U.S. patent application number 12/304913 was filed with the patent office on 2010-02-11 for bacterium.
Invention is credited to Christophe Fremaux, Philippe Horvath, Joachim Schwobe.
Application Number | 20100034924 12/304913 |
Document ID | / |
Family ID | 38832173 |
Filed Date | 2010-02-11 |
United States Patent
Application |
20100034924 |
Kind Code |
A1 |
Fremaux; Christophe ; et
al. |
February 11, 2010 |
Bacterium
Abstract
The present invention relates in one aspect to a fast acidifying
lactic acid bacterium that generates a viscosity in fermented milk
greater than about 62 Pas after 14 days of storage at 6.degree.
C.
Inventors: |
Fremaux; Christophe;
(Poitiers, FR) ; Horvath; Philippe;
(Saint-Gervais-les-3-Clochers, FR) ; Schwobe;
Joachim; (Niebull, FR) |
Correspondence
Address: |
STEPTOE & JOHNSON LLP
1330 CONNECTICUT AVENUE, N.W.
WASHINGTON
DC
20036
US
|
Family ID: |
38832173 |
Appl. No.: |
12/304913 |
Filed: |
June 8, 2007 |
PCT Filed: |
June 8, 2007 |
PCT NO: |
PCT/IB2007/002639 |
371 Date: |
July 6, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60804978 |
Jun 16, 2006 |
|
|
|
Current U.S.
Class: |
426/43 ; 426/61;
435/134; 435/252; 435/252.3; 435/252.9; 435/253.4; 435/320.1;
536/23.1; 536/24.33 |
Current CPC
Class: |
A23C 13/16 20130101;
C12R 1/46 20130101; A23C 19/0323 20130101; A23Y 2240/75 20130101;
A23C 9/1238 20130101; A23K 10/12 20160501; A23K 10/18 20160501;
A23V 2002/00 20130101; C07K 14/315 20130101; A23C 19/00 20130101;
C12N 15/746 20130101; A23L 33/135 20160801 |
Class at
Publication: |
426/43 ; 426/61;
435/252; 435/252.9; 435/253.4; 435/6; 536/23.1; 435/320.1;
435/252.3; 536/24.33 |
International
Class: |
A23C 9/12 20060101
A23C009/12; A23L 1/30 20060101 A23L001/30; A23K 1/16 20060101
A23K001/16; A23C 9/123 20060101 A23C009/123; A23C 13/00 20060101
A23C013/00; A23C 19/00 20060101 A23C019/00; A23G 9/36 20060101
A23G009/36; A23L 1/48 20060101 A23L001/48; C12N 1/22 20060101
C12N001/22; C12N 1/20 20060101 C12N001/20; C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00; C12N 15/74 20060101
C12N015/74 |
Claims
1. A fast acidifying lactic acid bacterium that generates a
viscosity in fermented milk greater than about 62 Pas after 14 days
of storage at 6.degree. C.
2. The lactic acid bacterium according to claim 1, wherein said
bacterium is phage resistant.
3. The lactic acid bacterium according to claim 1, wherein said
bacterium is selected from the group consisting of Streptococcus,
Lactococcus, Lactobacillus, Leuconostoc, Pediococcus and
Bifidobacterium.
4. The lactic acid bacterium according to claim 1, wherein said
bacterium is Streptococcus thermophilus.
5. The lactic acid bacterium according to claim 4, or a mutant
thereof and/or a variant thereof, wherein said Streptococcus
thermophilus belongs to the genetic cluster CLO189.
6. The lactic acid bacterium according to claim 1, or a mutant
thereof and/or a variant thereof, wherein said bacterium comprises
the sequence set forth in SEQ ID No. 20.
7. A lactic acid bacterium or a mutant thereof and/or a variant
thereof, comprising the sequence set forth in SEQ ID No. 19 or a
homologue thereof with at least 75% identity thereto.
8. An isolated Streptococcus thermophilus strain deposited at DSMZ
(Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH,
Mascheroder Weg 1 b, D-38124 Braunschweig) under deposit number
18344 on 14 Jun. 2006 or a mutant thereof and/or a variant
thereof.
9. A cell culture comprising the lactic acid bacterium according to
claim 1.
10. The cell culture according to claim 9, wherein said cell
culture is a starter culture, a probiotic culture or a dietary
supplement.
11. The cell culture according to claim 9, wherein said culture
comprises one or more further lactic acid bacteria selected from
the genera consisting of Streptococcus, Lactococcus, Lactobacillus,
Leuconostoc, Pediococcus and Bifidobacterium.
12. The cell culture according to claim 9, wherein said culture
comprises one or more further lactic acid bacteria selected from
the species consisting of Lactobacillus delbrueckii subsp.
bulgaricus, Lactobacillus acidophilus, Lactobacillus casei and/or
Bifidobacterium.
13. A food, food additive, feed, nutritional supplement, or
probiotic supplement comprising the lactic acid bacterium according
to claim 1.
14. A food, food additive, feed, nutritional supplement, or
probiotic supplement according to claim 13, wherein the food, food
additive, feed, nutritional supplement, or probiotic supplement is
a dairy, meat or cereal food, food additive, feed, nutritional
supplement, or probiotic supplement
15. A dairy food, food additive, feed, nutritional supplement, or
probiotic supplement according to claim 14, wherein the dairy food,
food additive, feed, nutritional supplement, or probiotic
supplement is a fermented milk, yoghurt, cream, matured cream,
cheese, fromage frais, a milk beverage, a processed cheese, a cream
dessert, a cottage cheese or infant milk.
16. A food, food additive, feed, nutritional supplement, or
probiotic supplement according to claim 15, wherein the milk
comprises milk of animal and/or plant origin.
17. A method for preparing a food, food additive, feed, nutritional
supplement, or probiotic supplement comprising the step of adding
the lactic acid bacterium according to claim 1.
18. The method according to claim 17, wherein said food, food
additive, feed, nutritional supplement, or probiotic supplement
comprises or consists of a fermented food, food additive, feed,
nutritional supplement, or probiotic supplement.
19. The method according to claim 17, wherein said food, food
additive, feed, nutritional supplement, or probiotic supplement
comprises or consists of a dairy food, food additive, feed,
nutritional supplement, or probiotic supplement.
20. A food, food additive, feed, nutritional supplement, or
probiotic supplement obtained or obtainable by the method of claim
17.
21. Use of the lactic acid bacterium according to claim 1 for
preparing a food, food additive, feed, nutritional supplement, or
probiotic supplement.
22. A method for modulating or modifying the viscosity of a food,
food additive, feed, nutritional supplement, or probiotic
supplement, comprising adding the lactic acid bacterium according
to claim 1.
23. A food, food additive, feed, nutritional supplement, or
probiotic supplement obtained or obtainable by the method of claim
22.
24. Use of the strain according to claim 8 for modifying the
viscosity of a food, food additive, feed, nutritional supplement,
or probiotic supplement.
25. A method for identifying a bacterium belonging to the genus
Streptococcus comprising the step of screening the bacterium for
the sequence set forth in SEQ ID No. 19 or a homologue thereof with
at least 75% identity thereto.
26. A method for identifying a bacterium belonging to the genus
Streptococcus comprising the step of amplifying the CRISPR locus of
a bacterium using at least one forward and at least one reverse
oligonucleotide primer, wherein each of the primers flank opposite
sides of one or more CRISPR spacers that are absent in
Streptococcus thermophilius DSMZ-18344.
27. A method according to claim 26, wherein the forward
oligonucleotide primer hybridises to SEQ ID No. 1 and the reverse
oligonucleotide primer hybridises to any of SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ
ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No.
12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16
and/or SEQ ID No. 17.
28. A method according to claim 26, wherein the forward
oligonucleotide primer hybridises to any of SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7
and/or SEQ ID No. 8 and a reverse oligonucleotide primer hybridises
to any of SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No.
12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16
and/or SEQ ID No. 17.
29. A method according to claim 26, wherein the forward
oligonucleotide primer hybridises to any of SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7
and/or SEQ ID No. 8 and the reverse oligonucleotide primer
hybridises to SEQ ID No. 18.
30. A method according to claim 26, wherein the forward
oligonucleotide primer hybridises to any of SEQ ID No. 9, SEQ ID
No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14,
SEQ ID No. 15, SEQ ID No. 16 and/or SEQ ID No. 17 and the reverse
oligonucleotide primer hybridises to SEQ ID No. 18.
31. A method according to claim 25, wherein the bacterium belonging
to the genus Streptococcus is Streptococcus thermophilus.
32. A method according to claim 31, wherein the Streptococcus
thermophilus strain belongs to the genetic cluster CLO189.
33. A method according to claim 31, wherein the Streptococcus
thermophilus strain has substantially the same characteristics as
the Streptococcus thermophilus strain deposited at DSMZ (Deutsche
Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg
1 b, D-38124 Braunschweig) under deposit number 18344 on 14 Jun.
2006.
34. A method according to claim 31, wherein the Streptococcus
thermophilus strain is the same as the Streptococcus thermophilus
strain deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und
Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124 Braunschweig) under
deposit number 18344 on 14 Jun. 2006.
35. A bacterium belonging to the genus Streptococcus that is
identified or identifiable by the method according to claim 25.
36. A nucleotide sequence comprising the sequence set forth in SEQ
ID No. 19 or a homologue thereof with at least 75% identity
thereto.
37. A nucleotide sequence complementary to the nucleotide sequence
of claim 36.
38. A construct or a vector comprising the nucleotide sequence
according to claim 36.
39. A host cell comprising the construct or the vector according to
claim 38.
40. An oligonucleotide primer that is capable of hybridising to the
nucleotide sequence of claim 36.
41. Use of an oligonucleotide primer according to claim 40 for
identifying a bacterium belonging to the genus Streptococcus.
42. (canceled)
Description
FIELD OF INVENTION
[0001] The present invention relates to inter alia a fast
acidifying lactic acid bacterium with improved texturzing
properties.
BACKGROUND TO THE INVENTION
[0002] The food industry uses bacteria in order to improve the
taste and the texture of foods and also to extend the shelf life of
these foods. In the case of the dairy industry, lactic bacteria are
commonly used in order to, for example, bring about the
acidification of milk (by fermentation) and to texturize the
product into which they are incorporated. Among the lactic bacteria
commonly used in the food industry, examples include the genera
Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus
and Bifidobacterium.
[0003] The lactic acid bacteria of the species Streptococcus
thermophilus are used extensively alone or in combination with
other bacteria for the production of food products, in particular
fermented products. They are used in particular in the formulation
of the ferments used for the production of fermented milks, for
example yogurts. Certain bacteria play a dominant role in the
development of the texture of the fermented product. This
characteristic is closely linked to the production of
polysaccharides. Among the strains of Streptococcus thermophilus it
is possible to distinguish texturizing and non-texturizing
strains.
[0004] In addition, cultures--such as starter cultures--are used
extensively in the food industry in the manufacture of fermented
products including milk products (such as yoghurt, butter and
cheese), meat products, bakery products, wine and vegetable
products. The preparation of cultures is labour intensive,
occupying much space and equipment, and there is a considerable
risk of contamination with spoilage bacteria and/or phages during
the step of propagation. The failure of bacterial cultures by
bacteriophage (phage) infection and multiplication is a major
problem with the industrial use of bacterial cultures. There are
many different types of phages with varying mechanisms to attack
bacteria. Moreover, new strains of bacteriophages appear.
[0005] Strategies used in industry to minimise bacteriophage
infection, and thus failure of a bacterial culture, include the use
of: (i) mixed starter cultures; and (ii) the alternate use of
strains having different phage susceptibility profiles (strain
rotation).
[0006] (i) Traditionally, starter cultures in the dairy industry
are mixtures of lactic acid bacterial strains. The complex
composition of mixed starter cultures ensures that a certain level
of resistance to phage attack is present. However, repeated
sub-culturing of mixed strain cultures leads to unpredictable
changes in the distribution of individual strains and eventually
undesired strain dominance. This in turn may lead to increased
susceptibility to phage attack and risk of fermentation
failures.
[0007] (ii) The rotation of selected bacterial strains which are
sensitive to different phages is another approach to limit phage
development. However, it is difficult and cumbersome to identify
and select a sufficient number of strains having different phage
type profiles to provide an efficient and reliable rotation
program. In addition, the continuous use of strains requires
careful monitoring for new infectious phages and the need to
quickly substitute a strain which is infected by the new
bacteriophage by a resistant strain. In manufacturing plants where
large quantities of bulk starter cultures are made ahead of time,
such a quick response is usually not possible.
[0008] There is a continuing need in the art to provide improved
bacterial strains for use in the food/feed industry--such as
bacterial strains that have improved texturizing properties.
Improved bacterial strains that are phage resistant are
particularly desirable.
SUMMARY OF THE PRESENT INVENTION
[0009] The fast acidifying lactic acid bacterium described herein
has numerous advantages. By way of example, the fast acidifying
lactic acid bacterium has advantages in terms of texturizing the
media into which it is incorporated. By way of further example, it
makes it possible to obtain gels from, for example, fermented
milks, which are thick, sticky, coated, stringy, resistant to
stirring and/or not granular.
[0010] Advantageously, the fast acidifying lactic acid bacterium is
bacteriophage resistant thereby minimising bacteriophage infection,
and thus failure of the bacterial culture. This is an important
property of the lactic acid bacterium described herein because it
reduces the risk of phage incidents during production, which may
stop production for a period of time for decontamination.
[0011] Most advantageously, the fast acidifying lactic acid
bacterium described herein has advantageous texturizing properties
and is also phage resistant.
SUMMARY ASPECTS OF THE PRESENT INVENTION
[0012] Aspects of the present invention are presented in the
accompanying claims.
[0013] In a first aspect, there is provided a fast acidifying
lactic acid bacterium that generates a viscosity in fermented milk
greater than about 62 Pas.
[0014] In a particularly preferred aspect, there is provided a fast
acidifying lactic acid bacterium that generates a viscosity in
fermented milk greater than about 62 Pas and which bacterium is
phage resistant.
[0015] In another aspect, there is provided a lactic acid bacterium
comprising the sequence set forth in SEQ ID No. 19 or a homologue
thereof with at least 75% identity thereto.
[0016] In a further aspect, there is provided an isolated
Streptococcus thermophilus strain deposited under the Budapest
Treaty by Danisco Deutschland Niebull GmbH, Buch-Johannsen
Strasse.1, Niebull-D-25899, Germany at DSMZ (Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124
Braunschweig) under deposit number 18344 on 14 Jun. 2006. We hereby
confirm that the depositor has authorised the applicant to refer to
the deposited biological material in this application and has given
his unreserved and irrevocable consent to the deposited material
being made available to the public.
[0017] There is also provided a cell culture comprising the lactic
acid bacterium or the strain described herein.
[0018] In a further aspect, there is provided a food, food
additive, feed, nutritional supplement, or probiotic supplement
comprising the lactic acid bacterium, the strain, or the cell
culture as described herein.
[0019] A method for preparing a food, food additive, feed,
nutritional supplement, or probiotic supplement comprising the step
of adding the lactic acid bacterium, the strain, or the cell
culture to said food, food additive, feed, nutritional supplement,
or probiotic supplement.
[0020] In a further aspect, a food, food additive, feed,
nutritional supplement, or probiotic supplement obtained or
obtainable by the method described herein. There is also described
the use of the lactic acid bacterium, the strain, or the cell
culture for preparing a food, food additive, feed, nutritional
supplement, or probiotic supplement.
[0021] In a further aspect, we described a method for modifying the
viscosity of a food, food additive, feed, nutritional supplement,
or probiotic supplement, comprising adding the lactic acid
bacterium, the strain, or the cell culture to said, food, food
additive, feed, nutritional supplement, or probiotic
supplement.
[0022] A food, food additive, feed, nutritional supplement, or
probiotic supplement obtained or obtainable by the method is also
provided.
[0023] There is provided, in a further aspect, the use of the
lactic acid bacterium, the strain, or the cell culture for
modifying the viscosity of a food, food additive, feed, nutritional
supplement, or probiotic supplement.
[0024] A method is also described for identifying a bacterium
belonging to the genus Streptococcus comprising the step of
screening the bacterium for the sequence set forth in SEQ ID No. 19
or a homologue thereof with at least 75% identity thereto.
[0025] A method for identifying a bacterium belonging to the genus
Streptococcus is also described comprising the step of amplifying
the CRISPR locus of a bacterium using at least one forward and at
least one reverse oligonucleotide primer, wherein each of the
primers flank opposite sides of one or more CRISPR spacers that are
absent in Streptococcus thermophilus DSMZ-18344.
[0026] A bacterium belonging to the genus Streptococcus that is
identified or identifiable by the method is also provided in a
further aspect.
[0027] In another aspect, there is described a nucleotide sequence
comprising the sequence set forth in SEQ ID No. 19 or a homologue
thereof with at least 75% identity thereto.
[0028] A nucleotide sequence complementary to the nucleotide
sequence is also provided, as is a construct or a vector comprising
the nucleotide sequence
[0029] In a further aspect, there is described a host cell
comprising the construct or the vector.
[0030] An oligonucleotide primer that is capable of hybridising to
the nucleotide sequence is also provided.
[0031] In still a further aspect, the use of the oligonucleotide
primer for identifying a bacterium belonging to the genus
Streptococcus is described.
[0032] There is also provided a lactic acid bacterium, an isolated
culture, a cell culture, a food, food additive, feed, nutritional
supplement, probiotic supplement, a method, a use, a nucleic acid
sequence, a construct, a vector, a host cell, an amino acid
sequence, or an oligonucleotide primer as hereinbefore described
with reference to the accompanying description and figures.
[0033] Other aspects of the present invention are presented in the
accompanying claims and in the following description and
discussion. These aspects are presented under separate section
headings. However, it is to be understood that the teachings under
each section heading are not necessarily limited to that particular
section heading.
PREFERRED EMBODIMENTS
[0034] Preferably, the bacterium is phage resistant.
[0035] Preferably, the bacterium is selected from the group
consisting of Streptococcus, Lactococcus, Lactobacillus,
Leuconostoc, Pediococcus and Bifidobacterium. Preferably, the
bacterium is Streptococcus thermophilus.
[0036] Preferably, the Streptococcus thermophilus belongs to the
genetic cluster CL0189. Preferably, the lactic acid bacterium
comprises the sequence set forth in SEQ ID No. 20.
[0037] Preferably, the cell culture is a starter culture, a
probiotic culture or a dietary supplement.
[0038] Preferably, the culture comprises one or more further lactic
acid bacteria selected from the genera consisting of Streptococcus,
Lactococcus, Lactobacillus, Leuconostoc, Pediococcus and
Bifidobacterium.
[0039] Preferably, the culture comprises one or more further lactic
acid bacteria selected from the species consisting of Lactobacillus
delbrueckii subsp. bulgaricus, Lactobacillus acidophilus,
Lactobacillus casei and/or Bifidobacterium.
[0040] Preferably, the food, food additive, feed, nutritional
supplement, or probiotic supplement is a dairy, meat or cereal
food, food additive, feed, nutritional supplement, or probiotic
supplement
[0041] Preferably, the dairy food, food additive, feed, nutritional
supplement, or probiotic supplement is a fermented milk, yoghurt,
cream, matured cream, cheese, fromage frais, a milk beverage, a
processed cheese, a cream dessert, a cottage cheese or infant
milk.
[0042] Preferably, the milk comprises milk of animal and/or plant
origin.
[0043] Preferably, the food, food additive, feed, nutritional
supplement, or probiotic supplement comprises or consists of a
fermented food, food additive, feed, nutritional supplement, or
probiotic supplement.
[0044] Preferably, the food, food additive, feed, nutritional
supplement, or probiotic supplement comprises or consists of a
dairy food, food additive, feed, nutritional supplement, or
probiotic supplement.
[0045] Preferably, the forward oligonucleotide primer hybridises to
SEQ ID No. 1 and the reverse oligonucleotide primer hybridises to
any of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ
ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10,
SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID
No. 15, SEQ ID No. 16 and/or SEQ ID No. 17.
[0046] Preferably, the forward oligonucleotide primer hybridises to
any of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ
ID No. 6, SEQ ID No. 7 and/or SEQ ID No. 8 and a reverse
oligonucleotide primer hybridises to any of SEQ ID No. 9, SEQ ID
No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14,
SEQ ID No. 15, SEQ ID No. 16 and/or SEQ ID No. 17.
[0047] Preferably, the forward oligonucleotide primer hybridises to
any of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ
ID No. 6, SEQ ID No. 7 and/or SEQ ID No. 8 and the reverse
oligonucleotide primer hybridises to SEQ ID No. 18.
[0048] Preferably, the forward oligonucleotide primer hybridises to
any of SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12,
SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16 and/or
SEQ ID No. 17 and the reverse oligonucleotide primer hybridises to
SEQ ID No. 18.
[0049] Preferably, the bacterium belonging to the genus
Streptococcus is Streptococcus thermophilus.
[0050] Preferably, the Streptococcus thermophilus strain belongs to
the genetic cluster CL0189.
[0051] Preferably, the Streptococcus thermophilus strain has
substantially the same characteristics as the Streptococcus
thermophilus strain deposited at DSMZ (Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124
Braunschweig) under deposit number 18344 on 14 Jun. 2006.
[0052] Preferably, the Streptococcus thermophilus strain is the
same as the Streptococcus thermophilus strain deposited DSMZ
(Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH,
Mascheroder Weg 1 b, D-38124 Braunschweig) under deposit number
18344 on 14 Jun. 2006.
[0053] The term "fast acidifying strain" as used herein preferably
means a strain that has the following properties: a speed of
acidification of less than -0.0100 upH/min and a time to reach pH
4.6 of less than 540 minutes at 43.degree. C. when the inoculation
rate is between 1E6 cfu/ml and 1E7 cfu/ml of milk (following the
fermentated milk process described in the section entitled
"Fermented Milk Process" below).
FIGURES
[0054] FIG. 1
[0055] Comparison of the results obtained using EPSAD PCR-RFLP for
S. thermophilus CNCM I-2423, S. thermophilus CNCM I-2425 and S.
thermophilus DSMZ-18344.
[0056] FIG. 2
[0057] Organisation of S. thermophilus eps gene clusters. All known
eps operons consist of a common proximal part (epsA-B-C-D genes)
which is followed by a highly variable part.
[0058] FIG. 3
[0059] Schematic representation of the sequence of the spacers of
the CRISPR 1 locus of S. thermophilus DSMZ-18344, S. thermophilus
CNCM I-2425, S. thermophilus CNRZ385 and S. thermophilus CNCM
I-2423. Each square represents one spacer sequence.
DETAILED DESCRIPTION OF THE INVENTION
Lactic Acid Bacteria
[0060] As used herein the term "lactic acid bacteria" refers to
Gram positive, microaerophillic or anaerobic bacteria which ferment
sugar with the production of acids including lactic acid as the
predominantly produced acid, acetic acid, formic acid and propionic
acid. They belong to the taxonomic group of the Firmicutes. Devoid
of catalase, the lactic bacteria constitute a heterogeneous group
of bacteria in the form of cocci for the genera Aeroccus,
Enterococcus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus,
Streptococcus, Tetragenococcus, Vagococcus and Weissella, or in the
form of rods for the genera Lactobacillus and Carnobacterium.
[0061] The industrially most useful lactic acid bacteria are found
among the genera Lactococcus, Lactobacillus, Bifidobacterium,
Streptococcus, Leuconostoc, Pediococcus and Propionibacterium. In
one embodiment, it is therefore preferred that the lactic acid
bacterium is selected from this group of genera.
[0062] In a particularly preferred embodiment, the lactic acid
bacterium belongs to the genus Streptococcus.
[0063] A preferred species of lactic bacterium is Streptococcus
thermophilus. Preferably, the Streptococcus thermophilus belongs to
the genetic cluster CL0189. Streptococcus thermophilus is a species
naturally present in milk and widely used in the food, and in
particular dairy industry because it can be used to acidify and
texturise products--such as milk. It is a homofermentative
thermophilic bacterium.
[0064] As described in further detail herein, lactic acid bacteria
starter cultures are commonly used in the food industry as mixed
strain cultures comprising one or more species. Mixtures of
preferred strains include mixtures of the lactic acid bacterium
described herein with one or more Streptococcus strains--such as
different Streptococcus thermophilus strains--or with one or more
strains belonging to the genera Lactococcus, Lactobacillus,
Bifidobacterium, Streptococcus, Leuconostoc, Pediococcus and/or
Propionibacterium.
[0065] Mixtures of the lactic acid bacterium described herein with
Lactobacillus delbrueckii subsp. Bulgaricus, Lactobacillus
acidophilus, Lactobacillus casei, Lactococcus lactis and/or
Bifidobacterium are preferred.
[0066] Mixtures of the lactic acid bacterium described herein with
Lactobacillus delbrueckii subsp. bulgaricus are particularly
preferred. Such mixed strain cultures are typically used as yoghurt
starter cultures where a symbiotic relationship exists between the
species (Rajagopal et al. J. Dairy Sci., 73, p. 894-899, 1990).
[0067] The lactic acid bacteria and mixtures thereof may be used in
the cultures described herein.
[0068] In one aspect, there is provided a fast acidifying lactic
acid bacterium that generates a viscosity in fermented milk greater
than about 62 Pas.
[0069] In addition an increase in the rate of acidification also
reduces the risk of fermentation failure due to phage
infection.
[0070] Preferably, said bacterium comprises the sequence set forth
in SEQ ID No. 19 or a homologue thereof with at least 75% identity
thereto.
[0071] Preferably, said bacterium comprises the sequence set forth
in SEQ ID No. 20 or a variant, fragment, homologue or derivative
thereof.
[0072] In a further aspect, there is provided a lactic acid
bacterium comprising the sequence set forth in SEQ ID No. 19 or a
homologue thereof with at least 75% identity thereto.
[0073] In a further aspect, there is provided a lactic acid
bacterium comprising the sequence set forth in SEQ ID No. 20 or a
variant, fragment, homologue or derivative thereof.
[0074] In a particularly preferred aspect, the present invention
relates to a strain of Streptococcus thermophilus deposited at DSMZ
(Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH,
Mascheroder Weg 1 b, D-38124 Braunschweig) under deposit number
18344 on 14 Jun. 2006.
[0075] The lactic acid bacterium may be a mutant and/or a variant
of the lactic acid bacterium described herein. Preferably, this
mutant and/or variant lactic acid bacterium has one or more
(preferably, all) of the characteristics of the S. thermophilus
strain of the present invention e.g. the mutant and/or variant
lactic acid bacterium is a fast acidifying lactic acid bacterium;
and/or the mutant and/or variant lactic acid bacterium generates a
viscosity in fermented milk greater than about 62 Pas, preferably
about 68 Pas; and/or the mutant and/or variant lactic acid
bacterium is phage resistant; and/or the mutant and/or variant
lactic acid bacterium belongs to the genetic cluster CL0189; and/or
the mutant and/or variant lactic acid bacterium comprises the
sequence set forth in SEQ ID No. 20; and/or the mutant and/or
variant lactic acid bacterium comprises the sequence set forth in
SEQ ID No. 19 or a variant, fragment, homologue or derivative
thereof.
Acidifying Activity
[0076] Acidifying activity is typically characterised by three
parameters: the kinetics of acidification, the titratable acidity
and the final fermentation pH which determines the organoleptic
characteristics of the product and its preservation quality, and
the post-acidification which develops during preservation of the
product.
[0077] Advantageously, a high rate of acidification makes it
possible to reduce the period during which a product is sensitive
to contaminants (pH>4.7) and thereby to reduce the risk of
bacterial contamination. An increase in the rate of acidification
also enhances the economics of the process by increasing the
productivity and the flexibility of the industrial material.
[0078] The acidifying activity of lactic acid bacteria may be
determined using various methods that are known in the art. By way
of example, the lactic acid bacteria may be initially grown in
broth and then in sterile reconstituted skimmed milk supplemented
with yeast extract and glucose for two successive subcultures.
Sterile reconstituted skimmed milk is then inoculated with a 24-h
activated culture and pH changes determined using pH meters during
incubation.
[0079] Advantageously, the lactic acid bacterium according to the
present invention is fast acidifying since it can be characterised
by a fast acidification of milk during the fermentation
process.
[0080] Preferably, the speed of acidification is from about -0.013
upH/min to about -0.019 upH/min. More preferably, the speed of
acidification is from about -0.0135 upH/min to about -0.018
upH/min. More preferably, the speed of acidification is from about
-0.014 upH/min to about -0.017 upH/min. More preferably, the speed
of acidification is from about -0.0145 upH/min to about -0.017
upH/min. More preferably, the speed of acidification is from about
-0.015 upH/min to about -0.017 upH/min. More preferably, the speed
of acidification is from about -0.015 upH/min to about -0.017
upH/min. Most preferably the speed of acidification is about
-0.0169 upH/min.
[0081] This rate of acidification compares favourably to other fast
acidifying strains of bacteria--such as 0.0129 upH/min, 0.0167
upH/min and 0.0209 upH/min for S. thermophilus CNCM 1-2423, S.
thermophilus CNCM I-2980 and S. thermophilus CNCM I-2425,
respectively.
[0082] S. thermophilus CNCM I-2423 has been previously deposited at
the CNCM as deposit number I-2423 and is described in
WO2004/085607.
[0083] S. thermophilus CNCM I-2425 has been previously deposited at
the CNCM as deposit number 1-2425
[0084] S. thermophilus CNCM I-2980 has been previously deposited at
the CNCM as deposit number 1-2980 and is described in
WO2004/085607.
[0085] Fast acidifying S. thermophilus is a bacterium that is
typically able to coagulate milk in less than 540 min at 43.degree.
C.+/-1.degree. C. when the inoculation rate is between 1E6 cfu/ml
and 1E7 cfu/ml of milk. The maximum speed of acidification is the
maximum value of the derived curve pH versus time. This final
measurement may be obtained using on line pH measurement in milk
using a CINAC device (Ysebaert Ltd).
[0086] In one embodiment, the rate of acidification is measured
using methods that are commonly known in the art. Typically, the
rate of acidification will be measured by monitoring the change in
pH over time.
[0087] In another embodiment, the rate of acidification is measured
using a CINAC device which is an extensively used apparatus in the
dairy industry to analyse acidification properties of lactic acid
bacteria.
[0088] An automated system for measuring the rate of acidification
is well known to the person of ordinary skill in the art. Reference
can be found in (for example) FR 2 629 612 for example. The CINAC
automated system is taught in the article Corrieu, G. et al Process
(ISSN 0998-6650); 1992, No. 1068, pp 24-27 (10 ref.).
Texturizing/Viscosity
[0089] As described herein, a lactic acid bacterium with improved
texturizing properties or activities is provided. In particular,
the lactic acid bacterium exhibits the property of conferring
viscosity to a fermentation medium.
[0090] The lactic acid bacterium generates fermented milk having a
viscosity greater than about 62 Pas, more preferably greater than
about 65 Pas, more preferably greater than about 68 Pas.
[0091] Preferably, the lactic acid bacterium generates fermented
milk having a viscosity in the range of about 62 Pas to about 75
Pas, preferably from about 65 Pas to about 75 Pas, more preferably
from about 62 Pas to about 68 Pas, most preferably from about 65 to
about 68 Pas, more preferably about 68 Pas.
[0092] Preferably, the viscosity is measured after 14 days of
storage at about 6.degree. C.
[0093] The lactic acid bacteria described herein are strongly
texturizing.
[0094] In one embodiment, the lactic acid bacterium generates
fermented milk having the viscosity described herein as measured
using the one or more of the methods described below.
[0095] Various rheological measurements are known in the art--such
as flow and viscosity.
Fermented Milk Process
[0096] In one embodiment, fresh fermented milks are produced at lab
scale. The milk base is composed of commercial UHT milk
supplemented with 3% (w/w) semi-skimmed milk powder. After mixing,
the milk base is heated during 10 min+/-1 min at 90.degree.
C.+/-0.2.degree. C. The base is then cooled down at 43.degree.
C.+/-1.degree. C. in a water bath regulated at 43.degree.
C.+/-1.degree. C. and the milk is dispatched into 125 ml glass
beakers. The milk is inoculated with the bacterium at a ratio of
1E6-1E7 cfu/ml. The fermentation is carried out at 43.degree.
C.+/-1.degree. C. without stirring and it is stopped when the pH
reaches 4.6+/-0.05. At this moment, the fresh fermented milk is
quickly cooled down at 6.degree. C.+/-1.degree. C. in less than 1
hour. Finally, the products are stored at this temperature during
28 days.
Method to Measure Viscosity:
[0097] In one embodiment, the viscosity measurements are carried
out at 6.degree. C. on fermented milks, after storage for 1, 7, 14
and 28 days at 6.degree. C. The apparatus used is an RVFtype
Brookfield.RTM. viscometer (Brookfield Engineering Laboratories,
Inc.) mounted on a Helipath stand (Brookfield Engineering
Laboratories, Inc.) The viscometer is equipped with a type C needle
and the oscillation speed applied to the needle is 10 rpm. In
accordance with the present invention this method is a preferred
method for measuring viscosity.
Method to Measure Flow:
[0098] In another embodiment, the flow measurements are carried out
at 6.degree. C. on fermented milks, after storage for 14 days at
6.degree. C. and which have been previously stirred. The apparatus
used is an ARI000-N rheometer (TA Instruments) equipped with
co-axial cylinders (Radius 1=15 mm, Radius 2=13.83 mm, Height 32
mm, Air gap=2 mm). For the ascending segment shear stress [Pa] is
applied in a continuous sweep from 0 to 60 Pa for a duration of 1
minute according to a linear mode. For the descending segment, the
shear stress [Pa] applied in a continuous sweep varies from 60 to 0
Pa for a duration of 1 minute according to a linear mode. The
values taken into account are the thixotropic area (Pa/s) and the
yield stress (Pa); the latter is calculated according to the Casson
model.
[0099] In accordance with the present invention, the viscosity of a
food, food additive, feed, nutritional supplement, or probiotic
supplement may be modified or modulated using the lactic acid
bacterium described herein. Preferably, the viscosity is
increased.
Bacteriophage
[0100] As used herein, the term "bacteriophage" has its
conventional meaning as understood in the art ie. a virus that
selectively infects one or more bacteria. Many bacteriophages are
specific to a particular genus or species or strain of
bacteria.
[0101] The term "bacteriophage" is synonymous with the term
"phage".
[0102] The bacteriophage may be a lytic bacteriophage or a
lysogenic bacteriophage.
[0103] A lytic bacteriophage is one that follows the lytic pathway
through completion of the lytic cycle, rather than entering the
lysogenic pathway. A lytic bacteriophage undergoes viral
replication leading to lysis of the cell membrane, destruction of
the cell, and release of progeny bacteriophage particles capable of
infecting other cells.
[0104] A lysogenic bacteriophage is one capable of entering the
lysogenic pathway, in which the bacteriophage becomes a dormant,
passive part of the cell's genome through prior to completion of
its lytic cycle.
[0105] Bacteriophages may include, but are not limited to,
bacteriophages that belong to any of the following virus families:
Corticoviridae, Cystoviridae, Inoviridae, Leviviridae,
Microviridae, Myoviridae, Podoviridae, Siphoviridae, or
Tectiviridae.
[0106] Advantageously, the lactic acid bacterium according to the
present invention is phage resistant.
[0107] Over the last 2 decades a library of more than one thousand
phages virulent for industrial S. thermophilus strains have been
collated. This collection of phages was intensively studied and
their host spectrum was established. This allowed the
identification of a set of 60 phages representative of all the host
spectrums identified within the collection of phages. Each of these
representative phages was tested on strains DSMZ18344, CNCM I-2423
and CNCM I-2425, as described herein. CNCM I-2423 was found to be
sensitive to phage D4126 and D3215. Strain CNCMI-2425 was found to
be sensitive to phage D4369. On the contrary strain DSMZ-18344 of
the present invention was resistant to all the representative
phages tested.
[0108] In one embodiment, the lactic acid bacterium of the present
invention is resistant to phage D4126 and/or D3215 and/or phage
D4369.
[0109] In one embodiment, the lactic acid bacterium according to
the present invention is resistant to one or more bacteriophage or
one or more sets of bacteriophage. In another embodiment, the
lactic acid bacterium according to the present invention is
resistant to the same bacteriophage that strain CNCM I-2423 and/or
CNCM I-2425 are resistant to.
CRISPR Locus
[0110] As used herein, the term "CRISPR locus" is defined as the
DNA segment which includes all of the CRISPR repeats, starting with
the first nucleotide of the first CRISPR repeat and ending with the
last nucleotide of the last (terminal) CRISPR repeat.
[0111] The CRISPR locus is a distinct class of interspersed short
sequence repeats (SSRs) that were first recognized in E. coli
(Ishino et al. (1987) J. Bacteriol. 169:5429-5433; Nakata et al.
(1989) J. Bacteriol. 171:3553-3556). Similar interspersed SSRs have
been identified in Haloferax mediterranei, Streptococcus pyogenes,
Anabaena, and Mycobacterium tuberculosis (Groenen et al. (1993)
Mol. Microbiol. 10:1057-1065; Hoe et al. (1999) Emerg Infect. Dis.
5:254-263; Masepohl et al. (1996) Biochim. Biophys. Acta
1307:26-30; Mojica et al. (1995) Mol. Microbiol. 17:85-93). The
CRISPR loci differ from other SSRs by the structure of the repeats,
which have been termed short regularly spaced repeats (SRSRs)
(Janssen et al. (2002) OMICS J. Integ. Biol. 6:23-33; Mojica et al.
(2000) Mol. Microbiol. 36:244-246). The repeats are short elements
that occur in clusters, that are always regularly spaced by unique
intervening sequences with a constant length (Mojica et al. (2000)
Mol. Microbiol. 36:244-246). Although the repeat sequences are
highly conserved between strains, the number of interspersed
repeats and the sequences of the spacer regions differ from strain
to strain (van Embden et al. (2000) J. Bacteriol.
182:2393-2401).
[0112] The common structural characteristics of the CRISPR locus
are described in Jansen et al. (2002) as (i) the presence of
multiple short direct repeats, which show no or very little
sequence variation within a given locus; (ii) the presence of
non-repetitive spacer sequences between the repeats of similar
size; (iii) the presence of a common leader sequence of a few
hundred basepairs in most species harbouring multiple CRISPR loci;
(iv) the absence of long open reading frames within the locus; and
(v) the presence of one or more cas genes.
[0113] CRISPR repeats are typically short partially palindromic
sequences of 24-40 bp containing inner and terminal inverted
repeats of up to 11 bp. Although isolated elements have been
detected, they are generally arranged in clusters (up to about 20
or more per genome) of repeated units spaced by unique intervening
20-58 bp sequences. CRISPR repeats are generally homogenous within
a given genome with most of them being identical. However, there
are examples of heterogeneity in, for example, the Archaea (Mojica
et al. 2000).
[0114] Advantageously, the CRISPR locus can be used to type and/or
screen bacteria.
[0115] As will be appreciated by a person skilled in the art, there
are numerous different methods for screening/typing a bacterium. In
this regard, numerous methods are set forth in, for example, J.
Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning:
A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor
Laboratory Press; Ausubel, F. M. et al. (1995 and periodic
supplements; Current Protocols in Molecular Biology, ch. 9, 13, and
16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree,
and A. Kahn, 1996, DNA Isolation and Sequencing: Essential
Techniques, John Wiley & Sons; M. J. Gait (Editor), 1984,
Oligonucleotide Synthesis: A Practical Approach, Irl Press; and, D.
M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA
Structure Part A: Synthesis and Physical Analysis of DNA Methods in
Enzymology, Academic Press.
[0116] In one embodiment, amplification is used.
[0117] By "amplification" we mean the production of additional
copies of a nucleic acid sequence.
[0118] Amplification techniques include, but are not limited to,
methods broadly classified as thermal cycling amplification methods
and isothermal amplification methods.
[0119] Suitable thermal cycling methods include, for example,
ligase chain reaction (Genomics 4:560, (1989); and Science 241:
1077 (1988)), the polymerase chain reaction (PCR) (as described in
U.S. Pat. No. 4,683,195; U.S. Pat. No. 4,683,202; and U.S. Pat. No.
4,965,188) and Real time PCR; the Polymerase Ligase Chain Reaction
(PCR Methods and Applic. (1991) 1:5-16); Gap-LCR (WO 90/01069); the
Repair Chain Reaction (EP 439,182); and 3SR (Proc. Natl. Acad. Sci.
U.S.A. (1989) 86:1173-1177; Proc. Natl. Acad. Sci. U.S.A. (1990)
87:1874-1878; and WO 92/0880). Isothermal amplification methods
include, for example, Strand Displacement Amplification (SDA)
(Proc. Nat. Acad. Sci. USA 89:392-396 (1992)), Q-beta-replicase
(Bio/Technology 6:1197-1202 (1988)); nucleic acid-based Sequence
Amplification (NASBA) (Bio/Technology 13:563-565 (1995)); and
Self-Sustained Sequence Replication (Proc. Nat. Acad. Sci. USA
87:1874-1878 (1990)).
[0120] In a preferred embodiment of the present invention, the
amplification method is PCR. This is generally carried out using
PCR technologies well known in the art (Dieffenbach and Dveksler
(1995) PCR Primer, a Laboratory Manual (Cold Spring Harbor Press,
Plainview, N.Y.).
[0121] As is well known in the art, oligonucleotide primers can be
designed for use in amplification reactions to amplify a desired
sequence.
[0122] By "primer" we mean an oligonucleotide, whether occurring
naturally as in a purified restriction digest or produced
synthetically, which is capable of acting as a point of initiation
of synthesis when placed under conditions in which synthesis of a
primer extension product which is complementary to a nucleic acid
strand is induced (i.e., in the presence of nucleotides and an
inducing agent--such as DNA polymerase and at a suitable
temperature and pH). The primer is preferably single stranded for
maximum efficiency in amplification, but may alternatively be
double stranded. If double stranded, the primer is first treated to
separate its strands before being used to prepare extension
products. Preferably, the primer is an oligodeoxyribonucleotide.
The primer must be sufficiently long to prime the synthesis of
extension products in the presence of the inducing agent. The exact
lengths of the primers will depend on many factors, including
temperature, source of primer, and the use of the method. PCR
primers are preferably at least about 10 nucleotides in length
(e.g. 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides in length),
and most preferably at least about 20 nucleotides in length.
[0123] Methods for designing PCR primers and PCR cloning are
generally known in the art and are disclosed in Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring
Harbor Laboratory Press, Plainview, N.Y.). See also Innis et al.,
eds. (1990) PCR Protocols: A Guide to Methods and Applications
(Academic Press, New York); Innis and Gelfand, eds. (1995) PCR
Strategies (Academic Press, New York); and Innis and Gelfand, eds.
(1999) PCR Methods Manual (Academic Press, New York). Known methods
of PCR include, but are not limited to, methods using paired
primers, nested primers, single specific primers, degenerate
primers, gene-specific primers, vector-specific primers, partially
mismatched primers, and the like.
[0124] Suitably, a bacterium may be screened by amplifying (e.g.
PCR amplifying) the CRISPR (e.g. CRISPR1) locus using primers
targeting conserved stretches within the leader and trailer (as
described in Bolotin et al., (2005) Microbiology
151(8):2551-61).
[0125] Suitably, a bacterium may be screened by amplifying (e.g.
PCR amplifying) selected portions of the CRISPR (e.g. CRISPR1)
locus. In this regard, it has been surprisingly found that the
Streptococcus thermophilus strain described herein lacks 5 CRISPR
spacers as compared to, for example, S. thermophilus CNCM I-2425
and S. thermophilus CNRZ385. In particular, it has been found that
the Streptococcus thermophilus strain of the present invention
lacks the first, second, tenth, eleventh and twelfth CRISPR1
spacers from the 5' end of the CRISPR spacer as compared to, for
example, S. thermophilus CNCM I-2425 and S. thermophilus CNRZ385.
As the skilled person will appreciate, this property of the
Streptococcus thermophilus strain of the present invention can
advantageously be used to detect this strain since amplicons of
different lengths will be obtained when compared to at least S.
thermophilus CNCM I-2425 and S. thermophilus CNRZ385. So for
example, a first primer could be designed to hybridise to the
leader sequence at the 5' end of the CRISPR locus and a second
primer could be designed to hybridise downstream of the second
missing CRISPR spacer sequence and/or downstream of the twelfth
missing CRISPR spacer in the Streptococcus thermophilus strain of
the present invention. By way of further example, a first primer
could be designed to hybridise downstream of the second missing
CRISPR spacer sequence and a second primer could be designed to
hybridise downstream of the twelfth missing spacer.
[0126] Preferably, said bacterium is screened using oligonucleotide
primers, which specifically or substantially hybridise to said
nucleotide sequence(s) as described herein.
[0127] In one aspect, there is provided a method for identifying a
Streptococcus thermophilus strain comprising the use of an
oligonucleotide primer which specifically hybridises to the
sequence set forth in SEQ ID No. 19 or a homologue thereof with at
least 75% identity thereto.
[0128] In a further aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of oligonucleotide primers which flank CRISPR spacers that are
absent in Streptococcus thermophilus DSMZ-18344.
[0129] In one embodiment, the forward primer hybridises to one or
more of the CRISPR1 spacers labelled C, D, E, F, G, H, or I (see
FIG. 3). The reverse primer hybridises to one or more of the
CRISPR1 spacers labelled M, N, O, P, Q, or R (see FIG. 3).
Suitably, primers do not hybridise to the spacer labelled as S.
Typically, the amplified fragment will be about 200 bp shorter with
DSMZ18344 as compared to other strains described herein--such as
CNCM I-2425.
[0130] In a further aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of a forward oligonucleotide primer which hybridises to SEQ ID No.
1 and a reverse oligonucleotide primer which hybridises to the SEQ
ID No. 18.
[0131] In another aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of a forward oligonucleotide primer which hybridises to SEQ ID No.
1 and a reverse oligonucleotide primer which hybridises to any of
SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No.
6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID
No. 11, SEQ ID No. 12, SEQ. ID No. 13, SEQ ID No. 14, SEQ ID No.
15, SEQ ID No. 16 and/or SEQ ID No. 17.
[0132] In another aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of a forward oligonucleotide primer which hybridises to any of SEQ
ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6,
SEQ ID No. 7, SEQ ID No. 8 and a reverse oligonucleotide primer why
hybridises to any of SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11,
SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID
No. 16 and/or SEQ ID No. 17.
[0133] In another aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of a forward oligonucleotide primer which hybridises to any of SEQ
ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6,
SEQ ID No. 7 and/or SEQ ID No. 8 and reverse oligonucleotide primer
which hybridises to SEQ ID No. 18.
[0134] In another aspect, there is provided a method for
identifying a Streptococcus thermophilus strain comprising the use
of a forward oligonucleotide primer which hybridises to any of SEQ
ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No.
13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16 and/or SEQ ID No.
17 and a reverse oligonucleotide primer why hybridises to any SEQ
ID No. 18. Preferably, forward and/or reverse oligonucleotide
primers that hybridise to SEQ ID No. 15 and SEQ ID No. 16 are not
used.
[0135] The forward oligonucleotide primer may even hybridise to a
sequence that is upstream of SEQ ID No. 2.
[0136] The reverse primer may even hybridise to a sequence that is
downstream of SEQ ID No. 18.
[0137] Following amplification/detection, the amplified sequence
may be identified using various methods that are known in the
art.
[0138] By way of example, the amplified sequence may be identified
by determining the amplification product restriction pattern.
Accordingly, once the DNA has been amplified, it may be digested
(e.g. cut) with one or more restriction enzymes.
[0139] As used herein, the term "restriction enzymes" refers to
enzymes (e.g. bacterial enzymes), each of which cut double-stranded
DNA at or near a specific nucleotide sequence. Restriction enzymes
are well known in the art and may be readily obtained, for example,
from variety of commercial sources (for example, New England
Biolabs, Inc., Beverly, Mass.). Similarly, methods for using
restriction enzymes are also generally well known and routine in
the art. Restriction enzymes that produce between 10 and 24
fragments of DNA when cutting the CRISPR locus or a portion thereof
may be used. Fragments of DNA obtained using restriction enzymes
may be detected, for example, as bands by gel electrophoresis.
Restriction enzymes may be used to create Restriction Fragment
Length Polymorphisms (RFLPs).
[0140] RFLPs are generated by cutting ("restricting") a DNA
molecule with a restriction endonuclease. Many hundreds of such
enzymes have been isolated, as naturally made by bacteria. In
essence, bacteria use such enzymes as a defensive system, to
recognise and then cleave (restrict) any foreign DNA molecules that
might enter the bacterial cell (e.g., a viral infection). Each of
the many hundreds of different restriction enzymes has been found
to cut (i.e., "cleave" or "restrict") DNA at a different sequence
of the 4 basic nucleotides (A, T, G, C) that make up all DNA
molecules, e.g., one enzyme might specifically and only recognise
the sequence A-A-T-G-A-C, while another might specifically and only
recognise the sequence G-T-A-C-T-A, etc. Depending on the unique
enzyme involved, such recognition sequences may vary in length,
from as few as 4 nucleotides to as many as 21 nucleotides. The
larger the recognition sequence, the fewer restriction fragments
will result, as the larger the recognition site, the lower the
probability that it will repeatedly be found throughout the
DNA.
[0141] By way of further example, the amplified sequence may be
identified by determining or also determining the difference in
size of the amplification product, as described above.
[0142] Separation may be achieved by any method suitable for
separating DNA, including, but not limited to, gel electrophoresis,
high performance liquid chromatography (HPLC), mass spectroscopy,
and use of a microfluidic device. In one embodiment, the
amplification products or DNA fragments are separated by agarose
gel electrophoresis. Gel electrophoresis separates different sized
charged molecules by their rate of movement through a stationary
gel under the influence of an electric current. These separated
amplification products or DNA fragments can easily be visualised,
for example, by staining with ethidium bromide and by viewing the
gel under UV illumination. The banding pattern reflects the sizes
of the restriction digested DNA or the amplification products.
[0143] By way of further example, the amplified sequence may be
identified by sequencing the amplification products.
[0144] The sequence of the amplified products may be obtained by
any method known in the art, including automatic and manual
sequencing methods. See, for example, Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.; Roe et al. (1996) DNA Isolation
and Sequencing (Essential Techniques Series, John Wiley &
Sons).
[0145] Preferably, the Streptococcus thermophilus that is
identified in accordance with the methods of the present invention
has substantially the same characteristics as the Streptococcus
thermophilus strain deposited at DSMZ (Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124
Braunschweig) under deposit number 18344 on 14 Jun. 2006. In the
context of the present invention, the phrase "substantially the
same characteristics" means that the Streptococcus thermophilus
strain has one or more (preferably all) of the characteristics of
the Streptococcus thermophilus strain deposited at DSMZ (Deutsche
Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg
1 b, D-38124 Braunschweig) under deposit number 18344 on 14 Jun.
2006.
[0146] Suitably, the Streptococcus thermophilus that is identified
is a fast acidifying lactic acid bacterium; and/or the
Streptococcus thermophilus that is identified generates a viscosity
in fermented milk greater than about 62 Pas, preferably about 68
Pas; and/or the Streptococcus thermophilus that is identified is
phage resistant; and/or the Streptococcus thermophilus that is
identified belongs to the genetic cluster CL0189; and/or the
Streptococcus thermophilus that is identified comprises the
sequence set forth in SEQ ID No. 20; and/or the Streptococcus
thermophilus that is identified comprises the sequence set forth in
SEQ ID No. 19 or a variant, fragment, homologue or derivative
thereof.
CRISPR Orientation
[0147] For the avoidance of doubt, in the context of the present
invention the CRISPR locus is orientated as follows.
[0148] The CRISPR leader is a conserved DNA segment of defined
size. For example, the leader sequence of S. thermophilus LMG18311
(Accession CP000024) CRISPR1 is the DNA segment starting
immediately after the stop codon of gene stu0660, and ending just
before the first repeat. The CRISPR leader is located at the 5' end
of the CRISPR locus. The CRISPR leader is located immediately
upstream of the first CRISPR repeat of the CRISPR locus.
[0149] The CRISPR trailer is a conserved DNA segment of defined
size. For example, the trailer sequence of S. thermophilus LMG18311
(Accession CP000024) CRISPR1 is the DNA segment starting
immediately after the terminal repeat, and ending just before the
stop codon of gene stu0661 (located on the opposite DNA strand).
The CRISPR trailer is located at the 3' end of the CRISPR locus.
The CRISPR trailer is located immediately downstream of the
terminal repeat.
[0150] By way of example, the CRISPR leader and CRISPR trailer
sequences in the CRISPR1 locus of Streptococcus thermophilus strain
CNRZ 1066 are:
TABLE-US-00001 CRISPIR leader
5'-CAAGGACAGTTATTGATTTTATAATCACTATGTGGGTATAAAAACGTCAAAATTTCATTTGAG-3'
CRISPR trailer 5'-TTGATTCAACATAAAAAGCCAGTTCAATTGAACTTGGCTTT-3'
[0151] The CRISPR leader corresponds to positions 625038 to 625100,
and the CRISPR trailer corresponds to positions 627845 to 627885 in
the full genome (CP000024) of Streptococcus thermophilus.
[0152] For the avoidance of doubt "upstream" means in the 5'
direction and "downstream" means in the 3' direction.
EPS
[0153] Lactic bacteria are known to be capable of producing two
classes of polysaccharides in their culture medium, namely
homopolysaccharides such as dextrans or levans which consist of the
repeated assembly of a single sugar, and heteropolysaccharides
commonly called exopolysaccharides or EPSs (EPS is short for the
term "exopolysaccharide") consisting of the assembly of several
different sugars forming a repeating unit (Cerning J., Bacteries
lactiques, [Lactic bacteria], Vol I, by de Roissart H and Luquet F.
M., Lorica, 309-329, 1994).
[0154] A lactic bacterium producing an EPS can impart a ropy
character and/or a smooth and creamy texture to an acidified milk
(Cerning et al., FEMS Microbiol., 87, 113-130, 1990). EPSs can also
display biological activities which are especially advantageous for
human or animal health, such as antitumour or probiotic activities,
for example (Oda M. et al., Agric. Biol. Chem., 47, 1623-1625,
1983; EP94870139.6).
[0155] Distinct EPS gene clusters have been characterised in S.
thermophilus. The distribution of regulatory and structural genes
within each of these clusters shows a modular organisation that is
conserved in other Streptococcus spp. Although the function of most
EPS-related genes (currently designated eps or cps) and gene
products are only inferred from sequence or structural homologies,
the 5' region of each cluster appears to encode proteins involved
in regulation of EPS synthesis, chain length determination, and
membrane translocation. These open reading frames are followed by
genes encoding the glycosyl-1-phosphate transferase and
glycosyltransferases required for assembly of the basic repeating
unit, and enzymes involved in repeat unit polymerization. Finally,
the 3' end of these clusters typically contain genes for additional
proteins involved in membrane translocation of the polymer
subunits, and enzymes needed for the production of sugar nucleotide
precursors (e.g., N-acetyl-D-galactosamine; that are unique to the
EPS (i.e., not found in other cell polymers).
[0156] The first four genes in the 5' region of S. thermophilus eps
clusters, epsA-D, are highly conserved among this and other
EPS.sup.+ Streptococcus spp appear to contribute regulation (epsA
and epsB), polymerization (epsC), and membrane translocation (epsD)
functions to EPS synthesis. epsE encodes a glycosyl-1-phosphate
transferase that catalyzes the first step in assembly of the EPS
basic repeating unit: addition of hexose-1-phosphate to the
lipid-phosphate carrier. Genes downstream of epsE appear to encode
glycosyltransferases, export/polymerization functions, sugar
biosynthesis, and a few enzymes whose function is unknown. Genes
encoding a variety of glycosyltransferases have been identified in
S. thermophilus and other lactic acid bacteria.
[0157] The lactic acid bacterium according to the present invention
comprises an EPS gene cluster comprising the sequence set forth in
SEQ ID No. 20 or a variant, fragment, homologue or derivative
thereof.
[0158] Surprisingly, the lactic acid bacterium described herein has
high eps sequence similarity with S. thermophilus CNCM I-2425 from
the start of the eps gene cluster sequence up to about position
3900 (ie. in epsE gene) and high eps sequence similarity with S.
thermophilus CNCM I-2423 from about position 3900 to the end of the
sequence.
Hybridisation
[0159] The present invention also encompasses sequences that are
complementary to the sequences of the present invention or
sequences that are capable of hybridising either to the sequences
of the present invention or to sequences that are complementary
thereto.
[0160] The term "hybridisation" as used herein shall include "the
process by which a strand of nucleic acid joins with a
complementary strand through base pairing" as well as the process
of amplification as carried out in polymerase chain reaction (PCR)
technologies.
[0161] The present invention also encompasses the use of nucleotide
sequences that are capable of hybridising to the sequences that are
complementary to the subject sequences discussed herein, or any
derivative, fragment or derivative thereof.
[0162] The present invention also encompasses sequences that are
complementary to sequences that are capable of hybridising to the
nucleotide sequences discussed herein.
[0163] Hybridisation conditions are based on the melting
temperature (Tm) of the nucleotide binding complex, as taught in
Berger and Kimmel (1987, Guide to Molecular Cloning Techniques,
Methods in Enzymology, Vol. 152, Academic Press, San Diego Calif.),
and confer a defined "stringency" as explained below.
[0164] Maximum stringency typically occurs at about Tm-5.degree. C.
(5.degree. C. below the Tm of the probe); high stringency at about
5.degree. C. to 10.degree. C. below Tm; intermediate stringency at
about 10.degree. C. to 20.degree. C. below Tm; and low stringency
at about 20.degree. C. to 25.degree. C. below Tm. As will be
understood by those of skill in the art, a maximum stringency
hybridisation can be used to identify or detect identical
nucleotide sequences while an intermediate (or low) stringency
hybridisation can be used to identify or detect similar or related
polynucleotide sequences.
[0165] Preferably, the present invention encompasses sequences that
are complementary to sequences that are capable of hybridising
under high stringency conditions or intermediate stringency
conditions to nucleotide sequences encoding polypeptides having the
specific properties as defined herein.
[0166] More preferably, the present invention encompasses sequences
that are complementary to sequences that are capable of hybridising
under high stringent conditions (e.g. 65.degree. C. and
0.1.times.SSC {1.times.SSC=0.15 M NaCl, 0.015 M Na-citrate pH 7.0})
to nucleotide sequences encoding polypeptides having the specific
properties as defined herein.
[0167] The present invention also relates to nucleotide sequences
that can hybridise to the nucleotide sequences discussed herein
(including complementary sequences of those discussed herein).
[0168] The present invention also relates to nucleotide sequences
that are complementary to sequences that can hybridise to the
nucleotide sequences discussed herein (including complementary
sequences of those discussed herein).
[0169] Also included within the scope of the present invention are
polynucleotide sequences that are capable of hybridising to the
nucleotide sequences discussed herein under conditions of
intermediate to maximal stringency.
[0170] In a preferred aspect, the present invention covers
nucleotide sequences that can hybridise to the nucleotide sequences
discussed herein, or the complement thereof, under stringent
conditions (e.g. 50.degree. C. and 0.2.times.SSC).
[0171] In a more preferred aspect, the present invention covers
nucleotide sequences that can hybridise to the nucleotide sequences
discussed herein, or the complement thereof, under high stringent
conditions (e.g. 65.degree. C. and 0.1.times.SSC).
Substantially
[0172] Suitably, the oligonucleotide primers described herein
substantially anneal or substantially hybridise to its respective
nucleic acid. This means that an oligonucleotide--such as a
primer--should be sufficiently complementary to hybridise or anneal
to its respective nucleic acid.
[0173] The oligonucleotide sequence need not reflect the exact
sequence of its respective nucleic acid, and can, in fact, be
"degenerate". Non-complementary bases or other sequences may be
interspersed into the oligonucleotide or the nucleic acid, provided
that the oligonucleotide sequence has sufficient complementarity
with the sequence to permit hybridisation. Thus, by way of example,
the primers used for PCR amplification may be selected to be
"substantially" complementary to the specific sequence to be
amplified.
Starter Cultures
[0174] Starter cultures are used extensively in the food industry
in the manufacture of products (e.g. fermented products) including
milk products--such as yoghurt and cheese.
[0175] Starter cultures used in the manufacture of many fermented
milk, cheese and butter products include cultures of bacteria,
generally classified as lactic acid bacteria. Such bacterial
starter cultures impart specific features to various dairy products
by performing a number of functions.
[0176] Commercial non-concentrated cultures of bacteria are
referred to in industry as `mother cultures`, and are propagated at
the production site, for example a dairy, before being added to an
edible starting material, such as milk, for fermentation. The
starter culture propagated at the production site for inoculation
into an edible starting material is referred to as the `bulk
starter`.
[0177] The bacterial starter culture may consist of the lactic acid
bacterium described herein, ie., a pure culture. In this case,
substantially all, or at least a significant portion of the
bacterial starter culture would generally comprise the same
bacterium.
[0178] In the alternative, the starter culture may comprise several
bacterial strains, ie. it may be a defined mixed culture.
[0179] For example, the starter culture may be suitable for use in
the dairy industry. When used in the dairy industry the starter
culture may additionally comprise a lactic acid bacteria species, a
Bifidobacterium species, a Brevibacterium species, and/or a
Propionibacterium species.
[0180] Cultures of lactic acid bacteria are commonly used in the
manufacture of fermented milk products--such as buttermilk, yoghurt
or sour cream, and in the manufacture of butter and cheese, for
example Brie or Harvati.
[0181] Suitable lactic acid bacteria include commonly used strains
of a Lactococcus species, a Streptococcus species, a Lactobacillus
species including the Lactobacillus acidophilus, Enterococcus
species, Pediococcus species, a Leuconostoc species and Oenococcus
species or combinations thereof.
[0182] Lactococcus species include the widely used Lactococcus
lactis, including Lactococcus lactis subsp. Lactis, Lactococcus
lactis subsp. lactis biovar diacetylactis and Lactococcus lactis
subsp. cremoris.
[0183] Other lactic acid bacteria species include Leuconostoc sp.,
Streptococcus thermophilus, Lactobacillus delbrueckii subsp.
bulgaricus and Lactobacillus helveticus. Mesophilic cultures of
lactic acid bacteria commonly used in the manufacture of fermented
milk products such as buttermilk, yoghurt or sour cream, and in the
manufacture of butter and cheese, for example Brie or Harvati. In
addition, probiotic strains such as Bifidobacterium lactis,
Lactobacillus acidophilus, Lactobacillus casei may be added during
said manufacturing to enhance flavour or to promote health.
[0184] Cultures of lactic acid bacteria commonly used in the
manufacture of cheddar and Monterey Jack cheeses include
Streptococcus thermophilus, Lactococcus lactis subsp. lactis and
Lactococcus lactis subsp. cremoris or combinations thereof.
[0185] Thermophilic cultures of lactic acid bacteria commonly used
in the manufacture of Italian cheeses such as Pasta filata or
parmesan, include Streptococcus thermophilus and Lactobacillus
delbrueckii subsp bulgaricus. Other Lactobacillus species--such as
Lactobacillus helveticus--may be added during manufacturing to
obtain a desired flavour.
[0186] The selection of organisms for the starter culture of the
invention will depend on the particular type of products to be
prepared and treated. Thus, for example, for cheese and butter
manufacturing, mesophillic cultures of Lactococcus species,
Leuconostoc species and Lactobacillus species are widely used,
whereas for yoghurt and other fermented milk products,
thermophillic strains of Streptococcus species and of Lactobacillus
species are typically used.
[0187] The starter culture may even be a dried starter culture.
[0188] The starter culture may be a concentrated starter culture.
The starter culture may be a concentrated starter culture used in
direct inoculation. The starter culture may be a frozen starter
culture.
Preparing Starter Cultures
[0189] Starter cultures may be prepared by techniques well known in
the art such as those disclosed in U.S. Pat. No. 4,621,058. By way
of example, starter cultures may be prepared by the introduction of
an inoculum, for example a bacterium, to a growth medium to produce
an inoculated medium and ripening the inoculated medium to produce
a starter culture.
Preparing Dried Starter Cultures
[0190] Dried starter cultures may be prepared by techniques well
known in the art, such as those discussed in U.S. Pat. No.
4,423,079 and U.S. Pat. No. 4,140,800.
[0191] Dried starter cultures for use in the present invention may
be in the form of solid preparations. Examples of solid
preparations include, but are not limited to tablets, pellets,
capsules, dusts, granules and powders which may be wettable,
spray-dried, freeze-dried or lyophilised.
[0192] The dried starter cultures for use in the present invention
may be in either a deep frozen pellet form or freeze-dried powder
form. Dried starter cultures in a deep frozen pellet or
freeze-dried powder form may be prepared according to the methods
known in the art.
[0193] The starter cultures for use in the present invention may be
in the form of concentrates which comprise a substantially high
concentration of one or more bacteria. Preferably the concentrates
may be diluted with water or resuspended in water or other suitable
diluents, for example, an appropriate growth medium or mineral or
vegetable oils, for use in the present invention. The dried starter
cultures of the present invention in the form of concentrates may
be prepared according to the methods known in the art, for example
by centrifugation, filtration or a combination of such
techniques.
Product
[0194] Any product, which is prepared from, contains or comprises a
lactic acid bacterium is contemplated in accordance with the
present invention.
[0195] Suitable products include, but are not limited to a food, a
foodstuff, a food additive, a food supplement, a feed, a
nutritional supplement, a probiotic supplement, a cosmetic product
or a pharmaceutical product.
[0196] These include, but are not limited to, fruits, legumes,
fodder crops and vegetables including derived products, grain and
grain-derived products, dairy foods and dairy food-derived
products, meat, poultry and seafood.
[0197] The term "food" is used in a broad sense and includes feeds,
foodstuffs, food ingredients, food supplements, and functional
foods. Here, the term "food" is used in a broad sense--and covers
food for humans as well as food for animals (i.e. a feed). In a
preferred aspect, the food is for human consumption.
[0198] As used herein the term "food ingredient" includes a
formulation, which is or can be added to foods and includes
formulations which can be used at low levels in a wide variety of
products that require, for example, acidifying or emulsifying.
[0199] As used herein, the term "functional food" means a food
which is capable of providing not only a nutritional effect and/or
a taste satisfaction, but is also capable of delivering a further
beneficial effect to consumer. Although there is no legal
definition of a functional food, most of the parties with an
interest in this area agree that there are foods marketed as having
specific health effects.
[0200] The bacteria described herein may be--or may be added to--a
food ingredient, a food supplement, or a functional food.
[0201] The food may be in the form of a solution or as a
solid--depending on the use and/or the mode of application and/or
the mode of administration.
[0202] The bacteria described here can be used in the preparation
of food products such as one or more of: confectionery products,
dairy products, meat products, poultry products, fish products and
bakery products.
[0203] By way of example, the bacteria can be used as ingredients
to soft drinks, a fruit juice or a beverage comprising whey
protein, health teas, cocoa drinks, milk drinks and lactic acid
bacteria drinks, yoghurt, drinking yoghurt and wine.
[0204] The present invention also provides in a further aspect a
method of preparing a food, food additive, feed, nutritional
supplement or probiotic supplement, the method comprising admixing
the lactic acid bacterium according to the present invention with a
food, food additive, feed, nutritional supplement, probiotic
supplement and/or food or feed ingredient (such as a starting
material for a food).
[0205] Preferably a food as described herein is a dairy product.
More preferably, a dairy product as described herein is one or more
of the following: a yoghurt, a cheese (such as an acid curd cheese,
a hard cheese, a semi-hard cheese, a cottage cheese), a buttermilk,
quark, a sour cream, kefir, a fermented whey-based beverage, a
koumiss, a milk beverage, a yoghurt drink, a fermented milk, a
matured cream, a cheese, a fromage frais, a milk, a dairy product
retentate, a process cheese, a cream dessert, or infant milk.
[0206] Preferably, a food as described herein is a fermented food
product. More preferably, a food as described herein is a fermented
dairy product--such as a milk beverage, a yoghurt drink, a
fermented milk, a matured cream, a cheese, a fromage frais, a dairy
product retentate, a process cheese, a cream dessert, or infant
milk.
[0207] Preferably the dairy product according to the invention
comprises milk of animal and/or plant origin.
[0208] Milk is understood to mean that of animal origin, such as
cow, goat, sheep, buffalo, zebra, horse, donkey, or camel, and the
like. The milk may be in the native state, a reconstituted milk, a
skimmed milk or a milk supplemented with compounds necessary for
the growth of the bacteria or for the subsequent processing of
fermented milk, such as fat, proteins of a yeast extract, peptone
and/or a surfactant, for example. The term milk also applies to
what is commonly called vegetable milk, that is to say extracts of
plant material which have been treated or otherwise, such as
leguminous plants (soya bean, chick pea, lentil and the like) or
oilseeds (colza, soya bean, sesame, cotton and the like), which
extract contains proteins in solution or in colloidal suspension,
which are coagulable by chemical action, by acid fermentation
and/or by heat. Finally, the word milk also denotes mixtures of
animal milks and of vegetable milks.
[0209] In one embodiment, the term "milk" means commercial UHT milk
supplemented with 3% (w/w) of semi-skimmed milk powder pasteurized
by heating during 10 min+/-1 min. at 90.degree. C.+/-0.2.degree.
C.
[0210] In a further aspect there is provided a method for preparing
a fermented milk product wherein said process comprises fermenting
a milk substrate in the presence of at least the lactic acid
bacterium, the culture or the starter culture described herein.
Preferably, the milk substrate is milk. Preferably, the milk
substrate comprises solid items. Preferably, the solid items
comprise or consist of fruits, chocolate products, or cereals.
Sequence
[0211] For some embodiments of the present invention, it is
preferred that the sequence is a naturally occurring nucleic acid
sequence.
[0212] The nucleic acid sequence may be DNA or RNA of genomic,
synthetic or recombinant origin e.g. cDNA. The nucleotide sequence
may be double-stranded or single-stranded whether representing the
sense or antisense strand or combinations thereof. Recombinant
nucleic acid sequences may be prepared by use of recombinant DNA
techniques, as described herein.
[0213] The nucleic acid sequence and the nucleic acids encompassed
by the present invention may be isolated or substantially purified.
By "isolated" or "substantially purified" is intended that the
nucleic acid molecules, or biologically active fragments or
variants, homologues or derivatives thereof are substantially or
essentially free from components normally found in association with
the nucleic acid in its natural state. Such components include
other cellular material, culture media from recombinant production,
and various chemicals used in chemically synthesising the nucleic
acids.
[0214] An "isolated" nucleic acid sequence or nucleic acid is
typically free of nucleic acid sequences that flank the nucleic
acid of interest in the genomic DNA of the organism from which the
nucleic acid was derived (such as coding sequences present at the
5' or 3' ends). However, the molecule may include some additional
bases or moieties that do not deleteriously affect the basic
characteristics of the composition.
[0215] In one aspect, there is provided the nucleotide sequence set
forth in SEQ ID No. 19 or fragment, variant, homologue or
derivative thereof.
[0216] In a further aspect, there is provided the sequence set
forth in SEQ ID No. 19 or a homologue thereof with at least 75%
identity thereto.
[0217] Suitably, the sequence set forth in SEQ ID No. 19 or a
homologue thereof has at least 75% identity thereto, when the full
length CRISPR loci are aligned.
Variants/Homologues/Derivatives/Fragments
[0218] The present invention encompasses the use of variants,
homologues, derivatives and fragments of nucleic acid
sequences.
[0219] The term "variant" is used to mean a naturally occurring
nucleotide sequence which differs from a wild-type sequence.
[0220] The term "fragment" indicates that a nucleotide sequence
comprises a fraction of a wild-type sequence. It may comprise one
or more large contiguous sections of sequence or a plurality of
small sections. Preferably the sequence comprises at least 50%,
more preferably at least 65%, more preferably at least 80%, more
preferably at least 85%, more preferably at least 90%, more
preferably at least 95%, more preferably at least 96%, more
preferably at least 97%, more preferably at least 98%, most
preferably at least 99% of the wild-type sequence.
[0221] Preferably, the fragment retains 50%, more preferably 60%,
more preferably 70%, more preferably 80%, more preferably 85%, more
preferably 90%, more preferably 95%, more preferably 96%, more
preferably 97%, more preferably 98%, or most preferably 99%
activity of the wild-type nucleotide sequence.
[0222] The fragment may be a functional fragment.
[0223] By a "functional fragment" of a molecule is understood a
fragment retaining or possessing substantially the same biological
activity as the intact molecule. In all instances, a functional
fragment of a molecule retains at least 10% and at least about 25%,
50%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the
biological activity of the intact molecule.
[0224] The term "homologue" means an entity having a certain
homology with the subject nucleotide sequences. Here, the term
"homology" can be equated with "identity".
[0225] In the present context, a homologous sequence is taken to
include a nucleotide sequence, which may be at least 60, 70, 75, 85
or 90% identical, preferably at least 95%, 96%, 97%, 98% or 99%
identical to the subject sequence. Although homology can also be
considered in terms of similarity, in the context of the present
invention it is preferred to express homology in terms of sequence
identity.
[0226] Homology comparisons may be conducted by eye, or more
usually, with the aid of readily available sequence comparison
programs. These commercially available computer programs can
calculate % homology between two or more sequences.
[0227] % homology may be calculated over contiguous sequences. This
is called an "ungapped" alignment. Typically, such ungapped
alignments are performed only over a relatively short number of
residues.
[0228] Most sequence comparison methods are designed to produce
optimal alignments that take into consideration possible insertions
and deletions without penalising unduly the overall homology score.
This is achieved by inserting "gaps" in the sequence alignment to
try to maximise local homology.
[0229] However, these more complex methods assign "gap penalties"
to each gap that occurs in the alignment. "Affine gap costs" are
typically used that charge a relatively high cost for the existence
of a gap and a smaller penalty for each subsequent residue in the
gap. This is the most commonly used gap scoring system. High gap
penalties will of course produce optimised alignments with fewer
gaps. Most alignment programs allow the gap penalties to be
modified. However, it is preferred to use the default values when
using such software for sequence comparisons. For example, when
using the GCG Wisconsin Bestfit package the default gap penalty for
amino acid sequences is -12 for a gap and -4 for each
extension.
[0230] Calculation of maximum % homology therefore firstly requires
the production of an optimal alignment, taking into consideration
gap penalties. A suitable computer program for carrying out such an
alignment is the GCG Wisconsin Bestfit package (University of
Wisconsin, U.S.A.; Devereux et al., 1984, Nucleic Acids Research
12:387). Examples of other software than can perform sequence
comparisons include, but are not limited to, the BLAST package (see
Ausubel et al., 1999 ibid--Chapter 18), FASTA (Atschul et al.,
1990, J. Mol. Biol., 403-410), the GENEWORKS suite of comparison
tools and CLUSTAL. Both BLAST and FASTA are available for offline
and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to
7-60). However, for some applications, it is preferred to use the
GCG Bestfit program. A new tool, called BLAST 2 Sequences is also
available for comparing protein and nucleotide sequence (see FEMS
Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999
177(1): 187-8).
[0231] Although the final % homology can be measured in terms of
identity, the alignment process itself is typically not based on an
all-or -nothing pair comparison. Instead, a scaled similarity score
matrix is generally used that assigns scores to each pairwise
comparison based on chemical similarity or evolutionary distance.
An example of such a matrix commonly used is the BLOSUM62
matrix--the default matrix for the BLAST suite of programs. GCG
Wisconsin programs generally use either the public default values
or a custom symbol comparison table if supplied (see user manual
for further details). For some applications, it is preferred to use
the public default values for the GCG package, or in the case of
other software, the default matrix--such as BLOSUM62.
[0232] Once the software has produced an optimal alignment, it is
possible to calculate % homology, preferably % sequence identity.
The software typically does this as part of the sequence comparison
and generates a numerical result.
[0233] Should Gap Penalties be used when determining sequence
identity, then preferably the following parameters are used:
TABLE-US-00002 FOR BLAST GAP OPEN 0 GAP EXTENSION 0
TABLE-US-00003 FOR CLUSTAL DNA PROTEIN WORD SIZE 2 1 K triple GAP
PENALTY 10 10 GAP EXTENSION 0.1 0.1
[0234] The nucleotide sequences may include within them synthetic
or modified nucleotides. A number of different types of
modification to oligonucleotides are known in the art. These
include methylphosphonate and phosphorothioate backbones and/or the
addition of acridine or polylysine chains at the 3' and/or 5' ends
of the molecule. For the purposes of the present invention, it is
to be understood that the nucleotide sequences may be modified by
any method available in the art. Such modifications may be carried
out to enhance the in vivo activity or life span of nucleotide
sequences useful in the present invention.
Vector
[0235] The nucleotide sequence(s) described herein may be present
in a vector. The nucleotide sequence may be operably linked to
regulatory sequences such that the regulatory sequences are capable
of providing for the expression of the nucleotide sequence by a
suitable host organism ie. the vector may be an expression
vector.
[0236] The term "expression vector" means a construct capable of in
vivo or in vitro expression.
[0237] Preferably, the expression vector is incorporated in the
genome of the organism. The term "incorporated" preferably covers
stable incorporation into the genome.
[0238] The vectors may be transformed into a suitable host cell as
described below to provide for expression of a polypeptide having
the specific properties as defined herein.
[0239] The choice of vector, e.g. plasmid, cosmid, virus or phage
vector, will often depend on the host cell into which it is to be
introduced.
[0240] The vectors may contain one or more selectable marker
genes--such as a gene which confers antibiotic resistance e.g.
ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
Alternatively, the selection may be accomplished by
co-transformation (as described in WO91/17243).
[0241] The vector may further comprise a nucleotide sequence
enabling the vector to replicate in the host cell in question.
Examples of such sequences are the origins of replication of
plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.
Constructs
[0242] The term "construct"--which is synonymous with terms such as
"conjugate", "cassette" and "hybrid"--includes a nucleotide
sequence directly or indirectly attached to a promoter. An example
of an indirect attachment is the provision of a suitable spacer
group such as an intron sequence, such as the Sh1-intron or the ADH
intron, intermediate the promoter and the nucleotide sequence of
the present invention. The same is true for the term "fused" in
relation to the present invention, which includes direct or
indirect attachment. In some cases, the terms do not cover the
natural combination of the nucleotide sequence coding for the
protein ordinarily associated with the wild type gene promoter and
when they are both in their natural environment.
[0243] The construct may even contain or express a marker, which
allows for the selection of the genetic construct.
[0244] For some applications, preferably the construct comprises at
least a nucleotide sequence operably linked to a promoter.
Host Cells
[0245] The term "host cell" includes any cell that comprises a
nucleotide sequence, a construct or a vector.
[0246] The cells will be chosen to be compatible with the said
vector and may for example be prokaryotic (for example bacterial),
fungal, yeast or plant cells. Preferably, the host cells are not
human cells.
[0247] Examples of suitable bacterial host organisms are gram
negative bacterium or gram positive bacteria.
General Recombinant DNA Methodology Techniques
[0248] The present invention employs, unless otherwise indicated,
conventional techniques of biochemistry, molecular biology,
microbiology and recombinant DNA, which are within the capabilities
of a person of ordinary skill in the art. Such techniques are
explained in the literature. See, for example, J. Sambrook, E. F.
Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory
Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory
Press; Ausubel, F. M. et al. (1995 and periodic supplements;
Current Protocols in Molecular Biology, ch. 9, 13, and 16, John
Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A.
Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques,
John Wiley & Sons; M. J. Gait (Editor), 1984, Oligonucleotide
Synthesis: A Practical Approach, Irl Press; and, D. M. J. Lilley
and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part
A: Synthesis and Physical Analysis of DNA Methods in Enzymology,
Academic Press. Each of these general texts is herein incorporated
by reference.
Further Aspects
[0249] In a further aspect, there is provided a lactic acid
bacterium comprising the sequence set forth in SEQ ID No. 20 or a
variant, fragment, homologue or derivative thereof, preferably, a
homologue thereof with at least 99% identity thereto.
[0250] In a further aspect, there is provided a nucleotide sequence
comprising the sequence set forth in SEQ ID No. 20 or a variant,
fragment, homologue or derivative thereof, preferably, a homologue
thereof with at least 99% identity thereto.
[0251] In a further aspect, there is provided a method for
identifying a lactic acid bacterium comprising the step of
screening a bacterium for the sequence set forth in SEQ ID No. 20
or a variant, fragment, homologue or derivative thereof,
preferably, a homologue thereof with at least 99% identity
thereto.
[0252] In a further aspect, there is provided a micro-organism a
Streptococcus thermophilus strain deposited under the Budapest
Treaty by Danisco Deutschland Niebull GmbH, Buch-Johannsen Strasse.
1, Niebull -D-25899, Germany at DSMZ (Deutsche The spacers of the
CRISPR 1 locus of S. thermophilus DSMZ-18344 have been sequenced
and compared to that of S. thermophilus CNCM I-2425, S.
thermophilus CNCM I-2423 and other spacer sequences. The only
similarities were found with S. thermophilus CNRZ 385 (Genbank
accession number DQ072992) and CNCM I-2425 (and related strains).
Interestingly, the spacers within this CRISPR locus have a
different organisation (5 missing spacers) and 1 additional spacer
were identified.
[0253] The lysotype of S. thermophilus DSMZ-18344 and the
differences observed between the lysotype of S. thermophilus
DSMZ-18344 and strains of the CL0189 genotype are shown in Table
2.
Example 5
S. thermophilus DSMZ-18344 is Phage Resistant
[0254] Over the last 2 decades a library of more than one thousand
phages virulent for industrial S. thermophilus strains have been
collated. This collection of phages was intensively studied and
their host spectrum was established. This allowed the
identification of a set of 60 phages representative of all the host
spectrums identified within the collection of phages.
[0255] Each of these representative phages was tested on strains
DSMZ18344, CNCM I-2423 and CNCM I-2425, as described herein.
[0256] CNCM I-2423 was found to be sensitive to phage D4126 and
D3215. Strain CNCMI-2425 was found to be sensitive to phage D4369.
On the contrary strain DSMZ-18344 was resistant to all the
representative phages tested.
TABLE-US-00004 TABLE 1 Strain Viscosity Casson yield stress
Thixotropy area name (Pa s) (Pa) (Pa/s) DSMZ-18344 68 6.48 627 CNCM
I-2425 28 14.43 21780 CNCM I-2423 49 9.28 1035
[0257] Sammlung von Mikroorganismen und Zellkulturen GmbH,
Mascheroder Weg 1 b, D-38124 Braunschweig) under deposit number
18344 on 14 Jun. 2006 or a mutant or variant thereof having one of
or more of the characteristics of the deposited Streptococcus
thermophilus strain.
[0258] The invention will now be further described by way of
Examples, which are meant to serve to assist one of ordinary skill
in the art in carrying out the invention and are not intended in
any way to limit the scope of the invention.
EXAMPLES
Example 1
Streptococcus thermophilus DSMZ-18344 is a Fast Acidifier of
Milk
[0259] The speed of acidification of milk during the fermentation
process is -0.0153 upH/min, compared to 0.0129 upH/min, 0.0167
upH/min and 0.0209 upH/min for Streptococcus thermophilus CNCM
I-2423, Streptococcus thermophilus CNCM I-2980 and Streptococcus
thermophilus CNCM I-2425, respectively.
Example 2
Streptococcus thermophilus DSMZ-18344 Generates Fermented Milk with
a Superior Viscosity
[0260] Fresh fermented milks are produced at lab scale. The milk
base is composed of commercial UHT milk supplemented with 3% (w/w)
semi-skimmed milk powder. After mixing, the milk base is heated
during 10 min+/-1 min at 90.degree. C.+/-0.2.degree. C. The base is
then cooled down at 43.degree. C.+/-1.degree. C. in a water bath
regulated at 43.degree. C.+/-1.degree. C. and the milk is
dispatched into 125 ml glass beakers.
[0261] The milk is inoculated with the bacterium at a ratio of
1E6-1E7 cfu/ml. The fermentation is carried out at 43.degree.
C.+/-1.degree. C. with out stirring and it is stopped when the pH
reaches 4.6+/-0.05. At this moment, the fresh fermented milk is
quickly cooled down at 6.degree. C.+/1.degree. C. in less than 1
hour. Finally, the products are stored at this temperature during
28 days.
[0262] Following this production of fermented milk either
viscosimetry is measured using a Brookfield viscosimeter.
[0263] The viscosity in fermented milk is 68 Pas after 14 days of
storage at 6.degree. C.
[0264] Usually a strain identified as highly texturizing generates
fermented milk with a viscosity superior to 45 Pas, a Casson yield
stress inferior to 12.0 Pa and a thixotropy area inferior to 1000
Pa/s.
[0265] A comparison of the rheological properties of three
texturizing S. thermophilus strains are shown in Table 1.
Example 3
Molecular Analysis of Streptococcus thermophilus DSMZ-18344
[0266] The EPSAD PCR-RFLP method is a molecular method to establish
genetic lineage between strains of S. thermophilus.
[0267] Streptococcus thermophilus genomic DNA is purified using the
DNeasy Tissue Kit (Qiagen). Purified DNA is then amplified by PCR
with the following parameters:
[0268] Composition of the PCR reaction mix (50 .mu.L): [0269]
buffer for DNA polymerase .times.1 [0270] MgCl.sub.2 2 mM [0271]
dNTP 200 .mu.M each [0272] genomic DNA 100 to 500 ng [0273] primer
EPSA632 (5'-AAATgAATTCAgAgCAAgCACTTg-3') 200 nM [0274] primer
EPSD1064 (5'-gTCATgTCAACTTTATTAAggACg-3') 200 nM [0275] DNA
polymerase 1.25 unit [0276] H.sub.2O qsp 50 .mu.L
[0277] Amplification Parameters: [0278] predenaturation at
94.degree. C. during 1 min [0279] cycles with denaturation at
94.degree. C. during 30 s, hybridization at 56.degree. C. during 30
s, elongation at 72.degree. C. during 3 min [0280] post-elongation
at 72.degree. C. during 6 min.
[0281] After amplification, the PCR product is checked by 1.5%
agarose gel electrophoresis. The size of the amplification product
is about 2.5 kb.
[0282] The PCR product is then digested by two restriction enzymes
FokI et MnlI in the following conditions: [0283] PCR product 15 to
30 .mu.L [0284] buffer 2 (New England Biolabs) .times.1 [0285] BSA
(New England Biolabs) .times.1 [0286] FokI (New England Biolabs) 1
unit [0287] MnlI (New England Biolabs) 1 unit [0288] H2O qsp 50
.mu.L
[0289] Incubation at 37.degree. C. during 1 hour.
[0290] The digested product is analysed by 3% agarose gel
electrophoresis.
[0291] Applied to S. thermophilus DSMZ-18344, it groups this strain
within a genetic cluster known as CL0189. This was further
confirmed by the sequencing of the proximal part of its eps operon
(that is the targeted chromosomal region with the EPSAD
method).
[0292] The EPSAD PCR-RFLP profile of S. thermophilus DSMZ-18344 is
shown in FIG. 1.
[0293] Referring to this Figure, S. thermophilus DSMZ-18344 shows
genetic lineage to S. thermophilus CNCM I-2425 profile which is the
representative strain of the CL0189 genetic cluster.
[0294] The distal part of the eps operon was also sequenced and
compared to that available in the literature. Unexpectedly, this
part of the S. thermophilus DSMZ-18344 eps operon is distinct to
that of strain S. thermophilus CNCM I-2425. However, it is very
similar to that of S. thermophilus CNCM I-2423 and other strains
within the S. thermophilus CNCM I-2423 genetic cluster (namely
CL0089 that also contains S. thermophilus CNCM I-2426 and S.
thermophilus Sfi39 (Genbank entry AF373595).
[0295] Schematic organisation of the distal part of the eps operon
and similarities between strains are shown in FIG. 2.
[0296] The sequence data on the distal part of the eps operon and
the EPSAD clustering data together suggest that the eps operon of
S. thermophilus DSMZ-18344 is a chimeric operon made of the
proximal part of the operon coming from S. thermophilus CNCM 1-2425
(or related strains) and the distal part of the operon coming from
S. thermophilus CNCM I-2423 (or related strains).
[0297] This unusual feature may be useful to develop a method to
specifically detect S. thermophilus DSMZ-18344 (or related strains
from other S. thermophilus) as described herein.
[0298] The strain S. thermophilus CNCM I-2423 is one of the fast
acidifying strains that presents texturizing properties of interest
in fermented milk whereas S. thermophilus CNCM I-2425 even if fast
acidifying does not have these interesting texturing properties. In
S. thermophilus, the distal part of the eps operon contains genes
that code for glycosyl transferases. These enzymes are known to be
responsible of the structure of the polysaccharidic units composing
the exopolysaccharide and the nature of this exopolysaccharide is
at least partly believed to be responsible of the texturizing
properties of a strain. Therefore, the chimeric structure of the
eps operon may explain its texturing capabilities.
Example 4
CRISPR Spacers of S. thermophilus DSMZ-18344
[0299] The spacer sequences in the CRISPR locus are genetic
features that are very specific to a strain or to related
strains.
TABLE-US-00005 TABLE 2 Sensitivity to Sensitivity to Sensitivity to
Distal part of CNCM I-2425 CNCM I-2423 other Strain Genotype eps
operon phages phages phages Texturing DSMZ-18344 CL0189 CNCM I-2423
type No No No Yes CNCM I-2423 CL0089 CNCM I-2423 type No Yes No Yes
CNCM I-2425 CL0189 CNCM I-2425 type Yes No No No
Sequences (5'-3')
TABLE-US-00006 [0300] SEQ ID No. 1 S. thermophilus DSMZ-18344
CRISPR1 sequence leader sequence
actatgtgggtataaaaacatcaaaatttcatttgag SEQ ID No. 2 S. thermophilus
DSMZ-18344CRISPR1 spacer (1) aatatctacaggtcactacaaagctacgct SEQ ID
No. 3 S. thermophilus DSMZ-18344 CRISPR1 spacer (2)
gttggggtgtgtttgtaacggcgtatgcta SEQ ID No. 4 S. thermophilus
DSMZ-18344 CRISPR1 spacer (3) tcaatcaggtgacggtgatgcttatattaa SEQ ID
No. 5 S. thermophilus DSMZ-18344 CRISPR1 spacer (4)
catacatgatagtttgtcaacacttttgat SEQ ID No. 6 S. thermophilus
DSMZ-18344 CRISPR1 spacer (5) tcagcatttggtttacatgacccacgtctg SEQ ID
No. 7 S. thermophilus DSMZ-18344 CRISPR1 spacer (6)
caatcaacaggtttgactgattataacggt SEQ ID No. 8 S. thermophilus
DSMZ-18344 CRISPR1 spacer (7) tagctacacatgaattttattacaatggtg SEQ ID
No. 9 S. thermophilus DSMZ-18344 CRISPR1 spacer (8)
ccgttcttcaaacgttaaattccaaggtgt SEQ ID No. 10 S. thermophilus
DSMZ-18344 CRISPR1 spacer (9) gctgcgattatgacaatgctgtctgtaagg SEQ ID
No. 11 S. thermophilus DSMZ-18344 CRISPR1 spacer (10)
gaagaatttattaataaagatggttctgct SEQ ID No. 12 S. thermophilus
DSMZ-18344CRISPR1 spacer (11) aggcagaaaagaagtattttggtaagtatg SEQ ID
No. 13 S. thermophilus DSMZ-18344 CRISPR1 spacer (12)
aaatggtttatcgacaagaaaatgaagct SEQ ID No. 14 S. thermophilus
DSMZ-18344 CRISPR1 spacer (13) ccaaatttgcattatacaaaacgctccttc SEQ
ID No. 15 S. thermophilus DSMZ-18344 CRISPR1 spacer (14)
atcctaactgctttgctaactacatcatgg SEQ ID No. 16 S. thermophilus
DSMZ-18344CRISPR1 spacer (15) atcctaactgctttgctgactacatcatgg SEQ ID
No. 17 S. thermophilus DSMZ-18344 CRISPR1 spacer (16)
taacaagataagattagtcgtcttctacat SEQ ID No. 18 S. thermophilus
DSMZ-18344 CRISPR1 sequence trailer sequence
ttgattcaacataaaaagccagttcaattgaacttggcttt SEQ ID No. 19 S.
thermophilus DSMZ-18344 CRISPR1 sequence
actatgtgggtataaaaacatcaaaatttcatttgaggtttttgtactct
caagatttaagtaactgtacaacaatatctacaggtcactacaaagctac
gctgtttttgtactctcaagatttaagtaactgtacaacgttggggtgtg
tttgtaacggcgtatgctagtttttgtactctcaagatttaagtaactgt
acaactcaatcaggtgacggtgatgcttatattaagtttttgtactctca
agatttaagtaactgtacaaccatacatgatagtttgtcaacacttttga
tgtttttgtactctcaagatttaagtaactgtacaactcagcatttggtt
tacatgacccacgtctggtttttgtactctcaagatttaagtaactgtac
aaccaatcaacaggtttgactgattataacggtgtttttgtactctcaag
atttaagtaactgtacaactagctacacatgaattttattacaatggtgg
tttttgtactctcaagatttaagtaactgtacaacccgttcttcaaacgt
taaattccaaggtgtgtttttgtactctcaagatttaagtaactgtacaa
cgctgcgattatgacaatgctgtctgtaagggtttttgtactctcaagat
ttaagtaactgtacaacgaagaatttattaataaagatggttctgctgtt
tttgtactctcaagatttaagtaactgtacaacaggcagaaaagaagtat
tttggtaagtatggtttttgtactctcaagatttaagtaactgtacaaca
aatggtttatcgacaagaaaatgaagctgtttttgtactctcaagattta
agtaactgtacaacccaaatttgcattatacaaaacgctccttcgttttt
gtactctcaagatttaagtaactgtacaacatcctaactgctttgctaac
tacatcatgggtttttgtactctcaagatttaagtaactgtacaacatcc
taactgctttgctgactacatcatgggtttttgtactctcaagatttaag
taactgtacaactaacaagataagattagtcgtcttctacatgtttttgt
actctcaagatttaagtaactgtacagtttgattcaacataaaaagccag
ttcaattgaacttggcttt SEQ ID No. 20 S. thermophilus DSMZ-18344 BPS
gene cluster gctgagccagcttactagcgtacaggcacctactaaggttgataagaaca
atatcgaggtcttgatgtcagctctcaaaaaagataaaaaagttgatgtt
aaagttgatgatgttgcttcatatcaagaagcttatgataatctcaagtc
tggcaaatctaaagctatggtcttgagtggctcttatgctagcctattag
agtctgtcaatagtaaccttgcttcaaatctaaaaacaatttatacttat
aaaattaaaaagaagaataacaactctgcaaaccaagtagattcaaaagt
cttcaatatttatattagtggtattgatacctacggttcgatttcaacag
tgtcacgttcagatgtcaatattattatgacagtaaacatgaatacacat
aagattctcttgacgactactccacgtgatgcatacgttaagattcctgg
tggtggggcaaaccagtatgataaattaacccacgcaggtatttatggtg
ttgaaacatctgaacaaactctggaagatctatatggtactaagattgat
tactatgcacgaattaacttcacatctttccttaagttgattgaccaact
tggtggtgtgacagtccataatgatcaagctttcacaagtcttcatggga
agtttgatttcccagttggagatatccaaatgaattcagagcaagcactt
ggatttgttcgtgaacgctatagtttagatggcggagataatgaccgtgg
taaaaaccaggagaaagtcatttctgcgattgtaaacaagttggcttctc
taaagtctgtatcaaactttacttcaatcgttaataatctccaagactct
gttcagacaaatatttctttggataccattaatgctttggctaatacaca
acttgattcaggctctaaatttacagtaacgtctcaagcagtaactggta
caggttcaaccggacaattgacctcttatgcgatgccaaattctagtctt
tacatgatgaaactagataattcgagtgtggcaagtgcctctcaagctat
caaaaatctgatggaggaaaaataagtgattgacgttcactcacatattg
tttttgatgttgatgatggtcctaaaactttagaagaaagtttagacctc
attggtgaaagttatgcccagggggtacgtaagattgtttcaacatccca
tcgtcgtaaggggatgtttgagactccagaggataaaatttttgccaact
tttctaaggtaaaagcagaagcagaagcactttatccagacttaactatt
tattatggaggtgaactttattacaccctagacattgtggagaaacttga
aaagaatctcattccgcgcatgcacaacactcaatttgctttgattgagt
ttagtgctcgcacatcttggaaagaaattcatagtgggcttagtaatgtt
ttgagagcgggggtaacgcctattgttgctcatattgagcgctatgatgc
cctcgaagaaaatgctgatcgtgttagagaaattatcaatatgggctgct
atactcaagtcaatagctcacatgtcctcaaaccaaagctctttggagat
aaagaaaaagtaagaaagaaacgtgttcgctttttcttggagaaaaattt
ggttcatatggttgctagcgacatgcataatcttgggccgagaccaccat
ttatgaaagatgcttatgaaattgttaaaaagaactacggctccaaacgt
gctaagaatctttttattgaaaatcccaaaacattactagaaaatcaata
tttataggagatattatgaatcaagataacactaaaagtgatgaaatcga
cgtactagcattgctacataaactttggacgaagaagcttttgattcttt
tcacagctttttatttcgctgctttcagtttcttaggtacttatttcttt
atccaaccaacatatacatcaacaacgcttatctatgttgttaatcaggc
aacagataataataatctttctgctcaagatttgcaagctggtacctatt
tggcaaatgactataaagagattattacatcaaatgatgtattatcagaa
gttattaaagatgaaaaattgaatttgagtgaggcagaactgtctaaaat
ggtttcagttaatattcctactgatactcgtcttatttcaatttctgtta
atgctaaaactggtcaagatgcgcaaacacttgctaataaggttcgtgaa
gttgcttcaaaaaaaatcaagaaggtgacaaaagttgaagatttcacaat
gctcgaagaagctaaattgccagagtcaccatcttcaccaaatatcaaac
ttaatgtgcttcttggggcagtgcttggaggattccttgcagtggttggt
gtattggtacgtgaaatcctagatgatcgtgttcgccgtccagaagatgt
ggaagatgcccttggaatggcacttcttggaattgtccctgatacagata
aaatttaaggagaagaaatgcctctattaaagttagtaaaatctaaagta
aactttgccaaacaaacagaagagtattacaatgccattcgcacaaatat
tcaattttctggtgctcagattaaagtgattgcgattagctctgttgaag
ctggtgaaggaaaatcaacgacatctcttaacttggcgatttcatttgct
agtgttgggctccgaacacttctgattgatgctgatactcgtaattctgt
tttttcaggtacatttaaatcaaatgagccttataaaggtctttcaaatt
ttctttcaggaaatgccgatctaaatgaaacgatttgccaaactgatatt
tctggtttggatgttattgcatctggtcctgttccacctaatccaacaag
tcttttgcaaaatgacaattttagacatttgatggaagttgctcgtagtc
gttatgattatgtcatcatcgatacaccaccagttggtttggttattgat
gcagttattattgcccatcaggctgatgccagtcttttggttacagcagc
tgggaaaatcaaacgtcgtttcgtaactaaggccgtcgaacaattggaac
aaagtggttctcagttcttaggtgtcgtccttaataaagttgacatgaca
gttgataaatatggatcatatggttcttacggatcatatggttcttacgg
atcatatggtgagtacaggaaaaaaacagaccaaactgaaggtcattcaa
gagcacatcgtcgtagaaaaggatagcattaatggggatgatgcggctcc
ttataccttaacagattaaaaaggggtttagagtgaaagaaaaacaagaa
attcgtcgcattgaaattggtattatacagttggttgtggttgttttcgc
agccatggtagctagtaaaataccatatacagagattacccaaggaagta
ttgtccttttaggtgtcgtacatgtagtgtcttactatatcagtagttat
tatgaaaatcttaagtatagaggctacttggatgaactcattgcaactgt
caaatattgtttcatatttgctctaattgcaacatttctctcgttttttg
cagatggaagtttttcaatctcacgtcgcggacttctttacgtcaccatg
atttcaggtgttctcttatacgttacaaatactgttcttaagtatttccg
ctcatctatttatacacgtcgtaaaagtaacaagaatattctcttgattt
ctgatcaggcacgtcttgataatgttttgtctcgtatgaaagacaatatg
gatggtaggattacagcagtttgtgtcttggataatccttattttactga
tccatttatcaagagtgttaaacctgaaaatttgattgaatatgcgacac
actcagtagtagaccaagttttgattaatctgccaagtgggcagtataag
atttgggattatgcatcaccttttgagatcatgggaattccagtttctat
taatttgaatgcccttgaatttatgagtcaaggtgaaaaacgtattcaac
aattgggtcctttcaaagttgttacgttttcaacgcaattttatagctat
ggagatatcttggcgaaacgtttcctcgatatctgtggagccctagttgg
tttggtgctctgtgggattgttggaatcttcctttatccacttattcgta
aggatggtgggccagccatttttgctcaagaccgtgtgggagaaaatgga
cgtatctttaagttttataaattccgttctatgtgtgttgatgcggaaga
aatcaagaagaatttgatggcacagaatcaaatgtctggtggtatgttta
agatggacaatgatccacgtattacaaaaattggacgtttcattcgtaaa
acaagtcttgatgaacttccacaattttggaatgtcctaaaaggtgatat
gagcttggttgggacacgtcctccaacagttgatgagtatgaaaaatata
cacctgaacagaaacgtcgtttaagttttaaacctggtatcactggtctt
tggcaagtaagcggtcgaagtgaaattactgattttgatgaagttgtaaa
actagacgttgcttatttggacggatggacaatctggcgtgatatcaaaa
tcttattgaaaacaattaaagtagtagtaatgaaggatggagcaaagtga
tggctttcaccatttcttttaatggtgattaaatgacaaaaacagtttat
atcgttggttctaaggggattccagcaaaatatggtggatttgagacctt
tgttgagaagttgacagagttccaacaagacaaagatatccaatattatg
tagcttgtatgcgggaaaactctgcaaaatcagacattacagcagatgat
tttcaaacttcgcaacagaaccctaaaaagaactccctaacggtcgtggc
tactttgtttagtctaaacactttgaatagtcctacaagctcatagtttc
ccttttattagttggtccaaggccaattctattttttgaagcgaaagaat
atggggagcgccttccttatttactgatatgtaaacctggaattactggt
tattggacgacacatggtcgaagtaaagttctttttcctcaacgagcaga
tttagaactctattatctccaatattacagcaccaagaacgacatcaagc
ttctaatacgtacaatttcacaaatcattaacggattggacgcttactaa
aaaattaatgaaaaaatatttgaaatcataactcgaaaaatattaaaaga
ttagatatgtatcataaaacccgaattgctagttaatttcattggaaaat
aaataagtcgtgctatcctaatcttaaaccactaagcattagaaagcgca
cgacttatatgacttataatagcacacttccaaaagtttttgtttattta
ctgacaaccattgagacgctttatcaaacgagtgttccccttgaggttca
aaaccgaaagaacgtccatctcgcaacatcagattgcttagttatcgctt
gttacctatggggcgtactgcattttagtgaaacgcttaaagcaaagcac
caattggctcaaagtttatttcctaatttcctagaatattctcactttgt
ccgccgttgtaatgccctcttaccgagtatccaagtcattcgccaagcac
tcgtatttaaagaggttgaaggaattagtgtatccattattgacagcttc
cccattcctttgtgtcagtctattcgtaatttcagaagcaaagttcttgg
agattatgcaaatgttggctacaatgctacaaagggacagtacttctatg
gatgtaaatgtcatgctttagtcagtgaatcaggctatgtcatagactac
acaattactcctgcttcaatggctgatagttcaatgaccgaggaagtgtt
gagtcaatttgggacaccaacagtccttggagatatgggatatttaggtc
agtcactgcatgataggctggaattaaaaggaattgatctaattacacct
gtcaggaagaacatgaagcaaaagaaaattcttttccctaatttttcaaa
acgtagaaaagtgattgagcgagttttctcttttttgacaaatctaggag
ctgagcgttgtaaaagtcgttcgcctcaaggttttcaattgaaattagag
atgatacttttagcgtattctttactgttaaaatcagctaaatcactgga
accagagactttaagatattctatcgggtatcaagtcatggctaaataat
caactagcaattcgggtatcataaaggagtgatttaatgaaaaaaattac
aatagcagttgcaacgcataaaaaatatcaaatgccaaaagataatattt
atctaccaattgaatgtggagcagttttaagaaaaaatcacctagactat
attgctgatgatagtggagataatatttctgaaaaaaacaagaattattc
agagttaacagcactatattggttatggaaaaataatgattctgagtata
aaggattagcacactatagacgtcatttttcagataaaaaggtgagtatt
ttttctacaggtaattttgataatatacttgataggacggtacttgagga
acatttagagaagtttgatattatacttcccaagcttcgacattactata
ttgaaacaatagaatctcactataaacatacgcattttgaaaaagattta
ttagcaacagaagaaataattaaaaaactatatcctgactatcttgattt
ttattatagtgcactaaaaagaaaatctgctcatatgtttaatatgttta
ttatgaaagataaatatttcaataattattgtgaatggttattttcgatt
ctttttgaattagaaaaagtactagatatttcagaatattctccctttca
tgcaagagtatttggtcgtgtgagtgaaattttattagatgtatggattt
tcaagaataatttaaatttcactgaaattccagttatgtttatggaaaag
caaaattggtgggataaatctaaaagatttatttctgcaaagcttttcaa
caaaaaatattattagactaggagaaataaattgcttacaatcggaataa
ttttaataatttttatgactattttcgattattatatacataaaacagta
ttttctccggtctttatgtttaattcactctttttattaataatatctct
ttcttctatgaggttatataatttgagagaatattctatcaaatcaatag
aagtaattgtgttagggatgatattcttctctttaggagtattttgtact
cgtattgtttctcatgaatttttaaaaaatcaaaataatgttattaatta
cgatgataatttaaatgtaaattggacttttttaaaaattcttttgatag
ttgtaaccacaggaaacgtattctctattattttttccttgaaattcctt
ttaggaggaggttcatacttagaattgagaaatatgatattgggatataa
tggagctgaaccacttattacgaatcctctcgtaaatatattaacaagat
atatatcgggaccagggttgactgctttgatcccattttctatttttttt
ctaattaggaaaaaaaacattaaattttccttaattattttattgaatct
tgttttggcaacattatcatccggtggtagaattttacttgtatatacta
ttattcaattgtttataggattatcttattcaaaaaaaaatataccaaaa
aaaattaagaaagtagtcataatatcaagtattatattttttatatctat
aattgtcttatctaacatcagaagttctaacagtatatatagagcgtttt
atgcatacttttcgggccctgtagttcttttatctacttggatgactgat
gttgatacttataatattcattcacatggattaggatttatttatcccat
cacatatctattaaattcattttgtaatttaataggaattcctaactcga
tgttggctaatgttgtcatgtggcaaggaatgcctcagaatgattgggta
ggcgtattccctaatcaatcgatgaacgcttttagtacacttttctattt
tttctataaagattttcgagaatttggagttgcttgcttttctttccttt
ttgggagtatttgtggttttatttattttaaagcgtttatcgaaagaaaa
agtaaatatctagtctattatttattaggggtacaggcaattatcggatc
ttttattatttggcaattggggagtactgcgtttttcttaagtattgtat
ttacaatattaagtctgaaatcaaagaaatcataactatagaaaaggaga
taaaatatgacaatcagcatagtaatcccagtttataatgttcaagatta
cataaaaaagtgtctagattctatattaagccagacattttcagatttag
aaattattcttgttgatgatggttctactgacttgagtggaagaatttgt
gattattattccgaaaatgataaacgtattaaagtaatccacacagcaaa
tgggggacagtcggaagcaaggaacgttggaatcaaaaatgccacatcag
aatggataacatttattgattctgatgactacgtttcttctgattatata
gagtatttatataatttgattcaagtacacaatgcagatatttcaatagc
tagttttacctatatcacacctaaaaagataattaagcacggtaacggtg
aagtagctcttatggatgcaaaaactgcaattcggagaatgttactgaat
gaaggtttcgatatgggagtttgggggaaaatgtatcgaacggagtattt
taataaatataaattcgtttcaggaaaactatttgaagattctttaatta
cataccagatattttcagaagcttcaacaattgtttttggagcaaaggat
atttatttttatgttaacaggaaaaattctactgttaatggtacttttaa
tataaaaaagtttgatcttattgaaatgaatgaagaagcaaataagttta
ttaaacataaatttccagatctttcatctgaagcacatcgtcgaatgata
tgggcatattttagtacactaaatcaagttttatcatcaactaatgaaca
cgatattgatttatatgcgccacaattagtagcttatctccttaaacagg
ataaattcataaaaaggaatacttttattcccaaaagagataagattgca
ttttttattttaaaaaattttggtttaaagacatatcgtaatgtttggaa
tttatatttaaaaatgacaagataaaaacaataatgaaagataaaaaata
atgaaaactgctacaattactttacattcagcacataataatggatctat
cttttctacagtcatttgctttgcagagaaagataatatctatgggatat
gataacgaaattataaattatattccactcaaattgctcgtagttttaag
aaccaagtgcaaaagattattaaggttaacaacgttacgattgttgctac
ggccgcaacgccgaagaagccgctgaatacgttgattgggctagttgtcg
gcttgctataggatttgtttatgcagcgattcggatgctcacggatcgcc
gcgttcacgaagctgatttcttaactgatgaattaggattgactagttta
ggcttggttaaccatcaacatcaccattcaatgaagaaacaggccttgaa
tctgaacggtggctatcatacgcataacgatcaaacatcttcacaagcga
tgaaacgagtttaggagggtgctagatgtttaaacgtaaagaaaagaata
taacgactacggcaccaattaatctcaccacgattaatgaacccatgtcg
gtcattactgagcagattaaaacaattcgaaccaatatcaattttgcggc
tactgaccataagctacgaactttgatggtgacttcggccatgcttggcg
agggtaaatcgacagtaagtggtaacttagcagtggagtatgccaaggaa
ggaaggcaagcaagtcttactggtcgatgctgacttgcgacgaccaacga
ttcataagacatttggccttaaaaaccataagggattaagttcatggtta
gccaatcagattgacgatgtgaatgatgcaattcatcccgtcattggcaa
tctataattgtataaatagtatgtatactttataacaatggagtgtttta
atgaatcttttgtttagtcaatgtcacattacattgaaaatttaaaaaat
gtaacttttttgcgtgtgaatagctatgtacaatgattttctgggtggca
gactaatcaagtataaaatagcttatactagttgacaacatcccgtgata
attattaacttatcaagtacaggccaaaatactggagcttaacaggaact
gttagaatatgattttatataattaggagtagaataaagagatgaatcca
ttaatatcaattattgttccaacatataatgttgaaaaatatattaggac
atgtattgaatcaatcttagctcaaacatatcgcaatattgaagtcatta
tagtaaatgatggtagcacagatcagtcgctagcagtaatttccgattta
atctgtagtcatcataatattaaggtaatcaaccaaaaaaaccaaggatt
atcagtagctcgaaacactggtattgatgcggcaactggtaaatatatag
cttttgtagatgcagatgacaaaattaagccagactttgttagctcgctc
tatcaaattgctgacaaaacaggagctgacattgtgcgtgggtcatttcg
agactttaatggcaatattcctaaaggctgggttccagatttcaatgttc
caaccaattatgggacaatagtattagaccaattcttatccagcaacata
tcttttgtagtttggtcgagtatctataggctagattttattaatagtaa
tcatatacgatttacaccagggattctatttgaggatgcagattttacaa
taagagcttatatgctcgctaagttagttgctacatcacctgaaccaaat
tatgcatatagaataaatcgtccaggaagtatattaaccacaaaaaccac
aaaaaatgcccaaaaaatgtctctttcagaagaaaaaattatatcacaat
ttattagtatgttaaagcatgaaaaatctgatgttttatgtagtttaatt
ctaaagtctatttatgcatgtatgagagattggacgggaattattgtgag
gaataacctatcgttggataggaagaacagttgttttgatactgctctca
ctctaataaaagaaataataaattctaggcccttaaaagaaaaaatcaaa
tttttaacaaaggttattattattaaggcgaaaaaccattaagccgttaa
acgaaaatccaaagggttcatatacaattatgttaattatggatttttta
tatcttcaatgggttcattaatcactgaatttgattatcttgttttaatg
aatgtgaagtcattcggttaaggggagtctttgatttgtctagttagcta
tctggacagatgttaagtgttaattacagtgaaggcagatgaaaacttat
taaaagttattctgcttgattaagaatggtaagatttcaccatctatata
cttttattagaacttaggtggacaggaggacccaatttttaatccttcct
gttatatagtttttgtttaatatttttcgggaggattattaatgcaaata
gtaaaaaattatctttataatgcaatgtatcaggtctttataattattgt
gccattacttaccattccttatttgtcaagaattttgggcccttcaggta
ttggaattaactcatataccaattctattgttcagtattttgttttattt
ggtagtataggagtcggtttgtatgggaatcgtcagattgcctttgttag
ggataatcaggtcaaaatgtctaaagtcttttatgaaatatttattttaa
gactattaacaatatgtttagcatatttattgttcgttgcttttttaacc
attaatggtcagtatcatgaatactatttgtttcaatccattgctatagt
tgcagctgcatttgatatctcttggttttttatgggaattgaaaatttta
aagtaactgtattaagaaattttatagttcagttacttgctctattcagt
attttcctatttgtcaaatcttacaatgatttgaatatatatatattgat
aacagttttatctacattaattggtaatttaacttttttcccaagtttac
acagatatctcgtaaaggttaactatcgtgaattaaggccaataaagcat
ttaaagcaatctttagttatgtttatcccacaaattgctgtccaaattta
ttgggttttgaataaaacaatgttaggttcattggattctgtcacgagct
ccggcttttttgatcagtctgataaaatagttaaactggttttggctatt
gctagtgcaacaggtactgtcatgttgccacgtgttgcaaatgcctttgc
acatagagagtatagtaaaattaaggagtacatgtacgcaggtttttctt
ttgtgtcggcaatttcgattcctatgatgtttggtctgatagctattact
cctaaattcgtgccacttttttttacatctcaatttagtgatgttattcc
tgtgttaatgatcgagtcaattgcaattatttttatagcttggagcaacg
caataggtaatcaatatcttttaccaactaatcaaaataagtcatataca
gtgtcggtgttcattggagcgatagtcaatttaatgttaaatattccact
gattatatatctaggtgctgttggtgcatcaattgcaactgtaatttctg
aaatgtctgtaactgtgtatcaactttttataattcataaacagcttaat
ttgcatacactgttttcggatttatctaagtatttaattgcaggattagt
gatgtttctaattgtctttaaaattagtttgttaacaccgacatcttgga
tattcattctgttggaaattactgtgggcataattatttatgttgtttta
ttaatatttttaaaggcagaaataattaataaactaaagtttattatgca
taaatagaggtatggatttaggtacctgcctttaggatttttaattcaaa
ggatttaggtacttatggttactttaattcgattgtgacctactttattc
ttttggcaactttaggtgttgctaactatggtactaaagagatttcagga
catcgaaaggatattcgtaaaaatttctggggtatttataccctccaatt
gattgcgactattttgtctcttgtcttgtatacatcattatgtttgttct
ttcctggtatgcaaaatatggtggcttatatcttaggattaagcttgata
tcgaaaggaatggatatttcttggttattccaaggtttggaggattttcg
tcgtattaccgcaaggaatacaacggtaaaggttttaggagttatttcta
tcttcctatttgtgaaaacacctggtgatttgtatctctatgttttccta
ttgaccttctttgaattgcttgggcaattaagtatatggttaccagcgag
accttacattggaaaaccacaatttgatttatcctatgctaagaaacatc
ttaaacctgttattttgctgtttctccctcaggttgccatttcactatac
gtgactttggatcgtacaatgttgggtgccttgtcatcgacaaatgatgt
agggatttatgatcaggctttgaaaataattaatattttgttgacgttgg
tgacttcattgggaagtgtaatgcttccaagggtatctggtcttttatct
aacggagatcataaggccgttaacaagatgcatgaattctctttcttgat
ttataatcttgtgattttcccgataatagcaggtctcttgattgttaata
aggattttgtgagtttcttactagggaaagatttccaagaggcttatctt
gccattgctattatggtctttaggatgttctttatcggttggacaaatat
tatgggaatccagattttgattccatataataaacatcgtgagttcatgc
tctctacgactattccggctgttgtcagtgttggacttaatctcttgtta
atttcctccatttggctttgttggggtctcaattgtatcagttttaacag
aggctttggtatgggttattcaattgaatttttcaaggatattcatcaaa
gatgtgtcaatccttccagccatatcaaaaattatcttagcatcagttgt
catgtatcttggactctttgtctttaagatgtttgtgcaattgaaaccaa
tgctaaatgtagcagtagatggtcttgtcggtgctatcatttatattgtc
ttgattattgtcttacgtgtcgttgatatgaaagacttgaagcaacagtt
aatgaaaaactaaggagaaaaatatgtacgattatcttatcgttggtgct
ggtttgtccggagcaatcttcgcacatgaagctacaaaacgtggcaaaaa
agtaaaagtgattgacaagcgtgatcacattggtggcaatatctactgtg
aagatgttgaaggtattaatgttcacaagtatggtgctcacattttccat
acctcaaataaaaaagtttgggattatgtcaaccaatttgctgaatttaa
taactatatcaactcaccaattgctaactacaagggcagtctttataacc
ttccatttaacatgaatacattttatgctatgtggggcactaagactcct
caagaagttaaggacaagattgctgaacaaacggctgatatgaaagatgt
tgagcctaaaaacttggaagaacaagctatcaagttgattggaccagata
tctacgaaaagttgatcaagggatacactgaaaaacaatggggacgttct
gccacagacctgcctcctttcatcatcaagcgtcttccggttcgtctaac
ttttgataacaactactttaatgaccgttaccaaggaattccgatcggtg
gttacaatgtcatcattgaaaatatgcttggagatgtagaagtagagctt
ggagttgacttctttgccaatcgtgaagagcttgaagcttcagctgaaaa
agttgtctttacaggaatgattgaccagtactttgattataaacatggtg
agttggagtatcgcagtcttcgttttgaacacgaagtcttggatgaagaa
aatcatcaaggaaatgccgtggtcaactacacagagcgtgagattcctta
tactcgtatcattgagcataagcacttcgagtatggtacacaacctaaga
cagttatcacacgtgaatacccagctgattggaaacgtggagatgaacca
tactacccaatcaatgatgaaaagaacaatgccatgtttgctaagtacca
agaagaagctgagaaaaatgacaaggttatcttctgtggacgtcttgcag
attataaatactacgacatgcacgtggtcattgagcgtgctctagaagtc
gttgagaaagaatttatttaataaataatggctctttgtcaactgtagtg
ggtgacgaaaagctaacatctagagaggaccggataggtcctctttttat
gtatgttcagtgtgatgaagacacgtttcttaaagttgatgaagtttcta
aaaccgaagcccaaccgtttgatgtctttgatcaacttattagtcgcttc
aagttttgcgtttggatagtccgtttctagtgcgtttttgatgtattgct
tgtgtctaagaaaagtcctaaagacagtttgaaaatagtgattgaccttg
ctcctattttcctctatcaggtcaaagaactcatctactctcttctcctg
aaagtgaaaaagcaaaagctgataaagtgtatagtagtcagtaagctctt
ttgaaaagactagtgtcttcgcaacaacttcatgtggtgctaaagtttgg
cggaaagtctttgaataaaaagaattgagagatagtttacagctgtcctt
ttggaagagtcgccagtgatttttcaaggctcgatagggtagtgacttct
tatcgaattagttcatgattgcaattctagtctttaaaaatgctttacca
aggtgctggatgatgtggaaacgatcaagaacgatttttgcgtttggaaa
gagtctgcgggctagtgggatataagctccagacttatccatcgtgataa
actgtacctgttatcggactttcaatggatacttcaaaagtagtttcgta
tagtagtttggcggcgattatcaaggatggttatgagttggtttgtctca
taattctgcgccacaaaagccaattcccctttcttgaacccaaactcatc
ccaggacataacagcagggagtttgtcataatgtttcttgaaagtaaact
gatcaagcttacgatagacagtggacgtcgacacacgaagtcttcttgca
atatcagttagtgacactttctcagttaggagttgtgtaactttttgttg
gactagattggagatttggtagtttttctcaacgatagatgtctcagcta
ccgtgactctcctacaatttttacactggaaacgacgttttttcagacgt
agtagagttggcgttcccgcttgctcgagaagagggattttagatttttt
ttgaaagtcatatttgatcatctttctttggcagtgaggacatgatggtg
tagggtaatcaagttttgcttgaatctcgatatgagtgtcagtttcaaaa
acaagtgaaataatgatattttggtctttaactccgattaattctgtggt
attcttaataggtctcataagttcttcctaatggtagtttcgtcgctttt
cattatagttcttatgggactttttgtgtacactcaaaaagctctataat
ctctacagtggttttactcactacagaaattatagagccaatatatctcc
tgtctatttttatgctacttttgggttagctcaactcaaccgccttttaa
tctcccaacaacaataataccctatcaaacaacccaaaaaattcaagata
atatcactaatggcaaatgtgcccaaataaaagataaattgaatggtttc
aattcctaaaagtgtgaccaaactgataatgacaaactgtttgaaattag
tattgatacagtaaaggccacctaaaggaatgaagta
[0301] All publications mentioned in the above specification are
herein incorporated by reference. Various modifications and
variations of the described methods and system of the present
invention will be apparent to those skilled in the art without
departing from the scope and spirit of the present invention.
Although the present invention has been described in connection
with specific preferred embodiments, it should be understood that
the invention as claimed should not be unduly limited to such
specific embodiments. Indeed, various modifications of the
described modes for carrying out the invention which are obvious to
those skilled in biochemistry, microbiology and molecular biology
or related fields are intended to be within the scope of the
following claims.
Sequence CWU 1
1
24137DNAStreptococcus thermophilus 1actatgtggg tataaaaaca
tcaaaatttc atttgag 37230DNAStreptococcus thermophilus 2aatatctaca
ggtcactaca aagctacgct 30330DNAStreptococcus thermophilus
3gttggggtgt gtttgtaacg gcgtatgcta 30430DNAStreptococcus
thermophilus 4tcaatcaggt gacggtgatg cttatattaa
30530DNAStreptococcus thermophilus 5catacatgat agtttgtcaa
cacttttgat 30630DNAStreptococcus thermophilus 6tcagcatttg
gtttacatga cccacgtctg 30730DNAStreptococcus thermophilus
7caatcaacag gtttgactga ttataacggt 30830DNAStreptococcus
thermophilus 8tagctacaca tgaattttat tacaatggtg
30930DNAStreptococcus thermophilus 9ccgttcttca aacgttaaat
tccaaggtgt 301030DNAStreptococcus thermophilus 10gctgcgatta
tgacaatgct gtctgtaagg 301130DNAStreptococcus thermophilus
11gaagaattta ttaataaaga tggttctgct 301230DNAStreptococcus
thermophilus 12aggcagaaaa gaagtatttt ggtaagtatg
301329DNAStreptococcus thermophilus 13aaatggttta tcgacaagaa
aatgaagct 291430DNAStreptococcus thermophilus 14ccaaatttgc
attatacaaa acgctccttc 301530DNAStreptococcus thermophilus
15atcctaactg ctttgctaac tacatcatgg 301630DNAStreptococcus
thermophilus 16atcctaactg ctttgctgac tacatcatgg
301730DNAStreptococcus thermophilus 17taacaagata agattagtcg
tcttctacat 301841DNAStreptococcus thermophilus 18ttgattcaac
ataaaaagcc agttcaattg aacttggctt t 41191169DNAStreptococcus
thermophilus 19actatgtggg tataaaaaca tcaaaatttc atttgaggtt
tttgtactct caagatttaa 60gtaactgtac aacaatatct acaggtcact acaaagctac
gctgtttttg tactctcaag 120atttaagtaa ctgtacaacg ttggggtgtg
tttgtaacgg cgtatgctag tttttgtact 180ctcaagattt aagtaactgt
acaactcaat caggtgacgg tgatgcttat attaagtttt 240tgtactctca
agatttaagt aactgtacaa ccatacatga tagtttgtca acacttttga
300tgtttttgta ctctcaagat ttaagtaact gtacaactca gcatttggtt
tacatgaccc 360acgtctggtt tttgtactct caagatttaa gtaactgtac
aaccaatcaa caggtttgac 420tgattataac ggtgtttttg tactctcaag
atttaagtaa ctgtacaact agctacacat 480gaattttatt acaatggtgg
tttttgtact ctcaagattt aagtaactgt acaacccgtt 540cttcaaacgt
taaattccaa ggtgtgtttt tgtactctca agatttaagt aactgtacaa
600cgctgcgatt atgacaatgc tgtctgtaag ggtttttgta ctctcaagat
ttaagtaact 660gtacaacgaa gaatttatta ataaagatgg ttctgctgtt
tttgtactct caagatttaa 720gtaactgtac aacaggcaga aaagaagtat
tttggtaagt atggtttttg tactctcaag 780atttaagtaa ctgtacaaca
aatggtttat cgacaagaaa atgaagctgt ttttgtactc 840tcaagattta
agtaactgta caacccaaat ttgcattata caaaacgctc cttcgttttt
900gtactctcaa gatttaagta actgtacaac atcctaactg ctttgctaac
tacatcatgg 960gtttttgtac tctcaagatt taagtaactg tacaacatcc
taactgcttt gctgactaca 1020tcatgggttt ttgtactctc aagatttaag
taactgtaca actaacaaga taagattagt 1080cgtcttctac atgtttttgt
actctcaaga tttaagtaac tgtacagttt gattcaacat 1140aaaaagccag
ttcaattgaa cttggcttt 11692017387DNAStreptococcus thermophilus
20gctgagccag cttactagcg tacaggcacc tactaaggtt gataagaaca atatcgaggt
60cttgatgtca gctctcaaaa aagataaaaa agttgatgtt aaagttgatg atgttgcttc
120atatcaagaa gcttatgata atctcaagtc tggcaaatct aaagctatgg
tcttgagtgg 180ctcttatgct agcctattag agtctgtcaa tagtaacctt
gcttcaaatc taaaaacaat 240ttatacttat aaaattaaaa agaagaataa
caactctgca aaccaagtag attcaaaagt 300cttcaatatt tatattagtg
gtattgatac ctacggttcg atttcaacag tgtcacgttc 360agatgtcaat
attattatga cagtaaacat gaatacacat aagattctct tgacgactac
420tccacgtgat gcatacgtta agattcctgg tggtggggca aaccagtatg
ataaattaac 480ccacgcaggt atttatggtg ttgaaacatc tgaacaaact
ctggaagatc tatatggtac 540taagattgat tactatgcac gaattaactt
cacatctttc cttaagttga ttgaccaact 600tggtggtgtg acagtccata
atgatcaagc tttcacaagt cttcatggga agtttgattt 660cccagttgga
gatatccaaa tgaattcaga gcaagcactt ggatttgttc gtgaacgcta
720tagtttagat ggcggagata atgaccgtgg taaaaaccag gagaaagtca
tttctgcgat 780tgtaaacaag ttggcttctc taaagtctgt atcaaacttt
acttcaatcg ttaataatct 840ccaagactct gttcagacaa atatttcttt
ggataccatt aatgctttgg ctaatacaca 900acttgattca ggctctaaat
ttacagtaac gtctcaagca gtaactggta caggttcaac 960cggacaattg
acctcttatg cgatgccaaa ttctagtctt tacatgatga aactagataa
1020ttcgagtgtg gcaagtgcct ctcaagctat caaaaatctg atggaggaaa
aataagtgat 1080tgacgttcac tcacatattg tttttgatgt tgatgatggt
cctaaaactt tagaagaaag 1140tttagacctc attggtgaaa gttatgccca
gggggtacgt aagattgttt caacatccca 1200tcgtcgtaag gggatgtttg
agactccaga ggataaaatt tttgccaact tttctaaggt 1260aaaagcagaa
gcagaagcac tttatccaga cttaactatt tattatggag gtgaacttta
1320ttacacccta gacattgtgg agaaacttga aaagaatctc attccgcgca
tgcacaacac 1380tcaatttgct ttgattgagt ttagtgctcg cacatcttgg
aaagaaattc atagtgggct 1440tagtaatgtt ttgagagcgg gggtaacgcc
tattgttgct catattgagc gctatgatgc 1500cctcgaagaa aatgctgatc
gtgttagaga aattatcaat atgggctgct atactcaagt 1560caatagctca
catgtcctca aaccaaagct ctttggagat aaagaaaaag taagaaagaa
1620acgtgttcgc tttttcttgg agaaaaattt ggttcatatg gttgctagcg
acatgcataa 1680tcttgggccg agaccaccat ttatgaaaga tgcttatgaa
attgttaaaa agaactacgg 1740ctccaaacgt gctaagaatc tttttattga
aaatcccaaa acattactag aaaatcaata 1800tttataggag atattatgaa
tcaagataac actaaaagtg atgaaatcga cgtactagca 1860ttgctacata
aactttggac gaagaagctt ttgattcttt tcacagcttt ttatttcgct
1920gctttcagtt tcttaggtac ttatttcttt atccaaccaa catatacatc
aacaacgctt 1980atctatgttg ttaatcaggc aacagataat aataatcttt
ctgctcaaga tttgcaagct 2040ggtacctatt tggcaaatga ctataaagag
attattacat caaatgatgt attatcagaa 2100gttattaaag atgaaaaatt
gaatttgagt gaggcagaac tgtctaaaat ggtttcagtt 2160aatattccta
ctgatactcg tcttatttca atttctgtta atgctaaaac tggtcaagat
2220gcgcaaacac ttgctaataa ggttcgtgaa gttgcttcaa aaaaaatcaa
gaaggtgaca 2280aaagttgaag atttcacaat gctcgaagaa gctaaattgc
cagagtcacc atcttcacca 2340aatatcaaac ttaatgtgct tcttggggca
gtgcttggag gattccttgc agtggttggt 2400gtattggtac gtgaaatcct
agatgatcgt gttcgccgtc cagaagatgt ggaagatgcc 2460cttggaatgg
cacttcttgg aattgtccct gatacagata aaatttaagg agaagaaatg
2520cctctattaa agttagtaaa atctaaagta aactttgcca aacaaacaga
agagtattac 2580aatgccattc gcacaaatat tcaattttct ggtgctcaga
ttaaagtgat tgcgattagc 2640tctgttgaag ctggtgaagg aaaatcaacg
acatctctta acttggcgat ttcatttgct 2700agtgttgggc tccgaacact
tctgattgat gctgatactc gtaattctgt tttttcaggt 2760acatttaaat
caaatgagcc ttataaaggt ctttcaaatt ttctttcagg aaatgccgat
2820ctaaatgaaa cgatttgcca aactgatatt tctggtttgg atgttattgc
atctggtcct 2880gttccaccta atccaacaag tcttttgcaa aatgacaatt
ttagacattt gatggaagtt 2940gctcgtagtc gttatgatta tgtcatcatc
gatacaccac cagttggttt ggttattgat 3000gcagttatta ttgcccatca
ggctgatgcc agtcttttgg ttacagcagc tgggaaaatc 3060aaacgtcgtt
tcgtaactaa ggccgtcgaa caattggaac aaagtggttc tcagttctta
3120ggtgtcgtcc ttaataaagt tgacatgaca gttgataaat atggatcata
tggttcttac 3180ggatcatatg gttcttacgg atcatatggt gagtacagga
aaaaaacaga ccaaactgaa 3240ggtcattcaa gagcacatcg tcgtagaaaa
ggatagcatt aatggggatg atgcggctcc 3300ttatacctta acagattaaa
aaggggttta gagtgaaaga aaaacaagaa attcgtcgca 3360ttgaaattgg
tattatacag ttggttgtgg ttgttttcgc agccatggta gctagtaaaa
3420taccatatac agagattacc caaggaagta ttgtcctttt aggtgtcgta
catgtagtgt 3480cttactatat cagtagttat tatgaaaatc ttaagtatag
aggctacttg gatgaactca 3540ttgcaactgt caaatattgt ttcatatttg
ctctaattgc aacatttctc tcgttttttg 3600cagatggaag tttttcaatc
tcacgtcgcg gacttcttta cgtcaccatg atttcaggtg 3660ttctcttata
cgttacaaat actgttctta agtatttccg ctcatctatt tatacacgtc
3720gtaaaagtaa caagaatatt ctcttgattt ctgatcaggc acgtcttgat
aatgttttgt 3780ctcgtatgaa agacaatatg gatggtagga ttacagcagt
ttgtgtcttg gataatcctt 3840attttactga tccatttatc aagagtgtta
aacctgaaaa tttgattgaa tatgcgacac 3900actcagtagt agaccaagtt
ttgattaatc tgccaagtgg gcagtataag atttgggatt 3960atgcatcacc
ttttgagatc atgggaattc cagtttctat taatttgaat gcccttgaat
4020ttatgagtca aggtgaaaaa cgtattcaac aattgggtcc tttcaaagtt
gttacgtttt 4080caacgcaatt ttatagctat ggagatatct tggcgaaacg
tttcctcgat atctgtggag 4140ccctagttgg tttggtgctc tgtgggattg
ttggaatctt cctttatcca cttattcgta 4200aggatggtgg gccagccatt
tttgctcaag accgtgtggg agaaaatgga cgtatcttta 4260agttttataa
attccgttct atgtgtgttg atgcggaaga aatcaagaag aatttgatgg
4320cacagaatca aatgtctggt ggtatgttta agatggacaa tgatccacgt
attaccaaaa 4380ttggacgttt cattcgtaaa acaagtcttg atgaacttcc
acaattttgg aatgtcctaa 4440aaggtgatat gagcttggtt gggacacgtc
ctccaacagt tgatgagtat gaaaaatata 4500cacctgaaca gaaacgtcgt
ttaagtttta aacctggtat cactggtctt tggcaagtaa 4560gcggtcgaag
tgaaattact gattttgatg aagttgtaaa actagacgtt gcttatttgg
4620acggatggac aatctggcgt gatatcaaaa tcttattgaa aacaattaaa
gtagtagtaa 4680tgaaggatgg agcaaagtga tggctttcac catttctttt
aatggtgatt aaatgacaaa 4740aacagtttat atcgttggtt ctaaggggat
tccagcaaaa tatggtggat ttgagacctt 4800tgttgagaag ttgacagagt
tccaacaaga caaagatatc caatattatg tagcttgtat 4860gcgggaaaac
tctgcaaaat cagacattac agcagatgat tttcaaactt cgcaacagaa
4920ccctaaaaag aactccctaa cggtcgtggc tactttgttt agtctaaaca
ctttgaatag 4980tcctacaagc tcatagtttc ccttttatta gttggtccaa
ggccaattct attttttgaa 5040gcgaaagaat atggggagcg ccttccttat
ttactgatat gtaaacctgg aattactggt 5100tattggacga cacatggtcg
aagtaaagtt ctttttcctc aacgagcaga tttagaactc 5160tattatctcc
aatattacag caccaagaac gacatcaagc ttctaatacg tacaatttca
5220caaatcatta acggattgga cgcttactaa aaaattaatg aaaaaatatt
tgaaatcata 5280actcgaaaaa tattaaaaga ttagatatgt atcataaaac
ccgaattgct agttaatttc 5340attggaaaat aaataagtcg tgctatccta
atcttaaacc actaagcatt agaaagcgca 5400cgacttatat gacttataat
agcacacttc caaaagtttt tgtttattta ctgacaacca 5460ttgagacgct
ttatcaaacg agtgttcccc ttgaggttca aaaccgaaag aacgtccatc
5520tcgcaacatc agattgctta gttatcgctt gttacctatg gggcgtactg
cattttagtg 5580aaacgcttaa agcaaagcac caattggctc aaagtttatt
tcctaatttc ctagaatatt 5640ctcactttgt ccgccgttgt aatgccctct
taccgagtat ccaagtcatt cgccaagcac 5700tcgtatttaa agaggttgaa
ggaattagtg tatccattat tgacagcttc cccattcctt 5760tgtgtcagtc
tattcgtaat ttcagaagca aagttcttgg agattatgca aatgttggct
5820acaatgctac aaagggacag tacttctatg gatgtaaatg tcatgcttta
gtcagtgaat 5880caggctatgt catagactac acaattactc ctgcttcaat
ggctgatagt tcaatgaccg 5940aggaagtgtt gagtcaattt gggacaccaa
cagtccttgg agatatggga tatttaggtc 6000agtcactgca tgataggctg
gaattaaaag gaattgatct aattacacct gtcaggaaga 6060acatgaagca
aaagaaaatt cttttcccta atttttcaaa acgtagaaaa gtgattgagc
6120gagttttctc ttttttgaca aatctaggag ctgagcgttg taaaagtcgt
tcgcctcaag 6180gttttcaatt gaaattagag atgatacttt tagcgtattc
tttactgtta aaatcagcta 6240aatcactgga accagagact ttaagatatt
ctatcgggta tcaagtcatg gctaaataat 6300caactagcaa ttcgggtatc
ataaaggagt gatttaatga aaaaaattac aatagcagtt 6360gcaacgcata
aaaaatatca aatgccaaaa gataatattt atctaccaat tgaatgtgga
6420gcagttttaa gaaaaaatca cctagactat attgctgatg atagtggaga
taatatttct 6480gaaaaaaaca agaattattc agagttaaca gcactatatt
ggttatggaa aaataatgat 6540tctgagtata aaggattagc acactataga
cgtcattttt cagataaaaa ggtgagtatt 6600ttttctacag gtaattttga
taatatactt gataggacgg tacttgagga acatttagag 6660aagtttgata
ttatacttcc caagcttcga cattactata ttgaaacaat agaatctcac
6720tataaacata cgcattttga aaaagattta ttagcaacag aagaaataat
taaaaaacta 6780tatcctgact atcttgattt ttattatagt gcactaaaaa
gaaaatctgc tcatatgttt 6840aatatgttta ttatgaaaga taaatatttc
aataattatt gtgaatggtt attttcgatt 6900ctttttgaat tagaaaaagt
actagatatt tcagaatatt ctccctttca tgcaagagta 6960tttggtcgtg
tgagtgaaat tttattagat gtatggattt tcaagaataa tttaaatttc
7020actgaaattc cagttatgtt tatggaaaag caaaattggt gggataaatc
taaaagattt 7080atttctgcaa agcttttcaa caaaaaatat tattagacta
ggagaaataa attgcttaca 7140atcggaataa ttttaataat ttttatgact
attttcgatt attatataca taaaacagta 7200ttttctccgg tctttatgtt
taattcactc tttttattaa taatatctct ttcttctatg 7260aggttatata
atttgagaga atattctatc aaatcaatag aagtaattgt gttagggatg
7320atattcttct ctttaggagt attttgtact cgtattgttt ctcatgaatt
tttaaaaaat 7380caaaataatg ttattaatta cgatgataat ttaaatgtaa
attggacttt tttaaaaatt 7440cttttgatag ttgtaaccac aggaaacgta
ttctctatta ttttttcctt gaaattcctt 7500ttaggaggag gttcatactt
agaattgaga aatatgatat tgggatataa tggagctgaa 7560ccacttatta
cgaatcctct cgtaaatata ttaacaagat atatatcggg accagggttg
7620actgctttga tcccattttc tatttttttt ctaattagga aaaaaaacat
taaattttcc 7680ttaattattt tattgaatct tgttttggca acattatcat
ccggtggtag aattttactt 7740gtatatacta ttattcaatt gtttatagga
ttatcttatt caaaaaaaaa tataccaaaa 7800aaaattaaga aagtagtcat
aatatcaagt attatatttt ttatatctat aattgtctta 7860tctaacatca
gaagttctaa cagtatatat agagcgtttt atgcatactt ttcgggccct
7920gtagttcttt tatctacttg gatgactgat gttgatactt ataatattca
ttcacatgga 7980ttaggattta tttatcccat cacatatcta ttaaattcat
tttgtaattt aataggaatt 8040cctaactcga tgttggctaa tgttgtcatg
tggcaaggaa tgcctcagaa tgattgggta 8100ggcgtattcc ctaatcaatc
gatgaacgct tttagtacac ttttctattt tttctataaa 8160gattttcgag
aatttggagt tgcttgcttt tctttccttt ttgggagtat ttgtggtttt
8220atttatttta aagcgtttat cgaaagaaaa agtaaatatc tagtctatta
tttattaggg 8280gtacaggcaa ttatcggatc ttttattatt tggcaattgg
ggagtactgc gtttttctta 8340agtattgtat ttacaatatt aagtctgaaa
tcaaagaaat cataactata gaaaaggaga 8400taaaatatga caatcagcat
agtaatccca gtttataatg ttcaagatta cataaaaaag 8460tgtctagatt
ctatattaag ccagacattt tcagatttag aaattattct tgttgatgat
8520ggttctactg acttgagtgg aagaatttgt gattattatt ccgaaaatga
taaacgtatt 8580aaagtaatcc acacagcaaa tgggggacag tcggaagcaa
ggaacgttgg aatcaaaaat 8640gccacatcag aatggataac atttattgat
tctgatgact acgtttcttc tgattatata 8700gagtatttat ataatttgat
tcaagtacac aatgcagata tttcaatagc tagttttacc 8760tatatcacac
ctaaaaagat aattaagcac ggtaacggtg aagtagctct tatggatgca
8820aaaactgcaa ttcggagaat gttactgaat gaaggtttcg atatgggagt
ttgggggaaa 8880atgtatcgaa cggagtattt taataaatat aaattcgttt
caggaaaact atttgaagat 8940tctttaatta cataccagat attttcagaa
gcttcaacaa ttgtttttgg agcaaaggat 9000atttattttt atgttaacag
gaaaaattct actgttaatg gtacttttaa tataaaaaag 9060tttgatctta
ttgaaatgaa tgaagaagca aataagttta ttaaacataa atttccagat
9120ctttcatctg aagcacatcg tcgaatgata tgggcatatt ttagtacact
aaatcaagtt 9180ttatcatcaa ctaatgaaca cgatattgat ttatatgcgc
cacaattagt agcttatctc 9240cttaaacagg ataaattcat aaaaaggaat
acttttattc ccaaaagaga taagattgca 9300ttttttattt taaaaaattt
tggtttaaag acatatcgta atgtttggaa tttatattta 9360aaaatgacaa
gataaaaaca ataatgaaag ataaaaaata atgaaaactg ctacaattac
9420tttacattca gcacataata atggatctat cttttctaca gtcatttgct
ttgcagagaa 9480agataatatc tatgggatat gataacgaaa ttataaatta
tattccactc aaattgctcg 9540tagttttaag aaccaagtgc aaaagattat
taaggttaac aacgttacga ttgttgctac 9600ggccgcaacg ccgaagaagc
cgctgaatac gttgattggg ctagttgtcg gcttgctata 9660ggatttgttt
atgcagcgat tcggatgctc acggatcgcc gcgttcacga agctgatttc
9720ttaactgatg aattaggatt gactagttta ggcttggtta accatcaaca
tcaccattca 9780atgaagaaac aggccttgaa tctgaacggt ggctatcata
cgcataacga tcaaacatct 9840tcacaagcga tgaaacgagt ttaggagggt
gctagatgtt taaacgtaaa gaaaagaata 9900taacgactac ggcaccaatt
aatctcacca cgattaatga acccatgtcg gtcattactg 9960agcagattaa
aacaattcga accaatatca attttgcggc tactgaccat aagctacgaa
10020ctttgatggt gacttcggcc atgcttggcg agggtaaatc gacagtaagt
ggtaacttag 10080cagtggagta tgccaaggaa ggaaggcaag caagtcttac
tggtcgatgc tgacttgcga 10140cgaccaacga ttcataagac atttggcctt
aaaaaccata agggattaag ttcatggtta 10200gccaatcaga ttgacgatgt
gaatgatgca attcatcccg tcattggcaa tctataattg 10260tataaatagt
atgtatactt tataacaatg gagtgtttta atgaatcttt tgtttagtca
10320atgtcacatt acattgaaaa tttaaaaaat gtaacttttt tgcgtgtgaa
tagctatgta 10380caatgatttt ctgggtggca gactaatcaa gtataaaata
gcttatacta gttgacaaca 10440tcccgtgata attattaact tatcaagtac
aggccaaaat actggagctt aacaggaact 10500gttagaatat gattttatat
aattaggagt agaataaaga gatgaatcca ttaatatcaa 10560ttattgttcc
aacatataat gttgaaaaat atattaggac atgtattgaa tcaatcttag
10620ctcaaacata tcgcaatatt gaagtcatta tagtaaatga tggtagcaca
gatcagtcgc 10680tagcagtaat ttccgattta atctgtagtc atcataatat
taaggtaatc aaccaaaaaa 10740accaaggatt atcagtagct cgaaacactg
gtattgatgc ggcaactggt aaatatatag 10800cttttgtaga tgcagatgac
aaaattaagc cagactttgt tagctcgctc tatcaaattg 10860ctgacaaaac
aggagctgac attgtgcgtg ggtcatttcg agactttaat ggcaatattc
10920ctaaaggctg ggttccagat ttcaatgttc caaccaatta tgggacaata
gtattagacc 10980aattcttatc cagcaacata tcttttgtag tttggtcgag
tatctatagg ctagatttta 11040ttaatagtaa tcatatacga tttacaccag
ggattctatt tgaggatgca gattttacaa 11100taagagctta tatgctcgct
aagttagttg ctacatcacc tgaaccaaat tatgcatata 11160gaataaatcg
tccaggaagt atattaacca caaaaaccac aaaaaatgcc caaaaaatgt
11220ctctttcaga agaaaaaatt atatcacaat ttattagtat gttaaagcat
gaaaaatctg 11280atgttttatg tagtttaatt ctaaagtcta tttatgcatg
tatgagagat tggacgggaa 11340ttattgtgag gaataaccta tcgttggata
ggaagaacag ttgttttgat actgctctca 11400ctctaataaa agaaataata
aattctaggc ccttaaaaga aaaaatcaaa tttttaacaa 11460aggttattat
tattaaggcg aaaaaccatt aagccgttaa acgaaaatcc aaagggttca
11520tatacaatta tgttaattat ggatttttta tatcttcaat gggttcatta
atcactgaat 11580ttgattatct tgttttaatg aatgtgaagt cattcggtta
aggggagtct ttgatttgtc 11640tagttagcta tctggacaga tgttaagtgt
taattacagt gaaggcagat gaaaacttat 11700taaaagttat tctgcttgat
taagaatggt aagatttcac catctatata cttttattag 11760aacttaggtg
gacaggagga cccaattttt aatccttcct gttatatagt ttttgtttaa
11820tatttttcgg gaggattatt aatgcaaata gtaaaaaatt atctttataa
tgcaatgtat 11880caggtcttta taattattgt gccattactt accattcctt
atttgtcaag aattttgggc 11940ccttcaggta ttggaattaa ctcatatacc
aattctattg ttcagtattt tgttttattt 12000ggtagtatag gagtcggttt
gtatgggaat cgtcagattg cctttgttag ggataatcag 12060gtcaaaatgt
ctaaagtctt ttatgaaata tttattttaa gactattaac aatatgttta
12120gcatatttat tgttcgttgc ttttttaacc attaatggtc agtatcatga
atactatttg
12180tttcaatcca ttgctatagt tgcagctgca tttgatatct cttggttttt
tatgggaatt 12240gaaaatttta aagtaactgt attaagaaat tttatagttc
agttacttgc tctattcagt 12300attttcctat ttgtcaaatc ttacaatgat
ttgaatatat atatattgat aacagtttta 12360tctacattaa ttggtaattt
aacttttttc ccaagtttac acagatatct cgtaaaggtt 12420aactatcgtg
aattaaggcc aataaagcat ttaaagcaat ctttagttat gtttatccca
12480caaattgctg tccaaattta ttgggttttg aataaaacaa tgttaggttc
attggattct 12540gtcacgagct ccggcttttt tgatcagtct gataaaatag
ttaaactggt tttggctatt 12600gctagtgcaa caggtactgt catgttgcca
cgtgttgcaa atgcctttgc acatagagag 12660tatagtaaaa ttaaggagta
catgtacgca ggtttttctt ttgtgtcggc aatttcgatt 12720cctatgatgt
ttggtctgat agctattact cctaaattcg tgccactttt ttttacatct
12780caatttagtg atgttattcc tgtgttaatg atcgagtcaa ttgcaattat
ttttatagct 12840tggagcaacg caataggtaa tcaatatctt ttaccaacta
atcaaaataa gtcatataca 12900gtgtcggtgt tcattggagc gatagtcaat
ttaatgttaa atattccact gattatatat 12960ctaggtgctg ttggtgcatc
aattgcaact gtaatttctg aaatgtctgt aactgtgtat 13020caacttttta
taattcataa acagcttaat ttgcatacac tgttttcgga tttatctaag
13080tatttaattg caggattagt gatgtttcta attgtcttta aaattagttt
gttaacaccg 13140acatcttgga tattcattct gttggaaatt actgtgggca
taattattta tgttgtttta 13200ttaatatttt taaaggcaga aataattaat
aaactaaagt ttattatgca taaatagagg 13260tatggattta ggtacctgcc
tttaggattt ttaattcaaa ggatttaggt acttatggtt 13320actttaattc
gattgtgacc tactttattc ttttggcaac tttaggtgtt gctaactatg
13380gtactaaaga gatttcagga catcgaaagg atattcgtaa aaatttctgg
ggtatttata 13440ccctccaatt gattgcgact attttgtctc ttgtcttgta
tacatcatta tgtttgttct 13500ttcctggtat gcaaaatatg gtggcttata
tcttaggatt aagcttgata tcgaaaggaa 13560tggatatttc ttggttattc
caaggtttgg aggattttcg tcgtattacc gcaaggaata 13620caacggtaaa
ggttttagga gttatttcta tcttcctatt tgtgaaaaca cctggtgatt
13680tgtatctcta tgttttccta ttgaccttct ttgaattgct tgggcaatta
agtatatggt 13740taccagcgag accttacatt ggaaaaccac aatttgattt
atcctatgct aagaaacatc 13800ttaaacctgt tattttgctg tttctccctc
aggttgccat ttcactatac gtgactttgg 13860atcgtacaat gttgggtgcc
ttgtcatcga caaatgatgt agggatttat gatcaggctt 13920tgaaaataat
taatattttg ttgacgttgg tgacttcatt gggaagtgta atgcttccaa
13980gggtatctgg tcttttatct aacggagatc ataaggccgt taacaagatg
catgaattct 14040ctttcttgat ttataatctt gtgattttcc cgataatagc
aggtctcttg attgttaata 14100aggattttgt gagtttctta ctagggaaag
atttccaaga ggcttatctt gccattgcta 14160ttatggtctt taggatgttc
tttatcggtt ggacaaatat tatgggaatc cagattttga 14220ttccatataa
taaacatcgt gagttcatgc tctctacgac tattccggct gttgtcagtg
14280ttggacttaa tctcttgtta atttcctcca tttggctttg ttggggtctc
aattgtatca 14340gttttaacag aggctttggt atgggttatt caattgaatt
tttcaaggat attcatcaaa 14400gatgtgtcaa tccttccagc catatcaaaa
attatcttag catcagttgt catgtatctt 14460ggactctttg tctttaagat
gtttgtgcaa ttgaaaccaa tgctaaatgt agcagtagat 14520ggtcttgtcg
gtgctatcat ttatattgtc ttgattattg tcttacgtgt cgttgatatg
14580aaagacttga agcaacagtt aatgaaaaac taaggagaaa aatatgtacg
attatcttat 14640cgttggtgct ggtttgtccg gagcaatctt cgcacatgaa
gctacaaaac gtggcaaaaa 14700agtaaaagtg attgacaagc gtgatcacat
tggtggcaat atctactgtg aagatgttga 14760aggtattaat gttcacaagt
atggtgctca cattttccat acctcaaata aaaaagtttg 14820ggattatgtc
aaccaatttg ctgaatttaa taactatatc aactcaccaa ttgctaacta
14880caagggcagt ctttataacc ttccatttaa catgaataca ttttatgcta
tgtggggcac 14940taagactcct caagaagtta aggacaagat tgctgaacaa
acggctgata tgaaagatgt 15000tgagcctaaa aacttggaag aacaagctat
caagttgatt ggaccagata tctacgaaaa 15060gttgatcaag ggatacactg
aaaaacaatg gggacgttct gccacagacc tgcctccttt 15120catcatcaag
cgtcttccgg ttcgtctaac ttttgataac aactacttta atgaccgtta
15180ccaaggaatt ccgatcggtg gttacaatgt catcattgaa aatatgcttg
gagatgtaga 15240agtagagctt ggagttgact tctttgccaa tcgtgaagag
cttgaagctt cagctgaaaa 15300agttgtcttt acaggaatga ttgaccagta
ctttgattat aaacatggtg agttggagta 15360tcgcagtctt cgttttgaac
acgaagtctt ggatgaagaa aatcatcaag gaaatgccgt 15420ggtcaactac
acagagcgtg agattcctta tactcgtatc attgagcata agcacttcga
15480gtatggtaca caacctaaga cagttatcac acgtgaatac ccagctgatt
ggaaacgtgg 15540agatgaacca tactacccaa tcaatgatga aaagaacaat
gccatgtttg ctaagtacca 15600agaagaagct gagaaaaatg acaaggttat
cttctgtgga cgtcttgcag attataaata 15660ctacgacatg cacgtggtca
ttgagcgtgc tctagaagtc gttgagaaag aatttattta 15720ataaataatg
gctctttgtc aactgtagtg ggtgacgaaa agctaacatc tagagaggac
15780cggataggtc ctctttttat gtatgttcag tgtgatgaag acacgtttct
taaagttgat 15840gaagtttcta aaaccgaagc ccaaccgttt gatgtctttg
atcaacttat tagtcgcttc 15900aagttttgcg tttggatagt ccgtttctag
tgcgtttttg atgtattgct tgtgtctaag 15960aaaagtccta aagacagttt
gaaaatagtg attgaccttg ctcctatttt cctctatcag 16020gtcaaagaac
tcatctactc tcttctcctg aaagtgaaaa agcaaaagct gataaagtgt
16080atagtagtca gtaagctctt ttgaaaagac tagtgtcttc gcaacaactt
catgtggtgc 16140taaagtttgg cggaaagtct ttgaataaaa agaattgaga
gatagtttac agctgtcctt 16200ttggaagagt cgccagtgat ttttcaaggc
tcgatagggt agtgacttct tatcgaatta 16260gttcatgatt gcaattctag
tctttaaaaa tgctctacca aggtgctgga tgatgtggaa 16320acgatcaaga
acgatttttg cgtttggaaa gagtctgcgg gctagtggga tataagctcc
16380agacttatcc atcgtgataa actgtacctg ttatcggact ttcaatggat
acttcaaaag 16440tagtttcgta tagtagtttg gcggcgatta tcaaggatgg
ttatgagttg gtttgtctca 16500taattctgcg ccacaaaagc caattcccct
ttcttgaacc caaactcatc ccaggacata 16560acagcaggga gtttgtcata
atgtttcttg aaagtaaact gatcaagctt acgatagaca 16620gtggacgtcg
acacacgaag tcttcttgca atatcagtta gtgacacttt ctcagttagg
16680agttgtgtaa ctttttgttg gactagattg gagatttggt agtttttctc
aacgatagat 16740gtctcagcta ccgtgactct cctacaattt ttacactgga
aacgacgttt tttcagacgt 16800agtagagttg gcgttcccgc ttgctcgaga
agagggattt tagatttttt ttgaaagtca 16860tatttgatca tctttctttg
gcagtgagga catgatggtg tagggtaatc aagttttgct 16920tgaatctcga
tatgagtgtc agtttcaaaa acaagtgaaa taatgatatt ttggtcttta
16980actccgatta attctgtggt attcttaata ggtctcataa gttcttccta
atggtagttt 17040cgtcgctttt cattatagtt cttatgggac tttttgtgta
cactcaaaaa gctctataat 17100ctctacagtg gttttactca ctacagaaat
tatagagcca atatatctcc tgtctatttt 17160tatgctactt ttgggttagc
tcaactcaac cgccttttaa tctcccaaca acaataatac 17220cctatcaaac
aacccaaaaa attcaagata atatcactaa tggcaaatgt gcccaaataa
17280aagataaatt gaatggtttc aattcctaaa agtgtgacca aactgataat
gacaaactgt 17340ttgaaattag tattgataca gtaaaggcca cctaaaggaa tgaagta
173872163DNAStreptococcus thermophilus 21caaggacagt tattgatttt
ataatcacta tgtgggtata aaaacgtcaa aatttcattt 60gag
632241DNAStreptococcus thermophilus 22ttgattcaac ataaaaagcc
agttcaattg aacttggctt t 412324DNAArtificialOligonucleotide primer
23aaatgaattc agagcaagca cttg 242424DNAArtificialOligonucleotide
primer 24gtcatgtcaa ctttattaag gacg 24
* * * * *