U.S. patent application number 13/364979 was filed with the patent office on 2012-08-09 for immunoassay tracer reagents and methods for measuring the amount of native human bioactive hepcidin.
This patent application is currently assigned to INTRINSIC LIFESCIENCES LLC. Invention is credited to Xavier LAUTH, Vaughn E. OSTLAND, Michael W. PENNINGTON, Jason A. STANNARD, Mark E. WESTERMAN.
Application Number | 20120202229 13/364979 |
Document ID | / |
Family ID | 35657698 |
Filed Date | 2012-08-09 |
United States Patent
Application |
20120202229 |
Kind Code |
A1 |
LAUTH; Xavier ; et
al. |
August 9, 2012 |
Immunoassay tracer reagents and methods for measuring the amount of
native human bioactive hepcidin
Abstract
The invention provides compositions and methods for measuring
human serum hepcidin levels. The invention provides methods for the
oxidative refolding of a hepcidin polypeptide to a form that is
mature, bioactive and folded as in the native configuration and
molecular mass; a method for measuring the level of native,
bioactive hepcidin in a vertebrate animal.
Inventors: |
LAUTH; Xavier; (San Diego,
CA) ; WESTERMAN; Mark E.; (San Diego, CA) ;
OSTLAND; Vaughn E.; (La Quinta, CA) ; STANNARD; Jason
A.; (San Diego, CA) ; PENNINGTON; Michael W.;
(Cherry Hill, NJ) |
Assignee: |
INTRINSIC LIFESCIENCES LLC
La Jolla
CA
|
Family ID: |
35657698 |
Appl. No.: |
13/364979 |
Filed: |
February 2, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12797797 |
Jun 10, 2010 |
|
|
|
13364979 |
|
|
|
|
12268964 |
Nov 11, 2008 |
7745162 |
|
|
12797797 |
|
|
|
|
11119293 |
Apr 28, 2005 |
7723063 |
|
|
12268964 |
|
|
|
|
60566387 |
Apr 28, 2004 |
|
|
|
Current U.S.
Class: |
435/7.93 ;
530/324 |
Current CPC
Class: |
C07K 16/26 20130101;
C07K 14/461 20130101 |
Class at
Publication: |
435/7.93 ;
530/324 |
International
Class: |
G01N 33/566 20060101
G01N033/566; C07K 14/47 20060101 C07K014/47 |
Goverment Interests
STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH
[0002] This invention was made with government support under
National Science Foundation Grants DMI-0215093 and DMI-0349772,
awarded by the National Science Foundation. The government has
certain rights in the invention.
Claims
1-18. (canceled)
19: An immunoassay tracer reagent comprising: (a) (i) an
oxidatively folded hepcidin peptide consisting of SEQ ID NO:28;
(ii) a hydrophilic spacer comprising one or more
(2-(2-Amino-Ethoxy)Ethoxy) Acetic Acid (AEEAc) residues, wherein
the peptide of (i) is covalently linked to the hydrophilic spacer
at its amino terminus, its lysine at position 18, or lysine at
position 24; and (iii) a detectable marker covalently linked to the
spacer residue of (ii).
20: The immunoassay tracer reagent of claim 37, wherein (i) the
detectable marker comprises a biotin, a fluorescent molecule or an
enzyme; or (ii) the detectable marker comprises a horseradish
peroxidase (HRP) enzyme.
21: The immunoassay tracer reagent of claim 37, wherein the
hydrophilic spacer comprises two (2-(2-Amino-Ethoxy)Ethoxy)Acetic
Acid (AEEAc) residues.
22: The immunoassay tracer reagent of claim 37, wherein the
hydrophilic spacer consists of two (2-(2-Amino-Ethoxy)Ethoxy)Acetic
Acid (AEEAc) residues.
23: The immunoassay tracer reagent of claim 37, wherein the
hepcidin peptide comprises an isolated, synthetic or recombinant
peptide.
24: The immunoassay tracer reagent of claim 37, wherein the
hepcidin peptide is oxidatively folded by a process comprising: (a)
solubilizing the hepcidin peptide consisting of SEQ ID NO:28 in an
acetic acid solution to produce a first solution; (b) diluting the
first solution with an aqueous buffer solution containing a
chaotropic reagent, an organic alcohol, and an oxidizing reagent to
produce a second solution; and (c) adjusting the pH of the second
solution to a level between approximately 5 and 7.
25: A method for measuring the amount of native human bioactive
hepcidin in a sample of tissue or bodily fluid taken from a human
using a competitive Enzyme-Linked Immunosorbent Assay (ELISA)
comprising: (a) obtaining a sample of a tissue or a bodily fluid
from a human, and preparing a solution comprising the sample of the
tissue or the bodily fluid; (b) providing a known amount of the
immunoassay tracer reagent of claim 37; (c) providing an
immobilized antibody that specifically binds to a bioactive human
hepcidin, and contacting the immobilized antibody with a blocking
solution; (d) contacting a known amount of the solution of step (a)
with a known amount of the reagent of step (b) in the presence of
the immobilized antibody of step (c), thereby forming immobilized
antibody-(human hepcidin) tracer reagent complexes and immobilized
antibody-sample human hepcidin complexes; (e) washing unbound
tracer reagent from the reaction solution; and (f) determining the
amount of bioactive human hepcidin in the sample by competitive
ELISA.
26: A method for measuring the amount of bioactive human hepcidin
in a sample of tissue or bodily fluid taken from a human using a
competitive Enzyme-Linked Immunosorbent Assay (ELISA) comprising:
(a) obtaining a sample of a tissue or a bodily fluid from a human,
and preparing a solution comprising the sample of the tissue or the
bodily fluid; (b) providing a known amount of immunoassay tracer
reagent of claim 37; (c) providing an immobilized antibody that
specifically binds to a bioactive human hepcidin, and contacting
the immobilized antibody with a blocking solution; (d) contacting a
known amount of the solution of step (a) with a known amount of the
reagent of step (b) in the presence of the immobilized antibody of
step (c), thereby forming complexes of immobilized antibody and
tracer reagent and immobilized antibody-sample human hepcidin
complexes; (e) washing unbound tracer reagent from the reaction
solution; (f) detecting the amount of tracer reagent of step (b)
bound to the antibody of step (c); and (g) calculating the amount
of bioactive human hepcidin in the sample based on results of the
detecting of step (f).
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is continuation of U.S. patent application
Ser. No. 12/797,797, filed Jun. 10, 2010 (now pending), which is a
continuation in part of U.S. Ser. No. 12/268,964, filed Aug. 27,
2009, now U.S. Pat. No. 7,745,162, issued Jun. 29, 2010, which is a
divisional of U.S. Ser. No. 11/119,293, filed Apr. 28, 2005, now
U.S. Pat. No. 7,723,063, issued May 25, 2010, which claims benefit
of priority to U.S. Provisional Patent Application Ser. No.
60/566,387, filed on Apr. 28, 2004. The contents of these
applications are expressly incorporated herein by reference in
their entirely for all purposes.
REFERENCE TO A COMPUTER LISTING, A TABLE, OR A COMPUTER PROGRAM
LISTING COMPACT DISK APPENDIX
[0003] The Sequence Listing enclosed herein is incorporated by
reference under 37 C.F.R. .sctn.1.821(e).
FIELD OF THE INVENTION
[0004] The present invention relates to a hepcidin polypeptide,
and, more particularly, to a method for the oxidative refolding of
a hepcidin polypeptide to a form that is mature, bioactive, and
folded as in the native configuration. The present invention
further relates to a method for measuring the level of hepcidin in
a vertebrate animal, to a method for measuring the level of gene
expression in a vertebrate animal, to a method for regulating the
production of native, bioactive hepcidin a vertebrate animal in
vivo, to an antibody or fragment thereof that specifically binds to
an epitope of hepcidin, and to a pharmaceutical composition
comprising the antibody or a hepcidin polypeptide.
BACKGROUND
[0005] Hepcidins form a new gene family of inducible,
liver-expressed, cysteine-rich peptides that have been identified
in vertebrate animals, from fish to humans.
[0006] Human hepcidin, also known as liver expressed antimicrobial
peptide (LEAP-1), was initially purified as a 25 amino acid peptide
from urine and plasma ultra-filtrates during screens for
proteins/peptides with antimicrobial activity. Through an Advanced
Technology Program Grant from the U.S. Department of Commerce to
Kent Sea Tech Corp., bass hepcidin was later purified from the gill
tissues of hybrid striped bass (Morone chrysops.times.M. saxatilis,
hereinafter HSB) based on its antimicrobial activity against an E.
coli strain, and was characterized as a second type of native,
bioactive hepcidin peptide found in a vertebrate species. In vivo,
bass hepcidin gene expression was shown to be strongly up-regulated
following clinical infection with the pathogen Streptococcus iniae.
The bass hepcidin peptide was shown to contain 21 amino acids like
one of the forms of human hepcidin, including eight cysteines
involved in four disulfide bonds, and to be predominantly expressed
in the liver in the HSB model. Notably, bass hepcidin was the first
hepcidin to be isolated from a non-human vertebrate, the first
cysteine-rich anti-microbial peptide (AMP) isolated from fish, and
the first demonstration of hepcidin gene expression induced by the
bacterial infection of a vertebrate.
[0007] In addition to their antimicrobial activities, hepcidins
were found to play an essential role in iron homeostasis. Such a
role was first suggested in studies using subtractive cloning
approaches in mice subjected to dietary iron overload, where
hepcidin gene expression was up-regulated under iron-overload
conditions, and where disruption of the hepcidin gene led to
accumulation of iron in the liver and pancreas, as well as iron
depletion in resident macrophages. This pattern closely paralleled
the iron distribution pattern seen in cases of hereditary
hemochromatosis in humans. In another study, over-expression of
hepcidin in transgenic mouse pups induced profound anemia and
postpartum mortality. These and other observations led to the
hypothesis that elevated levels of hepcidin limit dietary iron
uptake in duodenal enterocytes and block the release of iron by
macrophages, making hepcidin a key regulator/hormone of iron
homeostasis in higher vertebrates. The critical role for hepcidin
in human iron regulation has recently been corroborated by the
connection of deleterious mutations in the hepcidin gene in several
consanguine families with severe juvenile hemochromatosis and with
the demonstration of abnormal hepcidin gene expression levels in
patients with other genetic variants of this disease.
[0008] The association of hepcidin with innate immune response
derives from the observation of a robust upregulation of hepcidin
gene expression after inflammatory stimuli, such as infections,
which induce the acute phase response of the innate immune systems
of vertebrates. In bass, experimental infection with the
Gram-positive bacterial pathogen, Streptococcus iniae, strongly
upregulated hepcidin gene expression within 24 hours post
infection, and, in mice, hepcidin gene expression was shown to be
upregulated by lipopolysaccharide (LPS), turpentine, Freund's
complete adjuvant, and adenoviral infections.
[0009] Studies conducted with human primary hepatocytes indicated
that hepcidin gene expression responded to the addition of
interleukin-6 (IL-6), but not to interleukin-1.alpha. (IL-.alpha.)
or tumor necrosis factor-.alpha. (TNF-.alpha.). Concordant with
this observation, infusion of human volunteers with IL-6 caused the
rapid increase of bioactive hepcidin peptide levels in serum and
urine, and was paralleled by a decrease in serum iron and
transferrin saturation. A strong correlation between hepcidin
expression and anemia of inflammation was also found in patients
with chronic and inflammatory diseases, including bacterial,
fungal, and viral infections. These findings, further corroborated
in a mouse model, led to the conclusion that induction of hepcidin
during inflammation depends on IL-6, and that the hepcidin-IL-6
axis is responsible for the hypoferremic response and subsequent
restriction of iron from blood-borne pathogens.
[0010] Evidence of the essential role of hepcidin in iron
homeostasis and hypoferremia of inflammation has been primarily
gathered from genetic studies in humans and mice, because only two
native hepcidin peptides have been purified and the respective
genes cloned and characterized to date, one from humans and the
other from bass. The structure of mature, bioactive, folded, human
hepcidin shows it to be an amphipathic molecule composed of two
distorted, anti-parallel .beta.-sheets separated by a hairpin loop
containing a vicinal disulfide bond (that is, a disulfide bond
between adjacent cysteines) and stabilized by three
inter-.beta.-sheet disulfide bonds. The distinctive structure of
human hepcidin is due to a disulfide bonding pattern that appears
to be highly conserved evolutionarily, and to be required for
bioactivity as an iron regulatory molecule and as an antimicrobial
compound.
[0011] To date, the unique structure of the mature, folded,
bioactive hepcidin has severely limited the development and
application of sensitive, informative, immunoglobulin antibodies
and tools to detect a refolded, synthetic hepcidin and partial,
linear amino acid sequences by means of methods adapted from the
production of single chain antibodies. These failures suggest that
antibodies that recognize discontinuous and conformational epitopes
of the mature, correctly folded, bioactive hepcidin molecule of
interest are required for the sensitive measurement of the
bioactive forms of hepcidin in studies of disease.
[0012] The central role of hepcidin and its key functions in iron
regulation and in the innate immune response to infection
necessitates the invention of novel methods and informative
diagnostic tools for the measurement of the mature, bioactive forms
of hepcidin in vertebrates, for the regulation of hepcidin
production in animals, and for the production of a synthetic
hepcidin that has a properly folded tertiary structure as in the
native configuration. Further, the production, refolding,
purification, and validation of synthetic or recombinant hepcidin
peptides, and the development of antibodies specific to the native,
bioactive, vertebrate forms, will enable the treatment of human and
animal diseases and infections.
SUMMARY
[0013] In one embodiment, it is an advantage of the present
invention to provide methods for the production of bioactive
hepcidin by refolding linear hepcidin that is made available by a
variety of processes, such as chemical synthesis, production in
bacteria, production in yeast, and production in eukaryotic cell
lines.
[0014] In one embodiment, it is another advantage of the present
invention to provide methods for determining the concentration of
hepcidin in vertebrates using an Enzyme-Linked Immunosorbent Assay
(ELISA) with an anti-hepcidin antibody and with a hepcidin
conjugate, or using an immuno-chromatographic assay with an
anti-hepcidin antibody and a hepcidin conjugate.
[0015] In one embodiment, it is a further advantage of the present
invention to provide methods for determining hepcidin gene
abundance in a vertebrate animal by performing a Reverse
Polymerase-Transcriptase Chain Reaction (RT-PCR) on the ribonucleic
acid (RNA) present in a sample of tissue or bodily fluid of the
animal.
[0016] In one embodiment, it is yet another advantage of the
present invention to provide methods for inducing production of
hepcidin in vivo in vertebrate animals, thereby enhancing innate
immunity.
[0017] In one embodiment, it is still another advantage of the
present invention to provide an antibody capable of binding to an
epitope of hepcidin, and to further provide a diagnostic tool based
on said antibody for measuring the level of hepcidin in a
vertebrate animal.
[0018] In one embodiment, it is a still further advantage of the
present invention to provide a pharmaceutical composition that
comprises a hepcidin polypeptide and that has antimicrobial,
agonistic or antagonistic activity in relation to hepcidin
bioactivity in vivo in a vertebrate animal.
[0019] In one embodiment, the present invention concerns a method
for the oxidative refolding of a hepcidin polypeptide to a form
that is mature, bioactive and folded as in the native configuration
and molecular mass; a method for measuring the level of native,
bioactive hepcidin in a vertebrate animal; a method for measuring
the level of hepcidin gene expression in a vertebrate animal; and a
method for regulating the production of native, bioactive hepcidin
in a vertebrate animal in vivo. The present invention also concerns
an antibody or fragment thereof that specifically binds to a
continuous, discontinuous, and/or conformational epitope of a
mature and bioactive hepcidin folded as in the native
configuration; and a pharmaceutical composition that includes the
antibody or a hepcidin polypeptide and that provides antimicrobial,
agonistic, or antagonistic activities in vivo in a vertebrate
animal.
[0020] In one embodiment, it first method is provided for the
oxidative refolding of a hepcidin polypeptide to a form that is
mature, bioactive and folded as in the native configuration and
molecular mass. This first method comprises the steps of
solubilizing the hepcidin polypeptide in an acetic acid solution to
produce a first solution; of diluting the first solution with an
aqueous buffer solution containing a chaotropic reagent, an organic
alcohol, and an oxidizing reagent to produce a second solution, in
which the organic alcohol enhances the solubility of the
polypeptide and prevents hepcidin precipitation during the
oxidative refolding, increasing yield as a consequence; of
adjusting the pH of the second solution to a level between
approximately 5 and 7; and of exposing the hepcidin peptide to
oxidation for a suitable period of time, which causes the
polypeptide to configure to a bioactive hepcidin molecule that has
a folded tertiary structure as in the native configuration.
[0021] In one embodiment, a second method is also provided for the
measurement in a vertebrate animal of the level of the hepcidin
that is mature, bioactive, and folded as in the native
configuration. This second method comprises the steps of obtaining
a sample of tissue or bodily fluid from the animal; of causing the
sample to contact an antibody or a fragment thereof; and of
determining the hepcidin level in the sample. In this second
method, the antibody or the fragment thereof may specifically bind
to a continuous, discontinuous, or conformational epitope of the
hepcidin, and the hepcidin level may be determined quantitatively,
semi-qualitatively, or qualitatively.
[0022] In one embodiment, a third method is further provided for
measuring the level of hepcidin gene expression in a vertebrate
animal. This third method comprises the steps of obtaining a sample
of tissue or bodily fluid from the animal; of isolating the RNA of
the sample; and of performing a RT-PCR on said RNA to determine
hepcidin gene abundance. In this third method, the level of
hepcidin gene abundance correlates with the level of a mature,
folded, and bioactive form of a hepcidin peptide in the sample.
[0023] In one embodiment, a fourth method is provided for
regulating the production of native, bioactive hepcidin in a
vertebrate animal in vivo. This fourth method causes an enhancement
of the innate immunity of the vertebrate animal and also causes a
short term protection of the vertebrate animal from infection. This
fourth method comprises the step of causing an intake by the animal
of one or more compounds that stimulate hepcidin gene expression
and the subsequent production by the animal of the mature, folded,
and bioactive hepcidin peptide.
[0024] In one embodiment, the invention provides an antibody or
fragment thereof that specifically binds to a continuous,
discontinuous, and/or conformational epitope of hepcidin, which
hepcidin is in a form that is mature, bioactive, and folded as in
the native configuration.
[0025] The antibody or the fragment thereof may be affixed on a
support, and may include a tracer that is capable of binding to the
antibody or to the fragment thereof.
[0026] In one embodiment, the present invention provides a
pharmaceutical composition that includes the antibody or a hepcidin
polypeptide. In this pharmaceutical composition, the hepcidin
polypeptide provides properties that are antimicrobial, agonistic,
or antagonistic in relation to hepcidin bioactivity in vivo in a
vertebrate animal.
[0027] The details of one or more aspects of the invention are set
forth in the accompanying drawings and the description below. Other
features, objects, and advantages of the invention will be apparent
from the description and drawings, and from the claims.
[0028] All publications, patents, patent applications, GenBank
sequences and ATCC deposits, cited herein are hereby expressly
incorporated by reference for all purposes.
FIGURES
[0029] FIG. 1 shows a sequence listing illustrating the copy DNA
(cDNA) and predicted amino acid sequence of white bass hepcidin,
the location of introns, and the predicted peptide cleavage site,
according to one aspect of the present invention. FIG. 1 contains
the following sequences: SEQ ID NO:7, or atcagacagg agaagaagtc
aaaggagctg acaagagtca ccaaaagagt gaaagaattg aaaccttaaa gcagtcaaac
cctcctaaga tgaagacatt cagtgttgca gttgcagtgg ccgtcgtgct cgccttcatt
tgccttcagg agagctctgc tgtcccagtc actgaggtgc aagagctgga ggagccaatg
agcaatgagt atcaagagat gccagtggaa tcgtggaaga tgccgtataa caacagacac
aagcgtcaca gcagccccgg tggctgtcgc ttttgctgca attgctgtcc taatatgagc
ggatgtggtg tctgctgcag gttctgagga ttcctgctcc agcctgggat taacacaact
actacttaaa ctttttaact caatgttaca ttttcactgt actcctggtt gtaaatatct
gaggatgtta ctggagttca tggttgctca gtaatgtgat tgaatcatct aaacactgtg
tttaatttct gcagatttta ctgtgtattg tcataataaa gttcaatttc actgaaaaaa
aaaaaaaaaa aaaaaa (shown in FIG. 1 in uppercase characters), and
SEQ ID NO:8, or MKTFSVAVAV AVVLAFICLQ ESSAVPVTEV QELEEPMSNE
YQEMPVESWK MPYNNRHKRH SSPGGCRFCC NCCPNMSGCG VCCRF.
[0030] FIG. 2 is a diagrammatic illustration of gene organization,
genomic DNA, and mRNA regions coding related to a signal peptide, a
prodomain, and the mature peptide of white bass, in accordance with
another aspect of the present invention.
[0031] FIG. 3 is an illustration of the conserved hepcidin peptide
family showing the amino acid sequence similarity of known and
predicted hepcidins, more particularly, of Morone chrysops and Homo
sapiens hepcidin that have been isolated and characterized from
animal tissue samples, and of other sequences that are putative
mature hepcidin peptide translated from cDNA sequences. FIG. 3
contains the following sequences, shown here in tabular form:
TABLE-US-00001 SEQ 10 NO: 9 SPKOCQFCCG CCPOMSGCGI CCTY, or SEQ 10
NO: 10 SPAGCRFCCG CCPNMRGCGV CCRF, or SEQ 10 NO: 11 RRCRFCCGCC
POMIGSGTCC KF, or SEQ 10 NO: 12 SPKOCQFCCG CCPOMSGCGI CCRF, or SEQ
10 NO: 13 AIKCKFCCGC CIPGVCGLCC RF, or SEQ 10 NO: 14 WRCRFCCRCC
PRMRGCGLCC RF, or SEQ 10 NO: 15 RCKFCCRCCP NMIGGGTCCK F, or SEQ 10
NO: 16 QSHLSLCRFC CKCCRNKGCG YCCKF, or SEQ 10 NO: 17 QSHLSLCRYC
CKCCKNKGCG FCCRF, or SEQ 10 NO: 18 AIKCKFCCGC CTPGVCGVCC RF, or SEQ
10 NO: 19 GCRFCCNCCP NMSGCGVCCR F, or SEQ 10 NO: 20 GIKCRFCCGC
CTPGICGVCC RF, or SEQ 10 NO: 21 WRCRFCCRCC PRMRGCGLCC QRR, or SEQ
10 NO: 22 TNFPICLFCC KCCKNSSCGL CCIT, or SEQ 10 NO: 23 GMKCKFCCNC
CNLNGCGVCC RF, or SEQ 10 NO: 24 QSHISLCRWC CNCCKANKGC GFCCKF, or
SEQ 10 NO: 25 AIKCKFCCGC CTPGVCGVCC RF, or SEQ 10 NO: 26 QSHLHLCTLC
CNCCKGNKGC GFCCKF, or SEQ 10 NO: 27 OTHFPICIFC CGCCKTPKCG LCCKT, or
SEQ 10 NO: 28 OTHFPICIFC CGCCHRSKCG MCCKT, or SEQ 10 NO: 29
OTNFPICIFC CKCCNNSQCG ICCKT, or SEQ 10 NO: 30 OINFPICRFC CQCCNKPSCG
ICCEE, or SEQ 10 NO: 31 OTHFPICIFC CGCCHRSKCG MCCKT, or SEQ ID NO:
32 DTHFPICIFC CGCCHRSKCG MCCKT, or SEQ ID NO: 33 DTNFPICLFC
CKCCKNSSCG LCCIT, or SEQ ID NO: 34 DTHFPICIFC CGCCRKAICG MCCKT.,
or
[0032] FIG. 4 illustrates the HPLC profile of a crude refolding
mixture of bass hepcidin, wherein the major peaks screened by MIC
are numbered 1-8.
[0033] FIG. 5A shows a HPLC chromatogram of purified refolded bass
hepcidin, and FIG. 5B shows a MALDI-TOF mass spectrometric analysis
of bass hepcidin.
[0034] FIG. 6, Panel A illustrates a reverse phase-high performance
liquid chromatography (RP-HPLC) oxidation profile; FIG. 6, Panel B
illustrates a co-elution of a 1:1 mixture of synthetic bass
hepcidin with natural material; and FIG. 6, Panel C illustrates a
MALDI-TOF mass spectrum of the synthetic bass hepcidin.
[0035] FIG. 7A shows a summary of antibody titers for bass
hepcidin, and FIG. 7B illustrates an inhibition of an affinity
purified antibody using varying amounts of synthetic hepcidin.
[0036] FIG. 8A shows a competition curve of affinity purified
anti-hepcidin antibodies with diluted synthetic hepcidin; FIG. 8B
shows a standard curve generated using an ELISA with
biotinylated-hepcidin tracer; and FIG. 8C shows the effects of
serum on competitive an ELISA standard curve.
[0037] FIG. 9 depicts a sample standard curve for mature bass
hepcidin competition ELISA.
[0038] FIG. 10 depicts a Western blot of synthetic bass hepcidin
and of a partially purified, native bass hepcidin, 24 and 48 h
after infection with Streptococcus iniae.
[0039] FIG. 11 is a series of micrographs illustrating an
immunohistochemistry (IHC) analysis of hepcidin concentrations in
liver (A, B) and gill (C, D) in control (A, C) and infected tissues
(B, D), as well as IHC analysis of hepcidin concentrations in
intestine (E, F) and head kidney (G, H) in control (E, G) and
infected tissues (F, H).
[0040] FIG. 12 shows growth index as bacterial CFU
recovered/initial inoculum for three experiments employing
synthetic bass hepcidin and synthetic moronecidin or water control
on a culture of Yersinia enterocolitica, with each point
representing an average of three experiments.
[0041] FIG. 13 shows the percentage of absorbance for
antimicrobials bass hepcidin (.largecircle.) and moronecidin
(.cndot.) when added at different concentrations to spores of A.
niger, on an average of three experiments.
[0042] FIG. 14 illustrates the growth index for exponential phase
cultures of Y. enterocolitica or S. iniae with the indicated
concentrations of hepcidin, moronecidin or water as a control, and
with the experiment performed in triplicate for each sample.
[0043] FIG. 15 is a histogram showing quantity of bass hepcidin
messenger ribonucleic acid (mRNA) expressed in the liver of HSB
fingerlings after infection with S. iniae, A. salmonicida, and a
Piscirickettsia-like organism (PLO).
[0044] FIG. 16 depicts hepcidin expression levels over time in the
liver of HSB infected with S. iniae, A. salmonicida, and a PLO.
[0045] FIG. 17, Panel A shows a representative gel of reverse
transcriptase-polymerase chain reaction (RT-PCR) amplicons derived
from reactions from a mock-challenged fingerling (Lane 1) and five
individual fingerlings sampled post-challenge (Lanes 2-6
respectively) with either S. iniae (left image) or A. salmonicida
(right image), and FIG. 17, Panel B shows gel images of
quantitative, competitive RT-PCR amplicons derived using bass
hepcidin primers from a S. iniae infected bass (left image) and a
mock-challenged bass (right image).
[0046] FIG. 18 depicts a hepcidin copy number and spleen levels
over time for bass infected with a low dose and a high dose of
virulent S. iniae bacteria.
[0047] FIG. 19 shows the percent survival over 288 h of HSB induced
to produce hepcidin by IP injection of a live-attenuated S. iniae
mutant.
[0048] FIG. 20 illustrates graphically the effects of two chitosan
compounds on hepcidin in vivo levels in serum of HSB over time.
[0049] Like reference symbols in the various drawings indicate like
elements.
DETAILED DESCRIPTION
[0050] In one embodiment the invention provides methods for the
oxidative refolding of a hepcidin polypeptide to a form that is
mature, bioactive, and folded as in the native configuration; for
measuring the level of hepcidin in a vertebrate animal; for
measuring the level of gene expression in a vertebrate animal; and
for regulating the production of native, bioactive hepcidin in a
vertebrate animal in vivo.
[0051] In one embodiment the invention provides an antibody or
fragment thereof that specifically binds to an epitope of hepcidin,
and a pharmaceutical composition comprising the antibody or a
hepcidin polypeptide.
[0052] Small, compact peptides such as hepcidin are often difficult
to raise useful antibodies against because they are generally poor
immunogens. The failure of several groups of investigators to raise
a useful antibody to human hepcidin led us develop novel and
improved methods for development of antibodies to hepcidins. In the
prior art, the unique structure of the mature, folded, bioactive
hepcidin had severely limited the development and application of
sensitive, informative, immunoglobulin antibodies and tools to
detect refolded synthetic hepcidin and partial linear amino acid
sequences using methods adapted from the production of single chain
antibodies. These failures led us to believe that antibodies that
recognize discontinuous and conformational epitopes of the mature,
correctly folded, bioactive hepcidin molecule of interest should be
required for the sensitive measurement of bioactive forms of
hepcidin both in the study of diseases and of innate immunity.
[0053] The production, refolding, purification, and validation of
synthetic or recombinant hepcidin peptides, and the development of
antibodies specific to the native, folded, bioactive, forms of
vertebrate hepcidins, will be useful by enabling sensitive
diagnostics for monitoring and elucidating the role of hepcidin in
human and animal diseases. Following is a description of the
methodology employed to enable the present invention.
[0054] Synthesis of bass hepcidin peptide. Synthesis of one gram of
the bass hepcidin peptide SEQ ID NO: 19 (GCRFCCNCCPNMSGCGVCCRF) was
initiated on Fmoc-Phe-HMP resin. Side chain protected amino acid
derivatives included: Fmoc-Cys(Trt)-OH, Fmoc-Ser(tBu)-OH,
Fmoc-Asn(Trt) and Fmoc-Arg(Pmc)-OH. Standard Fmoc/tBu chemistry was
used to assemble the primary sequence proceeding from the
C-terminus to the N-terminus Activated HOST esters were used to
mediate the coupling steps. Following primary assembly, the peptide
was cleaved and simultaneously deprotected using trifluoroacetic
acid (TFA): triisopropylsilane:water:thioanisole (9 ml:0.5 ml:0.5
ml:0.5 ml) for 2 hr at RT. The spent resin beads were removed by
filtration and the TFA mixture containing the crude cleaved peptide
was precipitated into ice-cold diisopropyl ether. The precipitated
product was recovered by filtration and washed 3 times with
ice-cold ether and then subjected to amino acid analysis, C18
RP-HPLC, and mass spectroscopy to confirm successful synthesis
Amino acid analysis and mass spectroscopy results confirmed the
correct number and identity of amino acids were present in the
crude peptide and that the peptide had the correct mass. HPLC
analysis of the crude peptide showed several minor peaks and a
single major fraction that represented 33.4% of the total
sample.
[0055] Purification of linear bass hepcidin and initial refolding
experiments. We made several unsuccessful attempts to refold linear
bass hepcidin using each of three different approaches that had
been previously used to induce spontaneous refolding of the human
hepcidin peptide in an oxidative medium. The strong similarity
(60%) between bass hepcidin and human hepcidin suggested that these
refolding strategies would be successful with the bass peptide.
FIG. 3 is an illustration of the conserved hepcidin peptide family
showing the amino acid sequence similarity of known and predicted
hepcidins. In particular, Morone chrysops and Homo sapiens hepcidin
are the only two peptides that have been isolated and characterized
from animal tissue samples, while other sequences are putative
mature hepcidin peptide translated from cDNA sequences from search
of GENBANK.TM. EST entries Amino acids that match the Morone
chrysops hepcidin sequence exactly are shaded. In order to enhance
the probability of obtaining pure, refolded hepcidin peptide using
these simple air oxidation methods, we decided to first purify
linear bass hepcidin from the complex folding mixture using RP-HPLC
(Phenomex C18, 250.times.4.6 mm, 5 .mu.m, 120 .ANG., flow rate 1
ml/min, eluent A, acetonitrile (MeCN) w/0.05% trifluoroacetic acid
(TFA), eluent B, water with 0.05% TFA; gradient 0-20% A over 10
min, then 20-50% A over 60 min, UV detection at 215 nm). The
authentic linear hepcidin peptide eluted under these conditions at
30% MeCN (retention time 28 min). MALDI-TOF analysis of the
lyophilized fraction showed the correct molecular mass of 2263 (Mr
calc. 2263.8) for bass hepcidin peptide. Using this protocol we
were able to routinely purify linear bass hepcidin to very high
purity for refolding experiments. The refolding protocols cited in
the prior art involved simple, overnight air oxidation in phosphate
buffer (pH 7.5) and water (pH 7.5), respectively, such as dialysis
of human hepcidin in decreasing concentrations of guanidine
hydrochloride (6M-0M Gun HCl) in 100 mM phosphate buffer containing
20:1 cysteine:cystine (3 mM:0.15 mM). However, none of our attempts
using these published protocols yielded authentic bass hepcidin as
assessed by RP-HPLC and mass spectroscopy.
[0056] In the prior art, implementation of
dimethylsulfoxide-mediated oxidative refolding conditions was also
unsuccessful in producing a biologically active hepcidin. Refolding
in the presence of chaotropic agents and dimethylsulfoxide (DMSO)
did not result in any folded product with measurable biological
activity as assessed by MIC analysis of lyophilized fractions of
the major peaks observed. RP-HPLC analysis of the refolding
mixtures showed few if any products were produced and that those
produced were in extremely low concentrations relative to the
amount of input, purified, linear hepcidin. This suggested that the
cationic, cysteine rich peptide was most likely aggregating and
precipitating from the refolding mixture. This indicated to us that
other approaches that enhanced hepcidin solubility and decreased
its ability to aggregate would be required to properly fold this
molecule.
[0057] Development of an improved method for refolding hepcidins.
Inclusion of organic alcohols to mediate folding has been utilized
in the prior art in the presence of glutathione to increase the
yield of the correctly folded alpha-conotoxins. The effect of the
alcohol better solubilizes the hydrophobic residues by preventing
aggregation that often accompanies folding reactions. The process
of folding places side chains of amino acids which are normally
sequestered in an organic hydrophobic environment in direct contact
with the aqueous hydrophilic environment. The organic alcohols seem
to serve in co-solvent assisted manner to favor the most stable
configuration. We assessed the efficacy of organic alcohols to
enhance refolding of the crude, synthetic hepcidin peptide in
additional refolding experiments performed with chaotropic reagents
and DMSO.
[0058] The crude peptide was cleaved from the resin beads as
described above and following the washing steps immediately
dissolved in 8 M guanidinium HCl. The peptide solution was slowly
diluted to a total volume of 1.5 liters in the final folding buffer
(2 M guanidinium HCl, 10% DMSO, 10% isopropyl alcohol, pH 5.5) at a
peptide concentration of 0.2 mg/ml. The folding mixture was left
air exposed at RT and folding was complete in 18 hours. The folding
mixture was then diluted with water to 2.5 liters and loaded onto
RP-HPLC equipped with a Rainin DYNAMAX-ODS.TM. (5.times.30 cm)
column to concentrate the sample and remove any trace organic
solvents. Initial purification of bass hepcidin was performed using
a two-part step gradient (15% MeCN, 0.05% TFA followed by 40% MeCN,
0.05% TFA to elute product). A HPLC profile of the crude refolding
mixture eluted during the 40% MeCN step is shown in FIG. 4.
[0059] Fractions obtained from RP-HPLC analysis of peptide
refolding experiments were analyzed for antimicrobial activity.
Minimal inhibitory concentration (MIC) studies against a sensitive
reference strain of E. coli were used to screen fractions (FIG. 4)
derived from the refolding and HPLC purification studies. E. coli
was shown to be extremely sensitive to a predominant HPLC fraction
containing bass hepcidin (FIG. 4, peak 4; arrow; MIC of .gtoreq.2.7
.mu.M). Interestingly, two fractions (Fractions 3, 5) immediately
adjacent to this fraction also contained antimicrobial activity
(MIC of 22.17 .mu.M). Mass spectroscopy analysis of these fractions
showed a peak corresponding to the correct mass of bass hepcidin
containing four disulfide bonds (MW 2255), indicating that they
contained disulfide bond hepcidin variants (incorrectly folded
hepcidin containing four disulfide bonds). The biological
antimicrobial activity of these variants is a part of this
invention. One skilled in the arts will appreciate that refolding
variants of hepcidin can serve as agonist of antagonists of
hepcidins in biological activities in vivo.
[0060] Purification of bioactive hepcidin. The material eluted with
40% MeCN was lyophilized and re-dissolved in 1:1 MeCN/H2O and then
diluted prior to loading to 10% MeCN. Purification was performed on
a semi-preparative HPLC (Kromasil C18, 250.times.4.6 mm, 10 .mu.m
particle size, 120 .ANG. pore size, flow rate 8 ml/min, eluent A,
40% MeCN, 0.1% TFA, eluent B 0.1% TFA in water; gradient was from
15 to 40% MeCN into H2O containing 0.1% TFA in 100 minutes, UV
detection at 215 nm). Yield of the authentic bass hepcidin from
this refolding and purification protocol that began with 300
milligrams of the crude peptide was approximately 6 mg or 2% of the
original cleaved product. Thus, the refolding protocol outlined
above results in a reasonably robust oxidation mixture for a
peptide containing 4 disulfide bonds, with the major component
being the correctly refolded isomer (FIG. 4, peak 4--see arrow). In
addition, we have developed a relatively simple two step protocol
for HPLC purification of the correct hepcidin isomer from the
complex refolding mixture shown in FIG. 4 that is relatively rapid
and highly reproducible (FIG. 5A-B).
[0061] Synthesis, Refolding, and Purification of Bioactive Bass
Hepcidin. The Fmoc-amino acids derivatives were obtained from
Bachem AG (4416 Bubendorf, Switzerland) and included the following
side chain protected derivatives Arg(Pmc), Asn(Trt), and Cys(Trt).
Stepwise assembly was carried out on a Labortec SP6000.TM. peptide
synthesizer at the 5 mmol scale starting with Fmoc-Phe-Resin. Each
coupling was monitored for completeness using the ninhydrin
procedure. All couplings were mediated by dicyclohexylcarbodiimide
in the presence of 2 equivalents of 1-hydroxybenzotriazole.
Following final removal of the Fmoc-group from the peptide resin,
1.0 g of resin-bound peptide was cleaved from the solid support and
simultaneously deprotected using reagent K for 2 h at room
temperature. Following cleavage, the peptide was filtered to remove
the spent resin beads and precipitated with ice-cold diethyl ether.
The crude peptide was collected on a fine filter funnel and washed
with ice-cold diethyl ether, yielding 285 mg of crude linear
peptide. The crude peptide was subsequently dissolved with 50%
(v/v) AcOH in H2O. The crude, solubilized peptide was subsequently
diluted into 1.6 l of an aqueous buffer containing 2M guanidinium
HCl, 10% isopropyl alcohol, and 10% DMSO. The pH of the peptide
solution was adjusted to 5.8 with NH.sub.4OH and allowed to undergo
oxidative folding at room temperature for 18 h. Following oxidation
of the disulfide bonds, the peptide solution was acidified to pH
2.5 and pumped onto a Vydac C18 column (2.5.times.30 cm). The
sample was eluted at a flow rate of 8 ml min-1 with a stepwise
gradient from 10%, 20% and 40% acetonitrile into H2O containing
0.1% TFA to concentrate the sample. Each of the fractions was
analyzed by MALDI and RP-HPLC. The 40% fraction containing the
refolded hepcidin was lyophilized resulting in 135 mg of
approximately 40% pure peptide. This fraction was further purified
using the same semi-preparative RP-HPLC column and flow rate and a
gradient of 10-45% MeCN into 0.1% TFA in H2O over 120 min. The
resulting fractions were analyzed using two analytical RP-HPLC
systems: TFA and triethyl amine phosphate (TEAP). Pure fractions
were pooled and lyophilized. Upon lyophilization, 8.2 mg of bass
hepcidin was obtained, representing a yield of 2.9% (FIG. 6, Panel
A). Co-elution of a 1:1 mixture of the purified, native bass
hepcidin with purified, synthetic hepcidin revealed a single peak
(FIG. 6, Panel B).
[0062] Amino Acid and MALDI-TOF Mass Spectral Analysis. Synthetic
peptide samples were hydrolyzed in 6 N HCl at 110.degree. C. for 22
hr in vacuo Amino acid analysis was performed on a Beckman 126AA
System Gold amino acid analyzer. MALDI-TOF MS analysis was
performed on a Kratos MALDI-TOF mass spectrometer using CCA as a
matrix. Amino acid analysis of purified synthetic bass hepcidin
showed the following average amino acid ratios: Asx (2) 2.05, Ser
(1) 1.00, Pro (1) 0.97, Gly (3) 3.00, Met (1) 0.31, 0.99, Phe (2)
2.18, Val (1) 0.78, Arg (2) 1.82, and Cys (8) 5.46 (both Cys and
Met are partially destroyed during the acid hydrolysis method
used). MALDI-TOF mass spectral analysis of the purified synthetic
bass hepcidin determined a (M+H) of 2256.4 that was consistent with
the molecular mass of the native peptide (2255.97 MH+) (FIG. 6,
Panel C). In addition, the synthetic and native bass hepcidin gave
the same dose response killing-curve against E. coli. These
observations lead us to conclude that the two molecules are
identical. Interestingly, the MALDI-TOF mass profile showed the
presence of a non-covalent dimer as a sodium adduct. This species
is consistent with observations in other defensin-like peptides
that are known to self-associate and form aggregates. Further
optimization was achieved by increasing the organic alcohol
concentration to 15%, whereby the yield improved to 9%. Without
isopropanol, the yield was effectively 0%, as no correctly folded
material was detected when samples taken from the HPLC purification
were screened for activity. The use of the co-solvent alcohols with
the oxidative reaction of DMSO offer a dramatic improvement over
simple DMSO mediated methods at alkaline pH or with chaotropic
agents.
[0063] Polyclonal antibody production. One aspect of this invention
involves development of high-titer polyclonal antibodies to the
mature, folded, bioactive hepcidin. High-affinity polyclonal
antibodies raised against the mature, folded, bioactive hepcidin
will allow development of a sensitive and highly specific EIA
assays for the measurement of the concentration and localization of
bioactive hepcidin in fluids and tissues extracts.
[0064] Conjugation of linear bass hepcidin to keyhole limpet
hemocyanin (KLH). To examine the potential utility of antibodies
raised to the full length, mature linear hepcidin peptide SEQ ID
NO: 19 (GCRFCCNCCPNMSGCGVCCRF) for ELISA development, we used
maleimide activated keyhole limpet hemocyanin (mcKLH-Pierce,
Rockford, Ill.) for conjugation of purified, linear bass hepcidin
via cysteine residues present on both KLH and the peptide. Two mg
of HPLC purified linear bass hepcidin was dissolved in 300 .mu.l of
4M guanadine HCl, pH 6.8 and immediately mixed with two mg KLH in a
total volume of 500 .mu.l. The reaction mixture was left at RT for
two hours. No precipitation of the protein-peptide conjugates was
observed over the first hour, but precipitation was clearly
apparent after two hours. The conjugation mixture was centrifuged
to pellet the precipitate protein-peptide conjugate and the
supernatant removed. The soluble conjugate was subsequently
desalted by gel filtration and the protein concentration of the
recovered fractions determined Recovery of soluble conjugate
totaled .about.600 .mu.g. The soluble conjugate was then combined
with the precipitated conjugate (.about.3 mg), resuspended by
vigorous pipetting, and stored at -20.degree. C. until further
use.
[0065] Conjugation of refolded bass hepcidin to KLH. Two additional
conjugates were developed for polyclonal antibody production by
taking advantage of the only available (N-terminal) primary amine
group present in refolded bass hepcidin for conjugation to KLH
using EDC (1-Ethyl-3-[3-Dimethylamino-propyl]carbodiimide HCl) and
DSS (Disuccinimidyl suberate) chemistries. EDC promotes peptide
conjugation to carrier proteins via primary amines and carboxyl
groups, while the homobifunctional crosslinker, DSS, is primary
amine reactive and links peptides to carrier proteins primarily
through lysine residues.
[0066] EDC mediated conjugation of bass hepcidin to KLH. EDC
mediated conjugation of bass hepcidin to KLH was performed using
the IMJECT.RTM. Immunogen EDC Conjugation Kit essentially as
recommended by the manufacturer (Pierce, Rockford, Ill.). Two mg of
partially purified refolded bass hepcidin was dissolved in 600
.mu.l conjugation buffer containing DMSO (16.67%), which formed a
slightly yellow solution containing some insoluble material.
Undissolved material was removed by centrifugation and 500 .mu.l of
cleared supernatant was removed and added to 2 mg of KLH in 200
.mu.l of dH.sub.2O. EDC reagent was dissolved in water and
immediately added to the protein-peptide solution and the mixture
vortexed moderately. The reaction mixture was allowed to stand at
RT for two hours. A fine micro-precipitate was seen to form after
.sup..about.10 minutes and was present at two hours, however, very
little precipitate was recovered following centrifugation at
21,000.times.g. The conjugation mixture was desalted by gel
filtration and the protein concentration determined. A total of 3
mg of conjugate was present in the soluble fraction and we
estimated the insoluble to be <1 mg. Soluble and insoluble
conjugate were combined, resuspended, and stored at -20.degree.
C.
[0067] DSS mediated conjugation of bass hepcidin to KLH. Two mg of
partially purified bass hepcidin was dissolved in 50 .mu.l of DMSO
and 2 mg KLH was dissolved in 900 PI phosphate buffered saline
(PBS, pH 7.4) and vortexed. 40 .mu.g of DSS dissolved in DMSO was
added to the KLH solution and left at RT for 8 minutes to allow DSS
to react with KLH. At 8 minutes, 50 .mu.l of the bass hepcidin
solution was added to the DSS-KLH reaction mixture and vortexed.
The reaction mixture was incubated at RT for 30 minutes when 50
.mu.l of 1M TRIS-HCl, pH 8.8 was added to block unreacted DSS
molecules. A fine micro-precipitate was present following the
30-minute incubation period and was removed by centrifugation. A
large pellet of precipitate was observed. The soluble conjugation
mixture was desalted by gel filtration and the protein
concentration determined. A total of 2.1 mg of conjugate was
present in the soluble fraction and we estimated the insoluble to
be <2 mg. Soluble and insoluble conjugate were combined,
resuspended, and stored at -20.degree. C.
[0068] Bass hepcidin antibody production. All antibody production
was performed under AAALAC approved protocols. Two specific,
pathogen free New Zealand white rabbits were immunized with each of
the hepcidin-KLH conjugates following collection of 5 ml of
pre-immune serum. Each of the conjugates contained precipitated
material and required resuspension before the primary immunization
and each subsequent booster immunization. Conjugates were
resuspended by repeated passage through a 24-gauge needle. Primary
immunization was conducted with .sup..about.200 fig of the
conjugate that was homogenized in a highly refined Freund's
Complete Adjuvant. Booster immunizations were performed with 100
.mu.g of the conjugate in highly refined Freund's Incomplete
Adjuvant. Both the primary and the booster immunizations were
administered in a single subcutaneous site. Serum collected from
bleeds was collected and monitored for antibody response to the
mature, folded, bioactive hepcidin.
[0069] Determination of anti-bass hepcidin titers. Anti-bass
hepcidin antibody titers were determined by coating maleic
anhydride activated 96 well microtiter plates with a constant
amount (125 ng) of refolded bass hepcidin. After incubation
overnight at 28.degree. C., the plates were blocked using Pierce
SUPERBLOCK.TM. in tribuffered saline (TBS, 3.times. for 5 minutes
at 28.degree. C.). Dilutions of the pre-immune, test bleed, and
production bleed sera (1:500 or 1:4000) were placed in duplicate
wells, serial 2-fold dilutions were performed to 1:32,000 or
1:256,000, respectively, and the plates incubated for 2 h at
28.degree. C. After 3 washes with PBS containing 0.05% TWEEN-20.TM.
(PBS-T20), rabbit anti-bass hepcidin-specific immunoglobulin was
detected using a 1:10,000 dilution of horseradish peroxidase
(HRP)-conjugated-goat anti-rabbit IgG antibody (Pierce, Rockford,
Ill.). Following a 30 min incubation at 28.degree. C., the plates
were washed again (PBS-T20), 1-STEP TURBO TMB.TM. substrate was
added to all wells, and the reaction was allowed to develop for 15
min. Development was halted by the addition of a stop reagent and
the optical density (OD) was measured at 450 nm with a Molecular
Devices VMAX KINETIC.TM. microtiter plate reader.
[0070] Anti-linear bass hepcidin titers. The rabbit anti-linear
hepcidin-KLH-conjugate serum failed to recognize the mature,
refolded, bioactive, hepcidin peptide. Thus, adequate titers of
this antibody were not detected. The pre-immune sera from these
rabbits appeared to cross-react with the refolded bass hepcidin
resulting in high non-specific background roughly equivalent to the
entire response seen in the test and production bleeds.
[0071] Anti-mature, folded, bioactive bass hepcidin antibody
titers. Screening of the test bleed sera at five weeks
post-immunization demonstrated that both rabbits developed
acceptable titers to the EDC hepcidin-KLH conjugate. However, only
one of the two rabbits developed an acceptable titer when immunized
with the DSS hepcidin-KLH conjugate. The titer was expressed as the
dilution at which the OD of the immunized serum exceeded that of
the pre-immune serum (i.e. background) by at least 0.1 units. The
titer was calculated by setting x=0.1 in the linear regression
equation that was derived from plots of the inverse of the dilution
versus the corrected OD, i.e. the observed OD minus OD of
pre-immune serum. Anti-refolded bass hepcidin titers were estimated
to be 12,500 and 26,500 at 5 weeks post immunization with the two
KLH-conjugates prepared using EDC chemistry (KST 3, KST 4),
respectively. The titer the conjugate prepared using DSS chemistry
was estimated to be 8,000. Anti-mature, folded, bioactive hepcidin
antibody titers increased significantly by 7 weeks
post-immunization in production bleed #1 in all four sera tested
and were estimated to be 70,000 for KST 3, 163,000 for KST 4, and
35,000 for KST 5.
[0072] Protein A Affinity purification of bass hepcidin antibodies.
To further examine the specificity of these antibodies for
hepcidin, we performed Protein A affinity purification according to
manufacturer's instructions (Pierce). Aliquots of each of the two
sera (KST 3, KST 4) were diluted in IMMUNOPURE.TM. binding buffer
1:2 and applied Protein A affinity column (3 ml) mounted on a low
pressure chromatography system and washed extensively with binding
buffer. Antibodies were eluted using IMMUNOPURE.TM. Elution Buffer,
neutralized by addition of 1M Tris-HCl, pH 7.5, and dialyzed
against PBS. Protein concentrations were determined using the BCA
protein assay.
[0073] Affinity purification of anti-mature, folded, bioactive
hepcidin antibodies. Approximately 2 mgs of the mature, folded
hepcidin peptide was coupled to 2 ml (wet volume) of cyanogen
activated Sepharose 4B using essentially the manufacturer's
instructions. Polyclonal anti-hepcidin rabbit sera was diluted in
PBS and passed over the column at a flow rate of 1 ml/min, and
subsequently washed thoroughly with 10 column volumes of PBS. Bound
antibodies were eluted with glycine buffer, pH 2.5 and immediately
neutralized by addition of 1 M Tris, pH 8. Antibodies were then
dialyzed against PBS, concentrated, and stored at 4.degree. C.
until further use. ELISA comparisons between affinity purified
antibodies and Protein A affinity purified antibodies clearly
demonstrated enhanced signal and reduced background. Competition
experiments with synthetic hepcidin demonstrate that >90% of the
signal from the hepcidin affinity-purified antibodies can be
competed away. This is in contrast to Protein A affinity purified
antibodies and serum, where approximately 80% and 65%,
respectively, of the signal was competed. Higher signal to noise
ratios were also observed in Western blots and immunohistochemical
analysis of hepcidin expression in HSB tissues described below.
[0074] Western Blot analysis of purified HSB extracts using
affinity purified anti-hepcidin antibodies. Adult hybrid striped
bass were challenged with an intraperitoneal injection of live S.
iniae (K288, 100 .mu.l of a logarithmic phase culture at 2.10.sup.7
cfu/ml). Gill and liver tissue were harvested at 24 and 48 h after
bacterial challenge and immediately frozen by immersion in liquid
nitrogen. Frozen samples were ground into powder with a mortar and
pestle under liquid nitrogen. Proteins were extracted in 10% acetic
acid by shaking on ice-cold water bath for 2-3 h. After
centrifugation, (2800.times.g for 20 min), the supernatants were
filtered (0.45 .mu.m, MILLEX.TM.; Millipore Corp.), and loaded onto
SEP-PAK.TM. C18 cartridge (Waters Associates) equilibrated with 10%
acetic acid to concentrate extracted cationic peptides. The
cartridges were washed with acidified water (0.05% trifluoroacetic
acid), and elution was performed with 30% acetonitrile, 0.05%
trifluoroacetic acid. Eluted material was lyophilized, the protein
powder weighed, and re-suspended at 10 mg/ml (w/v). 6.5 .mu.l of
the 10 mg/ml extracts were prepared as instructed with NuPAGE
loading solution, loaded on NUPAGE.TM. Novex Bis-Tris Gel and run
at 200 V for 30 min. Proteins were transferred onto a PVDF membrane
(45 min at 30V). The membrane was blocked with BSA 3.3% in TBS,
0.1% TWEEN-20.TM. for 1 h. Affinity purified rabbit anti-mature,
folded, bioactive hepcidin antibody (KST4) (0.7 mg/ml) was used at
1/10,000 dilution in Tris Buffer Saline (TBS), 0.2% TWEEN-20.TM.,
BSA 2%. After an overnight incubation at 4.degree. C. the membrane
was washed with TBS TWEEN-20.TM. 0.2% twice rapidly, and for 30 min
by changing the washing solution every 5 min. The secondary
antibody (HRP-conjugated AFFINIPURE.TM. Goat Anti-Rabbit IgG,
Jackson Immuno Research) was used at 1/10,000 dilution in 1% BSA
TBS, 0.2% TWEEN-20.TM.. After 1 h incubation at room temperature
the membrane was washed using the same conditions as described
earlier and the blot was revealed by photoluminescence and film
following manufacturer's instructions (ECL kit, Amersham; FIG. 10).
The results of this Western Blot analysis of the native forms of
bass hepcidin using the anti-bass hepcidin affinity purified KST 4
antibodies demonstrate several critical aspects of the claimed
methods and inventions involving refolding hepcidin polypeptides
and antibody development to the mature, folded, bioactive hepcidin
described in this application. These antibodies clearly recognize a
native form of the HSB hepcidin in Western Blots, that is of the
same molecular weight as the synthetic, mature, folded, bioactive
hepcidin (2.54 kD). These affinity-purified antibodies were capable
of detecting the pro-hepcidin, and pre-prohepcidin forms in these
experiments, presumably due the same reasoning (see FIG. 10, lanes
4-6). It is also known in the art, that antibodies raised to
fragments of the mature human hepcidin linear polypeptide, fail to
yield signal when tested against the mature, folded, bioactive form
found in serum, by ELISA. This is exactly the observation we made
following analysis of our titer experiments described above.
Hepcidin is strongly expressed in liver of HSB following infection
with the Gram-positive S. iniae, with prohepcidin being the
predominant form detected, although significant amounts of the
mature hepcidin peptide are present as well. In contrast, the
mature form is observed in high concentration in gill.
Pre-prohepcidin and prohepcidin are observed in HSB gill tissue
following infection, confirming our previous hepcidin purification
results and kinetic RT-PCR, gene expression studies in gill
following infections with S. iniae. (see FIG. 10, lanes 4 and 6).
These results support the utility and several other embodiments of
the inventions described herein.
[0075] Development of bass hepcidin enzyme/ligand conjugates for
ELISA. We took advantage of the only available (N-terminal) primary
amine group present in refolded bass hepcidin for conjugation to
KLH using EDC (1-Ethyl-3-[3-Dimethylamino-propyl]carbodiimide HCl)
and DSS (Disuccinimidyl suberate) chemistries. These approaches
were very difficult to develop and apply to production of hepcidin
conjugates due to hepcidin's inherent solubility issues in higher
pH coupling buffers. Our studies have demonstrated that bioactive
hepcidin is very sensitive to salt in solution and readily
aggregates at relatively low concentrations (50 ng ml-1) in
phosphate buffered saline (PBS; pH 7.4) but can be dissolved with
vigorous vortexing at RT. We have encountered significant issues
when trying to solubilize hepcidin at the higher concentrations
(1-3 mg ml-1) in standard coupling buffers desirable for production
of high activity, soluble hepcidin-HRP conjugates for ELISA.
[0076] Synthesis and purification of derivatized hepcidin to
produce validated hepcidin-biotin conjugates for enzyme linked
immunosorbent assays (ELISA). We successfully synthesized and
refolded bass hepcidin containing two [2-(2-Amino-Ethoxy) Ethoxy]
Acetic Acid (AEEAc) residues at the amino terminus in an effort to
(i) enhance the solubility of the peptide, and (ii) add two spacer
amino acid analogs to reduce any steric or electrostatic hinderance
that may occur between enzymes/ligands and the cationic hepcidin
peptide. AEEAc is a hydrophilic spacer molecule that can be readily
coupled to other proteins. Oxygen species in AEEAc residues greatly
enhanced the solubility of hepcidin and allowed us to readily
couple biotin to hepcidin to produce a conjugate for ELISA. We used
EDC chemistry for production of this conjugate as we have described
previously. This conjugate proved to have very low non-specific
binding in our ELISA, allowing development of a sensitive,
competitive ELISA for hepcidin.
[0077] Competition ELISA Protocol. A high-binding 96-well
microplate (Corning, Inc., Cat. No. 3590) was coated with 100 .mu.l
of a 1:5,000 dilution of affinity-purified rabbit anti-HSB hepcidin
antibody (0.68 mg/ml) in carbonate-bicarbonate coating buffer pH
9.6 (Sigma-Aldrich Corp., Cat. No. C-3041). One well contained 100
.mu.l carbonate-bicarbonate coating buffer and no antibody. The
plate was covered and placed at 4.degree. C. Following a suitable
period of incubation at 4.degree. C., the plate was washed with
three, 300 .mu.l volumes of PBS-T (PBS containing 0.05%
TWEEN-20.TM.). Next, the plate was blocked with 250 .mu.l of a 2%
(w/v) dry milk solution in PBS, covered, and incubated for one hour
at RT, shaking at 150 rpm. Samples and standard curves were
prepared in a separate 96-well plate. Serum, plasma, and urine
samples were diluted with PBS diluted to be within the working
range of the standard curve. An aliquot of biotinylated
AEEAc-derivatized hepcidin (0.21 mg/ml diluted 1:2000) was added to
each well to give a final biotinylated hepcidin concentration of
94.5 ng/ml. From each well of the sample/standard curve dilution
plate, 100 .mu.l was transferred to the antibody coated and blocked
plate. The plate was covered and incubated at RT, shaking at 150
rpm, for 1 hour to allow competitive binding to occur. After
incubation, the plate was washed three times with 300 .mu.l PBS-T.
Next, 100 .mu.l of a 1:5000 dilution of streptavidin-HRP (Jackson
ImmunoResearch Laboratories, Inc.) in PBS was added to each well.
The plate was covered and incubated at RT, shaking at 150 rpm, for
30 minutes. Following incubation the plate was washed four times
with 300 .mu.l PBS-T. A 100 .mu.l volume of tetramethylbenzidine
(TMB) substrate (Moss, Inc.) was added to each well. The plate was
allowed to develop for 15 minutes then was stopped with 100 .mu.l
of 0.5N H2SO4. Absorbance at 450 nm was determined using a
THERMOMAX.TM. microplate reader with SOFTMAX PRO.TM. software
(Molecular Devices). Data were analyzed using a spreadsheet
program. A standard curve was fit using a logarithmic, exponential,
or power regression. Sample dilutions producing OD values lying
within the most informative range of the curve were used to compute
hepcidin concentrations. Two standard curves were run in the first
two columns of the dilution plate by serially diluting 100 and 10
.mu.g/ml stock native hepcidin solutions down the plate. Two wells
received PBS with no hepcidin competitor. Next, biotinylated
AEEAc-derivatized hepcidin (0.21 mg/ml diluted 1:2,000 in PBS) was
added to each standard curve well including a background well and a
no competition well to yield a biotinylated hepcidin concentration
of 94.5 ng/ml in each well. Standard curve had final hepcidin
concentrations of 10,000, 5,000, 2,500, 1,250, 625, 312.5, 156.3
and 1,000, 500, 250, 125, 62.5, 31.3, 15.6 ng/ml (see FIG. 9 for a
representative standard curve).
[0078] Immunohistochemical Tissue Collection and Processing.
Tissues were quickly removed from moribund animals and were placed
in roughly 10-20 equivalent volumes of Bouin's fixative overnight
(approx 15-18 hours) at room temperature. The following day tissues
were rough trimmed into cassettes, held in 70% ethanol and
submitted for routine histological processing. Tissues were
embedded in paraffin, and 5 .mu.M sections were cut and adhered to
glass microscope slides were prepared by routine procedures. The
slides were held at room temperature in a slide box until required
for immunohistochemical staining. Prior to IHC, all sections are
deparaffinized in 3 xylene washes, followed by two absolute ethanol
and one 95% ethanol wash, and held submerged in deionized water
until ready for probing with the primary antibody. Sections were
then transferred to 0.01M phosphate buffered saline (PBS,
containing 0.138M NaCl, 0.0027M KCl) for 10 min and held until IHC
staining was performed.
[0079] IHC Methodology. Detection of the primary anti-mature,
folded, bioactive hepcidin antibody probe overlayed on tissue
sections was performed using a commercially available rabbit
antibody detection kit (HISTOSTAIN PLUS.TM., Zymed Laboratories
Inc., San Francisco, Calif.). Prior to applying the primary
antibody (previously affinity purified against mature refolded,
bioactive bass hepcidin) the endogenous tissue peroxidase activity
was quenched by submerging slides in a solution containing 1 part
hydrogen peroxide (30% activity) and 9 parts absolute methanol for
30 min. Following this the slides were washed 3 times in PBS, the
sections were blocked for 30 min and each slide was probed with
rabbit anti-bass hepcidin antibody (1:1000 dilution in PBS) and
incubated at room temperature (22-24.degree. C.) overnight in a
humid chamber. The following day the slides were washed 3 times in
PBS then flooded with biotinylated goat anti-rabbit antibody,
incubated for 30 min and washed as described. The HRP:streptavidin
enzyme conjugate was applied for 15 min, removed with three PBS
washes, the chromogen (AEC) incubated for an additional 10 min and
all slides were then rinsed twice with distilled water. Tissues
were counterstained with hematoxylin for 10 min, washed twice with
distilled water (2 min each) and briefly immersed in PBS for 1 min.
Several drops of GVA mounting medium were applied to each section
and a cover-slip was placed over the stained tissues. The mounting
medium was allowed to dry overnight on the bench top at room
temperature. Tissues that contained hepcidin contained a
characteristic red-brown precipitate throughout, compared to
control tissues that gave a very weak but similarly colored
background signal.
[0080] Microbial Isolates. Aeromonas hydrophila, A. salmonicida,
Edwardsiella tarda, Plesiomonas shigelloides, and S. iniae were
laboratory isolates recovered from moribund hybrid striped bass
(HSB, Kent SeaTech Corp.). Biochemical analysis and ribosomal DNA
(16S) sequencing were used to confirm their identification.
Logarithmic phase cultures were used in all experiments. Most
bacteria and yeast were grown in Luria-Bertani Broth (LB, Difco),
although streptococcal isolates were grown in Todd Hewitt Broth
(THB, Difco). Filamentous fungi were grown in half-strength potato
dextrose broth (Proteine Data Bank, hereinafter PDB, Difco)
supplemented with tetracycline (10 .mu.g/ml).
[0081] Antimicrobial Assays. Minimal inhibitory concentration (MIC)
for liquid growth inhibition assay and minimal bactericidal
concentration (MBC) were determined as described previously.
Briefly, bacteria, yeast, and filamentous fungi were incubated in
the appropriate growth media in the presence of 2-fold serial
dilutions of synthetic bass hepcidin (44-5.5 .mu.M final
concentrations). Bacterial growth was measured (OD600) after 18 h
incubation at 37.degree. C. MIC was expressed as the lowest
concentration of peptide tested that inhibited microbial growth
completely. For determination of MBC, bacteria were incubated in
96-well plates in the presence of varying concentrations of
hepcidin for 18 h at 37.degree. C., then aliquots of the cultures
were plated on Todd Hewitt agar and bacterial growth was assessed
after overnight incubation at 37.degree. C. To examine the rate of
bacterial killing of bass hepcidin, kinetic studies were performed
using the Gram-negative pathogen, Yersinia enterocolitica. Briefly,
synthetic bass hepcidin (22 and 44 .mu.M), or moronecidin (10
.mu.M) was added to a log phase culture of Y. enterocolitica
(2.times.105 CFU ml-1) and incubated at 37.degree. C. Bacterial
viability was assessed at times 0, 0.5, 1, 2 and 3 h by plating
serial dilutions of the bacterial suspension on Todd Hewitt agar.
CFU counts were performed after overnight incubation at 37.degree.
C. The growth index was calculated as bacterial CFU recovered/CFU
at time zero.
[0082] Antimicrobial Synergism Studies. Synergism between synthetic
bass hepcidin and moronecidin was tested in checkerboard liquid
growth inhibition assays. In brief, two-fold serial dilutions of
each peptide were made in water, and 10 .mu.l of the solution added
to the bottom of the wells of a 96-well plate. Ninety .mu.l of
exponential phase bacterial cultures (OD600.sup..about.0.2) were
freshly diluted in culture media to .sup..about.2.times.105 CFU
ml-1 and added to peptide solutions. Controls consisted of wells
with the appropriate volume and concentration of each peptide
alone, or of water. Bacterial viability was assayed at 2 h by
plating aliquots of the bacterial suspension for CFU enumeration.
The bacterial suspensions were further incubated overnight at
37.degree. C. and bacterial growth was monitored by optical density
at 600 nm for determination of MIC. Synergistic activity was
quantify as fractional inhibition concentration (FIC)
index=([A]/MICA)+([B]/MICB), where MICA and MICB are the MICs of
the peptides alone and [A] and [B] are the MICs of A and B when
used together.
[0083] Germination and Fungicidal Assay. Spores of A. niger were
harvested and resuspended in sterile water containing 0.05%
TWEEN-80.TM., and the concentration adjusted to approximately
10.sup.8 spores per ml. Spores were diluted in half-strength PDB
containing 16 .mu.M chloramphenicol to a final concentration of
10.sup.5 spores per ml. Ninety .mu.l of the suspension was placed
in sterile flat-bottomed polystyrene 96-well plates with 10 .mu.l
of serial dilutions of peptide (440 .mu.M, 220 .mu.M, 110 .mu.M, 55
.mu.M), in water. Germination of spores was allowed to proceed for
2 days at 30.degree. C. in the dark, after which hyphae density was
measured by absorbance at 600 nm. After 2 days of incubation, the
contents of wells showing no germination were centrifuged for 3 min
at 5000 rpm, resuspended in 50 .mu.l of fresh PDB media, and
triplicate aliquots spotted onto PDB agar plates. Plates were
placed at 30.degree. C. for 3 days to monitor germination of
hyphae. The absence of germination indicated fungicidal
activity.
[0084] Hemolytic activity. Freshly packed striped bass erythrocytes
(3 ml) isolated from young fingerlings (.sup..about.30 g) and adult
fish (.sup..about.300 g) were washed with phosphate-buffered saline
(PBS; pH 7.4) until the supernatant was colorless and resuspended
in PBS (30 ml) supplemented with glucose (0.2%, w/v). Synthetic
bass hepcidin (10 .mu.l of 880-55 .mu.M) was added to 90 .mu.l of a
1% suspension of washed erythrocytes in microcentrifuge tubes.
Triplicate samples were incubated for 30, 90, 180, and 240 min at
37.degree. C. then centrifuged for 10 min at 3500 rpm. Supernatant
from the erythrocyte suspension (70 .mu.l) was placed in a
microtiter plate and optical density at 405 nm determined. The
percentage of hemolysis in hepcidin-treated erythrocytes was
expressed relative to hemolysis obtained with a control erythrocyte
suspension treated with 0.1% sodium dodecyl sulphate (SDS, 100%
hemolysis).
[0085] Development of a competitive reverse
transcriptase/polymerase chain reaction (cRT-PCR) tool for
measurement of hepcidin gene expression in vertebrate animals. To
characterize bass hepcidin expression levels in response to
infections against the Gram-positive (S. iniae) and Gram-negative
pathogens (A. salmonicida and a Piscirickettsia-like Organism; PLO)
affecting vertebrate animals, we developed and optimized a cRT-PCR.
Briefly, this assay is based on competition during an RT-PCR
reaction between the native mRNA target (i.e. bass hepcidin mRNA)
and a synthetic competitor mRNA (cRNA) that is constructed to serve
as an internal standard used to quantify native mRNA levels. The
synthetic cRNA is designed to have nucleotide sequence and primer
binding sites which are identical to the target native mRNA, but
also contains a deletion (or insertion) to allow discrimination
between the native mRNA and the cRNA following gel electrophoresis.
To perform this assay, a series of RT-PCR reactions are run using
decreasing amounts of the competitor RNA in the presence of a known
constant amount of total RNA (or mRNA) from an experimental tissue
sample. Signal strength of resulting PCR products from both the
target RNA and competitor RNA are compared using digital
densitometry analyses of the PCR amplicons and regression analysis.
Since the amount of cRNA in each reaction is known, the amount of
target native mRNA can be estimated at the point of signal
equivalence (i.e. Target:Competitor ratio=1:1).
[0086] Method for development of an expression vector for
production of a bass hepcidin mRNA competitor. RT-PCR analysis of
gene expression is based on reverse transcription of the target
mRNA templates to produce cDNA copies which then serve as templates
for amplification of the target region by standard PCR methods.
[0087] FIG. 1 is a sequence listing illustrating the copy DNA
(cDNA) and predicted amino acid sequence of white bass hepcidin.
Primer binding sites are shown with arrows (5' to 3'). The
organization of the peptide domains (signal peptide, prodomain, and
mature peptide) is shown by amino acid sequence enclosed by a. The
stop codon is indicated with an asterisk. Location of introns, and
the predicted peptide cleavage site are also shown, in accordance
with the present invention.
[0088] Since PCR artifacts resulting from target genomic DNA (gDNA)
contamination in the purified RNA can impair the accuracy of an
RT-PCR assay, we designed PCR primers on each side of a intron
splice site in the gene of interest. Primers designed in this
manner would amplify two amplicons in a simple RT-PCR assay (three
in cRT-PCR) where contaminating gDNA was present, with the larger
amplicon derived from the gDNA template. The size of the larger
amplicon would correspond to the expected amplicon size plus the
number of base pairs present in the intron. To construct an
expression vector for production of a bass hepcidin cRNA, we
synthesized two single stranded DNA oligonucleotides of 64 and 74
nucleotides. One oligonucleotide had a sequence identical to a
portion of the plus strand in exon 2 and exon 3 and spanned the
intron 2 splice site of bass hepcidin. The second oligonucleotide
had a sequence identical to a portion of the minus strand in exon 2
and 3 and spanned the Intron 2 splice site as well. The oligos were
also designed to include a 50 base pair (bp) deletion of coding
sequence and 30 bp of overlapping complementary sequence near each
of their 3' ends. Following synthesis, equimolar concentrations of
the two oligonucleotides were hybridized to each other in a
standard annealing reaction and made double-stranded by primer
extension using standard techniques. The resulting 108 bp
double-stranded product contained RT-PCR primer binding sites used
to amplify the target region (intron 2 splice site) of the bass
hepcidin mRNA. The internal 50 bp deletion in the cRNA expression
vector construct was engineered to allow simple electrophoretic
differentiation between amplicons derived from native mRNA and
cRNA. In FIG. 2, there is shown a diagrammatic illustration of gene
organization, the size and arrangement of the introns and exons of
the white bass hepcidin genomic DNA, as well as the corresponding
mRNA regions coding for a signal peptide, a prodomain, and the
mature peptide regions.
[0089] Method for development of cRT-PCR tools for vertebrate
animals. Hepcidin gene expression in infected and mock-challenged
HSB fingerlings was quantified using a competitive RT-PCR assay. A
homologous RNA competitor (designated as `cHEP`) was constructed
using a segment of the bass hepcidin prodomain containing a 50 bp
deletion spanning two RT-PCR primer binding sites: 1403F2 (SEQ ID
NO:1) (5'-GAGATGCCAGTGGAATCGTGGAAG-3') and 86R2 (SEQ ID NO:2)
(5'-GAGGCTGGAGCAGGAATCCTCAG-3'). The amplicon resulting from RT-PCR
of the competitor hepcidin mRNA ('cHEP': 99 bp) was designed to be
easily discernable from the native bass hepcidin mRNA ('bHEP': 153
bp) using agarose gel electrophoresis. To generate the competitor,
equimolar concentrations of two oligonucleotide primers cHEP1 (SEQ
ID NO:3) 5'
GGATCCGAGATGCCAGTGGAATCGTGGAAGTTGCTGCATTGCTGTCCTAATATGAG C
GGATGTGGTGTCTGCTGC3') and cHEP2 (SEQ ID NO:4) 5'
GGATCCGAGGCTGGAGCAGGAATCCTCAGAACCTGCAGCAGACACCACATCCGCTC A
TATTAGG3') were annealed using standard conditions, yielding a 109
bp product with 30 bp of complementary overlap, and the product was
amplified with the primer pair 1403F2 and 86R2. Purified PCR
product was cloned into pCC 1, which contained an upstream T7 RNA
polymerase promoter, following the manufacturer's instructions
(COPYCONTROL.TM. pCC 1 PCR Cloning Kit; Epicentre). Approximately
100 ng of plasmid vector, containing the modified hepcidin
prodomain segment, was linearized with Hind III (Invitrogen)
downstream of the insertion site and in vitro transcription was
performed using a T7 RNA polymerase (DURASCRIBE T7 TRANSCRIPTION
KIT.TM.; Epicentre). Competitor RNA was purified, treated with
DNAase, and resuspended in RNase-free water following
manufacturer's instructions (RNEASY PURIFICATION KIT.TM.; Qiagen).
Ribonucleic acid (RNA) concentrations were measured and aliquots of
10-fold serial dilutions were made (10-0.0001 ng/.mu.l) and stored
at -80.degree. C.
[0090] Clinical studies using cRT-PCR, tissue collection, and RNA
extraction. Thirty HSB fingerlings (43.35 g.+-.17.51 g) were
injected intraperitoneally (IP) with S. iniae (3.5.times.105 CFU)
or A. salmonicida (2.0.times.105 CFU). Fish injected with sterile
PBS served as controls. Following challenge, the three groups of
fish were maintained in separate 60 L flow-through tanks receiving
aerated water at 25.degree. C.+-.0.1.degree. C. For mRNA expression
analysis, two individual fingerlings from each challenged group (S.
iniae and A. salmonicida) were selected randomly at five time
points post-challenge (4, 8, 16, 24, and 48 h) and anesthetized
with MS-222 (Finquel; Argent). Liver tissue (.about.300 mg) was
dissected aseptically and preserved in RNALATER.TM. (Ambion). Liver
samples were also collected from the control group (i.e. PBS)
pre-challenge (0 hr), and at two time points (8 and 24 h)
post-challenge. The remaining fingerlings in each group were
monitored daily for morbidity and mortality; tissues (brain, head
kidney) from moribund animals were cultured on TSA plates
containing 5% sheep blood to confirm the presence of S. iniae or A.
salmonicida. Preserved liver tissues (50 mg) were homogenized in
TRI-REAGENT.TM. (Molecular Research Center) and total RNA was
extracted according to the manufacturer's protocol. An additional
DNase treatment was performed to further remove any genomic DNA
contamination. RNA concentrations were determined
spectrophotometrically (A.sub.260), and 50 ng .mu.l.sup.-1 working
aliquots were diluted in RNase-free H.sub.2O and stored at
-80.degree. C.
[0091] Method for quantification of hepcidin gene expression using
competitive RT-PCR. To assess levels of native bass hepcidin mRNA
using competitive RT-PCR (cRT-PCR), total RNA from each liver
sample (infected or mock-challenged HSB) was assayed in a series of
six single-tube RT-PCR reactions run in parallel. Each single-tube
RT-PCR reaction contained: (a) 100 ng of total RNA extracted from
the liver, and (b) one of six increasing amounts of hepcidin
competitor (0.0001 ng to 10 ng). A second, non-competitive RT-PCR
reaction was performed to confirm the quality of the RNA samples
using PCR primers that amplify a region of 18S rRNA of HSB (SB18S,
5'-GTTCGATTCCGGAGAGGGAG-3' (SEQ ID NO:5), SB18Srev,
5'-CCTTCCTTGGATGTGGTAGCC-3') (SEQ ID NO:6). In all cases, RNA was
reverse transcribed and amplified in a single reaction with the
primers 1403F2/86R2 or SB18S/SB18rev using the cycling profile: (1)
reverse transcription for 20 min at 60.degree. C.; (2) denaturation
for 30 s at 94.degree. C.; (3) annealing for 30 s at 58.degree. C.;
(4) extension for 30 s at 72.degree. C.; (5) Steps 2-4 were
repeated for a total of 20 cycles (6) final extension for 2 min at
72.degree. C. Amplified products were electrophoresed on 2.0%
agarose gel stained with ethidium bromide (0.05 .mu.g ml.sup.-1).
For competitive RT-PCR assays, gel images were digitized using an
EDAS 120 electrophoresis documentation system and mean fluorescent
intensities of the PCR products (cHEP and bHEP) were scanned by
densitometry using NIH IMAGE 1.63.TM.. Regression curves were
generated from each series of six single-tube RT-PCR reactions by
plotting, on double logarithmic scale, the value of the known
competitor quantity (0.0001 to 10 ng) against the fluorescent
signal ratio of the resulting RT-PCR amplicons (cHEP:bHEP). The
quantity of native hepcidin mRNA for each sample was determined
based on the point of signal equivalence (competitor:target=1).
[0092] Semi-quantitative or qualitative cRT-PCR. One aspect of this
invention, in addition to cRT-PCR and ELISA, is a simple, rapid,
single tube assay for the routine monitoring of hepcidin levels in
vertebrate animals, especially fish, and other mass-produced
vertebrate animals where it would be difficult to collect bodily
fluids for ELISA analysis. Our invention clearly demonstrates the
response of both hepcidin gene expression and the production of the
mature, folded, bioactive hepcidin in our clinical trials using our
fish infection model. The effect of infections on hepcidin gene
expression is rapid and significant, within 4-6 hours of the onset
of an infection. Thus, a simple, semi-quantitative or qualitative
tool for monitoring infection among populations, would be another
application of this technology. A simple kit containing
oligonucleotides designed as herein described, along with a set of
standards, would allow practitioners to assess normal levels of
hepcidin expression and detect anomalous ones within hours of
obtaining a sample. We define this tool semi-quantitative
competitive RT-PCR (sqcRT-PCR).
[0093] Method for sqcRT-PCR. For hepcidin sqcRT-PCR, total RNA was
isolated from .sup..about.0.05 grams of liver. Following RNA
quantification, a one-step/single-tube, competitive RT-PCRs
(One-step RT-PCR) were performed in 25 .mu.l reaction volumes
containing 0.5 .mu.M of each primer (1403F & 86R2), 50 ng of
total RNA, and 0.1 ng of `cHEP` (competitor hepcidin mRNA
containing a 50 bp deletion) using the following cycling profile:
20 minutes at 50.degree. C., followed by 20 cycles of 94.degree. C.
(5 seconds), 57.degree. C. (10 seconds) and 72.degree. C. (10
seconds), and final extension at 72.degree. C. for 1 minute. RT-PCR
products were visualized on a 1% agarose gel, stained with ethidium
bromide, and photographed. Comparison of relative gene expression
levels between treatment and control groups can be performed in two
ways, qualitatively and semi-quantitatively. The qualitative
approach involved estimating the relative level of endogenous
hepcidin mRNA levels as compared to the cRNA competitor by
intensity of staining of the bands and assessing the amount of
competitor added (see FIG. 19, bottom panel). Semi-quantitative
analysis requires an image analysis approach as described
immediately above for cRT-PCR (see FIG. 16).
[0094] Upregulation of endogenous hepcidin. Hybrid striped bass
(HSB, n=25/group, Ave Wt.=70 g) were injected, intraperitoneally
(IP), with either a mutant strain of Streptococcus iniae that was
attenuated for virulence (`TnM2`:.sup..about.2.times.106CFU) or
with PBS (control group). Both groups were subsequently maintained
in 80 l holding tanks with 26.degree. C. flow-through water; and
liver samples from three individual fish from each treatment
(`TnM2` and `PBS`) were collected at 24 and 48 hr post-injection to
determine relative levels of hepcidin gene expression using
sqcRT-PCR (FIG. 19). After 48 hrs, both groups were subsequently
challenged (IP), with an LD60 dose of wild-type, virulent
Streptococcus iniae (2.times.104 CFU), which were then held for an
additional 240 hrs in 26.degree. C. flow-through water and
monitored for morbidity and mortality.
[0095] Screening immunostimulatory compounds using ELISA. One
embodiment of the invention contemplates the use of competitive
ELISA, and related EIA methods described herein, to screen
immunostimulatory compounds for the ability to stimulate with the
innate immune systems of vertebrate animals. Immunostimulatory
compounds are widely used in vertebrate animal production systems
for a preventative treatment against opportunistic diseases and to
enhance the general health of animals. For these studies, chitosan,
or deacetylated chitin, was used a model immunostimulant. Chitin is
known to those practiced in the art to be a major component of
fungi and yeast, but also is a major component of crustacean
shells. We tested various formulations of chitosan in our fish
model system for their immunostimulatory properties were determined
by measuring hepcidin levels using competitive ELISA as described
above. Two doses of 1 mg and 5 mg injected into HSB fingerlings
(30-90 g) in 100 .mu.l volumes of PBS. Three fish per
treatment/control were used. The fish were sacrificed 48 h after
injection. The levels of mature, bioactive, hepcidin levels in the
serum of control and animals receiving the chitosan compounds were
determined by competitive ELISA. These preliminary experiments
demonstrated two compounds (45 and 49) were investigated further to
examine their activities over a one-week time course. In these
experiments a dose ten fold greater than the preliminary
experiments were used. At each time point, 3 treated fish and 1
control fish for each compound were sacrificed and serum collected.
Hepcidin levels in the serum were determined by competitive ELISA
and expressed as the inverse of the optical density which is a
surrogate measure for hepcidin concentration in a competitive ELISA
were high levels of hepcidin are associated with lower optical
densities. Thus, the inverse of a low optical density indicates the
relatively high levels of serum hepcidin in the sample. Hepcidin
levels from fish injected with either 45 or 49 peaked around 24
hours post-injection and returned to basal levels around 96 hours
post-injection (FIG. 20). Lipopolysaccharides (LPS) and
peptidoglycans are major cell wall components of Gram-negative and
Gram-positive bacteria, respectively, and are also associated with
immunostimulatory activity. Their effects on serum hepcidin levels
can be appreciated by examination of the results (FIG. 19), where a
live-attenuated S. iniae mutant, TnM2, caused significant
upregulation of hepcidin expression as shown by cRT-PCR analysis
(FIG. 19, bottom panel). Further evidence that measurement of
hepcidin is useful for screening immunostimulatory activities is
shown in Table 2, where HSB vaccinated with an adjuvanted, killed
S. iniae vaccine showed significantly higher levels of hepcidin 24
h post-vaccination when compared to controls. It is clear to one
practiced in the art, that measurement of mature, folded, bioactive
hepcidin using competitive ELISA, or other EIA embodiments of this
invention can be applied for screening a wide range of compounds,
including probiotics, adjuvants, killed bacterial vaccines, live
attenuated vaccines, orally administered vaccines, T-cell epitopes,
or feed additives for immunostimulatory activity in vertebrate
animals.
[0096] Methods for measurement of mature, folded, bioactive
hepcidin in fluids and tissues of vertebrate animals. Key
embodiments of the present invention are to provide methods of
producing synthetic or recombinantly expressed hepcidin peptides
that are folded so that they are identical to the native mature,
folded, bioactive vertebrate hepcidins. Hepcidins produced using
methods described here are then useful as reagents in measurement
of the native, mature, bioactive forms, in animal fluids and
tissues. Production of a synthetic version of the native HSB
peptide is an object of the present invention, however, several
approaches to produce these versions using recombinant technology,
are apparent to those practiced in the art. These methods include,
but are not restricted to purification of the native form from
vertebrate animals, cloning and recombinant expression in plants,
bacteria, yeast, mammalian and insect cell lines.
[0097] Another embodiment of this invention regards the production
of immunoglobulin antibodies that bind specifically to a
continuous, discontinuous, or conformation epitope or epitopes of
the mature, folded, bioactive forms of vertebrate hepcidins.
Development of rabbit polyclonal immunoglobulin antibodies is yet
another object of the present invention, although, those practiced
in the art can readily appreciate that production of immunoglobulin
antibodies can be accomplished in a variety of vertebrate animal,
including mouse, rat, hamster, goat, sheep, horse, donkey, chicken,
and others. Immunoglobulin antibodies can be produced in these
animals using essentially identical methods and reagents as
described herein.
[0098] Competitive ELISA. Another aspect of the present invention
involves using methods described here for the production of mature,
folded, bioactive vertebrate hepcidins, in conjunction with methods
to produce antibodies to the mature, folded, bioactive vertebrate
hepcidins in a competitive ELISA. The competitive ELISA in this
invention requires that an antibody specific to the mature, folded,
bioactive, vertebrate hepcidin is bound to a solid phase and that
remaining binding sites on the solid phase are blocked with
non-reactive protein solutions. Following washing of unbound
antibody and blocking solutions, the antibodies are challenged with
a solution containing a mixture of a known amount of a tracer
comprised of the mature, folded, bioactive hepcidin covalently
linked to a ligand, and a known volume of the vertebrate fluids or
tissues. The solid phase containing the antibody bound to the
tracer and native, mature, folded, bioactive form of the vertebrate
hepcidin, is washed as before with a buffer, and then exposed to a
second binding conjugate containing an enzyme. In some cases the
tracer contains the enzyme (e.g. HRP, AP) itself. This method
causes a competition for specific antibody binding sites between
the tracer and the native, folded, bioactive vertebrate hepcidin,
such that once the substrate of the enzyme is added, decrease in
signal from the pre-determined level is directly related to the
level of the mature, folded, bioactive hepcidin the sample. To one
practiced in the art, it is readily apparent that methods described
as parts of this invention, can be used to develop a variety of EIA
assays, including a sandwich assay, a double sandwich assay, a gel
immunodiffusion assay, an agglutination assay, a radioimmunoassay,
a precipitin reaction, a fluorescent immunoassay, an
immunoelectrophoresis assay, a protein A immunoassay, an
immuno-chromatographic assay, or other EIA assays.
[0099] Methods for validation of antibodies and conjugates. We
collected serum from each of three immunized rabbits (KST3, KST4,
KST5). KST3 and 4 are sera from rabbits immunized with hepcidin-KLH
conjugates produced using EDC chemistry, while KST5 is sera from
conjugates produced using DSS chemistry (FIG. 7A). These data show
that KST3 and 4 had the highest titers against the mature, folded,
bioactive hepcidin in ELISA. We analyzed the sensitivity by
competitive inhibition of the antibodies from each production
bleeds from KST3 and 4 by increasing concentrations of hepcidin
(data not shown). The inhibition curve shown in FIG. 7B
demonstrates that .sup..about.75% of the binding of Protein A
affinity purified KST4 (1:5000 dilution) is inhibited by 100-1000
ng synthetic hepcidin after a 90 m incubation. 50% inhibition of
bass hepcidin specific antibody activity in this experiment was
achieved at .sup..about.25 ng hepcidin or 2.5 ng/ml. Additional
validation of the anti-mature, folded, bioactive hepcidin
antibodies described above was performed and their utility in
competitive ELISA examined in the presence of varying dilutions of
bass serum (FIG. 8 A-C). Note increasing inhibition of signal with
increasing amounts of synthetic hepcidin added to tracer. Note the
effects of serum on competitive ELISA standard curve (FIG. 8 C)
generated with data from (FIG. 8 B) between 10-100 ngs of mature,
folded, bioactive hepcidin. Relatively little effect on the
standard curve is observed when serum is concentrated or dilute,
indicating that non-specific binding of serum proteins is not a
significant factor in the competitive ELISA assay. FIG. 9 is an
example of a routine standard curve where hepcidin competitor
concentrations are expressed as ng/ml, rather than total ngs added
to the competition. The competitive ELISA described herein as an
embodiment of the present invention, clearly has great utility and
has been reduced to practice in our fish farming operations in
California were random screening of broodstocks reveals extremely
high circulating levels of the mature, native form of hepcidin in
infected animals (Table 1 and 2). We have demonstrated the ability
of our anti-mature, folded, bioactive hepcidin antibodies to detect
native bass hepcidins any tissue examined, including key bodily
fluids such as serum, plasma, and urine, as well as key tissues,
including liver, gill, intestine, and head kidney (Tables 1, 2;
FIG. 11, Micrograph A-H). Urine levels from bass appear to be
approximately 10-15 fold lower in concentration of mature, folded,
bioactive hepcidin, than serum from the same animals. The ability
to detect the mature forms of hepcidin is a critical advantage of
this invention in that it permits non-invasive sampling of
vertebrate animals for routine monitoring or assessment of
diseases.
[0100] ELISA Kit. Contents of the Kit are:
[0101] 1 rabbit anti-HSB hepcidin antibody-coated and blocked
96-well strip plate; five 1.0 mL tubes of hepcidin standards (10.0,
5.0, 2.5, 1.0 and 0.0 ug/mL); one 10 mL bottle of biotinylated
hepcidin solution; one packet wash solution (makes 1 L); one packet
sample dilution buffer (makes 100 mL); one 15 mL bottle of
streptavidin-HRP solution; one 15 mL bottle of TMB substrate; and
one 15 mL bottle of H.sub.2SO.sub.4 stop solution.
[0102] Required Supplies are:
[0103] Pipetters; microplate reader with 450 nm filter; shaker
table; refrigerator; distilled water; timer; and paper towels.
[0104] The Procedure is as Follows:
[0105] Equilibrate plate and all reagents to room temperature; add
desired number of strips to 96-well plate frame; add packet of wash
buffer to 1 L of distilled water; add packet of sample dilution
buffer to 100 mL of distilled water; prepare desired sample
dilutions of serum, plasma, or urine in sample dilution buffer; add
50 .mu.l of standard or sample dilution to appropriate wells; add
50 .mu.l of biotinylated hepcidin solution to every well; cover and
place on a shaker at 150 rpm at room temperature for 1 hour;
briskly discard well contents; wash wells three times with 300
.mu.l wash solution; firmly tap plate on a stack of paper towels to
remove residual liquid; add 100 .mu.l of streptavidin-HRP solution
to each well; cover and place on a shaker at 150 rpm at room
temperature for 30 minutes; briskly discard well contents; wash
wells three times with 300 .mu.l wash solution; firmly tap plate on
a stack of paper towels to remove residual liquid; add 100 .mu.l of
TMB substrate to each well; allow plate to develop for 15 minutes;
add 100 .mu.l of stop solution to each well; read the plate at 450
nm with a micro-plate reader; and fit an appropriate standard curve
to the data to determine sample hepcidin concentrations.
[0106] Table 1 lists the average serum and urine hepcidin
concentrations for three control and three infected bass samples
collected from broodstock holding tanks. The control fish were
maintained at approximately 22.degree. C. recirculating water
systems, all appeared healthy, and there was no history of
infection in the control group. The diseased fish were taken from a
broodstock tank that had been exhibiting prolonged morbidity and
mortality due to stress associated with a prolonged exposure to low
temperatures as is commonly observed in Morone species.
TABLE-US-00002 TABLE 1 Group Serum Hepcidin (.mu.g/ml) Urine
Hepcidin (.mu.g/ml) Control Fish 11.16 0.99 Infected Fish 323.50
25.84
[0107] Table 2 shows results from competitive ELISA from HSB serum
samples collected from a series of controlled clinical trials, and
field production studies at the Kent SeaTech Coachella Valley
Production Facility near Palm Springs, Calif., USA. The data from
these studies is separated by double lines. The first data set is
from a clinical trial where HSB were infected with a dose of
virulent S. iniae and serum was assayed for hepcidin at the
indicated time-points (Rows 1-3). The second data set is from a
field study Production Tank 32, where HSB without apparent clinical
disease `Clinically Healthy` and "Infected/Moribund" HSB were
sampled and their serum hepcidin levels determined (Rows 4-5). The
third data set is a comparison of "Unvaccinated, Control" HSB
sampled at time zero, and HSB from the same tank sampled 24 h later
(Rows 6-7). The fourth experiment is a clinical where the indicated
quantities of synthetic, bioactive, bass hepcidin was injected IP
and measured in their serum at the indicated timepoints (Rows
8-11). The HSB in Row 11 received two doses, one at time zero, and
the second at 3 h, of the indicated amounts of synthetic hepcidin
and were sampled at 6 h only for assessment of serum hepcidin
levels. All serum hepcidin levels were determined by the
competitive ELISA described herein as an embodiment of the present
invention.
TABLE-US-00003 TABLE 2 Sample n Range (.mu.g/ml) Mean (.mu.g/ml) S.
iniae 15 hr Control 7 5.3-9.1 6.87 S. iniae, 15 hr 10{circumflex
over ( )}6 CFU 9 19.9-92.0 46.87 S. iniae, 72 hr 10{circumflex over
( )}6 CFU 9 2,717-12,828 6,318.31 Production T32, Clinically
Healthy 9 7.8-8.7 8.31 Production T32, Infected/Moribund 9
912-10,327 6,927.90 Unvaccinated, Control 5 0.99-1.44 1.19
Vaccinated, 24 h Post IP Injection 5 32.5-212 82.35 Hepcidin
Injection, Control (PBS), 9 1.1-3.6 2.2 3 h Hepcidin Injection, 50
.mu.g, 3 h 9 28.3-49.2 39.3 Hepcidin Injection, 300 .mu.g, 3 h 9
102.0-398.8 204.3 Hepcidin Injection, 2 .times. 300 .mu.g, 6 h 9
203.0-263.0 229.5
[0108] Following is a discussion if the immunohistochemical
analysis of HSB tissue hepcidin levels following infection.
[0109] Liver and Associated Structures. A strong, distinct diffuse
signal distribution was observed throughout the hepatocytes of S.
iniae-infected fish (FIG. 11, Micrographs A-H). In control tissues
(fish injected with PBS), the signal was essentially undetectable.
This finding closely parallels that described by others in that the
liver is generally accepted as the major site of hepcidin
production. One notable difference in the IHC staining pattern of
our studies was that the signal was diffuse throughout the
hepatocyte (i.e. both apical and basolateral), not restricted to a
basolateral distribution as described in U.S. Patent 2004/0096990
(FIG. 11A-B). Since our studies probed tissues with an antibody
raised against the mature, refolded, bioactive form of bass
hepcidin, this may help explain these apparent differences. A
strong, diffuse signal was also observed in the lumen of some of
the blood vessels in HSB, probably the result of the antibody
reacting with mature peptide being transported into the blood
vessels after its hepatocytic production and excretion. This is in
contrast with the prior art, where it had been reported that the
hepatic vascular system lacked hepcidin reactivity. Also of note
was that our findings provide strong evidence that the primary
antibody employed ion our studies cross-reacted with a
leukocyte-like cell lineage routinely observed within the hepatic
blood vessels.
[0110] Our present understanding of hepcidin's function as an
iron-regulating peptide has focused on the primary role that the
liver has played in the production and secretion of this
multifunctional peptide. Our molecular and IHC research has
demonstrated that not only is the hepcidin gene upregulated in
extra-hepatic tissues during bacterial infection but our specific
bass hepcidin antibody clearly demonstrates the presence of the
mature peptide in many other tissues during episodes of infectious
bacterial disease.
[0111] Gills and Associated Structures. In gills from control fish
that received a PBS injection, a very weak signal was present
throughout, usually associated with the amorphous substance present
within the blood vessels (FIG. 11, Micrograph C). This observation
merely confirms the presence of basal hepcidin levels in an
uninfected fish. Occasionally a weak signal was detected within
cells located at the base of and along the length of the gill
lamellae. While we were unable to differentiate the exact cell type
associated with this signal, it was not associated with goblet
cells, chloride cells or lamellar epithelial cells (data not
shown). Of note was the presence of weak signal associated with the
filamental cartilage. In this case some but not all chondrocytes
appeared to cross-react with the primary antibody indicating that
hepcidin may play a yet undescribed role in chondrocyte
proliferation and differentiation. In tissues from S.
iniae-infected fish, a strong signal was seen throughout the gills
(FIG. 11, Micrograph D). Strong signal was also observed among the
amorphous plasma proteins evident within the major blood vessels of
the gills (data not shown). In regions of overt inflammation (as
evidenced by the presence of increased quantities of many types of
inflammatory cells), this intravasculature signal stained even more
intensely. Of note was a strong surface-associated signal apparent
in a low proportion of the erythrocytes within the central blood
vessels of the gill filaments. The biological significance of this
observation was not determined however it may be related to iron
regulation within specific erythrocytes (or developmental stages
thereof) or represent an overabundance of hepcidin and/or its
receptor associated with this cell type.
[0112] A strong signal was also noted among many of the normal
cells present in this organ. Indeed, the most intensely staining
regions appeared to reside at the base of and be relatively evenly
distributed along the length of the lamellae at fairly constant
intervals, suggesting the signal may be associated with a
structural cell type (e.g. pillar cells). Often, in the right plane
of section, increased signal was associated with cells throughout
the basement membrane, adjacent to the central filamental venus
sinus. Again cell morphology was difficult to discern, although it
appeared to be of leukocyte-like origin. As noted in the control
tissues, the antibody to mature bass hepcidin cross reacted with
specific chondrocyte nuclei present in the filaments and gill
arches.
[0113] Intestine and Tissues Associated With the Peritoneum. At 72
hours post infection with S. iniae, a dramatic increase in signal
was seen in the columnar epithelium of the intestinal brush border
(FIG. 11, Micrograph F). This dramatically increased intestinal
signal did not involve the goblet (mucus producing) cells. In
contrast, essentially no signal was observed in the corresponding
intestinal tissues of fish that were previously injected with PBS
(FIG. 11, Micrograph E). These observations strongly support the
hypothesis that mature hepcidin may also be produced and
post-translationally modified in situ within the columnar
epithelium rather than originating from, for example, the lamina
propria, and being transported to the brush border. Strong signal
was also evident in close association with blood and lymphatic
vessels in the smooth muscle of the intestinal tract, particularly
proximal to the lamina propria. This observation may support the
hypothesis that hepcidin is produced at a distant site (i.e. the
liver) and transported to the intestine via a hematogenous
route.
[0114] The peritoneum of fish experimentally infected with S. iniae
contained significant levels of hepcidin, usually associated with
the inflammatory cells (mainly macrophages) commonly recruited to
this site during inflammation (not shown). This observation was
seen both on the serosal surface of the intestinal muscularis as
well as throughout the inflammatory foci present within the
visceral adipose tissues and mesenteries. Significant signal was
also noted among the pancreatic islets distributed throughout the
adipose tissue, usually in conjunction with a strong signal
associated with the amorphous plasma proteins inside the blood
vessels associated with this organ. This observation provides
further evidence that the pancreas (rather than the liver) may play
a role in regulating hepcidin in an endocrine-like fashion.
[0115] Head Kidney and Associated Structures. A strong
immunohistochemical signal was observed within the head kidney of
fish infected with S. iniae (FIG. 11, Micrograph H). In contrast, a
similar degree of signal was not detected in the control tissues
(FIG. 11, Micrograph G). Based on the signal, it appeared that
mature hepcidin was present in close association with the
endothelium of the renal portal system, yielding a staining pattern
with a reticulated appearance (FIG. 11, Micrograph H). This is a
dramatic finding in that while hepcidin was first detected in human
urine, this region of the teleost kidney is mainly hematopoetic in
function and not excretory as one would expect for an excretory
function. When present, signal was also detected within the blood
vessels of this hematopoietic organ, usually restricted to specific
types of leucocytic cell lineages. Again, a strong hepcidin signal
was observed throughout the amorphous plasma proteins seen in the
major blood vessels of this organ, suggesting that mature peptide
was present in the plasma (not shown).
[0116] In the control sections, a weak signal was seen in the
chromaffin cells and/or interrenal tissue of the head kidney region
but in contrast a strong hepcidin signal was present in the same
region of the infected tissues (data not shown). These tissues
surround the major blood vessels of the head kidney and although
their function is poorly understood, it is felt that they represent
the mammalian equivalent of the renal medulla and cortex,
respectively. Thus by definition, these teleost tissues represent
some form of endocrine function. Thus our findings demonstrate that
our antibody to bass hepcidin specifically recognizes epitopes in a
tissue of known neuroendocrine origin.
[0117] Antimicrobial Spectrum of Activity. Serial dilutions of
synthetic hepcidin beginning at 44 .mu.M, were tested in vitro in
liquid growth inhibition assays against 21 bacterial strains, a
filamentous fungi, and a yeast strain. Table 3 reports a summary of
MIC and MBC of bass hepcidin for various micro-organisms; the
highest concentration tested with bacteria and yeast was 44 .mu.M,
while 88 .mu.M was used for the fungi, A. niger. The peptide was
active against a panel of Gram-negative bacteria including three E.
coli strains, Pleisomonas shigelloides, Klebsiella pneumoniae,
Shigella sonnei, Shigella flexneri and Yersinia enterocolitica.
Hepcidin was not active at 44 .mu.M against another Klebsiella sp.,
K. oxytoca, as well as nine other Gram-negative species tested. The
minimum inhibitory concentrations of synthetic hepcidin against
Gram-negative bacteria ranged from 5.5 to 44 .mu.M, and overall,
8/18 (44%) of the Gram-negative species tested were sensitive to
bass hepcidin. The MBCs were either equal to or twice the MIC for
all bass hepcidin sensitive strains. Bass hepcidin showed no
activity at 44 .mu.M against the three Gram-positive bacteria and
single yeast strain tested. Hepcidin displayed anti-fungal activity
in vitro against A. niger at relatively high concentrations (44
.mu.M). Interestingly, hepcidin was not active against any of the
key fish pathogens we tested, including the Gram-positive pathogen,
S. iniae, and the Gram-negative pathogens, A. hydrophila, A.
salmonicida, and E. tarda.
TABLE-US-00004 TABLE 3 American Type Culture Microorganisms
Collection No. MIC MBC Gram-positive bacteria: Entercoccus faecalis
51299 >44 Not Tested (vancomycin-resistant) (NT) Staphylococcus
aureus 33591 >44 NT (methicillin-resistant) Streptococcus iniae
Kent Sea >44 NT Tech Corp. isolates form HSB (KST) Gram-negative
bacteria: Aeromonas hydrophilia KST >44 NT Aeromonas salmonicida
KST >44 NT Enterobacter cloacae 35030 >44 NT E. coli 25922 22
22 E. coli 35150 22 44 E. coli D31 11 11 Edwardsiella tarda KST
>44 NT Klebsiella oxytoca 49131 >44 NT Klebsiella pneumoniae
10031 22 44 Pleisomonas shigelloides KST 11 22 Pseudomonas
aeruginosa 35032 >44 NT Salmonella arizonae 13314 >44 NT
Salmonella choleraesuis 14028 >44 NT Salmonella typhimurium
13311 >44 NT Serratia marcescens 8100 >44 NT Shigella
flexneri 12022 22 44 Shigella sonnei 9290 44 44 Yersinia
enterocolitica 23715 22 22 Filamentous fungi: Aspergillus nigers 44
NT Yeast: Candida albicans 66027 >44 NT
[0118] Microbicidal Kinetics. An experiment was conducted to
examine the microbicidal kinetics of bass hepcidin and to compare
its killing activity to another bass antimicrobial peptide,
moronecidin. Moronecidin is a 22 amino acid, linear, amphipathic
.alpha.-helical peptide which was originally co-purified from the
gill of HSB with hepcidin. These experiments were carried out using
Y. enterocolitica, where the MIC for hepcidin and moronecidin were
measured at 22 .mu.M and .mu.M, respectively. We compared the
killing kinetics of hepcidin and moronecidin against Y.
enterocolitica at 30 min intervals over a 3 h time period using
2.times. their MIC concentrations for this organism (44 and 10
.mu.M; FIG. 12). The bactericidal activities of the peptides were
assessed by plating cultures and counting CFUs after overnight
incubation at 37.degree. C. Bass moronecidin killed Y.
enterocolitica within minutes of exposure to the bacteria leading
to 90% decrease in CFU after 30 min, whereas Y. enterocolitica
cultures were actually growing in the presence of 22 and 44 .mu.M
bass hepcidin at this time. Two and half hours were required for a
similar 90% reduction of CFU from the original inoculum with
hepcidin at 44 .mu.M. The microbiocidal activity of hepcidin was
temperature-dependent as was observed for moronecidin.
[0119] Fungicidal Activity. A germination assay with spores of the
filamentous fungi, A. niger, was conducted to test bass hepcidin's
fungistatic and fungicidal activities and compare them with those
of moronecidin (FIG. 13). No hyphae were observed at a peptide
concentration of 44 .mu.M after 2 days incubation at 30.degree. C.
At lower concentrations, the peptide caused delayed growth of
hyphae with abnormal morphology (data not shown). After 48 hr
exposure to the respective peptides, spores were removed and
cultured in fresh medium and examined 48 h later for growth. Bass
hepcidin was fungistatic at low concentrations with a lower IC50
concentration (peptide concentration giving 50% growth inhibition)
than moronecidin (5 .mu.M vs. 7 .mu.M) when tested in parallel
assays. Moronecidin, however, was fungicidal at 10 .mu.M, whereas
hepcidin was fungicidal at 44 .mu.M (FIG. 13).
[0120] Synergism Between Bass Hepcidin and Moronecidin
Antimicrobial Activities. Bass hepcidin and moronecidin were
originally co-purified from gill tissues of hybrid striped bass
opening the possibility that these peptides are co-localized in
this tissue and may act additively or synergistically to kill
invading microorganisms. To test for synergism between the two
antimicrobial peptides in vitro, we conducted liquid growth
inhibition/killing experiments with a Gram-positive (S. iniae) and
a Gram-negative bacterium (Y. enterocolitica) using varying
concentrations of the two synthetic peptides. The bacteria were
cultured in the presence of synthetic bass hepcidin and moronecidin
and plated after 2 h incubation at 37.degree. C. for determination
of CFU (FIG. 14). We observed (FIG. 14) that two-fold decreases in
the MIC of each peptide for Y. enterocolitica, when in combination,
reduced CFUs by more than 100 fold below that of either moronecidin
or hepcidin alone at their MIC concentrations for this bacteria. A
fourfold decrease in the MIC of each peptide in combination yielded
similar or better killing of Y. enterocolitica than either peptide
alone at their MIC (FIG. 14). Bass hepcidin had no detectable
antimicrobial activity against S. iniae after 2 h incubation with
concentrations as high as 88 .mu.M (FIG. 14). However, at a
hepcidin concentration eight times lower (11 .mu.M), in the
presence of 1.25 .mu.M moronecidin, strong killing of S. iniae was
observed. Under these conditions, a 10-fold reduction in CFU below
that of 1.25 .mu.M moronecidin was observed. While results shown in
FIGS. 6A and B give a more intuitive visualization of the synergism
between the two peptides, the standard measure for synergism is
through calculation of the Fractional Inhibitory Concentration
(FIC). We calculated FIC indices against a Gram-positive bacteria
(S. iniae) and three Gram-negative bacteria (E. coli, Y.
enterocolitica, Shigella sonnei) (Table 4, reporting FIC indices
for hepcidin and moronecidin against selected bacteria). An FIC
index of 0.5 indicates strong synergy (representing the equivalent
of a fourfold decrease in the MIC of each compound tested), while
an FIC index of 1.0 indicates that the antimicrobial activity of
the two compounds are additive (i.e. a twofold decrease in the MIC
of each compound tested). The FIC indices calculated for hepcidin
and moronecidin were between 0.5-0.75, indicating strong to
moderate antimicrobial synergy between the two peptides.
TABLE-US-00005 TABLE 4 Lowest FIC index MIC (.mu.M) ([A/[B]).sup.a
Species hepcidin moronecidin Hepcidin + Moronecidin S. iniae >88
2/5 0.56 (11/1.25) E. coli 22 5 0.75 (5.5/2.5) Y. enterocolitica 22
5 0.50 (5.5/1.25) S. sonnei 22/44 5 0.75/0.5 (11/1.25) .sup.aFIC
index = [A]/MICA + [B]MICB, where MICA and MICB are the MICs of
peptides A and B alone and [A] and [B] are the MICs of peptides A
and B in combination. The MICs for the peptides alone are as given
in Table II. The numbers in parentheses are the MICs in combination
(hepcidin/moronecidin). Since hepcidin MIC against S. iniae is
higher than 88 .mu.M, the highest concentration we tested, we chose
this value as the hepcidin MIC in the calculationof the FIC
index.
[0121] Hemolytic Activity. The hemolytic activity of bass hepcidin
was tested with erythrocytes from HSB. Bass hepcidin displayed
essentially no hemolytic activity towards HSB erythrocytes (Table
5, reporting Hemolytic activity expressed as percent of controls
.+-.standard deviation for bass erythrocytes over time.). Greater
than 98% of the bass erythrocytes exposed to 44 .mu.M hepcidin for
3 h at 37.degree. C. remained intact. This exposure corresponds to
a time point when 96% of Y. enterocolitica exposed to 44 .mu.M
hepcidin have been killed (see FIG. 6, Panel A). After 4 h
incubation with 44 .mu.M hepcidin, more than 97% of the
erythrocytes remained intact. No hemolysis was observed after 4 h
at hepcidin concentrations of 11 .mu.M and lower.
TABLE-US-00006 TABLE 5 Hepcidin (.mu.M) 30 min. 90 min. 180 min.
240 min. 5.5 0 0 0 11 0 0 0 22 0 0 0.4 .+-. 0.15 0.4 .+-. 0.4 44 0
0 1.4 .+-. 0.3 2.5 .+-. 1.2
[0122] Clinical trial using cRT-PCR analysis of HSB infected with
S. iniae. The mean quantities of hepcidin mRNA per microgram of
total RNA expressed in the liver following challenge with S. iniae,
and two additional Gram-negative pathogens (A. salmonicida, PLO),
are presented in FIG. 15. Results, based on these quantitative
competitive RT-PCR assays not only confirm extremely high levels of
hepcidin mRNA induction by bacterial challenge with the Gram
positive pathogen S. iniae, but also extend these results to
phylogenetically distant Gram-negative pathogens (A. salmonicida,
PLO). The hepcidin gene was reproducibly induced approximately
30,000-100,000-fold following challenge with all three pathogens.
The exact degree by which hepcidin is upregulated in our HSB
challenge model/cRT-PCR experimental system is highly dependent on
the resting levels of hepcidin expression in livers of healthy HSB
fingerlings. In our experiments, we have consistently observed
significant competition between the endogenous hepcidin mRNA and
100 femtogram (0.0001 ng; see FIG. 17) of hepcidin cRNA. In fact,
the PBS sham-challenged control level of hepcidin mRNA in naive HSB
fingerlings was calculated to be 70 femtograms which is near to the
limits of detection of the cRT-PCR assay. Determination of resting
levels of hepcidin in naive, healthy HSB will be a critical
component of clinical trials performed with vertebrate animals to
validate and apply the hepcidin ELISA described within to studies
of disease. Interestingly, levels of hepcidin induction in 24-hour
liver samples of S. iniae and A. salmonicida-challenged HSB were
over two-fold higher than PLO-challenged samples. Lower mean
quantities of hepcidin mRNA expression in PLO-challenged HSB may be
attributable to a 10-fold lower challenge dose (3.8.times.104 CFU)
compared to the other two challenge models (2.0-3.5.times.105
CFU).
[0123] Temporal analysis of bass hepcidin expression using
sqcRT-PCR. Levels of hepcidin gene expression over the first 48
hours post-challenge were evaluated following experimental
infections with S. iniae, A. salmoncida, and PLO. In these
experiments, 200 ng of total RNA from the livers of six infected
individuals at various time points post-challenge (FIG. 16).
Hepcidin expression levels over time based on RT-PCR
target:competitor signal strength ratios as described above. All
three bacterial challenge models in HSB appear to reveal a similar
pattern, in which levels of hepcidin gene expression increase
maximally over the first 24 hours post-challenge and expression
appears to level off between 24 and 48 hours. The consistent and
rapid induction of hepcidin mRNA, in response to challenges with a
diverse array of bacterial pathogens, lends further support to the
use of hepcidin-based assay to detect both Gram-positive and
Gram-negative bacterial infections in vertebrate animals.
[0124] Temporal Analysis of Bass Hepcidin Gene Expression Following
Bacterial Infection. In a previous study by our group, levels of
hepcidin gene expression were assessed at 24 h by kinetic RT-PCR
between HSB infected by immersion in a live suspension (5.times.107
CFU ml-1) of the virulent fish pathogen S. iniae, and
mock-challenged controls. Those studies demonstrated that hepatic
hepcidin expression in bass was strongly upregulated
(.sup..about.4,500-fold) following infection with this
Gram-positive bacterium. However, these clinical trials only
examined a single pathogen and time point post-infection under
conditions that did not allow the pathogen dose received by the HSB
to be quantified. To extend this study, we examined hepcidin gene
expression at intervals over the first 48 h post-challenge
following IP injection of a defined dose of A. salmonicida or S.
iniae. HSB fingerlings infected with either A. salmonicida or S.
iniae exhibited 44% and 78% cumulative mortality, respectively,
over the course of seven days. Both pathogens were recovered from
the head kidney (A. salmonicida) and brain/head kidney (S. iniae)
of moribund fingerlings, confirming the presence of an active
systemic infection. No mortalities occurred in mock-challenged
fingerlings and neither pathogen was recovered from the sacrificed
control HSB. Differences in hepcidin expression between
experimental HSB fingerlings infected with either A. salmonicida or
S. iniae were readily apparent using competitive RT-PCR, especially
when comparing hepcidin expression between infected and PBS
injected control animals at 24 h (Table 6, reporting hepcidin mRNA
expression in bass liver following infectious challenge; for an
example of single fish/time point experiment see FIG. 17). Temporal
differences in hepcidin expression were also readily apparent
following infection with S. iniae (FIG. 17).
TABLE-US-00007 TABLE 6 S. iniae Control A. Salmonicida Mean Copy
Hour Copy No..sup.a Range Mean Copy No. Range No. Range 0 4.37
.times. 10.sup.3 1.27-7.46 .times. 4.37 .times. 10.sup.3 1.27-7.46
.times. 4.37 .times. 10.sup.3 1.27-7.46 .times. 10.sup.3 10.sup.3
10.sup.3 4 5.23 .times. 10.sup.6 5.45-10.sup.5-9.92 .times. 1.06
.times. 10.sup.6 9.78 .times. 10.sup.5-1.14 .times. 10.sup.6
10.sup.6 8 1.96 .times. 10.sup.7 1.54-2.38 .times. 1.54 .times.
10.sup.7 3.73 .times. 10.sup.6-2.72 .times. 10.sup.7 10.sup.7 16
1.17 .times. 10.sup.8 1.02-1.32 .times. 1.39 .times. 10.sup.8
1.16-1.61 .times. 10.sup.8 10.sup.8 24 4.93 .times. 10.sup.3
2.39-7.46 .times. 1.44 .times. 10.sup.8 8.9 .times. 10.sup.7-1.99
.times. 1.63 .times. 10.sup.8 1.56-1.70 .times. 10.sup.3 10.sup.8
10.sup.8 48 2.30 .times. 10.sup.8 1.66-2.93 .times. 2.40 .times.
10.sup.8 1.89-2.92 .times. 10.sup.8 10.sup.8 .sup.aCopy # is
average of two HSB individuals expressed in copies ng.sup.-1 total
liver RNA
[0125] Hepcidin mRNA copy number was low in the livers of healthy
control HSB fingerlings at time zero and at 24 h, comprising
approximately 6.times.10-5% of total RNA in liver
(4.37-4.93.times.10.sup.3 copies ng.sup.-1 RNA). Resting levels of
hepcidin mRNA in bass liver were approximately 5-7 fg ng.sup.-1
total RNA. Hepcidin gene expression in HSB was rapidly up-regulated
following IP challenge with S. iniae and A. salmonicida,
Gram-positive and Gram-negative organisms, respectively. For both
fish pathogens, hepcidin expression increased roughly three orders
of magnitude between 4 and 8 h, four orders of magnitude by 16 h,
and nearly five orders of magnitude by 48 h (Table 6; FIG. 17).
Hepcidin hepatic gene expression levels reached >50% and >60%
of their 48 h peak levels by 16 h and 24 h, respectively, and
continued to increase through the end of the experiment at 48 h. In
these clinical trials, hepcidin mRNA comprised approximately 3% of
the total liver RNA at 48 h post-infection (2.3-2.4.times.10.sup.8
copies ng.sup.1 total RNA). The rate of increase and overall levels
of bass hepcidin mRNA was strikingly similar in HSB fingerlings
challenged with similar inoculums of either Gram-negative (A.
salmonicida; 2.3.times.10.sup.8 copies ng.sup.-1 RNA at 48 h) or
Gram-positive (S. iniae; 2.4.times.10.sup.8 copies ng.sup.-1 RNA at
48 h) fish pathogens (Table 6; FIG. 17).
[0126] Dose response of hepcidin. To evaluate our hepcidin
real-time quantitative RT-PCR assay and examine the relationship
between hepcidin expression and the degree of infection, we
challenged bass (n=30, Ave Wt.=160 g) IP with two doses of the S.
iniae (1.98.times.10.sup.2 or 1.93.times.10.sup.6 CFU) and
collected liver tissue from two fish at 0, 6, 12, 24, 48, 72, 96
and 120 h post-challenge for quantification of hepcidin mRNA.
Spleen from each fish was homogenized in 20 volumes of sterile PBS,
and plated on THB supplemented with 5% sheep blood to estimate S.
iniae CFUs/gram tissue. Total RNA was isolated from 0.05 grams of
liver using TRIZOL.TM. (MRC). The RNA was quantified, and 1 .mu.g
was converted to cDNA in a 20 .mu.l reaction containing 2 .mu.M of
d(T).sub.20 primer and 200 U SUPERSCRIPT III.TM. Reverse
Transcriptase (Invitrogen). Real-time RT-PCR was performed with 1
.mu.l of the cDNA reaction (.about.50 ng .mu.l.sup.-1) in duplicate
25 .mu.l reactions. Duplicate serial dilutions of the hepcidin
standard `pHEP4` (1.0 ng-1.0 fg) were used to generate a standard
curve for quantification of hepcidin mRNA. Bass challenged with
different doses of S. iniae displayed significant differences in
CFU/g spleen through 12 hours post-challenge. S. iniae levels in
the spleen were the same by 24 h and remained elevated through 120
h (FIG. 18). Quantification of hepcidin mRNA in liver tissue
samples revealed an expression pattern that was concordant with the
pathogen load estimated from spleen tissues. At 12 h, hepcidin
expression was significantly lower in HSB challenged with a low
dose of S. iniae, but the two treatment groups reached similar
levels of hepcidin expression by 48 h post-infection (FIG. 18).
These data confirm a dose-dependent response of hepcidin expression
to pathogen load, suggesting that our hepcidin-based diagnostics
may be able to provide a quantitative measure of the degree of
infection. Hepcidin expression increased dramatically (4 to 5
orders of magnitude relative to control levels) upon challenge, and
appeared to be maximal by 48 hours. These results are concordant
with our previous studies using competitive RT-PCR (cRT-PCR).
Hepcidin expression, and bacterial load, remained highly elevated
throughout the experiment. Additional experiments, using real-time
PCR analysis of hepcidin, are also being conducted to examine the
influence of stress on hepcidin expression.
[0127] Upregulation of hepcidin in vivo. As part of this invention,
we contemplate methods to manipulate endogenous hepcidin expression
in vivo in vertebrate animals. To demonstrate that upregulated
hepcidin expression is key to or associated with a protective
innate immune response, we used a live-attenuated S. iniae mutant
(TnM2). TnM2 has been shown to be avirulent at doses of
>10.sup.9 CFU. We predicted that IP injection of 10.sup.6 CFU of
TnM2 would strongly induce endogenous hepatic expression (FIG. 19)
and elevate the level of the peptide in blood and other key tissues
over several days without causing disease. This experimental model
for dietary upregulation of hepcidin allowed us to challenge
hepcidin-induced HSB with a virulent strain (K288) and compare
their survival with PBS controls where in vivo hepcidin levels are
significantly lower. High levels of hepcidin induction (>>0.1
ng/.mu.g RNA) were observed in fish injected with the attenuated S.
iniae strain, while upregulation of hepcidin in the control group
appeared negligible (<<0.1 ng/.mu.g RNA) given the lack of
endogenous hepcidin RT-PCR product visualized on the gel. FIG. 19
shows the results of this study and clearly demonstrates that
elevated hepcidin is associated with this protective response. At
the termination of the experiment, survival in the `TnM2` treated
group, which exhibited high levels of hepcidin expression at 48 hr
(just prior to challenge), was 95.8%. Survival in the untreated
control group was only 37.5%. Together, these results clearly
indicate that treatments, serving to induce endogenous hepcidin,
also confer short-term protection against bacterial pathogens.
These results support our concept of using dietary additives to
regulate hepcidin levels in vertebrate animals for prevention of
diseases, especially those associated with stressful animal
production practices.
[0128] Antimicrobial Activities. For the methods and inventions
described herein, we examined bass hepcidin as a pharmaceutical
composition, against 21 species of bacteria including strains
previously tested with human hepcidin (Table 3). Consistent with
studies of human hepcidin, bass hepcidin was active against E. coli
but had little or no detectable activities against P. aeruginosa,
S. aureus, or C. albicans. Bass hepcidin and human hepcidin were
also both active against A. niger in spore germination assays (FIG.
13). Our results indicate that bass hepcidin and human hepcidin
were both active in a similar range of concentrations against
Gram-negative bacteria (Table 3). Bass hepcidin's antimicrobial
potency contrasted sharply with another bass AMP, moronecidin, that
was also purified from HSB gill tissue (FIG. 12). Moronecidin is a
22 amino acid linear, cationic peptide with an amphipathic,
.alpha.-helical structure that exhibits a more potent, broader
spectrum of bactericidal activity than hepcidin. Peptides like
moronecidin are thought to aggregate and interact with negatively
charged bacterial membrane components, and disrupt them by forming
pores or solubilizing the membrane via a "detergent" effect. This
direct membrane disruption is believed to kill the bacterium by
creating osmotic imbalance and loss of cytoplasm. Bass hepcidin is
cationic and adopts an amphipathic structure in solution, and thus,
has the potential to interact with and disrupt bacterial membranes
like linear, .alpha.-helical peptides. Our studies with Y.
enterocolitica demonstrate that in vitro, hepcidin kills this
bacterium much more slowly than does moronecidin (FIG. 12). This
indicates inherent biophysical differences between the two
peptides. Hepcidin is less cationic and amphipathic than
moronecidin. Both of these parameters have been shown to be
important structural attributes for potent antimicrobial activity.
Alternatively, Y. enterocolitica is known to have an efflux
pump/potassium antiporter to combat the antimicrobial activities of
host cationic peptides. Thus, the differences in bactericidal
activity between the two peptides indicate different
susceptibilities of the peptides to this antibiotic resistance
mechanism. Finally, there are indications that hepcidin kills
bacteria by a mechanism independent of membrane permeabilization
(e.g. inhibiting a key metabolic process), which indicates that
prolonged contact with the bacteria is required to exert
microbicidal activity.
[0129] Hepcidin Expression In vivo Following Infection. Our results
show that infection of bass with either a Gram-positive (S. iniae)
or Gram-negative (A. hydrophila) fish pathogen, induces hepcidin
gene expression in the liver with very similar kinetics. The first
hepcidin transcripts were detected within hours following
experimental infections and expression was maximal at 48 h post
infection. The rapidity and remarkable amplitude of this expression
profile are consistent with the acute phase response to infections
observed in mammals. Human and mice hepcidin expression both
require the inflammatory cytokine IL-6, thus defining hepcidin as a
type II acute phase response protein. Mice show a four-fold
increase in hepcidin expression in response to inflammatory
stimulators, while studies in human patients with anemia of
inflammation show up to 100-fold greater concentrations of hepcidin
in their urine. Despite the limited spectrum and potency of
hepcidin antimicrobial activity observed in vitro, there are
several possible mechanisms by which hepcidin could be effective in
vivo as an antimicrobial compound. We have shown by our methods and
competitive ELISA, that serum concentrations of hepcidin reach
higher levels than we tested in vitro, compensating for the levels
of specific activity observed in vitro. The dramatic upregulation
of hepcidin expression in liver and other tissues upon experimental
infection of HSB with fish pathogens supports this hypothesis. In
this study, bass liver hepcidin expression increased three orders
of magnitude within 16 h of infection, four orders of magnitude
within 24 h, and was nearly five orders of magnitude above baseline
by 48 h post infection (Table 6). The magnitude and duration of the
upregulation of hepcidin expression in the liver following
infection indicates that high concentrations of hepcidin are
important to the innate immune response against these pathogens.
Another mechanism by which hepcidin shows to exert strong
antimicrobial effects in vivo is through synergistic interactions
with other inducible acute phase response proteins, and/or
constitutively expressed antimicrobial compounds in the tissues
(FIG. 14). There are a number of examples of co-localization of
antimicrobial compounds in various tissues and cell types, as well
as specific evidence of synergistic activity when AMPs are combined
in vitro. Our previous studies have demonstrated that both the
hepcidin and moronecidin genes are expressed in the gill tissue of
bass and that their mature peptides reside in this tissue. Thus,
our demonstration of synergism between hepcidin and moronecidin
antimicrobial activities in vitro against both Gram-positive and
Gram-negative bacteria reflects an elegant addition to innate
immune systems of teleosts. A model where the inducible hepcidin
peptide acted synergistically with constitutively expressed AMPs
such as moronecidin, indicates an increased broad-spectrum
antimicrobial defense during the early stages of an infection.
[0130] Hepcidin, Inflammation, and Hypoferremia. In mammals,
hepcidin plays a key role in the hypoferremic response during
inflammation, and given the similarity of the two structures and
activities, there is potential for a similar role for hepcidin in
bass and other teleosts. Bacterial pathogens require iron for
growth and most have evolved sophisticated mechanisms for obtaining
iron from their hosts to support their proliferation. In this
regard, hepcidin has been proposed to help combat infection by
restricting iron availability to invading pathogens through a
strong hypoferremic response, and thus limiting their
proliferation. The potential for hepcidin-induced hypoferremia in
fish is consistent with studies in trout and salmon, where lower
free iron in plasma was observed 24-48 h after injection of LPS. In
addition, symptoms of anemia have been observed in bass infected
with S. iniae or A. salmonicida, both of which we have shown to be
potent inducers of hepcidin expression.
[0131] Strong conservation of the structure and rare vicinal
disulfide between bass and human indicates that the hepcidins are
functionally constrained from sequence divergence. Since bass
hepcidin does not contain any acidic residues, no evidence was
found of direct binding of bass hepcidin to ferric iron by NMR.
Instead, hepcidin has shown to have the capability of exerting its
effects on the innate immune response of teleosts through a
combination of activities. The bass model employed in these studies
provides a powerful approach to further elucidate hepcidin
function(s), including it potential role in hypoferremia in
teleosts.
[0132] Disease states. One aspect of the present invention is
application of methods and reagents produced from those methods to
detect disease states in vertebrate animals. For the purposes of
the present invention, disease states comprises genetic and
non-genetic diseases responsible or associated with iron
deficiency, iron overload, and/or changes in iron distribution in
tissue such as accumulation of iron in reticuloendothelial cells
and decreased serum iron concentration. Disease states also
comprise infectious diseases comprises bacterial, fungal, yeast,
viruses, encapsulated viruses, prion diseases, and non-specific
infectious diseases caused by unculturable organisms; inflammatory
disease such as arthritis and certain type of cancer; inherited or
non-inherited iron overload diseases; liver diseases; hematological
diseases; diseases associated with blood loss, oxidative stress and
from exposure to toxic molecules such as heavy metal, carbon
monoxide; and neurodegenerative diseases such as Alzheimer's
diseases. Due the involvement of bioactive hepcidins with these
diseases, the methods to produce the key reagents, and the
diagnostic kits for accurate measurement of bioactive hepcidins,
are both aspects of the present invention, and enable (i) detection
and analysis of hepcidins role in a wide variety of human and other
vertebrate animals suffering from, or predisposed to these
diseases, and (ii) rapid diagnosis of these diseases. Our
diagnostic tool is unique in that the antibodies and associated
reagents are all specific to the bioactive form of hepcidin
associated with vertebrate iron regulation.
[0133] While the invention has been described in connection with
the above described examples, it is not intended to limit the scope
of the invention to the particular forms set forth, but on the
contrary, it is intended to cover such alternatives, modifications,
and equivalents as may be included within the scope of the
invention. Accordingly, the invention is limited only by the
following claims.
Sequence CWU 1
1
34124DNAMorone chrysops 1gagatgccag tggaatcgtg gaag 24223DNAMorone
chrysops 2gaggctggag caggaatcct cag 23375DNAMorone chrysops
3ggatccgaga tgccagtgga atcgtggaag ttgctgcatt gctgtcctaa tatgagcgga
60tgtggtgtct gctgc 75464DNAMorone chrysops 4ggatccgagg ctggagcagg
aatcctcaga acctgcagca gacaccacat ccgctcatat 60tagg 64520DNAMorone
chrysops 5gttcgattcc ggagagggag 20621DNAMorone chrysops 6ccttccttgg
atgtggtagc c 217576DNAMorone chrysops 7atcagacagg agaagaagtc
aaaggagctg acaagagtca ccaaaagagt gaaagaattg 60aaaccttaaa gcagtcaaac
cctcctaaga tgaagacatt cagtgttgca gttgcagtgg 120ccgtcgtgct
cgccttcatt tgccttcagg agagctctgc tgtcccagtc actgaggtgc
180aagagctgga ggagccaatg agcaatgagt atcaagagat gccagtggaa
tcgtggaaga 240tgccgtataa caacagacac aagcgtcaca gcagccccgg
tggctgtcgc ttttgctgca 300attgctgtcc taatatgagc ggatgtggtg
tctgctgcag gttctgagga ttcctgctcc 360agcctgggat taacacaact
actacttaaa ctttttaact caatgttaca ttttcactgt 420actcctggtt
gtaaatatct gaggatgtta ctggagttca tggttgctca gtaatgtgat
480tgaatcatct aaacactgtg tttaatttct gcagatttta ctgtgtattg
tcataataaa 540gttcaatttc actgaaaaaa aaaaaaaaaa aaaaaa
576885PRTMorone chrysops 8Met Lys Thr Phe Ser Val Ala Val Ala Val
Ala Val Val Leu Ala Phe1 5 10 15Ile Cys Leu Gln Glu Ser Ser Ala Val
Pro Val Thr Glu Val Gln Glu 20 25 30Leu Glu Glu Pro Met Ser Asn Glu
Tyr Gln Glu Met Pro Val Glu Ser 35 40 45Trp Lys Met Pro Tyr Asn Asn
Arg His Lys Arg His Ser Ser Pro Gly 50 55 60Gly Cys Arg Phe Cys Cys
Asn Cys Cys Pro Asn Met Ser Gly Cys Gly65 70 75 80Val Cys Cys Arg
Phe 85924PRTAcanthopagrus schegelii 9Ser Pro Lys Asp Cys Gln Phe
Cys Cys Gly Cys Cys Pro Asp Met Ser1 5 10 15Gly Cys Gly Ile Cys Cys
Thr Tyr 201024PRTAcanthopagrus schegelii 10Ser Pro Ala Gly Cys Arg
Phe Cys Cys Gly Cys Cys Pro Asn Met Arg1 5 10 15Gly Cys Gly Val Cys
Cys Arg Phe 201122PRTAcanthopagrus schegelii 11Arg Arg Cys Arg Phe
Cys Cys Gly Cys Cys Pro Asp Met Ile Gly Ser1 5 10 15Gly Thr Cys Cys
Lys Phe 201224PRTAcanthopagrus schegelii 12Ser Pro Lys Asp Cys Gln
Phe Cys Cys Gly Cys Cys Pro Asp Met Ser1 5 10 15Gly Cys Gly Ile Cys
Cys Arg Phe 201322PRTAcanthopagrus schegelii 13Ala Ile Lys Cys Lys
Phe Cys Cys Gly Cys Cys Ile Pro Gly Val Cys1 5 10 15Gly Leu Cys Cys
Arg Phe 201422PRTAcanthopagrus schegelii 14Trp Arg Cys Arg Phe Cys
Cys Arg Cys Cys Pro Arg Met Arg Gly Cys1 5 10 15Gly Leu Cys Cys Arg
Phe 201521PRTAcanthopagrus schegelii 15Arg Cys Lys Phe Cys Cys Arg
Cys Cys Pro Asn Met Ile Gly Gly Gly1 5 10 15Thr Cys Cys Lys Phe
201625PRTDanio rerio 16Gln Ser His Leu Ser Leu Cys Arg Phe Cys Cys
Lys Cys Cys Arg Asn1 5 10 15Lys Gly Cys Gly Tyr Cys Cys Lys Phe 20
251725PRTFundulus 17Gln Ser His Leu Ser Leu Cys Arg Tyr Cys Cys Lys
Cys Cys Lys Asn1 5 10 15Lys Gly Cys Gly Phe Cys Cys Arg Phe 20
251822PRTLateolabrax japonicus 18Ala Ile Lys Cys Lys Phe Cys Cys
Gly Cys Cys Thr Pro Gly Val Cys1 5 10 15Gly Val Cys Cys Arg Phe
201921PRTMorone chrysops 19Gly Cys Arg Phe Cys Cys Asn Cys Cys Pro
Asn Met Ser Gly Cys Gly1 5 10 15Val Cys Cys Arg Phe
202022PRTOreochromis niloticus 20Gly Ile Lys Cys Arg Phe Cys Cys
Gly Cys Cys Thr Pro Gly Ile Cys1 5 10 15Gly Val Cys Cys Arg Phe
202123PRTPagrus major 21Trp Arg Cys Arg Phe Cys Cys Arg Cys Cys Pro
Arg Met Arg Gly Cys1 5 10 15Gly Leu Cys Cys Gln Arg Arg
202224PRTSalmo salar 22Thr Asn Phe Pro Ile Cys Leu Phe Cys Cys Lys
Cys Cys Lys Asn Ser1 5 10 15Ser Cys Gly Leu Cys Cys Ile Thr
202322PRTScophthalmus maximus 23Gly Met Lys Cys Lys Phe Cys Cys Asn
Cys Cys Asn Leu Asn Gly Cys1 5 10 15Gly Val Cys Cys Arg Phe
202426PRTScophthalmus maximus 24Gln Ser His Ile Ser Leu Cys Arg Trp
Cys Cys Asn Cys Cys Lys Ala1 5 10 15Asn Lys Gly Cys Gly Phe Cys Cys
Lys Phe 20 252522PRTScophthalmus maximus 25Ala Ile Lys Cys Lys Phe
Cys Cys Gly Cys Cys Thr Pro Gly Val Cys1 5 10 15Gly Val Cys Cys Arg
Phe 202626PRTTetraodon nigrovirdis 26Gln Ser His Leu His Leu Cys
Thr Leu Cys Cys Asn Cys Cys Lys Gly1 5 10 15Asn Lys Gly Cys Gly Phe
Cys Cys Lys Phe 20 252725PRTCanis familiaris 27Asp Thr His Phe Pro
Ile Cys Ile Phe Cys Cys Gly Cys Cys Lys Thr1 5 10 15Pro Lys Cys Gly
Leu Cys Cys Lys Thr 20 252825PRTHomo sapiens 28Asp Thr His Phe Pro
Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg1 5 10 15Ser Lys Cys Gly
Met Cys Cys Lys Thr 20 252925PRTMus musculus 29Asp Thr Asn Phe Pro
Ile Cys Ile Phe Cys Cys Lys Cys Cys Asn Asn1 5 10 15Ser Gln Cys Gly
Ile Cys Cys Lys Thr 20 253025PRTMus musculus 30Asp Ile Asn Phe Pro
Ile Cys Arg Phe Cys Cys Gln Cys Cys Asn Lys1 5 10 15Pro Ser Cys Gly
Ile Cys Cys Glu Glu 20 253125PRTPan troglodytes 31Asp Thr His Phe
Pro Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg1 5 10 15Ser Lys Cys
Gly Met Cys Cys Lys Thr 20 253225PRTPongo pygmaeus 32Asp Thr His
Phe Pro Ile Tyr Ile Phe Cys Cys Gly Cys Cys His Arg1 5 10 15Ser Lys
Cys Gly Met Cys Cys Lys Thr 20 253325PRTRattus norvegicus 33Asp Thr
Asn Phe Pro Ile Cys Leu Phe Cys Cys Lys Cys Cys Lys Asn1 5 10 15Ser
Ser Cys Gly Leu Cys Cys Ile Thr 20 253425PRTSus scrofa 34Asp Thr
His Phe Pro Ile Cys Ile Phe Cys Cys Gly Cys Cys Arg Lys1 5 10 15Ala
Ile Cys Gly Met Cys Cys Lys Thr 20 25
* * * * *