U.S. patent number 8,263,091 [Application Number 10/666,022] was granted by the patent office on 2012-09-11 for method of treating and preventing infections in immunocompromised subjects with immunostimulatory cpg oligonucleotides.
This patent grant is currently assigned to N/A, The United States of America as represented by the Secretary of the Department of Health and Human Services. Invention is credited to Dennis M. Klinman, Daniela Verthelyi.
United States Patent |
8,263,091 |
Klinman , et al. |
September 11, 2012 |
Method of treating and preventing infections in immunocompromised
subjects with immunostimulatory CpG oligonucleotides
Abstract
A method is disclosed herein for increasing an immune response
to an opportunistic infection in an immunocompromised subject. In
one embodiment, the subject is infected with a lentivirus. The
method includes increasing an immune response to a pathogen using D
oligodeoxynucleotides including a CpG motif.
Inventors: |
Klinman; Dennis M. (Potomac,
MD), Verthelyi; Daniela (Potomac, MD) |
Assignee: |
The United States of America as
represented by the Secretary of the Department of Health and Human
Services (Washington, DC)
N/A (N/A)
|
Family
ID: |
32396979 |
Appl.
No.: |
10/666,022 |
Filed: |
September 17, 2003 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20040105872 A1 |
Jun 3, 2004 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60411944 |
Sep 18, 2002 |
|
|
|
|
Current U.S.
Class: |
424/278.1;
536/23.1; 424/184.1; 536/25.6; 424/190.1 |
Current CPC
Class: |
C07K
16/082 (20130101); A61K 31/7125 (20130101); A61K
39/39 (20130101); A61K 31/7115 (20130101); Y02A
50/41 (20180101); Y02A 50/489 (20180101); A61K
2039/55561 (20130101); Y02A 50/30 (20180101); Y02A
50/492 (20180101) |
Current International
Class: |
A61K
31/70 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 286 224 |
|
Oct 1988 |
|
EP |
|
0 302 758 |
|
Nov 1989 |
|
EP |
|
0 468 520 |
|
Jan 1991 |
|
EP |
|
0 092 574 |
|
Apr 1992 |
|
EP |
|
0 572 735 |
|
Dec 1993 |
|
EP |
|
0 855 184 |
|
Jul 1998 |
|
EP |
|
1 198 249 |
|
Apr 2002 |
|
EP |
|
WO 91/12811 |
|
Sep 1991 |
|
WO |
|
WO 92/03456 |
|
Apr 1992 |
|
WO |
|
WO 92/18522 |
|
Oct 1992 |
|
WO |
|
WO 92/21353 |
|
Dec 1992 |
|
WO |
|
WO 93/17115 |
|
Sep 1993 |
|
WO |
|
WO 94/19945 |
|
Sep 1994 |
|
WO |
|
WO 95/05853 |
|
Mar 1995 |
|
WO |
|
WO 95/18231 |
|
Jul 1995 |
|
WO |
|
WO 95/26204 |
|
Oct 1995 |
|
WO |
|
WO 96/02555 |
|
Feb 1996 |
|
WO |
|
WO 96/24380 |
|
Feb 1996 |
|
WO |
|
WO 96/35782 |
|
Nov 1996 |
|
WO |
|
WO 97/28259 |
|
Jan 1997 |
|
WO |
|
WO 98/29430 |
|
Dec 1997 |
|
WO |
|
WO 98/11211 |
|
Mar 1998 |
|
WO |
|
WO 98/14210 |
|
Apr 1998 |
|
WO |
|
WO 98/16247 |
|
Apr 1998 |
|
WO |
|
WO 98/18810 |
|
May 1998 |
|
WO |
|
WO 98/32462 |
|
Jul 1998 |
|
WO |
|
WO 98/37919 |
|
Sep 1998 |
|
WO |
|
WO 98/40100 |
|
Sep 1998 |
|
WO |
|
WO 98/49288 |
|
Nov 1998 |
|
WO |
|
WO 98/49348 |
|
Nov 1998 |
|
WO |
|
WO 98/52581 |
|
Nov 1998 |
|
WO |
|
WO 98/55495 |
|
Dec 1998 |
|
WO |
|
WO 99/11275 |
|
Mar 1999 |
|
WO |
|
WO 99/37151 |
|
Jul 1999 |
|
WO |
|
WO 99/51259 |
|
Oct 1999 |
|
WO |
|
WO 99/56755 |
|
Nov 1999 |
|
WO |
|
WO 99/58118 |
|
Nov 1999 |
|
WO |
|
WO 99/61056 |
|
Dec 1999 |
|
WO |
|
WO 99/62923 |
|
Dec 1999 |
|
WO |
|
WO 00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/20039 |
|
Apr 2000 |
|
WO |
|
WO 00/21556 |
|
Apr 2000 |
|
WO |
|
WO 00/06588 |
|
Oct 2000 |
|
WO |
|
WO 00/61151 |
|
Oct 2000 |
|
WO |
|
WO 00/62787 |
|
Oct 2000 |
|
WO |
|
WO 00/67023 |
|
Nov 2000 |
|
WO |
|
WO 00/67787 |
|
Nov 2000 |
|
WO |
|
WO 01/00232 |
|
Jan 2001 |
|
WO |
|
WO 01/02007 |
|
Jan 2001 |
|
WO |
|
WO 01/12223 |
|
Feb 2001 |
|
WO |
|
WO 01/12804 |
|
Feb 2001 |
|
WO |
|
WO 01/22990 |
|
Apr 2001 |
|
WO |
|
WO 01/51500 |
|
Jul 2001 |
|
WO |
|
WO 01/55341 |
|
Aug 2001 |
|
WO |
|
WO 01/68077 |
|
Sep 2001 |
|
WO |
|
WO 01/68103 |
|
Sep 2001 |
|
WO |
|
WO 01/68116 |
|
Sep 2001 |
|
WO |
|
WO 01/68117 |
|
Sep 2001 |
|
WO |
|
WO 02/069369 |
|
Sep 2002 |
|
WO |
|
Other References
Fraternale et al. (2000) JAIDS. 23: 209-220. cited by examiner
.
Horner et al. (2001) Journal of Immunology. 167: 1584-1591. cited
by examiner .
Calarota et al (1999) Journal of Immunology. 162: 2330-2338. cited
by examiner .
Walker et al (1999) PNAS. 96: 6970-6975. cited by examiner .
Klinman (2004) Nature Reviews. 4: 1-10. cited by examiner .
Krieg et al (1998) Journal of Immunology. 161: 2428-2434. cited by
examiner .
Lu et al. SIV DNA vaccine trial in macaques: post-challenge
necropsy in vaccine and control groups. Vaccine. Jun.
1997;15(8):920-3. cited by examiner .
Cho et al. Immunostimulatory DNA-based vaccines induce cytotoxic
lymphocyte activity by a T-helper cell-independent mechanism. Nat
Biotechnol. May 2000;18(5):509-14. cited by examiner .
Bielorai et al. Successful treatment of invasive aspergillosis in
chronic granulomatous disease by granulocyte transfusions followed
by peripheral blood stem cell transplantation. Bone Marrow
Transplant. Nov. 2000;26(9):1025-8. cited by examiner .
Hamour et al. Visceral leishmaniasis (Kala-azar) in two patients
with HIV-1 infection: atypical features and response to therapy. J
Infect. Mar. 1998;36(2):217-20. Abstract Only. cited by examiner
.
Glaser et al. Animal-associated opportunistic infections among
persons infected with the human immunodeficiency virus. Clin Infect
Dis. Jan. 1994;18(1):14-24. Review. Abstract Only. cited by
examiner .
Davis et al. CpG DNA overcomes hyporesponsiveness to hepatitis B
vaccine in orangutans. Vaccine. Mar. 17, 2000;18(18):1920-4. cited
by examiner .
Chung et al. HIV/Hepatitis B and C co-infection: pathogenic
interactions, natural history and therapy. Antivir Chem Chemother.
2001;12 Suppl 1:73-91. Abstract Only. cited by examiner .
de la Rosa et al. Incidence of and risk factors for symptomatic
visceral leishmaniasis among human immunodeficiency virus type
1-infected patients from Spain in the era of highly active
antiretroviral therapy. J Clin Microbiol. Mar. 2002;40(3):762-7.
cited by examiner .
Alvar et al. Leishmania and human immunodeficiency virus
coinfection: the first 10 years. Clin Microbiol Rev. Apr.
1997;10(2):298-319. cited by examiner .
Amaral et al., "Leishmania amazonensis: the Asian rhesus macaques
(Macaca mulatta) as an experimental model for study of cutaneous
leishmaniasis," Exp. Parasitol. 82(1):34-44, 1996. cited by other
.
Azzoni et al., "Sustained impairment of IFN-gamma secretion in
suppressed HIV-infected patients despite mature NK cell recovery:
evidence for a defective reconstitution of innate immunity," J.
Immunol. 168(11):5764-5770, 2002. cited by other .
Chehimi, "Persistent decreases in blood plasmacytoid dendritic cell
number and function despite effective highly active antiretroviral
therapy and increased blood myeloid dendritic cells in HIV-infected
individuals," J. Immunol. 168(9):4796-4801, 2002. cited by other
.
Gursel, "Sterically stabilized cationic liposomes improve the
uptake and immunostimulatory activity of CpG oligonucleotides," J.
Immunol. 167(6):3324-3328, 2001. cited by other .
Kenney et al., "Protective immunity using recombinant human IL-12
and alum as adjuvants in a primate model of cutaneous
leishmaniasis," J. Immunol. 163(8):4481-4488, 1999. cited by other
.
Maddon, "The isolation and nucleotide sequence of a cDNA encoding
the T cell surface protein T4: a new member of the immunoglobulin
gene family," Cell 42(1):93-104, 1985. cited by other .
Moss and Ledman, "Immunization of the immunocompromised host,"
Clinical Focus on Primary Immune Deficiencies 1(1):1-3, 1998. cited
by other .
Verthelyi et al., "Human peripheral blood cells differentially
recognize and respond to two distinct CPG motifs," J. Immunol.
166(4):2372-2377, 2001. cited by other .
Verthelyi et al., "CpG oligodeoxynucleotides as vaccine adjuvants
in primates," J. Immunol. 168(4):1659-1663, 2002. cited by other
.
Adya, et al., "Expansion of CREB's DNA recognition specificity by
Tax results from interaction with Ala-Ala-Arg at positions 282-284
near the conserved DNA-binding domain of CREB". Proc. Natl. Acad.
Sci. USA 91(12):5642-5646 (1994). cited by other .
Agrawal, et al., "Pharmacokinetics of Oligonucleotides". Ciba.
Found. Symp. 209:60-78 (1997), abstract only. cited by other .
Agrawal, et al., "Pharmacokinetics and Bioavailability of Antisense
Oligonucleotides Following Oral and Colorectal Adminstration of
Experimental Animals". Handb. Exp. Pharmacol.: Antisense Research
and Application 131:525-543 (1998). cited by other .
Agrawal, "Antisense Oligonucleotides: Toward Clinical Trials".
Tibtech 14:376-387 (1996). cited by other .
Agrawal, et al., "In Vivo Pharmacokinetics of Phosphorothloate
Oligonucleotides Containing Contiguous Guanosines". Antisense &
Nucleic Acid Drug Development 7:245-249 (1997). cited by other
.
Agrawal, et al., "Absorption, Tissue Distribution and In Vivo
Stability in Rats of a Hybrid Antisense Oligonucleotide Following
Oral Administration". Biochemical Pharmacology 50(4):571-576
(1995). cited by other .
Agrawal, et al., "Pharmacokinetics of Antisense Oligonucleotides".
Clin. Pharmacokinet 28(1):7 (1995). cited by other .
Agrawal, et al., "Antisense therapeutics: is it as simple as
complementary base recognition?". Molecular Med. Today 6(2):72-81
(2000), abstract only. cited by other .
Agrawal, et al., "Pharmacokinetics, biodistribution, and stability
of oligodeoxynucleotide phosphorothioates in mice". Proc. Natl.
Acad. Sci. USA 88:7595-7599 (1991). cited by other .
Agrawal, "Medicinal Chemistry and Therapeutic Potential of CpG
DNA". Trends in Molecular Medicine 8(3):114-121 (2002). cited by
other .
Alama, et al., "Antisense Oligonucleotides as Therapeutic Agents".
Pharmacol. Res. 36:171-178 (1997). cited by other .
Anderson, "Human Gene Therapy". Nature 392:25-30 (Apr. 1998). cited
by other .
Anderson, et al., "TH2 and `TH2-like` cells in allergy and asthma;
pharmacological perspectives". TiPS 15:324-332 (1994). cited by
other .
Anfossi, et al., "An oligomer complementary to c-myb-encoded mRNA
inhibits proliferation of human myeloid leukemia cell lines". Proc.
Natl. Acad. Sci. USA 86:3379-3383 (May 1989). cited by other .
Angier, "Microbe DNA seen as alien by immune system". New York
Times p. C1, 2 pages (1995). cited by other .
Azad, et al., "Antiviral activity of a phosphorothioate
oligonucleotide complementary to RNA of the human cytomegalovirus
major immediate-early region". Amtimicrobial Agents and
Chemotherapy 37:1945-1954 (1993). cited by other .
Azuma, "Biochemical and immunological studies on cellular
components of tubercle bacilli". Kekkaku 69(9):45-55 (1992). cited
by other .
Ballas, et al., "Induction of NK activity in murine and human cells
by CpG motifs in oligodeoxynucleotides and bacterial DNA". J.
Immunol. 157(5):1840-1845 (1996). cited by other .
Banchereau, et al., "Immunobiology of Dendritic Cells". Ann. Rev.
Immunol. 18:767-811 (2000). cited by other .
Banchereau & Steinman, "Dendritic Cells and the Control of
Immunity". Nature 392:245-252 (1998). cited by other .
Barouch, et al., "Control of Viremia and Prevention of Clinical
AIDS in Rhesus Monkeys by Cytokine-Augmented DNA Vaccination".
Science 290:486-492 (Oct. 2000). cited by other .
Bauer, et al., "Bacterial CpG-DNA Triggers Activation and
Maturation of Human CD11c-, CD123+ Dendritic Cells". J. Immunol.
166:5000-5007 (2001). cited by other .
Bayever, "Systemic administration of a phosphorothioate
oligonucleotide with a sequence complementary to p53 for acute
myelogenous leukemia and myelodysplastic syndrome: initial results
of a Phase I trial". Antisense Res. Dev. 3:383-390 (1993). cited by
other .
Benimetskaya, et al., "Formation of a G-tetrad and higher order
structures correlates with biological activity of the ReIA
(NF-.kappa.Bp65) `antisense` oligodeoxynucleotide". Nucleic Acids
Research 25(13):2648-2656 (1997). cited by other .
Bennett, et al., "DNA binding to human leukocytes: evidence for a
recptor-mediated association, internalization, and degradation of
DNA". J. Clin. Invest. 76(6):2182-2190 (1985). cited by other .
Berg, et al., "Interleukin-10 is a central regulator fo the
response to LPS in murine models of endotoxic shock and the
Shwartzman reaction but not endotoxin tolerance". J. Clin. Invest.
96(5):2339-2347 (1995). cited by other .
Biolabs, "1988-1989 Catalog, Random Primer #s 1230, 1601, 1602". (
). cited by other .
Bishop, et al., "Intramolecular G-quartet Motifs Confer Nuclease
Resistance to a Potent Anti-HIV Oligonucleotide". The Journal of
Biological Chemistry 271(10):5698-5703 (Mar. 1996). cited by other
.
Blanchard, et al., "Interferon-.gamma. Induction by
Lipopolysaccharide: Dependence of Interleukin 2 and Macrophages".
The Journal of Immunology 136(3):963-970 (Feb. 1986). cited by
other .
Blanco, et al., "Induction of Dendritic Cell Differentiation by
IFN-.alpha. in Systemic Lupus Erythermatosus". Science
294:1540-1543 (2001). cited by other .
Blaxter, et al., "Genes expressed in Brugia malayi infective third
stage larvae". Mol. Biochem. Parasitol. 77:77-93 (1996). cited by
other .
Boggs, et al., "Characterization and modulation of immune
stimulation by modified oligonucleotides". Antisense Nucl. Acid
Drug Dev. 7(5):461-471 (1997). cited by other .
Boiarkina, et al., "Dietary supplementals from ground fish meat
with DNA for treatment and prophylaxis". Vopr. Pitan 1:29-31
(1998), abstract only. cited by other .
Branda, et al., "Immune stimulation by an antisense oligomer
complementary to the rev gene of HIV-1". Biochem. Pharmacol.
45(10):2037-2043 (1993). cited by other .
Branda, et al., "Amplification of antibody production by
phosphorothioate oligodeoxynucleotides". J. Lab Clin. Med.
128(3):329-338 (1996). cited by other .
Briskin, et al., "Lipopolysaccharide-unresponsive mutant pre-B-cell
lines blocked in NF-kappa B activation". Mol. Cell Bio.
10(1):422-425 (1990). cited by other .
Burgess, "The antiproliferative activity of c-myb and c-myc
antisense oligonucleotides in smooth muscle cells is caused by a
nonantisense mechanism". Proc. Natl. Acad. Sci. USA 92:4051-4055
(Apr. 1995). cited by other .
Calarota, et al., "Immune Responses in Asymptomatic HIV-1 Infected
Patients After HIV-DNA Immunization Followed by Highly Active
Antiretroviral Threatment". J. Immunol. 163(4):2330-2338 (1999).
cited by other .
Chace, et al., "Regulation of differentiation in CD5+ and
conventional B cells". Clin. Immunol. Immunopathol. 68(3):327-332
(1993). cited by other .
Chang, et al., "The palindromic series I repeats in the simian
cytomegalovirus major immediate-early promoter behave as both
strong basal enhancers and cyclic AMP response elements". J. Virol.
64(1):264-277 (1990). cited by other .
Chapuis, et al., "Differentiation of Human Dendritic Cells from
Monocytes in vitro". Eur. J. Immunol. 27:431-441 (1997). cited by
other .
Chu, et al., "CpG oligodeoxynucleotides act as adjuvants that
switch on T helper 1 (Th1) immunity". J. Exp. Med.
186(10):1623-1631 (1997). cited by other .
Chun, et al., "Effect of interleukin-2 on the pool of latently
infected, resting CD4+ T-cells in HIV-1-infected patients receiving
highly active anti-retroviral therapy". Nature Med. 5(6):651-655
(1999). cited by other .
Chun, et al., "Perspective: Latent reservoirs of HIV: Obstacles to
the eradication of virus". Proc. Natl. Acad. Sci. USA
96:10958-10961 (1999). cited by other .
Cohen, et al., "Exploring How to Get at--and Eradicate--Hidden
HIV". Science 279:1854-1855 (1998). cited by other .
Cohen & Fauci, et al., "HIV/AIDS in 1998--Gaining the Upper
Hand?". JAMA 280(1):87-88 (1998). cited by other .
Cook, et al., "Effect of a Single Ethanol Exposure on HIV
Replication in Human Lymphocytes". J. Invest. Med. 45(5):265-271
(1997). cited by other .
Cooper, et al., "Therapeutic Strategies for HIV Infection--Time to
Think Hard". The New England Journal of Medicine 339(18):1319-1321
(1998). cited by other .
Cowdery, et al., "Bacterial DNA induces NKcells to produce
IFN-gamma in vivo and increases the toxici of lipopolysaccharides".
J. Immunol. 156(12):4570-4575 (1996). cited by other .
Crosby, et al., "The early responses gene NGFI-C encodes a zinc
finger transcriptional activator and is a member of the GCGGGGGCG
(GSG) element-binding protein family". Mol. Cell Bio. 2:3835-3841
(1991). cited by other .
Crystal, "Transfer of genes to humans: early lessons and obstacles
to success". Science 270:404-410 (1995). cited by other .
Cryz, et al., "Vaccine Delivery System--European Commission
COST/STD Initiative Report of the Expert Panel VII". Vaccine
14(7):665-690 (1996). cited by other .
D'Andrea, et al., "Interleukin 10 (IL-10) inhibits human lymphocyte
interferon gamma-production by suppressing natural killer cell
stimulatory factor/IL-12 synthesis in accessory cells". J. Exp.
Med. 178(3):1041-1048 (1993). cited by other .
Davey, et al., "HIV-1 and T-Cell dynamics after interruption of
highly antiretroviral therapy (HAART) in patients with a history of
sustained viral suppression". Proc. Natl. Acad. Sci. USA
96(26):15109-15114 (1999). cited by other .
Davis, et al., "CpG DNA is a Potent Enhancer of Specific Immunity
in Mice Immunized with Recombinant Hepatitis B Surface Antigen". J.
Immunol. 160(2):870-876 (1998). cited by other .
Davis, "Plasmid DNA expression systems for the purpose of
immunization". Curr. Opin. Biotechnol. 8(5):635-646 ( Oct. 1997).
cited by other .
Dematos, et al., "Pulsing of Dendritic Cells with Cell Lysates from
Either B16 Melanoma or MCA-106 Fibrosarcoma Yields Equally
Effective Vaccines Against B16 Tumors in Mice". J. Surg. Oncol.
68:79-91 (1998). cited by other .
Deml, et al., "Immunostimulatory CpG motifs trigger a T Helper-1
immune response to Human Immunodeficiency Virus Type-1 (HIV-1)
gp160 envelope protein". Clin. Chem. Lab. Med. 37(3):199-204
(1999). cited by other .
Dias et al., "Antisense Oligonucleotides: Basic Concepts and
Mechanisms," Mol. Cancer Ther. 1:317-355, 2002. cited by other
.
Doerfler, et al., "On the Insertion of Foreign DNA into Mammalian
Genomes: Mechanism and Consequences". Gene 157(1-2):241-254 (1995),
abstract only. cited by other .
Durham, et al., "Immunotherapy and Allergic Inflammation". Clin.
Exp. Allergy 21 Suppl 1:206-210 (1991). cited by other .
Eck, et al., "Chapter 5: Gene-Based Therapy". Goodman &
Gilman's The Pharmacological Basis of Therapeutics 9th ed.:77-101
(1996). cited by other .
Elkins, et al., "Bacterial DNA containing CpG motifs stimulates
lymphocyte-dependent protection of mice against lethal infection
with intracellular bacteria". J. Immunol. 162:2291-2298 (1999).
cited by other .
Englisch, et al., "Chemically modified oligonucleotides as probes
and inhibitors". Angew. Chem. Int. Ed. Engl. 30:613-629 (1991).
cited by other .
Erb, et al., "Infection of mice with Mycobacterium bovis-badillus
Calmette-Guerin (BCG) supresses allergen-induced airway
eosinophilia". J. Exp. Med. 184(4):561-569 (1998). cited by other
.
Etlinger, "Carrier sequence selection--one key to successful
vaccines". Immunology Today 13(2):52-55 (1992). cited by other
.
Fanslow, et al., "Effect of Nucleotide Restriction and
Supplementation on Resistance to Experimental Murine Candidasis".
J. Parenter. Enteral. Nutr. 12(1):49-52 Abstract (1988). cited by
other .
Fields, et al., "Murine Dendritic Cells Pulsed With Whole Tumor
Lysates Mediate Potent Antitumor Immune Responses in vitro and in
vivo". Proc. Natl. Acad. Sci. USA 95:9482-9487 (1998). cited by
other .
Filion, et al., "Major Limitations in the use of Cationic Liposomes
for DNA Delivery". Int. J. Pharmaceuticals 162:159-170 (1998).
cited by other .
Fox, "Mechanism of action of hydroxychloroquine as an antirheumatic
drug". Chem. Abstracts 120:15, Abstract No. 182630 (1 page) (1994).
cited by other .
Freidag, et al., "CpG oligodeoxynucleotides and interleukin-12
Improve the efficacy of Mycobacterium bovis BCG vaccination in mice
challenged with M. tuberculosis". Infect. Immun. 68:2948-2953
(2000). cited by other .
Gao, et al., "Phosphorothioate oligonucleotides are inhibitors of
human DNA polymerases and Rnase H: Implications for antisense
technology". Mol. Pharmacol. 41:223-229 (1992). cited by other
.
Garraud, "Regulation of Immunoglobin Production in Hyper-IgE
(Job's) Syndrome". J. Allergy Clin. Immunol. 103(2 Pt 1):333-340
(Feb. 1999). cited by other .
Gluckman, et al., "In Vitro Generation of Human Dendritic Cells and
Cell Therapy". Cytokines Cell Mol. Ther. 3:187-196 (1997). cited by
other .
Gramzinski, et al., "Interleukin-12- and gamma interferon-dependent
protection against malaria conferred by CpG oligodeoxynucleotide in
mice". Infect. Immun. 69(3):1643-1649 (2001). cited by other .
Gura, "Antisense has growing pains". Science 270:575-576 (1995).
cited by other .
Gursel, et al., "Differential and Competitive Activation of Human
Immune Cells by Distinct Classes of CpG Oligodeoxynucleotide". J.
Leuko. Biol. 71:813-820 (2002). cited by other .
Hadden, et al., "Immunopharmacology". JAMA 268(20):2964-2969
(1992). cited by other .
Hadden, et al., "Immunostimulants". TiPS 141:169-174 (1993). cited
by other .
Halpern, et al., "Bacterial DNA induces murine interferon-gamma
production by stimulation of interleukin-12 and tumor necrosis
factor-alpha". Cell Immunol. 167(1):72-78 (1996). cited by other
.
Haslett, et al., "Strong Human lmmunodificiency Virus (HIV)
Specific CD4+ T Cell Responses in a Cohort of Chronically Infected
Patients are Associated with Interruptions in Anti-HIV
Chemotherapy". J. Infect. Diseases 181:1264-1272 (2000). cited by
other .
Hatzfeld, "Release of early human hematopoietic progenitors from
quiescence by antisense transformin owth factor .beta.1 or Rb
oligonucleotides". J. Exp. Med. 174:925-929 (1991). cited by other
.
Havlir, et al., "Maintenance Antiretroviral Therapies in
HIV-Infected Subjects with Undetectable Plasma HIV RNA after
Triple-Drug Therapy". The New England Journal of Medicine
339(18):1261-1268 (1998). cited by other .
Hayashi, et al., "Enhancement of innate immunity against
Mycobacterium avium infection by immunostimutatory DNA is mediated
by indoteamine 2,3-dioxygenase". Infect. Immun. 69:6156-6164
(2001). cited by other .
Hertl, et al., "Inhibition of Interferon-.gamma.-Induced
Intercellular Adhesion Molecule-1 Expression on Human Keratinocytes
by Phosphorothioate Antisense Oligodeoxynucleotides is the
Consequence of Antisense-Specific and Antisense-Non-Specific
Effects". The Journal of Investigative Dermatology 104(5):813-818
(May 1995). cited by other .
Highfield, "Sepsis: the more, the murkier". Biotechnology 12:828
(1994). cited by other .
Hoeffler, et al., "Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions". Mol. Endocrinol. 5(2):256-266
(1991). cited by other .
Honess, et al., "Deviations from Expected Frequencies of CpG
Dinucleotides in Herpesvirus DNAs May be Diagnostic of Differences
in the States of Their Latent Genomes". J. Gen. Vir. 70(4):837-855
(1989). cited by other .
Horspool, et al., "Nucleic acid vaccine-induces immune responses
require CD28 costimulation and are regulated by CTLA4". J. Immunol.
160:2706-2714 (1998). cited by other .
Hughes, et al., "Influence of Base Composition on Membrane Binding
and Cellular Uptake of 10-mer Phosphorothioate Oligonucleotides in
Chinese Hamster Ovary (CHRC5) Cells". Antisense Research and
Development 4:211-215 (1994). cited by other .
Iguchi-Ariga, et al., "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation". Genes Dev.
3(5):612-619 (1989). cited by other .
Imami, et al., "Assessment of Type 1 and Type 2 Cytokines in HIV
Type 1-Infected Individuals: Impact of Highly Active Antiretroviral
Therapy". AIDS Research and Human Retroviruses 15(17)1499-1508
(1999). cited by other .
Ishibashi, et al., "Sp1 Decoy Transfected to Carcinoma Cells
Suppresses the Expression of Vascular Endothelial Growth Factor,
Transforming Growth Factor .beta., and Tissue Factor and Also Cell
Growth and Invasion Activities". Cancer Research 60:6531-6536
(2000). cited by other .
Ishikawa, et al., "IFN induction and associated changes in splenic
leukocyte distribution". J. Immunol. 150(9):3713-3727 (1993). cited
by other .
Iversen, et al., "Pharmacokinetics of an antisense phosphorothioate
oigodeoxynucleotide against rev from human immunodeficiency virus
type 1 in the adult male rat following single inections and
continuous infusion". Antisense Res. Dev. 4:43-52 (1994). cited by
other .
Jakway, et al., "Growth regulation of the B lymphoma cell line
WEHI-23 1 by anti-immunoglobulin, lipopolysaccharide, and other
bacterial products". J. Immunol. 137(7):2225-2231 (1996). cited by
other .
Jaroszewski, et al., "Cellular uptake of antisense
oligonucleotides". Adv. Drug Delivery Rev. 6(3):235-250 (1991).
cited by other .
Jilek, et al., "Antigen-Independent Suppression of the Allergic
Immune Response to Bee Venom Phospholipase A2 by DNA Vaccination in
CBA/J Mice". J. Immunol. 166:3612-3621 (2001). cited by other .
Jones, et al., "Synthetic Oligonucleotides Containing CpG Motifs
Enhance Immunogenicity of a Peptide Malaria Vaccine in Aotus
Monkeys". Vaccine 17:3065-3071 (1999). cited by other .
Juffermans, et al., "CpG oligodeoxynucleotides enhance host defense
during murine tuberculosis". Infect. Immun. 70:147-152 (2002).
cited by other .
Kadowaki, et al., "Distinct CpG DNA and Polyinosinic-Polycytldylic
Acid Double Stranded RNA, Respectively, Stimulate CD11c- Type 2
Dendritic Cell Precursoes and CD11c+ Dendritic cells to Produce
Type I IFN". J. Immunol. 166:2291-2295 (2001). cited by other .
Kataoka, et al., "Antitumor activity of synthetic oligonucleotides
with sequences from cDNA encodin proteins of Mycobacterium bovis
BCG". Jpn. J. Cancer Res. 83:244-247 (1992). cited by other .
Khaled, et al., "Multiple mechanisms may contribute to the cellular
anti-adhesive effects of phosphorothioate oligodeoxynucleotides".
Nucleic Acids Research 24(4):737-745 (1996). cited by other .
Kimura, et al., "Binding of oligoguanylate to scavenger receptors
is required for oligonucleotides to augment NK cell activity and
induce IFN". J. Biochem 116(5):991-994 (1994). cited by other .
Kline, et al., "CpG motif oligonucleotides are effective in
prevention of eosinophilic inflammation in a murine model of
asthma". J. Invest. Med. 44(7):380A (1 page) (1996). cited by other
.
Kline, et al., "CpG oligonucleotides can reverse as well as prevent
TH2-mediated inflammation in a murine model of asthma". J. Invest.
Med. 45(7):298A (1 page) (1997). cited by other .
Kline, et al., "Immune redirection by CpG oligonucleotides,
Conversion of a Th2 response to a Th1 response in a murine model of
asthma". J. Invest. Med. 45(3):282A (1 page) (1997). cited by other
.
Klinman, et al., "Immune recognition of foreign DNA: a cure for
bioterrorism?". Immunity 11:123 (1 page) (1999). cited by other
.
Klinman, et al., "Repeated administration of synthetic
oligodeoxynucteotides expressing CpG motifs provides tong-term
protection against bacterial infection". Infect. Immun.
67:5658-5663 (1999). cited by other .
Klinman, et al., "CpG motifs present in bacteria DNA rapidly induce
lymphocytes to secrete interleukin 6, interleukin 12, and
interferon gamma". Proc. Natl. Acad. Sci. USA 93(7):2879-2883
(1996). cited by other .
Klinman, et al., "Activation of the innate immune system by CpG
oligodeoxynucleotides: immunoprotective activity and safety".
Springer Semin. Immunopathol. 22:173-183 (2000). cited by other
.
Klinman, et al., "CpG Motids as Immune Adjuvants". Vaccine 17:19-25
(1999). cited by other .
Kou, et al., "Analysis and Regulation of interferon-gamma
production by peripheral blood lymphocytes from patients with
bronchial asthma". Arerugi 43(3):483-491 (1994), abstract only.
cited by other .
Krieg, et al., "CpG motifs in bacterial DNA and their immune
effect". Annu. Rev. Immunol. 20:709-760 (2002). cited by other
.
Krieg, et al., "Brief Communication: Oligodeoxynucleotide
Modifications Determine the Magnitude of B-Cell Stimulation by CpG
Motifs". Antisense & Nucleic Acid Drug Development 6:133-139
(1996). cited by other .
Krieg, et al., "Phosphorothioate oligodeoxynucleotides: antisense
or anti-protein?". Antisense Res. Dev. 5:241 (1 page) (1995). cited
by other .
Krieg, et al., "Uptake of oligodeoxyribonucleotides by lymphoid
cells is heterogeneous and inducible". Antisense Res. Dev.
1(2):161-171 (1991). cited by other .
Krieg, et al., "Leukocyte stimulation by oligodeoxynucleotides".
Applied Antisense Oligonucleotide Tech. (BOOK):431-448 (1998).
cited by other .
Krieg, et al., "Causing a Commotion in the Blood: Immunotherapy
Progresses from Bacteria to Bacterial DNA". Immunology Today
21(10):521-526 (2000). cited by other .
Krieg, et al., "CpG DNA: A pathogenic factor in systemic lupus
erythematosus?". J. Clin. Immunol. 15(6):284-292 (1995). cited by
other .
Krieg, et al, "CpG DNA induces sustained IL-12 expression in vivo
and resistance to Listeria monocytogenes challenge". J. Immunol.
161:2428-2434 (1998). cited by other .
Krieg, et al., "A role for endogenous retroviral sequences in the
regulation of lymphocyte activation". J. Immunol. 143(8):2448-2451
(1989). cited by other .
Krieg, "An innate immune defense mechanism based on the recognition
of CpG motifs in microbial DNA". J. Lab. Clin. Med. 128(2):128-133
(Abstract) (1996). cited by other .
Krieg, et al., "CpG motifs in bacterial DNA trigger direct B-cell
activation". Nature 374:546-549 (1995). cited by other .
Krieg, et al., "Modification of antisense phosphodiester
oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular
association and improves efficacy". Proc. Natl. Acad. Sci. USA
90:1048-1052 (1993). cited by other .
Krieg, et al., "The role of CpG dinucleotides in DNA vaccines".
Trends in Microbiol. 6:23-27 (1998). cited by other .
Krieger, et al., "Structures and Functions of Multiligand
Lipoprotein Receptors: Macrophage Scavenger Receptors and LDL
Receptor-Related Protein (LRP)". Annu. Rev. Biochem 63:601-637
(1994). cited by other .
Krug, et al., "Identification of CpG Oligonucleotide Sequences with
High Induction of IFN-.alpha./.beta. in Plasmacytoid Dendritic
Cells". Eur. J. Immunol. 31:2154-2163 (2001). cited by other .
Krug, et al., "Toll-like Receptor Expression Reveals CpG DNA as a
Unigue Microbial Stimulus for Plasmacytoid Dendritic Cells Which
Synergizes With CD40 Ligand to Induce High Amounts of IL-12". Eur.
J. Immunol. 31:3026-3037 (2001). cited by other .
Kuchan, et al., "Nucleotides in Infant Nutrition: Effects of Immune
Function". Pediatr. Adolesc. Med. Basel. Karger 8:80-94 (1998).
cited by other .
Kulkarni, et al., "Effect of Dietary Nucleotides on Response to
Bacterial Infection". J. Parenter. Enteral. Nutr. 10(2):169-171
Abstract (1986). cited by other .
Kuramoto, et al., "Oligonucleotide sequences required for natural
killer cell activation". Jpn. J. Cancer Res. 83:1128-1131 (1992).
cited by other .
Lagrange, et al., "Immune Responses Directed Against Infectious and
Parasitic Agents". Immunology (BOOK--ISBN:0471017604) (Chapter of
Book; Ed--Jean-Francois Bach): (1978). cited by other .
Lang, et al., "Guanosine-rich oligodeoxynucleotides induce
proliferation of macrophage progenitors in cultures of murine bone
marrow cells". Eur. J. Immunol. 29:3496-3506 (1999). cited by other
.
Lapatschek, et al., "Activation of Macrophages and B Lymphocytes by
an Oligodeoxynucleotide Derived from an Acutely Pathogenic Simian
Immunodeficiency Virus". Antisense Nucleic Acid Drug Dev.
8(5):357-370 (Oct. 1998). cited by other .
Ledergerber, et al., "Clinical Progression and Virological Failure
on Highly Active Antiretroviral Therapy in HIV-1 Patients: a
Prospective Cohort Study". The Lancet 353:863-868 (1999). cited by
other .
Lederman, et al., "Polydeooxyguanine Motifs in a 12-mer
Phosphorothioate Oligodeooxynucleotide Augment Binding to the v3
Loop of the HIV-1 gp120 and Potency of HIV-1 Inhibition
Independently of G-Tetrad Formation". Antisense & Nucleic Acid
Drug Development 6:281-289 (1996). cited by other .
Lee, et al., "An Oligonucleotide Blocks Interferon-.gamma. Signal
Transduction". Transplantation 62(9):1297-1301 (1996). cited by
other .
Leibson, et al., "Role of .gamma.-interferon in antibody-producing
responses". Nature 309:799-801 (1984). cited by other .
Leonard, et al., "Conformation of guanine 8-oxoadenine base pairs
in the crystal structure of d(CGCGAATT(O8A)GCG)". Biochemistry
31(36):8415-8420 (1992). cited by other .
Li, et al., "Long-Lasting Recovery in CDR T-Cell Function and
Viral-Load Reduction After Highly Active Antiretroviral Therapy in
Advanced HIV-1 Disease". The Lancet 351:1682-1686 (1998). cited by
other .
Liang, et al., "Activation of Human B Cells by Phosphorothioate
Oligodeoxynucleotides". J. Clin. Invest. 98:1119-1129 (1996). cited
by other .
Lipford, et al., "CpG-containing synthetic oligonucleotides promote
B and cytotoxic T cell responses to protein antigen: a new class of
vaccine adjuvants". Eur. J. Immunol. 27(9):2340-2344 (1997). cited
by other .
Lipford, et al., "Immunostimulatory DNA: sequence-dependent
production of potentially harmful or useful cytokines". Eur. J.
Immunol. 27(12):3420-3426 (1997). cited by other .
Lonnberg, et al., "Towards Genomic Drug Therapy with Antisense
Oligonucleotides". Ann. Med. 28:511-522 (1996). cited by other
.
Macaya, et al., "Thrombin-binding DNA aptamer forms a unimolecular
quadruplex structure in solution". Proc. Natl. Acad. Sci. USA
90:3745-3749 (Apr. 1993). cited by other .
MacFarlane, et al., "Antagonism of immunostimulatory
CpG-oligodeoxynucleotides by quinacrine, chloroquine, and
structurally related compounds". J. Immunol. 160(3):1122-1131
(1998). cited by other .
Maltese, et al., "Sequence context of antisense RelA/NF-kB
phohphorothioates determines specificity". Nucleic Acids Research
23(7):1146-1151 (1995). cited by other .
Manzel, et al., "Lack of Immune Stimulation by Immobilized
CpG-oligonucletide". Antisense & Nucleic Acid Drug Development
9(5):459-464 (1999). cited by other .
Mastrangelo, et al., "Gene therapy for human cancer: an essay for
clinicians". Seminars Oncology 23(1):4-21 (1996). cited by other
.
Matson, et al., "Nonspecific suppression of [3H]thymidine
incorporation by control oligonucleotides". Antisense Res. Dev.
2(4):325-330 (1992). cited by other .
McCluskie, et al., "Cutting Edge: CpG DNA Is a Potent Enhancer of
Systemic and Mucosal Immune Responses Against Hepatitis B Surface
Antigen with Intranasal Administration to Mice". J. Immun.
161:4463-4465 (1998). cited by other .
McCluskie, et al., "Route and Method of DNA Vaccine Influence
Immune Responses in Mice and Non-Human Primates". Molecular Med.
5(5):287-300 (1999). cited by other .
McIntyre, et al., "A sense phosphorothioate oligonucleotide
directed to the initiation codon of transcription factor NF-kappa B
p65 causes sequence-specific immune stimulation". Antisense Res.
Dev. 3(4):309-322 (1993). cited by other .
McKenzie, "Nucleic Acid Vaccines". Immunologic Res. 24(3):225-244
(2001). cited by other .
Merad, et al., "In vivo Manipulation of Dendritic Cells to Induce
Therapeutic Immunity". Blood 99(5):1676-1682 (2002). cited by other
.
Messina, et al., "Stimulation of in vitro murine lymphocyte
proliferation by bacterial DNA". Cell Immunol. 147(6):1759-1764
(1991). cited by other .
Messina, et al., "The influence of DNA structure on the in vitro
stimulation of murine lymphocytes by natural and synthetic
polynucleotide antigens". J. Immunol. 147:148-157 (1993). cited by
other .
Mojcik, et al., "Administration of a phosphorothioate
oligonucleotide antisense murine endogenous retroviral MCF env
causes immune effect in vivo in a sequence-specific manner". Clin.
Immunol. Immunopathol. 67(2):130-136 (1993). cited by other .
Mottram, et al., "A novel CDC2-related protein kinase from
leishmania mexicana, LmmCRK1, is post-translationally regulated
during the life cycle". J. Biol. Chem. 268(28):21044-21052 (1993).
cited by other .
Nyce, et al., "DNA antisense therapy for asthma in an animal
model". Nature 385:721-725 (1997). cited by other .
Oberbauer, "Not nonsense but antisense--Applications of Antisense
Oligonucleotides in Different Fields of Medicine". Wein Klin
Wochenschr 109:40-46 (1997). cited by other .
Ogg, et al., "Quantitation of HIV-1-Specific Cytotoxic
T-Lymphocytes and Plasma Load of Viral RNA". Science 279:2103-2106
(1998). cited by other .
Okada, et al., "Bone Marrow-Derived Dendritic Cells Pulsed With a
Tumor-Specific Peptide Elicit Effective Anti-Tumor Immunity Against
Intracranial Neoplasms". Int. J. Cancer 78:196-201 (1998). cited by
other .
Palucka, et al., "Dendritic Cells as the Terminal Stage of Monocyte
Differentiation". J. Immunol. 160:4587-4595 (1999). cited by other
.
Papasavvas, et al., "Enhancement of Human Immunodeficiency Virus
Type I-Specific CD4 and CD8 T Cell Responses in Chronically
Infected Persons after Temporary Treatement Interruption". J.
Infect. Diseases 182:766-775 (2000). cited by other .
Pialoux, et al., "A Randomized Trial of Three Maintenance Regimens
Given After Three Months of Induction Therapy with Zidovudine,
Lamivudine, and Indinavie in Previously Untreated HIV-1-Infected
Patients". The New England Journal of Medicine 339(18):1269-1276
(1998). cited by other .
Piscitelli, "Immune-Based Therapies for Treatment of HIV
Infection". The Annals of Pharmacotherapy 30:62-76 (1996). cited by
other .
Pisetsky, et al., "Immunological Properties of Bacterial DNA". Ann.
NY Acad. Sci. 772:152-163 (1995). cited by other .
Pisetsky, "Immunological consequences of nucleic acid therapy".
Antisense Res. Dev. 5:219- 225 (1995). cited by other .
Pisetsky, "The immunological properties of DNA". J. Immunol.
156:421-423 (1996). cited by other .
Pisetsky, et al., "Stimulation of murine lymphocyte proliferation
by a phosphorothioate oligonucleotide with antisense activity for
hepes simplex virus". Life Science 54:101-107 (1994). cited by
other .
Pisetsky, "Stimulation of in vitro proliferation of murine
lymphocytes by synthetic oligodeoxyucleotides". Molecular Biol.
Reports 18:217-221 (1993). cited by other .
Plenat, "Animal models of antisense oligonucleotides: lessons for
use in humans". J. Mol. Med. Today 2(6):250-257 (1996). cited by
other .
Prasad, et al., "Oligonucleotides Tethered to a Short Polyguanylic
Acid Stretch are Targeted to Macrophages: Enhanced Antiviral
Activity of a Vesicular Stomatitis Virus-Specific Antisense
Oligonucleotide". Antimicrobial Agents and Chemotherapy
43(11):2689-2696 (Nov. 1999). cited by other .
Quddus, et al., "Treating activated CD4+ T cells with either of two
distinct DNA methyltransferase inhibitors, 5-azacytidine or
procaniamlde, is sufficient to cause a lupus-like disease in
syngeneic mice". J. Clin. Invest. 92(1):38-53 (1993). cited by
other .
Ramanathan, et al., "Characterization of the
Oligodeoxynucleotide-mediated Inhibition of
Interferon-.gamma.-induced Major Histocompatibility Complex Class I
and Intercellular Adhesion Molecule-1". The Journal of Biological
Chemistry 269(40):24564-24574 (Oct. 1994). cited by other .
Ramanathan, et al., "Inhibition of Interferon-.gamma.-Induced Major
Histocompatibility Complex Class I Expression by Certain
Oligodeoxynucleotides". Transplantation 57(4):612-615 (Feb. 1994).
cited by other .
Raz, "Deviation of the Allergic IgE to an IgG Response by Gene
Immunotherapy". Int. Rev. Immunol. 18(3):271-289 (1999). cited by
other .
Raz, et al., "Preferential Induction of a Th1 Immune Response and
Inhibition of Specific IgE Antibody Formation by Plasmid DNA
Immunization". Proc. Natl. Acad. Sci. USA 93:5141-5145 (1996).
cited by other .
Raz, et al., "Intradermal gene immunization: the possible role of
DNA uptake in the induction of cellular immunity to viruses". Proc.
Natl. Acad. Sci. USA 91:9519-9523 (1994). cited by other .
Ricci, et al., "T cells, cytokines, IgE and allergic airways
inflammation". J. Invest. Allergol Clin. Immunol. 4(5):214-220
(1994). cited by other .
Rojanasakul, "Antisense oligonucleotide therapeutics: drug delivery
and targeting". Drug Delivery Reviews 18:115-131 (1996). cited by
other .
Roman, et al., "Immunostimulatory DNA sequences function as T
helper-1-promoting aduvants". Nature Med. 3(8):849-854 (1997).
cited by other .
Rosenberg, et al., "Immune Control of HIV-1 After Early Treatment
of Acute Infection". Nature 407:523-526 (2000). cited by other
.
Rosenberg, et al., "Vigorous HIV-1-Specific CD4+ T-Cell Responses
Associated with Control of Viremia". Science 278:1447-1450 (1997).
cited by other .
Ruiz, et al., "Structured Treatment Interruption in Chronically
HIV-1 Infected Patients After Long-Term Viral Suppression". AIDS
14:397-403 (2000). cited by other .
Santini, et al., "Type I Interferon as a Powerful Adjuvant for
Monocyte-derived Dendritic Cell Development and Activity In Vitro
and in Hu-PBL-SCID Mice". J. Exp. Med. 191:1777-1788 (2000). cited
by other .
Sato, et al., "Immunostimulatory DNA sequences necessary for
effective intradermal gene immunization". Science 273:352-354
(1996). cited by other .
Scanlon, et al., "Oligonucleotide-mediated Modulation of Mammalian
Gene Expression". FASEB J. 9:1288-1295 (1995). cited by other .
Schnell, et al., "Identification and characterization of a
Saccharomyces cerevisiae gene (PAR 1) conferring resistance to iron
chelators". Eur. J. Biochem. 200:487-493 (1991). cited by other
.
Schoofs, "Small Steps--A Limited Experiment Opens New Approach in
Fight Against HIV". Wall Street Journal (Sep. 28, 2000). cited by
other .
Schubbert, et al., "Ingested Foreign (phage M13) DNA Survives
Transiently in the Gastrointestinal Tract and Enters the
Bloodstream of Mice". Mol. Gen. Genet. 242:495-504 (1994). cited by
other .
Schwartz, et al., "Endotoxin responsiveness and grain dust-induced
inflammation in the lower respiratory tract". Am. J. Physiol.
267(5):609-617 (1994). cited by other .
Schwartz, et al., "The role of endotoxin in grain dust-induced lung
disease". Am. J. Respir. Crit. Care Med. 152(2):603-608 (1995).
cited by other .
Schwartz, et al., "CpG motifs in bacterial DNA cause inflammation
in the lower respiratory tract". J. Clin. Invest. 100(1):68-73
(1997). cited by other .
Sedegah, et al., "Intertukin 12 induction of interferon g-dependent
protection against malaria". Proc. Natl. Acad. Sci. USA
91:10700-10792 (1994). cited by other .
Sethi, et al., "Postexposure prophytaxis against prion disease with
a stimulator of innate immunity". Lancet 360:229-230 (2002). cited
by other .
Shafer, et al., "Highly Active Antiretroviral Therapy (HAART) for
the Treatment of Infection With Human Immunodeficiency Virus Type
1". Biomed. & Pharmachther. 53:73-86 (1999). cited by other
.
Shirakawa, et al., "The inverse association between tuberculin
responses and atopic disorder". Science 275(5296):77-79 (1997).
cited by other .
Sidman, et al., ".gamma.-Interferon is one of several direct B
cell-maturing lymphokines". Nature 309:801-804 (1984). cited by
other .
Sparwasser, et al., "Macrophages sense pathogens via DNA motifs:
induction of tumor necrosis factor-alpha-mediated shock". Eur. J.
Immunol. 27(7):1671-1679 (1997). cited by other .
Sparwasser, et al., "Bacterial DNA and immunostimulatory CpG
oligonuceotides trigger maturation and activation of murine
dendritic cells". Eur. J. Immunol. 28:2045-2054 (1998). cited by
other .
Spiegelberg, et al., "Recognition of T Cell Epitopes and Lymphokine
Secretion by Rye Grass Allergen Lolium perenne I-Specific Human T
Cell Clones". J. of Immunology 152:4706-4711 (1994). cited by other
.
Stacey, et al., "Immunostimulatory DNA as an adjuvant in
vaccination against Leishmania major". Infect. Immun. 67:3719-3726
(1999). cited by other .
Stein, et al., "Oligodeoxynucleotides as inhibitors of gene
expression: a review". Cancer Res. 48:2659-2668 (1998). cited by
other .
Stull, et al., "Antigene, ribozyme, and aptamer nucleic acid drugs:
progress and prospects". Pharm. Res. 12(4):465-483 (1995). cited by
other .
Su, et al., "Vaccination against Chlamydial Genital Tract Infection
after Immunization with Dendritic Cells Pulsed Ex Vivo with
Nonviable Chlamydiae". J. Exp. Med. 188:809-818 (1998). cited by
other .
Subramanian, et al., "Theoretical considerations on the `spine of
hydration` in the minor groove of d(CGCGAATTCGCG) d(CGGCTTAAGCGC):
Monte Carlo computer simulation". Proc. Natl. Acad. Sci. USA
85:1836-1840 (1988). cited by other .
Syme, et al., "Generation of Dendritic Cells ex vivo: Differences
in Steady State versus Mobilized Blood from Patients with Breast
Cancer, with Lymphoma, and from Normal Donors". J. Hematother. Stem
Cell Res. 10:621-630 (2001). cited by other .
Tanaka, et al., "An antisense oligonucleotide complementary to a
sequence in I gamma 2b increases gamma 2b germhine transcripts,
stimulates B cell DNA synthesis and inhibits immunoglobulin
secretion". J. Exp. Med. 175:597-607 (1992). cited by other .
Tarte, et al., "Extensive characterization of dendritic cells
generated in serum-free conditions: regulation of soluble antigen
uptake, apoptotic tumor cell phagocytosis, chemotaxis and T cell
activation during maturation in vitro". Leukemia 14:2182-2192
(2000). cited by other .
Thorne, "Experimental grain dust atmospheres generated by wet and
dry aerosolization techniques". Am. J. Ind. Med. 25(1):109-112
(1994). cited by other .
Tighe, et al., "Conjunction of Protein to Immunostimulatory DNA
results in a Rapid Long-Lasting and Potent Induction of
Cell-Mediated and Humoral Immunity". Eur. J. Immunol. 30:1939-1947
(2000). cited by other .
Tokunaga, et al., "A synthetic single-stranded DNA, poly(dG, dC),
induces interferon-.alpha./.beta. and -.gamma., augments natural
killer activity and suppresses tumor growth". Jpn. J. Cancer Res.
79:682-686 (1988). cited by other .
Tokunaga, et al., "Synthetic oligonucleotides with particular base
sequences from the cDNA encoding proteins of Mycobacterium bovis
BCG induce interferons and activate natural killer cells".
Microbiol. Immunol. 36(1):55-66 (1992). cited by other .
Uhlmann, et al., "Antisense oligonucleotides: a new therapeutic
principle". Chem. Rev. 90:543-584 (1990). cited by other .
Verdijk, et al., "Polyriboinosinic Polyribocytidylic Acid
(Poly(I:C)) Induces Stable Maturation of Functionally Active Human
Dendritic Cells". J. Immunol. 163:57-61 (1999). cited by other
.
Verma, et al., "Gene therapy--promises, problems and prospects".
Nature 389:239-242 (Sep.1997). cited by other .
Vil'Ner, "Effect of Amphotericin B on the interferonogenic activity
of poly(G).poly (C) and poly(G,I).poly(C) in mice and their
resistance to infection by the tick-borne encephalitis virus".
Antibiotiki 27(11):827-830 (Nov. 1982), abstract only. cited by
other .
Vil'Ner, et al., "Effect of virazole on the antiviral activity of
poly(G) X poly .COPYRGT. and other polyribonucleotide
interferongens". Antibiotiki 29(6):450-453 (1984), abstract only.
cited by other .
Vil'Ner, et al., "Evaluation of the size of the continuous poly(G)
site necessary for the biological activity of the poly(G).poly(C)
complex". Vopr Virusol 30(3):337-340 (1985), abstract only. cited
by other .
Vil'Ner, "Effect of the size of the continuous poly(G) site in
poly(G,A).poly(C) complexes on their interferon-inducing activity
and their capacity to stimulate the development of the immunity".
Vopr Virusol 31(6):697-700 (1986), abstract only. cited by other
.
Vil'Ner, et al., "Dependence of the antiviral activity of the
poly(G).poly(C) complex on the size of the continuous poly(C)
segments". Vopr Virusol 33(3):331-335 (1988), abstract only. cited
by other .
Wagner, "Bacterial CpG DNA Activates Immune Cells to Signal
Infectious Danger". Adv. lmmunol. 73:329-368 (1999). cited by other
.
Wagner, "Gene inhibition using antisense oligodeoxynucleotides".
Nature 372:333-335 (1994). cited by other .
Walker, et al., "Activated T Cells and Cytokines in Bronchoalveolar
Lavages from Patients with Various Lung Diseases Associated with
Eosinophilia". Am. J. Respir. Crit. Care Med. 150:10381048 (1994).
cited by other .
Walker, et al., "Immunostimulatory oligodeoxynucleotides promote
protective immunity and provide systemic therapy for leishmaniasis
via IL-12- and IFN-g-dependent mechanisms". Proc. Natl. Acad. Sci.
USA 96:6970-6975 (1999). cited by other .
Wallace, et al., "Oligonucleotide probes for the screening of
recombinant DNA libraries". Methods Enzymol. 152:432-442 (1987).
cited by other .
Weiner, "The immunobiology and clinical potential of
immunostimulatory CpG oligodeoxynucleotides". Leukocyte Bio.
68:455-463 (2000). cited by other .
Weiner, et al., "Immunostimulatory oligodeoxynucleotides containing
the CpG motif are effective as immune adjuvants in tumor antigen
immunization". Proc. Natl. Acad. Sci. USA 94:10833-10837 (1997).
cited by other .
Weiss, "Upping the antisense ante: scientists bet on profits from
reverse genetics". Science 139:108-109 (1991). cited by other .
Whalen, et al., "DNA-Mediated Immunization to the Helatitis B
Surface Antigen: Activation and Entrainment of the Immune
Response". Ann. NY Acad. Sci. 772:64-76 (1995). cited by other
.
Whalen, "DNA vaccines for emerging infection diseases: what if?".
Emerg. Infect. Dis. 2(3):168-175 (1996). cited by other .
Wloch, et al., "The influence of DNA sequence on the
immunostimulatory properties of plasmid DNA vectors". Hum. Gene
Ther. 9(10):1439-1447 (Jul. 1998). cited by other .
Woolridge, et al., "Immunostimulatory oligodeoxynucleotides
containing CpG motifs enhance the efficacy of monoclonal antibody
therapy of lymphoma". Blood 89:2994-2998 (1997). cited by other
.
Wu, et al., "Receptor-mediated gene delivery and expression in
vivo". J. Biol. Chem. 263:14621-14624 (1988). cited by other .
Wu-Pong, "Oligonucleotides: opportunities for drug therapy and
research". Pharmaceutical Tech. 18:102-114 (1994). cited by other
.
Wyatt, et al., "Combinatorially selected guanosine-quartet
structure is a potent Inhibitor of human immundeficiency virus
envelope-mediated cell fusion". Proc. Natl. Acad. Sci. USA
91:1356-1360 (Feb. 1994). cited by other .
Yamamoto, et al., "Ability of oligonucleotides with certain
palindromes to induce interferon production and augment natural
killer cell activity is associated with their base length".
Antisense Res. Dev. 4:119-123 (1994). cited by other .
Yamamoto, "Unique palindromic sequences in synthetic
oligonucleotides are required to induce inf and augment
INF-mediated natural killer activity". J. Immunol.
148(12):4072-4076 (1992). cited by other .
Yamamoto, et al., "In vitro augmentation of natural killer cell
activity and production of interferon-alpha/beta and -gamma with
deoxyribonucleic acid fraction from Mycobacterium bovis BCG". Jpn.
J. Cancer Res. 79:866-873 (1988). cited by other .
Yamamoto, et al., "Synthetic oligonucleotides with certain
palindromes stimulate interferon production of human peripheral
blood lymphocytes in vitro". Jpn. J. Cancer Res. 85:775-779 (1994).
cited by other .
Yamamoto, et al., "Mode of action of oligonucleotide fraction
extracted from Mycobacterium bovis BeG". Kekkaku 69(9):29-32
(1994). cited by other .
Yamamoto, et al., "DNA from bacteria, but not vetebrates, induces
interferons, activates natural killer cells, and inhibits tumor
growth". Microbiol. Immunol. 36(9):983-997 (1992). cited by other
.
Yamamoto, et al., "Lipofection of synthetic
oligodeoxyribonucleotide having a palindromic sequence AACGTT to
murine splenocytes enhances interferon production and natural
killer activity". Microbiol. Immunol. 38(10):831-836 (1994). cited
by other .
Yaswen, et al., "Effects of Sequence of Thioated Oligonucleotides
on Cultured Human Mammary Epithelial Cells". Antisense Research and
Development 3:67-77 (1993). cited by other .
Yew, et al., "Contribution of Plasmid DNA to Inflammation in the
Lung After Administration of Cationic Lipid: pDNA Complexes". Hum.
Gene Ther. 10(2):223-234 (1999). cited by other .
Yi, et al, "IFN-.gamma. promotes IL-6 and 1gM secretion in response
to CpG motifs in bacterial DNA and oligonucleotides". J. Immunol.
156:558-564 (1996). cited by other .
Yi, et al., "Rapid immune activation by CpG motifs in bacterial
DNA". J. Immunol. 157:5394-5402 (1996). cited by other .
Zelphati, et al., "Inhibition of HIV-1 Replication in Cultured
Cells with Antisense Oligonucleotides Encapsulated in
Immunoliposomes". Antisense Res: Dev. 3:323 (1993). cited by other
.
Zhang, et al., "Antigen- and Isotype-Specific Immune Responses to a
Recombinant Antigen-Allergen Chimeric (RAAC) Protein". J. Immunol.
151:791-799 (1993). cited by other .
Zhao, et al, "Comparison of cellular binding and uptake of
antisense phosphodiester, phosphorothioate, and mixed
phosphorothioate and methylphosphonate oligonucleotides". Antisense
Res. Dev. 3(1):53-66 (1993). cited by other .
Zhao, et al., "Stage-specific oligonucleotide uptake in murine bone
marrow B-cell precursors". Blood 84(11):3660-3666 (1994). cited by
other .
Zheng, et al., "Contribution of Vascular Endothelial Growth Factor
in the Neovascularization Process During the Pathogenesis of
Herpetic Stromal Keratitis". J. Vriol. 75(20):9828-9835 (2001).
cited by other .
Zhu, et al., "Macaque blood-derived antigen-presenting cells elicit
SIV-specific immune responses". J. Med. Primatol 29:182-192 (2000).
cited by other .
Zimmermann, et al., "CpG oligodeoxynucleotides trigger protective
and curative Th1 responses in lethal murine leishmaniasis". J.
Immunol. 160:3627-3630 (1998). cited by other .
U.S. Doc. No. 6,008,200, Dec. 28, 1999, (withdrawn). cited by
other.
|
Primary Examiner: Lucas; Zachariah
Assistant Examiner: Horning; Michelle S
Attorney, Agent or Firm: Klarquist Sparkman, LLP
Parent Case Text
PRIORITY CLAIM
This claims the benefit of U.S. Provisional Patent Application No.
60/411,944 filed Sep. 18, 2002, which is incorporated by reference
herein in its entirety.
Claims
The invention claimed is:
1. A method of increasing an immune response to an opportunistic
infection in an immunocompromised subject comprising selecting an
immunocompromised subject infected with a secondary infection,
wherein the immunocompromised subject is immunocompromised as a
result of an infection with human immunodeficiency virus (HIV) or a
simian immunodeficiency virus (SIV), and wherein the secondary
infection is infection with a Leishmania; administering to the
immunocompromised subject infected with the secondary infection a
therapeutically effective amount of an oligodeoxynucleotide
comprising the nucleic acid sequence set forth as SEQ ID NO: 176,
an oligodeoxynucleotide comprising the nucleic acid sequence set
forth as SEQ ID NO: 177 and an oligodeoxynucleotide comprising the
nucleic acid sequence set forth as SEQ ID NO: 178; and assessing
the immune response to the Leishmania in the subject; thereby
increasing the response to the Leishmania in the immunocompromised
subject.
2. The method of claim 1, wherein the human immunodeficiency virus
is HIV-1.
3. The method of claim 1, wherein the human immunodeficiency virus
is HIV-2.
4. The method of claim 1, wherein the subject has acquired immune
deficiency syndrome (AIDS).
5. The method of claim 1, wherein one or more of nucleotides 3-15
of SEQ ID NO: 176, nucleotides 2-18 of SEQ ID NO: 177, or
nucleotides 3-15 of SEQ ID NO: 178 comprise phosphodiester
bases.
6. The method of claim 1, wherein nucleotides 3-15 of SEQ ID NO:
176, nucleotides 2-18 of SEQ ID NO: 177, and nucleotides 3-15 of
SEQ ID NO: 178 are phosphodiester bases.
7. The method of claim 1, wherein one or more of nucleotides 1 or 2
of SEQ ID NO: 176, nucleotide 1 of SEQ ID NO: 177, or nucleotides 1
or 2 of SEQ ID NO: 178 comprise phosphorothioate bases.
8. The method of claim 1, wherein one or more of nucleotides 16-20
of SEQ ID NO: 176, nucleotides 19 or 20 of SEQ ID NO: 177, or
nucleotides 16-20 of SEQ ID NO: 178 comprises phosphorothioate
bases.
9. The method of claim 2, further comprising administering to the
subject a combination of drugs which comprises a highly active
anti-retroviral therapy (HAART).
10. The method of claim 1, further comprising administering an
anti-retroviral drug.
11. The method of claim 10, wherein the anti-retroviral drug
comprises 3'-azido-3' dexoy-thymidine (AZT).
12. A method of increasing an immune response to an opportunistic
infection with a pathogen in an immunocompromised subject,
comprising selecting an immunocompromised subject wherein the
subject is immunocompromised as a result of an infection with a
human immunodeficiency virus; and administering to the subject a
therapeutically effective amount of an oligodeoxynucleotide
comprising the nucleic acid sequence set forth as SEQ ID NO: 176,
an oligodeoxynucleotide comprising the nucleic acid sequence set
forth as SEQ ID NO: 177 and an oligodeoxynucleotide comprising the
nucleic acid sequence set forth as SEQ ID NO: 178, wherein an
antigenic epitope of a polypeptide from the pathogen is not
administered to the subject, thereby increasing the response to the
opportunistic infection, wherein the pathogen is a Leishmania.
Description
FIELD
The present disclosure relates to a method of increasing an immune
response to an opportunistic infection in an immunocompromised
subject or a subject infected with a lentivirus, specifically to a
method of increasing an immune response to a pathogen using
oligodeoxynucleotides including a CpG.
BACKGROUND
Primary disorders of the immune system can be divided into four
categories, (1) disorders of the humoral immunity, (2) disorders of
cellular immunity, (3) disorders of phagocytes, and (4) disorders
of complement. In addition, there are many causes of secondary
immunodeficiency such as treatment with immunosuppressive or
chemotherapeutic agents, protein-losing enteropathy, and infection
with a human immunodeficiency virus (HIV). Generally,
immunocompromised patients are unable to mount an immune response
to a vaccine or an infection in the same manner as
non-immunocompromised individuals.
Acquired immunodeficiency syndrome (AIDS) is a disease
characterized by a progressive loss of function of the immune
system. As a result, those afflicted with the syndrome are
susceptible to a variety of opportunistic infections. The etiologic
agent of AIDS is a cytopathic retrovirus designated the human
immunodeficiency virus (HIV). One of the major targets of the HIV
in humans is T helper cells (CD4+ cells). The infection of T helper
cells by HIV results in a profound dysregulation of the immune
system that includes both depleted numbers and impaired function of
T lymphocytes. Although the exact mechanism is unknown, the number
of T helper cells predictably declines during HIV infection.
Clinicians monitor this decline as an indicator of disease
progression.
Opportunistic infections to which individuals infected with HIV are
susceptible include bacterial infections such as salmonellosis,
syphilis and neurosyphilis, tuberculosis (TB), atypical
mycobacterial infection, and bacillary angiomatosis (cat scratch
disease), fungal infections such as aspergillosis, candidiasis
(thrush, yeast infection), coccidioidomycosis, cryptococcal
meningitis, and histoplasmosis, protozoal infections such as
cryptosporidiosis, isosporiasis, microsporidiosis, Pneumocystis
Carinii pneumonia (PCP), and toxoplasmosis, viral infections such
as Cytomegalovirus (CMV), hepatitis, herpes simplex (HSV, genital
herpes), herpes zoster (HZV, shingles), human papilloma virus (HPV,
genital warts, cervical cancer), Molluscum Contagiosum, oral hairy
leukoplakia (OHL), and progressive multifocal leukoencephalopathy
(PML), and neoplasms such as Kaposi's sarcoma, systemic
non-Hodgkin's lymphoma (NHL), and primary CNS lymphoma, among
others. These opportunistic infections remain principally
responsible for the morbidity and mortality associated with HIV
disease.
In view of the above, there exists a need for agents that act as
immunoprotective agents in immunocompromised individuals.
SUMMARY
Described herein are methods of increasing an immune response to an
opportunistic infection in an immunocompromised subject. In one
embodiment, the method includes administering to the subject a
therapeutically effective amount of an immunostimulatory D
oligodeoxynucleotide including a CpG motif, thereby increasing the
response to the opportunistic infection. In another embodiment, the
method includes administering to the subject a therapeutically
effective amount of an immunostimulatory K oligodeoxynucleotide
including a CpG motif, thereby increasing the response to the
opportunistic infection.
In some embodiments, the subject is infected with a lentivirus, for
example, a human immunodeficiency virus or a simian
immunodeficiency virus. In some embodiments, the ODN is
administered alone, whereas in other embodiments, the ODN is
administered in combination with drugs that comprise a highly
active anti-retroviral therapy (HAART), for example an
anti-retroviral drug such as 3'-azido-3'dexoy-thymidine (AZT).
In other embodiments, the oligodeoxynucleotide is at least about 16
nucleotides in length and includes a sequence represented by the
following formula: 5'X.sub.1X.sub.2X.sub.3Pu.sub.1Py.sub.2CpG
Pu.sub.3Py.sub.3X.sub.4X.sub.5X.sub.6(W).sub.M(G).sub.N-3' (SEQ ID
NO: 22) wherein the central CpG motif is unmethylated, Pu is a
purine nucleotide, Py is a pyrimidine nucleotide, X and W are any
nucleotide, M is any integer from 0 to 10, and N is any integer
from 4 to 10. In certain examples, Pu Py CpG Pu Py includes
phosphodiester bases, and in certain examples,
X.sub.1X.sub.2X.sub.3 and X.sub.4X.sub.5X.sub.6(W).sub.M (G).sub.N
includes phosphodiester bases. In some examples,
X.sub.1X.sub.2X.sub.3Pu Py and Pu Py X.sub.4X.sub.5X.sub.6 are self
complementary.
In still other embodiments, the method is a method of increasing an
immune response to an opportunistic infection in an
immunocompromised subject, including administering to the subject a
therapeutically effective amount of an immunostimulatory D
oligodeoxynucleotide, thereby increasing the immune response to the
opportunistic infection. In yet still other embodiments, the method
is a method of increasing an immune response to an opportunistic
infection in an immunocompromised subject, including administering
to the subject a therapeutically effective amount of an
immunostimulatory D oligodeoxynucleotide or an immunostimulatory K
oligodeoxynucleotide, wherein an antigenic epitope of a polypeptide
is not administered to the subject, thereby increasing the response
to the opportunistic infection.
The foregoing and other features and advantages will become more
apparent from the following detailed description of several
embodiments, which proceeds with reference to the accompanying
figures.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 is a set of graphs showing the response of primate
peripheral blood mononuclear cells (PBMC) to K and D
oligonucleotides (ODN). PBMC from 8-20 normal human donors and 20
rhesus macaques were stimulated for 72 hours with a panel of K, D
or control ODN (3 mM). IL-6 and IFN.alpha. levels in culture
supernatants were determined by ELISA while cell proliferation was
assessed by [H].sup.3 thymidine uptake. Note that D ODN induce the
secretion of IFN.alpha. while K ODN induce cell proliferation and
IL 6 production. The response of PBMC from rhesus macaques mirrors
that of human PBMC. All assays were performed in triplicate.
Statistical significance was determined by ANOVA of log normalized
data. A single asterisk (*) indicates a P value of <0.05; a
double asterisk (**) indicates a P value of <0.01.
FIG. 2 is a graph showing that treatment of primates with CpG D ODN
protects them from a local challenge with pathogenic Leishmania
parasites. Treatment of the macaques with D ODN, but not with K
ODN, significantly reduced the size of the cutaneous lesion
(p<0.001).
FIG. 3 is a set of graphs showing that D ODNs trigger the secretion
of IFN.alpha. and IFN.gamma.. In contrast, K ODNs increase cell
proliferation and IL-6 production. PBMC from healthy and HIV
infected subjects secreted similar levels of IFN.alpha. and
IFN.gamma. in the absence of stimulation or in the presence of
control ODN lacking the CpG motif. Upon stimulation with CpG D ODN,
however, PBMC from HIV infected subjects generated significantly
lower IFN.gamma.(p<0.05) or IFN.alpha. than healthy controls
(p<0.001).
FIG. 4 is a graph showing that D ODNs induce dendritic cell (DC)
maturation.
FIG. 5 is a set of graphs demonstrating that the response to K ODNs
is not significantly different in PBMC from HIV infected and
healthy subjects, indicating that B cells and monocytes retain
their ability to respond to CpG ODN. These data show that PBMC from
HIV infected subjects are activated by CpG ODN in vitro. The
responsiveness to CpG ODN, although reduced, is evident even among
patients with high viral loads and low CD4+ T cells. The reduction
in IFN.alpha. and IFN.gamma. secretion correlated directly with the
number of CD4+ T cells (p<0.01).
FIG. 6 is a set of graphs showing that, as observed with PBMC from
HIV infected patients, PBMC from SIV infected macaques showed a
response to CpG K ODN stimulation in vitro that was indistinct from
that of healthy macaques. Stimulation with CpG D ODNs, in turn,
generated significantly increased levels of IFN.alpha., although
the magnitude of the IFN.alpha. response was reduced when compared
with PBMC from healthy macaques.
FIG. 7 is a graph showing lesion size in SIV-infected rhesus
macaques challenged with L. Major. Fourteen rhesus macaques that
had been infected with XX SIV strain mac239 a year before the start
of the study (Viral load range: 0.3-28.times.10.sup.6 copies/ml)
were utilized. Monkeys were treated intradermally with D ODNs
(n=4), K ODNs (n=4), control ODNs (n=3) or saline 3 days before and
3 days after an intradermal challenge with 10.sup.7 viable
metacyclic promastigotes of L. major (WHOM/IR/-/173), a strain of
Leishmania that frequently infects HIV patients. Control monkeys
developed a typical self-limited in situ lesion characterized by
erythema, induration, and ulceration. The lesion size, which
reflects the severity of infection, was measured weekly. Monkeys
treated with D ODNs had significantly smaller lesions than control
or K ODN treated monkeys. The protection afforded to SIV infected
macaques was comparable to that obtained in healthy monkeys.
FIG. 8 is a graph showing the effect of D and K ODN as adjuvants to
the hepatitis B vaccine in rhesus macaques. Macaques (five/group)
were immunized with hepatitis B vaccine ENGERIX-B.TM. (10 .mu.g)
alone or together with D or K ODN (250 .mu.g/dose) on days 1, 30
and 60 of the study. Levels of IgG anti-hepatitis B surface antigen
(HbsAg) were monitored by ELISA every two weeks. Macaques that
received D or K ODN together with the vaccine developed
significantly higher antibody levels compared to those that
received the vaccine alone (p<0.01).
FIGS. 9A-B is a pair of graphs showing that D and K ODN boost the
immunogenicity of hepatitis B vaccine ENGERIX-B.TM. in SW-infected
rhesus macaques. SW infected macaques were immunized on days 1, 30
and 75 with hepatitis B vaccine ENGERIX-B.TM. alone (n=5) or
together with D or K ODN (n=6/group). Levels of IgG anti-HbsAg were
monitored as described in Example 8. FIG. 9A is a graph showing the
correlation of individual viral loads at the start of the study
with the antibody titers developed 45 days after the prime and 45
days after the last immunization. One macaque from the group that
received D ODN was euthanized during the study because of
intractable diarrhea and weight loss attributed to the SW
infection. FIG. 9B is a graph showing the anti-HbsAg antibody
levels by animals with viral loads <10.sup.7 copies/ml
(n=4/group). Animals that received the vaccine alone were unable to
mount an antibody response, while those that received K or D ODN
together with the HBV vaccine developed significant antibody
levels.
SEQUENCE LISTING
The nucleic acid sequences listed in the accompanying sequence
listing are shown using standard letter abbreviations for
nucleotide bases, as defined in 37 C.F.R. 1.822. In the
accompanying sequence listing: SEQ ID NOs: 1-16 are
immunostimulatory CpG oligonucleotide sequences. SEQ ID NOs: 17-18
are SIV primer sequences. SEQ ID NO: 19 is an SIV-specific probe.
SEQ ID NO: 20 is a K ODN that includes at least about 10
nucleotides described by Formula I. SEQ ID NO: 21 is a CpG motif in
D oligonucleotides described by Formula II. SEQ ID NO: 22 is an
immunostimulatory CpG oligonucleotide sequence. SEQ ID NOs: 23-98
are immunostimulatory CpG oligonucleotide sequences SEQ ID NOs:
99-175 are oligodeoxynucleotides that include a sequence
represented by Formula IV. SEQ ID NO: 176 is immunostimulatory CpG
oligonucleotide sequence D19. SEQ ID NO: 177 is immunostimulatory
CpG oligonucleotide sequence D35. SEQ ID NO: 178 is
immunostimulatory CpG oligonucleotide sequence D29. SEQ ID NO: 179
is immunostimulatory CpG oligonucleotide sequence K3. SEQ ID NO:
180 is immunostimulatory CpG oligonucleotide sequence K123. SEQ ID
NO: 181 is immunostimulatory CpG oligonucleotide sequence K23.
DETAILED DESCRIPTION
I. Abbreviations
A: adenine Ab: antibody AIDS: Acquired Immunodeficiency Syndrome
ANOVA: analysis of variance APC: antigen presenting cell AVT:
3'-azido-3'dexoy-thymidine BIV: bovine immunodeficiency virus BSA:
bovine serum albumin C: cytosine CAEV: caprine
arthritis-encephalitis virus CpG ODN: an oligodeoxynucleotide
(either a D or a K type) including a CpG motif CGD: chronic
granulomatous disease CMV: Cytomegalovirus CNS: central nervous
system DC: dendritic cell DNA: deoxyribonucleic acid EIAV: equine
infectious anemia virus ELISA: Enzyme-Linked Immunosorbent Assay
env: envelope EU: endotoxin units FAM: Carboxyfluorescein FCS:
fetal calf serum FDA: Food and Drug Administration FIV: feline
immunodeficiency virus G: guanine h: hour HAART: highly active
anti-retroviral therapy HbsAg: hepatitis B surface antigen HBV:
hepatitis B virus HEPES:
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV: human
immunodeficiency virus HIV-1: human immunodeficiency virus, type 1
HIV-2: human immunodeficiency virus, type 2 HPV: human papilloma
virus HSV: herpes simplex virus HZV: herpes zoster virus i.d.
intradermal IFN-.alpha.: interferon alpha IFN-.gamma.: interferon
gamma .mu.g: microgram mm: millimeter mRNA: messenger ribonucleic
acid. NA: nucleoside analog reverse transcriptase inhibitor NADPH:
nicotine amide dinucleotide phosphatase NHL: non-Hodgkin's lymphoma
NIH: National Institutes of Health NK: natural killer cells NNRTI:
non-nucleoside analog reverse transcriptase inhibitor ODN:
oligodeoxynucleotide OHL: oral hairy leukoplakia ORF: open reading
frame ORN: oligoribonucleotide PBMC: peripheral blood mononuclear
cells PBS: phosphate buffered saline PCP: Pneumocystis Carinii
pneumonia PCR: polymerase chain reaction pDC: plasmacytoid
dendritic cells PI: protease inhibitor PML: progressive multifocal
leukoencephalopathy pol: polymerase Pu: purine Py: pyrimidine RNA:
ribonucleic acid rtPCR: reverse transcriptase polymerase chain
reaction s.c.: subcutaneous SCID: severe combined immune deficiency
SIV: simian immunodeficiency virus SIVagm: simian immunodeficiency
virus, agm SIVcol: simian immunodeficiency virus, col SIVmnd:
simian immunodeficiency virus, rmnd SIVsyk: simian immunodeficiency
virus, syk T: thymine TB: tuberculosis TNF: tumor necrosis factor
U: uracil TAMRA: carboxytetramethyl rhodamine VL: viral load VMV:
Visna-Maedi virus
II. Terms
Unless otherwise noted, technical terms are used according to
conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
In order to facilitate review of the various embodiments of this
disclosure, the following explanations of specific terms are
provided:
AIDS: Acquired immunodeficiency syndrome (AIDS) is a disease
characterized by a progressive loss of function of the immune
system. As a result, those afflicted with the syndrome are
susceptible to a variety of opportunistic infections. The etiologic
agent of AIDS is a cytopathic retrovirus designated the human
immunodeficiency virus (HIV). One of the major targets of the HIV
in humans is T helper cells (CD4+ cells). The infection of T helper
cells by HIV results in a profound dysregulation of the immune
system that includes both depleted numbers and impaired function of
T lymphocytes. Although the exact mechanism is unknown, the number
of T helper cells predictably declines during HIV infection.
Clinicians monitor this decline as an indicator of disease
progression.
Animal: Living multi-cellular vertebrate organisms, a category that
includes, for example, mammals and birds. The term mammal includes
both human and non-human mammals. Similarly, the term "subject"
includes both human and veterinary subjects.
Anti-infectious agent: A substance (such as a chemical compound,
protein, antisense oligonucleotide, or other molecule) of use in
treating infection of a subject. Anti-infectious agents include,
but are not limited to, anti-fungals, anti-virals, and
antibiotics.
Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two
strands, a 5'.fwdarw.3' strand, referred to as the plus strand, and
a 3'.fwdarw.5' strand (the reverse compliment), referred to as the
minus strand. Because RNA polymerase adds nucleic acids in a
5'.fwdarw.3' direction, the minus strand of the DNA serves as the
template for the RNA during transcription. Thus, the RNA formed
will have a sequence complementary to the minus strand and
identical to the plus strand (except that U is substituted for
T).
Antisense molecules are molecules that are specifically
hybridizable or specifically complementary to either RNA or the
plus strand of DNA. Sense molecules are molecules that are
specifically hybridizable or specifically complementary to the
minus strand of DNA. Antigene molecules are either antisense or
sense molecules directed to a dsDNA target. In one embodiment, an
antisense molecule specifically hybridizes to a target mRNA and
inhibits transcription of the target mRNA.
CD4: Cluster of differentiation factor 4 polypeptide, a T-cell
surface protein that mediates interaction with the MHC class II
molecule. CD4 also serves as the primary receptor site for HIV on
T-cells during HIV infection.
The known sequence of the CD4 precursor has a hydrophobic signal
peptide, an extracellular region of approximately 370 amino acids,
a highly hydrophobic stretch with significant identity to the
membrane-spanning domain of the class II MHC beta chain, and a
highly charged intracellular sequence of 40 resides (Maddon, Cell
42:93, 1985).
CpG or CpG motif: A nucleic acid having a cytosine followed by a
guanine linked by a phosphate bond in which the pyrimidine ring of
the cytosine is unmethylated. The term "methylated CpG" refers to
the methylation of the cytosine on the pyrimidine ring, usually
occurring the 5-position of the pyrimidine ring. A CpG motif is a
pattern of bases that include an unmethylated central CpG
surrounded by at least one base flanking (on the 3' and the 5' side
of) the central CpG. Without being bound by theory, the bases
flanking the CpG confer part of the activity to the CpG
oligodeoxynucleotide. A CpG oligonucleotide is an oligonucleotide
that is at least about ten nucleotides in length and includes an
unmethylated CpG. CpG oligonucleotides include both D and K
oligodeoxynucleotides (see below). CpG oligodeoxynucleotides are
single-stranded. The entire CpG oligodeoxynucleotide can be
unmethylated or portions may be unmethylated. In one embodiment, at
least the C of the 5' CG 3' is unmethylated.
Cytokine: Proteins made by cells that affect the behavior of other
cells, such as lymphocytes. In one embodiment, a cytokine is a
chemokine, a molecule that affects cellular trafficking.
Epitope: An antigenic determinant. These are particular chemical
groups or peptide sequences on a molecule that are antigenic, for
example, that elicit a specific immune response. An antibody binds
a particular antigenic epitope. Particular HIV epitopes include,
but are not limited to Nef, gag-p24, reverse transcriptase, P17
gag.
Functionally Equivalent: Sequence alterations, for example in a D
ODN, that yield the same results as described herein. Such sequence
alterations can include, but are not limited to, deletions, base
modifications, mutations, labeling, and insertions.
Highly active anti-retroviral therapy (HAART): A combination of
drugs which, when administered in combination, inhibits a
retrovirus from replicating or infecting cells better than any of
the drugs individually. In one embodiment, the retrovirus is a
human immunodeficiency virus. In one embodiment, the highly active
anti-retroviral therapy includes the administration of
3'axido-3-deoxy-thymidine (AZT) in combination with other agents.
Examples of agents that can be used in combination in HAART for a
human immunodeficiency virus are nucleoside analog reverse
transcriptase inhibitor drugs (NA), non-nucleoside analog reverse
transcriptase inhibitor drugs (NNRTI), and protease inhibitor drugs
(PI). One specific, non-limiting example of HAART used to suppress
an HIV infection is a combination of indinavir and efavirenz, an
experimental non-nucleoside reverse transcriptase inhibitor
(NNRTI).
In one embodiment, HAART is a combination of three drugs used for
the treatment of an HIV infection, such as the drugs shown in Table
1 below. Examples of three drug HAART for the treatment of an HIV
infection include 1 protease inhibitor from column A plus 2
nucleoside analogs from column B in Table 1. In addition, ritonavir
and saquinavir can be used in combination with 1 or 2 nucleoside
analogs.
TABLE-US-00001 TABLE 1 Column A Column B indinavir (CRIXIVAN .TM.)
AZT/ddI nelfinavir (VIRACEPT .TM.) d4T/ddI ritonavir (VIRACEPT
.TM.) AZT/ddC saquinavir (FORTOVASE .TM.) AZT/3TC
ritonavir/saquinavir d4T/3TC
In addition, other 3- and 4-drug combinations can reduce HIV to
very low levels for sustained periods. The combination therapies
are not limited to the above examples, but include any effective
combination of agents for the treatment of HIV disease (including
treatment of AIDS).
HIV: (human immunodeficiency virus) is a retrovirus that causes
immunosuppression in humans (HIV disease), and leads to a disease
complex known as acquired immunodeficiency syndrome (AIDS). "HIV
disease" refers to a well-recognized constellation of signs and
symptoms (including the development of opportunistic infections) in
persons who are infected by an HIV virus, as determined by antibody
or western blot studies. Laboratory findings associated with this
disease are a progressive decline in T-helper cells.
Immune response: A response of a cell of the immune system, such as
a B cell or a T cell to a stimulus. In one embodiment, the response
is specific for a particular antigen (an "antigen-specific
response").
Immune system deficiency: A disease or disorder in which the
subject's immune system is not functioning in normal capacity or in
which it would be useful to boost a subject's immune response. In
one specific, non-limiting example, a subject with an immune system
deficiency has a tumor or cancer (for example, tumors of the brain,
lung (for example, small cell and non-small cell), ovary, breast,
prostate, colon, or another carcinoma or sarcoma).
Immunocompromised: An immunocompromised subject is a subject who is
incapable of developing or unlikely to develop a robust immune
response, usually as a result of disease, malnutrition, or
immunosuppressive therapy. An immunocompromised immune system is an
immune system that is functioning below normal. Immunocompromised
subjects are more susceptible to opportunistic infections, for
example viral, fungal, protozoan, or bacterial infections, prion
diseases, and certain neoplasms. Those who can be considered to be
immunocompromised include, but are not limited to, subjects with
AIDS (or HIV positive), subjects with severe combined immune
deficiency (SCID), diabetics, subjects who have had transplants and
who are taking immunosuppressives, and those who are receiving
chemotherapy for cancer. Immunocompromised individuals also
includes subjects with most forms of cancer (other than skin
cancer), sickle cell anemia, cystic fibrosis, those who do not have
a spleen, subjects with end stage kidney disease (dialysis), and
those who have been taking corticosteroids on a frequent basis by
pill or injection within the last year. Subjects with severe liver,
lung, or heart disease also may be immunocompromised.
Infectious agent: An agent that can infect a subject, including,
but not limited to, viruses, bacteria, and fungi. In one
embodiment, an infectious agent is opportunistic.
Examples of infectious viruses include: Retroviridae (for example,
human immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III) and other isolates, such
as HIV-LP; Picornaviridae (for example, polio viruses, hepatitis A
virus; enteroviruses, human coxsackie viruses, rhinoviruses,
echoviruses); Caliciviridae (such as strains that cause
gastroenteritis); Togaviridae (for example, equine encephalitis
viruses, rubella viruses); Flaviridae (for example, dengue viruses,
encephalitis viruses, yellow fever viruses); Coronaviridae (for
example, coronaviruses); Rhabdoviridae (for example, vesicular
stomatitis viruses, rabies viruses); Filoviridae (for example,
chola Ebola viruses); Paramyxoviridae (for example, parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (for example, influenza viruses); Bunyaviridae
(for example, Hantaan viruses, bunyaviruses, phleboviruses and
Nairo viruses); Arenaviridae (hemorrhagic fever viruses);
Reoviridae (for example, reoviruses, orbiviurses and rotaviruses);
Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae
(parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses);
Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex
virus (HSV)-1 and HSV-2, varicella zoster virus, cytomegalovirus
(CMV), herpes viruses); Poxyiridae (variola viruses, vaccinia
viruses, pox viruses); and Iridoviridae (such as African swine
fever virus); and unclassified viruses (for example, the
etiological agents of Spongiform encephalopathies, the agent of
delta hepatitis (thought to be a defective satellite of hepatitis B
virus), the agents of non-A, non-B hepatitis (class 1=internally
transmitted; class 2=parenterally transmitted (for example,
Hepatitis C); Norwalk and related viruses, and astroviruses).
Examples of infectious bacteria include: Helicobacter pylori,
Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps
(such as. M. tuberculosis, M. avium, M. intracellulare, M. kansaii,
M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae,
Neisseria meningitidis, Listeria monocytogenes, Streptococcus
pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B
Streptococcus), Streptococcus (viridans group), Streptococcus
faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.),
Streptococcus pneumoniae, pathogenic Campylobacter sp.,
Enterococcus sp., Haemophilus influenzae, Bacillus anthracis,
corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix
rhusiopathiae, Clostridium perfringers, Clostridium tetani,
Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella
multocida, Bacteroides sp., Fusobacterium nucleatum,
Streptobacillus moniliformis, Treponema pallidium, Treponema
pertenue, Leptospira, and Actinomyces israelli.
Examples of infectious fungi include, but are not limited to,
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and
Candida albicans.
Other infectious organisms (such as protists) include: Plasmodium
falciparum and Toxoplasma gondii.
Isolated: An "isolated" biological component (such as a nucleic
acid, peptide or protein) has been substantially separated,
produced apart from, or purified away from other biological
components in the cell of the organism in which the component
naturally occurs, for example, other chromosomal and
extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides
and proteins which have been "isolated" thus include nucleic acids
and proteins purified by standard purification methods. The term
also embraces nucleic acids, peptides and proteins prepared by
recombinant expression in a host cell as well as chemically
synthesized nucleic acids.
Lentivirus: A genus of the family Retroviridae consisting of
non-oncogenic retroviruses that produce multi-organ diseases
characterized by long incubation periods and persistent infection.
Lentiviruses are unique in that they contain open reading frames
(ORFs) between the polymerase (pol) and envelope (env) genes and in
the 3' env region. Five serogroups are recognized, reflecting the
mammalian hosts with which they are associated. Lentiviruses
include, but are not limited to human immunodeficiency virus, type
1 (HIV-1), human immunodeficiency virus, type 2 (HIV-2), simian
immunodeficiency virus, agm (SIVagm), simian immunodeficiency
virus, mnd (SIVmnd), simian immunodeficiency virus, syk (SIVsyk),
simian immunodeficiency virus, col (SIVcol), Visna-Maedi virus
(VMV), bovine immunodeficiency virus (BIV), feline immunodeficiency
virus (Hy), caprine arthritis-encephalitis virus (CAEV), and equine
infectious anemia virus (EIAV).
Leukocyte: Cells in the blood, also termed "white cells," that are
involved in defending the body against infective organisms and
foreign substances. Leukocytes are produced in the bone marrow.
There are 5 main types of white blood cell, subdivided between 2
main groups: polymorphonuclear leukocytes (neutrophils,
eosinophils, basophils) and mononuclear leukocytes (monocytes and
lymphocytes). When an infection is present, the production of
leukocytes increases.
Mammal: This term includes both human and non-human mammals.
Similarly, the term "subject" includes both human and veterinary
subjects.
Maturation: The process in which an immature cell, such as
dendritic cell, changes in form or function to become a functional
mature cell, such as an APC.
Nucleic acid: A deoxyribonucleotide or ribonucleotide polymer in
either single or double stranded form, and unless otherwise
limited, encompasses known analogues of natural nucleotides that
hybridize to nucleic acids in a manner similar to naturally
occurring nucleotides.
Oligonucleotide or "oligo": Multiple nucleotides (for example,
molecules comprising a sugar (for example, ribose or deoxyribose)
linked to a phosphate group and to an exchangeable organic base,
which is either a substituted pyrimidine (Py) (for example,
cytosine (C), thymine (T) or uracil (U)) or a substituted purine
(Pu) (for example, adenine (A) or guanine (G)). The term
"oligonucleotide" as used herein refers to both
oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs).
The term "oligonucleotide" also includes oligonucleosides (for
example, an oligonucleotide minus the phosphate) and any other
organic base polymer. Oligonucleotides can be obtained from
existing nucleic acid sources (for example, genomic or cDNA), but
are preferably synthetic (for example, produced by oligonucleotide
synthesis).
A "stabilized oligonucleotide" is an oligonucleotide that is
relatively resistant to in vivo degradation (for example via an
exo- or endo-nuclease). In one embodiment, a stabilized
oligonucleotide has a modified phosphate backbone. One specific,
non-limiting example of a stabilized oligonucleotide has a
phosphorothioate modified phosphate backbone (wherein at least one
of the phosphate oxygens is replaced by sulfur). Other stabilized
oligonucleotides include: nonionic DNA analogs, such as alkyl- and
aryl-phosphonates (in which the charged phosphonate oxygen is
replaced by an alkyl or aryl group), and phosphodiester and
alkylphosphotriesters, in which the charged oxygen moiety is
alkylated. Oligonucleotides that contain a diol, such as
tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
An "immunostimulatory oligonucleotide," "immunostimulatory CpG
containing oligodeoxynucleotide," "CpG ODN," refers to an
oligodeoxynucleotide, which contains a cytosine, guanine
dinucleotide sequence and stimulates (for example, has a mitogenic
effect) vertebrate immune cells. The cytosine, guanine is
unmethylated.
An "oligonucleotide delivery complex" is an oligonucleotide
associated with (for example, ionically or covalently bound to; or
encapsulated within) a targeting means (for example, a molecule
that results in a higher affinity binding to a target cell (for
example, a B-cell or natural killer (NK) cell) surface and/or
increased cellular uptake by target cells). Examples of
oligonucleotide delivery complexes include oligonucleotides
associated with: a sterol (for example, cholesterol), a lipid (for
example, a cationic lipid, virosome or liposome), or a target cell
specific binding agent (for example, a ligand recognized by a
target cell specific receptor). Preferred complexes must be
sufficiently stable in vivo to prevent significant uncoupling prior
to internalization by the target cell. However, the complex should
be cleavable or otherwise accessible under appropriate conditions
within the cell so that the oligonucleotide is functional. (Gursel,
J. Immunol. 167: 3324, 2001)
Opportunistic infection: An infection that occurs in an
immunocompromised subject. Opportunistic infections may result from
treatments or from alterations in the immune system. The infectious
agent can be viral, bacterial, protozoan, or fungal. Opportunistic
infections can include, but are not limited to bacterial infections
such as salmonellosis, syphilis and neurosyphilis, tuberculosis
(TB), atypical mycobacterial infection, and bacillary angiomatosis
(cat scratch disease), fungal infections such as aspergillosis,
candidiasis (thrush, yeast infection), coccidioidomycosis,
cryptococcal meningitis, and histoplasmosis, protozoal infections
such as cryptosporidiosis, isosporiasis, microsporidiosis,
Pneumocystis Carinii pneumonia (PCP), and toxoplasmosis, viral
infections such as Cytomegalovirus (CMV), hepatitis, herpes simplex
(HSV, genital herpes), herpes zoster (HZV, shingles), human
papilloma virus (HPV, genital warts, cervical cancer), Molluscum
Contagiosum, oral hairy leukoplakia (OHL), and progressive
multifocal leukoencephalopathy (PML), and neoplasms such as
Kaposi's sarcoma, systemic non-Hodgkin's lymphoma (NHL), and
primary CNS lymphoma, among others.
Pharmaceutical agent or drug: A chemical compound or composition
capable of inducing a desired therapeutic or prophylactic effect
when properly administered to a subject. Pharmaceutical agents
include, but are not limited to, chemotherapeutic agents and
anti-infective agents.
Pharmaceutically acceptable carriers: The pharmaceutically
acceptable carriers useful in this disclosure are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack
Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of the fusion proteins herein disclosed.
In general, the nature of the carrier will depend on the particular
mode of administration being employed. For instance, parenteral
formulations usually comprise injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(for example, powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
Purified: The term purified does not require absolute purity;
rather, it is intended as a relative term. Thus, for example, a
purified nucleotide preparation is one in which the nucleotide is
more enriched than the nucleotide is in its natural environment
within a cell. Preferably, a preparation is purified such that the
nucleotide represents at least 50% of the total peptide or protein
content of the preparation.
Retroviruses: RNA viruses wherein the viral genome is RNA. When a
host cell is infected with a retrovirus, the genomic RNA is reverse
transcribed into a DNA intermediate which is integrated very
efficiently into the chromosomal DNA of infected cells. The
integrated DNA intermediate is referred to as a provirus. The term
"lentivirus" is used in its conventional sense to describe a genus
of viruses containing reverse transcriptase. The lentiviruses
include the "immunodeficiency viruses" which include human
immunodeficiency virus (HIV) type 1 and type 2 (HIV-1 and HIV-2),
simian immunodeficiency virus (SIV), and feline immunodeficiency
virus (FIV).
Self-complementary nucleic acid sequence: A nucleic acid sequence
that can form Watson-Crick base pairs. The four bases
characteristic of deoxyribonucleic unit of DNA are the purines
(adenine and guanine) and the pyrimidines (cytosine and thymine).
Adenine pairs with thymine via two hydrogen bonds, while guanine
pairs with cytosine via three hydrogen bonds. If a nucleic acid
sequence includes two or more bases in sequence that can form
hydrogen bonds with two or more other bases in the same nucleic
acid sequence, then the nucleic acid includes a self-complementary
sequence.
Treatment: Refers to both prophylactic inhibition of initial
infection, and therapeutic interventions to alter the natural
course of an untreated disease process, such as infection with a
virus (for example, HIV infection). "Preventing" a disease refers
to inhibiting the full development of a disease, for example in a
person who is known to have a predisposition to a disease such a
person infected with HIV who does not exhibit the symptoms of AIDS.
"Treatment" refers to a therapeutic intervention that ameliorates a
sign or symptom of a disease or pathological condition, such as
AIDS, after it has begun to develop.
Therapeutically effective dose: A dose sufficient to prevent
advancement, or to cause regression of the disease, or which is
capable of relieving symptoms caused by the disease, such as pain
or swelling.
Vaccine: A preparation of attenuated microorganisms (including but
not limited to bacteria and viruses), living microorganisms,
antigen, or killed microorganisms, administered for the prevention,
amelioration, or treatment of infectious disease.
Virus: A microscopic infectious organism that reproduces inside
living cells. A virus consists essentially of a core of a single
nucleic acid surrounded by a protein coat, and has the ability to
replicate only inside a living cell. "Viral replication" is the
production of additional virus by the occurrence of at least one
viral life cycle. A virus may subvert the host cells' normal
functions, causing the cell to behave in a manner determined by the
virus. For example, a viral infection may result in a cell
producing a cytokine, or responding to a cytokine, when the
uninfected cell does not normally do so.
Unless otherwise explained, all technical and scientific terms used
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs. The
singular terms "a," "an," and "the" include plural referents unless
context clearly indicates otherwise. Similarly, the word "or" is
intended to include "and" unless the context clearly indicates
otherwise. It is further to be understood that all base sizes or
amino acid sizes, and all molecular weight or molecular mass
values, given for nucleic acids or polypeptides are approximate,
and are provided for description. Although methods and materials
similar or equivalent to those described herein can be used in the
practice or testing of this disclosure, suitable methods and
materials are described below. The term "comprises" means
"includes." All publications, patent applications, patents, and
other references mentioned herein are incorporated by reference in
their entirety. In case of conflict, the present specification,
including explanations of terms, will control. In addition, the
materials, methods, and examples are illustrative only and not
intended to be limiting.
III. Description of Several Embodiments
A. D and K-type ODNs
The present disclosure relates to a class of DNA motifs that
stimulates immune activation, for example the innate immune
response or the adaptive immune response by B cells, monocytes,
dendritic cells, and natural killer (NK) cells. K type CpG ODNs
have been previously described (see U.S. Pat. Nos. 6,194,388;
6,207,646; 6,214,806; 6,218,371; 6239,116, 6,339,068; 6,406,705,
and 6,429,199, which are herein incorporated by reference). K ODNs
that exhibit the greatest immunostimulatory activity share specific
characteristics. These characteristics differ from those of the
Formula II or D ODN (see below). In addition, K ODNs have specific
effects on the cells of the immune system, which differ from the
effects of D ODN. For example, K ODNs stimulate proliferation of B
cells and stimulate the production of IL-6.
The K ODNs include at least about 10 nucleotides and include a
sequence represented by Formula I:
5'N.sub.1N.sub.2N.sub.3T-CpG-WN.sub.4N.sub.5N.sub.63' (SEQ ID NO:
20) wherein the central CpG motif is unmethylated, W is A or T, and
N.sub.1, N.sub.2, N.sub.3, N.sub.4, N.sub.5, and N.sub.6 are any
nucleotides.
These Formula I or K ODNs stimulate B cell proliferation and the
secretion of IgM and IL-6, processes involved in the body's humoral
immunity, such as the production of antibodies against foreign
antigens. In one embodiment, the K ODNs induce a humoral immune
response.
Certain K oligonucleotides are of the formula:
5'N.sub.1N.sub.2N.sub.3T-CpG-WN.sub.4N.sub.5N.sub.6 3' (SEQ ID NO:
20) and contain a phosphate backbone modification. In one specific,
non-limiting example, the phosphate backbone modification is a
phosphorothioate backbone modification (for example, one of the
non-bridging oxygens is replaced with sulfur, as set forth in
International Patent Application WO 95/26204, herein incorporated
by reference). In one embodiment, K ODNs have a backbone, and at
least one unmethylated CpG dinucleotide. Eliminating the CpG
dinucleotide motif from the K ODN significantly reduces immune
activation. Incorporating multiple CpGs in a single K ODN increases
immune stimulation. In some embodiments, the K ODNs are at least 12
bases long. In addition, K ODNs containing CpG motifs at the 5' end
are the most stimulatory, although at least one base upstream of
the CpG is required. More particularly, the most active K ODNs
contain a thymidine immediately 5' from the CpG dinucleotide, and a
TpT or a TpA in a position 3' from the CpG motif. Modifications
which are greater than 2 base pairs from the CpG dinucleotide motif
appear to have little effect on K ODN activity.
D ODNs differ both in structure and activity from K ODNs. The
unique activities of D ODNs are disclosed below (see section C).
For example, as disclosed herein, D oligodeoxynucleotides stimulate
the release of cytokines from cells of the immune system. In
specific, non-limiting examples D oligonucleotides stimulate the
release or production of IP-10 and IFN-.alpha. by monocytes and/or
plasmacytoid dendritic cells and the release or production of
IFN-.gamma. by NK cells. The stimulation of NK cells by D
oligodeoxynucleotides can be either direct or indirect.
With regard to structure, a CpG motif in D oligonucleotides can be
described by Formula II: 5'RY-CpG-RY 3' (SEQ ID NO: 21) wherein the
central CpG motif is unmethylated, R is A or G (a purine), and Y is
C or T (a pyrimidine). D oligonucleotides include an unmethylated
CpG dinucleotide. Inversion, replacement, or methylation of the CpG
reduces or abrogates the activity of the D oligonucleotide.
Certain D ODNs are at least about 16 nucleotides in length and
includes a sequence represented by Formula III:
5'X.sub.1X.sub.2X.sub.3Pu.sub.1Py.sub.2CpG
Pu.sub.3Py.sub.3X.sub.4X.sub.5X.sub.6(W).sub.M(G).sub.N-3' (SEQ ID
NO: 22 wherein the central CpG motif is unmethylated, Pu is a
purine nucleotide, Py is a pyrimidine nucleotide, X and W are any
nucleotide, M is any integer from 0 to 10, and N is any integer
from 4 to 10.
The region Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 is termed the
CpG motif. The region X.sub.1X.sub.2X.sub.3 is termed the 5'
flanking region, and the region X.sub.4X.sub.5X.sub.6 is termed the
3' flanking region. If nucleotides are included 5' of
X.sub.1X.sub.2X.sub.3 in the D ODN, these nucleotides are termed
the 5' far flanking region. Nucleotides 3' of X.sub.4X.sub.5X.sub.6
in the D ODN are termed the 3' far flanking region.
In one specific non-limiting example, Py.sub.2 is a cytosine. In
another specific, non-limiting example, Pu.sub.3 is a guanidine. In
yet another specific, non-limiting example, Py.sub.2 is a thymidine
and Pu.sub.3 is an adenine. In a further specific, non-limiting
example, Pu.sub.1 is an adenine and Py.sub.2 is a tyrosine. In
another specific, non-limiting example, Pu.sub.3 is an adenine and
Py.sub.4 is a tyrosine.
In one specific not limiting example, N is from about 4 to about 8.
In another specific, non-limiting example, N is about 6.
D CpG oligonucleotides can include modified nucleotides. Without
being bound by theory, modified nucleotides can be included to
increase the stability of a D oligonucleotide. Without being bound
by theory, because phosphorothioate-modified nucleotides confer
resistance to exonuclease digestion, the D ODN are "stabilized" by
incorporating phosphorothioate-modified nucleotides. In one
embodiment, the CpG dinucleotide motif and its immediate flanking
regions include phosphodiester rather than phosphorothioate
nucleotides. In one specific non-limiting example, the sequence
Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 includes phosphodiester
bases. In another specific, non-limiting example, all of the bases
in the sequence Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 are
phosphodiester bases. In yet another specific, non-limiting
example, X.sub.1X.sub.2X.sub.3 and X.sub.4X.sub.5X.sub.6(W).sub.m
(G).sub.N include phosphodiester bases. In yet another specific,
non-limiting example, X.sub.1X.sub.2X.sub.3 Pu.sub.1 Py.sub.2 CpG
Pu.sub.3 Py.sub.4 X.sub.4X.sub.5X.sub.6(W).sub.M (G).sub.N include
phosphodiester bases. In further non-limiting examples the sequence
X.sub.1X.sub.2X.sub.3 includes at most one or at most two
phosphorothioate bases and/or the sequence X.sub.4X.sub.5X.sub.6
includes at most one or at most two phosphorothioate bases. In
additional non-limiting examples, X.sub.4X.sub.5X.sub.6(W)M (G)N
includes at least 1, at least 2, at least 3, at least 4, or at
least 5 phosphorothioate bases. Thus, a D oligodeoxynucleotide can
be a phosphorothioate/phosphodiester chimera.
As disclosed herein, any suitable modification can be used in the
present disclosure to render the D oligodeoxynucleotide resistant
to degradation in vivo (for example, via an exo- or endo-nuclease).
In one specific, non-limiting example, a modification that renders
the oligodeoxynucleotide less susceptible to degradation is the
inclusion of nontraditional bases such as inosine and quesine, as
well as acetyl-, thio- and similarly modified forms of adenine,
cytidine, guanine, thymine, and uridine. Other modified nucleotides
include nonionic DNA analogs, such as alkyl or aryl phosphonates
(for example, the charged phosphonate oxygen is replaced with an
alkyl or aryl group, as set forth in U.S. Pat. No. 4,469,863),
phosphodiesters and alkylphosphotriesters (for example, the charged
oxygen moiety is alkylated, as set forth in U.S. Pat. No. 5,023,243
and European Patent No. 0 092 574). Oligonucleotides containing a
diol, such as tetraethyleneglycol or hexaethyleneglycol, at either
or both termini, have also been shown to be more resistant to
degradation. The D oligodeoxynucleotides can also be modified to
contain a secondary structure (for example, stem loop structure).
Without being bound by theory, it is believed that incorporation of
a stem loop structure renders and oligodeoxynucleotide more
effective.
In a further embodiment, Pu.sub.1 Py.sub.2 and Pu.sub.3 Py.sub.4
are self-complementary. In another embodiment,
X.sub.1X.sub.2X.sub.3 and X.sub.4X.sub.5X.sub.6 are self
complementary. In yet another embodiment X.sub.1X.sub.2X.sub.3
Pu.sub.1 Py.sub.2 and PU.sub.3 Py.sub.4 X.sub.4X.sub.5X.sub.6 are
self complementary.
Specific non-limiting examples of a D oligonucleotide wherein
Pu.sub.1 Py.sub.2 and Pu.sub.3 Py.sub.4 are self-complementary
include, but are not limited to, ATCGAT (SEQ ID NO: 9), ACCGGT (SEQ
ID NO: 10), ATCGAC (SEQ ID NO: 11), ACCGAT (SEQ ID NO: 12), GTCGAC
(SEQ ID NO: 13), or GCCGGC (SEQ ID NO: 14). Without being bound by
theory, the self-complementary base sequences can help to form a
stem-loop structure with the CpG dinucleotide at the apex to
facilitate immunostimulatory functions. Thus, in one specific,
non-limiting example, D oligonucleotides wherein Pu.sub.1 Py.sub.2
and Pu.sub.3 Py.sub.4 are self-complementary induce higher levels
of IFN-.gamma. production from a cell of the immune system (see
below). The self-complementary need not be limited to Pu.sub.1
Py.sub.2 and Pu.sub.3 Py.sub.4. Thus, in another embodiment,
additional bases on each side of the three bases on each side of
the CpG-containing hexamer form a self-complementary sequence (see
above).
One specific, non-limiting example of a sequence wherein Pu.sub.1
Py.sub.2 and Pu.sub.3 Py.sub.4 are self-complementary, but wherein
the far-flanking sequences are not self-complementary is:
GGTGCATCGATACAGGGGGG (ODN D 113, SEQ ID NO:15). This
oligodeoxynucleotide has a far flanking region that is not self
complementary and induces high levels of IFN-.gamma. and
IFN-.alpha..
Another specific, non-limiting example of a D oligodeoxynucleotides
is: GGTGCGTCGATGCAGGGGGG (D28, SEQ ID NO: 16). This
oligodeoxynucleotide is of use for inducing production and/or
release of cytokines from immune cells, although it lacks a
self-complementary motif.
In one embodiment, the D oligodeoxynucleotides disclosed herein are
at least about 16 nucleotides in length. In a second embodiment, a
D oligodeoxynucleotide is at least about 18 nucleotides in length.
In another embodiment, a D oligodeoxynucleotide is from about 16
nucleotides in length to about 100 nucleotides in length. In yet
another embodiment, a D oligodeoxynucleotide is from about 16
nucleotides in length to about 50 nucleotides in length. In a
further embodiment, a D oligodeoxynucleotide is from about 18
nucleotides in length to about 30 nucleotides in length.
In another embodiment, the oligodeoxynucleotide is at least 18
nucleotides in length, and at least two Gs are included at the 5'
end of the molecule, such that the oligodeoxynucleotide includes a
sequence represented by Formula IV:
5'GGX.sub.1X.sub.2X.sub.3Pu.sub.1Py.sub.2CpG
Pu.sub.3Py.sub.4X.sub.4X.sub.5X.sub.6(W).sub.M(G).sub.N-3' (SEQ ID
NOs: 99-175).
The D oligodeoxynucleotide can include additional Gs at the 5' end
of the oligodeoxynucleotide. In one specific example, about 1 or
about 2 Gs are included at the 5' end of an oligodeoxynucleotide
including a sequence as set forth as Formula IV.
Examples of a D oligodeoxynucleotide include, but are not limited
to:
TABLE-US-00002 5'XXTGCATCGATGCAGGGGGG3' (SEQ ID NO: 1)
5'XXTGCACCGGTGCAGGGGGG3', (SEQ ID NO: 2) 5'XXTGCGTCGACGCAGGGGGG3',
(SEQ ID NO: 3) 5'XXTGCGTCGATGCAGGGGGG3', (SEQ ID NO: 4)
5'XXTGCGCCGGCGCAGGGGGG3', (SEQ ID NO: 5) 5'XXTGCGCCGATGCAGGGGGG3',
(SEQ TD NO: 6) 5'XXTGCATCGACGCAGGGGGG3', (SEQ ID NO: 7)
5'XXTGCGTCGGTGCAGGGGGG3', (SEQ ID NO: 8)
wherein X any base, or is no base at all. In one specific,
non-limiting example, X is a G. In particular, non-limiting
examples, the oligodeoxynucleotide includes a sequence selected
from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:
3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16.
The oligodeoxynucleotides disclosed herein can be synthesized de
novo using any of a number of procedures well known in the art. For
example, the oligodeoxynucleotides can be synthesized as set forth
in U.S. Pat. No. 6,194,388, which is herein incorporated by
reference in its entirety. A D oligodeoxynucleotide may be
synthesized using, for example, the B-cyanoethyl phosphoramidite
method or nucleoside H-phosphonate method. These chemistries can be
performed by a variety of automated oligonucleotide synthesizers
available in the market. Alternatively, oligodeoxynucleotides can
be prepared from existing nucleic acid sequences (for example,
genomic or cDNA) using known techniques, such as employing
restriction enzymes, exonucleases or endonucleases, although this
method is less efficient than direct synthesis.
B. Pharmaceutical Compositions
The immunostimulatory ODNs described herein may be formulated in a
variety of ways depending on the type of disease to be treated.
Pharmaceutical compositions are thus provided for both local use as
well as for systemic use. Therefore, the disclosure includes within
its scope pharmaceutical compositions comprising at least one
immunostimulatory ODN formulated for use in human or veterinary
medicine.
Pharmaceutical compositions that include at least one
immunostimulatory ODN as described herein as an active ingredient,
or that include both an immunostimulatory ODN and an additional
anti-viral, immunomodulatory, or anti-infective agent as active
ingredients, may be formulated with an appropriate solid or liquid
carrier, depending upon the particular mode of administration
chosen. Additional active ingredients include, for example,
antivirals such as AL-721 (from Ethigen of Los Angeles, Calif.),
recombinant human interferon beta (from Triton Biosciences of
Alameda, Calif.), Acemannan (from Carrington Labs of Irving, Tex.),
ganciclovir (from Syntex of Palo Alto, Calif.),
didehydrodeoxythymidine or d4T (from Bristol-Myers-Squibb), EL10
(from Elan Corp, of Gainesville, Ga.), dideoxycytidine or ddC (from
Hoffman-LaRoche), Novapren (from Novaferon Labs, Inc, of Akron,
Ohio), zidovudine or AZT (from Burroughs Wellcome), ribavirin (from
Viratek of Costa Mesa, Calif.), alpha interferon and acyclovir
(from Burroughs Wellcome), Indinavir (from Merck & Co.), 3TC
(from Glaxo Wellcome), Ritonavir (from Abbott), Saquinavir (from
Hoffmann-LaRoche), and others, immuno-modulators such as AS-101
(Wyeth-Ayerst Labs.), bropirimine (Upjohn), gamma interferon
(Genentech), GM-CSF (Genetics Institute), IL-2 (Cetus or
Hoffman-LaRoche), human immune globulin (Cutter Biological),
IMREG.TM. (from Imreg of New Orleans, La.), SK&F106528, TNF
(Genentech), and soluble TNF receptors (Immunex), anti-infectives
such as clindamycin with primaquine (from Upjohn, for the treatment
of pneumocystis pneumonia), fluconazlone (from Pfizer for the
treatment of cryptococcal meningitis or candidiasis), nystatin,
pentamidine, trimethaprim-sulfamethoxazole, and many others, and
agents used in HAART therapy, such as nucleoside analog reverse
transcriptase inhibitor drugs (NA), non-nucleoside analog reverse
transcriptase inhibitor drugs (NNRTI), protease inhibitor drugs
(PI).
The pharmaceutically acceptable carriers and excipients useful in
this disclosure are conventional. For instance, parenteral
formulations usually comprise injectable fluids that are
pharmaceutically and physiologically acceptable fluid vehicles such
as water, physiological saline, other balanced salt solutions,
aqueous dextrose, glycerol or the like. Excipients that can be
included are, for instance, proteins, such as human serum albumin
or plasma preparations. If desired, the pharmaceutical composition
to be administered may also contain minor amounts of non-toxic
auxiliary substances, such as wetting or emulsifying agents,
preservatives, and pH buffering agents and the like, for example
sodium acetate or sorbitan monolaurate.
The dosage form of the pharmaceutical composition will be
determined by the mode of administration chosen. For instance, in
addition to injectable fluids, topical and oral formulations can be
employed. Topical preparations can include eye drops, ointments,
sprays and the like. Oral formulations may be liquid (for example,
syrups, solutions, or suspensions), or solid (for example, powders,
pills, tablets, or capsules). For solid compositions, conventional
non-toxic solid carriers can include pharmaceutical grades of
mannitol, lactose, starch, or magnesium stearate. Actual methods of
preparing such dosage forms are known, or will be apparent, to
those of ordinary skill in the art.
The pharmaceutical compositions that comprise an immunostimulatory
ODN, in some embodiments, will be formulated in unit dosage form,
suitable for individual administration of precise dosages. The
amount of active compound(s) administered will be dependent on the
subject being treated, the severity of the affliction, and the
manner of administration, and is best left to the judgment of the
prescribing clinician. Within these bounds, the formulation to be
administered will contain a quantity of the active component(s) in
amounts effective to achieve the desired effect in the subject
being treated.
C. Therapeutic Uses
A method is disclosed herein for increasing an immune response to
an opportunistic infection in an immunocompromised subject.
Immunocompromised subjects are more susceptible to opportunistic
infections, for example viral, fungal, protozoan, or bacterial
infections, prion diseases, and certain neoplasms. Those who can be
considered to be immunocompromised include, but are not limited to,
subjects with AIDS (or HIV positive), subjects with severe combined
immune deficiency (SCID), diabetics, subjects who have had
transplants and who are taking immunosuppressives, and those who
are receiving chemotherapy for cancer. Immunocompromised
individuals also includes subjects with most forms of cancer (other
than skin cancer), sickle cell anemia, cystic fibrosis, those who
do not have a spleen, subjects with end stage kidney disease
(dialysis), and those who have been taking corticosteroids on a
frequent basis by pill or injection within the last year. Subjects
with severe liver, lung, or heart disease also may be
immunocompromised. The subject can be a human or a non-human
mammal, such as a primate.
In some embodiments, the immunocompromised subject is infected with
a lentivirus. Lentiviruses include, but are not limited to human
immunodeficiency virus type 1 (HIV-1), human immunodeficiency virus
type 2 (HIV-2), simian immunodeficiency virus agm (SIVagm), simian
immunodeficiency virus mnd (SIVmnd), simian immunodeficiency virus
syk (SIVsyk), simian immunodeficiency virus col (SIVcol),
Visna-Maedi virus (VMV), bovine immunodeficiency virus (BIV),
feline immunodeficiency virus (FIV), caprine arthritis-encephalitis
virus (CAEV), and equine infectious anemia virus (EIAV). In some
embodiments, the lentivirus is human immunodeficiency virus type 1
(HIV-1). In some embodiments, the lentivirus is human
immunodeficiency virus type 2 (HIV-2).
In some embodiments, the opportunistic infection is infection with
Leishmania major. In other embodiments, the opportunistic infection
is a bacterial infection such as salmonellosis, syphilis and
neurosyphilis, tuberculosis (TB), atypical mycobacterial infection,
and bacillary angiomatosis (cat scratch disease), a fungal
infection such as aspergillosis, candidiasis (thrush, yeast
infection), coccidioidomycosis, cryptococcal meningitis, and
histoplasmosis, protozoal infections such as cryptosporidiosis,
isosporiasis, microsporidiosis, Pneumocystis Carinii pneumonia
(PCP), and toxoplasmosis, or a viral infection such as
Cytomegalovirus (CMV), hepatitis, herpes simplex (HSV, genital
herpes), herpes zoster (HZV, shingles), human papilloma virus (HPV,
genital warts, cervical cancer), Molluscum Contagiosum, oral hairy
leukoplakia (OHL), and progressive multifocal leukoencephalopathy
(PML), and neoplasms, such as Kaposi's sarcoma, systemic
non-Hodgkin's lymphoma (NHL), and primary CNS lymphoma, among
others.
In order to increase an immune response to an opportunistic
infection in a subject infected with a lentivirus, a
therapeutically effective amount of a D or K ODN (see above) is
administered to the subject. In some embodiments, the
oligodeoxynucleotide is a D oligodeoxynucleotide, and in some
examples, the oligodeoxynucleotide is at least about 16 nucleotides
in length and comprises a sequence represented by the following
formula: 5'X.sub.1X.sub.2X.sub.3Pu.sub.1Py.sub.2CpG
Pu.sub.3Py.sub.4X.sub.4X.sub.5X.sub.6(W).sub.M(G).sub.N-3' (SEQ ID
NO: 22)
wherein the central CpG motif is unmethylated, Pu is a purine
nucleotide, Py is a pyrimidine nucleotide, X and W are any
nucleotide, M is any integer from 0 to 10, and N is any integer
from 4 to 10. In particular examples of certain embodiments, N is
about 6. In other examples, Pu Py CpG Pu Py includes phosphodiester
bases, and in particular examples, Pu.sub.1 Py.sub.2 CpG Pu.sub.3
Py.sub.4 are phosphodiester bases.
In some embodiments, X.sub.1X.sub.2X.sub.3 and
X.sub.4X.sub.5X.sub.6(W).sub.M (G).sub.N includes phosphodiester
bases. In particular examples, X.sub.1X.sub.2X.sub.3 includes one
or more phosphorothioate bases, and in other examples,
X.sub.4X.sub.5X.sub.6(W).sub.M (G).sub.N includes one or more
phosphorothioate bases. In still other embodiments
X.sub.1X.sub.2X.sub.3 Pu Py and Pu Py X.sub.4X.sub.5X.sub.6 are
self complementary, and in further embodiments, the lentiviral
infection is treated in subject without stimulating expression of
CD4 in T cells of the subject.
In some embodiments, the method includes administering to the
subject a therapeutically effective amount of an immunostimulatory
D oligodeoxynucleotide or an immunostimulatory K
oligodeoxynucleotide, and an antigenic epitope of a polypeptide is
not administered to the subject.
The method includes administering a therapeutically effective
amount of a D oligodeoxynucleotide or a K oligodeoxynucleotide to a
subject infected with a lentivirus, thereby treating the subject.
In one embodiment, the ODN can be administered locally, such as by
topical application or intradermal administration. For intradermal
injection, for example, ODN are injected into the skin at the site
of interest. ODNs can be injected, for example, once, or they may
be injected in divided doses two or more times, for example
monthly, weekly, daily, or 2-4 times daily. In other embodiments,
the administration of the ODN is systemic. Oral, intravenous,
intra-arterial, subcutaneous, intra-peritoneal, intra-muscular,
inhalational, and even rectal administration is contemplated.
In some embodiments the method includes administering to the
subject a therapeutically effective amount of an immunostimulatory
D oligodeoxynucleotide or an immunostimulatory K
oligodeoxynucleotide, and an antigenic epitope of a polypeptide is
not administered to the subject. The method results in an increased
response to an opportunistic infection.
D. Combination Therapy
The present methods also include combinations of the ODNs disclosed
herein with one or more drugs useful in the treatment of an
opportunistic infection. For example, the ODNs disclosed herein may
be administered, whether before or after exposure to a virus, in
combination with effective doses of other anti-virals,
immunomodulators, anti-infectives, or vaccines. The term
"administration" refers to both concurrent and sequential
administration of the active agents.
In one embodiment, a combination of ODN with one or more agents
useful in the treatment of a lentiviral disease is provided. In one
specific, non-limiting example, the lentiviral disease is an
HIV-1-induced, an HIV-2-induced, a SIV-induced, or a FIV induced
disease.
Specific, non-limiting examples of antivirals include: AL-721 (from
Ethigen of Los Angeles, Calif.), recombinant human interferon beta
(from Triton Biosciences of Alameda, Calif.), Acemannan (from
Carrington Labs of Irving, Tex.), ganciclovir (from Syntex of Palo
Alto, Calif.), didehydrodeoxythymidine or d4T (from
Bristol-Myers-Squibb), EL10 (from Elan Corp, of Gainesville, Ga.),
dideoxycytidine or ddC (from Hoffman-LaRoche), Novapren (from
Novaferon Labs, Inc, of Akron, Ohio), zidovudine or AZT (from
Burroughs Wellcome), ribavirin (from Viratek of Costa Mesa,
Calif.), alpha interferon and acyclovir (from Burroughs Wellcome),
Indinavir (from Merck & Co.), 3TC (from Glaxo Wellcome),
Ritonavir (from Abbott), Saquinavir (from Hoffmann-LaRoche), and
others.
Specific, non-limiting examples of immuno-modulators are AS-101
(Wyeth-Ayerst Labs.), bropirimine (Upjohn), gamma interferon
(Genentech), GM-CSF (Genetics Institute), IL-2 (Cetus or
Hoffman-LaRoche), human immune globulin (Cutter Biological),
IMREG.TM. (from Imreg of New Orleans, La.), SK&F106528, TNF
(Genentech), and soluble TNF receptors (Immunex).
Specific, non-limiting examples of some anti-infectives used
include clindamycin with primaquine (from Upjohn, for the treatment
of pneumocystis pneumonia), fluconazlone (from Pfizer for the
treatment of cryptococcal meningitis or candidiasis), nystatin,
pentamidine, trimethaprim-sulfamethoxazole, and many others.
"Highly active anti-retroviral therapy" or "HAART" refers to a
combination of drugs that, when administered in combination,
inhibits a retrovirus from replicating or infecting cells better
than any of the drugs individually. In one embodiment, the
retrovirus is a human immunodeficiency virus. In one embodiment,
the highly active anti-retroviral therapy includes the
administration of 3'axido-3-deoxy-thymidine (AZT) in combination
with other agents, such as a D ODN. Specific, non-limiting examples
of agents that can be used in combination in HAART for a human
immunodeficiency virus are nucleoside analog reverse transcriptase
inhibitor drugs (NA), non-nucleoside analog reverse transcriptase
inhibitor drugs (NNRTI), and protease inhibitor drugs (PI). One
specific, non-limiting example of HAART used to suppress an HIV
infection is a combination of indinavir and efavirenz, an
experimental non-nucleoside reverse transcriptase inhibitor
(NNRTI).
In one embodiment, HAART is a combination of three drugs used for
the treatment of an HIV infection, such as the drugs shown in Table
2 below. Examples of three drug HAART for the treatment of an HIV
infection include 1 protease inhibitor from column A plus 2
nucleoside analogs from column B in Table 2. In addition, ritonavir
and saquinavir can be used in combination with 1 or 2 nucleoside
analogs.
TABLE-US-00003 TABLE 2 Column A Column B indinavir (CRIXIVAN .TM.)
AZT/ddI nelfinavir (VIRACEPT .TM.) d4T/ddI ritonavir (NORVIR .TM.)
AZT/ddC saquinavir (FORTOVASE .TM.) AZT/3TC ritonavir/saquinavir
d4T/3TC
In addition, other 3- and 4-drug combinations can reduce HIV to
very low levels for sustained periods. The combination therapies
are not limited to the above examples, but include any effective
combination of agents for the treatment of HIV disease (including
treatment of AIDS).
The disclosure is illustrated by the following non-limiting
Examples.
EXAMPLES
Example 1
General Methods
Human PBMC:
Buffy coats from healthy blood donors were obtained from the NIH
Department of Transfusion Medicine. PBMC from HIV infected subjects
were obtained from the Infectious Diseases Section of the
Department of Transfusion Medicine at the National Institutes of
Health Blood Bank and from the National Institute of Allergy and
Infectious Diseases, NIH.
Rhesus Monkeys:
Healthy 3 year old rhesus macaques (M. mulata) were obtained from
the FDA colony in South Carolina. Animals were monitored daily by
veterinarians. No systemic or local adverse reactions to CpG ODN
were observed. Treatments were administered and peripheral blood
samples obtained from ketamine anesthetized animals (10 mg/kg,
Ketaject, Phoenix Pharmaceuticals, St Joseph, Md.).
Mononuclear Cell Preparation:
Human and monkey mononuclear cells were isolated by density
gradient centrifugation of PBMC over Ficoll Hypaque density
gradient medium FICOLL.TM.-Hypaque as described. Cells were washed
three times and cultured in RPMI 1640 supplemented with 10%
heat-inactivated fetal calf serum (FCS), 1.5 mM L-glutamine and 100
U/ml of penicillin/streptomycin at 5.times.10.sup.5 cells/well in
the presence of 1-3 .mu.M ODN. Supernatants were collected after 72
hours and tested by ELISA for cytokine and antibody levels.
Treatment Groups and Protocol:
For the first study 18 healthy rhesus macaques were challenged on
the forehead on day 0 with 10.sup.8 L. amazonensis (PH8) metacyclic
promastigotes intradermally (i.d.) as previously described (R.
Kenney et al., 1999, J. I. 163:4481-4488; Verthelyi et al., 2002,
J. I. 168:1659-1663). Three days before and three days after the
infectious challenge, monkeys (six per group) were treated i.d. at
the site of the challenge with 500 .mu.g of a mix of K or D ODN
previously shown to stimulate rhesus macaques (Verthelyi et al.,
2002, J. I. 168:1659-1663). Control monkeys (n=6) received saline.
The monkeys developed a typical self-limited lesion in situ
characterized by erythema, induration, and ulceration. Lesion size,
which reflects the severity of infection, was calculated from the
average diameter to approximate a circle, measuring length by width
was measured weekly in a blinded fashion. For the second study, 14
monkeys that had been infected with SIV (SIVmac 239/CEMx174 CL#215;
100 MID.sub.50 intrarectally) one year before were challenged with
10.sup.7 L. major metacyclic promastigotes (WHOM/IR/-/173). Three
days before and three days after the challenge they were treated
id. with D (n=4), K (n=4) or control (n=3) ODN at the site of
challenge. Monkeys that received saline served as untreated
controls. The size of the lesions and the viremia that developed
was measured weekly. On day 56, the lesions were biopsied, the
animals euthanized and the local and systemic parasitic load
measured.
Experimental Infections:
L. amazonensis (PH8) was obtained from American Type Culture
Collection (Manassas, Va.) and grown for infection. Promastigotes
were grown in medium 199 with 20% FCS, supplemented by 0.1 mM
adenine (Life Technologies, Gaithersburg, Md.), 25 mM HEPES (Life
Technologies), 5 g/ml hemin (Sigma, St. Louis, Mo.), 1 .mu.g/ml
biotin (Life Technologies), and Pen/Strep/L-glutamine (Life
Technologies). To ensure high infectivity, the strain was passed
through BALB/c mice once and frozen as amastigotes for storage.
These amastigotes were freshly transformed in culture to
promastigotes, then grown to late log phase for each experiment.
After washing the cells, metacyclic promastigotes were purified by
negative selection using mAb D5, which recognizes a surface
lipophosphoglycan determinant that is differentially expressed by
procyclic and other immature stages of L. amazonensis
promastigotes. The promastigotes were incubated for 30 minutes at
room temperature with a 1/200 dilution of D5 ascites, and the
agglutinated parasites were pelleted by low-speed centrifugation at
400.times.g for five minutes. Metacyclic promastigotes remaining in
suspension were pelleted and washed, then resuspended at
1.times.10.sup.8 promastigotes/ml in RPMI. Monkeys were challenged
by injection with 1.times.10.sup.7 metacyclic promastigotes in 0.1
ml in the forehead.
L. major clone V1 (MHOM/IL/80/Friedlin) promastigotes were grown at
26.degree. C. in medium 199 supplemented as described above.
Infective-stage metacyclic promastigotes were isolated from 4-5 day
old stationary cultures by negative selection using peanut
agglutinin (Vector Laboratories, Burlingame, Calif.).
Oligodeoxynucleotides:
ODN were synthesized by the CBER Core Facility. All ODN had less
than <0.1 EU of endotoxin per mg of ODN as assessed by a Limulus
amebocyte lysate assay (QCL-1000, BioWhittaker). Individual humans
and monkeys vary in their response to specific K and D ODNs.
Indeed, no single D or K CpG motif is optimally stimulatory in all
donors. However, mixtures of ODNs were identified that strongly
stimulated PBMC from all human donors. These D or K ODN mixtures
were used in the in vivo studies in macaques (Verthelyi et al.,
2002, J. Immunology 168:1659-1663).
Antibodies:
Cross-reactive Abs that recognized human and macaque IL-6 (R&D,
Minneapolis, Minn.) and IFN.gamma.(PBL Biomedical Laboratories, New
Brunswick, N.J.) were used in ELISA assays.
ELISA:
Microtiter plates (96-well, Millipore Corp., Bedford, Mass.) were
coated with anti-cytokine Ab and blocked with PBS-5% BSA (Verthelyi
et al., J. Immunology, 2001, 166:2372). Culture supernatants from
PBMC cultures were added, and their cytokine content quantitated by
the additional of biotin-labeled anti-cytokine Ab followed by
phosphatase-conjugated avidin and phosphatase-specific colorimetric
substrate. Standard curves were generated using known amounts of
recombinant human cytokine. All assays were performed in
triplicate. When supernatants from HIV/SIV-infected PBMC were used,
Triton X100 was used to inactivate the virus.
Flow Cytometry:
Cells cultured for various periods with D ODN were washed in cold
PBS, fixed and stained with fluorescent labeled antibodies to CD83,
CD86, CD14, MHC class II. Samples were washed and analyzed
(20,000-40,000 events) on a FACScan flow cytometer (Becton
Dickinson, San Jose, Calif.) after gating on monocytes with proper
electronic compensation. The data were analyzed with CeliQUest
software Becton Dickinson).
Cell Proliferation Assay:
10.sup.5 PBMC/well were incubated with 3 .mu.M of ODN for 68 hours,
pulsed with 1 .mu.Ci of [.sup.3H] thymidine and harvested four
hours later. All assays were performed in triplicate. Intraassay
variation was <15%.
Viral Load Measurements:
Particle-associated SIV RNA in plasma was quantitated using a
modification of a previously described real-time reverse
transcription-PCR (RT-PCR) assay for SIV gag RNA, on a Prism 7700
sequence detection system (PE Biosystems, Foster City, Calif.).
Specimen preparation and reverse transcription with random priming
were as previously described (Silverstein et al., J. Virol. 2000
November; 74(22): 10489-10497). For PCR amplification of the
resulting cDNA, the following primers and biterminally labeled and
3'-blocked probe were used: forward primer (SGAG21), 5'-gTC TgC gTC
ATP Tgg TgC ATT C-3' (SEQ ID NO: 17); reverse primer (SGAG22),
5'-CAC TAg KTg TCT CTg CAC TAT PTg TTT Tg-3'(SEQ ID NO: 18); and
probe (P-SGAG23), 5'-(FAM)CTT CPT CAg TKT gTT TCA CTT TCT CTT CTg
Cg(TAMRA) 3' (SEQ ID NO: 19), where P and K are modified bases
(Glen Research catalog no. 10-1047-90 and 10-1048-90,
respectively), introduced to minimize the impact of potential
sequence mismatches at positions of described heterogeneity among
SIV isolates (Los Alamos HIV sequence database, available on the
internet), and FAM and TAMRA indicate the reporter fluorochrome
6-carboxy-fluorescein and the quencher fluorochrome
6-carboxy-tetramethylrhodamine, respectively. After ten minutes at
95.degree. C. to activate the Taq Gold polymerase, 45 cycles of
amplification were performed (consisting of 95.degree. C. for 15
and 60.degree. C. for 60 seconds), and the nominal SIV gag copy
number for test specimens was determined by interpolation of the
average measured threshold cycle number for duplicate
determinations onto a standard curve of threshold cycle number
versus known input template copy number for a purified in vitro
transcript control template, essentially as described previously
(Silverstein et al., J. Virol. 2000 November; 74(22):
10489-10497).
The threshold sensitivity of the assay is 100 copy Eq/ml of plasma,
with an average inter-assay coefficient of variation of
<25%.
Statistical Analysis:
Statistically significant differences in cytokine and cell
proliferation levels were determined using a 2-tailed
non-parametric Rank Sum test or ANOVA with Dunnett's post test
analysis. Differences in lesion sizes were tested by Friedman
Repeated-Measures Analysis on Ranks with Tukey's All Pairwise
Multiple Comparison Procedure using Sigma Stat.
Example 2
Immunoprotective Activity of CpG ODN In Vivo
Previous studies had established that treatment with CpG ODN
protected mice from up to 10.sup.4 L metacyclic parasites). In
order to determine whether CpG ODNs were able to exert a similar
protective effect in primates we utilized a non-human primate model
for leishmaniasis. Eighteen rhesus macaques were treated with 500
.mu.g of either D or K CpG ODN mixes previously shown to be active
on PBMC of non-human primates (Verthelyi et al., 2002, J. I.
168:1659-1663). In situ intradermal (i.d.) inoculation was carried
out three days before and three days after challenge with L.
amazonensis in the skin of the forehead. As previously described,
intradermal inoculation with 10.sup.8 L. amazonensis induced the
development of a cutaneous Leishmania lesion that resembles the
ones observed in humans. In untreated monkeys its peak surface area
was of 14.+-.10 mm.sup.2 on day 22. As shown in FIG. 2, treatment
of the macaques with D ODN, but not with K ODN, significantly
reduced the size of the cutaneous lesion (p<0.001). This shows
that treatment of primates with CpG D ODN protect them from a local
challenge with pathogenic Leishmania parasites.
Example 3
PBMC From HIV Infected Subjects Respond to CpG ODN
HIV infection is associated with a progressive loss of immune
function and increased susceptibility to opportunistic infections
such as L. major. In addition to the gradual loss of CD4.sup.+ T
cells, there is a reduction in number and function of plasmacytoid
dendritic cells (pDC) and natural killer (NK) cells leading to
impaired immune responses and increase susceptibility to
opportunistic infections (Chehimi, 2002, J. I.:168: 4796-4801;
Azzoni et al., 2002 J. I. 168:5764-5770). In order to assess
whether PBMC from HIV infected patients would be responsive to CpG
ODN activation, the response of PBMC from 43 HIV-infected (Table 3)
and 16 healthy individuals to D and K CpG ODN was compared in
vitro.
As previously shown, the response elicited by PBMC from healthy
subjects to the two types of CpG ODN was distinct: D ODN triggered
the secretion of IFN.alpha. and IFN.gamma. (FIG. 3), and induced DC
maturation (FIG. 4). In contrast, K ODN increased cell
proliferation and IL-6 production (FIG. 3). PBMC from healthy and
HIV infected subjects secreted similar levels of IFN.alpha. and
IFN.gamma. in the absence of stimulation or in the presence of
control ODN lacking the CpG motif (FIG. 3). Upon stimulation with
CpG D ODN, however, PBMC from HIV infected subjects generated
significantly lower IFN.gamma.(p<0.05) or IFN.alpha. than
healthy controls (p<0.001) (FIG. 3). The reduction in IFN.alpha.
and IFN.gamma.secretion correlated directly with the number of CD4+
T cells (p<0.01) (FIG. 5) and inversely with viral load
(p<0.05), but did not correlate with the number of CD56.sup.+ NK
cells or CD14.sup.+ monocytes. The reduced response to D ODN did
not associate with antiretroviral therapy (ART).
TABLE-US-00004 TABLE 3 Description of HIV-infected PBMC Donors
<200 200-500 >500 number 9 17 17 age 40 +/- 2 39 +/- 1 37 +/-
2 race white 4 13 8 black 4 4 7 hispanic 1 1 2 gender male 8 15 17
female 0 2 0 CD4 25 +/- 7 317 +/- 20 735 +/- 67 % CD4T 3 +/- 1 21
+/- 1.9 31 +/- 3 Avg. VL 27000 +/- 1828 +/- 29000 663 +/- 330 50000
Range VL 50-75 .times. 10.sup.8 50-5 .times. 10.sup.8 ND-35000 NK 9
+/- 2 8.3 +/- 1 5.6 +/- 1.6 CD56.sup.+/ CD16.sup.+ % CD14 19 +/- 2
22 +/- 1 15.6 +/- 3 % CD19 19 +/- 5 14 +/- 1 9 +/- 2 % on 66 66 80
HAART
CPG D ODNs induce monocytes to mature into CD83.sup.+ CD86.sup.+ DC
in vitro. Fewer mature DC were evident in PB from HIV infected
patients, especially in those with higher viral loads. However,
upon stimulation with CpG D ODN, a 10-fold increase in the number
of mature DC was apparent.
The response to K ODN was not significantly different in PBMC from
HIV infected and healthy subjects (FIG. 3) indicating that B cells
and monocytes retain their ability to respond to CpG ODN. Together
these data show that PBMC from HIV infected subjects are activated
by CpG ODN in vitro. The responsiveness to CpG ODN, although
reduced, is evident even among patients with high viral loads and
low CD4+T cells.
Example 4
PBMC from SIV Infected Rhesus Macaques Respond to CpG ODN
Rhesus macaques are a relevant animal model for testing the
activity of CpG ODN planned for human use. It has been demonstrated
that D and K ODN elicit a cytokine profile in PBMC of rhesus
macaque that is similar to the one generated in human PBMC. To
assess whether PBMC from rhesus macaques infected with SIV would
respond to CpG ODN in vitro, PBMC from 16 SIV infected and 20
healthy macaques were stimulated in vitro with D and K CpG ODN. As
observed with PBMC from HIV infected patients, PBMC from SIV
infected macaques showed a response to CpG K ODN stimulation in
vitro that was indistinct from that of healthy macaques (FIG. 6).
Stimulation with CpG D ODN, in turn, generated significantly
increased levels of IFN.alpha., although the magnitude of the
IFN.alpha. response was reduced when compared with PBMC from
healthy macaques.
Example 5
CpG ODN Protect SIV Infected non-human Primates From a Cutaneous
Infection with L. Major
To assess whether the response to CpG ODN generated in
immunosuppressed HIV patients would suffice to generate an
immunoprotective response in vivo, 14 rhesus macaques that had been
infected with XX SIV strain mac239 a year before the start of the
study (Viral load range: 0.3-28.times.10.sup.6 copies/ml) were
utilized. Monkeys were treated i.d. with D ODN (n=4), K ODN (n=4),
control ODN (n=3) or saline 3 days before and 3 days after an
intra-dermal challenge with 10.sup.7 viable metacyclic
promastigotes of L. major (WHOM/IR/-/173), a strain of Leishmania
that frequently infects HIV patients. As shown in FIG. 7, control
monkeys developed a typical self-limited in situ lesion
characterized by erythema, induration, and ulceration. The lesion
size, which reflects the severity of infection (Amaral, et al.,
1996, Exp. Parasitol. 82:34), was measured weekly. Monkeys treated
with CpG D ODN had significantly smaller lesions than control or K
ODN treated monkeys. On day 56 the monkeys were euthanized and the
local and systemic parasite burden measured. Monkeys treated with D
ODN appeared to have a 1 log reduction in parasite burden at the
lesion site compared to the ones treated with control ODN or saline
but the difference did not reach statistical significance. No
systemic diffusion of the parasites were evident on any of the
groups.
Lastly, since vaccination and infection can activate the immune
cells and lead to an increase in viremia, the viral load of the
macaques was assessed every 2 weeks throughout the study. No
significant change in viral load was evident in any of the
groups.
Example 6
CpG ODN Protect p47phox-/-mice From Infection with Listeria
p47phox-/-mice exhibit a phenotype similar to that of human chronic
granulomatous disease (CGD). The biochemical basis for CGD is a
defect in the phagocyte nicotine amide dinucleotide phosphatase
(NADPH) oxidase, the enzyme responsible for producing superoxide
O-2, which in turn is critical for host defense against bacterial
and fungal infection. Mice were treated with CpG or saline 3 days
before and 3 days after a challenge with Listeria bacteria Mice
pre-treated with CpG D ODNs showed a 20% increase in protection
against Listeria as compared to those treated with control ODN or
saline.
Example 7
PBMC from Subjects with Human Chronic Granulomatous Disease (CGD)
Respond to CpG ODN
The biochemical basis for CGD is a defect in the phagocyte nicotine
amide dinucleotide phosphatase (NADPH) oxidase, the enzyme
responsible for producing superoxide O-2, which in turn is critical
for host defense against bacterial and fungal infection. In order
to assess whether PBMC from subjects with CGD are responsive to CpG
ODN activation, the response of PBMC from subjects with CGD and
healthy individuals to D and K CpG ODNs is compared in vitro. The
response elicited by PBMC from healthy subjects to the two types of
CpG ODN is distinct: D ODN trigger the secretion of IFN.alpha. and
IFN.gamma., and induce DC maturation. In contrast, K ODN increase
cell proliferation and IL-6 production. IFN.alpha. and IFN.gamma.
levels in PBMC from healthy and subjects with CGD are measured as
described above following stimulation with D and K CpG ODN.
Example 8
CpG Oligonucleotides Improve the Response to Hepatitis B
Immunization in Healthy and SIV Infected Rhesus Macaques
Development of an immunogenic vaccine against hepatitis B is
particularly important for HIV infected patients. Since shared
epidemiological risks result in HIV infected subjects having a high
incidence of HBV, and co-infection with HBV increases the rate of
hepatotoxicity of HAART. Although HBV vaccination is recommended to
all HIV patients, its efficacy in these patients is reduced. This
example compares the adjuvant effect of K and D type ODN as vaccine
adjuvants to the hepatitis B vaccine and compares their
effectiveness immunocompromised SIV infected rhesus macaques.
ODNs were synthesized as follows:
TABLE-US-00005 D19: GGtgcatcgatgcagGGGGG (SEQ ID NO: 176) D35:
GgtgcatcgatgcaggggGG (SEQ ID NO: 177) D29: GGtgcaccggtgcagGGGGG
(SEQ ID NO: 178) K3: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 179) K123:
TCGTTTGTTCT (SEQ ID NO: 180) K23: TCGAGCGTTCTC (SEQ ID NO: 181)
Phosphorothioate bases are shown in capital letters; phosphodiester
bases in lower case. All ODN had less than <0.1 EU of endotoxin
per mg of ODN as assessed by a Limulus amebocyte lysate assay
(QCL-1000, BioWhittaker). Due to individual heterogeneity in the
response to specific "K" and "D" sequences mixtures of ODN were
used in in vivo studies.
Two to three year old rhesus macaques (M. mulata) were obtained
from the FDA colony in South Carolina. Animals were monitored daily
by veterinarians. No systemic or local adverse reactions to CpG ODN
were observed.
SIV plasma RNA levels were determined by a real time RT-PCR assay,
as described in Example 1. IgG antibodies to HBs were assessed as
per manufacturer's instructions and quantitated using IgG
anti-Hepatitis B surface antigen (anti-HBs, DiaSorin, Saluggia,
Italy). Spearman's correlations were used to assess the
relationship between viral load and response to ODN. Differences in
antibody titers over time were tested by Friedman Repeated-Measures
Analysis on Ranks with Tukey's All Pairwise Multiple Comparison
Procedure using Sigma Stat (SPSS, San Rafael, Calif.). Differences
in viral load were tested by t test of log-normalized data.
To compare the efficacy of D and K type ODN as adjuvants for the
vaccine against hepatitis B, 15 two year-old rhesus macaques
weighing 6+/-1 lbs. (five per group) were immunized with the
pediatric dose of ENGERIX-B.TM. containing 10 .mu.g of HBsAg
adsorbed to alum alone or together with 250 .mu.g of D or K type
ODN. The animals were boosted 30 and 60 days later with the same
product. All monkeys were negative for antibodies to HbsAg at
baseline. Fourteen days after the first immunization, all macaques
vaccinated with ENGERIX-B.TM.-D ODN had antibodies to HBV greater
than 10 mIU/ml, compared to only 60 and 80% of those immunized with
ENGERIX-B.TM. K ODN or ENGERIX-B.TM. alone respectively. All
animals developed protective levels (>10 mIU/ml) of antibodies
to HBV after the first boost. As shown in FIG. 8, animals that
received K or D ODN as adjuvants developed significantly higher
antibody levels (peak titer: 20469+/-2240 and 21702+/-1764 for K
and D ODN respectively, compared to 9226+/-5237 for those animals
that received the vaccine alone, p=0.012). D and K type CpG ODN
were equally effective as vaccine adjuvants for the hepatitis B
vaccine.
Next, the efficacy of CpG ODN in eliciting a similar increase in
antibodies to HbsAg in SIV infected rhesus macaques was assessed.
Seventeen SIV infected animals were immunized with a pediatric dose
of hepatitis B vaccine ENGERIX-B.TM. alone or together with 250
.mu.g of D or K ODN. The animals were boosted 30 and 75 days after
prime. The levels of IgG anti-HbsAg in sera were measured every two
weeks for four months. Unlike healthy macaques, SIV infected
animals were unable to mount a protective antibody response when
immunized with the commercial hepatitis B vaccine alone, even after
three immunizations. Only 20% of the animals immunized with
ENGERIX-B.TM. alone had antibody levels greater than 10 mIU/ml, and
the mean peak level of antibodies produced was 9+/-7 mIU/ml. Among
the animals that received the vaccine together with D or K ODN, the
antibody titers achieved were inversely correlated with monkey's
viral load at the start of the study (FIG. 9A). Indeed, animals
with viral loads greater than 1.times.10.sup.7 copies/ml at the
time of immunization were unable to mount a protective response to
the vaccine regardless of the adjuvant used. Among those that had
viral loads greater than 10.sup.7 copies/ml, K and D ODN were
similarly effective at promoting the development of anti-HbsAg
antibodies (FIG. 9B). Although the antibody levels achieved were
significantly increased relative to those macaques receiving the
HBV vaccine alone, their absolute levels were significantly lower
than those developed by healthy macaques (p<0.001).
No significant increases in viral load were observed for any of the
groups during this experiment, indicating that at this dose, CpG
ODN do not appear to impact viral replication.
As demonstrated in this example, addition of K or D ODN boosts the
immunogenicity of the HBV vaccine to render refractory SIV infected
macaques responsive to vaccination. There is a pressing need for
the development of an immunogenic vaccine against hepatitis B that
is effective in HIV infected patients. These findings indicate that
addition of CpG ODN to commercially available vaccines may allow
patients with low or moderate viral loads to mount a protective
response.
It will be apparent that the precise details of the methods or
compositions described may be varied or modified without departing
from the spirit of the described disclosure. We claim all such
modifications and variations that fall within the scope and spirit
of the claims below.
SEQUENCE LISTINGS
1
181120DNAArtificial SequenceSynthetic oligonucleotide 1nntgcatcga
tgcagggggg 20220DNAArtificial SequenceSynthetic oligonucleotide
2nntgcaccgg tgcagggggg 20320DNAArtificial SequenceSynthetic
oligonucleotide 3nntgcgtcga cgcagggggg 20420DNAArtificial
SequenceSynthetic oligonucleotide 4nntgcgtcga tgcagggggg
20520DNAArtificial SequenceSynthetic oligonucleotide 5nntgcgccgg
cgcagggggg 20620DNAArtificial SequenceSynthetic oligonucleotide
6nntgcgccga tgcagggggg 20720DNAArtificial SequenceSynthetic
oligonucleotide 7nntgcatcga cgcagggggg 20820DNAArtificial
SequenceSynthetic oligonucleotide 8nntgcgtcgg tgcagggggg
2096DNAArtificial SequenceSynthetic oligonucleotide 9atcgat
6106DNAArtificial SequenceSynthetic oligonucleotide 10accggt
6116DNAArtificial SequenceSynthetic oligonucleotide 11atcgac
6126DNAArtificial SequenceSynthetic oligonucleotide 12accgat
6136DNAArtificial SequenceSynthetic oligonucleotide 13gtcgac
6146DNAArtificial SequenceSynthetic oligonucleotide 14gccggc
61520DNAArtificial SequenceSynthetic oligonucleotide 15ggtgcatcga
tacagggggg 201620DNAArtificial SequenceSynthetic oligonucleotide
16ggtgcgtcga tgcagggggg 201722DNAArtificial SequenceSynthetic
oligonucleotide 17gtctgcgtca tntggtgcat tc 221829DNAArtificial
SequenceSynthetic oligonucleotide 18cactagntgt ctctgcacta tntgttttg
291932DNAArtificial SequenceSynthetic oligonucleotide 19cttcntcagt
ntgtttcact ttctcttctg cg 322010DNAArtificial SequenceSynthetic
oligonucleotide 20nnntcnnnnn 10216DNAArtificial SequenceSynthetic
oligonucleotide 21rycnry 62216DNAArtificial SequenceSynthetic
oligonucleotide 22nnnrycgryn nngggg 162317DNAArtificial
SequenceSynthetic oligonucleotide 23nnnrycgryn nnngggg
172418DNAArtificial SequenceSynthetic oligonucleotide 24nnnrycgryn
nnnngggg 182519DNAArtificial SequenceSynthetic oligonucleotide
25nnnrycgryn nnnnngggg 192620DNAArtificial SequenceSynthetic
oligonucleotide 26nnnrycgryn nnnnnngggg 202721DNAArtificial
SequenceSynthetic oligonucleotide 27nnnrycgryn nnnnnnnggg g
212822DNAArtificial SequenceSynthetic oligonucleotide 28nnnrycgryn
nnnnnnnngg gg 222923DNAArtificial SequenceSynthetic oligonucleotide
29nnnrycgryn nnnnnnnnng ggg 233024DNAArtificial SequenceSynthetic
oligonucleotide 30nnnrycgryn nnnnnnnnnn gggg 243125DNAArtificial
SequenceSynthetic oligonucleotide 31nnnrycgryn nnnnnnnnnn ngggg
253226DNAArtificial SequenceSynthetic oligonucleotide 32nnnrycgryn
nnnnnnnnnn nngggg 263317DNAArtificial SequenceSynthetic
oligonucleotide 33nnnrycgryn nnggggg 173418DNAArtificial
SequenceSynthetic oligonucleotide 34nnnrycgryn nnnggggg
183519DNAArtificial SequenceSynthetic oligonucleotide 35nnnrycgryn
nnnnggggg 193620DNAArtificial SequenceSynthetic oligonucleotide
36nnnrycgryn nnnnnggggg 203721DNAArtificial SequenceSynthetic
oligonucleotide 37nnnrycgryn nnnnnngggg g 213822DNAArtificial
SequenceSynthetic oligonucleotide 38nnnrycgryn nnnnnnnggg gg
223923DNAArtificial SequenceSynthetic oligonucleotide 39nnnrycgryn
nnnnnnnngg ggg 234024DNAArtificial SequenceSynthetic
oligonucleotide 40nnnrycgryn nnnnnnnnng gggg 244125DNAArtificial
SequenceSynthetic oligonucleotide 41nnnrycgryn nnnnnnnnnn ggggg
254226DNAArtificial SequenceSynthetic oligonucleotide 42nnnrycgryn
nnnnnnnnnn nggggg 264327DNAArtificial SequenceSynthetic
oligonucleotide 43nnnrycgryn nnnnnnnnnn nnggggg 274418DNAArtificial
SequenceSynthetic oligonucleotide 44nnnrycgryn nngggggg
184519DNAArtificial SequenceSynthetic oligonucleotide 45nnnrycgryn
nnngggggg 194620DNAArtificial SequenceSynthetic oligonucleotide
46nnnrycgryn nnnngggggg 204721DNAArtificial SequenceSynthetic
oligonucleotide 47nnnrycgryn nnnnnggggg g 214822DNAArtificial
SequenceSynthetic oligonucleotide 48nnnrycgryn nnnnnngggg gg
224923DNAArtificial SequenceSynthetic oligonucleotide 49nnnrycgryn
nnnnnnnggg ggg 235024DNAArtificial SequenceSynthetic
oligonucleotide 50nnnrycgryn nnnnnnnngg gggg 245125DNAArtificial
SequenceSynthetic oligonucleotide 51nnnrycgryn nnnnnnnnng ggggg
255226DNAArtificial SequenceSynthetic oligonucleotide 52nnnrycgryn
nnnnnnnnnn gggggg 265327DNAArtificial SequenceSynthetic
oligonucleotide 53nnnrycgryn nnnnnnnnnn ngggggg 275428DNAArtificial
SequenceSynthetic oligonucleotide 54nnnrycgryn nnnnnnnnnn nngggggg
285519DNAArtificial SequenceSynthetic oligonucleotide 55nnnrycgryn
nnggggggg 195620DNAArtificial SequenceSynthetic oligonucleotide
56nnnrycgryn nnnggggggg 205721DNAArtificial SequenceSynthetic
oligonucleotide 57nnnrycgryn nnnngggggg g 215822DNAArtificial
SequenceSynthetic oligonucleotide 58nnnrycgryn nnnnnggggg gg
225923DNAArtificial SequenceSynthetic oligonucleotide 59nnnrycgryn
nnnnnngggg ggg 236024DNAArtificial SequenceSynthetic
oligonucleotide 60nnnrycgryn nnnnnnnggg gggg 246125DNAArtificial
SequenceSynthetic oligonucleotide 61nnnrycgryn nnnnnnnngg ggggg
256226DNAArtificial SequenceSynthetic oligonucleotide 62nnnrycgryn
nnnnnnnnng gggggg 266327DNAArtificial SequenceSynthetic
oligonucleotide 63nnnrycgryn nnnnnnnnnn ggggggg 276428DNAArtificial
SequenceSynthetic oligonucleotide 64nnnrycgryn nnnnnnnnnn nggggggg
286529DNAArtificial SequenceSynthetic oligonucleotide 65nnnrycgryn
nnnnnnnnnn nnggggggg 296620DNAArtificial SequenceSynthetic
oligonucleotide 66nnnrycgryn nngggggggg 206721DNAArtificial
SequenceSynthetic oligonucleotide 67nnnrycgryn nnnggggggg g
216822DNAArtificial SequenceSynthetic oligonucleotide 68nnnrycgryn
nnnngggggg gg 226923DNAArtificial SequenceSynthetic oligonucleotide
69nnnrycgryn nnnnnggggg ggg 237024DNAArtificial SequenceSynthetic
oligonucleotide 70nnnrycgryn nnnnnngggg gggg 247125DNAArtificial
SequenceSynthetic oligonucleotide 71nnnrycgryn nnnnnnnggg ggggg
257226DNAArtificial SequenceSynthetic oligonucleotide 72nnnrycgryn
nnnnnnnngg gggggg 267327DNAArtificial SequenceSynthetic
oligonucleotide 73nnnrycgryn nnnnnnnnng ggggggg 277428DNAArtificial
SequenceSynthetic oligonucleotide 74nnnrycgryn nnnnnnnnnn gggggggg
287529DNAArtificial SequenceSynthetic oligonucleotide 75nnnrycgryn
nnnnnnnnnn ngggggggg 297630DNAArtificial SequenceSynthetic
oligonucleotide 76nnnrycgryn nnnnnnnnnn nngggggggg
307721DNAArtificial SequenceSynthetic oligonucleotide 77nnnrycgryn
nngggggggg g 217822DNAArtificial SequenceSynthetic oligonucleotide
78nnnrycgryn nnnggggggg gg 227923DNAArtificial SequenceSynthetic
oligonucleotide 79nnnrycgryn nnnngggggg ggg 238024DNAArtificial
SequenceSynthetic oligonucleotide 80nnnrycgryn nnnnnggggg gggg
248125DNAArtificial SequenceSynthetic oligonucleotide 81nnnrycgryn
nnnnnngggg ggggg 258226DNAArtificial SequenceSynthetic
oligonucleotide 82nnnrycgryn nnnnnnnggg gggggg 268327DNAArtificial
SequenceSynthetic oligonucleotide 83nnnrycgryn nnnnnnnngg ggggggg
278428DNAArtificial SequenceSynthetic oligonucleotide 84nnnrycgryn
nnnnnnnnng gggggggg 288529DNAArtificial SequenceSynthetic
oligonucleotide 85nnnrycgryn nnnnnnnnnn ggggggggg
298630DNAArtificial SequenceSynthetic oligonucleotide 86nnnrycgryn
nnnnnnnnnn nggggggggg 308731DNAArtificial SequenceSynthetic
oligonucleotide 87nnnrycgryn nnnnnnnnnn nngggggggg g
318822DNAArtificial SequenceSynthetic oligonucleotide 88nnnrycgryn
nngggggggg gg 228923DNAArtificial SequenceSynthetic oligonucleotide
89nnnrycgryn nnnggggggg ggg 239024DNAArtificial SequenceSynthetic
oligonucleotide 90nnnrycgryn nnnngggggg gggg 249125DNAArtificial
SequenceSynthetic oligonucleotide 91nnnrycgryn nnnnnggggg ggggg
259226DNAArtificial SequenceSynthetic oligonucleotide 92nnnrycgryn
nnnnnngggg gggggg 269327DNAArtificial SequenceSynthetic
oligonucleotide 93nnnrycgryn nnnnnnnggg ggggggg 279428DNAArtificial
SequenceSynthetic oligonucleotide 94nnnrycgryn nnnnnnnngg gggggggg
289529DNAArtificial SequenceSynthetic oligonucleotide 95nnnrycgryn
nnnnnnnnng ggggggggg 299630DNAArtificial SequenceSynthetic
oligonucleotide 96nnnrycgryn nnnnnnnnnn gggggggggg
309731DNAArtificial SequenceSynthetic oligonucleotide 97nnnrycgryn
nnnnnnnnnn nggggggggg g 319832DNAArtificial SequenceSynthetic
oligonucleotide 98nnnrycgryn nnnnnnnnnn nnnnnnnngg gg
329918DNAArtificial SequenceSynthetic oligonucleotide 99ggnnnrycgr
ynnngggg 1810019DNAArtificial SequenceSynthetic oligonucleotide
100ggnnnrycgr ynnnngggg 1910120DNAArtificial SequenceSynthetic
oligonucleotide 101ggnnnrycgr ynnnnngggg 2010221DNAArtificial
SequenceSynthetic oligonucleotide 102ggnnnrycgr ynnnnnnggg g
2110322DNAArtificial SequenceSynthetic oligonucleotide
103ggnnnrycgr ynnnnnnngg gg 2210423DNAArtificial SequenceSynthetic
oligonucleotide 104ggnnnrycgr ynnnnnnnng ggg 2310524DNAArtificial
SequenceSynthetic oligonucleotide 105ggnnnrycgr ynnnnnnnnn gggg
2410625DNAArtificial SequenceSynthetic oligonucleotide
106ggnnnrycgr ynnnnnnnnn ngggg 2510726DNAArtificial
SequenceSynthetic oligonucleotide 107ggnnnrycgr ynnnnnnnnn nngggg
2610827DNAArtificial SequenceSynthetic oligonucleotide
108ggnnnrycgr ynnnnnnnnn nnngggg 2710928DNAArtificial
SequenceSynthetic oligonucleotide 109ggnnnrycgr ynnnnnnnnn nnnngggg
2811019DNAArtificial SequenceSynthetic oligonucleotide
110ggnnnrycgr ynnnggggg 1911120DNAArtificial SequenceSynthetic
oligonucleotide 111ggnnnrycgr ynnnnggggg 2011221DNAArtificial
SequenceSynthetic oligonucleotide 112ggnnnrycgr ynnnnngggg g
2111322DNAArtificial SequenceSynthetic oligonucleotide
113ggnnnrycgr ynnnnnnggg gg 2211423DNAArtificial SequenceSynthetic
oligonucleotide 114ggnnnrycgr ynnnnnnngg ggg 2311524DNAArtificial
SequenceSynthetic oligonucleotide 115ggnnnrycgr ynnnnnnnng gggg
2411625DNAArtificial SequenceSynthetic oligonucleotide
116ggnnnrycgr ynnnnnnnnn ggggg 2511726DNAArtificial
SequenceSynthetic oligonucleotide 117ggnnnrycgr ynnnnnnnnn nggggg
2611827DNAArtificial SequenceSynthetic oligonucleotide
118ggnnnrycgr ynnnnnnnnn nnggggg 2711928DNAArtificial
SequenceSynthetic oligonucleotide 119ggnnnrycgr ynnnnnnnnn nnnggggg
2812029DNAArtificial SequenceSynthetic oligonucleotide
120ggnnnrycgr ynnnnnnnnn nnnnggggg 2912120DNAArtificial
SequenceSynthetic oligonucleotide 121ggnnnrycgr ynnngggggg
2012221DNAArtificial SequenceSynthetic oligonucleotide
122ggnnnrycgr ynnnnggggg g 2112322DNAArtificial SequenceSynthetic
oligonucleotide 123ggnnnrycgr ynnnnngggg gg 2212423DNAArtificial
SequenceSynthetic oligonucleotide 124ggnnnrycgr ynnnnnnggg ggg
2312524DNAArtificial SequenceSynthetic oligonucleotide
125ggnnnrycgr ynnnnnnngg gggg 2412625DNAArtificial
SequenceSynthetic oligonucleotide 126ggnnnrycgr ynnnnnnnng ggggg
2512726DNAArtificial SequenceSynthetic oligonucleotide
127ggnnnrycgr ynnnnnnnnn gggggg
2612827DNAArtificial SequenceSynthetic oligonucleotide
128ggnnnrycgr ynnnnnnnnn ngggggg 2712928DNAArtificial
SequenceSynthetic oligonucleotide 129ggnnnrycgr ynnnnnnnnn nngggggg
2813029DNAArtificial SequenceSynthetic oligonucleotide
130ggnnnrycgr ynnnnnnnnn nnngggggg 2913130DNAArtificial
SequenceSynthetic oligonucleotide 131ggnnnrycgr ynnnnnnnnn
nnnngggggg 3013221DNAArtificial SequenceSynthetic oligonucleotide
132ggnnnrycgr ynnngggggg g 2113322DNAArtificial SequenceSynthetic
oligonucleotide 133ggnnnrycgr ynnnnggggg gg 2213423DNAArtificial
SequenceSynthetic oligonucleotide 134ggnnnrycgr ynnnnngggg ggg
2313524DNAArtificial SequenceSynthetic oligonucleotide
135ggnnnrycgr ynnnnnnggg gggg 2413625DNAArtificial
SequenceSynthetic oligonucleotide 136ggnnnrycgr ynnnnnnngg ggggg
2513726DNAArtificial SequenceSynthetic oligonucleotide
137ggnnnrycgr ynnnnnnnng gggggg 2613827DNAArtificial
SequenceSynthetic oligonucleotide 138ggnnnrycgr ynnnnnnnnn ggggggg
2713928DNAArtificial SequenceSynthetic oligonucleotide
139ggnnnrycgr ynnnnnnnnn nggggggg 2814029DNAArtificial
SequenceSynthetic oligonucleotide 140ggnnnrycgr ynnnnnnnnn
nnggggggg 2914130DNAArtificial SequenceSynthetic oligonucleotide
141ggnnnrycgr ynnnnnnnnn nnnggggggg 3014231DNAArtificial
SequenceSynthetic oligonucleotide 142ggnnnrycgr ynnnnnnnnn
nnnngggggg g 3114322DNAArtificial SequenceSynthetic oligonucleotide
143ggnnnrycgr ynnngggggg gg 2214423DNAArtificial SequenceSynthetic
oligonucleotide 144ggnnnrycgr ynnnnggggg ggg 2314524DNAArtificial
SequenceSynthetic oligonucleotide 145ggnnnrycgr ynnnnngggg gggg
2414625DNAArtificial SequenceSynthetic oligonucleotide
146ggnnnrycgr ynnnnnnggg ggggg 2514726DNAArtificial
SequenceSynthetic oligonucleotide 147ggnnnrycgr ynnnnnnngg gggggg
2614827DNAArtificial SequenceSynthetic oligonucleotide
148ggnnnrycgr ynnnnnnnng ggggggg 2714928DNAArtificial
SequenceSynthetic oligonucleotide 149ggnnnrycgr ynnnnnnnnn gggggggg
2815029DNAArtificial SequenceSynthetic oligonucleotide
150ggnnnrycgr ynnnnnnnnn ngggggggg 2915130DNAArtificial
SequenceSynthetic oligonucleotide 151ggnnnrycgr ynnnnnnnnn
nngggggggg 3015231DNAArtificial SequenceSynthetic oligonucleotide
152ggnnnrycgr ynnnnnnnnn nnnggggggg g 3115332DNAArtificial
SequenceSynthetic oligonucleotide 153ggnnnrycgr ynnnnnnnnn
nnnngggggg gg 3215423DNAArtificial SequenceSynthetic
oligonucleotide 154ggnnnrycgr ynnngggggg ggg 2315524DNAArtificial
SequenceSynthetic oligonucleotide 155ggnnnrycgr ynnnnggggg gggg
2415625DNAArtificial SequenceSynthetic oligonucleotide
156ggnnnrycgr ynnnnngggg ggggg 2515726DNAArtificial
SequenceSynthetic oligonucleotide 157ggnnnrycgr ynnnnnnggg gggggg
2615827DNAArtificial SequenceSynthetic oligonucleotide
158ggnnnrycgr ynnnnnnngg ggggggg 2715928DNAArtificial
SequenceSynthetic oligonucleotide 159ggnnnrycgr ynnnnnnnng gggggggg
2816029DNAArtificial SequenceSynthetic oligonucleotide
160ggnnnrycgr ynnnnnnnnn ggggggggg 2916130DNAArtificial
SequenceSynthetic oligonucleotide 161ggnnnrycgr ynnnnnnnnn
nggggggggg 3016231DNAArtificial SequenceSynthetic oligonucleotide
162ggnnnrycgr ynnnnnnnnn nngggggggg g 3116332DNAArtificial
SequenceSynthetic oligonucleotide 163ggnnnrycgr ynnnnnnnnn
nnnggggggg gg 3216433DNAArtificial SequenceSynthetic
oligonucleotide 164ggnnnrycgr ynnnnnnnnn nnnngggggg ggg
3316524DNAArtificial SequenceSynthetic oligonucleotide
165ggnnnrycgr ynnngggggg gggg 2416625DNAArtificial
SequenceSynthetic oligonucleotide 166ggnnnrycgr ynnnnggggg ggggg
2516726DNAArtificial SequenceSynthetic oligonucleotide
167ggnnnrycgr ynnnnngggg gggggg 2616827DNAArtificial
SequenceSynthetic oligonucleotide 168ggnnnrycgr ynnnnnnggg ggggggg
2716928DNAArtificial SequenceSynthetic oligonucleotide
169ggnnnrycgr ynnnnnnngg gggggggg 2817029DNAArtificial
SequenceSynthetic oligonucleotide 170ggnnnrycgr ynnnnnnnng
ggggggggg 2917130DNAArtificial SequenceSynthetic oligonucleotide
171ggnnnrycgr ynnnnnnnnn gggggggggg 3017231DNAArtificial
SequenceSynthetic oligonucleotide 172ggnnnrycgr ynnnnnnnnn
nggggggggg g 3117332DNAArtificial SequenceSynthetic oligonucleotide
173ggnnnrycgr ynnnnnnnnn nngggggggg gg 3217433DNAArtificial
SequenceSynthetic oligonucleotide 174ggnnnrycgr ynnnnnnnnn
nnnggggggg ggg 3317534DNAArtificial SequenceSynthetic
oligonucleotide 175ggnnnrycgr ynnnnnnnnn nnnngggggg gggg
3417620DNAArtificial SequenceSynthetic oligonucleotide
176ggtgcatcga tgcagggggg 2017720DNAArtificial SequenceSynthetic
oligonucleotide 177ggtgcatcga tgcagggggg 2017820DNAArtificial
SequenceSynthetic oligonucleotide 178ggtgcaccgg tgcagggggg
2017920DNAArtificial SequenceSynthetic oligonucleotide
179atcgactctc gagcgttctc 2018011DNAArtificial SequenceSynthetic
oligonucleotide 180tcgtttgttc t 1118112DNAArtificial
SequenceSynthetic oligonucleotide 181tcgagcgttc tc 12
* * * * *