U.S. patent application number 10/480343 was filed with the patent office on 2005-02-10 for identification and use of conserved noncoding sequences.
Invention is credited to Braun, David, Freeling, Michael, Kaplinsky, Nicholas.
Application Number | 20050032056 10/480343 |
Document ID | / |
Family ID | 23171711 |
Filed Date | 2005-02-10 |
United States Patent
Application |
20050032056 |
Kind Code |
A1 |
Freeling, Michael ; et
al. |
February 10, 2005 |
Identification and use of conserved noncoding sequences
Abstract
The invention is directed to the identification of conserved
noncoding sequences in various organisms and the use of those
sequences as primers for use in amplifying, mapping and analysis of
DNA among different species.
Inventors: |
Freeling, Michael;
(Berkeley, CA) ; Kaplinsky, Nicholas; (Berkeley,
CA) ; Braun, David; (Avenue State College,
PA) |
Correspondence
Address: |
Michael R Ward
Morrison & Foerster
425 Market Street
San Francisco
CA
94105
US
|
Family ID: |
23171711 |
Appl. No.: |
10/480343 |
Filed: |
September 27, 2004 |
PCT Filed: |
July 3, 2002 |
PCT NO: |
PCT/US02/21343 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60303356 |
Jul 6, 2001 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/91.2 |
Current CPC
Class: |
G09B 29/08 20130101;
C12Q 1/6858 20130101; C12Q 2525/15 20130101; G09B 29/04 20130101;
Y10T 428/24008 20150115; B42D 15/008 20130101; Y10T 428/21
20150115; C12Q 1/6895 20130101; C12Q 1/6858 20130101; Y10S 40/904
20130101; C12Q 1/6876 20130101; B42D 15/0086 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Goverment Interests
[0002] This invention was made with Government support order Grant
(Contract) No. R01GM42610 awarded by the National Institutes of
Health. The government has certain rights in this invention.
Claims
We claim:
1. A method of identifying a polymorphism between two or more DNA
sequences; comprising: a) selecting a first and a second primer for
use in an amplification reaction for each DNA sequence wherein said
first or second primer is a CNS in said two or more DNA sequences;
b) hybridizing said first and second primers to each DNA sequence
to form primer-DNA hybrids; c) amplifying said primer-DNA hybrids
to form amplified DNA products; and d) separating said DNA products
by size to identify a polymorphism between said two or more DNA
sequences.
2. The method of claim 1 wherein said DNA sequences are plant DNA
sequences.
3. The method of claim 1 wherein said polymorphism is utilized for
mapping.
4. The method of claim 1 wherein said first primer is a CNS and
said second primer is an exon sequence.
5. The method of claim 1 wherein both the first and second primers
are CNSS.
6. The method of claim 1 wherein said DNA products are digested
with a restriction endonuclease prior to separation in step d).
7. The method of claim 1 wherein said DNA products are separated by
electrophoresis.
8. The method of claim 1 wherein said primers are PCR primers.
9. The method of claim 1 wherein the primer-DNA hybrids are
amplified using an amplification technique selected from the group
consisting of cloning, PCR, LCR, TAS, 3SR, NASBA and QP
amplification.
10. The method of claim 9 wherein said technique is PCR.
11. A method of mapping a polymorphism between two or more species;
comprising: a) selecting a first and a second primer for use in an
amplification reaction wherein said first or second primer is a CNS
in the genomes of said two or more species wherein said genomes
include genomic DNA; b) hybridizing said first and second primers
to said genomic DNA sequences to form primer-genomic DNA hybrids;
c) amplifying said primer-genomic DNA hybrids to form amplified DNA
products; and d) separating said DNA products by size to map a
polymorphism between said two or more DNA sequences.
12. The method of claim 11 wherein said DNA sequences are plant DNA
sequences.
13. The method of claim 11 wherein said plant DNA is grass DNA.
14. The method of claim 11 wherein said first primer is a CNS and
said second primer is an exon sequence.
15. The method of claim 11 wherein both the first and second
primers are CNSs.
16. The method of claim 11 wherein said DNA products are digested
with a restriction endonuclease prior to separation in step d).
17. The method of claim 11 wherein said DNA products are separated
by electrophoresis.
18. The method of claim 11 wherein said primers are PCR
primers.
19. The method of claim 1 wherein the primer-DNA hybrids are
amplified using an amplification technique selected from the group
consisting of cloning, PCR, LCR, TAS, 3SR, NASBA and Q.beta.
amplification.
20. The method of claim 19 wherein said technique is PCR.
Description
RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 60/303,356 filed Jul. 6, 2001, which is hereby
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] This invention is in the field of molecular biology. In
particular this invention relates to the identification and use of
conserved noncoding sequences (CNS) for molecular and genetic
analysis.
BACKGROUND OF THE INVENTION
[0004] While much progress has been made in recent years in
traditional molecular and genetic mapping, sequencing of genomes
and molecular analysis of gene expression, there is still a
tremendous need to develop improved techniques for molecular and
genetic analysis within and between species.
[0005] Molecular markers are common tools that can reveal
polymorphism directly at the DNA level and are used for genetic
resource assessment, molecular analysis and genetic mapping.
Various types of markers have been developed: RFLP: restriction
fragment length polymorphism; PCR: polymerase chain reaction based
markers; SCAR: sequence characterized amplified region; SSR: simple
sequence repeats (microsatellites); ISSR: intersimple sequence
repeats; STS: sequence tagged sites and AFLP: amplified fragment
length polymorphisms. Although these methods are powerful, they are
useful only within one species or genus because the markers are not
from genes shared by larger taxonomic groups. There is thus a need
in the art to develop improved methods of genetic mapping and
molecular analysis within and across different kingdoms.
SUMMARY OF THE INVENTION
[0006] In order to meet these needs, the present invention is
directed to CNSs (conserved noncoding sequences) and their use in
molecular analysis and genetic mapping in any organism. The
conserved noncoding sequences (CNSs) of the invention find many
applications in molecular analysis and genetic mapping. In
particular, CNSs find use in identifying polymorphisms between two
or more DNA sequences. CNSs find further use in mapping including
cross-species alignment of DNA sequences and alignment of syntenic
regions outside of coding regions.
[0007] CNSs may also be utilized in gene cloning including
capturing or isolating of sets of related genes.
[0008] CNSs may be also utilized for analyzing promoter sequences
including (a) identifying functional cis-acting sequences within a
promoter; (b) identifying binding sites for transcription factor
complexes; (c) isolating or physically capturing DNA binding
proteins/transcription factors; (d) linking binding sites to
appropriate transcription factors via gene expression profiles; (e)
designing promoters with novel expression characteristics and (f)
titrating out transcription factors via replication of
CNS-containing DNA.
[0009] The CNSs of the invention can also be utilized to alter the
expression level and specificity of endogenous genes by in situ
modification of CNSs.
[0010] In one format of the invention, combinations of CNSs or
CNS-exon primer combinations are used to generate PCR fragments
including highly polymorphic regions and some exon regions. Such a
fragment, once shown to be linked with a characteristic of interest
in any species, (e.g. any grass) can be sequenced. The sequence, in
turn, is used to anchor the linked gene to the nearest species
genetic map.
[0011] The present invention is further directed to methods of
genetic mapping using the CNSs of the invention. The present
invention is further directed to kits containing various CNSs for
use in mapping such CNSS.
[0012] The present invention is further directed to a method of
identifying a polymorphism between two or more DNA sequences by a)
selecting a first and a second primer for use in an amplification
reaction wherein the first or second primer is a CNS in the two or
more DNA sequences; b) hybridizing the first and second primers to
the two or more DNA sequences to form primer-DNA hybrids; c)
amplifying the primer-DNA hybrids to form amplified DNA products;
and d) separating the DNA products by size to identify a
polymorphism between said two or more DNA sequences.
[0013] The DNA sequences may be from any organism including
plants.
[0014] In one format of the method of the invention, the
polymorphism is utilized for mapping.
[0015] In the method of detecting a polymorphism of the invention,
the first primer may be a CNS and the second primer may be an exon
sequence. Alternatively, both primers may be CNSs.
[0016] In the method of detecting a polymorphism of the invention
the DNA products may be digested with a restriction endonuclease
prior to separation in step d). After digestion, the DNA products
may be separated by electrophoresis.
[0017] In one format of the invention, the amplification primers
are PCR primers.
[0018] The primer-DNA hybrids may be amplified using any
amplification technique. Such amplification techniques include
cloning, PCR, LCR, TAS, 3SR, NASBA and Q.beta. amplification.
[0019] The present invention is further directed to a method of
mapping a polymorphism between two or more species by a) selecting
a first and a second primer for use in an amplification reaction
wherein the first or second primer is a CNS in the genomes of the
two or more species wherein the genomes include genomic DNA; b)
hybridizing the first and second primers to the genomic DNA to form
primer-genomic DNA hybrids; c) amplifying the primer-genomic DNA
hybrids to form amplified DNA products; and d) separating the DNA
products by size to map a polymorphism between the two or more DNA
sequences.
[0020] The present invention is further directed to kits including
the CNSs of the invention where the kits find use in detecting
polymorphisms and mapping. The kits may include all the components
necessary to carry out an amplification reaction utilizing the
CNSs. Such components may include primers, enzymes, directions for
use, etc.
[0021] The present invention is further directed to a method of
identifying cis-acting genomic DNA sequences that alter gene
expression in plants by a) obtaining the genomic DNA sequences of
orthologous genes from two or more related plants; b) comparing the
non-coding regions of the genomic DNA sequences to identify
conserved non-coding sequences at least 7 nucleotides in length and
c) testing the CNS in a plant to determine whether the CNS alters
gene expression in the plant to thereby identify the CNS as a
cis-acting genomic DNA sequences that alters gene expression in
plants.
[0022] In the method of identifying cis-acting genomic DNA
sequences that alter gene expression in plants, the genomic DNA
sequence of the orthologous genes may be obtained by searching DNA
sequence databases or by directly sequencing the genomic DNA.
[0023] In the method of identifying cis-acting genomic DNA
sequences that alter gene expression of the invention the testing
of the CNS in a plant may include the steps of: i) creating a
CNS-reporter gene construct; ii) introducing the CNS-reporter gene
construct into a plant to create a transgenic plant and iii)
measuring expression levels of the reporter gene in the transgenic
plant.
[0024] The present invention is further directed to a method of
identifying a binding site for transcription factor in a plants, by
a) obtaining the genomic DNA sequences of orthologous genes from
two or more related plants; b) comparing the non-coding regions of
the genomic DNA sequences to identify conserved non-coding
sequences at least 7 nucleotides in length and c) testing the CNS
to determine whether the CNS is a binding site for a transcription
factor complex.
[0025] In the method of identifying a binding site for a
transcription factor of the invention, the genomic DNA sequence of
the orthologous genes may be obtained by searching DNA sequence
databases or by directly sequencing the genomic DNA.
[0026] In the method of identifying a binding site for a
transcription factor of the invention, the CNS may be tested by a
gel shift-binding assay.
[0027] The present invention is further directed to a method of
identifying a conserved noncoding sequence in the genomes of at
least two plants by a) identifying coding regions in the genomes;
b) masking out the coding regions to formed masked genomic
sequences and unmasked genomic sequences in said genomes; c)
comparing the unmasked genomic sequences to identify two or more
conserved noncoding sequences wherein the conserved noncoding
sequences contain at least 7 identical nucleotides to identify the
conserved non-coding sequences.
[0028] In the method of identifying a conserved noncoding sequence
of the invention, the unmasked genomic sequences may be compared
using a word size of seven, a gap penalty existence from 2-5 and a
gap penalty extension from 1-2.
[0029] The method of identifying a conserved noncoding sequence may
further include identifying the position of the conserved noncoding
sequences relative to the masked genomic sequence.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 shows lg1 CNSs conserved between maize and rice by
presenting a graphic display of CNS locations and sizes found when
comparing 7142 bp of maize sequence at lg1 with 7100 bp of
orthologous rice sequence. In FIG. 1A, the Blast parameters were
adjusted to favor shorter, more stringent CNSs. In FIG. 1B, the
Blast parameters adjusted to favor longer, less exact matches. FIG.
1C shows a 5 grass alignment of lg1 intron 1.
[0031] FIG. 2 shows that lg1 CNS3 is conserved in grasses. CNS3 was
used as a PCR primer site, paired with a lg1 exon 1 site, to
amplify the promoter, 5' UTR and first exon regions of lg1 from
various grasses. FIG. 2A shows an ethidium bromide stained gel of
the PCR products. The gel was transferred onto a nylon membrane and
hybridized with a combined lg1 exon1 region from maize and rice.
FIG. 2B shows the autoradiogram after hybridization. In FIGS. 2A
and 2B Lane 1=rice (Oryza sativa), 2=weedy foxtail (Setaria
viridis), 3=sorghum (Sorghum bicolor), 4=maize (Zea mays),
5=Muhlenbergia porteri, 6=Arundo donax, 7=a bamboo (Bambusa
multiplex).
[0032] FIG. 3A shows piled-up sequences from various plant genes
containing the smaller CNS sequence: TTATTACATGPyG (SEQ ID NO: 1).
FIG. 3B is a line up of CNSlg3-i2 from representative grasses. FIG.
3C shows phylogenetic relationships between different plants. The
asterisk (*) in FIG. 3C indicates the species in which useful
conservation of CNS sequences has been demonstrated.
[0033] FIG. 4 shows amplification reaction products from
non-domesticated (wild species) using CNS. FIG. 4A shows PCR
products using primers CNS3-2 and Lg1-77. Lanes from left to right,
6 Setaria fabreii (2425, 641, 1816, 2418, 2423 and 2448) and 5
Setaria glauca (Z3, 003, 091, 098 and 2406) FIG. 4B shows PCR
products digested with Msp I.
DETAILED DESCRIPTION OF THE INVENTION
[0034] In order to more fully understand the invention, the
following definitions are provided.
[0035] An amplification pattern "database" denotes a set of stored
data which represent a collection of amplification patterns
generated by amplifying nucleic acids derived from a plurality of
test samples using the multi-site test device of the present
invention.
[0036] The term "conserved noncoding sequence," "(CNS)" refers to
evolutionarily conserved stretches of DNA that does not encode
protein. Conserved noncoding sequences are generally located near
exons and are more than 7 nucleotides in length.
[0037] The term "pan grass mapping marker" refers to any marker
that is useful in most, many or all members of the Gramineae (grass
family), a family of flowering plants that includes the majority of
food crops.
[0038] The term "PCR" refers to the Polymerase Chain Reaction.
[0039] The phrase "mixed defined plant population" refers to a
plant population containing many different families and lines of
plants. Typically, the defined plant population exhibits a
quantitative variability for a phenotype that is of interest.
[0040] The phrase "multiple plant families" refers to different
families of related plants within a population.
[0041] The term "exon" refers to specific regions of DNA, which
code for protein.
[0042] A "polymorphism" is a change or difference between two
related nucleic acids. A "nucleotide polymorphism" refers to a
nucleotide, which is different in one sequence when compared to a
related sequence when the two nucleic acids are aligned for maximal
correspondence. A "genetic nucleotide polymorphism" refers to a
nucleotide which is different in one sequence when compared to a
related sequence when the two nucleic acids are aligned for maximal
correspondence, where the two nucleic acids are genetically
related, i.e., homologous, e.g., where the nucleic acids are
isolated from different strains of a plant, or from different
alleles of a single strain, or the like.
[0043] A "QTL" or "quantitative trait locus" include genes that
control, to some degree, numerically representable phenotypic
traits (disease resistance, crop yield, resistance to environmental
extremes, etc.), that are distributed within a family of
individuals as well as within a population of families of
individuals. To measure QTLS, two inbred lines are typically
crossed and multiple marker loci are genotyped, with one to several
quantitative phenotypic traits among the progeny of the cross being
evaluated. QTL are then identified and ultimately selected for
based on significant statistical associations between the genotypic
values determined by genetic marker technology and the phenotypic
variability among the segregating progeny. Typical QTL include
yield, grain moisture, grain oil, root lodging, stalk lodging,
plant height, ear height, disease resistance, insect resistance,
resistance to soybean cyst nematode, resistance to brown stem rot,
resistance to phytopthora rot, and many others.
[0044] As used herein, the term "gene" is used broadly to refer to
any segment of nucleic acid associated with a biological function.
Thus, genes include coding sequences and/or the regulatory
sequences required for their expression. For example, gene refers
to a nucleic acid fragment that expresses mRNA or functional RNA,
or encodes a specific protein, and which includes regulatory
sequences. Genes also include nonexpressed DNA segments that, for
example, form recognition sequences for other proteins. Genes can
be obtained from a variety of sources, including cloning from a
source of interest or synthesizing from known or predicted sequence
information, and may include sequences designed to have desired
parameters. The term "native" or "wild type" gene refers to a gene
that is present in the genome of an untransformed cell, i.e., a
cell not having a known mutation.
[0045] A "marker gene" encodes a selectable or screenable
trait.
[0046] The term "chimeric gene" refers to any gene that contains 1)
DNA sequences, including regulatory and coding sequences, that are
not found together in nature, or 2) sequences encoding parts of
proteins not naturally adjoined, or 3) parts of promoters that are
not naturally adjoined. Accordingly, a chimeric gene may comprise
regulatory sequences and coding sequences that are derived from
different sources, or comprise regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different from that found in nature.
[0047] A "transgene" refers to a gene that has been introduced into
the genome by transformation and is stably maintained. Transgenes
may include, for example, genes that are either heterologous or
homologous to the genes of a particular plant to be transformed.
Additionally, transgenes may comprise native genes inserted into a
non-native organism, or chimeric genes. The term "endogenous gene"
refers to a native gene in its natural location in the genome of an
organism. A "foreign" gene refers to a gene not normally found in
the host organism but that is introduced by gene transfer.
[0048] An amplification "primer" corresponding to a conserved
noncoding sequence of the invention refers to primers for use in
amplification reactions. Primers may be about 30 or fewer
nucleotides in length (e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19 20, 21, 22, 23, or 24, or any number between 9 and 30).
Generally specific primers are upwards of 14 nucleotides in length.
For optimum specificity and cost effectiveness, primers of 16 to 24
nucleotides in length may be preferred. Those skilled in the art
are well versed in the design of primers for use in amplification
processes such as PCR. For use as amplification primers, conserved
noncoding sequences of 15, 16, 17 and 18 mers and longer
oligonucleotides generally find use in the invention. For
computational analysis, 7, 8, 9, 10, 11, 12, 13, 14, 15 and 16 mers
and longer oligonucleotides find use in the invention. When smaller
oligonucleotides (e.g. 7 mers) are used in computational analysis,
clusters of oligomers are generally required in addition to the use
of algorithms to interpret the data.
[0049] "Coding sequence" refers to a DNA or RNA sequence that codes
for a specific amino acid sequence and excludes the non-coding
sequences. It may constitute an "uninterrupted coding sequence",
i.e., lacking an intron, such as in a cDNA or it may include one or
more introns bounded by appropriate splice junctions. An "intron"
is a sequence of RNA which is contained in the primary transcript
but which is removed through cleavage and re-ligation of the RNA
within the cell to create the mature mRNA that can be translated
into a protein.
[0050] The terms "open reading frame" and "ORF" refer to the amino
acid sequence encoded between translation initiation and
termination codons of a coding sequence. The terms "initiation
codon" and "termination codon" refer to a unit of three adjacent
nucleotides (`codon`) in a coding sequence that specifies
initiation and chain termination, respectively, of protein
synthesis (mRNA translation).
[0051] A "functional RNA" refers to an antisense RNA, ribozyme, or
other RNA that is not translated. Functional RNA is encoded by
genes that encode RNA only.
[0052] The term "RNA transcript" refers to the product resulting
from RNA polymerase catalyzed transcription of a DNA sequence. When
the RNA transcript is a perfect complementary copy of the DNA
sequence, it is referred to as the primary transcript or it may be
a RNA sequence derived from posttranscriptional processing of the
primary transcript and is referred to as the mature RNA. "Messenger
RNA" (mRNA) refers to the RNA that is without introns and that can
be translated into protein by the cell. "cDNA" refers to a single-
or a double-stranded DNA that is complementary to and derived from
mRNA.
[0053] "Regulatory sequences" and "suitable regulatory sequences"
each refer to nucleotide sequences located upstream (5' non-coding
sequences), within, or downstream (3' non-coding sequences) of a
coding sequence, and which influence the transcription, RNA
processing or stability, or translation of the associated coding
sequence. Regulatory sequences include enhancers, promoters,
translation leader sequences, introns, and polyadenylation signal
sequences. They include natural and synthetic sequences as well as
sequences which may be a combination of synthetic and natural
sequences. The term "suitable regulatory sequences" is not limited
to promoters.
[0054] "5' non-coding sequence" refers to a nucleotide sequence
located 5' (upstream) to the coding sequence. It is present in the
fully processed mRNA upstream of the initiation codon and may
affect processing of the primary transcript to mRNA, mRNA stability
or translation efficiency.
[0055] "3' non-coding sequence" refers to nucleotide sequences
located 3' (downstream) to a coding sequence and include
polyadenylation signal sequences and other sequences encoding
regulatory signals capable of affecting mRNA processing or gene
expression. The polyadenylation signal is usually characterized by
affecting the addition of polyadenylic acid tracts to the 3' end of
the mRNA precursor.
[0056] "Promoter" refers to a nucleotide sequence, usually upstream
(5') to its coding sequence, which controls the expression of the
coding sequence by providing the recognition for RNA polymerase and
other factors required for proper transcription. "Promoter"
includes a minimal promoter that is a short DNA sequence comprised
of a TATA box and other sequences that serve to specify the site of
transcription initiation, to which regulatory elements are added
for control of expression. "Promoter" also refers to a nucleotide
sequence that includes a minimal promoter plus regulatory elements
that is capable of controlling the expression of a coding sequence
or functional RNA. This type of promoter sequence consists of
proximal and more distal upstream elements, the latter elements
often referred to as enhancers. Accordingly, an "enhancer" is a DNA
sequence, which can stimulate promoter activity, and may be an
innate element of the promoter or a heterologous element inserted
to enhance the level or tissue specificity of a promoter. It is
capable of operating in both orientations (normal or flipped), and
is capable of functioning even when moved either upstream or
downstream from the promoter. Both enhancers and other upstream
promoter elements bind sequence-specific DNA-binding proteins that
mediate their effects. Promoters may be derived in their entirety
from a native gene, or be composed of different elements derived
from different promoters found in nature, or even be comprised of
synthetic DNA segments. A promoter may also contain DNA sequences
that are involved in the binding of protein factors known as
"transcription factors" which control the effectiveness of
transcription initiation in response to physiological or
developmental conditions.
[0057] The "initiation site" is the position surrounding the first
nucleotide that is part of the transcribed sequence, which is also
defined as position +1. With respect to this site all other
sequences of the gene and its controlling regions are numbered.
Downstream sequences (i.e., further protein encoding sequences in
the 3' direction) are denominated positive, while upstream
sequences (mostly of the controlling regions in the 5' direction)
are denominated negative.
[0058] Promoter elements, particularly a TATA element, that are
inactive or that have greatly reduced promoter activity in the
absence of upstream activation are referred to as "minimal or core
promoters." In the presence of a suitable transcription factor, the
minimal promoter functions to permit transcription. A "minimal or
core promoter" thus consists only of all basal elements needed for
transcription initiation, e.g., a TATA box and/or an initiator.
[0059] The terms "heterologous DNA sequence," "exogenous DNA
segment" or "heterologous nucleic acid," as used herein, each refer
to a sequence that originates from a source foreign to the
particular host cell or, e.g. the CNSs of the present invention, if
from the same source, is modified from its original form. Thus, a
heterologous gene in a host cell includes a gene that is endogenous
to the particular host cell but has been modified through, for
example, the use of DNA shuffling. The terms also include
non-naturally occurring multiple copies of a naturally occurring
DNA sequence. Thus, the terms refer to a DNA segment that is
foreign or heterologous to the cell, or homologous to the cell but
in a position within the host cell nucleic acid in which the
element is not ordinarily found. Exogenous DNA segments are
expressed to yield exogenous polypeptides. A "homologous" DNA
sequence is a DNA sequence that is naturally associated with a host
cell into which it is introduced.
[0060] "Homologous to" in the context of nucleotide sequence
identity refers to the similarity between the nucleotide sequence
of two nucleic acid molecules or between the amino acid sequences
of two protein molecules. Estimates of such homology are provided
by either DNA-DNA or DNA-RNA hybridization under conditions of
stringency as is well understood by those skilled in the art (as
described in Haines and Higgins (eds.), Nucleic Acid Hybridization,
IRL Press, Oxford, U.K.), or by the comparison of sequence
similarity between two nucleic acids or proteins.
[0061] The term "altered plant trait" means any phenotypic or
genotypic change in a transgenic plant relative to the wild-type or
non-transgenic plant host.
[0062] "Genome" refers to the complete genetic material of an
organism.
[0063] The term "nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form, composed of monomers (nucleotides) containing
a sugar, phosphate and a base, which is either a purine or
pyrimidine. Unless specifically limited, the term encompasses
nucleic acids containing known analogs of natural nucleotides which
have similar binding properties as the reference nucleic acid and
are metabolized in a manner similar to naturally occurring
nucleotides. Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and
complementary sequences as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer, et al., 1991; Ohtsuka, et
al., 1985; Rossolini, et al. 1994). A "nucleic acid fragment" is a
fraction of a given nucleic acid molecule. In higher plants,
deoxyribonucleic acid (DNA) is the genetic material while
ribonucleic acid (RNA) is involved in the transfer of information
contained within DNA into proteins. The term "nucleotide sequence"
refers to a polymer of DNA or RNA which can be single- or
double-stranded, optionally containing synthetic, non-natural or
altered nucleotide bases capable of incorporation into DNA or RNA
polymers. The terms "nucleic acid" or "nucleic acid sequence" may
also be used interchangeably with gene, cDNA, DNA and RNA encoded
by a gene.
[0064] The nucleotide sequences of the invention include both the
naturally occurring CNS sequences as well as mutant (variant)
forms. Such variants will continue to possess the desired activity,
i.e., hybridizing to a region of interest of the non-variant
nucleotide sequence.
[0065] "Cloning vectors" typically contain one or a small number of
restriction endonuclease recognition sites at which foreign DNA
sequences can be inserted in a determinable fashion without loss of
essential biological function of the vector, as well as a marker
gene that is suitable for use in the identification and selection
of cells transformed with the cloning vector. Marker genes
typically include genes that provide tetracycline resistance,
hygromycin resistance or ampicillin resistance.
[0066] A "transgenic plant" is a plant having one or more plant
cells that contain an expression vector.
[0067] "Plant tissue" includes differentiated and undifferentiated
tissues or plants, including but not limited to roots, stems,
shoots, leaves, pollen, seeds, tumor tissue and various forms of
cells and culture such as single cells, protoplast, embryos, and
callus tissue. The plant tissue may be in plants or in organ,
tissue or cell culture.
[0068] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence", (b) "comparison window", (c) "sequence
identity", (d) "percentage of sequence identity", and (e)
"substantial identity".
[0069] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence
for example, as a segment of a full length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0070] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0071] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm. Preferred, non-limiting examples of such mathematical
algorithms are the algorithm of Myers and Miller, 1988; the local
homology algorithm of Smith et al. 1981; the homology alignment
algorithm of Needleman and Wunsch 1970; the
search-for-similarity-method of Pearson and Lipman 1988; the
algorithm of Karlin and Altschul, 1990, modified as in Karlin and
Altschul, 1993.
[0072] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters. The
CLUSTAL program is well described by Higgins et al. 1988; Higgins
et al. 1989; Corpet, et al. 1988; Huang, et al. 1992; and Pearson,
et al. 1994. The ALIGN program is based on the algorithm of Myers
and Miller, supra. The BLAST programs of Altschul et al., 1990, are
based on the algorithm of Karlin, and Altschul supra.
[0073] Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information. This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul, et al., 1990). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when the cumulative
alignment score falls off by the quantity X from its maximum
achieved value, the cumulative score goes to zero or below due to
the accumulation of one or more negative-scoring residue
alignments, or the end of either sequence is reached.
[0074] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul
(1993). One measure of similarity provided by the BLAST algorithm
is the smallest sum probability (P(N)), which provides an
indication of the probability by which a match between two
nucleotide or amino acid sequences would occur by chance. For
example, a test nucleic acid sequence is considered similar to a
reference sequence if the smallest sum probability in a comparison
of the test nucleic acid sequence to the reference nucleic acid
sequence is less than about 0.1, more preferably less than about
0.01, and most preferably less than about 0.001.
[0075] To obtain gapped alignments for comparison purposes, Gapped
BLAST (in BLAST 2.0) can be utilized as described in Altschul, et
al. 1997. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to
perform an iterated search that detects distant relationships
between molecules. See Altschul et al., supra. When utilizing
BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the
respective programs (e.g. BLASTN for nucleotide sequences, BLASTX
for proteins) can be used. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both
strands. For amino acid sequences, the BLASTP program uses as
defaults a wordlength (W) of 3, an expectation (E) of 10, and the
BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989).
Alignment may also be performed manually by inspection.
[0076] For purposes of the present invention, comparison of
nucleotide sequences for determination of percent sequence identity
to the promoter sequences disclosed herein is preferably made using
the BlastN program (version 1.4.7 or later) with its default
parameters or any equivalent program. By "equivalent program" is
intended any sequence comparison program that, for any two
sequences in question, generates an alignment having identical
nucleotide or amino acid residue matches and an identical percent
sequence identity when compared to the corresponding alignment
generated by the preferred program.
[0077] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity." Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0078] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0079] (e)(i) The term "substantial identity" of polynucleotide
sequences means that a polynucleotide comprises a sequence that has
at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%,
preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or
89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most
preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity,
compared to a reference sequence using one of the alignment
programs described using standard parameters. One of skill in the
art will recognize that these values can be appropriately adjusted
to determine corresponding identity of proteins encoded by two
nucleotide sequences by taking into account codon degeneracy, amino
acid similarity, reading frame positioning, and the like.
Substantial identity of amino acid sequences for these purposes
normally means sequence identity of at least 70%, more preferably
at least 80%, 90%, and most preferably at least 95%.
[0080] Another indication that nucleotide sequences are
substantially identical is if two molecules hybridize to each other
under stringent conditions (see below). Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength and pH. However, stringent conditions
encompass temperatures in the range of about 1.degree. C. to about
20.degree. C., depending upon the desired degree of stringency as
otherwise qualified herein. Nucleic acids that do not hybridize to
each other under stringent conditions are still substantially
identical if the polypeptides they encode are substantially
identical. This may occur, e.g., when a copy of a nucleic acid is
created using the maximum codon degeneracy permitted by the genetic
code. One indication that two nucleic acid sequences are
substantially identical is when the polypeptide encoded by the
first nucleic acid is immunologically cross reactive with the
polypeptide encoded by the second nucleic acid.
[0081] For sequence comparison, typically one sequence acts as a
reference sequence to which test sequences are compared. When using
a sequence comparison algorithm, test and reference sequences are
input into a computer, subsequence coordinates are designated if
necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0082] As noted above, another indication that two nucleic acid
sequences are substantially identical is that the two molecules
hybridize to each other under stringent conditions. The phrase
"hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence
under stringent conditions when that sequence is present in a
complex mixture (e.g., total cellular) DNA or RNA. "Bind(s)
substantially" refers to complementary hybridization between a
probe nucleic acid and a target nucleic acid and embraces minor
mismatches that can be accommodated by reducing the stringency of
the hybridization media to achieve the desired detection of the
target nucleic acid sequence.
[0083] "Recombinant DNA molecule" is a combination of DNA sequences
that are joined together using recombinant DNA technology and
procedures used to join together DNA sequences as described, for
example, in Sambrook et al., 1989.
[0084] The word "plant" refers to any plant, particularly to seed
plant, and "plant cell" is a structural and physiological unit of
the plant, which comprises a cell wall but may also refer to a
protoplast. The plant cell may be in form of an isolated single
cell or a cultured cell, or as a part of higher organized unit such
as, for example, a plant tissue, or a plant organ.
[0085] Taking into account these definitions, the present invention
is directed to the identification of CNSs and their use in
molecular and genetic analyses. While the specific example below
describes the use of various techniques in the analysis of plants
using CNSs, the techniques of this invention find use in the
analysis of all organisms.
[0086] Introduction to CNSs
[0087] The elucidation of gene regulatory networks depends on
identification of cis-acting elements and the products that bind
them. Cross species genomic DNA comparisons offer a powerful method
for finding cis regulatory sequences (Hardison, R. C. (2000) Trends
in Genetics 16, 369-372). Control of gene expression requires cis
acting regulatory DNA sequences. Historically these sequences have
been difficult to identify. Conserved noncoding sequences (CNSs)
have recently been identified in mammalian genes through cross
species genomic DNA comparisons.
[0088] Regulatory elements have historically been difficult to
identify because, unlike exons, they are not constrained by the
codon syntax necessary for use in translation. Traditionally,
cis-acting regulatory elements have been identified through
biochemical and molecular genetic experimental approaches.
Regulatory sequences are generally small, e.g., six to eight
nucleotides long (Tjian, R. (1995) Scientific American 272, 54-61;
Ficket, J. W. & Hatzigeorgiou, A. G. (1997) Genome Research 7,
861-878; Bucher, P. (1999) Current Opinion in Structural Biology 9,
400-407; Sumiyama, K. et al. (2001) Genomics 71, 260-262). A recent
advance in identifying mammalian cis regulatory elements was made
by leveraging the power of genomic DNA comparisons based on the
premise that these functionally important regulatory regions will
be conserved between species (Hardison, R. C. (2000) Trends in
Genetics 16, 369-372). Comparisons between a syntenous human and
mouse genomic DNA segment identified CNSs that were experimentally
shown to regulate the expression of several nearby genes (Loots, G.
G. et al. (2000) Science (Washington D.C.) 288, 136-140). CNSs
correspond to regions of endonuclease sensitivity in man/mouse
comparisons (Gottgens, B. et al. (2001) Genome Research 11, 87-97)
as well as other previously defined regulatory elements (Sumiyama
et al. (2001); Flint, J. et al. (2001) Human Molecular Genetics 10,
371-382; Stojanovic, N. et al. (1999) Nucleic Acids Research 27,
3899-3910). A study of 502 human genes showed that regulatory
sequences are enriched in CNSs compared to nonconserved noncoding
regions (Levy, S. et al. (2001) Bioinformatics (Oxford) 17,
871-877). Most identified CNSs have no experimentally defined
function (Dubchak, I. et al. (2000) Genome Research 10, 1304-1306).
There are now several web based tools that can be used to identify
CNSs (Mayor, C. et al. (2000) Bioinformatics (Oxford) 16,
1046-1047; Schwartz, S. et al. (2000) Genome Research 10, 577-586)
and functional RNAs (Carter, R. J. et al. (2001) Nucleic Acids
Research 29, 3928-3938).
[0089] Rice and maize are two domesticated species in the Poaceae,
the grass family of flowering plants, which includes wheat, barley,
sugarcane, and other cultivated staples. This family has about
10,000 species that have been grouped together based on shared
morphological traits and nucleotide sequences. [Phylogenies built
upon these data suggest that grasses are monophyletic, with an
ancestral genome existing about 50 million years ago (MYA) for
almost all of the common grasses, and perhaps 70 MYA if the basal
grass genera are included (Kellogg, E. A. (2001) Plant Physiology
(Rockville) 125, 1198-1205)]. Many grass genes are similar enough
at a nucleotide level to permit comparative grass gene mapping via
cross species Southern blot hybridization (Gale, M. D. & Devos,
K. M. (1998) Proceedings of the National Academy of Sciences of the
United States of America 95, 1971-1974). It has been hypothesized
that all grasses have approximately the same genes in roughly the
same order (Devos, K. M. & Gale, M. D. (2000) Plant Cell 12,
637-646). This order may need to be deduced by a process called
"consolidation" (Freeling, M. (2001) Plant Physiology (Rockville)
125, 1191-1197). Without being bound by theory, if different
grasses have the same genes in the same order, then the
morphological and physiological diversity of grasses is essentially
allelic diversity distributed phylogenetically. Thus, it is of
particular importance and interest to identify and to
phylogenetically analyze those potential regulatory sequences
responsible for the allelic diversity. There are now enough
orthologous genomic DNA sequences in grasses, notably between maize
and rice, to begin to address the question of grass gene regulatory
diversity.
[0090] When genomic DNA sequences carrying orthologous genes in
related organisms are compared, the exon sequences and the
exon-intron structure line-up near-perfectly. The regions of gene
that do not encode proteins, including the stretches of DNA that
encode untranslated RNA, are called "noncoding sequence." When
these are compared--which can be done using a variety of
algorithms, the general result is that noncoding regions show
little or no obvious sequence homology. The exceptions are called
CNSs, or conserved noncoding sequences. A recent review, focusing
on man and mouse, has been written by Ross C. Harrison (Harrison,
R. C., 2000. Trends in Genetics 16, 369-372: Conserved noncoding
sequences are reliable guides to regulatory elements. The
pioneering paper of G. G. Loots and coworkers (2000, Science 288,
136-140: Identification of coordinate regular of interleukins 4, 13
and 5 by cross-species comparisons.) showed that a CNS identified
by man-mouse comparison actually bound a regulatory protein.
Similarly, Kammandel and coworkers (Developmental Biology
205:79-97: Gottgens and coworkers (2001, genome Research 11, 87-97.
Long-range comparison of human and mouse SCL loci: localized
regions of sensitivity to restrictions endonucleases correspond
precisely with peaks of conserved noncoding sequence) find that
CNSs tend to be available to nucleases, as expected of regulatorily
active chromatin. Distinct cis-essential modules direct the
time-space pattern of the Pax6 gene activity.) showed function of a
CNS highly conserved between a fish, mouse and man. Similarly, when
dog is added to human-mouse comparisons, there remain a large
number of CNS conservations, conservations that hold during the
very approximately 100 million years of divergent evolution from a
Cretacious (144-65 Mya) ancestor, but there have been questions as
to how much of these CNSs are simply "leftover" from the ancestor,
and do not reflect conservation for function. Dogs, mice and humans
are species in different orders of mammals. All grasses are in the
same family, and are thought to be related to a common grass
ancestor 50-70 Mya, with rice and maize diverging approximately 50
Mya (E. A. Kellogg, 2001. Evolutionary history of the grasses.
Plant Physiology 125, 1198-1205; M. Freeling, 2001. Grasses as a
single genetic system: Reassessment 2001. Plant Physiology 125:
1191-97).
[0091] Identification of CNSs in Plants and Other Organisms
[0092] CNSs are identified in plants and other organisms by
techniques familiar to workers of ordinary skill in the art. As
detailed in the Example, in one non-limiting embodiment, CNSs are
identified using a set of custom Perl scripts that perform the
following operations: Input--Two genomic DNA sequences of the loci
to be compared and on protein sequence corresponding to one of the
genomic sequences are used as input for the program. Masking--The
coding regions of the DNA sequences are identified using NCBI's
BLASTX. The sequence in the coding regions is replaced with a
string of N's, which will not be compared in the next step. In the
comparison step, the DNA sequences are compared using NCBI's
BLASTN, which identifies stretches of homologous sequence between
the two masked sequences. A log file is generated containing these
results for use in the next step. This step identifies sequence
conservation of CNSs. In the graphical output step, the log file
from the comparison step is used to generate a graphical
representation showing which shows positional of CNSs. The search
window is set at a desired size in BLAST, for example 7 bp. The two
masked genomic sequences are then compared using, for example,
NCBI's bl2seq (Tatusova, T. A. & Madden, T. L. (1999) FEMS
Microbiology Letters 174, 247-250), with the following parameters:
for finding stringent CNSs Word size=7, Gap Penalties: Existence=5,
Extension=2; for finding long CNSs Word size=7, Gap Penalties:
Existence=2, Extension=1. The positions of CNSs relative to
intron/exon structure may be visualized using Perl scripts to parse
the output of both the blastx and bl2seq results.
[0093] For the purposes of this invention, CNSs can be identified
in any organism by many procedures including database scanning and
comparisons, direct sequence comparisons, etc.
[0094] Uses of CNSs
[0095] The conserved noncoding sequences (CNSs) of the invention
find many uses. In particular, the CNSs of the invention find use
in identifying polymorphisms between two or more DNA sequences. The
CNSs find further use in mapping including cross-species alignment
of DNA sequences and alignment of syntenic regions outside of
coding regions.
[0096] The CNSs may also be utilized in gene cloning including
capturing or isolating of sets of related genes.
[0097] The CNSs may be also utilized for analyzing promoter
sequences including (a) identifying functional cis-acting sequences
within a promoter; (b) identifying binding sites for transcription
factor complexes; (c) isolating or physically capturing DNA binding
proteins/transcription factors; (d) linking binding sites to
appropriate transcription factors via gene expression profiles; (e)
designing promoters with novel expression characteristics and (f)
titrating out transcription factors via replication of
CNS-containing DNA.
[0098] Stretches of genomic information may have shared noncoding
sequence motifs. These motifs may contain regulatory elements, such
as cis-acting promoters or transcription factor complex binding
sites. Thus, QTLs or genes in a region of genomic sequence may be
under the control of common cis-acting promoter elements. The CNSs
may be used to identify functional cis-acting sequences within a
promoter or binding sites for transcription factor complexes.
Additionally, through recognition of conserved nucleotide binding
sites within noncoding regions, techniques known in the art may be
used to capture the nucleotide binding proteins. The regulation of
gene expression may be altered through modification of one or
several CNS cis-acting regulation sites. QTL expression levels may
be controlled by in-situ modification of CNS sites. For example,
QTL expression may be altered by modification of CNS sequences.
Alternatively, promoters may be specifically designed to contain
novel expression characteristics. In addition, the regulatory
elements contained within a CNS may be capable of regulating
clusters of QTLS. Thus, by recognizing the regulation of QTLS,
regulatory networks and pathways may be construed, such that
clusters of gene sets which are co-regulated may be deciphered.
Futhermore, in addition to using the CNSs for gene cloning
directly, once a gene has been mapped, it can also be cloned.
Positional gene cloning uses the proximity of a genetic marker to
physically define a cloned chromosomal fragment that is linked to a
QTL identified using the CNSs of the invention. Clones of linked
nucleic acids have a variety of uses, including as genetic markers
for identification of linked QTLs in subsequent marker assisted
selection (MAS) protocols, and to improve desired properties in
recombinant plants where expression of the cloned sequences in a
transgenic plant affects an identified trait. Common linked
sequences, which are desirably cloned, include open reading frames,
e.g., encoding nucleic acids or proteins which provide a molecular
basis for an observed QTL. If markers are proximal to the open
reading frame, they may hybridize to a given DNA clone, thereby
identifying a clone on which the open reading frame is located. If
flanking markers are more distant, a fragment containing the open
reading frame may be identified by constructing a contig of
overlapping clones.
[0099] The CNSs of the invention further find use in identifying
genes encoding RNA only; constructing regulatory networks and
pathways and studying clustering and relationships of co-regulated
gene sets.
[0100] The CNSs of the invention can also be utilized to alter the
expression level and specificity of endogenous genes by in situ
modification of CNSs.
[0101] The CNSs of the invention find particular use as primers.
For use as amplification primers, conserved noncoding sequences of
15, 16, 17 and 18 mers and longer oligonucleotides find use in the
invention. For computational analysis, 7, 8, 9, 10, 11, 12, 13, 14,
15 and 16 mers and longer oligonucleotides find use in the
invention. When smaller oligonnucleotides (e.g. 7 mers) are used in
computational analysis clusters of oligomers are generally required
in addition to the use of algorithms to interpret the data.
[0102] Identification of Polymorphisms
[0103] In one embodiment, the CNSs of the invention find use in
identifying polymorphisms. As discussed above, a polymorphism is a
change or difference between two related nucleic acids. In one
format, the invention is directed to a method of identifying a
polymorphism between two or more DNA sequences by a) selecting a
first and a second primer for use in an amplification reaction
wherein the first or second primer is a CNS in the two or more DNA
sequences; b) hybridizing the first and second primers to the two
or more DNA sequences to form primer-DNA hybrids; c) amplifying the
primer-DNA hybrids to form amplified DNA products; and d)
separating the DNA products by size to identify a polymorphism
between the two or more DNA sequences.
[0104] Once isolated, such polymorphisms have many uses, including
use in gene cloning and mapping.
[0105] Mapping
[0106] The CNSs of the invention are useful in mapping in all
organisms including plants, animals, yeast and fungi. Such mapping
includes classical Mendelian mapping and QTL mapping. (Patterson,
A. H., 2002. What has QTL mapping taught us about plant
domestication? New Phytologist 154: 591-608.) Traits are encoded by
what are often called Quantitative Trait Loci or QTLS. The reason
that QTLs are not simply called "genes" or "gene regions" is simply
historical, because the difference in a quantitative trait is often
encoded by multiple alleles at multiple genes, and these often
involve complex patterns of interaction with modifier alleles. In
fact, a QTL is most often but a single allelic difference
penetrating through a great deal of noise.
[0107] Prior to the present invention, PCR-based QTL analyses were
done in species where mapped primer pairs are available that
amplify a fragment of genome that is rich in simple sequence
repeats (SSRs) or insertions/deletions (Indels). A recent example
of an SSR-based QTL map in maize is the work of Wang and coworkers,
on the subject of mapping QTLs influencing elongation factor la
content in the endosperm (Plant Physiology 125: 1271-1282).
However, the maize SSR primers used not only did not adequately
cover the maize genome, but were also useless very far outside the
genus Zea. Historically, when the genetic maps of different grasses
have been compared for the purpose of comparing them
one-to-another, coding sequence has been used to probe by DNA-DNA
hybridization Southern blots on which are segregating RFLP
fragments. In contrast to the use of CNS in mapping as described
for the present invention, this prior art method is not
amplification-based and takes a very large amount of time. The
typical map prepared utilizing RFLP fragments has markers every
20-30-map units; only a very course map emerges. Devos and Gale
(2001. Plant Cell 121, 637-646: Genome relationships: the grass
model in current research.) Have recently reviewed the comparative
grass genome mapping data; all of these data derive from probing
via hybridization with exon sequence.
[0108] In contrast to the prior art methods, mapping with CNSs is
rapid, efficient and effective. Mapping with CNSs uses many of the
basic techniques of mapping.
[0109] For plants, general mapping techniques are well known. In a
representative first step, two different parental lines that can
cross (P1 and P2) are selected. One parent should carry the trait
or traits of interest, while the other plant should not carry this
trait. These plants should represent races as different as is
possible so that they will be likely to display polymorphism for
the markers used in the mapping study. In a second step, a cross is
made between P1.times.P2. The result is the F1 (hybrid), which will
be a family or population of allelic pairs. In a subsequent step, a
specific crossing protocol is initiated, of the many that can work
(Patterson, 2002) and are available to one of ordinary skill in the
art.
[0110] Next, the plants are selfed and F2 seed is collected. F2
plants are grown for character analysis and for DNA collection and
is known as the F2 mapping population. Alternatively, individual
F2's can be selected to get F3's. These F3's are selfed to get F4's
etc., until recombinant inbred lines (RILs) are produced.
[0111] For dominant characters of interest, backcrossing to the
plant (P) that does not express the character generates a BC1
family. This might be repeated (BC2) and perhaps RILs generated
after the back crosses. The backcrosses are a good point to apply
some selection to ensure that the trait of interest is expressing
well in the mapping population.
[0112] There are many variations to the above mapping strategies
within the scope of the invention. Most mapping strategies will
generally utilize some of the steps outlined above. The subsequent
step(s) differ depending on the markers used in the mapping study
and the species mapped.
[0113] In one example, mapping may be carried out completely within
a model species, where molecular tools are available, like in
maize, rice, cows and the like.
[0114] Mapping with CNSs offers numerous advantages over prior
techniques. In prior art mapping techniques, microsatelite markers
covering all chromosomes were utilized. In these methods,
characters are interval mapped using one of the many QTL programs,
as has been done for twinning frequency in a population of cows
(Uen et al., 2000), or using AFLPs for measuring levels of
polymorphism between the crop foxtail millet and its weedy
relatives (Le Theirry d'Ennequin et al., 2000), SSRs for mapping
cold-tolerance in maize (Enoki et al., 2002), and for mapping
differences between cultivated and wild rice, two species in the
same genus (Brondanni et al, 2002). Brondanni, C, PHN Range[, RPV
Brondani and ME Ferreira, 2002. QTL mapping and introgression of
yield-related traits from Orya glumaepatula to cultivated rice
using microsatellite markers. Theor Appl Genet 104: 1192-1203.
However, in contrast to mapping with CNSS, the SNPs, SSRS, AFLPs
and microsatalites used in these studies do not work on species in
different tribes or subfamilies. Even when the markers are
gene-anchored, as with some of the SSRs, the exon region that is
polymorphic in one genus is simply not polymorphic in others.
[0115] CNS-AFLP analysis
[0116] In a preferred embodiment, CNS mapping is combined with AFLP
mapping to produce a robust and effective mapping technique herein
referred to as "CNS-AFLP mapping". CNS-Amplified Fragment Length
Polymorphism (AFLP) mapping analysis combines the efficiency of all
amplification-based techniques with the gene-anchored quality of
RFLP and allozyme markers.
[0117] Amplified Fragment Length Polymorphism is a DNA
fingerprinting technique available from Keygene, B. V. which
detects DNA restriction fragments by means of PCR amplification The
AFLP.RTM. technology usually includes the following steps: (1)
restriction of DNA with two restriction enzymes, generally a
hexa-cutter and a tetra-cutter; (2) ligation of double-stranded
(ds) adapters to the ends of the restriction fragments; (3)
amplification of a subset of the restriction fragments using two
primers complementary to the adapter and restriction site
sequences, and extended at their 3' ends by "selective"
nucleotides; (4) gel electrophoresis of the amplified restriction
fragments on denaturing polyacrylamide gels ("sequence gels"); (5)
the visualization of the DNA fingerprints by means of
autoradiography, phospho-imaging, or other methods.
[0118] Amplified Fragment Length Polymorphism technology is a
random amplification technique. In contrast, CNS-AFLP mapping
utilizes specific CNSs as primers and is, therefore, a specific
amplification technique. CNS-AFLP primers make use of stringent PCR
conditions. The CNS amplification primers are generally 15-21
nucleotides in length and anneal perfectly to their target
sequences. This renders Amplified Fragment Length Polymorphism with
CNS primers a very reliable and robust technique, which is
unaffected by small variations in amplification parameters (e.g.
thermal cyclers, template concentration, PCR cycle profile).
[0119] Restriction fragment patterns generated by means of the
Amplified Fragment Length Polymorphism with CNS primers are a rich
source of restriction fragment polymorphisms which can be utilized
as markers. The frequency with which markers are detected depends
on the level of sequence polymorphism between the tested DNA
samples. The molecular basis of polymorphisms will usually be
sequence polymorphisms at the nucleotide level.
[0120] The CNS-AFLP techniques can be used in a large number of
applications, such as the use of CNS markers in genetic studies,
such as biodiversity studies; the analysis of germplasm
collections; the genotyping of individuals; genetic distance
analyses; the identification of closely-linked DNA markers and the
construction of genetic DNA marker maps. The CNS-AFLP techniques
can also be utilized in the construction of physical maps using
genomic clones such as YACs and BACs, in the precision mapping of
genes, and the subsequent isolation of these genes.
[0121] One such CNS-AFLP marker is described in the Example:
CNS3-Exon1 lg1-specific marker. This pair of PCR primers is known
to work on many grasses from almost all subfamilies of grass. We
have compared different accessions--cultivars or landraces--of two
different species of Setaria: Setaria glauca and Setaria fabarii.
When the PCR products were run out on gels, they all looked to be
about the same size (FIG. 4A). However, when the products were cut
with 4-cutter restriction enzyme, MspI, polymorphism at the lg1
gene was detected for both species. (FIG. 4B, Setaria CNS-AFLP
polymorphisms). This is one CNS-AFLP marker anchored to the known
grass gene lg1. Identifying one of these markers every 10 map units
(130 or so), provides a pan-grass toolbox of CNS-AFLP mapping
markers for low resolution mapping.
[0122] CNS-AFLP can be utilized in conjunction with traditional
mapping techniques. For example, sort mapping of a population into
those members of the population that express the character and
those that do not express the character. In the method, DNA is
prepared from each individual and a small fraction of this DNA is
used as template for an amplification reaction with primer pairs
that differentiate--via fragment lengths, between P1 and P2. If the
character segregates and assorts independently of a marker
polymorphism, there is no linkage. However, if one of the marker
point happens to be right next to the locus determining the
character, or to a QTL specifying some component of the character,
or to some combination of alleles that--together--interact to
specify a character, then the character can be mapped, however
crudely, to a chromosome. Since CNS-AFLPs may be constructed for
every gene of interest, for example grass genes, a crude map
position can soon be reduced to more specific map positions. If a
character or QTL can be mapped to about 1 map unit, that is
approximately 147 genes (see Freeling, 2000 for calculation). Among
these genes will be the gene or genes responsible for the character
or component of character being mapped.
[0123] In one specific embodiment, CNS AFLP mapping can be utilized
in a cross between one rare, unknown grass with another rare,
unknown grass. The CNS-AFLP primer pairs will work just as well on
any grass genome, and map the character efficiently onto the rice
genome. General mapping techniques and strategies are described in
the following references which are hereby incorporated by reference
in their entirety. Crasta, OR, WW Xu, DT Rosaenow, i. Mullet and HT
Nguyen, 1999. Mapping of post-flowering drought resistance traits
in grain sorghum: association between QTLs influencing premature
senescence and maturity. Molec Gen Genetics 262: 579-588. Devos, KM
and MD Gale, 2000 Genome relationships: the grass model in current
research. Plant Cell 12: 637-646. Devos, KM, ZM Wand, J. Beales, T.
Sasaki and MD Gale, 1998. Comparative genetic maps of foxtail
millet (Setaria italica) and rice. Theor Appi Genet 96: 63-68.
Devos, K M, T S Pittaway, A Reynolds and M D Gale, 2000.
Comparative mapping reveals a complex relationship between the
pearl millet genome and those of foxtail millet and rice. Theor
Appl Genet 100: 190-198. Foolad, M R and F. Q Chen, 1999. RFLP
mapping of QTLs conferring salt-tolerance during the vegetative
stage of tomato. Theor Appl Genet 99: 235-243. Freeling, M, 2001.
Grasses as a single genetic system. Reassessment 2001. Plant
Physiology 125: 1191-1197. Le Thierry d'Ennequin, O. Panaud and B.
Toupance, 2000. Assessment of genetic relationships between Setaria
italica and its wild relative S viridis using AFLP markers.
Theoret. Appl. Genet. 100: 1061-1066. Uen, S, A. Karlsen, G.
Klemetsdal, DI Vage, I. Olsaker, H. Klungland, M. Aasland, B
Heringstad, J. Ruane and Lgomez-Raya, 2000. A primary screen of the
bovine genome for quantitative trait loci affecting twinning rate.
Mammalian Genome 11: 877-882. Poncet, V, f Lamy, KM Devos, MD Gale,
A. Sarr and T. Robert, 2000. Genetic control of domestication
traits in pearl millet. Theor Appl Genet 100: 147-159. Wang, R. L.,
Devos, K, Liu c., and M. Gale, 1998. Construction of RFLP-based
maps of foxtail millet, Setaria italica (L.) Theoret. Appi. Genet
96: 31-36. Yadev, RS, C T Hash, F R Bidinger, G P Cavab abd C J
Howarth, 2002. Quantitative trait loci associated with traits
determining grain and stover yield in pearl millet under terminal
drought-stress conditions. Theor Appl Genet 104: 67-83.
[0124] One way to map a character in an as yet unexplored plant is
to link that character to some PCR fragment size, and then--after
linkage is ascertained on a sequencing gel--one may go back and
sequence the responsible PCR fragment to obtain the exon sequence
that would anchor the marker to a real gene. By using combinations
of promoter CNS primers and either exon primers or intron CNS
primers, just such "exon-anchored" fragments are generated. If the
polymorphisms cannot be seen in whole PCR fragments, than the
fragments might be restricted with multiple 4-base cutters
(restriction enzymes) until small fragments are generated, and
analyzed on a sequencing gel. This method allows detection of small
promoter/intron indels and SSRS, and the gene from which this
fragment derived is reconstructed. Thus, a tool box of
amplification primers may be prepared that will generate a
diversity of amplification fragment sizes, and if any of these
lengths mark a trait of interest, that fragment can be
"reconstructed" and then the responsible amplification product
sequenced to identify the gene, and thus the location in the
ancestral grass gene order.
[0125] CNS-AFLP mapping offers several advantages over prior art
techniques as indicated below. Marker selection is dependent upon
whether or not the marker is gene-anchored, how difficult/expensive
they are to use, and whether or not the marker will work outside of
the species/genus for which it was designed to be polymorphic
(other tribes?). As you can see from the list below, of all the
molecular mapping marker "tool kits," CNS-AFLP is gene-anchored and
useful at the family level (like RFLPs are), but is also PCR-based
(inexpensive and quick).
1 Gene- Difficult?/ Method anchored? Expensive? Other tribes? RFLP
yes yes yes SSR sometimes no no SNP yes no no Microsatellite no no
no AFLP and relatives no no no CNS-AFLP yes no yes
[0126] A primary motivation for development of molecular markers in
animal and crop species is the potential for increased efficiency
in breeding through marker assisted selection (MAS). After
appropriate CNSs have been identified as described above, the
corresponding genetic marker alleles can be used to identify plants
that contain the desired genotype at multiple loci and would be
expected to transfer the desired genotype along with the desired
phenotype to its progeny.
[0127] The presence and/or absence of a particular genetic marker
allele in the genome of a plant or animal exhibiting a preferred
phenotypic trait is made by using the CNS techniques described
above. If the nucleic acids from the plarit hybridizes to a probe
specific for a desired genetic marker, the plant can be selfed to
create a true breeding line with the same genome or it can be
crossed with a plant with the same QTL or with other desired
characteristics to create a sexually crossed F.sub.1
generation.
[0128] In another embodiment, CNS primers may be used in
combination with other genetic markers, including RFLPs, AFLPs,
isozymes, specific alleles and variable sequences. Mapping may be
performed using high-throughput screening. In one embodiment, high
throughput screening involves providing a library of genetic
markers including RFLPs, AFLPS, isozymes, specific alleles and
variable sequences, including SSR. Such "libraries" are then
screened against plant genomes. Once the genetic marker alleles of
a plant have been identified, a link between the marker allele and
a desired phenotypic trait can be determined.
[0129] CNSs and Gene Cloning
[0130] The CNSs of the invention can be utilized to clone genes
from related species. For example, a CNS from rice and maize can be
utilized to clone the corresponding gene from another moncot by
procedures well known in the art and described below. Futhermore, a
CNS from Arabidopsis and tomato can be utilized to clone the
corresponding gene from another dicot by similar procedures. Such
procedures are described in, for example, Ausabel, et al. Current
Protocols in Molecular Biology as described in detail below.
[0131] CNS primers may also be used in related genomes to amplify a
genomic fragment. The CNS primers may be used to capture genes;
gene segments (exons) or non-coding regions. The CNS primers may
also be used with non-CNS primers to amplify a genomic fragment.
Thus, it is possible to capture sets of related genes in different
species using the conserved primers. Also, alignment of syntenic
regions which lie outside of coding regions may be performed.
Conserved noncoding regions are useful for phylogenetic studies
where evolutionarily divergent or convergent genes are being
studied.
[0132] In addition, any of the cloning or amplification strategies
described herein are useful for creating contigs of overlapping
clones, thereby providing overlapping nucleic acids which show the
physical relationship at the molecular level for genetically linked
nucleic acids. A common example of this strategy is found in whole
organism sequencing projects, in which overlapping clones are
sequenced to provide the entire sequence of a chromosome. In this
procedure, a library of the organism's cDNA or genomic DNA is made
according to standard procedures described, e.g., in the references
above. Individual clones are isolated and sequenced, and
overlapping sequence information is ordered to provide the sequence
of the organism. See also, Tomb, et al., Nature 388:539-547 (1997)
describing the whole genome random sequencing and assembly of the
complete genomic sequence of Helicobacter pylori, Fleischmann, et
al., Science 269:496-512 (1995) describing whole genome random
sequencing and assembly of the complete Haemophilus influenzae
genome; Fraser, et al., Science 270:397-403 (1995) describing whole
genome random sequencing and assembly of the complete Mycoplasma
genitalium genome and Bult, et al., Science 273:1058-1073 (1996)
describing whole genome random sequencing and assembly of the
complete Methanococcus jannaschii genome. Recently, Hagiwara and
Curtis, Nucleic Acids Res. 24(12): 2460-2461 (1996) developed a
"long distance sequencer" PCR protocol for generating overlapping
nucleic acids from very large clones to facilitate sequencing, and
methods of amplifying and tagging the overlapping nucleic acids
into suitable sequencing templates. The methods can be used in
conjunction with shotgun sequencing techniques to improve the
efficiency of shotgun methods typically used in whole organism
sequencing projects. As applied to the present invention, the
techniques are useful for identifying and sequencing genomic
nucleic acids genetically linked to the QTLs as well as "candidate"
genes responsible for QTL expression.
[0133] Cross-Species Alignment of DNA Sequences Using CNSs.
[0134] The CNSs of the invention can also be utilized for
cross-species alignment of DNA sequences. In one format, a
complete, annotated sequence of one individual, of one species such
as rice is obtained. In another format, shotgun sequence of a
rice-related species is obtained. Two sequences are said to be
related if they have about the same genes in about the same order
on the chromosome; e.g. corn shares this relationship to rice.
Next, the sequences are virtually aligned using the complete
sequence of rice to identify CNSs. Such CNSs are effective tools
for alignment of sequences.
[0135] Indentification of Genes that Encode RNA but Not
Protein.
[0136] Any transcribed sequence that is not translated is an RNA
gene. Ribosomal RNA subunits, spliceosomal RNAs, and other RNAs
involved in gene silencing are well known cases. As with any other
biologically important information, these RNA sequences will be
conserved over evolutionary time, and will be identifiable as CNSs.
Identification of genes encoding RNA is principally performed in
two ways: 1) Computationally--RNAs are identified based on
secondary structure, evolutionary conservation (CNS), or other
sequence based methods (Eddy, 2002; Storz, 2002). 2)
Experimentally--non-coding RNAs are physically isolated, purified,
and sequenced (Lau et al., 2001; Lee and Ambros, 2001). In another
format, reverse transcriptase PCR is utlized to determine if a CNS
region is represented in the RNA pool (Bauer et al., 1994). This
experimental verification step is needed because so little is known
about genes that encode RNA only. Bauer, P, M D Crespe, J Szecsi, L
A Allison, M. Schultze, P. Ratert, E. Kondorosi and A. Kondorosi,
1994. Alfalfa enod12 genes are differentially regulated during
nodule development by Nodfactors and Rhizobium invasion. Plant
Physiol. 105: 585-592.
[0137] Identification of Functional Cis-Acting Sequences Within a
Promoter
[0138] Functional cis-acting sequences can be identified both
computationally and experimentally based on evolutionary
conservation of the sequences utilizing the CNSs of the invention.
Generally, the following steps are followed: 1) Genomic sequences
from orthologous genes from two or more related organisms is
obtained. These sequences can be found in public DNA sequence
databases or can be generated by sequencing the gene of interest
from the organism's genomic DNA. 2) The sequences are then compared
with one of many sequence comparison tools. BLAST (Altschul et al.,
1997; Kaplinsky et al., 2002), and Vista (Dubchak et al., 2000;
Mayor et al., 2000) are two of many publicly available tools (Levy
et al., 2001; Sumiyama et al., 2001). The coding regions (exons)
will be conserved. Outside of the coding regions, any conserved
noncoding sequences (CNS) represent potentially functional
cis-acting sequences. 3) The function of the identified non-coding
sequences is then tested. Typically, transcription factor DNA
binding sites are identified by gel shift assays. After identifying
the promoter regions, the promoter region sequences can be employed
in double-stranded DNA arrays to identify molecules that affect the
interactions of the transcription factors with their promoters
(Bulyk et al. (1999) Nature Biotechnology 17:573-577). In addition,
this is accomplished by creating transgenic constructs with and
without modified or non-modified cis-elements. This could also be
tested by identifying individuals with altered cis-elements using a
reverse genetics approach. If the cis-elements are functional, a
difference in gene expression will reflect changes to the
cis-elements.
[0139] Identification of Binding Sites for Transcription Factor
Complexes
[0140] Transcription factor binding sites can be computationaly
identified in many ways, including the comparative methods
described above. Other methods rely on correlating gene expression
profiles with sequences or by looking for clusters of known
transcription factor (TF) binding sites or CNSs. Methods include 1)
acquiring genomic sequences (see above, step 1). A database of TF
binding sequences is needed for most of the analysis, and many are
publicly available (Ghosh, 2000; Heinemeyer et al., 1999;
Heinemeyer et al., 1998; Higo et al., 1999; Lescot et al., 2002;
Wingender et al., 1997). 2) Sequences are analyzed using one of
many methods including gel shift assays. These can include locating
clusters of previously identified TF binding sites (Markstein et
al., 2002; Zhu et al., 2002). Another method involves combining
frequency and positional information to predict
transcription-factor binding sites (Kielbasa et al., 2001). A third
method is identifying CNSs (see above). These CNSs are conserved
because they are biologically important, and one possible
biological function they could have is a TF binding site.
[0141] The CNSs may be utilized to physically capture DNA binding
proteins. There are many methods used to physically capture DNA
binding TFs available to those of skill in the art. Most of them
are based on using a specific cis-regulatory segment of DNA to
enrich total protein from an organism for TFs that bind
specifically to the DNA used (Heinekamp et al., 2002; Honda et al.,
2001).
[0142] Construction of Regulatory Networks and Pathways
[0143] Expression data or intimate knowledge of a promoter and its
trans-regulatory factors can be used to construct regulatory
networks of genetic function both computationally and
experimentally using CNSs. 1) Computationally--RNA expression
profiles from multiple experiments are analyzed and co-regulated
sets of genes (see clustering) are identified (Toh and Horimoto,
2002; Wyrick and Young, 2002). Genes that are co-regulated are
considered to be regulated by the same regulatory upstream genes.
By reiteratively elucidating the regulation of the upstream genes,
a regulatory network is constructed. 2) Experimentally--A promoter
is analyzed to determine the regions it contains that are
biologically important for regulation. Combined with knowledge
about the trans factors that bind these cis regulatory sequences, a
regulatory network can be elucidated (Davidson et al., 2002).
[0144] Clustering of Coregulated Gene Sets
[0145] Clustering of coregulated genes is performed by analyzing
gene expression data sets using the CNSs of the invention.
Generally, RNA or protein expression data is acquired from various
conditions or tissues. Next, this data is analyzed using one of
many available computational tools (Azuaje, 2002; Xu et al.,
2002).
[0146] Link Binding Sites to Appropriate Transcription Factors Via
Gene Expression profiles
[0147] Binding sites may be linked to appropriate transcription
factors via gene expression profiles by 1) generating dusters of
co-regulated genes using the methods described above; 2)
identifying cis-elements in the promoters/introns of coregulated
genes using any available computational method (Birnbaum et al.,
2001; Bussemaker et al., 2001; Harmer et al., 2000) and 3)
Identifying the TFs that bind to these cis-elements by physically
capturing them (above) or by searching binding site databases (for
example TRANSFAC, ooTFD, and PLACE) (Ghosh, 2000; Heinemeyer et
al., 1999; Heinemeyer et al., 1998; Higo et al., 1999; Wingender et
al., 1997) for the TFs that correspond to cis-element
sequences.
[0148] Phylogenetic Analysis of a Promoter.
[0149] Promoters may be analyzed by various methods. In a first
method, a hybridization probe is required to identify the target
sequence. This method is done individually for each species to
isolate the related fragment to compare the promoter sequences. In
step 1, the desired fragment to be cloned from the genomic DNA
(usually done by a hybridization based method) is identified. In
step 2, the genomic DNA of the corresponding size range is
isolated. In step 3, the DNA is subcloned into a phage vector, for
example, using the Stratagene Lambda Zap Express protocol available
from Stratagene, San Diego Calif. In step 4, the library is
screened by hybridization for the correct insert. In step 5, the
DNA is sequenced. In step 6, the sequence is compared with a
reference sequence (possibly a distantly related species). In step
7, Blast or other algorithms are utilized to identify CNSs.
[0150] In a second method, inverse PCR is utilized. A small amount
of sequence adjacent to the sought after sequence is required to
design PCR primers. This method is done individually for each
species to isolate the related fragment to compare the promoters.
In step 1, the genomic DNA is digested with a restriction enzyme.
In step 2, the DNA is ligated back together under conditions that
favor intramolecular ligation (within the same piece of DNA). In
step 3, the ligated circular DNA is used as templates for a PCR
reaction by amplifying with the primers facing outward (away from
the known sequence). In step 4, it is confirmed that the amplified
sequence is correct by using the amplified fragment in another
round of PCR using nested primers to amplify. In step 5, the DNA is
sequenced. In step 6, the sequences are compared with a reference
sequence (possibly a distantly related species). In step 7, Blast
or other algorithms are used to identify CNSs.
[0151] In a third method, one or more CNSs are utilized in a PCR
reaction. In this method, the CNS is identified using the methods
described above and is used to amplify the promoter region from any
related species. Multiple species are analyzed in parallel so the
analysis is much faster. In step 1, the identified CNS (facing
downstream towards the exons) and an exon 1 conserved primer
(facing upstream towards the promoter) in a PCR reaction is
utilized. In step 2, the identity of the amplified fragment is
confirmed as correct by hybridizing the amplified fragments with an
exon 1 conserved probe. In step 3, the DNA is sequenced. In step 4.
The sequences are compared with the other amplified sequences and
the original two reference sequences.
[0152] Biochemical Techniques for Use of the CNSs
[0153] Various techniques available and known to those of ordinary
skill in the art may be utilized in the techniques of the
invention. Such techniques include the following:
[0154] (a) Gel Electrophoresis
[0155] Techniques for gel electrophoresis of DNA, e.g., following a
CNS hybridization reaction, are well known in the art. See
generally, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, pp.
2.5.1-2.5.17, 5.4.1-5.4.4, 7.0.3-7.0.11, 7.6.1-7.6.9, 15.8.3 and
15.8.4-15.8.5 (Ausubel, et al., eds. John Wiley & Sons, 1994).
Both polyacrylamide and agarose gel electrophoresis can be used to
separate the selectively amplified DNA restriction fragments. The
composition of the gel is chosen based on the degree of resolution
that is needed. Agarose can separate DNA strands that are 50-100
nucleotides different in size, unless special materials are used.
Acrylamide can routinely separate molecules which differ by 1-2
bases. Following electrophoresis, the fragments can be visualized
by a number of staining techniques known in the art. For example,
silver staining can be used to visualize DNA on a polyacrylamide
gel. See BioTechniques 17(5):915 (1994). In a preferred embodiment,
4.5% polyacrylamide gels are fixed in 10% ethanol/0.5% acetic acid
for 5-10 minutes. Gels are then incubated in 10% ethanol/0.5%
acetic acid/0.25% silver nitrate for 5-10 minutes. Gels are then
rinsed twice with deionized water for less than one minute. Gels
are developed in 3% sodium hydroxide/1% formaldehyde until bands
appear (5-10 minutes). Following this, gels are incubated in a
fixing solution (10% ethanol/0.5% acetic acid) for 5 minutes and
washed in deionized water for 10 minutes.
[0156] Bands can also be visualized by using fluorescent dNTPs
during the PCR reaction. To visualize the bands the gel can be
continuously exposed to UV light. Additional information on
fluorescent labeling techniques are described, supra. Another
technique is labeling one of the PCR primers with T4 kinase and
P.sup.33 or P.sup.32, exposing the gel to film, and marking the
bands using pins which have been dipped in India ink prior to
excision. This technique is useful when a single unique band is
desired and high sensitivity is needed. It is, however, more
tedious than silver staining for isolating all polymorphic DNA
strands amplified with any given primer pair.
[0157] Each band visualized on the electrophoresis gel represents a
population of DNA fragments of approximately the same size. In
selecting DNA bands visualized on an electrophoresis gel that are
unique to the population of interest (polymorphisms), visual
comparison of DNA gel electrophoresis patterns is employed, using
techniques known in the art. Polymorphisms useful as markers are
selected on the basis of their visibility on the electrophoresis
gel and their ability to reproducibly hybridize. Primer pairs are
chosen for ability to amplify a large number of bands polymorphic
between a heterogeneous set of inbreds and for amplification of few
highly labeled monomorphic bands which can compete for nucleotides
during the amplification process.
[0158] (b) Band Isolation and Identification
[0159] Individual bands visualized on an electrophoresis gel are
cut out of the gel, e.g., using a scalpel, and amplified, e.g.,
using PCR, LCR, cloning, or the like. Using PCR as an example, the
DNA is amplified by placing the gel piece directly into a reaction
vessel containing the PCR reagents and appropriate CNS primers.
Typically, a selective primer (e.g., a Plus 1 or Plus 3 primer)
corresponding to that used in the CNS technique to produce the DNA
fragments which were electrophoresed is used as a primer for the
PCR amplification of the DNA in the gel band. In a preferred
embodiment, band amplification reactions contain the band cut out
of the gel, plus 3 primer, deoxy nucleotide triphosphates (dNTPs),
Hot Tub or Taq polymerase (Amersharm, Perkin Elmer or Boeinger
Mannheim), and buffer. Bands are amplified using 5 cycles of
94.degree. C. (30 s), 58.degree. C. (30 s), and 72.degree. C. (60
s); 5 cycles of 94.degree. C. (30 s), 56.degree. C. (30 s), and
94.degree. C. (60 s) and 20 cycles of 94.degree. C. (30 s),
50.degree. C. (30 s), and 72.degree. C. (60 s).
[0160] Variations in the exemplar amplification technique used will
be readily apparent to one skilled in the art and several
variations are set forth herein. For example, different polymerase
enzymes can be used and the reaction conditions can be varied to
optimize amplification of DNA contained in the gel band. Additional
information on PCR amplification are described supra. Similarly,
one of skill will be able to clone isolated DNAs, or amplified
DNAs.
[0161] Amplification products are run on an agarose gel, e.g.,
preferably about a 1% agarose gel, to confirm successful
amplification. If a band is seen, the products are optionally
re-amplified e.g., using the modified primers for Ligation
Independent Cloning (Pharmingen). To modify primers, a 13 bp DNA
segment complementary to the ends of the pPMG-LIC vector is added
to the Plus 1 primer according to the manufacture's instructions
(Pharmigen). The product from the second amplification is checked
on a 1% gel, and then purified using the. Qiaquick PCR Purification
Kit (Qiagen). The purified PCR products are then quantified e.g.,
by reading Hoechst dye (bis-Benzamide) fluorescence with a Dynatech
MicroFLUOR Reader.
[0162] More generally, in vitro amplification techniques suitable
for amplifying sequences for use as molecular probes (e.g., from
isolated, amplified or cloned AFLP fragments, or naturally
occurring sequences which map to unique loci) or generating nucleic
acid fragments for subsequent subcloning are available. Examples of
techniques sufficient to direct persons of skill through such in
vitro amplification methods, including the polymerase chain
reaction (PCR) the ligase chain reaction (LCR), Q.beta.-replicase
amplification and other RNA polymerase mediated techniques (e.g.,
NASBA) are found in Berger, Sambrook, and Ausubel, as well as
Mullis et al., (1987) U.S. Pat. No. 4,683,202; PCR Protocols A
Guide to Methods and Applications (Innis et al. eds) Academic Press
Inc. San Diego, Calif. (1990) (Innis); Amheim & Levinson (Oct.
1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3,
81-94; (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86, 1173;
Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874; Lomell
et al. (1989) J. Clin. Chem 35, 1826; Landegren et al., (1988)
Science 241, 1077-1080; Van Brunt (1990) Biotechnology 8, 291-294;
Wu and Wallace, (1989) Gene 4, 560; Barringer et al. (1990) Gene
89, 117, and Sooknanan and Malek (1995) Biotechnology 13: 563-564.
Improved methods of cloning in vitro amplified nucleic acids are
described in Wallace et al., U.S. Pat. No. 5,426,039. One of skill
will appreciate that essentially any RNA can be converted into a
double stranded DNA suitable for restriction digestion, PCR
expansion and sequencing using reverse transcriptase and a
polymerase. See, Ausbel, Sambrook and Berger, all supra. Further
details on these procedures are found supra.
[0163] Any of these amplification techniques can also be used to
generate amplified mixtures of DNA (i.e., from which amplified
bands are isolated, or against which probes are hybridized).
[0164] (c) Cloning Isolated Bands
[0165] Cloning methodologies for cloning DNAs from CNS amplified
gel bands (or amplicons of such bands), and for replicating nucleic
acids useful as probes, as well as sequencing methods to verify the
sequence of cloned nucleic acids are well known in the art.
Examples of appropriate cloning and sequencing techniques, and
instructions sufficient to direct persons of skill through many
cloning exercises are found in Berger and Kimmel, Guide to
Molecular Cloning Techniques, Methods in Enzymology volume 152
Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et al.
(1989) Molecular Cloning--A Laboratory Manual (2nd ed.) Vol. 1-3,
Cold Spring Harbor Laboratory, Cold Spring Harbor Press, N.Y.,
(Sambrook); and Current Protocols in Molecular Biology, F. M.
Ausubel et al., eds., Current Protocols, a joint venture between
Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.,
(through and including the 1997 Supplement) (Ausubel). A catalogue
of Bacteria and Bacteriophages useful for cloning is provided,
e.g., by the ATCC, e.g., The ATCC Catalogue of Bacteria and
Bacteriophage (1992) Gherna et al. (eds) published by the ATCC.
Additional basic procedures for sequencing, cloning and other
aspects of molecular biology and underlying theoretical
considerations are also found in Lewin (1995) Genes V Oxford
University Press Inc., New York (Lewin); and Watson et al. (1992)
Recombinant DNA Second Edition Scientific American Books, NY.
[0166] Most DNA sequencing today is carried out by chain
termination methods of DNA sequencing. The most popular chain
termination methods of DNA sequencing are variants of the
dideoxynucleotide mediated chain termination method of Sanger. See,
Sanger et al. (1977) Proc. Nat. Acad. Sci., USA 74:5463-5467. For a
simple introduction to dideoxy sequencing, see, Current Protocols
in Molecular Biology, F. M. Ausubel et al., eds., Current
Protocols, a joint venture between Greene Publishing Associates,
Inc. and John Wiley & Sons, Inc., (Supplement 37, current
through 1997) (Ausubel), Chapter 7. Thousands of laboratories
employ dideoxynucleotide chain termination techniques. Commercial
kits containing the reagents most typically used for these methods
of DNA sequencing are available and widely used.
[0167] (d) Amplification Detection Strategies
[0168] In a preferred embodiment, a polymorphic nucleotide is
detected by amplifying the polymorphic nucleotide and detecting the
resulting amplicon using the CNSs of the invention. A variety of
variations on this strategy are used to detect polymorphic nucleic
acids, depending on the materials available, and the like. In
typical cases, a biological nucleic acid is amplified. Example
biological nucleic acids are derived, e.g., from cDNA, genomic DNA
isolated from a plant or microbe, genomic DNA isolated from a plant
extract or microbial extract, genomic DNA isolated from an isolated
plant tissue, genomic DNA isolated from an isolated plant tissue
extract, genomic DNA isolated from a plant cell culture, genomic
DNA isolated from a plant cell culture extract, genomic DNA
isolated from a recombinant cell comprising a nucleic acid derived
from a plant, genomic DNA isolated from a plant seed, genomic DNA
isolated from an extract of a recombinant plant cell comprising a
nucleic acid derived from a plant, genomic DNA isolated from an
animal, genomic DNA isolated from an animal extract, genomic DNA
isolated from an isolated animal tissue, genomic DNA isolated from
an isolated animal tissue extract, genomic DNA isolated from an
animal cell culture, genomic DNA isolated from an animal cell
culture extract, genomic DNA isolated from a recombinant animal
cell comprising a nucleic acid derived from an animal, genomic DNA
isolated from an animal egg, genomic DNA isolated from an extract
of a recombinant animal cell. Certain types of sources are
preferred, depending on the application. For example, plant tissues
or seeds are preferred for performing marker assisted selection of
crops. Animal tissues are preferred for performing marker assisted
selection of animals.
[0169] In one embodiment, nucleic acid primers which hybridize to
regions of a genomic nucleic acid that flank a polymorphic
nucleotide to be detected are used in PCR LCR, or other
amplification reactions to generate an amplicon comprising a
polymorphic nucleotide to be detected. A variety of other PCR and
LCR strategies are known in the art and are found in Berger,
Sambrook, Ausubel, and Innis, all supra. See also, as Mullis et
al., (1987) U.S. Pat. No. 4,683,202, U.S. Pat. No. 4,683,195, PCR
TECHNOLOGY 1-31 (Henry A. Edich ed., Stockton Press 1989). In
brief, a nucleic acid having a polymorphic nucleic acid to be
detected (a genomic DNA, a genomic clone, a genomic amplicon a
cDNA, or the like) is hybridized to primers which flank the
polymorphic nucleotide to be detected (e.g., nucleotide
polymorphisms). As discussed, amplification mixtures are also
appropriate, in which several amplicons are simultaneously querried
in a given assay. Detection is typically performed by hybridizing
amplification reaction products to a selected probe, or to multiple
probes as described supra. Alternatively, an acrylamide or agarose
gel can be used to size separate reaction products (although this
decreases throughput, and is therefore, often undesirable); the
products can be detected by allele-specific hybridization, by
allele-specific hybridization to a polymer array as described
supra, or by sequencing the PCR amplicons (using standard Sanger
dideoxy or Maxam-Gilbert methods). Amplicons are optionally cloned
or sequenced by any of a variety of protocols as described supra
for bands isolated from AFLP gels.
[0170] Once an amplicon is sequenced, the sequence is optionally
used to select primers complementary to the amplicon, i.e., primers
which will hybridize to the amplicon. It is expected that one of
skill is thoroughly familiar with the theory and practice of
nucleic add hybridization and primer selection. Gait, ed.
Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford
(1984); W. H. A. Kuijpers Nucleic Acids Research 18(17), 5197
(1994); K. L. Dueholm]. Org. Chem. 59, 5767-5773 (1994); S. Agrawal
(ed.) Methods in Molecular Biology, volume 20; and Tijssen (1993)
Laboratory Techniques in biochemistry and molecular
biology-hybridization with nucleic acid probes, e.g., part I
chapter 2 "overview of principles of hybridization and the strategy
of nucleic acid probe assays", Elsevier, New York provide a basic
guide to nucleic acid hybridization. Innis, supra, provides an
overview of primer selection.
[0171] Primer sequences are optionally selected to hybridize only
to a perfectly complementary DNA, with the nearest mismatch
hybridization possibility from known DNA sequence typical having at
least about 50 to 70% hybridization mismatches, and preferably 100%
mismatches for the terminal 5 nucleotides at the 3' end of the
primer.
[0172] PCR primers are optionally selected so that no secondary
structure forms within the primer. Self-complementary primers have
poor hybridization properties, because the complementary portions
of the primers self hybridize (i.e., form hairpin structures).
Primers are selected to have minimal cross-hybridization, thereby
preventing competition between individual primers and a template
nucleic acid and preventing duplex formation of the primers in
solution, and possible concatenation of the primers during PCR. If
there is more than one constant region in the primer, the constant
regions of the primer are selected so that they do not
self-hybridize or form hairpin structures.
[0173] One of skill will recognize that there are a variety of
possible ways of performing the above selection steps, and that
variations on the steps are appropriate. Most typically, selection
steps are performed using simple computer programs to perform the
selection as outlined above; however, all of the steps are
optionally performed manually. One available computer program for
primer selection is the MacVector.TM.. program from Kodak. In
addition to programs for primer selection, one of skill can easily
design simple programs for any or all of the preferred selection
steps.
[0174] One of skill will recognize that a wide variety of amplicons
are provided by the present invention. In particular, amplicons are
generated with primers flanking polymorphic nucleic acids which are
identified by the methods herein. The amplicons can be generated by
exponential amplification as described in the examples herein, or
by linear amplification using a single specific primer, or by using
one of the example primers below in conjunction with a set of
random primers.
[0175] It will be appreciated that amplicons are characterized by a
variety of physicochemical properties, including, but not limited
to the following. First, the amplicons of the invention are
produced in an amplification reaction using the primers as
described above, with genomic or cDNA nucleic acid as a template
(or a derivative thereof, such as a cloned or in vitro amplified
genomic or cDNA nucleic acid). Second, single stranded forms of the
amplicons (e.g., denatured amplicons) hybridize under stringent
conditions to marker nucleic acids. Conditions for specific
hybridization of nucleic acids, including amplicon nucleic acids
are described above. A third physicochemical property of amplicons
of the invention is that they specifically hybridize to one or more
of the AFLP fragments identified using the methods herein.
[0176] In another embodiment, LCR is used to amplify a polymorphic
nucleic acid or a mixture of polymorphic nucleic acids. By
detecting the amplification product, presence of the polymorphic
nucleotide is confirmed. Detection is typically performed by
hybridizing LCR reaction products to a marker probe; alternatively,
LCR products can be run on an acrylamide or agarose gel and the
size of the reaction products detected (although this decreases
throughput in some applications, and is, therefore, often
undesireable), or the products can be detected by allele-specific
hybridization, by allele-specific hybridization to a polymer array
as described supra, or by sequencing the LCR amplicons (using
standard Sanger dideoxy or Maxam-Gilbert methods). Detection
techniques such as PCR amplification or other in vitro
amplification methods are also used to detect LCR products.
[0177] The ligation chain reaction (LCR; sometimes denoted the
"ligation amplification reaction" or "LAR") and related techniques
are used as diagnostic methods for detecting single nucleotide
variations in target nucleic acids. LCR provides a mechanism for
linear or exponential amplification of a target nucleic add, or a
mixture of DNAs comprising a target nucleic acid, via ligation of
complementary oligonucleotides hybridized to a target. This
amplification is performed to distinguish target nucleic acids that
differ by a single nucleotide, providing a powerful tool for the
analysis of genetic variation in the present invention, i.e., for
distinguishing polymorphic nucleotides.
[0178] The principle underlying LCR is straightforward:
Oligonucleotides which are complementary to adjacent segments of a
target nucleic acid are brought into proximity by hybridization to
the target, and ligated using a ligase. To achieve linear
amplification of the nucleic acid, a single pair of CNS
oligonucleotides which hybridize to adjoining areas of the target
sequence are employed: the oligonucleotides are ligated, denatured
from the template and the reaction is repeated. To achieve
exponential amplification of the target nucleic acid two pairs of
CNS oligonucleotides (or more) are used, each pair hybridizing to
complementary sequences on e.g., a double-stranded target
polynucleotide. After ligation and denaturation, the target and
each of the ligated oligonucleotide pairs serves as a template for
hybridization of the complementary oligonucleotides to achieve
ligation. The ligase enzyme used in performing LCR is typically
thermostable, allowing for repeated denaturation of the template
and ligated oligonucleotide complex by heating the ligation
reaction. To amplify a mixture of nucleic acids, multiple primers
are used (e.g., random primers, or primers comprising arbitrary
nucleotides as described supra.
[0179] LCR is useful as a diagnostic tool in the detection of
genetic variation. Using LCR methods, it is possible to distinguish
between target polynucleotides which differ by a single nucleotide
at the site of ligation. Ligation occurs only between
oligonucleotides hybridized to a target polynucleotide where the
complementarity between the oligonucleotides and the target is
perfect, enabling differentiation between allelic variants of a
gene or other chromosomal sequence. The specificity of ligation
during LCR can be increased by substituting the more specific
NAD.sup.+-dependant ligases such as E. coli ligase and
(thermostable) Taq ligase for the less specific T4 DNA ligase. The
use of NAD analogues in the ligation reaction further increases
specificity of the ligation reaction. See, U.S. Pat. No. 5,508,179
to Wallace et al.
[0180] Finally, multiple LCR reactions can be run simultaneously in
a single reaction, or in parallel reactions for simultaneous
detection of any or all of the nucleotide polymorphisms described
herein.
[0181] Nucleotide polymorphisms are also detected using other in
vitro detection methods, including TAS, 3SR and Q.beta.
amplification. (TAS), the self-sustained sequence replication
system (3SR) and the Q.beta. replicase amplification system (QB),
are reviewed in The Journal Of NIH Research (1991) 3, 81-94. The
present invention may be practiced in conjunction with TAS (Kwoh,
et al. (1989) Proc. Natl. Acad. Sci. USA 86, 1173 or the related
3SR (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874)
for detecting single-base alterations in target nucleic acids by
transcribing the target, annealing oligonucleotide primers to the
transcript and ligating the annealed primers. QB replication
(Lomell et al. (1989) J. Clin. Chem 35, 1826) may also be used in
conjunction with the ligation methods of the present invention to
detect mismatches by performing QB amplification on DNA ligated by
the methods of the present invention.
[0182] (d) Labeling and Detecting Probes
[0183] DNA from a CNS amplification reacton band can be amplified
and labeled in several ways. The DNA that is labeled can come from
the following sources: 1) Amplification product using DNA from a
gel piece as template, 2) Amplification product from an
amplification where the template is a plasmid containing an CNS
amplification band as an insert, 3) Plasmid DNA from a clone that
contains an CNS amplification band as an insert, and 4)
Oligonucleotide synthesis of subsequences of an CNS amplification
band.
[0184] Several preferred methods can be used to label and detect
the DNA from an CNS amplification band, including: 1)
Chemiluminescence [using both Horseradish Peroxidase and/or
Alkaline Phosphatase with substrates that produce photons as
breakdown products][kits available from Amersham,
Boehringer-Mannheim, and Life Technologies/Gibco BRL], 2) Color
production [using both Horseradish Peroxidase and/or Alkaline
Phosphatase with substrates that produce a colored precipitate]
[kits available from Life Technologies/Gibco BRL, and
Boehringer-Mannheim], 3) Chemifluorescence using Alkaline
Phosphatase and the substrate AttoPhos [Amersham] or other
substrates that produce fluorescent products, 4) Fluorescence
[using Cy-5 [Amersham], fluorescein, and other fluorescent tags],
5) Radioactivity using end-labeling, nick translation, random
priming, or PCR to incorporate radioactive molecules into the probe
DNA/oligonucleotide. Other methods for labeling and detection will
be readily apparent to one skilled in the art.
[0185] Amplification products are preferably diluted {fraction
(1/10)}, resulting in a concentration of approximately 10 ng
DNA/ml. The oligo probes are diluted to a concentration of
approximately 1.5 mM. The amount of these dilutions required to
easily detect products is 1 UL of dilution for every 1 ml of
hybridization solution used. Labeling methods such as the ECL
Direct Nucleic Acid Labeling and Detection System (Amersham
Corporation, 2636 Clearbrook Drive, Arlington Heights, Ill.), a
horseradish peroxidase chemiluminescence system, can be used for
labeling and detecting amplified bands. Methods of labeling
oligonucleotides, such as the alkaline phosphatase (AP) system
(E-Link kit Oligonucleotide Conjugation Kit from Genosys, Europe),
can also be used.
[0186] More generally, a probe for use in an in situ detection
procedure, an in vitro amplification procedure (PCR, LCR, NASBA,
etc.), hybridization techniques (allele-specific hybridization, in
situ analysis, Southern analysis, northern analysis, etc.) or any
other detection procedure herein, including CNS amplification
fragments, can be labeled with any composition detectable by
spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful labels in the present
invention include spectral labels such as fluorescent dyes (e.g.,
fluorescein isothiocyanate, Texas red, rhodamine, dixogenin,
biotin, and the like), radiolabels (e.g., .sup.3H, .sup.125I,
.sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.), enzymes (e.g.,
horse-radish peroxidase, alkaline phosphatase etc.) spectral
calorimetric labels such as colloidal gold or colored glass or
plastic (e.g. polystyrene, polypropylene, latex, etc.) beads. The
label may be coupled directly or indirectly to a component of the
detection assay (e.g., a probe, primer, isolated DNA, amplicon,
YAC, BAC or the like) according to methods well known in the art.
As indicated above, a wide variety of labels may be used, with the
choice of label depending on sensitivity required, ease of
conjugation with the compound, stability requirements, available
instrumentation, and disposal provisions. In general, a detector
which monitors a probe-target nucleic acid hybridization is adapted
to the particular label which is used. Typical detectors include
spectrophotometers, phototubes and photodiodes, microscopes,
scintillation counters, cameras, film and the like, as well as
combinations thereof. Examples of suitable detectors are widely
available from a variety of commercial sources known to persons of
skill. Commonly, an optical image of a substrate comprising a
nucleic acid array with particular set of probes bound to the array
is digitized for subsequent computer analysis.
[0187] Because incorporation of radiolabeled nucleotides into
nucleic acids is straightforward, this detection represents a
preferred labeling strategy. Exemplar technologies for
incorporating radiolabels include end-labeling with a kinase or
phoshpatase enzyme, nick translation, incorporation of radio-active
nucleotides with a polymerase and many other well known
strategies.
[0188] Fluorescent labels are also preferred labels, having the
advantage of requiring fewer precautions in handling, and being
amendable to high-throughput visualization techniques. Preferred
labels are typically characterized by one or more of the following:
high sensitivity, high stability, low background, low environmental
sensitivity and high specificity in labeling. Fluorescent moieties,
which are incorporated into the labels of the invention, are
generally are known, including Texas red, dixogenin, biotin, 1- and
2-aminonaphthalene, p,p'-diaminostilbenes, pyrenes, quaternary
phenanthridine salts, 9-aminoacridines, p,p'-diaminobenzophenone
imines, anthracenes, oxacarbocyanine, merocyanine,
3-aminoequilenin, perylene, bis-benzoxazole, bis-p-oxazolyl
benzene, 1,2-benzophenazin, retinol, bis-3-aminopyridinium salts,
hellebrigenin, tetracycline, sterophenol,
benzimidazolylphenylamine, 2-oxo-3-chromen, indole, xanthen,
7-hydroxycoumarin, phenoxazine, calicylate, strophanthidin,
porphyrins, triarylmethanes and flavin. Individual fluorescent
compounds which have functionalities for linking to an element
desirably detected in an apparatus or assay of the invention, or
which can be modified to incorporate such functionalities include,
e.g., dansyl chloride; fluoresceins such as
3,6-dihydroxy-9-phenylxanthydrol; rhodamineisothiocyanate; N-phenyl
1-amino-8-sulfonatonaphthalene; N-phenyl
2-amino-6-sulfonatonaphthalene; 4-acetamido-+isothiocyanato-stil-
bene-2,2'-disulfonic acid; pyrene-3-sulfonic acid;
2-toluidinonaphthalene-- 6-sulfonate;
N-phenyl-N-methyl-2-aminoaphthalene-6-sulfonate; ethidium bromide;
stebrine; auromine-0,2-(9'-anthroyl)palmitate; dansyl
phosphatidylethanolamine; N,N'-dioctadecyl oxacarbocyanine:
N,N'-dihexyl oxacarbocyanine; merocyanine, 4-(3'-pyrenyl)stearate;
d-3-aminodesoxy-equilenin; 12-(9'-anthroyl)stearate;
2-methylanthracene; 9-vinylanthracene;
2,2'(vinylene-p-phenylene)bisbenzoxazole;
p-bis(2-(4-methyl-5-phenyl-oxazolyl))benzene;
6-dimethylamino-1,2-benzoph- enazin; retinol;
bis(3'-aminopyridinium) 1,10-decandiyl diiodide;
sulfonaphthylhydrazone of hellibrienin; chlorotetracycline;
N-(7-dimethylamino-4-methyl-2-oxo-3-chromenyl)maleimide;
N-(p-(2benzimidazolyl)-phenyl)maleimide;
N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin;
4-chloro-7-nitro-2,1,3-benzooxadiazole- ; merocyanine 540;
resorufin; rose bengal; and 2,4-diphenyl-3(2H)-furanone- . Many
fluorescent tags are commercially available from SIGMA chemical
company (Saint Louis, Mo.), Molecular Probes, R&D systems
(Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway,
N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes
Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research,
Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, Md.), Fluka
Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland),
and Applied Biosystems (Foster City, Calif.) as well as other
commercial sources known to one of skill.
[0189] In one embodiment, nucleic acids are labeled by culturing
recombinant cells which encode the nucleic acid in a medium which
incorporates fluorescent or radioactive nucleotide analogues in the
growth medium, resulting in the production of fluorescently labeled
nucleic acids. Similarly, nucleic acids are synthesized in vitro
using a primer and a DNA polymerase such as taq. For example,
Hawkins et al. U.S. Pat. No. 5,525,711 describes pteridine
nucleotide analogs for use in fluorescent DNA probes, including PCR
amplicons.
[0190] The label is coupled directly or indirectly to a molecule to
be detected (a product, substrate, enzyme, or the like) according
to methods well known in the art. As indicated above, a wide
variety of labels are used, with the choice of label depending on
the sensitivity required, ease of conjugation of the compound,
stability requirements, available instrumentation, and disposal
provisions. Non radioactive labels are often attached by indirect
means. Generally, a ligand molecule (e.g., biotin) is covalently
bound to a nucleic acid such as a probe, primer, amplicon, YAC, BAC
or the like. The ligand then binds to an anti-ligand (e.g.,
streptavidin) molecule which is either inherently detectable or
covalently bound to a signal system, such as a detectable enzyme, a
fluorescent compound, or a chemiluminescent compound. A number of
ligands and anti-ligands can be used. Where a ligand has a natural
anti-ligand, for example, biotin, thyroxine, and cortisol, it can
be used in conjunction with labeled, anti-ligands. Alternatively,
any haptenic or antigenic compound can be used in combination with
an antibody. Labels can also be conjugated directly to signal
generating compounds, e.g., by conjugation with an enzyme or
fluorophore or chromophore. Enzymes of interest as labels will
primarily be hydrolases, particularly phosphatases, esterases and
glycosidases, or oxidoreductases, particularly peroxidases.
Fluorescent compounds include fluorescein and its derivatives,
rhodamine and its derivatives, dansyl, umbelliferone; etc.
Chemiluminescent compounds include luciferin, and
2,3-dihydrophthalazinediones, e.g., luminol. Means of detecting
labels are well known to those of skill in the art. Thus, for
example, where the label is a radioactive label, means for
detection include a scintillation counter or photographic film as
in autoradiography. Where the label is optically detectable,
typical detectors include microscopes, cameras, phototubes and
photodiodes and many other detection systems which are widely
available.
[0191] (e) Evaluation of DNA Fragments Isolated from Gel
[0192] Each DNA gel band that has been amplified and cloned is
evaluated for its utility as a polynucleotide probe in a dot blot
hybridization assay, or one of the other assays described herein.
Two parameters are often evaluated: the ability of each potential
probe to hybridize to (1) a set of fingerprinting inbred plants
amplified with the appropriate Plus 3 primers, that result in a
specific pattern of positives and negatives and (2) the amplified
DNA from the gel band used to generate the polynucleotide probe.
This hybridization can be evaluated using the dot blot
hybridization procedure described in this specification. A testing
membrane is created by separately amplifying DNA from the
fingerprinting inbreds and making a hand dot blot with (1) the
amplification products from a single primer pair and (2) the
amplified DNA gel bands isolated from a single primer pair. (1) and
(2) are immobilized onto a membrane. An amplified band that
specifically recognizes itself (i.e., the band from which the probe
was isolated or designed) and specifically hybridizes to the
fingerprinting set of inbreds is considered useful as a
polynucleotide probe for dot blots in the method of the invention.
These bands are considered dominant markers. Bands that when
hybridized to the testing membranes produce more positive inbreds
than expected and recognize two or more band dots can be evaluated
to determine if the additional positive bands belong to a
co-dominant marker. Co-dominant markers are not useful in the
method of the invention as polynucleotide probes for dot blot
assays unless specific oligonucleotide sequences are designed for
each allele.
[0193] Sources of CNSs
[0194] The CNSs of the invention can be isolated from any organism
including yeast, bacteria, animals and plants.
[0195] Preferred sources from which the plant CNSs of the invention
can be obtained or isolated include, but are not limited to, corn
(Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea),
particularly those Brassica species useful as sources of seed oil,
alfalfa (Medicago saliva), rice (Oryza saliva), rye (Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g.,
pearl millet (Pennisetum glaucum), proso millet (Panicum
miliaceum), foxtail millet (Setaria italica), finger millet
(Eleusine coracana)), sunflower (Helianthus annuus), safflower
(Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine
max, tobacco (Nicotiana tabacum), potato (Solanum tuberosum),
peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium
hirsutum), sweet potato (Ipomoea batatus), cassaya (Manihot
esculenta), coffee (Cofea spp.), coconut (Cocos nucifera),
pineapple (Ananas comosus), citrus trees (Citrusspp.), cocoa
(Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.),
avocado (Persea ultilane), fig (Ficus casica), guava (Psidium
guajava), mango (Mangifera indica), olive (Olea europaea), papaya
(Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgaris), sugarcane (Saccharum spp.), rye, rape, canola,
millet, oats, duckweed (Lemna), barley, vegetables, ornamentals,
and conifers.
[0196] Duckweed (Lemna, see WO 00/07210) includes members of the
family Lemnaceae. There are known four genera and 34 species of
duckweed as follows: genus Lemna (L. aequinoctialis, L. disperma,
L. ecuadoriensis, L. gibba, L. japonica, L. minor, L. miniscula, L.
obscura, L. perpusilla, L. tenera, L. trisulca, L. turionifera, L.
valdiviana); genus Spirodela (S. intermedia, S. polyrrhiza, S.
punctata), genus Woffia (Wa. Angusta, Wa. Arrhiza, Wa. Australina,
Wa. Borealis, Wa. Brasiliensis, Wa. Columbiana, Wa. Elongata, Wa.
Globosa, Wa. Microscopica, Wa. Neglecta) and genus Wofiella (W1.
ultila, W1. ultilane n, W1. gladiata, W1. ultila, W1. lingulata,
W1. repunda, W1. rotunda, and W1. neotropica). Any other genera or
species of Lemnaceae, if they exist, are also aspects of the
present invention. Lemna gibba, Lemna minor, and Lemna miniscula
are preferred, with Lemna minor and Lemna miniscula being most
preferred. Lemna species can be classified using the taxonomic
scheme described by Landolt, Biosystematic Investigation on the
Family of Duckweeds: The family of Lemnaceae--A Monograph Study.
Geobatanischen Institut ErH, Stiftung Rubel, Zurich (1986)).
[0197] Vegetables from which to obtain or isolate the CNS of the
invention include, but are not limited to, tomatoes (Lycopersicon
esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus
vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.),
and members of the genus Cucumis such as cucumber (C. sativus),
cantaloupe (C. cantalupensis), and musk melon (C. melo).
Ornamentals from which to obtain or isolate the CNS of the
invention include, but are not limited to, azalea (Rhododendron
spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus
rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils
(Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus
caryophyllus), poinsettia (Euphorbia pulcherrima), and
chrysanthemum. Conifers that may be employed in practicing the
present invention include, for example, pines such as loblolly pine
(Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus
ponderosa), lodgepole pine (Pinus contorta), and Monterey pine
(Pinus radiata), Douglas-fir (Pseudotsuga menziesii); Western
hemlock (Tsuga ultilane); Sitka spruce (Picea glauca); redwood
(Sequoia sempervirens); true firs such as silver fir (Abies
amabilis) and balsam fir (Abies balsamea); and cedars such as
Western red cedar (Thuja plicata) and Alaska yellow-cedar
(Chamaecyparis nootkatensis). Leguminous plants from which the CNS
of the invention can be isolated or obtained include, but are not
limited to, beans and peas. Beans include guar, locust bean,
fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava
bean, lentils, chickpea, and the like. Legumes include, but are not
limited to, Arachis, e.g., peanuts, Vicia, e.g., crown vetch, hairy
vetch, adzuki bean, mung bean, and chickpea, Lupinus, e.g., lupine,
trifolium, Phaseolus, e.g., common bean and lima bean, Pisum, e.g.,
field bean, Melilotus, e.g., clover, Medicago, e.g., alfalfa,
Lotus, e.g., trefoil, lens, e.g., lentil, and false indigo.
[0198] The plant CNSs of the invention can be isolated from papaya,
garlic, pea, peach, pepper, petunia, strawberry, sorghum, sweet
potato, turnip, safflower, corn, pea, endive, gourd, grape, snap
bean, chicory, cotton, tobacco, aubergine, beet, buckwheat, broad
bean, nectarine, avocado, mango, banana, groundnut, potato, peanut,
lettuce, pineapple, spinach, squash, sugarbeet, sugarcane, sweet
corn, chrysanthemum.
[0199] Other preferred sources of the CNS of the invention include
Acacia, aneth, artichoke, arugula, blackberry, canola, cilantro,
clementines, escarole, eucalyptus, fennel, grapefruit, honey dew,
jicama, kiwifruit, lemon, lime, mushroom, nut, okra, orange,
parsley, persimmon, plantain, pomegranate, poplar, radiata pine,
radicchio, Southern pine, sweetgum, tangerine, triticale, vine,
yams, apple, pear, quince, cherry, apricot, melon, hemp, buckwheat,
grape, raspberry, chenopodium, blueberry, nectarine, peach, plum,
strawberry, watermelon, eggplant, pepper, cauliflower, Brassica,
e.g., broccoli, cabbage, ultilan sprouts, onion, carrot, leek,
beet, broad bean, celery, radish, pumpkin, endive, gourd, garlic,
snapbean, spinach, squash, turnip, ultilane, and zucchini.
[0200] Yet other sources of plant CNSs are ornamental plants
including, but not limited to, impatiens, Begonia, Pelargonium,
Viola, Cyclamen, Verbena, Vinca, Tagetes, Primula, Saint Paulia,
Agertum, Amaranthus, Antihirrhinum, Aquilegia, Cineraria, Clover,
Cosmo, Cowpea, Dahlia, Datura, Delphinium, Gerbera, Gladiolus,
Gloxinia, Hippeastrum, Mesembryanthemum, Salpiglossos, and Zinnia,
and other plants. Preferred forage and turf grass nucleic acid
sources for the nucleic acid molecules of the invention include,
but are not limited to, alfalfa, orchard grass, tall fescue,
perennial ryegrass, creeping bent grass, and redtop.
[0201] Transgenic Plants of the Invention and Methods of
Preparation
[0202] In certain circumstances, it is desirable to test, analyze
or utilize the CNSs of the present invention in a transgenic plant.
As discussed above, several assays (transcription factor
identification, etc.) may be performed in transgenic plants. Plant
species may be transformed with the DNA constructs of the present
invention by the DNA-mediated transformation of plant cell
protoplasts and subsequent regeneration of the plant from the
transformed protoplasts in accordance with procedures well known in
the art.
[0203] Any plant tissue capable of subsequent clonal propagation,
whether by organogenesis or embryogenesis, may be transformed with
a vector of the present invention. The term "organogenesis," as
used herein, means a process by which shoots and roots are
developed sequentially from meristematic centers; the term
"embryogenesis," as used herein, means a process by which shoots
and roots develop together in a concerted fashion (not
sequentially), whether from somatic cells or gametes. The
particular tissue chosen will vary depending on the clonal
propagation systems available for, and best suited to, the
particular species being transformed. Exemplary tissue targets
include leaf disks, pollen, embryos, cotyledons, hypocotyls,
megagametophytes, callus tissue, existing meristematic tissue
(e.g., apical meristems, axillary buds, and root meristems), and
induced meristem tissue (e.g., cotyledon meristem and ultilane
meristem).
[0204] Plants of the present invention may take a variety of forms.
The plants may be chimeras of transformed cells and non-transformed
cells; the plants may be clonal transformants (e.g., all cells
transformed to contain the expression cassette); the plants may
comprise grafts of transformed and untransformed tissues (e.g., a
transformed root stock grafted to an untransformed scion in citrus
species). The transformed plants may be propagated by a variety of
means, such as by clonal propagation or classical breeding
techniques. For example, first generation (or T1) transformed
plants may be selfed to give homozygous second generation (or T2)
transformed plants, and the T2 plants further propagated through
classical breeding techniques. A dominant selectable marker (such
as npt II) can be associated with the expression cassette to assist
in breeding.
[0205] Transformation of plants can be undertaken with a single DNA
molecule or multiple DNA molecules (i.e., co-transformation), and
both these techniques are suitable for use with the expression
cassettes of the present invention. Numerous transformation vectors
are available for plant transformation, and the expression
cassettes of this invention can be used in conjunction with any
such vectors. The selection of vector will depend upon the
preferred transformation technique and the target species for
transformation.
[0206] A variety of techniques are available and known to those
skilled in the art for introduction of constructs into a plant cell
host. These techniques generally include transformation with DNA
employing A. tumefaciens or A. rhizogenes as the transforming
agent, liposomes, PEG precipitation, electroporation, DNA
injection, direct DNA uptake, microprojectile bombardment, particle
acceleration, and the like (See, for example, EP 295959 and EP
138341) (see below). However, cells other than plant cells may be
transformed with the expression cassettes of the invention. The
general descriptions of plant expression vectors and reporter
genes, and Agrobacterium and Agrobacterium-mediated gene transfer,
can be found in Gruber et al. (1993).
[0207] Expression vectors containing genomic or synthetic fragments
can be introduced into protoplasts or into intact tissues or
isolated cells. Preferably expression vectors are introduced into
intact tissue. General methods of culturing plant tissues are
provided for example by Maki et al., (1993); and by Phillips et al.
(1988). Preferably, expression vectors are introduced into maize or
other plant tissues using a direct gene transfer method such as
microprojectile-mediated delivery, DNA injection, electroporation
and the like. More preferably expression vectors are introduced
into plant tissues using the microprojectile media delivery with
the biolistic device. (See, for example, Tomes et al. 1995). The
vectors of the invention can not only be used for expression of
structural genes but may also be used in exon-trap cloning, or
promoter trap procedures to detect differential gene expression in
varieties of tissues, (Uindsey et al., 1993; Auch & Reth et
al.).
[0208] It is particularly preferred to use the binary type vectors
of Ti and Ri plasmids of Agrobacterium spp. Ti-derived vectors
transform a wide variety of higher plants, including
monocotyledonous and dicotyledonous plants, such as soybean,
cotton, rape, tobacco, and rice (Pacciotti et al., 1985: Byrne et
al., 1987; Sukhapinda et al., 1987; Park et al., 1985: Hiei et al.,
1994). The use of T-DNA to transform plant cells has received
extensive study and is amply described (EP 120516; Hoekema, 1985;
Knauf, et al., 1983; and An et al., 1985). For introduction into
plants, the chimeric genes of the invention can be inserted into
binary vectors as described in the examples.
[0209] Other transformation methods are available to those skilled
in the art, such as direct uptake of foreign DNA constructs (see EP
295959), techniques of electroporation (Fromm et al., 1986) or high
velocity ballistic bombardment with metal-particles coated with the
nucleic acid constructs (Kline et al., 1987, and U.S. Pat. No.
4,945,050). Once transformed, the cells can be regenerated by those
skilled in the art. Of particular relevance are the recently
described methods to transform foreign genes into commercially
important crops, such as rapeseed (De Block et al., 1989),
sunflower (Everett et al., 1987), soybean (McCabe et al., 1988;
Hinchee et al., 1988; Chee et al., 1989; Christou et al., 1989; EP
301749), rice (Hiei et al., 1994), and corn (Gordon Kamm et al.,
1990; Fromm et al., 1990).
[0210] Those skilled in the art will appreciate that the choice of
method might depend on the type of plant, i.e., monocotyledonous or
dicotyledonous, targeted for transformation. Suitable methods of
transforming plant cells include, but are not limited to,
microinjection (Crossway et al., 1986), electroporation (Riggs et
al., 1986), Agrobacterium-mediated transformation (Hinchee et al.,
1988), direct gene transfer (Paszkowski et al., 1984), and
ballistic particle acceleration using devices available from
Agracetus, Inc., Madison, Wis. And BioRad, Hercules, Calif. (see,
for example, Sanford et al., U.S. Pat. No. 4,945,050; and McCabe et
al., 1988). Also see, Weissinger et al., 1988; Sanford et al., 1987
(onion); Christou et al., 1988 (soybean); McCabe et al., 1988
(soybean); Datta et al., 1990 (rice); Klein et al., 1988 (maize);
Klein et al., 1988 (maize); Klein et al., 1988 (maize); Fromm et
al., 1990 (maize); and Gordon-Kamm et al., 1990 (maize); Svab et
al., 1990 (tobacco chloroplast); Koziel et al., 1993 (maize);
Shimamoto et al., 1989 (rice); Christou et al., 1991 (rice);
European Patent Application EP 0 332 581 (orchardgrass and other
Pooideae); Vasil et al., 1993 (wheat); Weeks et al., 1993 (wheat).
In one embodiment, the protoplast transformation method for maize
is employed (European Patent Application EP 0 292 435, U.S. Pat.
No. 5,350,689).
[0211] In another embodiment, a nucleotide sequence of the present
invention is directly transformed into the plastid genome. Plastid
transformation technology is extensively described in U.S. Pat.
Nos. 5,451,513, 5,545,817, and 5,545,818, in PCT application no. WO
95/16783, and in McBride et al., 1994. The basic technique for
chloroplast transformation involves introducing regions of cloned
plastid DNA flanking a selectable marker together with the gene of
interest into a suitable target tissue, e.g., using biolistics or
protoplast transformation (e.g., calcium chloride or PEG mediated
transformation). The 1 to 1.5 kb flanking regions, termed targeting
sequences, facilitate orthologous recombination with the plastid
genome and thus allow the replacement or modification of specific
regions of the plastome. Initially, point mutations in the
chloroplast 16S rRNA and rps12 genes conferring resistance to
spectinomycin and/or streptomydn are utilized as selectable markers
for transformation (Svab et al., 1990; Staub et al., 1992). This
resulted in stable homoplasmic transformants at a frequency of
approximately one per 100 bombardments of target leaves. The
presence of cloning sites between these markers allowed creation of
a plastid targeting vector for introduction of foreign genes (Staub
et al., 1993). Substantial increases in transformation frequency
are obtained by replacement of the recessive rRNA or r-protein
antibiotic resistance genes with a dominant selectable marker, the
bacterial aadA gene encoding the spectinomycin-detoxifying enzyme
aminoglycoside-3N-adenyltransferase (Svab et al., 1993). Other
selectable markers useful for plastid transformation are known in
the art and encompassed within the scope of the invention.
Typically, approximately 15-20 cell division cycles following
transformation are required to reach a homoplastidic state. Plastid
expression, in which genes are inserted by orthologous
recombination into all of the several thousand copies of the
circular plastid genome present in each plant cell, takes advantage
of the enormous copy number advantage over nuclear-expressed genes
to permit expression levels that can readily exceed 10% of the
total soluble plant protein. In a preferred embodiment, a
nucleotide sequence of the present invention is inserted into a
plastid targeting vector and transformed into the plastid genome of
a desired plant host. Plants homoplastic for plastid genomes
containing a nucleotide sequence of the present invention are
obtained, and are preferentially capable of high expression of the
nucleotide sequence.
[0212] Agrobacterium tumefaciens cells containing a vector
comprising an expression cassette of the present invention, wherein
the vector comprises a Ti plasmid, are useful in methods of making
transformed plants. Plant cells are infected with an Agrobacterium
tumefaciens as described above to produce a transformed plant cell,
and then a plant is regenerated from the transformed plant cell.
Numerous Agrobacterium vector systems useful in carrying out the
present invention are known.
[0213] For example, vectors are available for transformation using
Agrobacterium tumefaciens. These typically carry at least one T-DNA
border sequence and include vectors such as pBIN19 (Bevan, 1984).
In one preferred embodiment, the expression cassettes of the
present invention may be inserted into either of the binary vectors
pCIB200 and pCIB2001 for use with Agrobacterium. These vector
cassettes for Agrobacterium-mediated transformation wear
constructed in the following manner. PTJS75kan was created by NarI
digestion of pTJS75 (Schmidhauser & Helinski, 1985) allowing
excision of the tetracycline-resistance gene, followed by insertion
of an AccI fragment from pUC4K carrying an NPTII (Messing &
Vierra, 1982; Bevan et al., 1983; McBride et al., 1990). XhoI
linkers were ligated to the EcoRV fragment of pCIB7 which contains
the left and right T-DNA borders, a plant selectable nos/nptII
chimeric gene and the pUC polylinker (Rothstein et al., 1987), and
the XhoI-digested fragment was cloned into SalI-digested pTJS75kan
to create pCIB200 (see also EP 0 332 104, example 19). PCIB200
contains the following unique polylinker restriction sites: EcoRI,
SstI, KpnI, BglII, XbaI, and SalI. The plasmid pCIB2001 is a
derivative of pCIB200 which was created by the insertion into the
polylinker of additional restriction sites. Unique restriction
sites in the polylinker of pCIB2001 are EcoRI, Sstl, KpnI, BglII,
XbaI, SalIl, MluI, BclI, AvrII, ApaI, HpaI, and StuI. PCIB2001, in
addition to containing these unique restriction sites also has
plant and bacterial kanamycin selection, left and right T-DNA
borders for Agrobacterium-mediated transformation, the RK2-derived
trfA function for mobilization between E coli and other hosts, and
the OriT and OriV functions also from RK2. The pCIB2001 polylinker
is suitable for the cloning of plant expression cassettes
containing their own regulatory signals.
[0214] An additional vector useful for Agrobacterium-mediated
transformation is the binary vector pCIB 10, which contains a gene
encoding kanamycin resistance for selection in plants, T-DNA right
and left border sequences and incorporates sequences from the wide
host-range plasmid pRK252 allowing it to replicate in both E. coli
and Agrobacterium. Its construction is described by Rothstein et
al., 1987. Various derivatives of pCIB10 have been constructed
which incorporate the gene for hygromycin B phosphotransferase
described by Gritz et al., 1983. These derivatives enable selection
of transgenic plant cells on hygromycin only (pCIB743), or
hygromycin and kanamycin (pCIB715, pCIB717).
[0215] Methods using either a form of direct gene transfer or
Agrobacterium-mediated transfer usually, but not necessarily, are
undertaken with a selectable marker which may provide resistance to
an antibiotic (e.g., kanamycin, hygromycin or methotrexate) or a
herbicide (e.g., phosphinothricin). The choice of selectable marker
for plant transformation is not, however, critical to the
invention.
[0216] For certain plant species, different antibiotic or herbicide
selection markers may be preferred. Selection markers used
routinely in transformation include the nptII gene which confers
resistance to kanamycin and related antibiotics (Messing &
Vierra, 1982; Bevan et al., 1983), the bar gene which confers
resistance to the herbicide phosphinothricin (White et al., 1990,
Spencer et al., 1990), the hph gene which confers resistance to the
antibiotic hygromycin (Blochinger & Diggelmann), and the dhfr
gene, which confers resistance to methotrexate (Bourouis et al.,
1983).
[0217] One such vector useful for direct gene transfer techniques
in combination with selection by the herbicide Basta (or
phosphinothricin) is pCIB3064. This vector is based on the plasmid
pCIB246, which comprises the CaMV 35S promoter in operational
fusion to the E. coli GUS gene and the CaMV 35S transcriptional
terminator and is described in the PCT published application WO
93/07278, herein incorporated by reference. One gene useful for
conferring resistance to phosphinothricin is the bar gene from
Streptomyces viridochromogenes (Thompson et al., 1987). This vector
is suitable for the cloning of plant expression cassettes
containing their own regulatory signals.
[0218] An additional transformation vector is pSOG35 which utilizes
the E. coli gene dihydrofolate reductase (DHFR) as a selectable
marker conferring resistance to methotrexate. PCR was used to
amplify the 35S promoter (about 800 bp), intron 6 from the maize
Adh1 gene (about 550 bp) and 18 bp of the GUS untranslated leader
sequence from pSOG10. A 250 bp fragment encoding the E. coli
dihydrofolate reductase type II gene was also amplified by PCR and
these two PCR fragments were assembled with a SacI-PstI fragment
from pBI221 (Clontech) which comprised the pUC19 vector backbone
and the nopaline synthase terminator. Assembly of these fragments
generated pSOG19 which contains the .sup.35S promoter in fusion
with the intron 6 sequence, the GUS leader, the DHFR gene and the
nopaline synthase terminator. Replacement of the GUS leader in
pSOG19 with the leader sequence from Maize Chlorotic Mottle Virus
check (MCMV) generated the vector pSOG35. pSOG19 and pSOG35 carry
the pUC-derived gene for ampicillin resistance and have HindIII,
SphI, PstI and EcoRI sites available for the cloning of foreign
sequences.
[0219] Production and Characterization of Stably Transformed
Plants
[0220] Transgenic plant cells are then placed in an appropriate
selective medium for selection of transgenic cells which are then
grown to callus. Shoots are grown from callus and plantlets
generated from the shoot by growing in rooting medium. The various
constructs normally will be joined to a marker for selection in
plant cells. Conveniently, the marker may be resistance to a
biocide (particularly an antibiotic, such as kanamycin, G418,
bleomycin, hygromycin, chloramphenicol, herbicide, or the like).
The particular marker used will allow for selection of transformed
cells as compared to cells lacking the DNA which has been
introduced. Components of DNA constructs including transcription
cassettes of this invention may be prepared from sequences which
are native (endogenous) or foreign (exogenous) to the host. By
"foreign" it is meant that the sequence is not found in the
wild-type host into which the construct is introduced. Heterologous
constructs will contain at least one region which is not native to
the gene from which the transcription-initiation-r- egion is
derived.
[0221] To confirm the presence of the transgenes in transgenic
cells and plants, a variety of assays may be performed. Such assays
include, for example, "molecular biological" assays well known to
those of skill in the art, such as Southern and Northern blotting,
in situ hybridization and nucleic acid-based amplification methods
such as PCR or RT-PCR; "biochemical" assays, such as detecting the
presence of a protein product, e.g., by immunological means (ELISAs
and Western blots) or by enzymatic function; plant part assays,
such as leaf or root assays; and also, by analyzing the phenotype
of the whole regenerated plant, e.g., for disease or pest
resistance.
[0222] DNA may be isolated from cell lines or any plant parts to
determine the presence of the preselected nucleic acid segment
through the use of techniques well known to those skilled in the
art. Note that intact sequences will not always be present,
presumably due to rearrangement or deletion of sequences in the
cell.
[0223] The presence of nucleic acid elements introduced through the
methods of this invention may be determined by polymerase chain
reaction (PCR). Using this technique discreet fragments of nucleic
acid are amplified and detected by gel electrophoresis. This type
of analysis permits one to determine whether a preselected nucleic
acid segment is present in a stable transformant, but does not
prove integration of the introduced preselected nucleic acid
segment into the host cell genome. In addition, it is not possible
using PCR techniques to determine whether transformants have
exogenous genes introduced into different sites in the genome,
i.e., whether transformants are of independent origin. It is
contemplated that using PCR techniques it would be possible to
clone fragments of the host genomic DNA adjacent to an introduced
preselected DNA segment.
[0224] Positive proof of DNA integration into the host genome and
the independent identities of transformants may be determined using
the technique of Southern hybridization. Using this technique
specific DNA sequences that were introduced into the host genome
and flanking host DNA sequences can be identified. Hence the
Southern hybridization pattern of a given transformant serves as an
identifying characteristic of that transformant. In addition it is
possible through Southern hybridization to demonstrate the presence
of introduced preselected DNA segments in high molecular weight
DNA, i.e., confirm that the introduced preselected DNA segment has
been integrated into the host cell genome. The technique of
Southern hybridization provides information that is obtained using
PCR, e.g., the presence of a preselected DNA segment, but also
demonstrates integration into the genome and characterizes each
individual transformant.
[0225] It is contemplated that using the techniques of dot or slot
blot hybridization which are modifications of Southern
hybridization techniques one could obtain the same information that
is derived from PCR, e.g., the presence of a preselected DNA
segment.
[0226] Both PCR and Southern hybridization techniques can be used
to demonstrate transmission of a preselected DNA segment to
progeny. In most instances the characteristic Southern
hybridization pattern for a given transformant will segregate in
progeny as one or more Mendelian genes (Spencer et al., 1992);
Laursen et al., 1994) indicating stable inheritance of the gene.
The nonchimeric nature of the callus and the-parental transformants
(R.sub.0) was suggested by germline transmission and the identical
Southern blot hybridization patterns and intensities of the
transforming DNA in callus, R.sub.0 plants and R.sub.1 progeny that
segregated for the transformed gene.
[0227] Whereas DNA analysis techniques may be conducted using DNA
isolated from any part of a plant, RNA may only be expressed in
particular cells or tissue types and hence it will be necessary to
prepare RNA for analysis from these tissues. PCR techniques may
also be used for detection and quantitation of RNA produced from
introduced preselected DNA segments. In this application of PCR it
is first necessary to reverse transcribe RNA into DNA, using
enzymes such as reverse transcriptase, and then through the use of
conventional PCR techniques amplify the DNA. In most instances PCR
techniques, while useful, will not demonstrate integrity of the RNA
product. Further information about the nature of the RNA product
may be obtained by Northern blotting. This technique will
demonstrate the presence of an RNA species and give information
about the integrity of that RNA. The presence or absence of an RNA
species can also be determined using dot or slot blot Northern
hybridizations. These techniques are modifications of Northern
blotting and will only demonstrate the presence or absence of an
RNA species.
[0228] While Southern blotting and PCR may be used to detect the
preselected DNA segment in question, they do not provide
information as to whether the preselected DNA segment is being
expressed. Expression may be evaluated by specifically identifying
the protein products of the introduced preselected DNA segments or
evaluating the phenotypic changes brought about by their
expression.
[0229] Assays for the production and identification of specific
proteins may make use of physical-chemical, structural, functional,
or other properties of the proteins. Unique physical-chemical or
structural properties allow the proteins to be separated and
identified by electrophoretic procedures, such as native or
denaturing gel electrophoresis or isoelectric focusing, or by
chromatographic techniques such as ion exchange or gel exclusion
chromatography. The unique structures of individual proteins offer
opportunities for use of specific antibodies to detect their
presence in formats such as an ELISA assay. Combinations of
approaches may be employed with even greater specificity such as
Western blotting in which antibodies are used to locate individual
gene products that have been separated by electrophoretic
techniques. Additional techniques may be employed to absolutely
confirm the identity of the product of interest such as evaluation
by amino acid sequencing following purification. Although these are
among the most commonly employed, other procedures may be
additionally used.
[0230] Assay procedures may also be used to identify the expression
of proteins by their functionality, especially the ability of
enzymes to catalyze specific chemical reactions involving specific
substrates and products. These reactions may be followed by
providing and quantifying the loss of substrates or the generation
of products of the reactions by physical or chemical procedures.
Examples are as varied as the enzyme to be analyzed.
[0231] Very frequently the expression of a gene product is
determined by evaluating the phenotypic results of its expression.
These assays also may take many forms including but not limited to
analyzing changes in the chemical composition, morphology, or
physiological properties of the plant. Morphological changes may
include greater stature or thicker stalks. Most often changes in
response of plants or plant parts to imposed treatments are
evaluated under carefully controlled conditions termed
bioassays.
[0232] It is understood that the embodiments described herein are
for illustrative purposes only and that various modifications or
changes in light thereof will be suggested to persons skilled in
the art and are to be included within the spirit and purview of
this specification. All publications, patents, and patent
applications cited herein are hereby incorporated by reference for
all purposes to the same extent as if each individual publication,
patent or patent application were specifically and individually
indicated to be so incorporated by reference. The following example
is provided to illustrate, but no to limit, the invention.
EXAMPLE
[0233] Identification of CNSs
[0234] DNA sequences were processed using Perl scripts to automate
CNS discovery. Coding regions of maize and rice genes were
identified by comparing genomic sequences to predicted protein
translations using NCBI's blastx (Altschul, S. F. et al. (1997)
Nucleic Acids Research 25, 3389-3402). The coding regions were
masked out for further comparisons. The two. masked genomic
sequences were then compared using NCBI's bl2seq (Tatusova, T. A.
& Madden, T. L. (1999) FEMS Microbiology Letters 174, 247-250),
with the following parameters: for finding stringent CNSs (FIG. 1A
and Table 2) Word size=7, Gap Penalties: Existence=5, Extension=2;
for finding long CNSs (FIG. 6B) Word size=7, Gap Penalties:
Existence
[0235] =2, Extension=1. The positions of CNSs relative to
intron/exon structure were visualized using Perl scripts to parse
the output of both the blastx and bl2seq results.
[0236] Sequence Information
[0237] The Genbank accession number for the rice lg1 containing BAC
is AL442117. 7,142 bp of maize lg1 was sequenced from a genomic DNA
clone (AF451895). The lg1 intron 1 grasses Genbank accession
numbers are: Setaria (AF451892), Arundo (AF451893) and bamboo
(AF451894). The Genbank accession numbers for the additional seven
maize and rice genes used to obtain the data of Table 2 are: adh1
maize (X04049) and rice (AF172282); chalcone synthase maize
(X60204.1) and rice (AB058397.1); maize lg3, missing intron3
(AF479591, AF479592) and rice osh6 (AP002881); sh2 maize (M81603)
and rice (AF101045); wx1 maize (X03935) and rice (AF141955); H+
ATPase maize (AF480431) and rice (AL442117). The mouse BAC is
AC002397. The human region is 12p13, U47924.
[0238] PCR and Southern Blots
[0239] The lg1 CNS3: exon 1 PCR products were amplified using
primer pair CNS3-2 (gctatcaccmctcaccaactccaattaa; m=a or c (SEQ ID
NO: 2)) and lgl-77 (cgctggagaggtcggcctt (SEQ ID NO: 3)) with 94 C
30 sec, 60 C 30 sec, 72 C 1 min cycling conditions for 35 cycles.
The PCR products were hybridized with a combined maize and rice lg1
exon 1 derived probe that did not include the highly conserved SBP
domain. The maize exon 1 probe was amplified from a maize lg1 cDNA
clone using the following primers: ccgaattcatggagcagcagcaggagagc
(SEQ ID NO: 4) and tggccgtacgtgtagccctctggg (SEQ ID NO: 5); the
rice exon 1 probe was amplified from Nipponbare genomic DNA using
primers: atgatgaacgttccatccgcc (SEQ ID NO: 6) and
tcggcgggaagtaggtccggta (SEQ ID NO: 7). Both amplification
conditions were the same as used to amplify the CNS3-2: lg1-77 PCR
products. Hybridization and washes were done at 65 C, and the blot
was washed in 0.2.times.SSC/0.2% SDS. lg1 intron 1 from various
grasses were PCR amplified in two overlapping fragments using an
exon 1 derived primer (lg1-77 Rev, aaggccgacctctccagcg (SEQ ID NO:
8)) with a CNS 1 primer (tcagctgcaaaactccaagctgtct (SEQ ID NO: 9)),
and a CNS 4 primer (gatcaagactttgtacagcc (SEQ ID NO: 10)) with an
exon 2 derived primer (tcttrgcatcgtcgaactcatc; r=a or g (SEQ ID NO:
11)). Conditions for Lg1-77Rev: CNS 1-2R: 97.degree. C. 2 min, 30
cycles of 94.degree. C. 30 sec, 62.degree. C. 1 min, 72.degree. C.
2 min. Conditions for CNS 4-lg1-79: 97.degree. C. 2 min, 30 cycles
of 94.degree. C. 30 sec, 54.degree. C. 30 sec, 72.degree. C. 1 min.
The PCR products were cloned using Invitrogen's pTOPO cloning
system and sequenced at the UC-Berkeley DNA sequencing facility.
The fragments were assembled using DNASTAR Seqman II software. When
necessary, strand specific primers were used to fill in any gaps in
the sequences.
[0240] CNSs Exist in liguleless1
[0241] liguleless1 (lg1) encodes a member of the squamosa promoter
binding protein (SBP) family. It is required to specify the ligule,
an epidermal organ that exists along a line that bisects the grass
leaf into sheath and blade (24-27). Because grasses share the
homologous ligule structure, we reasoned that lg1 gene regulation
may also be evolutionarily conserved. To assess the conserved
regulatory sequences we identified an unannotated rice bacterial
artificial chromosome (BAC) that contains the rice lg1 orthologous
gene. This sequence maps to rice chromosome 4L (data not shown)
which is the syntenous region to maize chromosome 2S where lg1
resides (26). Within the coding region a comparison of the
predicted maize and rice proteins shows them to be 70% similar in
amino acid sequence overall and identical in the SBP domain (data
not shown). We identified CNSs based on three criteria:
conservation of sequence, conservation of position relative to the
intron/exon structure of the gene, and a size greater than or equal
to 15 basepairs (bp). For reference, any 15 bp stretch is expected
to exist about once, (1/4).sup.15, in the entire .about.400
megabasepair rice genome. Therefore, we utilized 15 identical bp
conserved between maize and rice (i.e., 15/15) as our cut off, but
we recognize that shorter sequences are also important.
[0242] A comparison of 7142 bp of maize genomic DNA sequence
containing the three exons of lg1 (and about 5.9 kb of noncoding
sequence) and 7100 bp of rice genomic sequence identified 7 CNSs
that met our stringent criteria (see methods). The same CNSs were
identified when the entire rice BAC sequence (.about.50 kb) was
used in the comparison (data not shown). FIG. 1A shows lg1
"stringent CNSs" listed as CNSs 1-7 in the order of their
significance. These seven CNSs identified in FIG. 1A are too small
to fit the definition used by most researchers working with
mammalian systems, >100 bp in length and >70% identity (11).
However, if we relax the gap and extension penalties to those used
by Levy and coworkers (15), we display the lg1 CNSs in a different
way (FIG. 1B). Here, we find two long CNSs, CNS1' (97/124) and
CNS2' (84/107), in intron 1 replacing the CNS4-CNS5-CNS1-CNS6
region of FIG. 1A. Both of these less stringent CNSs meet the
>100 bp, >70% identity criteria often used in mammalian
studies.
[0243] lg1 CNSs are Conserved Among Many Grasses
[0244] To test whether the CNSs identified between maize and rice
are conserved in other grasses we devised a polymerase chain
reaction (PCR) based assay. CNS3 (FIG. 1A) was used to design a PCR
primer (CNS3-2) facing downstream toward exon 1. A second primer
(lg1-77) was chosen within exon 1 directed upstream toward the
promoter and CNS3. In addition to maize and rice, this primer pair
amplified a fragment from five more grass species (FIG. 2). In all,
seven tribes and five different subfamilies (panicoids,
chloridoids, bambusoids, oryzoids, and arundinoids) are represented
(28, 29). FIG. 2A shows an ethidium bromide stained gel with one
predominant amplification product from each species. FIG. 2B shows
a Southern blot of this gel hybridized with a combined maize and
rice lg1 specific exon 1 probe. In each case the predominant PCR
product is homologous to the lg1 exon probe. Note the lg1
hybridizing sequences are polymorphic in length between the various
grasses, which is expected because they contain noncoding
sequences.
[0245] To further examine the conservation of CNSs in lg1 we PCR
amplified intron 1 from three other grasses, a bamboo, a Setaria,
and an Arundo, and compared them with maize and rice using ClustalX
to generate a 5 way sequence alignment (30). These five sequences
represent five tribes and four subfamilies of grasses. The results
are displayed in Table 1. Full intron sequences are posted online
at PNAS web site. All five intron 1 stringent CNSs are highly
conserved among all these grasses in both sequence and position.
Note that when the bamboo, Setaria and Arundo sequences were added
to the original rice and maize comparison, the CNSs became more
refined.
[0246] CNSs Exist in Other Grass Genes
[0247] To establish that the results we obtained at lg1 were
general properties of grass genes, we searched for stringent CNSs
in seven additional maize/rice gene pairs. The genes we have chosen
have unambiguous, experimental exon annotation. Table 2 summarizes
the number of stringent CNSs found, sorted by length; six of these
genes contained one or more CNSs with a significance greater than
or equal to a 15 bp exact match. None of these sequences contained
stringent CNSs greater than 60 bp in length. Researchers working in
mammalian systems have identified larger CNSs (11, 15), suggesting
that mammalian and higher plant gene CNSs may, on average, differ.
In order to compare our results directly to mammalian analyses, we
used our stringent algorithm to identify the CNSs in a previously
annotated 52 kb region of man and mouse genomic DNA containing six
genes (31). Our analysis is in complete concordance with that of
other mammalian CNS researchers as we identified twelve large
(>100 bp) CNSs and 94 smaller CNSs in these mammalian genes
(Table 2).
2TABLE 1 lg1 intron 1 CNSs are conserved in divergent grasses.
Intron 1 sequence from Arundo donax, Setaria viridis, a bamboo,
maize and rice were aligned using ClustalX 1.81. CNSs 4, 5, 1, 6
and 7 are listed. Asterisks represent sequence identity among all
five species. SEQ ID SEQ ID Species CNS4 NO CNS5 NO maize
CAA-GACTTTGTACAGCC 12 ACGTACGTACGTACGTACGAGCAAAAA-TTGCAAATGCAAGCAAC
17 rice CAAAGACTTTGTACAGCC 13 ACGTACATATGTACGTACCAGCACAAG-TTGCA-
TTTGCAAGCAAC 18 Setaria CAA-GACTTTGTACAGCC 14
---CGTGCACGTATGTACGAGCAAAAAATTCCAATTGCAAGCAAC 19 Arundo
CAA-GACTTTGTACAGCC 15 ---CATGTACGTACGTACCAGCAAAAG-TTGCAATTGCGAGCGAC
20 bamboo CAA-GACTTTGTACAGCC 16 --------ACGTACGTACCAGCACAAG-TTG-
CGATTGCAAGCAAC 21 Consensus *** ************** * *** **** **** **
** * *** *** ** SEQ ID SEQ ID SEQ ID Species CNS1 NO CNS6 NO CNS7
NO maize TCAGCTGCAAAACTCCAAGCTGTCT 22 ATTGGTCCCCGGAATGTTC 27
GTATTTCATGTGTAT 32 rice TCAGCTGCAAAACTCCAAGCTGTCT 23
ATTGGTCCCCAGAATGTTC 28 GTATTTCATGTGTAT 33 Setaria
TTAGCTGCAAGACTCCAAGCTGTCT 24 GTTGGTCCC-GGAATGTTC 29 GTCTTTGCTGTTAAT
34 Arundo TCAGCTGCAAGAATCCAAGCTGTCT 25 ATTGGTCCCCGGAATGTTC 30
GTATTTCATGTGTAT 35 bamboo TCAGCTGCAAAACTCCAAGCTGTCT 26
ATTGGTCCCCAGAATGTTC 31 GTATTTCATGTGTAT 36 Consensus * ******** *
************ ******** ******** ** *** *** **
[0248]
3TABLE 2 Summary of CNS frequencies and size-distributions in seven
rice/maize gene pairs. Maize and rice genomic DNA sequences were
analyzed for the presence of CNSs. The genes are listed with the
frequency of CNSs of the various size classes indicated. The last
column lists the size of the smaller of the two sequences being
compared. Size of 15- 21- 31- 61- >100 compared Gene Name 20 bp
30 bp 60 bp 99 bp bp region (bp) lg1 4 1 2 0 0 7142 lg3/osh6 1 0 1
0 0 2300 chalcone synthase 1 0 0 0 0 4000 wx1 0 0 0 0 0 4800 adh1 2
0 0 0 0 6000 sh2 0 1 0 0 0 7320 H.sup.+ATPase 1 0 0 0 0 6725 6 gene
mammalian 26 29 29 10 12 51187 region
[0249] Using cross species genomic DNA sequence comparisons, we
have identified CNSs in several grass genes. Comparison of maize
and rice genomic sequences at seven loci identified CNSs in six
genes. We extended this finding by showing that the lg1 CNSs are
highly conserved among all grasses analyzed. These potential
regulatory elements will help to elucidate networks of gene
regulation.
[0250] The question of what a functional CNS unit is becomes
particularly interesting since mammals' certainly have more long
CNSs than plants (Table 2). This raises the question of whether a
long CNS functions as a unit, is a collection of shorter functional
units, or both. One hypothetical function for long CNSs is as a
template for the assembly of regulatory protein complexes that may
not associate on their own. Our data suggest that regulatory
complexity differences between mammals and grasses might be
reflected in the complexity of the genes themselves. Man and mouse
are estimated to have diverged from a common ancestor living in
late Cretaceous period (65-98.9 MYA) (33), and a median of many
rodent/human genes have a synonymous (neutral) substitution
frequency of 4.times.10.sup.-9 mutations/yr (34). Thus, mammalian
and grass CNSs may be compared with one another.
[0251] Comparative gene mapping in grasses has been done using
conserved exons as hybridization probes (4). Current gene-specific
PCR-based mapping tools, like SSR primers, are useful within one or
a few closely related species. CNS-derived mapping tools should
work for all species within a family and perhaps related families.
With or without exon sequence, CNSs could be used to prepare
PCR-based gene specific amplification products that are designed to
detect polymorphisms. We successfully used primers complimentary to
CNS 1 and 4 along with exon derived primers to amplify lg1 intron 1
demonstrating that CNS 1 and 4 are useful pan-grass primer sites.
The other CNS primer we tested, CNS3, also specifically amplified
lg1 from all of the grasses tested (FIG. 2). The identification of
CNSs in many orthologous gene pairs should quickly lead to the
development of multiple PCR markers and high density linkage
maps.
[0252] No lg1 CNSs exist intact anywhere in the rice genome outside
of lg1 itself; this conclusion results from conducting short
sequence searches of the complete TMRI Nipponbare Japonica rice
genome. However, we were able to detect partial identity to lg1
stringent CNSs in rice and other organisms. For example, CNS1
(25/25 bp) exists as 17/17 bp in a rice gene (AF488772) similar to
a hypothetical Arabidoposis gene. However, as we lack the sequence
of a maize ortholog of this rice gene, we can not assay if this 17
bp sequence is itself a CNS, and therefore meaningful. As argued
convincingly by Hardison and coworkers, a sequenced mouse genome is
necessary to annotate the human genome (35). Without an annotation
sequence, finding human exons has proven problematic (36). With the
rice genome now completed, this same scenario is now true in the
grasses (37). A second sequenced grass genome is needed for
identification and annotation of conserved sequences, including
coding and regulatory components of genes. As another example, of
the seven lg1 CNSs, only one is obviously over-represented in
Genbank. A component of CNS5, acgtacgtacgtacgtacga (Table 1) is
found in 12 of the 17 top hits (19/19 bp) in different genes of
various grasses. The other five top hits were animal, and
surprisingly, none were from Arabidopsis. We suspected a grass
family transposon sequence, but there were no transposon terminal
repeats or insertion site duplications nearby. With a second fully
sequenced grass genome, testing the hypothesis that this sequence
is conserved and thus biologically important would be possible.
[0253] CNSs Exist in Multiple Genes.
[0254] Table 3A presents comparative sequence data for the maize
and rice adh genes. Table 3B presents comparative sequence data for
the maize and rice Cs genes. Table 3C presents comparative sequence
data for the maize and rice sh2 genes. These results demonstrate
that CNSs exist at three different genes.
4TABLE 3A DNA files adh1.maize (Query) and rice.adh1.small
(Subject), protein file adh1.prot.maize: Query = (5904 letters)
>rice adh1.small Length = 7000 Score = 34.2 bits (17), Expect =
0.002 #1 Identities = 17/17 (100%) Strand = Plus/Plus Query: 816
gcgcatccgacggccac 832 (SEQ ID NO: 37)
.vertline..vertline..vertline..vertline..vertline..vertline-
..vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 1505 gcgcatccgacggccac
1521 Score = 30.2 bits (15), Expect = 0.033 #2 Identities = 15/15
(100%) Strand = Plus/Plus Query: 1966 ggttgacttgcgcct 1980 (SEQ ID
NO: 38)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne. Sbjct: 2354 ggttgacttgcgcct 2368 Score = 28.2 bits (14), Expect
= 0.13 #3 Identities = 14/14 (100%) Strand = Plus/Minus Query: 2086
ctgactatagatgt 2099 (SEQ ID NO: 39)
.vertline..vertline..vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline. Sbjct: 6000 ctgactatagatgt 5987 Score = 28.2 bits
(14), Expect = 0.13 #4 Identities = 14/14 (100%) Strand = Plus/Plus
Query: 461 tttattaagctaat 474 (SEQ ID NO: 40)
.vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline..vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline. Sbjct: 5339 tttattaagctaat
5352 Score = 28.2 bits (14), Expect = 0.13 #5 Identities = 14/14
(100%) Strand = Plus/Plus Query: 2844 ttgagatgctgagt 2857 (SEQ ID
NO: 41)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 3649 ttgagatgctgagt 3662 Score = 26.3 bits (13), Expect =
0.51 #6 Identities = 16/17 (94%) Strand = Plus/Plus Query: 786
gctccgagccgcagatc 802 (SEQ ID NO: 42)
.vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 1476 gctcccagccgcagatc
1492 (SEQ ID NO: 43) Score = 26.3 bits (13), Expect = 0.51
Identities = 13/13 (100%) Strand = Plus/Plus Query: 5094
ttattttattttt 5106 (SEQ ID NO: 44)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline. Sbjct:
248 ttattttattttt 260 Score = 24.3 bits (12), Expect = 2.0
Identities = 12/12 (100%) Strand = Plus/Plus Query: 5465
taaattgtattt 5476 (SEQ ID NO: 45)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 351
taaattgtattt 362 Score = 24.3 bits (12), Expect = 2.0 Identities =
12/12 (100%) Strand = Plus/Minus Query: 2312 tatgattctttc 2323 (SEQ
ID NO: 46)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 2877
tatgattctttc 2866 Score = 24.3 bits (12), Expect = 2.0 Identities =
15/16 (93%) Strand = Plus/Plus Query: 3415 ttagtcattttattac 3430
(SEQ ID NO: 47) .vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine. Sbjct: 1966 ttaggcattttattac 1981 (SEQ ID NO: 48) Score = 24.3
bits (12), Expect = 2.0 Identities = 12/12 (100%) Strand =
Plus/Plus Query: 3213 cattttattact 3224 (SEQ ID NO: 49)
.vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 1971 cattttattact 1982 Score = 22.3 bits (11), Expect = 8.0
Identities = 11/11 (100%) Strand = Plus/Minus Query: 2246
tattatattat 2256 (SEQ ID NO: 50)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline. Sbjct: 775
tattatattat 765 Score = 22.3 bits (11), Expect = 8.0 Identities =
14/15 (93%) Strand = Plus/Plus Query: 3001 tcaattgcaatgaga 3015
(SEQ ID NO: 51)
.vertline..vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline. Sbjct: 3793 tcaattacaatgaga 3807 (SEQ ID NO: 52) Score =
22.3 bits (11), Expect = 8.0 Identities = 14/15 (93%) Strand =
Plus/Minus Query: 880 cccaccagtccacca 894 (SEQ ID NO: 53)
.vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline. Sbjct: 2137
cccaccaatccacca 2123 (SEQ ID NO: 54) Score = 22.3 bits (11), Expect
= 8.0 Identities = 11/11 (100%) Strand = Plus/Minus Query: 4437
ctgtatcagta 4447 (SEQ ID NO: 55)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline. Sbjct: 4123
ctgtatcagta 4113 Score = 22.3 bits (11), Expect = 8.0 Identities =
11/11 (100%) Strand = Plus/Plus Query: 5465 taaattgtatt 5475 (SEQ
ID NO: 56)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 504 taaattgtatt 514
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 2124 attatgttttt 2134 (SEQ ID NO: 57)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 2111 attatgttttt 2121 Score = 22.3 bits (11), Expect
= 8.0 Identities = 11/11 (100%) Strand = Plus/Plus Query: 468
agctaatttta 478 (SEQ ID NO: 58)
.vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline. Sbjct: 38 agctaatttta 48
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 5096 attttattttt 5106 (SEQ ID NO: 59)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 225 attttattttt 235 Score = 22.3 bits (11), Expect =
8.0 Identities = 11/11 (100%) Strand = Plus/Plus Query: 4986
gggctgttctg 4996 (SEQ ID NO: 60)
.vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline. Sbjct: 5143
gggctgttctg 5153 Score = 22.3 bits (11), Expect = 8.0 Identities =
11/11 (100%) Strand = Plus/Plus Query: 1681 ttcgaatttta 1691 (SEQ
ID NO: 61)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 112 ttcgaatttta 122
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 5465 taaattgtatt 5475 (SEQ ID NO: 62)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 47 taaattgtatt 57 Score = 22.3 bits (11), Expect =
8.0 Identities = 11/11 (100%) Strand = Plus/Plus Query: 470
ctaattttaga 480 (SEQ ID NO: 63)
.vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline. Sbjct: 388 ctaattttaga
398 Score = 22.3 bits (11), Expect = 8.0 Identities = 14/15 (93%)
Strand = Plus/Plus Query: 4533 gagaaggaaaagaag 4547 (SEQ ID NO: 64)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline.
.vertline..vertline..vertline..vertline..vertline..vertline. Sbjct:
6775 gagaaggagaagaag 6789 (SEQ ID NO: 65) Score = 22.3 bits (11),
Expect = 8.0 Identities = 11/11 (100%) Strand = Plus/Plus Query:
4404 tacaaattcca 4414 (SEQ ID NO: 66)
.vertline..vertline..vertline..vertline..vertline..vert-
line..vertline..vertline..vertline..vertline..vertline. Sbjct: 5934
tacaaattcca 5944 Score = 22.3 bits (11), Expect = 8.0 Identities =
11/11 (100%) Strand = Plus/Plus Query: 983 cgtggtttgct 993 (SEQ ID
NO: 67)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 1623 cgtggtttgct 1633
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Minus Query: 365 tttaaaaatag 375 (SEQ ID NO: 68)
.vertline..vertline..vertline..-
vertline..vertline..vertline..vertline..vertline..vertline..vertline..vert-
line. Sbjct: 507 tttaaaaatag 497 Score = 22.3 bits (11), Expect =
8.0 Identities = 11/11 (100%) Strand = Plus/Minus Query: 2246
tattatattat 2256 (SEQ ID NO: 69)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline. Sbjct: 995
tattatattat 985 Score = 22.3 bits (11), Expect = 8.0 Identities =
11/11 (100%) Strand = Plus/Minus Query: 365 tttaaaaatag 375 (SEQ ID
NO: 70)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 354 tttaaaaatag 344
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Minus Query: 381 gaatatgttag 391 (SEQ ID NO: 71)
.vertline..vertline..vertline..-
vertline..vertline..vertline..vertline..vertline..vertline..vertline..vert-
line. Sbjct: 3158 gaatatgttag 3148 Score = 22.3 bits (11), Expect =
8.0 Identities = 11/11 (100%) Strand = Plus/Plus Query: 3317
cattttattac 3327 (SEQ ID NO: 72)
.vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline. Sbjct: 1971
cattttattac 1981 Score = 22.3 bits (11), Expect = 8.0 Identities =
11/11 (100%) Strand = Plus/Plus Query: 944 tccaggtggag 954 (SEQ ID
NO: 73)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 1569 tccaggtggag 1579
Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 470 ctaattttaga 480 (SEQ ID NO: 74)
.vertline..vertline..vertline..-
vertline..vertline..vertline..vertline..vertline..vertline..vertline..vert-
line. Sbjct: 236 ctaattttaga 246 Score = 22.3 bits (11), Expect =
8.0 Identities = 11/11 (100%) Strand = Plus/Minus Query: 175
ttttagttagg 185 (SEQ ID NO: 75)
.vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. Sbjct: 1426 ttttagttagg
1416 Score = 22.3 bits (11), Expect = 8.0 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 167 cttcttggttt 177 (SEQ ID NO: 76)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 2698 cttcttggttt
2708
[0255]
5TABLE 3B DNA files cs.maize.fasta (Query) and cs.rice.fasta
(Subject), protein file cs.maize.prot: Query = (4069 letters)
>cs.rice.fasta Length = 8072 Score = 30.2 bits (15), Expect =
0.026 #1 Identities = 15/15 (100%) Strand = Plus/Plus Query: 4034
catggatggtgaggt 4048 (SEQ ID NO: 77)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne. Sbjct: 5062 catggatggtgaggt 5076 Score = 26.3 bits (13), Expect
= 0.41 #2 Identities = 13/13 (100%) Strand = Plus/Minus Query: 3982
ttaattgatttta 3994 (SEQ ID NO: 78)
.vertline..vertline..vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine. Sbjct: 7611 ttaattgatttta 7599 Score = 26.3 bits (13), Expect
= 0.41 Identities = 13/13 (100%) Strand = Plus/Plus Query: 2687
ggccggcctacgt 2699 (SEQ ID NO: 79)
.vertline..vertline..vertline..vertline..vertline..vertline-
..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 4783 ggccggcctacgt 4795 Score = 24.3 bits (12), Expect = 1.6
Identities = 12/12 (100%) Strand = Plus/Minus Query: 2291
agctagctagct 2302 (SEQ ID NO: 80)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline. Sbjct:
1810 agctagctagct 1799 Score = 24.3 bits (12), Expect = 1.6
Identities = 12/12 (100%) Strand = Plus/Plus Query: 2291
agctagctagct 2302 (SEQ ID NO: 81)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1799
agctagctagct 1810 Score = 24.3 bits (12), Expect = 1.6 Identities =
15/16 (93%) Strand = Plus/Minus Query: 2716 acttgcatgcttgtag 2731
(SEQ ID NO: 82)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertl- ine.
Sbjct: 1006 acttgcatgtttgtag 991 (SEQ ID NO: 83) Score = 24.3 bits
(12), Expect = 1.6 Identities = 12/12 (100%) Strand = Plus/Minus
Query: 756 cgctcgctctac 767 (SEQ ID NO: 84)
.vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 1546 cgctcgctctac 1535 Score = 24.3 bits (12), Expect = 1.6
Identities = 12/12 (100%) Strand = Plus/Minus Query: 439
ctagctctcgct 450 (SEQ ID NO: 85)
.vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline. Sbjct: 1804
ctagctctcgct 1793 Score = 24.3 bits (12), Expect = 1.6 Identities =
12/12 (100%) Strand = Plus/Minus Query: 2287 agctagctagct 2298 (SEQ
ID NO: 86)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1810
agctagctagct 1799 Score = 24.3 bits (12), Expect = 1.6 Identities =
12/12 (100%) Strand = Plus/Minus Query: 1404 aattaatatata 1415 (SEQ
ID NO: 87)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 5858
aattaatatata 5847 Score = 24.3 bits (12), Expect = 1.6 Identities =
12/12 (100%) Strand = Plus/Minus Query: 12 gttaacgtacat 23 (SEQ ID
NO: 88)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1069
gttaacgtacat 1058 Score = 24.3 bits (12), Expect = 1.6 Identities =
12/12 (100%) Strand = Plus/Plus Query: 2287 agctagctagct 2298 (SEQ
ID NO: 89)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1799
agctagctagct 1810 Score = 22.3 bits (11), Expect = 6.3 Identities =
11/11 (100%) Strand = Plus/Minus Query: 330 gtccaactcac 340 (SEQ ID
NO: 90)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 731 gtccaactcac 721
Score = 22.3 bits (11), Expect = 6.3 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 2218 catgcataaaa 2228 (SEQ ID NO: 91)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 3053 catgcataaaa 3063 Score = 22.3 bits (11), Expect
= 6.3 Identities = 11/11 (100%) Strand = Plus/Plus Query: 4059
acctgtgtaag 4069 (SEQ ID NO: 92)
.vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline. Sbjct: 5086
acctgtgtaag 5096 Score = 22.3 bits (11), Expect = 6.3 Identities =
11/11 (100%) Strand = Plus/Minus Query: 495 aggaagagaga 505 (SEQ ID
NO: 93)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 6731 aggaagagaga 6721
Score = 22.3 bits (11), Expect = 6.3 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 2092 aaaaaatcaaa 2102 (SEQ ID NO: 94)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 2445 aaaaaatcaaa 2455 Score = 22.3 bits (11), Expect
= 6.3 Identities = 14/15 (93%) Strand = Plus/Plus Query: 1341
ttctaatatacgatt 1355 (SEQ ID NO: 95)
.vertline..vertline..vertline..vertline..vertline..vertline-
..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..v- ertline. Sbjct: 2933
ttctaatatatgatt 2947 (SEQ ID NO: 96) Score = 22.3 bits (11), Expect
= 6.3 Identities = 11/11 (100%) Strand = Plus/Minus Query: 1251
tatattatata 1261 (SEQ ID NO: 97)
.vertline..vertline..vertline..vertline..v-
ertline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 5850 tatattatata 5840 Score = 22.3 bits (11), Expect = 6.3
Identities = 11/11 (100%) Strand = Plus/Minus Query: 1710
gtataaattga 1720 (SEQ ID NO: 98)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 5720 gtataaattga 5710
Score = 22.3 bits (11), Expect = 6.3 Identities = 11/11 (100%)
Strand = Plus/Plus Query: 2295 agctagctagc 2305 (SEQ ID NO: 99)
.vertline..vertline..vertline.-
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline. Sbjct: 1799 agctagctagc 1809 Score = 22.3 bits (11), Expect
= 6.3 Identities = 11/11 (100%) Strand = Plus/Plus Query: 1910
ttttcaattat 1920 (SEQ ID NO: 100)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline. Sbjct: 7170
ttttcaattat 7180 Score = 22.3 bits (11), Expect = 6.3 Identities =
11/11 (100%) Strand = Plus/Minus Query: 2295 agctagctagc 2305 (SEQ
ID NO: 101)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 1810 agctagctagc 1800
Score = 22.3 bits (11), Expect = 6.3 Identities = 11/11 (100%)
Strand = Plus/Minus Query: 2598 aaatcttagaa 2608 (SEQ ID NO: 102)
.vertline..vertline..vertline-
..vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline. Sbjct: 7832 aaatcttagaa 7822 Score = 22.3 bits (11), Expect
= 6.3 Identities = 14/15 (93%) Strand = Plus/Minus Query: 441
agctctcgcttgctc 455 (SEQ ID NO: 103)
.vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..- vertline. Sbjct: 1552
agctctcgctcgctc 1538 (SEQ ID NO: 104) Score = 22.3 bits (11),
Expect = 6.3 Identities = 11/11 (100%) Strand = Plus/Minus Query:
2700 gctatatacta 2710 (SEQ ID NO: 105)
.vertline..vertline..vertline..vertline..-
vertline..vertline..vertline..vertline..vertline..vertline..vertline.
Sbjct: 2564 gctatatacta 2554 Score = 22.3 bits (11), Expect = 6.3
Identities = 11/11 (100%) Strand = Plus/Plus Query: 1356
tcatccataca 1366 (SEQ ID NO: 106)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 2689 tcatccataca 2699
Score = 22.3 bits (11), Expect = 6.3 Identities = 14/15 (93%)
Strand = Plus/Minus Query: 138 aaaaatatactacat 152 (SEQ ID NO: 107)
.vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline. Sbjct: 2432
aaaaatataatacat 2418 (SEQ ID NO: 108) Score = 22.3 bits (11),
Expect = 6.3 Identities = 11/11 (100%) Strand = Plus/Plus Query:
1174 agcaaattaaa 1184 (SEQ ID NO: 109)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline. Sbjct: 3026
agcaaattaaa 3036 Score = 22.3 bits (11), Expect = 6.3 Identities =
11/11 (100%) Strand = Plus/Plus Query: 850 tgtttcttctt 860 (SEQ ID
NO: 110)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline. Sbjct: 2608 tgtttcttctt
2618
[0256]
6TABLE 3C DNA files sh2.maize.fasta (Query) and sh2.rice. small
(Subject), protein file sh2.maize.prot: Query = (7320 letters)
>sh2.rice.small Length = 7500 Score = 34.2 bits (17), Expect =
0.003 #1 Identities = 26/29 (89%) Strand = Plus/Plus Query: 935
gttgttgatgtctttacacagttcatctc 963 (SEQ ID NO: 111)
.vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..v- ertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vert-
line..vertline. Sbjct: 752 gttgttgatggcttcacacaattcatctc 780 (SEQ
ID NO: 112) Score = 30.2 bits (15), Expect = 0.043 #2 Identities =
15/15 (100%) Strand = Plus/Plus Query: 5210 tttgtaggttaacat 5224
(SEQ ID NO: 113)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne. Sbjct: 495 tttgtaggttaacat 509 Score = 26.3 bits (13), Expect =
0.68 #3 Identities = 22/25 (88%) Strand = Plus/Plus Query: 1019
ccacaagatcacttcgggaggcaag 1043 (SEQ ID NO: 114)
.vertline..vertline..vertline..vertline..-
vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..ver- tline..vertline.
.vertline..vertline. .vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline. Sbjct: 845
ccacaagaacacttgggcaggcaag 869 (SEQ ID NO: 115) Score = 26.3 bits
(13), Expect = 0.68 #4 Identities = 19/21 (90%) Strand = Plus/Plus
Query: 165 aaaggtttcatgtgtaccgtg 185 (SEQ ID NO: 116)
.vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline.
.vertline..vertline..vertline..vertline. Sbjct: 59
aaaggtttcatgcgtatcgtg 79 (SEQ ID NO: 117) Score = 24.3 bits (12),
Expect = 2.7 #5 Identities = 18/20 (90%) Strand = Plus/Minus Query:
638 cttcattaaatgtgaatttc 657 (SEQ ID NO: 118)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline.
.vertline..vertline..vertline.
.vertline..vertline..vertline..vertline. Sbjct: 6640
cttcattaaatatgattttc 6621 (SEQ ID NO: 119) Score = 24.3 bits (12),
Expect = 2.7 Identities = 12/12 (100%) Strand = Plus/Plus Query:
408 ggcatctccacc 419 (SEQ ID NO: 120)
.vertline..vertline..vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline. Sbjct: 336
ggcatctccacc 347 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Minus Query: 980 tcatactctata 991 (SEQ
ID NO: 121)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 4739
tcatactctata 4728 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Plus Query: 1281 ttctgttttttc 1292 (SEQ
ID NO: 122)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1428
ttctgttttttc 1439 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Plus Query: 983 tactctatataa 994 (SEQ ID
NO: 123)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 4853
tactctatataa 4864 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Minus Query: 7272 tattactaaatt 7283 (SEQ
ID NO: 124)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1584
tattactaaatt 1573 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Minus Query: 5365 ttcattaatatc 5376 (SEQ
ID NO: 125)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 7105
ttcattaatatc 7094 Score = 24.3 bits (12), Expect = 2.7 Identities =
12/12 (100%) Strand = Plus/Minus Query: 691 caaaattaatta 702 (SEQ
ID NO: 126)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline. Sbjct: 1473
caaaattaatta 1462 Score = 24.3 bits (12), Expect = 2.7 Identities =
15/16 (93%) Strand = Plus/Plus Query: 5078 tttttcttgaatttgt 5093
(SEQ ID NO: 127) .vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline. Sbjct: 2239 tttttattgaatttgt 2254 (SEQ
ID NO: 128)
[0257] CNSs are Conserved by Sequence
[0258] An TTATTACATGPyG (SEQ ID NO: 1) sequence exists in the
second intron of maize/rice lg3/osh6 and 1 g4a and b/osh71. This
sequence is of special interest because a reverse one hybrid screen
showed that it bound the homeodomain of LG3 homeodomain
transcription factor in maize. We designed conserved exon2 and
exon3 PCR primers such that we hoped to amplify the intron2 from
any grass.
[0259] The experiments were performed successfully. Amplified
fragments were sequenced and piled-up. The results are presented in
FIGS. 3A-B. FIG. 3A shows piled-up sequences from various plant
genes containing the smaller CNS sequence: TTATTACATGPyG (SEQ ID
NO: 1). FIG. 3B is a line up of CNSlg-l2 from representative
grasses. FIG. 3C shows phylogenetic relationships between different
plants. The asterisk (*) indicates the species in which useful
conservation of CNS sequences has been demonstrated.
[0260] The results demonstrate that only thing in common among
these several sequences, sequences from diverse grass species, is
the TTATTACATGPyG (SEQ ID NO: 1) consensus. The rest of intron2 is
the control for what noncoding sequence looks like when there is no
evolutionary pressure.
[0261] We specifically went after this lg3 CNS to check for exact
conservation of sequence in grasses. This particular CNS is too
small to be used as a PCR primer, so this was the only way to test
for it's conservation. We see no reason why this result should be
unique or special.
[0262] FIG. 3C shows the most recent consensus on the evolutionary
relationships among grasses. An asterisk denotes that we have
evidence for the sort of CNS conservation that will permit CNS
mapping. Our results suggest that that every grass will be amenable
to CNS mapping.
[0263] The size and frequency of a CNS region indicate the level of
biological complexity of a biological process, tissue, organ,
system, or other biological component. The CNS regions also provide
information regarding the complexity of the organism itself.
[0264] Mapping in Non Domesticated (Wild) Species
[0265] FIG. 3 shows polymorphisms within species using
Ig1CNS3-exon1 primers, which amplify a promoter fragment from
grasses.
[0266] Two different "wild" grass species are represented: Setaria
glauca (five individuals from five different collections; numbers
on figures refer to collections) and Setaria fabrii (six
individuals from six different collections).
[0267] The promoter PCR fragment amplified is about the same size
in all 11 individuals (FIG. 3A). However, if this PCR fragment(s)
is cut with a 4-cutter enzyme (FIG. 3B), then it is clear that the
different species have a different fragment pattern, and also that
individuals within both species differ in pattern. Both Setaria
glauca and Setaria fabrii are fertile species that each cross among
themselves (but not with each other). Thus, grasslg1CNS3 makes a
fine mapping primer for each of these two nondomesticated (wild)
species. This gel clearly illustrates the utility of CNSs as primer
sites useful in amplifying regions of gene that are expected to be
polymorpghic within a species.
REFERENCES
[0268] The following references are cited numerically in the
Example.
[0269] 1. Hardison, R. C. (2000) Trends in Genetics 16,
369-372.
[0270] 2. Kellogg, E. A. (2001) Plant Physiology (Rockville) 125,
1198-1205.
[0271] 3. Gale, M. D. & Devos, K. M. (1998) Proceedings of the
National Academy of Sciences of the United States of America 95,
1971-1974.
[0272] 4. Devos, K. M. & Gale, M. D. (2000) Plant Cell 12,
637-646.
[0273] 5. Freeling, M. (2001) Plant Physiology (Rockville) 125,
1191-1197.
[0274] 6. Paterson, A. H., Lin, Y.-R., Li, Z., Schertz, K. F.,
Doebley, J. F., Pinson, S. R. M., Liu, S.-C., Stansel, J. W. &
Irvine, J. E. (1995) Science (Washington D.C.) 269, 1714-1718.
[0275] 7. Tjian, R. (1995) Scientic American 272, 54-61.
[0276] 8. Ficket, J. W. & Hatzigeorgiou, A. G. (1997) Genome
Research 7, 861-878.
[0277] 9. Bucher, P. (1999) Current Opinion in Structural Biology
9, 400-407.
[0278] 10. Sumiyama, K., Kim, C.-B. & Ruddle, F. H. (2001)
Genomics 71, 260-262.
[0279] 11. Loots, G. G., Locksley, R. M., Blankespoor, C. M., Wang,
Z. E., Miller, W., Rubin, E. M. & Frazer, K. A. (2000) Science
(Washington D.C.) 288, 136-140.
[0280] 12. Gottgens, B., Gilbert, J. G. R., Barton, L. M., Grafham,
D., Rogers, J., Bentley, D. R. & Green, A. R. (2001) Genome
Research 11, 87-97.
[0281] 13. Flint, J., Tufarelli, C., Peden, J., Clark, K., Daniels,
R. J., Hardison, R., Miller, W., Philipsen, S., Tan-Un, K. C.,
McMorrow, T., Frampton, J., Alter, B. P., Frischauf, A.-M. &
Higgs, D. R. (2001) Human Molecular Genetics 10, 371-382.
[0282] 14. Stojanovic, N., Florea, L., Riemer, C., Gumucio, D.,
Slightom, J., Goodman, M., Miller, W. & Hardison, R. (1999)
Nucleic Acids Research 27, 3899-3910.
[0283] 15. Levy, S., Hannenhalli, S. & Workman, C. (2001)
Bioinformatics (Oxford) 17, 871-877.
[0284] 16. Dubchak, I., Brudno, M., Loots, G. G., Pachter, L.,
Mayor, C., Rubin, E. M. & Frazer, K. A. (2000) Genome Research
10, 1304-1306.
[0285] 17. Mayor, C., Brudno, M., Schwartz, J. R., Poliakov, A.,
Rubin, E. M., Frazer, K. A., Pachter, L. S. & Dubchak, I.
(2000) Bioinformatics (Oxford) 16, 1046-1047.
[0286] 18. Schwartz, S., Zhang, Z., Frazer, K. A., Smit, A.,
Riemer, C., Bouck, J., Gibbs, R., Hardison, R. & Miller, W.
(2000) Genome Research 10, 577-586.
[0287] 19. Carter, R. J., Dubchak, I. & Holbrook, S. R. (2001)
Nucleic Acids Research 29, 3928-3938.
[0288] 20. Vicente-Carbajosa, J., Moose, S. P., Parsons, R. L.
& Schmidt, R. J. (1997) Proceedings of the National Academy of
Sciences of the United States of America 94, 7685-7690.
[0289] 21. Forde, B., Heyworth, A., Pywell, J. & Kreis, M.
(1985) Nucleic Acids Research 13, 7327-7339.
[0290] 22. Altschul, S. F., Madden, T. L., Schaeffer, A. A., Zhang,
J., Zhang, Z., Miller, W. & Lipman, D. J. (1997) Nucleic Acids
Research 25, 3389-3402.
[0291] 23. Tatusova, T. A. & Madden, T. L. (1999) FEMS
Microbiology Letters 174, 247-250.
[0292] 24. Becraft, P. & Freeling, M. (1991) Plant Cell 3,
801-808.
[0293] 25. Sylvester, A. W., Cande, W. Z. & Freeling, M. (1990)
Development (Cambridge) 110, 985-1000.
[0294] 26. Becraft, P. W., Bongard-Pierce, D. K., Sylvester, A. W.,
Poethig, R. S. & Freeling, M. (1990) Developmental Biology 141,
220-232.
[0295] 27. Moreno, M. A., Harper, L. C., Krueger, R. W.,
Dellaporta, S. L. & Freeling, M. (1997) Genes & Development
11, 616-628.
[0296] 28. Clayton, W. D. & Renvoize, S. A. (1986) Genera
graminum: gasses of the world (H.M.S.O., London).
[0297] 29. Grass Phylogeny Working Group at
www.ftg.flu.edu/grass/gpwg
[0298] 30. Thompson, J. D., Higgins, D. G. & Gibson, T. J.
(1994) Nucleic Acids Research 22, 4673-4680.
[0299] 31. Ansari-Lari, M. A., Oelten, J. C., Schwartz, S., Zhang,
Z., Muzny, D. M., Lu, J., Gorrell, J. H., Chinault, A. C., Belmont,
J. W., Miller, W. & Gibbs, R. A. (1998) Genome Research 8,
2940.
[0300] 32. Gaut, B. S., Morton, B. R., McCaig, B. C. & Clegg,
M. T. (1996) Proceedings of the National Academy of Sciences of the
United States of America 93, 10274-10279.
[0301] 33. Freeman, S. & Herron, J. C. (2001) Evolutionary
analysis (Prentice Hall, Upper Saddle River, N.J.).
[0302] 34. Li, W.-H. & Graur, D. (1991) Fundamentals of
molecular evolution (Sinauer Associates, Sunderland, Mass.).
[0303] 35. Hardison, R. C., Oeltjen, J. & Miller, W. (1997)
Genome Research 7, 959-966.
[0304] 36. Hogenesch, J. B., Ching, K. A., Batalov, S., Su, A. I.,
Walker, J. R., Zhou, Y., Kay, S. A., Schulz, P. G. & Cooke, M.
P. (2001) Cell 106, 413-415;
[0305] 37. Messing, J. & Liaca, V. (1998) Proceedings of the
Nationa/Academy of Sciences of the United States of America 95,
2017-2020.
[0306] The following additional references are cited throughout the
specificatio.
[0307] Altschul, S. F., Madden, T. L., Schaeffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST and
PSI-BLAST: A new generation of protein database search programs.
Nucleic Acids Res. 25, 3389-3402.
[0308] Azuaje, F. (2002). A cluster validity framework for genome
expression data. Bioinformatics (Oxford) 18, 319-320.
[0309] Birnbaum, K., Benfey, P. N. and Shasha, D. E. (2001). cis
element/transcription factor analysis (cis/TF): A method for
discovering transcription factor/cis element relationships. Genome
Research 11, 1567-1573.
[0310] Bussemaker, H. J., Li, H. and Siggia, E. D. (2001).
Regulatory element detection using correlation with expression.
Nature Genetics 27, 167-171.
[0311] Davidson, E. H., Rast, J. P., Oliveri, P., Ransick, A.,
Calestani, C., Yuh, C.-H., Minokawa, T., Amore, G., Hinman, V.,
Arenas-Mena, C. et al. (2002). A genomic regulatory network for
development. Science (Washington D.C.) 295, 1669-1678.
[0312] Dubchak, I., Brudno, M., Loots, G. G., Pachter, L., Mayor,
C., Rubin, E. M. and Frazer, K. A. (2000). Active conservation of
noncoding sequences revealed by three-way species comparisons.
Genome Res. 10, 1304-1306.
[0313] Eddy, S. R. (2002). Computational genomics of noncoding RNA
genes. Cell 109, 137-140.
[0314] Ghosh, D. (2000). Object-oriented Transcription Factors
Database (ooTFD). Nucleic Acids Research 28, 308-310.
[0315] Harmer, S. L., Hogenesch, J. B., Straume, M., Chang, H.-S.,
Han, B., Zhu, T., Wang, X., Kreps, J. A. and Kay, S. A. (2000).
Orchestrated transcription of key pathways in Arabidopsis by the
circadian clock. Science (Washington D.C.) 290, 2110-2113.
[0316] Heinekamp, T., Kuhlmann, M., Lenk, A., Strathmann, A. and
Droege-Laser, W. (2002). The tobacco bZIP transcription factor
BZI-1 binds to G-box elements in the promoters of phenylpropanoid
pathway genes in vitro, but it is not involved in their regulation
in vivo. MGG Molecular Genetics and Genomics 267, 16-26.
[0317] Heinemeyer, T., Chen, X., Karas, H., Kel, A. E., Kel, O. V.,
Liebich, I., Meinhardt, T., Reuter, I., Schacherer, F. and
Wingender, E. (1999). Expanding the TRANSFAC database towards an
expert system of regulatory molecular mechanisms. Nucleic Acids
Research 27, 318-322.
[0318] Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H.,
Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A.,
Podkolodnaya, O. A., Kolpakov, F. A. et al. (1998). Databases on
transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic
Acids Research 26, 362-367.
[0319] Higo, K., Ugawa, Y., Iwamoto, M. and Korenaga, T. (1999).
Plant cis-acting regulatory DNA elements (PLACE) database: 1999.
Nucleic Acids Research 27, 297-300.
[0320] Honda S.-i., Matsumoto, T. and Harada, N. (2001).
Characterization and purification of a protein binding to the
cis-acting element for brain-specific exon 1 of the mouse aromatase
gene. Journal of Steroid Biochemistry and Molecular Biology 79,
255-260.
[0321] Kaplinsky, N. J., Braun, D. M., Penterman, J., Goff, S. A.
and Freeling, M. (2002). Utility and distribution of conserved
noncoding sequences in the grasses. Proc. Natl. Acad. Sci. USA 99,
6147-6151.
[0322] Kielbasa, S. M., Korbel, J. O., Beule, D., Schuchhardt, J.
and Herzel, H. (2001). Combining frequency and positional
information to predict transcription factor binding sites.
Bioinformatics (Oxford) 17, 1019-1026.
[0323] Lau, N. C., Lim, L. P., Weinstein, E. G. and Bartel, D. P.
(2001). An Abundant Class of Tiny RNAs with Probable Regulatory
Roles in Caenorhabditis elegans. Science 294, 858-862.
[0324] Lee, R. C. and Ambros, V. (2001). An Extensive Class of
Small RNAs in Caenorhabditis elegans. Science 294, 862-864.
[0325] Lescot, M., Dehais, P., Thijs, G., Marchal, K., Moreau, Y.,
Van, d. P. Y., Rouze, P. and Rombauts, S. (2002). PlantCARE, a
database of plant cis-acting regulatory elements and a portal to
tools for in silico analysis of promoter sequences. Nucleic Acids
Research 30, 325-327.
[0326] Levy, S., Hannenhalli, S. and Workman, C. (2001). Enrichment
of regulatory signals in conserved non-coding genomic sequence.
Bioinformatics (Oxford) 17, 871-877.
[0327] Loots, G. G., Locksley, R. M., Blankespoor, C. M., Wang, Z.
E., Miller, W., Rubin, E. M. and Frazer, K. A. (2000).
Identification of a coordinate regulator of interleukins 4, 13, and
5 by cross-species sequence comparisons. Science (Washington D.C.)
288, 136-140.
[0328] Markstein, M., Markstein, P., Markstein, V. and Levine, M.
S. (2002). Genome-wide analysis of clustered Dorsal binding sites
identifies putative target genes in the Drosophila embryo.
Proceedings of the National Academy of Sciences of the United
States of America 99, 763-768.
[0329] Mayor, C., Brudno, M., Schwartz, J. R., Poliakov, A., Rubin,
E. M., Frazer, K. A., Pachter, L. S. and Dubchak, I. (2000). VISTA:
Visualizing global DNA sequence alignments of arbitrary length.
Bioinformatics (Oxford) 16, 1046-1047.
[0330] Storz, G. (2002). An Expanding Universe of Noncoding RNAs.
Science 296, 1260-1263.
[0331] Sumiyama, K., Kim, C.-B. and Ruddle, F. H. (2001). An
efficient cis-element discovery method using multiple sequence
comparisons based on evolutionary relationships. Genomics 71,
260-262.
[0332] Toh, H. and Horimoto, K. (2002). Inference of a genetic
network by a combined approach of cluster analysis and graphical
Gaussian modeling. Bioinformatics (Oxford) 18, 287-297.
[0333] Wingender, E., Kel, A. E., Kel, O. V., Karas, H.,
Heinemeyer, T., Dietze, P., Knueppel, R., Romaschenko, A. G. and
Kolchanov, N. A. (1997). TRANSFAC, TRRD and COMPEL: Towards a
federated database system on transcriptional regulation. Nucleic
Acids Research 25, 265-268.
[0334] Wyrick, J. J. and Young, R. A. (2002). Deciphering gene
expression regulatory networks. Current Opinion in Genetics &
Development 12, 130-136.
[0335] Xu, Y., Olman, V. and Xu, D. (2002). Clustering gene
expression data using a graph-theoretic approach: An application of
minimum spanning trees. Bioinformatics (Oxford) 18, 536-545.
[0336] Zhu, Z., Pilpel, Y. and Church, G. M. (2002). Computational
identification of transcription factor binding sites via a
transcription-factor-centric clustering (TFCC) algorithm. Journal
of Molecular Biology 318, 71-81.
Sequence CWU 1
1
133 1 12 DNA Zea mays 1 ttattacatg yg 12 2 28 DNA Artificial
Sequence Primer 2 gctatcaccm ctcaccaact ccaattaa 28 3 19 DNA
Artificial Sequence Primer 3 cgctggagag gtcggcctt 19 4 29 DNA
Artificial Sequence Primer 4 ccgaattcat ggagcagcag caggagagc 29 5
26 DNA Artificial Sequence Primer 5 tggccgtacg tgtagcctcc tctggg 26
6 21 DNA Artificial Sequence Primer 6 atgatgaacg ttccatccgc c 21 7
22 DNA Artificial Sequence Primer 7 tcggcgggaa gtaggtccgg ta 22 8
19 DNA Artificial Sequence Primer 8 aaggccgacc tctccagcg 19 9 25
DNA Artificial Sequence Primer 9 tcagctgcaa aactccaagc tgtct 25 10
20 DNA Artificial Sequence Primer 10 gatcaagact ttgtacagcc 20 11 22
DNA Artificial Sequence Primer 11 tcttrgcatc gtcgaactca tc 22 12 17
DNA Zea mays 12 caagactttg tacagcc 17 13 18 DNA Oryza sativa 13
caaagacttt gtacagcc 18 14 17 DNA Setaria viridis 14 caagactttg
tacagcc 17 15 17 DNA Arundo donax 15 caagactttg tacagcc 17 16 17
DNA Bambusa multiplex 16 caagactttg tacagcc 17 17 44 DNA Zea mays
17 acgtacgtac gtacgtacga gcaaaaattg caaatgcaag caac 44 18 44 DNA
Oryza sativa 18 acgtacatat gtacgtacca gcacaagttg catttgcaag caac 44
19 42 DNA Setaria viridis 19 cgtgcacgta tgtacgagca aaaaattcca
attgcaagca ac 42 20 41 DNA Arundo donax 20 catgtacgta cgtaccagca
aaagttgcaa ttgcgagcga c 41 21 36 DNA Bambusa multiplex 21
acgtacgtac cagcacaagt tgcgattgca agcaac 36 22 25 DNA Zea mays 22
tcagctgcaa aactccaagc tgtct 25 23 25 DNA Oryza sativa 23 tcagctgcaa
aactccaagc tgtct 25 24 25 DNA Setaria viridis 24 ttagctgcaa
gactccaagc tgtct 25 25 25 DNA Arundo donax 25 tcagctgcaa gaatccaagc
tgtct 25 26 25 DNA Bambusa multiplex 26 tcagctgcaa aactccaagc tgtct
25 27 19 DNA Zea mays 27 attggtcccc ggaatgttc 19 28 19 DNA Oryza
sativa 28 attggtcccc agaatgttc 19 29 18 DNA Setaria viridis 29
gttggtcccg gaatgttc 18 30 19 DNA Arundo donax 30 attggtcccc
ggaatgttc 19 31 19 DNA Bambusa multiplex 31 attggtcccc agaatgttc 19
32 15 DNA Zea mays 32 gtatttcatg tgtat 15 33 15 DNA Oryza sativa 33
gtatttcatg tgtat 15 34 15 DNA Setaria viridis 34 gtctttgctg ttaat
15 35 15 DNA Arundo donax 35 gtatttcatg tgtat 15 36 15 DNA Bambusa
multiplex 36 gtatttcatg tgtat 15 37 17 DNA Zea mays 37 gcgcatccga
cggccac 17 38 15 DNA Zea mays 38 ggttgacttg cgcct 15 39 14 DNA Zea
mays 39 ctgactatag atgt 14 40 14 DNA Zea mays 40 tttattaagc taat 14
41 14 DNA Zea mays 41 ttgagatgct gagt 14 42 17 DNA Zea mays 42
gctccgagcc gcagatc 17 43 17 DNA Oryza sativa 43 gctcccagcc gcagatc
17 44 13 DNA Zea mays 44 ttattttatt ttt 13 45 12 DNA Zea mays 45
taaattgtat tt 12 46 12 DNA Zea mays 46 tatgattctt tc 12 47 16 DNA
Zea mays 47 ttagtcattt tattac 16 48 16 DNA Oryza sativa 48
ttaggcattt tattac 16 49 12 DNA Zea mays 49 cattttatta ct 12 50 11
DNA Zea mays 50 tattatatta t 11 51 15 DNA Zea mays 51 tcaattgcaa
tgaga 15 52 15 DNA Oryza sativa 52 tcaattacaa tgaga 15 53 15 DNA
Zea mays 53 cccaccagtc cacca 15 54 15 DNA Oryza sativa 54
cccaccaatc cacca 15 55 11 DNA Zea mays 55 ctgtatcagt a 11 56 11 DNA
Zea mays 56 taaattgtat t 11 57 11 DNA Zea mays 57 attatgtttt t 11
58 11 DNA Zea mays 58 agctaatttt a 11 59 11 DNA Zea mays 59
attttatttt t 11 60 11 DNA Zea mays 60 gggctgttct g 11 61 11 DNA Zea
mays 61 ttcgaatttt a 11 62 11 DNA Zea mays 62 taaattgtat t 11 63 11
DNA Zea mays 63 ctaattttag a 11 64 15 DNA Zea mays 64 gagaaggaaa
agaag 15 65 15 DNA Oryza sativa 65 gagaaggaga agaag 15 66 11 DNA
Zea mays 66 tacaaattcc a 11 67 11 DNA Zea mays 67 cgtggtttgc t 11
68 11 DNA Zea mays 68 tttaaaaata g 11 69 11 DNA Zea mays 69
tattatatta t 11 70 11 DNA Zea mays 70 tttaaaaata g 11 71 11 DNA Zea
mays 71 gaatatgtta g 11 72 11 DNA Zea mays 72 cattttatta c 11 73 11
DNA Zea mays 73 tccaggtgga g 11 74 11 DNA Zea mays 74 ctaattttag a
11 75 11 DNA Zea mays 75 ttttagttag g 11 76 11 DNA Zea mays 76
cttcttggtt t 11 77 15 DNA Zea mays 77 catggatggt gaggt 15 78 13 DNA
Zea mays 78 ttaattgatt tta 13 79 13 DNA Zea mays 79 ggccggccta cgt
13 80 12 DNA Zea mays 80 agctagctag ct 12 81 12 DNA Zea mays 81
agctagctag ct 12 82 16 DNA Zea mays 82 acttgcatgc ttgtag 16 83 16
DNA Oryza sativa 83 acttgcatgt ttgtag 16 84 12 DNA Zea mays 84
cgctcgctct ac 12 85 12 DNA Zea mays 85 ctagctctcg ct 12 86 12 DNA
Zea mays 86 agctagctag ct 12 87 12 DNA Zea mays 87 aattaatata ta 12
88 12 DNA Zea mays 88 gttaacgtac at 12 89 12 DNA Zea mays 89
agctagctag ct 12 90 11 DNA Zea mays 90 gtccaactca c 11 91 11 DNA
Zea mays 91 catgcataaa a 11 92 11 DNA Zea mays 92 acctgtgtaa g 11
93 11 DNA Zea mays 93 aggaagagag a 11 94 11 DNA Zea mays 94
aaaaaatcaa a 11 95 15 DNA Zea mays 95 ttctaatata cgatt 15 96 15 DNA
Oryza sativa 96 ttctaatata tgatt 15 97 11 DNA Zea mays 97
tatattatat a 11 98 11 DNA Zea mays 98 gtataaattg a 11 99 11 DNA Zea
mays 99 agctagctag c 11 100 11 DNA Zea mays 100 ttttcaatta t 11 101
11 DNA Zea mays 101 agctagctag c 11 102 11 DNA Zea mays 102
aaatcttaga a 11 103 15 DNA Zea mays 103 agctctcgct tgctc 15 104 15
DNA Oryza sativa 104 agctctcgct cgctc 15 105 11 DNA Zea mays 105
gctatatact a 11 106 11 DNA Zea mays 106 tcatccatac a 11 107 15 DNA
Zea mays 107 aaaaatatac tacat 15 108 15 DNA Oryza sativa 108
aaaaatataa tacat 15 109 11 DNA Zea mays 109 agcaaattaa a 11 110 11
DNA Zea mays 110 tgtttcttct t 11 111 29 DNA Zea mays 111 gttgttgatg
tctttacaca gttcatctc 29 112 29 DNA Oryza sativa 112 gttgttgatg
gcttcacaca attcatctc 29 113 15 DNA Zea mays 113 tttgtaggtt aacat 15
114 25 DNA Zea mays 114 ccacaagatc acttcgggag gcaag 25 115 25 DNA
Oryza sativa 115 ccacaagaac acttgggcag gcaag 25 116 21 DNA Zea mays
116 aaaggtttca tgtgtaccgt g 21 117 21 DNA Oryza sativa 117
aaaggtttca tgcgtatcgt g 21 118 20 DNA Zea mays 118 cttcattaaa
tgtgaatttc 20 119 20 DNA Oryza sativa 119 cttcattaaa tatgattttc 20
120 12 DNA Zea mays 120 ggcatctcca cc 12 121 12 DNA Zea mays 121
tcatactcta ta 12 122 12 DNA Zea mays 122 ttctgttttt tc 12 123 12
DNA Zea mays 123 tactctatat aa 12 124 12 DNA Zea mays 124
tattactaaa tt 12 125 12 DNA Zea mays 125 ttcattaata tc 12 126 12
DNA Zea mays 126 caaaattaat ta 12 127 16 DNA Zea mays 127
tttttcttga atttgt 16 128 16 DNA Oryza sativa 128 tttttattga atttgt
16 129 1789 DNA Setaria veridis 129 tcagtggatt attgatcgat
cgatgcacac acatctatca cctgcttctc aaattggagg 60 gatgaataaa
gttaccttct tggcggttgg gtaattaata ctagttcagg aggagtggat 120
cttattatct acatacacat gtcgtctgaa ctgaaatcac gagttgcatt aagtgatctc
180 tgatctcgaa gttccattca gttcgtcatt ggctggctac actgaaactg
attttatggt 240 caggcaattt gcctctccta agctacgatc tcatcatcag
agaaaaagct tttgggggat 300 atgattggtt tgtttcatcc catgatatac
caccaccact tataattctg tggatatata 360 attaccttta gttagaaaag
tcaaataaaa gaaaggggaa ggcaattgcc ttggttttca 420 tcatatatac
cacccttgcc ttgttcctct gactttttca gctgcatttt aagtgaatcc 480
cttcacagtt agacctagct acatttcctc atgtttccat tacatgaact ttctgaaaaa
540 ttcttatatt tcttgataca aacatccaat agctagctta ccattaatgc
catggttata 600 cttagcaaac tacttctatt tctgatgatt aaacacacca
aattaaggag ccagcatgca 660 gaattgacag aaccaacagt tgtgtacaca
caagatgcat atcactcatc agatgctaaa 720 ttaaatatca tctctcatat
atatcccact tggtggtttg gacttgaaat taatcttcaa 780 ctaacaatgc
atttcacgtt gggctcatca tttgcagaaa ttatccttct ttatcaatga 840
aatagacact ttcttgtgcc cgttcgttaa aaaaaatcat ttgcagaaat ttgcccttga
900 ttttcgtctc tcctcctctt gttatttctt cgttggcgct actctttcca
tttatttcct 960 tgacttctcc gtattttcga tcgagtagtt acttcattca
acagtgagct gccgggtaca 1020 tgtataatgt attggcctct caaaagtcag
aaacgacgac tctactttct tccaagtatc 1080 ccaagacttt gtacagcccg
tgcacgtatg tacgagcaaa aaattccaat tgcaagcaac 1140 tcctcttctt
tctctaccct ccctcgcatg ttatttctcc tccaagtggc tgttaggatc 1200
aatccattta ccagatgata ttatatatgc taaatctttt attttaccaa tccctgccgt
1260 catcagtgtg atatggatgg ctctgcgaat tgtacatctc gatagatctc
ggctgaagaa 1320 cgagatgcac gtgtgaagta actgaccggc aatgcattta
agggtaaaca ggatctctcc 1380 cagaatgatt cactacattg agacacacca
tatgagttag ctgcaagact ccaagctgtc 1440 tgttgggaag aacagtgtag
atatatgctt ctcatgttct ggatcatcat tagtaacatg 1500 ctgttggtcc
cggaatgttc tctctctttt ttttccagtc ctgggatgtc tttactctag 1560
ttaggaagtg gatttgtata taattcactt tctgggactg aaatttccta tctcgatttt
1620 gccgtatcaa ctcatcatgc atcatgcatg ataccaaatt agctatataa
tgctatatat 1680 tatgatgaat gatatatacg gaaccatgtc tttgctgtta
attggtattt catgtgtatg 1740 catgttttcc catttccctc ttttttaccg
tccaaatttg tcgttcaga 1789 130 1893 DNA Zea mays 130 tcagtaggcc
actcggtcat cactggatcc agccccaatt cagctccact tcaaattcaa 60
tccatcgatc tcgatctctc tggctcggca ggttctcaaa ataattcgag gggtaaataa
120 tctaccttta tggttgggtc gggtacttca catgtctata tagatcttgt
ctacacatac 180 atatatatct gaaatcatca cgagttgcat taagtgatct
ccaagtcccc cttcagttca 240 atggccagct tgatcgaaac tgatttcatg
catgctatat tgctcgatct cacgagttat 300 ctggcactct tcgaagctac
aattttgtca gagaaatctt ttggggagat aggttacttc 360 gttgcgcctc
atgatacatc acttatagtt ggcatgatat cataattatt accttctttt 420
ttagttataa aaagtcaatt gaacaaggag gtgaaagcta ttgcttttat tttcatgata
480 tcatccctgc ccttatttct ctctgacttc gtctcttcag ctgcatttta
agcgaatata 540 tctcagtttg acatgttata catttcgtta tatatgactc
catttcatga gcctaatttc 600 cccagaaacc ttatatttct tgagacaaac
tttctaaaat ggttgtactc ctacttatat 660 tagcaaccac tacttctcga
tctatatata ttattatatt atataacaat tgaatccaac 720 aacaaactaa
agagagcatg cttaattgac aaaaatccag ttgttattaa cacaaaatgc 780
ataaatatgt atttactggt tgcaaattaa agcaaaagat ctgtaagcca ttttccctcg
840 tcagttcaca tcccagttaa taatttgccg ctgaaattat ctagcccttt
ctcttcaaca 900 ttttgctgaa ccttgatttt cttttgtctc tcctcctcct
cctcttccat ttcatttcat 960 ttcttccttg gcattattta ctcctttcca
ttttatttct tccttggcat tacttgtttc 1020 catttatttc cttgacttct
ccgtccttgg tattttcgat ctagtagtta ttataaacag 1080 cgaggtggct
gtacaagtat tggcctctca aaaaaagtca gaagcaaggc tactttcttc 1140
caagcatcgc aagactttgt acagccgccg ggtagacgta cgtacgtacg tacgagcaaa
1200 aattgcaaat gcaagcaaca atgccttgtt agcttctctc tactctctct
ctctctctct 1260 ctctctctct ctctctctct ctcatgtatt atttctcttc
catatcaatt gcctggtata 1320 gtagctagca atccgttggc cagagaagag
acatacatac gttctgttac cggccaatcc 1380 atgggctggc cggacctgca
aatagatctc gtctgaggag catgcacgtg tgaagtaata 1440 accggcaatg
catttaatgg taaacaggat ctctcccaga atgattcacc acattgagac 1500
acgccatatg tgctcagctg caaaactcca agctgtctgc agggaagaac agtggagtag
1560 tatagataca tgttcctcat gttctggatc atcatcatta gtagtaacgc
gcatgccatt 1620 ggtccccgga atgttccgtt tttacttgag ggaaatggac
tcagatctcc ctcttccatc 1680 acgcatgtac gaggcatgca tcatcagctc
atcttgcatt aatattgcta tataatccaa 1740 ctacagtatc tatatatata
tgaatgatat atactgcatg catgatgcat ggctttcctc 1800 tggatacgtg
gtatttcatg tgtatcgatg ctttcgtaat actcttgctt caattctttt 1860
tctctttttc cttgtacacc tttgtcactc aga 1893 131 1648 DNA Arundo donax
131 ttagtgcatc catctatccg cttcattcat tctcaaatta tatatcagga
tctcgaatta 60 ctcctacctt gatgatgatg attgagttaa ttaatatgtt
cggatggatc ttgttgagac 120 ggctcatttg ataggggaat gatccattcc
tgattgaaat catgagtttc attcagttca 180 ttactgcata catagaaaca
acttagtaat taggttcatc tcctgaaaaa gtctaacgaa 240 acagaaggtg
gatagtattg ctttgatctc gcatgatatc atcctcgcct tgtttctcta 300
tccttttcag ttgcatcagt aattaaccct tgacaactca atctacattt cggtggtgta
360 tttccattgc atgaacgtct gaaataactg atatttcttg agataaatat
tcgctacctt 420 atgatttccg tggatgtagt tggcaaacat ctaaagacgt
agtacaagga tatcaattgc 480 aatggagaaa ttgtatcaat tttttctcca
catagtgcct aatttaggta agaacaggcg 540 tgtaccattt actactcttc
agtcttcaca atgcaagctg aatggacata acagttgtgc 600 gtgtaacaac
ataatccata gtagtactca gttgcaaaca aaagatatgt acgccatact 660
tttttctgta cttctaagtt aaaatatttc ctgaacatat tggcatttga aattaatcct
720 gaacaatgca tttcacgttg ggcaccattt
ccagatcaca tcttatcttt gagctgcttc 780 tcttctccta ctcttgtttc
ttcctgagct tggctctact ccttaatttc catttatttc 840 cttgacttct
ccttctcatt ttcgagtagt tacttcaaac aacgaggtgc ctgcacatgt 900
attggcctct caaaagtcag aaaatagtgc tgctttcttc caaagtatcg caagactttg
960 tacagcccat gtacgtacgt accagcaaaa gttgcaattg cgagcgacgc
cttcctctac 1020 cagtggtctg catccctcgt tctttctcag tccttcatgt
gcctggtagt agcaacctat 1080 tggccagctt acatctttac caattcgttt
aactgccctc actccgatgg atggctcata 1140 gctcgctctg cgaattgtac
atcgatctct gctgaagctt gcacgcgtga agaagtgacc 1200 ggcaatgcat
ttaagggtaa acaggaactc tcccagaatg actcaccata ttgagacatt 1260
ccatatgact cagctgcaag aatccaagct gtctgtaggg aagaacagtg tagatatatg
1320 cttctcatgt tcgtggtcat cattagcaac atattggtcc ccggaatgtt
ctttttcagt 1380 tctggatttt tttattagag gaaatggttt tttatattta
attcagttca attctggact 1440 gaagttcgat catgcatcaa gcatcaactc
atcatgcact aacatatgtg ttacgtaggc 1500 aacacttaat actattagaa
tgaacgatat aaataaacac catgtcttca ctgattgtac 1560 cttggtattt
catgtgtatg catgtcttca tgccatcctc ttttaatttc tgtccttttt 1620
ttcgtccaac gttgtcattc aattgaca 1648 132 1774 DNA Bambusa multiplex
132 ttagtagact cactgattga tttttcctaa agaggtgaag ttgcatattt
gatcgattgg 60 ttcaattaat gagatagatc ttgtagaagt gtacgtgttt
aattggagtg tgattctaaa 120 atcttgagtt gcttaaagtg atctgccagt
ttcattcagt tcagtattgg ataggttgaa 180 acgaggtatt gatcaacaac
tcatcttatt ctgtcacaaa attagtcttc taagctagga 240 tttgttagta
caagcttttg agacaagtaa tttcagctcg tgatatatga tatatcacct 300
gttcacctca agtaattact tttagttgga aaatcaaata aaatagaaga tgaagattat
360 tgctttgaac ttggaagata tcatctttgc cttcttttct gacctttttt
cgctgcatct 420 taaaagaatg tgcagcagtt gaatgtttga tctacatttt
agctagattt ccatttcata 480 gatgttccta catctatccc atgctcaagt
gcgctgctgg attgaaacaa ctaatatttc 540 ttgagtgaaa tatttgcata
cctgttctca cacattaaat tcccatggat atatatatga 600 tacaggcaag
agacaactga tcagcaatta gttgaagggg agaatttgca atggtgaaac 660
tgcaccccca ttcaatgtgc atatatagtg cctgtagtat aagaaaaacg taatgtgcat
720 atatagtgcc tgtagtataa gaaaaacgta atgtgcatat atagtgcctg
tagtataaga 780 aaaacgtgta ctaattaatc aattggatca caatgtgaat
taacgtttaa tgcacacaaa 840 cattcacttt ctaaaacaag atggtaacag
tattggtctc agtttatcca agcgatgaaa 900 gattcatgtg ctatcctctt
tctacatatt ttgaattgct tccagtactt aaaagattca 960 tgtatcatat
gttgggaacc atatatgcag acatcttgtc cttgagttgc ttcttttctc 1020
ctcctttggt tgttccttgc gctactcctt tccatttatt ttgcttgcct tctccttcga
1080 atgttttgag tggttacttg aaacacactc aaacagtgtg agctgtctgt
acatgtattg 1140 gcctctcaaa gtcagaaaca aagctacttt cttcctaagt
attgcaagac tttgtacagc 1200 ccgtgaacgt acgtaccagc acaagttgcg
attgcaagca acgctctctc attctttccc 1260 gtgcatgtgg catgtagtaa
caatagattg gccagcttaa taatacatgt ctatcaaacc 1320 atttacctgc
cctcactgag atgaatggtt cttagaattg taccatcgat ctctgttcaa 1380
gcatggacgt gtgaagtgac cagcattgca tttaagggta aacaggatct cttgcagtat
1440 gacacaccat aaggagacac tccatatgaa tcagctgcaa aactccaagc
tgtctgtgag 1500 atagaactgt ttagatgtat gtttctcatg ttcatgatca
tcattagcta gatattggtc 1560 cccagaatgt tctttcagtt ctgaactgaa
gtttgattat gactcaccga tcatgcactg 1620 atatgtatat tacgcaggaa
attacagcta gctcgtgctg ctcctagaat gattacgtca 1680 tgtctttatg
attatacctt attagtattt catgtgtatg tctttataca gccttctctt 1740
ttctctttgc ttcctccaac ctttttcatt caga 1774 133 1973 DNA Oryza
sativa 133 tcagtgttca tcgtcgtgtt tagtttgctg ctcgaattca ctattctccg
atccactgtt 60 catcgatttc ccagaagagg atgctggccc gatttaattt
gctttgtccg attgattggt 120 ttaattaatg agacacacat cttgttgcgg
cgtgtttaat ttgattggag aatatgattt 180 gtaggatcag agagttgcat
taattaagtg atctggaagt tccattctgc tcactattga 240 gatcatatcg
aagggtgaaa ctttaataat aaatctccta atttaactac ctaggattta 300
agcttttctt tttttttcat acaagtaatt tcagctcatc attagccgcc tgtttgccct
360 caaagtaatt acgttagttg gaacagtcag atgaaattga agacggcaat
tgctttgaac 420 tttaattgga tgtgtggtac catctttggc ctcttttcct
gagttcttcc ggttccttgc 480 ctcatgaacc catgagcagt tcaatgcttg
ctctacattt gcccagattt ccttgccttt 540 acatttcttt gaaagagaga
tttcttccta tacaattatc tgattcttaa ctgcttaaac 600 tgatatttct
agtatttttt gatgaacaat tccctaatct gttctcagaa atttgagcta 660
aattggatgc atttagcaag ctattgctgc atatttgata tatacgttta gccgatttcg
720 caattagcta tggtgaggag aaaattttgc acccatttta tattattgcc
tacactgcag 780 gctaattaag ataattcgtg tactatagtt attaatctgt
tcggacacaa tatataaatt 840 ttgaattatc gctgttctga acacataaac
gttcattcgc tttgcaaaac aaaattacaa 900 atagtatgcg tgcatgtttc
taggtttacc caggtgatga gctagagatt catatgccat 960 ctttttcttt
ctttgtgttt caaattaaag atctttcttt ggagaaaatt gtgtttcaaa 1020
atattgattt ctgtttaatt aaattgaatc ctgatcacta tctatcacat gctgggactt
1080 gggggggaat aaccaatatc tgtacaaata catattgatc ttgtcctaga
tagagttgct 1140 tattttctcc tcctttggtt attgttcctt gaaactagcc
cttcccattt atttttcttg 1200 acttctcctt cgcatgtttg agtggttact
tccaacagta ttcgagacgt ctgtacatgt 1260 attttggcct cacaaagtca
gaaacaatgc gactttcttt gcaagtatag caaagacttt 1320 gtacagcccg
ctcacgtaca tatgtacgta ccagcacaag ttgcatttgc aagcaacgtg 1380
ttctttctct ctctctcatt ctttttttac cctgaatgtg tggccggccg tcagtaacat
1440 ttacctcact gagatgaacg gctcggattg attgagaaac tgaagaagaa
actaccttcg 1500 atgcctccta agcatgcacg tgttaagctc agcaatgcat
ttaagggaaa acaggaacct 1560 tttgcagtat ggcacaccat atggaaacac
tccatatgag tcagctgcaa aactccaagc 1620 tgtctctggg atggaacagt
ttaggtgtat gtgcttctcg tgctcaggat catcattagc 1680 ttacatattg
gtccccagaa tgttcttttc atcagtagtt tcttctgaac tgaagtttga 1740
tctggcctga gcaacctgtc attttgtctt cgctaatgtg cacgtttatg taggaaatat
1800 gcatgcagga tcatgcaaca agcttctcaa tcgtagaagt agtacttcat
cttccatatc 1860 ctttatcgtt gtaccgtagt atttcatgtg tattcgtctt
cagctcttcg tagttgcatg 1920 catccctctc atttctgtat gttaaccttt
tctaacctgt tcaattattc aga 1973
* * * * *
References