U.S. patent application number 12/740211 was filed with the patent office on 2011-10-13 for targeting micrornas for the treatment of liver cancer.
This patent application is currently assigned to Rosetta Genomics Ltd.. Invention is credited to C. Bennett, Ayelet Chajut, Christine Esau, Eric Marcusson, Noga Yerushalmi.
Application Number | 20110251150 12/740211 |
Document ID | / |
Family ID | 40524369 |
Filed Date | 2011-10-13 |
United States Patent
Application |
20110251150 |
Kind Code |
A2 |
Bennett; C. ; et
al. |
October 13, 2011 |
Targeting MicroRNAs For The Treatment Of Liver Cancer
Abstract
Provided herein are methods for the treatment of liver cancer.
These methods encompass the administration of a compound comprising
a modified oligonucleotide, wherein the modified oligonucleotide is
targeted to a miRNA. Also provided herein are compositions for the
treatment of liver cancer. Such compositions include compounds
comprising a modified oligonucleotide, wherein the modified
oligonucleotide is targeted to a miRNA. Certain miRNAs have been
identified as overexpressed in liver cancer, such as, for example,
hepatocellular carcinoma, and are thus selected for targeting by
modified oligonucleotides. Further, certain miRNAs have been
identified as overexpressed in hepatocellular carcinoma cells
exposed to dioxin, and are thus selected for targeting by modified
oligonucleotides. Antisense inhibition of certain of these miRNAs
has been found to inhibit cell proliferation and induce
apoptosis.
Inventors: |
Bennett; C.; (Carlsbad,
CA) ; Chajut; Ayelet; (Ramat Hasharon, IL) ;
Esau; Christine; (La Jolla, CA) ; Marcusson;
Eric; (San Francisco, CA) ; Yerushalmi; Noga;
(Nes Ziona, IL) |
Assignee: |
Rosetta Genomics Ltd.
Regulus Therapeutics Inc.
Carlsbad
CA
92008
10 Plaut Street
Rehovot
76706
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20100267814 A1 |
October 21, 2010 |
|
|
Family ID: |
40524369 |
Appl. No.: |
12/740211 |
Filed: |
October 29, 2008 |
PCT Filed: |
October 29, 2008 |
PCT NO: |
PCT/US2008/081645 |
371 Date: |
April 28, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60/983,231 |
Oct 29, 2007 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61K 31/4745 20130101;
A61K 45/06 20130101; C12N 2310/321 20130101; A61K 31/7068 20130101;
A61K 31/407 20130101; A61K 31/7048 20130101; A61K 31/704 20130101;
C12N 2310/141 20130101; A61P 35/00 20180101; A61K 31/555 20130101;
A61K 31/7105 20130101; C12N 2310/346 20130101; A61P 1/16 20180101;
A61K 31/513 20130101; C12N 2310/3525 20130101; A61P 35/04 20180101;
C12N 2310/315 20130101; C12N 2310/3341 20130101; A61K 31/44
20130101; C12N 2310/113 20130101; A61K 31/7088 20130101; C12N
2310/321 20130101; C12N 15/113 20130101 |
Class at
Publication: |
514/044.00R |
International
Class: |
A61K 31/7125 20060101
A61K031/7125; A61P 35/00 20060101 A61P035/00; A61K 31/7115 20060101
A61K031/7115; A61K 31/7088 20060101 A61K031/7088; A61K 31/712
20060101 A61K031/712 |
Claims
1. A method for treating liver cancer comprising administering to a
subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NO: 1,
2, 3, 4, 5, 6, 7, and 8; or to a sequence at least about 80%
identical thereto.
2. The method of claim 1, wherein the compound consists of a
modified oligonucleotide.
3. The method of claim 1 or 2, wherein the liver cancer is
hepatocellular carcinoma.
4. The method of any of claims 1-3, wherein the subject is a
human.
5. The method of any of claims 1-4, wherein the nucleobase sequence
of the modified oligonucleotide has no more than two mismatches to
a nucleobase sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7,
and 8.
6. The method of any of claims 1-4, wherein the nucleobase sequence
of the modified oligonucleotide has no more than one mismatch to a
nucleobase sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7,
and 8.
7. The method of any of claims 1-4, wherein the nucleobase sequence
of the modified oligonucleotide has one mismatch to a nucleobase
sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
8. The method of any of claims 1-4, wherein the nucleobase sequence
of the modified oligonucleotide has no mismatches to a nucleobase
sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
9. The method of any of claims 1-8, wherein at least one
internucleoside linkage is a modified internucleoside linkage.
10. The method of any of claims 1-9, wherein each internucleoside
linkage is a modified internucleoside linkage.
11. The method of any of claims 1-10, wherein at least one
internucleoside linkage is a phosphorothioate internucleoside
linkage.
12. The method of any of claims 1-11, wherein each internucleoside
linkage is a phosphorothioate internucleoside linkage.
13. The method of any of claims 1-12, wherein at least one
nucleoside comprises a modified sugar.
14. The method of any of claims 1-13, wherein each of a plurality
of nucleosides comprises a modified sugar.
15. The method of any of claims 1-14, wherein each nucleoside
comprises a modified sugar.
16. The method of any of claims 1-15, wherein each nucleoside
comprises a 2'-O-methoxyethyl sugar.
17. The method of any claims 1-15, wherein each of a plurality of
nucleosides comprises a 2'-O-methoxyethyl sugar and each of a
plurality of nucleosides comprises a 2'-fluoro sugar
modification.
18. The method of claim 15, wherein each modified sugar is
independently selected from a 2'-O-methoxyethyl sugar, a 2'-fluoro
sugar, 2'-O-methyl sugar, or a bicyclic sugar moiety.
19. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 15 linked nucleosides.
20. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 16 linked nucleosides.
21. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 17 linked nucleosides.
22. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 18 linked nucleosides.
23. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 19 linked nucleosides.
24. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 20 linked nucleosides.
25. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 21 linked nucleosides.
26. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 22 linked nucleosides.
27. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 23 linked nucleosides.
28. The method of any of claims 1-18, wherein the modified
oligonucleotide consists of 24 linked nucleosides.
29. The method of any of claims 1-28, wherein the administering
comprises intravenous administration, subcutaneous administration,
intratumoral administration, or chemoembolization.
30. The method of any of claims 1-29, further comprising
administering at least one additional therapy.
31. The method of claim 30, wherein the at least one additional
therapy is a chemotherapeutic agent.
32. The method of claim 31, wherein the chemotherapeutic agent is
selected from 5-fluorouracil, gemcitabine, doxorubicine, mitomycin
c, sorafenib, etoposide, carboplatin, epirubicin, irinotecan and
oxaliplatin.
33. The method of any of claims 30-32, wherein the at least one
additional therapy is administered at the same time as the modified
oligonucleotide.
34. The method of any of claims 30-32, wherein the at least one
additional therapy is administered less frequently than the
modified oligonucleotide.
35. The method of any of claims 30-32, wherein the at least one
additional therapy is administered more frequently than the
modified oligonucleotide.
36. The method of any of claims 1-35, wherein the modified
oligonucleotide is administered at a dose selected from 50, 75,
100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400,
425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725,
750, 775, and 800 mg.
37. The method of any of claims 1-36, wherein the modified
oligonucleotide is administered one per day, once per week, once
per two weeks, once per three weeks, or once per four weeks.
38. The method of any of claims 1-37, wherein the administering
results in reduction of tumor size.
39. The method of any of claims 1-38, wherein the administering
results in reduction of tumor number.
40. The method of any of claims 1-39, wherein the administering
prevents an increase in tumor size.
41. The method of any of claims 1-40, wherein the administering
prevents an increase in tumor number.
42. The method of any of claims 1-41, wherein the administering
prevents metastatic progression.
43. The method of any of claims 1-42, wherein the administering
slows or stops metastatic progression.
44. The method of any of claims 1-43, wherein the administering
extends overall survival time of the subject.
45. The method of any of claims 1-44, wherein the administering
extends progression-free survival of the subject.
46. The method of any of claims 1-45, further comprising selecting
a subject having liver lesions.
47. The method of any of claims 1-46, further comprising selecting
a subject having elevated serum alpha-fetoprotein or elevated serum
des-gamma-carboxyprothrombin.
48. The method of any of claims 1-47, wherein the administering
reduces serum alpha-fetoprotein or serum
des-gamma-carboxyprothrombin.
49. The method of any of claims 1-48, further comprising selecting
a subject having abnormal liver function.
50. The method of any of claims 1-49, wherein the administering
improves liver function in the subject.
51. A compound comprising a modified oligonucleotide consisting of
15 to 30 linked nucleosides and having a nucleobase sequence that
is complementary to a nucleobase sequence selected from SEQ ID NO:
1, 2, 3, 4, 5, 6, 7, and 8; or to a sequence at least about 80%
identical thereto.
52. The compound of claim 51, wherein the compound consists of a
modified oligonucleotide.
53. The compound of claim 51 or 52, wherein the modified
oligonucleotide has no more than two mismatches to a sequence
selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
54. The compound of claim 51 or 52, wherein the modified
oligonucleotide has no more than one mismatch to the sequence
selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
55. The compound of claim 51 or 52, wherein the modified
oligonucleotide has one mismatch to a sequence selected from SEQ ID
NO: 1, 2, 3, 4, 5, 6, 7, and 8.
56. The compound of claim 51 or 52, wherein the modified
oligonucleotide has no mismatches to a sequence selected from SEQ
ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
57. The compound of any of claims 51-56, wherein at least one
internucleoside linkage is a modified internucleoside linkage.
58. The compound of any of claims 51-57, wherein each
internucleoside linkage is a modified internucleoside linkage.
59. The compound of any of claims 51-58, wherein at least one
internucleoside linkage is a phosphorothioate internucleoside
linkage.
60. The compound of any of claims 51-59, wherein each
internucleoside linkage is a phosphorothioate internucleoside
linkage.
61. The compound of any of claims 51-60, wherein at least one
nucleoside comprises a modified sugar.
62. The compound of any of claims 51-61, wherein each of a
plurality of nucleosides comprises a modified sugar.
63. The compound of any of claims 51-62, wherein each nucleoside
comprises a modified sugar.
64. The compound of any of claims 51-63, wherein each nucleoside
comprises a 2'-O-methoxyethyl sugar.
65. The compound of any of claims 51-63, wherein each of a
plurality of nucleosides comprises a 2'-O-methoxyethyl sugar and
each of a plurality of nucleosides comprises a 2'-fluoro sugar.
66. The compound of claim 62 or 63, wherein each modified sugar is
independently selected from a 2'-O-methoxyethyl sugar, a 2'-fluoro
sugar, a 2'-O-methyl sugar, or a bicyclic sugar moiety.
67. The compound of any of claims 51-66, wherein at least one
nucleoside comprises a modified nucleobase.
68. The compound of any of claim 67, wherein the modified
nucleobase is a 5-methylcytosine.
69. The compound of any of claims 51-68, wherein at least one
nucleoside comprises a cytosine, wherein the cytosine is a
5-methylcytosine.
70. The compound of any of claim 69, wherein each cytosine is a
5-methylcytosine.
71. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 15 linked nucleosides.
72. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 16 linked nucleosides.
73. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 17 linked nucleosides.
74. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 18 linked nucleosides.
75. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 19 linked nucleosides.
76. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 20 linked nucleosides.
77. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 21 linked nucleosides.
78. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 22 linked nucleosides.
79. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 23 linked nucleosides.
80. The compound of any of claims 51-70, wherein the modified
oligonucleotide consists of 24 linked nucleosides.
81. A method for treating liver cancer comprising administering to
a subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.
82. The method of claim 81, wherein the compound consists of a
modified oligonucleotide.
83. The method of claim 81 or 82, wherein the liver cancer is
hepatocellular carcinoma.
84. The method of any of claims 81-83, wherein the subject is a
human.
85. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 16
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
86. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 17
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
87. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 18
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
88. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 19
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
89. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 20
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
90. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 21
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
91. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 22
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
92. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 23
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
93. The method of any of claims 81-84, wherein the modified
oligonucleotide has a nucleobase sequence consisting of a
nucleobase sequence selected from among the nucleobase sequences
recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, and 30
94. The method of any of claims 81-93, wherein the compound
consists of a modified oligonucleotide.
95. The method of any of claims 81-94, wherein at least one
internucleoside linkage is a modified internucleoside linkage.
96. The method of any of claims 81-95, wherein each internucleoside
linkage is a modified internucleoside linkage.
97. The method of any of claims 81-96, wherein at least one
internucleoside linkage is a phosphorothioate internucleoside
linkage.
98. The method of any of claims 81-97, wherein each internucleoside
linkage is a phosphorothioate internucleoside linkage.
99. The method of any of claims 81-98, wherein at least one
nucleoside comprises a modified sugar.
100. The method of any of claims 81-99, wherein each of a plurality
of nucleosides comprises a modified sugar.
101. The method of any of claims 81-100, wherein each nucleoside
comprises a modified sugar.
102. The method of any of claims 81-101, wherein each nucleoside
comprises a 2'-O-methoxyethyl sugar.
103. The method of any of claims 81-102, wherein each of a
plurality of nucleosides comprises a 2'-O-methoxyethyl sugar and
each of a plurality of nucleosides comprises a 2'-fluoro sugar.
104. The method of claim 100 or 101, wherein each modified sugar is
independently selected from a 2'-O-methoxyethyl sugar, a 2'-fluoro
sugar, a 2'-O-methyl sugar, or a bicyclic sugar moiety.
105. The method of any of claims 81-104, wherein at least one
nucleoside comprises a modified nucleobase.
106. The method of any of claims 81-105, wherein the modified
nucleobase is a 5-methylcytosine.
107. The method of any of claims 81-106, wherein at least one
nucleoside comprises a cytosine, wherein the cytosine is a
5-methylcytosine.
108. The method of any of claims 81-107, wherein each cytosine is a
5-methylcytosine.
109. The method of any of claims 81-108, wherein the administering
comprises intravenous administration, subcutaneous administration,
intratumoral administration, or embolization.
110. The method of any of claims 81-109, further comprising
administering at least one additional therapy.
111. The method of any of claim 110, wherein the at least one
additional therapy is a chemotherapeutic agent.
112. The method of claim 111, wherein the chemotherapeutic agent is
selected from 5-fluorouracil, gemcitabine, doxorubicine, mitomycin
c, sorafenib, etoposide, carboplatin, epirubicin, irinotecan and
oxaliplatin.
113. The method of any of claims 110-112, wherein the at least one
additional therapy is administered at the same time as the
oligonucleotide.
114. The method of any of claims 110-112, wherein the at least one
additional therapy is administered less frequently than the
oligonucleotide.
115. The method of any of claims 110-112, wherein the at least one
additional therapy is administered more frequently than the
oligonucleotide.
116. The method of any of claims 81-115, wherein the modified
oligonucleotide is administered at a dose selected from 50, 75,
100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400,
425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725,
750, 775, and 800 mg.
117. The method of any of claims 81-116, wherein the modified
oligonucleotide is administered one per day, once per week, once
per two weeks, once per three weeks, or once per four weeks.
118. The method of any of claims 81-117, wherein the administering
results in reduction of tumor size.
119. The method of any of claims 81-118, wherein the administering
results in reduction of tumor number.
120. The method of any of claims 81-119, wherein the administering
prevents an increase in tumor size.
121. The method of any of claims 81-120, wherein the administering
prevents an increase in tumor number.
122. The method of any of claims 81-121, wherein the administering
prevents metastatic progression.
123. The method of any of claims 81-122, wherein the administering
slows metastatic progression.
124. The method of any of claims 81-123, wherein the administering
extends overall survival time of the animal.
125. The method of any of claims 81-124, wherein the administering
extends progression-free survival of the animal.
126. The method of any of claims 81-125, further comprising
selecting an animal having liver lesions.
127. The method of any of claims 81-126, further comprising
selecting an animal having elevated serum alpha-fetoprotein or
elevated serum des-gamma-carboxyprothrombin.
128. The method of any of claims 81-127, wherein the administering
reduces serum alpha-fetoprotein or serum
des-gamma-carboxyprothrombin.
129. The method of any of claims 81-128, further comprising
selecting an animal having abnormal liver function.
130. The method of any of claims 81-129, wherein the administering
improves liver function in the animal.
131. A compound comprising a modified oligonucleotide consisting of
15 to 30 linked nucleosides and having a nucleobase sequence
comprising at least 15 contiguous nucleobases of a nucleobase
sequence selected from among the nucleobase sequences recited in
SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and
30.
132. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 16
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
133. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 17
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
134. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 18
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
135. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 19
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
136. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 20
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
137. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 21
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
138. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 22
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
139. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence comprising at least 23
contiguous nucleobases of a nucleobase sequence selected from among
the nucleobase sequences recited in SEQ ID NOs 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, and 30.
140. The compound of claim 131, wherein the modified
oligonucleotide has a nucleobase sequence consisting of a
nucleobase sequence selected from among the nucleobase sequences
recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, and 30.
141. The compound of any of claims 131-140, wherein the compound
consists of a modified oligonucleotide.
142. The compound of any of claims 131-141, wherein at least one
internucleoside linkage is a modified internucleoside linkage.
143. The compound of any of claims 131-142, wherein each
internucleoside linkage is a modified internucleoside linkage.
144. The compound of any of claims 131-143, wherein at least one
internucleoside linkage is a phosphorothioate internucleoside
linkage.
145. The compound of any of claims 131-144, wherein each
internucleoside linkage is a phosphorothioate internucleoside
linkage.
146. The compound of any of claims 131-145, wherein at least one
nucleoside comprises a modified sugar.
147. The compound of any of claims 131-146, wherein each of a
plurality of nucleosides comprises a modified sugar.
148. The compound of any of claims 131-147, wherein each nucleoside
comprises a modified sugar.
149. The compound of any of claims 131-148, wherein each nucleoside
comprises a 2'-O-methoxyethyl sugar.
150. The compound of any of claims 131-149, wherein each of a
plurality of nucleosides comprises a 2'-O-methoxyethyl and each of
a plurality of nucleosides comprises a 2'-fluoro sugar.
151. The compound of claim 147 or 148, wherein each modified sugar
is independently selected from a 2'-O-methoxyethyl sugar, a
2'-fluoro sugar, a 2'-O-methyl sugar, or a bicyclic sugar
moiety.
152. The compound of any of claims 131-151, wherein at least one
nucleoside comprises a modified nucleobase.
153. The compound of any of claim 152, wherein the modified
nucleobase is a 5-methylcytosine.
154. The compound of any of claims 131-153, wherein at least one
nucleoside comprises a cytosine, wherein the cytosine is a
5-methylcytosine.
155. The compound of claim 154, wherein each cytosine is a
5-methylcytosine.
156. A pharmaceutical composition comprising a compound recited in
any of claims 51-80 or a salt thereof and a pharmaceutically
acceptable carrier or diluent.
157. The pharmaceutical composition of claim 156, wherein the
compound consists of a modified oligonucleotide.
158. A pharmaceutical composition comprising a compound recited in
any of claims 131-155 or a salt thereof and a pharmaceutically
acceptable carrier or diluent.
159. The pharmaceutical composition of claim 158, wherein the
compound consists of a modified oligonucleotide.
160. The method of any of claims 1-50, wherein the modified
oligonucleotide has a nucleobase sequence that is complementary to
a nucleobase sequence selected from the region of nucleobases 8-29
of SEQ ID NO: 1; the region of nucleobases 15-37 of SEQ ID NO: 2;
the region of nucleobases 15-38 of SEQ ID NO: 2; the region of
nucleobases 16-37 of SEQ ID NO: 3; the region of nucleobases 66-87
of SEQ ID NO: 4; the region of nucleobases 69-89 of SEQ ID NO: 5;
the region of nucleobases 69-91 of SEQ ID NO: 5; the region of
nucleobases 43-63 of SEQ ID NO: 6; the region of nucleobases 44-65
of SEQ ID NO: 6; the region of nucleobases 53-75 of SEQ ID NO: 7;
the region of nucleobases 53-74 of SEQ ID NO: 7; and the region of
nucleobases 16-40 of SEQ ID NO: 8.
161. The method of any of claims 1-50, wherein the modified
oligonucleotide has a nucleobase sequence that is complementary to
a nucleobase sequence selected from the nucleobase sequences
recited in SEQ ID NOs 9, 10, 11, 12, 13, 14, 15, and 16.
162. The compound of any of claims 51-80, wherein the modified
oligonucleotide has a nucleobase sequence that is complementary to
a nucleobase sequence selected from the region of nucleobases 8-29
of SEQ ID NO: 1; the region of nucleobases 15-37 of SEQ ID NO: 2;
the region of nucleobases 15-38 of SEQ ID NO: 2; the region of
nucleobases 16-37 of SEQ ID NO: 3; the region of nucleobases 66-87
of SEQ ID NO: 4; the region of nucleobases 69-89 of SEQ ID NO: 5;
the region of nucleobases 69-91 of SEQ ID NO: 5; the region of
nucleobases 43-63 of SEQ ID NO: 6; the region of nucleobases 44-65
of SEQ ID NO: 6; the region of nucleobases 53-75 of SEQ ID NO: 7;
the region of nucleobases 53-74 of SEQ ID NO: 7; and the region of
nucleobases 16-40 of SEQ ID NO: 8.
163. The compound of any of claims 51-80, wherein the modified
oligonucleotide has a nucleobase sequence that is complementary to
a nucleobase sequence selected from the nucleobase sequences
recited in SEQ ID NOs 9, 10, 11, 12, 13, 14, 15, and 16.
164. A method for treating a dioxin induced liver cancer comprising
administering to a subject in need thereof a compound comprising a
modified oligonucleotide consisting of 15 to 30 linked nucleosides,
wherein the modified oligonucleotide has a nucleobase sequence that
is complementary to a sequence selected from SEQ ID NO: 31, 32, 33,
34, 35, 36, 37, 38, 39, or 40; or to a sequence at least about 80%
identical thereto.
165. A method for preventing a dioxin induced liver cancer
comprising administering to a subject in need thereof a compound
comprising a modified oligonucleotide consisting of 15 to 30 linked
nucleosides, wherein the modified oligonucleotide has a nucleobase
sequence that is complementary to a sequence selected from SEQ ID
NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40; or to a sequence at
least about 80% identical thereto.
166. A method for preventing a dioxin induced liver cancer
comprising administering to a subject in need thereof a compound
comprising a modified oligonucleotide consisting of 15 to 30 linked
nucleosides, wherein the modified oligonucleotide has a nucleobase
sequence comprising at least 15 contiguous nucleobases of a
nucleobase sequence selected from among the nucleobase sequences
recited in SEQ ID NOs 38, 39, and 40; or to a sequence at least
about 80% identical thereto.
167. The method of any of claims 164-166, wherein the dioxin
induced liver cancer is hepatocellular carcinoma.
168. The method of any of claims 164-167, wherein the subject is a
human.
169. The method of any of claims 164-168, wherein the administering
comprises intravenous administration, subcutaneous administration,
intratumoral administration, or chemoembolization.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority under 35 U.S.C.
.sctn.119(e) to U.S. Provisional Application No. 60/983,231, filed
Oct. 29, 2007 which is herein incorporated by reference in its
entirety.
INCORPORATION OF SEQUENCE LISTING
[0002] The present application is filed with a Sequence Listing in
electronic format. The Sequence Listing is provided as a file
entitled REG0003WOSEQ.txt created on Oct. 29, 2008 which is 8 Kb in
size. The information in the electronic format of the sequence
listing is incorporated herein by reference in its entirety.
FIELD OF INVENTION
[0003] Provided herein are methods and compositions for the
treatment of liver cancer, including but not limited to
hepatocellular carcinoma. Provided herein are also methods and
compositions for the treatment of dioxin induced liver cancer,
including but not limited to dioxin induced hepatocellular
carcinoma. Such methods comprise administering a compound
comprising a modified oligonucleotide targeted to a miRNA.
DESCRIPTION OF RELATED ART
[0004] MicroRNAs (miRNAs), also known as "mature miRNA" are small
(approximately 18-24 nucleotides in length), non-coding RNA
molecules encoded in the genomes of plants and animals. In certain
instances, highly conserved, endogenously expressed miRNAs regulate
the expression of genes by binding to the 3'-untranslated regions
(3'-UTR) of specific mRNAs. More than 1000 different miRNAs have
been identified in plants and animals. Certain mature miRNAs appear
to originate from long endogenous primary miRNA transcripts (also
known as pri-miRNAs, pri-mirs, pri-miRs or pri-pre-miRNAs) that are
often hundreds of nucleotides in length (Lee, et al., EMBO J.,
2002, 21(17), 4663-4670).
[0005] Functional analyses of miRNAs have revealed that these small
non-coding RNAs contribute to different physiological processes in
animals, including developmental timing, organogenesis,
differentiation, patterning, embryogenesis, growth control and
programmed cell death. Examples of particular processes in which
miRNAs participate include stem cell differentiation, neurogenesis,
angiogenesis, hematopoiesis, and exocytosis (reviewed by
Alvarez-Garcia and Miska, Development, 2005, 132, 4653-4662). In
some instances, miRNAs are thought to exercise post-transcriptional
control in most eukaryotic organisms and have been detected in
plants and animals as well as certain viruses.
[0006] Families of miRNAs can be characterized by nucleotide
identity at positions 2-8 of the miRNA, a region known as the seed
sequence. Lewis et al. describe several miRNA families, as well as
miRNA superfamilies, which are characterized by related seed
sequences (Lewis et al. Cell. 2005, 120(1):15-20).
SUMMARY OF INVENTION
[0007] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to a
subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NO: 1,
2, 3, 4, 5, 6, 7, and 8; or to a sequence at least 80% identical
thereto.
[0008] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to the
subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides and
having a nucleobase sequence that is complementary to a nucleobase
sequence selected from SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, and
16; or to a nucleobase sequence at least 80% identical thereto.
[0009] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to a
subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30; or a
sequence at least 80% identical thereto.
[0010] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to a
subject in need thereof a pharmaceutical composition comprising a
modified oligonucleotide consisting of 15 to 30 linked nucleosides,
wherein the modified oligonucleotide has a nucleobase sequence that
is complementary to a nucleobase sequence selected from SEQ ID NO:
1, 2, 3, 4, 5, 6, 7, and 8; or to a sequence at least 80% identical
thereto.
[0011] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to the
subject in need thereof a pharmaceutical composition comprising a
modified oligonucleotide consisting of 15 to 30 linked nucleosides
and having a nucleobase sequence that is complementary to a
nucleobase sequence selected from SEQ ID NOs: 9, 10, 11, 12, 13,
14, 15, and 16; or to a nucleobase sequence at least 80% identical
thereto.
[0012] In certain embodiments, the present invention provides
methods for treating liver cancer, comprising administering to a
subject in need thereof a pharmaceutical composition comprising a
modified oligonucleotide consisting of 15 to 30 linked nucleosides,
wherein the modified oligonucleotide has a nucleobase sequence
comprising at least 15 contiguous nucleobases of a nucleobase
sequence selected from among the nucleobase sequences recited in
SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and
30; or a sequence at least 80% identical thereto.
[0013] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides, wherein the modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8; or to a
sequence at least 80% identical thereto, for use in treating liver
cancer.
[0014] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides, wherein the modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
selected from SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, and 16; or to a
sequence at least 80% identical thereto, for use in treating liver
cancer.
[0015] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides, wherein the modified oligonucleotide has a
nucleobase sequence comprising at least 15 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30; or to a sequence at least 80% identical
thereto, for use in treating liver cancer.
[0016] In certain embodiments, the invention provides methods for
treating a dioxin induced liver cancer comprising administering to
a subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence that is
complementary to a sequence selected from SEQ ID NO: 31, 32, 33,
34, 35, 36, and 37; or to a sequence at least about 80% identical
thereto.
[0017] In certain embodiments, the invention provides a compound
comprising a modified oligonucleotide consisting of 15 to 30 linked
nucleosides, wherein the modified oligonucleotide has a nucleobase
sequence that is complementary to a sequence selected from SEQ ID
NO: 31, 32, 33, 34, 35, 36, and 37; or to a sequence at least about
80% identical thereto, for use in treating a dioxin induced liver
cancer.
[0018] In certain embodiments, the invention provides methods for
treating a dioxin induced liver cancer comprising administering to
a subject in need thereof a compound comprising a modified
oligonucleotide consisting of 15 to 30 linked nucleosides, wherein
the modified oligonucleotide has a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
38, 39, and 40; or to a sequence at least about 80% identical
thereto.
[0019] In certain embodiments, the invention provides a compound
comprising a modified oligonucleotide consisting of 15 to 30 linked
nucleosides, wherein the modified oligonucleotide has a nucleobase
sequence comprising at least 15 contiguous nucleobases of a
nucleobase sequence selected from among the nucleobase sequences
recited in SEQ ID NOs 38, 39, and 40; or to a sequence at least
about 80% identical thereto, for use in treating a dioxin induced
liver cancer.
[0020] In certain embodiments, the dioxin induced liver cancer is
hepatocellular carcinoma.
[0021] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NO: 1,
2, 3, 4, 5, 6, 7, and 8; or to a sequence at least about 80%
identical thereto.
[0022] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NO: 1,
2, 3, 4, 5, 6, 7, and 8; or to a sequence at least about 80%
identical thereto, for use in treating liver cancer.
[0023] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NOs: 9,
10, 11, 12, 13, 14, 15, and 16; or to a sequence at least about 80%
identical thereto.
[0024] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence that is
complementary to a nucleobase sequence selected from SEQ ID NOs: 9,
10, 11, 12, 13, 14, 15, and 16; or to a sequence at least about 80%
identical thereto, for use in treating liver cancer.
[0025] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.
[0026] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30, for use
in treating liver cancer.
[0027] In certain embodiments, the present invention provides a
compound comprising a modified oligonucleotide consisting of 15 to
30 linked nucleosides and having a nucleobase sequence comprising
at least 15 contiguous nucleobases of a nucleobase sequence
selected from among the nucleobase sequences recited in SEQ ID NOs
38, 39, and 40, for use in treating liver cancer.
[0028] In certain embodiments, the present invention provides a
pharmaceutical composition comprising a modified oligonucleotide of
the invention or a salt thereof and a pharmaceutically acceptable
carrier or diluent.
[0029] In certain embodiments, the compound consists of a modified
oligonucleotide.
[0030] In certain embodiments, the modified oligonucleotide
consists of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 linked
nucleosides.
[0031] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has no more than two mismatches to a
nucleobase sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7,
and 8. In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has no more than one mismatch to a
nucleobase sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7,
and 8. In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has one mismatch to a nucleobase sequence
selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8. In certain
embodiments, the nucleobase sequence of the modified
oligonucleotide has no mismatches to a nucleobase sequence selected
from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, and 8.
[0032] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has no more than two mismatches to a
nucleobase sequence selected from SEQ ID NOs: 9, 10, 11, 12, 13,
14, 15, and 16. In certain embodiments, the nucleobase sequence of
the modified oligonucleotide has no more than one mismatch to a
nucleobase sequence selected from SEQ ID NOs: 9, 10, 11, 12, 13,
14, 15, and 16. In certain embodiments, the nucleobase sequence of
the modified oligonucleotide has one mismatch to a nucleobase
sequence selected from SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, and
16. In certain embodiments, the nucleobase sequence of the modified
oligonucleotide has no mismatches to a nucleobase sequence selected
from SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, and 16.
[0033] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has no more than two mismatches to a
nucleobase sequence selected from SEQ ID NOs: 31, 32, 33, 34, 35,
36, and 37. In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has no more than one mismatch to a
nucleobase sequence selected from SEQ ID NOs: 31, 32, 33, 34, 35,
36, and 37. In certain embodiments, the nucleobase sequence of the
modified oligonucleotide has one mismatch to a nucleobase sequence
selected from SEQ ID NOs: 31, 32, 33, 34, 35, 36, and 37. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide has no mismatches to a nucleobase sequence selected
from SEQ ID NOs: 31, 32, 33, 34, 35, 36, and 37.
[0034] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 16 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0035] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 17 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0036] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 18 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0037] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 19 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0038] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 20 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0039] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 21 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0040] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 22 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0041] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 23 contiguous nucleobases
of a nucleobase sequence selected from among the nucleobase
sequences recited in SEQ ID NOs 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, and 30.
[0042] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence consisting of a nucleobase sequence selected
from among the nucleobase sequences recited in SEQ ID NOs 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.
[0043] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising at least 16, at least 17, at least
18, at least 19, at least 20, at least 21, at least 22, or at least
23 contiguous nucleobases of a nucleobase sequence from among the
nucleobase sequences recited in SEQ ID Nos 38, 39, and 40.
[0044] In certain embodiments, the modified oligonucleotide
comprises one or more modified sugars, internucleoside linkages, or
nucleobases. In certain embodiments, at least one internucleoside
linkage is a modified internucleoside linkage. For example, at
least one internucleoside linkage may be a phosphorothioate
internucleoside linkage. In certain embodiments, each
internucleoside linkage is a modified internucleoside linkage. For
example, each internucleoside linkage may be a phosphorothioate
internucleoside linkage.
[0045] In certain embodiments, at least one nucleoside of the
modified oligonucleotide comprises a modified sugar. In certain
embodiments, each of a plurality of nucleosides comprises a
modified sugar. In certain embodiments, each nucleoside of the
modified oligonucleotide comprises a modified sugar. In each of
these embodiments, the modified sugar may be a 2'-O-methoxyethyl
sugar, a 2'-fluoro sugar, a 2'-O-methyl sugar, or a bicyclic sugar
moiety. In certain embodiments, each of a plurality of nucleosides
comprises a 2'-O-methoxyethyl sugar and each of a plurality of
nucleosides comprises a 2'-fluoro sugar.
[0046] In certain embodiments, the modified oligonucleotide
comprises at least one modified nucleobase. In certain such
embodiments, the modified nucleobase is a 5-methylcytosine. In
certain embodiments, at least one nucleoside comprises a cytosine,
wherein the cytosine is a 5-methylcytosine. In certain such
embodiments, each cytosine is a 5-methylcytosine.
[0047] In certain embodiments, the liver cancer is hepatocellular
carcinoma. In certain embodiments, the subject is a human. In
certain embodiments, the hepatocellular carcinoma is
dioxin-induced.
[0048] In certain embodiments, administration of a compound of the
invention comprises intravenous administration, subcutaneous
administration, intratumoral administration, or
chemoembolization.
[0049] In certain embodiments, the methods of the present invention
further comprise administering at least one additional therapy. The
additional therapy may be a chemotherapeutic agent. The
chemotherapeutic agent may be selected from 5-fluorouracil,
gemcitabine, doxorubicine, mitomycin c, sorafenib, etoposide,
carboplatin, epirubicin, irinotecan and oxaliplatin. The additional
therapy may be administered at the same time, less frequently, or
more frequently than a compound or pharmaceutical composition of
the invention.
[0050] In certain embodiments, the modified oligonucleotide is
administered at a dose selected from 50, 75, 100, 125, 150, 175,
200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500,
525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, and 800 mg.
The modified oligonucleotide may be administered one per day, once
per week, once per two weeks, once per three weeks, or once per
four weeks.
[0051] In certain embodiments, the administration of a compound of
the invention results in reduction of liver tumor size and/or liver
tumor number. In certain embodiments, the administration of a
compound of the invention prevents an increase in tumor size and/or
tumor number. In certain embodiments, the administration of a
compound of the invention prevents, slows, and/or stops metastatic
progression. In certain embodiments, the administration of a
compound of the invention extends the overall survival time of the
subject. In certain embodiments, the administration of a compound
of the invention extends the progression-free survival of the
subject. In certain embodiments, administration of a compound of
the invention prevents the recurrence of liver tumors. In certain
embodiments, administration of a compound of the invention prevents
recurrence of liver tumor metastasis. In certain embodiments,
administration of a compound of the invention prevents recurrence
of HCC-derived tumors. In certain embodiments, administration of a
compound of the invention prevents recurrence of HCC-derived tumor
metastasis.
[0052] In certain embodiments, a subject selected for treatment for
liver cancer has liver lesions. In certain embodiments, a subject
selected for treatment for liver cancer has elevated serum
alpha-fetoprotein and/or elevated serum
des-gamma-carboxyprothrombin. In certain embodiments, a subject
selected for treatment of liver cancer has abnormal liver
function.
[0053] In certain embodiments, administration of a compound of the
invention reduces serum alpha-fetoprotein and/or serum
des-gamma-carboxyprothrombin in a subject having liver cancer. In
certain embodiments, levels of serum alpha-fetoprotein and/or serum
des-gamma-carboxyprothrombin are measured to assess therapeutic
efficacy. In certain embodiments, administration of a compound of
the invention improves liver function of the subject.
[0054] These and other embodiments of the present invention will
become apparent in conjunction with the figures, description and
claims that follow.
BRIEF DESCRIPTION OF DRAWINGS
[0055] FIG. 1. Differential expression analysis of miRNAs in liver
tumor samples compared to normal liver tissue samples. Data points
having significant p-values are enclosed by red circles. Certain
miRNA targets that were later selected for further study are
represented by filled yellow circles. These miRNA targets include
miR-21, miR-125a-5p (labeled as miR-125a), miR-191, miR-210,
miR-222, miR-378 (labeled as miR-422b), miR-423-3p, and
miR-638.
[0056] FIG. 2. Inhibition of cell proliferation in liver cancer
cell lines following treatment with modified oligonucleotides
targeted to miRNAs. Proliferation of both SNU423 (FIG. 2A) and
Hep3B (FIG. 2B) cell lines was tested after transfection with
modified oligonucleotides. A proliferation assay was performed 72
hours after transfection. Proliferation was measured and compared
to proliferation of cells treated with a negative control
oligonucleotide and to proliferation of untransfected cells.
Modified oligonucleotides complementary to miR-21, miR-125a,
miR-191, miR-210, miR-222, miR-378 (labeled as miR-422b), miR-423,
and miR-638 resulted in antiproliferative activity.
[0057] FIG. 3. Induction of apoptosis in liver cancer cells
following treatment with modified oligonucleotides targeted to
miRNAs. Hep3B cells were transfected with modified
oligonucleotides. The induction of apoptosis was measured 24 hours
after transfection, by testing Caspase 3/7 activation. Treatment of
cells with modified oligonucleotides complementary to miR-21,
miR-125a, miR-191, miR-210, miR-378 (labeled as miR-422b), miR-423,
and miR-638 resulted in significant elevation of Caspase 3/7
activity, indicating an induction of apoptosis.
[0058] FIG. 4. Reduction of subcutaneous tumor volume in mice
treated with modified oligonucleotides. Subcutaneous tumors were
induced by the injection of HepG2 cells into nude mice. Treatment
with MOE-modified oligonucleotides complementary to miR-21 (FIG.
4a) and miR-210 (FIG. 4b) was shown to reduce tumor volume,
relative to saline control treatments.
[0059] FIG. 5. Median expression value (in log(fluorescence)) of
miRNA in HepG2 cells, wherein the X-axis represents cells 48 hours
after TCDD treatment, and the Y-axis represents untreated cells.
The dotted parallel lines describe a fold change of two in either
direction. The middle line describes an identical median expression
in both groups of cells.
[0060] mRNAs with relatively high expression values in the treated
cells include hsa-miR-191, hsa-miR-181a, hsa-miR-181b, and
hsa-miR-181a*.
[0061] FIG. 6: The results of the Dual-Luciferase Reporter Assay
are presented in a bar-chart, in which the Y-axis represents the
R/F % ratio of control vector. Each bar depicts the normalized
luminescence as follows: Bar a-p191 (plasmid baring reverse
complement seq of miR-191 at the 3'UTR of renilla luciferase only
with no modified oligonucleotides), Bar b-p191 ASO-miR-NC; Bar
c-pControl (control plasmid) ASO-miR-191; Bar d-p191 ASO-miR-191;
Bar e-pControl (no modified oligonucleotides).
[0062] FIG. 7. ChIP (Chromatin Immuno Precipitation) assay using a
specific antibody for AhR. The Y-axis depicts binding events per
1,000 cells, with the bars with diagonal stripes representing cells
treated with TCDD, and the bars with dots representing cells which
were not treated. The pair of bars on the left represents the
negative control. The two pairs of bars on the right represent the
two binding sites for the AhR/Arnt TF on CYP1A1 .
DETAILED DESCRIPTION
[0063] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the arts to which the invention belongs. Unless
specific definitions are provided, the nomenclature utilized in
connection with, and the procedures and techniques of, analytical
chemistry, synthetic organic chemistry, and medicinal and
pharmaceutical chemistry described herein are those well known and
commonly used in the art. In the event that there is a plurality of
definitions for terms herein, those in this section prevail.
Standard techniques may be used for chemical synthesis, chemical
analysis, pharmaceutical preparation, formulation and delivery, and
treatment of subjects. Certain such techniques and procedures may
be found for example in "Carbohydrate Modifications in Antisense
Research" Edited by Sangvi and Cook, American Chemical Society,
Washington D.C., 1994; and "Remington's Pharmaceutical Sciences,"
Mack Publishing Co., Easton, Pa., 18th edition, 1990; and which is
hereby incorporated by reference for any purpose. Where permitted,
all patents, patent applications, published applications and
publications, GENBANK sequences, websites and other published
materials referred to throughout the entire disclosure herein,
unless noted otherwise, are incorporated by reference in their
entirety. Where reference is made to a URL or other such identifier
or address, it is understood that such identifiers can change and
particular information on the internet can command go, but
equivalent information can be found by searching the internet.
Reference thereto evidences the availability and public
dissemination of such information.
[0064] Before the present compositions and methods are disclosed
and described, it is to be understood that the terminology used
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting. It must be noted that, as used
in the specification and the appended claims, the singular forms
"a," "an" and "the" include plural referents unless the context
clearly dictates otherwise.
DEFINITIONS
[0065] "Liver cancer" means malignancy of the liver, either a
primary cancer or metastasized cancer. In certain embodiments,
liver cancer includes, but is not limited to, cancer arising from
hepatocytes, such as, for example, hepatomas and hepatocellular
carcinomas; fibrolamellar carcinoma; and cholangiocarcinomas (or
bile duct cancer).
[0066] "Hepatocellular carcinoma" means primary cancer of the liver
arising from hepatocytes.
[0067] "Dioxin induced liver cancer" means a liver cancer that is
caused by dioxin exposure. In certain embodiments, a dioxin-induced
liver cancer is dioxin-induced hepatocellular carcinoma.
[0068] "Subject" means a human or non-human animal selected for
treatment or therapy.
[0069] "Subject in need thereof" means a subject identified as in
need of a therapy or treatment. In certain embodiments, a subject
has liver cancer. In such embodiments, a subject has one or more
clinical indications of liver cancer or is at risk for developing
liver cancer.
[0070] "Administering" means providing a pharmaceutical agent or
composition to a subject, and includes, but is not limited to,
administering by a medical professional and self-administering.
[0071] "Parenteral administration," means administration through
injection or infusion. Parenteral administration includes, but is
not limited to, subcutaneous administration, intravenous
administration, or intramuscular administration.
[0072] "Subcutaneous administration" means administration just
below the skin.
[0073] "Intravenous administration" means administration into a
vein.
[0074] "Intratumoral administration" means administration within a
tumor.
[0075] "Chemoembolization" means a procedure in which the blood
supply to a tumor is blocked surgically, mechanically, or
chemically and chemotherapeutic agents are administered directly
into the tumor.
[0076] "Duration" means the period of time during which an activity
or event continues. In certain embodiments, the duration of
treatment is the period of time during which doses of a
pharmaceutical agent or pharmaceutical composition are
administered.
[0077] "Therapy" means a disease treatment method. In certain
embodiments, therapy includes, but is not limited to, chemotherapy,
surgical resection, liver transplant, and/or chemoembolization.
[0078] "Treatment" means the application of one or more specific
procedures used for the cure or amelioration of a disease. In
certain embodiments, the specific procedure is the administration
of one or more pharmaceutical agents.
[0079] "Amelioration" means a lessening of severity of at least one
indicator of a condition or disease. In certain embodiments,
amelioration includes a delay or slowing in the progression of one
or more indicators of a condition or disease. The severity of
indicators may be determined by subjective or objective measures
which are known to those skilled in the art.
[0080] "Prevention" refers to delaying or forestalling the onset or
development or progression of a condition or disease for a period
of time, including weeks, months, or years.
[0081] "Therapeutic agent" means a pharmaceutical agent used for
the cure, amelioration or prevention of a disease.
[0082] "Chemotherapeutic agent" means a pharmaceutical agent used
to treat cancer.
[0083] "Chemotherapy" means treatment of a subject with one or more
pharmaceutical agents that kills cancer cells and/or slows the
growth of cancer cells.
[0084] "Dose" means a specified quantity of a pharmaceutical agent
provided in a single administration. In certain embodiments, a dose
may be administered in two or more boluses, tablets, or injections.
For example, in certain embodiments, where subcutaneous
administration is desired, the desired dose requires a volume not
easily accommodated by a single injection. In such embodiments, two
or more injections may be used to achieve the desired dose. In
certain embodiments, a dose may be administered in two or more
injections to minimize injection site reaction in an
individual.
[0085] "Dosage unit" means a form in which a pharmaceutical agent
is provided. In certain embodiments, a dosage unit is a vial
containing lyophilized oligonucleotide. In certain embodiments, a
dosage unit is a vial containing reconstituted oligonucleotide.
[0086] "Therapeutically effective amount" refers to an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
animal.
[0087] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual that includes a
pharmaceutical agent. For example, a pharmaceutical composition may
comprise a modified oligonucleotide and a sterile aqueous
solution.
[0088] "Pharmaceutical agent" means a substance that provides a
therapeutic effect when administered to a subject.
[0089] "Active pharmaceutical ingredient" means the substance in a
pharmaceutical composition that provides a desired effect.
[0090] "Metastasis" means the process by which cancer spreads from
the place at which it first arose as a primary tumor to other
locations in the body. The metastatic progression of a primary
tumor reflects multiple stages, including dissociation from
neighboring primary tumor cells, survival in the circulation, and
growth in a secondary location.
[0091] "Overall survival time" means the time period for which a
subject survives after diagnosis of or treatment for a disease. In
certain embodiments, the disease is cancer.
[0092] "Progression-free survival" means the time period for which
a subject having a disease survives, without the disease getting
worse. In certain embodiments, progression-free survival is
assessed by staging or scoring the disease. In certain embodiments,
progression-free survival of a subject having liver cancer is
assessed by evaluating tumor size, tumor number, and/or
metastasis.
[0093] "Blood tumor marker" means a biomarker that increases or
decreases in the blood of a subject having cancer.
[0094] "Improved liver function" means the change in liver function
toward normal limits. In certain embodiments, liver function is
assessed by measuring molecules found in a subject's blood. For
example, in certain embodiments, improved liver function is
measured by a reduction in blood liver transaminase levels.
[0095] "Acceptable safety profile" means a pattern of side effects
that is within clinically acceptable limits.
[0096] "Side effect" means a physiological response attributable to
a treatment other than desired effects. In certain embodiments,
side effects include, without limitation, injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, and myopathies. Such side effects may be detected
directly or indirectly. For example, increased aminotransferase
levels in serum may indicate liver toxicity or liver function
abnormality. For example, increased bilirubin may indicate liver
toxicity or liver function abnormality.
[0097] "Injection site reaction" means inflammation or abnormal
redness of skin at a site of injection in an individual.
[0098] "Subject compliance" means adherence to a recommended or
prescribed therapy by a subject.
[0099] "Comply" means the adherence with a recommended therapy by a
subject.
[0100] "Recommended therapy" means a treatment recommended by a
medical professional for the treatment, amelioration, or prevention
of a disease.
[0101] "Target nucleic acid," "target RNA," "target RNA transcript"
and "nucleic acid target" all mean any nucleic acid capable of
being targeted by antisense compounds.
[0102] "Targeting" means the process of design and selection of
nucleobase sequence that will hybridize to a target nucleic acid
and induce a desired effect.
[0103] "Targeted to" means having a nucleobase sequence that will
allow hybridization to a target nucleic acid to induce a desired
effect. In certain embodiments, a desired effect is reduction of a
target nucleic acid.
[0104] "Modulation" means to a perturbation of function or
activity. In certain embodiments, modulation means an increase in
gene expression. In certain embodiments, modulation means a
decrease in gene expression.
[0105] "Expression" means any functions and steps by which a gene's
coded information is converted into structures present and
operating in a cell.
[0106] "5' target site" refers to the nucleobase of a target
nucleic acid which is complementary to the 5'-most nucleobase of a
particular oligonucleotide.
[0107] "3' target site" means the nucleobase of a target nucleic
acid which is complementary to the 3'-most nucleobase of a
particular oligonucleotide.
[0108] "Region" means a portion of linked nucleosides within a
nucleic acid. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to a region of a
target nucleic acid. For example, in certain such embodiments a
modified oligonucleotide is complementary to a region of a miRNA
stem-loop sequence. In certain such embodiments, a modified
oligonucleotide is fully complementary to a region of a miRNA
stem-loop sequence.
[0109] "Segment" means a smaller or sub-portion of a region.
[0110] "Nucleobase sequence" means the order of contiguous
nucleobases, in a 5' to 3' orientation, independent of any sugar,
linkage, and/or nucleobase modification.
[0111] "Contiguous nucleobases" means nucleobases immediately
adjacent to each other in a nucleic acid.
[0112] "Nucleobase complementarity" means the ability of two
nucleobases to pair non-covalently via hydrogen bonding.
[0113] "Complementary" means a first nucleobase sequence is at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 97%, at least
98% at least 99%, or 100%, identical to the complement of a second
nucleobase sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, 100 or more nucleobases, or that the
two sequences hybridize under stringent hybridization
conditions.
[0114] "Complementarity" means the nucleobase pairing ability
between a first nucleic acid and a second nucleic acid.
[0115] "Fully complementary" means each nucleobase of a first
nucleic acid is capable of pairing with a nucleobase at each
corresponding position in a second nucleic acid. For example, in
certain embodiments, a modified oligonucleotide wherein each
nucleobase has complementarity to a nucleobase within a region of a
miRNA stem-loop sequence is fully complementary to the miRNA
stem-loop sequence. In certain embodiments, a modified
oligonucleotide that is fully complementary to a miRNA or a
precursor thereof has a nucleobase sequence that is identical to
the complement of a miRNA or a precursor thereof over a region of
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or
more nucleobases.
[0116] "Percent complementarity" means the number of complementary
nucleobases in a nucleic acid divided by the length of the nucleic
acid. In certain embodiments, percent complementarity of a modified
oligonucleotide means the number of nucleobases that are
complementary to the target nucleic acid, divided by the length of
the modified oligonucleotide.
[0117] "Percent identity" means the number of nucleobases in first
nucleic acid that are identical to nucleobases at corresponding
positions in a second nucleic acid, divided by the total number of
nucleobases in the first nucleic acid.
[0118] "Substantially identical" used herein may mean that a first
and second nucleobase sequence are at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 97%, at least 98% at least 99%, or 100%,
identical over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100 or more nucleobases.
[0119] "Hybridize" means the annealing of complementary nucleic
acids that occurs through nucleobase complementarity.
[0120] "Mismatch" means a nucleobase of a first nucleic acid that
is not capable of pairing with a nucleobase at a corresponding
position of a second nucleic acid.
[0121] "Non-complementary nucleobase" means two nucleobases that
are not capable of pairing through hydrogen bonding.
[0122] "Identical" means having the same nucleobase sequence.
[0123] "miR-21" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 9.
[0124] "miR-21 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 1.
[0125] "miR-125a-5p" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 10.
[0126] "miR-125a stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 2.
[0127] "miR-191" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 11.
[0128] "miR-191 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 3.
[0129] "miR-210" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 12.
[0130] "miR-210 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 4.
[0131] "miR-222" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 13.
[0132] "miR-222 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 5.
[0133] "miR-378" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 14.
[0134] "miR-378 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 6.
[0135] "miR-423-3p" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 15.
[0136] "miR-423 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 7.
[0137] "miR-638" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 16.
[0138] "miR-638 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 8.
[0139] "miR-181a" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 31.
[0140] "miR-181a*" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 32.
[0141] "miR-181b" means the mature miRNA having the nucleobase
sequence set forth in SEQ ID NO: 33.
[0142] "miR-181a-1 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 34.
[0143] "miR-181a-2 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 35.
[0144] "miR-181b-1 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 36.
[0145] "miR-181b-2 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence set forth in SEQ ID NO: 37.
[0146] "miRNA" or "miR" means a non-coding RNA between 18 and 25
nucleobases in length, which is the product of cleavage of a
pre-miRNA by the enzyme Dicer. Examples of mature miRNAs are found
in the miRNA database known as miRBase
(http://microrna.sanger.ac.uk/).
[0147] "Pre-miRNA" or "pre-miR" means a non-coding RNA having a
hairpin structure, which is the product of cleavage of a pri-miR by
the double-stranded RNA-specific ribonuclease known as Drosha.
[0148] "Stem-loop sequence" means an RNA having a hairpin structure
and containing a mature miRNA sequence. Pre-miRNA sequences and
stem-loop sequences may overlap. Examples of stem-loop sequences
are found in the miRNA database known as miRBase
(http://microrna.sanger.ac.uk/).
[0149] "Pri-miRNA" or "pri-miR" means a non-coding RNA having a
hairpin structure that is a substrate for the double-stranded
RNA-specific ribonuclease Drosha.
[0150] "miRNA precursor" means a transcript that originates from a
genomic DNA and that comprises a non-coding, structured RNA
comprising one or more miRNA sequences. For example, in certain
embodiments a miRNA precursor is a pre-miRNA. In certain
embodiments, a miRNA precursor is a pri-miRNA.
[0151] "Monocistronic transcript" means a miRNA precursor
containing a single miRNA sequence.
[0152] "Polycistronic transcript" means a miRNA precursor
containing two or more miRNA sequences.
[0153] "Seed sequence" means nucleotides 2 to 6 or 2 to 7 from the
5'-end of a mature miRNA sequence.
[0154] "Oligomeric compound" means a compound comprising a polymer
of linked monomeric subunits.
[0155] "Oligonucleotide" means a polymer of linked nucleosides,
each of which can be modified or unmodified, independent from one
another.
[0156] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage between nucleosides.
[0157] "Natural sugar" means a sugar found in DNA (2'-H) or RNA
(2'-OH).
[0158] "Natural nucleobase" means a nucleobase that is unmodified
relative to its naturally occurring form.
[0159] "Internucleoside linkage" means a covalent linkage between
adjacent nucleosides.
[0160] "Linked nucleosides" means nucleosides joined by a covalent
linkage.
[0161] "Nucleobase" means a heterocyclic moiety capable of
non-covalently pairing with another nucleobase.
[0162] "Nucleoside" means a nucleobase linked to a sugar.
[0163] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of a nucleoside.
[0164] "Modified oligonucleotide" means an oligonucleotide having
one or more modifications relative to a naturally occurring
terminus, sugar, nucleobase, and/or internucleoside linkage.
[0165] "Single-stranded modified oligonucleotide" means a modified
oligonucleotide which is not hybridized to a complementary
strand.
[0166] "Modified internucleoside linkage" means any change from a
naturally occurring internucleoside linkage.
[0167] "Phosphorothioate internucleoside linkage" means a linkage
between nucleosides where one of the non-bridging atoms is a sulfur
atom.
[0168] "Modified sugar" means substitution and/or any change from a
natural sugar.
[0169] "Modified nucleobase" means any substitution and/or change
from a natural nucleobase.
[0170] "5-methylcytosine" means a cytosine modified with a methyl
group attached to the 5' position.
[0171] "2'-O-methyl sugar" or "2'-OMe sugar" means a sugar having a
O-methyl modification at the 2' position.
[0172] "2'-O-methoxyethyl sugar" or "2'-MOE sugar" means a sugar
having a O-methoxyethyl modification at the 2' position.
[0173] "2'-O-fluoro" or "2'-F" means a sugar having a fluoro
modification of the 2' position.
[0174] "Bicyclic sugar moiety" means a sugar modified by the
bridging of two non-geminal ring atoms.
[0175] "2'-O-methoxyethyl nucleoside" means a 2'-modified
nucleoside having a 2'-O-methoxyethyl sugar modification.
[0176] "2'-fluoro nucleoside" means a 2'-modified nucleoside having
a 2'-fluoro sugar modification.
[0177] "2'-O-methyl" nucleoside means a 2'-modified nucleoside
having a 2'-O-methyl sugar modification.
[0178] "Bicyclic nucleoside" means a 2'-modified nucleoside having
a bicyclic sugar moiety.
[0179] "Motif" means a pattern of modified and/or unmodified
nucleobases, sugars, and/or internucleoside linkages in an
oligonucleotide.
[0180] A "fully modified oligonucleotide" means each nucleobase,
each sugar, and/or each internucleoside linkage is modified.
[0181] A "uniformly modified oligonucleotide" means each
nucleobase, each sugar, and/or each internucleoside linkage has the
same modification throughout the modified oligonucleotide.
[0182] A "gapmer" means a modified oligonucleotide having an
internal region of linked nucleosides positioned between two
external regions of linked nucleosides, where the nucleosides of
the internal region comprise a sugar moiety different than that of
the nucleosides of each external region.
[0183] A "gap segment" is an internal region of a gapmer that is
positioned between the external regions.
[0184] A "wing segment" is an external region of a gapmer that is
located at the 5' or 3' terminus of the internal region.
[0185] A "symmetric gapmer" means each nucleoside of each external
region comprises the same sugar modification.
[0186] An "asymmetric gapmer" means each nucleoside of one external
region comprises a first sugar modification, and each nucleoside of
the other external region comprises a second sugar
modification.
[0187] A "stabilizing modification" means a modification to a
nucleoside that provides enhanced stability to a modified
oligonucleotide, in the presence of nucleases, relative to that
provided by 2'-deoxynucleosides linked by phosphodiester
internucleoside linkages. For example, in certain embodiments, a
stabilizing modification is a stabilizing nucleoside modification.
In certain embodiments, a stabilizing modification is a
internucleoside linkage modification.
[0188] A "stabilizing nucleoside" means a nucleoside modified to
provide enhanced nuclease stability to an oligonucleotide, relative
to that provided by a 2'-deoxynucleoside. In one embodiment, a
stabilizing nucleoside is a 2'-modified nucleoside.
[0189] A "stabilizing internucleoside linkage" means an
internucleoside linkage that provides enhanced nuclease stability
to an oligonucleotide relative to that provided by a phosphodiester
internucleoside linkage. In one embodiment, a stabilizing
internucleoside linkage is a phosphorothioate internucleoside
linkage.
OVERVIEW
[0190] Liver cancer is a common cause of cancer deaths in both men
and women worldwide. The incidence of hepatocellular carcinoma
(HCC), the most common type of liver cancer, is rising in relation
to the increasing incidence of hepatitis C viral infection. Certain
HCC cases have been linked to chronic hepatitis B infection,
chronic hepatitis C infection, or cirrhosis.
[0191] Subjects with HCC have a very poor prognosis, with typical
median survival from the date of diagnosis ranging from 7 to 8
months, and a 5 year survival rate of less than 5%. Limited
treatments are available for HCC. Subjects with early stage disease
may be treated by liver resection or liver transplantation.
However, in approximately 85% of subjects the disease is too
advanced at the time of diagnosis for liver resection or
transplantation. Subjects with intermediate disease may be
candidates for chemoembolization. However, the poor health of
subjects with advanced disease limits the use of
chemoembolization.
[0192] Certain changes in miRNA expression patterns in cancer
cells, including liver cancer cells such as HCC, relative to
non-cancerous cells, have been reported. Both increases and
decreases in miRNA expression have been described in relation to
cancer. The total number of miRNAs in the human genome is estimated
to range from approximately 500 to several thousand. In view of
this high number of total miRNAs, identification of particular
miRNAs linked to particular cancer types is necessary in order to
identify miRNAs that could be targeted for cancer therapy, either
through inhibition or augmentation of the miRNA.
[0193] Accordingly, there exists a need for the identification of
miRNAs that can be inhibited for the treatment of liver cancer,
including HCC. Also needed are inhibitory agents useful for the
treatment of liver cancer, such as HCC. Further, there exists a
need for methods of treating liver cancer, such as HCC, by
administering to a subject in need thereof a pharmaceutical agent
capable of inhibiting a miRNA identified as dysregulated in
connection with liver cancer, such as HCC. As cancer is a disease
caused by the uncontrolled proliferation of cells, as well as
increased cell survival, desirable traits of pharmaceutical agents
for the treatment of liver cancer include the ability to reduce
cell proliferation, and/or induce apoptosis, which will in turn
reduce tumor size, reduce tumor number, and/or prevent or slow the
metastasis of liver cancer cells.
[0194] In certain embodiments, the methods provided herein are
useful for the treatment of liver cancer, such as HCC. These
methods may result in one or more clinically desirable outcomes in
a subject having liver cancer, such as reduction in tumor number
and/or size, reduced metastatic progression, prolonged survival
time, and/or increased progression-free survival time. Also
provided herein are pharmaceutical agents, such as modified
oligonucleotides, that may be used for the treatment of liver
cancer, such as HCC.
[0195] As illustrated herein, using microarrays containing probes
designed to about 700 miRNAs, liver samples from HCC tumors were
compared to normal liver tissue samples. Of the about 700 miRNAs
tested, approximately 90 were found to be upregulated in HCC
samples relative to normal liver tissue samples. Following in vitro
experiments in HCC-derived cell lines, 8 miRNAs were selected as
candidate miRNAs to be targeted for HCC therapy: miR-21,
miR-125a-5p, miR-191, miR-210, miR-222, miR-378, miR-423-3p, and
miR-638. As illustrated herein, a reduction in cell proliferation
was observed following the inhibition of 8 of these miRNAs in liver
cancer cell lines, using modified oligonucleotides complementary to
the miRNAs. Additionally, inhibition of 7 of the miRNAs resulted in
increased apoptosis of liver cancer cells. As such, the modified
oligonucleotides complementary to each of these 8 miRNAs are
pharmaceutical agents for the treatment of liver cancer, including
HCC.
[0196] As illustrated herein in a mouse subcutaneous tumor model,
the administration of a modified oligonucleotide targeted to
microRNAs identified as upregulated in HCC resulted in tumor volume
reduction. Accordingly, such modified oligonucleotides are
pharmaceutical agents for the treatment of liver cancer, including
HCC.
Certain Treatments
[0197] In certain embodiments, the present invention provides
methods for the treatment of cancer comprising administering to a
subject in need thereof a modified oligonucleotide complementary to
a miRNA. A subject may be diagnosed with liver cancer following the
administration of medical tests well-known to those in the medical
profession. The liver cancer may be hepatocellular carcinoma (HCC).
The diagnosis of hepatocellular carcinoma is typically made by
liver imaging tests such as abdominal ultrasound, helical computed
tomography (CT) scan or triple phase CT scan. Such imaging tests
may be performed in conjunction with measurement of blood levels of
alpha-fetoprotein and/or blood levels of
des-gamma-carboxyprothrombin. In certain subjects, MRI may be used
in place of CT scan. The liver imaging tests allow the assessment
of the tumor size, number, location, metastasis outside the liver,
patency and or invasion of the arteries and veins of the liver by
the tumor. This assessment aids the decision as to the mode of
therapeutic or palliative intervention that is appropriate. The
final diagnosis is typically confirmed by needle biopsy and
histopathological examination.
[0198] Accordingly, in certain embodiments, the liver cancer is
detected following a computed tomography (CT) scan that detects
tumors. In certain embodiments, the liver cancer is detected
following magnetic resonance imaging (MRI). In certain embodiments,
HCC is characterized as a single primary tumor. In certain
embodiments, HCC is characterized as multiple primary tumors. In
certain embodiments, HCC is characterized as a poorly defined
primary tumor with an infiltrative growth pattern. In certain
embodiments, the HCC is a single primary tumor with vascular
invasion. In certain embodiments, the HCC is characterized as
multiple primary tumors with vascular invasion. In certain
embodiments, the HCC has metastasized to one or more lymph nodes.
In certain such embodiments, the lymph nodes are regional lymph
nodes. In certain embodiments, the HCC has metastasized to one or
more distant tissues. In certain embodiments, the HCC has
metastasized to other regions of the liver, the portal vein, lymph
nodes, adrenal glands, bone or lungs. In certain embodiments,
fibrosis is present.
[0199] A number of systems have been employed to predict the
prognosis for HCC, including the TNM system, the Okuda system, the
Barcelona Clinic Liver Cancer (BCLC) and the CLIP score. Each of
these systems incorporates four features that have been recognized
as being important determinants of survival: the severity of
underlying liver disease, the size of the tumor, extension of the
tumor into adjacent structures, and the presence of metastases. The
TNM system classifies HCC as stage I, II, III, IV, or V. The BCLC
classifies HCC as Stage A1, A2, A3, A4, B, C, and D, and includes
consideration of a Child-Pugh score.
[0200] In certain embodiments, liver cancer is classified as Stage
1, Stage 2, Stage 3A, Stage 3B, Stage 3C, or Stage 4. Stage 1 is
characterized by a cancer is no bigger than 2 cm in size and that
has not begun to spread. At Stage 2, the cancer is affecting blood
vessels in the liver, or there is more than one tumor in the liver.
At Stage 3A, the cancer is bigger than 5 cm in size or has spread
to the blood vessels near the liver. At Stage 3B, the cancer has
spread to nearby organs, such as the bowel or the stomach, but has
not spread to the lymph nodes. At Stage 3C the cancer can be of any
size and has spread to nearby lymph nodes. At Stage 4 the cancer
has spread to parts of the body further away from the liver, such
as the lungs.
[0201] Biomarkers in a subject's blood may be used to augment a
diagnosis of liver cancer, stage a liver cancer, or develop a
prognosis for survival. Such biomarkers include blood tumor
biomarkers, such as alpha-fetoprotein and des-gamma
carboxyprothrombin. In certain such embodiments, the subject has
elevated blood alpha-fetoprotein. In certain such embodiments, the
subject has elevated blood des-gamma carboxyprothrombin.
[0202] A subject having liver cancer may also suffer from abnormal
liver function. Liver function may be assessed by liver function
tests, which measure, among other things, blood levels of liver
transaminases. In certain embodiments, a subject having abnormal
liver function has elevated blood liver transaminases. Blood liver
transaminases include alanine aminotransferase (ALT) and aspartate
aminotransferase (AST). In certain embodiments, a subject having
abnormal liver function has elevated blood bilirubin. In certain
embodiments, a subject has abnormal blood albumin levels.
[0203] In certain embodiments, a subject's liver function is
assessed by the Child-Pugh classification system, which defines
three classes of liver function. In this classification system,
points are assigned to measurements in one of five categories:
bilirubin levels, albumin levels, prothrombin time, ascites, and
encephalopathy. One point is assigned per each of the following
characteristics present: blood bilirubin of less than 2.0 mg/dl;
blood albumin of greater than 3.5 mg/dl; a prothrombin time of less
than 1.7 international normalized ratio (INR); ascites is absent;
or encephalopathy is absent. Two points are assigned per each of
the following characteristics present: blood bilirubin of 2-3
mg/dl; blood bilirubin of 3.5 to 2.8 mg/dl; prothrombin time of
1.7-2.3 INR; ascites is mild to moderate; or encephalopathy is
mild. Three points are assigned per each of the following
characteristics present: bilirubin of greater than 3.0 mg/dl; blood
albumin of less than 2.8 mg/dl; prothrombin time of greater than
2.3 INR; ascites is severe to refractory; or encephalopathy is
severe. The scores are added and Class A is assigned for a score of
5-6 points, Class B is assigned for a score of 7-9 points, and
Class C is assigned for a score of 10-15 points,
[0204] A subject having liver cancer may have suffered from chronic
hepatitis C infection, chronic hepatitis B infection, or cirrhosis.
Subjects having liver cancer caused by hepatitis C infection,
hepatitis B infection, or cirrhosis may be treated by the methods
described herein.
[0205] A subject's response to treatment may be evaluated by tests
similar to those used to diagnosis the liver cancer, including,
without limitation, CT scan, MRI, and needle biopsy. Response to
treatment may also be assessed by measuring biomarkers in blood,
for comparison to pre-treatment levels of biomarkers.
[0206] Administration of a pharmaceutical composition of the
present invention to a subject having liver cancer results in one
or more clinically desirable outcomes. Such clinically desirable
outcomes include reduction of tumor number or reduction of tumor
size. Additional clinically desirable outcomes include the
extension of overall survival time of the subject, and/or extension
of progression-free survival time of the subject. In certain
embodiments, administration of a pharmaceutical composition of the
invention prevents an increase in tumor size and/or tumor number.
In certain embodiments, administration of a pharmaceutical
composition of the invention prevents metastatic progression. In
certain embodiments, administration of a pharmaceutical composition
of the invention slows or stops metastatic progression. In certain
embodiments, administration of a pharmaceutical composition of the
invention prevents the recurrence of liver tumors. In certain
embodiments, administration of a pharmaceutical composition of the
invention prevents recurrence of liver tumor metastasis. In certain
embodiments, administration of a pharmaceutical composition of the
invention prevents the recurrence of HCC-derived tumors. In certain
embodiments, administration of a pharmaceutical composition of the
invention prevents the recurrence of HCC-derived tumor
metastasis.
[0207] Administration of a pharmaceutical composition of the
present invention to liver cancer cells, including HCC cells, may
result in desirable phenotypic effects. In certain embodiments, a
modified oligonucleotide may stop, slow or reduce the uncontrolled
proliferation of liver cancer cells. In certain embodiments, a
modified oligonucleotide may induce apoptosis in liver cancer
cells. In certain embodiments, a modified oligonucleotide may
reduce liver cancer cell survival.
[0208] A miRNA hybridizes to a mRNA to regulate expression of the
mRNA and its protein product. Generally, the hybridization of a
miRNA to its mRNA target inhibits expression of the mRNA. Thus, the
inhibition of a miRNA may result in the increased expression of a
miRNA nucleic acid target. In certain embodiments, the inhibition
of a miRNA results in the increase of a protein encoded by a miRNA
nucleic acid target. For example, in certain embodiments, the
antisense inhibition of miR-222 results in an increase of
p27.sup.kiP1.
[0209] Certain desirable clinical outcomes may be assessed by
measurements of blood biomarkers. In certain embodiments,
administration of a pharmaceutical composition of the invention may
result in the decrease of blood alpha-fetoprotein and/or blood
des-gamma carboxyprothrombin. Administration of a pharmaceutical
composition of the invention may further result in the improvement
of liver function, as evidenced by a reduction in blood ALT and/or
AST levels.
Certain Compounds
[0210] The compounds provided herein are useful for the treatment
of liver cancer, such as HCC. In certain embodiments, the compound
comprises a modified oligonucleotide. In certain such embodiments,
the compound consists of a modified oligonucleotide.
[0211] In certain such embodiments, the compound comprises a
modified oligonucleotide hybridized to a complementary strand, i.e.
the compound comprises a double-stranded oligomeric compound. In
certain embodiments, the hybridization of a modified
oligonucleotide to a complementary strand forms at least one blunt
end. In certain such embodiments, the hybridization of a modified
oligonucleotide to a complementary strand forms a blunt end at each
terminus of the double-stranded oligomeric compound. In certain
embodiments, a terminus of a modified oligonucleotide comprises one
or more additional linked nucleosides relative to the number of
linked nucleosides of the complementary strand. In certain
embodiments, the one or more additional nucleosides are at the 5'
terminus of a modified oligonucleotide. In certain embodiments, the
one or more additional nucleosides are at the 3' terminus of a
modified oligonucleotide. In certain embodiments, at least one
nucleobase of a nucleoside of the one or more additional
nucleosides is complementary to the target RNA. In certain
embodiments, each nucleobase of each one or more additional
nucleosides is complementary to the target RNA. In certain
embodiments, a terminus of the complementary strand comprises one
or more additional linked nucleosides relative to the number of
linked nucleosides of a modified oligonucleotide. In certain
embodiments, the one or more additional linked nucleosides are at
the 3' terminus of the complementary strand. In certain
embodiments, the one or more additional linked nucleosides are at
the 5' terminus of the complementary strand. In certain
embodiments, two additional linked nucleosides are linked to a
terminus. In certain embodiments, one additional nucleoside is
linked to a terminus.
[0212] In certain embodiments, the compound comprises a modified
oligonucleotide conjugated to one or more moieties which enhance
the activity, cellular distribution or cellular uptake of the
resulting antisense oligonucleotides. In certain such embodiments,
the moiety is a cholesterol moiety or a lipid moiety. Additional
moieties for conjugation include carbohydrates, phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. In certain
embodiments, a conjugate group is attached directly to a modified
oligonucleotide. In certain embodiments, a conjugate group is
attached to a modified oligonucleotide by a linking moiety selected
from amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g.,
double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC),
6-aminohexanoic acid (AHEX or AHA), substituted C1-C10 alkyl,
substituted or unsubstituted C2-C10 alkenyl, and substituted or
unsubstituted C2-C10 alkynyl. In certain such embodiments, a
substituent group is selected from hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl and alkynyl.
[0213] In certain such embodiments, the compound comprises a
modified oligonucleotide having one or more stabilizing groups that
are attached to one or both termini of a modified oligonucleotide
to enhance properties such as, for example, nuclease stability.
Included in stabilizing groups are cap structures. These terminal
modifications protect a modified oligonucleotide from exonuclease
degradation, and can help in delivery and/or localization within a
cell. The cap can be present at the 5'-terminus (5'-cap), or at the
3'-terminus (3'-cap), or can be present on both termini. Cap
structures include, for example, inverted deoxy abasic caps.
[0214] Suitable cap structures include a 4',5'-methylene
nucleotide, a 1-(beta-D-erythrofuranosyl) nucleotide, a 4'-thio
nucleotide, a carbocyclic nucleotide, a 1,5-anhydrohexitol
nucleotide, an L-nucleotide, an alpha-nucleotide, a modified base
nucleotide, a phosphorodithioate linkage, a threo-pentofuranosyl
nucleotide, an acyclic 3',4'-seco nucleotide, an acyclic
3,4-dihydroxybutyl nucleotide, an acyclic 3,5-dihydroxypentyl
nucleotide, a 3'-3'-inverted nucleotide moiety, a 3'-3'-inverted
abasic moiety, a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted
abasic moiety, a 1,4-butanediol phosphate, a 3'-phosphoramidate, a
hexylphosphate, an aminohexyl phosphate, a 3'-phosphate, a
3'-phosphorothioate, a phosphorodithioate, a bridging
methylphosphonate moiety, and a non-bridging methylphosphonate
moiety 5'-amino-alkyl phosphate, a 1,3-diamino-2-propyl phosphate,
3-aminopropyl phosphate, a 6-aminohexyl phosphate, a
1,2-aminododecyl phosphate, a hydroxypropyl phosphate, a
5'-5'-inverted nucleotide moiety, a 5'-5'-inverted abasic moiety, a
5'-phosphoramidate, a 5'-phosphorothioate, a 5'-amino, a bridging
and/or non-bridging 5'-phosphoramidate, a phosphorothioate, and a
5'-mercapto moiety.
Certain Nucleobase Sequences
[0215] In certain embodiments, a modified oligonucleotide has a
sequence that is complementary to a miRNA or a precursor thereof.
Nucleobase sequences of mature miRNAs and their corresponding
stem-loop sequences described herein are the sequences found in
miRBase, an online searchable database of miRNA sequences and
annotation, found at http://microrna.sanger.ac.uk/. Entries in the
miRBase Sequence database represent a predicted hairpin portion of
a miRNA transcript (the stem-loop), with information on the
location and sequence of the mature miRNA sequence. The miRNA
stem-loop sequences in the database are not strictly precursor
miRNAs (pre-miRNAs), and may in some instances include the
pre-miRNA and some flanking sequence from the presumed primary
transcript. The miRNA nucleobase sequences described herein
encompass any version of the miRNA, including the sequences
described in Release 10.0 of the miRBase sequence database and
sequences described in any earlier Release of the miRBase sequence
database. A sequence database release may result in the re-naming
of certain miRNAs. For example, miR-378 of Release 10.0 described
herein was formerly named miR-422b. A sequence database release may
result in a variation of a mature miRNA sequence. For example,
miR-125a-5p of Release 10.0 is found at nucleobases 15-38 of the
miR-125a stem-loop sequence (SEQ ID NO: 2). miR-125a in a previous
database Releases is found at nucleobases 15-37 of the miR-125a
stem-loop sequence (SEQ ID NO: 2). The compositions of the present
invention encompass modified oligonucleotides that are
complementary to any nucleobase sequence version of the miRNAs
described herein.
[0216] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a miRNA or a precursor
thereof, meaning that the nucleobase sequence of a modified
oligonucleotide is a least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
97%, 98% or 99% identical to the complement of a miRNA or precursor
thereof over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 100 or more nucleobases, or that the two sequences
hybridize under stringent hybridization conditions. Accordingly, in
certain embodiments the nucleobase sequence of a modified
oligonucleotide may have one or more mismatched basepairs with
respect to its target miRNA or precursor sequence, and is capable
of hybridizing to its target sequence. In certain embodiments, a
modified oligonucleotide has a nucleobase sequence that is fully
complementary to a miRNA or precursor thereof, meaning that the
nucleobase sequence of a modified oligonucleotide is 100% identical
of the complement of an miRNA or a precursor thereof over a region
of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100
or more nucleobases.
[0217] In certain embodiments, a modified oligonucleotide has a
sequence that is complementary to a nucleobase sequence of a miRNA
stem-loop sequence selected from the miR-21 stem-loop sequence (SEQ
ID NO: 1), the miR-125a stem-loop sequence (SEQ ID NO: 2), the
miR-191 stem-loop sequence (SEQ ID NO: 3), the miR-210 stem-loop
sequence (SEQ ID NO: 4), the miR-222 stem-loop sequence (SEQ ID NO:
5), the miR-378 stem-loop sequence (SEQ ID NO: 6), the miR-423
stem-loop sequence (SEQ ID NO: 7), and the miR-638 stem-loop
sequence (SEQ ID NO: 8).
[0218] In certain embodiments, a modified oligonucleotide has a
sequence that is complementary to a nucleobase sequence of a miRNA,
where the nucleobase sequence of the miRNA is selected from SEQ ID
NO: 9, 10, 11, 12, 13, 14, 15, and 16.
[0219] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the miR-21
stem-loop sequence (SEQ ID NO: 1). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 8-29 of SEQ ID NO: 1. In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the nucleobase sequence of miR-21
(SEQ ID NO: 9). In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to nucleobases 1-22
of SEQ ID NO: 9. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence comprising the nucleobase sequence
TCAACATCAGTCTGATAAGCTA (SEQ ID NO: 17). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence TCAACATCAGTCTGATAAGCTA (SEQ ID NO: 17).
[0220] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-125a stem-loop sequence (SEQ ID NO: 2). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 15-37 of SEQ ID NO: 2.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the region of nucleobases 15-38
of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to the nucleobase
sequence of miR-125-5p (SEQ ID NO: 10). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence that is
complementary to nucleobases 1-23 of SEQ ID NO: 10. In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to nucleobases 1-24 of SEQ ID NO: 10. In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence comprising the nucleobase sequence CACAGGTTAAAGGGTCTCAGGGA
(SEQ ID NO: 18). In certain embodiments, a modified oligonucleotide
has a nucleobase sequence consisting of the nucleobase sequence
CACAGGTTAAAGGGTCTCAGGGA (SEQ ID NO: 18). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence TCACAGGTTAAAGGGTCTCAGGGA (SEQ ID NO:
19).
[0221] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-191 stem-loop sequence (SEQ ID NO: 3). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 16-37 of SEQ ID NO: 3.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the region of nucleobases 16-38
of SEQ ID NO: 3. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to the nucleobase
sequence of miR-191 (SEQ ID NO: 1). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence AGCTGCTTTTGGGATTCCGTTG (SEQ ID NO: 20). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
AGCTGCTTTTGGGATTCCGTTG (SEQ ID NO: 20). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence of CAGCTGCTTTTGGGATTCCGTTG (SEQ ID NO:
21).
[0222] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-210 stem-loop sequence (SEQ ID NO: 4). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 66-87 of SEQ ID NO: 4.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the nucleobase sequence of
miR-210 (SEQ ID NO: 12). In certain embodiments, a modified
oligonucleotide has a nucleobase sequence comprising the nucleobase
sequence TCAGCCGCTGTCACACGCACAG (SEQ ID NO: 22). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
consisting of the nucleobase sequence TCAGCCGCTGTCACACGCACAG (SEQ
ID NO: 22).
[0223] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-222 stem-loop sequence (SEQ ID NO: 5). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 69-89 of SEQ ID NO: 5.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the region of nucleobases 69-91
of SEQ ID NO: 5. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to the nucleobase
sequence of miR-222 (SEQ ID NO: 13). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence ACCCAGTAGCCAGATGTAGCT (SEQ ID NO: 24). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
ACCCAGTAGCCAGATGTAGCT (SEQ ID NO: 24). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence GAGACCCAGTAGCCAGATGTAGCT (SEQ ID NO:
23).
[0224] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-378 stem-loop sequence (SEQ ID NO: 6). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 43-63 of SEQ ID NO: 6.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the region of nucleobases 44-65
of SEQ ID NO: 6. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to the nucleobase
sequence of miR-378 (SEQ ID NO: 14). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence CCTTCTGACTCCAAGTCCAG (SEQ ID NO: 25). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
GGCCTTCTGACTCCAAGTCCAG (SEQ ID NO: 26). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence CCTTCTGACTCCAAGTCCAGT (SEQ ID NO: 27).
[0225] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-423 stem-loop sequence (SEQ ID NO: 7). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 53-75 of SEQ ID NO: 7.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the region of nucleobases 53-74
of SEQ ID NO: 7. In certain embodiments, a modified oligonucleotide
has a nucleobase sequence that is complementary to the nucleobase
sequence of miR-423-3p (SEQ ID NO: 15). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence CTGAGGGGCCTCAGACCGAGCT (SEQ ID NO: 28). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
CTGAGGGGCCTCAGACCGAGCT (SEQ ID NO: 28). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence consisting of
the nucleobase sequence TCTGAGGGGCCTCAGACCGAGCT (SEQ ID NO:
29).
[0226] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-638 stem-loop sequence (SEQ ID NO: 8). In certain embodiments,
a modified oligonucleotide has a nucleobase sequence that is
complementary to the region of nucleobases 16-40 of SEQ ID NO: 8.
In certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to the nucleobase sequence of
miR-638 (SEQ ID NO: 16). In certain embodiments, a modified
oligonucleotide has a nucleobase sequence comprising the nucleobase
sequence AGGCCGCCACCCGCCCGCGATCCCT (SEQ ID NO: 30). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
consisting of the nucleobase sequence AGGCCGCCACCCGCCCGCGATCCCT
(SEQ ID NO: 30).
[0227] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181a-1 stem-loop sequence (SEQ ID NO: 34). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 24-46 of SEQ ID
NO: 34. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181a-2 stem-loop sequence (SEQ ID NO: 35). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 39-61 of SEQ ID
NO: 35. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to the nucleobase
sequence of miR-181a (SEQ ID NO: 31). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence TCACTCCGTCTGCGAAGTTAGAA (SEQ ID NO: 38). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
TCACTCCGTCTGCGAAGTTAGAA (SEQ ID NO: 38).
[0228] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181a-1 stem-loop sequence (SEQ ID NO: 34). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 64-85 of SEQ ID
NO: 34. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181a-2 stem-loop sequence (SEQ ID NO: 35). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 77-98 of SEQ ID
NO: 35. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to the nucleobase
sequence of miR-181a* (SEQ ID NO: 32). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence GGATCTTACTTCGGACGTAGGA (SEQ ID NO: 39). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
GGATCTTACTTCGGACGTAGGA (SEQ ID NO: 39).
[0229] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181b-1 stem-loop sequence (SEQ ID NO: 36). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 36-58 of SEQ ID
NO: 36. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a region of the
miR-181b-2 stem-loop sequence (SEQ ID NO: 37). In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
that is complementary to the region of nucleobases 16-38 of SEQ ID
NO: 37. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to the nucleobase
sequence of miR-181b (SEQ ID NO: 33). In certain embodiments, a
modified oligonucleotide has a nucleobase sequence comprising the
nucleobase sequence TCCCTCCGTCTGCTTAGTTAGAA (SEQ ID NO: 40). In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence consisting of the nucleobase sequence
TCCCTCCGTCTGCTTAGTTAGAA (SEQ ID NO: 40).
[0230] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
of a pre-miR sequence comprising a mature miRNA selected from
miR-21, miR-125a-5p, miR-191, miR-210, miR-222, miR-378,
miR-423-3p, and miR-638.
[0231] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
of a pri-miR sequence comprising a mature miRNA selected from
miR-21, miR-125a-5p, miR-191, miR-210, miR-222, miR-378,
miR-423-3p, and miR-638.
[0232] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
of a pri-miR sequence comprising a mature miRNA selected from
miR-181a, miR-181a*, and miR-181b. In certain embodiments, a
modified oligonucleotide has a nucleobase sequence that is
complementary to a nucleobase sequence of a pre-miR sequence
comprising a mature miRNA selected from miR-181a, miR-181a*, and
miR-181b.
[0233] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 80% identity to a nucleobase sequence of a miR
stem-loop sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7,
and 8. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 85%, at least 90%, at least 92%, at least 94%, at
least 96%, at least 98% identity, or 100% identity to a nucleobase
sequence of a miR stem-loop sequence selected from SEQ ID NOs 1, 2,
3, 4, 5, 6, 7, and 8.
[0234] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 80% identity to a nucleobase sequence of a miRNA
having a nucleobase sequence selected from SEQ ID NO: 9, 10, 11,
12, 13, 14, 15, and 16. In certain embodiments, a modified
oligonucleotide has a nucleobase sequence that is complementary to
a nucleobase sequence having at least 85%, at least 90%, at least
92%, at least 94%, at least 96%, at least 98% identity, or 100%
identity to a nucleobase sequence of a miRNA nucleobase sequence
selected from SEQ ID NOs 9, 10, 11, 12, 13, 14, 15, and 16.
[0235] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 80% identity to a nucleobase sequence of a miR
stem-loop sequence selected from SEQ ID NO: 34, 35, 36, and 37. In
certain embodiments, a modified oligonucleotide has a nucleobase
sequence that is complementary to a nucleobase sequence having at
least 85%, at least 90%, at least 92%, at least 94%, at least 96%,
at least 98% identity, or 100% identity to a nucleobase sequence of
a miR stem-loop sequence selected from SEQ ID NOs 34, 35, 36, and
37.
[0236] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 80% identity to a nucleobase sequence of a miRNA
having a nucleobase sequence selected from SEQ ID NO: 31, 32, and
33. In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to a nucleobase sequence
having at least 85%, at least 90%, at least 92%, at least 94%, at
least 96%, at least 98% identity, or 100% identity to a nucleobase
sequence of a miRNA nucleobase sequence selected from SEQ ID NOs
31, 32, and 33.
[0237] In certain embodiments, a nucleobase sequence of a modified
oligonucleotide is fully complementary to a miRNA nucleobase
sequence listed herein, or a precursor thereof. In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
having one mismatch with respect to the nucleobase sequence of the
mature miRNA, or a precursor thereof. In certain embodiments, a
modified oligonucleotide has a nucleobase sequence having two
mismatches with respect to the nucleobase sequence of the miRNA, or
a precursor thereof. In certain such embodiments, a modified
oligonucleotide has a nucleobase sequence having no more than two
mismatches with respect to the nucleobase sequence of the mature
miRNA, or a precursor thereof. In certain such embodiments, the
mismatched nucleobases are contiguous. In certain such embodiments,
the mismatched nucleobases are not contiguous.
[0238] In certain embodiments, a modified oligonucleotide consists
of a number of linked nucleosides that is equal to the length of
the mature miR to which it is complementary.
[0239] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is less than the length of the mature
miRNA to which it is complementary. In certain such embodiments,
the number of linked nucleosides of a modified oligonucleotide is
one less than the length of the mature miR to which it is
complementary. In certain such embodiments, a modified
oligonucleotide has one less nucleoside at the 5' terminus. In
certain such embodiments, a modified oligonucleotide has one less
nucleoside at the 3' terminus. In certain such embodiments, a
modified oligonucleotide has two fewer nucleosides at the 5'
terminus. In certain such embodiments, a modified oligonucleotide
has two fewer nucleosides at the 3' terminus. A modified
oligonucleotide having a number of linked nucleosides that is less
than the length of the miRNA, wherein each nucleobase of a modified
oligonucleotide is complementary to each nucleobase at a
corresponding position in a miRNA, is considered to be a modified
oligonucleotide having a nucleobase sequence that is fully
complementary to a portion of a miRNA sequence.
[0240] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is greater than the length of the miRNA
to which it is complementary. In certain such embodiments, the
nucleobase of an additional nucleoside is complementary to a
nucleobase of a miRNA stem-loop sequence. In certain embodiments,
the number of linked nucleosides of a modified oligonucleotide is
one greater than the length of the miRNA to which it is
complementary. In certain such embodiments, the additional
nucleoside is at the 5' terminus of a modified oligonucleotide. In
certain such embodiments, the additional nucleoside is at the 3'
terminus of a modified oligonucleotide. In certain embodiments, the
number of linked nucleosides of a modified oligonucleotide is two
greater than the length of the miRNA to which it is complementary.
In certain such embodiments, the two additional nucleosides are at
the 5' terminus of a modified oligonucleotide. In certain such
embodiments, the two additional nucleosides are at the 3' terminus
of a modified oligonucleotide. In certain such embodiments, one
additional nucleoside is located at the 5' terminus and one
additional nucleoside is located at the 3' terminus of a modified
oligonucleotide.
[0241] In certain embodiments, a portion of the nucleobase sequence
of a modified oligonucleotide is fully complementary to the
nucleobase sequence of the miRNA, but the entire modified
oligonucleotide is not fully complementary to the miRNA. In certain
such embodiments, the number of nucleosides of a modified
oligonucleotide having a fully complementary portion is greater
than the length of the miRNA. For example, a modified
oligonucleotide consisting of 24 linked nucleosides, where the
nucleobases of nucleosides 1 through 23 are each complementary to a
corresponding position of a miRNA that is 23 nucleobases in length,
has a 23 nucleoside portion that is fully complementary to the
nucleobase sequence of the miRNA and approximately 96% overall
complementarity to the nucleobase sequence of the miRNA.
[0242] In certain embodiments, the nucleobase sequence of a
modified oligonucleotide is fully complementary to a portion of the
nucleobase sequence of a miRNA. For example, a modified
oligonucleotide consisting of 22 linked nucleosides, where the
nucleobases of nucleosides 1 through 22 are each complementary to a
corresponding position of a miRNA that is 23 nucleobases in length,
is fully complementary to a 22 nucleobase portion of the nucleobase
sequence of a miRNA. Such a modified oligonucleotide has
approximately 96% overall complementarity to the nucleobase
sequence of the entire miRNA, and has 100% complementarity to a 22
nucleobase portion of the miRNA.
[0243] In certain embodiments, a portion of the nucleobase sequence
of a modified oligonucleotide is fully complementary to a portion
of the nucleobase sequence of a miRNA, or a precursor thereof. In
certain such embodiments, 15 contiguous nucleobases of a modified
oligonucleotide are each complementary to 15 contiguous nucleobases
of a miRNA, or a precursor thereof. In certain such embodiments, 16
contiguous nucleobases of a modified oligonucleotide are each
complementary to 16 contiguous nucleobases of a miRNA, or a
precursor thereof. In certain such embodiments, 17 contiguous
nucleobases of a modified oligonucleotide are each complementary to
17 contiguous nucleobases of a miRNA, or a precursor thereof. In
certain such embodiments, 18 contiguous nucleobases of a modified
oligonucleotide are each complementary to 18 contiguous nucleobases
of a miRNA, or a precursor thereof. In certain such embodiments, 19
contiguous nucleobases of a modified oligonucleotide are each
complementary to 19 contiguous nucleobases of a miRNA, or a
precursor thereof. In certain such embodiments, 20 contiguous
nucleobases of a modified oligonucleotide are each complementary to
20 contiguous nucleobases of a miRNA, or a precursor thereof. In
certain such embodiments, 22 contiguous nucleobases of a modified
oligonucleotide are each complementary to 22 contiguous nucleobases
of a miRNA, or a precursor thereof. In certain such embodiments, 23
contiguous nucleobases of a modified oligonucleotide are each
complementary to 23 contiguous nucleobases of a miRNA, or a
precursor thereof. In certain such embodiments, 24 contiguous
nucleobases of a modified oligonucleotide are each complementary to
24 contiguous nucleobases of a miRNA, or a precursor thereof.
[0244] The nucleobase sequences set forth herein, including but not
limited to those found in the Examples and in the sequence listing,
are independent of any modification to the nucleic acid. As such,
nucleic acids defined by a SEQ ID NO may comprise, independently,
one or more modifications to one or more sugar moieties, to one or
more internucleoside linkages, and/or to one or more
nucleobases.
[0245] Although the sequence listing accompanying this filing
identifies each nucleobase sequence as either "RNA" or "DNA" as
required, in reality, those sequences may be modified with any
combination of chemical modifications. One of skill in the art will
readily appreciate that such designation as "RNA" or "DNA" to
describe modified oligonucleotides is somewhat arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine base could be described as a DNA
having a modified sugar (2'-OH for the natural 2'-H of DNA) or as
an RNA having a modified base (thymine (methylated uracil) for
natural uracil of RNA).
[0246] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligomeric compound having the
nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and oligomeric
compounds having other modified bases, such as "AT.sup.meCGAUCG,"
wherein .sup.meC indicates a cytosine base comprising a methyl
group at the 5-position.
[0247] Nucleic acids described herein by Isis Number (Isis NO.)
comprise a combination of nucleobase sequence and certain
identified modifications.
Certain Modified Oligonucleotides
[0248] In certain embodiments, a modified oligonucleotide consists
of 15 to 30 linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 19 to 24 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 21 to 24 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 15 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 16 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 17
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 18 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 19 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 20 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 21 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 22
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 23 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 24 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 25 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 26 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 27
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 28 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 29 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 30 linked nucleosides.
Certain Modifications
[0249] Modified oligonucleotides of the present invention comprise
one or more modifications to a nucleobase, sugar, and/or
internucleoside linkage. A modified nucleobase, sugar, and/or
internucleoside linkage may be selected over an unmodified form
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for other oligonucleotides or
nucleic acid targets and increased stability in the presence of
nucleases.
[0250] In certain embodiments, a modified oligonucleotide of the
present invention comprises one or more modified nucleosides. In
certain such embodiments, a modified nucleoside is a stabilizing
nucleoside. An example of a stabilizing nucleoside is a
sugar-modified nucleoside.
[0251] In certain embodiments, a modified nucleoside is a
sugar-modified nucleoside. In certain such embodiments, the
sugar-modified nucleosides can further comprise a natural or
modified heterocyclic base moiety and/or a natural or modified
internucleoside linkage and may include further modifications
independent from the sugar modification. In certain embodiments, a
sugar modified nucleoside is a 2'-modified nucleoside, wherein the
sugar ring is modified at the 2' carbon from natural ribose or
2'-deoxy-ribose.
[0252] In certain embodiments, a 2'-modified nucleoside has a
bicyclic sugar moiety. In certain such embodiments, the bicyclic
sugar moiety is a D sugar in the alpha configuration. In certain
such embodiments, the bicyclic sugar moiety is a D sugar in the
beta configuration. In certain such embodiments, the bicyclic sugar
moiety is an L sugar in the alpha configuration. In certain such
embodiments, the bicyclic sugar moiety is an L sugar in the beta
configuration.
[0253] In certain embodiments, the bicyclic sugar moiety comprises
a bridge group between the 2' and the 4'-carbon atoms. In certain
such embodiments, the bridge group comprises from 1 to 8 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises from 1 to 4 linked biradical groups. In certain
embodiments, the bicyclic sugar moiety comprises 2 or 3 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises 2 linked biradical groups. In certain embodiments, a
linked biradical group is selected from --O--, --S--,
--N(R.sub.1)--, --C(R.sub.1)(R.sub.2)--,
--C(R.sub.1).dbd.C(R.sub.1)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --Si(R.sub.1)(R.sub.2)--,
--S(.dbd.O).sub.2--, --S(.dbd.O)--, --C(.dbd.O)-- and
--C(.dbd.S)--; where each R.sub.1 and R.sub.2 is, independently, H,
hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12
alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12
alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12
alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl,
a heterocycle radical, a substituted heterocycle radical,
heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic
radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen,
substituted oxy (--O--), amino, substituted amino, azido, carboxyl,
substituted carboxyl, acyl, substituted acyl, CN, thiol,
substituted thiol, sulfonyl (S(.dbd.O).sub.2--H), substituted
sulfonyl, sulfoxyl (S(.dbd.O)--H) or substituted sulfoxyl; and each
substituent group is, independently, halogen, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, amino, substituted
amino, acyl, substituted acyl, C.sub.1-C.sub.12 aminoalkyl,
C.sub.1-C.sub.12 aminoalkoxy, substituted C.sub.1-C.sub.12
aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkoxy or a
protecting group.
[0254] In some embodiments, the bicyclic sugar moiety is bridged
between the 2' and 4' carbon atoms with a biradical group selected
from --O--(CH.sub.2).sub.p--, --O--CH.sub.2--,
--O--CH.sub.2CH.sub.2--, --O--CH(alkyl)-, --NH--(CH.sub.2)P--,
--N(alkyl)-(CH.sub.2).sub.p--, --O--CH(alkyl)-,
--(CH(alkyl))-(CH.sub.2).sub.p--, --NH--O--(CH.sub.2).sub.p--,
--N(alkyl)-O--(CH.sub.2).sub.p--, or
--O--N(alkyl)-(CH.sub.2).sub.p--, wherein p is 1, 2, 3, 4 or 5 and
each alkyl group can be further substituted. In certain
embodiments, p is 1, 2 or 3.
[0255] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from halo, allyl, amino, azido, SH,
CN, OCN, CF.sub.3, OCF.sub.3, O--, S--, or N(R.sub.m)-alkyl; O--,
S--, or N(R.sub.m)-alkenyl; O--, S-- or N(R.sub.m)-alkynyl;
O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl,
O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0256] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3,
O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2--CH.dbd.CH.sub.2,
O--CH.sub.2--CH.dbd.CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0257] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, OCF.sub.3, O--CH.sub.3,
OCH.sub.2CH.sub.2OCH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N--(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0258] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, O--CH.sub.3, and
OCH.sub.2CH.sub.2OCH.sub.3.
[0259] In certain embodiments, a sugar-modified nucleoside is a
4'-thio modified nucleoside. In certain embodiments, a
sugar-modified nucleoside is a 4'-thio-2'-modified nucleoside. A
4'-thio modified nucleoside has a .beta.-D-ribonucleoside where the
4'-O replaced with 4'-S. A 4'-thio-2'-modified nucleoside is a
4'-thio modified nucleoside having the 2'-OH replaced with a
2'-substituent group. Suitable 2'-substituent groups include
2'-OCH.sub.3, 2'-O--(CH.sub.2).sub.2--OCH.sub.3, and 2'-F.
[0260] In certain embodiments, a modified oligonucleotide of the
present invention comprises one or more internucleoside
modifications. In certain such embodiments, each internucleoside
linkage of a modified oligonucleotide is a modified internucleoside
linkage. In certain embodiments, a modified internucleoside linkage
comprises a phosphorus atom.
[0261] In certain embodiments, a modified oligonucleotide of the
present invention comprises at least one phosphorothioate
internucleoside linkage. In certain embodiments, each
internucleoside linkage of a modified oligonucleotide is a
phosphorothioate internucleoside linkage.
[0262] In certain embodiments, a modified internucleoside linkage
does not comprise a phosphorus atom. In certain such embodiments,
an internucleoside linkage is formed by a short chain alkyl
internucleoside linkage. In certain such embodiments, an
internucleoside linkage is formed by a cycloalkyl internucleoside
linkages. In certain such embodiments, an internucleoside linkage
is formed by a mixed heteroatom and alkyl internucleoside linkage.
In certain such embodiments, an internucleoside linkage is formed
by a mixed heteroatom and cycloalkyl internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more short chain heteroatomic internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more heterocyclic internucleoside linkages. In certain such
embodiments, an internucleoside linkage has an amide backbone. In
certain such embodiments, an internucleoside linkage has mixed N,
O, S and CH.sub.2 component parts.
[0263] In certain embodiments, a modified oligonucleotide comprises
one or more modified nucleobases. In certain embodiments, a
modified oligonucleotide comprises one or more 5-methylcytosines.
In certain embodiments, each cytosine of a modified oligonucleotide
comprises a 5-methylcytosine.
[0264] In certain embodiments, a modified nucleobase is selected
from 5-hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine.
In certain embodiments, a modified nucleobase is selected from
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
In certain embodiments, a modified nucleobase is selected from
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2 aminopropyladenine,
5-propynyluracil and 5-propynylcytosine.
[0265] In certain embodiments, a modified nucleobase comprises a
polycyclic heterocycle. In certain embodiments, a modified
nucleobase comprises a tricyclic heterocycle. In certain
embodiments, a modified nucleobase comprises a phenoxazine
derivative. In certain embodiments, the phenoxazine can be further
modified to form a nucleobase known in the art as a G-clamp.
Certain Oligonucleotide Motifs
[0266] Suitable motifs for modified oligonucleotides of the present
invention include, but are not limited to, fully modified,
uniformly modified, positionally modified, and gapmer. Modified
oligonucleotides having a fully modified motif, including a
uniformly modified motif, may be designed to target mature miRNAs.
Alternatively, modified oligonucleotides having a fully modified
motif, including a uniformly modified motif, may be designed to
target certain sites of pri-miRNAs or pre-miRNAs, to block the
processing of miRNA precursors into mature miRNAs. Modified
oligonucleotides having a fully modified motif or uniformly
modified motif are effective inhibitors of miRNA activity.
[0267] In certain embodiments, a fully modified oligonucleotide
comprises a sugar modification at each nucleoside. In certain such
embodiments, pluralities of nucleosides are 2'-O-methoxyethyl
nucleosides and the remaining nucleosides are 2'-fluoro
nucleosides. In certain such embodiments, each of a plurality of
nucleosides is a 2'-O-methoxyethyl nucleoside and each of a
plurality of nucleosides is a bicyclic nucleoside. In certain such
embodiments, a fully modified oligonucleotide further comprises at
least one modified internucleoside linkage. In certain such
embodiments, each internucleoside linkage of a fully sugar-modified
oligonucleotide is a modified internucleoside linkage. In certain
embodiments, a fully sugar-modified oligonucleotide further
comprises at least one phosphorothioate internucleoside linkage. In
certain such embodiments, each internucleoside linkage of a fully
sugar-modified oligonucleotide is a phosphorothioate
internucleoside linkage.
[0268] In certain embodiments, a fully modified oligonucleotide is
modified at each internucleoside linkage. In certain such
embodiments, each internucleoside linkage of a fully modified
oligonucleotide is a phosphorothioate internucleoside linkage.
[0269] In certain embodiments, a uniformly modified oligonucleotide
comprises the same sugar modification at each nucleoside. In
certain such embodiments, each nucleoside of a modified
oligonucleotide comprises a 2'-O-methoxyethyl sugar modification.
In certain embodiments, each nucleoside of a modified
oligonucleotide comprises a 2'-O-methyl sugar modification. In
certain embodiments, each nucleoside of a modified oligonucleotide
comprises a 2'-fluoro sugar modification. In certain such
embodiments, a uniformly modified oligonucleotide further comprises
at least one modified internucleoside linkage. In certain such
embodiments, each internucleoside linkage of a uniformly
sugar-modified oligonucleotide is a modified internucleoside
linkage. In certain embodiments, a uniformly sugar-modified
oligonucleotide further comprises at least one phosphorothioate
internucleoside linkage. In certain such embodiments, each
internucleoside linkage of a uniformly sugar-modified
oligonucleotide is a phosphorothioate internucleoside linkage.
[0270] In certain embodiments, a uniformly modified oligonucleoside
comprises the same internucleoside linkage modifications
throughout. In certain such embodiments, each internucleoside
linkage of a uniformly modified oligonucleotide is a
phosphorothioate internucleoside linkage.
[0271] Table 1 illustrates certain uniformly modified
oligonucleotides complementary to the miRNAs described herein. Each
nucleoside comprises a 2'-O-methoxyethyl sugar, each
internucleoside linkage is phosphorothioate, and each cytosine is a
5-methylcytosine. TABLE-US-00001 TABLE 1 Modified Oligonucleotide
SEQ ID Version 10 # NO miRNA Sanger mir ID 327917 1 miR-21
hsa-miR-21 341787 2 miR-125a hsa-miR-125a-5p 341802 3 mir-191
hsa-miR-191 401852 4 mir-210 hsa~miR-210 327920 5 mir-222
hsa~miR-222 379242 6 miR-422b hsa-miR-378 379243 7 mir-423
hsa-miR-423-3p 399329 8 miR-638 hsa-miR-638
[0272] In certain embodiments, a positionally modified
oligonucleotide comprises regions of linked nucleosides, where each
nucleoside of each region comprises the same sugar moiety, and
where each nucleoside of each region comprises a sugar moiety
different from that of an adjacent region.
[0273] In certain embodiments, a positionally modified
oligonucleotide comprises at least 10 2'-fluoro modified
nucleosides. Such a positionally modified oligonucleotide may be
represented by the following formula I:
5'-T.sub.1-(Nu.sub.1-L.sub.1).sub.n1-(Nu.sub.2-L.sub.2).sub.n2-Nu.sub.2-(-
L.sub.3-Nu.sub.3).sub.n3-T.sub.2-3', wherein:
[0274] each Nu.sub.1 and Nu.sub.3 is, independently, a stabilizing
nucleoside;
[0275] at least 10 Nu.sub.2 are 2'-fluoro nucleosides;
[0276] each L.sub.1, L.sub.2 and L.sub.3 is, independently, an
internucleoside linkage;
[0277] each T.sub.1 and T.sub.2 is, independently, H, a hydroxyl
protecting group, an optionally linked conjugate group or a capping
group;
[0278] n.sub.1 is from 0 to about 3;
[0279] n.sub.2 is from about 14 to about 22;
[0280] n.sub.3 is from 0 to about 3; and
[0281] provided that if n.sub.1 is 0 then T.sub.1 is not H or a
hydroxyl protecting group, and if n.sub.3 is 0, then T.sub.2 is not
H or a hydroxyl protecting group.
[0282] In certain such embodiments, n.sub.1 and n.sub.3 are each,
independently, from 1 to about 3. In certain embodiments, n.sub.1
and n.sub.3 are each, independently, from 2 to about 3. In certain
embodiments, n.sub.1 is 1 or 2 and n.sub.3 is 2 or 3. In certain
embodiments, n.sub.1 and n.sub.3 are each 2. In certain
embodiments, at least one of n.sub.1 and n.sub.3 is greater than
zero. In certain embodiments, n.sub.1 and n.sub.3 is each greater
than zero. In certain embodiments, one of n.sub.1 and n.sub.3 is
greater than zero. In certain embodiments, one of n.sub.1 and
n.sub.3 is greater than one.
[0283] In certain embodiments, n.sub.2 is from 16 to 20. In certain
embodiments, n.sub.2 is from 17 to 19. In certain embodiments,
n.sub.2 is 18. In certain embodiments, n.sub.2 is 19. In certain
embodiments, n.sub.2 is 20.
[0284] In certain embodiments, about 2 to about 8 of the Nu.sub.2
nucleosides are stabilizing nucleosides. In certain embodiments,
from about 2 to about 6 of the Nu.sub.2 nucleosides are stabilizing
nucleosides. In certain embodiments, from about 3 to about 4 of the
Nu.sub.2 nucleosides are stabilizing nucleosides. In certain
embodiments, 3 of the Nu.sub.2 nucleosides are stabilizing
nucleosides.
[0285] In certain embodiments, each of the Nu.sub.2 stabilizing
nucleosides is separated from the Nu.sub.3 stabilizing nucleosides
by from 2 to about 8 2'-fluoro nucleosides. In certain embodiments
each of the Nu.sub.2 stabilizing nucleosides is separated from the
Nu.sub.3 stabilizing nucleosides by from 3 to about 8 2'-fluoro
nucleosides. In certain embodiments each of the Nu.sub.2
stabilizing nucleosides is separated from the Nu.sub.3 stabilizing
nucleosides by from 5 to about 8 2'-fluoro nucleosides.
[0286] In certain embodiments, a modified oligonucleotide comprises
from 2 to about 6 Nu.sub.2 stabilizing nucleosides. In certain
embodiments, a modified oligonucleotide comprises 3 Nu.sub.2
stabilizing nucleosides.
[0287] In certain embodiments, each of the Nu.sub.2 stabilizing
nucleosides is linked together in one contiguous sequence. In
certain embodiments, at least two of the Nu.sub.2 stabilizing
nucleosides are separated by at least one of the 2'-fluoro
nucleosides. In certain embodiments, each of the Nu.sub.2
stabilizing nucleosides is separated by at least one of the
2'-fluoro nucleosides.
[0288] In certain embodiments, at least two contiguous sequences of
the Nu.sub.2 2'-fluoro nucleosides are separated by at least one of
the stabilizing nucleosides wherein each of the contiguous
sequences have the same number of 2'-fluoro nucleosides.
[0289] In certain embodiments, T.sub.1 and T.sub.2 are each,
independently, H or a hydroxyl protecting group. In certain
embodiments, at least one of T.sub.1 and T.sub.2 is
4,4'-dimethoxytrityl. In certain embodiments, at least one of
T.sub.1 and T.sub.2 is an optionally linked conjugate group. In
certain embodiments, at least one of T.sub.1 and T.sub.2 is a
capping group. In certain embodiments, the capping group is an
inverted deoxy abasic group.
[0290] In certain embodiments, a positionally modified
oligonucleotide comprises at least one modified internucleoside
linkage. In certain such embodiments, each internucleoside linkage
of a positionally modified oligonucleoside is a modified
internucleoside linkage. In certain embodiments, at least one
internucleoside linkage of a positionally modified oligonucleotide
is a phosphorothioate internucleoside linkage. In certain such
embodiments, each internucleoside linkage of a positionally
modified oligonucleotide is a phosphorothioate internucleoside
linkage.
[0291] In certain embodiments, a positionally modified motif is
represented by the following formula II, which represents a
modified oligonucleotide consisting of linked nucleosides:
T.sub.1-(Nu.sub.1).sub.n1-(Nu.sub.2).sub.n2-(Nu.sub.3).sub.n3-(Nu.sub.4).-
sub.n4-(Nu.sub.5).sub.n5-T.sub.2, wherein:
[0292] Nu.sub.1 and Nu.sub.5 are, independently, 2' stabilizing
nucleosides;
[0293] Nu.sub.2 and Nu.sub.4 are 2'-fluoro nucleosides;
[0294] Nu.sub.3 is a 2'-modified nucleoside;
[0295] each of n.sub.1 and n.sub.5 is, independently, from 0 to
3;
[0296] the sum of n.sub.2 plus n.sub.4 is between 10 and 25;
[0297] n.sub.3 is from 0 and 5; and
[0298] each T.sub.1 and T.sub.2 is, independently, H, a hydroxyl
protecting group, an optionally linked conjugate group or a capping
group.
[0299] In certain embodiments, the sum of n.sub.2 and n.sub.4 is
16. In certain embodiments, the sum of n.sub.2 and n.sub.4 is 17.
In certain embodiments, the sum of n.sub.2 and n.sub.4 is 18. In
certain embodiments, n.sub.1 is 2; n.sub.3 is 2 or 3; and n.sub.5
is 2.
[0300] In certain embodiments, Nu.sub.1 and Nu.sub.5 are,
independently, 2'-modified nucleosides.
[0301] In certain embodiments, Nu.sub.1 is
O--(CH.sub.2).sub.2--OCH.sub.3, Nu.sub.3 is
O--(CH.sub.2).sub.2--OCH.sub.3, Nu.sub.5
O--(CH.sub.2).sub.2--OCH.sub.3, T.sub.1 is H and T.sub.2 is H.
[0302] In certain embodiments, a modified oligonucleotide
complementary to a miRNA and consisting of 21 linked nucleosides
has a Formula II selected from Table 2, where each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a modified oligonucleotide having a Formula II
selected from Table 2 has a nucleobase sequence selected from the
nucleobase sequences recited in SEQ ID NOs 24 and 27.
TABLE-US-00002 TABLE 2 n.sub.1 n.sub.2 n.sub.3 n.sub.4 n.sub.5
Nu.sub.1 Nu.sub.3 Nu.sub.5 T.sub.1 T.sub.2 2 17 0 0 2 2'-MOE 2'-MOE
2'-MOE H H 2 2 2 13 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 2 12 2 2'-MOE
2'-MOE 2'-MOE H H 2 4 2 11 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 2 10 2
2'-MOE 2'-MOE 2'-MOE H H 2 6 2 9 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 2 8
2 2'-MOE 2'-MOE 2'-MOE H H 2 8 2 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 9 2
6 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 2 5 2 2'-MOE 2'-MOE 2'-MOE H H 2
11 2 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 2 3 2 2'-MOE 2'-MOE 2'-MOE H
H 2 13 2 2 2 2'-MOE 2'-MOE 2'-MOE H H 2 2 3 12 2 2'-MOE 2'-MOE
2'-MOE H H 2 3 3 11 2 2'-MOE 2'-MOE 2'-MOE H H 2 4 3 10 2 2'-MOE
2'-MOE 2'-MOE H H 2 5 3 9 2 2'-MOE 2'-MOE 2'-MOE H H 2 6 3 8 2
2'-MOE 2'-MOE 2'-MOE H H 2 7 3 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 3 6
2 2'-MOE 2'-MOE 2'-MOE H H 2 9 3 5 2 2'-MOE 2'-MOE 2'-MOE H H 2 10
3 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 11 3 3 2 2'-MOE 2'-MOE 2'-MOE H H
2 12 3 2 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 6 3 2 2'-MOE 2'-MOE 2'-MOE
H H
[0303] In certain embodiments, a modified oligonucleotide
complementary to a miRNA and consisting of 22 linked nucleosides
has a Formula II selected from Table 3, where each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a modified oligonucleotide having a Formula II
selected from Table 3 has a nucleobase sequence selected from the
nucleobase sequences recited in SEQ ID NOs 17, 20, 22, 26, and 28.
TABLE-US-00003 TABLE 3 n.sub.1 n.sub.2 n.sub.3 n.sub.4 n.sub.5
Nu.sub.1 Nu.sub.3 Nu.sub.5 T.sub.1 T.sub.2 2 18 0 0 2 2'-MOE 2'-MOE
2'-MOE H H 2 2 2 14 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 2 13 2 2'-MOE
2'-MOE 2'-MOE H H 2 4 2 12 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 2 11 2
2'-MOE 2'-MOE 2'-MOE H H 2 6 2 10 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 2
9 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 2 8 2 2'-MOE 2'-MOE 2'-MOE H H 2 9
2 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 2 6 2 2'-MOE 2'-MOE 2'-MOE H H
2 11 2 5 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 2 4 2 2'-MOE 2'-MOE 2'-MOE
H H 2 13 2 3 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 2 2 2 2'-MOE 2'-MOE
2'-MOE H H 2 2 3 13 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 3 12 2 2'-MOE
2'-MOE 2'-MOE H H 2 4 3 11 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 3 10 2
2'-MOE 2'-MOE 2'-MOE H H 2 6 3 9 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 3 8
2 2'-MOE 2'-MOE 2'-MOE H H 2 8 3 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 9 3
6 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 3 5 2 2'-MOE 2'-MOE 2'-MOE H H 2
11 3 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 3 3 2 2'-MOE 2'-MOE 2'-MOE H
H 2 13 3 2 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 6 4 2 2'-MOE 2'-MOE
2'-MOE H H
[0304] In certain embodiments, a modified oligonucleotide
complementary to a miRNA and consisting of 23 linked nucleosides
has a Formula II selected from Table 4, where each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a modified oligonucleotide having a Formula II
selected from Table 4 has a nucleobase sequence selected from the
nucleobase sequences recited in SEQ ID NOs 18, 21, and 23.
TABLE-US-00004 TABLE 4 n.sub.1 n.sub.2 n.sub.3 n.sub.4 n.sub.5
Nu.sub.1 Nu.sub.3 Nu.sub.5 T.sub.1 T.sub.2 2 19 0 0 2 2'-MOE 2'-MOE
2'-MOE H H 2 2 2 15 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 2 14 2 2'-MOE
2'-MOE 2'-MOE H H 2 4 2 13 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 2 12 2
2'-MOE 2'-MOE 2'-MOE H H 2 6 2 11 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 2
10 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 2 9 2 2'-MOE 2'-MOE 2'-MOE H H 2
9 2 8 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 2 7 2 2'-MOE 2'-MOE 2'-MOE H
H 2 11 2 6 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 2 5 2 2'-MOE 2'-MOE
2'-MOE H H 2 13 2 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 2 3 2 2'-MOE
2'-MOE 2'-MOE H H 2 15 2 2 2 2'-MOE 2'-MOE 2'-MOE H H 2 2 3 14 2
2'-MOE 2'-MOE 2'-MOE H H 2 3 3 13 2 2'-MOE 2'-MOE 2'-MOE H H 2 4 3
12 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 3 11 2 2'-MOE 2'-MOE 2'-MOE H H 2
6 3 10 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 3 9 2 2'-MOE 2'-MOE 2'-MOE H
H 2 8 3 8 2 2'-MOE 2'-MOE 2'-MOE H H 2 9 3 7 2 2'-MOE 2'-MOE 2'-MOE
H H 2 10 3 6 2 2'-MOE 2'-MOE 2'-MOE H H 2 11 3 5 2 2'-MOE 2'-MOE
2'-MOE H H 2 12 3 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 13 3 3 2 2'-MOE
2'-MOE 2'-MOE H H 2 14 3 2 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 6 5 2
2'-MOE 2'-MOE 2'-MOE H H
[0305] In certain embodiments, a modified oligonucleotide
complementary to a miRNA and consisting of 24 linked nucleosides
has a Formula II selected from Table 5, where each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a modified oligonucleotide having a Formula II
selected from Table 5 has a nucleobase sequence selected from the
nucleobase sequences recited in SEQ ID NOs 19 and 23.
TABLE-US-00005 TABLE 5 n.sub.1 n.sub.2 n.sub.3 n.sub.4 n.sub.5
Nu.sub.1 Nu.sub.3 Nu.sub.5 T.sub.1 T.sub.2 2 20 0 0 2 2'-MOE 2'-MOE
2'-MOE H H 2 2 2 16 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 2 15 2 2'-MOE
2'-MOE 2'-MOE H H 2 4 2 14 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 2 13 2
2'-MOE 2'-MOE 2'-MOE H H 2 6 2 12 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 2
11 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 2 10 2 2'-MOE 2'-MOE 2'-MOE H H 2
9 2 9 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 2 8 2 2'-MOE 2'-MOE 2'-MOE H
H 2 11 2 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 2 6 2 2'-MOE 2'-MOE
2'-MOE H H 2 13 2 5 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 2 4 2 2'-MOE
2'-MOE 2'-MOE H H 2 15 2 3 2 2'-MOE 2'-MOE 2'-MOE H H 2 16 2 2 2
2'-MOE 2'-MOE 2'-MOE H H 2 2 3 15 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 3
14 2 2'-MOE 2'-MOE 2'-MOE H H 2 4 3 13 2 2'-MOE 2'-MOE 2'-MOE H H 2
5 3 12 2 2'-MOE 2'-MOE 2'-MOE H H 2 6 3 11 2 2'-MOE 2'-MOE 2'-MOE H
H 2 7 3 10 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 3 9 2 2'-MOE 2'-MOE
2'-MOE H H 2 9 3 8 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 3 7 2 2'-MOE
2'-MOE 2'-MOE H H 2 11 3 6 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 3 5 2
2'-MOE 2'-MOE 2'-MOE H H 2 13 3 4 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 3
3 2 2'-MOE 2'-MOE 2'-MOE H H 2 15 3 2 2 2'-MOE 2'-MOE 2'-MOE H H 2
8 6 6 2 2'-MOE 2'-MOE 2'-MOE H H
[0306] In certain embodiments, a modified oligonucleotide
complementary to a miRNA and consisting of 25 linked nucleosides
has a Formula II selected from Table 6, where each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a modified oligonucleotide having a Formula II
selected from Table 6 has the nucleobase sequence recited in SEQ ID
NOs 30. TABLE-US-00006 TABLE 6 n.sub.1 n.sub.2 n.sub.3 n.sub.4
n.sub.5 Nu.sub.1 Nu.sub.3 Nu.sub.5 T.sub.1 T.sub.2 2 21 0 0 2
2'-MOE 2'-MOE 2'-MOE H H 2 2 2 17 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 2
16 2 2'-MOE 2'-MOE 2'-MOE H H 2 4 2 15 2 2'-MOE 2'-MOE 2'-MOE H H 2
5 2 14 2 2'-MOE 2'-MOE 2'-MOE H H 2 6 2 13 2 2'-MOE 2'-MOE 2'-MOE H
H 2 7 2 12 2 2'-MOE 2'-MOE 2'-MOE H H 2 8 2 11 2 2'-MOE 2'-MOE
2'-MOE H H 2 9 2 10 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 2 9 2 2'-MOE
2'-MOE 2'-MOE H H 2 11 2 8 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 2 7 2
2'-MOE 2'-MOE 2'-MOE H H 2 13 2 6 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 2
5 2 2'-MOE 2'-MOE 2'-MOE H H 2 15 2 4 2 2'-MOE 2'-MOE 2'-MOE H H 2
16 2 3 2 2'-MOE 2'-MOE 2'-MOE H H 2 17 2 2 2 2'-MOE 2'-MOE 2'-MOE H
H 2 2 3 16 2 2'-MOE 2'-MOE 2'-MOE H H 2 3 3 15 2 2'-MOE 2'-MOE
2'-MOE H H 2 4 3 14 2 2'-MOE 2'-MOE 2'-MOE H H 2 5 3 13 2 2'-MOE
2'-MOE 2'-MOE H H 2 6 3 12 2 2'-MOE 2'-MOE 2'-MOE H H 2 7 3 11 2
2'-MOE 2'-MOE 2'-MOE H H 2 8 3 10 2 2'-MOE 2'-MOE 2'-MOE H H 2 9 3
9 2 2'-MOE 2'-MOE 2'-MOE H H 2 10 3 8 2 2'-MOE 2'-MOE 2'-MOE H H 2
11 3 7 2 2'-MOE 2'-MOE 2'-MOE H H 2 12 3 6 2 2'-MOE 2'-MOE 2'-MOE H
H 2 13 3 5 2 2'-MOE 2'-MOE 2'-MOE H H 2 14 3 4 2 2'-MOE 2'-MOE
2'-MOE H H 2 15 3 3 2 2'-MOE 2'-MOE 2'-MOE H H 2 16 3 2 2 2'-MOE
2'-MOE 2'-MOE H H 2 8 6 7 2 2'-MOE 2'-MOE 2'-MOE H H
[0307] A modified oligonucleotide having a gapmer motif may have an
internal region consisting of linked 2'-deoxynucleotides, and
external regions consisting of linked 2'-modified nucleosides. Such
a gapmer may be designed to elicit RNase H cleavage of a miRNA
precursor. The internal 2'-deoxynucleoside region serves as a
substrate for RNase H, allowing the cleavage of the miRNA precursor
to which a modified oligonucleotide is targeted. In certain
embodiments, each nucleoside of each external region comprises the
same 2'-modified nucleoside. In certain embodiments, one external
region is uniformly comprised of a first 2'-modified nucleoside and
the other external region is uniformly comprised of a second
2'-modified nucleoside.
[0308] A modified oligonucleotide having a gapmer motif may have a
sugar modification at each nucleoside. In certain embodiments, the
internal region is uniformly comprised of a first 2'-modified
nucleoside and each of the wings is uniformly comprised of a second
2'-modified nucleoside. In certain such embodiments, the internal
region is uniformly comprised of 2'-fluoro nucleosides and each
external region is uniformly comprised of 2'-O-methoxyethyl
nucleosides.
[0309] In certain embodiments, each external region of a gapmer
consists of linked 2'-O-methoxyethyl nucleosides. In certain
embodiments, each external region of a gapmer consists of linked
2'-O-methyl nucleosides. In certain embodiments, each external
region of a gapmer consists of 2'-fluoro nucleosides. In certain
embodiments, each external region of a gapmer consists of linked
bicyclic nucleosides.
[0310] In certain embodiments, each nucleoside of one external
region of a gapmer comprises 2'-O-methoxyethyl nucleosides and each
nucleoside of the other external region comprises a different
2'-modification. In certain such embodiments, each nucleoside of
one external region of a gapmer comprises 2'-O-methoxyethyl
nucleosides and each nucleoside of the other external region
comprises 2'-O-methyl nucleosides. In certain such embodiments,
each nucleoside of one external region of a gapmer comprises
2'-O-methoxyethyl nucleosides and each nucleoside of the other
external region comprises 2'-fluoro nucleosides. In certain such
embodiments, each nucleoside of one external region of a gapmer
comprises 2'-O-methyl nucleosides and each nucleoside of the other
external region comprises 2'-fluoro nucleosides. In certain such
embodiments, each nucleoside of one external region of a gapmer
comprises 2'-O-methoxyethyl nucleosides and each nucleoside of the
other external region comprises bicyclic nucleosides. In certain
such embodiments, each nucleoside of one external region of a
gapmer comprises 2'-O-methyl nucleosides and each nucleoside of the
other external region comprises bicyclic nucleosides.
[0311] In certain embodiments, nucleosides of one external region
comprise two or more sugar modifications. In certain embodiments,
nucleosides of each external region comprise two or more sugar
modifications. In certain embodiments, at least one nucleoside of
an external region comprises a 2'-O-methoxyethyl sugar and at least
one nucleoside of the same external region comprises a 2'-fluoro
sugar. In certain embodiments, at least one nucleoside of an
external region comprises a 2'-O-methoxyethyl sugar and at least
one nucleoside of the same external region comprises a bicyclic
sugar moiety. In certain embodiments, at least one nucleoside of an
external region comprises a 2'-O-methyl sugar and at least one
nucleoside of the same external region comprises a bicyclic sugar
moiety. In certain embodiments at least one nucleoside of an
external region comprises a 2'-O-methyl sugar and at least one
nucleoside of the same external region comprises a 2'-fluoro sugar.
In certain embodiments, at least one nucleoside of an external
region comprises a 2'-fluoro sugar and at least one nucleoside of
the same external region comprises a bicyclic sugar moiety.
[0312] In certain embodiments, each external region of a gapmer
consists of the same number of linked nucleosides. In certain
embodiments, one external region of a gapmer consists a number of
linked nucleosides different that that of the other external
region.
[0313] In certain embodiments, the external regions comprise,
independently, from 1 to 6 nucleosides. In certain embodiments, an
external region comprises 1 nucleoside. In certain embodiments, an
external region comprises 2 nucleosides. In certain embodiments, an
external region comprises 3 nucleosides. In certain embodiments, an
external region comprises 4 nucleosides. In certain embodiments, an
external region comprises 5 nucleosides. In certain embodiments, an
external region comprises 6 nucleosides. In certain embodiments,
the internal region consists of 17 to 28 linked nucleosides. In
certain embodiments, an internal region consists of 17 to 21 linked
nucleosides. In certain embodiments, an internal region consists of
17 linked nucleosides. In certain embodiments, an internal region
consists of 18 linked nucleosides. In certain embodiments, an
internal region consists of 19 linked nucleosides. In certain
embodiments, an internal region consists of 20 linked nucleosides.
In certain embodiments, an internal region consists of 21 linked
nucleosides. In certain embodiments, an internal region consists of
22 linked nucleosides. In certain embodiments, an internal region
consists of 23 linked nucleosides. In certain embodiments, an
internal region consists of 24 linked nucleosides. In certain
embodiments, an internal region consists of 25 linked nucleosides.
In certain embodiments, an internal region consists of 26 linked
nucleosides. In certain embodiments, an internal region consists of
27 linked nucleosides. In certain embodiments, an internal region
consists of 28 linked nucleosides.
Certain Additional Therapies
[0314] Cancer treatments often comprise more than one therapy. As
such, in certain embodiments the present invention provides methods
for treating liver cancer comprising administering to a subject in
need thereof a compound comprising a modified oligonucleotide
complementary to a miRNA, or a precursor thereof, and further
comprising administering at least one additional therapy.
[0315] In certain embodiments, an additional therapy may also be
designed to treat liver cancer, such as HCC. An additional therapy
may be a chemotherapeutic agent. Suitable chemotherapeutic agents
include 5-fluorouracil, gemcitabine, doxorubicine, mitomycin c,
sorafenib, etoposide, carboplatin, epirubicin, irinotecan and
oxaliplatin. An additional suitable chemotherapeutic agent includes
a modified oligonucleotide, other than a modified oligonucleotide
of the present invention, that is used to treat cancer. An
additional therapy may be surgical resection of a liver tumor(s),
liver transplantation, or chemoembolization.
[0316] In certain embodiments, an additional therapy may be
designed to treat a disease other than liver cancer, including HCC.
In certain such embodiments, an additional therapy may be a
treatment for hepatitis C infection or hepatitis B infection.
[0317] In certain embodiments, an additional therapy is a treatment
for hepatitis C infection. Therapeutic agents for treatment of
hepatitis C infection include interferons, for example, interferon
alfa-2b, interferon alfa-2a, and interferon alfacon-1. Less
frequent interferon dosing can be achieved using pegylated
interferon (interferon attached to a polyethylene glycol moiety
which significantly improves its pharmacokinetic profile).
Combination therapy with interferon alfa-2b (pegylated and
unpegylated) and ribavarin has also been shown to be efficacious
for some patient populations. Other agents currently being
developed include RNA replication inhibitors (e.g., ViroPharma's
VP50406 series), antisense agents (for example, anti-miR-122),
therapeutic vaccines, protease inhibitors, helicase inhibitors and
antibody therapy (monoclonal and polyclonal).
[0318] In certain embodiments, an additional therapy may be a
pharmaceutical agent that enhances the body's immune system,
including low-dose cyclophosphamide, thymostimulin, vitamins and
nutritional supplements (e.g., antioxidants, including vitamins A,
C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-10 and
echinacea), and vaccines, e.g., the immunostimulating complex
(ISCOM), which comprises a vaccine formulation that combines a
multimeric presentation of antigen and an adjuvant.
[0319] In certain such embodiments, the additional therapy is
selected to treat or ameliorate a side effect of one or more
pharmaceutical compositions of the present invention. Such side
effects include, without limitation, injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, and myopathies. For example, increased
aminotransferase levels in serum may indicate liver toxicity or
liver function abnormality. For example, increased bilirubin may
indicate liver toxicity or liver function abnormality.
[0320] In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are administered at the same time. In certain
embodiments, one or more pharmaceutical compositions of the present
invention and one or more other pharmaceutical agents are
administered at different times. In certain embodiments, one or
more pharmaceutical compositions of the present invention and one
or more other pharmaceutical agents are prepared together in a
single formulation. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are prepared separately.
Certain Pharmaceutical Compositions
[0321] In certain embodiments, a compound comprising a modified
oligonucleotide complementary to a miRNA, or precursor thereof,
described herein is prepared as a pharmaceutical composition for
the treatment of liver cancer, including HCC. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intraventricular, intraperitoneal,
intranasal, intraocular, intratumoral, and parenteral (e.g.,
intravenous, intramuscular, intramedullary, and subcutaneous). An
additional suitable administration route includes
chemoembolization. In certain embodiments, pharmaceutical
intrathecals are administered to achieve local rather than systemic
exposures. For example, pharmaceutical compositions may be injected
directly in the area of desired effect (e.g., into a tumor).
[0322] In certain embodiments, a pharmaceutical composition of the
present invention is administered in the form of a dosage unit
(e.g., tablet, capsule, bolus, etc.). In certain embodiments, such
pharmaceutical compositions comprise a modified oligonucleotide in
a dose selected from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55
mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg,
105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145
mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg,
190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230
mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg,
270 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315
mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg,
360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400
mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg,
445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485
mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg,
530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570
mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610 mg,
615 mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg, 655
mg, 660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695 mg,
700 mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg, 740
mg, 745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780 mg,
785 mg, 790 mg, 795 mg, and 800 mg. In certain such embodiments, a
pharmaceutical composition of the present invention comprises a
dose of modified oligonucleotide selected from 25 mg, 50 mg, 75 mg,
100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 600
mg, 700 mg, and 800 mg.
[0323] In certain embodiments, a pharmaceutical agent is sterile
lyophilized modified oligonucleotide that is reconstituted with a
suitable diluent, e.g., sterile water for injection or sterile
saline for injection. The reconstituted product is administered as
a subcutaneous injection or as an intravenous infusion after
dilution into saline. The lyophilized drug product consists of a
modified oligonucleotide which has been prepared in water for
injection, or in saline for injection, adjusted to pH 7.0-9.0 with
acid or base during preparation, and then lyophilized. The
lyophilized modified oligonucleotide may be 25-800 mg of a modified
oligonucleotide. It is understood that this encompasses 25, 50, 75,
100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425,
450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750,
775, and 800 mg of modified lyophilized oligonucleotide. The
lyophilized drug product may be packaged in a 2 mL Type I, clear
glass vial (ammonium sulfate-treated), stoppered with a bromobutyl
rubber closure and sealed with an aluminum FLIP-OFF.RTM.
overseal.
[0324] In certain embodiments, the compositions of the present
invention may additionally contain other adjunct components
conventionally found in pharmaceutical compositions, at their
art-established usage levels. Thus, for example, the compositions
may contain additional, compatible, pharmaceutically-active
materials such as, for example, antipruritics, astringents, local
anesthetics or anti-inflammatory agents, or may contain additional
materials useful in physically formulating various dosage forms of
the compositions of the present invention, such as dyes, flavoring
agents, preservatives, antioxidants, opacifiers, thickening agents
and stabilizers. However, such materials, when added, should not
unduly interfere with the biological activities of the components
of the compositions of the present invention. The formulations can
be sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the oligonucleotide(s) of the
formulation.
[0325] In certain embodiments, pharmaceutical compositions of the
present invention comprise one or more modified oligonucleotides
and one or more excipients. In certain such embodiments, excipients
are selected from water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylase, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0326] In certain embodiments, a pharmaceutical composition of the
present invention is prepared using known techniques, including,
but not limited to mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or tabletting
processes.
[0327] In certain embodiments, a pharmaceutical composition of the
present invention is a liquid (e.g., a suspension, elixir and/or
solution). In certain of such embodiments, a liquid pharmaceutical
composition is prepared using ingredients known in the art,
including, but not limited to, water, glycols, oils, alcohols,
flavoring agents, preservatives, and coloring agents.
[0328] In certain embodiments, a pharmaceutical composition of the
present invention is a solid (e.g., a powder, tablet, and/or
capsule). In certain of such embodiments, a solid pharmaceutical
composition comprising one or more oligonucleotides is prepared
using ingredients known in the art, including, but not limited to,
starches, sugars, diluents, granulating agents, lubricants,
binders, and disintegrating agents.
[0329] In certain embodiments, a pharmaceutical composition of the
present invention is formulated as a depot preparation. Certain
such depot preparations are typically longer acting than non-depot
preparations. In certain embodiments, such preparations are
administered by implantation (for example subcutaneously or
intramuscularly) or by intramuscular injection. In certain
embodiments, depot preparations are prepared using suitable
polymeric or hydrophobic materials (for example an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0330] In certain embodiments, a pharmaceutical composition of the
present invention comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0331] In certain embodiments, a pharmaceutical composition of the
present invention comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present invention to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0332] In certain embodiments, a pharmaceutical composition of the
present invention comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0333] In certain embodiments, a pharmaceutical composition of the
present invention comprises a sustained-release system. A
non-limiting example of such a sustained-release system is a
semi-permeable matrix of solid hydrophobic polymers. In certain
embodiments, sustained-release systems may, depending on their
chemical nature, release pharmaceutical agents over a period of
hours, days, weeks or months.
[0334] In certain embodiments, a pharmaceutical composition of the
present invention is prepared for oral administration. In certain
of such embodiments, a pharmaceutical composition is formulated by
combining one or more compounds comprising a modified
oligonucleotide with one or more pharmaceutically acceptable
carriers. Certain of such carriers enable pharmaceutical
compositions to be formulated as tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a subject. In certain embodiments, pharmaceutical
compositions for oral use are obtained by mixing oligonucleotide
and one or more solid excipient. Suitable excipients include, but
are not limited to, fillers, such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). In certain embodiments, such a
mixture is optionally ground and auxiliaries are optionally added.
In certain embodiments, pharmaceutical compositions are formed to
obtain tablets or dragee cores. In certain embodiments,
disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone,
agar, or alginic acid or a salt thereof, such as sodium alginate)
are added.
[0335] In certain embodiments, dragee cores are provided with
coatings. In certain such embodiments, concentrated sugar solutions
may be used, which may optionally contain gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or
titanium dioxide, lacquer solutions, and suitable organic solvents
or solvent mixtures. Dyestuffs or pigments may be added to tablets
or dragee coatings.
[0336] In certain embodiments, pharmaceutical compositions for oral
administration are push-fit capsules made of gelatin. Certain of
such push-fit capsules comprise one or more pharmaceutical agents
of the present invention in admixture with one or more filler such
as lactose, binders such as starches, and/or lubricants such as
talc or magnesium stearate and, optionally, stabilizers. In certain
embodiments, pharmaceutical compositions for oral administration
are soft, sealed capsules made of gelatin and a plasticizer, such
as glycerol or sorbitol. In certain soft capsules, one or more
pharmaceutical agents of the present invention are be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin,
or liquid polyethylene glycols. In addition, stabilizers may be
added.
[0337] In certain embodiments, pharmaceutical compositions are
prepared for buccal administration. Certain of such pharmaceutical
compositions are tablets or lozenges formulated in conventional
manner.
[0338] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0339] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0340] In certain embodiments, a pharmaceutical composition is
prepared for administration by inhalation. Certain of such
pharmaceutical compositions for inhalation are prepared in the form
of an aerosol spray in a pressurized pack or a nebulizer. Certain
of such pharmaceutical compositions comprise a propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
certain embodiments using a pressurized aerosol, the dosage unit
may be determined with a valve that delivers a metered amount. In
certain embodiments, capsules and cartridges for use in an inhaler
or insufflator may be formulated. Certain of such formulations
comprise a powder mixture of a pharmaceutical agent of the
invention and a suitable powder base such as lactose or starch.
[0341] In certain embodiments, a pharmaceutical composition is
prepared for rectal administration, such as a suppositories or
retention enema. Certain of such pharmaceutical compositions
comprise known ingredients, such as cocoa butter and/or other
glycerides.
[0342] In certain embodiments, a pharmaceutical composition is
prepared for topical administration. Certain of such pharmaceutical
compositions comprise bland moisturizing bases, such as ointments
or creams. Exemplary suitable ointment bases include, but are not
limited to, petrolatum, petrolatum plus volatile silicones, and
lanolin and water in oil emulsions. Exemplary suitable cream bases
include, but are not limited to, cold cream and hydrophilic
ointment.
[0343] In certain embodiments, a pharmaceutical composition of the
present invention comprises a modified oligonucleotide in a
therapeutically effective amount. In certain embodiments, the
therapeutically effective amount is sufficient to prevent,
alleviate or ameliorate symptoms of a disease or to prolong the
survival of the subject being treated. Determination of a
therapeutically effective amount is well within the capability of
those skilled in the art.
[0344] In certain embodiments, one or more modified
oligonucleotides of the present invention is formulated as a
prodrug. In certain embodiments, upon in vivo administration, a
prodrug is chemically converted to the biologically,
pharmaceutically or therapeutically more active form of a modified
oligonucleotide. In certain embodiments, prodrugs are useful
because they are easier to administer than the corresponding active
form. For example, in certain instances, a prodrug may be more
bioavailable (e.g., through oral administration) than is the
corresponding active form. In certain instances, a prodrug may have
improved solubility compared to the corresponding active form. In
certain embodiments, prodrugs are less water soluble than the
corresponding active form. In certain instances, such prodrugs
possess superior transmittal across cell membranes, where water
solubility is detrimental to mobility. In certain embodiments, a
prodrug is an ester. In certain such embodiments, the ester is
metabolically hydrolyzed to carboxylic acid upon administration. In
certain instances the carboxylic acid containing compound is the
corresponding active form. In certain embodiments, a prodrug
comprises a short peptide (polyaminoacid) bound to an acid group.
In certain of such embodiments, the peptide is cleaved upon
administration to form the corresponding active form.
[0345] In certain embodiments, a prodrug is produced by modifying a
pharmaceutically active compound such that the active compound will
be regenerated upon in vivo administration. The prodrug can be
designed to alter the metabolic stability or the transport
characteristics of a drug, to mask side effects or toxicity, to
improve the flavor of a drug or to alter other characteristics or
properties of a drug. By virtue of knowledge of pharmacodynamic
processes and drug metabolism in vivo, those of skill in this art,
once a pharmaceutically active compound is known, can design
prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal
Chemistry A Biochemical Approach, Oxford University Press, New
York, pages 388-392).
Certain Experimental Models
[0346] In certain embodiments, the present invention provides
methods of using and/or testing modified oligonucleotides of the
present invention in an experimental model. In certain embodiments,
experimental models are employed to evaluate the effectiveness of
modified oligonucleotides of the invention for the treatment of
liver cancer, including HCC. Those having skill in the art are able
to select and modify the protocols for such experimental models to
evaluate a pharmaceutical agent of the invention.
[0347] Generally, modified oligonucleotides are first tested in
cultured cells. Suitable cell types include those that are related
to the cell type to which delivery of a modified oligonucleotide is
desired in vivo. For example, suitable cell types for the study of
modified oligonucleotides for the treatment of liver cancer include
cell types derived from liver cancer, such as HepG2, Hep3B,
SK-Hep1, 7721, SNU-398, SNU423, SNU449, Huh7, HCCLM3 and MHT
cells.
[0348] In certain embodiments, the extent to which a modified
oligonucleotide interferes with the activity of a miRNA is assessed
in cultured cells. In certain embodiments, inhibition of miRNA
activity may be assessed by measuring the levels of the miRNA.
Alternatively, the level of a predicted or validated miRNA target
may be measured. An inhibition of miRNA activity may result in the
increase in the mRNA and/or protein of a miRNA target. Further, in
certain embodiments, certain phenotypic outcomes may be measured.
For example, suitable phenotypic outcomes include inhibition of
cell proliferation, the induction of cell death, and/or the
induction of apoptosis. Other suitable phenotypic outcomes include
the arrest of cells at any point of the cell cycle, such as the
G1/S transition, S phase, the G2/M transition, mitotic division, or
cytokinesis.
[0349] Following the in vitro identification of a modified
oligonucleotide that effectively inhibits the activity of a miRNA,
modified oligonucleotides are further tested in in vivo
experimental models. Suitable experimental models for the testing
of chemotherapeutic agents, including modified oligonucleotides
complementary to a miRNA described herein, include: a subcutaneous
xenograft mouse model, an orthotopic liver xenograft mouse model,
an SV40 t/T transgenic mouse model, a TGF-.alpha./c-myc transgenic
mouse model and a chemically induced carcinogenic
(diethylnitrosamine) mouse model.
[0350] A suitable in vivo experimental model for the testing of
modified oligonucleotides of the present invention includes the
subcutaneous xenograft mouse model. In this model, cells are
removed from culture and injected subcutaneously into mice.
Suitable cells include, for example, Hep3B cells. Suitable mice
include, for example, BALB/c nude mice. A suitable injection site
is, for example, the flank of the mouse. Modified oligonucleotide,
dissolved in saline, is administered to the mice at a frequency of
2 to 3 times per week. Modified oligonucleotide is administered
prior to implantation, simultaneously with implantation, or after
implantation. Suitable administration route include intraperitoneal
administration and intratumoral administration. Modified
oligonucleotide doses range from 5 to 50 mg/kg. The animals are
treated for 3 to 4 weeks, after which tumor size, tumor number, and
liver weight are measured. Measurements may be made with digital
calipers. Saline-treated animals are used as a control group. A
chemotherapeutic agent, such as, for example, 5-fluorouracil, may
be used as a positive control for the inhibition of tumor size or
number. Various endpoints are assessed, including tumor size, tumor
number, and liver weight. Modified oligonucleotide-treated mice are
compared to the same endpoints in control-treated mice. Statistical
analyses are employed to identify significant differences in any of
the endpoints. The subcutaneous xenograft model is an art-accepted
model for the in vivo evaluation of chemotherapeutic agents,
including modified oligonucleotides. See, for example, Koller et
al., Cancer Res., 2006, 66, 2059-2066, and Cheng et al., Cancer
Res., 2007, 67, 309-317.
[0351] A suitable in vivo experimental model for the testing of
modified oligonucleotides of the present invention is the HCCLM3
orthotopic liver xenograft model. In this model, approximately 1
million HCCLM3 cells (a highly metastatic human HCC cell line) are
subcutaneously injected into the flanks of BALB/c nude mice. Once
tumors are an appropriate size (e.g. 1 mm.sup.3), tumor fragments
are removed and intrahepatically implanted into other BALB/c nude
mice. At this point, modified oligonucleotide, dissolved in saline,
is administered to the mice at a frequency of 2 to 3 times per
week. Alternatively, administration of modified oligonucleotide
begins several days (e.g. 10 days) following implantation. Suitable
administration route include intraperitoneal administration and
intratumoral administration. Modified oligonucleotide doses range
from 5 to 50 mg/kg. The animals are treated for 3 to 4 weeks for a
short term study, after which tumor size, tumor number, and liver
weight are measured. Alternatively, the animals are treated for 8
to 30 weeks for a long term study, after which various endpoints
are assessed, including tumor size, tumor number, liver weight,
number of metastases and survival will be measured. Metastasis is
measured in tissues such as lung tissue. Measurements of tumor size
and weight may be made with digital calipers. Saline-treated
animals are used as a control group. A chemotherapeutic agent, such
as, for example, 5-fluorouracil, may be used as a positive control
for the inhibition of tumor size or number. Endpoints observed in
modified oligonucleotide-treated mice are compared to the same
endpoints in control-treated mice. Statistical analyses are
employed to identify significant differences in any of the
endpoints. The orthotopic xenograft model is an art-accepted model
for the in vivo evaluation of chemotherapeutic agents, including
modified oligonucleotides. See, for example, Li et al., Clin.
Cancer Res., 2006, 12, 7140-7148. As an alternative to HCCLM3
cells, HepG2 cells may be used to establish the orthotopic
model.
[0352] An additional suitable in vivo experimental model is the
SV40 t/T transgenic mouse model. Transgenic mice have been
engineered to express the SV40 large T antigen (SV40 t/T mice)
under the control of the liver-specific C-reactive protein promoter
(Ruther et al., Oncogene, 1993, 8, 87-93). The expression of SV40
large T antigen can be transiently induced by injection of
bacterial lipopolysaccacharide, and results in the development of
hepatocellular carcinoma. At this point, modified oligonucleotide,
dissolved in saline, is administered to the mice at a frequency of
2 to 3 times per week. Modified oligonucleotide doses range from 5
to 50 mg/kg. Suitable administration route include intraperitoneal
administration and intratumoral administration. The animals are
treated for 3 to 4 weeks for a short term study, after which tumor
size, tumor number, and liver weight are measured. Alternatively,
the animals are treated for 8 to 30 weeks for a long term study,
after which various endpoints are measured, including tumor size,
tumor number, liver weight, number of metastases, and survival.
Metastasis is measured in tissues such as lung tissue. Measurements
of tumor size and weight may be made with digital calipers.
Saline-treated animals are used as a control group. A
chemotherapeutic agent, such as, for example, 5-fluorouracil, may
be used as a positive control for the inhibition of tumor size or
number. Endpoints observed in modified oligonucleotide-treated mice
are compared to the same endpoints in control-treated mice.
Statistical analyses are employed to identify significant
differences in any of the endpoints.
[0353] A suitable in vivo experimental model is a
chemically-induced carcinogenic mouse model. In this model, liver
cancer is induced by administration of the carcinogen
diethylnitrosamine (DEN). Mice are injected intraperitoneally with
5 or 25 mg/kg DEN. Modified oligonucleotide, dissolved in saline,
is administered to the mice at a frequency of 2 to 3 times per
week. Modified oligonucleotide doses range from 5 to 50 mg/kg.
Suitable administration route include intraperitoneal
administration and intratumoral administration. The animals are
treated for 4 to 8 weeks for a short term study, after which tumor
size, tumor number, and liver weight are measured. Alternatively,
the animals are treated for 8 to 30 weeks for a long term study,
after which tumor size, tumor number, liver weight, number of
metastases and survival will be measured. Metastasis is measured in
tissues such as lung tissue. Measurements of tumor size and weight
may be made with digital calipers. Saline-treated animals are used
as a control group. A chemotherapeutic agent, such as, for example,
5-fluorouracil, may be used as a positive control for the
inhibition of tumor size or number. Endpoints observed in modified
oligonucleotide-treated mice are compared to the same endpoints in
control-treated mice. Statistical analyses are employed to identify
significant differences in any of the endpoints. The DEN-induced
HCC model has been used for the study of HCC. See, for example,
Maeda et al., Cell, 2005, 121, 977-990.
Dioxins
[0354] Dioxins are a family of environmental pollutants such as
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), that are known to have
multiple hazardous effects. TCDD is known to be a most potent
carcinogen, and also to induce other adverse biological responses.
Dioxin induced effects include, but are not limited to, skin
diseases, birth defects, miscarriages, developmental defects,
teratogenesis, immunotoxicity and cancer. Dioxins are produced in
small concentrations when organic material is burned in the
presence of chlorine. This procedure occurs often in a variety of
industrial processes such as in the bleaching of paper, but dioxins
can also be produced from natural sources such as volcanoes and
forest fires. Dioxins enter the general population primarily from
ingestion of food (herbicides), due to their lipophilic properties,
but also by inhalation. The general treatment after dioxin exposure
is dietary fat to remove it from the body since it is very
lypophilic. Additional approaches for lowering dioxin include
dietary intake of mineral oil (Moser and McLachlan, 1999),
activated charcoal (Araki, 1974), rice bran oil (Ilda, 1995), or
the fat substitute Olestra (Geusau et al., 1999, 2002), however the
effectiveness of these treatments is minimal.
[0355] The mechanism of dioxins' carcinogenic effect is not yet
fully understood, however it is known to be an Aryl hydrocarbon
receptor (AhR) ligand, and most, if not all of its effects, are
thought to be mediated through the activation of AhR.
[0356] AhR belongs to a family of ligand activated transcription
factors basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) that
mediates transcriptional activation of sets of enzymes that
function in the metabolism of xenobiotics. Upon ligand binding the
AhR translocates to the nucleus and associates with its partner
protein Arnt to form a heterodimer. The heterodimer binds to an
enhancer site on the DNA designated xenobiotic responsive element
(XRE) and is responsible to regulate a variety of transcription
activation of enzymes involved in xenobiotic metabolism and other
functions. One of the genes that are transcriptionally regulated by
AhR is an AhR repressor (AhRR) that can also form a heterodimer
with Arnt and bind to XRE, however this forms transcriptional
repression. Since AhRR transcription is regulated by AhR, AhR and
AhRR form a regulatory feedback loop.
[0357] As a result of AhR activation an "AhR gene battery" of Phase
I and Phase II metabolizing enzymes consisting of CYP1A1, CYP1A2,
CYP1B1, NQO1, ALHD3A1, UGT1A2 and GSTA1 is up-regulated. This
response presumably evolved to be able to detect a wide range of
chemicals, indicated by the wide range of substrates AhR is able to
bind and facilitate their biotransformation and elimination as
detoxification process.
[0358] However, AhR activation also elicits toxic responses.
Toxicity results from two different pathways of AhR signaling. The
first is when the induction of metabolizing enzymes results in the
production of toxic intermediate metabolites. The second path to
toxicity is the result of aberrant changes in global gene
transcription beyond those observed in the "AhR gene battery."
These global changes in gene expression lead to adverse changes in
cellular processes and function.
[0359] Many studies conducted in order to elucidate the mechanism
and understand the toxicity and carcinogenicity of TCDD via AhR
activation resulted with paradoxical outcomes. Repeatedly
inconsistent results are reported, showing both apoptotic and
anti-apoptotic effects of TCDD activated AhR cellular responses,
usually explained by differences in the treatment regiment and
models tested.
[0360] Although the induction of the AhR by dioxins is well
characterized, the function and mechanism of some of its toxicities
are still unknown and the paradoxical and contradicting results
appearing in many articles indicate the necessity for further study
of TCDD mechanism of carcinogenicity.
[0361] To date there has been no definitive description of any miR
whose expression is directly regulated by dioxins, or of the
functional consequences of such regulation; Moffat et al. (Toxicol
Sci. 2007 October; 99(2):470-87) showed only very moderate changes
in miRs in response to TCDD in rodent models and concluded that
microRNAs do not play a role in dioxin toxicity.
[0362] As demonstrated herein, hsa-miR-191, which is up-regulated
in HCC, is also up-regulated after TCDD activation of the AhR
transcription factor, together with miR-181a, and hsa-miR-181b, and
to a lesser degree hsa-miR-181a*. Thus, the AhR transcription
factor is responsible for the regulation of the expression of miRs
having an AhR TFBS motif at their promoters. The involvement of
miRs in the mechanism of TCDD activity can explain the down
regulation of several genes as seen on expression arrays, apart
from transcriptional activation through AhR.
Certain Quantitation Assays
[0363] The effects of antisense inhibition of a miRNA following the
administration of modified oligonucleotides may be assessed by a
variety of methods known in the art. In certain embodiments, these
methods are be used to quantitate miRNA levels in cells or tissues
in vitro or in vivo. In certain embodiments, changes in miRNA
levels are measured by microarray analysis. In certain embodiments,
changes in miRNA levels are measured by one of several commercially
available PCR assays, such as the TaqMan.RTM. MicroRNA Assay
(Applied Biosystems). In certain embodiments, antisense inhibition
of a miRNA is assessed by measuring the mRNA and/or protein level
of a target of a miRNA. Antisense inhibition of a miRNA generally
results in the increase in the level of mRNA and/or protein of a
target of the miRNA.
[0364] The following examples are presented in order to more fully
illustrate some embodiments of the invention. They should, in no
way be construed, however, as limiting the broad scope of the
invention.
EXAMPLES
Example 1
Expression Profiling of miRNAs in Tissue Samples
[0365] To identify miRNAs that are dysregulated in association with
cancer, miRNA expression profiles were analyzed in liver samples
from subjects with hepatocellular carcinoma (HCC), and were
compared to expression profiles in normal liver. Samples analyzed
included: 37 liver samples from human HCC subjects; 39 liver
samples of normal liver adjacent to HCC; and 2 liver samples from
normal human liver. Of the 39 samples of normal liver adjacent to
HCC, 36 were from the human HCC subjects.
[0366] Liver samples were also collected from transgenic mice which
express the SV40 t/T antigen under the control of the C-reactive
protein promoter. This promoter results in hepatocyte-specific
expression of the oncogenic SV40 t/T antigen, which eventually
leads to the development of liver tumors that are histologically
characterized as hepatocellular carcinoma. Samples analyzed
included: 12 samples from normal mouse liver; 18 HCC samples from
SV40 transgenic mice.
[0367] Also analyzed were HCC-related cell lines, including HepG2,
Hep3B, SK-Hep1, 7721, SNU-398, SNU423, SNU449, Huh7 and MHT. MHT
cells are isolated from the livers of SV40 t/T antigen transgenic
mice. Monkey hepatocytes were also analyzed.
[0368] RNA was extracted from the samples using the miRvana miRNA
isolation kit (Ambion) according to the manufacturer's instructions
and hybridized to a microRNA array. Custom microarrays were
produced by printing DNA oligonucleotide probes representing about
700 miRNAs, including miRNAs from the Sanger database, version 9
and additional Rosetta genomics validated and predicted miRs. Each
probe, printed in triplicate, carries up to 22-nt linker at the
3'end of the miRNA's complement sequence in addition to an amine
group used to couple the probes to coated glass slides. 2 .mu.M of
each probe were dissolved in 2.times.SSC+0.0035% SDS and spotted in
triplicate on Schott Nexterion.RTM. Slide E coated microarray
slides using a Genomic Solutions.RTM. BioRobotics MicroGrid II
according the MicroGrid manufacturer's directions. 64 negative
control probes were designed using the sense sequences of different
miRNAs. Two groups of positive control probes were designed to
hybridize to miRdicator.TM. array (1) synthetic spikes small RNA
were added to the RNA before labeling to verify the labeling
efficiency and (2) probes for abundant small RNA (e.g. small
nuclear RNAs (U43, U49, U24, Z30, U6, U48, U44), 5.8s and 5s
ribosomal RNA) are spotted on the array to verify RNA quality. The
slides were blocked in a solution containing 50 mM ethanolamine, 1M
Tris (pH 9.0) and 0.1% SDS for 20 min at 50.degree. C., then
thoroughly rinsed with water and spun dry.
[0369] Five .mu.g of total RNA was labeled by ligation of a
RNA-linker p-rCrU-Cy-dye (Thomson et al., 2004, Nat Methods 1,
47-53) (Dharmacon) to the 3'-end with Cy3 or Cy5. The labeling
reaction contained total RNA, spikes (0.1-20 fmoles), 300 ng
RNA-linker-dye, 15% DMSO, 1.times. ligase buffer and 20 units of T4
RNA ligase (NEB) and proceeded at 4.degree. C. for 1 hr followed by
1 hr at 37.degree. C. The labeled RNA was mixed with 3.times.
hybridization buffer (Ambion), heated to 95.degree. C. for 3 min
and than added on top of the miRdicator.TM. array. Slides were
hybridize 12-16 hr, followed by two washes with 1.times.SSC and
0.2% SDS and a final wash with 0.1.times.SSC.
[0370] Arrays were scanned using an Agilent Microarray Scanner
Bundle G2565BA (resolution of 10 .mu.m at 100% power). Array images
were analyzed using SpotReader software (Niles Scientific).
[0371] Raw data of miRNA signals were normalized and a T-test was
used to identify statistically significant differentially expressed
miRNAs.
[0372] 94 miRNAs were selected as candidate miRNAs for further
study. These miRNAs were selected based on one or more of the
following criteria: differential expression in human liver tumor
samples relative to normal human liver samples; differential
expression in mouse HCC samples relative to normal mouse liver
samples; or high expression in human liver tissue. FIG. 1
illustrates 8 of the miRNAs that exhibited elevated expression in
liver tumor samples.
Example 2
miRNA Expression Profiling of Cancer Cell Lines
[0373] The miRNA expression profiles of miRNAs in various cancer
cell lines were compared to miRNA expression profiles of human
liver cancer samples. It was observed that many of the miRNAs
highly expressed in human liver cancer samples were also highly
expressed in human cancer cell lines. These miRNAs included, for
example, miR-21, and miR-191. Accordingly, the human liver cancer
cell lines are useful for the identification and study of modified
oligonucleotides that are candidates for the treatment of liver
cancer.
Example 3
Anti-Proliferative Effects of Modified Oligonucleotides
[0374] To determine the involvement of the candidate miRNAs in cell
proliferation, modified oligonucleotides were used to inhibit the
activity of the candidate miRNAs.
[0375] The ability of the cells to proliferate was measured using
the MTS Cell Proliferation Assay (CellTiter 96.RTM. AQueous One
Solution Cell Proliferation Assay Promega Corporation Madison,
Wis.). The MTS assay is a colorimetric assay that measures the
reduction of a tetrazolium component (MTS reagent) into an
insoluble formazan product by the mitochondria of viable cells.
After incubation of the cells with the MTS reagent for
approximately 2 to 4 hours, the samples are read using an ELISA
plate reader at a wavelength of 490 nM. The amount of color
produced is directly proportional to the number of cells.
[0376] Modified oligonucleotides complementary to the selected
miRNAs were designed and synthesized. Each nucleoside of each
modified oligonucleotide has a 2'-O-methoxyethyl sugar, each
internucleoside linkage is a phosphorothioate internucleoside
linkage, and all cytosines are 5-methylcytosines. Additional
modified oligonucleotides tested included modified oligonucleotides
having a 2'-O-methoxyethyl sugar at each nucleoside, and
phosphodiester internucleoside linkages.
[0377] The modified oligonucleotides were tested for their
anti-proliferative effects in Hep3B cells and SNU423 cells. Cells
were treated with 20, 40, 70, 150, or 300 nM of modified
oligonucleotide, in triplicate samples, for a period of 4 hours,
after which the media was replaced with normal growth media.
Oligofectamine was used as the transfection reagent. Untreated
cells served as controls, as well as transfection with a modified
oligonucleotide with 6 mismatches to hsa-mir-122. As a control for
inhibition of proliferation, cells were treated with a modified
oligonucleotide known to inhibit cell proliferation. The
proliferation assay was performed 48 to 72 hours following addition
of the modified oligonucleotides.
[0378] The number of cells in modified oligonucleotide-treated
samples was compared to the number of cells in untreated control
samples. In this way, the proliferation of cells was measured. The
comparison revealed that antisense inhibition of miR-21,
miR-125a-5p, miR-191, miR-210, miR-222, miR-378, miR-423-3p, and
miR-638 resulted in inhibition of cell proliferation (FIG. 2).
Thus, modified oligonucleotides complementary to a miR selected
from miR-21, miR-125a-5p, miR-191, miR-210, miR-222, miR-378,
miR-423-3p, and miR-638 exhibited anti-proliferative effects in HCC
cell lines. As shown in FIG. 1, the expression of each of these 8
miRNAs is elevated in liver tumor samples, relative to normal liver
tissue samples. Accordingly, such modified oligonucleotides are
therapeutic agents for the treatment of HCC. Examples of such
modified oligonucleotides are illustrated in Table 1.
Example 4
Apoptotic Activity of Modified Oligonucleotides
[0379] To determine the involvement of the candidate miRNAs in cell
survival, modified oligonucleotides were used to inhibit the
activity of the miRNAs, and caspase activity was used as an
indicator of apoptosis.
[0380] Apoptosis was evaluated by measuring the activity of caspase
3 and caspase 7. A fluorogenic substrate was added to the wells of
cells. When this substrate is cleaved by activated caspases 3 and
7, a fluorescent signal is generated. This signal can be
quantitated in a fluorescence plate reader and used to determine
the extent of capsase activation.
[0381] The modified oligonucleotides shown in Table 1 were tested
for their effects on caspase 3 and caspase 7 activity in Hep3B
cells. Cells were treated with 50, 100, 150, or 200 nM of modified
oligonucleotide, in triplicate samples, for a period of 24 hours.
Oligofectamine was used as the transfection reagent. Untreated
cells served as controls as well as transfection with a modified
oligonucleotide having 6 mismatches to has-miR-122.
[0382] The caspase 3/7 activity in oligonucleotide-treated samples
was compared to the caspase 3/7 activity in untreated control
samples. In this way, the induction of apoptosis was measured. The
comparison revealed that antisense inhibition of miR-21,
miR-125a-5p, miR-191, miR-210, miR-378, miR-423-3p, and miR-638
resulted in increased caspase 3/7 activity (FIG. 3). Thus, modified
oligonucleotides complementary to a miR selected from miR-21,
miR-125a-5p, miR-191, miR-210, miR-378, miR-423-3p, and miR-638
induced apoptosis in Hep3B cells. Accordingly, such modified
oligonucleotides are therapeutic agents for the treatment of
HCC.
Example 5
Anti-Tumor Effects of Modified Oligonucleotides In Vivo
[0383] To determine the effects of modified oligonucleotides
targeted to miRNAs on tumor growth, modified oligonucleotides were
evaluated in a mouse model of hepatocellular carcinoma. In this
mouse model, HCC-derived cells injected into nude mice form tumors,
and modified oligonucleotides are tested for their ability to slow
and/or inhibit tumor growth.
[0384] To induce tumor formation, a solution containing
approximately 5.times.10.sup.6 HepG2 cells suspended in Matrigel
was injected subcutaneously into nude mice.
[0385] The modified oligonucleotides tested in this model included:
MOE-modified anti-miR-21, a modified oligonucleotide targeted to
miR-21 having a 2'-MOE modification at each sugar, phosphorothioate
internucleoside linkages throughout, where each cytosine is a
5-methyl cytosine; and MOE-modified anti-miR-210 having a 2'-MOE
modification at each sugar, phosphorothioate internucleoside
linkages throughout, where each cytosine is a 5-methyl cytosine.
Phosphate-buffered saline (PBS) was used as a control
treatment.
[0386] Treatment groups were as follows: (1) control; (2) 50 mg/kg
MOE-modified anti-miR21; (3) 50 mg/kg MOE-modified anti-miR-210.
Each treatment group contained 10 mice. Mice received
intraperitoneal injections of control or modified oligonucleotide
beginning on day 4 following tumor induction and continuing every
other day for a total of 12 injections (i.e. days 4, 6, 8, 10, 12,
14, 16, 18, 20, 22, 24, and 26). Tumor size was monitored with
calipers on days 12, 15, 18, 22, 25, and 28 following tumor
induction. Tumor volume was calculated as (L*W.sup.2)/2, where
L=length (mm) and W=width (mm). Mean tumor volumes for modified
oligonucleotide-treated groups were compared to mean tumor volumes
for control-treated groups; fold changes in mean tumor volume are
shown in Table 7 and FIG. 4. P-values were calculated by t-test.
TABLE-US-00007 TABLE 7 Fold change in Days post tumor mean tumor
Treatment induction volume p-value MOE-modified anti-miR-21 12 2
0.0466 15 1.9 0.0109 18 1.9 0.0067 22 1.6 0.0251 25 1.2 0.2973 28
1.2 0.2785 MOE-modified anti-miR- 12 3.9 0.0004 210 15 2 0.0006 18
1.6 0.0113 22 1.3 0.1531 25 1.1 0.4919 28 1.1 0.3646
[0387] As shown in Table 7, treatment with 50 mg/kg MOE-modified
anti-miR-21 resulted in statistically significant smaller tumor
size at days 12, 15, 18, and 22 following tumor induction, relative
to tumor size in control-treated mice. Reductions in tumor size
were also observed at days 25 and 28 following tumor induction.
Similarly, treatment with 50 mg/kg MOE-modified anti-miR-210
resulted in statistically significant smaller tumor size at days
12, 15, 18, and 22 following tumor induction, relative to tumor
size in control-treated mice. Reductions in tumor size were also
observed at days 25 and 28 following tumor induction. Accordingly,
modified oligonucleotides complementary to miR-21 and miR-210 are
therapeutic agents for the treatment of HCC.
Example 6
Induction of miR Expression by Activation of the AhR TF by TCDD
[0388] HCC cells treated with TCDD were studied for miR expression
on a microarray (microarray analysis was performed as described in
Example 1). As demonstrated in FIG. 5, expression of each of
hsa-miR-191, hsa-miR-181a, hsa-miR-181b and hsa-miR-181a* was shown
to be elevated more than twofold in TCDD treated cells after 48
hours, compared to untreated cells.
Example 7
Dual-Luciferase Reporter assay for miR-191
[0389] A dual-luciferase reporter assay was prepared to evaluate
miR-191 activity. Custom-made 42-nucleotide long complementary
oligonucleotides (IDT) were designed to be inserted into the 3' UTR
of renilla luciferase in a psiCHECK-2 vector (Promega); these
oligonucleotides included the reverse complement sequence to
selected miRs. Complementary oligonucleotides were annealed,
creating NotI and XhoI sticky ends. Sequences included the relevant
reverse complement miR sequences and one negative control. These
inserts were designed to create miR binding sites, and each insert
was cloned in the 3' UTR of renilla luciferase in a psiCHECK-2
vector. Clones were verified in three stages: (1) colony PCR, (2)
restriction with HindIII utilizing the site added with the insert,
and (3) sequencing. SNU423 cells were transfected in triplicates
with either one of the vectors or co-transfected with a vector and
an ASO using Lipofectamine-2000 reagent (Invitrogen, Cat#
11668027). Luminescence was assayed 24 and 48 hours later using the
Dual-Luciferase Reporter Assay System (Promega, Cat#E1961)
according to manufacturer's instructions, on "The Reporter"
microplate luminometer (Turner designs). Results were normalized to
the constitutively expressed firefly luciferase from the same
vector, and presented as the ratio between the various treatments
and cells transfected with a non-modified vector.
[0390] As indicated in FIG. 6, endogenous hsa-miR-191 (bar a)
indeed downregulates the reporter expression, and this effect is
almost completely abolished by co-transfection of the reporter
vector together with the antisense oligonucleotide inhibiting
hsa-miR-191 (bar b). The bar-chart further shows the specificity of
the response, since another control ASO could not abolish the miR
regulation of the reporter (bar c), and the endogenous miR did not
change the expression of the reporter on a control plasmid having
an altered 3' UTR but with a non-relevant sequence, with (bar d) or
without an ASO (bar e).
Example 8
AhR/Arnt and Regulation of hsa-miR-191
[0391] Transcription factor binding site (TFBS) motifs were
searched for at locations +/-1000 bp from the Transcription Start
Site of hsa-miR-191. The AhR/Arnt TFBS was predicted at the
following location: TABLE-US-00008 #hg18.tfbs hg18.tfbsCo
hg18.tfbsCon hg18.tfbsConsSites.name hg18.tfbsC hg18.tfbsC
hg18.tfbsC hg18.tfbsConsFactors.id chr3 49034918 49034937
V$AHRARNT_02 + 2.42 AhR,Amt, P35869,P27540,
[0392] A ChIP (Chromatin Immuno Precipitation) assay was conducted
to validate the predicted TFBS and the involvement of this TF in
the transcriptional regulation of hsa-miR-191.
[0393] The ChIP assay was performed as follows:
[0394] HepG2 cells were treated with TCDD at 10 nM concentration.
Cells were then fixed when freshly-prepared 11% Formaldehyde
Solution was added to the existing media.
[0395] Fixation was stopped by adding Glycine Solution. Cells are
then scraped off from the culture surface, washed in chilled
PBS-Igepal and treated with 1 mM PMSF. Cells are finally
centrifuged and pellet is snap-frozen.
[0396] The immunoprecipitation is done at Genepathway and the
binding of Chromatin to the precipitated TF was quantified by
qPCR.
[0397] Data values were generated using a standard curve of genomic
DNA with known copy numbers. Positive controls are genomic regions
containing known binding sites for the factor under investigation,
and the negative controls are genomic regions not bound by the
factor under investigation. Analysis was done in triplicates.
[0398] Input DNA values (unprecipitated genomic DNA) were used to
calculate the Primer Efficiency Ratio for every primer pair
relative to the primer pair used in the standard curve. The data
was presented as the Binding Events Per 1000 Cells for each genomic
region tested. These values, which are calculated from the average
of the triplicate qPCR values for each test, take into account the
amount of chromatin that was immunoprecipitated plus the proportion
tested by qPCR, and are normalized for primer efficiency. Also the
standard deviations for each test are calculated, which have been
normalized in the same way as the test values.
[0399] Genpathway has demonstrated that changes in factor binding
as low as 1.3.times. can be reproducibly determined in a variety of
biological systems. Therefore, genomic regions showing fold
differences of 1.5 or greater are considered significant.
[0400] Since TCDD is a known ligand of AhR and activates this TF to
induce the expression of CYP1 proteins, TCDD treatment was included
as an activator for the TF, and CYP1A1 was chosen as a control gene
in the ChIP assay. CYP1A1 has two TFBSs for the AhR/Arnt TF, both
which were tested.
[0401] As seen in FIG. 7, which summarizes the results of the ChIP
assay using a specific antibody for the AhR TF, AhR was found to
bind to the promoter of the hsa-miR-191 transcript. Similar results
were achieved when a ChIP assay was conducted with an Ab against
Arnt, which indicates the activity of the heterodimer AhR/Arnt.
[0402] The foregoing description of the specific embodiments so
fully reveals the general nature of the invention that others can,
by applying current knowledge, readily modify and/or adapt for
various applications such specific embodiments without undue
experimentation and without departing from the generic concept,
and, therefore, such adaptations and modifications should and are
intended to be comprehended within the meaning and range of
equivalents of the disclosed embodiments. Although the invention
has been described in conjunction with specific embodiments
thereof, it is evident that many alternatives, modifications and
variations will be apparent to those skilled in the art.
Accordingly, it is intended to embrace all such alternatives,
modifications and variations that fall within the spirit and broad
scope of the appended claims.
* * * * *
References