Methods for enhancing antibody-induced cell lysis and treating cancer

Weiner , et al. May 19, 2

Patent Grant 7534772

U.S. patent number 7,534,772 [Application Number 09/888,326] was granted by the patent office on 2009-05-19 for methods for enhancing antibody-induced cell lysis and treating cancer. This patent grant is currently assigned to Coley Pharmaceutical GmbH, University of Iowa Research Foundation. Invention is credited to Gunther Hartmann, George Weiner.

United States Patent 7,534,772
Weiner ,   et al. May 19, 2009
Methods for enhancing antibody-induced cell lysis and treating cancer

Abstract

The invention relates to methods and products for treating cancer. In particular the invention relates to combinations of nucleic acids and antibodies for the treatment and prevention of cancer. The invention also relates to diagnostic methods for screening cancer cells.

Inventors: Weiner; George (Iowa City, IA), Hartmann; Gunther (Alfter, DE)
Assignee: University of Iowa Research Foundation (Iowa City, IA)
Coley Pharmaceutical GmbH (Dusseldorf, DE)
Family ID: 22794755
Appl. No.: 09/888,326
Filed: June 22, 2001
Prior Publication Data
Document Identifier Publication Date
US 20030026801 A1 Feb 6, 2003
Related U.S. Patent Documents
Application Number Filing Date Patent Number Issue Date
60213346 Jun 22, 2000
Current U.S. Class: 514/44R; 424/130.1
Current CPC Class: C07K 16/2803 (20130101); A61P 35/04 (20180101); A61P 35/02 (20180101); A61P 43/00 (20180101); C07K 16/2878 (20130101); A61K 39/39541 (20130101); C07K 16/2896 (20130101); A61P 35/00 (20180101); A61K 39/39541 (20130101); A61K 2300/00 (20130101); A61K 2039/505 (20130101)
Current International Class: A61K 48/00 (20060101); A61K 39/395 (20060101)
Field of Search: ;514/44 ;536/24.5,24.3,23.1 ;424/130.1,1.11
References Cited [Referenced By]
U.S. Patent Documents
3854480 December 1974 Zaffaroni
3906092 September 1975 Hilleman et al.
4452775 June 1984 Kent
4469863 September 1984 Ts'o et al.
4675189 June 1987 Kent et al.
5023243 June 1991 Tullis
5075109 December 1991 Tice et al.
5133974 July 1992 Paradissis et al.
5208146 May 1993 Irie
5212295 May 1993 Cook
5248670 September 1993 Draper et al.
5359052 October 1994 Stee et al.
5407686 April 1995 Patel et al.
5506212 April 1996 Hoke et al.
5512668 April 1996 Stec et al.
5521302 May 1996 Cook
5565354 October 1996 Ostberg
5567610 October 1996 Borrebaeck et al.
5569825 October 1996 Lonberg et al.
5571893 November 1996 Baker et al.
5585479 December 1996 Hoke et al.
5599797 February 1997 Cook et al.
5663153 September 1997 Hutcherson et al.
5679647 October 1997 Carson et al.
5723335 March 1998 Hutcherson et al.
5736152 April 1998 Dunn
5780448 July 1998 Davis
5786189 July 1998 Locht et al.
5837856 November 1998 Arnold, Jr. et al.
5849719 December 1998 Carson et al.
5856465 January 1999 Stec et al.
5883237 March 1999 Stec et al.
5969135 October 1999 Ramasamy et al.
6015886 January 2000 Dale et al.
6194388 February 2001 Krieg et al.
6207646 March 2001 Krieg et al.
6214804 April 2001 Felgner et al.
6214806 April 2001 Krieg et al.
6218371 April 2001 Krieg et al.
6239116 May 2001 Krieg et al.
6306393 October 2001 Goldenberg
2002/0091097 July 2002 Bratzler et al.
2002/0164341 November 2002 Davis et al.
2003/0050263 March 2003 Krieg et al.
2003/0050268 March 2003 Krieg et al.
2003/0055014 March 2003 Bratzler
2003/0091599 May 2003 Davis et al.
2003/0100527 May 2003 Krieg et al.
2003/0104523 June 2003 Bauer et al.
2003/0139364 July 2003 Krieg et al.
2003/0148316 August 2003 Lipford et al.
2003/0148976 August 2003 Krieg et al.
2003/0166001 September 2003 Lipford
2003/0181406 September 2003 Schetter et al.
2003/0191079 October 2003 Krieg et al.
2003/0232074 December 2003 Lipford et al.
2003/0232856 December 2003 MacFarlane
2004/0009949 January 2004 Krieg
2004/0030118 February 2004 Wagner et al.
2004/0053880 March 2004 Krieg
2004/0067902 April 2004 Bratzler et al.
2004/0067905 April 2004 Krieg
2004/0087534 May 2004 Krieg et al.
2004/0087538 May 2004 Krieg et al.
2004/0092472 May 2004 Krieg
2004/0106568 June 2004 Krieg et al.
2004/0131628 July 2004 Bratzler et al.
2004/0132685 July 2004 Krieg et al.
2004/0142469 July 2004 Krieg et al.
2004/0143112 July 2004 Krieg et al.
2004/0147468 July 2004 Krieg et al.
2004/0152649 August 2004 Krieg
2004/0152656 August 2004 Krieg et al.
2004/0152657 August 2004 Krieg et al.
2004/0162258 August 2004 Krieg et al.
2004/0162262 August 2004 Krieg et al.
2004/0167089 August 2004 Krieg et al.
2004/0171150 September 2004 Krieg et al.
2004/0171571 September 2004 Krieg et al.
2004/0181045 September 2004 Krieg et al.
2004/0198680 October 2004 Krieg
2004/0198688 October 2004 Krieg et al.
2004/0229835 November 2004 Krieg et al.
2004/0234512 November 2004 Wagner et al.
2004/0235770 November 2004 Davis et al.
2004/0235774 November 2004 Bratzler et al.
2004/0235777 November 2004 Wagner et al.
2004/0235778 November 2004 Wagner et al.
2004/0266719 December 2004 McCluskie et al.
2005/0004061 January 2005 Krieg et al.
2005/0004062 January 2005 Krieg et al.
2005/0009774 January 2005 Krieg et al.
2005/0032734 February 2005 Krieg et al.
2005/0032736 February 2005 Krieg et al.
2005/0037403 February 2005 Krieg et al.
2005/0037985 February 2005 Krieg et al.
2005/0043529 February 2005 Davis et al.
2005/0049215 March 2005 Krieg et al.
2005/0049216 March 2005 Krieg et al.
2005/0054601 March 2005 Wagner et al.
2005/0054602 March 2005 Krieg et al.
2005/0059619 March 2005 Krieg et al.
2005/0059625 March 2005 Krieg et al.
2005/0070491 March 2005 Krieg et al.
2005/0075302 April 2005 Hutcherson et al.
2005/0100983 May 2005 Bauer et al.
2005/0101554 May 2005 Krieg et al.
2005/0101557 May 2005 Krieg et al.
2005/0119273 June 2005 Lipford et al.
2005/0123523 June 2005 Krieg et al.
2005/0130911 June 2005 Uhlmann et al.
2005/0148537 July 2005 Krieg et al.
2005/0169888 August 2005 Hartman et al.
2005/0171047 August 2005 Krieg et al.
2005/0181422 August 2005 Bauer et al.
2005/0182017 August 2005 Krieg
2005/0197314 September 2005 Krieg et al.
2005/0215501 September 2005 Lipford et al.
2005/0233995 October 2005 Krieg et al.
2005/0233999 October 2005 Krieg et al.
2005/0239732 October 2005 Krieg et al.
2005/0239733 October 2005 Jurk et al.
2005/0239734 October 2005 Uhlmann et al.
2005/0239736 October 2005 Krieg et al.
2005/0244379 November 2005 Krieg et al.
2005/0244380 November 2005 Krieg et al.
2005/0245477 November 2005 Krieg et al.
2005/0250726 November 2005 Krieg et al.
2005/0256073 November 2005 Lipford et al.
2005/0267064 December 2005 Krieg et al.
2005/0277604 December 2005 Krieg et al.
2005/0277609 December 2005 Krieg et al.
2006/0003955 January 2006 Krieg et al.
2006/0003962 January 2006 Ahluwalia et al.
2006/0019916 January 2006 Krieg et al.
2006/0019923 January 2006 Davis et al.
2006/0058251 March 2006 Krieg et al.
2006/0089326 April 2006 Krieg et al.
2006/0094683 May 2006 Krieg et al.
2006/0140875 June 2006 Krieg et al.
2006/0154890 July 2006 Bratzler et al.
2006/0172966 August 2006 Lipford et al.
2006/0188913 August 2006 Krieg et al.
2006/0211639 September 2006 Bratzler et al.
2006/0211644 September 2006 Krieg et al.
2006/0229271 October 2006 Krieg et al.
2006/0241076 October 2006 Uhlmann et al.
2006/0246035 November 2006 Ahluwalia et al.
2006/0286070 December 2006 Hartmann et al.
2006/0287263 December 2006 Davis et al.
2007/0009482 January 2007 Krieg et al.
2007/0010470 January 2007 Krieg et al.
2007/0037767 February 2007 Bratzler et al.
2007/0065467 March 2007 Krieg et al.
2007/0066553 March 2007 Krieg et al.
2007/0066554 March 2007 Krieg et al.
2007/0078104 April 2007 Krieg et al.
2007/0129320 June 2007 Davis et al.
2007/0142315 June 2007 Forsbach et al.
2007/0184465 August 2007 Wagner et al.
2007/0202128 August 2007 Krieg et al.
2007/0224210 September 2007 Krieg et al.
2007/0232622 October 2007 Lipford et al.
Foreign Patent Documents
0 092 574 Nov 1983 EP
0 239 490 Sep 1987 EP
0 301 758 Feb 1989 EP
0 468 520 Jan 1992 EP
WO91/12811 Sep 1991 WO
WO92/03456 Mar 1992 WO
WO92/04381 Mar 1992 WO
WO92/18522 Oct 1992 WO
WO92/21353 Dec 1992 WO
WO94/19945 Sep 1994 WO
WO95/05853 Mar 1995 WO
WO95/26204 Oct 1995 WO
WO96/02555 Feb 1996 WO
WO96/02560 Feb 1996 WO
WO96/35782 Nov 1996 WO
WO97/28259 Aug 1997 WO
WO98/14210 Apr 1998 WO
WO98/16247 Apr 1998 WO
WO98/18810 May 1998 WO
WO98/32462 Jul 1998 WO
WO98/37919 Sep 1998 WO
WO98/40100 Sep 1998 WO
WO 9840100 Sep 1998 WO
WO 98/42378 Oct 1998 WO
WO98/52581 Nov 1998 WO
WO98/55495 Dec 1998 WO
WO99/51259 Oct 1999 WO
WO99/56755 Nov 1999 WO
WO99/58118 Nov 1999 WO
WO99/61056 Dec 1999 WO
WO00/06588 Feb 2000 WO
WO00/14217 Mar 2000 WO
WO 00/27428 May 2000 WO
WO00/67023 Nov 2000 WO
WO 00/67795 Nov 2000 WO
WO 00/75348 Dec 2000 WO
WO 01/22972 Apr 2001 WO
WO 01/95935 Dec 2001 WO
WO 02/069369 Sep 2002 WO
WO 2004/007743 Jan 2004 WO
WO 2004/026888 Apr 2004 WO
WO 2004/094671 Nov 2004 WO
WO 2006/080946 Aug 2006 WO
WO 2007/031877 Mar 2007 WO
WO 2007/038720 Apr 2007 WO

Other References

Crystal R.G. Transfer of genes to humans: early lessons and obstacles to success (Science, 1995; 270:404-409). cited by examiner .
Walther W. et al. Viral vectors for gene transfer. (Drugs, 2000; 60:249-271). cited by examiner .
Greco O. et al. Cancer gene therapy: delivery, delivery, delivery (Front. Biosci., 2002; 7:d1516-d1524; 2002). cited by examiner .
Agrawal S. et al. Medicinal chemistry and therapeutic potential of CpG DNA (Trends in Mol. Med., 2002; 8:114-121). cited by examiner .
Hartmann G. et al. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. (Journ. Immunology, 2000; 164:1617-1624). cited by examiner .
Krieg A. The CpG motif: implications for clinical immunology. (BioDrugs, 1998; 5:341-346). cited by examiner .
Wooldridge J. et al. Immunostimulatory oligonucleotides containing CpG motifs enhance the efficacy of monoclonal antibody therapy of lymphocytes. (Blood, 1997; 89:2994-2998). cited by examiner .
Winkler et al. (Blood, 1999; vol. 94(7), pp. 2217-2224). cited by examiner .
Pawade et al. (Histopathology, 1995; vol. 27(2), pp. 129-137). cited by examiner .
Taji et al. (Japanese Juornal of Cancer Research, 1998; vol. 89(7), pp 748-759). cited by examiner .
Micouin, A. et al. (Leukemia, 1997; vol. 1, pp. 552-560). cited by examiner .
Azad RF et al., Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region. Antimicrob Agents Chemother. Sep. 1993;37(9):1945-54. cited by other .
Azuma I, Biochemical and immunological studies on cellular components of tubercle bacilli. Kekkaku 1992;67(9):45-55. cited by other .
Ballas ZK et al., Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol. Sep. 1, 1996;157(5):1840-5. cited by other .
Bayever E et al., Systemic administration of a Phosphorothioate oligonucleotide with a sequence complementary to p53 for acute myelogenous leukemia and myelodysplastic syndrome: initial results of a phase I trial. Antisense Res Dev. 1993 Winter;3(4);383-90. cited by other .
Beaucage SL et al., Deoxynucleoside phosphoramidites--a new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett 22:1859, 1981. cited by other .
Bennett RM et al., DNA binding to human leukocytes. Evidence for a receptor -mediated association, internalization, and degradation of DNA. J Clin Invest. Dec. 1985; 76(6):2182-90. cited by other .
Blaxter ML et al., Genes expressed in Brugia malayi infective third stage larvae. Mol Biochem Parasitol. Apr. 1996;77(1);77-93. cited by other .
Boggs RT et al., Characterization and modulation of immune stimulation by modified oligonucleotides. Antisense Nucleic Acid Drug Dev. Oct. 1997;7(5);461-71. cited by other .
Branda RF et al., Amplification of antibody production by phosphorothioate oligodeoxynucleotides. J Lab Clin Med. Sep. 1996;128(3):329-38. cited by other .
Branda RF et al., Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1. Biochem Pharmacol. May 25, 1993;45(10):2037-43. cited by other .
Chace JH et al., Regulation of differentiation in CD5+ and conventional B cells. Sensitivity to LPS-induced differentiation and interferon-gamma-mediated inhibition of differentiation. Clin Immunol Immunopathol. Sep. 1993;68(3):327-32. cited by other .
Chang YN et al., The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements. J Virol. Jan. 1990; 64(1):264-77. cited by other .
Chu RS et al., CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp Med. Nov. 17, 1997;186(10);1623-31. cited by other .
Coiffier B et al., Rituximab (anti-CD20 monoclonal antibody) for the treatment of patients with relapsing or refractory aggressive lymphoma: a multicenter phase II study. Blood. Sep. 15, 1998;92(6):1927-32. cited by other .
Cowdery JS et al., Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases to toxicity of lipopolysaccharides. J Immunol. Jun. 15, 1996;156(12):4570-5. cited by other .
Crystal RG, Transfer of genes to humans: early lessons and obstacles to success. Science. Oct. 20, 1995;270(5235):404-10. cited by other .
Davis HL et al., CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J Immunol. Jan. 15, 1998;160(2):870-6. cited by other .
Decker T et al., Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells. Blood. Feb. 1, 2000;95(3):999-1006. cited by other .
Englisch U et al., Chemically modified oligonucleotides as probes and inhibitors. Angew Chemie Int Ed Engl. Jun. 1991;30(6);613-29. cited by other .
Erb KJ et al., Infection of mice with Mycobacterium bovis-Bacillus Calmette-Guerin (BCG) suppresses allergen-induced airway eosinophilia. J Exp Med. Feb. 16, 1998;187(4):561-9. cited by other .
Etlinger HM, Carrier sequence selection--one key to successful vaccines. Immunol Today. Feb. 1992;13(2);52-5. cited by other .
Froehler BC et al., Synthesis of DNA via deoxynucleoside H-phosphonate intermediates. Nucleic Acids Res. Jul. 11, 1986;14(13);5399-407. cited by other .
Gaffney BL et al., Large-scale oligonucleotide synthesis by the H-phosphonate method. Tetrahedron Lett 29:2619-22 (1988). cited by other .
Garegg PJ et al., Nucleoside H-phosphonates. III. Chemical synthesis of oligodeoxyribonucleotides by the hydrogenphosphonate approach. Tetrahedron Lett 27:4051-4 (1986). cited by other .
Garegg PJ et al., Nucleoside H-phosphonates. IV. Automated solid phase synthesis of oligoribonucleotides by the hydrogenphosphonate approach. Tetrahedron Lett 27:4055-8 (1986). cited by other .
Goodchild J, Conjugates of oligonucleotides and modified oligonucleotides: a review of their synthesis and properties. Bioconjugate Chem 1:165-87 (1990). cited by other .
Gura T, Antisense has growing pains. Science. Oct. 27, 1995;270(5236):575-7. cited by other .
Hadden JW et al., Immunopharmacology. Immunomodulation and immunotherapy. JAMA. Nov. 25, 1992;268(20);2964-9. cited by other .
Hadden JW, Immunostimulants. Trends Pharmacol Sci. May 1993;14(5):169-74. cited by other .
Halpern MD et al., Bacterial DNA induces murine interferon-gamma production by stimulation of interleukin-12 and tumor necrosis factor-alpha. Cell Immunol. Jan. 10, 1996;167(1);72-8. cited by other .
Hartmann G et al., Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J Immunol. Jan. 15, 2000;164(2):944-53. cited by other .
Hartmann G et al., Spontaneous and cationic lipid-mediated uptake of antisense oligonucleotides in human monocytes and lymphocytes. J Pharmacol Exp Ther. May 1998; 285(2):920-8. cited by other .
Hatzfeld J et al., Release of early human hematopoietic progenitors from quiescence by antisense transforming growth factor beta 1 or Rb oligonucleotides. J Exp Med. Oct. 1,1991;174(4):925-9. cited by other .
Hazenbos WLW et al., Murine IgG1 complexes trigger immune effector functions predominantly via Fc gamma RIII (CD16). J Immunol. Sep. 15, 1998;161(6):3026-32. cited by other .
Highfield PE, Sepsis: the more, the murkier. Biotechnology (NY). Aug. 1994;12(8):828. cited by other .
Hoeffler JP et al., Identification of multiple nuclear factors that interact with cyclic adenosine 3'5'-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions. Mol Endocrinol. Feb. 1991;5(2):256-66. cited by other .
Iguchi-Ariga SM et al., CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation. Genes Dev. May 1989;3(5):612-9. cited by other .
Ishikawa R et al., IFN induction and associated changes in splenic leukocyte distribution. J Immunol. May 1, 1993;150(9):3713-27. cited by other .
Iversen PL et al., Pharmacokinetics of an antisense phosphorothioate oligodeoxynucleotide against rev from human immunodeficiency virus type 1 in adult male rat following single injections and continuous infusion. Antisense Res Dev. 1994 Spring;4(1);43-52. cited by other .
Jakobovits A et al., Analysis of homozygous mutant chimeric mice: deletion of the immunoglobulin heavy-chain joining region blocks B-cell development and antibody production. Proc Natl Acad Sci USA. Mar. 15, 1993;90(6):2551-5. cited by other .
Jakway JP et al., Growth regulation of the B lymphoma cell line WEHI-231 by anti-immunoglobulin, lipopolysaccharide, and other bacterial products. J Immunol. Oct. 1, 1986;137(7);2225-31. cited by other .
Jaroszewski JW et al., Cellular uptake of antisense oligodeoxynucleotides. Adv Drug Del Rev 1991; 6(3):235-50. cited by other .
Kataoka T et al., Antitumor activity of synthetic oligonucleotides with sequences from cDNA encoding proteins of Mycobacterium bovis BCG. Jpn J Cancer Res. Mar. 1992;83(3):244-7. cited by other .
Kataoka T et al., Immunotherapeutic potential in guinea-pig tumor model of deoxyribonucleic acid from Mycobacterium bovis BCG complexed with poly-L-lysine and carboxymethycellulose. Jpn J Med Sci Biol. Oct. 1990;43(5):171-82. cited by other .
Kimura Y et al., Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J Biochem (Tokyo). Nov. 1994;116(5):991-4. cited by other .
Klinman DM et al., Contribution of CpG motifs to the immunogenicity of DNA vaccines. J Immunol. Apr. 15, 1997;158(8):3635-9. cited by other .
Klinman DM et al., Immune recognition of foreign DNA: a cure for bioterrorism? Immunity. Aug. 1999;11(2):123-9. cited by other .
Krieg AM et al., A role for endogenous retroviral sequences in the regulation of lymphocyte activation. J Immunol. Oct. 15, 1989;143(8):2448-51. cited by other .
Krieg AM et al., CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. Apr. 6, 1995;374(6522):546-9. cited by other .
Krieg AM et al., Leukocyte stimulation by oligodeoxynucleotides. In: Applied Antisense Oligonucleotide Technology, Stein CA and Krieg AM, eds., New York: Wiley-Liss, 1998; pp. 431-438. cited by other .
Krieg AM et al., Mechanism of action of CpG DNA. Curr Top Microbiol Immunol. 2000;247:1-21. cited by other .
Krieg AM et al., Mechanisms and therapeutic applications of immune stimulatory CpG DNA. Pharmacol Ther. Nov. 1999;84(2):113-20. cited by other .
Krieg Am et al., Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy. Proc Natl Acad Sci U S A. Feb. 1, 1993; 90(3);1048-52. cited by other .
Krieg Am et al., Oligodeoxynucleotide modifications determine the magnitude of B cell stimulation by CpG motifs. Antisense Nucleic Acid Drug Dev. 1996 Summer;6(2):133-9. cited by other .
Krieg AM et al., Phosphorothioate oligodeoxynucleotides: antisense or anti-protein? Antisense Res Dev. 1995 Winter;5(4);241. cited by other .
Krieg AM et al., The role of CpG dinucleotides in DNA vaccines. Trends Microbiol. Jan. 1998;6(1):23-7. cited by other .
Krieg AM et al., Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible. Antisense Res Dev. 1991 Summer;1(2):161-71. cited by other .
Krieg AM, An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J Lab Clin Med. Aug. 1996;128(2):128-33. cited by other .
Krieg AM, CpG DNA: a pathogenic factor in systemic lupus erythematosus? J Clin Immunol. Nov. 1995;15(6):284-92. cited by other .
Krieger M et al., Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annu Rev Biochem. 1994;63:601-37. cited by other .
Kuramoto E et al., Oligonucleotide sequences required for natural killer cell activation. Jpn J Cancer Res. Nov. 1992;83(11):1128-31. cited by other .
Lagneaux L et al., Chronic lymphocytic leukemic B cells but not normal B cells are rescued from apoptosis by contact with normal bone marrow stromal cells. Blood. Apr. 1, 1998; 91(7);2387-96. cited by other .
Lipford GB et al., Bacterial DNA as immune cell activator. Trends Microbiol. Dec. 1998;6(12);496-500. cited by other .
Lipford GB et al., CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur J Immunol. Sep. 1997;27(9):2340-4. cited by other .
Lipford GB et al., Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur J Immunol. Dec. 1997;27(12);3420-6. cited by other .
Lyons AB et al., Determination of lymphocytic division by flow cytometry. J Immunol Methods. May 2 1994;171(1):131-7. cited by other .
Macaya RF et al., Thrombin-binding DNA aptamer forms a unimolecular quadruplex structure in solution. Proc Natl Acad Sci USA. Apr. 15, 1993;90(8):3745-9. cited by other .
Macfarlane DE et al., Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds. J Immunol. Feb. 1, 1988; 160(3):1122-31. cited by other .
Manzel L et al., CpG-oligodeoxynucleotide-resistant variant of WEHI 231 cells. J Leukoc Biol. Nov. 1999;66(5):817-21. cited by other .
Mastrangelo MJ et al., Gene therapy for human cancer: an essay for clinicians. Semin Oncol. Feb. 1996;23(1):4-21. cited by other .
Matson S et al., Nonspecific suppression of [3H]thymidine incorporation by "control" oligonucleotides. Antisense Res Dev. 1992 Winter;2(4);325-30. cited by other .
McIntyre KW et al., A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NF-kappa B p65 causes sequence-specific immune stimulation. Antisense Res Dev. 1993 Winter;3(4):309-22. cited by other .
Messina JP et al., Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J Immunol. Sep. 15, 1991;147(6):1759-64. cited by other .
Messina JP et al., The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens. Cell Immunol. Mar. 1993;147(1):148-57. cited by other .
Mojcik CF et al., Administration of a phosphorothioate oligonucleotide antisense to murine endogenous retroviral MCF env causes immune effects in vivo in a sequence-specific manner. Clin Immunol Immunopathol. May 1993;67(2):130-6. cited by other .
Moldoveanu Z et al., CpG DNA, a novel immune enhancer for systemic and mucosal immunization with influenza virus. Vaccine. Jul. 1998; 16(11-12):1216-24. cited by other .
Mottram JC et al., A novel CDC2-related protein kinase from Leishmania mexicana, LmmCRK1, is post-translationally regulated during the life cycle. J Biol Chem. Oct. 5, 1993;268(28):21044-52. cited by other .
NYCE JW et al., DNA antisense therapy for asthma in an animal model. Nature. Feb. 20, 1997;385(6618):721-5. cited by other .
Paca-Uccaralertkun S et al., In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax. Mol Cell Biol. Jan. 1994;14(1):456-62. cited by other .
Pisetsky DS et al., Stimulation of in vitro proliferation of murine lymphocytes by synthetic oligodeoxynucleotides. Mol Biol Rep. Oct. 1993;18(3);217-21. cited by other .
Pisetsky DS et al., Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus. Life Sci. 1994;54(2):101-7. cited by other .
Pisetsky DS et al., The influence of base sequence on the immunological properties of defined oligonucleotides. Immunopharmacology. Nov. 1998,40(3):199-208. cited by other .
Pisetsky DS, Immunologic consequences of nucleic acid therapy. Antisense Res Dev. 1995 Fall;5(3):219-25. cited by other .
Pisetsky DS, The immunologic properties of DNA. J Immunol. Jan. 15, 1996;156(2):421-3. cited by other .
Raz E et al., Preferential induction of a Th1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization. Proc Natl Acad Sci USA. May 14, 1996;93(10):5141-5. cited by other .
Roman M et al., Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat Med. Aug. 1997;3:849-54. cited by other .
Sato Y et al., Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science. Jul. 19, 1996;273(5273):352-4. cited by other .
Schnell N et al., Identification and characterization of a Saccharomyces cerevisiae gene (PAR1) conferring resistance to iron chelators. Eur J Biochem. Sep. 1, 1991;200(2):487-93. cited by other .
Shan D et al., Apoptosis of malignant human B cells by ligation of CD20 with monoclonal antibodies. Blood. Mar. 1, 1998;91(5):1644-52. cited by other .
Shirakawa T et al., The inverse association between tuberculin responses and atopic disorder. Science. Jan. 3, 1997;275(5296):77-9. cited by other .
Sparwasser T et al., Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol. Jun. 1998;28(6):2045-54. cited by other .
Sparwasser T et al., Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-alpha-mediated shock. Eur J Immunol. Jul 1997;27(7):1671-9. cited by other .
Stec WJ et al., Diastereomers of nucleoside 3'-O-(2-thio-1,3,2-oxa(selena)phospholanes): building blocks for stereocontrolled synthesis of oligo(nucleoside phosphorothioate)s. J Am Chem Soc. Dec. 13, 1995;117(49):12019-29. cited by other .
Stein CA et al., Oligodeoxynucleotides as inhibitors of gene expression: a review. Cancer Res. May 15, 1988, 48(10);2659-68. cited by other .
Stull RA et al., Antigene, ribozyme and aptamer nucleic acid drugs: progress and prospects. Pharm Res. Apr. 1995;12(4):465-83. cited by other .
Subramanian PS et al., Theoretical considerations on the "spine of hydration" in the minor groove of d(CGCGAATTCGCG).d(GCGCTTAAGCGC): Monte Carlo computer simulation. Proc Natl Acad Sci U S A. Mar. 1988;85(6):1836-40. cited by other .
Sun S et al., Mitogenicity of DNA from different organisms for murine B cells. J Immunol. Oct. 1, 1997;159(7):3119-25. cited by other .
Tanaka T et al., An antisense oligonucleotide complementary to a sequence in I gamma 2b increases gamma 2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion. J Exp Med. Feb. 1, 1992;175(2):597-607. cited by other .
Threadgill DS et al., Mitogenic synthetic polynucleotides suppress the antibody response to a bacterial polysaccharide. Vaccine. Jan. 1998;16(1):76-82. cited by other .
Tsukada J et al., Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 beta gene. Mol Cell Biol. Nov. 1994;14(11);7285-97. cited by other .
Tutt AL et al., Monoclonal antibody therapy of B cell lymphoma: signaling activity on tumor cells appears more important than recruitment of effectors. J Immunol. Sep. 15, 1998;161(6):3176-85. cited by other .
Uhlmann E et al., Antisense oligonucleotides: a new therapeutic principle. Chem Rev. Jun. 1990; 90(4):543-84. cited by other .
Wagner RW, Gene inhibition using antisense oligodeoxynucleotides. Nature. Nov. 24, 1994;372(6504):333-5. cited by other .
Wallace RB et al., Oligonucleotide probes for the screening of recombinant DNA libraries. Methods Enzymol. 1987;152:432-42. cited by other .
Weiner GJ et al., Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc Natl Acad Sci USA. Sep. 30, 1997;94(20):10833-7. cited by other .
Wooldridge JE et al., Immunostimulatory oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal antibody therapy of lymphoma. Blood. Apr. 15, 1997;89(8):2994-8. cited by other .
Wu GY et al., Receptor-mediated gene delivery and expression in vivo. J Biol Chem. Oct. 15, 1988;263(29):14621-4. cited by other .
Wu-Pong S, Oligonucleotides: opportunities for drug therapy and research. Pharm Technol. Oct. 1994;18:102-14. cited by other .
Wyatt JR et al., Combinatorially selected guanosine-quartet structure is a potent inhibitor of human immunodeficiency virus envelope-mediated cell fusion. Proc Natl Acad Sci USA. Feb. 15, 1994;91(4):1356-60. cited by other .
Yamamoto S et al., Mode of action of oligonucleotide fraction extracted from Mycobacterium bovis BCG. Kekkaku 1994;69(9):29-32. cited by other .
Yamamoto T et al., Lipofection of synthetic oligodeoxyribonucleotide having a palindromic sequence of AACGTT to murine splenocytes enhances interferon production and natural killer activity. Microbiol Immunol. 1994;38(10):831-6. cited by other .
Yamamoto T et al., Synthetic oligonucleotides with certain palindromes stimulate interferon production of human peripheral blood lymphocytes in vitro. Jpn J Cancer Res. Aug. 1994;85(8):775-9. cited by other .
Yi AK et al., IFN-gamma promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J Immunol. Jan. 15, 1996;156(2):558-64. cited by other .
Zhao Q et al., Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides. Antisense Res Dev. 1993 Spring;3(1):53-66. cited by other .
Zhao Q et al., Stage-specific oligonucleotide uptake in murine bone marrow B-cell precursors. Blood. Dec. 1, 1994;84(11):3660-6. cited by other .
Tokunaga T et al., Synthetic oligonucleotides with particular base sequences from the cDNA encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells. Microbiol Immunol. 1992;36(1):55-66. cited by other .
Tokunaga T et al., A synthetic single-stranded DNA, poly(dG,dC), induces interferon-alpha/beta and -gamma, augments natural killer activity, and suppresses tumor growth, Jpn J Cancer Res. Jun. 1988;79(6):682-6. cited by other .
Yamamoto T et al., Ability of oligonucleotides with certain palindromes to induce interferon production and augment natural killer cell activity is associated with their base length. Antisense Res Dev. 1994 Summer;4(2):119-22. cited by other .
Yamamoto S et al., DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol Immunol. 1992;36(9):983-97. cited by other .
Yamamoto S et al., In vitro augmentation of natural killer cell activity and production of interferon-alpha/beta and -gamma with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn J Cancer Res. Jul. 1988;79(7):866-73. cited by other .
Yamamoto S et al., Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN and augment IFN-mediated natural killer activity. J Immunol. Jun.15, 1992;148(12):4072-6. cited by other .
Jahrsdorfer B et al., CpG DNA increases primary malignant B cell expression of costimulatory molecules and target antigens. J Leukoc Biol. Jan. 2001;69(1):81-8. cited by other .
Krieg AM et al., Applications of immune stimulatory CpG DNA for antigen-specific immunotherapy. Eur J Cancer 1999; 35 Supp 5:S10. cited by other .
Warren TL et al., CpG oligodeoxynucleotides enhance monoclonal antibody therapy of a murine lymphoma. Clin Lymphoma. Jun. 2000;1(1):57-61. cited by other .
Boerner P et al., Production of antigen-specific human monoclonal antibodies from in vitro-primed human splenocytes. J Immunol. Jul. 1, 1991;147(1):86-95. cited by other .
Chaperot L et al., Functional expression of CD80 and CD86 allows immunogenicity of malignant B cells from non-Hodgkin's lymphomas. Exp Hematol. Mar. 1999;27(3):479-88. cited by other .
Davis TA et al., Single-agent monoclonal antibody efficacy in bulky non-Hodgkin's lymphoma: results of a phase II trial of rituximab. J Clin Oncol. Jun. 1999;17(6):1851-7. cited by other .
Davis TA et al., Therapy of B-cell lymphoma with anti-CD20 antibodies can result in the loss of CD20 antigen expression. Clin Cancer Res. Mar. 1999;5(3):611-5. cited by other .
Elsasser D et al., HLA class II as potential target antigen on malignant B cells for therapy with bispecific antibodies in combination with granulocyte colony-stimulating factor. Blood. May 1, 1996;87(9):3803-12. cited by other .
Foran JM et al., European phase II study of rituximab (chimeric anti-CD20 monoclonal antibody) for patients with newly diagnosed mantle-cell lymphoma and previously treated mantle-cell lymphoma, immunocytoma, and small B-cell lymphocytic lymphoma. J Clin Oncol. Jan. 2000;18(2):317-24. cited by other .
Funakoshi S et al., Inhibition of human B-cell lymphoma growth by CD40 stimulation. Blood. May 15, 1994;83(10):2787-94. cited by other .
Ginaldi L et al., Levels of expression of CD19 and CD20 in chronic B cell leukaemias. J Clin Pathol. May 1998;51(5):364-9. cited by other .
Gordon J et al., Regulation of survival in normal and neoplastic B lymphocytes. Leukemia. Aug. 1993;7 Suppl 2:S5-9. cited by other .
Gordon J et al., Signals for survival and apoptosis in normal and neoplastic B lymphocytes. Adv Exp Med Biol. 1996;406:139-44. cited by other .
Grillo-Lopez AJ et al, Overview of the clinical development of rituximab: first monoclonal antibody approved for the treatment of lymphoma. Semin Oncol. Oct. 1999;26(5 Suppl 14):66-73. cited by other .
Higaki Y et al., Mechanisms involved in the inhibition of growth of a human B lymphoma cell line, B104, by anti-MHC class II antibodies. Immunol Cell Biol. Jun. 1994;72(3):205-14. cited by other .
Jakobovits A et al., Germ-line transmission and expression of a human-derived yeast artificial chromosome. Nature. Mar. 18, 1993;362(6417):255-8. cited by other .
Kinoshita T et al., CD20-negative relapse in B-cell lymphoma after treatment with Rituximab. J Clin Oncol. Dec. 1998;16(12)3916. cited by other .
Kozbor D et al., A human hybrid myeloma for production of human monoclonal antibodies. J Immunol. Dec. 1984;133(6):3001-5. cited by other .
Langer R, New methods of drug delivery. Science. Sep. 28, 1990;249(4976):1527-33. cited by other .
Li X et al., Detection of apoptosis and DNA replication by differential labeling of DNA strand breaks with fluorochromes of different color. Exp Cell Res. Jan. 10, 1996;222(1):28-37. cited by other .
Link BK et al., Anti-CD3-based bispecific antibody designed for therapy of human B-cell malignancy can induce T-cell activation by antigen-dependent and antigen-independent mechanisms. Int J Cancer. Jul. 17, 1998;77(2):251-6. cited by other .
Link BK et al., Production and characterization of a bispecific IgG capable of inducing T-cell-mediated lysis of malignant B cells. Blood. Jun. 15, 1993;81(12):3343-9. cited by other .
Maloney DG, Preclinical and phase I and II trials of rituximab. Semin Oncol. Oct. 1999;26(5 Suppl 14):74-8. cited by other .
Martin-Orozco E et al., Enhancement of antigen-presenting cell surface molecules involved in cognate interactions by immunostimulatory DNA sequences. Int Immunol. Jul. 1999;11(7):1111-8. cited by other .
Mayumi M et al., Negative signaling in B cells by surface immunoglobulins. J Allergy Clin ImmunolDec. 1996;98(6 Pt 2):S238-47. cited by other .
McLaughlin P et al., Clinical status and optimal use of rituximab for B-cell lymphomas. Oncology (Huntingt). Dec. 1998;12(12):1763-9. cited by other .
McLaughlin P et al., Rituximab in indolent lymphoma: the single-agent pivotal trial. Semin Oncol. Oct. 1999;26(5 Suppl 14):79-87. cited by other .
Schultze JL et al., T cell mediated immunotherapy for B cell lymphoma. J Mol Med. Mar. 1999;77(3):322-31. cited by other .
Wagner H, Bacterial CpG DNA activates immune cells to signal infectious danger. Adv Immunol. 1999;73:329-68. cited by other .
Wagner RW et al., Potent and selective inhibition of gene expression by an antisense heptanucleotide. Nat Biotechnol. Jul. 1996;14(7):840-4. cited by other .
Wahl RL et al., Improved radioimaging and tumor localization with monoclonal F(ab')2.J Nucl Med. Apr. 1983;24(4):316-25. cited by other .
Wiseman GA et al., Radioimmunotherapy of relapsed non-Hodgkin's lymphoma with zevalin, a 90Y-labeled anti-CD20 monoclonal antibody. Clin Cancer Res. Oct. 1999;5(10 Suppl):3281s-3286s. cited by other .
Witzig TE et al., Phase I/II trial of IDEC-Y2B8 radioimmunotherapy for treatment of relapsed or refractory CD20(+) B-cell non-Hodgkin's lymphoma. J Clin Oncol. Dec. 1999;17(12):3793-803. cited by other .
Wooldridge JE et al., Select unmethylated CpG oligodeoxynucleotides improve antibody-dependent cellular cytotoxicity in vitro and in vivo. Abstract #3253. Proc Am Assn Cancer Res Mar. 1996;37:477. cited by other .
Wooldridge JE et al., Select unmethylated CpG oligodeoxynucleotides improve antibody dependent cellular cytotoxicity in vitro of both murine and human B cell lymphomas. Abstract #2877. Blood Dec. 1995;86:722A. cited by other .
Bauer M et al., DNA activates human immune cells through a CpG sequence-dependent manner. Immunology. Aug. 1999;97(4):699-705. cited by other .
Hartmann G et al., CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S A. Aug. 3, 1999;96(16):9305-10. cited by other .
Macfarlane DE et al., Immunostimulatory CpG-oligodeoxynucleotides induce a factor that inhibits macrophage adhesion. J Lab Clin Med . Nov. 1999;134(5):501-9. cited by other .
Sun S et al, Type I interferon-mediated stimulation of T cells by CpG DNA. J Exp Med. Dec. 21, 1998;188(12):2335-42. cited by other.

Primary Examiner: Angell; J. E
Attorney, Agent or Firm: Wolf, Greenfield & Sacks, P.C. Benson; Gregg C.
Parent Case Text


PRIORITY

This application claims the benefit of U.S. Provisional Application No. 60/213,346, filed Jun. 22, 2000.
Claims


We claim:

1. A method for treating a subject having a B-cell malignancy resistant to therapy with an antibody specific for a surface antigen selected from CD19, CD20, and CD22, wherein cells of the malignancy have low or no baseline expression of the surface antigen, the method comprising: administering to the subject the immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C, in an effective amount to upregulate expression of the surface antigen by the cells; and administering to the subject an antibody specific for the upregulated surface antigen, in an effective amount to treat the subject.

2. A method for treating a subject having a B-cell malignancy, wherein cells of the B-cell malignancy have low or no baseline expression of CD20, the method comprising: administering to the subject the immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C, in an effective amount to upregulate expression of CD20 by the cells; and administering to the subject an antibody specific for CD20, in an effective amount to treat the subject.

3. A method for treating a subject having a marginal zone lymphoma or B-cell chronic lymphocytic leukemia, wherein cells of the lymphoma or leukemia have low or no baseline expression of an antigen selected from CD19 and CD22, the method comprising: administering to the subject the immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C, in an effective amount to upregulate expression of the antigen by the cells of the lymphoma or leukemia; and administering to the subject an antibody specific for the upregulated antigen, in an effective amount to treat the subject.

4. A method for treating a subject having a B-cell malignancy, wherein cells of the malignancy upregulate expression of a surface antigen selected from CD19, CD20, and CD22, in response to immunostimulatory CpG oligonucleotide, the method comprising: isolating malignant B cells from the subject; identifying a surface antigen selected from CD19, CD20, and CD22, the expression of which can be upregulated in response to immunostimulatory CpG oligonucleotide, wherein the surface antigen is expressed by the malignant B cells in an amount lower than that of normal B cells; administering to the subject the immunostimulatory CpG oligonucleotide ODN 2006 (SEQ ID NO:729) comprising a backbone modification and an unmethylated C, in an effective amount to upregulate expression of the surface antigen by the cells; and administering to the subject an antibody specific for the upregulated surface antigen, in an amount effective to treat the subject.
Description


FIELD OF THE INVENTION

The invention relates to the treatment and prevention of cancer using immunostimulatory nucleic acids and antibodies.

BACKGROUND OF THE INVENTION

Cancer is the second leading cause of death, resulting in one out of every four deaths in the United States. In 1997, the estimated total number of new diagnoses for lung, breast, prostate, colorectal and ovarian cancer was approximately two million. Due to the ever increasing aging population in the United States, it is reasonable to expect that rates of cancer incidence will continue to grow.

Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.

Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy. The choice of treatment modality will depend upon the type, location and dissemination of the cancer. For example, surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma. One of the advantages of surgery and radiation therapy is the ability to control to some extent the impact of the therapy, and thus to limit the toxicity to normal tissues in the body. However, surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells. Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.

More recently, the use of CpG containing nucleic acids has been proposed for the treatment and prevention of cancer. We have found that unmethylated CG-dinucleotides within certain sequence contexts (CpG DNA) are recognized by the vertebrate immune system as foreign DNA (bacterial or viral). CpG DNA activates a coordinated set of immune responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity. Krieg A M et al., Pharmacol Ther 84:113-20 (1999); Krieg A M et al., Curr Top Microbiol Immunol 247:1-21 (2000); Wagner H, Adv Immunol 73:329-68 (1999). As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Th1 activity and demonstrates less toxicity. Chu R S et al., J Exp Med 186:1623-31 (1997); Weiner G J et al., Proc Natl Acad Sci USA 94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997); Lipford G B et al., Eur J Immunol 27:2340-4 (1997); Davis H L et al., J Immunol 160:870-6 (1998). Recently, we identified a human CpG motif which triggers proliferation and activation of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000).

SUMMARY OF THE INVENTION

The invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies. Thus in one aspect the invention is a method for treating or preventing cancer. The method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody. The cancer, in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression. The B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments the CD20 antibody is C2B8 or Rituximab.

The invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma. In some embodiments the subject has a type of lymphoma. In some embodiments the subject is suspected of having a type of lymphoma. The method may optionally include a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface antigens induced on the B cell in order to treat the cancer.

In another aspect the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD19 antibody.

According to another aspect of the invention, a method for treating lymphoma is provided. The method includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.

A method for treating a lymphoma resistant to antibody therapy is provided according to another aspect of the invention. The method includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.

The surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids. In some embodiments the surface antigen is CD20, CD40, CD22, or CD19. In other embodiments the lymphoma is B-CLL or marginal zone lymphoma. In some embodiments the antibody is an anti-CD20 antibody. In some embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-CD20 antibody is Rituximab.

In some preferred embodiments the antibody is a human IgG1 antibody. In some preferred embodiments the antibody is a murine IgG2a antibody.

In some embodiments the methods also include administering an anti-cancer therapy to the subject.

The invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgG1 isotype (an IgG1 isotype antibody as used herein refers to a human or humanized IgG1 unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.

Optionally the nucleic acid and the antibody are administered together. Alternatively the nucleic acid and the antibody may be administered separately.

In some embodiments the method includes the step of administering a cancer therapy. As used herein the term "a cancer therapy" is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.

A chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as Melphalan, Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP 16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.

In some preferred embodiments the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.

A cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys. Biological response modifiers include interferon, and lymphokines such as IL-2. Hormone replacement therapy includes tamoxifen alone or in combination with progesterone. In a further embodiment, the cancer therapy is interferon-.alpha. (e.g., INTRON.RTM. A, Schering).

The cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer. In preferred embodiments, the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.

In another aspect the invention encompasses a kit. The kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen. In one embodiment the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and an anti-CD22 antibody.

The nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an unmethylated CpG motif, immunostimulatory T-rich nucleic acids, immunostimulatory poly-G nucleic acids, bacterial DNA, yeast DNA, or eukaryotic DNA.

In some embodiments the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions. In other embodiments the nucleic acid does hybridize with genomic DNA or RNA under stringent conditions.

The nucleic acid may have natural linkages or may include at least one modified backbone internucleotide linkage. In some embodiments the modified backbone is a phosphate backbone modification. In other embodiments the modified backbone is a peptide modified oligonucleotide backbone. The nucleic acid may also include native bases or modified bases. The nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.

The immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.

The CpG nucleic acid in one embodiment contains at least one unmethylated CpG dinucleotide having a sequence including at least the following formula: 5' X.sub.1X.sub.2CGX.sub.3X.sub.4 3' wherein C is unmethylated, wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In one embodiment the 5' X.sub.1X.sub.2CGX.sub.3X.sub.4 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.

In some embodiments X.sub.1X.sub.2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X.sub.3X.sub.4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA. In other embodiments X.sub.1X.sub.2 are GpA or GpT and X.sub.3X.sub.4 are TpT. In yet other embodiments X.sub.1 or X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or both are pyrimidines. In one embodiment X.sub.2 is a T and X.sub.3 is a pyrimidine.

In other embodiments the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91, 92, 101, 108, 111, 135, 141, 151, 274, 277, 280, 286, 319, 350, 363, 368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557, 560-563, 566, 585, 590, 591, 595, 599, 603, 605, 611, 614-616, 650, 676, 679, 682, 684, 702, 703, 707-710, 717-720, 729-732, 752, 755, 770, and 801-803.

In some embodiments the T-rich immunostimulatory nucleic acid is a poly-T nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly-T nucleic acid comprises 5' X.sub.1X.sub.2TTTTX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In some embodiments X.sub.1X.sub.2 is TT and/or X.sub.3X.sub.4 is TT. In other embodiments X.sub.1X.sub.2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and/or X.sub.3X.sub.4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.

The T-rich immunostimulatory nucleic acid may have only a single poly-T motif or it may have a plurality of poly-T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.

In yet other embodiments at least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T nucleotide residues. In other embodiments the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T nucleotide residues or the plurality of poly-T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.

The T-rich immunostimulatory nucleic acid may include one or more CpG motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG dinucleotides.

In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues. Preferably the T-rich immunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25% A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C sequences, poly-G sequences or poly-A sequences.

In some cases the T-rich immunostimulatory nucleic acid may be free of poly-T motifs, but rather, comprises a nucleotide composition of greater than 25% T. In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 25% T. In some embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, or greater than 90% T nucleotide residues.

In some embodiments the poly-G nucleic acid comprises: 5' X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In embodiments at least one of X.sub.3 and X.sub.4 are a G or both of X.sub.3 and X.sub.4 are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGGNGGG 3' (SEQ ID NO:849) wherein N represents between 0 and 20 nucleotides.

The poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG dinucleotides or poly-T motifs.

Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone lymphoma cells upon CpG oligonucleotide stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ ID NO: 168, B and E) or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729, C and F) and analyzed by flow cytometry. A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis).

FIG. 2 depicts data from flow cytometry which demonstrates the change in expression of surface antigens on marginal zone lymphoma cells upon CpG oligodoexynucleotide (ODN) treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed using either CpG or non-CpG oligonucleotide. Thin curves indicate incubation with medium alone, dotted curves indicate incubation with control oligonucleotide, and bold curves indicate incubation with CpG oligonucleotide.

FIG. 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ ID NO: 168), or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment.

FIG. 4 is a set of graphs depicting the observation that the effect of CpG oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated with or without CpG oligonucleotide, and expression of CD20 and CD40 was measured by flow cytometry.

FIG. 5 depicts data from flow cytometry which demonstrates the effect of CpG oligonucleotide-induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right), were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry. CFSE fluorescence (x-axis) and expression of CD5 (B-CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated.

FIG. 6 is a graph depicting the survival of mice injected on Day 0 with tumor cells in response to CpG simulation in combination with murine IgG2a and murine IgG1 anti-tumor antibodies. Treatments are shown as filled squares, untreated controls; filled circles, murine IgG1; filled triangles, murine IgG1 plus CpG; filled diamonds, murine IgG2a; and open squares, murine IgG2a plus CpG.

DETAILED DESCRIPTION

Present cancer treatments are often ineffective as well as being associated with a high degree of patient morbidity. The invention provides methods and products for the more effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies.

The invention is based, in part, on the surprising discovery that administration to a subject of immunostimulatory nucleic acids induces the expression of cell surface antigens including CD20, CD19, and CD22 on the surface of a cancer cell and that the induction of these antigens leads to enhanced antibody-dependent cellular cytotoxicity (ADCC). It was previously believed that CpG oligonucleotides enhanced ADCC by influencing the effector cell (e.g., by activating natural killer (NK) cells). Now it has been discovered according to the invention that immunostimulatory nucleic acids actually cause the induction of specific antigens CD20, CD19, and CD22, each of which can be targeted by specific antibody therapies. The discovery that immunostimulatory nucleic acids are capable of upregulating expression of certain target antigens on the surface of cancer cells, supports the development of therapies using immunostimulatory nucleic acids in combination with specific antibodies which interact with these cell surface antigens. Thus, in one aspect, the invention provides a method for treating or preventing cancer which involves the administration to a subject of a combination of an immunostimulatory nucleic acid and an antibody which specifically interacts with CD20, CD19, and CD22 in an effective amount to prevent or treat the cancer.

Additionally, it was discovered that the increased expression of these and other cell surface antigens varies widely depending upon the histological state of the tumor cell studied. The effect of immunostimulatory nucleic acids on different types of primary malignant B cells and reactive follicular hyperplasia was extensively examined. All B-cell lymphoma cells tested increased in size and granularity, upregulated activation markers (CD80, CD86, CD40, CD54, CD69), and upregulated antigen presentation molecules (class I major histocompatibility complex (MHC I), class II major histocompatibilty complex (MHC II)) in response to immunostimulatory nucleic acids. A control poly-C oligodeoxynucleotide (ODN) showed only minor effects. The extent of phenotypic change induced by immunostimulatory nucleic acids differed from sample to sample. Immunostimulatory nucleic acids, but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia. Immunostimulatory nucleic acids also enhanced expression of both class I and class II MHC in most samples. CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma.

Furthermore, an inverse correlation was found between baseline expression of specific cell surface antigens and their expression after exposure to immunostimulatory nucleic acids. Thus the most significant increase in expression of these molecules was found in those samples that had the lowest (or no) baseline levels. These data indicate that immunostimulatory nucleic acids may reverse low expression of co-stimulatory molecules on malignant B cells that correspond to a low level of activation, while their effects on cells that are already in an activated state are less profound.

Thus, the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy. The method can be accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B cells. The antigens which are expressed in low levels or not at all on the malignant B cell can be identified. The subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigen(s) which are expressed in low levels or not at all on the malignant B cell.

The invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B cell lymphoma. Maloney D G, Semin Oncol 26:74-8 (1999); Foran J M et al., J Clin Oncol 18:317-24 (2000); Witzig T E et al., J Clin Oncol 17:3793-803 (1999); Davis T A et al., J Clin Oncol 17:1851-7 (1999); Wiseman G A et al., Clin Cancer Res 5:3281s-3286s (1999); Grillo-Lopez A J et al, Semin Oncol 26:66-73 (1999). There are reports that with lymphomas a small minority of tumors that re-emerge following Rituximab therapy can lack CD20 expression. Davis T A et al., Clin Cancer Res 5:611-5 (1999); Kinoshita T et al., J Clin Oncol 16:3916 (1998). The immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an explanation for why Rituximab is less effective for CLL than for some other B-cell malignancies. Grinaldi L et al., J Clin Pathol 51:364-9 (1998). The immunostimulatory nucleic acids of the invention are also useful for treating these tumors.

The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen. Link B K et al., Blood 81:3343-9 (1993). This antibody is currently being tested in a phase I clinical trial in patients with lymphoma. One limitation to the use of this antibody is that the target antigen is only expressed by approximately 50% of B-cell lymphomas. Interestingly, its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen. Thus in another aspect the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR. One useful antibody is the humanized monoclonal antibody 1D10. It is particularly useful for treating resistant tumors.

The invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgG1 isotype results in an increased (synergistic) survival rate. When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone. The IgG2 isotype (which correlates with the murine IgG1 isotype) is believed to be recognized by the Fc receptor designated CD16 that is expressed largely by NK cells. Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is surprising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or murine IgG1 antibodies. Since NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or murine IgG1) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.

A cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some instances, it is possible to distinguish cancer cells from their normal counterparts based on profiles of expressed genes and proteins, as well as to the level of their expression. Genes commonly affected in cancer cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET and WT. Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.

The term "tumor" is usually equated with neoplasm, which literally means "new growth" and is used interchangeably with "cancer." A "neoplastic disorder" is any disorder associated with cell proliferation, specifically with a neoplasm. A "neoplasm" is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance. There are two types of neoplasms, benign and malignant. Nearly all benign tumors are encapsulated and are noninvasive; in contrast, malignant tumors are almost never encapsulated but invade adjacent tissue by infiltrative destructive growth. This infiltrative growth can be followed by tumor cells implanting at sites discontinuous with the original tumor. The method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein.

"Cancer" as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hemopoietic cancers, such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.

A metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body. At the time of diagnosis of the primary tumor mass, the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MRI) scans, computed tomography (CT) scans, blood and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.

Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.

The immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject. A "subject" unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. Thus the invention can be used to treat cancer and tumors in human and non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Other treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy. The choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.

Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasias in dogs include genital squamous cell carcinoma, transmissable venereal tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma. The ferret, an ever-more popular house pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.

Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses); hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species); retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lymphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.

In one aspect, a method for treating cancer is provided which involves administering the compositions of the invention to a subject having cancer. A "subject having cancer" is a subject that has been diagnosed with a cancer. In some embodiments, the subject has a cancer type characterized by a solid mass tumor. The solid tumor mass, if present, may be a primary tumor mass. A primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue.

However, some primary tumors are not palpable and can be detected only through medical imaging techniques such as X-rays (e.g., mammography), or by needle aspirations. The use of these latter techniques is more common in early detection. Molecular and phenotypic analysis of cancer cells within a tissue will usually confirm if the cancer is endogenous to the tissue or if the lesion is due to metastasis from another site.

With respect to the prophylactic treatment methods, the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer. A subject at risk of developing a cancer is one who has a high probability of developing cancer. These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer. Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein. When a subject at risk of developing a cancer is treated with an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy, on a regular basis, such as monthly, the cancer growth will be prevented from initiating. This aspect of the invention is particularly advantageous when the subjects employed in certain trades which are exposed to cancer-causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.

A carcinogen is an agent capable of initiating development of malignant cancers. Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body.

Substances for which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens. Included in this category are the following substances: Aflatoxins, Alcoholic beverages, Aluminium production, 4-aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, 1-(2-Chloroethyl)-3-(4-methylcyclohexyl)-1 nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide, Cyclosporin, Erionite, Ethylene oxide, Furniture and cabinet making, Underground haematite mining with exposure to radon, Iron and steel founding, Isopropyl alcohol manufacture (strong acid process), Manufacture of magenta, Melphalan, 8-Methoxypsoralen (Methoxsalen) plus ultraviolet radiation, Mineral oils-untreated and mildly-treated oils, MOPP and other combined chemotherapy for cancer, Mustard gas (sulphur mustard), 2-Naphthylamine, Nickel and nickel compounds (essentially sulphate and sulphide), Nonsteroidal estrogens (not necessarily all in group) includes diethylstilbestrol, Estrogen replacement therapy, and Combined oral contraceptives and sequential oral contraceptives, Steroidal estrogens (not all in group), Painter (occupational exposure as a painter), Phenacetin (analgesic mixtures containing), Rubber industry, Salted fish (Chinese style), Solar radiation, Shale oils, Soots, Sulphuric acid (occupational exposures to strong-inorganic-acid mists of sulphuric acid), Talc containing asbestiform fibres, Thiotepa, Tobacco products (smokeless), Tobacco smoke, Treosulphan, and Vinyl chloride.

Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens. This category of substances includes: Acrylamide, Acrylonitrile, Adriamycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrenel,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1-(2-Chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho-toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethyl sulphate, Dimethylcarbamoyl chloride, Dimethyl sulphate, Epichlorohydrin, Ethylene dibromide, N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry (occupational exposure), Art glass (glass containers and pressed ware), Hairdresser or barber (occupational exposure, probably dyes), Insecticide use (occupational), IQ (2-Amino-3-methylimidazo[4,5-f]quinoline), Mate drinking (hot), 5-Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA), N-Methyl-N-nitro-N-nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea, Nitrogen mustard, N-Nitrosodiethylamine, N-Nitrosodimethylamine, Petroleum refining (occupational refining exposures), Phenacetin, Polychlorinated biphenyls, Procarbazine hydrochloride, Silica (crystalline), Styrene-7,8-oxide, Tris(1-azaridinyl)phosphine sulphide (Thiotepa), Tris(2,3-dibromopropyl) phosphate, Ultraviolet radiation: A, B and C including sunlamps and sunbeds, and Vinyl bromide.

Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens. This category of substances includes: A-C(2-Amino-9H-pyrido[2,3-b]indole), Acetaldehyde, Acetamide, AF-2[2-(2-Furyl)-3-(5-nitro-2-furyl)acrylamide, para-Aminoazobenzene, ortho-Aminoazobenzene, 2-Amino-5-(5-nitro-2-furyl)-1,3,4-thiadiazole, Amitrole, ortho-Anisidine, Antimony trioxide, Aramite, Atrazine, Attapulgite, Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene, Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of steam-refined and air-refined bitumens), Bleomycins, Bracken ferns, Bromodichloromethane, Butylated hydroxyanisole (BHA), a-Butyrolactone, Caffeic acid, Carbon black extract, Carbon tetrachloride, Carrageenan (degraded), Ceramic fibres, Chloramphenicol, Chlordane, Chlordecone, Chlorendic acid, Chlorinated paraffins of average carbon-chain length C12 and average degree of chlorination approx 60%, alpha-Chlorinated toluenes (not necessarily all in group), Benzotrichloride, para-Chloroaniline, Chloroform, Chlorophenols, Pentachlorophenol, 2,4,6-Trichlorophenol, Chlorophenoxy herbicides (not necessarily all in group), 4-Chloro-ortho-phenylenediamine, CI Acid Red 114, CI Basic Red 9, CI Direct Blue 15, Citrus Red No. 2, Cobalt and cobalt compounds, Coffee (bladder), para-Cresidine, Cycasin, Dacarbazine, Dantron (1,8-dihydroxyanthraquinone), Daunomycin, DDT, N,N'-Diacetylbenzidine, 4,4'-Diaminodiphenyl ether, 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine, 7H-Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, 1,2-Dibromo-3-chloropropane, para-Dichlorobenzene, 3,3'-Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl resorcinol ether, Dihydrosafrole, Diisopropyl sulfate, 3,3'-Dimethoxybenzidine, para-Dimethylaminoazobenzene, trans-2-[(Dimethylamino)methylimino]-5-[2-(5-nitro-2-furyl[vinyl]-1,3,4-o- xidiazole, 2,6-Dimethylaniline (2,6-Xylidene), 3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylformamide, 1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6-Dinitropyrene, 1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, 1Ethyl acrylate, Ethylene thiourea, Ethyl methanesulphonate, 2-(2-Formylhydrazino)-4-(5-nitro-2-furyl)thiazole, Fuel oils (residual, heavy), Fusarium moniliforme (toxins derived from), Fumonisin B1; Fumonisin B2; Fusarin C, Gasoline, Gasoline engine exhausts, Glasswool, Glu-P-1 (2-Amino-6-methyldipyrido[1,2-a:3'2'-d]imidazole), Glu-P-2(-Aminodipyrido[1,2-a:3'2'-d]imidazole),Glycidaldehyde, Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene, Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer (lindane), Hexamethylphosphoramide, Hydrazine, Indeno[1,2,3-cd]pyrene, Iron-dextran complex, Isoprene, Lasiocarpine, Lead and lead compounds (inorganic), Magenta (containing CI Basic Red 9), Man-made mineral fibres (see glasswool, rockwool, slagwool, and ceramic fibres), MeA-a-C (2-Amino-3-methyl-9H-pyrido[2,3-b]indole), MeIQ (2-Amino-3,4-dimethylimidazo[4,5-f]-quinolone), MeIQx (2-Amino-3,8-dimethylamidazo[4,5-f]quinoxaline), Methylmercury compounds (methylmercuric chloride), Melphalan, 2-Methylaziridine, Methylazoxymethanol and its acetate, 5-Methylchrysene, 4,4'-Methylenebis(2-methylaniline), 4,4'-Methylenedianiline, Methylmethanesulphonate, 2-methyl-1-nitroanthraquinone (uncertain purity), N-methyl-N-nitrosourethane, Methylthiouracil, Metronidazole, Mirex, Mitomycin, Monocrotaline 5-(Morpholinomethyl)-3-[(5-nitrofurfurylidene)amino]-2-oxazolidinone, Nafenopin, Niridazole, 5-Nitroacenaphthene, 6-Nitrochrysene, Nitrofen (technical grade), 2-Nitrofluorenel-[(5-Nitrofurfurylidene)amino]-2-imidazolidinone, N-[4-(5-Nitro-2-furyl)-2-thiazolyl]acetamide, Nitrogen mustard, N-oxide, Nitrolotriacetic acid and its salts, 2-Nitropropanel-Nitropyrene, 4-Nitropyrene, N-Nitrosodi-n-butylamine, N-Nitrosodiethanolamine, N-Nitrosodi-n-propylamine, 3-(N-Nitrosomethylamino)propionitrile, 4-(N-Nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK), N-Nitrosomethylethylamine, N-Nitrosomethylvinylamine, N-Nitrosomorpholine, N-Nitrosonomicotine, N-Nitrosopiperidene, N-Nitrosopyrrolidine, N-Nitrososarcosine, Ochratoxin A, Oil Orange, Panfuran S (containing dihydroxymethylfuratzine), Phenazopyridine hydrochloride, Phenobarbital, Phenoxybenzamine hydrochloride, Phenyl glycidyl ether, PhenytoinPhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, Pickled vegetables, traditional Asian, Polybrominated biphenyls, Ponceau MXPonceau 3R, Potassium bromate, 1,3-Propane sultone, Propylene oxide, Progestins, Medroxyprogesterone acetate, a-Propiolactone, Propylthiouracil, Rockwool, Saccharin, Safrole, Slagwool, Sodium ortho-phenylphenate, Sterigmatocystin, Streptozotocin, Styrene, Sulfallate, 2,3,7,8-Tetrachlorodibenzo-para-dioxin (TCDD), Tetrachloroethylene, Textile manufacturing (occupational exposures), Thiocetamide, 4,4'-Thiodianiline, Thiourea, Toluene, diisocyanatesortho-Toluidine, Toxaphene (polychlorinated camphenes), Trichlormethine (trimustine hydrochloride), Trp-P-1 (3-Amino-1,4-dimethyl-5-H-pyrido[4,3-b]indole), Trp-P-2 (3-Amino-1-methyl-5H-pyrido[4,3-b]indole), Trypan blue, Uracil mustard, Urethane, 4-Vinylcyclohexene, 4-Vinylcyclohexene diepoxide, Welding fumes, Wood industries and Carpentry and joinery.

Subjects at risk of developing cancer also include those who have a genetic predisposition to cancer. In many cases, genetic predisposition to cancer can be identified by studying the occurrence of cancer in family members. Examples of genetic predisposition to common forms of cancer include, but are not limited to, mutation of BRCA1 and BRCA2 in familial breast cancer, mutation of APC in familial colony cancer (familial polyposis coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation of Rb1 in retinoblastoma, mutation of RET in multiple endocrine neoplasia type 2 (MEN2), mutation of VHL in renal cancer and mutation of WT1 in Wilms' tumor. Other cancers for which a familial predisposition has been identified include ovarian, prostate, melanoma and lung cancer.

It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament. However, many forms of cancer, including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments. In fact, only about 5-10 percent of cancers can be cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment of still other cancers, including breast cancer, requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament.

The immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens. These antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from commercial sources or may be synthesized de novo.

Commercially available anti-CD20 antibodies include but are not limited to those presented in Table 1 below.

TABLE-US-00001 Commercially Available Anti-CD20 Antibodies. Product/Supplier Catalog # Monoclonal Antibody to CD20, Human, ANC-169-020 Purified, 100 .mu.g Alexis Corp. CD20, B-Cell Bab Mouse: anti-Human V6021 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human V1018 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell MAb Mouse: anti-Human K026 Clone: L26 Isotype: IgG2a, Kappa; Dehydrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human 058D Clone: L26 Isotype: IgG2a, Kappa; Prediluted Biomeda Corporation Mouse anti-Human CD20 AHS2022 BioSource International Mouse anti-Human CD20 AHS2001 BioSource International Mouse anti-Human CD20 AHS2028 BioSource International Mouse anti-Human CD20 AHS2002 BioSource International Mouse anti-Human CD20 AHS2021 BioSource International Mouse Anti-CD20, B-Cell, Human IgG2a MOB004 Antibody, Kappa, Supernatant, Clone L26, 1 mL BIOTREND Chemikalien GmbH AnTesti-CD20, Human, Mouse, 100 .mu.g 217670 Calbiochem Mouse Monoclonal Anti-(Human CD20) MHCD2000 IgG3 Antibody, Clone H147, 0.5 mL Caltag Laboratories Mouse Monoclonal Anti-(Human CD20) MHCD2000-4 IgG3 Antibody, Clone B-ly 1, 1 mL Caltag Laboratories Mouse Monoclonal Anti-(Human CD20), MON1111 Mature B-cell) IgG1 Antibody, Clone MEM-97, 1 mL Caltag Laboratories CD20, B-cell, Mouse Anti-Human, Clone: N150230 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, 12 mL DAKO Corp. CD20, B-cell, Mouse Anti-Human, Clone: N150289 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, EnVision & EnVision Doublestain, Monoclonal Antibody, Packaged for DAKO Autostainer, 33 mL\ DAKO Corp. CD20, L26 B-cell Marker, Mouse Anti-Human, M075501 Human, Monoclonal Antibody, 1 mL DAKO Corp. CD20, L26 B-cell Marker, Mouse Anti-Human M077401 Monoclonal Antibody, 1 mL DAKO Corp. MxH B cell, CD20 RTU, 12 mL L185030 DAKO Corp. Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, concentrated, 1 mL Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, concentrated, 1 mL Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL Diagnostic Biosystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 C06603858 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6604106 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6603446 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6602381 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM1925 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6602140 Fisher Scientific Co. CD20, Pan B-cell marker, Mouse Anti- M077401 Human, Monoclonal Antibody, 1 mL DAKO Corp. MxH B Cell, CD20 RTU, 12 mL L185030 DAKO Corp. Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, Concentrated, 1 mL Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG1 Mob 241 Antibody, Clone 7D1, Concentrated, 1 mL Diagnostic BioSystems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-01 Antibody, Clone L26, Concentrated, 1 mL Diagnostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL Diagnostic BioSystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6603858 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6604106 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6603446 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6602381 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 COIM 1925 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6602140 Fisher Scientific Co. Coulter* Antibodies to Human CDs::CD20 CO6602471 Fisher Scientific Co. CD20 (B Cell) AM-1165-11 InnoGenex Coulter* Antibodies to Human CDs::CD20 CO6602471 Fisher Scientific Co. CD20 (B Cell) AM-1165-11 InnoGenex CD20 (B Cell), Unpurified AM-1165-11 (0.1 mg/0.1 mL), Clone: B1, Isotype: InnoGenex Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-SO Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 0.1 mL Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S1 Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 0.5 mL Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 1.0 mL Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-R7 Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: L26, Workshop, 7.0 mL Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P1 Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9, Workshop V; 100 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9, Workshop V; 200 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 (Ab-1 (B- MS-431-PO Cell Marker) IgG.sub.2a/.kappa. Antibody, Clone: B9E9, Workshop V; 20 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-758-P1 Cell Marker) IgG.sub.1/.kappa. Antibody, Clone: 93-1B3, Workshop V; Code: CD20.4, 200 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P Cell Marker) IgG.sub.1/.kappa. Antibody, Clone: 93-1B3, Workshop V; Code: CD20.4, 200 .mu.g Lab Vision Corp. Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-PO Cell Marker) IgG.sub.1/ Antibody, Clone: 93-1B3, Workshop V; Code: CD20.4 Lab Vision Corp. Human CD20, B Cell, 6 mL MAB-0020 Maxim Biotech Inc. Mouse Monoclonal Anti-B Cell, CD20 A9004C IgG.sub.2a, .kappa. Antibody, Concentrate, 1 mL Scytek Mouse Monoclonal Anti-B Cell, CD20 A20003 IgG.sub.2a, .kappa. Antibody, Ready-to-Use, 1 mL Scytek Mouse Monoclonal Anti-CD20, B Cell A9001C IgG.sub.2a, .kappa. Antibody, Concentrate, 1 mL (Clone: L26) Scytek Mouse Monoclonal Anti-CD20, B Cell A00003 IgG.sub.2a, .kappa. Antibody, Ready-to-Use, 6 mL Scytek Mouse Monoclonal Anti-(Human CD20 MCA 1807 IgG1 Antibody, Clone 7D1, 1 mL Serotec, Inc. Mouse Monoclonal Anti-(Human CD20 MCA 1822 IgG1 Antibody, Clone AT80, 0.2 mg Serotec, Inc. Mouse Monoclonal Anti-(Human CD20 MCA 1710 IgG2b Antibody, Clone 2H7, 0.2 mg Serotec, Inc. Antibody Panels, Hematopoietic 324-01 Markers, Lymphocyre Related Antigens, CD20, B Cell, Clone L26, Concentrated, 1 mL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc. Antibody Panels, Hematopoietic 324-13 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 1, 3 mL, Ab 324 Signet Pathology Systems, Inc. Antibody Panels, Hematopoietic 324-16 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, level 1, 6 mL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc. Antibody Panels, Hematopoietic 324-26 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 2, 6 mL, Ab Source Mouse, Ab# 324 Signet Pathology Systems, Inc. Monoclonal Mouse anti-CD20, B9E9, Epitope- 07-2003 Affinity Purified-Unconjugated, IgG.sub.2a-.kappa., 200 .mu.g Zymed Laboratories, Inc.

Antibodies are well known to those of ordinary skill in the science of immunology. As used herein, the term "antibody" means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term "antibody" means not only intact immunoglobulin molecules but also the well-known active fragments F(ab').sub.2, and Fab. F(ab').sub.2, and Fab fragments which lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl R L et al., J Nucl Med 24:316-25 (1983). Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR binding, e.g., include an Fe portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fc containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with immunotoxins and/or radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).

Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity-determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity-determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.

It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as "chimeric" antibodies. A "humanized monoclonal antibody" as used herein is a human monoclonal antibody or functionally active fragment thereof having human constant regions and a binding CDR3 region from a mammal of a species other than a human. Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. There are entities in the United States which will synthesize humanized antibodies from specific murine antibody regions commercially, such as Protein Design Labs (Mountain View Calif.).

European Patent Application 0239400, the entire contents of which is hereby incorporated by reference, provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a murine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR. A first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a murine antibody is prepared. Optionally a second replicable expression vector is prepared which includes a suitable promoter operably linked to a DNA sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively. A cell line is then transformed with the vectors. Preferably the cell line is an immortalized mammalian cell line of lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma cell line, or is a normal lymphoid cell which has been immortalized by transformation with a virus. The transformed cell line is then cultured under conditions known to those of skill in the art to produce the humanized antibody.

As set forth in European Patent Application 0239400 several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector. (Preferred vectors and recombinant techniques are discussed in greater detail below.) For example, the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis. Alternatively a synthetic gene lacking the CDR regions in which four framework regions are fused together with suitable restriction sites at the junctions, such that double-stranded synthetic or restricted subcloned CDR cassettes with sticky ends could be ligated at the junctions of the framework regions. Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site-directed mutagenesis. Each of these methods is well known in the art. Therefore, those skilled in the art may construct humanized antibodies containing a murine CDR region without destroying the specificity of the antibody for its epitope.

Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Pat. No. 5,567,610, issued to Borrebaeck et al., U.S. Pat. No. 5,565,354, issued to Ostberg, U.S. Pat. No. 5,571,893, issued to Baker et al, Kozbor D et al., J Immunol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc, New York, 1987), and Boerner P et al., J Immunol 147:86-95 (1991). In addition to the conventional methods for preparing human monoclonal antibodies, such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nature 362:255-8 (1993); Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Pat. No. 5,569,825 issued to Lonberg).

Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab').sub.2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.

Other antibodies useful according to the invention are antibodies of the IgG1 isotype. As mentioned above, anti-IgG1 isotype antibody as used herein refers to a human or humanized anti-IgG1 unless otherwise specified. IgG1 isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.

TABLE-US-00002 TABLE 2 Cancer Immunotherapies In Development Or On The Market. Marketer Brand Name (Generic Name) Indication IDEC/Genentech, Rituxan .TM. (rituximab, Mabthera) (IDEC- non-Hodgkin's lymphoma Inc./Hoffmann-LaRoche (first C2B8, chimene murine/human anti-CD20 monoclonal antibody licensed for MAb) the treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet (CYT-424) radiotherapeutic Bone metastases agent Centocor/Glaxo/Ajinomoto Panorex .RTM. (17-1A) (murine monoclonal Adjuvant therapy for antibody) colorectal (Dukes-C) Centocor/Ajinomoto Panorex .RTM. (17-1A) (chimeric murine Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8 (murine, anti-CD20 MAb non-Hodgkin's lymphoma labeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD.sub.3 Small cell lung epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal antibody to Renal cell epidermal growth factor receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1 monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to 131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute myleoid leukemia Techniclone .sup.131I LYM-1 (Oncolym .TM.) non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head & neck, non-small antibody) + cisplatin or radiation cell lung cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA125, Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar (anti-CD20 Mab labeled with .sup.131I) non-Hodgkin's lymphoma have been positive, but the drug has been associated with significant bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. Kaposi's sarcoma IDEC Pharmaceuticals Rituxan .TM. (MAb against CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo, with chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte antigen Chronic lymphocytic CAMPATH leukemia (CLL) Center of Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast, ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate, non-small cell antibody) lung, pancreatic, breast Medarex MDX-11 (complement activating receptor Acute myelogenous (CAR) monoclonal antibody) leukemia (AML) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and colon antibody) Medarex MDX-11 (complement activating receptor Ex vivo bone marrow (CAR) monoclonal antibody) purging in acute myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific antibody, Acute myleoid leukemia MAb-conjugates) (complement cascade activators) Cytogen OV103 (Yttrium-90 labelled antibody) Ovarian Cytogen OV103 (Yttrium-90 labelled antibody) Prostate Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. non-Hodgkin's lymphoma Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A) non-small cell lung, pancarcinoma antigen on adenocarcinomas prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits Lung, breast, prostate, angiogenesis) colorectal Protein Design Labs Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab, humanized) Protein Design Labs SMART M195 Ab, humanized Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Breast antibody) + taxol ImClone Systems (licensed C225 (chimeric anti-EGFr monoclonal prostate from RPR) antibody) + doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal prostate antibody) + adriamycin ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD.sub.3 Melanoma epitope) Medarex MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex MDX-220 (bispecific for tumors that express Lung, colon, prostate, TAG-72) ovarian, endometrial, pancreatic and gastric Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor EGF receptor cancers bispecific antibody) (head & neck, prostate, lung, bladder, cervical, ovarian) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G- antibody) CSF for various cancers, esp. breast IDEC MELIMMUNE-2 (murine monoclonal Melanoma antibody therapeutic vaccine) IDEC MELIMMUNE-1 (murine monoclonal Melanoma antibody therapeutic vaccine) Immunomedics, Inc. CEACIDE .RTM. (I-131) Colorectal and other NeoRx Pretarget .RTM. radioactive antibodies non-Hodgkin's B cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma specific Ab) Cancer Techniclone Corporation/ TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Techniclone TNT (chimeric MAb to histone antigens) Brain International/Cambridge Antibody Technology Novopharm Gliomab-H (Monoclonals - Humanized Abs) Brain, melanomas, neuroblastomas Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000 (chimeric-EGF antagonist) Cancer Immunomedics LymphoCide (humanized LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676 (monoclonal antibody conjugate) Acute myelogenous leukemia Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, small-cell lung Center of Molecular Immunology ior egf/r3 (anti EGF-R humanzied Ab) Radioimmunotherapy Center of Molecular Immunology ior c5 (murine MAb colorectal) for Colorectal radioimmunotherapy Creative BioMolecules/ BABS (biosynthetic antibody binding site) Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2 (monoclonal antibody to fetal liver Tumor-associated kinase-2 (FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/small-drug conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab Cancer Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon Immunomedics, Inc. ImmuRAIT-CEA Colorectal

In some embodiments the nucleic acid and antibody are administered in combination with a cancer therapy. As used herein, a "cancer therapy" refers to an agent which prevents growth of a cancer cell by decreasing or slowing the rate of growth, by inhibiting growth altogether, or by killing or inducing apoptosis of the cancer cell. Thus, as used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer therapy is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the purpose of this specification, cancer therapies are classified as chemotherapeutic agents, cancer vaccines, hormone therapy, biological response modifiers, surgical procedures, and radiotherapy aimed at treating cancer. Additionally, the methods of the invention are intended to embrace the use of more than one cancer therapy along with the immunostimulatory nucleic acids and antibody. As an example, where appropriate, the immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and a radiotherapy.

Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer therapies can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells.

Other cancer therapies target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-.alpha., TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.

As used herein, chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.

TABLE-US-00003 TABLE 3 Cancer Drugs In Development Or On The Market. Marketer Brand Name Generic Name Indication Abbott TNP 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TNP 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA Meglamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer Carmustaine + Brain Tumor Polifepr Osan Warner Lambert Undisclosed Cancer (b) Undisclosed Cancer (b) Cancer Bristol-Myers RAS Famesyl Transferase RAS FamesylTransferase Cancer Squibb Inhibitor Inhibitor Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY 12-9566 Cancer Merck Famesyl Transferase Inhibitor Famesyl Transferase Cancer (Solid tumors - Inhibitor pancreas, colon, lung, breast) Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE Tyrosine Kinase Cancer, angiogenesis Lilly MTA/LY 231514 MTA/LY 231514 Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast, linolenate) colon Warner Lambert CI-994 CI-994 Cancer, Solid Tumors/ Leukemia Schering AG Angiogenesis inhibitor Angiogenesis Inhibitor Cancer/Cardio Takeda TNP-470 n/k Malignant Tumor Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer Beecham Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 Myeloid Leukemia/Ovarian Cancer Immunex Novantrone Mitoxantrone Pain related to hormone refractory prostate cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF Anti-VEGF Prostate/Breast/Colorectal/ NSCL Cancer British Biotech Batimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682 CS-682 Solid Tumors Agouron AG2037 AG2037 Solid Tumors IDEC Pharma 9-AC 9-AC Solid Tumors Agouron VEGF/b-FGF Inhibitors VEGF/b-FGF Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors/Macular Degeneration Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853 VX-853 Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors Tanube Seiyaku TA 2516 Marimistat Solid Tumors British Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors/Breast Cancer Chiroscience D2163 D2163 Solid Tumors/Metastases Warner Lambert PD 183805 PD 183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa FK 317 FK 317 Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD 32/valrubicin Valrubicin Bladder Cancer-Refractory Amersham In situ Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer (adjunct Amersham therapy, Pain) Schering Plough Temodal Temozolomide Brain Tumors Schering Plough Temodal Temozolonide Brain Tumors Liposome Evacet Doxorubicin, Liposomal Breast Cancer Nycomed Yewtaxan Paclitaxel Breast Cancer Advanced, Amersham Ovarian Cancer Advanced Bristol-Myers Taxol Paclitaxel Breast Cancer Advanced, Squibb Ovarian Cancer Advanced, NSCLC Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Novantrone Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol-Myers BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squibb Bristol-Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Cancer Oral Squibb Johnson & Ergamisol Levamisole Cancer Therapy Johnson Glaxo Wellcome Eniluracil/776C85 5FU Enhancer Cancer, Refractory Solid & Colorectal Cancer Johnson & Ergamisol Levamisole Colon Cancer Johnson Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer, Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy Cell Leukaemia Johnson Ivax Paxene Paclitaxel Kaposi Sarcoma Sequus Doxil Doxorubicin, Liposomal KS/Cancer Sequus Caelyx Doxorubicin, Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia Pharmacia & Pharmorubicin Epirubicin Lung/Breast Cancer Upjohn Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553 Bis-Naphtalimide Oncology BASF LU 103793 Dolastain Oncology Schering Plough Caetyx Doxorubicin-Liposome Ovarian/Breast Cancer Lilly Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL, ovarian etc. Yamanouchi YM 116 YM 116 Prostate Cancer Nycomed Seeds/I-125 Rapid St Iodine Seeds Prostate Cancer Amersham Agouron Cdk4/cdk2 inhibitors cdk4/cdk2 inhibitors Solid Tumors Agouron PARP inhibitors PARP Inhibitors Solid Tumors Chiroscience D4809 Dexifosamide Solid Tumors Bristol-Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Solid Tumors Squibb Sankyo Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide Solid Tumors Bristol-Myers Ifex/Mesnex Ifosamide Solid Tumors Squibb Bristol-Myers Vumon Teniposide Solid Tumors Squibb Bristol-Myers Paraplatin Carboplatin Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin, Stealth Solid Tumors Squibb Bristol-Myers Plantinol Cisplatin Solid Tumors Squibb Bristol-Myers Vepeside Etoposide Solid Tumors Melanoma Squibb Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast Cancer Glaxo Wellcome Prodrug of guanine arabinside prodrug of arabinside T Cell Leukemia/Lymphoma & B Cell Neoplasm Bristol-Myers Taxane Analog Taxane Analog Taxol follow up Squibb

Another useful anti-cancer therapy is Interferon-.alpha. (e.g., INTRON.RTM. A, Schering).

The compounds useful according to the invention are nucleic acids. The nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity. The terms "nucleic acid" and "oligonucleotide" refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base. As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. The terms "nucleic acid" and "oligonucleotide" also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments the nucleic acids are homogeneous in backbone composition.

Nucleic acids also can include base analogs such as C-5 propyne modified bases. Wagner R W et al., Nature Biotechnol 14:840-4 (1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.

The nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or "linkage" means two entities are bound to one another by any physicochemical means. Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature connecting the individual units of a nucleic acid, are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.

Whenever a nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5'.fwdarw.3' order from left to right and that "A" denotes adenosine, "C" denotes cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U" denotes uracil unless otherwise noted.

Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids. The nucleic acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids. The term "isolated" as used herein refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated. The nucleic acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a subject the plasmid can be degraded into oligonucleotides. One skilled in the art can purify viral, bacterial, eukaryotic, etc., nucleic acids using standard techniques, such as those employing restriction enzymes, exonucleases or endonucleases.

For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage S L et al., Tetrahedron Lett 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986; Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffney et al., Tetrahedron Lett 29:2619-22, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.

In some embodiments, the nucleic acids useful according to the invention are immunostimulatory nucleic acids. An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response. A nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation. Immunostimulatory nucleic acids include, but are not limited to, CpG nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.

A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system. The entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.

In one embodiment the invention provides a CpG nucleic acid represented by at least the formula: 5' N.sub.1X.sub.1CGX.sub.2N.sub.2 3' wherein X.sub.1 and X.sub.2 are nucleotides and N is any nucleotide and N.sub.1 and N.sub.2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments X.sub.1 is adenine, guanine, or thymine and X.sub.2 is cytosine, adenine, or thymine. In other embodiments X.sub.1 is cytosine and/or X.sub.2 is guanine.

In other embodiments the CpG nucleic acid is represented by at least the formula: 5' N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2 3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In some embodiments, X.sub.1X.sub.2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X.sub.3X.sub.4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N.sub.1 and N.sub.2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments, X.sub.1X.sub.2 are GpA or GpT and X.sub.3X.sub.4 are TpT. In other embodiments X.sub.1 or X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or both are pyrimidines.

In some embodiments N.sub.1 and N.sub.2 of the nucleic acid do not contain a CCGG or CGCG quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful. In another embodiment the CpG nucleic acid has the sequence 5' TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub.4 3' (SEQ ID NO:850).

A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid" is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic acid includes more than one poly-T sequence. In preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729). One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5' TTTTTTTTTTTTTTTTTTTTTTTT 3', SEQ ID NO: 841). Other T-rich nucleic acids have a nucleotide composition of greater than 25% T nucleotide residues, but do not necessarily include a poly-T sequence. In these T-rich nucleic acids the T nucleotide resides may be separated from one another by other types of nucleotide residues, i.e., G, C, and A. In some embodiments the T-rich nucleic acids have a nucleotide composition of greater than 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T nucleotide residues.

In one embodiment the T-rich nucleic acid is represented by at least the formula: 5' X.sub.1X.sub.2TTTTX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In one embodiment X.sub.1X.sub.2 is TT and/or X.sub.3X.sub.4 is TT. In another embodiment X.sub.1X.sub.2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X.sub.3X.sub.4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.

In some embodiments it is preferred that the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs. Thus in some embodiments of the invention the T-rich nucleic acids include CpG dinucleotides and in other embodiments the T-rich nucleic acids are free of CpG dinucleotides. The CpG dinucleotides may be methylated or unmethylated.

Poly-G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky D S et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Annu Rev Biochem 63:601-37 (1994); Macaya R F et al., Proc Natl Acad Sci USA 90:3745-9 (1993); Wyatt J R et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In: Applied Antisense Oligonucleotide Technology, eds. Krieg A M and Stein C, pp. 335-352; and Kimura Y et al., J Biochem (Tokyo) 116:991-4 (1994) also describe the immunostimulatory properties of poly-G nucleic acids.

Poly G nucleic acids preferably are nucleic acids having the following formulas: 5' X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In preferred embodiments at least one of X.sub.3 and X.sub.4 are a G. In other embodiments both of X.sub.3 and X.sub.4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' (SEQ ID NO:849) wherein N represents between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dinucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430, 432, 435, 438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673, 807, 808, 821, 823, and 834. In other embodiments the poly-G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 6, 7, 22, 26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.

Nucleic acids having modified backbones, such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids. U.S. Pat. Nos. 5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication WO95/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.

The immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size. Immunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.

"Palindromic sequence" shall mean an inverted repeat (i.e., a sequence such as ABCDEE'D'C'BA' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures. In one embodiment the nucleic acid contains a palindromic sequence. In some embodiments when the nucleic acid is a CpG nucleic acid, a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome. In another embodiment the nucleic acid is free of a palindrome. A nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic. A nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic.

A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease). Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3' end of an oligonucleotide has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized and therefore exhibits more activity.

Some stabilized oligonucleotides of the instant invention have a modified backbone. It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in PCT Published Patent Application WO98/18810 claiming priority to U.S. Ser. No. 08/738,652 (now issued as U.S. Pat. No. 6,207,646 B1) and Ser. No. 08/960,774 (now issued as U.S. Pat. No. 6,239,116 B1), filed on Oct. 30, 1996 and Oct. 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization. Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.

Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.

For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g., via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990).

The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An "S chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S chirality. An "R chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R chirality. The backbone modification may be any type of modification that forms a chiral center. The modifications include but are not limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, 2'-OMe and combinations thereof. In other embodiments they are non-chiral. A non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.

The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R. A "plurality" as used herein refers to an amount greater than or equal to 75%. Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the chiral centers have S or R chirality. In other embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications.

The S- and R- chiral immunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides. Stec et al. teach methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane. Stec W J et al., J Am Chem Soc 117:12019 (1995). Other methods for making chirally pure oligonucleotides have been described by companies such as ISIS Pharmaceuticals. U.S. patents which disclose methods for generating stereopure oligonucleotides include U.S. Pat. Nos. 5,212,295, 5,359,052, 5,506,212, 5,512,668, 5,521,302, 5,599,797, 5,837,856, 5,856,465, and 5,883,237, each of which is hereby incorporated by reference in its entirety.

Other sources of nucleic acids useful according to the invention include standard viral and bacterial vectors, many of which are commercially available. In its broadest sense, a "vector" is any nucleic acid material which is ordinarily used to deliver and facilitate the transfer of nucleic acids to cells. The vector as used herein may be an empty vector or a vector carrying a gene which can be expressed. In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In this case the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell.

In general, vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources. Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA.

Standard protocols for producing empty vectors or vectors carrying genes (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and/or infection of the target cells with viral particles) are provided in Kriegler M, "Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry E J, Ed., "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, N.J. (1991).

Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.

It has recently been discovered that plasmids (empty or gene-carrying) can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles. The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid.

As used herein, administration of an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect. As an example, CpG nucleic acids and T-rich nucleic acids may be administered to a single subject along with an antibody and optionally a cancer therapy. In another example, a plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subject.

Some of the nucleic acids useful according to the invention and described herein are presented in Table 4 below.

TABLE-US-00004 TABLE 4 Exemplary Nucleic Acids. SEQUENCE BACKBONE SEQ ID NO: aaaaaa s 1 aaaaaaaaaaaaaaaaaaaa o 2 aaaaaccccccccccaaaaa o 3 aaaacatgacgttcaaaaaa sos 4 aaaacatgacgttcaaaaaa s2 5 aaaacatgacgttcgggggg sos 6 aaaacatgacgttcgggggg s2 7 aaaacgtt o 8 aaaatcaacgttgaaaaaaa sos 9 aaaatctgtgcttttaaaaaa sos 10 aaaattgacgttttaaaaaa sos 11 aaacattctgggggaattttaagaagtaaacat o 12 aaacattctgggggaattttaagaagttcctccctcccc o 13 aaacattctgggggaattttgtctagtaaacat o 14 aacgctcgaccttcgat o 15 aacgctggaccttccat o 16 aacgctggaccttccatgtc sos 17 aacgtt o 18 aacgttct o 19 aacgttg s 20 aacgttga o 21 aacgttgaggggcat o 22 aaggtggggcagtctcaggga 23 aatagtcgccataacaaaac o 24 aatagtcgccatcccccccc o 25 aatagtcgccatcccgggac o 26 aatagtcgccatcgcgcgac o 27 aatagtcgccatggcggggc o 28 aattctctatcggggcttctgtgtctgttgctggttccgctttat o 29 acaaccacgagaacgggaac 30 acaacgtt o 31 acaacgttga o 32 accacaacgagaggaacgca 33 accatcctgaggccattcgg 34 accatggacgaactgtttcccctc s 35 accatggacgacctgtttcccctc s 36 accatggacgagctgtttcccctc s 37 accatggacgagctgtttcccctc 38 accatggacgatctgtttcccctc s 39 accatggacggtctgtttcccctc s 40 accatggacgtactgtttcccctc s 41 accatggacgttctgtttcccctc s 42 acccatcaatagctctgtgc s 43 acccgtcgtaattatagtaaaaccc o 44 accgcatggattctaggcca s 45 accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o 46 acgctggaccttccat 47 acgtcgttcccccccccccc o 48 acgtgt s 49 actagacgttagtgtga o 50 actagacgttagtgtga s 51 actggacgttagcgtga o 52 acttctcatagtccctttggtccag o 53 agaacgtt o 54 agacagacacgaaacgaccg 55 agactcatgggaaaatcccacatttga o 56 agatagcaaatcggctgacg o 57 agatggttctcagataaagcggaa 58 agcaccgaacgtgagagg o 59 agcacggtagccttccta 60 agcagctttagagctttagagctt s 61 agcatcaggaacgacatgga o 62 agcatcaggaccgacatgga o 63 agcgctga o 64 agctcaacgtcatgc o 65 agctccatggtgctcactg s 66 aggatatc o 67 aggtacagccaggactacga 68 agicccgigaacgiattcac o 69 agtgactctccagcgttctc o 70 agtgcgattcgagatcg o 71 agtgcgattgcagatcg o 72 agtgct s 73 agtgct o 74 agttgcaact o 75 ataaagcgaaactagcagcagtttc o 76 ataacgtt o 77 ataatagagcttcaagcaag s 78 ataatccagcttgaaccaag s 79 ataatcgacgttcaagcaag s 80 ataatcgacgttcccccccc s 81 ataatcgtcgttcaagcaag s 82 ataatcgtgcgttcaagaaag s 83 atagacaaaaattccctccccggagcc o 84 atatatatatatatatat s 85 atatctaatcaaaacattaacaaa o 86 atcaggaacgtcatgggaagc o 87 atcgacctacgtgcgttctc o 88 atcgacctacgtgcgttztc o 89 atcgactcgagcgttctc o 90 atcgactctcgagcgttctc o 91 atcgactctcgagcgttctc sos 92 atcgactctcgagtgttctc o 93 atcgactctcgagzgttctc o 94 atcgactctctcgagcgttctc o 95 atcgacttcgagcgttctc o 96 atcgatcgagcgttctc o 97 atcgatgt o 98 atcggaggactggcgcgccg 99 atctggtgagggcaagctatg s 100 atgacgttcctgacgtt s 101 atgcactctgcagcgttctc o 102 atgcatgt o 103 atgcccctcaacgtt o 104 atgctaaaggacgtcacattgca o 105 atggaaggtccacgttctc o 106 atggaaggtccagcgttct o 107 atggaaggtccagcgttctc o 108 atggaaggtccagtgttctc o 109 atggaaggtcgagcgttctc o 110 atggactctccagcgttctc o 111 atgtcctcggtcctgatgct o 112 atgtttactagacaaaattcccccagaatgttt o 113 atgtttacttcttaaaattcccccagaatgttt o 114 attcgatcggggcggggcgag o 115 atzgacctacgtgcgttctc o 116 atzgactctzgagzgttctc o 117 batggaaggtccagcgttctc o 118 bgagaacgctccagcactgat o 119 bgagaacgctcgaccttcgat o 120 bgagaazgctccagcactgat o 121 bgagaazgctcgaccttcgat o 122 bgagaaagctggaccttccat o 123 bgagcaagztggaccttccat o 124 bgctagacgttagcgtga o 125 btcaacgtt o 126 btccatgacgttcctgatgct o 127 btccatgagcttcctgatgct o 128 btccattccatgacgttcctgatgcttcca os 129 btccattccattctaggcctgagtcttccat os 130 btcgtcgttttgtcgttttgtcgttttttt os 131 btttttccatgtcgttcctgatgcttttt os 132 btttttcgtcgttcccccccccccc os 133 caaacgtt o 134 caacgtt o 135 caagagatgctaacaatgca s 136 caataaatctgaggagaccc 137 cacaccttggtcaatgtcacgt o 138 caccaccttggtcaatgtcacgt o 139 cacggtagccttccta 140 cacgttgaggggcat s 141 cactgtccttcgtcga sos 142 cagacacagaagcccgatagacg 143 cagattgtgcaatgtctcga o 144 cataacataggaatatttactcctcgc o 145 cataggatctcgagctcggaaagtcccctac o 146 catgagctcatctggaggaagcgg o 147 catttccacgatttccca o 148 cattttacgggcgggcgggc 149 ccaaatatcggtggtcaagcac 150 ccaacgtt s 151 ccacgtcgaccctcaggcga s 152 ccacgtggacctctagc o 153 ccactcacatctgctgctccacaag o 154 ccagatgagctcatgggtttctcc o 155 ccaggttaagaggaaatgacttcggg o 156 ccaggttgtatagaggc 157 ccagtgctgatcaccgatatcctgttcggcagtcg 158 ccatcgat o 159 ccatgcat o 160 ccatgctaacctctagc o 161 ccatgtcggtcctgatgct o 162 ccccaaagggatgagaagtt o 163 cccccaaaaaaaaaaccccc o 164 cccccc s 165 cccccccc s 166 cccccccccccc s 167 cccccccccccccccccccc s 168 cccccccccccccccccccc sos 169 cccccccccccccccccccccccc s 170 cccccccccccccccccccccccccccc s 171 ccccccccccccccccccccccccccccccccccc s 172 ccccttgacgttttcccccc sos 173 cccgaagtcatttcctcttaacctgg o 174 ccgaacaggatatcggtgatcagcac 175 ccgcttcctccagatgagctcatg o 176 ccgcttcctccagatgagctcatgggtttctccaccaag o 177 ccggccggccggccggccgg o 178 ccgtcgttcccccccccccc o 179 cctacgttgtatgcgcccagct o 180 cctccaaatgaaagaccccc 181 cctctatacaacctgggac 182 ccttccatgtcggtcctgat sos 183 ccttcgat o 184 cgaacgtt o 185 cgacga o 186 cgacgt s 187 cgactctcgagcgttctc o 188 cgactgccgaacaggatatcggtgatcagcactgg 189 cgccgtcgcggcggttgg o 190 cgcctggggctggtctgg o 191 cgcgcgcgcgcgcgcgcgcg s 192 cgcgcgcgcgcgcgcgcgcg o 193 cgcgta s 194 cgctagaggttagcgtga o 195 cgctggaccttccat o 196 cgctggaccttccatgtcgg sos 197 cggctgacgtcatcaa s 198 cgggcgactcagtctatcgg 199 cgggcttacggcggatgctg 200 cggtagccttccta 201 cgtaccttacggtga o 202 cgtacg s 203 cgtcga s 204 cgtcga o 205 cgtcgt s 206 cgtcgtcgt o 207 cgtcgtcgtcgtcgtcgtcgt s 208 cgtctatcgggcttctgtgtctg 209 cgttcg s 210 ctaacgtt o 211 ctaatctttctaatttttttctaa s 212 ctagataaagcggaaccagcaacagacacagaagccccgatagag o 213 ctagcgct o 214 ctagcggctgacgtcataaagctagc s 215 ctagcggctgacgtcatcaagctag o 216 ctagcggctgacgtcatcaatctag o 217 ctagcggctgagctcataaagctagc s 218 ctagcttgatgacgtcagccgctag o 219 ctagcttgatgagctcagccgctag o 220 ctagctttatgacgtcagccgctagc s 221 ctaggctgacgtcatcaagctagt o 222 ctagtggctgacgtcatcaagctag s 223 ctatcggaggactggcgcgcc 224 ctatcggaggactggcgcgccg 225 ctcaacgctggaccttccat o 226 ctcatgggtttctccaccaag o 227 ctccagctccaagaaaggacg o 228 ctcgccccgccccgatcgaat o 229 ctctccaagctcacttacag 230 ctctctgtaggcccgcttgg s 231 ctcttgcgacctggaaggta 232 ctgacgtcat o 233 ctgacgtg o 234 ctgattgctctctcgtga sos 235 ctgattgctctctcgtga o 236 ctgcagcctgggac o 237 ctgcgttagcaatttaactgtg o 238 ctgctgagactggag s 239 ctgctgctgctgctgctgctg 240 ctggaccttccatgtc sos 241 ctggaccttccatgtcgg sos 242 ctggtctttctggtttttttctgg s 243 ctggtctttctggtttttttctgg o 244 ctgtaagtgagcttggagag 245

ctgtatgaaacaaattttcctctttgggca o 246 ctgtca s 247 ctgtcaggaactgcaggtaagg o 248 ctgtcccatatttttagaca 249 ctgtcg s 250 ctgtcg o 251 ctgtcgttcccccccccccc o 252 ctgtgctttctgtgtttttctgtg s 253 cttggagggcctcccggcgg 254 cttggtggagaaacccatgag o 255 cttggtggagaaacccatgagctcatctggaggaagcgg o 256 ctttccgttggacccctggg s 257 czggczggczgggczccgg o 258 faacgttga o 259 fcgcgaattcgcg o 260 ftcaacgtt o 261 gaaacgtt o 262 gaaactgctgctagtttcgctttat o 263 gaaccttccatgctgtt 264 gaaccttccatgctgttccg 265 gaacgctggaccttccat 266 gaagttcacgttgaggggcat o 267 gaagtttctggtaagtcttcg o 268 gaccttccat 269 gaccttccatgtcggtcctgat 270 gaccttctatgtcggtcctg 271 gacgtcat o 272 gactgacgtcagcgt o 273 gagaacgatggaccttccat o 274 gagaacgctagaccttctat o 275 gagaacgctccaccttccat o 276 gagaacgctccagcactgat o 277 gagaacgctccagcttcgat o 278 gagaacgctccgaccttcgat s 279 gagaacgctcgaccttccat o 280 gagaacgctcgaccttcgatb s 281 gagaacgctggacctatccat o 282 gagaacgctggacctcatcatccat o 283 gagaacgctggacctcatccat o 284 gagaacgctggaccttcc 285 gagaacgctggaccttccat 286 gagaacgctggaccttccat s 287 gagaacgctggaccttccatgt 288 gagaacgctggaccttcgat o 289 gagaacgctggaccttcgta o 290 gagaacgctggaccttgcat o 291 gagaacgctggacgctcatccat o 292 gagaacgctggacttccat o 293 gagaacgctggaczttccat o 294 gagaacgctggatccat o 295 gagaatgctggaccttccat o 296 gagaazgctggaccttccat o 297 gagaccgctcgaccttcgat 298 gagcaagctggaccttccat s 299 gagcaagctggaccttccatb s 300 gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga o 301 gaggaaggigiggaigacgt o 302 gaggggaccattttacgggc 303 gatccagattctgccaggtcactgtgactggat o 304 gatccagattctgctgagtcactgtgactggat o 305 gatccagtcacagtgacctggcagaatctggat o 306 gatccagtcacagtgactcagcagaatctggat o 307 gatccggctgactcatcactagatc o 308 gatcgctgatctaatgctcg sos 309 gatcggaggactggcgcgccg 310 gatctagtgatgagtcagccggatc o 311 gattcaacttgcgctcatcttaggc o 312 gcaacgtt o 313 gcaatattgcb o 314 gcaatattgcf o 315 gcacatcgtcccgcagccga s 316 gcagcctctatacaacctgggacggga 317 gcatagcgttgagct sos 318 gcatgacgttgagct s 319 gcatgacgttgagct sos 320 gcatgacgttgagct o 321 gcatgacgttgagct s 322 gcatgagcttgagctga o 323 gcatgatgttgagct o 324 gcatgazgttgagct o 325 gcatggcgttgagct sos 326 gcatgtagctgagct o 327 gcatgtcgttgagct sos 328 gcattcatcaggcgggcaagaat o 329 gcattgcgttgagct sos 330 gcatttcgaggagct o 331 gccaccaaaacttgtccatg 332 gccagatgttagctgga o 333 gccatggacgaactgttccccctc s 334 gcgacgggcggcgcgcgccc s 335 gcgacggtcggcgcgcgccc s 336 gcgacgtgcggcgcgcgccc s 337 gcgacgttcggcgcgcgccc s 338 gcgatgtcgttcctgatgcg o 339 gcgatgtcgttcctgatgct o 340 gcgccagtcctccgatagac 341 gcgcgcgcgcgcgcgcgcg o 342 gcgctaccggtagcctgagt 343 gcggcgggcggcgcgcgccc o 344 gcggcgggcggcgcgcgccc s 345 gcggcggtcggcgcgcgccc s 346 gcggcgtgcggcgcgcgccc s 347 gcggcgttcggcgcgcgccc s 348 gcgtcgttcccccccccccc o 349 gcgtgcgttgtcgttgtcgtt s 350 gcgtttttttttgcg s 351 gctaaacgttagcgt o 352 gctaacgttagcgtga o 353 gctaccttagcgtga o 354 gctaccttagzgtga o 355 gctacttagcgtga o 356 gctagacgatagcgt o 357 gctagacgctagcgtga o 358 gctagacgt o 359 gctagacgtaagcgtga o 360 gctagacgtctagc o 361 gctagacgttagc o 362 gctagacgttagcgt o 363 gctagacgttagcgtga 364 gctagacgttagctgga o 365 gctagacgttagctgga sos 366 gctagacgttaggctga o 367 gctagacgttagtgt o 368 gctagacgttagzgt o 369 gctagacgtttagc o 370 gctagagcttagcgtga o 371 gctagaggttagcgtga o 372 gctagaggttagcgtga s 373 gctagatgttaacgt o 374 gctagatgttagcgt o 375 gctagatgttagcgt s 376 gctagatgttagcgtga o 377 gctagazgttagcgt o 378 gctagazgttagtgt o 379 gctagctttagagctttagagctt o 380 gctaggcgttagcgt o 381 gctagtcgatagc o 382 gctagtcgatagcgt o 383 gctagtcgctagc o 384 gctandcghhagc o 385 gctatgacgttccaaggg s 386 gctcga s 387 gctcgttcagcgcgtct sos 388 gctgaaccttccatgctgtt 389 gctgagctcatgccgtctgc sos 390 gctggaccttccat 391 gctggaccttccat o 392 gctggccagcttacctcccg 393 gctgtaaaatgaatcggccg sos 394 gctgtggggcggctcctg s 395 gcttgacgtcaagc o 396 gcttgacgtctagc o 397 gcttgacgtttagc o 398 gcttgcgttgcgttt sos 399 gcttggagggcctgtaagtg 400 ggaacgtt o 401 ggaagacgttaga o 402 ggaattagtaatagatatagaagtt o 403 ggagaaacccatgagctcatctgg o 404 ggagctcttcgaacgccata 405 ggcagtgcaggctcaccggg 406 ggccaactttcaatgtgggatggcctc 407 ggccatcccacattgaaagtt 408 ggccttttcccccccccccc o 409 ggcggcggcggcggcggcgg o 410 ggcgttattcctgactcgcc o 411 ggctatgtcgatcctagcc o 412 ggctatgtcgttcctagcc o 413 ggctccggggagggaatttttgtctat o 414 ggctgtattcctgactgccc s 415 gggaatgaaagattttattataag o 416 ggggactttccgctggggactttccagggggactttcc sos 417 ggggagggaggaacttcttaaaattcccccagaatgttt o 418 ggggagggg s 419 ggggagggt s 420 ggggcatgacgttcaaaaaa s 421 ggggcatgacgttcaaaaaa sos 422 ggggcatgacgttcgggggg s2 423 ggggcatgacgttcgggggg sos 424 ggggcatgagcttcgggggg s 425 ggggcatgagcttcgggggg sos 426 ggggcctctatacaacctggg 427 gggggacgttggggg o 428 gggggggggggggggggggg sos 429 gggggggggggggggggggg o 430 ggggggttggggaaaacccggacttcctgca o 431 gggggttttttttttggggg o 432 ggggtaatcgatcagggggg sos 433 ggggtaatcgatgagggggg o 434 ggggtaatgcatcagggggg sos 435 ggggtcaacgttgagggggg sos 436 ggggtcaacgttgagggggg s 437 ggggtcaagcttgagggggg sos 438 ggggtcaagtctgagggggg sos 439 ggggtccagcgtgcgccatggggg sos 440 ggggtccctgagactgcc 441 ggggtcgaccttggagggggg sos 442 ggggtcgacgtcgagggggg s 443 ggggtcgtcgttttgggggg 444 ggggtctgtcgttttgggggg sos 445 ggggtctgtgcttttgggggg sos 446 ggggtgacgttcagggggg sos 447 ggggtgtcgttcagggggg sos 448 ggggttgacgttttgggggg sos 449 ggggttgggggtt s 450 ggtacctgtggggacattgtg o 451 ggtgaggtg s 452 ggtggtgtaggttttgg o 453 ggttacggtctgtcccatat 454 ggttcacgtgctcatggctg o 455 gtaacgtt o 456 gtagccttccta 457 gtaggggactttccgagctcgagatcctatg o 458 gtcactcgtggtacctcga s 459 gtccatggcgtgcgggatga 460 gtcccaggttgtatagaggctgc 461 gtccccatttcccagaggaggaaat o 462 gtccgggccaggccaaagtc s 463 gtcggtcctgatgctgttcc sos 464 gtctatcggaggactggcgc 465 gtctgtcccatgatctcgaa 466 gtgaaticgttcicgggict o 467 gtgccggggtctccgggc s 468 gtgccggggtctccgggc o 469 gtgcgcgcgagcccgaaatc s 470 gtgctgatcaccgatatcctgttcgg 471 gtgcttgaccaccgatatttgg 472 gtggttacggtcgtgcccat 473 gtgtcggggtctccgggc o 474 gttctcagataaagcggaaccagcaacagacacagaa 475 gttgaaacccgagaacatcat s 476 gttggatacaggccagactttgttg o 477 gtttttatataatttggg o 478 gzaatattgcb o 479 gzggzgggzggzgzgzgccc 480 taaacgtt s 481 taagcgct o 482 taagctctgtcaacgccagg 483 taccgagcttcgacgagatttca o 484 taccgcgtgcgaccctct s 485 tactcttcggatcccttgcg sos 486 tagaaacagcattcttcttttagggcagcaca 487 tagacgtc o 488 tagacgttagcgtga o 489 tatagtccctgagactgccccaccttctcaacaacc 490 tatcggaggactggcgcgccg 491 tatgccgcgcccggacttat sos 492 tcaaatgtgggattttcccatgagtct o 493 tcaacgt s 494 tcaacgtc o 495 tcaacgtt p-ethoxy 496

tcaacgtt s 497 tcaacgtt o 498 tcaacgttaacgttaacgtt o 499 tcaacgttaacgttaacgttaacgttaacgttb s 500 tcaacgttga s 501 tcaacgttga o 502 tcaacgttgab o 503 tcaacgttgaf o 504 tcaagctt p-ethoxy 505 tcaagctt o 506 tcaatgctgaf o 507 tcaazgtt o 508 tcaazgttgab o 509 tcaccggt s 510 tcacgctaacctctagc o 511 tcacgctaacctctgac o 512 tcacgctaacgtctagc o 513 tcacgt o 514 tcagaccacgtggtcgggtgttcctga o 515 tcagaccagctggtcgggtgttcctga o 516 tcagcgct o 517 tcagcgtgcgcc s 518 tcagctctggtactttttca 519 tcaggaacacccgaccacgtggtctga o 520 tcaggaacacccgaccagctggtctga o 521 tcaggggtggggggaacctt sos 522 tcagzgct o 523 tcatcgat o 524 tccaagacgttcctgatgct o 525 tccaagtagttcctagttct o 526 tccaccacgtggctgatgct o 527 tccaccacgtggtctatgct s 528 tccacgacgttttcgacgtt s 529 tccagacggtgaagt o 530 tccagacgttgaagt o 531 tccagagcttgaagt o 532 tccagcgtgcgccata sos 533 tccaggacgttcctagttct o 534 tccaggacttctctcaggtt s 535 tccaggacttctctcaggtt sos 536 tccaggactttcctcaggtt s 537 tccaggactttcctcaggtt o 538 tccaggagcttcctagttct o 539 tccaggatgttcctagttct o 540 tccagtctaggcctagttct o 541 tccagttccttcctcagtct o 542 tccagttcgagcctagttct o 543 tccataacgttcctgagtct sos 544 tccataacgttcctgatgct o 545 tccatagcgatcctagcgat o 546 tccatagcggtcctagcggt o 547 tccatagcgttcctagcgtt s 548 tccatagcgttcctagcgtt o 549 tccatcacgtgcctgagtct sos 550 tccatgacattcctgatgct o 551 tccatgacggtcctgacggt s 552 tccatgacggtcctgacggt o 553 tccatgacggtcctgagtct sos 554 tccatgacggtcctgatgct s 555 tccatgacgtccctgagtct sos 556 tccatgacgtccctgatgct o 557 tccatgacgttcctagttct o 558 tccatgacgttcctctccatgacgttcctctccatgacgttcctc o 559 tccatgacgttcctgacgtt s 560 tccatgacgttcctgacgtt 561 tccatgacgttcctgacgtt sos 562 tccatgacgttcctgacgtt o 563 tccatgacgttcctgagtct sos 564 tccatgacgttcctgatcc 565 tccatgacgttcctgatgct o 566 tccatgacgttcctgatgct s 567 tccatgacgttcctgcagttcctgacgtt s 568 tccatgacgttcctgccgtt s 569 tccatgacgttcctgcgttt s 570 tccatgacgttcctggcggg s 571 tccatgacgttcztgatgct o 572 tccatgagcttcctgagctt s 573 tccatgagcttcctgagtct o 574 tccatgagcttcctgagtct p-ethoxy 575 tccatgagcttcctgagtct s 576 tccatgagcttcctgatgct s2 577 tccatgagcttccttgagtct 578 tccatgaigttcctgaigtt s 579 tccatgatgttcctagttct o 580 tccatgazgttcctagttct o 581 tccatgazgttcctgatgct o 582 tccatgazgttcctgazgtt s 583 tccatgccggtcctgagtct sos 584 tccatgccggtcctgatgct o 585 tccatgccggtcctgccggt o 586 tccatgccgttcctgccgtt s 587 tccatgccgttcctgccgtt o 588 tccatgcgcgtcctgcgcgt o 589 tccatgcgtgcgtgcgtttt s 590 tccatgcgttgcgttgcgtt s 591 tccatgctggtcctgagtct sos 592 tccatgctggtcctgatgct o 593 tccatggcgggcctggcggg s 594 tccatggcggtcctgatgct o 595 tccatgtagttcctagttct o 596 tccatgtccttcctgatgct 597 tccatgtcgatcctgagtct sos 598 tccatgtcgatcctgatgct o 599 tccatgtcgctcctgagtct sos 600 tccatgtcgctcctgatcct o 601 tccatgtcggtcctgagtct sos 602 tccatgtcggtcctgatgct 603 tccatgtcggtcctgatgct s 604 tccatgtcggtcctgctgat o 605 tccatgtcggtzctgatgct o 606 tccatgtcgttccgcgcgcg o 607 tccatgtcgttcctagttct 608 tccatgtcgttcctgagtct sos 609 tccatgtcgttcctgatgcg o 610 tccatgtcgttcctgatgct o 611 tccatgtcgttcctgccgct o 612 tccatgtcgttcctgtagct o 613 tccatgtcgttcctgtcgtt s 614 tccatgtcgttcctgtcgtt o 615 tccatgtcgtttttgtcgtt s 616 tccatgtgcttcctgatgct o 617 tccatgtzggtcctgagtct sos 618 tccatgtzggtcctgatgct o 619 tccatgtzgttcctgatgct o 620 tccatgtzgttcctgtzgtt s 621 tccattgcgttccttgcgtt o 622 tcccgacggtgaagt o 623 tcccgccgttgaagt o 624 tcccgcgcgttccgcgcgtt s 625 tccctgagactgccccacctt 626 tccgatcg o 627 tccggacggtgaagt o 628 tccggccgttgaagt o 629 tccgtacg o 630 tcctaacgttgaagt o 631 tcctagcgttgaagt o 632 tcctcacgttgaagt o 633 tcctga o 634 tcctgaaaaggaagt s 635 tcctgacgatgaagt o 636 tcctgacgctgaagt o 637 tcctgacggggaagt o 638 tcctgacggggaagt s 639 tcctgacggggagt s 640 tcctgacggtgaagt o 641 tcctgacggtgaagt s 642 tcctgacgtagaagt o 643 tcctgacgtcgaagt o 644 tcctgacgtggaagt o 645 tcctgacgtggaagt s 646 tcctgacgttaga o 647 tcctgacgttccc o 648 tcctgacgttcccctggcggtcccctgtcgct o 649 tcctgacgttcctgacgtt s 650 tcctgacgttcctggcggtcctgtcgct o 651 tcctgacgttccttc o 652 tcctgacgttcggcgcgcgccc s 653 tcctgacgttgaagt o 654 tcctgacgttgaagt s 655 tcctgagcttgaagt o 656 tcctgagcttgaagt s 657 tcctgazgttgaagt o 658 tcctgccgttgaagt o 659 tcctgccgttgaagt s 660 tcctggaggggaagt o 661 tcctggaggggaagt s 662 tcctggcggggaagt o 663 tcctggcggggaagt s 664 tcctggcggtcctggcggtt s 665 tcctggcggtgaagt o 666 tcctggcggtgaagt s 667 tcctggcgtggaagt s 668 tcctggcgttgaagt o 669 tcctggcgttgaagt s 670 tcctgggggggaagt o 671 tcctggtggggaagt o 672 tcctggzggggaagt o 673 tcctgtcgctcctgtcgct o 674 tcctgtcgctcctgtcgctcctgtcgct o 675 tcctgtcgttcctgtcgtt s 676 tcctgtcgttcctgtcgttggaacgacagg o 677 tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 678 tcctgtcgttccttgtcgtt s 679 tcctgtcgttgaagt o 680 tcctgtcgttgaagtttttt o 681 tcctgtcgttttttgtcgtt s 682 tccttacgttgaagt o 683 tccttgtcgttcctgtcgtt s 684 tcgacgtc o 685 tcgacgttcccccccccccc o 686 tcgagacattgcacaatcatctg o 687 tcgccgttcccccccccccc o 688 tcgcgtgcgttttgtcgttttgacgtt s 689 tcgga o 690 tcggcgttcccccccccccc o 691 tcgtag s 692 tcgtca o 693 tcgtcattcccccccccccc o 694 tcgtcgatcccccccccccc o 695 tcgtcgctcccccccccccc o 696 tcgtcgctgtctccg s 697 tcgtcgctgtctccgcttctt s 698 tcgtcgctgtctccgcttctt so 699 tcgtcgctgtctccgcttctt s2o 700 tcgtcgctgtctccgcttcttcttgcc s 701 tcgtcgctgtctgcccttctt s 702 tcgtcgctgttgtcgtttctt s 703 tcgtcggtcccccccccccc o 704 tcgtcgtcagttcgctgtcg sos 705 tcgtcgtcgtcgtcgtcgtcgtt sos 706 tcgtcgtcgtcgtt s 707 tcgtcgtcgtcgtt s2 708 tcgtcgtcgtcgtt s2o 709 tcgtcgtcgtcgtt os2 710 tcgtcgttccccccccc s 711 tcgtcgttcccccccccccc o 712 tcgtcgttccccccccccccb o 713 tcgtcgttccccccczcccc o 714 tcgtcgttggtgtcgttggtgtcgtt s 715 tcgtcgttggttgtcgttttggtt s 716 tcgtcgttgtcgttgtcgtt s 717 tcgtcgttgtcgttgtcgtt sos 718 tcgtcgttgtcgttttgtcgtt s 719 tcgtcgttgtcgttttgtcgtt sos 720 tcgtcgtttcgtcgttttgacgtt s 721 tcgtcgtttgcgtgcgtttcgtcgtt s 722 tcgtcgtttgtcgttttgtcgtt s 723 tcgtcgttttgacgttttgacgtt s 724 tcgtcgttttgacgttttgtcgtt s 725 tcgtcgttttgcgtgcgttt s 726 tcgtcgttttgtcgttttgggggg 727 tcgtcgttttgtcgttttgtcgt s2 728 tcgtcgttttgtcgttttgtcgtt s 729 tcgtcgttttgtcgttttgtcgtt sos 730 tcgtcgttttgtcgttttgtcgtt o 731 tcgtcgttttgtcgttttgtcgtt s2 732 tcgtcgttttgtcgttttgtcgttb o 733 tcgtcgttttgtcgttttgtcgttttgtcgtt s 734 tcgtcgttttgtggttttgtggtt s 735 tcgtcgttttttgtcgttttttgtcgtt s 736 tcgtcgtttttttttttttt s 737 tcgtga s 738 tcgtga o 739 tcgtgg s 740 tcgtzgttcccccccccccc o 741 tcntcgtnttntcgtnttntcgtn s 742 tctaaaaaccatctattcttaaccct o 743 tctagcgtttttagcgttcc sos 744 tctatcccaggtggttcctgttag o 745 tctatcgacgttcaagcaag s 746 tctccatcctatggttttatcg o 747

tctccatgatggttttatcg 748 tctcccagcgagcgagcgccat s 749 tctcccagcgagcgccat s 750 tctcccagcgcgcgccat s 751 tctcccagcgggcgcat s 752 tctcccagcgtacgccat s 753 tctcccagcgtcgccat s 754 tctcccagcgtgcgccat s 755 tctcccagcgtgcgccat o 756 tctcccagcgtgcgccatat sos 757 tctcccagcgtgcgcctttt sos 758 tctcccagcgtgcgtgcgccat s 759 tctcccagcgtgcgttatat sos 760 tctcccagcgtgcgtttt s 761 tctcccagcgttgcgccatat sos 762 tctcccatcgtcgccat s 763 tctcccgacgtgcgccat s 764 tctcccgtcgtgcgccat s 765 tctccctgcgtgcgccatat sos 766 tctcctagcgtgcgccatat sos 767 tctgacgtcatctgacgttggctgacgtct o 768 tctgcgtgcgtgcgccatat sos 769 tcttcgaa o 770 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt o 771 tctttattagtgactcagcacttggca o 772 tcztgacgttgaagt o 773 tgaacgtt o 774 tgcaatgtgacgtcctttagcat o 775 tgcaggaagtccgggttttccccaacccccc o 776 tgcatcagctct s 777 tgcatcagctct sos 778 tgcatcccccaggccaccat s 779 tgcatgccgtacacagctct sos 780 tgcatgccgtacacagctct s 781 tgcatgccgtacacagctct o 782 tgcatgccgtgcatccgtacacagctct s 783 tgccaagtgctgagtcactaataaaga o 784 tgcccaaagaggaaaatttgtttcatacag o 785 tgcgctct s 786 tgctagctgtgcctgtacct 787 tgctagctgtgcctgtacct s 788 tgctgcttcccccccccccc o 789 tgctgcttcccccccccccc s 790 tgctgcttttgtgcttttgtgctt o 791 tgctgcttttgtgcttttgtgctt s 792 tggaccttccat 793 tggaccttctatgtcggtcc 794 tggagggtgagggtggggccagagcgggtggggctgattggaa o 795 tggaggtcccaccgagatcggag o 796 tggttacggtctgtcccatg 797 tgtatctctctgaaggact o 798 tgtccagccgaggggaccat 799 tgtcccatgtttttagaagc 800 tgtcgttgtcgtt s 801 tgtcgttgtcgttgtcgttgtcgtt s 802 tgtcgtttgtcgtttgtcgtt s 803 ttaacggtggtagcggtattggtc o 804 ttaacgtt o 805 ttaagaccaataccgctaccaccg o 806 ttaggacaaggtctagggtg 807 ttagggttagggttagggtt s2 808 ttcagttgtcttgctgcttagctaa o 809 ttcatgccttgcaaaatggcg 810 ttccaatcagccccacccgctctggccccaccctcaccctcca o 811 ttccatgctgttccggctgg 812 ttccatgtcggtcctgat sos 813 ttccgccgaatggcctcaggatggtac 814 ttccgctttatctgagaaccatct 815 ttcctctctgcaagagact o 816 ttcgggcggactcctccatt sos 817 ttcgggcggactcctccatt o 818 ttcgtcgttttgtcgttttgtcgtt s 819 ttctgtgtctgttgctggttccgctttatctgagaac 820 ttgaaactgaggtgggac 821 ttgccccatattttagaaac 822 ttggggggggtt s 823 ttgtactctccatgatggtt 824 tttaccttttataaacataactaaaacaaa o 825 tttgaatcctcagcggtctccagtggc o 826 tttgaattcaggactggtgaggttgag o 827 tttgaattccgtgtacagaagcgagaagc o 828 tttgagaacgctggaccttc sos 829 tttgcggccgctagacttaacctgagagata o 830 tttgggcccacgagagacagagacacttc o 831 tttgggcccgcttctcgcttctgtacacg o 832 ttttctagagaggtgcacaatgctctgg o 833 tttttggggggggggttttt o 834 tttttttttttttf o 835 tttttttttttttf so 836 tttttttttttttttttt s 837 tttttttttttttttttttt s 838 tttttttttttttttttttt o 839 ttttttttttttttttttttt s 840 tttttttttttttttttttttttt s 841 ttttttttttttttttttttttttttt s 842 tzaacgtt o 843 tzgtcgttcccccccccccc o 844 tzgtcgttttgtcgttttgtcgtt o 845 tzgtggttcccccccccccc o 846 tzgtzgttttgtzgttttgtzgtt o 847 tzgtzgttttgtzgttttgtzgtt s 848

In Table 4 with respect to sequences the letter symbols aside from a, c, t, and g are defined as follows: "b" indicates a biotin moiety attached to that end of the oligonucleotide when it is single and is listed on the 5' or 3' end of oligonucleotide; "d" represents a, g, or t; "f" represents fluorescein isothiocyanate (FITC) moiety attached to the 5' or 3' end of oligonucleotide; "h" represents a, c, or t; "i" represents inosine; "n" represents any nucleotide; "z" represents 5-methylcytosine.

Also in Table 4 with respect to backbones the notations are defined as follows: "o" represents phosphodiester; "os" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 5' end; "os2" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 5' end; "p-ethoxy" represents p-ethoxy backbone (see, e.g., U.S. Pat. No. 6,015,886); "po" represents phospholdiester; "s" represents phosphorothioate; "s2" represents phosphorodithioate; "s2o" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 3' end; "so" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 3' end; and "sos" represents chimeric phosphorothioate/phosphodiester with phosphorothioate at the 5' and 3' ends.

The nucleic acids are delivered in effective amounts. The term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system. According to some aspects of the invention, an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer. In some embodiments a synergistic effect is observed. A synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone. For example, a synergistic combination of an immunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately. The biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer. In another embodiment, the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells.

The effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid. The effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.

Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer. Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein.

Subject doses of the compounds described herein typically range from about 0.1 .mu.g to mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 .mu.g to 5 mg per administration, and most typically from about 100 .mu.g to 1 mg, with 2-4 administrations being spaced hours, days or weeks apart. More typically, immune stimulant doses range from 1 .mu.g to 10 mg per administration, and most typically 10 .mu.g to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. More typically parenteral doses for these purposes range from about 10 .mu.g to 5 mg per administration, and most typically from about 100 .mu.g to 1 mg, with 2-4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.

For any compound described herein the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein. A therapeutically effective dose can also be determined from human data for CpG nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar pharmacological activities. Higher doses may be required for parenteral administration, as described above. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.

The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.

For use in therapy, an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject. "Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.

For oral administration, the compounds (i.e., nucleic acids and antibodies) can be delivered alone without any pharmaceutical carriers or formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.

Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions.

Dragee cores may be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.

Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990), which is incorporated herein by reference.

The nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.

Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).

The nucleic acids or other therapeutics useful in the invention may be delivered in mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.

A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.

The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.

Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix =such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

The nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable carrier or a delivery vehicle. The nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. One type of delivery vehicle is referred to herein as a nucleic acid delivery complex. A "nucleic acid delivery complex" shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells). Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form.

The nucleic acids may be delivered by non-invasive methods as described above. Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury. Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus Calmette -Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998); Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998).

The invention also includes kits. The kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention. The active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.

The following examples are provided to illustrate specific instances of the practice of the present invention and are not to be construed as limiting the present invention to these examples. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.

EXAMPLES

Introduction:

Extensive cross-talk exists between healthy B cells and T cells. There is evidence that malignant B cells also communicate with T cells. However, malignant cells appear to differ from their normal counterparts in a number of ways, including a decreased tendency to undergo apoptosis in response to normal signals, altered expression of a variety of surface markers, and altered ability to function as effective antigen presenting cells. Lagneaux L et al., Blood 91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:S5-9 (1993); Gordon J et al., Adv Exp Med Biol 406:139-44 (1996); Chaperot L et al., Exp Hematol 27:479-88 (1999). Immunotherapeutic approaches have recently become part of our therapy of some subtypes of B-cell malignancy. Improved immunotherapy of B-cell malignancy will need to be designed based on the growing understanding of the cellular immunology of this disease. Schultze J L et al., J Mol Med 77:322-32 (1999).

A variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies. Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC II, CD80, CD86 and CD40. Maloney D G, Semin Oncol 26:74-8 (1999); McLaughlin P et al., Semin Oncol 26:79-87 (1999); Shan D et al., Blood 91:1644-52 (1998); Coiffier B et al., Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt) 12:1763-70, 1775-7 (1998); Tutt A L et al., J Immunol 161:3176-85 (1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et al., J Allergy Clin Immunol 98:S238-47 (1996); Higaki Y et al., Immunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood 87:3803-12 (1996); Link B K et al., Blood 81:3343-9 (1993); Link B K et al., Int J Cancer 77:251-6 (1998). The relative contribution of antibody dependent cellular cytotoxicity (ADCC) versus trans-membrane signaling mediated by anti-B cell antibodies remains unclear. In the present study, we examined how CpG-DNA impacts on the phenotype, apoptosis and proliferation of different types of B-cell malignancy including follicular B-cell lymphoma and B-CLL.

Materials and Methods:

Cell culture: Fresh lymph node samples were obtained from the operating suite and were minced with a scalpel under aseptic conditions. The resulting suspension was passed sequentially through a sterilized sieve-tissue grinder containing a nylon mesh screen, a 150 .mu.m mesh screen and a 60 .mu.m mesh screen. Alternatively, mononuclear cells were obtained from peripheral blood or pleural fluid as described. Hartmann G et al., J Pharmacol Exp Ther 285:920-8 (1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen. For analysis, cells were thawed and resuspended in 10% (v/v) heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, U T), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, N.Y.) and incubated on a 96-well-plate (1.times.10.sup.6 cells/ml) in the presence of ODN as indicated below. Not all assays were performed for all samples because of the limited number of cells available for some samples.

Oligonucleotides: Nuclease-resistant phosphorothioate-modified oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, Calif.) and Hybridon Specialty Products (Milford, Mass.). Sequences were as follows: CpG ODN 2006: 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017: 5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ ID NO: 168). ODN was diluted in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final concentration of 5 .mu.g/ml.

Flow cytometry: Cells were washed and resuspended in ice-cold PBS or Annexin V binding buffer (10 mM HEPES/NaOH, 140 mM NaCl, 2.5 mM CaCl.sub.2, pH 7.4). Murine or human serum was added (final concentration 1%) to block non-specific binding of antibodies. Surface antigen staining was performed as described. Hartmann G et al., J Pharmacol Exp Ther 285:920-8 (1998). In brief, 1.times.10.sup.5 cells per sample were stained with CyChrome-labeled anti-CD19 and FITC- or PE-labeled antibodies as indicated for 20 min on ice. They were then washed and analyzed by flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HA58), MHC I (G46-2.6) and MHC II (TU39) as well as isotype controls (IgG1, MOPC-21 and IgG2a, G155-178) were purchased from PharMingen, San Diego, Calif. FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, Ala. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link B K et al., Blood 81:3343-9 (1993). C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from IDEC Pharmaceuticals, San Diego, Calif. 1D10 and C2B8 were labeled with FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (>97% viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation. Flow cytometric data from 1.times.10.sup.4 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).

CFSE staining: CFSE 5-(and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described in detail previously. Lyons A B et al., J Immunol Methods 171:131-7 (1994). Briefly, cells were washed twice in PBS, resuspended in PBS (1.times.10.sup.7 cells/ml) containing CFSE at a final concentration of 1 .mu.M, and incubated at 37.degree. C. for 10 minutes. Cells were washed three times with PBS.

TUNEL assay: A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated for 16 hours in 10 .mu.M BrdU and placed onto slides by cytospin. Cells were then in 1% paraformaldehyde in PBS for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage indicative of apoptosis cells was detected by labeling the 3'-DNA end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The use of dideoxy-dUTP prevented further elongation of the 3'-ends in subsequent steps. Slides were then placed face-down on a 2 mm support at both ends on a UV transilluminator and exposed for 5 minutes. The new DNA strand breaks induced by photolysis at sites of BrdU incorporation (i.e., proliferating cells) were detected by a second TUNEL labeling using tetramethylrhodamine-dUTP (TMR-dUTP, Boehringer-Mannheim). Both TUNEL staining steps included incubating slides in 50 .mu.l of TdT mix (34 .mu.l distilled water, 10 .mu.l of 5.times.TdT buffer, 5 .mu.l of 25 mM cobalt chloride, 12.5 units terminal transferase and 0.5 nmol fluorochrome-conjugated-dUTP) (Boehringer-Mannheim) under a coverslip for one hour at 37.degree. C. in a humidified chamber. The slides were then washed in 5 quick changes of distilled water followed by 3 changes of 2.times.SSC containing 30% formamide for 5 minutes each at room temperature. After the second TUNEL labeling step, cells were counterstained for CD19, and also stained with Wright solution for blood cell differentiation and mounted in Vectashield media containing DAPI counterstain (Vector Laboratories, Burlingame, Calif.). The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was determined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.

Example 1

Immunostimulatory Nucleic Acids Induce Morphological and Phenotypic Changes in Malignant B Cells

Our prior studies demonstrated that activation of naive human B cells by CpG ODN results in increased cell size (FSC) and granularity (SSC). Hartmann G et al., J Immunol 164:944-53 (2000). We therefore first determined whether such changes also occur in malignant B cells. Primary malignant B cells were obtained from lymph node biopsies, peripheral blood, or pleural fluid of patients with various types of B-cell malignancy. In addition, cells from the lymph node of a patient with benign reactive follicular hyperplasia were studied. Nine samples in total were evaluated (see Table 5). Cells were incubated for 72 hours in media containing CpG ODN 2006 (5 .mu.g/ml) or control ODN 2017. FSC and SSC were examined with gating on CD19+ viable cells (FIG. 1). Varying degrees of change in FSC and SSC were noted in response to CpG ODN 2006 when compared to control ODN 2017 or medium alone. Comparable changes were not found in the cells from the patient with benign reactive follicular hyperplasia.

FIG. 1 depicts the morphologic changes of marginal zone lymphoma cells upon CpG ODN stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with 5 .mu.g/ml of no ODN (A and D), control ODN (B and E) or CpG ODN (C and F) for 72 hours and analyzed by flow cytometry. A, B, and C illustrate FSC (x-axis) vs. SSC (y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations. Upon stimulation with CpG ODN, B cells shifted up and to the right, indicating an increase in granularity and size. No changes could be detected without stimulation or on stimulation with the non-CpG ODN.

Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC I, MHC II, and an HLA-DR variant antigen (moAb 1D10) were examined on viable CD19+ cells after incubation of cells with CpG ODN for 72 hours. Each of these markers was upregulated to varying extents in response to the CpG ODN 2006 compared to the control ODN 2017 (FIG. 2, FIG. 3).

FIG. 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 .mu.g/ml of either CpG ODN or non-CpG ODN. On stimulation with CpG ODN, median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression. Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN, and bold curves incubation with CpG ODN.

FIG. 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN treatment. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.

CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell malignancies of other histologies. CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (FIG. 3). This data demonstrated a reverse correlation between the baseline expression of CD20 and CD40, and expression of these markers after incubation with CpG ODN; thus the lower the baseline level of CD20 and CD40, the higher was the responsiveness to CpG ODN (r: -0.6; -0.4) (FIG. 4). This correlation was less clear for the other markers. CD19+ cells derived from the reactive follicular hyperplasia showed high baseline expression of activation markers which was not further upregulated by CpG.

FIG. 4 shows the CpG ODN effect on CD20 and CD40 is dependent on the baseline level of expression. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies (see Table 5) were incubated with or without CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by flow cytometry. Baseline expression of CD20 and CD40 with medium alone was compared to the expression of CD20 and CD40 in the presence of CpG ODN. The coefficients of correlation are indicated.

TABLE-US-00005 TABLE 5 Percentage Of CD19+ Cells In Samples Tested. Sample Number Histology Source % CD19+ Cells 1 Chronic Lymphocytic Peripheral >98% Leukemia 1 Blood 2 Chronic Lymphocytic Peripheral 70% Leukemia 2 Blood 3 Large Cell Lymphoma 1 Pleural Fluid 55% 4 Large Cell Lymphoma 2 Lymph Node 75% 5 Mantle Cell Lymphoma Lymph Node 98% 6 Diffuse Mixed Small and Lymph Node 50% Large Cell Lymphoma 7 Marginal Zone Lymphoma 1 Lymph Node 80% 8 Marginal Zone Lymphoma 2 Peripheral >94% Blood 9 Reactive Follicular Lymph Node 35% Hyperplasia

Example 2

Immunostimulatory Nucleic Acids Induce Proliferation and Apoptosis of Malignant B Cells

CpG induces a strong proliferative response of primary human B cells. Hartmann G et. al., J Immunol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE stain with every cell division. In B-CLL, CD5 can be used to identify malignant B cells among CD19+ cells. Proliferation of malignant B cells (CD5+ and CD19+) was lower than proliferation of normal B cells (CD5- and CD19+) (FIG. 5). For the marginal zone lymphoma, CpG ODN 2006 induced proliferation of the CD19+ cell population (FIG. 5).

FIG. 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells, were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry. CFSE fluorescence (x-axis) and expression of CD5 (CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated. In CLL, CpG ODN enhanced proliferation of both CD5+ and the CD5- cells. However the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset. In marginal zone lymphoma CpG ODN enhanced proliferation in the CD19+ cell subset.

No consistent pattern was apparent related to determining whether CpG ODN altered the percent of dead cells as determined by morphological criteria (see Table 6).

TABLE-US-00006 TABLE 6 Percent Apoptotic Cells Based On Morphologic Criteria. Sample Number Histology Media CpG ODN 2006 1 Chronic Lymphocytic 25.9 21.5 Leukemia 1 2 Chronic Lymphocytic 32.6 45.3 Leukemia 2 3 Large Cell Lymphoma 1 33.9 26.2 4 Large Cell Lymphoma 2 16.0 9.8 5 Mantle Cell Lymphoma 55.1 60.0 6 Diffuse Mixed Small and 27.6 26.6 Large Cell Lymphoma 7 Marginal Zone 32.9 32.8 Lymphoma 1 8 Marginal Zone 38.8 56.0 Lymphoma 2 9 Reactive Follicular 8.6 18.0 Hyperplasia

A TUNEL assay was utilized to assess the effect of CpG ODN on both proliferation and apoptosis. The results are shown in Table 7.

TABLE-US-00007 TABLE 7 Apoptosis And Proliferation As Determined By TUNEL. Baseline CpG ODN Control ODN Sample Apop Prolif Apop Prolif Apop Prolif 1663141 15 8 11 10 12 5 12142812 3 <1 1 10 2 12 12141811 <1 <1 <1 11 ? ?

Example 3

CpG ODN Enhance the Therapeutic Effect of Murine IgG2a (Which Relates to Human IgG1) but not Murine IgG1 (Which Relates to Human IgG2) Anti-tumor Antibody

CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C cells on day 0. They were then given 100 .mu.g anti-idiotype monoclonal antibody as either IgG1 (MS5A10) or IgG2a (MS11G6) on days 5, 7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells. Therefore, the anti-tumor antibodies are also "anti-idiotype." These antibodies (MS5A10 and MS11G6) are simultaneously both anti-tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN 1826 (5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time. Results are shown in FIG. 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgG1 antibody plus CpG ODN had survival that was similar to those treated with murine IgG1 antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).

The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.

All references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference.

SEQUENCE LISTINGS

1

SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 848 <210> SEQ ID NO 1 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 1 aaaaaa 6 <210> SEQ ID NO 2 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 2 aaaaaaaaaa aaaaaaaaaa 20 <210> SEQ ID NO 3 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 3 aaaaaccccc cccccaaaaa 20 <210> SEQ ID NO 4 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: Chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 4 aaaacatgac gttcaaaaaa 20 <210> SEQ ID NO 5 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 5 aaaacatgac gttcaaaaaa 20 <210> SEQ ID NO 6 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 6 aaaacatgac gttcgggggg 20 <210> SEQ ID NO 7 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 7 aaaacatgac gttcgggggg 20 <210> SEQ ID NO 8 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 8 aaaacgtt 8 <210> SEQ ID NO 9 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 9 aaaatcaacg ttgaaaaaaa 20 <210> SEQ ID NO 10 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 10 aaaatctgtg cttttaaaaa a 21 <210> SEQ ID NO 11 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 11 aaaattgacg ttttaaaaaa 20 <210> SEQ ID NO 12 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 12 aaacattctg ggggaatttt aagaagtaaa cat 33 <210> SEQ ID NO 13 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 13 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 <210> SEQ ID NO 14 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 14 aaacattctg ggggaatttt gtctagtaaa cat 33 <210> SEQ ID NO 15 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 15 aacgctcgac cttcgat 17 <210> SEQ ID NO 16 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 16 aacgctggac cttccat 17

<210> SEQ ID NO 17 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 17 aacgctggac cttccatgtc 20 <210> SEQ ID NO 18 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 18 aacgtt 6 <210> SEQ ID NO 19 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 19 aacgttct 8 <210> SEQ ID NO 20 <211> LENGTH: 7 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 20 aacgttg 7 <210> SEQ ID NO 21 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 21 aacgttga 8 <210> SEQ ID NO 22 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 22 aacgttgagg ggcat 15 <210> SEQ ID NO 23 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 23 aaggtggggc agtctcaggg a 21 <210> SEQ ID NO 24 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 24 aatagtcgcc ataacaaaac 20 <210> SEQ ID NO 25 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 25 aatagtcgcc atcccccccc 20 <210> SEQ ID NO 26 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 26 aatagtcgcc atcccgggac 20 <210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 27 aatagtcgcc atcgcgcgac 20 <210> SEQ ID NO 28 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 28 aatagtcgcc atggcggggc 20 <210> SEQ ID NO 29 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 29 aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210> SEQ ID NO 30 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 30 acaaccacga gaacgggaac 20 <210> SEQ ID NO 31 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 31 acaacgtt 8 <210> SEQ ID NO 32 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 32 acaacgttga 10 <210> SEQ ID NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 33 accacaacga gaggaacgca 20 <210> SEQ ID NO 34 <211> LENGTH: 20 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 34 accatcctga ggccattcgg 20 <210> SEQ ID NO 35 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 35 accatggacg aactgtttcc cctc 24 <210> SEQ ID NO 36 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 36 accatggacg acctgtttcc cctc 24 <210> SEQ ID NO 37 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 37 accatggacg agctgtttcc cctc 24 <210> SEQ ID NO 38 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 38 accatggacg agctgtttcc cctc 24 <210> SEQ ID NO 39 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 39 accatggacg atctgtttcc cctc 24 <210> SEQ ID NO 40 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 40 accatggacg gtctgtttcc cctc 24 <210> SEQ ID NO 41 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 41 accatggacg tactgtttcc cctc 24 <210> SEQ ID NO 42 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 42 accatggacg ttctgtttcc cctc 24 <210> SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 43 acccatcaat agctctgtgc 20 <210> SEQ ID NO 44 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 44 acccgtcgta attatagtaa aaccc 25 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 45 accgcatgga ttctaggcca 20 <210> SEQ ID NO 46 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 46 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45 <210> SEQ ID NO 47 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 47 acgctggacc ttccat 16 <210> SEQ ID NO 48 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 48 acgtcgttcc cccccccccc 20 <210> SEQ ID NO 49 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 49 acgtgt 6 <210> SEQ ID NO 50 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 50 actagacgtt agtgtga 17 <210> SEQ ID NO 51 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)

<223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 51 actagacgtt agtgtga 17 <210> SEQ ID NO 52 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 52 actggacgtt agcgtga 17 <210> SEQ ID NO 53 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 53 acttctcata gtccctttgg tccag 25 <210> SEQ ID NO 54 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 54 agaacgtt 8 <210> SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 55 agacagacac gaaacgaccg 20 <210> SEQ ID NO 56 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 56 agactcatgg gaaaatccca catttga 27 <210> SEQ ID NO 57 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 57 agatagcaaa tcggctgacg 20 <210> SEQ ID NO 58 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 58 agatggttct cagataaagc ggaa 24 <210> SEQ ID NO 59 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 59 agcaccgaac gtgagagg 18 <210> SEQ ID NO 60 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 60 agcacggtag ccttccta 18 <210> SEQ ID NO 61 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 61 agcagcttta gagctttaga gctt 24 <210> SEQ ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 62 agcatcagga acgacatgga 20 <210> SEQ ID NO 63 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 63 agcatcagga ccgacatgga 20 <210> SEQ ID NO 64 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 64 agcgctga 8 <210> SEQ ID NO 65 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 65 agctcaacgt catgc 15 <210> SEQ ID NO 66 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 66 agctccatgg tgctcactg 19 <210> SEQ ID NO 67 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 67 aggatatc 8 <210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 68 aggtacagcc aggactacga 20 <210> SEQ ID NO 69

<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (3)...(3) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (14)...(14) <223> OTHER INFORMATION: I <400> SEQUENCE: 69 agncccgnga acgnattcac 20 <210> SEQ ID NO 70 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 70 agtgactctc cagcgttctc 20 <210> SEQ ID NO 71 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 71 agtgcgattc gagatcg 17 <210> SEQ ID NO 72 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 72 agtgcgattg cagatcg 17 <210> SEQ ID NO 73 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 73 agtgct 6 <210> SEQ ID NO 74 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 74 agtgct 6 <210> SEQ ID NO 75 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 75 agttgcaact 10 <210> SEQ ID NO 76 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 76 ataaagcgaa actagcagca gtttc 25 <210> SEQ ID NO 77 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 77 ataacgtt 8 <210> SEQ ID NO 78 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 78 ataatagagc ttcaagcaag 20 <210> SEQ ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 79 ataatccagc ttgaaccaag 20 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 80 ataatcgacg ttcaagcaag 20 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 81 ataatcgacg ttcccccccc 20 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 82 ataatcgtcg ttcaagcaag 20 <210> SEQ ID NO 83 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 83 ataatcgtgc gttcaagaaa g 21 <210> SEQ ID NO 84 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 84 atagacaaaa attccctccc cggagcc 27 <210> SEQ ID NO 85 <211> LENGTH: 18 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 85 atatatatat atatatat 18 <210> SEQ ID NO 86 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 86 atatctaatc aaaacattaa caaa 24 <210> SEQ ID NO 87 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 87 atcaggaacg tcatgggaag c 21 <210> SEQ ID NO 88 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 88 atcgacctac gtgcgttctc 20 <210> SEQ ID NO 89 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (18)...(18) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 89 atcgacctac gtgcgttntc 20 <210> SEQ ID NO 90 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 90 atcgactcga gcgttctc 18 <210> SEQ ID NO 91 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 91 atcgactctc gagcgttctc 20 <210> SEQ ID NO 92 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 92 atcgactctc gagcgttctc 20 <210> SEQ ID NO 93 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 93 atcgactctc gagtgttctc 20 <210> SEQ ID NO 94 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (14)...(14) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 94 atcgactctc gagngttctc 20 <210> SEQ ID NO 95 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 95 atcgactctc tcgagcgttc tc 22 <210> SEQ ID NO 96 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 96 atcgacttcg agcgttctc 19 <210> SEQ ID NO 97 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 97 atcgatcgag cgttctc 17 <210> SEQ ID NO 98 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 98 atcgatgt 8 <210> SEQ ID NO 99 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 99 atcggaggac tggcgcgccg 20 <210> SEQ ID NO 100 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 100 atctggtgag ggcaagctat g 21 <210> SEQ ID NO 101 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone

<400> SEQUENCE: 101 atgacgttcc tgacgtt 17 <210> SEQ ID NO 102 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 102 atgcactctg cagcgttctc 20 <210> SEQ ID NO 103 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 103 atgcatgt 8 <210> SEQ ID NO 104 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 104 atgcccctca acgtt 15 <210> SEQ ID NO 105 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 105 atgctaaagg acgtcacatt gca 23 <210> SEQ ID NO 106 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 106 atggaaggtc cacgttctc 19 <210> SEQ ID NO 107 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 107 atggaaggtc cagcgttct 19 <210> SEQ ID NO 108 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 108 atggaaggtc cagcgttctc 20 <210> SEQ ID NO 109 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 109 atggaaggtc cagtgttctc 20 <210> SEQ ID NO 110 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 110 atggaaggtc gagcgttctc 20 <210> SEQ ID NO 111 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 111 atggactctc cagcgttctc 20 <210> SEQ ID NO 112 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 112 atgtcctcgg tcctgatgct 20 <210> SEQ ID NO 113 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 113 atgtttacta gacaaaattc ccccagaatg ttt 33 <210> SEQ ID NO 114 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 114 atgtttactt cttaaaattc ccccagaatg ttt 33 <210> SEQ ID NO 115 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 115 attcgatcgg ggcggggcga g 21 <210> SEQ ID NO 116 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (3)...(3) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 116 atngacctac gtgcgttctc 20 <210> SEQ ID NO 117 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (3)...(3) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (14)...(14) <223> OTHER INFORMATION: m5c

<400> SEQUENCE: 117 atngactctn gagngttctc 20 <210> SEQ ID NO 118 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 118 atggaaggtc cagcgttctc 20 <210> SEQ ID NO 119 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated 5' end <400> SEQUENCE: 119 gagaacgctc cagcactgat 20 <210> SEQ ID NO 120 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated 5' end <400> SEQUENCE: 120 gagaacgctc gaccttcgat 20 <210> SEQ ID NO 121 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated 5' end <221> NAME/KEY: modified_base <222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 121 gagaangctc cagcactgat 20 <210> SEQ ID NO 122 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated 5' end <221> NAME/KEY: modified_base <222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 122 gagaangctc gaccttcgat 20 <210> SEQ ID NO 123 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 123 gagcaagctg gaccttccat 20 <210> SEQ ID NO 124 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 124 gagcaagntg gaccttccat 20 <210> SEQ ID NO 125 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 125 gctagacgtt agcgtga 17 <210> SEQ ID NO 126 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 126 tcaacgtt 8 <210> SEQ ID NO 127 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 127 tccatgacgt tcctgatgct 20 <210> SEQ ID NO 128 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 128 tccatgagct tcctgatgct 20 <210> SEQ ID NO 129 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 129 tccattccat gacgttcctg atgcttcca 29 <210> SEQ ID NO 130 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 130 tccattccat tctaggcctg agtcttccat 30

<210> SEQ ID NO 131 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 131 tcgtcgtttt gtcgttttgt cgttttttt 29 <210> SEQ ID NO 132 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 132 tttttccatg tcgttcctga tgcttttt 28 <210> SEQ ID NO 133 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: biotinylated at 5' end <400> SEQUENCE: 133 tttttcgtcg ttcccccccc cccc 24 <210> SEQ ID NO 134 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 134 caaacgtt 8 <210> SEQ ID NO 135 <211> LENGTH: 7 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 135 caacgtt 7 <210> SEQ ID NO 136 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 136 caagagatgc taacaatgca 20 <210> SEQ ID NO 137 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 137 caatcaatct gaggagaccc 20 <210> SEQ ID NO 138 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 138 cacaccttgg tcaatgtcac gt 22 <210> SEQ ID NO 139 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 139 caccaccttg gtcaatgtca cgt 23 <210> SEQ ID NO 140 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 140 cacggtagcc ttccta 16 <210> SEQ ID NO 141 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 141 cacgttgagg ggcat 15 <210> SEQ ID NO 142 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 142 cactgtcctt cgtcga 16 <210> SEQ ID NO 143 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 143 cagacacaga agcccgatag acg 23 <210> SEQ ID NO 144 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 144 cagattgtgc aatgtctcga 20 <210> SEQ ID NO 145 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 145 cataacatag gaatatttac tcctcgc 27 <210> SEQ ID NO 146 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 146 cataggatct cgagctcgga aagtccccta c 31 <210> SEQ ID NO 147 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature

<222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 147 catgagctca tctggaggaa gcgg 24 <210> SEQ ID NO 148 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 148 catttccacg atttccca 18 <210> SEQ ID NO 149 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 149 cattttacgg gcgggcgggc 20 <210> SEQ ID NO 150 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 150 ccaaatatcg gtggtcaagc ac 22 <210> SEQ ID NO 151 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 151 ccaacgtt 8 <210> SEQ ID NO 152 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 152 ccacgtcgac cctcaggcga 20 <210> SEQ ID NO 153 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 153 ccacgtggac ctctagc 17 <210> SEQ ID NO 154 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 154 ccactcacat ctgctgctcc acaag 25 <210> SEQ ID NO 155 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 155 ccagatgagc tcatgggttt ctcc 24 <210> SEQ ID NO 156 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 156 ccaggttaag aggaaatgac ttcggg 26 <210> SEQ ID NO 157 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 157 ccaggttgta tagaggc 17 <210> SEQ ID NO 158 <211> LENGTH: 35 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 158 ccagtgctga tcaccgatat cctgttcggc agtcg 35 <210> SEQ ID NO 159 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 159 ccatcgat 8 <210> SEQ ID NO 160 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 160 ccatgcat 8 <210> SEQ ID NO 161 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 161 ccatgctaac ctctagc 17 <210> SEQ ID NO 162 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 162 ccatgtcggt cctgatgct 19 <210> SEQ ID NO 163 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 163 ccccaaaggg atgagaagtt 20 <210> SEQ ID NO 164 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 164 cccccaaaaa aaaaaccccc 20

<210> SEQ ID NO 165 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 165 cccccc 6 <210> SEQ ID NO 166 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 166 cccccccc 8 <210> SEQ ID NO 167 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 167 cccccccccc cc 12 <210> SEQ ID NO 168 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 168 cccccccccc cccccccccc 20 <210> SEQ ID NO 169 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 169 cccccccccc cccccccccc 20 <210> SEQ ID NO 170 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 170 cccccccccc cccccccccc cccc 24 <210> SEQ ID NO 171 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 171 cccccccccc cccccccccc cccccccc 28 <210> SEQ ID NO 172 <211> LENGTH: 35 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 172 cccccccccc cccccccccc cccccccccc ccccc 35 <210> SEQ ID NO 173 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 173 ccccttgacg ttttcccccc 20 <210> SEQ ID NO 174 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 174 cccgaagtca tttcctctta acctgg 26 <210> SEQ ID NO 175 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 175 ccgaacagga tatcggtgat cagcac 26 <210> SEQ ID NO 176 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 176 ccgcttcctc cagatgagct catg 24 <210> SEQ ID NO 177 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 177 ccgcttcctc cagatgagct catgggtttc tccaccaag 39 <210> SEQ ID NO 178 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 178 ccggccggcc ggccggccgg 20 <210> SEQ ID NO 179 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 179 ccgtcgttcc cccccccccc 20 <210> SEQ ID NO 180 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 180 cctacgttgt atgcgcccag ct 22 <210> SEQ ID NO 181 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 181 cctccaaatg aaagaccccc 20

<210> SEQ ID NO 182 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 182 cctctataca acctgggac 19 <210> SEQ ID NO 183 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 183 ccttccatgt cggtcctgat 20 <210> SEQ ID NO 184 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 184 ccttcgat 8 <210> SEQ ID NO 185 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 185 cgaacgtt 8 <210> SEQ ID NO 186 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 186 cgacga 6 <210> SEQ ID NO 187 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 187 cgacgt 6 <210> SEQ ID NO 188 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 188 cgactctcga gcgttctc 18 <210> SEQ ID NO 189 <211> LENGTH: 35 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 189 cgactgccga acaggatatc ggtgatcagc actgg 35 <210> SEQ ID NO 190 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 190 cgccgtcgcg gcggttgg 18 <210> SEQ ID NO 191 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 191 cgcctggggc tggtctgg 18 <210> SEQ ID NO 192 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 192 cgcgcgcgcg cgcgcgcgcg 20 <210> SEQ ID NO 193 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 193 cgcgcgcgcg cgcgcgcgcg 20 <210> SEQ ID NO 194 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 194 cgcgta 6 <210> SEQ ID NO 195 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 195 cgctagaggt tagcgtga 18 <210> SEQ ID NO 196 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 196 cgctggacct tccat 15 <210> SEQ ID NO 197 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 197 cgctggacct tccatgtcgg 20 <210> SEQ ID NO 198 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 198 cggctgacgt catcaa 16

<210> SEQ ID NO 199 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 199 cgggcgactc agtctatcgg 20 <210> SEQ ID NO 200 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 200 cgggcttacg gcggatgctg 20 <210> SEQ ID NO 201 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 201 cggtagcctt ccta 14 <210> SEQ ID NO 202 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 202 cgtaccttac ggtga 15 <210> SEQ ID NO 203 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 203 cgtacg 6 <210> SEQ ID NO 204 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 204 cgtcga 6 <210> SEQ ID NO 205 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 205 cgtcga 6 <210> SEQ ID NO 206 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 206 cgtcgt 6 <210> SEQ ID NO 207 <211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 207 cgtcgtcgt 9 <210> SEQ ID NO 208 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 208 cgtcgtcgtc gtcgtcgtcg t 21 <210> SEQ ID NO 209 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 209 cgtctatcgg gcttctgtgt ctg 23 <210> SEQ ID NO 210 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 210 cgttcg 6 <210> SEQ ID NO 211 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 211 ctaacgtt 8 <210> SEQ ID NO 212 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 212 ctaatctttc taattttttt ctaa 24 <210> SEQ ID NO 213 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 213 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45 <210> SEQ ID NO 214 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 214 ctagcgct 8 <210> SEQ ID NO 215 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 215 ctagcggctg acgtcataaa gctagc 26 <210> SEQ ID NO 216 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)

<223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 216 ctagcggctg acgtcatcaa gctag 25 <210> SEQ ID NO 217 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 217 ctagcggctg acgtcatcaa tctag 25 <210> SEQ ID NO 218 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 218 ctagcggctg agctcataaa gctagc 26 <210> SEQ ID NO 219 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 219 ctagcttgat gacgtcagcc gctag 25 <210> SEQ ID NO 220 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 220 ctagcttgat gagctcagcc gctag 25 <210> SEQ ID NO 221 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 221 ctagctttat gacgtcagcc gctagc 26 <210> SEQ ID NO 222 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 222 ctaggctgac gtcatcaagc tagt 24 <210> SEQ ID NO 223 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 223 ctagtggctg acgtcatcaa gctag 25 <210> SEQ ID NO 224 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 224 ctatcggagg actggcgcgc c 21 <210> SEQ ID NO 225 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 225 ctatcggagg actggcgcgc cg 22 <210> SEQ ID NO 226 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 226 ctcaacgctg gaccttccat 20 <210> SEQ ID NO 227 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 227 ctcatgggtt tctccaccaa g 21 <210> SEQ ID NO 228 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 228 ctccagctcc aagaaaggac g 21 <210> SEQ ID NO 229 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 229 ctcgccccgc cccgatcgaa t 21 <210> SEQ ID NO 230 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 230 ctctccaagc tcacttacag 20 <210> SEQ ID NO 231 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 231 ctctctgtag gcccgcttgg 20 <210> SEQ ID NO 232 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 232 ctcttgcgac ctggaaggta 20 <210> SEQ ID NO 233 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 233 ctgacgtcat 10 <210> SEQ ID NO 234

<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 234 ctgacgtg 8 <210> SEQ ID NO 235 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 235 ctgattgctc tctcgtga 18 <210> SEQ ID NO 236 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 236 ctgattgctc tctcgtga 18 <210> SEQ ID NO 237 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 237 ctgcagcctg ggac 14 <210> SEQ ID NO 238 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 238 ctgcgttagc aatttaactg tg 22 <210> SEQ ID NO 239 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 239 ctgctgagac tggag 15 <210> SEQ ID NO 240 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 240 ctgctgctgc tgctgctgct g 21 <210> SEQ ID NO 241 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 241 ctggaccttc catgtc 16 <210> SEQ ID NO 242 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 242 ctggaccttc catgtcgg 18 <210> SEQ ID NO 243 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 243 ctggtctttc tggttttttt ctgg 24 <210> SEQ ID NO 244 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 244 ctggtctttc tggttttttt ctgg 24 <210> SEQ ID NO 245 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 245 ctgtaagtga gcttggagag 20 <210> SEQ ID NO 246 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 246 ctgtatgaaa caaattttcc tctttgggca 30 <210> SEQ ID NO 247 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 247 ctgtca 6 <210> SEQ ID NO 248 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 248 ctgtcaggaa ctgcaggtaa gg 22 <210> SEQ ID NO 249 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 249 ctgtcccata tttttagaca 20 <210> SEQ ID NO 250 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 250 ctgtcg 6

<210> SEQ ID NO 251 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 251 ctgtcg 6 <210> SEQ ID NO 252 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 252 ctgtcgttcc cccccccccc 20 <210> SEQ ID NO 253 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 253 ctgtgctttc tgtgtttttc tgtg 24 <210> SEQ ID NO 254 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 254 cttggagggc ctcccggcgg 20 <210> SEQ ID NO 255 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 255 cttggtggag aaacccatga g 21 <210> SEQ ID NO 256 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 256 cttggtggag aaacccatga gctcatctgg aggaagcgg 39 <210> SEQ ID NO 257 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 257 ctttccgttg gacccctggg 20 <210> SEQ ID NO 258 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (15)...(15) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 258 cnggcnggcn gggcnccgg 19 <210> SEQ ID NO 259 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 259 aacgttga 8 <210> SEQ ID NO 260 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 260 cgcgaattcg cg 12 <210> SEQ ID NO 261 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 261 tcaacgtt 8 <210> SEQ ID NO 262 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 262 gaaacgtt 8 <210> SEQ ID NO 263 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 263 gaaactgctg ctagtttcgc tttat 25 <210> SEQ ID NO 264 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 264 gaaccttcca tgctgtt 17 <210> SEQ ID NO 265 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 265 gaaccttcca tgctgttccg 20 <210> SEQ ID NO 266 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 266 gaacgctgga ccttccat 18 <210> SEQ ID NO 267 <211> LENGTH: 21

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 267 gaagttcacg ttgaggggca t 21 <210> SEQ ID NO 268 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 268 gaagtttctg gtaagtcttc g 21 <210> SEQ ID NO 269 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 269 gaccttccat 10 <210> SEQ ID NO 270 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 270 gaccttccat gtcggtcctg at 22 <210> SEQ ID NO 271 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 271 gaccttctat gtcggtcctg 20 <210> SEQ ID NO 272 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 272 gacgtcat 8 <210> SEQ ID NO 273 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 273 gactgacgtc agcgt 15 <210> SEQ ID NO 274 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 274 gagaacgatg gaccttccat 20 <210> SEQ ID NO 275 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 275 gagaacgcta gaccttctat 20 <210> SEQ ID NO 276 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 276 gagaacgctc caccttccat 20 <210> SEQ ID NO 277 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 277 gagaacgctc cagcactgat 20 <210> SEQ ID NO 278 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 278 gagaacgctc cagcttcgat 20 <210> SEQ ID NO 279 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 279 gagaacgctc cgaccttcga t 21 <210> SEQ ID NO 280 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 280 gagaacgctc gaccttccat 20 <210> SEQ ID NO 281 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: misc_feature <222> LOCATION: (20)...(20) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 281 gagaacgctc gaccttcgat 20 <210> SEQ ID NO 282 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 282 gagaacgctg gacctatcca t 21 <210> SEQ ID NO 283 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 283 gagaacgctg gacctcatca tccat 25 <210> SEQ ID NO 284 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 284 gagaacgctg gacctcatcc at 22 <210> SEQ ID NO 285 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 285 gagaacgctg gaccttcc 18 <210> SEQ ID NO 286 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 286 gagaacgctg gaccttccat 20 <210> SEQ ID NO 287 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 287 gagaacgctg gaccttccat 20 <210> SEQ ID NO 288 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 288 gagaacgctg gaccttccat gt 22 <210> SEQ ID NO 289 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 289 gagaacgctg gaccttcgat 20 <210> SEQ ID NO 290 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 290 gagaacgctg gaccttcgta 20 <210> SEQ ID NO 291 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 291 gagaacgctg gaccttgcat 20 <210> SEQ ID NO 292 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 292 gagaacgctg gacgctcatc cat 23 <210> SEQ ID NO 293 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 293 gagaacgctg gacttccat 19 <210> SEQ ID NO 294 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (14)...(14) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 294 gagaacgctg gacnttccat 20 <210> SEQ ID NO 295 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 295 gagaacgctg gatccat 17 <210> SEQ ID NO 296 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 296 gagaatgctg gaccttccat 20 <210> SEQ ID NO 297 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 297 gagaangctg gaccttccat 20 <210> SEQ ID NO 298 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 298 gagaccgctc gaccttcgat 20 <210> SEQ ID NO 299 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 299 gagcaagctg gaccttccat 20 <210> SEQ ID NO 300 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: misc_feature <222> LOCATION: (20)...(20) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 300 gagcaagctg gaccttccat 20 <210> SEQ ID NO 301 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 301 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45 <210> SEQ ID NO 302 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (9)...(9) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (11)...(11) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (15)...(15) <223> OTHER INFORMATION: I <400> SEQUENCE: 302 gaggaaggng nggangacgt 20 <210> SEQ ID NO 303 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 303 gaggggacca ttttacgggc 20 <210> SEQ ID NO 304 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 304 gatccagatt ctgccaggtc actgtgactg gat 33 <210> SEQ ID NO 305 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 305 gatccagatt ctgctgagtc actgtgactg gat 33 <210> SEQ ID NO 306 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 306 gatccagtca cagtgacctg gcagaatctg gat 33 <210> SEQ ID NO 307 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 307 gatccagtca cagtgactca gcagaatctg gat 33 <210> SEQ ID NO 308 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 308 gatccggctg actcatcact agatc 25 <210> SEQ ID NO 309 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 309 gatcgctgat ctaatgctcg 20 <210> SEQ ID NO 310 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 310 gatcggagga ctggcgcgcc g 21 <210> SEQ ID NO 311 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 311 gatctagtga tgagtcagcc ggatc 25 <210> SEQ ID NO 312 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 312 gattcaactt gcgctcatct taggc 25 <210> SEQ ID NO 313 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 313 gcaacgtt 8 <210> SEQ ID NO 314 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 314 gcaatattgc 10 <210> SEQ ID NO 315 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 315 gcaatattgc 10 <210> SEQ ID NO 316 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 316 gcacatcgtc ccgcagccga 20 <210> SEQ ID NO 317 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 317

gcagcctcta tacaacctgg gacggga 27 <210> SEQ ID NO 318 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 318 gcatagcgtt gagct 15 <210> SEQ ID NO 319 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 319 gcatgacgtt gagct 15 <210> SEQ ID NO 320 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 320 gcatgacgtt gagct 15 <210> SEQ ID NO 321 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 321 gcatgacgtt gagct 15 <210> SEQ ID NO 322 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 322 gcatgacgtt gagct 15 <210> SEQ ID NO 323 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 323 gcatgagctt gagctga 17 <210> SEQ ID NO 324 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 324 gcatgatgtt gagct 15 <210> SEQ ID NO 325 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 325 gcatgangtt gagct 15 <210> SEQ ID NO 326 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 326 gcatggcgtt gagct 15 <210> SEQ ID NO 327 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 327 gcatgtagct gagct 15 <210> SEQ ID NO 328 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 328 gcatgtcgtt gagct 15 <210> SEQ ID NO 329 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 329 gcattcatca ggcgggcaag aat 23 <210> SEQ ID NO 330 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 330 gcattgcgtt gagct 15 <210> SEQ ID NO 331 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 331 gcatttcgag gagct 15 <210> SEQ ID NO 332 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 332 gccaccaaaa cttgtccatg 20 <210> SEQ ID NO 333 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 333 gccagatgtt agctgga 17 <210> SEQ ID NO 334 <211> LENGTH: 24

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 334 gccatggacg aactgttccc cctc 24 <210> SEQ ID NO 335 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 335 gcgacgggcg gcgcgcgccc 20 <210> SEQ ID NO 336 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 336 gcgacggtcg gcgcgcgccc 20 <210> SEQ ID NO 337 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 337 gcgacgtgcg gcgcgcgccc 20 <210> SEQ ID NO 338 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 338 gcgacgttcg gcgcgcgccc 20 <210> SEQ ID NO 339 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 339 gcgatgtcgt tcctgatgcg 20 <210> SEQ ID NO 340 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 340 gcgatgtcgt tcctgatgct 20 <210> SEQ ID NO 341 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 341 gcgccagtcc tccgatagac 20 <210> SEQ ID NO 342 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 342 gcgcgcgcgc gcgcgcgcg 19 <210> SEQ ID NO 343 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 343 gcgctaccgg tagcctgagt 20 <210> SEQ ID NO 344 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 344 gcggcgggcg gcgcgcgccc 20 <210> SEQ ID NO 345 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 345 gcggcgggcg gcgcgcgccc 20 <210> SEQ ID NO 346 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 346 gcggcggtcg gcgcgcgccc 20 <210> SEQ ID NO 347 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 347 gcggcgtgcg gcgcgcgccc 20 <210> SEQ ID NO 348 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 348 gcggcgttcg gcgcgcgccc 20 <210> SEQ ID NO 349 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 349 gcgtcgttcc cccccccccc 20 <210> SEQ ID NO 350 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 350 gcgtgcgttg tcgttgtcgt t 21 <210> SEQ ID NO 351 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 351 gcgttttttt ttgcg 15 <210> SEQ ID NO 352 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 352 gctaaacgtt agcgt 15 <210> SEQ ID NO 353 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 353 gctaacgtta gcgtga 16 <210> SEQ ID NO 354 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 354 gctaccttag cgtga 15 <210> SEQ ID NO 355 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (11)...(11) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 355 gctaccttag ngtga 15 <210> SEQ ID NO 356 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 356 gctacttagc gtga 14 <210> SEQ ID NO 357 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 357 gctagacgat agcgt 15 <210> SEQ ID NO 358 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 358 gctagacgct agcgtga 17 <210> SEQ ID NO 359 <211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 359 gctagacgt 9 <210> SEQ ID NO 360 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 360 gctagacgta agcgtga 17 <210> SEQ ID NO 361 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 361 gctagacgtc tagc 14 <210> SEQ ID NO 362 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 362 gctagacgtt agc 13 <210> SEQ ID NO 363 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 363 gctagacgtt agcgt 15 <210> SEQ ID NO 364 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 364 gctagacgtt agcgtga 17 <210> SEQ ID NO 365 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 365 gctagacgtt agctgga 17 <210> SEQ ID NO 366 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 366 gctagacgtt agctgga 17 <210> SEQ ID NO 367 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 367 gctagacgtt aggctga 17

<210> SEQ ID NO 368 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 368 gctagacgtt agtgt 15 <210> SEQ ID NO 369 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 369 gctagacgtt agngt 15 <210> SEQ ID NO 370 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 370 gctagacgtt tagc 14 <210> SEQ ID NO 371 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 371 gctagagctt agcgtga 17 <210> SEQ ID NO 372 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 372 gctagaggtt agcgtga 17 <210> SEQ ID NO 373 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 373 gctagaggtt agcgtga 17 <210> SEQ ID NO 374 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 374 gctagatgtt aacgt 15 <210> SEQ ID NO 375 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 375 gctagatgtt agcgt 15 <210> SEQ ID NO 376 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 376 gctagatgtt agcgt 15 <210> SEQ ID NO 377 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 377 gctagatgtt agcgtga 17 <210> SEQ ID NO 378 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 378 gctagangtt agcgt 15 <210> SEQ ID NO 379 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 379 gctagangtt agtgt 15 <210> SEQ ID NO 380 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 380 gctagcttta gagctttaga gctt 24 <210> SEQ ID NO 381 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 381 gctaggcgtt agcgt 15 <210> SEQ ID NO 382 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 382 gctagtcgat agc 13 <210> SEQ ID NO 383 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 383 gctagtcgat agcgt 15 <210> SEQ ID NO 384 <211> LENGTH: 13

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 384 gctagtcgct agc 13 <210> SEQ ID NO 385 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 385 gctandcghh agc 13 <210> SEQ ID NO 386 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 386 gctatgacgt tccaaggg 18 <210> SEQ ID NO 387 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 387 gctcga 6 <210> SEQ ID NO 388 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 388 gctcgttcag cgcgtct 17 <210> SEQ ID NO 389 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 389 gctgaacctt ccatgctgtt 20 <210> SEQ ID NO 390 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 390 gctgagctca tgccgtctgc 20 <210> SEQ ID NO 391 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 391 gctggacctt ccat 14 <210> SEQ ID NO 392 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 392 gctggacctt ccat 14 <210> SEQ ID NO 393 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 393 gctggccagc ttacctcccg 20 <210> SEQ ID NO 394 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 394 gctgtaaaat gaatcggccg 20 <210> SEQ ID NO 395 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 395 gctgtggggc ggctcctg 18 <210> SEQ ID NO 396 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 396 gcttgacgtc aagc 14 <210> SEQ ID NO 397 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 397 gcttgacgtc tagc 14 <210> SEQ ID NO 398 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 398 gcttgacgtt tagc 14 <210> SEQ ID NO 399 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 399 gcttgcgttg cgttt 15 <210> SEQ ID NO 400 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 400 gcttggaggg cctgtaagtg 20 <210> SEQ ID NO 401 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 401 ggaacgtt 8 <210> SEQ ID NO 402 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 402 ggaagacgtt aga 13 <210> SEQ ID NO 403 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 403 ggaattagta atagatatag aagtt 25 <210> SEQ ID NO 404 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 404 ggagaaaccc atgagctcat ctgg 24 <210> SEQ ID NO 405 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 405 ggagctcttc gaacgccata 20 <210> SEQ ID NO 406 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 406 ggcagtgcag gctcaccggg 20 <210> SEQ ID NO 407 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 407 ggccaacttt caatgtggga tggcctc 27 <210> SEQ ID NO 408 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 408 ggccatccca cattgaaagt t 21 <210> SEQ ID NO 409 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 409 ggccttttcc cccccccccc 20 <210> SEQ ID NO 410 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 410 ggcggcggcg gcggcggcgg 20 <210> SEQ ID NO 411 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 411 ggcgttattc ctgactcgcc 20 <210> SEQ ID NO 412 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 412 ggctatgtcg atcctagcc 19 <210> SEQ ID NO 413 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 413 ggctatgtcg ttcctagcc 19 <210> SEQ ID NO 414 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 414 ggctccgggg agggaatttt tgtctat 27 <210> SEQ ID NO 415 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 415 ggctgtattc ctgactgccc 20 <210> SEQ ID NO 416 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 416 gggaatgaaa gattttatta taag 24 <210> SEQ ID NO 417 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 417 ggggactttc cgctggggac tttccagggg gactttcc 38 <210> SEQ ID NO 418 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 418 ggggagggag gaacttctta aaattccccc agaatgttt 39

<210> SEQ ID NO 419 <211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 419 ggggagggg 9 <210> SEQ ID NO 420 <211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 420 ggggagggt 9 <210> SEQ ID NO 421 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 421 ggggcatgac gttcaaaaaa 20 <210> SEQ ID NO 422 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 422 ggggcatgac gttcaaaaaa 20 <210> SEQ ID NO 423 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 423 ggggcatgac gttcgggggg 20 <210> SEQ ID NO 424 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 424 ggggcatgac gttcgggggg 20 <210> SEQ ID NO 425 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 425 ggggcatgag cttcgggggg 20 <210> SEQ ID NO 426 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 426 ggggcatgag cttcgggggg 20 <210> SEQ ID NO 427 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 427 ggggcctcta tacaacctgg g 21 <210> SEQ ID NO 428 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 428 gggggacgtt ggggg 15 <210> SEQ ID NO 429 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 429 gggggggggg gggggggggg 20 <210> SEQ ID NO 430 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 430 gggggggggg gggggggggg 20 <210> SEQ ID NO 431 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 431 ggggggttgg ggaaaacccg gacttcctgc a 31 <210> SEQ ID NO 432 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 432 gggggttttt tttttggggg 20 <210> SEQ ID NO 433 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 433 ggggtaatcg atcagggggg 20 <210> SEQ ID NO 434 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 434 ggggtaatcg atgagggggg 20 <210> SEQ ID NO 435 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature

<222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 435 ggggtaatgc atcagggggg 20 <210> SEQ ID NO 436 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 436 ggggtcaacg ttgagggggg 20 <210> SEQ ID NO 437 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 437 ggggtcaacg ttgagggggg 20 <210> SEQ ID NO 438 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 438 ggggtcaagc ttgagggggg 20 <210> SEQ ID NO 439 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 439 ggggtcaagt ctgagggggg 20 <210> SEQ ID NO 440 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 440 ggggtccagc gtgcgccatg gggg 24 <210> SEQ ID NO 441 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 441 ggggtccctg agactgcc 18 <210> SEQ ID NO 442 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 442 ggggtcgacc ttggaggggg g 21 <210> SEQ ID NO 443 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 443 ggggtcgacg tcgagggggg 20 <210> SEQ ID NO 444 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 444 ggggtcgtcg ttttgggggg 20 <210> SEQ ID NO 445 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 445 ggggtctgtc gttttggggg g 21 <210> SEQ ID NO 446 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 446 ggggtctgtg cttttggggg g 21 <210> SEQ ID NO 447 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 447 ggggtgacgt tcagggggg 19 <210> SEQ ID NO 448 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 448 ggggtgtcgt tcagggggg 19 <210> SEQ ID NO 449 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 449 ggggttgacg ttttgggggg 20 <210> SEQ ID NO 450 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 450 ggggttgggg gtt 13 <210> SEQ ID NO 451 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 451 ggtacctgtg gggacattgt g 21

<210> SEQ ID NO 452 <211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 452 ggtgaggtg 9 <210> SEQ ID NO 453 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 453 ggtggtgtag gttttgg 17 <210> SEQ ID NO 454 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 454 ggttacggtc tgtcccatat 20 <210> SEQ ID NO 455 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 455 ggttcacgtg ctcatggctg 20 <210> SEQ ID NO 456 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 456 gtaacgtt 8 <210> SEQ ID NO 457 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 457 gtagccttcc ta 12 <210> SEQ ID NO 458 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 458 gtaggggact ttccgagctc gagatcctat g 31 <210> SEQ ID NO 459 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 459 gtcactcgtg gtacctcga 19 <210> SEQ ID NO 460 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 460 gtccatggcg tgcgggatga 20 <210> SEQ ID NO 461 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 461 gtcccaggtt gtatagaggc tgc 23 <210> SEQ ID NO 462 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 462 gtccccattt cccagaggag gaaat 25 <210> SEQ ID NO 463 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 463 gtccgggcca ggccaaagtc 20 <210> SEQ ID NO 464 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 464 gtcggtcctg atgctgttcc 20 <210> SEQ ID NO 465 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 465 gtctatcgga ggactggcgc 20 <210> SEQ ID NO 466 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 466 gtctgtccca tgatctcgaa 20 <210> SEQ ID NO 467 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (18)...(18) <223> OTHER INFORMATION: I <400> SEQUENCE: 467 gtgaatncgt tcncgggnct 20 <210> SEQ ID NO 468 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 468 gtgccggggt ctccgggc 18 <210> SEQ ID NO 469 <211> LENGTH: 18

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 469 gtgccggggt ctccgggc 18 <210> SEQ ID NO 470 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 470 gtgcgcgcga gcccgaaatc 20 <210> SEQ ID NO 471 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 471 gtgctgatca ccgatatcct gttcgg 26 <210> SEQ ID NO 472 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 472 gtgcttgacc accgatattt gg 22 <210> SEQ ID NO 473 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 473 gtggttacgg tcgtgcccat 20 <210> SEQ ID NO 474 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 474 gtgtcggggt ctccgggc 18 <210> SEQ ID NO 475 <211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 475 gttctcagat aaagcggaac cagcaacaga cacagaa 37 <210> SEQ ID NO 476 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 476 gttgaaaccc gagaacatca t 21 <210> SEQ ID NO 477 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 477 gttggataca ggccagactt tgttg 25 <210> SEQ ID NO 478 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 478 gtttttatat aatttggg 18 <210> SEQ ID NO 479 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 479 gnaatattgc 10 <210> SEQ ID NO 480 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (9)...(9) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (12)...(12) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (14)...(14) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (16)...(16) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 480 gnggngggng gngngngccc 20 <210> SEQ ID NO 481 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 481 taaacgtt 8 <210> SEQ ID NO 482 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 482 taagcgct 8 <210> SEQ ID NO 483 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 483 taagctctgt caacgccagg 20 <210> SEQ ID NO 484 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 484 taccgagctt cgacgagatt tca 23 <210> SEQ ID NO 485 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature

<222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 485 taccgcgtgc gaccctct 18 <210> SEQ ID NO 486 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 486 tactcttcgg atcccttgcg 20 <210> SEQ ID NO 487 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 487 tagaaacagc attcttcttt tagggcagca ca 32 <210> SEQ ID NO 488 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 488 tagacgtc 8 <210> SEQ ID NO 489 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 489 tagacgttag cgtga 15 <210> SEQ ID NO 490 <211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 490 tatagtccct gagactgccc caccttctca acaacc 36 <210> SEQ ID NO 491 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 491 tatcggagga ctggcgcgcc g 21 <210> SEQ ID NO 492 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 492 tatgccgcgc ccggacttat 20 <210> SEQ ID NO 493 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 493 tcaaatgtgg gattttccca tgagtct 27 <210> SEQ ID NO 494 <211> LENGTH: 7 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 494 tcaacgt 7 <210> SEQ ID NO 495 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 495 tcaacgtc 8 <210> SEQ ID NO 496 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: p-ethoxy backbone <400> SEQUENCE: 496 tcaacgtt 8 <210> SEQ ID NO 497 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 497 tcaacgtt 8 <210> SEQ ID NO 498 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 498 tcaacgtt 8 <210> SEQ ID NO 499 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 499 tcaacgttaa cgttaacgtt 20 <210> SEQ ID NO 500 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: misc_feature <222> LOCATION: (32)...(32) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 500 tcaacgttaa cgttaacgtt aacgttaacg tt 32 <210> SEQ ID NO 501 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 501 tcaacgttga 10 <210> SEQ ID NO 502 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature

<222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 502 tcaacgttga 10 <210> SEQ ID NO 503 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 503 tcaacgttga 10 <210> SEQ ID NO 504 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 504 tcaacgttga 10 <210> SEQ ID NO 505 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: p-ethoxy backbone <400> SEQUENCE: 505 tcaagctt 8 <210> SEQ ID NO 506 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 506 tcaagctt 8 <210> SEQ ID NO 507 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 507 tcaatgctga 10 <210> SEQ ID NO 508 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 508 tcaangtt 8 <210> SEQ ID NO 509 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (10)...(10) <223> OTHER INFORMATION: biotinylated at 3' end <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 509 tcaangttga 10 <210> SEQ ID NO 510 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 510 tcaccggt 8 <210> SEQ ID NO 511 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 511 tcacgctaac ctctagc 17 <210> SEQ ID NO 512 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 512 tcacgctaac ctctgac 17 <210> SEQ ID NO 513 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 513 tcacgctaac gtctagc 17 <210> SEQ ID NO 514 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 514 tcacgt 6 <210> SEQ ID NO 515 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 515 tcagaccacg tggtcgggtg ttcctga 27 <210> SEQ ID NO 516 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 516 tcagaccagc tggtcgggtg ttcctga 27 <210> SEQ ID NO 517 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 517 tcagcgct 8

<210> SEQ ID NO 518 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 518 tcagcgtgcg cc 12 <210> SEQ ID NO 519 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 519 tcagctctgg tactttttca 20 <210> SEQ ID NO 520 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 520 tcaggaacac ccgaccacgt ggtctga 27 <210> SEQ ID NO 521 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 521 tcaggaacac ccgaccagct ggtctga 27 <210> SEQ ID NO 522 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 522 tcaggggtgg ggggaacctt 20 <210> SEQ ID NO 523 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 523 tcagngct 8 <210> SEQ ID NO 524 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 524 tcatcgat 8 <210> SEQ ID NO 525 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 525 tccaagacgt tcctgatgct 20 <210> SEQ ID NO 526 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 526 tccaagtagt tcctagttct 20 <210> SEQ ID NO 527 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 527 tccaccacgt ggctgatgct 20 <210> SEQ ID NO 528 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 528 tccaccacgt ggtctatgct 20 <210> SEQ ID NO 529 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 529 tccacgacgt tttcgacgtt 20 <210> SEQ ID NO 530 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 530 tccagacggt gaagt 15 <210> SEQ ID NO 531 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 531 tccagacgtt gaagt 15 <210> SEQ ID NO 532 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 532 tccagagctt gaagt 15 <210> SEQ ID NO 533 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 533 tccagcgtgc gccata 16 <210> SEQ ID NO 534 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone

<400> SEQUENCE: 534 tccaggacgt tcctagttct 20 <210> SEQ ID NO 535 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 535 tccaggactt ctctcaggtt 20 <210> SEQ ID NO 536 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 536 tccaggactt ctctcaggtt 20 <210> SEQ ID NO 537 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 537 tccaggactt tcctcaggtt 20 <210> SEQ ID NO 538 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 538 tccaggactt tcctcaggtt 20 <210> SEQ ID NO 539 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 539 tccaggagct tcctagttct 20 <210> SEQ ID NO 540 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 540 tccaggatgt tcctagttct 20 <210> SEQ ID NO 541 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 541 tccagtctag gcctagttct 20 <210> SEQ ID NO 542 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 542 tccagttcct tcctcagtct 20 <210> SEQ ID NO 543 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 543 tccagttcga gcctagttct 20 <210> SEQ ID NO 544 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 544 tccataacgt tcctgagtct 20 <210> SEQ ID NO 545 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 545 tccataacgt tcctgatgct 20 <210> SEQ ID NO 546 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 546 tccatagcga tcctagcgat 20 <210> SEQ ID NO 547 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 547 tccatagcgg tcctagcggt 20 <210> SEQ ID NO 548 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 548 tccatagcgt tcctagcgtt 20 <210> SEQ ID NO 549 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 549 tccatagcgt tcctagcgtt 20 <210> SEQ ID NO 550 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 550 tccatcacgt gcctgagtct 20 <210> SEQ ID NO 551 <211> LENGTH: 20

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 551 tccatgacat tcctgatgct 20 <210> SEQ ID NO 552 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 552 tccatgacgg tcctgacggt 20 <210> SEQ ID NO 553 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 553 tccatgacgg tcctgacggt 20 <210> SEQ ID NO 554 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 554 tccatgacgg tcctgagtct 20 <210> SEQ ID NO 555 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 555 tccatgacgg tcctgatgct 20 <210> SEQ ID NO 556 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 556 tccatgacgt ccctgagtct 20 <210> SEQ ID NO 557 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 557 tccatgacgt ccctgatgct 20 <210> SEQ ID NO 558 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 558 tccatgacgt tcctagttct 20 <210> SEQ ID NO 559 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 559 tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 <210> SEQ ID NO 560 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 560 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 561 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 561 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 562 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 562 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 563 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 563 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 564 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 564 tccatgacgt tcctgagtct 20 <210> SEQ ID NO 565 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 565 tccatgacgt tcctgatcc 19 <210> SEQ ID NO 566 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 566 tccatgacgt tcctgatgct 20 <210> SEQ ID NO 567 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 567 tccatgacgt tcctgatgct 20

<210> SEQ ID NO 568 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 568 tccatgacgt tcctgcagtt cctgacgtt 29 <210> SEQ ID NO 569 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 569 tccatgacgt tcctgccgtt 20 <210> SEQ ID NO 570 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 570 tccatgacgt tcctgcgttt 20 <210> SEQ ID NO 571 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 571 tccatgacgt tcctggcggg 20 <210> SEQ ID NO 572 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 572 tccatgacgt tcntgatgct 20 <210> SEQ ID NO 573 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 573 tccatgagct tcctgagctt 20 <210> SEQ ID NO 574 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 574 tccatgagct tcctgagtct 20 <210> SEQ ID NO 575 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: p-ethoxy backbone <400> SEQUENCE: 575 tccatgagct tcctgagtct 20 <210> SEQ ID NO 576 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 576 tccatgagct tcctgagtct 20 <210> SEQ ID NO 577 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 577 tccatgagct tcctgatgct 20 <210> SEQ ID NO 578 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 578 tccatgagct tccttgagtc t 21 <210> SEQ ID NO 579 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: I <221> NAME/KEY: modified_base <222> LOCATION: (17)...(17) <223> OTHER INFORMATION: I <400> SEQUENCE: 579 tccatgangt tcctgangtt 20 <210> SEQ ID NO 580 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 580 tccatgatgt tcctagttct 20 <210> SEQ ID NO 581 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 581 tccatgangt tcctagttct 20 <210> SEQ ID NO 582 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 582 tccatgangt tcctgatgct 20 <210> SEQ ID NO 583 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (17)...(17)

<223> OTHER INFORMATION: m5c <400> SEQUENCE: 583 tccatgangt tcctgangtt 20 <210> SEQ ID NO 584 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 584 tccatgccgg tcctgagtct 20 <210> SEQ ID NO 585 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 585 tccatgccgg tcctgatgct 20 <210> SEQ ID NO 586 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 586 tccatgccgg tcctgccggt 20 <210> SEQ ID NO 587 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 587 tccatgccgt tcctgccgtt 20 <210> SEQ ID NO 588 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 588 tccatgccgt tcctgccgtt 20 <210> SEQ ID NO 589 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 589 tccatgcgcg tcctgcgcgt 20 <210> SEQ ID NO 590 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 590 tccatgcgtg cgtgcgtttt 20 <210> SEQ ID NO 591 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 591 tccatgcgtt gcgttgcgtt 20 <210> SEQ ID NO 592 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 592 tccatgctgg tcctgagtct 20 <210> SEQ ID NO 593 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 593 tccatgctgg tcctgatgct 20 <210> SEQ ID NO 594 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 594 tccatggcgg gcctggcggg 20 <210> SEQ ID NO 595 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 595 tccatggcgg tcctgatgct 20 <210> SEQ ID NO 596 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 596 tccatgtagt tcctagttct 20 <210> SEQ ID NO 597 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 597 tccatgtcct tcctgatgct 20 <210> SEQ ID NO 598 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 598 tccatgtcga tcctgagtct 20 <210> SEQ ID NO 599 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 599 tccatgtcga tcctgatgct 20 <210> SEQ ID NO 600 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 600 tccatgtcgc tcctgagtct 20 <210> SEQ ID NO 601 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 601 tccatgtcgc tcctgatcct 20 <210> SEQ ID NO 602 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 602 tccatgtcgg tcctgagtct 20 <210> SEQ ID NO 603 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 603 tccatgtcgg tcctgatgct 20 <210> SEQ ID NO 604 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 604 tccatgtcgg tcctgatgct 20 <210> SEQ ID NO 605 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 605 tccatgtcgg tcctgctgat 20 <210> SEQ ID NO 606 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (12)...(12) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 606 tccatgtcgg tnctgatgct 20 <210> SEQ ID NO 607 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 607 tccatgtcgt tccgcgcgcg 20 <210> SEQ ID NO 608 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 608 tccatgtcgt tcctagttct 20 <210> SEQ ID NO 609 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 609 tccatgtcgt tcctgagtct 20 <210> SEQ ID NO 610 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 610 tccatgtcgt tcctgatgcg 20 <210> SEQ ID NO 611 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 611 tccatgtcgt tcctgatgct 20 <210> SEQ ID NO 612 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 612 tccatgtcgt tcctgccgct 20 <210> SEQ ID NO 613 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 613 tccatgtcgt tcctgtagct 20 <210> SEQ ID NO 614 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 614 tccatgtcgt tcctgtcgtt 20 <210> SEQ ID NO 615 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 615 tccatgtcgt tcctgtcgtt 20 <210> SEQ ID NO 616 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 616 tccatgtcgt ttttgtcgtt 20

<210> SEQ ID NO 617 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 617 tccatgtgct tcctgatgct 20 <210> SEQ ID NO 618 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 618 tccatgtngg tcctgagtct 20 <210> SEQ ID NO 619 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 619 tccatgtngg tcctgatgct 20 <210> SEQ ID NO 620 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 620 tccatgtngt tcctgatgct 20 <210> SEQ ID NO 621 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (17)...(17) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 621 tccatgtngt tcctgtngtt 20 <210> SEQ ID NO 622 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 622 tccattgcgt tccttgcgtt 20 <210> SEQ ID NO 623 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 623 tcccgacggt gaagt 15 <210> SEQ ID NO 624 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 624 tcccgccgtt gaagt 15 <210> SEQ ID NO 625 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 625 tcccgcgcgt tccgcgcgtt 20 <210> SEQ ID NO 626 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 626 tccctgagac tgccccacct t 21 <210> SEQ ID NO 627 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 627 tccgatcg 8 <210> SEQ ID NO 628 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 628 tccggacggt gaagt 15 <210> SEQ ID NO 629 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 629 tccggccgtt gaagt 15 <210> SEQ ID NO 630 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 630 tccgtacg 8 <210> SEQ ID NO 631 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 631 tcctaacgtt gaagt 15 <210> SEQ ID NO 632 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 632 tcctagcgtt gaagt 15

<210> SEQ ID NO 633 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 633 tcctcacgtt gaagt 15 <210> SEQ ID NO 634 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 634 tcctga 6 <210> SEQ ID NO 635 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 635 tcctgaaaag gaagt 15 <210> SEQ ID NO 636 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 636 tcctgacgat gaagt 15 <210> SEQ ID NO 637 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 637 tcctgacgct gaagt 15 <210> SEQ ID NO 638 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 638 tcctgacggg gaagt 15 <210> SEQ ID NO 639 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 639 tcctgacggg gaagt 15 <210> SEQ ID NO 640 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 640 tcctgacggg gagt 14 <210> SEQ ID NO 641 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 641 tcctgacggt gaagt 15 <210> SEQ ID NO 642 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 642 tcctgacggt gaagt 15 <210> SEQ ID NO 643 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 643 tcctgacgta gaagt 15 <210> SEQ ID NO 644 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 644 tcctgacgtc gaagt 15 <210> SEQ ID NO 645 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 645 tcctgacgtg gaagt 15 <210> SEQ ID NO 646 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 646 tcctgacgtg gaagt 15 <210> SEQ ID NO 647 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 647 tcctgacgtt aga 13 <210> SEQ ID NO 648 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 648 tcctgacgtt ccc 13 <210> SEQ ID NO 649 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone

<400> SEQUENCE: 649 tcctgacgtt cccctggcgg tcccctgtcg ct 32 <210> SEQ ID NO 650 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 650 tcctgacgtt cctgacgtt 19 <210> SEQ ID NO 651 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 651 tcctgacgtt cctggcggtc ctgtcgct 28 <210> SEQ ID NO 652 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 652 tcctgacgtt ccttc 15 <210> SEQ ID NO 653 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 653 tcctgacgtt cggcgcgcgc cc 22 <210> SEQ ID NO 654 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 654 tcctgacgtt gaagt 15 <210> SEQ ID NO 655 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 655 tcctgacgtt gaagt 15 <210> SEQ ID NO 656 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 656 tcctgagctt gaagt 15 <210> SEQ ID NO 657 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 657 tcctgagctt gaagt 15 <210> SEQ ID NO 658 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 658 tcctgangtt gaagt 15 <210> SEQ ID NO 659 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 659 tcctgccgtt gaagt 15 <210> SEQ ID NO 660 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 660 tcctgccgtt gaagt 15 <210> SEQ ID NO 661 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 661 tcctggaggg gaagt 15 <210> SEQ ID NO 662 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 662 tcctggaggg gaagt 15 <210> SEQ ID NO 663 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 663 tcctggcggg gaagt 15 <210> SEQ ID NO 664 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 664 tcctggcggg gaagt 15 <210> SEQ ID NO 665 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 665 tcctggcggt cctggcggtt 20 <210> SEQ ID NO 666 <211> LENGTH: 15

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 666 tcctggcggt gaagt 15 <210> SEQ ID NO 667 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 667 tcctggcggt gaagt 15 <210> SEQ ID NO 668 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 668 tcctggcgtg gaagt 15 <210> SEQ ID NO 669 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 669 tcctggcgtt gaagt 15 <210> SEQ ID NO 670 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 670 tcctggcgtt gaagt 15 <210> SEQ ID NO 671 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 671 tcctgggggg gaagt 15 <210> SEQ ID NO 672 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 672 tcctggtggg gaagt 15 <210> SEQ ID NO 673 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 673 tcctggnggg gaagt 15 <210> SEQ ID NO 674 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 674 tcctgtcgct cctgtcgct 19 <210> SEQ ID NO 675 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 675 tcctgtcgct cctgtcgctc ctgtcgct 28 <210> SEQ ID NO 676 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 676 tcctgtcgtt cctgtcgtt 19 <210> SEQ ID NO 677 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 677 tcctgtcgtt cctgtcgttg gaacgacagg 30 <210> SEQ ID NO 678 <211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 678 tcctgtcgtt cctgtcgttt caacgtcagg aacgacagga 40 <210> SEQ ID NO 679 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 679 tcctgtcgtt ccttgtcgtt 20 <210> SEQ ID NO 680 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 680 tcctgtcgtt gaagt 15 <210> SEQ ID NO 681 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 681 tcctgtcgtt gaagtttttt 20 <210> SEQ ID NO 682 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone

<400> SEQUENCE: 682 tcctgtcgtt ttttgtcgtt 20 <210> SEQ ID NO 683 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 683 tccttacgtt gaagt 15 <210> SEQ ID NO 684 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 684 tccttgtcgt tcctgtcgtt 20 <210> SEQ ID NO 685 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 685 tcgacgtc 8 <210> SEQ ID NO 686 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 686 tcgacgttcc cccccccccc 20 <210> SEQ ID NO 687 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 687 tcgagacatt gcacaatcat ctg 23 <210> SEQ ID NO 688 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 688 tcgccgttcc cccccccccc 20 <210> SEQ ID NO 689 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 689 tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> SEQ ID NO 690 <211> LENGTH: 5 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 690 tcgga 5 <210> SEQ ID NO 691 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 691 tcggcgttcc cccccccccc 20 <210> SEQ ID NO 692 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_difference <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 692 tcgtag 6 <210> SEQ ID NO 693 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 693 tcgtca 6 <210> SEQ ID NO 694 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 694 tcgtcattcc cccccccccc 20 <210> SEQ ID NO 695 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 695 tcgtcgatcc cccccccccc 20 <210> SEQ ID NO 696 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 696 tcgtcgctcc cccccccccc 20 <210> SEQ ID NO 697 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 697 tcgtcgctgt ctccg 15 <210> SEQ ID NO 698 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 698 tcgtcgctgt ctccgcttct t 21 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 3' end <400> SEQUENCE: 699 tcgtcgctgt ctccgcttct t 21 <210> SEQ ID NO 700 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 3' end <400> SEQUENCE: 700 tcgtcgctgt ctccgcttct t 21 <210> SEQ ID NO 701 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 701 tcgtcgctgt ctccgcttct tcttgcc 27 <210> SEQ ID NO 702 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 702 tcgtcgctgt ctgcccttct t 21 <210> SEQ ID NO 703 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 703 tcgtcgctgt tgtcgtttct t 21 <210> SEQ ID NO 704 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 704 tcgtcggtcc cccccccccc 20 <210> SEQ ID NO 705 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 705 tcgtcgtcag ttcgctgtcg 20 <210> SEQ ID NO 706 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 706 tcgtcgtcgt cgtcgtcgtc gtt 23 <210> SEQ ID NO 707 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 707 tcgtcgtcgt cgtt 14 <210> SEQ ID NO 708 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 708 tcgtcgtcgt cgtt 14 <210> SEQ ID NO 709 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 3' end <400> SEQUENCE: 709 tcgtcgtcgt cgtt 14 <210> SEQ ID NO 710 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 5' end <400> SEQUENCE: 710 tcgtcgtcgt cgtt 14 <210> SEQ ID NO 711 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 711 tcgtcgttcc ccccccc 17 <210> SEQ ID NO 712 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 712 tcgtcgttcc cccccccccc 20 <210> SEQ ID NO 713 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (20)...(20) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 713 tcgtcgttcc cccccccccc 20 <210> SEQ ID NO 714 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (16)...(16) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 714 tcgtcgttcc cccccncccc 20 <210> SEQ ID NO 715 <211> LENGTH: 26

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 715 tcgtcgttgg tgtcgttggt gtcgtt 26 <210> SEQ ID NO 716 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 716 tcgtcgttgg ttgtcgtttt ggtt 24 <210> SEQ ID NO 717 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 717 tcgtcgttgt cgttgtcgtt 20 <210> SEQ ID NO 718 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 718 tcgtcgttgt cgttgtcgtt 20 <210> SEQ ID NO 719 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 719 tcgtcgttgt cgttttgtcg tt 22 <210> SEQ ID NO 720 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 720 tcgtcgttgt cgttttgtcg tt 22 <210> SEQ ID NO 721 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 721 tcgtcgtttc gtcgttttga cgtt 24 <210> SEQ ID NO 722 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 722 tcgtcgtttg cgtgcgtttc gtcgtt 26 <210> SEQ ID NO 723 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 723 tcgtcgtttg tcgttttgtc gtt 23 <210> SEQ ID NO 724 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 724 tcgtcgtttt gacgttttga cgtt 24 <210> SEQ ID NO 725 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 725 tcgtcgtttt gacgttttgt cgtt 24 <210> SEQ ID NO 726 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 726 tcgtcgtttt gcgtgcgttt 20 <210> SEQ ID NO 727 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 727 tcgtcgtttt gtcgttttgg gggg 24 <210> SEQ ID NO 728 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 728 tcgtcgtttt gtcgttttgt cgt 23 <210> SEQ ID NO 729 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 729 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 730 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 730 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 731 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 731 tcgtcgtttt gtcgttttgt cgtt 24

<210> SEQ ID NO 732 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 732 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 733 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (24)...(24) <223> OTHER INFORMATION: biotinylated at 3' end <400> SEQUENCE: 733 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 734 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 734 tcgtcgtttt gtcgttttgt cgttttgtcg tt 32 <210> SEQ ID NO 735 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 735 tcgtcgtttt gtggttttgt ggtt 24 <210> SEQ ID NO 736 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 736 tcgtcgtttt ttgtcgtttt ttgtcgtt 28 <210> SEQ ID NO 737 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 737 tcgtcgtttt tttttttttt 20 <210> SEQ ID NO 738 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 738 tcgtga 6 <210> SEQ ID NO 739 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 739 tcgtga 6 <210> SEQ ID NO 740 <211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 740 tcgtgg 6 <210> SEQ ID NO 741 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 741 tcgtngttcc cccccccccc 20 <210> SEQ ID NO 742 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 742 tcntcgtntt ntcgtnttnt cgtn 24 <210> SEQ ID NO 743 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 743 tctaaaaacc atctattctt aaccct 26 <210> SEQ ID NO 744 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 744 tctagcgttt ttagcgttcc 20 <210> SEQ ID NO 745 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 745 tctatcccag gtggttcctg ttag 24 <210> SEQ ID NO 746 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 746 tctatcgacg ttcaagcaag 20 <210> SEQ ID NO 747 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 747 tctccatcct atggttttat cg 22 <210> SEQ ID NO 748 <211> LENGTH: 20

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 748 tctccatgat ggttttatcg 20 <210> SEQ ID NO 749 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 749 tctcccagcg agcgagcgcc at 22 <210> SEQ ID NO 750 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 750 tctcccagcg agcgccat 18 <210> SEQ ID NO 751 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 751 tctcccagcg cgcgccat 18 <210> SEQ ID NO 752 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 752 tctcccagcg ggcgcat 17 <210> SEQ ID NO 753 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 753 tctcccagcg tacgccat 18 <210> SEQ ID NO 754 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 754 tctcccagcg tcgccat 17 <210> SEQ ID NO 755 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 755 tctcccagcg tgcgccat 18 <210> SEQ ID NO 756 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 756 tctcccagcg tgcgccat 18 <210> SEQ ID NO 757 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 757 tctcccagcg tgcgccatat 20 <210> SEQ ID NO 758 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 758 tctcccagcg tgcgcctttt 20 <210> SEQ ID NO 759 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 759 tctcccagcg tgcgtgcgcc at 22 <210> SEQ ID NO 760 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 760 tctcccagcg tgcgttatat 20 <210> SEQ ID NO 761 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 761 tctcccagcg tgcgtttt 18 <210> SEQ ID NO 762 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 762 tctcccagcg ttgcgccata t 21 <210> SEQ ID NO 763 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 763 tctcccatcg tcgccat 17 <210> SEQ ID NO 764 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 764

tctcccgacg tgcgccat 18 <210> SEQ ID NO 765 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 765 tctcccgtcg tgcgccat 18 <210> SEQ ID NO 766 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 766 tctccctgcg tgcgccatat 20 <210> SEQ ID NO 767 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 767 tctcctagcg tgcgccatat 20 <210> SEQ ID NO 768 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 768 tctgacgtca tctgacgttg gctgacgtct 30 <210> SEQ ID NO 769 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 769 tctgcgtgcg tgcgccatat 20 <210> SEQ ID NO 770 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 770 tcttcgaa 8 <210> SEQ ID NO 771 <211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 771 tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45 <210> SEQ ID NO 772 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 772 tctttattag tgactcagca cttggca 27 <210> SEQ ID NO 773 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (3)...(3) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 773 tcntgacgtt gaagt 15 <210> SEQ ID NO 774 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 774 tgaacgtt 8 <210> SEQ ID NO 775 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 775 tgcaatgtga cgtcctttag cat 23 <210> SEQ ID NO 776 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 776 tgcaggaagt ccgggttttc cccaaccccc c 31 <210> SEQ ID NO 777 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 777 tgcatcagct ct 12 <210> SEQ ID NO 778 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 778 tgcatcagct ct 12 <210> SEQ ID NO 779 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 779 tgcatccccc aggccaccat 20 <210> SEQ ID NO 780 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 780 tgcatgccgt acacagctct 20

<210> SEQ ID NO 781 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 781 tgcatgccgt acacagctct 20 <210> SEQ ID NO 782 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 782 tgcatgccgt acacagctct 20 <210> SEQ ID NO 783 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 783 tgcatgccgt gcatccgtac acagctct 28 <210> SEQ ID NO 784 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 784 tgccaagtgc tgagtcacta ataaaga 27 <210> SEQ ID NO 785 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 785 tgcccaaaga ggaaaatttg tttcatacag 30 <210> SEQ ID NO 786 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 786 tgcgctct 8 <210> SEQ ID NO 787 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 787 tgctagctgt gcctgtacct 20 <210> SEQ ID NO 788 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 788 tgctagctgt gcctgtacct 20 <210> SEQ ID NO 789 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 789 tgctgcttcc cccccccccc 20 <210> SEQ ID NO 790 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 790 tgctgcttcc cccccccccc 20 <210> SEQ ID NO 791 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 791 tgctgctttt gtgcttttgt gctt 24 <210> SEQ ID NO 792 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 792 tgctgctttt gtgcttttgt gctt 24 <210> SEQ ID NO 793 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 793 tggaccttcc at 12 <210> SEQ ID NO 794 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 794 tggaccttct atgtcggtcc 20 <210> SEQ ID NO 795 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 795 tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 <210> SEQ ID NO 796 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 796 tggaggtccc accgagatcg gag 23 <210> SEQ ID NO 797 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 797 tggttacggt ctgtcccatg 20 <210> SEQ ID NO 798 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0)

<223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 798 tgtatctctc tgaaggact 19 <210> SEQ ID NO 799 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 799 tgtccagccg aggggaccat 20 <210> SEQ ID NO 800 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 800 tgtcccatgt ttttagaagc 20 <210> SEQ ID NO 801 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 801 tgtcgttgtc gtt 13 <210> SEQ ID NO 802 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 802 tgtcgttgtc gttgtcgttg tcgtt 25 <210> SEQ ID NO 803 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 803 tgtcgtttgt cgtttgtcgt t 21 <210> SEQ ID NO 804 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 804 ttaacggtgg tagcggtatt ggtc 24 <210> SEQ ID NO 805 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 805 ttaacgtt 8 <210> SEQ ID NO 806 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 806 ttaagaccaa taccgctacc accg 24 <210> SEQ ID NO 807 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 807 ttaggacaag gtctagggtg 20 <210> SEQ ID NO 808 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorodithioate backbone <400> SEQUENCE: 808 ttagggttag ggttagggtt 20 <210> SEQ ID NO 809 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 809 ttcagttgtc ttgctgctta gctaa 25 <210> SEQ ID NO 810 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 810 ttcatgcctt gcaaaatggc g 21 <210> SEQ ID NO 811 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 811 ttccaatcag ccccacccgc tctggcccca ccctcaccct cca 43 <210> SEQ ID NO 812 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 812 ttccatgctg ttccggctgg 20 <210> SEQ ID NO 813 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 813 ttccatgtcg gtcctgat 18 <210> SEQ ID NO 814 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 814 ttccgccgaa tggcctcagg atggtac 27 <210> SEQ ID NO 815 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 815 ttccgcttta tctgagaacc atct 24 <210> SEQ ID NO 816 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone

<400> SEQUENCE: 816 ttcctctctg caagagact 19 <210> SEQ ID NO 817 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 817 ttcgggcgga ctcctccatt 20 <210> SEQ ID NO 818 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 818 ttcgggcgga ctcctccatt 20 <210> SEQ ID NO 819 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 819 ttcgtcgttt tgtcgttttg tcgtt 25 <210> SEQ ID NO 820 <211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 820 ttctgtgtct gttgctggtt ccgctttatc tgagaac 37 <210> SEQ ID NO 821 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 821 ttgaaactga ggtgggac 18 <210> SEQ ID NO 822 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 822 ttgccccata ttttagaaac 20 <210> SEQ ID NO 823 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 823 ttgggggggg tt 12 <210> SEQ ID NO 824 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 824 ttgtactctc catgatggtt 20 <210> SEQ ID NO 825 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 825 tttacctttt ataaacataa ctaaaacaaa 30 <210> SEQ ID NO 826 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 826 tttgaatcct cagcggtctc cagtggc 27 <210> SEQ ID NO 827 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 827 tttgaattca ggactggtga ggttgag 27 <210> SEQ ID NO 828 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 828 tttgaattcc gtgtacagaa gcgagaagc 29 <210> SEQ ID NO 829 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> SEQUENCE: 829 tttgagaacg ctggaccttc 20 <210> SEQ ID NO 830 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 830 tttgcggccg ctagacttaa cctgagagat a 31 <210> SEQ ID NO 831 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 831 tttgggccca cgagagacag agacacttc 29 <210> SEQ ID NO 832 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 832 tttgggcccg cttctcgctt ctgtacacg 29 <210> SEQ ID NO 833 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 833 ttttctagag aggtgcacaa tgctctgg 28

<210> SEQ ID NO 834 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 834 tttttggggg gggggttttt 20 <210> SEQ ID NO 835 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: misc_feature <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 835 tttttttttt ttt 13 <210> SEQ ID NO 836 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 3' end <221> NAME/KEY: misc_difference <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: FITC labeled <400> SEQUENCE: 836 tttttttttt ttt 13 <210> SEQ ID NO 837 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 837 tttttttttt tttttttt 18 <210> SEQ ID NO 838 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 838 tttttttttt tttttttttt 20 <210> SEQ ID NO 839 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <400> SEQUENCE: 839 tttttttttt tttttttttt 20 <210> SEQ ID NO 840 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 840 tttttttttt tttttttttt t 21 <210> SEQ ID NO 841 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 841 tttttttttt tttttttttt tttt 24 <210> SEQ ID NO 842 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <400> SEQUENCE: 842 tttttttttt tttttttttt ttttttt 27 <210> SEQ ID NO 843 <211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 843 tnaacgtt 8 <210> SEQ ID NO 844 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 844 tngtcgttcc cccccccccc 20 <210> SEQ ID NO 845 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 845 tngtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 846 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 846 tngtggttcc cccccccccc 20 <210> SEQ ID NO 847 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphodiester backbone <221> NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (21)...(21) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 847 tngtgntttt gtngttttgt ngtt 24 <210> SEQ ID NO 848 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: phosphorothioate backbone <221> NAME/KEY: modified_base

<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (13)...(13) <223> OTHER INFORMATION: m5c <221> NAME/KEY: modified_base <222> LOCATION: (21)...(21) <223> OTHER INFORMATION: m5c <400> SEQUENCE: 848 tngtngtttt gtngttttgt ngtt 24

* * * * *

uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed