bind to itself (to form homodimers, homotrimers, etc.)
and/or it can bind to one or more molecules of a different protein
or proteins. A binding protein can have more than one type of
binding activity. For example, zinc finger proteins have
DNA-binding, RNA-binding and protein-binding activity.
[0028] A "zinc finger DNA binding protein" (or binding domain) is a
protein, or a domain within a larger protein, that binds DNA in a
sequence-specific manner through one or more zinc fingers, which
are regions of amino acid sequence within the binding domain whose
structure is stabilized through coordination of a zinc ion. The
term zinc finger DNA binding protein is often abbreviated as zinc
finger protein or ZFP.
[0029] Zinc finger binding domains can be "engineered" to bind to a
predetermined nucleotide sequence. Non-limiting examples of methods
for engineering zinc finger proteins are design and selection. A
designed zinc finger protein is a protein not occurring in nature
whose design/composition results principally from rational
criteria. Rational criteria for design include application of
substitution rules and computerized algorithms for processing
information in a database storing information of existing ZFP
designs and binding data. See, for example, U.S. Pat. Nos.
6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO
98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO
03/016496.
[0030] "Cleavage" refers to the breakage of the covalent backbone
of a DNA molecule. Cleavage can be initiated by a variety of
methods including, but not limited to, enzymatic or chemical
hydrolysis of a phosphodiester bond. Both single-stranded cleavage
and double-stranded cleavage are possible, and double-stranded
cleavage can occur as a result of two distinct single-stranded
cleavage events. DNA cleavage can result in the production of
either blunt ends or staggered ends. In certain embodiments, fusion
polypeptides are used for targeted double-stranded DNA cleavage. A
"cleavage domain" comprises one or more polypeptide sequences which
possesses catalytic activity for DNA cleavage. A cleavage domain
can be contained in a single polypeptide chain or cleavage activity
can result from the association of two (or more) polypeptides.
[0031] A "target site" or "target sequence" is a nucleic acid
sequence that defines a portion of a nucleic acid to which a
binding molecule will bind, provided sufficient conditions for
binding exist.
[0032] An "exogenous" molecule is a molecule that is not normally
present in a cell, but can be introduced into a cell by one or more
genetic, biochemical or other methods. "Normal presence in the
cell" is determined with respect to the particular developmental
stage and environmental conditions of the cell. Thus, for example,
a molecule induced by heat shock is an exogenous molecule with
respect to a non heat-shocked cell. An exogenous molecule can
comprise, for example, a coding sequence for any polypeptide or
fragment thereof, a functioning version of a malfunctioning
endogenous molecule or a malfunctioning version of a
normally-functioning endogenous molecule. Additionally, an
exogenous molecule can comprise a coding sequence from another
species.
[0033] Nucleic acids include DNA and RNA, can be single- or
double-stranded; can be linear, branched or circular; and can be of
any length. Nucleic acids include those capable of forming
duplexes, as well as triplex-forming nucleic acids. See, for
example, U.S. Pat. Nos. 5,176,996 and 5,422,251. Proteins include,
but are not limited to, DNA-binding proteins, transcription
factors, chromatin remodeling factors, methylated DNA binding
proteins, polymerases, methylases, demethylases, acetylases,
deacetylases, kinases, phosphatases, integrases, recombinases,
ligases, topoisomerases, gyrases and helicases.
[0034] A "product of an exogenous nucleic acid" includes both
polynucleotide and polypeptide products, for example, transcription
products (polynucleotides such as RNA) and translation products
(polypeptides) and the products of gene expression and gene
products.
[0035] A "fusion" molecule is a molecule in which two or more
subunit molecules are linked, for example, covalently. The subunit
molecules can be the same chemical type of molecule, or can be
different chemical types of molecules. Examples of the first type
of fusion molecule include, but are not limited to, fusion proteins
(for example, a fusion between a ZFP DNA-binding domain and a
cleavage domain) and fusion nucleic acids (for example, a nucleic
acid encoding the fusion protein described supra). Examples of the
second type of fusion molecule include, but are not limited to, a
fusion between a triplex-forming nucleic acid and a polypeptide,
and a fusion between a minor groove binder and a nucleic acid.
[0036] Expression of a fusion protein in a cell can result from
delivery of the fusion protein to the cell or by delivery of a
polynucleotide encoding the fusion protein to a cell, wherein the
polynucleotide is transcribed, and the transcript is translated, to
generate the fusion protein. Trans-splicing, polypeptide cleavage
and polypeptide ligation can also be involved in expression of a
protein in a cell. Methods for polynucleotide and polypeptide
delivery to cells are presented elsewhere in this disclosure.
[0037] For the purposes of the present disclosure, a "gene,"
includes a DNA region encoding a gene product (see infra), as well
as all DNA regions which regulate the production of the gene
product, whether or not such regulatory sequences are adjacent to
coding and/or transcribed sequences. Accordingly, a gene includes,
but is not necessarily limited to, promoter sequences, terminators,
translational regulatory sequences such as ribosome binding sites
and internal ribosome entry sites, enhancers, silencers,
insulators, boundary elements, replication origins, matrix
attachment sites and locus control regions.
[0038] "Gene expression" refers to the conversion of the
information, contained in a gene, into a gene product. A gene
product can be the direct transcriptional product of a gene (e.g.,
mRNA, tRNA, rRNA, antisense RNA, interfering RNA, ribozyme,
structural RNA or any other type of RNA) or a protein produced by
translation of a mRNA. Gene products also include RNAs which are
modified, by processes such as capping, polyadenylation,
methylation, and editing, and proteins modified by, for example,
methylation, acetylation, phosphorylation, ubiquitination,
ADP-ribosylation, myristilation, and glycosylation.
[0039] The disclosed methods and compositions include fusion
proteins comprising a cleavage domain and a DNA-binding domain
(ZFP) in which the DNA-binding domain by binding to a sequence in
the E32 locus directs the activity of the cleavage domain to the
vicinity of the sequence and, hence, induces a double stranded
break) in the E32 locus. As set forth elsewhere in this disclosure,
a zinc finger domain can be engineered to bind to virtually any
desired sequence. Accordingly, one or more DNA-binding domains can
be engineered to bind to one or more sequences in the E32 locus.
Expression of a fusion protein comprising a DNA-binding domain and
a cleavage domain in a cell, effects cleavage at or near the target
site.
[0040] Selection of a target site in the E32 locus for binding by a
zinc finger domain can be accomplished, for example, according to
the methods disclosed in U.S. Pat. No. 6,453,242 that also
discloses methods for designing ZFPs to bind to a selected
sequence. It will be clear to those skilled in the art that simple
visual inspection of a nucleotide sequence can also be used for
selection of a target site. Accordingly, any means for target site
selection can be used in the methods described herein.
[0041] For ZFP DNA-binding domains, target sites are generally
composed of a plurality of adjacent target subsites. A target
subsite refers to the sequence, usually either a nucleotide triplet
or a nucleotide quadruplet which may overlap by one nucleotide with
an adjacent quadruplet, that is bound by an individual zinc finger.
See, for example, WO 02/077227. The strand with which a zinc finger
protein makes most contacts is designated the target strand
"primary recognition strand," or "primary contact strand," some
zinc finger proteins bind to a three base triplet in the target
strand and a fourth base on the non-target strand. A target site
generally has a length of at least 9 nucleotides and, accordingly,
is bound by a zinc finger binding domain comprising at least three
zinc fingers. However binding of, for example, a 4-finger binding
domain to a 12-nucleotide target site, a 5-finger binding domain to
a 15-nucleotide target site or a 6-finger binding domain to an
18-nucleotide target site, is also possible. As will be apparent,
binding of larger binding domains (e.g., 7-, 8-, 9-finger and more)
to longer target sites is also consistent with the invention.
[0042] It is not necessary for a target site to be a multiple of
three nucleotides. In cases in which cross-strand interactions
occur (see, e.g., U.S. Pat. No. 6,453,242 and WO 02/077227), one or
more of the individual zinc fingers of a multi-finger binding
domain can bind to overlapping quadruplet subsites. As a result, a
three-finger protein can bind a 10-nucleotide sequence, wherein the
tenth nucleotide is part of a quadruplet bound by a terminal
finger, a four-finger protein can bind a 13-nucleotide sequence,
wherein the thirteenth nucleotide is part of a quadruplet bound by
a terminal finger, etc.
[0043] The length and nature of amino acid linker sequences between
individual zinc fingers in a multi-finger binding domain also
affects binding to a target sequence. For example, the presence of
a so-called "non-canonical linker," "long linker" or "structured
linker" between adjacent zinc fingers in a multi-finger binding
domain can allow those fingers to bind subsites which are not
immediately adjacent. Non-limiting examples of such linkers are
described, for example, in U.S. Pat. No. 6,479,626 and WO 01/53480.
Accordingly, one or more subsites, in a target site for a zinc
finger binding domain, can be separated from each other by 1, 2, 3,
4, 5 or more nucleotides. To provide but one example, a four-finger
binding domain can bind to a 13-nucleotide target site comprising,
in sequence, two contiguous 3-nucleotide subsites, an intervening
nucleotide, and two contiguous triplet subsites.
[0044] Distance between target sites refers to the number of
nucleotides or nucleotide pairs intervening between two target
sites as measured from the edges of the sequences nearest each
other. In certain embodiments in which cleavage depends on the
binding of two zinc finger domain/cleavage half-domain fusion
molecules to separate target sites, the two target sites can be on
opposite DNA strands. In other embodiments, both target sites are
on the same DNA strand.
[0045] For targeted integration into the E32 locus, one or more
ZFPs are engineered to bind a target site at or near the
predetermined cleavage site, and a fusion protein comprising the
engineered DNA-binding domain and a cleavage domain is expressed in
the cell. Upon binding of the zinc finger portion of the fusion
protein to the target site, the DNA is cleaved, preferably via a
double-stranded break, near the target site by the cleavage
domain.
[0046] The presence of a double-stranded break in the Event32 locus
facilitates integration of exogenous sequences via homologous
recombination or via non-homology directed repair mechanisms. Thus,
the polynucleotide comprising the exogenous sequence to be inserted
into the Event32 locus will include one or more regions of homology
with E32 to facilitate homologous recombination.
[0047] In addition to the fusion molecules described herein,
targeted replacement of a selected genomic sequence also involves
the introduction of a donor sequence. The donor sequence can be
introduced into the cell prior to, concurrently with, or subsequent
to, expression of the fusion protein(s). The donor polynucleotide
contains sufficient homology to E32 to support homologous
recombination between it and the E32 genomic sequence to which it
bears homology. Approximately 25, 50, 100, 200, 500, 750, 1,000,
1,500, 2,000 nucleotides or more of sequence homology between a
donor and a genomic sequence, or any integral value between 10 and
2,000 nucleotides or more, will support homologous recombination.
In certain embodiments, the homology arms are less than 1,000 base
pairs in length. In other embodiments, the homology arms are less
than 750 base pairs in length.
[0048] Donor sequences can range in length from 10 to 50,000 base
pairs or any integral value of nucleotides between or longer. It
will be readily apparent that the donor sequence is typically not
identical to the genomic sequence that it replaces. Additionally,
donor sequences can comprise a vector molecule containing sequences
that are not homologous to the replaced region. Generally, the
homologous region(s) of a donor sequence will have at least 50%
sequence identity to a genomic sequence with which recombination is
desired. In certain embodiments, 60%, 70%, 80%, 90%, 95%, 98%, 99%,
or 99.9% sequence identity is present. Any value between 1% and
100% sequence identity can be present, depending upon the length of
the donor polynucleotide.
[0049] A donor molecule can contain several, discontinuous regions
of homology to cellular chromatin. For example, for targeted
insertion of sequences not normally present in a region of
interest, said sequences can be present in a donor nucleic acid
molecule and flanked by regions of homology to a gene sequence in
the region of interest.
[0050] Donor molecules can also be inserted into the E32 locus to
serve as a reservoir for later use. For example, a donor molecule
containing a mutation of interest may be inserted in the E32 locus.
Next, ZFNs specific to the gene of interest can be introduced which
will cleave both the endogenous locus and the donor molecule in the
E32 locus which contains the mutation of interest. The resulting
double stranded break in the genome can then become the integration
site for the donor molecule released from the E32 locus. In this
way, the efficiency of targeted integration of a donor sequence at
any region of interest can be greatly increased since the method
does not rely on simultaneous uptake of both the nucleic acids
encoding the ZFNs and those donor sequences.
[0051] Donor molecules can also be inserted into the E32 locus to
serve as a target site for subsequent insertions. For example, a
donor molecule comprised of DNA sequences that contain recognition
sites for additional ZFN designs may be inserted into the locus.
Subsequently, additional ZFN designs may be generated and expressed
in cells such that the original donor molecule is cleaved and
modified by repair or homologous recombination. In this way,
reiterative integrations of donor molecules may occur at the E32
locus.
[0052] Any exogenous sequence can be introduced into the E32 locus
as described herein. Exemplary exogenous sequences include, but are
not limited to any polypeptide coding sequence (e.g., cDNAs),
promoter, enhancer and other regulatory sequences (e.g.,
interfering RNA sequences, shRNA expression cassettes, epitope
tags, marker genes, cleavage enzyme recognition sites and various
types of expression constructs. Such sequences can be readily
obtained using standard molecular biological techniques (cloning,
synthesis, etc.) and/or are commercially available.
[0053] To express ZFNs, sequences encoding the fusion proteins are
typically subcloned into an expression vector that contains a
promoter to direct transcription. Suitable bacterial and eukaryotic
promoters are well known in the art and described, e.g., in
Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed.
1989; 3.sup.rd ed., 2001); Kriegler, Gene Transfer and Expression:
A Laboratory Manual (1990); and Current Protocols in Molecular
Biology (Ausubel et al., supra. Bacterial expression systems for
expressing the ZFNs are available in, e.g., E. coli, Bacillus sp.,
and Salmonella (Palva et al., Gene 22:229-235 (1983)). Kits for
such expression systems are commercially available. Eukaryotic
expression systems for mammalian cells, yeast, and insect cells are
well known by those of skill in the art and are also commercially
available.
[0054] The particular expression vector used to transport the
genetic material into the cell is selected with regard to the
intended use of the fusion proteins, e.g., expression in plants,
animals, bacteria, fungus, protozoa, etc. (see expression vectors
described below). Standard bacterial and animal expression vectors
are known in the art and are described in detail, for example, U.S.
Patent Publication 20050064474A1 and International Patent
Publications WO05/084190, WO05/014791 and WO03/080809.
[0055] Standard transfection methods can be used to produce
bacterial, mammalian, yeast or insect cell lines that express large
quantities of protein, which can then be purified using standard
techniques (see, e.g., Colley et al., J. Biol. Chem.
264:17619-17622 (1989); Guide to Protein Purification, in Methods
in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of
eukaryotic and prokaryotic cells are performed according to
standard techniques (see, e.g., Morrison, J. Bact. 132:349-351
(1977); Clark-Curtiss & Curtiss, Methods in Enzymology
101:347-362 (Wu et al., eds., 1983).
[0056] Any of the well known procedures for introducing foreign
nucleotide sequences into such host cells may be used. These
include the use of calcium phosphate transfection, polybrene,
protoplast fusion, electroporation, ultrasonic methods (e.g.,
sonoporation), liposomes, microinjection, naked DNA, plasmid
vectors, viral vectors, both episomal and integrative, and any of
the other well known methods for introducing cloned genomic DNA,
cDNA, synthetic DNA or other foreign genetic material into a host
cell (see, e.g., Sambrook et al., supra). It is only necessary that
the particular genetic engineering procedure used be capable of
successfully introducing at least one gene into the host cell
capable of expressing the protein of choice.
[0057] As noted above, DNA constructs may be introduced into the
genome of a desired plant species by a variety of conventional
techniques. For reviews of such techniques see, for example,
Weissbach & Weissbach Methods for Plant Molecular Biology
(1988, Academic Press, N.Y.) Section VIII, pp. 421-463; and
Grierson & Corey, Plant Molecular Biology (1988, 2d Ed.),
Blackie, London, Ch. 7-9.
[0058] A DNA construct may be introduced directly into the genomic
DNA of the plant cell using techniques such as electroporation and
microinjection of plant cell protoplasts, or the DNA constructs can
be introduced directly to plant tissue using biolistic methods,
such as DNA particle bombardment (see, e.g., Klein et al. (1987)
Nature 327:70-73). Alternatively, the DNA construct can be
introduced into the plant cell via nanoparticle transformation
(see, e.g., US Patent Publication No. 20090104700, which is
incorporated herein by reference in its entirety). Alternatively,
the DNA constructs may be combined with suitable T-DNA
border/flanking regions and introduced into a conventional
Agrobacterium tumefaciens host vector. Agrobacterium
tumefaciens-mediated transformation techniques, including disarming
and use of binary vectors, are well described in the scientific
literature. See, for example Horsch et al. (1984) Science
233:496-498, and Fraley et al. (1983) Proc. Nat'l. Acad. Sci. USA
80:4803.
[0059] In addition, gene transfer may be achieved using
non-Agrobacterium bacteria or viruses such as Rhizobium sp. NGR234,
Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X,
cauliflower mosaic virus and cassava vein mosaic virus and/or
tobacco mosaic virus, See, e.g., Chung et al. (2006) Trends Plant
Sci. 11(1):1-4.
[0060] The virulence functions of the Agrobacterium tumefaciens
host will direct the insertion of a T-strand containing the
construct and adjacent marker into the plant cell DNA when the cell
is infected by the bacteria using binary T DNA vector (Bevan (1984)
Nuc. Acid Res. 12:8711-8721) or the co-cultivation procedure
(Horsch et al. (1985) Science 227:1229-1231). Generally, the
Agrobacterium transformation system is used to engineer
dicotyledonous plants (Bevan et al. (1982) Ann. Rev. Genet.
16:357-384; Rogers et al. (1986) Methods Enzymol. 118:627-641). The
Agrobacterium transformation system may also be used to transform,
as well as transfer, DNA to monocotyledonous plants and plant
cells. See U.S. Pat. No. 5,591,616; Hernalsteen et al. (1984) EMBO
J. 3:3039-3041; Hooykass-Van Slogteren et al. (1984) Nature
311:763-764; Grimsley et al. (1987) Nature 325:1677-179; Boulton et
al. (1989) Plant Mol. Biol. 12:31-40; and Gould et al. (1991) Plant
Physiol. 95:426-434.
[0061] Alternative gene transfer and transformation methods
include, but are not limited to, protoplast transformation through
calcium-, polyethylene glycol (PEG)- or electroporation-mediated
uptake of naked DNA (see Paszkowski et al. (1984) EMBO J.
3:2717-2722, Potrykus et al. (1985) Molec. Gen. Genet. 199:169-177;
Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; and
Shimamoto (1989) Nature 338:274-276) and electroporation of plant
tissues (D'Halluin et al. (1992) Plant Cell 4:1495-1505).
Additional methods for plant cell transformation include
microinjection, silicon carbide mediated DNA uptake (Kaeppler et
al. (1990) Plant Cell Reporter 9:415-418), and microprojectile
bombardment (see Klein et al. (1988) Proc. Nat. Acad. Sci. USA
85:4305-4309; and Gordon-Kamm et al. (1990) Plant Cell
2:603-618).
[0062] The disclosed methods and compositions can be used to insert
exogenous sequences into a predetermined location such as the E32
locus. This is useful inasmuch as expression of an introduced
transgene into the maize genome depends critically on its
integration site. Accordingly, genes encoding herbicide tolerance,
insect resistance, nutrients, antibiotics or therapeutic molecules
can be inserted, by targeted recombination.
[0063] Transformed plant cells which are produced by any of the
above transformation techniques can be cultured to regenerate a
whole plant which possesses the transformed genotype and thus the
desired phenotype. Such regeneration techniques rely on
manipulation of certain phytohormones in a tissue culture growth
medium, typically relying on a biocide and/or herbicide marker
which has been introduced together with the desired nucleotide
sequences. Plant regeneration from cultured protoplasts is
described in Evans, et al., "Protoplasts Isolation and Culture" in
Handbook of Plant Cell Culture, pp. 124-176, Macmillian Publishing
Company, New York, 1983; and Binding, Regeneration of Plants, Plant
Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration
can also be obtained from plant callus, explants, organs, pollens,
embryos or parts thereof. Such regeneration techniques are
described generally in Klee et al. (1987) Ann. Rev. of Plant Phys.
38:467-486.
[0064] One skilled in the art will recognize that after the
exogenous sequence is stably incorporated in transgenic plants and
confirmed to be operable, it can be introduced into other plants by
sexual crossing. Any of a number of standard breeding techniques
can be used, depending upon the species to be crossed.
[0065] A transformed maize cell, callus, tissue or plant may be
identified and isolated by selecting or screening the engineered
plant material for traits encoded by the marker genes present on
the transforming DNA. For instance, selection can be performed by
growing the engineered plant material on media containing an
inhibitory amount of the antibiotic or herbicide to which the
transforming gene construct confers resistance. Further,
transformed cells can also be identified by screening for the
activities of any visible marker genes (e.g., the
beta-glucuronidase, luciferase, B or C1 genes) that may be present
on the recombinant nucleic acid constructs. Such selection and
screening methodologies are well known to those skilled in the
art.
[0066] Physical and biochemical methods also may be used to
identify plant or plant cell transformants containing inserted gene
constructs. These methods include but are not limited to: 1)
Southern analysis or PCR amplification for detecting and
determining the structure of the recombinant DNA insert; 2)
Northern blot, S1 RNase protection, primer-extension or reverse
transcriptase-PCR amplification for detecting and examining RNA
transcripts of the gene constructs; 3) enzymatic assays for
detecting enzyme or ribozyme activity, where such gene products are
encoded by the gene construct; 4) protein gel electrophoresis,
Western blot techniques, immunoprecipitation, or enzyme-linked
immunoassays (ELISA), where the gene construct products are
proteins. Additional techniques, such as in situ hybridization,
enzyme staining, and immunostaining, also may be used to detect the
presence or expression of the recombinant construct in specific
plant organs and tissues. The methods for doing all these assays
are well known to those skilled in the art.
[0067] Effects of gene manipulation using the methods disclosed
herein can be observed by, for example, northern blots of the RNA
(e.g., mRNA) isolated from the tissues of interest. Typically, if
the mRNA is present or the amount of mRNA has increased, it can be
assumed that the corresponding transgene is being expressed. Other
methods of measuring gene and/or encoded polypeptide activity can
be used. Different types of enzymatic assays can be used, depending
on the substrate used and the method of detecting the increase or
decrease of a reaction product or by-product. In addition, the
levels of polypeptide expressed can be measured immunochemically,
i.e., ELISA, RIA, EIA and other antibody based assays well known to
those of skill in the art, such as by electrophoretic detection
assays (either with staining or western blotting). As one
non-limiting example, the detection of the AAD-1 (aryloxyalkanoate
dioxygenase; see WO 2005/107437) and PAT
(phosphinothricin-N-acetyl-transferase (PAT), EC 2.3.1.183)
proteins using an ELISA assay is described in U.S. Patent
Publication No. 20090093366 which is herein incorporated by
reference in its entirety. The transgene may be selectively
expressed in some tissues of the plant or at some developmental
stages, or the transgene may be expressed in substantially all
plant tissues, substantially along its entire life cycle. However,
any combinatorial expression mode is also applicable.
[0068] The present disclosure also encompasses seeds of the
transgenic plants described above wherein the seed has the
transgene or gene construct. The present disclosure further
encompasses the progeny, clones, cell lines or cells of the
transgenic plants described above wherein said progeny, clone, cell
line or cell has the transgene or gene construct.
[0069] Administration of effective amounts is by any of the routes
normally used for introducing fusion proteins into ultimate contact
with the plant cell to be treated. The ZFPs are administered in any
suitable manner, preferably with acceptable carriers. Suitable
methods of administering such modulators are available and well
known to those of skill in the art, and, although more than one
route can be used to administer a particular composition, a
particular route can often provide a more immediate and more
effective reaction than another route.
EXAMPLES
Example 1
Production of Zinc Finger Proteins Designed to Bind the Genomic
Locus for Corn Event DAS-59132
[0070] Zinc finger proteins directed against DNA sequences which
comprise the genomic locus for Corn Event DAS-59132 (see, FIG. 1)
were designed per the methods described in Urnov et al. (2005)
Nature 435:646-651. Exemplary target sequence and recognition
helices are shown in Table 1A (recognition helix regions designs)
and Table 1B (target sites). In Table 1B, nucleotides in the target
site that are contacted by the ZFP recognition helices are
indicated in uppercase letters; non-contacted nucleotides are
indicated in lowercase.
TABLE-US-00002 TABLE 1A Genomic locus for Corn Event
DAS-59132-binding zinc finger designs. ZFP# F1 F2 F3 F4 F5 25716
RSDDLSK QSGSLTR RSDNLRE QSGDLTR DTGARLK SEQ ID NO: 43 SEQ ID NO: 44
SEQ ID NO: 45 SEQ ID NO: 46 SEQ ID NO: 47 25717 RSADRKT DRSHLSR
TSGNLTR RSDDLSR QSANRTK SEQ ID NO: 48 SEQ ID NO: 49 SEQ ID NO: 50
SEQ ID NO: 51 SEQ ID NO: 52
TABLE-US-00003 TABLE 1B Target Sequences for zinc finger proteins.
Zinc SEQ Finger ID Number NO: Target Sequence 25686 2
caCAACAAGACtGCGGGTtcggtggcgc 25687 3 gaTAGGTGGCAGTGGCAgtggcactggc
25688 4 taTCGGCACAACAAGACtgcgggttcgg 25689 5
tgGCAGTGGCAGTGGCActggcacggca 25692 6 caGCAGATGAGcGGAGCGatcgatcgcg
25693 7 caGTGGATAGAGCAGCGttggccgttgg 25710 8
agGAAGCCGGCGGTGAAtgtcgccgtgt 25711 9 cgTCGCCAcTCGGCACAAggctcatcag
25712 10 atCGGGCATCGGCGACTgatgagccttg 25713 11
gaTCAACGGAAGCGGATGGCccgcttct 25716 12 tgATCGCAtCGGGCATCGgcgactgatg
25717 13 cgGAAGCGGATGGCCCGcttctttagaa
[0071] The E32 zinc finger protein designs were incorporated into
vectors encoding a protein having at least one finger with a CCHC
structure. See, U.S. Patent Publication No. 2008/0182332. In
particular, the last finger in each protein had a CCHC backbone for
the recognition helix. The non-canonical zinc finger-encoding
sequences were fused to the nuclease domain of the type IIS
restriction enzyme FokI (amino acids 384-579 of the sequence of Wah
et al. (1998) Proc. Natl. Acad. Sci. USA 95:10564-10569) via a four
amino acid ZC linker and an opaque-2 nuclear localization signal
derived from Zea mays to form Corn Event DAS-59132 zinc-finger
nucleases (ZFNs). The optimal zinc fingers were verified for
cleavage activity using a budding yeast based system previously
shown to identify active nucleases. See, e.g., U.S. Patent
Publication No. 20090111119; Doyon et al. (2008) Nat Biotechnol.
26:702-708; Geurts et al. (2009) Science 325:433. Zinc fingers for
the various functional domains were selected for in-vivo use. Of
the numerous ZFNs that were designed, produced and tested to bind
to the putative Corn Event DAS-59132 genomic polynucleotide target
sites, six pairs of ZFNs were identified as having in vivo activity
at high levels, and selected for further experimentation. See,
Table 1A. The selected ZFN pairs which optimally bound the E32
locus were advanced for testing in a transient corn transformation
assay.
[0072] FIG. 1 shows the genomic organization of the E32 locus in
relation to the ZFN polynucleotide binding/target sites of the six
ZFN pairs. The first three ZFN pairs (E32 ZFN1, E32 ZFN2, and E32
ZFN3) bind upstream of the Corn Event DAS-59132 transgenic insert,
the second three ZFN pairs (E32 ZFN4, E32 ZFN5, and E32 ZFN6) bind
downstream of the Corn Event DAS-59132 transgenic insert. Four ZFNs
were characterized as being capable of efficiently binding and
cleaving Corn Event DAS-59132 genomic polynucleotide target sites
in planta.
Example 2
Zinc Finger Nuclease Constructs and AAD-1 Gene Donor Construct
[0073] Plasmid vectors containing ZFN expression constructs of the
six exemplary zinc finger nucleases were designed and constructed
using skill commonly practiced in the art. Each zinc
finger-encoding sequence was fused to a sequence encoding an
opaque-2 nuclear localization signal (Maddaloni et al. (1989) Nuc.
Acids Res. 17(18):7532), that was positioned upstream of the zinc
finger nuclease.
[0074] The opaque-2 nuclear localization signal and zinc finger
nuclease fusion sequence was paired with the complementary opaque-2
nuclear localization signal and zinc finger nuclease fusion
sequence. As such, each construct consisted of a single open
reading frame comprised of two opaque-2 nuclear localization
signals and zinc finger nuclease fusion sequences separated by the
2A sequence from Thosea asigna virus (Mattion et al. (1996) J.
Virol. 70:8124-8127). Expression of the ZFN coding sequence was
driven by the highly expressing constitutive Zea mays Ubiquitin 1
promoter (Christensen et al. (1992) Plant Mol. Biol. 18(4):675-89)
and flanked by the Zea mays Per 5 3' polyA untranslated region
(U.S. Pat. No. 6,699,984). The resulting six plasmid constructs
were confirmed via restriction enzyme digestion and via DNA
sequencing. FIGS. 2 and 3 provide a graphical representation of the
completed plasmid constructs. The ZFN expressed in plasmid
construct, pDAB105906 (FIG. 2), contains "Fok-Mono" which is a wild
type FokI endonuclease. The ZFN expressed in plasmid construct,
pDAB111809 (FIG. 3), contains "Fok1-ELD" which is a modified Fold
endonuclease. The modified Fok1 endonuclease contains alterations
as described in Doyon Y., Vo T., Mendel M., Greenberg S., Wang J.,
Xia D., Miller J., Urnov F., Gregory P., and Holmes M. (2010)
Enhancing zinc-finger-nuclease activity with improved obligate
heterodimeric architecture. Nature Methods, 8(1); 74-79.
[0075] A donor construct was designed to integrate into the ZFN
cleaved genomic DNA of the E32 locus. FIG. 4 illustrates the donor
construct, pDAB100655, which consists of a single gene expression
cassette. This single gene expression cassette is comprised of the
Zea mays Ubiquitin 1 promoter (ZmUbi1 promoter), the AAD-1 coding
sequence (U.S. Pat. No. 7,838,733) and the Zea mays Per 5 3'
untranslated region (ZmPer5 3' UTR). The construct contains a pair
of repeated Corn Event DAS-59132 ZFN6 binding sequences which were
included downstream of the AAD-1 gene expression cassette. The
various gene elements were assembled in a high copy number pUC
based plasmid.
Example 3
Transient Transformation of Maize Hi-II Cultures to Determine ZFN
Efficiency
Transformation of ZFN Genes
[0076] Maize Hi-II embryogenic cultures were produced as described
in U.S. Pat. No. 7,179,902 and were used to evaluate and test the
efficiencies of the different ZFNs. Plasmid DNA consisting of
pDAB105901, pDAB105902, pDAB105903, pDAB105904, pDAB105905 and
pDAB105906 were transiently transformed into maize callus cells to
compare the cutting frequency of different ZFNs against a standard
tested ZFN, pDAB7430, which was designed to the inositol
polyphosphate 2-kinase gene locus within the maize genome as
described in U.S. Patent Application No. 2011/0119786.
[0077] From Hi-II cultures, 12 mL of packed cell volume (PCV) from
a previously cryo-preserved cell line plus 28 mL of conditioned
medium was subcultured into 80 mL of GN6 liquid medium (N6 medium
(Chu et al., (1975) Sci Sin. 18:659-668), 2.0 mg/L 2, 4-D, 30 g/L
sucrose, pH 6.0) in a 500 mL Erlenmeyer flask, and placed on a
shaker at 125 rpm at 28.degree. C. This step was repeated two times
using the same cell line, such that a total of 36 mL PCV was
distributed across three flasks. After 24 hours, the contents were
poured into a sterile PETRI.TM. dish and the GN6 liquid media was
removed. Slightly moistened callus was transferred to a 2.5 cm
diameter circle on GN6 S/M solid medium (N6 Medium (Chu et al.,
(1975) Sci Sin. 18:659-668), 2.0 mg/L 2,4-D, 30 g/L sucrose, 45.5
g/L sorbitol, 45.5 g/L mannitol, 100 mg/L myo-inositol, 2.5 g/L
Gelrite.TM., pH 6.0) containing filter paper. The plates were
incubated in the dark for 4 hours at 28.degree. C.
[0078] Microparticle gold (0.6 micron, BioRad, Hercules, Calif.)
was prepared for DNA precipitation by weighing out 21 mg into a
sterile, siliconized 1.7 mL microcentrifuge tube (Sigma-Aldrich,
St. Louis, Mo.) and 350 .mu.L of ice cold 100% ethanol was added
and vortexed for 1 minute. The gold was pelleted by centrifugation
at 10,000 rpm for 15 seconds using a MINISPIN.TM. centrifuge
(Eppendorf, Hauppauge, N.Y.). After removing the supernatant, 350
.mu.L of ice cold, sterile water was added, mixed up and down with
the pipette and centrifuged at 10,000 rpm for 15 seconds. The wash
step was repeated one more time prior to suspending the gold in 350
.mu.L of ice cold, sterile water. The washed gold was then stored
at -20.degree. C. until needed.
[0079] For each DNA precipitation, 3 mg of gold in 50 .mu.L of
water was aliqouted into a siliconized 1.7 mL microcentrifuge tube
(Sigma-Aldrich, St. Louis, Mo.). Plasmid DNA (2.5 .mu.g E32 ZFN in
plasmids pDAB105901, pDAB105902, pDAB105903, pDAB105904, pDAB105905
or pDAB105906 and 2.5 .mu.g IPK1 ZFN in plasmid pDAB7430) was
premixed in 0.6 mL microcentrifuge tubes (Fisher Scientific,
Nazareth, Pa.) and added to the gold suspension gently pipetting up
and down 5-10 times to mix thoroughly. Twenty microliters (20
.mu.L) of cold 0.1 M spermidine was then added and gently mixed by
pipetting up and down 5-10 times. Fifty microliters (50 .mu.L) of
ice cold 2.5 M calcium chloride was added slowly and gently mixed
by pipetting up and down 5-10 times. The tube was then capped and
allowed to incubate at room temperature for 10 minutes. After
centrifuging for 15 seconds at 10,000 rpm, the supernatant was
carefully removed and 60 .mu.L of ice cold, 100% ethanol was added.
The gold DNA mixture was resuspended by gently pipetting up and
down 5-10 times.
[0080] For microparticle bombardment, sterilized macrocarriers
(BioRad, Hercules, Calif.) were fit into stainless steel holders
(BioRad, Hercules, Calif.) and autoclaved. Nine microliters (9
.mu.L) of gold/DNA suspension was evenly spread in the center of
the macrocarrier being sure to pipette up and down so as to keep
the suspension well mixed between aliquots. Macrocarriers were then
placed onto a piece of sterile 125 mm Whatman #4 filter paper (GE
Healthcare, Buckinghamshire, UK) on a bed of 8-mesh DRIERITE.TM.
(W.A Hammond Drierite Co., Xenia, Ohio) in a 140.times.25 mm glass
PETRI.TM. dish. The gold/DNA was allowed to dry completely for
about 5-10 minutes. Rupture discs (1,100 psi, BioRad, Hercules,
Calif.) were sterilized by soaking for a few seconds in isopropyl
alcohol then loaded into the retaining cap of a microparticle
bombardment devise (PDS-1000, BioRad, Hercules, Calif.). An
autoclaved stopping screen (BioRad, Hercules, Calif.) and a loaded
macrocarrier was placed into the launch assembly, the lid was
screwed on and placed into the bombardment chamber just under the
nozzle. The PETRI.TM. dish containing target was uncovered and
placed in the bombardment chamber 6 cm below the nozzle. A vacuum
was pulled (-0.9 bar) and the devise was fired. The above described
steps were repeated for each target blasted. Targets were incubated
in dark at a temperature of 28.degree. C. for 24 hours on the same
blasting medium. Blasted cells were transferred to recovery GN6
solid recovery medium (N6 medium (Chu et al., (1975) Sci Sin.
18:659-668), 2.0 mg/L 2, 4-D, 30 g/L sucrose, 2.5 g/L Gelrite, pH
6.0) and incubated for additional 48 hours at 28.degree. C. in the
dark. Seventy-two hours post bombardment, the cells were harvested
into 2 mL EPPENDORF MICROFUGE SAFE LOCK TUBES.TM. and lyophilized
for 48 hours in a VIRTIS MODEL #50L VIRTUAL XL-70 LYOPHILIZER.TM.
(SP Scientific, Gardiner N.Y.).
Next Generation Sequencing (NGS) Analysis of Transiently
Transformed Maize
[0081] The transiently transformed maize callus tissue was analyzed
to determine the cleavage efficiency of the zinc finger nuclease
proteins.
Sample Preparation
[0082] Maize callus tissue transiently transformed with the ZFN
constructs and two control vectors, pDAB100664 and pDAB100665 were
collected in 2 mL EPPENDORF.TM. tubes and lyophilized for 48 hr.
Genomic DNA (gDNA) was extracted from lyophilized tissue using the
QIAGEN PLANT DNA EXTRACTION KIT.TM. (Valencia, Calif.) according to
manufacturer's specifications. The isolated gDNA was resuspended in
200 .mu.L of water and the concentration was determined using a
NANODROP.RTM. spectrophotometer (Invitrogen, Carlsbad, Calif.).
Integrity of the DNA was estimated by running samples on a 0.8%
agarose E-gels (Invitrogen). gDNA samples were normalized (25
ng/.mu.L) for PCR amplification to generate amplicons which would
be analyzed via ILLUMINA.TM. sequencing (San Diego, Calif.).
[0083] PCR primers for amplification of the genomic regions which
span each tested ZFN cleavage site and the control samples were
purchased from Integrated DNA Technologies (Coralville, Iowa).
Optimum amplification conditions for the primers were identified by
temperature gradient PCR using 0.2 .mu.M appropriate primers,
ACCUPRIME PFX SUPERMIX.TM. (1.1.times., Invitrogen) and 100 ng of
template genomic DNA in a 23.5 .mu.L reaction. Cycling parameters
were initial denaturation at 95.degree. C. (5 min) followed by 35
cycles of denaturation (95.degree. C., 15 sec), annealing
(55-72.degree. C., 30 sec), extension (68.degree. C., 1 min) and a
final extension (72.degree. C., 7 min). Amplification products were
analyzed on 3.5% TAE agarose gels. After identifying an optimum
annealing temperature, preparative PCR reactions were carried out
to validate each set of PCR primers and for generating the
ILLUMINA.TM. sequencing amplicon.
[0084] For preparative PCR, 8-individual small scale PCR reactions
were performed for each template using conditions described above
and the resulting PCR products were pooled together and gel
purified on 3.5% agarose gels using the QIAGEN MINELUTE GEL
EXTRACTION/PURIFICATION KIT.TM. per manufacturer's recommendations.
Concentrations of the gel purified amplicons were determined by
NANODROP.TM. and the ILLUMINA.TM. sequencing samples were prepared
by pooling approximately 100 ng of PCR amplicons from ZFN targeted
and corresponding wild type controls. Primers used for the PCR
amplicon generation are shown in Table 2 below.
TABLE-US-00004 TABLE 2 Oligonucleotides for amplification of ZFN
binding sites. Corn Event DAS- 59132 Zinc Finger Number
Direction//SEQ ID NO: Primer Sequence 25686/25687 and Forward//SEQ
ID NO: 14 CAGGCAGCGCCACCGAAC 25688/25689 Reverse//SEQ ID NO: 15
CGATCGATCGCGTGCCGT 256892/256893 Forward//SEQ ID NO: 16
CTGGCACGGCACGCGATC Reverse//SEQ ID NO: 17 CGGAGATCCGGCCCCAAC
25710/25711 Forward//SEQ ID NO: 18 GACACGGCACACACGGCG Reverse//SEQ
ID NO: 19 TCGGGCATCGGCGACTGA 25712/25713 and Forward//SEQ ID NO: 20
ACTCGGCACAAGGCTCAT 25716/25717 Reverse//SEQ ID NO: 21
CCTGTGCCAATTCTAAAG 9149/9215 Forward//SEQ ID NO: 22
GCAGTGCATGTTATGAGC Reverse//SEQ ID NO: 23
CAGGACATAAATGAACTGAATC
ILLUMINA.TM. Sequencing and Analysis
[0085] The ZFNs were designed to recognize, bind and modify
specific DNA sequences within the genomic locus of transgenic Corn
Event DAS-59132. The efficiency by which the six ZFNs cleaved the
genomic locus were assayed to determine which ZFN cleaved most
efficiently. ILLUMINA.TM. sequencing was performed at Cofactor
Genomics (St. Louis, Mo.) and sequences were analyzed using a
sequence analysis script. Low quality sequences were filtered out
and the remaining sequences were parsed according to unique DNA
sequences identifiers. The unique DNA sequences identifiers were
then aligned with the reference sequence and scored for
insertions/deletions (indels). To determine the level of cleavage
activity, the region surrounding the ZFN cleavage site was scored
for the presence of sequence variants which resulted from the
indels. Cleavage activity for each ZFN in the study was calculated
as the number of sequences with indels/1M high quality sequences or
as a percentage of high quality sequences with indels. The levels
of cleavage efficiency were determined by normalizing the ZFN level
of cleavage activity with the activity of a ZFN directed to the
IPP2-K gene as described in U.S. Patent Publication No.
2011/0119786.
[0086] The E32 ZFN6 which contains the 25716 and 25717 zinc finger
binding domains cleaved the genomic locus of transgenic Corn Event
DAS-59132 with the highest efficiency. This ZFN functioned at 3.8
times the efficiency of the control IPPK2 zinc finger nuclease.
Given the high levels of cleavage activity of E32 ZFN6, this ZFN
was selected for use in integrating the donor DNA fragment into the
genomic locus via non homologous end-joining.
TABLE-US-00005 TABLE 3 Cleavage efficiency of the tested eZFNs. E32
ZFN Number % IPPK2 ZFN Activity 25686/25687 32 25688/25689 108
25712/25713 69 25716/25717 380
Example 4
Transient Expression of E32 ZFNs in Maize Protoplasts to
Demonstrate NHEJ Targeting to the E32 Locus
[0087] A rapid testing system for gene targeting was established to
target the endogenous genomic loci of Corn Event DAS-59132 and to
optimize donor targeting parameters in maize. Double strand breaks
were generated within the genome at Corn Event DAS-59132 and
repaired by either the non-homologous end joining (NHEJ) or
homology dependent repair (HDR).
Protoplast Isolation
[0088] Maize Hi-II embryogenic suspension cultures were maintained
on a 3.5 day subculturing schedule. A 10 mL solution of sterile 6%
(w/v) cellulase and a 10 mL solution of sterile 0.6% (w/v)
pectolyase enzyme solutions was pipetted into a 50 mL conical tube.
Next, 4 mL of pack cell volumes (PCV) of Hi-II suspension cells
were added into the 50 mL tube containing the digest solution and
wrapped with Parafilm.RTM.. The tubes were placed on a platform
rocker at room temperature for about 16-18 hr. Next, the cells and
enzyme solution were slowly filtered through a 100 .mu.M cell
strainer placed in a 50 mL conical tube. The cells were then rinsed
using a 100 .mu.M cell strainer by pipetting 10 mL of W5 media
through the strainer. The cells and enzyme solution were slowly
filtered through a 70 .mu.M cell strainer. This straining step was
followed by another straining step, wherein the cells and enzyme
solution were slowly filtered through a 40 .mu.M cell strainer
placed in a 50 mL conical tube. Using a 10 mL pipette tip, the 40
.mu.M cell strainer was rinsed with 10 mL of W5 media to give a
final volume of 40 mL and the tube was inverted. Very slowly, 8 mL
of a sucrose cushion solution was added to the bottom of the
protoplast/enzyme solution. Using a centrifuge with a swing arm
bucket rotor, the tubes were spun for 15 minutes at 1,500 rpm. The
protoplast cells were removed using a 5 mL narrow bore pipette tip.
These cells (7-8 mLs) which were observed as a protoplast band were
removed very slowly and put into a sterile 50 mL conical tube.
Next, 25 mL of W5 media was used to wash the tubes. The W5 wash
media was added to the protoplasts and the tubes were inverted
slowly and centrifuged for 10 minutes at 1,500 rpm. The supernatant
was removed and 10 mL of MMG solution was added with slow inversion
of the tube to resuspend the protoplast pellet. The density of
protoplasts were determined using a haemocytometer. Four PCVs yield
about 30 million protoplasts.
Protoplast Transformation
[0089] The protoplast cells were diluted to 1.6 million protoplasts
per mL using MMG solution. The protoplasts were gently resuspended
by slowly inverting the tube. Next, 300 .mu.L of protoplasts (about
500k protoplasts) were added to a sterile 2 mL tube and the tubes
were inverted to evenly distribute the protoplast cells. Plasmid
DNA at a concentration of 40 -80 .mu.g in TE buffer was added to
the protoplasts. The experimental conditions are described in Table
4. The tubes were slowly rolled to suspend the DNA with the
protoplasts and the tubes were incubated for 5-10 minutes at room
temperature. Next, 300 .mu.L of a PEG solution was added to the
protoplast/DNA solution. Once all the PEG solution had been added,
the PEG solution was mixed with the protoplast solution by gently
inverting the tube. The cocktail was incubated at room temperature
for 15-20 minutes with periodic inverting of the tube(s). After the
incubation, 1 mL of W5 solution was slowly added to the tubes and
the tubes were gently inverted. Finally, the solution was
centrifuged at 1,000 rpm for 15 minutes. The supernatant was
carefully removed so as not to disturb the cell pellet. One
milliliter of washing/incubating solution was added. The tubes were
gently inverted to resuspend the cell pellet. The tubes were
covered with aluminum foil to eliminate any exposure to light, and
were laid on a rack on their side to incubate overnight. The cells
were harvested 24 hours post-transformation for molecular
analysis.
TABLE-US-00006 TABLE 4 Treatment groups for protoplast
transformation. Salmon Sperm Donor DNA E32-ZFN6 pUC19 DNA Total
pDAB100651 pDAB105906 Filler Filler DNA Treatment Groups (.mu.g)
(.mu.g) (.mu.g) (.mu.g) (.mu.g) E32 Donor alone + pDAB100651 N/A
pUC19 N/A 80 No enzyme control (40 .mu.g) (0 .mu.g) (40 .mu.g) (0
.mu.g) (filler-1) E32 Donor alone + pDAB100651 N/A N/A ssDNA 80 No
enzyme control (40 .mu.g) (0 .mu.g) (0 .mu.g) (40 .mu.g) (filler-2)
E32 Donor alone pDAB100651 N/A N/A N/A 40 control (no filler) (40
.mu.g) (0 .mu.g) (0 .mu.g) (0 .mu.g) E32-ZFN6 alone N/A pDAB105906
pUC19 N/A 80 control (no donor) (0 .mu.g) (4 .mu.g) (76 .mu.g) (0
.mu.g) filler1 E32-ZFN6 alone N/A pDAB105906 N/A ssDNA 80 control
(no donor) (0 .mu.g) (4 .mu.g) (0 .mu.g) (76 .mu.g) filler2
E32-ZFN6 wt Fokl N/A pDAB105906 N/A N/A 40 alone control (no (0
.mu.g) (40 .mu.g) (0 .mu.g) (0 .mu.g) donor) No filler E32-ZFN6 wt
pDAB100651 pDAB105906 pUC19 N/A 80 Fokl + E32 Donor (40 .mu.g) (4
.mu.g) (36 .mu.g) (0 .mu.g) (1:10) filler1 E32-ZFN6 wt pDAB100651
pDAB105906 N/A ssDNA 80 Fokl + E32 Donor (40 .mu.g) (4 .mu.g) (0
.mu.g) (36 .mu.g) (1:10) filler1
Sequence Validation of Targeting Using NGS
[0090] ZFN cleavage activity in maize protoplasts was determined
using the Next Generation Sequencing method described in EXAMPLE 3.
The sequenced PCR amplified fragments were scored for the presence
of sequence variants resulting from indels. The relative frequency
of indels from each of E32 ZFN6 treatment cleaved the genomic locus
of transgenic Corn Event DAS-59132 at about 1.5% of the DNA
molecules in the amplicons.
Demonstration of Targeting Using In-Out PCR
[0091] Targeting of an AAD-1 gene-containing donor cassette into
the genomic locus of transgenic Corn Event DAS-59132 into the Hi-II
maize transgenic cell suspensions via NHEJ was confirmed via a
in-out PCR reactions. The in-out PCR reactions amplified fragments
containing the junction of the AAD-1 gene donor and genomic locus
of transgenic Corn Event DAS-59132. The resulting amplicon was
subjected to a second PCR reaction, wherein primers were designed
to bind internally within the first amplicon. The combination of
two independent PCR reactions resulted in the removal of background
amplifications which may be false-positives.
[0092] The in-out PCR results of the protoplast transformation
experiments demonstrated that the genomic locus of transgenic Corn
Event DAS-59132 could be reproducibly targeted with a 5.3 kb AAD-1
gene plasmid donor and the E32-ZFN6 zinc finger nuclease at a ratio
of 1:10 .mu.g of DNA Targeting via a NHEJ method was evidenced by
the insertion of the AAD-1 gene donor cassette in both
orientations. Sequence of the in-out PCR amplicons showed three
instances of perfect integration of the donor DNA.
Example 5
WHISKERS.TM. Mediated Stable Transformation of ZFN and Donor for
Targeted Integration via NHEJ in Maize Hi-II Cultures
[0093] Transgenic events were targeted to the endogenous genomic
locus of Corn Event DAS-59132. Constructs as described in Example 1
include the donor sequence (pDAB100655) and Event 32 ZFN 6 (E32
ZFN6; pDAB105906).
[0094] Maize callus cells, consisting of 12 mL of packed cell
volume (PCV) from a previously cryo-preserved Hi-II cell line, plus
28 mL of conditioned medium was subcultured into 80 mL of GN6
liquid medium (N6 medium (Chu et al., (1975) Sci Sin. 18:659-668),
2.0 mg/L of 2,4-D, 30 g/L sucrose, pH 5.8) in a 500 mL Erlenmeyer
flask, and placed on a shaker at 125 rpm at 28.degree. C. This step
was repeated two times using the same cell line, such that a total
of 36 mL PCV was distributed across three flasks. After 24 hours,
the GN6 liquid media was removed and replaced with 72 mL GN6 S/M
osmotic medium (N6 Medium, 2.0 mg/L 2,4-D, 30 g/L sucrose, 45.5 g/L
sorbitol, 45.5 g/L mannitol, 100 mg/L myo-inositol, pH 6.0). The
flask was incubated in the dark for 30-35 minutes at 28.degree. C.
with moderate agitation (125 rpm). During the incubation period, a
50 mg/mL suspension of silicon carbide WHISKERS.TM. (Advanced
Composite Materials, LLC, Greer, S.C.) was prepared by adding 8.1
mL of GN6 S/M liquid medium to 405 mg of sterile, silicon carbide
WHISKERS.TM..
[0095] Following incubation in GN6 S/M osmotic medium, the contents
of each flask were pooled into a 250 mL centrifuge bottle. After
all cells in the flask settled to the bottom, the content volume in
excess of approximately 14 mL of GN6 S/M liquid was drawn off and
collected in a sterile 1 L flask for future use. The pre-wetted
suspension of WHISKERS.TM. was mixed at maximum speed on a vortex
for 60 seconds, and then added to the centrifuge bottle.
[0096] In this example, 159 .mu.g of pDAB100655 (donor sequence)
and 11 .mu.g of pDAB10506 (ZFN) plasmid DNA were added to each
bottle. Once the plasmid DNA was added, the bottle was immediately
placed in a modified RED DEVIL 5400.TM. commercial paint mixer (Red
Devil Equipment Co., Plymouth, Minn.), and agitated for 10 seconds.
Following agitation, the cocktail of cells, media, WHISKERS.TM. and
plasmid DNA were added to the contents of a 1 L flask along with
125 mL fresh GN6 liquid medium to reduce the osmoticant. The cells
were allowed to recover on a shaker set at 125 rpm for 2 hours.
About 6 mL of dispersed suspension was filtered onto Whatman #4
filter paper (5.5 cm) using a glass cell collector unit connected
to a house vacuum line such that 60 filters were obtained per
bottle. Filters were placed onto 60.times.20 mm plates of GN6 solid
medium (same as GN6 liquid medium except with 2.5 g/L glufosinate).
Identification and isolation of putative targeted events
[0097] One week post-DNA delivery, filter papers were transferred
to 60.times.20 mm plates of GN6 (1H) selection medium (N6 Medium,
2.0 mg/L 2,4-D, 30 g/L sucrose, 100 mg/L myo-inositol, 2.5 g/L
Gelrite, pH 5.8) containing a selective agent. These selection
plates were incubated at 28.degree. C. for one week in the dark.
Following 1 week of selection in the dark, the tissue was embedded
onto fresh media by scraping 1/2 the cells from each plate into a
tube containing 3.0 mL of GN6 agarose medium held at 37-38.degree.
C. (N6 medium, 2.0 mg/L 2,4-D, 30 g/L sucrose, 100 mg/L
myo-inositol, 7 g/L SEAPLAQUE.RTM. agarose, pH 5.8, autoclaved for
10 minutes at 121.degree. C.).
[0098] The agarose/tissue mixture was broken up with a spatula, and
then 3 mL of agarose/tissue mixture was evenly poured onto the
surface of a 100.times.25 mm PETRI.TM. dish containing GN6 (1H)
medium. This process was repeated for both halves of each plate.
Once all the tissue was embedded, the plates were incubated at
28.degree. C. under dark conditions for up to 10 weeks. Putatively
transformed isolates that grew under these selection conditions
were removed from the embedded plates and transferred to fresh
selection medium in 60.times.20 mm plates. If sustained growth was
evident after approximately 2 weeks, an event was deemed to be
resistant to the applied herbicide (selective agent) and an aliquot
of cells was subsequently harvested for genotype analysis. In this
example, 24 events were recovered from 6 treated bottles. These
events were advance for molecular analysis to confirm the
integration.
Molecular Analysis of NHEJ Targeting to the E32 Locus
[0099] The 24 events that were recovered from the WHISKERS.TM.
mediated transformation, as described above, were analyzed using
several different molecular tools. As a result of the analysis,
events which contained a copy of the AAD-1 transgene integrated
within the E32 genomic locus were identified. The 24 various events
were confirmed to contain a copy of the AAD-1 transgene and then it
was determined if there was disruption of the E32 site by either
indels or by the insertion of AAD-1 cassette. The events that were
positive for the presence of the AAD-1 gene and a disrupted ZFN
site were further characterized for the presence of the expected
donor and target junction fragments (by In-Out PCR), and for
expected molecular weight fragments that corresponded with band
sizes in Southern blot that indicated a targeted insertion of the
donor DNA region within the E33 genomic locus. These assays
confirmed that events containing a copy of the AAD-1 transgene
integrated within the E32 genomic locus via an NHEJ mechanism.
DNA Extraction
[0100] DNA was extracted from lyophilized maize callus tissue using
a QIAGEN BIOSPRINT 96.TM. DNA isolation kit per manufacturer's
recommendations. A pre-defined program was used for the automation
extraction and DNA was eluted in 200 .mu.L of 1:1 TE
Buffer/distilled water. Two microliters (2 .mu.L) of each sample
was quantified on THERMOSCIENTIFIC NANODROP 8000.TM. and samples
were normalized to 100 ng/.mu.L using QIAGEN BIOROBOT 3000.TM..
Normalized DNA was stored at 4.degree. C. until further
analysis.
Copy Number Evaluation
[0101] Transgene copy number determination by a hydrolysis probe
assay, analogous to a TAQMAN.RTM. assay, was performed by real-time
PCR using the LIGHTCYCLER.RTM.480 system (Roche Applied Science,
Indianapolis, Ind.). Assays were designed for AAD-1 and the
internal reference gene, Invertase, using LIGHTCYCLER.RTM. Probe
Design Software 2.0. For amplification, LIGHTCYCLER.RTM.480 Probes
Master mix (Roche Applied Science, Indianapolis, Ind.) was prepared
at 1.times. final concentration in a 10 .mu.L volume multiplex
reaction containing 0.4 .mu.M of each primer and 0.2 .mu.M of each
probe (Table 5). A two step amplification reaction was performed
with an extension at 60.degree. C. for 40 seconds with fluorescence
acquisition. Analysis of real time PCR copy number data was
performed using LIGHTCYCLER.RTM. software release 1.5 using the
relative quant module and is based on the .DELTA..DELTA.Ct method.
For this, a sample of gDNA from a single copy calibrator and a
known two-copy check were included in each run.
TABLE-US-00007 TABLE 5 Primer/Probe Sequences for hydrolysis probe
assay of AAD-1 and internal reference. Primer Name Sequence
Detection GAAD1F SEQ ID NO: 24; TGTTCGGTTCCCTCTACCAA -- GAAD1R SEQ
ID NO: 25; CAACATCCATCACCTTGACTGA -- GAAD1R SEQ ID NO: 26;
CACAGAACCGTCGCTTCAGCAACA FAM IVF-Taq SEQ ID NO: 27;
TGGCGGACGACGACTTGT -- IVR-Taq SEQ ID NO: 28; AAAGTTTGGAGGCTGCCGT --
IV Probe SEQ ID NO: 29; CGAGCAGACCGCCGTGTACTTCTACC HEX
Corn Event DAS-59132 Genomic Locus Disruption Assay
[0102] A genomic locus disruption assay for Corn Event DAS-59132
was performed by real-time PCR using the LIGHTCYCLER.RTM.480 system
(Roche Applied Science, Indianapolis, Ind.). Assays were designed
to monitor the specificity for which E32 ZFN6 (25716/25717) bound
and cleaved genomic sequences of the E32 locus and the internal
reference gene invertase using the LIGHTCYCLER.RTM. Probe Design
Software 2.0. For amplification, LIGHTCYCLER.RTM.480 Probes Master
mix (Roche Applied Science, Indianapolis, Ind.) was prepared at
1.times. final concentration in a 10 .mu.L volume multiplex
reaction containing 0.4 .mu.M of each primer and 0.2 .mu.M of each
probe (Table 6). A two step amplification reaction was performed
with an extension at 55.degree. C. for 30 seconds with fluorescence
acquisition. Analysis for the disruption assay was performed using
target to reference ratio (FIG. 5). Four of the eight events were
identified as containing an AAD-1 transgene integrated into the
genomic locus of Corn Event DAS-59132. The following events,
consisting of; Event 100655/105906[1]-001, Event
100655/105906[5]-013, Event 100655/105906[5]-015, and Event
100655/105906[3]-018, were advance for further molecular analysis
to confirm the integration of the AAD-1 transgene within the
genomic locus of Corn Event DAS-59132.
Event32 Locus Specific In-Out qPCR
[0103] The insertion of the AAD-1 donor DNA within the genomic
locus of E32 via NHEJ can occur in one of two orientations. The
integration of the AAD-1 transgene and the orientation fo the
insert were confirmed with an in-out PCR assay. The in-out PCR
assay utilizes an "out" primer that was designed to bind to the
genomic locus of E32; an "in" primer was designed to bind to the
AAD-1 donor sequence. The amplification reactions using these
primers only amplify a donor gene which is inserted at the target
site. The resulting PCR amplicons represent the junction fragments
of the E32 target site and the donor DNA sequences at either the 5'
or 3' ends of the insert. Positive and negative controls were
included in the assay. Two positive control plasmids, pDAB100664
and pDAB100665, were constructed to simulate donor insertion at the
genomic locus of E32 in each of the two different orientations.
[0104] For the in-out PCR, a DNA intercalating dye, SYTO-13.RTM.,
was used in the PCR mix in order to detect amplification in real
time on a thermocycler with fluorescence detection capability. In
addition, a melting temperature (Tm) analysis program was attached
to a regular PCR program so the amplified products could be
analyzed for their Tm profiles. Any similarity between the Tm
profiles of an unknown sample and the positive control sample would
indicate that the unknown sample has the same amplified product as
that of the positive control. The PCR reactions were conducted
using 10 ng of template genomic DNA, 0.2 .mu.M dNTPs, 0.2 .mu.M
forward and reverse primers, 4 .mu.M SYTO-13.RTM. and 0.15 .mu.L of
Ex Taq HS. Reactions were completed in two steps: the first step
consisted of one cycle at 94.degree. C. (2 minutes) and 35 cycles
at 98.degree. C. (12 seconds), 66.degree. C. (30 seconds) and
68.degree. C. (1.3 minutes); the second step was a Tm program
covering 60-95.degree. C. followed by 65.degree. C. (30 seconds)
and 72.degree. C. (10 minutes) (Table 6). The amplicons were
sequenced to confirm that the AAD-1 gene had integrated within the
genomic locus of E32.
[0105] The results of the real-time, in-out PCR amplicons were
visualized using the ABI software. These results were further
confirmed using a gel shift assay, wherein the amplicons were run
on a 1.2% TAE gel. Expected amplicon sizes were approximately 1.8
kb for the orientation as depicted in pDAB100664 and about 2 kb for
the orientation depicted in pDAB100665. The gel shift assay results
confirmed the real-time, in-out PCR data.
[0106] The locus disruption data and in-out PCR suggested that a
copy of the AAD-1 transgene had integrated via NHEJ into the E32
locus in some maize events recovered by selection on 2,4-D.
TABLE-US-00008 TABLE 6 Primers for In-Out PCR to detect NHEJ
mediated targeting. Expected Amplicon size/ Primer Name Sequence
control E32-3R2 Forward Primer SEQ ID NO: 30 1.8 kb NJ-AAD1-Pri2
GCC CTT ACA GTT CAT GGG CG pDAB100664 Reverser Primer SEQ ID NO: 31
GAC CAA GTC CTT GTC TGG GAC A E32-5F1 Forward Primer SEQ ID NO: 32
2.0 kb NJ-AAD1-Pri2 ACA AAC ACG TCC TCC AAG GCT pDAB100665 Reverse
Primer SEQ ID NO: 33 GAC CAA GTC CTT GTC TGG GAC A
Southern Blot Analysis
[0107] The maize callus events identified above as putatively
targeted were further screened using a Southern blot assay to
confirm that the AAD-1 transgene had integrated via NHEJ into the
E32 locus. The Southern blot analysis experiments generated data
which demonstrated the integration and integrity of the AAD-1
transgene within the maize genome.
DNA Extraction
[0108] Genomic DNA was extracted from the callus tissue harvested
from each individual event. Initially, the tissue samples were
collected in 2 mL tubes and lyophilized for 2 days. Tissue
maceration was performed with a KLECO TISSUE PULVERIZER.TM. and
tungsten beads (Kleco, Visalia, Calif.). Following tissue
maceration the genomic DNA was isolated using the DNEASY PLANT MINI
KIT.TM. (Qiagen, Germantown, Md.) according to the manufacturer's
suggested protocol.
[0109] Genomic DNA (gDNA) was quantified using the QUANT-IT PICO
GREEN DNA ASSAY KIT.TM. (Molecular Probes, Invitrogen, Carlsbad,
Calif.). Quantified gDNA was adjusted to 4 .mu.g for the Southern
blot analysis. DNA samples were then digested using the NcoI
restriction enzyme (New England BioLabs, Ipswich, Mass.) overnight
at 37 .degree. C. and purified using QUICK-PRECIP.TM. (Edge
BioSystem, Gaithersburg, Md.) according to the manufacturer's
suggested protocol. DNA was resuspended in 1' dye and
electrophoresed for 5 hours on a 0.8% SEAKEM LE AGAROSE.TM. (Lonza,
Rockland, Me.) gel. The gel was denatured, neutralized, and then
transferred to a nylon charged membrane (Millipore, Bedford, Mass.)
overnight and DNA was crosslinked to the membrane using a UV STRATA
LINKER 1800.TM. (Stratagene, La Jolla, Calif.), and blots were
prehybridized with 20 mL of PERFECTHYB PLUS.TM. (Sigma, St. Louis,
Mo.). The 226 by probe SEQ ID NO:34
TABLE-US-00009 (GTGCATTCGGATTACTGTTTAGTCGAGTCATATTTAAGGAATTCATTGT
AAATGTTCTAACCTAACCTAAGTATTAGGCAGCTATGGCTGATATGGATC
TGATTGGACTTGATTTATCCATGATAAGTTTAAGAGCAACTCAAAGAGGT
TAGGTATATATGGTTTTGTAAAGGTAAATTTAGTTAATATTAGAAAAAAA
AAGTGTATCCAATAGGCTCTATAAACA)
was labeled using PRIME-IT RMT RANDOM.TM. (Stratagene, La Jolla,
Calif.) according to manufacturer's suggested protocol and purified
using PROBE QUANT G-50 MICRO COLUMNS.TM. (GE Healthcare,
Buckinghamshire, UK) per the manufacturer's suggested protocol.
Approximately, 20.times.10.sup.6 cpm of the labeled probe was added
to the blots and incubated overnight. Blots were washed twice for
15 minutes per wash and placed on a phosphor image screen for 24
hours and analyzed by a STORM 860 SCANNER.TM. (Molecular
Dynamics).
[0110] The results from Southern blot analysis showed DNA from some
events had NcoI bands of the size expected (2.9 and 5.5 kb) from
integration of the donor DNA via NHEJ into the E32 locus.
[0111] The transformed maize tissue was regenerated into fertile
corn plants bearing the true-breeding phenotype resistance to the
2,4-dichlorophenoxyacetic acid herbicides conferred by the AAD-1
gene introduced by the donor DNA.
Example 6
Targeting Event 32 via Homology Directed Repair in Zea Mays c.v.
Hi-IIPlasmid Vectors
[0112] Plasmid vectors containing ZFN expression constructs were
constructed as described in Example 2. The ZFN expressed in plasmid
construct, pDAB105906 (FIG. 2), contains "Fok-Mono" which is a wild
type FokI endonuclease. The ZFN expressed in plasmid construct,
pDAB111809 (FIG. 3), contains "Fok1-ELD" which is a modified Fold
endonuclease. The modified Fok1 endonuclease contains alterations
as described in Doyon Y., Vo T., Mendel M., Greenberg S., Wang J.,
Xia D., Miller J., Urnov F., Gregory P., and Holmes M. (2010)
Enhancing zinc-finger-nuclease activity with improved obligate
heterodimeric architecture. Nature Methods, 8(1); 74-79.
[0113] A donor construct, pDAB107855 (FIG. 15), was designed and
built to integrate into the ZFN cleaved genomic DNA of the
DAS-59132 genomic locus. This single gene expression cassette is
comprised of the OsAct1 promoter, the phosphinothricin acetyl
transferase (PAT) coding sequence :: and the ZmLip 3' UTR. In
addition, the donor plasmid was designed with 1 kb sequences
(homology arms) on either end of the target PAT gene that were
homologous to sequence on either end of the ZFN cut site in the
DAS-59132 genomic locus. The homology arms served as the substrate
that the homologous recombination machinery used to insert the
transgene into the genomic ZFN cut site. The various gene elements
were assembled in a high copy number pUC based plasmid.
Plant Transformation
[0114] WHISKERS.TM. transformations were done as described in
EXAMPLE 5 using pDAB107855 (donor sequence) and pDAB105906 (ZFN)
plasmid DNA.
Molecular Analysis to Confirm Targeted Integration of a Pat Gene
Cassette into the E32 Locus of Hi-II
DNA Extraction
[0115] DNA extractions were done as described in EXAMPLE 5.
Targeted Locus Disruption Assay
[0116] WHISKERS.TM. mediated transformation of Hi-II callus cells
with the DAS-59132-ZFN and donor plasmid resulted in targeted and
random transgene insertions. To distinguish random insertion events
from the targeted event populations, all 854 events generated were
initially screened using a locus disruption assay (done as
described in EXAMPLE 5 using primers in Table 7). This assay
determined whether the ZFN binding site within the locus remains
intact or had been disrupted through ZFN cleavage or donor
insertion. Indication of a disruption within the genomic loci is
initial evidence that the ZFN has cleaved the endogenous DAS-59132
target locus and indicates targeted insertion of the donor DNA
molecule. Primers were designed to amplify the endogenous target
region that contains the ZFN recognition sites, and samples were
set up to be analyzed by qPCR. Amplification of the intact region,
indicative of an untargeted event, resulted in a 140 base pair
amplicon measured as a detectable qPCR signal. Successful targeted
integration of the donor molecule results in disruption of the
detectable qPCR signal and is shown as a lower overall signal
compared to control.
TABLE-US-00010 TABLE 7 Oligonucleotide Primer and Probe Sequences
for targeted Locus Disruption Assay. Primer Name SEQ ID NO:
Sequence Detection MAS604 SEQ ID NO: 35 ACACGGCACACACGGCGACATTCA --
MAS606 SEQ ID NO: 36 AGGGCAGTGGCCAGTGTTCCTGTG -- UPL 69 -- Roche
Sequence FAM IVF-Taq SEQ ID NO: 37 TGGCGGACGACGACTTGT -- IVR-Taq
SEQ ID NO: 38 AAAGTTTGGAGGCTGCCGT -- IV-Probe SEQ ID NO: 39
CGAGCAGACCGCCGTGTACTTCTACC HEX
[0117] The 854 events generated from precision transformation were
screened with the disruption assay, and scored as disrupted based
on a significant drop in the target to reference signal. The
results indicated that 63 of the 854 events assayed had a disrupted
signal at the targeted locus, indicative of targeted gene insertion
or indels at the site.
Targeted Locus In-Out PCR Assay
[0118] The presence of an insert were further confirmed using
in-out PCR as described in EXAMPLE 5 and using the primers in Table
8. Positive samples identified on the real-time system were further
confirmed using a standard gel shift assay.
TABLE-US-00011 TABLE 8 Primer and Probe Sequences for DAS-59132
Locus In-Out Assay. Primer Name SEQ ID NO: Primer Sequence 5'
E32-5F3 SEQ ID NO: 40 GAAGGCAAAACGAATATAAGTGCATTCGG Junction
E32-OLP-R1 SEQ ID NO: 41 TCGTGGATAGCACTTTGGGCT Sequence 3'
E32-OLP-F3 SEQ ID NO: 42 TCTACAGTGAACTTTAGGACAGAGCCA Junction
E32-3R2 SEQ ID NO: 30 GCCCTTACAGTTCATGGGCG Sequence
[0119] The results of the disruption assay and the targeted locus
in-out PCR assay were further confirmed via Southern blotting and
sequencing (standard of Next Generation Sequencing).
[0120] In this example, 63 events out of a total of 854 samples
submitted showed disruption of the E32 Locus. Of these, 8 targeted
events were identified by in-out PCR and Southern analysis.
[0121] The transformed maize tissue was regenerated into fertile
corn plants bearing the true-breeding phenotype, resistance to
glufosinate and L-phosphinothricin, herbicides, of the donor
DNA.
Example 7
Agrobacterium-Mediated Delivery of Plasmid Vectors for Event 32
Locus Disruption in Zea Mays c.v. B104
Transformation
[0122] Zea mays c.v. B104 was transformed with binary constructs
pDAB108688 (control vector, FIG. 6) and pDAB108690 (targeting
vector, FIG. 7) using the superbinary transformation system (U.S.
Pat. No. 5,591,616). As such, Agrobacterium was used for delivery
of the ZFNs to the E32 genomic locus. Transgenic maize callus were
obtained and analyzed via molecular confirmation assays to
determine whether or not the E32 genomic locus of Zea mays c.v.
B104 was disrupted. The results of the assays confirmed that
Agrobacterium could be used to deliver ZFNs to cleave and disrupt
the E32 genomic locus.
Binary Vectors
[0123] A binary construct, pDAB108690 (targeting vector, FIG. 7),
was designed and built to contain a donor gene expression cassette
and a ZFN gene expression cassette. This donor gene expression
cassette was comprised of the Zea mays Ubiquitin 1 gene promoter
(Zm Ubi1 promoter), the AAD-1 coding sequence and was terminated by
the Zea mays lipase 3' untranslated region (ZmLip 3'UTR). In
addition, the donor plasmid was designed with 1 kb sequence
(homology arms) on either end of the AAD-1 gene that are homologous
to sequence on either end of the ZFN cut site in the E32 genomic
locus to facilitate donor insertion by HDR. The ZFN gene expression
cassette was comprised of the rice Actin1 gene promoter (OsAct1
promoter), the 25716 and 25717 ZFN coding sequences and the ZmPer5
3' UTR.
[0124] In addition, a second control binary construct, pDAB108688
(control vector, FIG. 6), was designed and built to contain a gene
expression cassette the same AAD-1 gene In addition, the donor
plasmid was designed with 1 kb sequence (homology arms) on either
end of the target aad-1 gene that is homologous to sequence on
either end of the ZFN cut site in the E32 genomic locus.
Zea Mays c.v. B104 Transformations
[0125] The constructs were transferred into Agrobacterium and used
to transform Zea mays c.v. B104. The transformation procedure that
was utilized is described in U.S. Pat. Pub. No. 2013/0157369. After
completion of the transformation, isolated maize callus tissues
were selected for and obtained from media containing the herbicide
selectable agent. Table 9 shows the transformation frequency in the
experiments. The resulting events were analyzed via molecular
analysis to confirm ZFN mediated cleavage of the E32 Locus of Zea
mays c.v. B104 following delivery of ZFN and donor via
Agrobacterium-mediated transformation.
TABLE-US-00012 TABLE 9 Summary of transformation events produced
using pDAB108688 (control vector) and pDAB108690 (targeting
vector). Number of immature Putative events Transformation
Construct embryos transformed produced frequency (%) pDAB108688 930
355 38.17 (control vector) pDAB108690 4789 1002 20.92 (targeting
vector)
Genomic DNA Isolation for PCR from Callus Tissue
[0126] Genomic DNA was isolated as described in EXAMPLE 5.
Copy Number Determination
[0127] Transgene detection by hydrolysis probe assay, analogous to
TaqMan.RTM. assay, was performed by real-time PCR using the
LightCycler.RTM.480 system (Roche Applied Science). Assays were
designed for detection of AAD-1 and ZFN disruption and were
multiplexed with internal reference assays (Invertase) to ensure
appropriate amount of gDNA was present in each assay. For
amplification, LightCycler.RTM.480 Probes Master mix.TM. (Roche
Applied Science, Indianapolis, Ind.) was prepared at 1.times. final
concentration in a 10 .mu.L volume multiplex reaction containing
0.4 .mu.M of each primer and 0.2 .mu.M of each probe (Table 10). A
two step amplification reaction was performed with an extension at
60.degree. C. for 40 seconds (for the AAD1 reaction) or 60.degree.
C. for 30 seconds (for the ZFN disruption reaction) and with
fluorescence acquisition.
[0128] Cp scores, the point at which the fluorescence signal
crosses the background threshold using the fit points algorithm
(Light Cycler.RTM. software release 1.5) and the Relative Quant
module (based on the .DELTA..DELTA.Ct method), was used to perform
the analysis of real time PCR data.
[0129] The ZFN disruption qPCR assay determines if the ZFN target
site is intact or has been modified during the experiment (by donor
insertion or by NHEJ). This assay used the Roche UPL probe with
primers designed to anneal outside of the ZFN cut site and probe
hybridization region (FIG. 8). If events are disrupted at both
alleles, the target to reference ratio is reduced compared to
controls. Analysis of non-targeted controls and events that are not
disrupted showed a target to reference ratio in the 0.4 to 0.6
range; disrupted events showed a target to reference ratio in the
0.2 to 0.35 range (FIG. 9).
[0130] This data demonstrates that the E32 Locus can be cleaved by
introduction of the ZFN via Agrobacterium-mediated
transformation.
TABLE-US-00013 TABLE 10 Primers and probes for qPCR. Probe
(Flourophore/ Name SEQ ID NO: Oligo Sequence quencher) MAS604 SEQ
ID NO: 53 ACACGGCACACACGGCGACATTCA -- MAS606 SEQ ID NO: 54
AGGGCAGTGGCCAGTGTTCCTGTG -- UPL69 -- See Roche See Roche IVF-Taq
SEQ ID NO: 55 TGGCGGACGACGACTTGT -- IVR-Taq SEQ ID NO: 56
AAAGTTTGGAGGCTGCCGT -- IV-Probe SEQ ID NO: 57
CGAGCAGACCGCCGTGTACTTCTACC HEX/BHQ GAAD1F SEQ ID NO: 58
TGTTCGGTTCCCTCTACCAA -- GAAD1R SEQ ID NO: 59 CAACATCCATCACCTTGACTGA
-- GAAD1P SEQ ID NO: 60 CACAGAACCGTCGCTTCAGCAACA FAM
Example 8
Event 32 Locus Targeting via Homology Directed Repair in Zea Mays
c.v. B104
Vectors
[0131] Plasmid vectors for expression of ZFNs were described in
EXAMPLE 2.
[0132] A donor construct, pDAB104179 (FIG. 10, SEQ ID NO:61),
designed to integrate into the ZFN cleaved genomic DNA of the E32
genomic locus was a single gene expression cassette comprised of
the the OsAct1 promoter, the PAT coding sequence and the ZmLip 3'
UTR. In addition, the donor plasmid was designed with 1 kb sequence
(homology arms) on either end of the target PAT gene that is
identical to sequence on either end of the ZFN cut site in the E32
genomic locus to facilitate integration of the donor DNA
region.
Transformation into B104 Using Particle Bombardment
[0133] Ears of the inbred line Zea mays c.v. B104 were
self-pollinated and harvested when immature embryos were
approximately 1.8-2.2 mm in length. De-husked ears were transported
to the laboratory for sterilization. The end of a #4 stainless
steel scalpel handle (lacking a blade) was placed into the distal
portion of each ear. Ears were scrubbed with a nailbrush using
liquid detergent (Liqui-Nox.RTM., ALCONOX, Inc.) and
surface-sterilized by immersion in 20% commercial bleach (Ultra
Clorox.RTM. Germicidal Bleach, 6.15% sodium hypochlorite) for 20
minutes then rinsed with sterile deionized water 3 times inside a
laminar flow hood. Immature zygotic embryos were aseptically
excised from each ear and placed into an Eppendorf.TM. tube
containing approximately 2.0 mL `LS-inf medium` (LS salts, N6
vitamins, 68.5 g/L sucrose, 36 g/L D-glucose, 700 mg/L L-proline
and 1.5 mg/L 2,4-D). The contents of the tube were poured onto
plates of `resting medium` (MS salts and vitamins, 30 g/L sucrose,
700 mg/L L-proline, 15 mg/L silver nitrate, 500 mg/L MES, 100 mg/L
casein hydrolysate, 100 mg/L myo-inositol and 3.3 mg/L dicamba
adjusted to pH 5.8 and solidified with 2.3 g/L Gelzan.TM.), excess
liquid was removed, and embryos were oriented with the scutellum
facing upwards. Plates were placed at 28.degree. C. with 24 hours
continuous lighting at 50 .mu.moles/m.sup.2s for 3 days.
[0134] Four hours prior to bombardment, 30 embryos were arranged in
the center of Petri dish of `osmolysis medium` Cresting medium with
the addition of 45.5 g/L sorbitol and 45.5 g/L mannitol) within a
2.5 cm diameter area with the scutella facing upwards. The embryos
were incubated on this medium for 4 hours at 50 .mu.moles/m.sup.2s
at 28 .degree. C. prior to bombardment.
[0135] To prepare gold microparticles for bombardment, 15 mg of 0.6
micron gold (Bio-Rad, Hercules, Calif., USA) were weighed into a
siliconized microcentrifuge tube and 500 .mu.L of cold ethanol
(100%) was added. The tube was sonicated in an ultrasonic water
bath for 15 seconds, allowed to sit at room temperature for 30
minutes, and then centrifuged for 60 seconds at 3,000 rpm. The
supernatant was removed, and 1 mL cold, sterile water was added.
The tube was finger-vortexed, allowed to settle for 3-5 minutes,
and centrifuged for 60 seconds at 3,000 rpm. The supernatant was
removed, and the water wash was repeated two additional times.
After the second water wash, the gold was re-suspended in 500 .mu.L
cold water, sonicated for 15 seconds, and aliquoted 25 .mu.L at a
time into 10 sterile, siliconized microcentrifuge tubes. Individual
tubes were frozen at -20.degree. C. until use.
[0136] For precipitation of DNA onto prepared gold microparticles,
one tube of gold was thawed for every 10 plates to be bombarded.
The tube was sonicated in an ultrasonic water bath for 15 seconds,
finger-vortexed, and then tapped on the laminar flow hood surface
to gather all droplets to the bottom. To obtain a 20:1 molar ratio
of donor to zinc finger constructs, 4.75 .mu.g of donor DNA
(pDAB104182) was pre-mixed with 0.25 .mu.g of zinc finger
(pDAB105941), then added to the gold, while pipetting up and down.
Fifty .mu.L of 2.5 M calcium chloride (anhydrous) was added, while
pipetting up and down, and 20 .mu.L of 0.1M spermidine (free base)
was added, while pipetting up and down. The tube was placed on a
Turbomix.TM. attachment for a Vortex-Genie.RTM. set at 2, and
allowed to shake for 10 minutes at room temperature. The tube was
removed from the shaker and allowed to settle for 3-5 minutes
before being centrifuged for 15 seconds at 5,000 rpm. The
supernatant was removed, 250 .mu.L cold ethanol (100%) was added
and the tube was finger vortexed to dislodge the pellet and ensure
a uniform suspension. The DNA-coated microparticles settled for 3-5
minutes, and the tube was centrifuged again for 15 seconds at 5,000
rpm. The pellet was resuspended in 120 .mu.L cold ethanol (100%),
and finger vortexed to ensure dispersal. Macrocarriers were placed
into macrocarrier holders, autoclaved for sterility, coated with 10
.mu.L of the prepared solution and allowed to dry completely prior
to bombardment.
[0137] Bombardment of embryos was done using a PDS-1000.TM.
(Bio-Rad) per manufacturer's specifications at 900 psi under 28
inches vacuum at a distance of 6 cm from the stopping screen. Each
sample was bombarded once, and then returned to 50
.mu.moles/m.sup.2s 24-hour lighting overnight at 28.degree. C. The
next day, embryos were transferred to fresh `resting medium` for 7
days under the same temperature and lighting conditions. Embryos
were subsequently transferred to `sel-5 Bi medium` Cresting medium
with the addition of 5 mg/L Bialaphos) for 7 days, transferred a
second time to the same medium for 14 days and then transferred to
`pre-regen medium` (MS salts and vitamins, 30 g/L sucrose, 700 mg/L
L-proline, 15 mg/L silver nitrate, 500 mg/L MES, 100 mg/L casein
hydrolysate, 100 mg/L myo-inositol and 3.3 mg/L dicamba, 2.5 mg/L
ABA, 1 mg/L BAP, 0.5 mg/L NAA and 5 mg/L Bialaphos adjusted to pH
5.8 and solidified with 2.3 g/L Gelzan) for 7 days under the same
temperature and lighting conditions. Tissues were then transferred
to `regen media` (MS salts and vitamins, 30 g/L sucrose, 100 mg/L
myo-insitol and 5 mg/L Bialaphos adjusted to pH 5.8 and solidified
with 2.3 g/L Gelzan) under a 16/8 light/dark photoperiod with 90
.mu.moles/m.sup.2s lighting for 14 days at 28.degree. C. Plantlets
were transferred to `plant robusting medium` (MS salts and
vitamins, 30 g/L sucrose, 500 mg/L MES and 100 mg/L myo-insitol
adjusted to pH 5.8 and solidified with 2.3 g/L Gelzan) under
150-200 .mu.moles/m.sup.2s lighting at 28.degree. C. using the same
photoperiod. Once plants grew to at least 8 cm, a 2 cm section of
leaf tissue was collected on wet ice, and delivered to a 4.degree.
C. cold room for analysis. Plantlets were then transplanted into
soil and transferred to the greenhouse and analyzed via molecular
analysis.
Molecular Analysis Bialophos-Selected Events
[0138] Genomic DNA Isolation for qPCR from Callus Tissue
[0139] Tissue samples were collected in 96-well collection plates
(Qiagen) and lyophilized for 48 hours. Tissue disruption was
performed with a Kleco.TM. tissue pulverizer (Garcia Manufacturing,
Visalia, Calif.) in Biosprint96 RLT lysis buffer.TM. with one
stainless steel bead. Following tissue maceration, genomic DNA was
isolated in a high throughput format using the Biosprint96 Plant
kit.TM. (Qiagen) and the Biosprint96 extraction robot.TM.. Genomic
DNA was then diluted to 2 ng/.mu.L.
Copy Number Determination
[0140] Gene copy number and the disruption assay were done as
described in EXAMPLE 7. Analysis of non-targeted controls and
events that are not targeted or disrupted showed a target to
reference ratio in the 0.4 to 0.6 range; disrupted or targeted
events showed a target to reference ratio in the 0.2 to 0.35 range
(FIG. 12).
TABLE-US-00014 TABLE 11 Primers and probes for qPCR. SEQ Probe ID
(Flourophore/ Name NO: Oligo Sequence quencher) MAS604 53
ACACGGCACACACGGCGACATTCA -- MAS606 54 AGGGCAGTGGCCAGTGTTCCTGTG --
UPL69 -- See Roche See Roche IVF-Taq 55 TGGCGGACGACGACTTGT --
IVR-Taq 56 AAAGTTTGGAGGCTGCCGT -- IV-Probe 57
CGAGCAGACCGCCGTGTACTTCTACC HEX/BHQ TQPATS 62
ACAAGAGTGGATTGATGATCTAGAGAGG -- T TQPATA 63
CTTTGATGCCTATGTGACACGTAAACAGT -- TQPATF 64
GGTGTTGTGGCTGGTATTGCTTACGCTGG CY5/BHQ2 Q ZGP3S 65
CCTGCTCCACTACCAGTACAA -- ZGP3A 66 GTCCAAGAAGGTGACCTTCTC -- TQZGP3
67 AGATCACCGACTTTGCGCTCTTT 6FAM/BHQ1
Locus-Specific In-Out PCR
[0141] Locus-specific in-out PCR was done as described in EXAMPLE
5.
TABLE-US-00015 TABLE 12 Primer sequences for in-out PCR. Name SEQ
ID NO: Oligo Sequence E32- SEQ ID NO: 68
GAAGGCAAAACGAATATAAGTGCATTCGG 5F3 E32- SEQ ID NO: 69
TCTACAGTGAACTTTAGGACAGAGCCA OLP- F3 E32- SEQ ID NO: 70
TCGTGGATAGCACTTTGGGCT OLP- R1 E32- SEQ ID NO: 71
GCCCTTACAGTTCATGGGCG 3R2
[0142] Expected amplification sizes for the 5' end amplicon was
1,874 by and the 3' end was 2,089 bp. The PCR bands were excised
and sequenced. The resulting sequence data confirmed that the
amplicons contained the expected genomic E32 locus-donor
chromosomal junctional sequences.
Southern Blot
[0143] DNA from events that showed positive disruption and in-out
PCR were analyzed by Southern blots to confirm intact donor
insertion at the target. DNA was digested with NcoI and probed with
flanking genomic DNA outside the homology arms (FIG. 14). A band at
1,950 by was predicted for the endogenous, non-targeted locus and a
band of 4,370 by was predicted for a targeted locus.
[0144] For Southerns, genomic DNA (from 1 .mu.g to 5 .mu.g) was
digested in 1.times. Buffer 3 (New England BioLabs) with 50 Units
of NcoI (New England BioLabs) in a final volume of 125 .mu.L.
Samples were incubated at 37.degree. C. overnight. The digested DNA
was concentrated by re-precipitation with Quick Precipitation
Solution.TM. (Edge Biosystems) according to manufacturer's
suggested protocol. Recovered digest was resuspended in 30 .mu.L of
1.times. loading buffer and incubated at 65.degree. C. for 30
minutes. Resuspended samples were loaded onto a 0.8% agarose gel
prepared in 1.times. TAE (0.8M Tris-acetate [pH8.0]/0.04 mM EDTA)
and electrophoresed in 1.times. TAE buffer. The gel was
sequentially subjected to denaturation (0.2 M NaOH/0.6M NaCl) for
30 minutes, and neutralization (0.5 M Tris-HCl [pH7.5]/1.5M NaCl)
for 30 minutes. Transfer of DNA fragments was performed by
passively wicking 20.times.SSC solution overnight through the gel
onto treated Immobilon NY+.TM. (Millipore) Following transfer, the
membrane was briefly washed with 2.times.SSC, cross-linked with a
StrataLinker 1800.TM. (Stratagene), and baked at 80.degree. C. for
1 hour.
[0145] Blots were incubated with prehybridization solution (Perfect
Hyb plus.TM., Sigma) for 1 hour at 65.degree. C. in glass roller
bottles using a model 400 Hybridization Incubator.TM. (Robbins
Scientific). For probe preparation, genomic sequence outside the
donor homology region was PCR amplified with primers (Table 13) and
purified from agarose gels using a QIAquick gel extraction kit.TM.
(Qiagen). The fragment was labeled with 3000 Ci/mmol
.alpha..sup.32P-dCTP (Perkin/Elmer/BLU513H) using Prime-IT.RTM. II
Random Primer labeling kit.TM. (Stratagene) according to
manufacturer's suggested protocol. Blots were hybridized overnight
at 65.degree. C. with denatured probe at approximately
2.times.10.sup.6 counts per mL/hybridization buffer. Following
hybridization, blots were washed at 65.degree. C. with
0.1.times.SSC/0.1% SDS for 40 minutes. Blots were exposed using
phosphor imager screens (Molecular Dynamics) and imaged using a
Storm Imaging System.TM. (Molecular Dynamics, Storm 860.TM.).
TABLE-US-00016 TABLE 13 Primers used to make Southern probe. Name
SEQ ID NO: Oligo Sequence MAS600 SEQ ID NO: 72
TGTTTATAGAGCCTATTGGATACA MAS603 SEQ ID NO: 73
AGTGCATTCGGATTACTGTTTAGTC
[0146] A total of 912 events were screened by disruption and in-out
PCR and 16 were confirmed to be targeted based on Southern
analysis. The targeting frequency for a donor fragment within the
E32 genomic locus was calculated to be 1.8%.
[0147] Although disclosure has been provided in some detail by way
of illustration and example for the purposes of clarity of
understanding, it will be apparent to those skilled in the art that
various changes and modifications can be practiced without
departing from the spirit or scope of the disclosure. Accordingly,
the foregoing descriptions and examples should not be construed as
limiting.
Sequence CWU 1
1
7313102DNAArtificial SequenceEvent 32 Locus 1agttgggaag gcaaaacgaa
tataagtgca ttcggattac tgtttagtcg agtcatattt 60aaggaattca ttgtaaatgt
tctaacctaa cctaagtatt aggcagctat ggctgatatg 120gatctgattg
gacttgattt atccatgata agtttaagag caactcaaag aggttaggta
180tatatggttt tgtaaaggta aatttagtta atattagaaa aaaaaagtgt
atccaatagg 240ctctataaac aactcttcaa atttagtggc tttctatcca
tccacctttg ctctctattt 300ttggatagcc tgatttactc tctattcagt
ccgtaggttt aatgagtctg ttggattagc 360ctacactttt tctgtaaaat
ctattttaga tagtagctaa atcagtaaat ttggctagta 420tttttagcta
ttctcttgga gtttgctata agaccagaac atgtaaattg gaagtttgtg
480gacccggacg agaatgcatg acaaatccag agtattgatg atggaattca
cctattttac 540ccgactcttc cattgtgtcc atttctcatc atccccgggc
gctttctgca tccggtacag 600ctgacatgac acgttcacgc gttacatggc
tgatggctca caagtcaccc ccacatgtct 660agtgttcgcc caggcagatc
gtcctcggcc tgcgctgccg tgctcttgcc gccgcttgct 720tgggccctgc
tggcgcccgc tgccgatcac acggcctacg cggtgcaggc agcgccaccg
780aacccgcagt cttgttgtgc cgataggtgg cagtggcagt ggcactggca
cggcacgcga 840tcgatcgctc cgctcatctg ctgacagtgg atagagcagc
gttggccgtt ggggccggat 900ctccgtgaag cggtcgtccc tgctgtactg
tgccgctatg gcgtgtcgct ttcgccatgt 960tttcttttct tttttttttc
tttttctttt tgctagggcg gtttctcgtt cgctggtaac 1020agggaccact
tcggttgatc cgttgaattt actgaaagag atgggaatgg tcgctgtgcc
1080cgggacattg aatgagatgt tgtgtaagtg aatatggctt tagccttttg
cgagtggggc 1140ggcaatgcac ggcatgaact ataatttccg gtcaaacttt
tgtgtggaaa tggatgctaa 1200acgaacacaa accgggttta aaccagaggc
cgacacggca cacacggcga cattcaccgc 1260cggcttcctc cgtcgccact
cggcacaagg ctcatcagtc gccgatgccc gatgcgatca 1320acggaagcgg
atggcccgct tctttagaat tggcacagga acactggcca ctgcccttga
1380tgtgcaatta tgcctgcgaa agcctaggca acacacgcga ataaacgagc
gaatgacacg 1440gaaagctgat gtggtatgaa ttatacaaca ttatgggcca
aaatattatt ctatccacca 1500ttgtgtagcc acagcatcgg tatttgagtt
gtgcgaggac aaatccctcg tgaggtcaaa 1560aacagcaaat aataaaccca
tctcctgaag acaccaaaaa aaaggagcag ctcctcgtgt 1620caatgaacaa
gcgtcacaag aaaagggagc acgtaaataa cctcttcaat tgcttcagca
1680tgaaaagaac gggaagaaat gcaagtctac agaggaaagt gcagctgttt
cggctgccat 1740ggcaagttcc tacatgggcg aggaaaagct gaactggatt
ccagtcttcg cgctgtcatg 1800ctcagcttgc tttaggatgc ggcaatagtt
cacctggatg aaaaagatac aagttagtct 1860tgaagcagtc gagtggacat
ccaaagtatc aaaatcgaaa gcttgtaaat ggggaaggaa 1920atatacctct
acccggaaaa gtttggtagg caaaataatc ccaacgccag cagagctccg
1980gaacgtttgc cgaaattcag aagccgaaaa gttcttgtac tcaccctccg
acagtttcgc 2040aaggtttcca gcagtaagga atgcgtggcc atggattcca
gcgtctctga atatcttgag 2100gggcagatca aaagaaaggt cagcgaaggc
agacacggcc agatcacctc ccaagtaatc 2160ccttccaggg tcagccgagc
cactctccga gttattaagg acatgcctcc gcgcctctgt 2220tgggccaact
ccccttaatc tgaaacccag cagagatgac ggtccgccca agctgcacac
2280tggagaagaa ttacctccaa gataaaacct ctctggcact gatgaagtcg
aattcatgaa 2340tccccctgca agcggtaaaa tgacacccgc tcctacacca
acgttgagag cagcactata 2400aaatcccaaa ggcacagcac cacgtacatc
gaactcctga gagcaaaccc aacggcaata 2460tttttgtaat agtgatggtc
agaactgaga agatcagata aaattataca ctgatgcaat 2520tatttcatag
tttcgcccat gaactgtaag ggctagacaa agcaaaaagt aagacatgaa
2580gggcaagaga ataacctgcc ggaaatatct caatcctttg ctattccata
gaccaccaac 2640ttgagaagtt gactgaaacg catatccttt cgttggccta
agatgtgaat ccctcttatc 2700aatcttgtat gtgtacttca atgcagaaag
aaggttatgc cctaactgcc tccttatggc 2760ctttgatgag acacgtgatg
gatcagttaa ggtacgccac gcaaggttgt atgacaagtc 2820atggttcctt
gttgacagca aaccaaatga aaggccaagt aggcgctcct tgtatgatga
2880aaacttcagc caatcttgtg atgacaaaga tgcccgagcc atcaatggtg
ttggtattga 2940tttaaacctc ggtaggcaga ctccaacacc aacctctgtt
gtttggtccc aaccaaagga 3000tcctgatgca tcccagatgt caccatagcc
aaacaagttc ttcaacttaa gtgacccttc 3060cagcgaccaa gatcttgcct
acaagagtgg caagcacagt ca 3102228DNAArtificial SequenceZinc Finger
Binding Sequence 2cacaacaaga ctgcgggttc ggtggcgc 28328DNAArtificial
SequenceZinc Finger Binding Sequence 3gataggtggc agtggcagtg
gcactggc 28428DNAArtificial SequenceZinc Finger Binding Sequence
4tatcggcaca acaagactgc gggttcgg 28528DNAArtificial SequenceZinc
Finger Binding Sequence 5tggcagtggc agtggcactg gcacggca
28628DNAArtificial SequenceZinc Finger Binding Sequence 6cagcagatga
gcggagcgat cgatcgcg 28728DNAArtificial SequenceZinc Finger Binding
Sequence 7cagtggatag agcagcgttg gccgttgg 28828DNAArtificial
SequenceZinc Finger Binding Sequence 8aggaagccgg cggtgaatgt
cgccgtgt 28928DNAArtificial SequenceZinc Finger Binding Sequence
9cgtcgccact cggcacaagg ctcatcag 281028DNAArtificial SequenceZinc
Finger Binding Sequence 10atcgggcatc ggcgactgat gagccttg
281128DNAArtificial SequenceZinc Finger Binding Sequence
11gatcaacgga agcggatggc ccgcttct 281228DNAArtificial SequenceZinc
Finger Binding Sequence 12tgatcgcatc gggcatcggc gactgatg
281328DNAArtificial SequenceZinc Finger Binding Sequence
13cggaagcgga tggcccgctt ctttagaa 281418DNAArtificial SequencePrimer
Sequence 14caggcagcgc caccgaac 181518DNAArtificial SequencePrimer
Sequence 15cgatcgatcg cgtgccgt 181618DNAArtificial SequencePrimer
Sequence 16ctggcacggc acgcgatc 181718DNAArtificial SequencePrimer
Sequence 17cggagatccg gccccaac 181818DNAArtificial SequencePrimer
Sequence 18gacacggcac acacggcg 181918DNAArtificial SequencePrimer
Sequence 19tcgggcatcg gcgactga 182018DNAArtificial SequencePrimer
Sequence 20actcggcaca aggctcat 182118DNAArtificial SequencePrimer
Sequence 21cctgtgccaa ttctaaag 182218DNAArtificial SequencePrimer
Sequence 22gcagtgcatg ttatgagc 182322DNAArtificial SequencePrimer
Sequence 23caggacataa atgaactgaa tc 222420DNAArtificial
SequencePrimer Sequence 24tgttcggttc cctctaccaa 202522DNAArtificial
SequencePrimer Sequence 25caacatccat caccttgact ga
222624DNAArtificial SequencePrimer Sequence 26cacagaaccg tcgcttcagc
aaca 242718DNAArtificial SequencePrimer Sequence 27tggcggacga
cgacttgt 182819DNAArtificial SequencePrimer Sequence 28aaagtttgga
ggctgccgt 192926DNAArtificial SequencePrimer Sequence 29cgagcagacc
gccgtgtact tctacc 263020DNAArtificial SequencePrimer Sequence
30gcccttacag ttcatgggcg 203122DNAArtificial SequencePrimer Sequence
31gaccaagtcc ttgtctggga ca 223221DNAArtificial SequencePrimer
Sequence 32acaaacacgt cctccaaggc t 213322DNAArtificial
SequencePrimer Sequence 33gaccaagtcc ttgtctggga ca
2234226DNAArtificial SequenceProbe Sequence 34gtgcattcgg attactgttt
agtcgagtca tatttaagga attcattgta aatgttctaa 60cctaacctaa gtattaggca
gctatggctg atatggatct gattggactt gatttatcca 120tgataagttt
aagagcaact caaagaggtt aggtatatat ggttttgtaa aggtaaattt
180agttaatatt agaaaaaaaa agtgtatcca ataggctcta taaaca
2263524DNAArtificial SequencePrimer Sequence 35acacggcaca
cacggcgaca ttca 243624DNAArtificial SequencePrimer Sequence
36agggcagtgg ccagtgttcc tgtg 243718DNAArtificial SequencePrimer
Sequence 37tggcggacga cgacttgt 183819DNAArtificial SequencePrimer
Sequence 38aaagtttgga ggctgccgt 193926DNAArtificial SequencePrimer
Sequence 39cgagcagacc gccgtgtact tctacc 264029DNAArtificial
SequencePrimer Sequence 40gaaggcaaaa cgaatataag tgcattcgg
294121DNAArtificial SequencePrimer Sequence 41tcgtggatag cactttgggc
t 214227DNAArtificial SequencePrimer Sequence 42tctacagtga
actttaggac agagcca 27437PRTArtificial SequenceZinc Finger Protein
Recognition Helices 43Arg Ser Asp Asp Leu Ser Lys 1 5
447PRTArtificial SequenceZinc Finger Protein Recognition Helices
44Gln Ser Gly Ser Leu Thr Arg 1 5 457PRTArtificial SequenceZinc
Finger Protein Recognition Helices 45Arg Ser Asp Asn Leu Arg Glu 1
5 467PRTArtificial SequenceZinc Finger Protein Recognition Helices
46Gln Ser Gly Asp Leu Thr Arg 1 5 477PRTArtificial SequenceZinc
Finger Protein Recognition Helices 47Asp Thr Gly Ala Arg Leu Lys 1
5 487PRTArtificial SequenceZinc Finger Protein Recognition Helices
48Arg Ser Ala Asp Arg Lys Thr 1 5 497PRTArtificial SequenceZinc
Finger Protein Recognition Helices 49Asp Arg Ser His Leu Ser Arg 1
5 507PRTArtificial SequenceZinc Finger Protein Recognition Helices
50Thr Ser Gly Asn Leu Thr Arg 1 5 517PRTArtificial SequenceZinc
Finger Protein Recognition Helices 51Arg Ser Asp Asp Leu Ser Arg 1
5 527PRTArtificial SequenceZinc Finger Protein Recognition Helices
52Gln Ser Ala Asn Arg Thr Lys 1 5 5324DNAArtificial SequencePrimer
Sequence 53acacggcaca cacggcgaca ttca 245424DNAArtificial
SequencePrimer Sequence 54agggcagtgg ccagtgttcc tgtg
245518DNAArtificial SequencePrimer Sequence 55tggcggacga cgacttgt
185619DNAArtificial SequencePrimer Sequence 56aaagtttgga ggctgccgt
195726DNAArtificial SequencePrimer Sequence 57cgagcagacc gccgtgtact
tctacc 265820DNAArtificial SequencePrimer Sequence 58tgttcggttc
cctctaccaa 205922DNAArtificial SequencePrimer Sequence 59caacatccat
caccttgact ga 226024DNAArtificial SequencePrimer Sequence
60cacagaaccg tcgcttcagc aaca 24614431DNAArtificial
SequencepDAB104179 plasmid 61tctctattca gtccgtaggt ttaatgagtc
tgttggatta gcctacactt tttctgtaaa 60atctatttta gatagtagct aaatcagtaa
atttggctag tatttttagc tattctcttg 120gagtttgcta taagaccaga
acatgtaaat tggaagtttg tggacccgga cgagaatgca 180tgacaaatcc
agagtattga tgatggaatt cacctatttt acccgactct tccattgtgt
240ccatttctca tcatccccgg gcgctttctg catccggtac agctgacatg
acacgttcac 300gcgttacatg gctgatggct cacaagtcac ccccacatgt
ctagtgttcg cccaggcaga 360tcgtcctcgg cctgcgctgc cgtgctcttg
ccgccgcttg cttgggccct gctggcgccc 420gctgccgatc acacggccta
cgcggtgcag gcagcgccac cgaacccgca gtcttgttgt 480gccgataggt
ggcagtggca gtggcactgg cacggcacgc gatcgatcgc tccgctcatc
540tgctgacagt ggatagagca gcgttggccg ttggggccgg atctccgtga
agcggtcgtc 600cctgctgtac tgtgccgcta tggcgtgtcg ctttcgccat
gttttctttt cttttttttt 660tctttttctt tttgctaggg cggtttctcg
ttcgctggta acagggacca cttcggttga 720tccgttgaat ttactgaaag
agatgggaat ggtcgctgtg cccgggacat tgaatgagat 780gttgtgtaag
tgaatatggc tttagccttt tgcgagtggg gcggcaatgc acggcatgaa
840ctataatttc cggtcaaact tttgtgtgga aatggatgct aaacgaacac
aaaccgggtt 900taaaccagag gccgacacgg cacacacggc gacattcacc
gccggcttcc tccgtcgcca 960ctcggcacaa ggctcatcag tcgccgatgc
ccgatgcgat caacgtttat agcggccgca 1020ttattatggc cggccattta
aatatcgatt ctagtctcga ggtcattcat atgcttgaga 1080agagagtcgg
gatagtccaa aataaaacaa aggtaagatt acctggtcaa aagtgaaaac
1140atcagttaaa aggtggtata aagtaaaata tcggtaataa aaggtggccc
aaagtgaaat 1200ttactctttt ctactattat aaaaattgag gatgtttttg
tcggtacttt gatacgtcat 1260ttttgtatga attggttttt aagtttattc
gcttttggaa atgcatatct gtatttgagt 1320cgggttttaa gttcgtttgc
ttttgtaaat acagagggat ttgtataaga aatatcttta 1380aaaaaaccca
tatgctaatt tgacataatt tttgagaaaa atatatattc aggcgaattc
1440tcacaatgaa caataataag attaaaatag ctttcccccg ttgcagcgca
tgggtatttt 1500ttctagtaaa aataaaagat aaacttagac tcaaaacatt
tacaaaaaca acccctaaag 1560ttcctaaagc ccaaagtgct atccacgatc
catagcaagc ccagcccaac ccaacccaac 1620ccaacccacc ccagtccagc
caactggaca atagtctcca caccccccca ctatcaccgt 1680gagttgtccg
cacgcaccgc acgtctcgca gccaaaaaaa aaaaaagaaa gaaaaaaaag
1740aaaaagaaaa aacagcaggt gggtccgggt cgtgggggcc ggaaacgcga
ggaggatcgc 1800gagccagcga cgaggccggc cctccctccg cttccaaaga
aacgcccccc atcgccacta 1860tatacatacc cccccctctc ctcccatccc
cccaacccta ccaccaccac caccaccacc 1920tccacctcct cccccctcgc
tgccggacga cgcctccccc ctccccctcc gccgccgccg 1980cgccggtaac
caccccgccc ctctcctctt tctttctccg tttttttttt ccgtctcggt
2040ctcgatcttt ggccttggta gtttgggtgg gcgagaggcg gcttcgtgcg
cgcccagatc 2100ggtgcgcggg aggggcggga tctcgcggct ggggctctcg
ccggcgtgga tccggcccgg 2160atctcgcggg gaatggggct ctcggatgta
gatctgcgat ccgccgttgt tgggggagat 2220gatggggggt ttaaaatttc
cgccatgcta aacaagatca ggaagagggg aaaagggcac 2280tatggtttat
atttttatat atttctgctg cttcgtcagg cttagatgtg ctagatcttt
2340ctttcttctt tttgtgggta gaatttgaat ccctcagcat tgttcatcgg
tagtttttct 2400tttcatgatt tgtgacaaat gcagcctcgt gcggagcttt
tttgtaggta gaccatgtct 2460ccggagagga gaccagttga gattaggcca
gctacagcag ctgatatggc cgcggtttgt 2520gatatcgtta accattacat
tgagacgtct acagtgaact ttaggacaga gccacaaaca 2580ccacaagagt
ggattgatga tctagagagg ttgcaagata gatacccttg gttggttgct
2640gaggttgagg gtgttgtggc tggtattgct tacgctgggc cctggaaggc
taggaacgct 2700tacgattgga cagttgagag tactgtttac gtgtcacata
ggcatcaaag gttgggccta 2760ggatccacat tgtacacaca tttgcttaag
tctatggagg cgcaaggttt taagtctgtg 2820gttgctgtta taggccttcc
aaacgatcca tctgttaggt tgcatgaggc tttgggatac 2880acagcccgtg
gtacattgcg cgcagctgga tacaagcatg gtggatggca tgatgttggt
2940ttttggcaaa gggattttga gttgccagct cctccaaggc cagttaggcc
agttacccag 3000atctgactga gcttgagctt atgagcttat gagcttagag
ctcggtcgca gcgtgtgcgt 3060gtccgtcgta cgttctggcc ggccgggcct
tgggcgcgcg atcagaagcg ttgcgttggc 3120gtgtgtgtgc ttctggtttg
ctttaatttt accaagtttg tttcaaggtg gatcgcgtgg 3180tcaaggcccg
tgtgctttaa agacccaccg gcactggcag tgagtgttgc tgcttgtgta
3240ggctttggta cgtatgggct ttatttgctt ctggatgttg tgtactactt
gggtttgttg 3300aattattatg agcagttgcg tattgtaatt cagctgggct
acctggacat tgttatgtat 3360taataaatgc tttgctttct tctaaagatc
tttaagtgct actagattaa ttaactcgag 3420gtcgaccaac ggaagcggat
ggcccgcttc tttagaattg gcacaggaac actggccact 3480gcccttgatg
tgcaattatg cctgcgaaag cctaggcaac acacgcgaat aaacgagcga
3540atgacacgga aagctgatgt ggtatgaatt atacaacatt atgggccaaa
atattattct 3600atccaccatt gtgtagccac agcatcggta tttgagttgt
gcgaggacaa atccctcgtg 3660aggtcaaaaa cagcaaataa taaacccatc
tcctgaagac accaaaaaaa aggagcagct 3720cctcgtgtca atgaacaagc
gtcacaagaa aagggagcac gtaaataacc tcttcaattg 3780cttcagcatg
aaaagaacgg gaagaaatgc aagtctacag aggaaagtgc agctgtttcg
3840gctgccatgg caagttccta catgggcgag gaaaagctga actggattcc
agtcttcgcg 3900ctgtcatgct cagcttgctt taggatgcgg caatagttca
cctggatgaa aaagatacaa 3960gttagtcttg aagcagtcga gtggacatcc
aaagtatcaa aatcgaaagc ttgtaaatgg 4020ggaaggaaat atacctctac
ccggaaaagt ttggtaggca aaataatccc aacgccagca 4080gagctccgga
acgtttgccg aaattcagaa gccgaaaagt tcttgtactc accctccgac
4140agtttcgcaa ggtttccagc agtaaggaat gcgtggccat ggattccagc
gtctctgaat 4200atcttgaggg gcagatcaaa agaaaggtca gcgaaggcag
acacggccag atcacctccc 4260aagtaatccc ttccagggtc agccgagcca
ctctccgagt tattaaggac atgcctccgc 4320gcctctgttg ggccaactcc
ccttaatctg aaacccagca gagatgacgg tccgcccaag 4380ctgcacactg
gagaagaatt acctccaaga taaaacctct ctggcactga t 44316229DNAArtificial
SequencePrimer Sequence 62acaagagtgg attgatgatc tagagaggt
296329DNAArtificial SequencePrimer Sequence 63ctttgatgcc tatgtgacac
gtaaacagt 296429DNAArtificial SequencePrimer Sequence 64ggtgttgtgg
ctggtattgc ttacgctgg 296521DNAArtificial SequencePrimer Sequence
65cctgctccac taccagtaca a 216621DNAArtificial SequencePrimer
Sequence 66gtccaagaag gtgaccttct c 216723DNAArtificial
SequencePrimer Sequence 67agatcaccga ctttgcgctc ttt
236829DNAArtificial SequencePrimer Sequence 68gaaggcaaaa cgaatataag
tgcattcgg 296927DNAArtificial SequencePrimer Sequence 69tctacagtga
actttaggac agagcca 277021DNAArtificial SequencePrimer Sequence
70tcgtggatag cactttgggc t 217120DNAArtificial SequencePrimer
Sequence 71gcccttacag ttcatgggcg 207224DNAArtificial SequencePrimer
Sequence 72tgtttataga gcctattgga taca
247325DNAArtificial SequencePrimer Sequence 73agtgcattcg gattactgtt
tagtc 25
* * * * *