U.S. patent application number 13/497985 was filed with the patent office on 2013-01-03 for amidase and use thereof for producing 3-aminocarboxylic acid esters.
This patent application is currently assigned to BASF SE. Invention is credited to Thomas Friedrich, Bernhard Hauer, Wolf-Rudiger Krahnert, Susanne Krauser, Nina Schneider, Rainer Sturmer.
Application Number | 20130005002 13/497985 |
Document ID | / |
Family ID | 43088380 |
Filed Date | 2013-01-03 |
United States Patent
Application |
20130005002 |
Kind Code |
A1 |
Hauer; Bernhard ; et
al. |
January 3, 2013 |
AMIDASE AND USE THEREOF FOR PRODUCING 3-AMINOCARBOXYLIC ACID
ESTERS
Abstract
Process for producing optically active 3-aminocarboxylic acid
ester compounds of general Formula I, and the ammonium salts
thereof, ##STR00001## in which R.sup.1 stands for alkyl,
alkoxyalkyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, or
hetaryl, and R.sup.2 stands for alkyl, cycloalkyl or aryl, in which
an enantiomeric mixture of a simply N-acylated 3-aminocarboxylic
acid ester of general formula (I.b), ##STR00002## in which R.sup.1
and R.sup.2 have the meanings given above and R.sup.3 stands for
hydrogen, alkyl, cycloalkyl or aryl, is submitted to an
enantioselective deacylation by adding a polypeptide according to
claim 1.
Inventors: |
Hauer; Bernhard;
(Fussgonheim, DE) ; Friedrich; Thomas; (Ratingen,
DE) ; Sturmer; Rainer; (Rodersheim-Gronau, DE)
; Schneider; Nina; (Offenburg, DE) ; Krauser;
Susanne; (Kleinblittersdorf, DE) ; Krahnert;
Wolf-Rudiger; (Schifferstadt, DE) |
Assignee: |
BASF SE
Ludwigshafen
DE
|
Family ID: |
43088380 |
Appl. No.: |
13/497985 |
Filed: |
September 24, 2010 |
PCT Filed: |
September 24, 2010 |
PCT NO: |
PCT/EP10/64098 |
371 Date: |
March 23, 2012 |
Current U.S.
Class: |
435/128 ;
435/228 |
Current CPC
Class: |
C12P 13/04 20130101;
C12P 41/007 20130101; C12N 9/80 20130101; C12P 13/001 20130101 |
Class at
Publication: |
435/128 ;
435/228 |
International
Class: |
C12P 13/00 20060101
C12P013/00; C12N 9/80 20060101 C12N009/80 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 25, 2009 |
EP |
09171414.7 |
Claims
1-8. (canceled)
9. A polypeptide with amidase activity, selected from a)
polypeptide comprising an amino acid sequence according to SEQ ID
NO: 2, and b) polypeptide comprising an amino acid sequence that
has at least 96% identity with SEQ ID NO:2.
10. A polypeptide with amidase activity, selected from a)
polypeptide comprising an amino acid sequence according to SEQ ID
NO: 4, and b) polypeptide comprising an amino acid sequence that
has at least 80% identity with SEQ ID NO:4.
11. A process for producing optically active 3-aminocarboxylic acid
ester compounds of general Formula I, and the ammonium salts
thereof, ##STR00015## wherein R.sup.1 stands for alkyl,
alkoxyalkyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, or
hetaryl, and R.sup.2 stands for alkyl, cycloalkyl or aryl, in which
an enantiomeric mixture of a simply N-acylated 3-aminocarboxylic
acid ester of general formula (I.b), ##STR00016## in which R.sup.1
and R.sup.2 have the meanings given above and R.sup.3 stands for
hydrogen, alkyl, cycloalkyl or aryl, is submitted to an
enantioselective deacylation by adding a polypeptide according to
claim 9.
12. A process for producing optically active 3-aminocarboxylic acid
ester compounds of general Formula I, and the ammonium salts
thereof, ##STR00017## wherein R.sup.1 stands for alkyl,
alkoxyalkyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, or
hetaryl, and R.sup.2 stands for alkyl, cycloalkyl or aryl, in which
an enantiomeric mixture of a simply N-acylated 3-aminocarboxylic
acid ester of general formula (I.b), ##STR00018## in which R.sup.1
and R.sup.2 have the meanings given above and R.sup.3 stands for
hydrogen, alkyl, cycloalkyl or aryl, is submitted to an
enantioselective deacylation by adding a polypeptide according to
claim 10.
13. A process for producing optically active 3-aminocarboxylic acid
ester compounds of general Formula I', and derivatives thereof,
##STR00019## in which R.sup.1 stands for alkyl, alkoxyalkyl,
alkenyl, cycloalkyl, heterocycloalkyl, aryl, or hetaryl, and
R.sup.2 stands for hydrogen, a cation equivalent M.sup.+, alkyl,
cycloalkyl or aryl, in which a) a .beta.-ketoester of general
Formula I.1 ##STR00020## in which R.sup.1 and R.sup.2 have the
meanings given above, is reacted a 1) with at least one carboxylic
acid amide of formula R.sup.3--C(O)NH.sub.2, in which R.sup.3 has
the meaning given above, in the presence of an amidation catalyst,
or a 2) with ammonia and then with a carboxylic acid derivative of
formula R.sup.3--C(O)X, in which X stands for halogen or a residue
of formula OC(O)R.sup.4, in which R.sup.4 has the meaning given
above for R.sup.3, obtaining the corresponding N-acylated,
.alpha.-.beta.-unsaturated (Z)-3-aminocarboxylic acid ester, of
general formula (I.a), ##STR00021## in which R.sup.1, R.sup.2 and
R.sup.3 have the meanings given above, b) the enamide (I.a)
obtained in this reaction is submitted to a hydrogenation,
obtaining an enantiomeric mixture of simply N-acylated
.beta.-aminocarboxylic acid esters of general formula (I.b),
##STR00022## in which R.sup.1, R.sup.2 and R.sup.3 have the
meanings given above, c) the enantiomeric mixture of compounds I.b
obtained in the hydrogenation is submitted to an enantioselective
deacylation by adding a polypeptide according to claim 9 and the
resultant ammonium salt of a 3-aminocarboxylic acid ester, enriched
with respect to a stereoisomer, is isolated, and d) optionally the
ammonium salt isolated is converted to the 3-aminocarboxylic acid
ester, and e) optionally the 3-aminocarboxylic acid ester is
converted to the free 3-aminocarboxylic acid or a salt thereof.
14. The process according to claim 11, wherein a .beta.-ketoester
of Formula I.1 is reacted with at least one carboxylic acid amide
of formula R.sup.3--C(O)NH.sub.2, in the presence of an amidation
catalyst, with removal of the reaction water, to a
3-aminocarboxylic acid ester of Formula I.a.
15. The process according to claim 12, wherein a .beta.-ketoester
of Formula I.1 is reacted with at least one carboxylic acid amide
of formula R.sup.3--C(O)NH.sub.2, in the presence of an amidation
catalyst, with removal of the reaction water, to a
3-aminocarboxylic acid ester of Formula I.a.
16. The process according to claim 9, wherein the deacylation is
carried out in aqueous buffer as reaction medium.
17. The process according to claim 10, wherein the deacylation is
carried out in aqueous buffer as reaction medium.
18. The process according to claim 13, wherein the hydrogenation b)
is carried out in the presence of a hydrogenation catalyst, which
comprises at least one complex of a transition metal of groups 8 to
11 of the periodic table of the elements and comprises, as ligand,
at least one chiral, phosphorus atom-containing compound.
19. The process according to claim 11, wherein R.sup.1 stands for
phenyl and R.sup.2 and R.sup.3 have the meanings stated in claim
10.
20. The process according to claim 11, wherein R.sup.1 stands for
phenyl and R.sup.2 and R.sup.3 have the meanings stated in claim
10.
Description
[0001] The present invention relates to a new amidase and use
thereof for producing optically active 3-aminocarboxylic acid ester
compounds, and derivatives thereof.
[0002] Asymmetric synthesis, i.e. reactions in which a chiral group
is produced from a prochiral group, so that the stereoisomeric
products (enantiomers or diastereomers) are formed in unequal
amounts, has become tremendously important chiefly in the
pharmaceutical industry, as often only a particular optically
active isomer is therapeutically active. In this connection,
optically active intermediates of the active compounds are also
becoming increasingly important. This also applies to
3-aminocarboxylic acid esters (Formula I), and derivatives
thereof.
##STR00003##
[0003] Therefore there is a great need for effective synthesis
routes for producing optically active compounds of general formula
I.
[0004] WO 97/41214 describes biocatalysts with aminoacylase
activity, which do not have lipase or esterase activity.
[0005] WO 2008/003761 describes a process for producing optically
active 3-aminocarboxylic acid esters in which an enantiomeric
mixture of a simply N-acylated 3-aminocarboxylic acid ester,
enriched in one enantiomer, is submitted, by adding an acidic
salt-forming substance, to a deacylation and a subsequent further
enantiomeric enrichment by crystallization.
[0006] The problem to be solved by the present invention is
therefore to provide a simple and therefore economical process for
producing optically active 3-aminocarboxylic acid esters and
derivatives thereof.
[0007] Surprisingly, it was found that the above problem is solved
by a process for producing optically active 3-aminocarboxylic acid
ester compounds of general Formula I, and the ammonium salts
thereof,
##STR00004## [0008] in which [0009] R.sup.1 stands for alkyl,
alkoxyalkyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, or
hetaryl, and [0010] R.sup.2 stands for alkyl, cycloalkyl or aryl,
[0011] wherein an enantiomeric mixture of a simply N-acylated
3-aminocarboxylic acid ester of general formula (I.b),
##STR00005##
[0011] in which R.sup.1 and R.sup.2 have the meanings given above
and R.sup.3 stands for hydrogen, alkyl, cycloalkyl or aryl, is
submitted, by adding a polypeptide according to claim 1 or 2, to an
enantioselective deacylation.
[0012] The invention further relates to a process for producing
optically active 3-aminocarboxylic acid ester compounds of general
Formula I', and derivatives thereof,
##STR00006## [0013] in which [0014] R.sup.1 stands for alkyl,
alkoxyalkyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, or
hetaryl, and [0015] R.sup.2 stands for hydrogen, a cation
equivalent M.sup.+, alkyl, cycloalkyl or aryl, in which [0016] a) a
.beta.-ketoester of general Formula I.1
[0016] ##STR00007## [0017] in which R.sup.1 and R.sup.2 have the
meanings given above, is reacted [0018] a 1) with at least one
carboxylic acid amide of formula R.sup.3--C(O)NH.sub.2, in which
R.sup.3 has the meaning given above, in the presence of an
amidation catalyst, or [0019] a 2) with ammonia and then with a
carboxylic acid derivative of formula R.sup.3--C(O)X, in which X
stands for halogen or a residue of formula OC(O)R.sup.4, in which
R.sup.4 has the meaning given above for R.sup.3, [0020] obtaining
the corresponding N-acylated, .alpha.-unsaturated
(Z)-3-aminocarboxylic acid ester, of general formula (I.a),
[0020] ##STR00008## [0021] in which R.sup.1, R.sup.2 and R.sup.3
have the meanings given above, [0022] b) the enamide (I.a) obtained
in this reaction is submitted to a hydrogenation, obtaining an
enantiomeric mixture of simply N-acylated .beta.-aminocarboxylic
acid esters of general formula (I.b),
[0022] ##STR00009## [0023] in which R.sup.1, R.sup.2 and R.sup.3
have the meanings given above, [0024] c) the enantiomeric mixture
of compounds I.b obtained in the hydrogenation is submitted, by
adding a polypeptide with amidase activity, to an enantioselective
deacylation and the resultant ammonium salt of a 3-aminocarboxylic
acid ester, enriched with respect to a stereoisomer, is isolated,
and [0025] d) optionally the ammonium salt isolated is converted to
the 3-aminocarboxylic acid ester, and [0026] e) optionally the
3-aminocarboxylic acid ester is converted to the free
3-aminocarboxylic acid or a salt thereof.
[0027] The invention further relates to a polypeptide with amidase
activity, selected from [0028] a) polypeptide comprising an amino
acid sequence according to SEQ ID NO: 2, and [0029] b) polypeptide
comprising an amino acid sequence that has at least 96%, preferably
98%, especially preferably 99% identity with SEQ ID NO:2.
[0030] The invention further relates to a polypeptide with amidase
activity, selected from [0031] c) polypeptide comprising an amino
acid sequence according to SEQ ID NO: 4, and [0032] d) polypeptide
comprising an amino acid sequence that has at least 80%, preferably
85, 88%, 90%, especially preferably 92%, 94%, 96%, 98%, 99%
identity with SEQ ID NO:4.
[0033] "Chiral compounds" are, in the context of the present
invention, compounds with at least one chiral centre (i.e. at least
one asymmetric atom, e.g. at least one asymmetric carbon atom or
phosphorus atom), with chiral axis, chiral plane or helical shape.
The term "chiral catalyst" comprises catalysts that have at least
one chiral ligand.
[0034] "Achiral compounds" are compounds that are not chiral.
[0035] "Prochiral compound" means a compound with at least one
prochiral centre. "Asymmetric synthesis" denotes a reaction in
which, from a compound with at least one prochiral centre, a
compound is produced with at least one chiral centre, a chiral
axis, chiral plane or helical shape, wherein the stereoisomeric
products form in unequal amounts.
[0036] "Stereoisomers" are compounds with the same constitution but
with different atomic arrangement in three-dimensional space.
[0037] "Enantiomers" are stereoisomers that relate to one another
as object to mirror image. The "enantiomeric excess" (ee) achieved
in an asymmetric synthesis can be found from the following formula:
ee[%]=(R-S)/(R+S)*100. R and S are the descriptors of the CIP
system for the two enantiomers and represent the absolute
configuration on the asymmetric atom. The enantiomerically pure
compound (ee=100%) is also known as "homochiral compound".
[0038] The process according to the invention leads to products
that are enriched with respect to a particular stereoisomer. The
"enantiomeric excess" (ee) achieved is as a rule at least 95%,
preferably at least 98% and especially preferably at least 99%.
[0039] "Diastereomers" are stereoisomers that are not enantiomeric
to one another.
[0040] Although further asymmetric atoms can be present in the
compounds covered by the present invention, the stereochemical
concepts presented herein refer, unless expressly stated otherwise,
to the carbon atom of the respective compounds corresponding to the
asymmetric .beta.-carbon atom in compound I or I'. If further
stereocentres are present, they are ignored in the naming in the
context of the present invention.
[0041] Hereinafter, the expression "alkyl" comprises linear and
branched alkyl groups. Preferably they are linear or branched
C.sub.1-C.sub.20-alkyl, preferably C.sub.1-C.sub.12-alkyl,
especially preferably C.sub.1-C.sub.8-alkyl and quite especially
preferably C.sub.1-C.sub.6-alkyl groups. Examples of alkyl groups
are in particular methyl, ethyl, propyl, isopropyl, n-butyl,
isobutyl, sec.-butyl, tert.-butyl, n-pentyl, 2-pentyl,
2-methylbutyl, 3-methylbutyl, 1,2-dimethylpropyl,
1,1-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, n-hexyl,
2-hexyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl,
1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl,
1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl,
1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1-ethylbutyl,
2-ethylbutyl, 1-ethyl-2-methylpropyl, n-heptyl, 2-heptyl, 3-heptyl,
2-ethylpentyl, 1-propylbutyl, n-octyl, 2-ethylhexyl,
2-methylheptyl, nonyl, decyl, 2-propylheptyl.
[0042] The expression "alkyl" also comprises substituted alkyl
groups, which can generally carry 1, 2, 3, 4 or 5, preferably 1, 2
or 3 and especially preferably 1 substituents, selected from the
groups cycloalkyl, aryl, hetaryl, halogen, COOR.sup.f,
COO.sup.-M.sup.+ and NE.sup.1E.sup.2, wherein R.sup.f stands for
hydrogen, alkyl, cycloalkyl or aryl, M.sup.+ stands for a cation
equivalent and E.sup.1 and E.sup.2, independently of one another,
stand for hydrogen, alkyl, cycloalkyl or aryl.
[0043] The expression "alkoxyalkyl" comprises linear and branched
alkyl groups that are linked to an alkoxy residue. The alkoxy
residue can also be linear or branched. Preferably they are linear
or branched C.sub.1-C.sub.20-alkyl, preferably
C.sub.1-C.sub.12-alkyl, especially preferably C.sub.1-C.sub.8-alkyl
and quite especially preferably C.sub.1-C.sub.6-alkyl groups, which
are linked C.sub.1-C.sub.12-alkoxy, especially preferably
C.sub.1-C.sub.6-alkoxy residues. Examples of alkyl groups are
mentioned above; examples of alkoxy groups are in particular
methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, isobutoxy,
sec.-butoxy. Examples of alkoxyalkyls are in particular
methoxymethyl, ethoxymethyl, ethoxyethyl, ethoxypropyl.
[0044] The expression "alkenyl" comprises linear and branched alkyl
groups, which still bear at least one C.dbd.C double bond.
Preferably they are linear C.sub.1-C.sub.20-alkyl groups, bearing a
C.dbd.C double bond. Examples of alkenyl groups are in particular
1-propenyl, 1-butenyl, 1-pentenyl, 1-hexenyl.
[0045] The expression "cycloalkyl" comprises, in the sense of the
present invention, both unsubstituted and substituted cycloalkyl
groups, preferably C.sub.3-C.sub.8-cycloalkyl groups, such as
cyclopentyl, cyclohexyl or cycloheptyl, which in the case of a
substitution can generally bear 1, 2, 3, 4 or 5, preferably 1, 2 or
3 and especially preferably 1 substituents, preferably selected
from alkyl and the substituents mentioned for alkyl.
[0046] The expression "heterocycloalkyl" comprises, in the sense of
the present invention, saturated cycloaliphatic groups generally
with 4 to 7, preferably 5 or 6 ring atoms, in which 1 or 2 of the
ring carbon atoms are replaced with heteroatoms, preferably
selected from the elements oxygen, nitrogen and sulphur, and which
optionally can be substituted, wherein in the case of a
substitution, these heterocycloaliphatic groups can bear 1, 2 or 3,
preferably 1 or 2, especially preferably 1 substituents, selected
from alkyl, cycloalkyl, aryl, COOR.sup.f, COO.sup.-M.sup.+ and
NE.sup.1E.sup.2, preferably alkyl, wherein R.sup.f stands for
hydrogen, alkyl, cycloalkyl or aryl, M.sup.+ stands for a cation
equivalent and E.sup.1 and E.sup.2 independently of one another
stand for hydrogen, alkyl, cycloalkyl or aryl. As examples of these
heterocycloaliphatic groups we may mention pyrrolidinyl,
piperidinyl, 2,2,6,6-tetramethylpiperidinyl, imidazolidinyl,
pyrazolidinyl, oxazolidinyl, morpholidinyl, thiazolidinyl,
isothiazolidinyl, isoxazolidinyl, piperazinyl,
tetrahydrothiophenyl, tetrahydrofuranyl, tetrahydropyranyl,
dioxanyl.
[0047] The expression "aryl" comprises, in the sense of the present
invention, unsubstituted and substituted aryl groups, and
preferably stands for phenyl, tolyl, xylyl, mesityl, naphthyl,
fluorenyl, anthracenyl, phenanthrenyl or naphthacenyl, especially
preferably for phenyl or naphthyl, wherein these aryl groups in the
case of a substitution can generally bear 1, 2, 3, 4 or 5,
preferably 1, 2 or 3 and especially preferably 1 substituents,
selected from the groups alkyl, alkoxy, nitro, cyano or
halogen.
[0048] The expression "hetaryl" comprises, in the sense of the
present invention, unsubstituted or substituted,
heterocycloaromatic groups, preferably the groups pyridyl,
quinolinyl, acridinyl, pyridazinyl, pyrimidinyl, pyrazinyl,
pyrrolyl, imidazolyl, pyrazolyl, indolyl, purinyl, indazolyl,
benzotriazolyl, 1,2,3-triazolyl, 1,3,4-triazolyl and carbazolyl,
wherein these heterocycloaromatic groups can, in the case of a
substitution, generally bear 1, 2 or 3 substituents, selected from
the groups alkyl, alkoxy, acyl, carboxyl, carboxylate, --SO.sub.3H,
sulphonate, NE.sup.1E.sup.2, alkylene-NE.sup.1E.sup.2 or halogen,
wherein E.sup.1 and E.sup.2 have the meanings given above.
[0049] The above explanations for the expressions "alkyl",
"cycloalkyl", "aryl", "heterocycloalkyl" and "hetaryl" apply
correspondingly for the expressions "alkoxy", "cycloalkoxy",
"aryloxy", "heterocycloalkoxy" and "hetaryloxy".
[0050] The expression "acyl" stands, in the sense of the present
invention, for alkanoyl or aroyl groups generally with 2 to 11,
preferably 2 to 8 carbon atoms, for example for the acetyl,
propanoyl, butanoyl, pentanoyl, hexanoyl, heptanoyl,
2-ethylhexanoyl, 2-propylheptanoyl, benzoyl, naphthoyl or
trifluoroacetyl group.
[0051] "Halogen" stands for fluorine, chlorine, bromine and iodine,
preferably for fluorine, chlorine and bromine.
[0052] M.sup.+ stands for a cation equivalent, i.e. a monovalent
cation or the unipositive component of the charge of a multiple
cation. This includes e.g. Li, Na, K, Ca and Mg.
[0053] The processes according to the invention make possible, as
already described, the production of optically active compounds of
general Formula I, and the production of derivatives thereof.
[0054] R.sup.1 preferably stands for C.sub.1-C.sub.6-alkyl,
1-C.sub.3-C.sub.6-alkenyl, or C.sub.6-C.sub.14-aryl, which can
optionally be substituted, as mentioned at the beginning. In
particular R.sup.1 stands for methyl, ethyl, n-propyl, isopropyl,
n-butyl, tert.-butyl, 1-propenyl, 1-heptenyl, or phenyl, especially
for methyl and phenyl.
[0055] R.sup.2 preferably stands for unsubstituted or substituted
C.sub.1-C.sub.6-alkyl, C.sub.3-C.sub.7-cycloalkyl or
C.sub.6-C.sub.14-aryl. Especially preferred R.sup.2 residues are
methyl, ethyl, n-propyl, isopropyl, n-butyl, tert.-butyl,
trifluoromethyl, cyclohexyl, phenyl and benzyl.
[0056] R.sup.2' stands for hydrogen, M.sup.+, and for the meanings
stated for R.sup.2.
[0057] R.sup.3 stands for hydrogen, alkyl, cycloalkyl or aryl, in
particular for hydrogen, methyl, ethyl, trifluoromethyl, benzyl and
phenyl.
[0058] According to the invention, an enantiomeric mixture of
compounds I.b is submitted, by adding an amidase, to an
enantioselective deacylation and the resultant ammonium salt of a
3-aminocarboxylic acid ester, enriched with respect to a
stereoisomer, is isolated.
[0059] It is a characteristic feature of the process according to
the invention that the isomeric mixture of compounds of general
Formula I.b used for the deacylation also comprises the
corresponding enantiomer, or starting from chiral .beta.-ketoesters
also diastereomers in non-negligible amounts. Advantageously, the
process therefore makes possible the production of optically active
compounds of general Formula I, starting from isomeric mixtures of
compounds of general Formula I.b, such as are obtainable for
example from the precursor compounds by usual asymmetric
hydrogenation of enamides.
[0060] Usually, in this process step, enantiomeric mixtures are
used that comprise the enantiomers in the same molar ratio or else
are already enriched in one enantiomer. The ee value of these
mixtures is preferably above 75% and especially preferably above
90%. Depending on the conditions selected for the hydrogenation of
the enamide (I.a), racemates or mixtures already enriched in one
enantiomer are produced. In order to obtain mixtures that are
already enriched in one enantiomer, as a rule enantioselective
hydrogenation processes are chosen, for example such as are
mentioned in WO 2008/003761, whose description is expressly
included here by reference.
[0061] The deacylation is preferably carried out at a temperature
of 20-40.degree. C., especially preferably between 20 and
30.degree. C. The reaction is usually carried out in an aqueous
buffer.
[0062] The invention further relates to a process comprising the
reaction stages a) to c) and optionally d) and e) described
below.
Stage a)
[0063] In one embodiment of stage a) of the process according to
the invention a .beta.-ketoester of Formula I.1 is reacted with at
least one carboxylic acid amide of formula R.sup.3--C(O)NH.sub.2,
in the presence of an amidation catalyst with removal of the
reaction water, to a 3-aminocarboxylic acid ester of Formula I.a
(step a.1).
[0064] Preferably, in step a.1, the carboxylic acid amides of
formula R.sup.3--C(O)NH.sub.2 are acetamide, propionic acid amide,
benzoic acid amide, formamide or trifluoroacetamide, in particular
benzoic acid amide or acetamide.
[0065] Solvents suitable for step a.1 are those that form a
low-boiling azeotrope with water, from which the reaction water can
be removed by separation techniques (e.g. azeotropic distillation)
known by a person skilled in the art. In particular they are
aromatics, such as toluene, benzene, etc., ketones, such as methyl
isobutyl ketone or methyl ethyl ketone etc. and haloalkanes, such
as chloroform. Preferably toluene is used.
[0066] Suitable amidation catalysts are for example acids, such as
p-toluenesulphonic acid, methanesulphonic acid, sulphuric acid or
the like. p-Toluenesulphonic acid is preferably used.
[0067] Preferably the reaction in process step a.1 takes place at a
temperature in the range from 20 to 110.degree. C., especially
preferably 60 to 90.degree. C. Especially preferably, the
temperature is above the boiling point of the solvent used under
S.T.P.
[0068] Process step a.1 is usually carried out at a pressure from
0.01 to 1.5 bar, in particular 0.1 to 0.5 bar. Optionally the
aminocarboxylic acid ester obtained in step a.1 can be submitted to
a purification by usual methods known by a person skilled in the
art, e.g. by distillation.
[0069] In an alternative embodiment a .beta.-ketoester of Formula
I.1 is reacted with aqueous ammonia and then with a carboxylic acid
derivative of formula R.sup.3--C(O)X to the N-acylated,
.beta.-unsaturated (Z)-3-aminocarboxylic acid ester (I.a), in which
X stands for halogen or a residue of formula OC(O)R.sup.4, in which
R.sup.4 has the meaning given above for R.sup.3 (step a.2).
[0070] The carboxylic acid derivative is preferably selected from
carboxylic acid chlorides, wherein X stands for chlorine and
R.sup.3 has the meaning given above, or carboxylic acid anhydrides,
wherein X stands for OC(O)R.sup.4 and R.sup.4 preferably has the
same meaning as R.sup.3, especially preferably the carboxylic acid
derivatives are acetyl chloride, benzoyl chloride or acetic
anhydride.
[0071] Preferably the acylation in step a.2 is carried out at a
temperature in the range from 20.degree. C. to 120.degree. C.,
especially preferably at a temperature in the range from 60.degree.
C. to 90.degree. C.
[0072] The acylation in step a.2 is carried out in a polar solvent
or a mixture of a polar solvent with a nonpolar solvent, preferably
the polar solvent is a carboxylic acid of formula R.sup.3COOH or a
tertiary amine, haloalkanes and aromatics are suitable in
particular as nonpolar solvent, especially preferably acetic acid
or triethylamine is used as solvent.
[0073] The acylation in step a.2 can be carried out using a
catalyst, this can be used both in catalytic amounts and
stoichiometrically or as solvent, non-nucleophilic bases are
preferred, such as tertiary amines, especially preferably these are
triethylamine and/or dimethylaminopyridine (DMAP).
[0074] Optionally in steps a.1 and a.2 the (Z)-3-aminocarboxylic
acid ester will be obtained as a mixture with the
(E)-3-aminocarboxylic acid ester and optionally further acylation
products. In this case the (Z)-3-aminocarboxylic acid ester of
Formula I.a will be isolated by methods known by a person skilled
in the art. A preferred method is separation by distillation.
Stage b)
[0075] The .alpha.-unsaturated (Z)-3-aminocarboxylic acid ester
compounds of Formula I.a obtained in stage a) can then be submitted
to a hydrogenation, optionally an enantioselective hydrogenation,
in the presence of an optionally chiral hydrogenation catalyst,
obtaining a racemate or an enantiomeric mixture of simply
N-acylated .beta.-aminocarboxylic acid esters of general formula
(I.b) enriched in one enantiomer.
[0076] Preferably at least one complex of a transition metal of
groups 8 to 11 of the periodic table of the elements, which
comprises at least one chiral, phosphorus atom-containing compound
as ligand, is used as hydrogenation catalyst in stage b).
[0077] For hydrogenation, preferably a chiral hydrogenation
catalyst is used, which is capable of hydrogenating the
.alpha.-unsaturated, N-acylated 3-aminocarboxylic acid ester (I.a)
used preferentially for the desired isomer. Preferably the compound
of Formula I.b obtained in stage b) has, after the asymmetric
hydrogenation, an ee value of at least 75%, especially preferably
at least 90%. However, such a high enantiomeric purity is often not
necessary in the process according to the invention, because
according to the process of the invention, further enantiomeric
enrichment takes place in the subsequent deacylation step.
Preferably, however, the ee value of compound Lb is at least
75%.
[0078] Preferably the process according to the invention makes
enantioselective hydrogenation possible at substrate/catalyst
ratios (s/c) of at least 1000:1, especially preferably at least
5000:1 and in particular at least 15000:1.
[0079] Preferably a complex of a metal of group 8, 9 or 10 with at
least one of the ligands stated hereunder is used for the
asymmetric hydrogenation. Preferably the transition metal is
selected from Ru, Rh, Ir, Pd or Pt. Catalysts based on Rh and Ru
are especially preferred. Rh catalysts are preferred in
particular.
[0080] The phosphorus-containing compound used as ligand is
preferably selected from bidentate and multidentate phosphine,
phosphinite, phosphonite, phosphoramidite and phosphite
compounds.
[0081] Catalysts are preferred for hydrogenation that have at least
one ligand selected from the compounds of the following
formulae,
##STR00010## ##STR00011##
or enantiomers thereof, wherein Ar stands for optionally
substituted phenyl, preferably for tolyl or xylyl.
[0082] Bidentate compounds of the aforementioned classes of
compounds are especially preferred. P-chiral compounds, such as
DuanPhos, TangPhos or Binapine are preferred in particular.
[0083] Suitable chiral ligands coordinating to the transition metal
via at least one phosphorus atom are known by a person skilled in
the art and for example are commercially available from Chiral
Quest ((Princeton) Inc., Monmouth Junction, N.J.). The nomenclature
of the examples of chiral ligands given above corresponds to their
commercial designation.
[0084] Chiral transition-metal complexes can be obtained in a
manner known by a person skilled in the art (e.g. Uson, Inorg.
Chim. Acta 73, 275 1983, EP-A-0 158 875, EP-A-437 690) by reaction
of suitable ligands with complexes of the metals that comprise
labile or hemilabile ligands. In this case, complexes such as
Pd.sub.2(dibenzylideneacetone).sub.3, Pd(OAc).sub.2 (Ac=acetyl),
RhCl.sub.3, Rh(OAc).sub.3, [Rh(COD)Cl].sub.2, [Rh(COD)OH].sub.2,
[Rh(COD)OMe].sub.2 (Me=methyl), Rh(COD)acac, Rh.sub.4(CO).sub.12,
Rh.sub.6(COD).sub.16, [Rh(COD).sub.2)]X, Rh(acac)(CO).sub.2
(acac=acetylacetonato), RuCl.sub.3, Ru(acac).sub.3,
RuCl.sub.2(COD), Ru(COD)(methallyl).sub.2, Ru(Ar)I.sub.2 and
Ru(Ar)Cl.sub.2, Ar=aryl, both unsubstituted and substituted,
[Ir(COD)Cl].sub.2, [Ir(COD).sub.2]X, Ni(allyl)X can be used as
precatalysts. Instead of COD (=1,5-cyclooctadiene) it is also
possible to use NBD (=norbornadiene). [Rh(COD)Cl].sub.2,
[Rh(COD).sub.2)]X, Rh(acac)(CO).sub.2, RuCl.sub.2(COD),
Ru(COD)(methallyl).sub.2, Ru(Ar)Cl.sub.2, Ar=aryl, both
unsubstituted and substituted, and the corresponding systems with
NBD instead of COD, are preferred. [Rh(COD).sub.2)]X and
[Rh(NBD).sub.2)]X are especially preferred.
[0085] X can be any anion known by a person skilled in the art,
generally unstable in asymmetric synthesis. Examples of X are
halogens such as Cl.sup.-, Br.sup.- or I.sup.-, BF.sub.4.sub.-,
ClO.sub.4.sub.-, SbF.sub.6.sub.-, PF.sub.6.sub.-,
CF.sub.3SO.sub.3.sub.-, BAr.sub.4.sub.-. BF.sub.4.sub.-,
PF.sub.6.sub.-, CF.sub.3SO.sub.3.sub.-, SbF.sub.6.sub.- are
preferred for X.
[0086] The chiral transition-metal complexes can either be produced
in situ in the reaction vessel before the actual hydrogenation
reaction or can be produced separately, isolated and then used. It
may happen that at least one solvent molecule adds onto the
transition-metal complex. The common solvents (e.g. methanol,
diethyl ether, tetrahydrofuran (THF), dichloromethane, etc.) for
the preparation of complexes are known by a person skilled in the
art.
[0087] Phosphine-, phosphinite-, phosphonite-, phosphoramidite- and
phosphite-metal or -metal-Solv-complexes (Solv=solvent) together
with at least one labile or hemilabile ligand are suitable
precatalysts, from which the actual catalyst is generated under the
hydrogenation conditions.
[0088] The hydrogenation step (step b) of the process according to
the invention is as a rule carried out at a temperature from -10 to
150.degree. C., preferably at 0 to 120.degree. C. and especially
preferably at 10 to 70.degree. C.
[0089] The hydrogen pressure can be varied in a range between 0.1
bar and 600 bar. Preferably it is in a pressure range from 0.5 to
20 bar, especially preferably between 1 and 10 bar.
[0090] All solvents for asymmetric hydrogenation known by a person
skilled in the art are suitable as solvents for the hydrogenation
reaction of the enamides I.a. Preferred solvents are lower alkyl
alcohols such as methanol, ethanol, isopropanol, and toluene, THF,
ethyl acetate. Especially preferably, ethyl acetate or THF is used
as solvent in the process according to the invention.
[0091] The hydrogenation catalysts (or hydrogenation precatalysts)
described above can also be immobilized in a suitable way, e.g. by
attachment via functional groups suitable as anchor groups,
adsorption, grafting, etc., on a suitable support, e.g. of glass,
silica gel, synthetic resins, polymer supports, etc. They are then
also suitable for use as solid-phase catalysts. Advantageously,
catalyst consumption can be lowered further by these methods. The
catalysts described above are also suitable for a continuous
reaction, e.g. after immobilization, as described above, in the
form of solid-phase catalysts.
[0092] In another embodiment the hydrogenation in stage b is
carried out continuously. Continuous hydrogenation can take place
in one or preferably in several reaction zones. Several reaction
zones can be formed by several reactors or by spatially different
regions within one reactor. When several reactors are used, they
can be identical or different. They can in each case have identical
or different mixing characteristics and/or can be subdivided once
or more by internal fittings. The reactors can be connected
together in any way, e.g. in parallel or in series.
[0093] Suitable pressure-proof reactors for hydrogenation are known
by a person skilled in the art. These include the generally usual
reactors for gas-liquid reactions, for example tubular reactors,
shell-and-tube reactors, stirred reactors, gas circulating
reactors, bubble columns, etc., which can optionally be filled or
subdivided by internal fittings.
Step c)
[0094] In process step c) the enantiomeric mixture of compounds I.b
obtained in the hydrogenation is submitted to an enantioselective
deacylation by adding a polypeptide with amidase activity and the
resultant ammonium salt of a 3-aminocarboxylic acid ester, enriched
with respect to a stereoisomer, is isolated. The polypeptide with
amidase activity can be used as purified enzyme, as partially
purified raw extract or in the form of a living or killed
microorganism, which contains the amidase. Preferred amidases are
those with the primary structure SEQ ID NO:2 or NO:4 or variants of
SEQ ID NO:2 or NO:4, which are obtained by insertion, deletion or
substitution of a few amino acids, preferably 1-20, especially
preferably 1-10 amino acids.
[0095] The reaction usually takes place in aqueous buffer. The
resultant reaction product can be purified and isolated by usual
methods.
Step d)
[0096] If desired, the ammonium salts isolated in the
enantiomer-enriching deacylation by amidase reaction can be
submitted to further processing. Thus, it is possible, for example,
for releasing the optically active compound of Formula I, to bring
the product of crystallization into contact with a suitable base,
preferably NaHCO.sub.3, NaOH, KOH. In a suitable procedure, the
product of deacylation is dissolved or suspended in water and then
the pH is adjusted by addition of base to about 8 to 12, preferably
about 10. For isolating the free 3-aminocarboxylic acid ester it is
possible to extract the basic solution or suspension with a
suitable organic solvent, e.g. an ether, such as methyl butyl
ether, a hydrocarbon or hydrocarbon mixture, e.g. an alkane, such
as pentane, hexane, heptane, or an alkane mixture, naphtha or
petroleum ether, or aromatics, such as toluene. A preferred
extractant is toluene. In this procedure, the 3-amino acid ester
can be obtained almost quantitatively, while also maintaining the
ee value.
Step e)
[0097] Optionally the 3-aminocarboxylic acid esters can be
derivatized using methods known by a person skilled in the art.
Possible derivatizations comprise for example saponification of the
ester or stereoselective reduction of the carboxyl carbon atom to
an optically active alcohol.
[0098] Derivatives of compounds of Formula I' according to the
invention therefore comprise for example ammonium salts of the
3-aminocarboxylic acid esters, the free carboxylic acid in which
R.sup.2' is hydrogen, salts of the free carboxylic acid, in which
R.sup.2' is M.sup.+, and optically active 3-aminoalcohols.
[0099] The invention further relates to polypeptides that can
catalyse an amidase reaction, and comprise the following primary
structure (amino acid sequence):
[0100] SEQ ID NO:2
[0101] or a polypeptide sequence that has at least 96%, preferably
98%, especially preferably 99% identity with SEQ ID NO:2.
[0102] SEQ ID NO:4
[0103] or a polypeptide sequence that has at least 80%, preferably
at least 85%, especially preferably at least 95% identity with SEQ
ID NO:4.
[0104] The following model reaction is understood as amidase
reaction in the sense of this invention:
##STR00012##
wherein R1 and R3 in each case stand for methyl and R2 stands for
ethyl.
[0105] The following reaction conditions were selected:
[0106] 200 .mu.l cells
[0107] 50 .mu.l 1 M KH.sub.2PO.sub.4 buffer pH 7.0
[0108] 1-10 g/L substrate racemic or S-enantiomer-enriched
[0109] 740 .mu.l H.sub.2O.
[0110] For culture of the cells, see example 2.
[0111] The amidase with SEQ ID NO:2 can for example be isolated by
cloning from Rhodococcus equi DSM 19590.
EXAMPLE 1
Cloning of an Amidase from Rhodococcus equi
[0112] The coding region of the S-selective amidase from
Rhodococcus equi was amplified by PCR with the following
oligonucleotide primers:
TABLE-US-00001 Mke 973 GTCAGATGGATCCTCATGGCACTTCTTC Mke 959
ATCTCCTCTGCGATCTCGTTG Mke 972 GTTCACGATCAAGGACCTCACCGACGTC Mke 912
GCCGTGGTAGGCCCAGTTGTTGTAGCGGCC Mke 913 CGACGTCCTCATCTCGCCGACCCTCGC
Mke 904 CTACGCCACAGGACGACGGTCCGCCCACGG Mke 974
CTGGTCCCCACTGCGTCGGTAGGTGATC
[0113] In order to insert the corresponding cleavage sites for
cloning, the sequence obtained in this way was amplified in another
PCR with the following primers:
TABLE-US-00002 5'-GGGATACTCATATGAGTACATCGGATCCGGG-3'
3'-GAGTCTCAAGCTTACGCCACCGGTCGACGATCC-5'
[0114] Rhodococcus equi is a soil isolate, which was isolated from
screening for 3-acetylamino-3-phenyl-propionic-acid ethyl esters.
The strain was determined at the DSMZ. The strain was deposited at
the DSM under No. 19590.
[0115] The genomic DNA was obtained by means of a Qiagen kit:
[0116] For isolation of chromosomal DNA from Rhodococcus equi, a
bacterial culture was inoculated in 30 ml FP medium and incubated
overnight at 30.degree. C.
[0117] The culture was centrifuged at 5000.times.g and 22 .mu.l
RNase A solution was added to an 11 ml aliquot of B1 buffer. The
cell pellet was resuspended in each case with 11 ml
RNase-containing B1 buffer. Then 300 ml of lysozyme stock solution
(100 mg/ml) and 500 .mu.l of proteinase-K stock solution (20 mg/ml)
were added and, for lysis of the cells, incubated at 37.degree. C.
for 30 min. Meanwhile, a QIAGEN Genomic-tip 500/G was equilibrated
with 10 ml QBT buffer. The clear lysate was applied to the column
and allowed to pass through. Then the column was washed 2.times.
with 15 ml QC buffer. Finally the genomic DNA was eluted with 5 ml
QF buffer. The chromosomal DNA was then precipitated with
isopropanol and transferred with a glass rod into TE buffer.
[0118] The amplified gene was cut with the restriction enzymes Ndel
and HindIII and ligated into the multiple cloning site of the
vector pDHE-vector, which possesses a rhamnose-inducible promoter.
This vector was expressed in TG1 cells (DSMZ 6056).
[0119] This strain was fermented as fed-batch at 37.degree. C. in a
minimal medium. The cells were used in the tests as
bio-moist-matter with a bio-dry-matter of 150 g/l. The specific
enzyme activity was 50 U/g bio-dry-matter (BDM).
EXAMPLE 2
Preparation of 3-amino-3-phenyl-propionic Acid Ethyl Ester with a
Wild-Type Strain of Rhodococcus equi
##STR00013##
[0121] a) Preparation of the Cells:
[0122] Inoculate FP medium with cells. The cells are incubated at
28.degree. C. and 180 rpm. After 20 h of growth, the wild
type-strain is induced with a solution of 1 g/l
3-acetylamino-3-phenyl-propionic-acid ethyl ester and incubated for
a further 7 h. The cells are lysed and the raw extract is used in
the activity test.
[0123] b) Reaction of 3-acetylamino-3-phenyl-propionic Acid Ethyl
Ester:
[0124] In a buffer (100 mM KH.sub.2PO.sub.4 pH 7), 1 g/l
3-acetylamino-3-phenyl-propionic acid ethyl ester (AAPEE) and x
.mu.l (see Table 1) of cell-free raw extract (see Table 1) are
incubated overnight at 28.degree. C. or 40.degree. C.
[0125] The formation of the amine or the degradation of the amide
is measured by HPLC. For determination of the enantioselectivity,
the samples are measured by chiral GC.
Preparation:
TABLE-US-00003 [0126] TABLE 1 Preparations for the reaction of
3-acetylamino- 3-phenyl-propionic acid ethyl ester 1 2 3 Raw
extract 200 400 800 1M KH.sub.2PO.sub.4 pH 7 200 200 200 H.sub.2O
1380 1180 780 Ester (100 g/l in acetone) 20 20 20 HCl 200 200
200
Results:
[0127] FIG. 1 shows the formation of
3-acetylamino-3-phenyl-propionic acid ethyl ester as a function of
reaction time and temperature
[0128] As can be seen from FIG. 2, the concentration of
3-amino-3-phenyl-propionic acid ethyl ester reaches a maximum after
about 24 hours. After that, the amine that formed is also degraded.
The reactions at 40.degree. C. go faster at the beginning, but
collapse earlier than at 28.degree. C.
Analysis:
Achiral HPLC
[0129] column: Onyx Monolith C18, 50*4.6 mm, from Phenomenex
[0130] Mob. Phase A: 20 mM KH.sub.2PO.sub.4 pH2.5
[0131] Mob. Phase B: Acetonitrile
[0132] Flow: 1.5 ml/min
[0133] Furnace temp.: 45.degree. C.
[0134] Inj. vol.: 2 .mu.l
[0135] Gradient:
TABLE-US-00004 0.0 min 20% B 0.5 min 20% B 0.6 min 80% B 1.2 min
80% B 1.3 min 20% B 2.0 min 20% B
[0136] Detection: UV 210 nm
[0137] Retention time: Educt 1.49 min
[0138] Product 0.74 min
Chiral GC:
TABLE-US-00005 [0139] Solvent: Acetonitrile Derivatization ~100
.mu.l solution +300 .mu.l TFAA (trifluoroacetic acid anhydride)
leave to stand for ~30 minutes at 100.degree. C. GC conditions
Column 25 m Lipodex G 0.25 mm internal 0.25 .mu.m FD Furnace
program 80/10/2/180/10/700 Injection 1-5 .mu.l depending on
concentration at 250.degree. C. Detector FID at 250.degree. C.
Carrier gas Helium 16.7 PSI, flow 1.6 ml/min, split 100:1
[0140] Comparison: Reaction with racemic vs. enriched substrate
[0141] Test conditions: 500 mM AAPPEE (rac./enriched)
[0142] 100 mM KH.sub.2PO.sub.4 pH 7.0
[0143] 25 g/l (bio-dry-matter) cells from fermenter discharge
(cloned enzyme from Rhodococcus erythropolis)
[0144] 30.degree. C.
[0145] FIG. 3 shows a comparison of the reaction with racemic or
enantiomer-enriched substrate
[0146] Up to 20 g/l of 3-acetylamino-3-phenyl-propionic acid methyl
ester (AAPEE) was reacted. If racemic substrate is used, enrichment
of the S-enantiomer is obtained (ee.about.94%). However, if already
enriched substrate is used (ee.about.80%), ee>99% can be
achieved.
Preparative 4-I Preparation
4I Preparation:
[0147] 130 mM AAPPEE
[0148] 100 mM KH.sub.2PO.sub.4 pH 7.0
[0149] 34 g/L BDM cells (cloned enzyme from Rhodococcus
erythropolis)
[0150] 30.degree. C., 5 h
Preparation:
[0151] Set the reactor with 60 ml/102 g H.sub.3PO.sub.4 (85%) to pH
3.0. The final weight was 4113 g/4150 ml. The preparation was
centrifuged (5000*g, 20 min) and the pellet was washed with 200 mL.
A clear, slightly yellow supernatant was obtained (final weight
3804 g).
[0152] This was extracted with 3.times.1400 ml 2-butanol, first in
order to separate educt and by-products from educt synthesis that
are still present. Then, at 10.degree. C., it was adjusted with 20%
NaOH to pH 10 and the amino acid ester was isolated by extraction
with 1500 ml 2-butanol and subsequent removal of the solvent under
vacuum. 23.0 g of almost enantiomerically pure (99.3% ee) amino
ester was obtained as slightly yellow oil. The chemical purity is
>98% (GC).
[0153] FIG. 4 shows the reaction of enriched S-AAPEE
EXAMPLE 3
Preparation of 3-aminobutyric Acid Methyl Ester
[0154] The wild-type strain Rhodococcus erythropolis was used as
amidase (SEQ ID NO:4). This amidase can be produced by genetic
engineering methods that are familiar to a person skilled in the
art, for example by expression of the nucleic acid according to SEQ
ID NO:3 in a suitable host system, e.g. E. coli.
##STR00014##
[0155] Execution similar to example 2.
Analysis:
Achiral HPLC
[0156] Column: Luna C8(2), 150*3.0 mm, from Phenomenex
[0157] Mob. Phase A: 10 mM KH.sub.2PO.sub.4 pH2.5
[0158] Mob. Phase B: Acetonitrile
[0159] Flow: 1.0 ml/min
[0160] Furnace temp.: 40.degree. C.
[0161] Inj. vol.: 1 .mu.l
[0162] Gradient:
TABLE-US-00006 0.0 min 0% B 7.0 min 30% B 10 min 30% B 1.2 min 80%
B 1.3 min 20% B 2.0 min 20% B
[0163] Detection: UV 200 nm
[0164] Retention time: Educt 4.35 min
[0165] Product 1.13 min
Chiral GC
[0166] Column: Hydrodex-.beta.-6-TBDM, 25*0.25 mm, film thickness
16 .mu.m M & N
[0167] Temp. progr.: 90.degree. C., 15 min, 10.degree. C., 10 min,
160.degree. C., 15 min
[0168] Detector: FID
[0169] Retention time: Educt enant. 1 21.46 min
[0170] (educt only)
Preparation:
TABLE-US-00007 [0171] TABLE 2 Preparations for the reaction of
3-acetylamino-butyric acid methyl ester 60 g/l Blank Enzyme 1000
.mu.l 0 .mu.l 1M KH.sub.2PO.sub.4 pH 7 200 .mu.l 200 .mu.l
Substrate 200 .mu.l 200 .mu.l (pure substrate) (pure substrate)
VE-H.sub.2O 400 .mu.l 1400 .mu.l HCl 200 .mu.l 200 .mu.l
[0172] FIG. 6 shows the variation of the concentrations of
3-acetylamino-butyric acid methyl ester, 3-amino-butyric acid
methyl ester, and a control without enzyme, LU8676 denotes the
Rhodococcus erythropolis wild-type strain.
Sequence CWU 1
1
411419DNARhodococcus equiCDS(1)..(1419) 1atg agt aca tcg gat ccg
ggt tgg atg ccg gcg acc gag atg gcc gcc 48Met Ser Thr Ser Asp Pro
Gly Trp Met Pro Ala Thr Glu Met Ala Ala1 5 10 15cag gtc gcc tcg aag
aga ttg tcg ccc aac gag atc gca gag gag atg 96Gln Val Ala Ser Lys
Arg Leu Ser Pro Asn Glu Ile Ala Glu Glu Met 20 25 30atc cgt cga gtc
gag gag gtc aat ccc tcc gtc aac gcg atc gtg cac 144Ile Arg Arg Val
Glu Glu Val Asn Pro Ser Val Asn Ala Ile Val His 35 40 45ttc gac gcc
gag cag gtg cgc cgc gac gcc gcc gac ctg gca cgg gcg 192Phe Asp Ala
Glu Gln Val Arg Arg Asp Ala Ala Asp Leu Ala Arg Ala 50 55 60cag gag
agc ggt gag acg ctc ggt ccg ctg cac ggc gtc ccg ttc acg 240Gln Glu
Ser Gly Glu Thr Leu Gly Pro Leu His Gly Val Pro Phe Thr65 70 75
80atc aag gac ctc acc gac gtc cgt ggc ctg ccg acc acg ttc ggc ctg
288Ile Lys Asp Leu Thr Asp Val Arg Gly Leu Pro Thr Thr Phe Gly Leu
85 90 95aag ccc atg cgc gac aac atc gcc gaa cgc gac gcg gtg atc gtc
acc 336Lys Pro Met Arg Asp Asn Ile Ala Glu Arg Asp Ala Val Ile Val
Thr 100 105 110cgg ttg cgg cag gcc ggc ggc ctc tac ctc ggc aag acc
aac acc ccg 384Arg Leu Arg Gln Ala Gly Gly Leu Tyr Leu Gly Lys Thr
Asn Thr Pro 115 120 125gag agc ggc tac tac ggc ggc acc gac aac cac
ctg ttc ggc ccg acc 432Glu Ser Gly Tyr Tyr Gly Gly Thr Asp Asn His
Leu Phe Gly Pro Thr 130 135 140cac aat ccg tgg aag ccc ggc cac acc
ccc ggc gga tcg agc ggt ggc 480His Asn Pro Trp Lys Pro Gly His Thr
Pro Gly Gly Ser Ser Gly Gly145 150 155 160gcc gcc gcg gcc gtc gcc
gcc ggt ctc ggt ccg ctc gcc gag ggc agc 528Ala Ala Ala Ala Val Ala
Ala Gly Leu Gly Pro Leu Ala Glu Gly Ser 165 170 175gac ggc gcc ggg
tcg gtc cgg atc ccg tcg gca ttg tgc ggc gtc gtc 576Asp Gly Ala Gly
Ser Val Arg Ile Pro Ser Ala Leu Cys Gly Val Val 180 185 190gga ctc
aag ccc acg acc ggc gtg atc ccg cag acg atc ctg ccc ggc 624Gly Leu
Lys Pro Thr Thr Gly Val Ile Pro Gln Thr Ile Leu Pro Gly 195 200
205cgc tac aac aac tgg gcg tac cac ggt ccc atc acc cgc acc gtt gcc
672Arg Tyr Asn Asn Trp Ala Tyr His Gly Pro Ile Thr Arg Thr Val Ala
210 215 220gac aac gcc ctg atg ctg gac gtt ctt gcc ggg ccg gat cat
tcg gat 720Asp Asn Ala Leu Met Leu Asp Val Leu Ala Gly Pro Asp His
Ser Asp225 230 235 240ccg ctg agc atc gaa cga gtc gag ggc tcg tac
gtc gag gcg gcg cgg 768Pro Leu Ser Ile Glu Arg Val Glu Gly Ser Tyr
Val Glu Ala Ala Arg 245 250 255ggt ggg atc gac ggg ctg cga gtc gcg
tgg tcg ccg gac ctc ggt ctc 816Gly Gly Ile Asp Gly Leu Arg Val Ala
Trp Ser Pro Asp Leu Gly Leu 260 265 270ggc cac gtc gag ccc gac gtc
gcc gcg gtc tgc gcc gag gcg gtc gcg 864Gly His Val Glu Pro Asp Val
Ala Ala Val Cys Ala Glu Ala Val Ala 275 280 285tgt ttc gag gag atg
ggc gcc aag gtc gtc gag gcg acg ccg gac tgg 912Cys Phe Glu Glu Met
Gly Ala Lys Val Val Glu Ala Thr Pro Asp Trp 290 295 300ggc gat ccg
tcg gag gcg atg tgg cac ggc atc tgg gtg ccg ggc ttc 960Gly Asp Pro
Ser Glu Ala Met Trp His Gly Ile Trp Val Pro Gly Phe305 310 315
320gcc ggc gag cac gac atg ctc gac tgg gac gcg ctg cac ggc cag gtc
1008Ala Gly Glu His Asp Met Leu Asp Trp Asp Ala Leu His Gly Gln Val
325 330 335gac gag aac ctg atc gaa ctg atc cac gag ggc cgg cga ctc
acc ggc 1056Asp Glu Asn Leu Ile Glu Leu Ile His Glu Gly Arg Arg Leu
Thr Gly 340 345 350gtc gac tac ggc cgc gcc gac acg ttc cgc ggt ggc
atg tgg gac acc 1104Val Asp Tyr Gly Arg Ala Asp Thr Phe Arg Gly Gly
Met Trp Asp Thr 355 360 365tgg acc gag ttc atg aac gac tac gac gtc
ctg atc tcg ccg acg ctg 1152Trp Thr Glu Phe Met Asn Asp Tyr Asp Val
Leu Ile Ser Pro Thr Leu 370 375 380gcg tcc gcc acg ttc ccg ctc acc
cag ttc gcg ccg gac tgg cta cag 1200Ala Ser Ala Thr Phe Pro Leu Thr
Gln Phe Ala Pro Asp Trp Leu Gln385 390 395 400ggc aag tcg ctg cgc
gag caa ctg ctc gac tgg ctg ctg acc tac ccg 1248Gly Lys Ser Leu Arg
Glu Gln Leu Leu Asp Trp Leu Leu Thr Tyr Pro 405 410 415tac aac atg
ctg aac aac ccc gcg atc acg gtc ccc gca ggc ttc acc 1296Tyr Asn Met
Leu Asn Asn Pro Ala Ile Thr Val Pro Ala Gly Phe Thr 420 425 430ccg
gac ggg cgc ccg gtc gga ctc cag atc gcg gcg cgc cat cgt cag 1344Pro
Asp Gly Arg Pro Val Gly Leu Gln Ile Ala Ala Arg His Arg Gln 435 440
445gac gcg ctc gtg ctg cgg gtc gcg gcg aac ctg gag cag gca cgg ccg
1392Asp Ala Leu Val Leu Arg Val Ala Ala Asn Leu Glu Gln Ala Arg Pro
450 455 460tgg gcg gat cgt cga ccg gtg gcg tag 1419Trp Ala Asp Arg
Arg Pro Val Ala465 4702472PRTRhodococcus equi 2Met Ser Thr Ser Asp
Pro Gly Trp Met Pro Ala Thr Glu Met Ala Ala1 5 10 15Gln Val Ala Ser
Lys Arg Leu Ser Pro Asn Glu Ile Ala Glu Glu Met 20 25 30Ile Arg Arg
Val Glu Glu Val Asn Pro Ser Val Asn Ala Ile Val His 35 40 45Phe Asp
Ala Glu Gln Val Arg Arg Asp Ala Ala Asp Leu Ala Arg Ala 50 55 60Gln
Glu Ser Gly Glu Thr Leu Gly Pro Leu His Gly Val Pro Phe Thr65 70 75
80Ile Lys Asp Leu Thr Asp Val Arg Gly Leu Pro Thr Thr Phe Gly Leu
85 90 95Lys Pro Met Arg Asp Asn Ile Ala Glu Arg Asp Ala Val Ile Val
Thr 100 105 110Arg Leu Arg Gln Ala Gly Gly Leu Tyr Leu Gly Lys Thr
Asn Thr Pro 115 120 125Glu Ser Gly Tyr Tyr Gly Gly Thr Asp Asn His
Leu Phe Gly Pro Thr 130 135 140His Asn Pro Trp Lys Pro Gly His Thr
Pro Gly Gly Ser Ser Gly Gly145 150 155 160Ala Ala Ala Ala Val Ala
Ala Gly Leu Gly Pro Leu Ala Glu Gly Ser 165 170 175Asp Gly Ala Gly
Ser Val Arg Ile Pro Ser Ala Leu Cys Gly Val Val 180 185 190Gly Leu
Lys Pro Thr Thr Gly Val Ile Pro Gln Thr Ile Leu Pro Gly 195 200
205Arg Tyr Asn Asn Trp Ala Tyr His Gly Pro Ile Thr Arg Thr Val Ala
210 215 220Asp Asn Ala Leu Met Leu Asp Val Leu Ala Gly Pro Asp His
Ser Asp225 230 235 240Pro Leu Ser Ile Glu Arg Val Glu Gly Ser Tyr
Val Glu Ala Ala Arg 245 250 255Gly Gly Ile Asp Gly Leu Arg Val Ala
Trp Ser Pro Asp Leu Gly Leu 260 265 270Gly His Val Glu Pro Asp Val
Ala Ala Val Cys Ala Glu Ala Val Ala 275 280 285Cys Phe Glu Glu Met
Gly Ala Lys Val Val Glu Ala Thr Pro Asp Trp 290 295 300Gly Asp Pro
Ser Glu Ala Met Trp His Gly Ile Trp Val Pro Gly Phe305 310 315
320Ala Gly Glu His Asp Met Leu Asp Trp Asp Ala Leu His Gly Gln Val
325 330 335Asp Glu Asn Leu Ile Glu Leu Ile His Glu Gly Arg Arg Leu
Thr Gly 340 345 350Val Asp Tyr Gly Arg Ala Asp Thr Phe Arg Gly Gly
Met Trp Asp Thr 355 360 365Trp Thr Glu Phe Met Asn Asp Tyr Asp Val
Leu Ile Ser Pro Thr Leu 370 375 380Ala Ser Ala Thr Phe Pro Leu Thr
Gln Phe Ala Pro Asp Trp Leu Gln385 390 395 400Gly Lys Ser Leu Arg
Glu Gln Leu Leu Asp Trp Leu Leu Thr Tyr Pro 405 410 415Tyr Asn Met
Leu Asn Asn Pro Ala Ile Thr Val Pro Ala Gly Phe Thr 420 425 430Pro
Asp Gly Arg Pro Val Gly Leu Gln Ile Ala Ala Arg His Arg Gln 435 440
445Asp Ala Leu Val Leu Arg Val Ala Ala Asn Leu Glu Gln Ala Arg Pro
450 455 460Trp Ala Asp Arg Arg Pro Val Ala465
47031431DNARhodococcus erythropolisCDS(1)..(1431) 3atg acc gaa cag
aat ctg cat tgg ctc tcc gct acc gag atg gcg gcg 48Met Thr Glu Gln
Asn Leu His Trp Leu Ser Ala Thr Glu Met Ala Ala1 5 10 15tcg gtc gcg
tcg aac agt ctc tcg ccc aac gag att gcc gaa gcg atg 96Ser Val Ala
Ser Asn Ser Leu Ser Pro Asn Glu Ile Ala Glu Ala Met 20 25 30atc cag
cgc gtc gac gct gtc aat ccg tcg atc aac gcg ata gtg cag 144Ile Gln
Arg Val Asp Ala Val Asn Pro Ser Ile Asn Ala Ile Val Gln 35 40 45ttc
gat cgc gag cag gtc acg cgc gac gcg gcc gaa ctc tca cgg caa 192Phe
Asp Arg Glu Gln Val Thr Arg Asp Ala Ala Glu Leu Ser Arg Gln 50 55
60cag gaa tcg ggc gag aaa ctc ggc ccg ctg cac ggc gtt ccg ttc acg
240Gln Glu Ser Gly Glu Lys Leu Gly Pro Leu His Gly Val Pro Phe
Thr65 70 75 80atc aaa gat ctg acg gca gtc gac ggg ctg ccg acc acg
ttc ggg atg 288Ile Lys Asp Leu Thr Ala Val Asp Gly Leu Pro Thr Thr
Phe Gly Met 85 90 95aag ccg atg gcc gac aac atc gcg acg gga aat gcc
gtc gtc gtg gac 336Lys Pro Met Ala Asp Asn Ile Ala Thr Gly Asn Ala
Val Val Val Asp 100 105 110agg ctg cgc ggc gcc ggc gga ctg ttc ctg
gga aag acg aac act ccc 384Arg Leu Arg Gly Ala Gly Gly Leu Phe Leu
Gly Lys Thr Asn Thr Pro 115 120 125gaa agc ggt tac tac ggt ggc acg
gac aac cac ctg tac ggg ccg acg 432Glu Ser Gly Tyr Tyr Gly Gly Thr
Asp Asn His Leu Tyr Gly Pro Thr 130 135 140cac aac ccg tgg aag ctc
ggc aac agc gcg ggc ggg tcc agt ggc ggc 480His Asn Pro Trp Lys Leu
Gly Asn Ser Ala Gly Gly Ser Ser Gly Gly145 150 155 160gcg tcg gct
gcc gtg gct gca ggc ctc ggg cca ctt gcc gag ggc agt 528Ala Ser Ala
Ala Val Ala Ala Gly Leu Gly Pro Leu Ala Glu Gly Ser 165 170 175gac
ggc gcc gga tcg gtg cgt atc cca tcg gcg ctc tgc ggg gtc gtc 576Asp
Gly Ala Gly Ser Val Arg Ile Pro Ser Ala Leu Cys Gly Val Val 180 185
190ggg ctc aaa ccg acc acc ggc gtc att ccg cag acc att ctg gcc ggg
624Gly Leu Lys Pro Thr Thr Gly Val Ile Pro Gln Thr Ile Leu Ala Gly
195 200 205cgg ttc tac aac tgg gcg tac cac ggt ccg atc acc agg acc
gtc gcc 672Arg Phe Tyr Asn Trp Ala Tyr His Gly Pro Ile Thr Arg Thr
Val Ala 210 215 220gac aac gcg ctc atg ctc gac atc atg gcc ggg ccg
gac aat gcg gat 720Asp Asn Ala Leu Met Leu Asp Ile Met Ala Gly Pro
Asp Asn Ala Asp225 230 235 240ccg ctc tcg atc gag cgt gcg gag acc
tcg tac gtc gaa gcg gcg aag 768Pro Leu Ser Ile Glu Arg Ala Glu Thr
Ser Tyr Val Glu Ala Ala Lys 245 250 255ggt gac gtg aag ggg ctt cgc
gtc gcg tgg tcg acg aat ctc ggc ctc 816Gly Asp Val Lys Gly Leu Arg
Val Ala Trp Ser Thr Asn Leu Gly Leu 260 265 270ggc cat gtt gat ccg
gag gtg ctg gcg gtg tgc ctc gac gcg ctg gcg 864Gly His Val Asp Pro
Glu Val Leu Ala Val Cys Leu Asp Ala Leu Ala 275 280 285gca ttc gag
gaa ttg ggt gcc cag atc acc gag gcg acc ccg cag tgg 912Ala Phe Glu
Glu Leu Gly Ala Gln Ile Thr Glu Ala Thr Pro Gln Trp 290 295 300gga
aat ccg tcg gag tcg atg tgg aac ggc atc tgg gtt ccc ggt ttc 960Gly
Asn Pro Ser Glu Ser Met Trp Asn Gly Ile Trp Val Pro Gly Phe305 310
315 320gct tcc gaa tac gac ttg ctc gac tgg gag aac cag cgc ggc gag
gtc 1008Ala Ser Glu Tyr Asp Leu Leu Asp Trp Glu Asn Gln Arg Gly Glu
Val 325 330 335gac gac aac ctg atc gag atc atg cac gag gcc gag cgg
ctc acc ggt 1056Asp Asp Asn Leu Ile Glu Ile Met His Glu Ala Glu Arg
Leu Thr Gly 340 345 350gtc gac gtc ggg cgg gcc gac gca ttc cgc ggc
gtc atg tgg gac acg 1104Val Asp Val Gly Arg Ala Asp Ala Phe Arg Gly
Val Met Trp Asp Thr 355 360 365tgg acc acg ttc atg aac gac tac gac
gtg ttg gtc tcg ccg acc ttg 1152Trp Thr Thr Phe Met Asn Asp Tyr Asp
Val Leu Val Ser Pro Thr Leu 370 375 380gct tcg gcc acg ttc ccg ctc
agt cag ttc gcg ccg tcg tgg ctc gaa 1200Ala Ser Ala Thr Phe Pro Leu
Ser Gln Phe Ala Pro Ser Trp Leu Glu385 390 395 400ggt gcg tcg ttg
cgt gag cag ttg ctc gat tgg ctc ttc acc tac ccg 1248Gly Ala Ser Leu
Arg Glu Gln Leu Leu Asp Trp Leu Phe Thr Tyr Pro 405 410 415tac aac
atg ctc aac aac ccc gcg atc acc gtg ccc gcc gga ttt acc 1296Tyr Asn
Met Leu Asn Asn Pro Ala Ile Thr Val Pro Ala Gly Phe Thr 420 425
430gcc gac ggt cga ccg gtg ggg ctg cag atc gcc gca cgc cac cgc cag
1344Ala Asp Gly Arg Pro Val Gly Leu Gln Ile Ala Ala Arg His Arg Gln
435 440 445gac gca ctg gtt ctg cgg act gcc gcg aac ttc gaa gcg gtg
cgt ccg 1392Asp Ala Leu Val Leu Arg Thr Ala Ala Asn Phe Glu Ala Val
Arg Pro 450 455 460tgg gcg gac agg aag ccg gcc gat tca ctg gtg gtg
gcc 1431Trp Ala Asp Arg Lys Pro Ala Asp Ser Leu Val Val Ala465 470
4754477PRTRhodococcus erythropolis 4Met Thr Glu Gln Asn Leu His Trp
Leu Ser Ala Thr Glu Met Ala Ala1 5 10 15Ser Val Ala Ser Asn Ser Leu
Ser Pro Asn Glu Ile Ala Glu Ala Met 20 25 30Ile Gln Arg Val Asp Ala
Val Asn Pro Ser Ile Asn Ala Ile Val Gln 35 40 45Phe Asp Arg Glu Gln
Val Thr Arg Asp Ala Ala Glu Leu Ser Arg Gln 50 55 60Gln Glu Ser Gly
Glu Lys Leu Gly Pro Leu His Gly Val Pro Phe Thr65 70 75 80Ile Lys
Asp Leu Thr Ala Val Asp Gly Leu Pro Thr Thr Phe Gly Met 85 90 95Lys
Pro Met Ala Asp Asn Ile Ala Thr Gly Asn Ala Val Val Val Asp 100 105
110Arg Leu Arg Gly Ala Gly Gly Leu Phe Leu Gly Lys Thr Asn Thr Pro
115 120 125Glu Ser Gly Tyr Tyr Gly Gly Thr Asp Asn His Leu Tyr Gly
Pro Thr 130 135 140His Asn Pro Trp Lys Leu Gly Asn Ser Ala Gly Gly
Ser Ser Gly Gly145 150 155 160Ala Ser Ala Ala Val Ala Ala Gly Leu
Gly Pro Leu Ala Glu Gly Ser 165 170 175Asp Gly Ala Gly Ser Val Arg
Ile Pro Ser Ala Leu Cys Gly Val Val 180 185 190Gly Leu Lys Pro Thr
Thr Gly Val Ile Pro Gln Thr Ile Leu Ala Gly 195 200 205Arg Phe Tyr
Asn Trp Ala Tyr His Gly Pro Ile Thr Arg Thr Val Ala 210 215 220Asp
Asn Ala Leu Met Leu Asp Ile Met Ala Gly Pro Asp Asn Ala Asp225 230
235 240Pro Leu Ser Ile Glu Arg Ala Glu Thr Ser Tyr Val Glu Ala Ala
Lys 245 250 255Gly Asp Val Lys Gly Leu Arg Val Ala Trp Ser Thr Asn
Leu Gly Leu 260 265 270Gly His Val Asp Pro Glu Val Leu Ala Val Cys
Leu Asp Ala Leu Ala 275 280 285Ala Phe Glu Glu Leu Gly Ala Gln Ile
Thr Glu Ala Thr Pro Gln Trp 290 295 300Gly Asn Pro Ser Glu Ser Met
Trp Asn Gly Ile Trp Val Pro Gly Phe305 310 315 320Ala Ser Glu Tyr
Asp Leu Leu Asp Trp Glu Asn Gln Arg Gly Glu Val 325 330 335Asp Asp
Asn Leu Ile Glu Ile Met His Glu Ala Glu Arg Leu Thr Gly 340 345
350Val Asp Val Gly Arg Ala Asp Ala Phe Arg Gly Val Met Trp Asp Thr
355 360 365Trp Thr Thr Phe Met Asn Asp Tyr Asp Val Leu Val Ser Pro
Thr Leu 370 375 380Ala Ser Ala Thr Phe Pro Leu Ser Gln Phe Ala Pro
Ser Trp Leu Glu385 390 395 400Gly Ala Ser Leu Arg Glu Gln Leu Leu
Asp Trp Leu Phe Thr Tyr Pro 405 410 415Tyr Asn Met Leu Asn Asn Pro
Ala Ile Thr Val Pro Ala Gly Phe Thr 420 425 430Ala Asp Gly Arg Pro
Val Gly Leu Gln Ile Ala Ala Arg His Arg Gln 435 440 445Asp Ala Leu
Val Leu Arg Thr Ala Ala Asn Phe Glu Ala Val Arg Pro 450
455 460Trp Ala Asp Arg Lys Pro Ala Asp Ser Leu Val Val Ala465 470
475
* * * * *