U.S. patent application number 10/261517 was filed with the patent office on 2003-07-31 for novel response element.
This patent application is currently assigned to Biovitrum AB, a Swedish corporation. Invention is credited to Climent-Johansson, Isabel, Dahlman-Wright, Karin, Lake, Staffan, Wasserman, Wyeth.
Application Number | 20030143583 10/261517 |
Document ID | / |
Family ID | 27355988 |
Filed Date | 2003-07-31 |
United States Patent
Application |
20030143583 |
Kind Code |
A1 |
Climent-Johansson, Isabel ;
et al. |
July 31, 2003 |
Novel response element
Abstract
The present invention is directed to a novel Afx response
element comprising the nucleotide sequence AACATGTT, said
nucleotide sequence having a DNA binding site for the human fork
head transkription factor Afx. The invention also relates to the
use of the Afx response element in the screening for genes as
diabetes drug targets and in the bioinformatic analysis of the
human genome, said genes in turn being useful in other screening
methods for compounds modifying the insulin receptor signaling
pathway. A further aspect of the invention is a vector construct
comprising the novel nucleotide sequence, a host cell transformed
with said vector construct as well as the fusion protein expressed
by said host cell.
Inventors: |
Climent-Johansson, Isabel;
(Stockholm, SE) ; Dahlman-Wright, Karin; (Bromma,
SE) ; Lake, Staffan; (Lidingo, SE) ;
Wasserman, Wyeth; (Stockholm, SE) |
Correspondence
Address: |
FISH & RICHARDSON PC
225 FRANKLIN ST
BOSTON
MA
02110
US
|
Assignee: |
Biovitrum AB, a Swedish
corporation
|
Family ID: |
27355988 |
Appl. No.: |
10/261517 |
Filed: |
October 1, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10261517 |
Oct 1, 2002 |
|
|
|
09645629 |
Aug 24, 2000 |
|
|
|
6472515 |
|
|
|
|
60151867 |
Aug 31, 1999 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/199; 435/320.1; 435/325; 435/69.1; 536/23.2; 702/20 |
Current CPC
Class: |
C12N 15/85 20130101;
C07K 14/4702 20130101; C07K 14/4701 20130101; C07K 2319/00
20130101; C12N 2830/002 20130101; C12N 15/11 20130101 |
Class at
Publication: |
435/6 ; 435/69.1;
435/199; 435/320.1; 435/325; 536/23.2; 702/20 |
International
Class: |
C12Q 001/68; G06F
019/00; G01N 033/48; G01N 033/50; C07H 021/04; C12N 009/22; C12P
021/02; C12N 005/06 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 26, 1999 |
SE |
9903009-0 |
Nov 25, 1999 |
SE |
9904269-9 |
Claims
1. A nucleotide sequence AACATGTT, said nucleotide sequence
comprising a DNA binding site for the human fork head transcription
factor Afx.
2. An Afx response element comprising the nucleotide sequence
AACATGTT.
3. An Afx response element according to claim 2, which is a
cytokine response element.
4. An Afx response element according to claim 3, which is an
insulin response element.
5. A vector construct comprising the nucleotide sequence according
to claim 1.
6. The vector construct according to claim 5, which is
pGEX-DBD.
7. A host cell transformed with the vector construct of claim 5 or
6.
8. A fusion protein expressed by the host cell of claim 7.
9. A fusion protein according to claim 8, which is the protein
expressed by GST/AfxDBD.
10. Use of a nucleotide sequence according to claim 1, in the
screening for genes.
11. Use of a nucleotide sequence according to claim 1, in
bioinformatic analysis.
12. A gene identified by the use of a nucleotide sequence according
to claim 1.
Description
TECHNICAL FIELD
[0001] The present invention is directed to a novel Afx response
element comprising a DNA binding site for the human fork head
transcription factor Afx, as well as to its use in the screening
for genes.
BACKGROUND AND PRIOR ART
[0002] Diabetes and obesity are global health problems. Diabetes is
the leading cause of blindness, renal failure, and lower limb
amputations in adults, as well as the major risk factor for
cardiovascular disease and stroke. Normal glucose homeostasis
requires the finely tuned orchestration of insulin secretion by
pancreatic beta-cells in response to subtle changes in blood
glucose levels, delicately balanced with secretion of
counter-regulatory hormones such as glucagon.
[0003] Type 1 diabetes or insulin-dependent diabetes mellitus,
IDDM, results from autoimmune destruction of pancreatic beta-cells
causing insulin deficiency. Type 2 or NIDDM (non-insulin dependent
diabetes mellitus) is characterized by a triad of (1) resistance to
insulin action on glucose uptake in peripheral tissues, especially
skeletal muscle and adipocytes, (2) impaired insulin action to
inhibit hepatic glucose production, and (3) dysregulated insulin
secretion (R. A. DeFronzo, (1997); Diabetes Reviews, 5, pp.
177-269). After glucose infusion or ingestion (i.e., in the insulin
stimulated state), the liver in type 2 diabetic patients
overproduces glucose and the muscle glucose uptake is decreased
leading to both hyperinsulinemia and hyperglycemia.
[0004] Insulin regulates a wide range of biological processes,
including glucose transport, glycogen synthesis, protein synthesis,
cell growth, and gene expression. Insulin regulates these processes
by altering the concentration of critical proteins or by producing
activity-altering modifications of pre-existing enzyme molecules.
It is clear that insulin can have both positive and negative
effects on the transcription of specific genes (R. M O'Brien, et
al. (1996). Gene regulation in Diabetes Mellitus Lippincott-Raven
publishers, Philadelphia. pp. 234-242). The genes regulated by
insulin encode proteins that have well-established metabolic
connection to insulin, but also secretory proteins/hormones,
integral membrane proteins, oncogenes, transcription factors, and
structural proteins. Not unexpectedly, this type of regulation of
gene expression is seen in the primary tissues associated with the
metabolic actions of insulin, namely, liver, muscle, and adipose
tissue, but also in tissues not commonly associated with these
metabolic effects.
[0005] The cis/trans model of trancriptional control can be
utilized to understand how insulin regulates gene transcription at
the molecular level. The fidelity and frequency of initiation of
transcription of eukariotic genes is determined by the interaction
of cis-acting DNA elements with trans-acting factors. The specific
sequence of the cis-acting element determines which trans-acting
factor will bind. Several cis-acting elements that mediate the
effect of insulin on gene transcription have recently been defined.
These are referred to as insulin response sequences or elements
(IRSs/IREs) (R. M. O'Brien, et al. (1996). Gene regulation in
Diabetes Mellitus Lippincott-Raven publishers, Philadelphia. pp.
234-242; G. J. P. Kops, et al. (1999). Nature, 398, pp. 630-634; S.
Guo et al (1999). J. Biol. Chem. 274, 17184-17192; J. E. Ayala et
al. (1999). Diabetes, 48, 1885-1889; and S. K. Durham et al.
(1999). Endocrinology, 140, 3140-3146). However, it should be
mentioned that to date, there is lack of agreement upon a single
insulin response element. Also, that formation of heterodimers
between two trans-acting factors can alter their ability to
activate transcription, their affinity for DNA or sequence
specificity.
[0006] One important question in the study of insulin-regulated
gene transcription is how a signal passes from the insulin receptor
in the plasma membrane through the cytoplasm and the nuclear
membrane to a specific trans-acting factor binding to an IRE.
Well-characterised signal transduction mechanisms downstream of the
insulin receptor involve cascades of kinase/phosphatase reactions,
including, among others, the phosphatidylinositol 3-kinase (PI3K)
pathway (P. J. Coffer, et al. (1998), Biochem. J. 335, pp. 1-13, S.
Paradis, et al (1998), Genes & Development, 12, pp. 2488-2498,
B. B. Kahn (1998); Cell, 92, pp. 593-596). Binding if insulin to
its cell surface transmembrane receptor stimulates receptor
autophosphorylation and activation of the intrinsic tyrosine kinase
activity, which results in phosphorylation of several cytosolic
docking proteins called insulin receptor substrates (IRSs). IRSs
bind to various effector molecules including the 85 kDa regulatory
subunit of PI3K. This localizes the 110 kDa catalytic domain of
PI3K to the plasma membrane. The activated PI3K phosphorylates
membrane bound phosphoinositides (PtdIns), generating PtdIns(3,4)P2
and PtdIns(3,4,5)P3. These lipids bind to the pleckstrin homology
(PH) domain of protein kinase B (PKB, also known as Akt) leading to
its accumulation at the cell membrane. The binding causes a
conformational change in PKB that makes it more accessible to
phosphorylation, which is necessary for its activation. The
kinases, which phosphorylate PKB, are themselves targets for lipid
products of PI3K and are therefore also localized to the membrane.
These kinases are called phosphoinositide-dependent protein kinases
(PDK1 and PDK2). Activated PKB dissociates from the membrane and
moves to the nucleus and other subcellular compartments.
[0007] The Insulin-Like Pathway in the Nematode Caenorhabditis
elegans
[0008] Recent studies in the nematode Caenorhabditis elegans show
that a major target of the Akt/PKB homologues, akt-1 and akt-2, is
a transcription factor (S. Paradis, et al. (1998); Genes &
Development, 12, pp. 2488-2498). An insulin receptor-like signaling
pathway regulates C. elegans metabolism, development, and
longevity. This pathway is required for reproductive growth and
normal metabolism. Mutations in the insulin receptor homologue
daf-2 or in the PI3K homologue age-1 cause animals to arrest as
dauers, shift metabolism to fat storage, and live longer. This
regulation of C. elegans metabolism is similar to the physiological
role of mammalian insulin in metabolic regulation. Mutations in the
gene daf-16, which encodes a fork head transcription factor that
acts downstream of the kinases, suppress the effects of mutations
in daf-2 or age-1 (S. Ogg et al. (1997); Nature, 389, pp. 994-999,
K Lin et al. (1997); Science, 278, pp. 1319-1322). The principal
role of DAF-2/AGE-1 signaling is thus to antagonize DAF-16. Paradis
et al. showed further that inactivation of C. elegans Akt/PKB
signaling also causes a dauer constitutive phenotype, and that
loss-of-function mutations in the Fork head transcription factor
DAF-16 relieves the requirement for Akt/PKB signaling to repress
dauer formation. This indicates that DAF-16 is a negatively
regulated downstream target of Akt/PKB signaling. DAF-16 contains
four consensus sites for Akt/PKB phosphorylation, which indicate
that the kinase exert the negative regulatory effect by directly
phosphorylating DAF-16 and altering its transcriptional regulatory
function.
[0009] Human DAF-16 Homologues
[0010] The most closely related proteins, identified so far, to
DAF-16 are the human fork head transcription factors Afx, FKHR and
FKHRL1. Based on amino acid sequence comparison of their fork head
DNA-binding domains, Afx, FKHR, and FKHRL1 share about 60-65%
identity with DAF-16 (S. Ogg et al. (1997); Nature, 389, pp.
994-999). Afx shares 83% and 81% identity to the fork head domains
of FKHR and FKHRL1, respectively (M. J. Anderson et al. (1998);
Genomics, 47, pp.187-199). Although this high homology is confined
to the fork head domain, amino acid sequences on either side of
this domain show little relatedness. However, there are several
amino acid stretches outside the fork head domain that show marked
sequence conservation. A N-terminal region of 24 amino acids is
75-83% conserved, and the C-terminal ends of each protein where the
transactivation domains are located (J. L. Bennicelli et al.
(1995). Oncogene, 11, pp. 119-130 and G. J. P. Kops, et al. (1999).
Nature, 398, pp. 630-634) contain several stretches of homology.
The genes for the human DAF-16 homologues were first identified at
chromosomal breakpoints in human tumours (A. Borkhardt et al.
(1997); Oncogene, 14, pp. 195-202; W. J Fredericks, et al. (1995);
Molecular and Cellular Biology, 15, pp. 1522-1535, M. J. Anderson
et al. (1998); Genomics, 47, pp. 187-199). These tumours were
associated with translocation-generated fusion proteins,
Afx/mixed-lineage leukemia (MLL) fusion protein in acute leukemias,
and PAX3/FKHR fusion protein in alveolar rhabdomyosarcomas. These
fork head proteins contain three PKB phosphorylation sites. It has
recently been proposed that Afx is a substrate for PKB (S. R. James
et al. Recent Res. Devel. Biochem., 1 (1999), pp. 63-76; and G. J.
P. Kops, et al. (1999), Nature, 398, pp. 630-634). The
phosphorylation of Afx increases after insulin stimulation, and
this in terms reduces the activity of the transcription factor.
Thus, Afx is negatively regulated by PKB.
[0011] A. Brunet, et al. demonstrated in Cell 96 (1999); pp.
857-868, that PKB also regulates the activity of FKHRL1. In the
presence of survival factors, such as insulin-like growth factor 1
(IGF1) and neurotrophins, PKB phosphorylates FKHRL1, leading to
FKHRL1's retention in the cytoplasm. Survival factor withdrawal
leads to FKHRL1 dephosphorylation, nuclear translocation, and
target gene activation.
[0012] It has been shown that Afx can activate insulin response
element-driven reporter genes (S. R. James et al. Recent Res.
Devel. Biochem., 1 (1999), pp. 63-76; and G. J. P. Kops, et al.
(1999); Nature, 398; pp. 630-634). However, it has not been shown
if these are the optimal response elements, if Afx, FKHR, and
FKHRL1 show identical or similar DNA-binding characteristics, or
how specific they are with regard to DNA binding.
[0013] Given a representative sampling of DNA sequences to which a
transcription factor will bind, it is possible to generate a
specific profile or model which can be applied to identify DNA
sequences to which a transcription factor will bind in vitro. Such
a model is useful for the identification of genes with a potential
binding site for the transcription factor in the promoter,
intergenic sequences, or 3' regions (the introns and sequences
which flank the first and last exons). Subset of the found genes
can be created, e.g. based on biological knowledge.
THE INVENTION
[0014] The object of the present invention was to find a response
element comprising a DNA binding site for the human fork head
transcription factor Afx. In accordance with the present invention,
a novel Afx response element comprising the nucleotide sequence
AACATGTT is hereby provided, said nucleotide sequence having a
binding site for the human fork head transkription factor Afx.
[0015] The DNA binding specificity of the fork head protein Afx has
in accordance with the present invention been identified. The
binding site for Afx is a palindromic sequence, AACATGTT.
[0016] The present invention provides the basis for future computer
analysis for the identification of genes that are potentially
regulated by the transcription factor Afx. The use of this found
response element is thus useful in the screening for genes that may
be used as diabetes drug targets, as well as in bioinformatic
analysis of the human genome. Thus, the present invention provides
a subset of genes transcriptionally responsive to insulin, said
transcription responsive element being useful in the construction
and development of assays which enable and facilitates the analysis
of genes interacting with the cytokine receptor signaling pathways
(e.g. the insulin receptor). Genes found in such screening may in
turn be useful in additional screening methods for compounds
modifying the insulin receptor signaling pathway.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a schematic presentation of the fusion proteins
used in the selection procedure.
[0018] FIG. 2 is a schematic presentation of the selection and
amplification cycle procedure to isolate high-affinity DNA binding
sites for the transcription factors.
[0019] FIG. 3 is an alignment of the 20 sequences selected for
GST/AfxDBD. Each sequence contains 25 nucleotides and at the bottom
is shown in bold and italics the conserved core motif and partially
conserved flanking nucleotides, respectively.
[0020] FIG. 4 is a summary of selected DNA binding sites for the
three fork head proteins Afx, FKHR and FKHRL1. Numbers represent
the frequency in percentage for each nucleotide at each position.
The number of sequences on which this summary is based is 20, 27
and 10 for Afx, FKHR and FKHRL1, respectively.
[0021] FIG. 5 shows the AfX frequency and weight matrix.
[0022] FIG. 6 is a map over the expression plasmid pGEX-DBD used
for expression of the GST fusion protein GST/AfxDBD, GST/FKHRDBD,
and GST/FKHRL1DBD.
[0023] FIG. 7 shows the nucleotide sequence encoding GST-AfxDBD;
and
[0024] FIG. 8 is the corresponding amino acid sequence for the
protein expressed by GST-AfxDBD.
DEFINITIONS AND ABBREVIATIONS
[0025] In order to provide a clear and consistent understanding of
the invention, the following definitions are provided.
[0026] BSA: Bovine Serum Albumin
[0027] C-terminal: Carboxy-terminal
[0028] dNTP: Deoxy Nucleotide Triphosphate
[0029] DTT: Dithiothreitol
[0030] EDTA: Ethylenediaminetetraacetic acid
[0031] GST: Glutathione S-Transferase
[0032] HEPES: N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic
acid]
[0033] IPTG: Isopropylthiogalactoside, an inducer for the E. Coli
lac operon
[0034] MOPS buffer: 3-[N-Morpholino]propanesulfonic acid
[0035] NuPAGE.RTM., from the company Novex/Invitrogen
[0036] PBS: Phosphate buffered saline
[0037] PCR: Polymerase Chain Reaction
[0038] PMSF: Phenylmethylsulfonyl fluoride
[0039] SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel
electrophoresis
[0040] Tris-HCl: Tris(hydroxymethyl)aminomethane
[0041] Triton X-100: t-octylphenoxypolyethoxyethanol
[0042] Tween 20: Polyoxyethylene sorbitan monolaurate
[0043] X-gal: X-galactose
[0044] Plasmid: A cloning vector which is able to replicate
autonomously in a host cell, and which is characterized by one or a
small number of restriction endonuclease recognition sites. A
foreign DNA fragment may be spliced into the plasmid/cloning vector
at these sites in order to bring about the replication and cloning
of the fragment. The vector may contain a marker suitable for use
in the identification of transformed cells. For example, markers
may provide tetracycline resistance or ampicillin resistance.
[0045] Expression: Expression is the process by which a polypeptide
is produced from DNA. The expression process involves the
transcription of the gene into mRNA, and the translation of this
mRNA into a polypeptide.
[0046] Expression vector: A vector similar to a cloning vector but
which is capable of inducing the expression of the DNA that has
been cloned into it, after transformation into a host. The cloned
DNA is usually placed under the control of (i.e. operably linked
to) certain regulatory sequences such as promoters or enhancers.
Promoter sequences may be constitutive, inducible or
repressible.
[0047] Host: Any prokaryotic or eukaryotic cell that is the
recipient of a replicable expression vector or cloning vector, is
the "host" for that vector. The term encompasses prokaryotic or
eukaryotic cells that have been engineered to incorporate a desired
gene on its chromosome or in its genome. Examples of cells that can
serve as hosts are well known in the art, as are techniques for
cellular transformation (see e.g. Sambrook et al. Molecular
Cloning: A Laboratory Manual, 2.sup.nd ed. Cold Spring Harbor
(1989)).
[0048] Promoter: A DNA sequence typically found in the 5' region of
a gene, located proximal to the start codon. Transcription is
initiated at the promoter. If the promoter is of the inducible
type, then the rate of transcription increases in response to an
inducing agent.
[0049] Response element: The nucleotide sequence of a cis-acting
element located in the promotor region of a gene and involved in
transcriptional control. A response element is a short DNA sequence
located in the promotor, intergenic sequences, or 3" regions (the
introns, and sequences which flank the first or last exons) of a
gene and that is involved in transcriptional control.
[0050] Scoring: For any given sequence as wide as the model, take
the corresponding numbers for the observed nucleotide at each
position and sum the numbers.
[0051] I. Construction of Plasmids
[0052] DNA binding domain sequences of the human transcription
factors Afx, FKHR, and FKHRL1 comprising amino acid residues G86 to
A211 (hAfxDBD); L145 to A270 (hFKHRDBD); and G142 to A267
(hFKHRL1DBD) respectively (FIG. 1), were amplified by PCR using
primers which included 5' and 3' BamHI sites, digested with BamHI
and inserted into BamHI digested pGEX-2T-KB (FIG. 6). This vector
originated from pGEX-2T (Amersham Pharmacia Biotech) after the
introduction of a polylinker (5'GATCTGGTACCGAGCTCGGATCCCCGGG,
Scandinavian Gene Synthesis, Sweden) at the BamH1 and EcoR1 sites.
The cloning cassette of the resulting pGEX-2T-KB vector contains,
in addition to BamH1, EcoR1 and SmaI sites present in pGEX-2T, a
KpnI, SacI and AvaI new restriction sites. The DNA binding domains
were cloned in frame with the GST-tag in pGEX-2T-KB to produce
pGEX-AfxDBD, pGEX-FKHRDBD, and pGEX-FKHRL1DBD. The sequences of the
inserted DNA fragments were confirmed by DNA sequencing. Nucleotide
sequences of primers used for the PCR amplification were
(Scandinavian Gene Synthesis, Sweden):
1 AfxDBD5', 5'GACGACGGATCCGGGGCTGTAACAGGTCCTC; AfxDBD3',
5'GACGACGGATCCTCAGGCTTTACTGCGGCCCCG; FKHRDBD5',
5'GACGACGGATCCCTCGCGGGGCAGCCGCGC; FKHRDBD3',
5'GACGACGGATCCTCAAGCTCGGCTTCGGCTC; FKHRL1DBD5',
5'GACGACGGATCCGGGGGCTCCGGGCAGCCG; FKHRL1DBD3',
5'GACGACGGATCCTCATGCGCGGCCACGGCTCTTG
[0053] II. Expression and Analysis of Recombinant Proteins
[0054] Escherichia coli BL21(DE3) (Novagen) were transformed with
pGEX-AfxDBD, pGEX-FKHRDBD, pGEXFKHRL1DBD, and pGEX-2T-KB (control),
and transformants were used for inoculation of 20 ml of Luria broth
medium (Luria, S. E., and Burrows, J. W. (1957), J. Bacteriol. 74:
p. 461-476) containing 100 .mu.g/ml carbenicillin (Sigma) and
incubated in shaking flasks at 37.degree. C. overnight. The
cultures were diluted into 100 ml of fresh medium to an OD600 of
0.1 and incubated with vigorous shaking at 37.degree. C. Expression
was induced by addition of IPTG (final concentration 1 mM) at an
OD600 of 0.5-0.6, and the incubation was continued for 2.5 h.
Bacteria were harvested by centrifugation at 4,000.times.g for 15
min at 4.degree. C. and the cell pellets were stored at -70.degree.
C.
[0055] Expression was analysed by SDS-polyacrylamide gel
electrophoresis followed by staining with Coomassie brilliant blue
(Sigma). Aliquots collected before and after IPTG induction were
centrifuged at 20,000.times.g for 10 minutes. Pellets were
resuspended in sample buffer containing DTT, and heated at
95.degree. C. for 5 minutes. The samples were loaded on NuPAGE 10%
Bis-Tris gels (Novex). Gels were run for 50 minutes at 200 volts in
MOPS buffer (Biorad Model 100/500, Power Supply).
[0056] III. Preparation and Analysis of Bacterial Extracts
[0057] Cell pellets from 50 ml culture were thawed on ice before
suspension in 2.5 ml TNT buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA,
100 mM NaCl, 1% Triton X-100). Bacteria were lysed by addition of
2.5 mg lysozyme (Merck), incubation at 4.degree. C. for 1 h, and
sonication with vibra cell high intensity ultrasonic processor
(Sonics & Materials) (4.times.20 s, 50% duty cycle, 3.5 output
control). The lysates were cleared by ultracentrifugation at
100,000.times.g for 1 h at 7.degree. C. DTT and glycerol were added
to 2 mM and 15% final concentration, respectively, and the lysates
were frozen in 1 ml aliquots at -70.degree. C.
[0058] Aliquots of the bacterial extracts collected before and
after the ultracentrifugation were analysed by SDS-polyacrylamide
gel electrophoresis, as described above, followed by Coomassie
brilliant blue staining, and Western blotting analysis. Proteins
were transferred onto a 0.45 .mu.m nitrocellulose membrane (Hybond,
ECL, Amersham Pharmacia Biotech) for one hour at 100 volts by using
a Novex Western Transfer Apparatus. The membrane was incubated in
blocking buffer containing 5% low fat dried milk and 0.1% Tween20
in 1.times.PBS for 1 h to block nonspecific binding. Before
addition of the primary antibody, the membrane was washed 2.times.5
minutes in washing buffer containing 1.times.PBS and 0.1% Tween20.
Primary antibodies raised against the GST-tag (goat anti-GST
antibody, Amersham Pharmacia Biotech) were used at a concentration
of 5 .mu.g/ml. The membrane was washed 3.times.10 minutes with
washing buffer before addition of the secondary antibody (rabbit
anti-goat antibody, from DAKO). Secondary antibodies were used at a
concentration of 0.23 .mu.g/ml. Incubation with primary and
secondary antibodies was for one hour at room temperature. Before
detection with the ECL-kit (Amersham Pharmacia Biotech), the
membrane was washed 4.times.10 minutes in washing buffer. Equal
volumes of detection solution 1 and 2 from the kit were added to
the membrane and incubated for one minute. The membrane was placed
in a film cassette and Hyperfilm-ECL (Amersham Pharmacia Biotech)
was placed on top of the membrane for 3 s. The film was developed
in a Curix 60 Agfa.
EXAMPLES
[0059] The invention will now be described in more detail by way of
the following examples, which however should not in any way be
construed as limiting the invention.
Example 1
[0060] I. Generation of Randomized Oligonucleotides
[0061] Sequence of the random oligonucleotide and primers
(Scandinavian Gene Synthesis) used for DNA binding site selection
procedure and sequencing:
2 N25: 5'CGCTCGAGGGATCCGAATTC(N)25TCTAGAAAGCTTGTCGACGC;
N255'primer: 5'CGCTCGAGGGATCCGAATTC; N253'primer:
5'GCGTCGACAAGCTTTCTAGA.
[0062] To obtain double-stranded oligonucleotides with randomized
sequence in the central 25 base pairs as starting material for the
selection procedure, 12 .mu.g of N25 was mixed with 10 .mu.g of
N253'primer in 100 .mu.l of 10 mM Tris-Cl, pH 7.5, 10 mM MgCl2, 1
mM DTT. The solution was heated to 95.degree. C., followed by slow
cooling in a water bath to 55.degree. C., and kept at this
temperature for 30 minutes. Following annealing at 55.degree. C.,
the tube was transferred to 37.degree. C., 10 .mu.l of 10 mM dNTP
(10 mM) and 2.5 .mu.l Klenow enzyme (Boehringer, 2 U/.mu.l) were
added, and the incubation was continued at 37.degree. C. for 30
minutes. NaCl was added to a final concentration of 0.25 M, and the
DNA was precipitated with 300 .mu.l ethanol at -20.degree. C.
overnight. The precipitated DNA was recovered by centrifugation,
washed with 70% ethanol, recovered by centrifugation, vacuum dried,
and finally resuspended in 148 .mu.l dH2O. Successful conversion of
N25 to double-stranded oligonucleotides was verified by running an
aliquot on a 4% NuSieve agarose gel (FMC, BioProducts).
[0063] II. Selection of Binding Sites
[0064] 148 .mu.l of double-stranded 65-mer was mixed with 10 .mu.l
of 2 mg/ml poly(dI-dC)/poly(dI-dC) (Amersham Pharmacia Biotech) and
40 .mu.l of 5.times.binding buffer (1.times.binding buffer is 20 mM
Hepes, pH 7.9, 50 mM KCl, 2 mM MgCl2, 0.5 mM EDTA, 10% glycerol,
0.1 mg/ml BSA, 2 mM DTT, 0.5 mM PMSF). This solution was divided
into two eppendorf tubes and 1 .mu.l of undiluted and {fraction
(1/10)}-diluted bacterial extract, was added to each tube,
respectively. The bacterial extract was estimated to contain
approximately 500 ng fusion protein (SDS-PAGE analysis). This was
done for GST/AfxDBD, GST/FKHRDBD, GST/FKHRL1DBD, and GST (control).
Following incubation of the binding reactions at room temperature
for 10 minutes, 50 .mu.l of a 10% slurry of glutathione-Sepharose
in 1.times.binding buffer (Amersham Pharmacia Biotech) were added
and the tubes were flicked gently for 2 minutes to prevent the
Sepharose from settling. The glutathione-Sepharose beads with bound
protein-DNA complexes were pelleted in a microcentrifuge at
3,000.times.g for 1 minute. The supernatants were removed and the
pellets were resuspended in 1 ml of ice-cold 1.times.binding
buffer, transferred to new tubes, centrifuged, and the supernatants
were removed. Three more 1 ml washes were made with the samples
transferred to new tubes before the last centrifugation.
[0065] The washed glutathione-Sepharose pellets were resuspended in
50 .mu.l of PCR buffer (10 mM Tris-Cl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, 0.001% gelatin) and transferred to 0.5-ml microcentrifuge
tubes. Fifty microliters amplification mix (PCR buffer containing
0.4 mM dNTP, 2 .mu.M N255'primer, and 2 .mu.M N253'primer) and 0.5
.mu.l Taq polymerase (Boehringer, 5 U/.mu.l) were added and the
samples were PCR amplified for 30 cycles (Perkin Elmer, Gene Amp
PCR System 2400). Each cycle consisted of a 1 min incubation at
96.degree. C. and a 30 s incubation at 60.degree. C. The final
amplification step consisted of a single 30 s incubation at
72.degree. C. A 10 .mu.ls aliquot of each selection was analysed on
a 4% NuSieve agarose gel to verify the presence of a 65-bp product,
and the rest of the PCR reaction was precipitated with 10 .mu.l 5 M
NaCl and 250 .mu.l ethanol at -20.degree. C. overnight. The
precipitated 65-mer PCR products were recovered by centrifugation,
washed with 70% ethanol, recovered by centrifugation, vacuum dried,
and finally resuspened in 120 .mu.l dH2O. The solutions were
filtered through 0.45 .mu.m Spin-x filters (Costar) to remove the
Sepharose beads.
[0066] The second round of selection was identical to the first,
except for the following modifications: The binding reaction was
set up with 10 .mu.l of the Spin-x filtrate from the first
amplification, 64 .mu.l dH2O, 5 .mu.l poly(dI-dC)(poly(dI-dC) (2
mg/ml), 20 .mu.l of 5.times.binding buffer and 1 .mu.l of bacterial
extract as described above for the first round of selection. After
the last wash, the Sepharose pellets were resuspended in 100 .mu.l
PCR buffer and boiled. Fifty microliters were combined with 50
.mu.l amplification mix. The remaining 50 .mu.l were set aside as
backup in case the PCR had to be repeated. The number of cycles in
the PCR reaction was decreased to 20.
[0067] The following rounds of selection and amplification were
identical to the second round, except that the number of cycles in
the PCR reaction were decreased, from 30 cycles in the first
amplification to 10 cycles in the sixth and last amplification, as
the fraction of high-affinity binding sites in the DNA pool
increased.
[0068] After the sixth round of selection and amplification, the
PCR products were separated on a 4% NuSieve agarose gel, and
purified using the QIAEX II Gel Extraction Kit (QIAGEN). A 10 .mu.l
aliquot of the purified PCR products was analysed on a 4% NuSieve
agarose gel.
[0069] III. Cloning and Sequencing of Selected Oligonucleotides
[0070] The gel purified PCR products from the last selection and
amplification cycle were cloned into the pCR-script SK(+) vector
(1) (Stratagene) or the pT7Blue vector (2) (Novagen). E. coli XL1
Blue Ultra Competent cells (Stratagene) and NovaBlue competent
cells (Novagen) were transformed with the ligation reactions from 1
and 2 respectively, followed by spreading of the transformation
mixtures on Luria Agar (LA) plates containing 100 .mu.g/ml of
ampicillin, 80 .mu.M IPTG, and X-gal. For each GST-fusion protein,
20 to 30 white colonies were selected, plasmid-DNA (70 .mu.g/ml)
prepared (QUIAGEN, Quiaprep spin), and digested with PvuII
(Boeringer Mannheim) followed by analysis on a 4% NuSieve agarose
gel. The clones were analysed by DNA sequencing and the central 25
bp of the insert were aligned using Vector NTI Suite, Multiple
Sequence Alignment (Informax, USA).
Example 2
Production of GST Fusion Proteins
[0071] The DNA binding domains (DBD) of Afx, FKHR, and FKHRL1, were
expressed as GST-fusion proteins. For this, the DBDs of the fork
head proteins were inserted into the BamHI site of the pGEX-2T-KB
plasmid, to produce pGEX-DBD plasmids. The sequence of the inserted
DNA fragments were confirmed by DNA sequencing, except for the
C-terminal of FKHRL1DBD. This part was GC-rich, which made it
difficult to sequence. Even after several attempts with different
sequence analysis the last 15 nucleotides could not be determined.
However, even though the C-terminal was not confirmed the plasmid
construct was used in following experiments. The GST-fusion
proteins and GST alone (control) (see FIG. 1) were expressed in E.
coli. A SDS polyacrylamide gel electrophoresis analysis of the
expression before and after IPTG induction shows expression of
GST-fusion proteins of expected sizes.
[0072] The nucleotide sequence encoding the fusion protein
GST-Afx-DBD is shown in FIG. 7, and the corresponding amino acid
sequence is shown in FIG. 8.
[0073] Insolubility of recombinant proteins can occur when
expressing them in E. coli. The fusion proteins used here had
different solubility properties, GST/FKHRDBD, GST/FKHRL1DBD, and
GST were soluble, whilst GST-AfxDBD partly existed as inclusion
bodies. However, there was still enough GST/AfxDBD in the soluble
fraction to successfully complete the selection procedure.
Example 3
Generation of Randomized Oligonucleotide
[0074] To obtain the randomized oligonucleotides used as starting
material in the selection of the DNA binding sites, single-stranded
oligonucleotides with randomized sequences in the central 25 bases
were converted to double-stranded oligonucleotide. The smear of
bands observed in agarose gel underneath the 65-mer band presumably
reflects partially converted double-stranded oligonucleotides.
[0075] I. Selection of DNA-Binding Sites
[0076] Selection of DNA-binding sites for the fork head proteins,
AFX, FKHR, and FKHRL1, was performed according to Pierrou et al.
(S. Pierrou et al. (1995); Analytical biochemistry, 229, pp.
99-105), shown in FIG. 2. Binding reactions are set up with
bacterial extract containing the GST-fusion protein, and
double-stranded oligonucleotides for which the central 25 bp have
been randomized. To minimize non-specific protein-DNA interactions,
binding is done in the presence of high levels of
poly(dI-dC)(poly(dI-dC). The GST fusion protein DNA-bound complex
is recovered by the addition of glutathione-Sepharose beads.
Following extensive washing of the resin, the bound
oligonucleotides are rescued by polymerase chain reaction
amplification. The amplified material is used as DNA-pool in the
next cycle of selection and amplification. After six cycles the
amplified oligonucleotides are cloned and DNA sequence
determined.
[0077] The PCR products from each cycle of selection and
amplification were analysed by agarose gel electrophoresis. For all
of the GST-fusion proteins the gel shows a distinct band of 65 bp.
The analysis of the PCR products for the GST-fusion proteins gave
similar results after each round of selection. When GST alone
(control) is used in the selection procedure, PCR products were
found only after the first two rounds of selection, but not after
subsequent cycles. This verifies that the oligonucleotides are
selected by the fork head DBD moiety of the fusion proteins. Two
different concentrations of bacterial extract were used for each
fusion protein in the selection and amplification procedure.
However the two different concentrations used in these experiments
did not show any difference in terms of the amount of amplified
oligonucleotides.
[0078] After the sixth round of selection and amplification, the
PCR products selected by the various fork head fusion proteins were
cloned, and 20-30 colonies from each selection were sequenced. The
central 25 bp of the oligonucleotide sequences were aligned and the
results for the Afx selection are shown in FIG. 3. A common motif
can easily be identified for each fork head protein. The consensus
alignment sequence obtained for the Afx transcription factor has a
palindrome structure, AACATGTT (FIG. 3). The other two fork head
proteins, FKHR and FKHRL1, share the DNA-binding sequence,
GTAAA(C/T)A.
[0079] The frequency of the four nucleotides in each position of
the binding site was calculated from the aligned sequences (FIG.
4). To make sure that the calculation was based only on
high-affinity sites, any sequences in which there were more than
one possible match to the consensus motif were excluded. This
ensured that oligonucleotides which produced sufficient binding
energy to survive the selection procedure through the combined
action of several, suboptimal binding sites, rather than a single,
high-affinity site did not contribute to the final consensus.
Example 4
[0080] In order to produce a weight matrix representing a group of
binding sites for a transcription factor, it is necessary to
identify a representative frequency matrix. It is necessary to
identify near-optimal alignments for each set of sites sequence
displayed in FIGS. 4A, 4B and 4C. Most alignment methods are not
designed for the small transcription factor binding sites with
highly variable columns present between conserved positions. The
Gibbs sampling expectation-maximumization method originally
described by C. E. Lawrence et al. (1993); Science, 262 (5131), pp.
208-214, J. W. Fickett (1996); Mol. Cell Biol., 16 (1), pp. 437-44,
has been utilized with modifications for DNA sequences introduced
by J W Fickett; Mol Cell Biol. January 1996; 16(1):437-41.
[0081] This method determines patterns present in biopolymer
sequences which are significantly stronger (more information
content in terms of information theory) than random patterns. The
program used performs 5 separate searches and reports back the
strongest pattern detected. In the case of the Afx data, all 5
searches produced the same pattern. The user must specify the
number of instances of the pattern expected, which impacts the
output of the program.
[0082] Afx-Specific Notes
[0083] For the Afx weight matrix, the sequences described in FIGS.
3 and 4A are utilized to find 24 sites or pattern instances of
width 12 bp. The resulting frequency matrix is as shown in FIG. 5A.
After conversion to a weight matrix and the knowledge adaptation
procedure, the pattern is as shown in FIG. 5B. Suggested threshold
score for sites to consider is 14.0, which is achieved 267 times in
22.2 megabases (22.000.000 basepairs) of genomic sequence.
[0084] FKHR-Specific Notes
[0085] For the FKHR weight matrix, the sequences described in FIG.
4B are utilized to find 35 sites or pattern instances of width 8
bp. After conversion to a weight matrix and the knowledge
adaptation procedure, the pattern obtained suggested that threshold
score for sites to consider is 12.0, which is achieved 3284 times
in 22.2 megabases (22.000.000 basepairs) of genomic sequence.
[0086] FKHRL1-Specific Notes
[0087] For the FKHRL1 weight matrix, the sequences described in
FIG. 4C are utilized to find 16 sites or pattern instances of width
7 bp. After conversion to a weight matrix and the knowledge
adaptation procedure, the pattern obtained suggested that threshold
score for sites to consider is 9.0, which is achieved 7487 times in
22.2 megabases (22.000.000 basepairs) of genomic sequence.
[0088] Searching for Potential Afx Sites
[0089] In order to screen the available genomic sequences for
potential Afx sites, the model described above is used, and the
range of scores for the sites obtained in the site selection assay
is determined. A threshold score of 14.0 is used. The EMBL/GenBank
database of sequences for entries with sequences scoring above this
threshold was used for screening. By scoring is meant: For any
given sequence as wide as the model, take the corresponding numbers
for the observed nucleotide at each position and sum the
numbers.
[0090] This search produced a number of hits. In order to create a
subset of the sites for expert review, the list was narrowed
to:
[0091] (1) genomic sequences present in a collection of genes
selectively expressed in the liver or in adipocytes; and
[0092] (2) GenBank entries which contained in the title line
"promoter" or "enhancer" or "regulatory".
[0093] After expert curation, this list was narrowed to Table 1
below.
3TABLE 1 Selected genomic gene sequences for potential Afx sites
from transcripts expressed in liver/ adipocytes and the EMBL-990629
sequence release Score Clone/gene 5.44 Mouse M20497 adipose fatty
acid binding protein 5.75 hPPARg2 promoter AB005520 7.5 hPCK1
U31519 14.0 hPAC-RPCI4-79 14.2 mouse LPL (exon1) hChr17-HCIT104N19
proenkephalin U09941.1 15.3 hChr20718J7 hOB-gene/exon3 15.4
hBACRG118E13 mouse AC00529 15.5 hNH0576I16 hAldolase reductase 15.7
h.alpha.-fetoprotein 15.9 hTyrosine amino transferase 16.0 HIV
type-1 enhancer binding protein-2 16.4 hApolipoprotein B-100, and
hCOX-2 16.4 hBacRG118E13 (NPY) 16.5 hPacCh14-rpCI4-794B2 18.0 h
c-fos 18.2 rat CYP4A1
[0094] This study has identified a novel DNA binding site for the
human fork head transcription factor Afx from random sequence
oligonucleotides. In FIG. 3 a set of sequences are aligned that
have been selected using the GST-AfxDBD protein. A common motif can
easily be identified comprising the nucleotide sequence
AACATGTT.
[0095] Several studies of DNA target sites for other fork head
proteins have been performed. All these studies have a seven base
pair recognition core motif, (G/A)(T/C)(C/A)AA(C/T)A, in common,
whereas sequences flanking either side do not share any obvious
similarities (E Kaufmann et al. (1996); Mechanisms of Development,
57, pp. 3-20). The positions within the binding sites will be
referred to relative to the first position of this core, i.e. the
(G/A) position. The three adenosines at positions +4, +5, and +7,
appear to be critical since they are conserved in all of the
earlier studies and also in the selected response element sequences
for the three fork head proteins Afx, FKHR, and FKHRL1. During the
last years, different insulin response elements (IRE) have been
published (R. M. O'Brien, et al. (1996). Gene regulation in
Diabetes Mellitus Lippincott-Raven publishers, Philadelphia. pp.
234-242; G. J. P. Kops, et al. (1999). Nature, 398, pp. 630-634; S.
Guo et al. (1999). J. Biol. Chem. 274, 17184-17192; J. E. Ayala et
al. (1999). Diabetes, 48, 1885-1889; and S. K. Durham et al.
(1999). Endocrinology, 140, 3140-3146). One of them is an element
that has been identified in the promoter region of several genes
repressed by insulin in a PI3K/Akt-dependent manner, such as
insulin-like growth factor binding protein-1 (IGFBP-1). This
proposed IRE consists of 8 bp, (CAAAAC/TAA). A comparison of this
core sequence with the selected consensus sequences for Afx, FKHR,
and FKHRL1 reveals that the three adenosines are conserved also in
this IRE.
[0096] The selected DNA binding site for Afx differs from the other
two fork head proteins. The core sequence appears to be more
specific than those for FKHR and FKHRL1, which show more variety
among the clones, and it has a palindrome structure that is not
observed for the other fork head proteins.
[0097] The novel response element according to the present
invention, is useful in the screening for genes as diabetes drug
targets, and also for the bioinformatic analysis of the human
genome (See Example 4), providing a subset of genes
transcriptionally responsive to insulin and also in construction
and development of assays that enables and facilitates the analysis
of genes interacting with the insulin receptor signaling pathway.
Genes found in this screening can in turn then be used in other
screening methods for compounds modifying the insulin receptor
signaling pathway.
[0098] Flanking sequences have been shown to be important in
contributing DNA-binding site specificity, while at the same time
they are less well defined than the core. This has been shown more
directly for some of the fork head proteins FREAC (S Pierrou et al.
(1994) EMBO J., 13, pp. 5002-5012).
Sequence CWU 1
1
34 1 24 DNA Artificial Sequence synthetically generated
oligonucleotide 1 gccccactcc ataacatgtt gttc 24 2 25 DNA Artificial
Sequence synthetically generated oligonucleotide 2 ggccgcggat
aacaacatgt tgttg 25 3 25 DNA Artificial Sequence synthetically
generated oligonucleotide 3 ggccgactat caacatgttt gcctg 25 4 25 DNA
Artificial Sequence synthetically generated oligonucleotide 4
gnaaccgnct gttgtnaaca tgttg 25 5 25 DNA Artificial Sequence
synthetically generated oligonucleotide 5 ggacggtagg ggagtaaaca
tgttg 25 6 25 DNA Artificial Sequence synthetically generated
oligonucleotide 6 ggcgggaggt gtcaacatgt tgtgc 25 7 25 DNA
Artificial Sequence synthetically generated oligonucleotide 7
ggcacccgca gtaaacatgt tatgc 25 8 25 DNA Artificial Sequence
synthetically generated oligonucleotide 8 ggcatagctc tgtgtaaaca
tgttg 25 9 25 DNA Artificial Sequence synthetically generated
oligonucleotide 9 ggcaggacgg tacacaaaca tgttg 25 10 25 DNA
Artificial Sequence synthetically generated oligonucleotide 10
ggcatcaaca tgtttataat gggtg 25 11 25 DNA Artificial Sequence
synthetically generated oligonucleotide 11 ggcagcggta aacatgttgt
ctccc 25 12 25 DNA Artificial Sequence synthetically generated
oligonucleotide 12 ggcccacggt caacatgttt tgatg 25 13 25 DNA
Artificial Sequence synthetically generated oligonucleotide 13
ggcggggact cgggtaaaca tgttg 25 14 25 DNA Artificial Sequence
synthetically generated oligonucleotide 14 ggagcataaa catgttgttg
gcggc 25 15 25 DNA Artificial Sequence synthetically generated
oligonucleotide 15 ggcggtaaac atgttgngat cagng 25 16 25 DNA
Artificial Sequence synthetically generated oligonucleotide 16
gggcgggata aacatgttat gctcc 25 17 25 DNA Artificial Sequence
synthetically generated oligonucleotide 17 ggtaggcagc acaacatgtt
taccc 25 18 25 DNA Artificial Sequence synthetically generated
oligonucleotide 18 ggtacatacg gtaaacatgt tgtgc 25 19 25 DNA
Artificial Sequence synthetically generated oligonucleotide 19
gggagcccca taacatgttt tcacg 25 20 25 DNA Artificial Sequence
synthetically generated oligonucleotide 20 gggcccaggc ataaacatgt
tgttg 25 21 15 DNA Artificial Sequence consensus sequence 21
gggtaaacat gttgt 15 22 1073 DNA Artificial Sequence synthetically
generated GST-AfxDBD construct 22 atgtccccta tactaggtta ttggaaaatt
aagggccttg tgcaacccac tcgacttctt 60 ttggaatatc ttgaagaaaa
atatgaagag catttgtatg agcgcgatga aggtgataaa 120 tggcgaaaca
aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac
240 atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg
agcggttttg 300 gatattagat acggtgtttc gagaattgca tatagtaaag
actttgaaac tctcaaagtt 360 gattttctta gcaagctacc tgaaatgctg
aaaatgttcg aagatcgttt atgtcataaa 420 acatatttaa atggtgatca
tgtaacccat cctgacttca tgttgtatga cgctcttgat 480 gttgttttat
acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca
600 tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc
aaaatcggat 660 ctggttccgc gtggatctgg taccgagctc ggatccgggg
ctgtaacagg tcctcggaag 720 ggaggctccc gccggaatgc ctggggaaat
cagtcatatg cagaactcat cagccaggcc 780 attgaaagcg ccccggagaa
gcgactgaca cttgcccaga tctacgagtg gatggtccgt 840 actgtaccct
acttcaagga caagggtgac agcaacagct cagcaggatg gaagaactcg 900
atccgccaca acctgtccct gcacagcaag ttcatcaagg ttcacaacga ggccaccggc
960 aaaagctctt ggtggatgct gaaccctgag ggaggcaaga gcggcaaagc
cccccgccgc 1020 cgggccgcct ccatggatag cagcagaagc tgctccgggg
ccgcagtaaa gcc 1073 23 358 PRT Artificial Sequence synthetically
generated GST-AfxDBD construct 23 Met Ser Pro Ile Leu Gly Tyr Trp
Lys Ile Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu
Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp
Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu
Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 50 55 60
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn 65
70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met
Leu Glu 85 90 95 Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg
Ile Ala Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe
Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg
Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His
Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu
Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val
Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 180 185
190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val
Pro Arg 210 215 220 Gly Ser Gly Thr Glu Leu Gly Ser Gly Ala Val Thr
Gly Pro Arg Lys 225 230 235 240 Gly Gly Ser Arg Arg Asn Ala Trp Gly
Asn Gln Ser Tyr Ala Glu Leu 245 250 255 Ile Ser Gln Ala Ile Glu Ser
Ala Pro Glu Lys Arg Leu Thr Leu Ala 260 265 270 Gln Ile Tyr Glu Trp
Met Val Arg Thr Val Pro Tyr Phe Lys Asp Lys 275 280 285 Gly Asp Ser
Asn Ser Ser Ala Gly Trp Lys Asn Ser Ile Arg His Asn 290 295 300 Leu
Ser Leu His Ser Lys Phe Ile Lys Val His Asn Glu Ala Thr Gly 305 310
315 320 Lys Ser Ser Trp Trp Met Leu Asn Pro Glu Gly Gly Lys Ser Gly
Lys 325 330 335 Ala Pro Arg Arg Arg Ala Ala Ser Met Asp Ser Ser Ser
Lys Leu Leu 340 345 350 Arg Gly Arg Ser Lys Ala 355 24 28 DNA
Artificial Sequence polylinker sequence 24 gatctggtac cgagctcgga
tccccggg 28 25 31 DNA Artificial Sequence primer for PCR 25
gacgacggat ccggggctgt aacaggtcct c 31 26 33 DNA Artificial Sequence
primer for PCR 26 gacgacggat cctcaggctt tactgcggcc ccg 33 27 30 DNA
Artificial Sequence primer for PCR 27 gacgacggat ccctcgcggg
gcagccgcgc 30 28 31 DNA Artificial Sequence primer for PCR 28
gacgacggat cctcaagctc ggcttcggct c 31 29 30 DNA Artificial Sequence
primer for PCR 29 gacgacggat ccgggggctc cgggcagccg 30 30 34 DNA
Artificial Sequence primer for PCR 30 gacgacggat cctcatgcgc
ggccacggct cttg 34 31 65 DNA Artificial Sequence oligonucleotide
for DNA binding site selection 31 cgctcgaggg atccgaattc nnnnnnnnnn
nnnnnnnnnn nnnnntctag aaagcttgtc 60 gacgc 65 32 20 DNA Artificial
Sequence primer for DNA binding site selection 32 cgctcgaggg
atccgaattc 20 33 20 DNA Artificial Sequence primer for DNA binding
site selection 33 gcgtcgacaa gctttctaga 20 34 13 DNA Artificial
Sequence binding motif 34 gtaaacatgt tgt 13
* * * * *