U.S. patent number 7,534,772 [Application Number 09/888,326] was granted by the patent office on 2009-05-19 for methods for enhancing antibody-induced cell lysis and treating cancer.
This patent grant is currently assigned to Coley Pharmaceutical GmbH, University of Iowa Research Foundation. Invention is credited to Gunther Hartmann, George Weiner.
United States Patent |
7,534,772 |
Weiner , et al. |
May 19, 2009 |
Methods for enhancing antibody-induced cell lysis and treating
cancer
Abstract
The invention relates to methods and products for treating
cancer. In particular the invention relates to combinations of
nucleic acids and antibodies for the treatment and prevention of
cancer. The invention also relates to diagnostic methods for
screening cancer cells.
Inventors: |
Weiner; George (Iowa City,
IA), Hartmann; Gunther (Alfter, DE) |
Assignee: |
University of Iowa Research
Foundation (Iowa City, IA)
Coley Pharmaceutical GmbH (Dusseldorf, DE)
|
Family
ID: |
22794755 |
Appl.
No.: |
09/888,326 |
Filed: |
June 22, 2001 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20030026801 A1 |
Feb 6, 2003 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60213346 |
Jun 22, 2000 |
|
|
|
|
Current U.S.
Class: |
514/44R;
424/130.1 |
Current CPC
Class: |
C07K
16/2803 (20130101); A61P 35/04 (20180101); A61P
35/02 (20180101); A61P 43/00 (20180101); C07K
16/2878 (20130101); A61K 39/39541 (20130101); C07K
16/2896 (20130101); A61P 35/00 (20180101); A61K
39/39541 (20130101); A61K 2300/00 (20130101); A61K
2039/505 (20130101) |
Current International
Class: |
A61K
48/00 (20060101); A61K 39/395 (20060101) |
Field of
Search: |
;514/44
;536/24.5,24.3,23.1 ;424/130.1,1.11 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 092 574 |
|
Nov 1983 |
|
EP |
|
0 239 490 |
|
Sep 1987 |
|
EP |
|
0 301 758 |
|
Feb 1989 |
|
EP |
|
0 468 520 |
|
Jan 1992 |
|
EP |
|
WO91/12811 |
|
Sep 1991 |
|
WO |
|
WO92/03456 |
|
Mar 1992 |
|
WO |
|
WO92/04381 |
|
Mar 1992 |
|
WO |
|
WO92/18522 |
|
Oct 1992 |
|
WO |
|
WO92/21353 |
|
Dec 1992 |
|
WO |
|
WO94/19945 |
|
Sep 1994 |
|
WO |
|
WO95/05853 |
|
Mar 1995 |
|
WO |
|
WO95/26204 |
|
Oct 1995 |
|
WO |
|
WO96/02555 |
|
Feb 1996 |
|
WO |
|
WO96/02560 |
|
Feb 1996 |
|
WO |
|
WO96/35782 |
|
Nov 1996 |
|
WO |
|
WO97/28259 |
|
Aug 1997 |
|
WO |
|
WO98/14210 |
|
Apr 1998 |
|
WO |
|
WO98/16247 |
|
Apr 1998 |
|
WO |
|
WO98/18810 |
|
May 1998 |
|
WO |
|
WO98/32462 |
|
Jul 1998 |
|
WO |
|
WO98/37919 |
|
Sep 1998 |
|
WO |
|
WO98/40100 |
|
Sep 1998 |
|
WO |
|
WO 9840100 |
|
Sep 1998 |
|
WO |
|
WO 98/42378 |
|
Oct 1998 |
|
WO |
|
WO98/52581 |
|
Nov 1998 |
|
WO |
|
WO98/55495 |
|
Dec 1998 |
|
WO |
|
WO99/51259 |
|
Oct 1999 |
|
WO |
|
WO99/56755 |
|
Nov 1999 |
|
WO |
|
WO99/58118 |
|
Nov 1999 |
|
WO |
|
WO99/61056 |
|
Dec 1999 |
|
WO |
|
WO00/06588 |
|
Feb 2000 |
|
WO |
|
WO00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/27428 |
|
May 2000 |
|
WO |
|
WO00/67023 |
|
Nov 2000 |
|
WO |
|
WO 00/67795 |
|
Nov 2000 |
|
WO |
|
WO 00/75348 |
|
Dec 2000 |
|
WO |
|
WO 01/22972 |
|
Apr 2001 |
|
WO |
|
WO 01/95935 |
|
Dec 2001 |
|
WO |
|
WO 02/069369 |
|
Sep 2002 |
|
WO |
|
WO 2004/007743 |
|
Jan 2004 |
|
WO |
|
WO 2004/026888 |
|
Apr 2004 |
|
WO |
|
WO 2004/094671 |
|
Nov 2004 |
|
WO |
|
WO 2006/080946 |
|
Aug 2006 |
|
WO |
|
WO 2007/031877 |
|
Mar 2007 |
|
WO |
|
WO 2007/038720 |
|
Apr 2007 |
|
WO |
|
Other References
Crystal R.G. Transfer of genes to humans: early lessons and
obstacles to success (Science, 1995; 270:404-409). cited by
examiner .
Walther W. et al. Viral vectors for gene transfer. (Drugs, 2000;
60:249-271). cited by examiner .
Greco O. et al. Cancer gene therapy: delivery, delivery, delivery
(Front. Biosci., 2002; 7:d1516-d1524; 2002). cited by examiner
.
Agrawal S. et al. Medicinal chemistry and therapeutic potential of
CpG DNA (Trends in Mol. Med., 2002; 8:114-121). cited by examiner
.
Hartmann G. et al. Delineation of a CpG phosphorothioate
oligodeoxynucleotide for activating primate immune responses in
vitro and in vivo. (Journ. Immunology, 2000; 164:1617-1624). cited
by examiner .
Krieg A. The CpG motif: implications for clinical immunology.
(BioDrugs, 1998; 5:341-346). cited by examiner .
Wooldridge J. et al. Immunostimulatory oligonucleotides containing
CpG motifs enhance the efficacy of monoclonal antibody therapy of
lymphocytes. (Blood, 1997; 89:2994-2998). cited by examiner .
Winkler et al. (Blood, 1999; vol. 94(7), pp. 2217-2224). cited by
examiner .
Pawade et al. (Histopathology, 1995; vol. 27(2), pp. 129-137).
cited by examiner .
Taji et al. (Japanese Juornal of Cancer Research, 1998; vol. 89(7),
pp 748-759). cited by examiner .
Micouin, A. et al. (Leukemia, 1997; vol. 1, pp. 552-560). cited by
examiner .
Azad RF et al., Antiviral activity of a phosphorothioate
oligonucleotide complementary to RNA of the human cytomegalovirus
major immediate-early region. Antimicrob Agents Chemother. Sep.
1993;37(9):1945-54. cited by other .
Azuma I, Biochemical and immunological studies on cellular
components of tubercle bacilli. Kekkaku 1992;67(9):45-55. cited by
other .
Ballas ZK et al., Induction of NK activity in murine and human
cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J
Immunol. Sep. 1, 1996;157(5):1840-5. cited by other .
Bayever E et al., Systemic administration of a Phosphorothioate
oligonucleotide with a sequence complementary to p53 for acute
myelogenous leukemia and myelodysplastic syndrome: initial results
of a phase I trial. Antisense Res Dev. 1993 Winter;3(4);383-90.
cited by other .
Beaucage SL et al., Deoxynucleoside phosphoramidites--a new class
of key intermediates for deoxypolynucleotide synthesis. Tetrahedron
Lett 22:1859, 1981. cited by other .
Bennett RM et al., DNA binding to human leukocytes. Evidence for a
receptor -mediated association, internalization, and degradation of
DNA. J Clin Invest. Dec. 1985; 76(6):2182-90. cited by other .
Blaxter ML et al., Genes expressed in Brugia malayi infective third
stage larvae. Mol Biochem Parasitol. Apr. 1996;77(1);77-93. cited
by other .
Boggs RT et al., Characterization and modulation of immune
stimulation by modified oligonucleotides. Antisense Nucleic Acid
Drug Dev. Oct. 1997;7(5);461-71. cited by other .
Branda RF et al., Amplification of antibody production by
phosphorothioate oligodeoxynucleotides. J Lab Clin Med. Sep.
1996;128(3):329-38. cited by other .
Branda RF et al., Immune stimulation by an antisense oligomer
complementary to the rev gene of HIV-1. Biochem Pharmacol. May 25,
1993;45(10):2037-43. cited by other .
Chace JH et al., Regulation of differentiation in CD5+ and
conventional B cells. Sensitivity to LPS-induced differentiation
and interferon-gamma-mediated inhibition of differentiation. Clin
Immunol Immunopathol. Sep. 1993;68(3):327-32. cited by other .
Chang YN et al., The palindromic series I repeats in the simian
cytomegalovirus major immediate-early promoter behave as both
strong basal enhancers and cyclic AMP response elements. J Virol.
Jan. 1990; 64(1):264-77. cited by other .
Chu RS et al., CpG oligodeoxynucleotides act as adjuvants that
switch on T helper 1 (Th1) immunity. J Exp Med. Nov. 17,
1997;186(10);1623-31. cited by other .
Coiffier B et al., Rituximab (anti-CD20 monoclonal antibody) for
the treatment of patients with relapsing or refractory aggressive
lymphoma: a multicenter phase II study. Blood. Sep. 15,
1998;92(6):1927-32. cited by other .
Cowdery JS et al., Bacterial DNA induces NK cells to produce
IFN-gamma in vivo and increases to toxicity of lipopolysaccharides.
J Immunol. Jun. 15, 1996;156(12):4570-5. cited by other .
Crystal RG, Transfer of genes to humans: early lessons and
obstacles to success. Science. Oct. 20, 1995;270(5235):404-10.
cited by other .
Davis HL et al., CpG DNA is a potent enhancer of specific immunity
in mice immunized with recombinant hepatitis B surface antigen. J
Immunol. Jan. 15, 1998;160(2):870-6. cited by other .
Decker T et al., Immunostimulatory CpG-oligonucleotides cause
proliferation, cytokine production, and an immunogenic phenotype in
chronic lymphocytic leukemia B cells. Blood. Feb. 1,
2000;95(3):999-1006. cited by other .
Englisch U et al., Chemically modified oligonucleotides as probes
and inhibitors. Angew Chemie Int Ed Engl. Jun. 1991;30(6);613-29.
cited by other .
Erb KJ et al., Infection of mice with Mycobacterium bovis-Bacillus
Calmette-Guerin (BCG) suppresses allergen-induced airway
eosinophilia. J Exp Med. Feb. 16, 1998;187(4):561-9. cited by other
.
Etlinger HM, Carrier sequence selection--one key to successful
vaccines. Immunol Today. Feb. 1992;13(2);52-5. cited by other .
Froehler BC et al., Synthesis of DNA via deoxynucleoside
H-phosphonate intermediates. Nucleic Acids Res. Jul. 11,
1986;14(13);5399-407. cited by other .
Gaffney BL et al., Large-scale oligonucleotide synthesis by the
H-phosphonate method. Tetrahedron Lett 29:2619-22 (1988). cited by
other .
Garegg PJ et al., Nucleoside H-phosphonates. III. Chemical
synthesis of oligodeoxyribonucleotides by the hydrogenphosphonate
approach. Tetrahedron Lett 27:4051-4 (1986). cited by other .
Garegg PJ et al., Nucleoside H-phosphonates. IV. Automated solid
phase synthesis of oligoribonucleotides by the hydrogenphosphonate
approach. Tetrahedron Lett 27:4055-8 (1986). cited by other .
Goodchild J, Conjugates of oligonucleotides and modified
oligonucleotides: a review of their synthesis and properties.
Bioconjugate Chem 1:165-87 (1990). cited by other .
Gura T, Antisense has growing pains. Science. Oct. 27,
1995;270(5236):575-7. cited by other .
Hadden JW et al., Immunopharmacology. Immunomodulation and
immunotherapy. JAMA. Nov. 25, 1992;268(20);2964-9. cited by other
.
Hadden JW, Immunostimulants. Trends Pharmacol Sci. May
1993;14(5):169-74. cited by other .
Halpern MD et al., Bacterial DNA induces murine interferon-gamma
production by stimulation of interleukin-12 and tumor necrosis
factor-alpha. Cell Immunol. Jan. 10, 1996;167(1);72-8. cited by
other .
Hartmann G et al., Mechanism and function of a newly identified CpG
DNA motif in human primary B cells. J Immunol. Jan. 15,
2000;164(2):944-53. cited by other .
Hartmann G et al., Spontaneous and cationic lipid-mediated uptake
of antisense oligonucleotides in human monocytes and lymphocytes. J
Pharmacol Exp Ther. May 1998; 285(2):920-8. cited by other .
Hatzfeld J et al., Release of early human hematopoietic progenitors
from quiescence by antisense transforming growth factor beta 1 or
Rb oligonucleotides. J Exp Med. Oct. 1,1991;174(4):925-9. cited by
other .
Hazenbos WLW et al., Murine IgG1 complexes trigger immune effector
functions predominantly via Fc gamma RIII (CD16). J Immunol. Sep.
15, 1998;161(6):3026-32. cited by other .
Highfield PE, Sepsis: the more, the murkier. Biotechnology (NY).
Aug. 1994;12(8):828. cited by other .
Hoeffler JP et al., Identification of multiple nuclear factors that
interact with cyclic adenosine 3'5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions. Mol Endocrinol. Feb.
1991;5(2):256-66. cited by other .
Iguchi-Ariga SM et al., CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation. Genes Dev. May
1989;3(5):612-9. cited by other .
Ishikawa R et al., IFN induction and associated changes in splenic
leukocyte distribution. J Immunol. May 1, 1993;150(9):3713-27.
cited by other .
Iversen PL et al., Pharmacokinetics of an antisense
phosphorothioate oligodeoxynucleotide against rev from human
immunodeficiency virus type 1 in adult male rat following single
injections and continuous infusion. Antisense Res Dev. 1994
Spring;4(1);43-52. cited by other .
Jakobovits A et al., Analysis of homozygous mutant chimeric mice:
deletion of the immunoglobulin heavy-chain joining region blocks
B-cell development and antibody production. Proc Natl Acad Sci USA.
Mar. 15, 1993;90(6):2551-5. cited by other .
Jakway JP et al., Growth regulation of the B lymphoma cell line
WEHI-231 by anti-immunoglobulin, lipopolysaccharide, and other
bacterial products. J Immunol. Oct. 1, 1986;137(7);2225-31. cited
by other .
Jaroszewski JW et al., Cellular uptake of antisense
oligodeoxynucleotides. Adv Drug Del Rev 1991; 6(3):235-50. cited by
other .
Kataoka T et al., Antitumor activity of synthetic oligonucleotides
with sequences from cDNA encoding proteins of Mycobacterium bovis
BCG. Jpn J Cancer Res. Mar. 1992;83(3):244-7. cited by other .
Kataoka T et al., Immunotherapeutic potential in guinea-pig tumor
model of deoxyribonucleic acid from Mycobacterium bovis BCG
complexed with poly-L-lysine and carboxymethycellulose. Jpn J Med
Sci Biol. Oct. 1990;43(5):171-82. cited by other .
Kimura Y et al., Binding of oligoguanylate to scavenger receptors
is required for oligonucleotides to augment NK cell activity and
induce IFN. J Biochem (Tokyo). Nov. 1994;116(5):991-4. cited by
other .
Klinman DM et al., Contribution of CpG motifs to the immunogenicity
of DNA vaccines. J Immunol. Apr. 15, 1997;158(8):3635-9. cited by
other .
Klinman DM et al., Immune recognition of foreign DNA: a cure for
bioterrorism? Immunity. Aug. 1999;11(2):123-9. cited by other .
Krieg AM et al., A role for endogenous retroviral sequences in the
regulation of lymphocyte activation. J Immunol. Oct. 15,
1989;143(8):2448-51. cited by other .
Krieg AM et al., CpG motifs in bacterial DNA trigger direct B-cell
activation. Nature. Apr. 6, 1995;374(6522):546-9. cited by other
.
Krieg AM et al., Leukocyte stimulation by oligodeoxynucleotides.
In: Applied Antisense Oligonucleotide Technology, Stein CA and
Krieg AM, eds., New York: Wiley-Liss, 1998; pp. 431-438. cited by
other .
Krieg AM et al., Mechanism of action of CpG DNA. Curr Top Microbiol
Immunol. 2000;247:1-21. cited by other .
Krieg AM et al., Mechanisms and therapeutic applications of immune
stimulatory CpG DNA. Pharmacol Ther. Nov. 1999;84(2):113-20. cited
by other .
Krieg Am et al., Modification of antisense phosphodiester
oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular
association and improves efficacy. Proc Natl Acad Sci U S A. Feb.
1, 1993; 90(3);1048-52. cited by other .
Krieg Am et al., Oligodeoxynucleotide modifications determine the
magnitude of B cell stimulation by CpG motifs. Antisense Nucleic
Acid Drug Dev. 1996 Summer;6(2):133-9. cited by other .
Krieg AM et al., Phosphorothioate oligodeoxynucleotides: antisense
or anti-protein? Antisense Res Dev. 1995 Winter;5(4);241. cited by
other .
Krieg AM et al., The role of CpG dinucleotides in DNA vaccines.
Trends Microbiol. Jan. 1998;6(1):23-7. cited by other .
Krieg AM et al., Uptake of oligodeoxyribonucleotides by lymphoid
cells is heterogeneous and inducible. Antisense Res Dev. 1991
Summer;1(2):161-71. cited by other .
Krieg AM, An innate immune defense mechanism based on the
recognition of CpG motifs in microbial DNA. J Lab Clin Med. Aug.
1996;128(2):128-33. cited by other .
Krieg AM, CpG DNA: a pathogenic factor in systemic lupus
erythematosus? J Clin Immunol. Nov. 1995;15(6):284-92. cited by
other .
Krieger M et al., Structures and functions of multiligand
lipoprotein receptors: macrophage scavenger receptors and LDL
receptor-related protein (LRP). Annu Rev Biochem. 1994;63:601-37.
cited by other .
Kuramoto E et al., Oligonucleotide sequences required for natural
killer cell activation. Jpn J Cancer Res. Nov. 1992;83(11):1128-31.
cited by other .
Lagneaux L et al., Chronic lymphocytic leukemic B cells but not
normal B cells are rescued from apoptosis by contact with normal
bone marrow stromal cells. Blood. Apr. 1, 1998; 91(7);2387-96.
cited by other .
Lipford GB et al., Bacterial DNA as immune cell activator. Trends
Microbiol. Dec. 1998;6(12);496-500. cited by other .
Lipford GB et al., CpG-containing synthetic oligonucleotides
promote B and cytotoxic T cell responses to protein antigen: a new
class of vaccine adjuvants. Eur J Immunol. Sep. 1997;27(9):2340-4.
cited by other .
Lipford GB et al., Immunostimulatory DNA: sequence-dependent
production of potentially harmful or useful cytokines. Eur J
Immunol. Dec. 1997;27(12);3420-6. cited by other .
Lyons AB et al., Determination of lymphocytic division by flow
cytometry. J Immunol Methods. May 2 1994;171(1):131-7. cited by
other .
Macaya RF et al., Thrombin-binding DNA aptamer forms a unimolecular
quadruplex structure in solution. Proc Natl Acad Sci USA. Apr. 15,
1993;90(8):3745-9. cited by other .
Macfarlane DE et al., Antagonism of immunostimulatory
CpG-oligodeoxynucleotides by quinacrine, chloroquine, and
structurally related compounds. J Immunol. Feb. 1, 1988;
160(3):1122-31. cited by other .
Manzel L et al., CpG-oligodeoxynucleotide-resistant variant of WEHI
231 cells. J Leukoc Biol. Nov. 1999;66(5):817-21. cited by other
.
Mastrangelo MJ et al., Gene therapy for human cancer: an essay for
clinicians. Semin Oncol. Feb. 1996;23(1):4-21. cited by other .
Matson S et al., Nonspecific suppression of [3H]thymidine
incorporation by "control" oligonucleotides. Antisense Res Dev.
1992 Winter;2(4);325-30. cited by other .
McIntyre KW et al., A sense phosphorothioate oligonucleotide
directed to the initiation codon of transcription factor NF-kappa B
p65 causes sequence-specific immune stimulation. Antisense Res Dev.
1993 Winter;3(4):309-22. cited by other .
Messina JP et al., Stimulation of in vitro murine lymphocyte
proliferation by bacterial DNA. J Immunol. Sep. 15,
1991;147(6):1759-64. cited by other .
Messina JP et al., The influence of DNA structure on the in vitro
stimulation of murine lymphocytes by natural and synthetic
polynucleotide antigens. Cell Immunol. Mar. 1993;147(1):148-57.
cited by other .
Mojcik CF et al., Administration of a phosphorothioate
oligonucleotide antisense to murine endogenous retroviral MCF env
causes immune effects in vivo in a sequence-specific manner. Clin
Immunol Immunopathol. May 1993;67(2):130-6. cited by other .
Moldoveanu Z et al., CpG DNA, a novel immune enhancer for systemic
and mucosal immunization with influenza virus. Vaccine. Jul. 1998;
16(11-12):1216-24. cited by other .
Mottram JC et al., A novel CDC2-related protein kinase from
Leishmania mexicana, LmmCRK1, is post-translationally regulated
during the life cycle. J Biol Chem. Oct. 5, 1993;268(28):21044-52.
cited by other .
NYCE JW et al., DNA antisense therapy for asthma in an animal
model. Nature. Feb. 20, 1997;385(6618):721-5. cited by other .
Paca-Uccaralertkun S et al., In vitro selection of DNA elements
highly responsive to the human T-cell lymphotropic virus type I
transcriptional activator, Tax. Mol Cell Biol. Jan.
1994;14(1):456-62. cited by other .
Pisetsky DS et al., Stimulation of in vitro proliferation of murine
lymphocytes by synthetic oligodeoxynucleotides. Mol Biol Rep. Oct.
1993;18(3);217-21. cited by other .
Pisetsky DS et al., Stimulation of murine lymphocyte proliferation
by a phosphorothioate oligonucleotide with antisense activity for
herpes simplex virus. Life Sci. 1994;54(2):101-7. cited by other
.
Pisetsky DS et al., The influence of base sequence on the
immunological properties of defined oligonucleotides.
Immunopharmacology. Nov. 1998,40(3):199-208. cited by other .
Pisetsky DS, Immunologic consequences of nucleic acid therapy.
Antisense Res Dev. 1995 Fall;5(3):219-25. cited by other .
Pisetsky DS, The immunologic properties of DNA. J Immunol. Jan. 15,
1996;156(2):421-3. cited by other .
Raz E et al., Preferential induction of a Th1 immune response and
inhibition of specific IgE antibody formation by plasmid DNA
immunization. Proc Natl Acad Sci USA. May 14, 1996;93(10):5141-5.
cited by other .
Roman M et al., Immunostimulatory DNA sequences function as T
helper-1-promoting adjuvants. Nat Med. Aug. 1997;3:849-54. cited by
other .
Sato Y et al., Immunostimulatory DNA sequences necessary for
effective intradermal gene immunization. Science. Jul. 19,
1996;273(5273):352-4. cited by other .
Schnell N et al., Identification and characterization of a
Saccharomyces cerevisiae gene (PAR1) conferring resistance to iron
chelators. Eur J Biochem. Sep. 1, 1991;200(2):487-93. cited by
other .
Shan D et al., Apoptosis of malignant human B cells by ligation of
CD20 with monoclonal antibodies. Blood. Mar. 1, 1998;91(5):1644-52.
cited by other .
Shirakawa T et al., The inverse association between tuberculin
responses and atopic disorder. Science. Jan. 3,
1997;275(5296):77-9. cited by other .
Sparwasser T et al., Bacterial DNA and immunostimulatory CpG
oligonucleotides trigger maturation and activation of murine
dendritic cells. Eur J Immunol. Jun. 1998;28(6):2045-54. cited by
other .
Sparwasser T et al., Macrophages sense pathogens via DNA motifs:
induction of tumor necrosis factor-alpha-mediated shock. Eur J
Immunol. Jul 1997;27(7):1671-9. cited by other .
Stec WJ et al., Diastereomers of nucleoside
3'-O-(2-thio-1,3,2-oxa(selena)phospholanes): building blocks for
stereocontrolled synthesis of oligo(nucleoside phosphorothioate)s.
J Am Chem Soc. Dec. 13, 1995;117(49):12019-29. cited by other .
Stein CA et al., Oligodeoxynucleotides as inhibitors of gene
expression: a review. Cancer Res. May 15, 1988, 48(10);2659-68.
cited by other .
Stull RA et al., Antigene, ribozyme and aptamer nucleic acid drugs:
progress and prospects. Pharm Res. Apr. 1995;12(4):465-83. cited by
other .
Subramanian PS et al., Theoretical considerations on the "spine of
hydration" in the minor groove of d(CGCGAATTCGCG).d(GCGCTTAAGCGC):
Monte Carlo computer simulation. Proc Natl Acad Sci U S A. Mar.
1988;85(6):1836-40. cited by other .
Sun S et al., Mitogenicity of DNA from different organisms for
murine B cells. J Immunol. Oct. 1, 1997;159(7):3119-25. cited by
other .
Tanaka T et al., An antisense oligonucleotide complementary to a
sequence in I gamma 2b increases gamma 2b germline transcripts,
stimulates B cell DNA synthesis, and inhibits immunoglobulin
secretion. J Exp Med. Feb. 1, 1992;175(2):597-607. cited by other
.
Threadgill DS et al., Mitogenic synthetic polynucleotides suppress
the antibody response to a bacterial polysaccharide. Vaccine. Jan.
1998;16(1):76-82. cited by other .
Tsukada J et al., Transcription factors NF-IL6 and CREB recognize a
common essential site in the human prointerleukin 1 beta gene. Mol
Cell Biol. Nov. 1994;14(11);7285-97. cited by other .
Tutt AL et al., Monoclonal antibody therapy of B cell lymphoma:
signaling activity on tumor cells appears more important than
recruitment of effectors. J Immunol. Sep. 15, 1998;161(6):3176-85.
cited by other .
Uhlmann E et al., Antisense oligonucleotides: a new therapeutic
principle. Chem Rev. Jun. 1990; 90(4):543-84. cited by other .
Wagner RW, Gene inhibition using antisense oligodeoxynucleotides.
Nature. Nov. 24, 1994;372(6504):333-5. cited by other .
Wallace RB et al., Oligonucleotide probes for the screening of
recombinant DNA libraries. Methods Enzymol. 1987;152:432-42. cited
by other .
Weiner GJ et al., Immunostimulatory oligodeoxynucleotides
containing the CpG motif are effective as immune adjuvants in tumor
antigen immunization. Proc Natl Acad Sci USA. Sep. 30,
1997;94(20):10833-7. cited by other .
Wooldridge JE et al., Immunostimulatory oligodeoxynucleotides
containing CpG motifs enhance the efficacy of monoclonal antibody
therapy of lymphoma. Blood. Apr. 15, 1997;89(8):2994-8. cited by
other .
Wu GY et al., Receptor-mediated gene delivery and expression in
vivo. J Biol Chem. Oct. 15, 1988;263(29):14621-4. cited by other
.
Wu-Pong S, Oligonucleotides: opportunities for drug therapy and
research. Pharm Technol. Oct. 1994;18:102-14. cited by other .
Wyatt JR et al., Combinatorially selected guanosine-quartet
structure is a potent inhibitor of human immunodeficiency virus
envelope-mediated cell fusion. Proc Natl Acad Sci USA. Feb. 15,
1994;91(4):1356-60. cited by other .
Yamamoto S et al., Mode of action of oligonucleotide fraction
extracted from Mycobacterium bovis BCG. Kekkaku 1994;69(9):29-32.
cited by other .
Yamamoto T et al., Lipofection of synthetic
oligodeoxyribonucleotide having a palindromic sequence of AACGTT to
murine splenocytes enhances interferon production and natural
killer activity. Microbiol Immunol. 1994;38(10):831-6. cited by
other .
Yamamoto T et al., Synthetic oligonucleotides with certain
palindromes stimulate interferon production of human peripheral
blood lymphocytes in vitro. Jpn J Cancer Res. Aug.
1994;85(8):775-9. cited by other .
Yi AK et al., IFN-gamma promotes IL-6 and IgM secretion in response
to CpG motifs in bacterial DNA and oligodeoxynucleotides. J
Immunol. Jan. 15, 1996;156(2):558-64. cited by other .
Zhao Q et al., Comparison of cellular binding and uptake of
antisense phosphodiester, phosphorothioate, and mixed
phosphorothioate and methylphosphonate oligonucleotides. Antisense
Res Dev. 1993 Spring;3(1):53-66. cited by other .
Zhao Q et al., Stage-specific oligonucleotide uptake in murine bone
marrow B-cell precursors. Blood. Dec. 1, 1994;84(11):3660-6. cited
by other .
Tokunaga T et al., Synthetic oligonucleotides with particular base
sequences from the cDNA encoding proteins of Mycobacterium bovis
BCG induce interferons and activate natural killer cells. Microbiol
Immunol. 1992;36(1):55-66. cited by other .
Tokunaga T et al., A synthetic single-stranded DNA, poly(dG,dC),
induces interferon-alpha/beta and -gamma, augments natural killer
activity, and suppresses tumor growth, Jpn J Cancer Res. Jun.
1988;79(6):682-6. cited by other .
Yamamoto T et al., Ability of oligonucleotides with certain
palindromes to induce interferon production and augment natural
killer cell activity is associated with their base length.
Antisense Res Dev. 1994 Summer;4(2):119-22. cited by other .
Yamamoto S et al., DNA from bacteria, but not from vertebrates,
induces interferons, activates natural killer cells and inhibits
tumor growth. Microbiol Immunol. 1992;36(9):983-97. cited by other
.
Yamamoto S et al., In vitro augmentation of natural killer cell
activity and production of interferon-alpha/beta and -gamma with
deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn J
Cancer Res. Jul. 1988;79(7):866-73. cited by other .
Yamamoto S et al., Unique palindromic sequences in synthetic
oligonucleotides are required to induce IFN and augment
IFN-mediated natural killer activity. J Immunol. Jun.15,
1992;148(12):4072-6. cited by other .
Jahrsdorfer B et al., CpG DNA increases primary malignant B cell
expression of costimulatory molecules and target antigens. J Leukoc
Biol. Jan. 2001;69(1):81-8. cited by other .
Krieg AM et al., Applications of immune stimulatory CpG DNA for
antigen-specific immunotherapy. Eur J Cancer 1999; 35 Supp 5:S10.
cited by other .
Warren TL et al., CpG oligodeoxynucleotides enhance monoclonal
antibody therapy of a murine lymphoma. Clin Lymphoma. Jun.
2000;1(1):57-61. cited by other .
Boerner P et al., Production of antigen-specific human monoclonal
antibodies from in vitro-primed human splenocytes. J Immunol. Jul.
1, 1991;147(1):86-95. cited by other .
Chaperot L et al., Functional expression of CD80 and CD86 allows
immunogenicity of malignant B cells from non-Hodgkin's lymphomas.
Exp Hematol. Mar. 1999;27(3):479-88. cited by other .
Davis TA et al., Single-agent monoclonal antibody efficacy in bulky
non-Hodgkin's lymphoma: results of a phase II trial of rituximab. J
Clin Oncol. Jun. 1999;17(6):1851-7. cited by other .
Davis TA et al., Therapy of B-cell lymphoma with anti-CD20
antibodies can result in the loss of CD20 antigen expression. Clin
Cancer Res. Mar. 1999;5(3):611-5. cited by other .
Elsasser D et al., HLA class II as potential target antigen on
malignant B cells for therapy with bispecific antibodies in
combination with granulocyte colony-stimulating factor. Blood. May
1, 1996;87(9):3803-12. cited by other .
Foran JM et al., European phase II study of rituximab (chimeric
anti-CD20 monoclonal antibody) for patients with newly diagnosed
mantle-cell lymphoma and previously treated mantle-cell lymphoma,
immunocytoma, and small B-cell lymphocytic lymphoma. J Clin Oncol.
Jan. 2000;18(2):317-24. cited by other .
Funakoshi S et al., Inhibition of human B-cell lymphoma growth by
CD40 stimulation. Blood. May 15, 1994;83(10):2787-94. cited by
other .
Ginaldi L et al., Levels of expression of CD19 and CD20 in chronic
B cell leukaemias. J Clin Pathol. May 1998;51(5):364-9. cited by
other .
Gordon J et al., Regulation of survival in normal and neoplastic B
lymphocytes. Leukemia. Aug. 1993;7 Suppl 2:S5-9. cited by other
.
Gordon J et al., Signals for survival and apoptosis in normal and
neoplastic B lymphocytes. Adv Exp Med Biol. 1996;406:139-44. cited
by other .
Grillo-Lopez AJ et al, Overview of the clinical development of
rituximab: first monoclonal antibody approved for the treatment of
lymphoma. Semin Oncol. Oct. 1999;26(5 Suppl 14):66-73. cited by
other .
Higaki Y et al., Mechanisms involved in the inhibition of growth of
a human B lymphoma cell line, B104, by anti-MHC class II
antibodies. Immunol Cell Biol. Jun. 1994;72(3):205-14. cited by
other .
Jakobovits A et al., Germ-line transmission and expression of a
human-derived yeast artificial chromosome. Nature. Mar. 18,
1993;362(6417):255-8. cited by other .
Kinoshita T et al., CD20-negative relapse in B-cell lymphoma after
treatment with Rituximab. J Clin Oncol. Dec. 1998;16(12)3916. cited
by other .
Kozbor D et al., A human hybrid myeloma for production of human
monoclonal antibodies. J Immunol. Dec. 1984;133(6):3001-5. cited by
other .
Langer R, New methods of drug delivery. Science. Sep. 28,
1990;249(4976):1527-33. cited by other .
Li X et al., Detection of apoptosis and DNA replication by
differential labeling of DNA strand breaks with fluorochromes of
different color. Exp Cell Res. Jan. 10, 1996;222(1):28-37. cited by
other .
Link BK et al., Anti-CD3-based bispecific antibody designed for
therapy of human B-cell malignancy can induce T-cell activation by
antigen-dependent and antigen-independent mechanisms. Int J Cancer.
Jul. 17, 1998;77(2):251-6. cited by other .
Link BK et al., Production and characterization of a bispecific IgG
capable of inducing T-cell-mediated lysis of malignant B cells.
Blood. Jun. 15, 1993;81(12):3343-9. cited by other .
Maloney DG, Preclinical and phase I and II trials of rituximab.
Semin Oncol. Oct. 1999;26(5 Suppl 14):74-8. cited by other .
Martin-Orozco E et al., Enhancement of antigen-presenting cell
surface molecules involved in cognate interactions by
immunostimulatory DNA sequences. Int Immunol. Jul.
1999;11(7):1111-8. cited by other .
Mayumi M et al., Negative signaling in B cells by surface
immunoglobulins. J Allergy Clin ImmunolDec. 1996;98(6 Pt
2):S238-47. cited by other .
McLaughlin P et al., Clinical status and optimal use of rituximab
for B-cell lymphomas. Oncology (Huntingt). Dec. 1998;12(12):1763-9.
cited by other .
McLaughlin P et al., Rituximab in indolent lymphoma: the
single-agent pivotal trial. Semin Oncol. Oct. 1999;26(5 Suppl
14):79-87. cited by other .
Schultze JL et al., T cell mediated immunotherapy for B cell
lymphoma. J Mol Med. Mar. 1999;77(3):322-31. cited by other .
Wagner H, Bacterial CpG DNA activates immune cells to signal
infectious danger. Adv Immunol. 1999;73:329-68. cited by other
.
Wagner RW et al., Potent and selective inhibition of gene
expression by an antisense heptanucleotide. Nat Biotechnol. Jul.
1996;14(7):840-4. cited by other .
Wahl RL et al., Improved radioimaging and tumor localization with
monoclonal F(ab')2.J Nucl Med. Apr. 1983;24(4):316-25. cited by
other .
Wiseman GA et al., Radioimmunotherapy of relapsed non-Hodgkin's
lymphoma with zevalin, a 90Y-labeled anti-CD20 monoclonal antibody.
Clin Cancer Res. Oct. 1999;5(10 Suppl):3281s-3286s. cited by other
.
Witzig TE et al., Phase I/II trial of IDEC-Y2B8 radioimmunotherapy
for treatment of relapsed or refractory CD20(+) B-cell
non-Hodgkin's lymphoma. J Clin Oncol. Dec. 1999;17(12):3793-803.
cited by other .
Wooldridge JE et al., Select unmethylated CpG oligodeoxynucleotides
improve antibody-dependent cellular cytotoxicity in vitro and in
vivo. Abstract #3253. Proc Am Assn Cancer Res Mar. 1996;37:477.
cited by other .
Wooldridge JE et al., Select unmethylated CpG oligodeoxynucleotides
improve antibody dependent cellular cytotoxicity in vitro of both
murine and human B cell lymphomas. Abstract #2877. Blood Dec.
1995;86:722A. cited by other .
Bauer M et al., DNA activates human immune cells through a CpG
sequence-dependent manner. Immunology. Aug. 1999;97(4):699-705.
cited by other .
Hartmann G et al., CpG DNA: a potent signal for growth, activation,
and maturation of human dendritic cells. Proc Natl Acad Sci U S A.
Aug. 3, 1999;96(16):9305-10. cited by other .
Macfarlane DE et al., Immunostimulatory CpG-oligodeoxynucleotides
induce a factor that inhibits macrophage adhesion. J Lab Clin Med .
Nov. 1999;134(5):501-9. cited by other .
Sun S et al, Type I interferon-mediated stimulation of T cells by
CpG DNA. J Exp Med. Dec. 21, 1998;188(12):2335-42. cited by
other.
|
Primary Examiner: Angell; J. E
Attorney, Agent or Firm: Wolf, Greenfield & Sacks, P.C.
Benson; Gregg C.
Parent Case Text
PRIORITY
This application claims the benefit of U.S. Provisional Application
No. 60/213,346, filed Jun. 22, 2000.
Claims
We claim:
1. A method for treating a subject having a B-cell malignancy
resistant to therapy with an antibody specific for a surface
antigen selected from CD19, CD20, and CD22, wherein cells of the
malignancy have low or no baseline expression of the surface
antigen, the method comprising: administering to the subject the
immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729)
comprising a backbone modification and an unmethylated C, in an
effective amount to upregulate expression of the surface antigen by
the cells; and administering to the subject an antibody specific
for the upregulated surface antigen, in an effective amount to
treat the subject.
2. A method for treating a subject having a B-cell malignancy,
wherein cells of the B-cell malignancy have low or no baseline
expression of CD20, the method comprising: administering to the
subject the immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID
NO:729) comprising a backbone modification and an unmethylated C,
in an effective amount to upregulate expression of CD20 by the
cells; and administering to the subject an antibody specific for
CD20, in an effective amount to treat the subject.
3. A method for treating a subject having a marginal zone lymphoma
or B-cell chronic lymphocytic leukemia, wherein cells of the
lymphoma or leukemia have low or no baseline expression of an
antigen selected from CD19 and CD22, the method comprising:
administering to the subject the immunostimulatory CpG
oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone
modification and an unmethylated C, in an effective amount to
upregulate expression of the antigen by the cells of the lymphoma
or leukemia; and administering to the subject an antibody specific
for the upregulated antigen, in an effective amount to treat the
subject.
4. A method for treating a subject having a B-cell malignancy,
wherein cells of the malignancy upregulate expression of a surface
antigen selected from CD19, CD20, and CD22, in response to
immunostimulatory CpG oligonucleotide, the method comprising:
isolating malignant B cells from the subject; identifying a surface
antigen selected from CD19, CD20, and CD22, the expression of which
can be upregulated in response to immunostimulatory CpG
oligonucleotide, wherein the surface antigen is expressed by the
malignant B cells in an amount lower than that of normal B cells;
administering to the subject the immunostimulatory CpG
oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone
modification and an unmethylated C, in an effective amount to
upregulate expression of the surface antigen by the cells; and
administering to the subject an antibody specific for the
upregulated surface antigen, in an amount effective to treat the
subject.
Description
FIELD OF THE INVENTION
The invention relates to the treatment and prevention of cancer
using immunostimulatory nucleic acids and antibodies.
BACKGROUND OF THE INVENTION
Cancer is the second leading cause of death, resulting in one out
of every four deaths in the United States. In 1997, the estimated
total number of new diagnoses for lung, breast, prostate,
colorectal and ovarian cancer was approximately two million. Due to
the ever increasing aging population in the United States, it is
reasonable to expect that rates of cancer incidence will continue
to grow.
Cancer is a disease which involves the uncontrolled growth (i.e.,
division) of cells. Some of the known mechanisms which contribute
to the uncontrolled proliferation of cancer cells include growth
factor independence, failure to detect genomic mutation, and
inappropriate cell signaling. The ability of cancer cells to ignore
normal growth controls may result in an increased rate of
proliferation. Although the causes of cancer have not been firmly
established, there are some factors known to contribute, or at
least predispose a subject, to cancer. Such factors include
particular genetic mutations (e.g., BRCA gene mutation for breast
cancer, APC for colon cancer), exposure to suspected cancer-causing
agents, or carcinogens (e.g., asbestos, UV radiation) and familial
disposition for particular cancers such as breast cancer.
Cancer is currently treated using a variety of modalities including
surgery, radiation therapy and chemotherapy. The choice of
treatment modality will depend upon the type, location and
dissemination of the cancer. For example, surgery and radiation
therapy may be more appropriate in the case of solid well-defined
tumor masses and less practical in the case of non-solid tumor
cancers such as leukemia and lymphoma. One of the advantages of
surgery and radiation therapy is the ability to control to some
extent the impact of the therapy, and thus to limit the toxicity to
normal tissues in the body. However, surgery and radiation therapy
are often followed by chemotherapy to guard against any remaining
or radio-resistant cancer cells. Chemotherapy is also the most
appropriate treatment for disseminated cancers such as leukemia and
lymphoma as well as metastases.
More recently, the use of CpG containing nucleic acids has been
proposed for the treatment and prevention of cancer. We have found
that unmethylated CG-dinucleotides within certain sequence contexts
(CpG DNA) are recognized by the vertebrate immune system as foreign
DNA (bacterial or viral). CpG DNA activates a coordinated set of
immune responses that include innate immunity (macrophages,
dendritic cells, and natural killer cells), humoral immunity, and
cellular immunity. Krieg A M et al., Pharmacol Ther 84:113-20
(1999); Krieg A M et al., Curr Top Microbiol Immunol 247:1-21
(2000); Wagner H, Adv Immunol 73:329-68 (1999). As a vaccine
adjuvant, CpG DNA is at least as effective as the gold standard
complete Freund's adjuvant (CFA), but induces higher Th1 activity
and demonstrates less toxicity. Chu R S et al., J Exp Med
186:1623-31 (1997); Weiner G J et al., Proc Natl Acad Sci USA
94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997); Lipford
G B et al., Eur J Immunol 27:2340-4 (1997); Davis H L et al., J
Immunol 160:870-6 (1998). Recently, we identified a human CpG motif
which triggers proliferation and activation of primary human B
cells. Hartmann G et al., J Immunol 164:944-53 (2000).
SUMMARY OF THE INVENTION
The invention relates in some aspects to methods for treating and
preventing cancer using immunostimulatory nucleic acids and
antibodies. Thus in one aspect the invention is a method for
treating or preventing cancer. The method involves administering to
a subject having or at risk of developing cancer an effective
amount to upregulate CD20 expression of a nucleic acid, and an
anti-CD20 antibody. The cancer, in some embodiments, is B-cell
lymphoma associated with low levels of CD20 expression. The B-cell
lymphoma in other embodiments is B-cell chronic lymphocytic
leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments
the CD20 antibody is C2B8 or Rituximab.
The invention in other aspects relates to a method for diagnosing
lymphoma by isolating a B cell from a subject and identifying a
change in cell surface markers when the B cell is contacted with an
immunostimulatory nucleic acid, wherein the cell surface marker
induced on the B cell is indicative of the type of lymphoma. In
some embodiments the subject has a type of lymphoma. In some
embodiments the subject is suspected of having a type of lymphoma.
The method may optionally include a method for treating cancer by
administering to the subject an immunostimulatory nucleic acid and
an antibody specific for the cell surface antigens induced on the B
cell in order to treat the cancer.
In another aspect the invention is a method for treating or
preventing cancer by administering to a subject having or at risk
of developing cancer an effective amount to induce expression of a
surface antigen on a cancer cell surface, of a nucleic acid, and
administering to the subject an antibody selected from the group
consisting of an anti-CD22 antibody and an anti-CD19 antibody.
According to another aspect of the invention, a method for treating
lymphoma is provided. The method includes the steps of isolating a
B cell from a subject having lymphoma, identifying a surface
antigen which is not expressed or which is expressed on the surface
of the B cell in an amount lower than that of a control B cell,
administering to the subject an antibody specific for the
identified surface antigen and an immunostimulatory nucleic acid in
order to treat the lymphoma, wherein the nucleic acid is
administered in an effective amount to upregulate expression of the
surface antigen on the lymphoma cell surface.
A method for treating a lymphoma resistant to antibody therapy is
provided according to another aspect of the invention. The method
includes administering to a subject having a lymphoma resistant to
therapy with an antibody specific for a surface antigen, an
antibody specific for the surface antigen to which the lymphoma is
resistant and a nucleic acid in order to treat the lymphoma,
wherein the nucleic acid is administered in an effective amount to
upregulate expression of the surface antigen on the lymphoma cell
surface.
The surface antigen may be any type of surface antigen which is
capable of being expressed on the surface of a cancer cell and
which is induced by stimulation with immunostimulatory nucleic
acids. In some embodiments the surface antigen is CD20, CD40, CD22,
or CD19. In other embodiments the lymphoma is B-CLL or marginal
zone lymphoma. In some embodiments the antibody is an anti-CD20
antibody. In some embodiments the anti-CD20 antibody is C2B8. In
another embodiment the anti-CD20 antibody is Rituximab.
In some preferred embodiments the antibody is a human IgG1
antibody. In some preferred embodiments the antibody is a murine
IgG2a antibody.
In some embodiments the methods also include administering an
anti-cancer therapy to the subject.
The invention also includes a method for treating cancer in a human
by administering to a human an immunostimulatory nucleic acid and
an antibody of IgG1 isotype (an IgG1 isotype antibody as used
herein refers to a human or humanized IgG1 unless otherwise
specified), which binds to a cell surface antigen of a cancer cell
and wherein the nucleic acid and the antibody are administered in
an effective amount for killing the cancer cell.
Optionally the nucleic acid and the antibody are administered
together. Alternatively the nucleic acid and the antibody may be
administered separately.
In some embodiments the method includes the step of administering a
cancer therapy. As used herein the term "a cancer therapy" is meant
to embrace a single medicament, a plurality of medicaments of a
particular class and a plurality of medicaments of different
classes, and includes but is not limited to chemotherapeutic
agents, cancer vaccines, biological response modifiers, and hormone
therapies.
A chemotherapeutic agent may be selected from the group consisting
of methotrexate, vincristine, adriamycin, cisplatin, non-sugar
containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C,
bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine
GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566,
RAS famesyl transferase inhibitor, famesyl transferase inhibitor,
MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470,
Hycamtin/Topotecan, PKC412, Valspodar/PSC833,
Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070,
BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853,
ZD0101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP
845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317,
Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative,
Temodal/Temozolomide, Evacet/liposomal doxorubicin,
Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine,
Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid,
SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609
(754)/RAS oncogene inhibitor, BMS-182751/oral platinum,
UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU
enhancer, Campto/Levamisole, Camptosar/Irinotecan,
Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin,
Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU
79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal
doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine
seeds, CDK4 and CDK2 inhibitors, PARP inhibitors,
D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide,
Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD
9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane
Analog, nitrosoureas, alkylating agents such as Melphalan,
Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP
16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea
(hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine
sulfate.
In some preferred embodiments the chemotherapeutic agent may be
selected from the group consisting of methotrexate, vincristine,
adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin,
dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone,
Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel,
Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol,
BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel,
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin,
Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt,
Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine,
Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin,
Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel,
prodrug of guanine arabinoside, nitrosoureas, alkylating agents
such as melphalan and cyclophosphamide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl,
Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide,
Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU),
Mechlorethamine HCl (nitrogen mustard), Mercaptopurine,
Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa,
Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin
(2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine
sulfate.
A cancer vaccine may be selected from the group consisting of EGF,
Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine,
MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax,
L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic
vaccine, Melacine, peptide antigen vaccines, toxin/antigen
vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN,
DISC-virus and ImmuCyst/TheraCys. Biological response modifiers
include interferon, and lymphokines such as IL-2. Hormone
replacement therapy includes tamoxifen alone or in combination with
progesterone. In a further embodiment, the cancer therapy is
interferon-.alpha. (e.g., INTRON.RTM. A, Schering).
The cancer may be selected from the group consisting of basal cell
carcinoma, bladder cancer, bone cancer, brain and central nervous
system (CNS) cancer, breast cancer, cervical cancer, colon and
rectum cancer, connective tissue cancer, esophageal cancer, eye
cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung
cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, melanoma,
myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and
pharynx), ovarian cancer, pancreatic cancer, prostate cancer,
rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer,
and uterine cancer. In preferred embodiments, the cancer to be
treated may be selected from the group consisting of bone cancer,
brain and CNS cancer, connective tissue cancer, esophageal cancer,
eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer
(e.g., lip, tongue, mouth, and pharynx), skin cancer, and
testicular cancer.
In another aspect the invention encompasses a kit. The kit includes
a package including at least two containers, the first container
housing an immunostimulatory nucleic acid, the second container
housing an antibody specific for a cell surface antigen, and
instructions for screening a cell to determine whether the
immunostimulatory nucleic acid upregulates expression of the cell
surface antigen. In one embodiment the antibody is selected from
the group consisting of an anti-CD20 antibody, an anti-CD19
antibody, and an anti-CD22 antibody.
The nucleic acids useful according to the invention are
immunostimulatory nucleic acids and in some embodiments are
immunostimulatory CpG nucleic acids having an unmethylated CpG
motif, immunostimulatory T-rich nucleic acids, immunostimulatory
poly-G nucleic acids, bacterial DNA, yeast DNA, or eukaryotic
DNA.
In some embodiments the nucleic acid does not hybridize with
genomic DNA or RNA under stringent conditions. In other embodiments
the nucleic acid does hybridize with genomic DNA or RNA under
stringent conditions.
The nucleic acid may have natural linkages or may include at least
one modified backbone internucleotide linkage. In some embodiments
the modified backbone is a phosphate backbone modification. In
other embodiments the modified backbone is a peptide modified
oligonucleotide backbone. The nucleic acid may also include native
bases or modified bases. The nucleotide backbone may be chimeric,
or the nucleotide backbone is entirely modified.
The immunostimulatory nucleic acid can have any length greater than
6 nucleotides, but in some embodiments is between 8 and 100
nucleotide residues in length. In other embodiments the nucleic
acid comprises at least 20 nucleotides, at least 24 nucleotides, at
least 27, nucleotides, or at least 30 nucleotides. The nucleic acid
may be single-stranded or double-stranded. In some embodiments the
nucleic acid is isolated and in other embodiments the nucleic acid
may be a synthetic nucleic acid.
The CpG nucleic acid in one embodiment contains at least one
unmethylated CpG dinucleotide having a sequence including at least
the following formula: 5' X.sub.1X.sub.2CGX.sub.3X.sub.4 3' wherein
C is unmethylated, wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4
are nucleotides. In one embodiment the 5'
X.sub.1X.sub.2CGX.sub.3X.sub.4 3' sequence of the CpG nucleic acid
is a non-palindromic sequence, and in other embodiments it is a
palindromic sequence.
In some embodiments X.sub.1X.sub.2 are nucleotides selected from
the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA,
CpG, TpA, TpT, and TpG; and X.sub.3X.sub.4 are nucleotides selected
from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC,
ApC, CpC, TpA, ApA, and CpA. In other embodiments X.sub.1X.sub.2
are GpA or GpT and X.sub.3X.sub.4 are TpT. In yet other embodiments
X.sub.1 or X.sub.2 or both are purines and X.sub.3 or X.sub.4 or
both are pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or
X.sub.4 or both are pyrimidines. In one embodiment X.sub.2 is a T
and X.sub.3 is a pyrimidine.
In other embodiments the CpG nucleic acid has a sequence selected
from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91, 92,
101, 108, 111, 135, 141, 151, 274, 277, 280, 286, 319, 350, 363,
368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557,
560-563, 566, 585, 590, 591, 595, 599, 603, 605, 611, 614-616, 650,
676, 679, 682, 684, 702, 703, 707-710, 717-720, 729-732, 752, 755,
770, and 801-803.
In some embodiments the T-rich immunostimulatory nucleic acid is a
poly-T nucleic acid comprising 5' TTTT 3'. In yet other embodiments
the poly-T nucleic acid comprises 5'
X.sub.1X.sub.2TTTTX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2,
X.sub.3, and X.sub.4 are nucleotides. In some embodiments
X.sub.1X.sub.2 is TT and/or X.sub.3X.sub.4 is TT. In other
embodiments X.sub.1X.sub.2 is selected from the group consisting of
TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC;
and/or X.sub.3X.sub.4 is selected from the group consisting of TA,
TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
The T-rich immunostimulatory nucleic acid may have only a single
poly-T motif or it may have a plurality of poly-T nucleic acid
motifs. In some embodiments the T-rich immunostimulatory nucleic
acid comprises at least 2, at least 3, at least 4, at least 5, at
least 6, at least 7, or at least 8 T motifs. In other embodiments
it comprises at least 2, at least 3, at least 4, at least 5, at
least 6, at least 7, or at least 8 CpG motifs. In some embodiments
the plurality of CpG motifs and poly-T motifs are interspersed.
In yet other embodiments at least one of the plurality of poly-T
motifs comprises at least 3, at least 4, at least 5, at least 6, at
least 7, at least 8, or at least 9 contiguous T nucleotide
residues. In other embodiments the plurality of poly-T motifs is at
least 3 motifs and wherein at least 3 motifs each comprises at
least 3 contiguous T nucleotide residues or the plurality of poly-T
motifs is at least 4 motifs and wherein the at least 4 motifs each
comprises at least 3 contiguous T nucleotide residues.
The T-rich immunostimulatory nucleic acid may include one or more
CpG motifs. In other embodiments the T-rich immunostimulatory
nucleic acid is free of one or more CpG dinucleotides.
In other embodiments the T-rich immunostimulatory nucleic acid has
poly A, poly-G, and/or poly C motifs. In other embodiments the
T-rich immunostimulatory nucleic acid is free of two poly C
sequences of at least 3 contiguous C nucleotide residues.
Preferably the T-rich immunostimulatory nucleic acid is free of two
poly A sequences of at least 3 contiguous A nucleotide residues. In
other embodiments the T-rich immunostimulatory nucleic acid
comprises a nucleotide composition of greater than 25% C or greater
than 25% A. In yet other embodiments the T-rich immunostimulatory
nucleic acid is free of poly-C sequences, poly-G sequences or
poly-A sequences.
In some cases the T-rich immunostimulatory nucleic acid may be free
of poly-T motifs, but rather, comprises a nucleotide composition of
greater than 25% T. In other embodiments the T-rich
immunostimulatory nucleic acid may have poly-T motifs and also
comprise a nucleotide composition of greater than 25% T. In some
embodiments the T-rich immunostimulatory nucleic acid comprises a
nucleotide composition of greater than 25% T, greater than 30% T,
greater than 40% T, greater than 50% T, greater than 60% T, greater
than 80% T, or greater than 90% T nucleotide residues.
In some embodiments the poly-G nucleic acid comprises: 5'
X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2,
X.sub.3, and X.sub.4 are nucleotides. In embodiments at least one
of X.sub.3 and X.sub.4 are a G or both of X.sub.3 and X.sub.4 are a
G. In other embodiments the poly-G nucleic acid comprises the
following formula: 5' GGGNGGG 3' wherein N represents between 0 and
20 nucleotides. In yet other embodiments the poly-G nucleic acid
comprises the following formula: 5' GGGNGGGNGGG 3' (SEQ ID NO:849)
wherein N represents between 0 and 20 nucleotides.
The poly-G immunostimulatory nucleic acid may include one or more
CpG motifs or T-rich motifs. In other embodiments the poly-G
nucleic acid is free of one or more CpG dinucleotides or poly-T
motifs.
Each of the limitations of the invention can encompass various
embodiments of the invention. It is, therefore, anticipated that
each of the limitations of the invention involving any one element
or combinations of elements can be included in each aspect of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts data from flow cytometry which demonstrates the
induction of a morphologic change in marginal zone lymphoma cells
upon CpG oligonucleotide stimulation. Malignant B cells from a
patient with marginal zone lymphoma were stimulated with no
oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ
ID NO: 168, B and E) or CpG oligonucleotide (ODN 2006, SEQ ID NO:
729, C and F) and analyzed by flow cytometry. A, B, and C
illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC;
y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC
(y-axis).
FIG. 2 depicts data from flow cytometry which demonstrates the
change in expression of surface antigens on marginal zone lymphoma
cells upon CpG oligodoexynucleotide (ODN) treatment. Flow
cytometric analysis of surface antigen expression on malignant B
cells from a patient with marginal zone lymphoma was performed
using either CpG or non-CpG oligonucleotide. Thin curves indicate
incubation with medium alone, dotted curves indicate incubation
with control oligonucleotide, and bold curves indicate incubation
with CpG oligonucleotide.
FIG. 3 is a set of bar graphs depicting changes in expression of
surface antigens on primary cells representing different B-cell
malignancies and cells of a benign follicular hyperplasia upon
treatment with, from left to right in each panel: negative control,
no oligonucleotide, control oligonucleotide (ODN 2017, SEQ ID NO:
168), or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel
represents one experiment.
FIG. 4 is a set of graphs depicting the observation that the effect
of CpG oligonucleotide on CD20 (top) and CD40 (bottom) is dependent
on the baseline level of expression of CD20 and CD40. Cells from
lymph node biopsies, peripheral blood or pleural fluid from
patients with different B-cell malignancies were incubated with or
without CpG oligonucleotide, and expression of CD20 and CD40 was
measured by flow cytometry.
FIG. 5 depicts data from flow cytometry which demonstrates the
effect of CpG oligonucleotide-induced proliferation of malignant
and normal B cells. Peripheral blood mononuclear cells from
patients with B-CLL (left) or marginal zone lymphoma with
circulating malignant cells (right), were incubated with CpG
oligonucleotide (bottom) or medium alone (top) and evaluated by
two-color flow cytometry. CFSE fluorescence (x-axis) and expression
of CD5 (B-CLL) or CD19 (marginal zone lymphoma) (y-axis) were
evaluated.
FIG. 6 is a graph depicting the survival of mice injected on Day 0
with tumor cells in response to CpG simulation in combination with
murine IgG2a and murine IgG1 anti-tumor antibodies. Treatments are
shown as filled squares, untreated controls; filled circles, murine
IgG1; filled triangles, murine IgG1 plus CpG; filled diamonds,
murine IgG2a; and open squares, murine IgG2a plus CpG.
DETAILED DESCRIPTION
Present cancer treatments are often ineffective as well as being
associated with a high degree of patient morbidity. The invention
provides methods and products for the more effective treatment of
cancer using a combination of immunostimulatory nucleic acids,
antibodies, and optionally cancer therapies.
The invention is based, in part, on the surprising discovery that
administration to a subject of immunostimulatory nucleic acids
induces the expression of cell surface antigens including CD20,
CD19, and CD22 on the surface of a cancer cell and that the
induction of these antigens leads to enhanced antibody-dependent
cellular cytotoxicity (ADCC). It was previously believed that CpG
oligonucleotides enhanced ADCC by influencing the effector cell
(e.g., by activating natural killer (NK) cells). Now it has been
discovered according to the invention that immunostimulatory
nucleic acids actually cause the induction of specific antigens
CD20, CD19, and CD22, each of which can be targeted by specific
antibody therapies. The discovery that immunostimulatory nucleic
acids are capable of upregulating expression of certain target
antigens on the surface of cancer cells, supports the development
of therapies using immunostimulatory nucleic acids in combination
with specific antibodies which interact with these cell surface
antigens. Thus, in one aspect, the invention provides a method for
treating or preventing cancer which involves the administration to
a subject of a combination of an immunostimulatory nucleic acid and
an antibody which specifically interacts with CD20, CD19, and CD22
in an effective amount to prevent or treat the cancer.
Additionally, it was discovered that the increased expression of
these and other cell surface antigens varies widely depending upon
the histological state of the tumor cell studied. The effect of
immunostimulatory nucleic acids on different types of primary
malignant B cells and reactive follicular hyperplasia was
extensively examined. All B-cell lymphoma cells tested increased in
size and granularity, upregulated activation markers (CD80, CD86,
CD40, CD54, CD69), and upregulated antigen presentation molecules
(class I major histocompatibility complex (MHC I), class II major
histocompatibilty complex (MHC II)) in response to
immunostimulatory nucleic acids. A control poly-C
oligodeoxynucleotide (ODN) showed only minor effects. The extent of
phenotypic change induced by immunostimulatory nucleic acids
differed from sample to sample. Immunostimulatory nucleic acids,
but not control nucleic acids, increased the expression of
co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on
malignant B cells without altering the phenotype of B cells derived
from reactive follicular hyperplasia. Immunostimulatory nucleic
acids also enhanced expression of both class I and class II MHC in
most samples. CD20 expression was increased in response to
immunostimulatory nucleic acids, most notably in B-CLL and marginal
zone lymphoma.
Furthermore, an inverse correlation was found between baseline
expression of specific cell surface antigens and their expression
after exposure to immunostimulatory nucleic acids. Thus the most
significant increase in expression of these molecules was found in
those samples that had the lowest (or no) baseline levels. These
data indicate that immunostimulatory nucleic acids may reverse low
expression of co-stimulatory molecules on malignant B cells that
correspond to a low level of activation, while their effects on
cells that are already in an activated state are less profound.
Thus, the invention relates to methods for identifying an
appropriate therapy for a lymphoma patient, and for treating the
patient using that therapy. The method can be accomplished by
isolating a B cell from a lymphoma patient and comparing the
surface antigens expressed on the malignant B cell with those
expressed on normal B cells. The antigens which are expressed in
low levels or not at all on the malignant B cell can be identified.
The subject can then be treated using a combination of an
immunostimulating nucleic acid and an antibody which specifically
recognizes the antigen(s) which are expressed in low levels or not
at all on the malignant B cell.
The invention is also useful for treating cancers which are
resistant to monoclonal antibody therapy. It has been discovered
according to the invention, that immunostimulatory nucleic acids
can reverse the resistance of tumor cells and render tumor cells
which were previously non-responsive or only weakly responsive,
sensitive to therapy. In particular it has been discovered that
immunostimulatory nucleic acids can cause a phenotypic change to a
resistant tumor cell that renders it sensitive to monoclonal
antibody therapy. For instance, the monoclonal anti-CD20 antibody
Rituximab has been shown to be effective clinically in several
trials and has recently been approved for the therapy of follicular
B cell lymphoma. Maloney D G, Semin Oncol 26:74-8 (1999); Foran J M
et al., J Clin Oncol 18:317-24 (2000); Witzig T E et al., J Clin
Oncol 17:3793-803 (1999); Davis T A et al., J Clin Oncol 17:1851-7
(1999); Wiseman G A et al., Clin Cancer Res 5:3281s-3286s (1999);
Grillo-Lopez A J et al, Semin Oncol 26:66-73 (1999). There are
reports that with lymphomas a small minority of tumors that
re-emerge following Rituximab therapy can lack CD20 expression.
Davis T A et al., Clin Cancer Res 5:611-5 (1999); Kinoshita T et
al., J Clin Oncol 16:3916 (1998). The immunostimulatory nucleic
acids of the invention are useful for treating this set of
resistant tumors. Additionally, Rituximab has not been useful for
the treatment of all types of B cell malignancies. Expression of
CD20 is relatively low on B-CLL cells, which provides an
explanation for why Rituximab is less effective for CLL than for
some other B-cell malignancies. Grinaldi L et al., J Clin Pathol
51:364-9 (1998). The immunostimulatory nucleic acids of the
invention are also useful for treating these tumors.
The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant
antigen. Link B K et al., Blood 81:3343-9 (1993). This antibody is
currently being tested in a phase I clinical trial in patients with
lymphoma. One limitation to the use of this antibody is that the
target antigen is only expressed by approximately 50% of B-cell
lymphomas. Interestingly, its expression was upregulated by
immunostimulatory nucleic acids in all lymphoma samples tested. It
was discovered according to the invention that immunostimulatory
nucleic acids may enhance the efficacy of therapy with these and
other antibodies by increasing expression of target antigen. Thus
in another aspect the invention includes methods for treating
lymphoma by administering to a subject an immunostimulatory nucleic
acid and antibodies specific for HLA-DR. One useful antibody is the
humanized monoclonal antibody 1D10. It is particularly useful for
treating resistant tumors.
The invention also relates to the discovery of a specific subclass,
or isotype, of antibody which when combined with immunostimulatory
nucleic acids produces a synergistic immune response. Another
subclass, or isotype, does not even provide an additive response
when combined with immunostimulatory nucleic acids. It was
discovered according to the invention that the combination of
immunostimulatory nucleic acids and human antibodies of the IgG1
isotype results in an increased (synergistic) survival rate. When
immunostimulatory nucleic acids are combined with human antibodies
of the IgG2 isotype, no increase in survival rate is observed over
the use of the IgG2 antibody alone. The IgG2 isotype (which
correlates with the murine IgG1 isotype) is believed to be
recognized by the Fc receptor designated CD16 that is expressed
largely by NK cells. Immunostimulatory nucleic acids are known to
activate NK cells, and thus, it is surprising that
immunostimulatory nucleic acids do not enhance the therapeutic
effect of human IgG2 or murine IgG1 antibodies. Since NK cells are
believed to be involved in ADCC and are activated by
immunostimulatory nucleic acids, it was surprising that antibodies
of the human IgG2 (or murine IgG1) isotype do not produce a
synergistic or even additive response when administered with
immunostimulatory nucleic acids.
A cancer cell is a cell that divides and reproduces abnormally due
to a loss of normal growth control. Cancer cells almost always
arise from at least one genetic mutation. In some instances, it is
possible to distinguish cancer cells from their normal counterparts
based on profiles of expressed genes and proteins, as well as to
the level of their expression. Genes commonly affected in cancer
cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and
abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET
and WT. Cancer-related mutations in some of these genes leads to a
decrease in their expression or a complete deletion. In others,
mutations cause an increase in expression or the expression of an
activated variant of the normal counterpart.
The term "tumor" is usually equated with neoplasm, which literally
means "new growth" and is used interchangeably with "cancer." A
"neoplastic disorder" is any disorder associated with cell
proliferation, specifically with a neoplasm. A "neoplasm" is an
abnormal mass of tissue that persists and proliferates after
withdrawal of the carcinogenic factor that initiated its
appearance. There are two types of neoplasms, benign and malignant.
Nearly all benign tumors are encapsulated and are noninvasive; in
contrast, malignant tumors are almost never encapsulated but invade
adjacent tissue by infiltrative destructive growth. This
infiltrative growth can be followed by tumor cells implanting at
sites discontinuous with the original tumor. The method of the
invention can be used to treat neoplastic disorders in humans,
including but not limited to: sarcoma, carcinoma, fibroma, glioma,
leukemia, lymphoma, melanoma, myeloma, neuroblastoma,
retinoblastoma, and rhabdomyosarcoma, as well as each of the other
tumors described herein.
"Cancer" as used herein refers to an uncontrolled growth of cells
which interferes with the normal functioning of the bodily organs
and systems. Cancers which migrate from their original location and
seed vital organs can eventually lead to the death of the subject
through the functional deterioration of the affected organs.
Hemopoietic cancers, such as leukemia, are able to out-compete the
normal hemopoietic compartments in a subject, thereby leading to
hemopoietic failure (in the form of anemia, thrombocytopenia and
neutropenia), ultimately causing death.
A metastasis is a region of cancer cells, distinct from the primary
tumor location, resulting from the dissemination of cancer cells
from the primary tumor to other parts of the body. At the time of
diagnosis of the primary tumor mass, the subject may be monitored
for the presence of metastases. Metastases are most often detected
through the sole or combined use of magnetic resonance imaging
(MRI) scans, computed tomography (CT) scans, blood and platelet
counts, liver function studies, chest X-rays and bone scans in
addition to the monitoring of specific symptoms.
Cancers include, but are not limited to, basal cell carcinoma,
biliary tract cancer; bladder cancer; bone cancer; brain and CNS
cancer; breast cancer; cervical cancer; choriocarcinoma; colon and
rectum cancer; connective tissue cancer; cancer of the digestive
system; endometrial cancer; esophageal cancer; eye cancer; cancer
of the head and neck; gastric cancer; intra-epithelial neoplasm;
kidney cancer; larynx cancer; leukemia; liver cancer; lung cancer
(e.g., small cell and non-small cell); lymphoma including Hodgkin's
and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral
cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian
cancer; pancreatic cancer; prostate cancer; retinoblastoma;
rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the
respiratory system; sarcoma; skin cancer; stomach cancer;
testicular cancer; thyroid cancer; uterine cancer; cancer of the
urinary system, as well as other carcinomas and sarcomas.
The immunostimulatory nucleic acids and antibodies are useful for
treating or preventing cancer in a subject. A "subject" unless
otherwise specified shall mean a human or vertebrate mammal
including but not limited to a dog, cat, horse, cow, pig, sheep,
goat, or primate, e.g., monkey. Thus the invention can be used to
treat cancer and tumors in human and non human subjects. Cancer is
one of the leading causes of death in companion animals (i.e., cats
and dogs). Cancer usually strikes older animals which, in the case
of house pets, have become integrated into the family. Forty-five
percent of dogs older than 10 years of age are likely to succumb to
the disease. The most common treatment options include surgery,
chemotherapy and radiation therapy. Other treatment modalities
which have been used with some success are laser therapy,
cryotherapy, hyperthermia and immunotherapy. The choice of
treatment depends on the type of cancer and degree of
dissemination. Unless the malignant growth is confined to a
discrete area in the body, it is difficult to remove only malignant
tissue without also affecting normal cells.
Malignant disorders commonly diagnosed in dogs and cats include but
are not limited to lymphosarcoma, osteosarcoma, mammary tumors,
mastocytoma, brain tumor, melanoma, adenosquamous carcinoma,
carcinoid lung tumor, bronchial gland tumor, bronchiolar
adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma,
neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma,
Wilms' tumor, Burkitt's lymphoma, microglioma, neuroblastoma,
osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
rhabdomyosarcoma. Other neoplasias in dogs include genital squamous
cell carcinoma, transmissable venereal tumor, testicular tumor,
seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma,
chloroma (granulocytic sarcoma), corneal papilloma, corneal
squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma,
basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma,
oral papillomatosis, hemangioendothelioma and cystadenoma.
Additional malignancies diagnosed in cats include follicular
lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary
squamous cell carcinoma. The ferret, an ever-more popular house
pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma,
pancreatic islet cell tumor, gastric MALT lymphoma and gastric
adenocarcinoma.
Neoplasias affecting agricultural livestock include leukemia,
hemangiopericytoma and bovine ocular neoplasia (in cattle);
preputial fibrosarcoma, ulcerative squamous cell carcinoma,
preputial carcinoma, connective tissue neoplasia and mastocytoma
(in horses); hepatocellular carcinoma (in swine); lymphoma and
pulmonary adenomatosis (in sheep); pulmonary sarcoma, lymphoma,
Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma,
B-cell lymphoma and lymphoid leukosis (in avian species);
retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic
lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish),
caseous lymphadenitis (CLA): chronic, infectious, contagious
disease of sheep and goats caused by the bacterium Corynebacterium
pseudotuberculosis, and contagious lung tumor of sheep caused by
jaagsiekte.
In one aspect, a method for treating cancer is provided which
involves administering the compositions of the invention to a
subject having cancer. A "subject having cancer" is a subject that
has been diagnosed with a cancer. In some embodiments, the subject
has a cancer type characterized by a solid mass tumor. The solid
tumor mass, if present, may be a primary tumor mass. A primary
tumor mass refers to a growth of cancer cells in a tissue resulting
from the transformation of a normal cell of that tissue. In most
cases, the primary tumor mass is identified by the presence of a
cyst, which can be found through visual inspection or palpation
methods, or by irregularity in shape, texture or weight of the
tissue.
However, some primary tumors are not palpable and can be detected
only through medical imaging techniques such as X-rays (e.g.,
mammography), or by needle aspirations. The use of these latter
techniques is more common in early detection. Molecular and
phenotypic analysis of cancer cells within a tissue will usually
confirm if the cancer is endogenous to the tissue or if the lesion
is due to metastasis from another site.
With respect to the prophylactic treatment methods, the invention
is aimed at administering the compositions of the invention to a
subject at risk of developing cancer. A subject at risk of
developing a cancer is one who has a high probability of developing
cancer. These subjects include, for instance, subjects having a
genetic abnormality, the presence of which has been demonstrated to
have a correlative relation to a higher likelihood of developing a
cancer. Subjects exposed to cancer-causing agents such as tobacco,
asbestos, or other chemical toxins are also subjects at risk of
developing cancers used herein. When a subject at risk of
developing a cancer is treated with an immunostimulatory nucleic
acid, an antibody and optionally a cancer therapy, on a regular
basis, such as monthly, the cancer growth will be prevented from
initiating. This aspect of the invention is particularly
advantageous when the subjects employed in certain trades which are
exposed to cancer-causing agents on an ongoing basis. For example,
many airborne, or inhaled, carcinogens such as tobacco smoke and
asbestos have been associated with lung cancer.
A carcinogen is an agent capable of initiating development of
malignant cancers. Exposure to carcinogens generally increases the
risk of neoplasms in subjects, usually by affecting DNA directly.
Carcinogens may take one of several forms such as chemical,
electromagnetic radiation, or may be an inert solid body.
Substances for which there is sufficient evidence to establish a
causal relationship in cancer in humans are referred to as
confirmed human carcinogens. Included in this category are the
following substances: Aflatoxins, Alcoholic beverages, Aluminium
production, 4-aminobiphenyl, Arsenic and arsenic compounds,
Asbestos, Manufacture of auramine, Azathioprine, Benzene,
Benzidine, Beryllium and beryllium compounds, Betel quid with
tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether
(technical grade), Boot and shoe manufacture and repair
(occupational exposure), 1,4 Butanediol dimethanesulphonate
(Myleran), Cadmium and cadmium compounds, Chlorambucil,
Chlornaphazine, 1-(2-Chloroethyl)-3-(4-methylcyclohexyl)-1
nitrosourea, Chloromethyl methyl ether (technical), Chromium
compounds (hexavalent), Coal gasification, Coal tar pitches, Coal
tars, Coke production, Cyclophosphamide, Cyclosporin, Erionite,
Ethylene oxide, Furniture and cabinet making, Underground haematite
mining with exposure to radon, Iron and steel founding, Isopropyl
alcohol manufacture (strong acid process), Manufacture of magenta,
Melphalan, 8-Methoxypsoralen (Methoxsalen) plus ultraviolet
radiation, Mineral oils-untreated and mildly-treated oils, MOPP and
other combined chemotherapy for cancer, Mustard gas (sulphur
mustard), 2-Naphthylamine, Nickel and nickel compounds (essentially
sulphate and sulphide), Nonsteroidal estrogens (not necessarily all
in group) includes diethylstilbestrol, Estrogen replacement
therapy, and Combined oral contraceptives and sequential oral
contraceptives, Steroidal estrogens (not all in group), Painter
(occupational exposure as a painter), Phenacetin (analgesic
mixtures containing), Rubber industry, Salted fish (Chinese style),
Solar radiation, Shale oils, Soots, Sulphuric acid (occupational
exposures to strong-inorganic-acid mists of sulphuric acid), Talc
containing asbestiform fibres, Thiotepa, Tobacco products
(smokeless), Tobacco smoke, Treosulphan, and Vinyl chloride.
Substances for which there is a lesser degree of evidence in humans
but sufficient evidence in animal studies, or degrees of evidence
considered unequivocal of mutagenicity in mammalian cells, are
referred to as probable human carcinogens. This category of
substances includes: Acrylamide, Acrylonitrile, Adriamycin,
Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based
dyes (technical grade), Direct Black 38, Direct Blue 6, Direct
Brown 95, Benzopyrenel,3-Butadiene, Captafol, Bischloroethyl
nitrosourea (BCNU), 1-(2-Chloroethyl)-3-cyclohexyl-1-nitrosourea
(CCNU), Chloramphenicolpara-Chloro-ortho-toluidine and its strong
acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene,
Diesel engine exhaust, Diethyl sulphate, Dimethylcarbamoyl
chloride, Dimethyl sulphate, Epichlorohydrin, Ethylene dibromide,
N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry
(occupational exposure), Art glass (glass containers and pressed
ware), Hairdresser or barber (occupational exposure, probably
dyes), Insecticide use (occupational), IQ
(2-Amino-3-methylimidazo[4,5-f]quinoline), Mate drinking (hot),
5-Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA),
N-Methyl-N-nitro-N-nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea,
Nitrogen mustard, N-Nitrosodiethylamine, N-Nitrosodimethylamine,
Petroleum refining (occupational refining exposures), Phenacetin,
Polychlorinated biphenyls, Procarbazine hydrochloride, Silica
(crystalline), Styrene-7,8-oxide, Tris(1-azaridinyl)phosphine
sulphide (Thiotepa), Tris(2,3-dibromopropyl) phosphate, Ultraviolet
radiation: A, B and C including sunlamps and sunbeds, and Vinyl
bromide.
Substances for which there is sufficient evidence in animal tests
are referred to as possible human carcinogens. This category of
substances includes: A-C(2-Amino-9H-pyrido[2,3-b]indole),
Acetaldehyde, Acetamide,
AF-2[2-(2-Furyl)-3-(5-nitro-2-furyl)acrylamide,
para-Aminoazobenzene, ortho-Aminoazobenzene,
2-Amino-5-(5-nitro-2-furyl)-1,3,4-thiadiazole, Amitrole,
ortho-Anisidine, Antimony trioxide, Aramite, Atrazine, Attapulgite,
Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene,
Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of
steam-refined and air-refined bitumens), Bleomycins, Bracken ferns,
Bromodichloromethane, Butylated hydroxyanisole (BHA),
a-Butyrolactone, Caffeic acid, Carbon black extract, Carbon
tetrachloride, Carrageenan (degraded), Ceramic fibres,
Chloramphenicol, Chlordane, Chlordecone, Chlorendic acid,
Chlorinated paraffins of average carbon-chain length C12 and
average degree of chlorination approx 60%, alpha-Chlorinated
toluenes (not necessarily all in group), Benzotrichloride,
para-Chloroaniline, Chloroform, Chlorophenols, Pentachlorophenol,
2,4,6-Trichlorophenol, Chlorophenoxy herbicides (not necessarily
all in group), 4-Chloro-ortho-phenylenediamine, CI Acid Red 114, CI
Basic Red 9, CI Direct Blue 15, Citrus Red No. 2, Cobalt and cobalt
compounds, Coffee (bladder), para-Cresidine, Cycasin, Dacarbazine,
Dantron (1,8-dihydroxyanthraquinone), Daunomycin, DDT,
N,N'-Diacetylbenzidine, 4,4'-Diaminodiphenyl ether,
2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine,
7H-Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene,
Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene,
1,2-Dibromo-3-chloropropane, para-Dichlorobenzene,
3,3'-Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether,
1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical
grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine),
Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl
resorcinol ether, Dihydrosafrole, Diisopropyl sulfate,
3,3'-Dimethoxybenzidine, para-Dimethylaminoazobenzene,
trans-2-[(Dimethylamino)methylimino]-5-[2-(5-nitro-2-furyl[vinyl]-1,3,4-o-
xidiazole, 2,6-Dimethylaniline (2,6-Xylidene),
3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylformamide,
1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6-Dinitropyrene,
1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, 1Ethyl acrylate,
Ethylene thiourea, Ethyl methanesulphonate,
2-(2-Formylhydrazino)-4-(5-nitro-2-furyl)thiazole, Fuel oils
(residual, heavy), Fusarium moniliforme (toxins derived from),
Fumonisin B1; Fumonisin B2; Fusarin C, Gasoline, Gasoline engine
exhausts, Glasswool, Glu-P-1
(2-Amino-6-methyldipyrido[1,2-a:3'2'-d]imidazole),
Glu-P-2(-Aminodipyrido[1,2-a:3'2'-d]imidazole),Glycidaldehyde,
Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene,
Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer
(lindane), Hexamethylphosphoramide, Hydrazine,
Indeno[1,2,3-cd]pyrene, Iron-dextran complex, Isoprene,
Lasiocarpine, Lead and lead compounds (inorganic), Magenta
(containing CI Basic Red 9), Man-made mineral fibres (see
glasswool, rockwool, slagwool, and ceramic fibres), MeA-a-C
(2-Amino-3-methyl-9H-pyrido[2,3-b]indole), MeIQ
(2-Amino-3,4-dimethylimidazo[4,5-f]-quinolone), MeIQx
(2-Amino-3,8-dimethylamidazo[4,5-f]quinoxaline), Methylmercury
compounds (methylmercuric chloride), Melphalan, 2-Methylaziridine,
Methylazoxymethanol and its acetate, 5-Methylchrysene,
4,4'-Methylenebis(2-methylaniline), 4,4'-Methylenedianiline,
Methylmethanesulphonate, 2-methyl-1-nitroanthraquinone (uncertain
purity), N-methyl-N-nitrosourethane, Methylthiouracil,
Metronidazole, Mirex, Mitomycin, Monocrotaline
5-(Morpholinomethyl)-3-[(5-nitrofurfurylidene)amino]-2-oxazolidinone,
Nafenopin, Niridazole, 5-Nitroacenaphthene, 6-Nitrochrysene,
Nitrofen (technical grade),
2-Nitrofluorenel-[(5-Nitrofurfurylidene)amino]-2-imidazolidinone,
N-[4-(5-Nitro-2-furyl)-2-thiazolyl]acetamide, Nitrogen mustard,
N-oxide, Nitrolotriacetic acid and its salts,
2-Nitropropanel-Nitropyrene, 4-Nitropyrene,
N-Nitrosodi-n-butylamine, N-Nitrosodiethanolamine,
N-Nitrosodi-n-propylamine, 3-(N-Nitrosomethylamino)propionitrile,
4-(N-Nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK),
N-Nitrosomethylethylamine, N-Nitrosomethylvinylamine,
N-Nitrosomorpholine, N-Nitrosonomicotine, N-Nitrosopiperidene,
N-Nitrosopyrrolidine, N-Nitrososarcosine, Ochratoxin A, Oil Orange,
Panfuran S (containing dihydroxymethylfuratzine), Phenazopyridine
hydrochloride, Phenobarbital, Phenoxybenzamine hydrochloride,
Phenyl glycidyl ether, PhenytoinPhIP
(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, Pickled
vegetables, traditional Asian, Polybrominated biphenyls, Ponceau
MXPonceau 3R, Potassium bromate, 1,3-Propane sultone, Propylene
oxide, Progestins, Medroxyprogesterone acetate, a-Propiolactone,
Propylthiouracil, Rockwool, Saccharin, Safrole, Slagwool, Sodium
ortho-phenylphenate, Sterigmatocystin, Streptozotocin, Styrene,
Sulfallate, 2,3,7,8-Tetrachlorodibenzo-para-dioxin (TCDD),
Tetrachloroethylene, Textile manufacturing (occupational
exposures), Thiocetamide, 4,4'-Thiodianiline, Thiourea, Toluene,
diisocyanatesortho-Toluidine, Toxaphene (polychlorinated
camphenes), Trichlormethine (trimustine hydrochloride), Trp-P-1
(3-Amino-1,4-dimethyl-5-H-pyrido[4,3-b]indole), Trp-P-2
(3-Amino-1-methyl-5H-pyrido[4,3-b]indole), Trypan blue, Uracil
mustard, Urethane, 4-Vinylcyclohexene, 4-Vinylcyclohexene
diepoxide, Welding fumes, Wood industries and Carpentry and
joinery.
Subjects at risk of developing cancer also include those who have a
genetic predisposition to cancer. In many cases, genetic
predisposition to cancer can be identified by studying the
occurrence of cancer in family members. Examples of genetic
predisposition to common forms of cancer include, but are not
limited to, mutation of BRCA1 and BRCA2 in familial breast cancer,
mutation of APC in familial colony cancer (familial polyposis
coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon
cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation
of Rb1 in retinoblastoma, mutation of RET in multiple endocrine
neoplasia type 2 (MEN2), mutation of VHL in renal cancer and
mutation of WT1 in Wilms' tumor. Other cancers for which a familial
predisposition has been identified include ovarian, prostate,
melanoma and lung cancer.
It has been estimated that almost half of all currently diagnosed
cancers will be treated with some form of cancer medicament.
However, many forms of cancer, including melanoma, colorectal,
prostate, endometrial, cervical and bladder cancer, do not respond
well to treatment with cancer medicaments. In fact, only about 5-10
percent of cancers can be cured using cancer medicaments alone.
These include some forms of leukemias and lymphomas, testicular
cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma,
neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment
of still other cancers, including breast cancer, requires a
combination therapy of surgery or radiotherapy in conjunction with
a cancer medicament.
The immunostimulatory nucleic acids are administered in combination
with antibodies which specifically bind to cancer cell surface
antigens. These antibodies include but are not limited to anti-CD20
antibodies, anti-CD40 antibodies, anti-CD19 antibodies, anti-CD22
antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86
antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These
antibodies are available from commercial sources or may be
synthesized de novo.
Commercially available anti-CD20 antibodies include but are not
limited to those presented in Table 1 below.
TABLE-US-00001 Commercially Available Anti-CD20 Antibodies.
Product/Supplier Catalog # Monoclonal Antibody to CD20, Human,
ANC-169-020 Purified, 100 .mu.g Alexis Corp. CD20, B-Cell Bab
Mouse: anti-Human V6021 Clone: L26 Isotype: IgG2a, Kappa;
Concentrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human
V1018 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda
Corporation CD20, B-Cell MAb Mouse: anti-Human K026 Clone: L26
Isotype: IgG2a, Kappa; Dehydrated Biomeda Corporation CD20, B-Cell
Mab Mouse: anti-Human 058D Clone: L26 Isotype: IgG2a, Kappa;
Prediluted Biomeda Corporation Mouse anti-Human CD20 AHS2022
BioSource International Mouse anti-Human CD20 AHS2001 BioSource
International Mouse anti-Human CD20 AHS2028 BioSource International
Mouse anti-Human CD20 AHS2002 BioSource International Mouse
anti-Human CD20 AHS2021 BioSource International Mouse Anti-CD20,
B-Cell, Human IgG2a MOB004 Antibody, Kappa, Supernatant, Clone L26,
1 mL BIOTREND Chemikalien GmbH AnTesti-CD20, Human, Mouse, 100
.mu.g 217670 Calbiochem Mouse Monoclonal Anti-(Human CD20) MHCD2000
IgG3 Antibody, Clone H147, 0.5 mL Caltag Laboratories Mouse
Monoclonal Anti-(Human CD20) MHCD2000-4 IgG3 Antibody, Clone B-ly
1, 1 mL Caltag Laboratories Mouse Monoclonal Anti-(Human CD20),
MON1111 Mature B-cell) IgG1 Antibody, Clone MEM-97, 1 mL Caltag
Laboratories CD20, B-cell, Mouse Anti-Human, Clone: N150230 L26,
Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision
Doublestain, Monoclonal Antibody, 12 mL DAKO Corp. CD20, B-cell,
Mouse Anti-Human, Clone: N150289 L26, Isotype: IgG2a, kappa,
Ready-to-Use, LSAB2, EnVision & EnVision Doublestain,
Monoclonal Antibody, Packaged for DAKO Autostainer, 33 mL\ DAKO
Corp. CD20, L26 B-cell Marker, Mouse Anti-Human, M075501 Human,
Monoclonal Antibody, 1 mL DAKO Corp. CD20, L26 B-cell Marker, Mouse
Anti-Human M077401 Monoclonal Antibody, 1 mL DAKO Corp. MxH B cell,
CD20 RTU, 12 mL L185030 DAKO Corp. Monoclonal Anti-B-Cell, CD20
IgG2a Mob 004 Antibody, Clone L26, concentrated, 1 mL Diagnostic
BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody,
Clone 7D1, concentrated, 1 mL Diagnostic BioSystems Monoclonal
Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26,
Concentrated, 1 mL Diagnostic BioSystems Rabbit Polyclonal
Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL Diagnostic
Biosystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher
Scientific Co. Coulter* Antibodies to Human CDs::CD20 C06603858
Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM
1342 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20
COIM 1565 Fisher Scientific Co. Coulter* Antibodies to Human
CDs::CD20 COIM 1454 Fisher Scientific Co. Coulter* Antibodies to
Human CDs::CD20 CO6604106 Fisher Scientific Co. Coulter* Antibodies
to Human CDs::CD20 CO6603446 Fisher Scientific Co. Coulter*
Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific
Co. Coulter* Antibodies to Human CDs::CD20 CO6602381 Fisher
Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM1925
Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20
CO6602140 Fisher Scientific Co. CD20, Pan B-cell marker, Mouse
Anti- M077401 Human, Monoclonal Antibody, 1 mL DAKO Corp. MxH B
Cell, CD20 RTU, 12 mL L185030 DAKO Corp. Monoclonal Anti-B-Cell,
CD20 IgG2a Mob 004 Antibody, Clone L26, Concentrated, 1 mL
Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241
Antibody, Clone 7D1, Concentrated, 1 mL Diagnostic BioSystems
Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26,
Concentrated, 1 mL Diagnostic BioSystems Rabbit Polyclonal
Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL Diagnostic
BioSystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher
Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6603858
Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM
1342 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20
COIM 1565 Fisher Scientific Co. Coulter* Antibodies to Human
CDs::CD20 COIM 1454 Fisher Scientific Co. Coulter* Antibodies to
Human CDs::CD20 CO6604106 Fisher Scientific Co. Coulter* Antibodies
to Human CDs::CD20 CO6603446 Fisher Scientific Co. Coulter*
Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.
Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific
Co. Coulter* Antibodies to Human CDs::CD20 CO6602381 Fisher
Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1925
Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20
CO6602140 Fisher Scientific Co. Coulter* Antibodies to Human
CDs::CD20 CO6602471 Fisher Scientific Co. CD20 (B Cell) AM-1165-11
InnoGenex Coulter* Antibodies to Human CDs::CD20 CO6602471 Fisher
Scientific Co. CD20 (B Cell) AM-1165-11 InnoGenex CD20 (B Cell),
Unpurified AM-1165-11 (0.1 mg/0.1 mL), Clone: B1, Isotype:
InnoGenex Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-SO Cell
Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 0.1 mL
Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S1 Cell
Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 0.5 mL
Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S Cell
Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 1.0 mL
Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-R7 Cell
Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 7.0 mL
Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P1 Cell
Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9, Workshop V; 100
.mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P
Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9, Workshop V;
200 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 (Ab-1 (B-
MS-431-PO Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9,
Workshop V; 20 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20
Ab-1 (B- MS-758-P1 Cell Marker) IgG.sub.1/.kappa. Antibody, Clone:
93-1B3, Workshop V; Code: CD20.4, 200 .mu.g Lab Vision Corp. Mouse
Monoclonal Anti-CD20 Ab-3 (B- MS-758-P Cell Marker)
IgG.sub.1/.kappa. Antibody, Clone: 93-1B3, Workshop V; Code:
CD20.4, 200 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-3
(B- MS-758-PO Cell Marker) IgG.sub.1/ Antibody, Clone: 93-1B3,
Workshop V; Code: CD20.4 Lab Vision Corp. Human CD20, B Cell, 6 mL
MAB-0020 Maxim Biotech Inc. Mouse Monoclonal Anti-B Cell, CD20
A9004C IgG.sub.2a, .kappa. Antibody, Concentrate, 1 mL Scytek Mouse
Monoclonal Anti-B Cell, CD20 A20003 IgG.sub.2a, .kappa. Antibody,
Ready-to-Use, 1 mL Scytek Mouse Monoclonal Anti-CD20, B Cell A9001C
IgG.sub.2a, .kappa. Antibody, Concentrate, 1 mL (Clone: L26) Scytek
Mouse Monoclonal Anti-CD20, B Cell A00003 IgG.sub.2a, .kappa.
Antibody, Ready-to-Use, 6 mL Scytek Mouse Monoclonal Anti-(Human
CD20 MCA 1807 IgG1 Antibody, Clone 7D1, 1 mL Serotec, Inc. Mouse
Monoclonal Anti-(Human CD20 MCA 1822 IgG1 Antibody, Clone AT80, 0.2
mg Serotec, Inc. Mouse Monoclonal Anti-(Human CD20 MCA 1710 IgG2b
Antibody, Clone 2H7, 0.2 mg Serotec, Inc. Antibody Panels,
Hematopoietic 324-01 Markers, Lymphocyre Related Antigens, CD20, B
Cell, Clone L26, Concentrated, 1 mL, Ab Source Mouse, Ab# 324
Signet Pathology Systems, Inc. Antibody Panels, Hematopoietic
324-13 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone
L26, Level 1, 3 mL, Ab 324 Signet Pathology Systems, Inc. Antibody
Panels, Hematopoietic 324-16 Markers, Lymphocyte Related Antigens,
CD20, B Cell, Clone L26, level 1, 6 mL, Ab Source Mouse, Ab# 324
Signet Pathology Systems, Inc. Antibody Panels, Hematopoietic
324-26 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone
L26, Level 2, 6 mL, Ab Source Mouse, Ab# 324 Signet Pathology
Systems, Inc. Monoclonal Mouse anti-CD20, B9E9, Epitope- 07-2003
Affinity Purified-Unconjugated, IgG.sub.2a-.kappa., 200 .mu.g Zymed
Laboratories, Inc.
Antibodies are well known to those of ordinary skill in the science
of immunology. As used herein, the term "antibody" means not only
intact antibody molecules but also fragments of antibody molecules
retaining specific binding ability. Such fragments are also well
known in the art and are regularly employed both in vitro and in
vivo. In particular, as used herein, the term "antibody" means not
only intact immunoglobulin molecules but also the well-known active
fragments F(ab').sub.2, and Fab. F(ab').sub.2, and Fab fragments
which lack the Fc fragment of intact antibody, clear more rapidly
from the circulation, and may have less non-specific tissue binding
of an intact antibody. Wahl R L et al., J Nucl Med 24:316-25
(1983). Antibody fragments which are particularly useful according
to the methods of the invention are those which are bispecific and
constructed to enhance FcR binding, e.g., include an Fe portion.
These include, but are not limited to Medarex antibodies (MDX-210,
220, 22, 447, and 260). Other non-Fc containing fragments which
interact with the antigens induced on the cell surface are also
useful. These are particularly useful in combination with
immunotoxins and/or radioactivity. The fragments can be delivered
separately from the immunotoxins or radioactivity or conjugated
thereto (e.g., radiolabled antibodies or antibody fragments).
Within the antigen-binding portion of an antibody, as is well-known
in the art, there are complementarity-determining regions (CDRs),
which directly interact with the epitope of the antigen, and
framework regions (FRs), which maintain the tertiary structure of
the paratope (see, in general, Clark, 1986; Roitt, 1991). In both
the heavy chain Fd fragment and the light chain of IgG
immunoglobulins, there are four framework regions (FR1 through FR4)
separated respectively by three complementarity-determining regions
(CDR1 through CDR3). The CDRs, and in particular the CDR3 regions,
and more particularly the heavy chain CDR3, are largely responsible
for antibody specificity.
It is now well-established in the art that the non-CDR regions of a
mammalian antibody may be replaced with similar regions of
conspecific or heterospecific antibodies while retaining the
epitopic specificity of the original antibody. This is most clearly
manifested in the development and use of "humanized" antibodies in
which non-human CDRs are covalently joined to human FR and/or
Fc/pFc' regions to produce a functional antibody. Thus, for
example, PCT International Publication Number WO 92/04381 teaches
the production and use of humanized murine RSV antibodies in which
at least a portion of the murine FR regions have been replaced by
FR regions of human origin. Such antibodies, including fragments of
intact antibodies with antigen-binding ability, are often referred
to as "chimeric" antibodies. A "humanized monoclonal antibody" as
used herein is a human monoclonal antibody or functionally active
fragment thereof having human constant regions and a binding CDR3
region from a mammal of a species other than a human. Humanized
monoclonal antibodies may be made by any method known in the art.
Humanized monoclonal antibodies, for example, may be constructed by
replacing the non-CDR regions of a non-human mammalian antibody
with similar regions of human antibodies while retaining the
epitopic specificity of the original antibody. For example,
non-human CDRs and optionally some of the framework regions may be
covalently joined to human FR and/or Fc/pFc' regions to produce a
functional antibody. There are entities in the United States which
will synthesize humanized antibodies from specific murine antibody
regions commercially, such as Protein Design Labs (Mountain View
Calif.).
European Patent Application 0239400, the entire contents of which
is hereby incorporated by reference, provides an exemplary teaching
of the production and use of humanized monoclonal antibodies in
which at least the CDR portion of a murine (or other non-human
mammal) antibody is included in the humanized antibody. Briefly,
the following methods are useful for constructing a humanized CDR
monoclonal antibody including at least a portion of a mouse CDR. A
first replicable expression vector including a suitable promoter
operably linked to a DNA sequence encoding at least a variable
domain of an Ig heavy or light chain and the variable domain
comprising framework regions from a human antibody and a CDR region
of a murine antibody is prepared. Optionally a second replicable
expression vector is prepared which includes a suitable promoter
operably linked to a DNA sequence encoding at least the variable
domain of a complementary human Ig light or heavy chain
respectively. A cell line is then transformed with the vectors.
Preferably the cell line is an immortalized mammalian cell line of
lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma
cell line, or is a normal lymphoid cell which has been immortalized
by transformation with a virus. The transformed cell line is then
cultured under conditions known to those of skill in the art to
produce the humanized antibody.
As set forth in European Patent Application 0239400 several
techniques are well known in the art for creating the particular
antibody domains to be inserted into the replicable vector.
(Preferred vectors and recombinant techniques are discussed in
greater detail below.) For example, the DNA sequence encoding the
domain may be prepared by oligonucleotide synthesis. Alternatively
a synthetic gene lacking the CDR regions in which four framework
regions are fused together with suitable restriction sites at the
junctions, such that double-stranded synthetic or restricted
subcloned CDR cassettes with sticky ends could be ligated at the
junctions of the framework regions. Another method involves the
preparation of the DNA sequence encoding the variable CDR
containing domain by oligonucleotide site-directed mutagenesis.
Each of these methods is well known in the art. Therefore, those
skilled in the art may construct humanized antibodies containing a
murine CDR region without destroying the specificity of the
antibody for its epitope.
Human monoclonal antibodies may be made by any of the methods known
in the art, such as those disclosed in U.S. Pat. No. 5,567,610,
issued to Borrebaeck et al., U.S. Pat. No. 5,565,354, issued to
Ostberg, U.S. Pat. No. 5,571,893, issued to Baker et al, Kozbor D
et al., J Immunol 133:3001-5 (1984), Brodeur et al., Monoclonal
Antibody Production Techniques and Applications, pp. 51-63 (Marcel
Dekker, Inc, New York, 1987), and Boerner P et al., J Immunol
147:86-95 (1991). In addition to the conventional methods for
preparing human monoclonal antibodies, such antibodies may also be
prepared by immunizing transgenic animals that are capable of
producing human antibodies (e.g., Jakobovits A et al., Proc Natl
Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nature
362:255-8 (1993); Bruggermann et al., Year in Immunology 7:33
(1993); and U.S. Pat. No. 5,569,825 issued to Lonberg).
Significantly, as is well-known in the art, only a small portion of
an antibody molecule, the paratope, is involved in the binding of
the antibody to its epitope (see, in general, Clark, W. R. (1986)
The Experimental Foundations of Modern Immunology Wiley & Sons,
Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed.,
Blackwell Scientific Publications, Oxford). The pFc' and Fc
regions, for example, are effectors of the complement cascade but
are not involved in antigen binding. An antibody from which the
pFc' region has been enzymatically cleaved, or which has been
produced without the pFc' region, designated an F(ab').sub.2
fragment, retains both of the antigen binding sites of an intact
antibody. Similarly, an antibody from which the Fc region has been
enzymatically cleaved, or which has been produced without the Fc
region, designated an Fab fragment, retains one of the antigen
binding sites of an intact antibody molecule. Proceeding further,
Fab fragments consist of a covalently bound antibody light chain
and a portion of the antibody heavy chain denoted Fd. The Fd
fragments are the major determinant of antibody specificity (a
single Fd fragment may be associated with up to ten different light
chains without altering antibody specificity) and Fd fragments
retain epitope-binding ability in isolation.
Other antibodies useful according to the invention are antibodies
of the IgG1 isotype. As mentioned above, anti-IgG1 isotype antibody
as used herein refers to a human or humanized anti-IgG1 unless
otherwise specified. IgG1 isotype antibodies are well known in the
art and include at least the antibodies listed in Table 2
below.
TABLE-US-00002 TABLE 2 Cancer Immunotherapies In Development Or On
The Market. Marketer Brand Name (Generic Name) Indication
IDEC/Genentech, Rituxan .TM. (rituximab, Mabthera) (IDEC-
non-Hodgkin's lymphoma Inc./Hoffmann-LaRoche (first C2B8, chimene
murine/human anti-CD20 monoclonal antibody licensed for MAb) the
treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche
Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet
(CYT-424) radiotherapeutic Bone metastases agent
Centocor/Glaxo/Ajinomoto Panorex .RTM. (17-1A) (murine monoclonal
Adjuvant therapy for antibody) colorectal (Dukes-C)
Centocor/Ajinomoto Panorex .RTM. (17-1A) (chimeric murine
Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8
(murine, anti-CD20 MAb non-Hodgkin's lymphoma labeled with
Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the
GD.sub.3 Small cell lung epitope) (with BCG) ImClone Systems C225
(chimeric monoclonal antibody to Renal cell epidermal growth factor
receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1
monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to
131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute
myleoid leukemia Techniclone .sup.131I LYM-1 (Oncolym .TM.)
non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. Acute promyelocytic
leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head
& neck, non-small antibody) + cisplatin or radiation cell lung
cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA125,
Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar
(anti-CD20 Mab labeled with .sup.131I) non-Hodgkin's lymphoma have
been positive, but the drug has been associated with significant
bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN .RTM.
Kaposi's sarcoma IDEC Pharmaceuticals Rituxan .TM. (MAb against
CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo, with
chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte
antigen Chronic lymphocytic CAMPATH leukemia (CLL) Center of
Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast,
ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2
bispecific Prostate, non-small cell antibody) lung, pancreatic,
breast Medarex MDX-11 (complement activating receptor Acute
myelogenous (CAR) monoclonal antibody) leukemia (AML)
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and
colon antibody) Medarex MDX-11 (complement activating receptor Ex
vivo bone marrow (CAR) monoclonal antibody) purging in acute
myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific
antibody, Acute myleoid leukemia MAb-conjugates) (complement
cascade activators) Cytogen OV103 (Yttrium-90 labelled antibody)
Ovarian Cytogen OV103 (Yttrium-90 labelled antibody) Prostate
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. non-Hodgkin's lymphoma
Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A)
non-small cell lung, pancarcinoma antigen on adenocarcinomas
prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits Lung,
breast, prostate, angiogenesis) colorectal Protein Design Labs
Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab,
humanized) Protein Design Labs SMART M195 Ab, humanized Acute
promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr
monoclonal Breast antibody) + taxol ImClone Systems (licensed C225
(chimeric anti-EGFr monoclonal prostate from RPR) antibody) +
doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal
prostate antibody) + adriamycin ImClone Systems BEC2
(anti-idiotypic MAb, mimics the GD.sub.3 Melanoma epitope) Medarex
MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex
MDX-220 (bispecific for tumors that express Lung, colon, prostate,
TAG-72) ovarian, endometrial, pancreatic and gastric
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate
antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor
EGF receptor cancers bispecific antibody) (head & neck,
prostate, lung, bladder, cervical, ovarian) Medarex/Novartis
MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G-
antibody) CSF for various cancers, esp. breast IDEC MELIMMUNE-2
(murine monoclonal Melanoma antibody therapeutic vaccine) IDEC
MELIMMUNE-1 (murine monoclonal Melanoma antibody therapeutic
vaccine) Immunomedics, Inc. CEACIDE .RTM. (I-131) Colorectal and
other NeoRx Pretarget .RTM. radioactive antibodies non-Hodgkin's B
cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma
specific Ab) Cancer Techniclone Corporation/ TNT (chimeric MAb to
histone antigens) Brain Cambridge Antibody Technology Techniclone
TNT (chimeric MAb to histone antigens) Brain
International/Cambridge Antibody Technology Novopharm Gliomab-H
(Monoclonals - Humanized Abs) Brain, melanomas, neuroblastomas
Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000
(chimeric-EGF antagonist) Cancer Immunomedics LymphoCide (humanized
LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676
(monoclonal antibody conjugate) Acute myelogenous leukemia
Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic
Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, small-cell
lung Center of Molecular Immunology ior egf/r3 (anti EGF-R
humanzied Ab) Radioimmunotherapy Center of Molecular Immunology ior
c5 (murine MAb colorectal) for Colorectal radioimmunotherapy
Creative BioMolecules/ BABS (biosynthetic antibody binding site)
Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2
(monoclonal antibody to fetal liver Tumor-associated kinase-2
(FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/small-drug
conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets
GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab
Cancer Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein
Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon
Immunomedics, Inc. ImmuRAIT-CEA Colorectal
In some embodiments the nucleic acid and antibody are administered
in combination with a cancer therapy. As used herein, a "cancer
therapy" refers to an agent which prevents growth of a cancer cell
by decreasing or slowing the rate of growth, by inhibiting growth
altogether, or by killing or inducing apoptosis of the cancer cell.
Thus, as used herein, "treating cancer" includes preventing the
development of a cancer, reducing the symptoms of cancer, and/or
inhibiting the growth of an established cancer. In other aspects,
the cancer therapy is administered to a subject at risk of
developing a cancer for the purpose of reducing the risk of
developing the cancer. Various types of medicaments for the
treatment of cancer are described herein. For the purpose of this
specification, cancer therapies are classified as chemotherapeutic
agents, cancer vaccines, hormone therapy, biological response
modifiers, surgical procedures, and radiotherapy aimed at treating
cancer. Additionally, the methods of the invention are intended to
embrace the use of more than one cancer therapy along with the
immunostimulatory nucleic acids and antibody. As an example, where
appropriate, the immunostimulatory nucleic acids may be
administered with a both a chemotherapeutic agent and a
radiotherapy.
Cancer therapies function in a variety of ways. Some cancer
therapies work by targeting physiological mechanisms that are
specific to tumor cells. Examples include the targeting of specific
genes and their gene products (i.e., proteins primarily) which are
mutated in cancers. Such genes include but are not limited to
oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g.,
EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21,
telomerase). Cancer therapies can alternately target signal
transduction pathways and molecular mechanisms which are altered in
cancer cells.
Other cancer therapies target cells other than cancer cells. For
example, some medicaments prime the immune system to attack tumor
cells (i.e., cancer vaccines). Still other medicaments, called
angiogenesis inhibitors, function by attacking the blood supply of
solid tumors. Since the most malignant cancers are able to
metastasize (i.e., exit the primary tumor site and seed a distal
tissue, thereby forming a secondary tumor), medicaments that impede
this metastasis are also useful in the treatment of cancer.
Angiogenic mediators include basic FGF, VEGF, angiopoietins,
angiostatin, endostatin, TNF-.alpha., TNP-470, thrombospondin-1,
platelet factor 4, CAI, and certain members of the integrin family
of proteins. One category of this type of medicament is a
metalloproteinase inhibitor, which inhibits the enzymes used by the
cancer cells to exit the primary tumor site and extravasate into
another tissue.
As used herein, chemotherapeutic agents encompass both chemical and
biological agents. These agents function to inhibit a cellular
activity which the cancer cell is dependent upon for continued
survival. Categories of chemotherapeutic agents include
alkylating/alkaloid agents, antimetabolites, hormones or hormone
analogs, and miscellaneous antineoplastic drugs. Most if not all of
these agents are directly toxic to cancer cells and do not require
immune stimulation. Chemotherapeutic agents which are currently in
development or in use in a clinical setting are shown in Table 3
below.
TABLE-US-00003 TABLE 3 Cancer Drugs In Development Or On The
Market. Marketer Brand Name Generic Name Indication Abbott TNP
470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TNP
470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine
GLA Meglamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder
Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin
Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer
Carmustaine + Brain Tumor Polifepr Osan Warner Lambert Undisclosed
Cancer (b) Undisclosed Cancer (b) Cancer Bristol-Myers RAS Famesyl
Transferase RAS FamesylTransferase Cancer Squibb Inhibitor
Inhibitor Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY
12-9566 Cancer Merck Famesyl Transferase Inhibitor Famesyl
Transferase Cancer (Solid tumors - Inhibitor pancreas, colon, lung,
breast) Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE Tyrosine
Kinase Cancer, angiogenesis Lilly MTA/LY 231514 MTA/LY 231514
Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol Cancer
Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer,
pancreatic, breast, linolenate) colon Warner Lambert CI-994 CI-994
Cancer, Solid Tumors/ Leukemia Schering AG Angiogenesis inhibitor
Angiogenesis Inhibitor Cancer/Cardio Takeda TNP-470 n/k Malignant
Tumor Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer
Beecham Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer
Novartis Valspodar PSC 833 Myeloid Leukemia/Ovarian Cancer Immunex
Novantrone Mitoxantrone Pain related to hormone refractory prostate
cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF
Anti-VEGF Prostate/Breast/Colorectal/ NSCL Cancer British Biotech
Batimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid
Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682
CS-682 Solid Tumors Agouron AG2037 AG2037 Solid Tumors IDEC Pharma
9-AC 9-AC Solid Tumors Agouron VEGF/b-FGF Inhibitors VEGF/b-FGF
Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors/Macular
Degeneration Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853
VX-853 Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid
Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN
698 Solid Tumors Tanube Seiyaku TA 2516 Marimistat Solid Tumors
British Biotech Marimastat Marimastat (BB 2516) Solid Tumors
Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors/Breast Cancer
Chiroscience D2163 D2163 Solid Tumors/Metastases Warner Lambert PD
183805 PD 183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi
Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa FK 317 FK 317
Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor
Nycomed AD 32/valrubicin Valrubicin Bladder Cancer-Refractory
Amersham In situ Carcinoma Nycomed Metastron Strontium Derivative
Bone Cancer (adjunct Amersham therapy, Pain) Schering Plough
Temodal Temozolomide Brain Tumors Schering Plough Temodal
Temozolonide Brain Tumors Liposome Evacet Doxorubicin, Liposomal
Breast Cancer Nycomed Yewtaxan Paclitaxel Breast Cancer Advanced,
Amersham Ovarian Cancer Advanced Bristol-Myers Taxol Paclitaxel
Breast Cancer Advanced, Squibb Ovarian Cancer Advanced, NSCLC Roche
Xeloda Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon
Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer
Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia
Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone
Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Novantrone
Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer
Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer
Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol-Myers
BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squibb
Bristol-Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Cancer Oral
Squibb Johnson & Ergamisol Levamisole Cancer Therapy Johnson
Glaxo Wellcome Eniluracil/776C85 5FU Enhancer Cancer, Refractory
Solid & Colorectal Cancer Johnson & Ergamisol Levamisole
Colon Cancer Johnson Rhone Poulenc Campto Irinotecan Colorectal
Cancer, Cervical Cancer Pharmacia & Camptosar Irinotecan
Colorectal Cancer, Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed
Colorectal Cancer, Lung Cancer, Breast Cancer Johnson &
Leustain Cladribine Hairy Cell Leukaemia Johnson Ivax Paxene
Paclitaxel Kaposi Sarcoma Sequus Doxil Doxorubicin, Liposomal
KS/Cancer Sequus Caelyx Doxorubicin, Liposomal KS/Cancer Schering
AG Fludara Fludarabine Leukaemia Pharmacia & Pharmorubicin
Epirubicin Lung/Breast Cancer Upjohn Chiron DepoCyt DepoCyt
Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung
Cancer, Pancreatic Cancer BASF LU 79553 Bis-Naphtalimide Oncology
BASF LU 103793 Dolastain Oncology Schering Plough Caetyx
Doxorubicin-Liposome Ovarian/Breast Cancer Lilly Gemzar Gemcitabine
Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and
Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL,
ovarian etc. Yamanouchi YM 116 YM 116 Prostate Cancer Nycomed
Seeds/I-125 Rapid St Iodine Seeds Prostate Cancer Amersham Agouron
Cdk4/cdk2 inhibitors cdk4/cdk2 inhibitors Solid Tumors Agouron PARP
inhibitors PARP Inhibitors Solid Tumors Chiroscience D4809
Dexifosamide Solid Tumors Bristol-Myers UFT (Tegafur/Uracil) UFT
(Tegafur/Uracil) Solid Tumors Squibb Sankyo Krestin Krestin Solid
Tumors Asta Medica Ifex/Mesnex Ifosamide Solid Tumors Bristol-Myers
Ifex/Mesnex Ifosamide Solid Tumors Squibb Bristol-Myers Vumon
Teniposide Solid Tumors Squibb Bristol-Myers Paraplatin Carboplatin
Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin, Stealth
Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin Solid Tumors
Squibb Bristol-Myers Vepeside Etoposide Solid Tumors Melanoma
Squibb Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal
Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc
Taxotere Docetaxel Solid Tumors, Breast Cancer Glaxo Wellcome
Prodrug of guanine arabinside prodrug of arabinside T Cell
Leukemia/Lymphoma & B Cell Neoplasm Bristol-Myers Taxane Analog
Taxane Analog Taxol follow up Squibb
Another useful anti-cancer therapy is Interferon-.alpha. (e.g.,
INTRON.RTM. A, Schering).
The compounds useful according to the invention are nucleic acids.
The nucleic acids may be double-stranded or single-stranded.
Generally, double-stranded molecules may be more stable in vivo,
while single-stranded molecules may have increased activity. The
terms "nucleic acid" and "oligonucleotide" refer to multiple
nucleotides (i.e., molecules comprising a sugar (e.g., ribose or
deoxyribose) linked to a phosphate group and to an exchangeable
organic base, which is either a substituted pyrimidine (e.g.,
cytosine (C), thymine (T) or uracil (U)) or a substituted purine
(e.g., adenine (A) or guanine (G)) or a modified base. As used
herein, the terms refer to oligoribonucleotides as well as
oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e., a polynucleotide minus the phosphate) and
any other organic base-containing polymer. The terms "nucleic acid"
and "oligonucleotide" also encompass nucleic acids or
oligonucleotides with a covalently modified base and/or sugar. For
example, they include nucleic acids having backbone sugars which
are covalently attached to low molecular weight organic groups
other than a hydroxyl group at the 3' position and other than a
phosphate group at the 5' position. Thus modified nucleic acids may
include a 2'-O-alkylated ribose group. In addition, modified
nucleic acids may include sugars such as arabinose instead of
ribose. Thus the nucleic acids may be heterogeneous in backbone
composition thereby containing any possible combination of polymer
units linked together such as peptide-nucleic acids (which have
amino acid backbone with nucleic acid bases). In some embodiments
the nucleic acids are homogeneous in backbone composition.
Nucleic acids also can include base analogs such as C-5 propyne
modified bases. Wagner R W et al., Nature Biotechnol 14:840-4
(1996). Purines and pyrimidines include but are not limited to
adenine, cytosine, guanine, thymine, 5-methylcytosine,
2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine,
hypoxanthine, and other naturally and non-naturally occurring
nucleobases, substituted and unsubstituted aromatic moieties.
The nucleic acid is a linked polymer of bases or nucleotides. As
used herein with respect to linked units of a nucleic acid,
"linked" or "linkage" means two entities are bound to one another
by any physicochemical means. Any linkage known to those of
ordinary skill in the art, covalent or non-covalent, is embraced.
Such linkages are well known to those of ordinary skill in the art.
Natural linkages, which are those ordinarily found in nature
connecting the individual units of a nucleic acid, are most common.
The individual units of a nucleic acid may be linked, however, by
synthetic or modified linkages.
Whenever a nucleic acid is represented by a sequence of letters it
will be understood that the nucleotides are in 5'.fwdarw.3' order
from left to right and that "A" denotes adenosine, "C" denotes
cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U"
denotes uracil unless otherwise noted.
Nucleic acid molecules useful according to the invention can be
obtained from natural nucleic acid sources (e.g., genomic nuclear
or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by
oligonucleotide synthesis). Nucleic acids isolated from existing
nucleic acid sources are referred to herein as native, natural, or
isolated nucleic acids. The nucleic acids useful according to the
invention may be isolated from any source, including eukaryotic
sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc.
Thus, the term nucleic acid encompasses both synthetic and isolated
nucleic acids. The term "isolated" as used herein refers to a
nucleic acid which is substantially free of other nucleic acids,
proteins, lipids, carbohydrates or other materials with which it is
naturally associated. The nucleic acids can be produced on a large
scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A
Laboratory Manual", Cold Spring Harbor Laboratory Press, New York,
1989) and separated into smaller pieces or administered whole.
After being administered to a subject the plasmid can be degraded
into oligonucleotides. One skilled in the art can purify viral,
bacterial, eukaryotic, etc., nucleic acids using standard
techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
For use in the instant invention, the nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the b-cyanoethyl phosphoramidite method
(Beaucage S L et al., Tetrahedron Lett 22:1859, 1981); nucleoside
H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4,
1986; Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et
al., Tetrahedron Lett 27:4055-8, 1986; Gaffney et al., Tetrahedron
Lett 29:2619-22, 1988). These chemistries can be performed by a
variety of automated oligonucleotide synthesizers available in the
market.
In some embodiments, the nucleic acids useful according to the
invention are immunostimulatory nucleic acids. An immunostimulatory
nucleic acid is any nucleic acid, as described above, which is
capable of modulating an immune response. A nucleic acid which
modulates an immune response is one which produces any form of
immune stimulation, including, but not limited to, induction of
cytokines, B-cell activation, T-cell activation, monocyte
activation. Immunostimulatory nucleic acids include, but are not
limited to, CpG nucleic acids, methylated CpG nucleic acids, T-rich
nucleic acids, poly-G nucleic acids, and nucleic acids having
phosphate modified backbones, such as phosphorothioate
backbones.
A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as
used herein is a nucleic acid containing at least one unmethylated
CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e.,
"CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine
and linked by a phosphate bond) and activates a component of the
immune system. The entire CpG nucleic acid can be unmethylated or
portions may be unmethylated but at least the C of the 5' CG 3'
must be unmethylated.
In one embodiment the invention provides a CpG nucleic acid
represented by at least the formula: 5'
N.sub.1X.sub.1CGX.sub.2N.sub.2 3' wherein X.sub.1 and X.sub.2 are
nucleotides and N is any nucleotide and N.sub.1 and N.sub.2 are
nucleic acid sequences composed of from about 0-25 N's each. In
some embodiments X.sub.1 is adenine, guanine, or thymine and
X.sub.2 is cytosine, adenine, or thymine. In other embodiments
X.sub.1 is cytosine and/or X.sub.2 is guanine.
In other embodiments the CpG nucleic acid is represented by at
least the formula: 5' N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2
3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides.
In some embodiments, X.sub.1X.sub.2 are nucleotides selected from
the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA,
CpG, TpA, TpT, and TpG; and X.sub.3X.sub.4 are nucleotides selected
from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC,
ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N.sub.1 and
N.sub.2 are nucleic acid sequences composed of from about 0-25 N's
each. In some embodiments, X.sub.1X.sub.2 are GpA or GpT and
X.sub.3X.sub.4 are TpT. In other embodiments X.sub.1 or X.sub.2 or
both are purines and X.sub.3 or X.sub.4 or both are pyrimidines or
X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or both are
pyrimidines.
In some embodiments N.sub.1 and N.sub.2 of the nucleic acid do not
contain a CCGG or CGCG quadmer or more than one CCG or CGG trimer.
The effect of a CCGG or CGCG quadmer or more than one CCG or CGG
trimer depends in part on the status of the nucleic acid backbone.
For instance, if the nucleic acid has a phosphodiester backbone or
a chimeric backbone the inclusion of these sequences in the nucleic
acid will only have minimal if any affect on the biological
activity of the nucleic acid. If the backbone is completely
phosphorothioate or significantly phosphorothioate then the
inclusion of these sequences may have more influence on the
biological activity or the kinetics of the biological activity, but
compounds containing these sequences are still useful. In another
embodiment the CpG nucleic acid has the sequence 5'
TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub.4 3' (SEQ ID NO:850).
A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid"
is a nucleic acid which includes at least one poly-T sequence
and/or which has a nucleotide composition of greater than 25% T
nucleotide residues and which activates a component of the immune
system. A nucleic acid having a poly-T sequence includes at least
four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic
acid includes more than one poly-T sequence. In preferred
embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T
sequences, such as oligonucleotide #2006 (5'
TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729). One of the most
highly immunostimulatory T-rich oligonucleotides discovered
according to the invention is a nucleic acid composed entirely of T
nucleotide residues, e.g., oligonucleotide #2183 (5'
TTTTTTTTTTTTTTTTTTTTTTTT 3', SEQ ID NO: 841). Other T-rich nucleic
acids have a nucleotide composition of greater than 25% T
nucleotide residues, but do not necessarily include a poly-T
sequence. In these T-rich nucleic acids the T nucleotide resides
may be separated from one another by other types of nucleotide
residues, i.e., G, C, and A. In some embodiments the T-rich nucleic
acids have a nucleotide composition of greater than 30%, 40%, 50%,
60%, 70%, 80%, 90%, and 99%, T nucleotide residues and every
integer % in between. Preferably the T-rich nucleic acids have at
least one poly-T sequence and a nucleotide composition of greater
than 25% T nucleotide residues.
In one embodiment the T-rich nucleic acid is represented by at
least the formula: 5' X.sub.1X.sub.2TTTTX.sub.3X.sub.4 3' wherein
X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In one
embodiment X.sub.1X.sub.2 is TT and/or X.sub.3X.sub.4 is TT. In
another embodiment X.sub.1X.sub.2 are any one of the following
nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA,
and GC; and X.sub.3X.sub.4 are any one of the following nucleotides
TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
In some embodiments it is preferred that the T-rich nucleic acid
does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG
motifs, or multiple GGs. In other embodiments the T-rich nucleic
acid includes these motifs. Thus in some embodiments of the
invention the T-rich nucleic acids include CpG dinucleotides and in
other embodiments the T-rich nucleic acids are free of CpG
dinucleotides. The CpG dinucleotides may be methylated or
unmethylated.
Poly-G containing nucleic acids are also immunostimulatory. A
variety of references, including Pisetsky D S et al., Mol Biol Rep
18:217-21 (1993); Krieger M et al., Annu Rev Biochem 63:601-37
(1994); Macaya R F et al., Proc Natl Acad Sci USA 90:3745-9 (1993);
Wyatt J R et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando
and Hogan, 1998, In: Applied Antisense Oligonucleotide Technology,
eds. Krieg A M and Stein C, pp. 335-352; and Kimura Y et al., J
Biochem (Tokyo) 116:991-4 (1994) also describe the
immunostimulatory properties of poly-G nucleic acids.
Poly G nucleic acids preferably are nucleic acids having the
following formulas: 5' X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein
X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In
preferred embodiments at least one of X.sub.3 and X.sub.4 are a G.
In other embodiments both of X.sub.3 and X.sub.4 are a G. In yet
other embodiments the preferred formula is 5' GGGNGGG 3', or 5'
GGGNGGGNGGG 3' (SEQ ID NO:849) wherein N represents between 0 and
20 nucleotides. In other embodiments the poly-G nucleic acid is
free of unmethylated CG dinucleotides, such as, for example, the
nucleic acids listed in Table 4 below as SEQ ID NOs: 12-14, 23, 56,
100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430, 432, 435,
438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673,
807, 808, 821, 823, and 834. In other embodiments the poly-G
nucleic acid includes at least one unmethylated CG dinucleotide,
such as, for example, the nucleic acids listed in Table 4 below as
SEQ ID NOs: 6, 7, 22, 26, 28-30, 87, 115, 141, 177, 191, 209, 254,
258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418,
423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458,
460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752,
776, 795, 799, 817, 818, 831, and 832.
Nucleic acids having modified backbones, such as phosphorothioate
backbones, also fall within the class of immunostimulatory nucleic
acids. U.S. Pat. Nos. 5,723,335 and 5,663,153 issued to Hutcherson,
et al. and related PCT publication WO95/26204 describe immune
stimulation using phosphorothioate oligonucleotide analogues. These
patents describe the ability of the phosphorothioate backbone to
stimulate an immune response in a non-sequence specific manner.
The immunostimulatory nucleic acids may be any size but in some
embodiments are in the range of between 6 and 100 or in some
embodiments between 8 and 35 nucleotides in size. Immunostimulatory
nucleic acids can be produced on a large scale in plasmids. These
may be administered in plasmid form or alternatively they can be
degraded into oligonucleotides.
"Palindromic sequence" shall mean an inverted repeat (i.e., a
sequence such as ABCDEE'D'C'BA' in which A and A' are bases capable
of forming the usual Watson-Crick base pairs and which includes at
least 6 nucleotides in the palindrome. In vivo, such sequences may
form double-stranded structures. In one embodiment the nucleic acid
contains a palindromic sequence. In some embodiments when the
nucleic acid is a CpG nucleic acid, a palindromic sequence used in
this context refers to a palindrome in which the CpG is part of the
palindrome, and optionally is the center of the palindrome. In
another embodiment the nucleic acid is free of a palindrome. A
nucleic acid that is free of a palindrome does not have any regions
of 6 nucleotides or greater in length which are palindromic. A
nucleic acid that is free of a palindrome can include a region of
less than 6 nucleotides which are palindromic.
A "stabilized nucleic acid molecule" shall mean a nucleic acid
molecule that is relatively resistant to in vivo degradation (e.g.,
via an exonuclease or endonuclease). Stabilization can be a
function of length or secondary structure. Nucleic acids that are
tens to hundreds of kbs long are relatively resistant to in vivo
degradation. For shorter nucleic acids, secondary structure can
stabilize and increase their effect. For example, if the 3' end of
an oligonucleotide has self-complementarity to an upstream region,
so that it can fold back and form a sort of stem loop structure,
then the oligonucleotide becomes stabilized and therefore exhibits
more activity.
Some stabilized oligonucleotides of the instant invention have a
modified backbone. It has been demonstrated that modification of
the oligonucleotide backbone provides enhanced activity of the
nucleic acids when administered in vivo. Nucleic acids, including
at least two phosphorothioate linkages at the 5' end of the
oligonucleotide and multiple phosphorothioate linkages at the 3'
end, preferably 5, may provide maximal activity and protect the
oligonucleotide from degradation by intracellular exo- and
endo-nucleases. Other modified oligonucleotides include
phosphodiester modified oligonucleotide, combinations of
phosphodiester and phosphorothioate oligonucleotide,
methylphosphonate, methylphosphorothioate, phosphorodithioate, and
combinations thereof. Each of these combinations and their
particular effects on immune cells is discussed in more detail in
PCT Published Patent Application WO98/18810 claiming priority to
U.S. Ser. No. 08/738,652 (now issued as U.S. Pat. No. 6,207,646 B1)
and Ser. No. 08/960,774 (now issued as U.S. Pat. No. 6,239,116 B1),
filed on Oct. 30, 1996 and Oct. 30, 1997 respectively, the entire
contents of which is hereby incorporated by reference. It is
believed that these modified oligonucleotides may show more
stimulatory activity due to enhanced nuclease resistance, increased
cellular uptake, increased protein binding, and/or altered
intracellular localization. Both phosphorothioate and
phosphodiester nucleic acids are active in immune cells.
Other stabilized oligonucleotides include: nonionic DNA analogs,
such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Oligonucleotides which contain diol,
such as tetraethyleneglycol or hexaethyleneglycol, at either or
both termini have also been shown to be substantially resistant to
nuclease degradation.
For use in vivo, nucleic acids are preferably relatively resistant
to degradation (e.g., via endonucleases and exonucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications. One type of stabilized nucleic acid has at least a
partial phosphorothioate modified backbone. Phosphorothioates may
be synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild
J, Bioconjugate Chem 1:165-87 (1990).
The immunostimulatory nucleic acids having backbone modifications
useful according to the invention in some embodiments are S- or
R-chiral immunostimulatory nucleic acids. An "S chiral
immunostimulatory nucleic acid" as used herein is an
immunostimulatory nucleic acid wherein at least two nucleotides
have a backbone modification forming a chiral center and wherein a
plurality of the chiral centers have S chirality. An "R chiral
immunostimulatory nucleic acid" as used herein is an
immunostimulatory nucleic acid wherein at least two nucleotides
have a backbone modification forming a chiral center and wherein a
plurality of the chiral centers have R chirality. The backbone
modification may be any type of modification that forms a chiral
center. The modifications include but are not limited to
phosphorothioate, methylphosphonate, methylphosphorothioate,
phosphorodithioate, 2'-OMe and combinations thereof. In other
embodiments they are non-chiral. A non-chiral nucleic acid is any
nucleic acid which does not have at least two chiral centers.
The chiral immunostimulatory nucleic acids must have at least two
nucleotides within the nucleic acid that have a backbone
modification. All or less than all of the nucleotides in the
nucleic acid, however, may have a modified backbone. Of the
nucleotides having a modified backbone (referred to as chiral
centers), a plurality have a single chirality, S or R. A
"plurality" as used herein refers to an amount greater than or
equal to 75%. Thus, less than all of the chiral centers may have S
or R chirality as long as a plurality of the chiral centers have S
or R chirality. In some embodiments at least 75%, 80%, 85%, 90%,
95%, or 100% of the chiral centers have S or R chirality. In other
embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the
nucleotides have backbone modifications.
The S- and R- chiral immunostimulatory nucleic acids may be
prepared by any method known in the art for producing chirally pure
oligonucleotides. Stec et al. teach methods for producing
stereopure phosphorothioate oligodeoxynucleotides using an
oxathiaphospholane. Stec W J et al., J Am Chem Soc 117:12019
(1995). Other methods for making chirally pure oligonucleotides
have been described by companies such as ISIS Pharmaceuticals. U.S.
patents which disclose methods for generating stereopure
oligonucleotides include U.S. Pat. Nos. 5,212,295, 5,359,052,
5,506,212, 5,512,668, 5,521,302, 5,599,797, 5,837,856, 5,856,465,
and 5,883,237, each of which is hereby incorporated by reference in
its entirety.
Other sources of nucleic acids useful according to the invention
include standard viral and bacterial vectors, many of which are
commercially available. In its broadest sense, a "vector" is any
nucleic acid material which is ordinarily used to deliver and
facilitate the transfer of nucleic acids to cells. The vector as
used herein may be an empty vector or a vector carrying a gene
which can be expressed. In the case when the vector is carrying a
gene the vector generally transports the gene to the target cells
with reduced degradation relative to the extent of degradation that
would result in the absence of the vector. In this case the vector
optionally includes gene expression sequences to enhance expression
of the gene in target cells such as immune cells, but it is not
required that the gene be expressed in the cell.
In general, vectors include, but are not limited to, plasmids,
phagemids, viruses, other vehicles derived from viral or bacterial
sources. Viral vectors are one type of vector and include, but are
not limited to, nucleic acid sequences from the following viruses:
retrovirus, such as Moloney murine leukemia virus, Harvey murine
sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus;
adenovirus, adeno-associated virus; SV40-type viruses; polyoma
viruses; Epstein-Barr viruses; papilloma viruses; herpes virus;
vaccinia virus; polio virus; and RNA virus such as a retrovirus.
One can readily employ other vectors not named but known to the
art. Some viral vectors are based on non-cytopathic eukaryotic
viruses in which non-essential genes have been replaced with a
nucleic acid to be delivered. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA.
Standard protocols for producing empty vectors or vectors carrying
genes (including the steps of incorporation of exogenous genetic
material into a plasmid, transfection of a packaging cell lined
with plasmid, production of recombinant retroviruses by the
packaging cell line, collection of viral particles from tissue
culture media, and/or infection of the target cells with viral
particles) are provided in Kriegler M, "Gene Transfer and
Expression, A Laboratory Manual," W.H. Freeman Co., New York (1990)
and Murry E J, Ed., "Methods in Molecular Biology," vol. 7, Humana
Press, Inc., Cliffton, N.J. (1991).
Other vectors include plasmid vectors. Plasmid vectors have been
extensively described in the art and are well-known to those of
skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A
Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory
Press, 1989. In the last few years, plasmid vectors have been found
to be particularly advantageous for delivering genes to cells in
vivo because of their inability to replicate within and integrate
into a host genome. Some plasmids, however, having a promoter
compatible with the host cell, can express a peptide from a gene
operatively encoded within the plasmid. Some commonly used plasmids
include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript.
Other plasmids are well-known to those of ordinary skill in the
art. Additionally, plasmids may be custom designed using
restriction enzymes and ligation reactions to remove and add
specific fragments of DNA.
It has recently been discovered that plasmids (empty or
gene-carrying) can be delivered to the immune system using
bacteria. Modified forms of bacteria such as Salmonella can be
transfected with the plasmid and used as delivery vehicles. The
bacterial delivery vehicles can be administered to a host subject
orally or by other administration means. The bacteria deliver the
plasmid to immune cells, e.g., dendritic cells, probably by passing
through the gut barrier. High levels of immune protection have been
established using this methodology. Such methods of delivery are
useful for the aspects of the invention utilizing systemic delivery
of nucleic acid.
As used herein, administration of an immunostimulatory nucleic acid
is intended to embrace the administration of one or more
immunostimulatory nucleic acids which may or may not differ in
terms of their profile, sequence, backbone modifications and
biological effect. As an example, CpG nucleic acids and T-rich
nucleic acids may be administered to a single subject along with an
antibody and optionally a cancer therapy. In another example, a
plurality of CpG nucleic acids which differ in nucleotide sequence
may also be administered to a subject.
Some of the nucleic acids useful according to the invention and
described herein are presented in Table 4 below.
TABLE-US-00004 TABLE 4 Exemplary Nucleic Acids. SEQUENCE BACKBONE
SEQ ID NO: aaaaaa s 1 aaaaaaaaaaaaaaaaaaaa o 2 aaaaaccccccccccaaaaa
o 3 aaaacatgacgttcaaaaaa sos 4 aaaacatgacgttcaaaaaa s2 5
aaaacatgacgttcgggggg sos 6 aaaacatgacgttcgggggg s2 7 aaaacgtt o 8
aaaatcaacgttgaaaaaaa sos 9 aaaatctgtgcttttaaaaaa sos 10
aaaattgacgttttaaaaaa sos 11 aaacattctgggggaattttaagaagtaaacat o 12
aaacattctgggggaattttaagaagttcctccctcccc o 13
aaacattctgggggaattttgtctagtaaacat o 14 aacgctcgaccttcgat o 15
aacgctggaccttccat o 16 aacgctggaccttccatgtc sos 17 aacgtt o 18
aacgttct o 19 aacgttg s 20 aacgttga o 21 aacgttgaggggcat o 22
aaggtggggcagtctcaggga 23 aatagtcgccataacaaaac o 24
aatagtcgccatcccccccc o 25 aatagtcgccatcccgggac o 26
aatagtcgccatcgcgcgac o 27 aatagtcgccatggcggggc o 28
aattctctatcggggcttctgtgtctgttgctggttccgctttat o 29
acaaccacgagaacgggaac 30 acaacgtt o 31 acaacgttga o 32
accacaacgagaggaacgca 33 accatcctgaggccattcgg 34
accatggacgaactgtttcccctc s 35 accatggacgacctgtttcccctc s 36
accatggacgagctgtttcccctc s 37 accatggacgagctgtttcccctc 38
accatggacgatctgtttcccctc s 39 accatggacggtctgtttcccctc s 40
accatggacgtactgtttcccctc s 41 accatggacgttctgtttcccctc s 42
acccatcaatagctctgtgc s 43 acccgtcgtaattatagtaaaaccc o 44
accgcatggattctaggcca s 45
accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o 46 acgctggaccttccat
47 acgtcgttcccccccccccc o 48 acgtgt s 49 actagacgttagtgtga o 50
actagacgttagtgtga s 51 actggacgttagcgtga o 52
acttctcatagtccctttggtccag o 53 agaacgtt o 54 agacagacacgaaacgaccg
55 agactcatgggaaaatcccacatttga o 56 agatagcaaatcggctgacg o 57
agatggttctcagataaagcggaa 58 agcaccgaacgtgagagg o 59
agcacggtagccttccta 60 agcagctttagagctttagagctt s 61
agcatcaggaacgacatgga o 62 agcatcaggaccgacatgga o 63 agcgctga o 64
agctcaacgtcatgc o 65 agctccatggtgctcactg s 66 aggatatc o 67
aggtacagccaggactacga 68 agicccgigaacgiattcac o 69
agtgactctccagcgttctc o 70 agtgcgattcgagatcg o 71 agtgcgattgcagatcg
o 72 agtgct s 73 agtgct o 74 agttgcaact o 75
ataaagcgaaactagcagcagtttc o 76 ataacgtt o 77 ataatagagcttcaagcaag s
78 ataatccagcttgaaccaag s 79 ataatcgacgttcaagcaag s 80
ataatcgacgttcccccccc s 81 ataatcgtcgttcaagcaag s 82
ataatcgtgcgttcaagaaag s 83 atagacaaaaattccctccccggagcc o 84
atatatatatatatatat s 85 atatctaatcaaaacattaacaaa o 86
atcaggaacgtcatgggaagc o 87 atcgacctacgtgcgttctc o 88
atcgacctacgtgcgttztc o 89 atcgactcgagcgttctc o 90
atcgactctcgagcgttctc o 91 atcgactctcgagcgttctc sos 92
atcgactctcgagtgttctc o 93 atcgactctcgagzgttctc o 94
atcgactctctcgagcgttctc o 95 atcgacttcgagcgttctc o 96
atcgatcgagcgttctc o 97 atcgatgt o 98 atcggaggactggcgcgccg 99
atctggtgagggcaagctatg s 100 atgacgttcctgacgtt s 101
atgcactctgcagcgttctc o 102 atgcatgt o 103 atgcccctcaacgtt o 104
atgctaaaggacgtcacattgca o 105 atggaaggtccacgttctc o 106
atggaaggtccagcgttct o 107 atggaaggtccagcgttctc o 108
atggaaggtccagtgttctc o 109 atggaaggtcgagcgttctc o 110
atggactctccagcgttctc o 111 atgtcctcggtcctgatgct o 112
atgtttactagacaaaattcccccagaatgttt o 113
atgtttacttcttaaaattcccccagaatgttt o 114 attcgatcggggcggggcgag o 115
atzgacctacgtgcgttctc o 116 atzgactctzgagzgttctc o 117
batggaaggtccagcgttctc o 118 bgagaacgctccagcactgat o 119
bgagaacgctcgaccttcgat o 120 bgagaazgctccagcactgat o 121
bgagaazgctcgaccttcgat o 122 bgagaaagctggaccttccat o 123
bgagcaagztggaccttccat o 124 bgctagacgttagcgtga o 125 btcaacgtt o
126 btccatgacgttcctgatgct o 127 btccatgagcttcctgatgct o 128
btccattccatgacgttcctgatgcttcca os 129
btccattccattctaggcctgagtcttccat os 130
btcgtcgttttgtcgttttgtcgttttttt os 131 btttttccatgtcgttcctgatgcttttt
os 132 btttttcgtcgttcccccccccccc os 133 caaacgtt o 134 caacgtt o
135 caagagatgctaacaatgca s 136 caataaatctgaggagaccc 137
cacaccttggtcaatgtcacgt o 138 caccaccttggtcaatgtcacgt o 139
cacggtagccttccta 140 cacgttgaggggcat s 141 cactgtccttcgtcga sos 142
cagacacagaagcccgatagacg 143 cagattgtgcaatgtctcga o 144
cataacataggaatatttactcctcgc o 145 cataggatctcgagctcggaaagtcccctac o
146 catgagctcatctggaggaagcgg o 147 catttccacgatttccca o 148
cattttacgggcgggcgggc 149 ccaaatatcggtggtcaagcac 150 ccaacgtt s 151
ccacgtcgaccctcaggcga s 152 ccacgtggacctctagc o 153
ccactcacatctgctgctccacaag o 154 ccagatgagctcatgggtttctcc o 155
ccaggttaagaggaaatgacttcggg o 156 ccaggttgtatagaggc 157
ccagtgctgatcaccgatatcctgttcggcagtcg 158 ccatcgat o 159 ccatgcat o
160 ccatgctaacctctagc o 161 ccatgtcggtcctgatgct o 162
ccccaaagggatgagaagtt o 163 cccccaaaaaaaaaaccccc o 164 cccccc s 165
cccccccc s 166 cccccccccccc s 167 cccccccccccccccccccc s 168
cccccccccccccccccccc sos 169 cccccccccccccccccccccccc s 170
cccccccccccccccccccccccccccc s 171
ccccccccccccccccccccccccccccccccccc s 172 ccccttgacgttttcccccc sos
173 cccgaagtcatttcctcttaacctgg o 174 ccgaacaggatatcggtgatcagcac 175
ccgcttcctccagatgagctcatg o 176
ccgcttcctccagatgagctcatgggtttctccaccaag o 177 ccggccggccggccggccgg
o 178 ccgtcgttcccccccccccc o 179 cctacgttgtatgcgcccagct o 180
cctccaaatgaaagaccccc 181 cctctatacaacctgggac 182
ccttccatgtcggtcctgat sos 183 ccttcgat o 184 cgaacgtt o 185 cgacga o
186 cgacgt s 187 cgactctcgagcgttctc o 188
cgactgccgaacaggatatcggtgatcagcactgg 189 cgccgtcgcggcggttgg o 190
cgcctggggctggtctgg o 191 cgcgcgcgcgcgcgcgcgcg s 192
cgcgcgcgcgcgcgcgcgcg o 193 cgcgta s 194 cgctagaggttagcgtga o 195
cgctggaccttccat o 196 cgctggaccttccatgtcgg sos 197 cggctgacgtcatcaa
s 198 cgggcgactcagtctatcgg 199 cgggcttacggcggatgctg 200
cggtagccttccta 201 cgtaccttacggtga o 202 cgtacg s 203 cgtcga s 204
cgtcga o 205 cgtcgt s 206 cgtcgtcgt o 207 cgtcgtcgtcgtcgtcgtcgt s
208 cgtctatcgggcttctgtgtctg 209 cgttcg s 210 ctaacgtt o 211
ctaatctttctaatttttttctaa s 212
ctagataaagcggaaccagcaacagacacagaagccccgatagag o 213 ctagcgct o 214
ctagcggctgacgtcataaagctagc s 215 ctagcggctgacgtcatcaagctag o 216
ctagcggctgacgtcatcaatctag o 217 ctagcggctgagctcataaagctagc s 218
ctagcttgatgacgtcagccgctag o 219 ctagcttgatgagctcagccgctag o 220
ctagctttatgacgtcagccgctagc s 221 ctaggctgacgtcatcaagctagt o 222
ctagtggctgacgtcatcaagctag s 223 ctatcggaggactggcgcgcc 224
ctatcggaggactggcgcgccg 225 ctcaacgctggaccttccat o 226
ctcatgggtttctccaccaag o 227 ctccagctccaagaaaggacg o 228
ctcgccccgccccgatcgaat o 229 ctctccaagctcacttacag 230
ctctctgtaggcccgcttgg s 231 ctcttgcgacctggaaggta 232 ctgacgtcat o
233 ctgacgtg o 234 ctgattgctctctcgtga sos 235 ctgattgctctctcgtga o
236 ctgcagcctgggac o 237 ctgcgttagcaatttaactgtg o 238
ctgctgagactggag s 239 ctgctgctgctgctgctgctg 240 ctggaccttccatgtc
sos 241 ctggaccttccatgtcgg sos 242 ctggtctttctggtttttttctgg s 243
ctggtctttctggtttttttctgg o 244 ctgtaagtgagcttggagag 245
ctgtatgaaacaaattttcctctttgggca o 246 ctgtca s 247
ctgtcaggaactgcaggtaagg o 248 ctgtcccatatttttagaca 249 ctgtcg s 250
ctgtcg o 251 ctgtcgttcccccccccccc o 252 ctgtgctttctgtgtttttctgtg s
253 cttggagggcctcccggcgg 254 cttggtggagaaacccatgag o 255
cttggtggagaaacccatgagctcatctggaggaagcgg o 256 ctttccgttggacccctggg
s 257 czggczggczgggczccgg o 258 faacgttga o 259 fcgcgaattcgcg o 260
ftcaacgtt o 261 gaaacgtt o 262 gaaactgctgctagtttcgctttat o 263
gaaccttccatgctgtt 264 gaaccttccatgctgttccg 265 gaacgctggaccttccat
266 gaagttcacgttgaggggcat o 267 gaagtttctggtaagtcttcg o 268
gaccttccat 269 gaccttccatgtcggtcctgat 270 gaccttctatgtcggtcctg 271
gacgtcat o 272 gactgacgtcagcgt o 273 gagaacgatggaccttccat o 274
gagaacgctagaccttctat o 275 gagaacgctccaccttccat o 276
gagaacgctccagcactgat o 277 gagaacgctccagcttcgat o 278
gagaacgctccgaccttcgat s 279 gagaacgctcgaccttccat o 280
gagaacgctcgaccttcgatb s 281 gagaacgctggacctatccat o 282
gagaacgctggacctcatcatccat o 283 gagaacgctggacctcatccat o 284
gagaacgctggaccttcc 285 gagaacgctggaccttccat 286
gagaacgctggaccttccat s 287 gagaacgctggaccttccatgt 288
gagaacgctggaccttcgat o 289 gagaacgctggaccttcgta o 290
gagaacgctggaccttgcat o 291 gagaacgctggacgctcatccat o 292
gagaacgctggacttccat o 293 gagaacgctggaczttccat o 294
gagaacgctggatccat o 295 gagaatgctggaccttccat o 296
gagaazgctggaccttccat o 297 gagaccgctcgaccttcgat 298
gagcaagctggaccttccat s 299 gagcaagctggaccttccatb s 300
gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga o 301
gaggaaggigiggaigacgt o 302 gaggggaccattttacgggc 303
gatccagattctgccaggtcactgtgactggat o 304
gatccagattctgctgagtcactgtgactggat o 305
gatccagtcacagtgacctggcagaatctggat o 306
gatccagtcacagtgactcagcagaatctggat o 307 gatccggctgactcatcactagatc o
308 gatcgctgatctaatgctcg sos 309 gatcggaggactggcgcgccg 310
gatctagtgatgagtcagccggatc o 311 gattcaacttgcgctcatcttaggc o 312
gcaacgtt o 313 gcaatattgcb o 314 gcaatattgcf o 315
gcacatcgtcccgcagccga s 316 gcagcctctatacaacctgggacggga 317
gcatagcgttgagct sos 318 gcatgacgttgagct s 319 gcatgacgttgagct sos
320 gcatgacgttgagct o 321 gcatgacgttgagct s 322 gcatgagcttgagctga o
323 gcatgatgttgagct o 324 gcatgazgttgagct o 325 gcatggcgttgagct sos
326 gcatgtagctgagct o 327 gcatgtcgttgagct sos 328
gcattcatcaggcgggcaagaat o 329 gcattgcgttgagct sos 330
gcatttcgaggagct o 331 gccaccaaaacttgtccatg 332 gccagatgttagctgga o
333 gccatggacgaactgttccccctc s 334 gcgacgggcggcgcgcgccc s 335
gcgacggtcggcgcgcgccc s 336 gcgacgtgcggcgcgcgccc s 337
gcgacgttcggcgcgcgccc s 338 gcgatgtcgttcctgatgcg o 339
gcgatgtcgttcctgatgct o 340 gcgccagtcctccgatagac 341
gcgcgcgcgcgcgcgcgcg o 342 gcgctaccggtagcctgagt 343
gcggcgggcggcgcgcgccc o 344 gcggcgggcggcgcgcgccc s 345
gcggcggtcggcgcgcgccc s 346 gcggcgtgcggcgcgcgccc s 347
gcggcgttcggcgcgcgccc s 348 gcgtcgttcccccccccccc o 349
gcgtgcgttgtcgttgtcgtt s 350 gcgtttttttttgcg s 351 gctaaacgttagcgt o
352 gctaacgttagcgtga o 353 gctaccttagcgtga o 354 gctaccttagzgtga o
355 gctacttagcgtga o 356 gctagacgatagcgt o 357 gctagacgctagcgtga o
358 gctagacgt o 359 gctagacgtaagcgtga o 360 gctagacgtctagc o 361
gctagacgttagc o 362 gctagacgttagcgt o 363 gctagacgttagcgtga 364
gctagacgttagctgga o 365 gctagacgttagctgga sos 366 gctagacgttaggctga
o 367 gctagacgttagtgt o 368 gctagacgttagzgt o 369 gctagacgtttagc o
370 gctagagcttagcgtga o 371 gctagaggttagcgtga o 372
gctagaggttagcgtga s 373 gctagatgttaacgt o 374 gctagatgttagcgt o 375
gctagatgttagcgt s 376 gctagatgttagcgtga o 377 gctagazgttagcgt o 378
gctagazgttagtgt o 379 gctagctttagagctttagagctt o 380
gctaggcgttagcgt o 381 gctagtcgatagc o 382 gctagtcgatagcgt o 383
gctagtcgctagc o 384 gctandcghhagc o 385 gctatgacgttccaaggg s 386
gctcga s 387 gctcgttcagcgcgtct sos 388 gctgaaccttccatgctgtt 389
gctgagctcatgccgtctgc sos 390 gctggaccttccat 391 gctggaccttccat o
392 gctggccagcttacctcccg 393 gctgtaaaatgaatcggccg sos 394
gctgtggggcggctcctg s 395 gcttgacgtcaagc o 396 gcttgacgtctagc o 397
gcttgacgtttagc o 398 gcttgcgttgcgttt sos 399 gcttggagggcctgtaagtg
400 ggaacgtt o 401 ggaagacgttaga o 402 ggaattagtaatagatatagaagtt o
403 ggagaaacccatgagctcatctgg o 404 ggagctcttcgaacgccata 405
ggcagtgcaggctcaccggg 406 ggccaactttcaatgtgggatggcctc 407
ggccatcccacattgaaagtt 408 ggccttttcccccccccccc o 409
ggcggcggcggcggcggcgg o 410 ggcgttattcctgactcgcc o 411
ggctatgtcgatcctagcc o 412 ggctatgtcgttcctagcc o 413
ggctccggggagggaatttttgtctat o 414 ggctgtattcctgactgccc s 415
gggaatgaaagattttattataag o 416
ggggactttccgctggggactttccagggggactttcc sos 417
ggggagggaggaacttcttaaaattcccccagaatgttt o 418 ggggagggg s 419
ggggagggt s 420 ggggcatgacgttcaaaaaa s 421 ggggcatgacgttcaaaaaa sos
422 ggggcatgacgttcgggggg s2 423 ggggcatgacgttcgggggg sos 424
ggggcatgagcttcgggggg s 425 ggggcatgagcttcgggggg sos 426
ggggcctctatacaacctggg 427 gggggacgttggggg o 428
gggggggggggggggggggg sos 429 gggggggggggggggggggg o 430
ggggggttggggaaaacccggacttcctgca o 431 gggggttttttttttggggg o 432
ggggtaatcgatcagggggg sos 433 ggggtaatcgatgagggggg o 434
ggggtaatgcatcagggggg sos 435 ggggtcaacgttgagggggg sos 436
ggggtcaacgttgagggggg s 437 ggggtcaagcttgagggggg sos 438
ggggtcaagtctgagggggg sos 439 ggggtccagcgtgcgccatggggg sos 440
ggggtccctgagactgcc 441 ggggtcgaccttggagggggg sos 442
ggggtcgacgtcgagggggg s 443 ggggtcgtcgttttgggggg 444
ggggtctgtcgttttgggggg sos 445 ggggtctgtgcttttgggggg sos 446
ggggtgacgttcagggggg sos 447 ggggtgtcgttcagggggg sos 448
ggggttgacgttttgggggg sos 449 ggggttgggggtt s 450
ggtacctgtggggacattgtg o 451 ggtgaggtg s 452 ggtggtgtaggttttgg o 453
ggttacggtctgtcccatat 454 ggttcacgtgctcatggctg o 455 gtaacgtt o 456
gtagccttccta 457 gtaggggactttccgagctcgagatcctatg o 458
gtcactcgtggtacctcga s 459 gtccatggcgtgcgggatga 460
gtcccaggttgtatagaggctgc 461 gtccccatttcccagaggaggaaat o 462
gtccgggccaggccaaagtc s 463 gtcggtcctgatgctgttcc sos 464
gtctatcggaggactggcgc 465 gtctgtcccatgatctcgaa 466
gtgaaticgttcicgggict o 467 gtgccggggtctccgggc s 468
gtgccggggtctccgggc o 469 gtgcgcgcgagcccgaaatc s 470
gtgctgatcaccgatatcctgttcgg 471 gtgcttgaccaccgatatttgg 472
gtggttacggtcgtgcccat 473 gtgtcggggtctccgggc o 474
gttctcagataaagcggaaccagcaacagacacagaa 475 gttgaaacccgagaacatcat s
476 gttggatacaggccagactttgttg o 477 gtttttatataatttggg o 478
gzaatattgcb o 479 gzggzgggzggzgzgzgccc 480 taaacgtt s 481 taagcgct
o 482 taagctctgtcaacgccagg 483 taccgagcttcgacgagatttca o 484
taccgcgtgcgaccctct s 485 tactcttcggatcccttgcg sos 486
tagaaacagcattcttcttttagggcagcaca 487 tagacgtc o 488 tagacgttagcgtga
o 489 tatagtccctgagactgccccaccttctcaacaacc 490
tatcggaggactggcgcgccg 491 tatgccgcgcccggacttat sos 492
tcaaatgtgggattttcccatgagtct o 493 tcaacgt s 494 tcaacgtc o 495
tcaacgtt p-ethoxy 496
tcaacgtt s 497 tcaacgtt o 498 tcaacgttaacgttaacgtt o 499
tcaacgttaacgttaacgttaacgttaacgttb s 500 tcaacgttga s 501 tcaacgttga
o 502 tcaacgttgab o 503 tcaacgttgaf o 504 tcaagctt p-ethoxy 505
tcaagctt o 506 tcaatgctgaf o 507 tcaazgtt o 508 tcaazgttgab o 509
tcaccggt s 510 tcacgctaacctctagc o 511 tcacgctaacctctgac o 512
tcacgctaacgtctagc o 513 tcacgt o 514 tcagaccacgtggtcgggtgttcctga o
515 tcagaccagctggtcgggtgttcctga o 516 tcagcgct o 517 tcagcgtgcgcc s
518 tcagctctggtactttttca 519 tcaggaacacccgaccacgtggtctga o 520
tcaggaacacccgaccagctggtctga o 521 tcaggggtggggggaacctt sos 522
tcagzgct o 523 tcatcgat o 524 tccaagacgttcctgatgct o 525
tccaagtagttcctagttct o 526 tccaccacgtggctgatgct o 527
tccaccacgtggtctatgct s 528 tccacgacgttttcgacgtt s 529
tccagacggtgaagt o 530 tccagacgttgaagt o 531 tccagagcttgaagt o 532
tccagcgtgcgccata sos 533 tccaggacgttcctagttct o 534
tccaggacttctctcaggtt s 535 tccaggacttctctcaggtt sos 536
tccaggactttcctcaggtt s 537 tccaggactttcctcaggtt o 538
tccaggagcttcctagttct o 539 tccaggatgttcctagttct o 540
tccagtctaggcctagttct o 541 tccagttccttcctcagtct o 542
tccagttcgagcctagttct o 543 tccataacgttcctgagtct sos 544
tccataacgttcctgatgct o 545 tccatagcgatcctagcgat o 546
tccatagcggtcctagcggt o 547 tccatagcgttcctagcgtt s 548
tccatagcgttcctagcgtt o 549 tccatcacgtgcctgagtct sos 550
tccatgacattcctgatgct o 551 tccatgacggtcctgacggt s 552
tccatgacggtcctgacggt o 553 tccatgacggtcctgagtct sos 554
tccatgacggtcctgatgct s 555 tccatgacgtccctgagtct sos 556
tccatgacgtccctgatgct o 557 tccatgacgttcctagttct o 558
tccatgacgttcctctccatgacgttcctctccatgacgttcctc o 559
tccatgacgttcctgacgtt s 560 tccatgacgttcctgacgtt 561
tccatgacgttcctgacgtt sos 562 tccatgacgttcctgacgtt o 563
tccatgacgttcctgagtct sos 564 tccatgacgttcctgatcc 565
tccatgacgttcctgatgct o 566 tccatgacgttcctgatgct s 567
tccatgacgttcctgcagttcctgacgtt s 568 tccatgacgttcctgccgtt s 569
tccatgacgttcctgcgttt s 570 tccatgacgttcctggcggg s 571
tccatgacgttcztgatgct o 572 tccatgagcttcctgagctt s 573
tccatgagcttcctgagtct o 574 tccatgagcttcctgagtct p-ethoxy 575
tccatgagcttcctgagtct s 576 tccatgagcttcctgatgct s2 577
tccatgagcttccttgagtct 578 tccatgaigttcctgaigtt s 579
tccatgatgttcctagttct o 580 tccatgazgttcctagttct o 581
tccatgazgttcctgatgct o 582 tccatgazgttcctgazgtt s 583
tccatgccggtcctgagtct sos 584 tccatgccggtcctgatgct o 585
tccatgccggtcctgccggt o 586 tccatgccgttcctgccgtt s 587
tccatgccgttcctgccgtt o 588 tccatgcgcgtcctgcgcgt o 589
tccatgcgtgcgtgcgtttt s 590 tccatgcgttgcgttgcgtt s 591
tccatgctggtcctgagtct sos 592 tccatgctggtcctgatgct o 593
tccatggcgggcctggcggg s 594 tccatggcggtcctgatgct o 595
tccatgtagttcctagttct o 596 tccatgtccttcctgatgct 597
tccatgtcgatcctgagtct sos 598 tccatgtcgatcctgatgct o 599
tccatgtcgctcctgagtct sos 600 tccatgtcgctcctgatcct o 601
tccatgtcggtcctgagtct sos 602 tccatgtcggtcctgatgct 603
tccatgtcggtcctgatgct s 604 tccatgtcggtcctgctgat o 605
tccatgtcggtzctgatgct o 606 tccatgtcgttccgcgcgcg o 607
tccatgtcgttcctagttct 608 tccatgtcgttcctgagtct sos 609
tccatgtcgttcctgatgcg o 610 tccatgtcgttcctgatgct o 611
tccatgtcgttcctgccgct o 612 tccatgtcgttcctgtagct o 613
tccatgtcgttcctgtcgtt s 614 tccatgtcgttcctgtcgtt o 615
tccatgtcgtttttgtcgtt s 616 tccatgtgcttcctgatgct o 617
tccatgtzggtcctgagtct sos 618 tccatgtzggtcctgatgct o 619
tccatgtzgttcctgatgct o 620 tccatgtzgttcctgtzgtt s 621
tccattgcgttccttgcgtt o 622 tcccgacggtgaagt o 623 tcccgccgttgaagt o
624 tcccgcgcgttccgcgcgtt s 625 tccctgagactgccccacctt 626 tccgatcg o
627 tccggacggtgaagt o 628 tccggccgttgaagt o 629 tccgtacg o 630
tcctaacgttgaagt o 631 tcctagcgttgaagt o 632 tcctcacgttgaagt o 633
tcctga o 634 tcctgaaaaggaagt s 635 tcctgacgatgaagt o 636
tcctgacgctgaagt o 637 tcctgacggggaagt o 638 tcctgacggggaagt s 639
tcctgacggggagt s 640 tcctgacggtgaagt o 641 tcctgacggtgaagt s 642
tcctgacgtagaagt o 643 tcctgacgtcgaagt o 644 tcctgacgtggaagt o 645
tcctgacgtggaagt s 646 tcctgacgttaga o 647 tcctgacgttccc o 648
tcctgacgttcccctggcggtcccctgtcgct o 649 tcctgacgttcctgacgtt s 650
tcctgacgttcctggcggtcctgtcgct o 651 tcctgacgttccttc o 652
tcctgacgttcggcgcgcgccc s 653 tcctgacgttgaagt o 654 tcctgacgttgaagt
s 655 tcctgagcttgaagt o 656 tcctgagcttgaagt s 657 tcctgazgttgaagt o
658 tcctgccgttgaagt o 659 tcctgccgttgaagt s 660 tcctggaggggaagt o
661 tcctggaggggaagt s 662 tcctggcggggaagt o 663 tcctggcggggaagt s
664 tcctggcggtcctggcggtt s 665 tcctggcggtgaagt o 666
tcctggcggtgaagt s 667 tcctggcgtggaagt s 668 tcctggcgttgaagt o 669
tcctggcgttgaagt s 670 tcctgggggggaagt o 671 tcctggtggggaagt o 672
tcctggzggggaagt o 673 tcctgtcgctcctgtcgct o 674
tcctgtcgctcctgtcgctcctgtcgct o 675 tcctgtcgttcctgtcgtt s 676
tcctgtcgttcctgtcgttggaacgacagg o 677
tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 678 tcctgtcgttccttgtcgtt
s 679 tcctgtcgttgaagt o 680 tcctgtcgttgaagtttttt o 681
tcctgtcgttttttgtcgtt s 682 tccttacgttgaagt o 683
tccttgtcgttcctgtcgtt s 684 tcgacgtc o 685 tcgacgttcccccccccccc o
686 tcgagacattgcacaatcatctg o 687 tcgccgttcccccccccccc o 688
tcgcgtgcgttttgtcgttttgacgtt s 689 tcgga o 690 tcggcgttcccccccccccc
o 691 tcgtag s 692 tcgtca o 693 tcgtcattcccccccccccc o 694
tcgtcgatcccccccccccc o 695 tcgtcgctcccccccccccc o 696
tcgtcgctgtctccg s 697 tcgtcgctgtctccgcttctt s 698
tcgtcgctgtctccgcttctt so 699 tcgtcgctgtctccgcttctt s2o 700
tcgtcgctgtctccgcttcttcttgcc s 701 tcgtcgctgtctgcccttctt s 702
tcgtcgctgttgtcgtttctt s 703 tcgtcggtcccccccccccc o 704
tcgtcgtcagttcgctgtcg sos 705 tcgtcgtcgtcgtcgtcgtcgtt sos 706
tcgtcgtcgtcgtt s 707 tcgtcgtcgtcgtt s2 708 tcgtcgtcgtcgtt s2o 709
tcgtcgtcgtcgtt os2 710 tcgtcgttccccccccc s 711 tcgtcgttcccccccccccc
o 712 tcgtcgttccccccccccccb o 713 tcgtcgttccccccczcccc o 714
tcgtcgttggtgtcgttggtgtcgtt s 715 tcgtcgttggttgtcgttttggtt s 716
tcgtcgttgtcgttgtcgtt s 717 tcgtcgttgtcgttgtcgtt sos 718
tcgtcgttgtcgttttgtcgtt s 719 tcgtcgttgtcgttttgtcgtt sos 720
tcgtcgtttcgtcgttttgacgtt s 721 tcgtcgtttgcgtgcgtttcgtcgtt s 722
tcgtcgtttgtcgttttgtcgtt s 723 tcgtcgttttgacgttttgacgtt s 724
tcgtcgttttgacgttttgtcgtt s 725 tcgtcgttttgcgtgcgttt s 726
tcgtcgttttgtcgttttgggggg 727 tcgtcgttttgtcgttttgtcgt s2 728
tcgtcgttttgtcgttttgtcgtt s 729 tcgtcgttttgtcgttttgtcgtt sos 730
tcgtcgttttgtcgttttgtcgtt o 731 tcgtcgttttgtcgttttgtcgtt s2 732
tcgtcgttttgtcgttttgtcgttb o 733 tcgtcgttttgtcgttttgtcgttttgtcgtt s
734 tcgtcgttttgtggttttgtggtt s 735 tcgtcgttttttgtcgttttttgtcgtt s
736 tcgtcgtttttttttttttt s 737 tcgtga s 738 tcgtga o 739 tcgtgg s
740 tcgtzgttcccccccccccc o 741 tcntcgtnttntcgtnttntcgtn s 742
tctaaaaaccatctattcttaaccct o 743 tctagcgtttttagcgttcc sos 744
tctatcccaggtggttcctgttag o 745 tctatcgacgttcaagcaag s 746
tctccatcctatggttttatcg o 747
tctccatgatggttttatcg 748 tctcccagcgagcgagcgccat s 749
tctcccagcgagcgccat s 750 tctcccagcgcgcgccat s 751 tctcccagcgggcgcat
s 752 tctcccagcgtacgccat s 753 tctcccagcgtcgccat s 754
tctcccagcgtgcgccat s 755 tctcccagcgtgcgccat o 756
tctcccagcgtgcgccatat sos 757 tctcccagcgtgcgcctttt sos 758
tctcccagcgtgcgtgcgccat s 759 tctcccagcgtgcgttatat sos 760
tctcccagcgtgcgtttt s 761 tctcccagcgttgcgccatat sos 762
tctcccatcgtcgccat s 763 tctcccgacgtgcgccat s 764 tctcccgtcgtgcgccat
s 765 tctccctgcgtgcgccatat sos 766 tctcctagcgtgcgccatat sos 767
tctgacgtcatctgacgttggctgacgtct o 768 tctgcgtgcgtgcgccatat sos 769
tcttcgaa o 770 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt o 771
tctttattagtgactcagcacttggca o 772 tcztgacgttgaagt o 773 tgaacgtt o
774 tgcaatgtgacgtcctttagcat o 775 tgcaggaagtccgggttttccccaacccccc o
776 tgcatcagctct s 777 tgcatcagctct sos 778 tgcatcccccaggccaccat s
779 tgcatgccgtacacagctct sos 780 tgcatgccgtacacagctct s 781
tgcatgccgtacacagctct o 782 tgcatgccgtgcatccgtacacagctct s 783
tgccaagtgctgagtcactaataaaga o 784 tgcccaaagaggaaaatttgtttcatacag o
785 tgcgctct s 786 tgctagctgtgcctgtacct 787 tgctagctgtgcctgtacct s
788 tgctgcttcccccccccccc o 789 tgctgcttcccccccccccc s 790
tgctgcttttgtgcttttgtgctt o 791 tgctgcttttgtgcttttgtgctt s 792
tggaccttccat 793 tggaccttctatgtcggtcc 794
tggagggtgagggtggggccagagcgggtggggctgattggaa o 795
tggaggtcccaccgagatcggag o 796 tggttacggtctgtcccatg 797
tgtatctctctgaaggact o 798 tgtccagccgaggggaccat 799
tgtcccatgtttttagaagc 800 tgtcgttgtcgtt s 801
tgtcgttgtcgttgtcgttgtcgtt s 802 tgtcgtttgtcgtttgtcgtt s 803
ttaacggtggtagcggtattggtc o 804 ttaacgtt o 805
ttaagaccaataccgctaccaccg o 806 ttaggacaaggtctagggtg 807
ttagggttagggttagggtt s2 808 ttcagttgtcttgctgcttagctaa o 809
ttcatgccttgcaaaatggcg 810
ttccaatcagccccacccgctctggccccaccctcaccctcca o 811
ttccatgctgttccggctgg 812 ttccatgtcggtcctgat sos 813
ttccgccgaatggcctcaggatggtac 814 ttccgctttatctgagaaccatct 815
ttcctctctgcaagagact o 816 ttcgggcggactcctccatt sos 817
ttcgggcggactcctccatt o 818 ttcgtcgttttgtcgttttgtcgtt s 819
ttctgtgtctgttgctggttccgctttatctgagaac 820 ttgaaactgaggtgggac 821
ttgccccatattttagaaac 822 ttggggggggtt s 823 ttgtactctccatgatggtt
824 tttaccttttataaacataactaaaacaaa o 825
tttgaatcctcagcggtctccagtggc o 826 tttgaattcaggactggtgaggttgag o 827
tttgaattccgtgtacagaagcgagaagc o 828 tttgagaacgctggaccttc sos 829
tttgcggccgctagacttaacctgagagata o 830 tttgggcccacgagagacagagacacttc
o 831 tttgggcccgcttctcgcttctgtacacg o 832
ttttctagagaggtgcacaatgctctgg o 833 tttttggggggggggttttt o 834
tttttttttttttf o 835 tttttttttttttf so 836 tttttttttttttttttt s 837
tttttttttttttttttttt s 838 tttttttttttttttttttt o 839
ttttttttttttttttttttt s 840 tttttttttttttttttttttttt s 841
ttttttttttttttttttttttttttt s 842 tzaacgtt o 843
tzgtcgttcccccccccccc o 844 tzgtcgttttgtcgttttgtcgtt o 845
tzgtggttcccccccccccc o 846 tzgtzgttttgtzgttttgtzgtt o 847
tzgtzgttttgtzgttttgtzgtt s 848
In Table 4 with respect to sequences the letter symbols aside from
a, c, t, and g are defined as follows: "b" indicates a biotin
moiety attached to that end of the oligonucleotide when it is
single and is listed on the 5' or 3' end of oligonucleotide; "d"
represents a, g, or t; "f" represents fluorescein isothiocyanate
(FITC) moiety attached to the 5' or 3' end of oligonucleotide; "h"
represents a, c, or t; "i" represents inosine; "n" represents any
nucleotide; "z" represents 5-methylcytosine.
Also in Table 4 with respect to backbones the notations are defined
as follows: "o" represents phosphodiester; "os" represents
phosphorothioate and phosphodiester chimeric with phosphodiester on
5' end; "os2" represents phosphorodithioate and phosphodiester
chimeric with phosphodiester on 5' end; "p-ethoxy" represents
p-ethoxy backbone (see, e.g., U.S. Pat. No. 6,015,886); "po"
represents phospholdiester; "s" represents phosphorothioate; "s2"
represents phosphorodithioate; "s2o" represents phosphorodithioate
and phosphodiester chimeric with phosphodiester on 3' end; "so"
represents phosphorothioate and phosphodiester chimeric with
phosphodiester on 3' end; and "sos" represents chimeric
phosphorothioate/phosphodiester with phosphorothioate at the 5' and
3' ends.
The nucleic acids are delivered in effective amounts. The term
"effective amount" of a immunostimulatory nucleic acid refers to
the amount necessary or sufficient to realize a desired biologic
effect. For example, an effective amount of an immunostimulatory
nucleic acid could be that amount necessary to cause activation of
the immune system. According to some aspects of the invention, an
effective amount is that amount of an immunostimulatory nucleic
acid and that amount of an antibody, which when combined or
co-administered, results in the prevention or the treatment of the
cancer. In some embodiments a synergistic effect is observed. A
synergistic amount is that amount which produces an anti-cancer
response that is greater than the sum of the individual effects of
either the immunostimulatory nucleic acid and the antibody alone.
For example, a synergistic combination of an immunostimulatory
nucleic acid and an antibody provides a biological effect which is
greater than the combined biological effect which could have been
achieved using each of the components (i.e., the nucleic acid and
the antibody) separately. The biological effect may be the
amelioration and or absolute elimination of symptoms resulting from
the cancer. In another embodiment, the biological effect is the
complete abrogation of the cancer, as evidenced for example, by the
absence of a tumor or a biopsy or blood smear which is free of
cancer cells.
The effective amount of immunostimulatory nucleic acid necessary to
treat a cancer or in the reduction of the risk of developing a
cancer may vary depending upon the sequence of the
immunostimulatory nucleic acid, the backbone constituents of the
nucleic acid, and the mode of delivery of the nucleic acid. The
effective amount for any particular application can also vary
depending on such factors as the cancer being treated, the
particular immunostimulatory nucleic acid being administered (e.g.,
the nature, number or location of immunostimulatory motifs in the
nucleic acid), the size of the subject, or the severity of the
disease or condition. One of ordinary skill in the art can
empirically determine the effective amount of a particular
immunostimulatory nucleic acid and antibody combination without
necessitating undue experimentation. Combined with the teachings
provided herein, by choosing among the various active compounds and
weighing factors such as potency, relative bioavailability, patient
body weight, severity of adverse side-effects and preferred mode of
administration, an effective prophylactic or therapeutic treatment
regimen can be planned which does not cause substantial toxicity
and yet is entirely effective to treat the particular subject.
Therapeutic doses of cancer therapies are well known in the field
of medicine for the treatment of cancer. These dosages have been
extensively described in references such as Remington's
Pharmaceutical Sciences, 18th ed., 1990; as well as many other
medical references relied upon by the medical profession as
guidance for the treatment of cancer. Therapeutic dosages of
immunostimulatory nucleic acids have also been described in the art
and methods for identifying therapeutic dosages in subjects are
described in more detail herein.
Subject doses of the compounds described herein typically range
from about 0.1 .mu.g to mg per administration, which depending on
the application could be given daily, weekly, or monthly and any
other amount of time therebetween. More typically mucosal or local
doses range from about 10 .mu.g to 5 mg per administration, and
most typically from about 100 .mu.g to 1 mg, with 2-4
administrations being spaced hours, days or weeks apart. More
typically, immune stimulant doses range from 1 .mu.g to 10 mg per
administration, and most typically 10 .mu.g to 1 mg, with daily or
weekly administrations. Subject doses of the compounds described
herein for parenteral delivery, wherein the compounds are delivered
without another therapeutic agent are typically 5 to 10,000 times
higher than the effective mucosal dose or for immune stimulant
applications, and more typically 10 to 1,000 times higher, and most
typically 20 to 100 times higher. More typically parenteral doses
for these purposes range from about 10 .mu.g to 5 mg per
administration, and most typically from about 100 .mu.g to 1 mg,
with 2-4 administrations being spaced hours, days or weeks apart.
In some embodiments, however, parenteral doses for these purposes
may be used in a range of 5 to 10,000 times higher than the typical
doses described above.
For any compound described herein the therapeutically effective
amount can be initially determined from animal models, e.g., the
animal models described herein. A therapeutically effective dose
can also be determined from human data for CpG nucleic acids which
have been tested in humans (human clinical trials have been
initiated and the results publicly disseminated) and for compounds
which are known to exhibit similar pharmacological activities.
Higher doses may be required for parenteral administration, as
described above. The applied dose can be adjusted based on the
relative bioavailability and potency of the administered compound.
Adjusting the dose to achieve maximal efficacy based on the methods
described above and other methods as are well-known in the art is
well within the capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
For use in therapy, an effective amount of the nucleic acid can be
administered to a subject by any mode that delivers the nucleic
acid to a subject. "Administering" the pharmaceutical composition
of the present invention may be accomplished by any means known to
the skilled artisan. Some routes of administration include but are
not limited to oral, intranasal, intratracheal, inhalation, ocular,
vaginal, rectal, parenteral (e.g., intramuscular, intradermal,
intravenous or subcutaneous injection) and direct injection.
For oral administration, the compounds (i.e., nucleic acids and
antibodies) can be delivered alone without any pharmaceutical
carriers or formulated readily by combining the active compound(s)
with pharmaceutically acceptable carriers well known in the art.
The term "pharmaceutically-acceptable carrier" means one or more
compatible solid or liquid filler, dilutants or encapsulating
substances which are suitable for administration to a human or
other vertebrate animal. The term "carrier" denotes an organic or
inorganic ingredient, natural or synthetic, with which the active
ingredient is combined to facilitate the application. The
components of the pharmaceutical compositions also are capable of
being commingled with the compounds of the present invention, and
with each other, in a manner such that there is no interaction
which would substantially impair the desired pharmaceutical
efficiency.
Such carriers enable the compounds of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels,
syrups, slurries, suspensions and the like, for oral ingestion by a
subject to be treated. Pharmaceutical preparations for oral use can
be obtained as solid excipient, optionally grinding a resulting
mixture, and processing the mixture of granules, after adding
suitable auxiliaries, if desired, to obtain tablets or dragee
cores. Suitable excipients are, in particular, fillers such as
sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers for neutralizing
internal acid conditions.
Dragee cores may be provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of
tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according
to the present invention may be conveniently delivered in the form
of an aerosol spray, from pressurized packs or a nebulizer, with
the use of a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide
or other suitable gas. In the case of a pressurized aerosol the
dosage unit may be determined by providing a valve to deliver a
metered amount. Capsules and cartridges of e.g., gelatin for use in
an inhaler or insufflator may be formulated containing a powder mix
of the compound and a suitable powder base such as lactose or
starch.
The compounds, when it is desirable to deliver them systemically,
may be formulated for parenteral administration by injection, e.g.,
by bolus injection or continuous infusion. Formulations for
injection may be presented in unit dosage form, e.g., in ampoules
or in multi-dose containers, with an added preservative. The
compositions may take such forms as suspensions, solutions or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing
agents.
Pharmaceutical formulations for parenteral administration include
aqueous solutions of the active compounds in water-soluble form.
Additionally, suspensions of the active compounds may be prepared
as appropriate oily injection suspensions. Suitable lipophilic
solvents or vehicles include fatty oils such as sesame oil, or
synthetic fatty acid esters, such as ethyl oleate or triglycerides,
or liposomes. Aqueous injection suspensions may contain substances
which increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for
constitution with a suitable vehicle, e.g., sterile pyrogen-free
water, before use.
The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
In addition to the formulations described previously, the compounds
may also be formulated as a depot preparation. Such long acting
formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or
gel phase carriers or excipients. Examples of such carriers or
excipients include but are not limited to calcium carbonate,
calcium phosphate, various sugars, starches, cellulose derivatives,
gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for
example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions may also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of present methods for drug delivery,
see Langer R, Science 249:1527-33 (1990), which is incorporated
herein by reference.
The nucleic acids and/or antibodies may be administered per se
(neat) or in the form of a pharmaceutically acceptable salt. When
used in medicine the salts should be pharmaceutically acceptable,
but non-pharmaceutically acceptable salts may conveniently be used
to prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
Suitable buffering agents include: acetic acid and a salt (1-2%
w/v); citric acid and a salt (1-3% w/v); boric acid and a salt
(0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
The nucleic acids or other therapeutics useful in the invention may
be delivered in mixtures with additional antibodies. A mixture may
consist of several antibodies in addition to the nucleic acid.
A variety of administration routes are available. The particular
mode selected will depend, of course, upon the particular nucleic
acids or antibodies selected, the particular condition being
treated and the dosage required for therapeutic efficacy. The
methods of this invention, generally speaking, may be practiced
using any mode of administration that is medically acceptable,
meaning any mode that produces effective levels of an immune
response without causing clinically unacceptable adverse effects.
Preferred modes of administration are discussed above.
The compositions may conveniently be presented in unit dosage form
and may be prepared by any of the methods well known in the art of
pharmacy. All methods include the step of bringing the compounds
into association with a carrier which constitutes one or more
accessory ingredients. In general, the compositions are prepared by
uniformly and intimately bringing the compounds into association
with a liquid carrier, a finely divided solid carrier, or both, and
then, if necessary, shaping the product. Liquid dose units are
vials or ampoules. Solid dose units are tablets, capsules and
suppositories.
Other delivery systems can include time-release, delayed release or
sustained release delivery systems. Such systems can avoid repeated
administrations of the compounds, increasing convenience to the
subject and the physician. Many types of release delivery systems
are available and known to those of ordinary skill in the art. They
include polymer base systems such as poly(lactide-glycolide),
copolyoxalates, polycaprolactones, polyesteramides,
polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
Microcapsules of the foregoing polymers containing drugs are
described in, for example, U.S. Pat. No. 5,075,109. Delivery
systems also include non-polymer systems that are: lipids including
sterols such as cholesterol, cholesterol esters and fatty acids or
neutral fats such as mono-, di-, and tri-glycerides; hydrogel
release systems; sylastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix =such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152, and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
The nucleic acid may be directly administered to the subject or may
be administered in conjunction with a pharmaceutically acceptable
carrier or a delivery vehicle. The nucleic acid and optionally
other therapeutic agents may be administered alone (e.g., in saline
or buffer) or using any delivery vehicles known in the art. One
type of delivery vehicle is referred to herein as a nucleic acid
delivery complex. A "nucleic acid delivery complex" shall mean a
nucleic acid molecule associated with (e.g., ionically or
covalently bound to; or encapsulated within) a targeting means
(e.g., a molecule that results in higher affinity binding to target
cell (e.g., dendritic cell surfaces and/or increased cellular
uptake by target cells). Examples of nucleic acid delivery
complexes include nucleic acids associated with: a sterol (e.g.,
cholesterol), a lipid (e.g., a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g., a ligand
recognized by target cell specific receptor). Preferred complexes
may be sufficiently stable in vivo to reduce significant uncoupling
prior to internalization by the target cell. However, the complex
may be cleavable under appropriate conditions within the cell so
that the nucleic acid may be released in a functional form.
The nucleic acids may be delivered by non-invasive methods as
described above. Non-invasive delivery of compounds is desirable
for treatment of children, elderly, animals, and even adults and
also to avoid the risk of needle-stick injury. Delivery vehicles
for delivering compounds to mucosal surfaces have been described
and include but are not limited to: Cochleates (Gould-Fogerite et
al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al.,
1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et
al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999,
Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial
vectors (e.g., Salmonella, Escherichia coli, Bacillus Calmette
-Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et
al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et
al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes
Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent
et al., 1998, Flexner et al., 1988, Morrow et al., 1999);
Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al.,
1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al.,
1989); nucleic acid vaccines (Fynan et al., 1993, Kuklin et al.,
1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997);
Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al.,
1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al.,
1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988,
1996, 1997); Sodium Fluoride (Hashi et al., 1998); Transgenic
plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995);
Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al.,
1998); Virus-like particles (Jiang et al., 1999, Leibl et al.,
1998).
The invention also includes kits. The kits generally include a
package with a plurality of containers housing active agents and
instructions for carrying out the methods of the invention. The
active agents include but are not limited to immunostimulatory
nucleic acids, antibodies such as antibodies specific for a cell
surface antigen, and anti-cancer therapies.
The following examples are provided to illustrate specific
instances of the practice of the present invention and are not to
be construed as limiting the present invention to these examples.
As will be apparent to one of ordinary skill in the art, the
present invention will find application in a variety of
compositions and methods.
EXAMPLES
Introduction:
Extensive cross-talk exists between healthy B cells and T cells.
There is evidence that malignant B cells also communicate with T
cells. However, malignant cells appear to differ from their normal
counterparts in a number of ways, including a decreased tendency to
undergo apoptosis in response to normal signals, altered expression
of a variety of surface markers, and altered ability to function as
effective antigen presenting cells. Lagneaux L et al., Blood
91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:S5-9 (1993);
Gordon J et al., Adv Exp Med Biol 406:139-44 (1996); Chaperot L et
al., Exp Hematol 27:479-88 (1999). Immunotherapeutic approaches
have recently become part of our therapy of some subtypes of B-cell
malignancy. Improved immunotherapy of B-cell malignancy will need
to be designed based on the growing understanding of the cellular
immunology of this disease. Schultze J L et al., J Mol Med
77:322-32 (1999).
A variety of cellular receptors and antigens are involved in
growth, differentiation and apoptosis of B-cell malignancies.
Antibodies or ligands against a variety of antigens can cause
growth inhibition or even apoptosis including CD20, surface
immunoglobulins, MHC II, CD80, CD86 and CD40. Maloney D G, Semin
Oncol 26:74-8 (1999); McLaughlin P et al., Semin Oncol 26:79-87
(1999); Shan D et al., Blood 91:1644-52 (1998); Coiffier B et al.,
Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt)
12:1763-70, 1775-7 (1998); Tutt A L et al., J Immunol 161:3176-85
(1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et
al., J Allergy Clin Immunol 98:S238-47 (1996); Higaki Y et al.,
Immunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood
87:3803-12 (1996); Link B K et al., Blood 81:3343-9 (1993); Link B
K et al., Int J Cancer 77:251-6 (1998). The relative contribution
of antibody dependent cellular cytotoxicity (ADCC) versus
trans-membrane signaling mediated by anti-B cell antibodies remains
unclear. In the present study, we examined how CpG-DNA impacts on
the phenotype, apoptosis and proliferation of different types of
B-cell malignancy including follicular B-cell lymphoma and
B-CLL.
Materials and Methods:
Cell culture: Fresh lymph node samples were obtained from the
operating suite and were minced with a scalpel under aseptic
conditions. The resulting suspension was passed sequentially
through a sterilized sieve-tissue grinder containing a nylon mesh
screen, a 150 .mu.m mesh screen and a 60 .mu.m mesh screen.
Alternatively, mononuclear cells were obtained from peripheral
blood or pleural fluid as described. Hartmann G et al., J Pharmacol
Exp Ther 285:920-8 (1998). Red blood cells were removed by
resuspending the cells in 5 ml ACK lysis buffer according to
standard procedures. Cells were frozen slowly and stored in liquid
nitrogen. For analysis, cells were thawed and resuspended in 10%
(v/v) heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, U
T), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, N.Y.) and
incubated on a 96-well-plate (1.times.10.sup.6 cells/ml) in the
presence of ODN as indicated below. Not all assays were performed
for all samples because of the limited number of cells available
for some samples.
Oligonucleotides: Nuclease-resistant phosphorothioate-modified
oligodeoxynucleotide (ODN) were purchased from Operon Technologies
(Alameda, Calif.) and Hybridon Specialty Products (Milford, Mass.).
Sequences were as follows: CpG ODN 2006:
5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN
2017: 5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ ID NO: 168). ODN was diluted
in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free
reagents. ODN was added at a final concentration of 5 .mu.g/ml.
Flow cytometry: Cells were washed and resuspended in ice-cold PBS
or Annexin V binding buffer (10 mM HEPES/NaOH, 140 mM NaCl, 2.5 mM
CaCl.sub.2, pH 7.4). Murine or human serum was added (final
concentration 1%) to block non-specific binding of antibodies.
Surface antigen staining was performed as described. Hartmann G et
al., J Pharmacol Exp Ther 285:920-8 (1998). In brief,
1.times.10.sup.5 cells per sample were stained with
CyChrome-labeled anti-CD19 and FITC- or PE-labeled antibodies as
indicated for 20 min on ice. They were then washed and analyzed by
flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50),
CD80 (L307.4), CD86 (IT2.2), CD54 (HA58), MHC I (G46-2.6) and MHC
II (TU39) as well as isotype controls (IgG1, MOPC-21 and IgG2a,
G155-178) were purchased from PharMingen, San Diego, Calif.
FITC-labeled polyclonal anti-human Ig was purchased from Southern
Biotech, Birmingham, Ala. 1D10, a monoclonal humanized antibody
directed against a variant of HLA-DR was produced in our laboratory
as described earlier. Link B K et al., Blood 81:3343-9 (1993).
C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from
IDEC Pharmaceuticals, San Diego, Calif. 1D10 and C2B8 were labeled
with FITC according to standard protocols. The analysis gate was
set on viable cells identified according to FSC/SSC characteristics
and Annexin V staining (>97% viable cells within analysis gate).
Spectral overlap was corrected by appropriate compensation. Flow
cytometric data from 1.times.10.sup.4 cells per sample were
acquired on a FACScan (Beckton Dickinson Immunocytometry Systems,
San Jose, Calif.). Data were analyzed using the computer program
FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).
CFSE staining: CFSE 5-(and 6-) carboxyfluorescein diacetate
succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived
intracellular fluorescent label which is divided equally between
daughter cells upon cell division. Staining of cells with CFSE
allows both quantification and immunophenotyping of proliferating
cells in a mixed cell suspension. Interference between
oligonucleotide degradation products and thymidine uptake (standard
proliferation assay) is avoided by using this method. The technique
has described in detail previously. Lyons A B et al., J Immunol
Methods 171:131-7 (1994). Briefly, cells were washed twice in PBS,
resuspended in PBS (1.times.10.sup.7 cells/ml) containing CFSE at a
final concentration of 1 .mu.M, and incubated at 37.degree. C. for
10 minutes. Cells were washed three times with PBS.
TUNEL assay: A two-color DNA strand break labeling assay, based on
a modification of the assay described by Li et al. (Li X et al.,
ExpCell Res 222:28-37 (1996)) was used to assess B-cell
proliferation in response to CpG ODN. This assay involved terminal
transferase-mediated dUTP nick end labeling (TUNEL) before and
after induction of DNA strand breaks in BrdU-labeled cells.
Briefly, cells were cultured for 3 days with and without ODN. They
were then incubated for 16 hours in 10 .mu.M BrdU and placed onto
slides by cytospin. Cells were then in 1% paraformaldehyde in PBS
for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage
indicative of apoptosis cells was detected by labeling the 3'-DNA
end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The
use of dideoxy-dUTP prevented further elongation of the 3'-ends in
subsequent steps. Slides were then placed face-down on a 2 mm
support at both ends on a UV transilluminator and exposed for 5
minutes. The new DNA strand breaks induced by photolysis at sites
of BrdU incorporation (i.e., proliferating cells) were detected by
a second TUNEL labeling using tetramethylrhodamine-dUTP (TMR-dUTP,
Boehringer-Mannheim). Both TUNEL staining steps included incubating
slides in 50 .mu.l of TdT mix (34 .mu.l distilled water, 10 .mu.l
of 5.times.TdT buffer, 5 .mu.l of 25 mM cobalt chloride, 12.5 units
terminal transferase and 0.5 nmol fluorochrome-conjugated-dUTP)
(Boehringer-Mannheim) under a coverslip for one hour at 37.degree.
C. in a humidified chamber. The slides were then washed in 5 quick
changes of distilled water followed by 3 changes of 2.times.SSC
containing 30% formamide for 5 minutes each at room temperature.
After the second TUNEL labeling step, cells were counterstained for
CD19, and also stained with Wright solution for blood cell
differentiation and mounted in Vectashield media containing DAPI
counterstain (Vector Laboratories, Burlingame, Calif.). The
morphology and staining of cells were assessed using both visible
light and fluorescence microscopy. Apoptotic cells were identified
by green fluorescence (FITC label), and proliferating cells by red
fluorescence (TMR label). The percentage of apoptotic and
proliferating cells was determined by counting at least 200 cells
per sample by three observers blinded to whether cells were treated
with ODN. Mean and standard error were determined for each sample
based on these three readings.
Example 1
Immunostimulatory Nucleic Acids Induce Morphological and Phenotypic
Changes in Malignant B Cells
Our prior studies demonstrated that activation of naive human B
cells by CpG ODN results in increased cell size (FSC) and
granularity (SSC). Hartmann G et al., J Immunol 164:944-53 (2000).
We therefore first determined whether such changes also occur in
malignant B cells. Primary malignant B cells were obtained from
lymph node biopsies, peripheral blood, or pleural fluid of patients
with various types of B-cell malignancy. In addition, cells from
the lymph node of a patient with benign reactive follicular
hyperplasia were studied. Nine samples in total were evaluated (see
Table 5). Cells were incubated for 72 hours in media containing CpG
ODN 2006 (5 .mu.g/ml) or control ODN 2017. FSC and SSC were
examined with gating on CD19+ viable cells (FIG. 1). Varying
degrees of change in FSC and SSC were noted in response to CpG ODN
2006 when compared to control ODN 2017 or medium alone. Comparable
changes were not found in the cells from the patient with benign
reactive follicular hyperplasia.
FIG. 1 depicts the morphologic changes of marginal zone lymphoma
cells upon CpG ODN stimulation. Malignant B cells from a patient
with marginal zone lymphoma were stimulated with 5 .mu.g/ml of no
ODN (A and D), control ODN (B and E) or CpG ODN (C and F) for 72
hours and analyzed by flow cytometry. A, B, and C illustrate FSC
(x-axis) vs. SSC (y-axis). D, E and F illustrate CD19 expression
(x-axis) against FSC (y-axis), allowing for separation of B cells
from other leukocyte subpopulations. Upon stimulation with CpG ODN,
B cells shifted up and to the right, indicating an increase in
granularity and size. No changes could be detected without
stimulation or on stimulation with the non-CpG ODN.
Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC
I, MHC II, and an HLA-DR variant antigen (moAb 1D10) were examined
on viable CD19+ cells after incubation of cells with CpG ODN for 72
hours. Each of these markers was upregulated to varying extents in
response to the CpG ODN 2006 compared to the control ODN 2017 (FIG.
2, FIG. 3).
FIG. 2 depicts the expression of surface antigens on marginal zone
lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of
surface antigen expression on malignant B cells from a patient with
marginal zone lymphoma was performed 72 hours after stimulation
with 5 .mu.g/ml of either CpG ODN or non-CpG ODN. On stimulation
with CpG ODN, median fluorescence intensity for all markers tested
shifted to the right, indicating an increase in surface expression.
Thin curves indicate incubation with medium alone, dotted curves
incubation with control ODN, and bold curves incubation with CpG
ODN.
FIG. 3 depicts the expression of surface antigens on primary cells
representing different B-cell malignancies and cells of a benign
follicular hyperplasia upon CpG ODN treatment. Cells from lymph
node biopsies, peripheral blood or pleural fluid from patients with
different B-cell malignancies were incubated for 72 hours with
either media alone, control ODN or CpG ODN. Each panel represents
one experiment.
CD20 was expressed to varying degrees in all samples tested. As is
well known, baseline CD20 expression was lower in the B-CLL samples
when compared to the B-cell malignancies of other histologies.
CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression
in both B-CLLs and both marginal zone lymphomas. No or only little
upregulation was seen in the other lymphoma samples. Non-malignant
CD19+ cells derived from the reactive follicular hyperplasia
decreased CD20 expression in response to CpG (FIG. 3). This data
demonstrated a reverse correlation between the baseline expression
of CD20 and CD40, and expression of these markers after incubation
with CpG ODN; thus the lower the baseline level of CD20 and CD40,
the higher was the responsiveness to CpG ODN (r: -0.6; -0.4) (FIG.
4). This correlation was less clear for the other markers. CD19+
cells derived from the reactive follicular hyperplasia showed high
baseline expression of activation markers which was not further
upregulated by CpG.
FIG. 4 shows the CpG ODN effect on CD20 and CD40 is dependent on
the baseline level of expression. Cells from lymph node biopsies,
peripheral blood or pleural fluid from patients with different
B-cell malignancies (see Table 5) were incubated with or without
CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by
flow cytometry. Baseline expression of CD20 and CD40 with medium
alone was compared to the expression of CD20 and CD40 in the
presence of CpG ODN. The coefficients of correlation are
indicated.
TABLE-US-00005 TABLE 5 Percentage Of CD19+ Cells In Samples Tested.
Sample Number Histology Source % CD19+ Cells 1 Chronic Lymphocytic
Peripheral >98% Leukemia 1 Blood 2 Chronic Lymphocytic
Peripheral 70% Leukemia 2 Blood 3 Large Cell Lymphoma 1 Pleural
Fluid 55% 4 Large Cell Lymphoma 2 Lymph Node 75% 5 Mantle Cell
Lymphoma Lymph Node 98% 6 Diffuse Mixed Small and Lymph Node 50%
Large Cell Lymphoma 7 Marginal Zone Lymphoma 1 Lymph Node 80% 8
Marginal Zone Lymphoma 2 Peripheral >94% Blood 9 Reactive
Follicular Lymph Node 35% Hyperplasia
Example 2
Immunostimulatory Nucleic Acids Induce Proliferation and Apoptosis
of Malignant B Cells
CpG induces a strong proliferative response of primary human B
cells. Hartmann G et. al., J Immunol 164:944-53 (2000). Two
techniques were used to assess whether CpG ODN is capable of
inducing proliferation of B-CLL cells. For select samples, cells
were stained with CFSE and incubated for four days. Proliferation
of cells is indicated by a loss of CFSE stain with every cell
division. In B-CLL, CD5 can be used to identify malignant B cells
among CD19+ cells. Proliferation of malignant B cells (CD5+ and
CD19+) was lower than proliferation of normal B cells (CD5- and
CD19+) (FIG. 5). For the marginal zone lymphoma, CpG ODN 2006
induced proliferation of the CD19+ cell population (FIG. 5).
FIG. 5 shows a comparison of CpG ODN induced proliferation of
malignant and normal B cells. Peripheral blood mononuclear cells
from two patients, one with B-CLL and one with marginal zone
lymphoma with circulating malignant cells, were incubated for 72
hours with CpG ODN or medium alone and evaluated by two-color flow
cytometry. CFSE fluorescence (x-axis) and expression of CD5 (CLL)
or CD19 (marginal zone lymphoma) (y-axis) were evaluated. In CLL,
CpG ODN enhanced proliferation of both CD5+ and the CD5- cells.
However the relative number of proliferating cells and the number
of divisions is lower in the CD5- subset than in the CD5+ subset.
In marginal zone lymphoma CpG ODN enhanced proliferation in the
CD19+ cell subset.
No consistent pattern was apparent related to determining whether
CpG ODN altered the percent of dead cells as determined by
morphological criteria (see Table 6).
TABLE-US-00006 TABLE 6 Percent Apoptotic Cells Based On Morphologic
Criteria. Sample Number Histology Media CpG ODN 2006 1 Chronic
Lymphocytic 25.9 21.5 Leukemia 1 2 Chronic Lymphocytic 32.6 45.3
Leukemia 2 3 Large Cell Lymphoma 1 33.9 26.2 4 Large Cell Lymphoma
2 16.0 9.8 5 Mantle Cell Lymphoma 55.1 60.0 6 Diffuse Mixed Small
and 27.6 26.6 Large Cell Lymphoma 7 Marginal Zone 32.9 32.8
Lymphoma 1 8 Marginal Zone 38.8 56.0 Lymphoma 2 9 Reactive
Follicular 8.6 18.0 Hyperplasia
A TUNEL assay was utilized to assess the effect of CpG ODN on both
proliferation and apoptosis. The results are shown in Table 7.
TABLE-US-00007 TABLE 7 Apoptosis And Proliferation As Determined By
TUNEL. Baseline CpG ODN Control ODN Sample Apop Prolif Apop Prolif
Apop Prolif 1663141 15 8 11 10 12 5 12142812 3 <1 1 10 2 12
12141811 <1 <1 <1 11 ? ?
Example 3
CpG ODN Enhance the Therapeutic Effect of Murine IgG2a (Which
Relates to Human IgG1) but not Murine IgG1 (Which Relates to Human
IgG2) Anti-tumor Antibody
CpG ODN when combined with antibody of murine subtype IgG2a
dramatically promotes survival in mice having tumors. Mice were
injected i.p. with 5000 T3C cells on day 0. They were then given
100 .mu.g anti-idiotype monoclonal antibody as either IgG1 (MS5A10)
or IgG2a (MS11G6) on days 5, 7, and 10. In this model, the target
antigen is the idiotype expressed by the lymphoma cells. Therefore,
the anti-tumor antibodies are also "anti-idiotype." These
antibodies (MS5A10 and MS11G6) are simultaneously both anti-tumor
antibodies and anti-idiotype antibodies. Twenty micrograms of CpG
ODN 1826 (5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at
the same time. Results are shown in FIG. 6. Untreated controls had
a median survival time (MST) of 17 days after inoculation with
tumor. Mice treated with murine IgG1 antibody plus CpG ODN had
survival that was similar to those treated with murine IgG1
antibody alone (MST 28 days and 27 days, respectively). In
contrast, mice treated with murine IgG2a plus CpG ODN had survival
that was significantly improved when compared to mice treated with
murine IgG2a alone (MST 45 days and 37 days, respectively).
The foregoing written specification is considered to be sufficient
to enable one skilled in the art to practice the invention. The
present invention is not to be limited in scope by examples
provided, since the examples are intended as a single illustration
of one aspect of the invention and other functionally equivalent
embodiments are within the scope of the invention. Various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
All references, patents and patent publications that are recited in
this application are incorporated in their entirety herein by
reference.
SEQUENCE LISTINGS
1
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 848 <210>
SEQ ID NO 1 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 1
aaaaaa 6 <210> SEQ ID NO 2 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 2 aaaaaaaaaa aaaaaaaaaa 20 <210> SEQ ID NO 3
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 3
aaaaaccccc cccccaaaaa 20 <210> SEQ ID NO 4 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
Chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 4
aaaacatgac gttcaaaaaa 20 <210> SEQ ID NO 5 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorodithioate backbone <400> SEQUENCE: 5 aaaacatgac
gttcaaaaaa 20 <210> SEQ ID NO 6 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 6 aaaacatgac gttcgggggg 20
<210> SEQ ID NO 7 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorodithioate backbone
<400> SEQUENCE: 7 aaaacatgac gttcgggggg 20 <210> SEQ ID
NO 8 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 8
aaaacgtt 8 <210> SEQ ID NO 9 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 9 aaaatcaacg ttgaaaaaaa 20
<210> SEQ ID NO 10 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 10 aaaatctgtg cttttaaaaa a 21
<210> SEQ ID NO 11 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 11 aaaattgacg ttttaaaaaa 20
<210> SEQ ID NO 12 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 12 aaacattctg ggggaatttt aagaagtaaa cat 33 <210>
SEQ ID NO 13 <211> LENGTH: 39 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 13 aaacattctg ggggaatttt aagaagttcc tccctcccc 39
<210> SEQ ID NO 14 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 14 aaacattctg ggggaatttt gtctagtaaa cat 33 <210>
SEQ ID NO 15 <211> LENGTH: 17 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 15 aacgctcgac cttcgat 17 <210> SEQ ID NO 16
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 16
aacgctggac cttccat 17
<210> SEQ ID NO 17 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 17 aacgctggac cttccatgtc 20
<210> SEQ ID NO 18 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 18 aacgtt 6 <210> SEQ ID NO 19 <211> LENGTH:
8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 19 aacgttct 8 <210> SEQ ID NO
20 <211> LENGTH: 7 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 20
aacgttg 7 <210> SEQ ID NO 21 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 21 aacgttga 8 <210> SEQ ID NO
22 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 22
aacgttgagg ggcat 15 <210> SEQ ID NO 23 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 23 aaggtggggc agtctcaggg a 21
<210> SEQ ID NO 24 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 24 aatagtcgcc ataacaaaac 20 <210> SEQ ID NO 25
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 25
aatagtcgcc atcccccccc 20 <210> SEQ ID NO 26 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 26 aatagtcgcc
atcccgggac 20 <210> SEQ ID NO 27 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 27 aatagtcgcc atcgcgcgac 20
<210> SEQ ID NO 28 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 28 aatagtcgcc atggcggggc 20 <210> SEQ ID NO 29
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 29
aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210>
SEQ ID NO 30 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 30 acaaccacga gaacgggaac 20 <210> SEQ
ID NO 31 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 31
acaacgtt 8 <210> SEQ ID NO 32 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 32 acaacgttga 10 <210> SEQ ID
NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
33 accacaacga gaggaacgca 20 <210> SEQ ID NO 34 <211>
LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 34 accatcctga ggccattcgg 20 <210> SEQ
ID NO 35 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 35
accatggacg aactgtttcc cctc 24 <210> SEQ ID NO 36 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 36 accatggacg
acctgtttcc cctc 24 <210> SEQ ID NO 37 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 37 accatggacg agctgtttcc cctc 24
<210> SEQ ID NO 38 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 38 accatggacg agctgtttcc cctc 24 <210>
SEQ ID NO 39 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 39 accatggacg atctgtttcc cctc 24 <210>
SEQ ID NO 40 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 40 accatggacg gtctgtttcc cctc 24 <210>
SEQ ID NO 41 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 41 accatggacg tactgtttcc cctc 24 <210>
SEQ ID NO 42 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 42 accatggacg ttctgtttcc cctc 24 <210>
SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 43 acccatcaat agctctgtgc 20 <210> SEQ
ID NO 44 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 44
acccgtcgta attatagtaa aaccc 25 <210> SEQ ID NO 45 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 45 accgcatgga
ttctaggcca 20 <210> SEQ ID NO 46 <211> LENGTH: 45
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 46 accttattaa gattgtgcaa tgtgacgtcc
tttagcatcg caaga 45 <210> SEQ ID NO 47 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 47 acgctggacc ttccat 16
<210> SEQ ID NO 48 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 48 acgtcgttcc cccccccccc 20 <210> SEQ ID NO 49
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 49
acgtgt 6 <210> SEQ ID NO 50 <211> LENGTH: 17
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 50 actagacgtt agtgtga 17 <210>
SEQ ID NO 51 <211> LENGTH: 17 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION:
(0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 51 actagacgtt agtgtga 17 <210> SEQ ID
NO 52 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 52
actggacgtt agcgtga 17 <210> SEQ ID NO 53 <211> LENGTH:
25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 53 acttctcata gtccctttgg tccag 25
<210> SEQ ID NO 54 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 54 agaacgtt 8 <210> SEQ ID NO 55 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 55 agacagacac
gaaacgaccg 20 <210> SEQ ID NO 56 <211> LENGTH: 27
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 56 agactcatgg gaaaatccca catttga 27
<210> SEQ ID NO 57 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 57 agatagcaaa tcggctgacg 20 <210> SEQ ID NO 58
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 58
agatggttct cagataaagc ggaa 24 <210> SEQ ID NO 59 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 59 agcaccgaac
gtgagagg 18 <210> SEQ ID NO 60 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 60 agcacggtag ccttccta 18
<210> SEQ ID NO 61 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 61 agcagcttta gagctttaga gctt 24 <210>
SEQ ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 62 agcatcagga acgacatgga 20 <210> SEQ ID NO 63
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 63
agcatcagga ccgacatgga 20 <210> SEQ ID NO 64 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 64 agcgctga 8
<210> SEQ ID NO 65 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 65 agctcaacgt catgc 15 <210> SEQ ID NO 66
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 66
agctccatgg tgctcactg 19 <210> SEQ ID NO 67 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 67 aggatatc 8
<210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 68 aggtacagcc aggactacga 20 <210> SEQ
ID NO 69
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (3)...(3) <223> OTHER
INFORMATION: I <221> NAME/KEY: modified_base <222>
LOCATION: (8)...(8) <223> OTHER INFORMATION: I <221>
NAME/KEY: modified_base <222> LOCATION: (14)...(14)
<223> OTHER INFORMATION: I <400> SEQUENCE: 69
agncccgnga acgnattcac 20 <210> SEQ ID NO 70 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 70 agtgactctc
cagcgttctc 20 <210> SEQ ID NO 71 <211> LENGTH: 17
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 71 agtgcgattc gagatcg 17 <210>
SEQ ID NO 72 <211> LENGTH: 17 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 72 agtgcgattg cagatcg 17 <210> SEQ ID NO 73
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 73
agtgct 6 <210> SEQ ID NO 74 <211> LENGTH: 6 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 74 agtgct 6 <210> SEQ ID NO 75 <211> LENGTH:
10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 75 agttgcaact 10 <210> SEQ ID
NO 76 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 76
ataaagcgaa actagcagca gtttc 25 <210> SEQ ID NO 77 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 77 ataacgtt 8
<210> SEQ ID NO 78 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 78 ataatagagc ttcaagcaag 20 <210> SEQ
ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 79
ataatccagc ttgaaccaag 20 <210> SEQ ID NO 80 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 80 ataatcgacg
ttcaagcaag 20 <210> SEQ ID NO 81 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 81 ataatcgacg ttcccccccc 20
<210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 82 ataatcgtcg ttcaagcaag 20 <210> SEQ
ID NO 83 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 83
ataatcgtgc gttcaagaaa g 21 <210> SEQ ID NO 84 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 84 atagacaaaa
attccctccc cggagcc 27 <210> SEQ ID NO 85 <211> LENGTH:
18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 85 atatatatat atatatat 18 <210> SEQ ID
NO 86 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 86
atatctaatc aaaacattaa caaa 24 <210> SEQ ID NO 87 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 87 atcaggaacg
tcatgggaag c 21 <210> SEQ ID NO 88 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 88 atcgacctac gtgcgttctc 20
<210> SEQ ID NO 89 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (18)...(18)
<223> OTHER INFORMATION: m5c <400> SEQUENCE: 89
atcgacctac gtgcgttntc 20 <210> SEQ ID NO 90 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 90 atcgactcga
gcgttctc 18 <210> SEQ ID NO 91 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 91 atcgactctc gagcgttctc 20
<210> SEQ ID NO 92 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 92 atcgactctc gagcgttctc 20
<210> SEQ ID NO 93 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 93 atcgactctc gagtgttctc 20 <210> SEQ ID NO 94
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (14)...(14) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 94 atcgactctc gagngttctc 20
<210> SEQ ID NO 95 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 95 atcgactctc tcgagcgttc tc 22 <210> SEQ ID NO 96
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 96
atcgacttcg agcgttctc 19 <210> SEQ ID NO 97 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 97 atcgatcgag cgttctc
17 <210> SEQ ID NO 98 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 98 atcgatgt 8 <210> SEQ ID NO 99 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 99 atcggaggac
tggcgcgccg 20 <210> SEQ ID NO 100 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 100 atctggtgag ggcaagctat g 21
<210> SEQ ID NO 101 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 101 atgacgttcc tgacgtt 17 <210> SEQ ID
NO 102 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 102
atgcactctg cagcgttctc 20 <210> SEQ ID NO 103 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 103 atgcatgt 8
<210> SEQ ID NO 104 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 104 atgcccctca acgtt 15 <210> SEQ ID NO 105
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 105
atgctaaagg acgtcacatt gca 23 <210> SEQ ID NO 106 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 106 atggaaggtc
cacgttctc 19 <210> SEQ ID NO 107 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 107 atggaaggtc cagcgttct 19
<210> SEQ ID NO 108 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 108 atggaaggtc cagcgttctc 20 <210> SEQ ID NO 109
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 109
atggaaggtc cagtgttctc 20 <210> SEQ ID NO 110 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 110 atggaaggtc
gagcgttctc 20 <210> SEQ ID NO 111 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 111 atggactctc cagcgttctc 20
<210> SEQ ID NO 112 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 112 atgtcctcgg tcctgatgct 20 <210> SEQ ID NO 113
<211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 113
atgtttacta gacaaaattc ccccagaatg ttt 33 <210> SEQ ID NO 114
<211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 114
atgtttactt cttaaaattc ccccagaatg ttt 33 <210> SEQ ID NO 115
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 115
attcgatcgg ggcggggcga g 21 <210> SEQ ID NO 116 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: modified_base
<222> LOCATION: (3)...(3) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 116 atngacctac gtgcgttctc 20 <210> SEQ
ID NO 117 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (3)...(3) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (10)...(10) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION:
(14)...(14) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 117 atngactctn gagngttctc 20 <210> SEQ
ID NO 118 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(1) <223> OTHER
INFORMATION: biotinylated at 5' end <400> SEQUENCE: 118
atggaaggtc cagcgttctc 20 <210> SEQ ID NO 119 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(1) <223> OTHER INFORMATION:
biotinylated 5' end <400> SEQUENCE: 119 gagaacgctc cagcactgat
20 <210> SEQ ID NO 120 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223>
OTHER INFORMATION: biotinylated 5' end <400> SEQUENCE: 120
gagaacgctc gaccttcgat 20 <210> SEQ ID NO 121 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(1) <223> OTHER INFORMATION:
biotinylated 5' end <221> NAME/KEY: modified_base <222>
LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c <400>
SEQUENCE: 121 gagaangctc cagcactgat 20 <210> SEQ ID NO 122
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(1) <223> OTHER
INFORMATION: biotinylated 5' end <221> NAME/KEY:
modified_base <222> LOCATION: (6)...(6) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 122 gagaangctc gaccttcgat 20
<210> SEQ ID NO 123 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223>
OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 123
gagcaagctg gaccttccat 20 <210> SEQ ID NO 124 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(1) <223> OTHER INFORMATION:
biotinylated at 5' end <221> NAME/KEY: modified_base
<222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 124 gagcaagntg gaccttccat 20 <210> SEQ
ID NO 125 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(1) <223> OTHER
INFORMATION: biotinylated at 5' end <400> SEQUENCE: 125
gctagacgtt agcgtga 17 <210> SEQ ID NO 126 <211> LENGTH:
8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 126 tcaacgtt 8 <210> SEQ ID NO 127
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(1) <223> OTHER
INFORMATION: biotinylated at 5' end <400> SEQUENCE: 127
tccatgacgt tcctgatgct 20 <210> SEQ ID NO 128 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(1) <223> OTHER INFORMATION:
biotinylated at 5' end <400> SEQUENCE: 128 tccatgagct
tcctgatgct 20 <210> SEQ ID NO 129 <211> LENGTH: 29
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 5'
end <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 129 tccattccat gacgttcctg atgcttcca 29
<210> SEQ ID NO 130 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 5'
end <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 130 tccattccat tctaggcctg agtcttccat 30
<210> SEQ ID NO 131 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 5'
end <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 131 tcgtcgtttt gtcgttttgt cgttttttt 29
<210> SEQ ID NO 132 <211> LENGTH: 28 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 5'
end <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 132 tttttccatg tcgttcctga tgcttttt 28
<210> SEQ ID NO 133 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 5'
end <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end
<400> SEQUENCE: 133 tttttcgtcg ttcccccccc cccc 24 <210>
SEQ ID NO 134 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 134 caaacgtt 8 <210> SEQ ID NO 135 <211>
LENGTH: 7 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 135 caacgtt 7
<210> SEQ ID NO 136 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 136 caagagatgc taacaatgca 20 <210> SEQ
ID NO 137 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
137 caatcaatct gaggagaccc 20 <210> SEQ ID NO 138 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 138 cacaccttgg
tcaatgtcac gt 22 <210> SEQ ID NO 139 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 139 caccaccttg gtcaatgtca cgt 23
<210> SEQ ID NO 140 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 140 cacggtagcc ttccta 16 <210> SEQ ID
NO 141 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 141
cacgttgagg ggcat 15 <210> SEQ ID NO 142 <211> LENGTH:
16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 142 cactgtcctt cgtcga 16
<210> SEQ ID NO 143 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 143 cagacacaga agcccgatag acg 23 <210>
SEQ ID NO 144 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 144 cagattgtgc aatgtctcga 20 <210> SEQ ID NO 145
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 145
cataacatag gaatatttac tcctcgc 27 <210> SEQ ID NO 146
<211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 146
cataggatct cgagctcgga aagtccccta c 31 <210> SEQ ID NO 147
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 147 catgagctca
tctggaggaa gcgg 24 <210> SEQ ID NO 148 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 148 catttccacg atttccca 18
<210> SEQ ID NO 149 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 149 cattttacgg gcgggcgggc 20 <210> SEQ
ID NO 150 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
150 ccaaatatcg gtggtcaagc ac 22 <210> SEQ ID NO 151
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 151
ccaacgtt 8 <210> SEQ ID NO 152 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 152 ccacgtcgac cctcaggcga 20
<210> SEQ ID NO 153 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 153 ccacgtggac ctctagc 17 <210> SEQ ID NO 154
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 154
ccactcacat ctgctgctcc acaag 25 <210> SEQ ID NO 155
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 155
ccagatgagc tcatgggttt ctcc 24 <210> SEQ ID NO 156 <211>
LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 156 ccaggttaag
aggaaatgac ttcggg 26 <210> SEQ ID NO 157 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 157 ccaggttgta tagaggc 17
<210> SEQ ID NO 158 <211> LENGTH: 35 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 158 ccagtgctga tcaccgatat cctgttcggc agtcg 35
<210> SEQ ID NO 159 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 159 ccatcgat 8 <210> SEQ ID NO 160 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 160 ccatgcat 8
<210> SEQ ID NO 161 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 161 ccatgctaac ctctagc 17 <210> SEQ ID NO 162
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 162
ccatgtcggt cctgatgct 19 <210> SEQ ID NO 163 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 163 ccccaaaggg
atgagaagtt 20 <210> SEQ ID NO 164 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 164 cccccaaaaa aaaaaccccc 20
<210> SEQ ID NO 165 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 165 cccccc 6 <210> SEQ ID NO 166
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 166
cccccccc 8 <210> SEQ ID NO 167 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 167 cccccccccc cc 12 <210> SEQ
ID NO 168 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 168
cccccccccc cccccccccc 20 <210> SEQ ID NO 169 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 169
cccccccccc cccccccccc 20 <210> SEQ ID NO 170 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 170 cccccccccc
cccccccccc cccc 24 <210> SEQ ID NO 171 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 171 cccccccccc cccccccccc cccccccc
28 <210> SEQ ID NO 172 <211> LENGTH: 35 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 172 cccccccccc cccccccccc cccccccccc ccccc 35
<210> SEQ ID NO 173 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 173 ccccttgacg ttttcccccc 20
<210> SEQ ID NO 174 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 174 cccgaagtca tttcctctta acctgg 26 <210> SEQ ID NO
175 <211> LENGTH: 26 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
175 ccgaacagga tatcggtgat cagcac 26 <210> SEQ ID NO 176
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 176
ccgcttcctc cagatgagct catg 24 <210> SEQ ID NO 177 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 177 ccgcttcctc
cagatgagct catgggtttc tccaccaag 39 <210> SEQ ID NO 178
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 178
ccggccggcc ggccggccgg 20 <210> SEQ ID NO 179 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_difference
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 179 ccgtcgttcc
cccccccccc 20 <210> SEQ ID NO 180 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 180 cctacgttgt atgcgcccag ct 22
<210> SEQ ID NO 181 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 181 cctccaaatg aaagaccccc 20
<210> SEQ ID NO 182 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 182 cctctataca acctgggac 19 <210> SEQ
ID NO 183 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 183
ccttccatgt cggtcctgat 20 <210> SEQ ID NO 184 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_difference
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 184 ccttcgat 8
<210> SEQ ID NO 185 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 185 cgaacgtt 8 <210> SEQ ID NO 186 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 186 cgacga 6
<210> SEQ ID NO 187 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 187 cgacgt 6 <210> SEQ ID NO 188
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 188
cgactctcga gcgttctc 18 <210> SEQ ID NO 189 <211>
LENGTH: 35 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 189 cgactgccga
acaggatatc ggtgatcagc actgg 35 <210> SEQ ID NO 190
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 190
cgccgtcgcg gcggttgg 18 <210> SEQ ID NO 191 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 191 cgcctggggc
tggtctgg 18 <210> SEQ ID NO 192 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 192 cgcgcgcgcg cgcgcgcgcg 20
<210> SEQ ID NO 193 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 193 cgcgcgcgcg cgcgcgcgcg 20 <210> SEQ ID NO 194
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 194
cgcgta 6 <210> SEQ ID NO 195 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 195 cgctagaggt tagcgtga 18
<210> SEQ ID NO 196 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 196 cgctggacct tccat 15 <210> SEQ ID NO 197
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 197
cgctggacct tccatgtcgg 20 <210> SEQ ID NO 198 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 198 cggctgacgt
catcaa 16
<210> SEQ ID NO 199 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 199 cgggcgactc agtctatcgg 20 <210> SEQ
ID NO 200 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
200 cgggcttacg gcggatgctg 20 <210> SEQ ID NO 201 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 201 cggtagcctt ccta
14 <210> SEQ ID NO 202 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 202 cgtaccttac ggtga 15 <210> SEQ ID NO 203
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 203
cgtacg 6 <210> SEQ ID NO 204 <211> LENGTH: 6
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 204 cgtcga 6 <210> SEQ ID NO
205 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 205
cgtcga 6 <210> SEQ ID NO 206 <211> LENGTH: 6
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 206 cgtcgt 6 <210> SEQ ID NO
207 <211> LENGTH: 9 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 207
cgtcgtcgt 9 <210> SEQ ID NO 208 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 208 cgtcgtcgtc gtcgtcgtcg t 21
<210> SEQ ID NO 209 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 209 cgtctatcgg gcttctgtgt ctg 23 <210>
SEQ ID NO 210 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 210 cgttcg 6 <210> SEQ ID NO 211
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 211
ctaacgtt 8 <210> SEQ ID NO 212 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 212 ctaatctttc taattttttt ctaa 24
<210> SEQ ID NO 213 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 213 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45
<210> SEQ ID NO 214 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 214 ctagcgct 8 <210> SEQ ID NO 215 <211>
LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 215 ctagcggctg
acgtcataaa gctagc 26 <210> SEQ ID NO 216 <211> LENGTH:
25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 216 ctagcggctg acgtcatcaa gctag 25 <210> SEQ ID NO
217 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 217
ctagcggctg acgtcatcaa tctag 25 <210> SEQ ID NO 218
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 218
ctagcggctg agctcataaa gctagc 26 <210> SEQ ID NO 219
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 219
ctagcttgat gacgtcagcc gctag 25 <210> SEQ ID NO 220
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 220
ctagcttgat gagctcagcc gctag 25 <210> SEQ ID NO 221
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 221
ctagctttat gacgtcagcc gctagc 26 <210> SEQ ID NO 222
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 222
ctaggctgac gtcatcaagc tagt 24 <210> SEQ ID NO 223 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 223 ctagtggctg
acgtcatcaa gctag 25 <210> SEQ ID NO 224 <211> LENGTH:
21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 224 ctatcggagg actggcgcgc c
21 <210> SEQ ID NO 225 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 225 ctatcggagg actggcgcgc cg 22 <210>
SEQ ID NO 226 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 226 ctcaacgctg gaccttccat 20 <210> SEQ ID NO 227
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 227
ctcatgggtt tctccaccaa g 21 <210> SEQ ID NO 228 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 228 ctccagctcc
aagaaaggac g 21 <210> SEQ ID NO 229 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 229 ctcgccccgc cccgatcgaa t 21
<210> SEQ ID NO 230 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 230 ctctccaagc tcacttacag 20 <210> SEQ
ID NO 231 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 231
ctctctgtag gcccgcttgg 20 <210> SEQ ID NO 232 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 232 ctcttgcgac
ctggaaggta 20 <210> SEQ ID NO 233 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 233 ctgacgtcat 10 <210> SEQ ID
NO 234
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 234
ctgacgtg 8 <210> SEQ ID NO 235 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 235 ctgattgctc tctcgtga 18
<210> SEQ ID NO 236 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 236 ctgattgctc tctcgtga 18 <210> SEQ ID NO 237
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 237
ctgcagcctg ggac 14 <210> SEQ ID NO 238 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 238 ctgcgttagc aatttaactg tg 22
<210> SEQ ID NO 239 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 239 ctgctgagac tggag 15 <210> SEQ ID NO
240 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 240
ctgctgctgc tgctgctgct g 21 <210> SEQ ID NO 241 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 241
ctggaccttc catgtc 16 <210> SEQ ID NO 242 <211> LENGTH:
18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 242 ctggaccttc catgtcgg 18
<210> SEQ ID NO 243 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 243 ctggtctttc tggttttttt ctgg 24 <210>
SEQ ID NO 244 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 244 ctggtctttc tggttttttt ctgg 24 <210> SEQ ID NO
245 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
245 ctgtaagtga gcttggagag 20 <210> SEQ ID NO 246 <211>
LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 246 ctgtatgaaa
caaattttcc tctttgggca 30 <210> SEQ ID NO 247 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 247 ctgtca 6
<210> SEQ ID NO 248 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 248 ctgtcaggaa ctgcaggtaa gg 22 <210> SEQ ID NO 249
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 249
ctgtcccata tttttagaca 20 <210> SEQ ID NO 250 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 250 ctgtcg 6
<210> SEQ ID NO 251 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 251 ctgtcg 6 <210> SEQ ID NO 252 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 252 ctgtcgttcc
cccccccccc 20 <210> SEQ ID NO 253 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 253 ctgtgctttc tgtgtttttc tgtg 24
<210> SEQ ID NO 254 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 254 cttggagggc ctcccggcgg 20 <210> SEQ
ID NO 255 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 255
cttggtggag aaacccatga g 21 <210> SEQ ID NO 256 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 256 cttggtggag
aaacccatga gctcatctgg aggaagcgg 39 <210> SEQ ID NO 257
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 257
ctttccgttg gacccctggg 20 <210> SEQ ID NO 258 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION: (6)...(6)
<223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (10)...(10) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (15)...(15) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 258 cnggcnggcn gggcnccgg 19 <210> SEQ
ID NO 259 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(1) <223> OTHER
INFORMATION: FITC labeled <400> SEQUENCE: 259 aacgttga 8
<210> SEQ ID NO 260 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223>
OTHER INFORMATION: FITC labeled <400> SEQUENCE: 260
cgcgaattcg cg 12 <210> SEQ ID NO 261 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(1) <223> OTHER INFORMATION: FITC labeled <400>
SEQUENCE: 261 tcaacgtt 8 <210> SEQ ID NO 262 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 262 gaaacgtt 8
<210> SEQ ID NO 263 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 263 gaaactgctg ctagtttcgc tttat 25 <210> SEQ ID NO
264 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
264 gaaccttcca tgctgtt 17 <210> SEQ ID NO 265 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 265 gaaccttcca
tgctgttccg 20 <210> SEQ ID NO 266 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 266 gaacgctgga ccttccat 18
<210> SEQ ID NO 267 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 267 gaagttcacg ttgaggggca t 21
<210> SEQ ID NO 268 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 268 gaagtttctg gtaagtcttc g 21 <210> SEQ ID NO 269
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 269
gaccttccat 10 <210> SEQ ID NO 270 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 270 gaccttccat gtcggtcctg at
22 <210> SEQ ID NO 271 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 271 gaccttctat gtcggtcctg 20 <210> SEQ
ID NO 272 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 272
gacgtcat 8 <210> SEQ ID NO 273 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 273 gactgacgtc agcgt 15 <210>
SEQ ID NO 274 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 274 gagaacgatg gaccttccat 20 <210> SEQ ID NO 275
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 275
gagaacgcta gaccttctat 20 <210> SEQ ID NO 276 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 276 gagaacgctc
caccttccat 20 <210> SEQ ID NO 277 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 277 gagaacgctc cagcactgat 20
<210> SEQ ID NO 278 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 278 gagaacgctc cagcttcgat 20 <210> SEQ ID NO 279
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 279
gagaacgctc cgaccttcga t 21 <210> SEQ ID NO 280 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 280 gagaacgctc
gaccttccat 20 <210> SEQ ID NO 281 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(20)...(20) <223> OTHER INFORMATION: biotinylated at 3' end
<400> SEQUENCE: 281 gagaacgctc gaccttcgat 20 <210> SEQ
ID NO 282 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 282
gagaacgctg gacctatcca t 21 <210> SEQ ID NO 283 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 283 gagaacgctg
gacctcatca tccat 25 <210> SEQ ID NO 284 <211> LENGTH:
22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 284 gagaacgctg gacctcatcc at 22 <210> SEQ ID NO 285
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 285
gagaacgctg gaccttcc 18 <210> SEQ ID NO 286 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 286 gagaacgctg
gaccttccat 20 <210> SEQ ID NO 287 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 287 gagaacgctg gaccttccat 20
<210> SEQ ID NO 288 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 288 gagaacgctg gaccttccat gt 22 <210>
SEQ ID NO 289 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 289 gagaacgctg gaccttcgat 20 <210> SEQ ID NO 290
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 290
gagaacgctg gaccttcgta 20 <210> SEQ ID NO 291 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 291 gagaacgctg
gaccttgcat 20 <210> SEQ ID NO 292 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 292 gagaacgctg gacgctcatc cat 23
<210> SEQ ID NO 293 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 293 gagaacgctg gacttccat 19 <210> SEQ ID NO 294
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (14)...(14) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 294 gagaacgctg gacnttccat 20
<210> SEQ ID NO 295 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 295 gagaacgctg gatccat 17 <210> SEQ ID NO 296
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 296
gagaatgctg gaccttccat 20 <210> SEQ ID NO 297 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: modified_base
<222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 297 gagaangctg gaccttccat 20 <210> SEQ
ID NO 298 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
298 gagaccgctc gaccttcgat 20 <210> SEQ ID NO 299 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 299 gagcaagctg
gaccttccat 20 <210> SEQ ID NO 300 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(20)...(20) <223> OTHER INFORMATION: biotinylated at 3' end
<400> SEQUENCE: 300 gagcaagctg gaccttccat 20 <210> SEQ
ID NO 301 <211> LENGTH: 45 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 301 gaggaacgtc atggagagga acgtcatgga
gaggaacgtc atgga 45 <210> SEQ ID NO 302 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(9)...(9) <223> OTHER INFORMATION: I <221> NAME/KEY:
modified_base <222> LOCATION: (11)...(11) <223> OTHER
INFORMATION: I <221> NAME/KEY: modified_base <222>
LOCATION: (15)...(15) <223> OTHER INFORMATION: I <400>
SEQUENCE: 302 gaggaaggng nggangacgt 20 <210> SEQ ID NO 303
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 303
gaggggacca ttttacgggc 20 <210> SEQ ID NO 304 <211>
LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 304 gatccagatt
ctgccaggtc actgtgactg gat 33 <210> SEQ ID NO 305 <211>
LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 305 gatccagatt
ctgctgagtc actgtgactg gat 33 <210> SEQ ID NO 306 <211>
LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 306 gatccagtca
cagtgacctg gcagaatctg gat 33 <210> SEQ ID NO 307 <211>
LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 307 gatccagtca
cagtgactca gcagaatctg gat 33 <210> SEQ ID NO 308 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 308 gatccggctg
actcatcact agatc 25 <210> SEQ ID NO 309 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 309 gatcgctgat ctaatgctcg 20
<210> SEQ ID NO 310 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 310 gatcggagga ctggcgcgcc g 21 <210>
SEQ ID NO 311 <211> LENGTH: 25 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 311 gatctagtga tgagtcagcc ggatc 25 <210> SEQ ID NO
312 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 312
gattcaactt gcgctcatct taggc 25 <210> SEQ ID NO 313
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 313
gcaacgtt 8 <210> SEQ ID NO 314 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end
<400> SEQUENCE: 314 gcaatattgc 10 <210> SEQ ID NO 315
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (10)...(10) <223> OTHER
INFORMATION: FITC labeled <400> SEQUENCE: 315 gcaatattgc 10
<210> SEQ ID NO 316 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 316 gcacatcgtc ccgcagccga 20 <210> SEQ
ID NO 317 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
317
gcagcctcta tacaacctgg gacggga 27 <210> SEQ ID NO 318
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 318
gcatagcgtt gagct 15 <210> SEQ ID NO 319 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 319 gcatgacgtt gagct 15 <210>
SEQ ID NO 320 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 320 gcatgacgtt gagct 15
<210> SEQ ID NO 321 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 321 gcatgacgtt gagct 15 <210> SEQ ID NO 322
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 322
gcatgacgtt gagct 15 <210> SEQ ID NO 323 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 323 gcatgagctt gagctga 17
<210> SEQ ID NO 324 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 324 gcatgatgtt gagct 15 <210> SEQ ID NO 325
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (7)...(7) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 325 gcatgangtt gagct 15
<210> SEQ ID NO 326 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 326 gcatggcgtt gagct 15
<210> SEQ ID NO 327 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 327 gcatgtagct gagct 15 <210> SEQ ID NO 328
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 328
gcatgtcgtt gagct 15 <210> SEQ ID NO 329 <211> LENGTH:
23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 329 gcattcatca ggcgggcaag aat 23
<210> SEQ ID NO 330 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 330 gcattgcgtt gagct 15
<210> SEQ ID NO 331 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 331 gcatttcgag gagct 15 <210> SEQ ID NO 332
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 332
gccaccaaaa cttgtccatg 20 <210> SEQ ID NO 333 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 333 gccagatgtt
agctgga 17 <210> SEQ ID NO 334 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 334 gccatggacg aactgttccc cctc 24
<210> SEQ ID NO 335 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 335 gcgacgggcg gcgcgcgccc 20 <210> SEQ
ID NO 336 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 336
gcgacggtcg gcgcgcgccc 20 <210> SEQ ID NO 337 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 337 gcgacgtgcg
gcgcgcgccc 20 <210> SEQ ID NO 338 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 338 gcgacgttcg gcgcgcgccc 20
<210> SEQ ID NO 339 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 339 gcgatgtcgt tcctgatgcg 20 <210> SEQ ID NO 340
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 340
gcgatgtcgt tcctgatgct 20 <210> SEQ ID NO 341 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 341 gcgccagtcc
tccgatagac 20 <210> SEQ ID NO 342 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 342 gcgcgcgcgc gcgcgcgcg 19
<210> SEQ ID NO 343 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 343 gcgctaccgg tagcctgagt 20 <210> SEQ
ID NO 344 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 344
gcggcgggcg gcgcgcgccc 20 <210> SEQ ID NO 345 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 345 gcggcgggcg
gcgcgcgccc 20 <210> SEQ ID NO 346 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 346 gcggcggtcg gcgcgcgccc 20
<210> SEQ ID NO 347 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 347 gcggcgtgcg gcgcgcgccc 20 <210> SEQ
ID NO 348 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 348
gcggcgttcg gcgcgcgccc 20 <210> SEQ ID NO 349 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 349 gcgtcgttcc
cccccccccc 20 <210> SEQ ID NO 350 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 350 gcgtgcgttg tcgttgtcgt t 21
<210> SEQ ID NO 351 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 351 gcgttttttt ttgcg 15 <210>
SEQ ID NO 352 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 352 gctaaacgtt agcgt 15 <210> SEQ ID NO 353
<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 353
gctaacgtta gcgtga 16 <210> SEQ ID NO 354 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 354 gctaccttag cgtga 15 <210>
SEQ ID NO 355 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (11)...(11)
<223> OTHER INFORMATION: m5c <400> SEQUENCE: 355
gctaccttag ngtga 15 <210> SEQ ID NO 356 <211> LENGTH:
14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 356 gctacttagc gtga 14 <210>
SEQ ID NO 357 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 357 gctagacgat agcgt 15 <210> SEQ ID NO 358
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 358
gctagacgct agcgtga 17 <210> SEQ ID NO 359 <211> LENGTH:
9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 359 gctagacgt 9 <210> SEQ ID
NO 360 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 360
gctagacgta agcgtga 17 <210> SEQ ID NO 361 <211> LENGTH:
14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 361 gctagacgtc tagc 14 <210>
SEQ ID NO 362 <211> LENGTH: 13 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 362 gctagacgtt agc 13 <210> SEQ ID NO 363
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 363
gctagacgtt agcgt 15 <210> SEQ ID NO 364 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 364 gctagacgtt agcgtga 17
<210> SEQ ID NO 365 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 365 gctagacgtt agctgga 17 <210> SEQ ID NO 366
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 366
gctagacgtt agctgga 17 <210> SEQ ID NO 367 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 367 gctagacgtt aggctga 17
<210> SEQ ID NO 368 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 368 gctagacgtt agtgt 15 <210> SEQ ID NO 369
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (13)...(13) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 369 gctagacgtt agngt 15
<210> SEQ ID NO 370 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 370 gctagacgtt tagc 14 <210> SEQ ID NO 371
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 371
gctagagctt agcgtga 17 <210> SEQ ID NO 372 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 372 gctagaggtt agcgtga 17
<210> SEQ ID NO 373 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 373 gctagaggtt agcgtga 17 <210> SEQ ID
NO 374 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 374
gctagatgtt aacgt 15 <210> SEQ ID NO 375 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 375 gctagatgtt agcgt 15 <210>
SEQ ID NO 376 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 376 gctagatgtt agcgt 15 <210> SEQ ID NO
377 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 377
gctagatgtt agcgtga 17 <210> SEQ ID NO 378 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE:
378 gctagangtt agcgt 15 <210> SEQ ID NO 379 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: modified_base
<222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 379 gctagangtt agtgt 15 <210> SEQ ID NO
380 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 380
gctagcttta gagctttaga gctt 24 <210> SEQ ID NO 381 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 381 gctaggcgtt agcgt
15 <210> SEQ ID NO 382 <211> LENGTH: 13 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 382 gctagtcgat agc 13 <210> SEQ ID NO 383
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 383
gctagtcgat agcgt 15 <210> SEQ ID NO 384 <211> LENGTH:
13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 384 gctagtcgct agc 13 <210>
SEQ ID NO 385 <211> LENGTH: 13 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 385 gctandcghh agc 13 <210> SEQ ID NO 386
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 386
gctatgacgt tccaaggg 18 <210> SEQ ID NO 387 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_difference
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 387 gctcga 6
<210> SEQ ID NO 388 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 388 gctcgttcag cgcgtct 17
<210> SEQ ID NO 389 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 389 gctgaacctt ccatgctgtt 20 <210> SEQ
ID NO 390 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 390
gctgagctca tgccgtctgc 20 <210> SEQ ID NO 391 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 391 gctggacctt ccat
14 <210> SEQ ID NO 392 <211> LENGTH: 14 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 392 gctggacctt ccat 14 <210> SEQ ID NO 393
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 393
gctggccagc ttacctcccg 20 <210> SEQ ID NO 394 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 394
gctgtaaaat gaatcggccg 20 <210> SEQ ID NO 395 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 395 gctgtggggc
ggctcctg 18 <210> SEQ ID NO 396 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 396 gcttgacgtc aagc 14 <210>
SEQ ID NO 397 <211> LENGTH: 14 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 397 gcttgacgtc tagc 14 <210> SEQ ID NO 398
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 398
gcttgacgtt tagc 14 <210> SEQ ID NO 399 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 399 gcttgcgttg cgttt 15
<210> SEQ ID NO 400 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 400 gcttggaggg cctgtaagtg 20 <210> SEQ
ID NO 401 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 401 ggaacgtt 8 <210> SEQ ID NO 402 <211>
LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 402 ggaagacgtt aga 13
<210> SEQ ID NO 403 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 403 ggaattagta atagatatag aagtt 25 <210> SEQ ID NO
404 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 404
ggagaaaccc atgagctcat ctgg 24 <210> SEQ ID NO 405 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 405 ggagctcttc
gaacgccata 20 <210> SEQ ID NO 406 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 406 ggcagtgcag gctcaccggg 20
<210> SEQ ID NO 407 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 407 ggccaacttt caatgtggga tggcctc 27
<210> SEQ ID NO 408 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 408 ggccatccca cattgaaagt t 21 <210>
SEQ ID NO 409 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 409 ggccttttcc cccccccccc 20 <210> SEQ ID NO 410
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 410
ggcggcggcg gcggcggcgg 20 <210> SEQ ID NO 411 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 411 ggcgttattc
ctgactcgcc 20 <210> SEQ ID NO 412 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 412 ggctatgtcg atcctagcc 19
<210> SEQ ID NO 413 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 413 ggctatgtcg ttcctagcc 19 <210> SEQ ID NO 414
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 414
ggctccgggg agggaatttt tgtctat 27 <210> SEQ ID NO 415
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 415
ggctgtattc ctgactgccc 20 <210> SEQ ID NO 416 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 416 gggaatgaaa
gattttatta taag 24 <210> SEQ ID NO 417 <211> LENGTH: 38
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 417 ggggactttc cgctggggac
tttccagggg gactttcc 38 <210> SEQ ID NO 418 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 418 ggggagggag
gaacttctta aaattccccc agaatgttt 39
<210> SEQ ID NO 419 <211> LENGTH: 9 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 419 ggggagggg 9 <210> SEQ ID NO 420
<211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 420
ggggagggt 9 <210> SEQ ID NO 421 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 421 ggggcatgac gttcaaaaaa 20
<210> SEQ ID NO 422 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 422 ggggcatgac gttcaaaaaa 20
<210> SEQ ID NO 423 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorodithioate backbone
<400> SEQUENCE: 423 ggggcatgac gttcgggggg 20 <210> SEQ
ID NO 424 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 424
ggggcatgac gttcgggggg 20 <210> SEQ ID NO 425 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 425 ggggcatgag
cttcgggggg 20 <210> SEQ ID NO 426 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 426 ggggcatgag cttcgggggg 20
<210> SEQ ID NO 427 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 427 ggggcctcta tacaacctgg g 21 <210>
SEQ ID NO 428 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 428 gggggacgtt ggggg 15 <210> SEQ ID NO 429
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 429
gggggggggg gggggggggg 20 <210> SEQ ID NO 430 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 430 gggggggggg
gggggggggg 20 <210> SEQ ID NO 431 <211> LENGTH: 31
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 431 ggggggttgg ggaaaacccg gacttcctgc
a 31 <210> SEQ ID NO 432 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 432 gggggttttt tttttggggg 20 <210> SEQ ID NO 433
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 433
ggggtaatcg atcagggggg 20 <210> SEQ ID NO 434 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 434 ggggtaatcg
atgagggggg 20 <210> SEQ ID NO 435 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 435
ggggtaatgc atcagggggg 20 <210> SEQ ID NO 436 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 436
ggggtcaacg ttgagggggg 20 <210> SEQ ID NO 437 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 437 ggggtcaacg
ttgagggggg 20 <210> SEQ ID NO 438 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 438 ggggtcaagc ttgagggggg 20
<210> SEQ ID NO 439 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 439 ggggtcaagt ctgagggggg 20
<210> SEQ ID NO 440 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 440 ggggtccagc gtgcgccatg gggg
24 <210> SEQ ID NO 441 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 441 ggggtccctg agactgcc 18 <210> SEQ ID
NO 442 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 442
ggggtcgacc ttggaggggg g 21 <210> SEQ ID NO 443 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 443 ggggtcgacg
tcgagggggg 20 <210> SEQ ID NO 444 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 444 ggggtcgtcg ttttgggggg 20
<210> SEQ ID NO 445 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 445 ggggtctgtc gttttggggg g 21
<210> SEQ ID NO 446 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 446 ggggtctgtg cttttggggg g 21
<210> SEQ ID NO 447 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 447 ggggtgacgt tcagggggg 19
<210> SEQ ID NO 448 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 448 ggggtgtcgt tcagggggg 19
<210> SEQ ID NO 449 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 449 ggggttgacg ttttgggggg 20
<210> SEQ ID NO 450 <211> LENGTH: 13 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 450 ggggttgggg gtt 13 <210> SEQ ID NO
451 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 451
ggtacctgtg gggacattgt g 21
<210> SEQ ID NO 452 <211> LENGTH: 9 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 452 ggtgaggtg 9 <210> SEQ ID NO 453
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 453
ggtggtgtag gttttgg 17 <210> SEQ ID NO 454 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 454 ggttacggtc tgtcccatat 20
<210> SEQ ID NO 455 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 455 ggttcacgtg ctcatggctg 20 <210> SEQ ID NO 456
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 456
gtaacgtt 8 <210> SEQ ID NO 457 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 457 gtagccttcc ta 12
<210> SEQ ID NO 458 <211> LENGTH: 31 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 458 gtaggggact ttccgagctc gagatcctat g 31 <210> SEQ
ID NO 459 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 459
gtcactcgtg gtacctcga 19 <210> SEQ ID NO 460 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 460 gtccatggcg
tgcgggatga 20 <210> SEQ ID NO 461 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 461 gtcccaggtt gtatagaggc tgc
23 <210> SEQ ID NO 462 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 462 gtccccattt cccagaggag gaaat 25 <210> SEQ ID NO
463 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 463
gtccgggcca ggccaaagtc 20 <210> SEQ ID NO 464 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 464
gtcggtcctg atgctgttcc 20 <210> SEQ ID NO 465 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 465 gtctatcgga
ggactggcgc 20 <210> SEQ ID NO 466 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 466 gtctgtccca tgatctcgaa 20
<210> SEQ ID NO 467 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223>
OTHER INFORMATION: I <221> NAME/KEY: modified_base
<222> LOCATION: (13)...(13) <223> OTHER INFORMATION: I
<221> NAME/KEY: modified_base <222> LOCATION:
(18)...(18) <223> OTHER INFORMATION: I <400> SEQUENCE:
467 gtgaatncgt tcncgggnct 20 <210> SEQ ID NO 468 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 468 gtgccggggt
ctccgggc 18 <210> SEQ ID NO 469 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 469 gtgccggggt ctccgggc 18
<210> SEQ ID NO 470 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 470 gtgcgcgcga gcccgaaatc 20 <210> SEQ
ID NO 471 <211> LENGTH: 26 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
471 gtgctgatca ccgatatcct gttcgg 26 <210> SEQ ID NO 472
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 472
gtgcttgacc accgatattt gg 22 <210> SEQ ID NO 473 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 473 gtggttacgg
tcgtgcccat 20 <210> SEQ ID NO 474 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 474 gtgtcggggt ctccgggc 18
<210> SEQ ID NO 475 <211> LENGTH: 37 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 475 gttctcagat aaagcggaac cagcaacaga cacagaa
37 <210> SEQ ID NO 476 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 476 gttgaaaccc gagaacatca t 21 <210>
SEQ ID NO 477 <211> LENGTH: 25 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_difference <222> LOCATION:
(0)...(0) <223> OTHER INFORMATION: phosphodiester backbone
<400> SEQUENCE: 477 gttggataca ggccagactt tgttg 25
<210> SEQ ID NO 478 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 478 gtttttatat aatttggg 18 <210> SEQ ID NO 479
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (10)...(10) <223> OTHER
INFORMATION: biotinylated at 3' end <221> NAME/KEY:
modified_base <222> LOCATION: (2)...(2) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 479 gnaatattgc 10
<210> SEQ ID NO 480 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: modified_base <222> LOCATION: (2)...(2)
<223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (5)...(5) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (9)...(9) <223> OTHER INFORMATION: m5c <221>
NAME/KEY: modified_base <222> LOCATION: (12)...(12)
<223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (14)...(14) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (16)...(16) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 480 gnggngggng gngngngccc 20 <210> SEQ
ID NO 481 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 481
taaacgtt 8 <210> SEQ ID NO 482 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 482 taagcgct 8 <210> SEQ ID NO
483 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
483 taagctctgt caacgccagg 20 <210> SEQ ID NO 484 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 484 taccgagctt
cgacgagatt tca 23 <210> SEQ ID NO 485 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 485 taccgcgtgc
gaccctct 18 <210> SEQ ID NO 486 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 486 tactcttcgg atcccttgcg 20
<210> SEQ ID NO 487 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 487 tagaaacagc attcttcttt tagggcagca ca 32
<210> SEQ ID NO 488 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 488 tagacgtc 8 <210> SEQ ID NO 489 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 489 tagacgttag cgtga
15 <210> SEQ ID NO 490 <211> LENGTH: 36 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 490 tatagtccct gagactgccc caccttctca acaacc
36 <210> SEQ ID NO 491 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 491 tatcggagga ctggcgcgcc g 21 <210>
SEQ ID NO 492 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 492 tatgccgcgc ccggacttat 20
<210> SEQ ID NO 493 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 493 tcaaatgtgg gattttccca tgagtct 27 <210> SEQ ID
NO 494 <211> LENGTH: 7 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 494
tcaacgt 7 <210> SEQ ID NO 495 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 495 tcaacgtc 8 <210> SEQ ID NO
496 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: p-ethoxy backbone <400> SEQUENCE: 496 tcaacgtt 8
<210> SEQ ID NO 497 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 497 tcaacgtt 8 <210> SEQ ID NO 498
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 498
tcaacgtt 8 <210> SEQ ID NO 499 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 499 tcaacgttaa cgttaacgtt 20
<210> SEQ ID NO 500 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<221> NAME/KEY: misc_feature <222> LOCATION:
(32)...(32) <223> OTHER INFORMATION: biotinylated at 3' end
<400> SEQUENCE: 500 tcaacgttaa cgttaacgtt aacgttaacg tt 32
<210> SEQ ID NO 501 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 501 tcaacgttga 10 <210> SEQ ID NO 502
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 502 tcaacgttga 10
<210> SEQ ID NO 503 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (10)...(10)
<223> OTHER INFORMATION: biotinylated at 3' end <400>
SEQUENCE: 503 tcaacgttga 10 <210> SEQ ID NO 504 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <221> NAME/KEY: misc_feature
<222> LOCATION: (10)...(10) <223> OTHER INFORMATION:
FITC labeled <400> SEQUENCE: 504 tcaacgttga 10 <210>
SEQ ID NO 505 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: p-ethoxy backbone <400>
SEQUENCE: 505 tcaagctt 8 <210> SEQ ID NO 506 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 506 tcaagctt 8
<210> SEQ ID NO 507 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (10)...(10)
<223> OTHER INFORMATION: FITC labeled <400> SEQUENCE:
507 tcaatgctga 10 <210> SEQ ID NO 508 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(5)...(5) <223> OTHER INFORMATION: m5c <400> SEQUENCE:
508 tcaangtt 8 <210> SEQ ID NO 509 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: misc_feature <222> LOCATION:
(10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end
<221> NAME/KEY: modified_base <222> LOCATION: (5)...(5)
<223> OTHER INFORMATION: m5c <400> SEQUENCE: 509
tcaangttga 10 <210> SEQ ID NO 510 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 510 tcaccggt 8 <210> SEQ ID NO
511 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 511
tcacgctaac ctctagc 17 <210> SEQ ID NO 512 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 512 tcacgctaac ctctgac 17
<210> SEQ ID NO 513 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 513 tcacgctaac gtctagc 17 <210> SEQ ID NO 514
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 514
tcacgt 6 <210> SEQ ID NO 515 <211> LENGTH: 27
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 515 tcagaccacg tggtcgggtg ttcctga 27
<210> SEQ ID NO 516 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 516 tcagaccagc tggtcgggtg ttcctga 27 <210> SEQ ID
NO 517 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 517
tcagcgct 8
<210> SEQ ID NO 518 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 518 tcagcgtgcg cc 12 <210> SEQ ID NO
519 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
519 tcagctctgg tactttttca 20 <210> SEQ ID NO 520 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 520 tcaggaacac
ccgaccacgt ggtctga 27 <210> SEQ ID NO 521 <211> LENGTH:
27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 521 tcaggaacac ccgaccagct ggtctga 27
<210> SEQ ID NO 522 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 522 tcaggggtgg ggggaacctt 20
<210> SEQ ID NO 523 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 523 tcagngct 8
<210> SEQ ID NO 524 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 524 tcatcgat 8 <210> SEQ ID NO 525 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 525 tccaagacgt
tcctgatgct 20 <210> SEQ ID NO 526 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 526 tccaagtagt tcctagttct 20
<210> SEQ ID NO 527 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 527 tccaccacgt ggctgatgct 20 <210> SEQ ID NO 528
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 528
tccaccacgt ggtctatgct 20 <210> SEQ ID NO 529 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 529 tccacgacgt
tttcgacgtt 20 <210> SEQ ID NO 530 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 530 tccagacggt gaagt 15 <210>
SEQ ID NO 531 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 531 tccagacgtt gaagt 15 <210> SEQ ID NO 532
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 532
tccagagctt gaagt 15 <210> SEQ ID NO 533 <211> LENGTH:
16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 533 tccagcgtgc gccata 16
<210> SEQ ID NO 534 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone
<400> SEQUENCE: 534 tccaggacgt tcctagttct 20 <210> SEQ
ID NO 535 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 535
tccaggactt ctctcaggtt 20 <210> SEQ ID NO 536 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 536
tccaggactt ctctcaggtt 20 <210> SEQ ID NO 537 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 537 tccaggactt
tcctcaggtt 20 <210> SEQ ID NO 538 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 538 tccaggactt tcctcaggtt 20
<210> SEQ ID NO 539 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 539 tccaggagct tcctagttct 20 <210> SEQ ID NO 540
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 540
tccaggatgt tcctagttct 20 <210> SEQ ID NO 541 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 541 tccagtctag
gcctagttct 20 <210> SEQ ID NO 542 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 542 tccagttcct tcctcagtct 20
<210> SEQ ID NO 543 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 543 tccagttcga gcctagttct 20 <210> SEQ ID NO 544
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 544
tccataacgt tcctgagtct 20 <210> SEQ ID NO 545 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 545 tccataacgt
tcctgatgct 20 <210> SEQ ID NO 546 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 546 tccatagcga tcctagcgat 20
<210> SEQ ID NO 547 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 547 tccatagcgg tcctagcggt 20 <210> SEQ ID NO 548
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 548
tccatagcgt tcctagcgtt 20 <210> SEQ ID NO 549 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 549 tccatagcgt
tcctagcgtt 20 <210> SEQ ID NO 550 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 550 tccatcacgt gcctgagtct 20
<210> SEQ ID NO 551 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 551 tccatgacat tcctgatgct 20
<210> SEQ ID NO 552 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 552 tccatgacgg tcctgacggt 20 <210> SEQ
ID NO 553 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 553
tccatgacgg tcctgacggt 20 <210> SEQ ID NO 554 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 554
tccatgacgg tcctgagtct 20 <210> SEQ ID NO 555 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 555 tccatgacgg
tcctgatgct 20 <210> SEQ ID NO 556 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 556 tccatgacgt ccctgagtct 20
<210> SEQ ID NO 557 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 557 tccatgacgt ccctgatgct 20 <210> SEQ ID NO 558
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 558
tccatgacgt tcctagttct 20 <210> SEQ ID NO 559 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 559 tccatgacgt
tcctctccat gacgttcctc tccatgacgt tcctc 45 <210> SEQ ID NO 560
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 560
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 561 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 561 tccatgacgt
tcctgacgtt 20 <210> SEQ ID NO 562 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 562 tccatgacgt tcctgacgtt 20
<210> SEQ ID NO 563 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 563 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 564
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 564
tccatgacgt tcctgagtct 20 <210> SEQ ID NO 565 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 565 tccatgacgt
tcctgatcc 19 <210> SEQ ID NO 566 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 566 tccatgacgt tcctgatgct 20
<210> SEQ ID NO 567 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 567 tccatgacgt tcctgatgct 20
<210> SEQ ID NO 568 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 568 tccatgacgt tcctgcagtt cctgacgtt 29
<210> SEQ ID NO 569 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 569 tccatgacgt tcctgccgtt 20 <210> SEQ
ID NO 570 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 570
tccatgacgt tcctgcgttt 20 <210> SEQ ID NO 571 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 571 tccatgacgt
tcctggcggg 20 <210> SEQ ID NO 572 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(13)...(13) <223> OTHER INFORMATION: m5c <400>
SEQUENCE: 572 tccatgacgt tcntgatgct 20 <210> SEQ ID NO 573
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 573
tccatgagct tcctgagctt 20 <210> SEQ ID NO 574 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 574 tccatgagct
tcctgagtct 20 <210> SEQ ID NO 575 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: p-ethoxy
backbone <400> SEQUENCE: 575 tccatgagct tcctgagtct 20
<210> SEQ ID NO 576 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 576 tccatgagct tcctgagtct 20 <210> SEQ
ID NO 577 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 577
tccatgagct tcctgatgct 20 <210> SEQ ID NO 578 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 578 tccatgagct
tccttgagtc t 21 <210> SEQ ID NO 579 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(8)...(8) <223> OTHER INFORMATION: I <221> NAME/KEY:
modified_base <222> LOCATION: (17)...(17) <223> OTHER
INFORMATION: I <400> SEQUENCE: 579 tccatgangt tcctgangtt 20
<210> SEQ ID NO 580 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 580 tccatgatgt tcctagttct 20 <210> SEQ ID NO 581
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 581 tccatgangt tcctagttct 20
<210> SEQ ID NO 582 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 582 tccatgangt
tcctgatgct 20 <210> SEQ ID NO 583 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(8)...(8) <223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (17)...(17)
<223> OTHER INFORMATION: m5c <400> SEQUENCE: 583
tccatgangt tcctgangtt 20 <210> SEQ ID NO 584 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 584
tccatgccgg tcctgagtct 20 <210> SEQ ID NO 585 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 585 tccatgccgg
tcctgatgct 20 <210> SEQ ID NO 586 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 586 tccatgccgg tcctgccggt 20
<210> SEQ ID NO 587 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 587 tccatgccgt tcctgccgtt 20 <210> SEQ
ID NO 588 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 588
tccatgccgt tcctgccgtt 20 <210> SEQ ID NO 589 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 589 tccatgcgcg
tcctgcgcgt 20 <210> SEQ ID NO 590 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 590 tccatgcgtg cgtgcgtttt 20
<210> SEQ ID NO 591 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 591 tccatgcgtt gcgttgcgtt 20 <210> SEQ
ID NO 592 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 592
tccatgctgg tcctgagtct 20 <210> SEQ ID NO 593 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 593 tccatgctgg
tcctgatgct 20 <210> SEQ ID NO 594 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 594 tccatggcgg gcctggcggg 20
<210> SEQ ID NO 595 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 595 tccatggcgg tcctgatgct 20 <210> SEQ ID NO 596
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 596
tccatgtagt tcctagttct 20 <210> SEQ ID NO 597 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 597 tccatgtcct
tcctgatgct 20 <210> SEQ ID NO 598 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 598 tccatgtcga tcctgagtct 20
<210> SEQ ID NO 599 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 599 tccatgtcga tcctgatgct 20 <210> SEQ ID NO 600
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 600 tccatgtcgc tcctgagtct 20
<210> SEQ ID NO 601 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 601 tccatgtcgc tcctgatcct 20 <210> SEQ ID NO 602
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 602
tccatgtcgg tcctgagtct 20 <210> SEQ ID NO 603 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 603 tccatgtcgg
tcctgatgct 20 <210> SEQ ID NO 604 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 604 tccatgtcgg tcctgatgct 20
<210> SEQ ID NO 605 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 605 tccatgtcgg tcctgctgat 20 <210> SEQ ID NO 606
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (12)...(12) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 606 tccatgtcgg tnctgatgct 20
<210> SEQ ID NO 607 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 607 tccatgtcgt tccgcgcgcg 20 <210> SEQ ID NO 608
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 608
tccatgtcgt tcctagttct 20 <210> SEQ ID NO 609 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 609
tccatgtcgt tcctgagtct 20 <210> SEQ ID NO 610 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 610 tccatgtcgt
tcctgatgcg 20 <210> SEQ ID NO 611 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 611 tccatgtcgt tcctgatgct 20
<210> SEQ ID NO 612 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 612 tccatgtcgt tcctgccgct 20 <210> SEQ ID NO 613
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 613
tccatgtcgt tcctgtagct 20 <210> SEQ ID NO 614 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 614 tccatgtcgt
tcctgtcgtt 20 <210> SEQ ID NO 615 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 615 tccatgtcgt tcctgtcgtt 20
<210> SEQ ID NO 616 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 616 tccatgtcgt ttttgtcgtt 20
<210> SEQ ID NO 617 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 617 tccatgtgct tcctgatgct 20 <210> SEQ ID NO 618
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <221> NAME/KEY:
modified_base <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 618 tccatgtngg tcctgagtct 20
<210> SEQ ID NO 619 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 619 tccatgtngg
tcctgatgct 20 <210> SEQ ID NO 620 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE:
620 tccatgtngt tcctgatgct 20 <210> SEQ ID NO 621 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <221> NAME/KEY: modified_base
<222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION:
(17)...(17) <223> OTHER INFORMATION: m5c <400>
SEQUENCE: 621 tccatgtngt tcctgtngtt 20 <210> SEQ ID NO 622
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 622
tccattgcgt tccttgcgtt 20 <210> SEQ ID NO 623 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 623 tcccgacggt gaagt
15 <210> SEQ ID NO 624 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 624 tcccgccgtt gaagt 15 <210> SEQ ID NO 625
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 625
tcccgcgcgt tccgcgcgtt 20 <210> SEQ ID NO 626 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 626 tccctgagac
tgccccacct t 21 <210> SEQ ID NO 627 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 627 tccgatcg 8 <210> SEQ ID NO
628 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 628
tccggacggt gaagt 15 <210> SEQ ID NO 629 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 629 tccggccgtt gaagt 15 <210>
SEQ ID NO 630 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 630 tccgtacg 8 <210> SEQ ID NO 631 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 631 tcctaacgtt gaagt
15 <210> SEQ ID NO 632 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 632 tcctagcgtt gaagt 15
<210> SEQ ID NO 633 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 633 tcctcacgtt gaagt 15 <210> SEQ ID NO 634
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 634
tcctga 6 <210> SEQ ID NO 635 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 635 tcctgaaaag gaagt 15 <210>
SEQ ID NO 636 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 636 tcctgacgat gaagt 15 <210> SEQ ID NO 637
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 637
tcctgacgct gaagt 15 <210> SEQ ID NO 638 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 638 tcctgacggg gaagt 15 <210>
SEQ ID NO 639 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 639 tcctgacggg gaagt 15 <210> SEQ ID NO
640 <211> LENGTH: 14 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 640
tcctgacggg gagt 14 <210> SEQ ID NO 641 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 641 tcctgacggt gaagt 15 <210>
SEQ ID NO 642 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 642 tcctgacggt gaagt 15 <210> SEQ ID NO
643 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 643
tcctgacgta gaagt 15 <210> SEQ ID NO 644 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 644 tcctgacgtc gaagt 15 <210>
SEQ ID NO 645 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_difference <222> LOCATION:
(0)...(0) <223> OTHER INFORMATION: phosphodiester backbone
<400> SEQUENCE: 645 tcctgacgtg gaagt 15 <210> SEQ ID NO
646 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 646
tcctgacgtg gaagt 15 <210> SEQ ID NO 647 <211> LENGTH:
13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 647 tcctgacgtt aga 13 <210>
SEQ ID NO 648 <211> LENGTH: 13 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 648 tcctgacgtt ccc 13 <210> SEQ ID NO 649
<211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone
<400> SEQUENCE: 649 tcctgacgtt cccctggcgg tcccctgtcg ct 32
<210> SEQ ID NO 650 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 650 tcctgacgtt cctgacgtt 19 <210> SEQ
ID NO 651 <211> LENGTH: 28 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 651
tcctgacgtt cctggcggtc ctgtcgct 28 <210> SEQ ID NO 652
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 652
tcctgacgtt ccttc 15 <210> SEQ ID NO 653 <211> LENGTH:
22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 653 tcctgacgtt cggcgcgcgc cc 22
<210> SEQ ID NO 654 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 654 tcctgacgtt gaagt 15 <210> SEQ ID NO 655
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 655
tcctgacgtt gaagt 15 <210> SEQ ID NO 656 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 656 tcctgagctt gaagt 15 <210>
SEQ ID NO 657 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 657 tcctgagctt gaagt 15 <210> SEQ ID NO
658 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (7)...(7) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 658 tcctgangtt gaagt 15
<210> SEQ ID NO 659 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 659 tcctgccgtt gaagt 15 <210> SEQ ID NO 660
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 660
tcctgccgtt gaagt 15 <210> SEQ ID NO 661 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 661 tcctggaggg gaagt 15 <210>
SEQ ID NO 662 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 662 tcctggaggg gaagt 15 <210> SEQ ID NO
663 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 663
tcctggcggg gaagt 15 <210> SEQ ID NO 664 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 664 tcctggcggg gaagt 15 <210>
SEQ ID NO 665 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 665 tcctggcggt cctggcggtt 20 <210> SEQ
ID NO 666 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 666 tcctggcggt gaagt 15 <210>
SEQ ID NO 667 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 667 tcctggcggt gaagt 15 <210> SEQ ID NO
668 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 668
tcctggcgtg gaagt 15 <210> SEQ ID NO 669 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 669 tcctggcgtt gaagt 15 <210>
SEQ ID NO 670 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 670 tcctggcgtt gaagt 15 <210> SEQ ID NO
671 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 671
tcctgggggg gaagt 15 <210> SEQ ID NO 672 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 672 tcctggtggg gaagt 15 <210>
SEQ ID NO 673 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 673 tcctggnggg gaagt
15 <210> SEQ ID NO 674 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 674 tcctgtcgct cctgtcgct 19 <210> SEQ ID NO 675
<211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 675
tcctgtcgct cctgtcgctc ctgtcgct 28 <210> SEQ ID NO 676
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 676
tcctgtcgtt cctgtcgtt 19 <210> SEQ ID NO 677 <211>
LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 677 tcctgtcgtt
cctgtcgttg gaacgacagg 30 <210> SEQ ID NO 678 <211>
LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 678 tcctgtcgtt
cctgtcgttt caacgtcagg aacgacagga 40 <210> SEQ ID NO 679
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 679
tcctgtcgtt ccttgtcgtt 20 <210> SEQ ID NO 680 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 680 tcctgtcgtt gaagt
15 <210> SEQ ID NO 681 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 681 tcctgtcgtt gaagtttttt 20 <210> SEQ ID NO 682
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 682 tcctgtcgtt ttttgtcgtt 20 <210> SEQ
ID NO 683 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 683
tccttacgtt gaagt 15 <210> SEQ ID NO 684 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 684 tccttgtcgt tcctgtcgtt 20
<210> SEQ ID NO 685 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 685 tcgacgtc 8 <210> SEQ ID NO 686 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 686 tcgacgttcc
cccccccccc 20 <210> SEQ ID NO 687 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 687 tcgagacatt gcacaatcat ctg 23
<210> SEQ ID NO 688 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 688 tcgccgttcc cccccccccc 20 <210> SEQ ID NO 689
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 689
tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> SEQ ID NO 690
<211> LENGTH: 5 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 690
tcgga 5 <210> SEQ ID NO 691 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 691 tcggcgttcc cccccccccc 20
<210> SEQ ID NO 692 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_difference <222> LOCATION:
(0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 692 tcgtag 6 <210> SEQ ID NO 693
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 693
tcgtca 6 <210> SEQ ID NO 694 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 694 tcgtcattcc cccccccccc 20
<210> SEQ ID NO 695 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 695 tcgtcgatcc cccccccccc 20 <210> SEQ ID NO 696
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 696
tcgtcgctcc cccccccccc 20 <210> SEQ ID NO 697 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 697 tcgtcgctgt
ctccg 15 <210> SEQ ID NO 698 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 698 tcgtcgctgt ctccgcttct t 21
<210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 3'
end <400> SEQUENCE: 699 tcgtcgctgt ctccgcttct t 21
<210> SEQ ID NO 700 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorodithioate/phosphodiester backbone with phosphodiester on
3' end <400> SEQUENCE: 700 tcgtcgctgt ctccgcttct t 21
<210> SEQ ID NO 701 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 701 tcgtcgctgt ctccgcttct tcttgcc 27
<210> SEQ ID NO 702 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 702 tcgtcgctgt ctgcccttct t 21 <210>
SEQ ID NO 703 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 703 tcgtcgctgt tgtcgtttct t 21 <210>
SEQ ID NO 704 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 704 tcgtcggtcc cccccccccc 20 <210> SEQ ID NO 705
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 705
tcgtcgtcag ttcgctgtcg 20 <210> SEQ ID NO 706 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 706
tcgtcgtcgt cgtcgtcgtc gtt 23 <210> SEQ ID NO 707 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 707 tcgtcgtcgt cgtt
14 <210> SEQ ID NO 708 <211> LENGTH: 14 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorodithioate backbone
<400> SEQUENCE: 708 tcgtcgtcgt cgtt 14 <210> SEQ ID NO
709 <211> LENGTH: 14 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorodithioate/phosphodiester backbone
with phosphodiester on 3' end <400> SEQUENCE: 709 tcgtcgtcgt
cgtt 14 <210> SEQ ID NO 710 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorodithioate/phosphodiester backbone with phosphodiester on
5' end <400> SEQUENCE: 710 tcgtcgtcgt cgtt 14 <210> SEQ
ID NO 711 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 711
tcgtcgttcc ccccccc 17 <210> SEQ ID NO 712 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 712 tcgtcgttcc cccccccccc 20
<210> SEQ ID NO 713 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (20)...(20)
<223> OTHER INFORMATION: biotinylated at 3' end <400>
SEQUENCE: 713 tcgtcgttcc cccccccccc 20 <210> SEQ ID NO 714
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (16)...(16) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 714 tcgtcgttcc cccccncccc 20
<210> SEQ ID NO 715 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 715 tcgtcgttgg tgtcgttggt gtcgtt 26
<210> SEQ ID NO 716 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 716 tcgtcgttgg ttgtcgtttt ggtt 24 <210>
SEQ ID NO 717 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 717 tcgtcgttgt cgttgtcgtt 20 <210> SEQ
ID NO 718 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 718
tcgtcgttgt cgttgtcgtt 20 <210> SEQ ID NO 719 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 719 tcgtcgttgt
cgttttgtcg tt 22 <210> SEQ ID NO 720 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 720 tcgtcgttgt cgttttgtcg tt
22 <210> SEQ ID NO 721 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 721 tcgtcgtttc gtcgttttga cgtt 24 <210>
SEQ ID NO 722 <211> LENGTH: 26 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 722 tcgtcgtttg cgtgcgtttc gtcgtt 26
<210> SEQ ID NO 723 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 723 tcgtcgtttg tcgttttgtc gtt 23 <210>
SEQ ID NO 724 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 724 tcgtcgtttt gacgttttga cgtt 24 <210>
SEQ ID NO 725 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 725 tcgtcgtttt gacgttttgt cgtt 24 <210>
SEQ ID NO 726 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 726 tcgtcgtttt gcgtgcgttt 20 <210> SEQ
ID NO 727 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
727 tcgtcgtttt gtcgttttgg gggg 24 <210> SEQ ID NO 728
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 728
tcgtcgtttt gtcgttttgt cgt 23 <210> SEQ ID NO 729 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 729 tcgtcgtttt
gtcgttttgt cgtt 24 <210> SEQ ID NO 730 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 730 tcgtcgtttt gtcgttttgt cgtt
24 <210> SEQ ID NO 731 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 731 tcgtcgtttt gtcgttttgt cgtt 24
<210> SEQ ID NO 732 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorodithioate backbone
<400> SEQUENCE: 732 tcgtcgtttt gtcgttttgt cgtt 24 <210>
SEQ ID NO 733 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: misc_feature <222> LOCATION: (24)...(24)
<223> OTHER INFORMATION: biotinylated at 3' end <400>
SEQUENCE: 733 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
734 <211> LENGTH: 32 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 734
tcgtcgtttt gtcgttttgt cgttttgtcg tt 32 <210> SEQ ID NO 735
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 735
tcgtcgtttt gtggttttgt ggtt 24 <210> SEQ ID NO 736 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 736 tcgtcgtttt
ttgtcgtttt ttgtcgtt 28 <210> SEQ ID NO 737 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 737 tcgtcgtttt
tttttttttt 20 <210> SEQ ID NO 738 <211> LENGTH: 6
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 738 tcgtga 6 <210> SEQ ID NO
739 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 739
tcgtga 6 <210> SEQ ID NO 740 <211> LENGTH: 6
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 740 tcgtgg 6 <210> SEQ ID NO
741 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (5)...(5) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 741 tcgtngttcc cccccccccc 20
<210> SEQ ID NO 742 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 742 tcntcgtntt ntcgtnttnt cgtn 24 <210>
SEQ ID NO 743 <211> LENGTH: 26 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 743 tctaaaaacc atctattctt aaccct 26 <210> SEQ ID NO
744 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 744
tctagcgttt ttagcgttcc 20 <210> SEQ ID NO 745 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 745 tctatcccag
gtggttcctg ttag 24 <210> SEQ ID NO 746 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 746 tctatcgacg ttcaagcaag 20
<210> SEQ ID NO 747 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 747 tctccatcct atggttttat cg 22 <210> SEQ ID NO 748
<211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 748 tctccatgat ggttttatcg 20
<210> SEQ ID NO 749 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 749 tctcccagcg agcgagcgcc at 22 <210>
SEQ ID NO 750 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 750 tctcccagcg agcgccat 18 <210> SEQ ID
NO 751 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 751
tctcccagcg cgcgccat 18 <210> SEQ ID NO 752 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 752 tctcccagcg
ggcgcat 17 <210> SEQ ID NO 753 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 753 tctcccagcg tacgccat 18
<210> SEQ ID NO 754 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 754 tctcccagcg tcgccat 17 <210> SEQ ID
NO 755 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 755
tctcccagcg tgcgccat 18 <210> SEQ ID NO 756 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 756 tctcccagcg
tgcgccat 18 <210> SEQ ID NO 757 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 757 tctcccagcg tgcgccatat 20
<210> SEQ ID NO 758 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 758 tctcccagcg tgcgcctttt 20
<210> SEQ ID NO 759 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 759 tctcccagcg tgcgtgcgcc at 22 <210>
SEQ ID NO 760 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 760 tctcccagcg tgcgttatat 20
<210> SEQ ID NO 761 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 761 tctcccagcg tgcgtttt 18 <210> SEQ ID
NO 762 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 762
tctcccagcg ttgcgccata t 21 <210> SEQ ID NO 763 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 763 tctcccatcg
tcgccat 17 <210> SEQ ID NO 764 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 764
tctcccgacg tgcgccat 18 <210> SEQ ID NO 765 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 765 tctcccgtcg
tgcgccat 18 <210> SEQ ID NO 766 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 766 tctccctgcg tgcgccatat 20
<210> SEQ ID NO 767 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 767 tctcctagcg tgcgccatat 20
<210> SEQ ID NO 768 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 768 tctgacgtca tctgacgttg gctgacgtct 30 <210> SEQ
ID NO 769 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 769
tctgcgtgcg tgcgccatat 20 <210> SEQ ID NO 770 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 770 tcttcgaa 8
<210> SEQ ID NO 771 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 771 tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45
<210> SEQ ID NO 772 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 772 tctttattag tgactcagca cttggca 27 <210> SEQ ID
NO 773 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (3)...(3) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 773 tcntgacgtt gaagt 15
<210> SEQ ID NO 774 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 774 tgaacgtt 8 <210> SEQ ID NO 775 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 775 tgcaatgtga
cgtcctttag cat 23 <210> SEQ ID NO 776 <211> LENGTH: 31
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 776 tgcaggaagt ccgggttttc cccaaccccc
c 31 <210> SEQ ID NO 777 <211> LENGTH: 12 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 777 tgcatcagct ct 12 <210> SEQ ID NO
778 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 778
tgcatcagct ct 12 <210> SEQ ID NO 779 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 779 tgcatccccc aggccaccat 20
<210> SEQ ID NO 780 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphorothioate at
5' and 3' ends <400> SEQUENCE: 780 tgcatgccgt acacagctct
20
<210> SEQ ID NO 781 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 781 tgcatgccgt acacagctct 20 <210> SEQ
ID NO 782 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 782
tgcatgccgt acacagctct 20 <210> SEQ ID NO 783 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 783 tgcatgccgt
gcatccgtac acagctct 28 <210> SEQ ID NO 784 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 784 tgccaagtgc
tgagtcacta ataaaga 27 <210> SEQ ID NO 785 <211> LENGTH:
30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 785 tgcccaaaga ggaaaatttg tttcatacag
30 <210> SEQ ID NO 786 <211> LENGTH: 8 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 786 tgcgctct 8 <210> SEQ ID NO 787
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 787
tgctagctgt gcctgtacct 20 <210> SEQ ID NO 788 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 788 tgctagctgt
gcctgtacct 20 <210> SEQ ID NO 789 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 789 tgctgcttcc cccccccccc 20
<210> SEQ ID NO 790 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 790 tgctgcttcc cccccccccc 20 <210> SEQ
ID NO 791 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 791
tgctgctttt gtgcttttgt gctt 24 <210> SEQ ID NO 792 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 792 tgctgctttt
gtgcttttgt gctt 24 <210> SEQ ID NO 793 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 793 tggaccttcc at 12
<210> SEQ ID NO 794 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 794 tggaccttct atgtcggtcc 20 <210> SEQ
ID NO 795 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 795
tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 <210> SEQ
ID NO 796 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 796
tggaggtccc accgagatcg gag 23 <210> SEQ ID NO 797 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 797 tggttacggt
ctgtcccatg 20 <210> SEQ ID NO 798 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 798 tgtatctctc tgaaggact 19 <210> SEQ ID NO 799
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 799
tgtccagccg aggggaccat 20 <210> SEQ ID NO 800 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 800 tgtcccatgt
ttttagaagc 20 <210> SEQ ID NO 801 <211> LENGTH: 13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 801 tgtcgttgtc gtt 13 <210>
SEQ ID NO 802 <211> LENGTH: 25 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 802 tgtcgttgtc gttgtcgttg tcgtt 25
<210> SEQ ID NO 803 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 803 tgtcgtttgt cgtttgtcgt t 21 <210>
SEQ ID NO 804 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 804 ttaacggtgg tagcggtatt ggtc 24 <210> SEQ ID NO
805 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 805
ttaacgtt 8 <210> SEQ ID NO 806 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 806 ttaagaccaa taccgctacc accg 24
<210> SEQ ID NO 807 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 807 ttaggacaag gtctagggtg 20 <210> SEQ
ID NO 808 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 808
ttagggttag ggttagggtt 20 <210> SEQ ID NO 809 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 809 ttcagttgtc
ttgctgctta gctaa 25 <210> SEQ ID NO 810 <211> LENGTH:
21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 810 ttcatgcctt gcaaaatggc g
21 <210> SEQ ID NO 811 <211> LENGTH: 43 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 811 ttccaatcag ccccacccgc tctggcccca ccctcaccct cca 43
<210> SEQ ID NO 812 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 812 ttccatgctg ttccggctgg 20 <210> SEQ
ID NO 813 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 813
ttccatgtcg gtcctgat 18 <210> SEQ ID NO 814 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 814 ttccgccgaa
tggcctcagg atggtac 27 <210> SEQ ID NO 815 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 815 ttccgcttta tctgagaacc
atct 24 <210> SEQ ID NO 816 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone
<400> SEQUENCE: 816 ttcctctctg caagagact 19 <210> SEQ
ID NO 817 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 817
ttcgggcgga ctcctccatt 20 <210> SEQ ID NO 818 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 818 ttcgggcgga
ctcctccatt 20 <210> SEQ ID NO 819 <211> LENGTH: 25
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate
backbone <400> SEQUENCE: 819 ttcgtcgttt tgtcgttttg tcgtt 25
<210> SEQ ID NO 820 <211> LENGTH: 37 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 820 ttctgtgtct gttgctggtt ccgctttatc tgagaac
37 <210> SEQ ID NO 821 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 821 ttgaaactga ggtgggac 18 <210> SEQ ID
NO 822 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
822 ttgccccata ttttagaaac 20 <210> SEQ ID NO 823 <211>
LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 823 ttgggggggg tt
12 <210> SEQ ID NO 824 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 824 ttgtactctc catgatggtt 20 <210> SEQ
ID NO 825 <211> LENGTH: 30 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 825
tttacctttt ataaacataa ctaaaacaaa 30 <210> SEQ ID NO 826
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 826
tttgaatcct cagcggtctc cagtggc 27 <210> SEQ ID NO 827
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 827
tttgaattca ggactggtga ggttgag 27 <210> SEQ ID NO 828
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <400> SEQUENCE: 828
tttgaattcc gtgtacagaa gcgagaagc 29 <210> SEQ ID NO 829
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: chimeric phosphorothioate/phosphodiester backbone with
phosphorothioate at 5' and 3' ends <400> SEQUENCE: 829
tttgagaacg ctggaccttc 20 <210> SEQ ID NO 830 <211>
LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 830 tttgcggccg
ctagacttaa cctgagagat a 31 <210> SEQ ID NO 831 <211>
LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 831 tttgggccca
cgagagacag agacacttc 29 <210> SEQ ID NO 832 <211>
LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 832 tttgggcccg
cttctcgctt ctgtacacg 29 <210> SEQ ID NO 833 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphodiester backbone <400> SEQUENCE: 833 ttttctagag
aggtgcacaa tgctctgg 28
<210> SEQ ID NO 834 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <400>
SEQUENCE: 834 tttttggggg gggggttttt 20 <210> SEQ ID NO 835
<211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
misc_feature <222> LOCATION: (13)...(13) <223> OTHER
INFORMATION: FITC labeled <400> SEQUENCE: 835 tttttttttt ttt
13 <210> SEQ ID NO 836 <211> LENGTH: 13 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: chimeric
phosphorothioate/phosphodiester backbone with phosphodiester on 3'
end <221> NAME/KEY: misc_difference <222> LOCATION:
(13)...(13) <223> OTHER INFORMATION: FITC labeled <400>
SEQUENCE: 836 tttttttttt ttt 13 <210> SEQ ID NO 837
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphorothioate backbone <400> SEQUENCE: 837
tttttttttt tttttttt 18 <210> SEQ ID NO 838 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <400> SEQUENCE: 838 tttttttttt
tttttttttt 20 <210> SEQ ID NO 839 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <400> SEQUENCE: 839 tttttttttt tttttttttt 20
<210> SEQ ID NO 840 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 840 tttttttttt tttttttttt t 21 <210>
SEQ ID NO 841 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 841 tttttttttt tttttttttt tttt 24 <210>
SEQ ID NO 842 <211> LENGTH: 27 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphorothioate backbone
<400> SEQUENCE: 842 tttttttttt tttttttttt ttttttt 27
<210> SEQ ID NO 843 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 843 tnaacgtt 8
<210> SEQ ID NO 844 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223>
OTHER INFORMATION: m5c <400> SEQUENCE: 844 tngtcgttcc
cccccccccc 20 <210> SEQ ID NO 845 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester
backbone <221> NAME/KEY: modified_base <222> LOCATION:
(2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE:
845 tngtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 846
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: (0)...(0) <223> OTHER
INFORMATION: phosphodiester backbone <221> NAME/KEY:
modified_base <222> LOCATION: (2)...(2) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 846 tngtggttcc cccccccccc 20
<210> SEQ ID NO 847 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)
<223> OTHER INFORMATION: phosphodiester backbone <221>
NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223>
OTHER INFORMATION: m5c <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION:
(13)...(13) <223> OTHER INFORMATION: m5c <221>
NAME/KEY: modified_base <222> LOCATION: (21)...(21)
<223> OTHER INFORMATION: m5c <400> SEQUENCE: 847
tngtgntttt gtngttttgt ngtt 24 <210> SEQ ID NO 848 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION:
phosphorothioate backbone <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION: (5)...(5)
<223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (13)...(13) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (21)...(21) <223> OTHER INFORMATION: m5c
<400> SEQUENCE: 848 tngtngtttt gtngttttgt ngtt 24
* * * * *