U.S. patent number 6,977,245 [Application Number 10/068,160] was granted by the patent office on 2005-12-20 for oligodeoxynucleotide and its use to induce an immune response.
This patent grant is currently assigned to The United States of America as represented by the Department of Health and Human Services, The United States of America as represented by the Department of Health and Human Services. Invention is credited to Mayda Gursel, Ken Ishii, Dennis Klinman, James J. Mond, Daniela Verthelyi.
United States Patent |
6,977,245 |
Klinman , et al. |
December 20, 2005 |
**Please see images for:
( Certificate of Correction ) ** |
Oligodeoxynucleotide and its use to induce an immune response
Abstract
D type CpG oligodeoxynucleotides are provided herein that
include a sequence represented by the following formula: wherein
the central CpG motif is unmethylated, Pu is a purine nucleotide,
Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any
integer from 0 to 10, and N is any integer from 4 to 10. Methods of
using these oligodeoxynucleotides to induce an immune response are
provided.
Inventors: |
Klinman; Dennis (Potomac,
MD), Verthelyi; Daniela (Potomac, MD), Ishii; Ken
(Osaka, JP), Mond; James J. (Silver Spring, MD),
Gursel; Mayda (Rockville, MD) |
Assignee: |
The United States of America as
represented by the Department of Health and Human Services
(Washington, DC)
|
Family
ID: |
26748644 |
Appl.
No.: |
10/068,160 |
Filed: |
February 6, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
958713 |
|
|
|
|
|
Current U.S.
Class: |
514/44R;
536/23.1; 536/25.6; 536/25.5 |
Current CPC
Class: |
A61P
37/04 (20180101); A61P 33/02 (20180101); C07H
21/04 (20130101); A61K 31/7088 (20130101); A61K
39/008 (20130101); A61K 39/39 (20130101); A61K
31/7088 (20130101); A61K 2300/00 (20130101); A61K
39/39 (20130101); A61K 2300/00 (20130101); A61K
2039/55561 (20130101); Y02A 50/30 (20180101) |
Current International
Class: |
A61K 048/00 () |
Field of
Search: |
;536/23.1,25.5,25.6
;514/44 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 286 224 |
|
Oct 1988 |
|
EP |
|
0 302 758 |
|
Nov 1989 |
|
EP |
|
0 468 520 |
|
Jan 1991 |
|
EP |
|
0 092 574 |
|
Apr 1992 |
|
EP |
|
0 572 735 |
|
Dec 1993 |
|
EP |
|
0 855 184 |
|
Jul 1998 |
|
EP |
|
1 198 249 |
|
Apr 2002 |
|
EP |
|
WO 91/12811 |
|
Sep 1991 |
|
WO |
|
WO 92/03456 |
|
Apr 1992 |
|
WO |
|
WO 92/18522 |
|
Oct 1992 |
|
WO |
|
WO 92/21353 |
|
Dec 1992 |
|
WO |
|
WO 93/17115 |
|
Sep 1993 |
|
WO |
|
WO 94/19945 |
|
Sep 1994 |
|
WO |
|
WO 95/05853 |
|
Mar 1995 |
|
WO |
|
WO 95/18231 |
|
Jul 1995 |
|
WO |
|
WO 95/26204 |
|
Oct 1995 |
|
WO |
|
WO 96/02555 |
|
Feb 1996 |
|
WO |
|
WO 96/24380 |
|
Feb 1996 |
|
WO |
|
WO 96/35782 |
|
Nov 1996 |
|
WO |
|
WO 97/28259 |
|
Jan 1997 |
|
WO |
|
WO 98/29430 |
|
Dec 1997 |
|
WO |
|
WO 98/14210 |
|
Apr 1998 |
|
WO |
|
WO 98/16247 |
|
Apr 1998 |
|
WO |
|
WO 98/18810 |
|
May 1998 |
|
WO |
|
WO 98/32462 |
|
Jul 1998 |
|
WO |
|
WO 98/37919 |
|
Sep 1998 |
|
WO |
|
WO 98/38319 |
|
Sep 1998 |
|
WO |
|
WO 98/49348 |
|
Nov 1998 |
|
WO |
|
WO 98/52581 |
|
Nov 1998 |
|
WO |
|
WO 98/55495 |
|
Dec 1998 |
|
WO |
|
WO 99/11275 |
|
Mar 1999 |
|
WO |
|
WO 99/37151 |
|
Jul 1999 |
|
WO |
|
WO 99/51259 |
|
Oct 1999 |
|
WO |
|
WO 99/56755 |
|
Nov 1999 |
|
WO |
|
WO 99/58118 |
|
Nov 1999 |
|
WO |
|
WO 99/61056 |
|
Dec 1999 |
|
WO |
|
WO 99/62923 |
|
Dec 1999 |
|
WO |
|
WO 00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/20039 |
|
Apr 2000 |
|
WO |
|
WO 00/21556 |
|
Apr 2000 |
|
WO |
|
WO 00/06588 |
|
Oct 2000 |
|
WO |
|
WO 00/61151 |
|
Oct 2000 |
|
WO |
|
WO 00/62787 |
|
Oct 2000 |
|
WO |
|
WO 00/67023 |
|
Nov 2000 |
|
WO |
|
WO 00/67787 |
|
Nov 2000 |
|
WO |
|
WO 01/00232 |
|
Jan 2001 |
|
WO |
|
WO 01/02007 |
|
Jan 2001 |
|
WO |
|
WO 01/12223 |
|
Feb 2001 |
|
WO |
|
WO 01/12804 |
|
Feb 2001 |
|
WO |
|
WO 01/22990 |
|
Apr 2001 |
|
WO |
|
WO 01/51500 |
|
Jul 2001 |
|
WO |
|
WO 01/55341 |
|
Aug 2001 |
|
WO |
|
WO 01/68077 |
|
Sep 2001 |
|
WO |
|
WO 01/68103 |
|
Sep 2001 |
|
WO |
|
WO 01/68116 |
|
Sep 2001 |
|
WO |
|
WO 01/68117 |
|
Sep 2001 |
|
WO |
|
WO 02/69369 |
|
Sep 2002 |
|
WO |
|
Other References
Mahairas, PNAS, vol. 96, 17:9739-9744, 1999. .
NCBI database, AR009571, Dec. 1998. .
NCBI Database, A86868, Jan. 2000. .
Gene Bank database, AN:: Aq834558/c, Aug. 1999. .
Alama et al., Antisense Oligonucleotides as Therapeutic Agents,:
Pharmacol. Res. 36: 171 (1997). .
Ballas et al., "Induction of NK Activity in Murine and Human Cells
by CpG Motifs in Oligodeoxynucleotides and Bacterial DNA," J.
Immun. 157: 1840 (1996). .
Klinman et al., "CpG Motifs Present in Bacterial DNA Rapidly Induce
Lymphocytes to Secrete Interleukin 6, Interleukin 12 and Interferon
.gamma.," Proc. Natl. Acad. Sci. USA 93: 2879 (1996). .
Kreig et al., "CpG Motifs in Bacterial DNA Trigger Direct B-Cell
Activation," Nature 374: 546 (1995). .
Krieg et al., "CpG Motifs in Bacterial DNA Trigger Direct B-Cell
Activation," Nature 374: 546 (1995). .
Liang et al., "Activation of Human B Cells by Phosphorothioate
Oligodeoxynucleotides," J. Clin. Invest. 98: 1119 (1996). .
Lonnberg et al., "Towards Genomic Drug Therapy with Antisense
Oligonucleotides," Ann. Med. 28: 511 (1996). .
McCluskie et al., "CpG DNA is a Potent Enhancer of Systemic &
Mucosal Immune Response Against Hepatitis B Surface Antigen with
Intra-Nasal Administration to Mice," J. Immun. 161: 4463 (1998).
.
Oberauer, "Not Non-Sense but Antisense--Applications of Antisense
Oligonucleotides in Different Fields of Medicine," Wein Klin
Wochenschr 109: 40 (1997). .
Scanlon et al., "Oligonucleotides-Mediated Modulation of Mammalian
Gene Expression," FASEB J. 9: 1288 (1995). .
Yi et al., "Rapid Immune Activation by CpG Motifs in Bacterial
DNA," J. Immun. 157: 5394 (1996). .
Adya, et al., "Expansion of CREB's DNA recognition specificity by
Tax results from interaction with Ala-Ala-Arg at positions 282-284
near the conserved DNA-binding domain of CREB". Proc. Natl. Acad.
Sci. USA 91(12):5642-5646 (1994). .
Agrawal, et al., "Pharmacokinetics of Oligonucleotides". Ciba.
Found. Symp. 209:60-78 (1997), abstract only. .
Agrawal, et al., "Pharmacokinetics and Bioavailability of Antisense
Oligonucleotides Following Oral and Colorectal Administration of
Experimental Animals". Handb. Exp. Pharmacol.: Antisense Research
and Application 131:525-543 (1998). .
Agrawal, "Antisense Oligonucleotides: Toward Clinical Trials".
Tibtech 14:376-387 (1996). .
Agrawal, et al., "In Vivo Pharmacokinetics of Phosphorothioate
Oligonucleotides Containing Contiguous Guanosines". Antisense &
Nucleic Acid Drug Development 7:245-249 (1997). .
Agrawal, et al., "Absorption, Tissue Distribution and In Vivo
Stability in Rats of a Hybrid Antisense Oligonucleotide Following
Oral Administration". Biochemical Pharmacology 50(4):571-576
(1995). .
Agrawal, et al., "Pharmacokinetics of Antisense Oligonucleotides".
Clin. Pharmacokinet 28(1):7 (1995). .
Agrawal, et al., "Antisense therapeutics: is it as simple as
complementary base recognition?". Molecular Med. Today 6(2):72-81
(2000), abstract only. .
Agrawal, et al., "Pharmacokinetics, biodistribution, and stability
of oligodeoxynucleotide phosphorothioates in mice". Proc. Natl.
Acad. Sci. USA 88:7595-7599 (1991). .
Agrawal, "Medicinal Chemistry and Therapeutic Potential of CpG
DNA". Trends in Molecular Medicine 8(3):114-121 (2002). .
Amaral, et al., "Leishmania amazonensis: The asian rhesus macaques
(Macaca mulatta) as an experimental model for study of cutaneous
leishmaniasis". Exp. Parasitol. 82(1):34-44 (1996). .
Anderson, "Human Gene Therapy". Nature 392:25-30 (Apr. 1998). .
Anderson, et al., "TH2 and `TH2-like` cells in allergy and asthma;
pharmacological perspectives". TiPS 15:324-332 (1994). .
Anfossi, et al., "An oligomer complementary to c-myb-encoded mRNA
inhibits proliferation of human myeloid leukemia cell lines". Proc.
Natl. Acad. Sci. USA 86:3379-3383 (May 1989). .
Angier, "Microbe DNA seen as alien by immune system". New York
Times Page C1, 2 pages (1995). .
Azad, et al., "Antiviral activity of a phosphorothioate
oligonucleotide complementary to RNA of the human cytomegalovirus
major immediate-early region". Amtimicrobial Agents and
Chemotherapy 37:1945-1954 (1993). .
Azuma, "Biochemical and immunological studies on cellular
components of tubercle bacilli", Kekkaku 69(9):45-55 (1992). .
Azzoni, et al., "Sustained Impairment of IFN-.gamma. Secretion in
Suppressed HIV-Infected Patients Despite Mature NK Cell Recovery:
Evidence for a Defective Reconstruction of Innate Immunity". J.
Immunol. 168(11):5764-5770 (2002). .
Banchereau, et al., "Immunobiology of Dendritic Cells". Ann. Rev.
Immunol. 18:767-811 (2000). .
Banchereau & Steinman, "Dendritic Cells and the Control of
Immunity". Nature 392:245-252 (1998). .
Barouch, et al., "Control of Viremia and Prevention of Clinical
AIDS in Rhesus Monkeys by Cytokine-Augmented DNA Vaccination".
Science 290:486-492 (Oct, 2000). .
Bauer, et al., "Bacterial CpG-DNA Triggers Activation and
Maturation of Human CD11c-, CD123+ Dendritic Cells". J. Immunol.
166:5000-5007 (2001). .
Bayever, "Systemic administration of a phosphorothioate
oligonucleotide with a sequence complementary to p53 for acute
myelogenous leukemia and myelodysplastic syndrome: initial results
of a Phase I trial". Antisense Res. Dev. 3:383-390 (1993). .
Benimetskaya, et al., "Formation of a G-tetrad and higher order
structures correlates with biological activity of the RelA
(NF-kBp65) `antisense` oligodeoxynucleotide". Nucleic Acids
Research 25(13):2648-2656 (1997). .
Bennett, et al., "DNA binding to human leukocytes: evidence for a
recptor-mediated association, internalization, and degradation of
DNA". J. Clin. Invest. 76(6):2182-2190 (1985). .
Berg, et al., "Interleukin-10 is a central regulator fo the
response to LPS in murine models of endotoxic shock and the
Shwartzman reaction but not endotoxin tolerance". J. Clin. Invest.
96(5):2339-2347 (1995). .
BIOLABS, "1988-1989 Catalog, Random Primer #s 1230, 1601, 1602".
(). .
Bishop, et al., "Intramolecular G-quartet Motifs Confer Nuclease
Resistance to a Potent Anti-HIV Oligonucleotide". The Journal of
Biological Chemistry 271(10):5698-5703 (Mar. 1996). .
Blanchard, et al., "Interferon-.gamma.Induction by
Lipopolysaccharide: Dependence of Interleukin 2 and Macrophages".
The Journal of Immunology 136(3):963-970 (Feb. 1986). .
Blanco, et al., "Induction of Dendritic Cell Differentiation by
IFN-.alpha. in Systemic Lupus Erythermatosus". Science
294:1540-1543 (2001). .
Blaxter, et al., "Genes expressed in Brugia malayi infective third
stage larvae". Mol. Biochem. Parasitol. 77:77-93 (1996). .
Boggs, et al., "Characterization and modulation of immune
stimulation by modified oligonucleotides". Antisense Nucl. Acid
Drug Dev. 7(5):461-471 (1997). .
Boiarkina, et al., "Dietary supplemental from ground fish meat with
DNA for treatment and prophylaxis". Vopr. Pitan 1:29-31 (1998),
abstract only. .
Branda, et al., "Immune stimulation by an antisense oligomer
complemetary to the rev genes of HIV-1". Biochem. Pharmacol.
45(10):2037-2043 (1993). .
Branda, et al., "Amplification of antibody production by
phosphorothioate oligodeoxynucleotides". J. Lab Clin. Med.
128(3):329-338 (1996). .
Briskin, et al., "Lipopolysaccharide-unresponsive mutant pre-B-cell
lines blocked in NF-kappa B activation". Mol. Cell Bio.
10(1):422-425 (1990). .
Burgess, "The antiproliferative activity of c-myb and c-myc
antisense oligonucleotides in smooth muscle cells is caused by a
nonantisense mechanism". Proc. Natl. Acad. Sci. USA 92:4051-4055
(Apr. 1995). .
Calarota, et al., "Immune Responses in Asymptomatic HIV-1 Infected
patients After HIV-DNA Immunization Followed by Highly Active
Antiretroviral Threatment". J. Immunol. 163(4):2330-2338 (1999).
.
Chace, et al., "Regulation of differentiation in CD5+ and
conventional B cells". Clin. Immunol. Immunopathol. 68(3):327-332
(1993). .
Chang, et al., "The palindromic series I repeats in the simian
cytomegalovirus major immediate-early promoter behave as both
strong basal enhancers and cyclic AMP response elements". J. Virol.
64(1):264-277 (1990). .
Chapuis, et al., "Differentiation of Human Dendritic Cells from
Monocytes in vitro". Eur. J. Immunol. 27:431-441 (1997). .
Chehimi, "Persistent Decreases in Blood Plasmacytoid Dendritic Cell
Number and Function Despite Effective Highly Active Antiretroviral
Therapy and Increased Blood Myeloid Dendritic Cells in HIV-Infected
Individuals". J. Immunol. 168(9):4796-4801 (2002). .
Chu, et al., "CpG oligodeoxynucleotides act as adjuvants that
switch on T helper 1 (Th1) immunity". J. Exp. Med.
186(10):1623-1631 (1997). .
Chun, et al., "Effect of interleukin-2 on the pool of latently
infected, resting CD4+ T-cells in HIV-1-infected patients receiving
highly active anti-retroviral therapy". Nature Med. 5(6):651-655
(1999). .
Chun, et al., "Perspective: Latent reservoirs of HIV: Obstacles to
the eradication of virus". Proc. Natl. Acad. Sci. USA
96:10958-10961 (1999). .
Cohen, et al., "Exploring How to Get at--and Eradicate--Hidden
HIV". Science 279:1854-1855 (1998). .
Cohen & Fauci, et al., "HIV/AIDS in 1998--Gaining the Upper
Hand?". JAMA 280(1):87-88 (1998). .
Cook, et al., "Effect of a Single Ethanol Exposure in HIV
Replication in Human Lymphocytes". J. Invest. Med. 45(5):265-271
(1997). .
Cooper, et al., "Therapeutic Strategies for HIV Infection--Time To
Think Hard". The New England Journal of Medicine 339(18):1319-1321
(1998). .
Cowdery, et al., "Bacterial DNA induces NKcells to product
IFN-gamma in vivo and increases the toxici of lipopolysaccharides".
J. Immunol. 156(12):4570-4575 (1996). .
Crosby, et al., "The early responses gene NGFI-C encodes a zinc
finger transcriptional activator and is a member of the GCGGGGGCG
(GSG) element-binding protein family". Mol. Cell Bio. 2:3835-3841
(1991). .
Crystal, "Transfer of genes to humans: early lessons and obstacles
to success". Science 270:404-410 (1995). .
Cryz, et al., "Vaccine Delivery System--European Commission
COST/STD Initiative Report of the Expert Panel VII". Vaccine
14(7):665-690 (1996). .
D'Andrea, et al., "Interleukin 10 (IL-10) inhibits human lymphocyte
interferon gamma-production by suppressing natural killer cell
stimulatory factor/IL-12 synthesis in accessory cells". J. Exp.
Med. 178(3):1041-1048 (1993). .
Davey, et al., "HIV-1 and T-Cell dynamics after interruption of
highly antiretroviral therapy (HAART) in patients with a history of
sustained viral suppression". Proc. Natl. Acad. Sci. USA
96(26):15109-15114 (1999). .
Davis, et al., "CpG DNA is a Potent Enhancer of Specific Immunity
in Mice Immunized with Recombinant Hepatitis B Surface Antigen". J.
Immunol. 160(2):870-876 (1998). .
Davis, "Plasmid DNA expression systems for the purpose of
immunization". Curr. Opin. Biotechnol. 8(5):635-646 ( Oct. 1997).
.
Dematos, et al., "Pulsing of Dendritic Cells with Cell Lysates from
Either B16 Melanoma or MCA-106 Fibrosarcoma Yields Equally
Effective Vaccines Against B16 Tumors in Mice". J. Surg. Oncol.
68:79-91 (1998). .
Deml, et al., "Immunostimulatory CpG motifs trigger a T Helper-1
immune response to Human Immunodeficiency Virus Type-1 (HIV-1)
gp160 envelope protein". Clin. Chem. Lab. Med. 37(3):199-204
(1999). .
Dias et al., "Minireview: Antisense Oligonucleotides: Basic
Concepts and Mechanisms," Mol. Can. Ther. 1:347-355, 2002. .
Doerfler, et al., "On the Insertion of Foreign DNA into Mammalian
Genomes: Mechanism and Consequences". Gene 157(1-2):241-254 (1995),
abstract only. .
Durham, et al., "Immunotherapy and Allergic Inflammation". Clin.
Exp. Allergy 21 Suppl 1:206-210 (1991). .
Eck, et al., "Chapter 5: Gene-Based Therapy". Goodman &
Gilman's The Pharmacological Basis of Therapeutics 9th ed.:77-101
(1996). .
Elkins, et al., "Bacterial DNA containing CpG motifs stimulates
lymphocyte-dependent protection of mice against lethal infection
with intracellular bacteria". J. Immunol. 162:2291-2298 (1999).
.
Englisch, et al., "Chemically modified oligonucleotides as probes
and inhibitors". Angew. Chem. Int. Ed. Engl. 30:613-629 (1991).
.
Erb, et al., "Infection of mice with Mycobacterium bovis-badillus
Calmette-Guerin (BCG) supresses allergen-induced airway
eosinophilia". J. Exp. Med. 184(4):561-569 (1998). .
Etlinger, "Carrier sequence selection--one key to successful
vaccines". Immunology Today 13(2):52-55 (1992). .
Fanslow, et al., "Effect of Nucleotide Restriction and
Supplementation on Resistance to Experimental Murine Candidasis".
J. Parenter. Enteral. Nutr. 12(1):49-52 Abstract (1988). .
Fields, et al., "Murine Dendritic Cells Pulsed With Whole Tumor
Lysates Mediate Potent Antitumor Immune Response in vitro and in
vivo". Proc. Natl. Acad. Sci. USA 95:9482-9487 (1998). .
Filion, et al., "Major Limitations in the use of Cationic Liposomes
for DNA Delivery". Int. J. Pharmaceuticals 162:159-170 (1998).
.
Fox, "Mechanism of action of hydroxychloroquine as an antirheumatic
drug". Chem. Abstracts 120:15, Abstract No. 182630 (1 page) (1994).
.
Freidag, et al., "CpG oligodeoxynucleotides and interleukin-12
improve the efficacy of Mycobacterium bovis BCG vaccination in mice
challenged with M. tuberculosis". Infect. Immun. 68:2948-2953
(2000). .
Gao, et al., "Phosphorothioate oligonucleotides are inhibitors of
human DNA polymerases and Rnase H: Implications for antisense
technology". Mol. Pharmacol. 41:223-229 (1992). .
Garraud, "Regulation of Immunoglobin Production in Hyper-IgE
(Job's) Syndrome". J. Allergy Clin. Immunol. 103(2 Pt 1):333-340
(Feb. 1999). .
Gluckman, et al., "In Vitro Generation of Human Dendritic Cells and
Cell Therapy". Cytokines Cell Mol. Ther. 3:187-196 (1997). .
Gramzinski, et al., "Interleukin-12- and gamma interferon-dependent
protection against malaria conferred by CpG oligodeoxynucleotide in
mice". Infect. Immun. 69(3):1643-1649 (2001). .
Gura, "Antisense has growing pains". Science 270:575-576 (1995).
.
Gursel, "Sterically Stabilized Cationic Liposomes Improve the
Uptakeand Immunostimulatory Activity of CpG Oligonucleotides". J.
Immunol. 167(6):3324-3328 (2001). .
Gursel, et al., "Differential and Competitive Activation of Human
Immune Cells by Distinct Classes of CpG Oligodeoxynucleotide". J.
Leuko. Biol. 71:813-820 (2002). .
Hadden, et al., "Immunopharmacology". JAMA 268(20):2964-2969
(1992). .
Hadden, et al., "Immunostimulants". TiPS 141:169-174 (1993). .
Halpern, et al., "Bacterial DNA induces murine interferon-gamma
production by stimulation of interleukin-12 and tumor necrosis
factor-alpha". Cell Immunol. 167(1):72-89 (1996). .
Haslett, et al., "Strong Human Immunodeficiency Virus (HIV)
Specific CVD4+ T Cell Responses in a Cohort of Chronically Infected
Patients are Associated with Interruptions in Anti-HIV
Chemotherapy", J. Infect. Diseases 181:1264-1272 (2000). .
Hatzfeld, "Release of early human hematopoietic progenitors from
quiescence by antisense transformin owth factor .beta.1 or Rb
oligonucleotides". J. Exp. Med. 174:925-929 (1991). .
Havlir, et al., "Maintenance Antiretroviral Therapies in
HIV-Infected Subjects with Undetectable Plasma HIV RNA after
Triple-Drug Therapy". The New England Journal of Medicine
339(18):1261-1268 (1998). .
Hayashi, et al., "Enhancement of innate immunity against
Mycobacterium avium infection by immunostimulatory DNA is mediated
by indoteamine 2,3-dioxygenase". Infect. Immun. 69:6156-6164
(2001). .
Hertl, et al., "Inhibition of Interferon-.gamma.-Induced
Intercellular Adhesion Molecule-1 Expression on Human Keratinocytes
by Phosphorothioate Antisense Oligodeoxynucleotides is the
Consequence of Antisense-Specific and Antisense-Non-Specific
Effects". The Journal of Investigative Dermatology 104(5):813-818
(May 1995). .
Highfield, "Sepsis: the more, the murkier". Biotechnology 12:828
(1994). .
Hoeffler, et al., "Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5', monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions". Mol. Endocrinol. 5(2):256-266
(1991). .
Honess, et al., "Deviations from Expected Frequencies of CpG
Dinucleotides in Herpesvirus DNAs May be Diagnostic of Differences
in the States of Their Latent Genomes". J. Gen. Vir. 70(4):837-855
(1989). .
Horspool, et al., "Nucleic acid vaccine-induces immune responses
require CD28 costimulation and are regulated by CTLA4". J. Immunol.
160:2706-2714 (1998). .
Hughes, et al., "Influence of Base Composition on Membrane Binding
and Cellular Uptake of 10-mer Phosphorothioate Oligonucleotides in
Chinese Hamster Ovary (CHRC5) Cells". Antisense Research and
Development 4:211-215 (1994). .
Iguchi-Ariga, et al., "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation". Genes Dev.
3(5):612-619 (1989). .
Imami, et al., "Assessment of Type 1 and Type 2 Cytokines in HIV
Type 1-Infected Individuals: Impact of Highly Active Antiretroviral
Therapy". AIDS Research and Human Retroviruses 15(17):1499-1508
(1999). .
Ishibashi, et al., "Sp1 Decoy Transfected to Carcinoma Cells
Suppresses the Expression of Vascular Endothelial Growth Factor,
Transforming Growth Factor .beta., and Tissue Factor and Also Cell
Growth and Invasion Activities". Cancer Research 60:6531-6536
(2000). .
Ishikawa, et al., "IFN induction and associated changes in splenic
leukocyte distribution". J. Immunol. 150(9):3713-3727 (1993). .
Iversen, et al., "Pharmacokinetics of an antisense phosphorothioate
oigodeoxynucleotide against rev from human immunodeficiency virus
type 1 in the adult male rat following single inections and
continuous infusion". Antisense Res. Dev. 4:43-52 (1994). .
Jakway, et al., "Growth regulation of the B lymphoma cell line
WEHI-23 1 by anti-immunoglobulin, lipopolysaccharide, and other
bacterial products". J. Immunol. 137(7):2225-2231 (1996). .
Jaroszewski, et al., "Cellular uptake of antisense
oligonucleotides". Adv. Drug Delivery Rev. 6(3):235-250 (1991).
.
Jilek, et al., "Antigen-Independent Suppression of the Allergic
Immune Response to Bee Venom Phospholipase A2 by DNA Vaccination in
CBA/J Mice". J. Immunol. 166:3612-3621 (2001). .
Jones, et al., "Synthetic Oligonucleotides Containing CpG Motifs
Enhance Immunogenicity of a Peptide Malaria Vaccine in Aotus
Monkeys". Vaccine 17:3065-3071 (1999). .
Juffermans, et al., "CpG oligodeoxynucleotides enhance host defense
during murine tuberculosis". Infect. Immun. 70:147-152 (2002).
.
Kadowaki, et al., "Distinct CpG DNA and Polyinosinic-Polycytidylic
Acid Double Stranded RNA, Respectively, Stimulate CD11c- Type 2
Dendritic Cell Precursoes and CD11c+ Dendritic cells to Produce
Type I IFN". J. Immunol. 166:2291-2295 (2001). .
Kataoka, et al., "Antitumor activity of synthetic oligonucleotides
with sequences from cDNA encodin proteins of Mycobacterium bovis
BCG". Jpn. J. Cancer Res. 83:244-247 (1992). .
Kenney, et al., "Protective Immunity Using Recombinant Human IL-12
and Alum as Adjuvants in a Primate Model of Cutaneous
leishmaniasis". J. Immunol. 163(8):4481-4488 (1999). .
Khaled, et al., "Multiple mechanisms may contribute to the cellular
anti-adhesive effects of phosphorothioate oligodeoxynucleotides".
Nucleic Acids Research 24(4):737-745 (1996). .
Kimura, et al., "Binding of oligoguanylate to scavenger receptors
is required for oligonucleotides to augment NK cell activity and
induce IFN". J. Biochem 116(5):991-994 (1994). .
Kline, et al., "CpG motif oligonucleotides are effective in
prevention of eosinophilic inflammation in a murine model of
asthma". J. Invest. Med. 44(7):380A (1 page) (1996). .
Kline, et al., "CpG oligonucleotides can reverse as well as prevent
TH2-mediated inflammation in a murine model of asthma". J. Invest.
Med. 45(7):298A (1 page) (1997). .
Kline, et al., "Immune redirection by CpG oligonucleotides,
Conversion of a Th2 response to a Th1 response in a murine model of
asthma". J. Invest. Med. 45(3):282A (1 page) (1997). .
Klinman, et al., "Immune recognition of foreign DNA: a cure for
bioterrorism?". Immunity 11:123 (1 page) (1999). .
Klinman, et al., "Repeated administration of synthetic
oligodeoxynucteotides expressing CpG motifs provides tong-term
protection against bacterial infection". Infect. Immun.
67:5658-5663 (1999). .
Klinman, et al., "Activation of the innate immune system by CpG
oligodeoxynucleotides: immunoprotective activity and safety".
Springer Semin. Immunopathol. 22:173-183 (2000). .
Kou, et al., "Analysis and Regulation of interferon-gamma
production by peripheral blood lymphocytes from patients with
bronchial asthma". Arerugi 43(3):483-491 (1994), abstract only.
.
Krieg, et al., "CpG motifs in bacterial DNA and their immune
effect". Annu. Rev. Immunol. 20:709-760 (2002). .
Kreig, et al., "Brief Communication: Oligodeoxynucleotide
Modifications Determine the Magnitude of B-Cell Stimulation by CpG
Motifs". Antisense & Nucleic Acid Drug Development 6:133-139
(1996). .
Krieg, et al., "Phosphorothioate oligodeoxynucleotides: antisense
or anti-protein?". Antisense Res. Dev. 5:241 (1 page) (1995). .
Krieg, et al., "Uptake of oligodeoxyribonucleotides by lymphoid
cells is heterogeneous and inducible". Antisense Res. Dev.
1(2):161-171 (1991). .
Krieg, et al., "Leukocyte stimulation by oligodeoxynucleotides".
Applied Antisense Oligonucleotide Tech. (BOOK):431-448 (1998).
.
Krieg, et al., "Causing a Commotion in the Blood: Immunotherapy
Progresses from Bacteria to Bacterial DNA". Immunology Today
21(10):521-526 (2000). .
Krieg, et al., "CpG DNA: A pathogenic factor in systemic lupus
erythematosus?". J. Clin. Immunol. 15(6):284-292 (1995). .
Krieg, et al., "CpG DNA induces sustained IL-12 expression in vivo
and resistance to Listeria monocytogenes challenge". J. Immunol.
161:2428-2434 (1998). .
Krieg, et al., "A role for endogenous retroviral sequences in the
regulation of lymphocyte activation". J. Immunol. 143(8):2448-2451
(1989). .
Krieg, "An inate immune defense mechanism based on the recognition
of CpG motifs in microbial DNA". J. Lab. Clin. Med. 128(2):128-133
(Abstract) (1996). .
Krieg, et al., "Modification of antisense phosphodiester
oligodeoxynucleotides by a 5'cholesteryl moiety increases cellular
association and improves efficacy". Proc. Natl. Acad. Sci. USA
90:1048-1052 (1993). .
Krieg, et al., "The role of CpG dinucleotides in DNA vaccines".
Trends in Microbiol. 6:23-27 (1998). .
Krieger, et al., "Structures and Functions of Multiligand
Lipoprotein Receptors: Macrophage Scavenger Receptors and LDL
Receptor-Related Protein (LRP)". Annu. Rev. Biochem 63:601-637
(1994). .
Krug, et al., "Identification of CpG Oligonucleotide Sequences with
High Induction of IFN-.alpha./.beta. in Plasmacytoid Dendritic
Cells". Eur. J. Immunol. 31:2154-2163 (2001). .
Krug, et al., "Toll-like Receptor Expression Reveals CpG DNA as a
Unigue Microbial Stimulus for Plasmacytoid Dendritic Cells Which
Synergizes With CD40 Ligand to Induce High Amounts of IL-12". Eur.
J. Immunol. 31:3026-3037 (2001). .
Kuchan, et al., "Nucleotides in Infant Nutrition: Effects of Immune
Function". Pediatr. Adolesc. Med. Basel. Karger 8:80-94 (1998).
.
Kulkarni, et al., "Effect of Dietary Nucleotides on Response to
Bacterial Infection". J. Parenter. Enteral. Nutr. 10(2):169-171
Abstract (1986). .
Kuramoto, et al., "Oligonucleotide sequences required for natural
killer cell activation". Jpn. J. Cancer Res. 83:1128-1131 (1992).
.
Lagrange, et al., "Immune Responses Directed Against Infectious and
Parasitic Agents". Immunology (BOOK--ISBN:0471017604)(Chapter of
Book; Ed--Jean-Francois Bach): (1978). .
Lang, et al., "Guanosine-rich oligodeoxynucleotides induce
proliferation of macrophage progenitors in cultures of murine bone
marrow cells". Eur. J. Immunol. 29:3496-3506 (1999). .
Lapatschek, et al., "Activation of Macrophages and B Lymphocytes by
an Oligodeoxynucleotide Derived from an Acutely Pathogenic Simian
Immunodeficiency Virus". Antisense Nucleic Acid Drug Dev.
8(5):357-370 (Oct. 1998). .
Ledergerber, et al., "Clinical Progression and Virological Failure
on Highly Active Antiretroviral Therapy in HIV-1 Patients: a
Prospective Cohort Study". The Lancet 353:863-868 (1999). .
Lederman, et al., "Polydeooxyguanine Motifs in a 12-mer
Phosphorothioate Oligodeooxynucleotide Augment Binding to the v3
Loop of the HIV-1 gp120 and Potency of HIV-1 Inhibition
Independently of G-Tetrad Formation". Antisense & Nucleic Acid
Drug Development 6:281-289 (1996). .
Lee, et al., "An Oligonucleotide Blocks Interferon-y Signal
Transduction". Transplantation 62(9):1297-1301 (1996). .
Leibson, et al., "Role of .gamma.-interferon in antibody-producing
responses". Nature 309:799-801 (1984). .
Leonard, et al., "Conformation of guanine 8-oxoadenine base pairs
in the crystal structure of d(CGCGCAATT(O8A)GCG)". Biochemistry
31(36):8415-8420 (1992). .
Li, et al., "Long-Lasting Recovery in CDR T-Cell Function and Viral
-Load Reduction After Highly Active Antiretroviral Therapy in
Advanced HIV-1 Disease". The Lancet 351:1682-1686 (1998). .
Lipford, et al., "CpG-containing synthetic oligonucleotides promote
B and cytotoxic T cell responses to protein antigen: a new class of
vaccine adjuvants". Eur. J. Immunol. 27(9):2340-2344 (1997). .
Lipford, et al., "Immunostimulatory DNA: sequence-dependent
production of potentially harmful or useful cytokines". Eur. J.
Immunol. 27(12):3420-3426 (1997). .
Macaya, et al., "Thrombin-binding DNA aptamer forms a unimolecular
quadruplex structure in solution". Proc. Natl. Acad. Sci. USA
90:3745-3749 (Apr. 1993). .
Macfarlane, et al., "Antagonism of immunostimulatory
CpG-oligodeoxynucleotides by quinacrine, chloroquine, and
structurally related compounds". J. Immunol. 160(3):1122-1131
(1998). .
Maddon, "The Isolation and Nucleotide Sequence of a cDNA Encoding
the T Cell Surface Protein T4: A New Member of the Immunoglobulin
Gene Family". Cell 42(1):93-104 (1985). .
Maltese, et al., "Sequence context of antisense RelA/NF-kB
phohphorothioates determines specificity". Nucleic Acids Research
23(7):1146-1151 (1995). .
Manzel, et al., "Lack of Immune Stimulation by Immobilized
CpG-oligonucletide". Antisense & Nucleic Acid Drug Development
9(5):459-464 (1999). .
Mastrangelo, et al., "Gene therapy for human cancer: an essay for
clinicians". Seminars Oncology 23(1):4-21 (1996). .
Matson, et al., "Nonspecific suppression of [3H]thymidine
incorporation by control oligonucleotides". Antisense Res. Dev.
2(4):325-330 (1992). .
McCluskie, et al., "Route and Method of DNA Vaccine Influence
Immune Responses in Mice and Non-Human Primates". Molecular Med.
5(5):287-300 (1999). .
McIntyre, et al., "A sense phosphorothioate oligonucleotide
directed to the initiation codon of transcription factor NF-kappa B
p65 causes sequence-specific immune stimulation". Antisense Res.
Dev. 3(4):309-322 (1993). .
McKenzie, "Nucleic Acid Vaccines". Immunologic Res. 24(3):225-244
(2001). .
Merad, et al., "In vivo Manipulation of Dendritic Cells to Induce
Therapeutic Immunity". Blood 99(5):1676-1682 (2002). .
Messina, et al., "Stimulation of in vitro murine lymphocyte
proliferation by bacterial DNA". Cell Immunol. 147(6):1759-1764
(1991). .
Messina, et al., "The influence of DNA structure on the in vitro
stimulation of murine lymphocytes by natural and synthetic
polynucleotide antigens". J. Immunol. 147:148-157 (1993). .
Mojcik, et al., "Administration of a phosphorothioate
oligonucleotide antisense murine endogeneous retroviral MCF env
causes immune effect in vivo in a sequence-specific manner". Clin.
Immunol. Immunopathol. 67(2):130-136 (1993). .
Moss & Ledman, "Immunication of the Immunocompromised Host".
Clinical Focus on Primary Immune Deficiencies (1(1):1-3 (1998).
.
Mottram, et al., "A novel CDC2-related protein kinase from
leishmania mexicana, LmmCRK1, is post-translationally regulated
during the life cycle". J. Biol. Chem. 268(28):21044-21052 (1993).
.
Nyce, et al., "DNA antisense therapy for asthma in an animal
model". Nature 385:721-725 (1997). .
Ogg, et al., "Quantitation of HIV-1-Specific Cytotoxic
T-Lymphocytes and Plasma Load of Viral RNA". Science 279:2103-2106
(1998). .
Okada, et al., "Bone Marrow-Derived Dendritic Cells Pulsed With a
Tumor-Specific Peptide Elicit Effective Anti-Tumor Immunity Against
Intracranial Neoplasms". Int. J. Cancer 78:196-201 (1998). .
Palucka, et al., "Dendritic Cells as the Terminal Stage of Monocyte
Differentiation". J. Immunol. 160:4587-4595 (1999). .
Papasavvas, et al., "Enhancement of Human Immunodeficiency Virus
Type I-Specific CD4 and CD8 T Cell Responses in Chronically
Infected Persons after Temporary Treatement Interruption". J.
Infect. Diseases 182:766-775 (200). .
Pialoux, et al., "A Randomized Trial of Three Maintenance Regimens
Given After Three Months of Induction Therapy with Zidovudine,
Lamivudine, and Indinavie in Previously Untreated HIV-1-Infected
Patients". The New England Journal of Medicine 339(18):1269-1276
(1998). .
Piscitelli, "Immune-Based Therapies for Treatment of HIV
Infection". The Annals of Pharmacotherapy 30:62-76 (1996). .
Pisetsky, et al., "Immunological Properties of Bacterial DNA". Ann.
NY Acad. Sci. 772:152-163 (1995). .
Pisetsky, "Immunological consequences of nucleic acid therapy".
Antisense Res. Dev. 5:219-225 (1995). .
Pisetsky, "The immunological properties of DNA". J. Immunol.
156:421-423 (1996). .
Pisetsky, et al., "Stimulation of murine lymphocyte proliferation
by a phosphorothioate oligonucleotide with antisense activity for
hepes simplex virus". Life Science 54:101-107 (1994), abstract
only. .
Pisetsky, "Stimulation of in vitro proliferation of murine
lymphocytes by synthetic oligodeoxynucleotides". Molecular Biol.
Reports 18:217-221 (1993). .
Plenat, "Animal models of antisense oligonucleotides: lessons for
use in humans". J. Mol. Med. Today 2(6):250-257 (1996). .
Prasad, et al., "Oligonucleotides Tethered to a Short Polyguanylic
Acid Stretch are Targeted to Macrophages: Enhanced Antiviral
Activity of a Vesicular Stomatitis Virus-Specific Antisense
Oligonucleotide". Antimicrobial Agents and Chemotherapy
43(11):2689-2696 (Nov. 1999). .
Quddus, et al., "Treating activated CD4+ T cells with either of two
distinct DNA methyltransferase inhibitors, 5-azacytidine or
procaniamide, is sufficient to cause a lupus-like disease in
syngeneic mice". J. Clin. Invest. 92(1):38-53 (1993). .
Ramanathan, et al., "Characterization of the
Oligodeoxynucleotide-mediated Inhibition of
Interferon-.gamma.-induced Major Histocompatibility Complex Class I
and Intercellular Adhesion Molecule-1". The Journal of Biological
Chemistry 269(40):24564-24574 (Oct. 1994). .
Ramanathan, et al., "Inhibition of Interferon-.gamma.-Induced Major
Histocompatibility Complex Class I Expression by Certain
Oligodeoxynucleotides". Transplantation 57(4):612-615 (Feb. 1994).
.
Raz, "Deviation of the Allergic IgE to an IgG Response by Gene
Immunotherapy". Int. Rev. Immunol. 18(3):271-289 (1999). .
Raz, et al., "Preferential Induction of a Th1 Immune Response and
Inhibition of Specific IgE Antibody Formation by Plasmid DNA
Immunization". Proc. Natl. Acad. Sci. USA 93:5141-5145 (1996).
.
Raz, et al., "Intradermal gene immunization: the possible role of
DNA uptake in the induction of cellular immunity to viruses". Proc.
Natl. Acad. Sci. USA 91:9519-9523 (1994). .
Ricci, et al., "T cells, cytokines, IgE and allergic airways
inflammation". J. Invest. Allergol Clin. Immunol. 4(5):214-220
(1994). .
Rojanasakul, "Antisense oligonucleotide therapeutics: drug delivery
and targeting". Drug Delivery Reviews 18:115-131 (1996). .
Roman, et al., "Immunostimulatory DNA sequences function as T
helper-1-promoting aduvants". Nature Med. 3(8):849-854 (1997).
.
Rosenberg, et al., "Immune Control of HIV-1 After Early Treatment
of Acute Infection". Nature 407:523-526 (2000). .
Rosenberg, et al., "Vigorous HIV-1-Specific CD4+ T-Cell Responses
Associated with Control of Viremia". Science 278:1447-1450 (1997).
.
Ruiz, et al., "Structured Treatment Interruption in Chronically
HIV-1 Infected Patients After Long-Term Viral Suppression". AIDS
14:397-403 (2000). .
Santini, et al., "Type I Interferon as a Powerful Adjuvant for
Monocyte-derived Dendritic Cell Development and Activity In Vitro
and in Hu-PBL-SCID Mice". J. Exp. Med. 191:1777-1788 (2000). .
Sato, et al., "Immunostimulatory DNA sequences necessary for
effective intradermal gene immunization". Science 273:352-354
(1996). .
Schnell, et al., "Identification and characterization of a
Saccharomyces cerevisiae gene (PAR 1) conferring resistance to iron
chelators". Eur. J. Biochem. 200:487-493 (1991). .
Schoofs, "Small Steps--A Limited Experiment Opens New Approach in
Fight Against HIV". Wall Street Journal (Sep. 28, 2000). .
Schubbert, et al., "Ingested Foreign (phage M13) DNA Survives
Transiently in the Gastrointestinal Tract and Enters the
Bloodstream of Mice". Mol. Gen. Genet. 242:495-504 (1994). .
Schwartz, et al., "Endotoxin responsiveness and grain dust-induced
inflammation in the lower respiratory tract". Am. J. Physiol.
267(5):609-617 (1994). .
Schwartz, et al., "The role of endotoxin in grain dust-induced lung
disease". Am. J. Respir. Crit. Care Med. 152(2):603-608 (1995).
.
Schwartz, et al., "CpG motifs in bacterial DNA cause inflammation
in the lower respiratory tract". J. Clin. Invest. 100(1):68-73
(1997). .
Sedegah, et al., "Intertukin 12 induction of interferon g-dependent
protection against malaria". Proc. Natl. Acad. Sci. USA
91:10700-10792 (1994). .
Sethi, et al., "Postexposure prophytaxis against prion disease with
a stimulator of innate immunity". Lancet 360:229-230 (2002). .
Shafer, et al., "Highly Active Antiretroviral Therapy (HAART) for
the Treatment of Infection With Human Immunodeficiency Virus Type
1". Biomed. & Pharmachther. 53:73-86 (1999). .
Shirakawa, et al., "The inverse association between tuberculin
responses and atopic disorder". Science 275(5296):77-79 (1997).
.
Sidman, et al., ".gamma.-Interferon is one of several direct B
cell-maturing lymphokines". Nature 309:801-804 (1984). .
Sparwasser, et al., "Macrophages sense pathogens via DNA motifs:
induction of tumor necrosis factor-alpha-mediated shock". Eur. J.
Immunol. 27(7):1671-1679 (1997). .
Sparwasser, et al., "Bacterial DNA and immunostimulatory CpG
oligonuceotides trigger maturation and activation of murine
dendritic cells". Eur. J. Immunol. 28:2045-2054 (1998). .
Spiegelberg, et al., "Recognition of T Cell Epitopes and Lymphokine
Secretion by Rye Grass Allergen Lolium perenne I-Specific Human T
Cell Clones". J. of Immunology 152:4706-4711 (1994). .
Stacey, et al., "Immunostimulatory DNA as an adjuvant in
vaccination against Leishmania major". Infect. Immun. 67:3719-3726
(1999). .
Stein, et al., "Oligodeoxynucleotides as inhibitors of gene
expression: a review". Cancer Res. 48:2659-2668 (1998). .
Stull, et al., "Antigene, ribozyme, and aptamer nucleic acid drugs:
progress and prospects". Pharm. Res. 12(4):465-483 (1995). .
Su, et al., "Vaccination against Chlamydial Genital Tract Infection
after Immunization with Dendritic Cells Pulsed Ex Vivo with
Nonviable Chlamydiae". J. Exp. Med. 188:809-818 (1998). .
Subramanian, et al., "Theoretical considerations on the `spine of
hydration` in the minor groove of d(CGCGAATTCGCG) d(CGGCTTAAGCGC):
Monte Carlo computer simulation". Proc. Natl. Acad. Sci. USA
85:1836-1840 (1988). .
Syme, et al., "Generation of Dendritic Cells ex vivo: Differences
in Steady State versus Mobilized Blood from Patients with Breast
Cancer, with Lymphoma, and from Normal Donors". J. Hematother. Stem
Cell Res. 10:621-630 (2001). .
Tanaka, et al., "An antisense oligonucleotide complementary to a
sequence in I gamma 2b increases gamma 2b germhine transcripts,
stimulates B cell DNA synthesis and inhibits immunoglobulin
secretion". J. Exp. Med. 175:597-607 (1992). .
Tarte, et al., "Extensive characterization of dendritic cells
generated in serum-free conditions: regulation of soluble antigen
uptake, apoptotic tumor cell phagocytosis, chemotaxis and T cell
activation during maturation in vitro". Leukemia 14:2182-2192
(2000). .
Thorne, "Experimental grain dust atmospheres generated by wet and
dry aerosolization techniques". Am. J. Ind. Med. 25(1):109-112
(1994). .
Tighe, et al., "Conjunction of Protein to Immunostimulatory DNA
results in a Rapid Long-Lasting and Potent Induction of
Cell-Mediated and Humoral Immunity". Eur. J. Immunol. 30:1939-1947
(2000). .
Tokunaga, et al., "A synthetic single-stranded DNA, poly(dG, dC),
induces interferon-.alpha./.beta. and -.gamma., augments natural
killer activity and suppresses tumor growth". Jpn. J. Cancer Res.
79:682-686 (1988). .
Tokunaga, et al., "Synthetic oligonucleotides with particular base
sequences from the cDNA encoding proteins of Mycobacterium bovis
BCG induce interferons and activate natural killer cells".
Microbiol. Immunol. 36(1):55-66 (1992). .
Uhlmann, et al., "Antisense oligonucleotides: a new therapeutic
principle". Chem. Rev. 90:543-584 (1990). .
Verdijk, et al., "Polyriboinosinic Polyribocytidylic Acid
(Poly(I:C)) Induces Stable Maturation of Functionally Active Human
Dendritic Cells". J. Immunol. 163:57-61 (1999). .
Verma, et al., "Gene therapy--promises, problems and prospects".
Nature 389:239-242 (Sep. 1997). .
Verthelyi, et al., "Human Peripheral Blood Cells Differentially
Recognize and Respond to Two Distinct CpG Motifs". J. Immunol.
166:2372-2377 (2001). .
Verthelyi, et al., "CpG Oligodeoxynucleotides as Vaccine Adjuvants
in Primates". J. Immunol. 168:1659-1663 (2002). .
Vil'ner, "Effect of Amphotericin B on the interferonogenic activity
of poly(G) poly (C) and poly(G,I).poly(C) in mice and their
resistance to infection by the tick-borne encephalitis virus".
Antibiotiki 27(11):827-830 (Nov. 1982), abstract. .
Vil'ner, et al., "Effect of virazole on the antiviral activity of
poly(G) X poly.COPYRGT. and other polyribonucleotide
interferongens". Antibiotiki 29(6):450-453 (1984), abstract. .
Vil'ner, et al., "Evaluation of the size of the continuous poly(G)
site necessary for the biological activity of the poly(G).poly(C)
complex". Vopr Virusol 30(3):337-340 (1985), abstract. .
Vil'ner, "Effect of the size of the continuous poly(G) site in
poly(G,A).poly(C) complexes on their interferon-inducing activity
and their capacity to stimulate the development of the immunity".
Vopr Virusol 31(6):697-700 (1986), abstract. .
Vil'ner, et al., "Dependence of the antiviral activity of the
poly(G).poly(C) complex on the size of the continuous poly(C)
segments". Vopr Virusol 33(3):331-335 (1988), abstract. .
Wagner, "Bacterial CpG DNA Activates Immune Cells to Signal
Infectious Danger". Adv. Immunol. 73:329-368 (1999). .
Wagner, "Gene inhibition using antisense oligodeoxynucleotides".
Nature 372:333-335 (1994). .
Walker, et al., "Activated T Cells and Cytokines in Bronchoalveolar
Lavages from Patients with Various Lung Diseases Associated with
Eosinophilia". Am. J. Respir. Crit. Care Med. 150: 1038-1048
(1994). .
Walker, et al., "Iminunostimulatory oligodeoxynucleotides promote
protective immunity and provide systemic therapy for leishmaniasis
via IL-12- and IFN-g-dependent mechanisms". Proc. Natl. Acad. Sci.
USA 96:6970-6975 (1999). .
Wallace, et al., "Oligonucleotide probes for the screening of
recombinant DNA libraries". Methods Enzymol. 152:432-442 (1987).
.
Weiner, "The immunobiology and clinical potential of
immunostimulatory CpG oligodeoxynucleotides". Leukocyte Bio.
68:455-463 (2000). .
Weiner, et al., "Immunostimulatory oligodeoxynucleotides containing
the CpG motif are effective as immune adjuvants in tumor antigen
immunization". Proc. Natl. Acad. Sci. USA 94:10833-10837 (1997).
.
Weiss, "Upping the antisense ante: scientists bet on profits from
reverse genetics". Science 139:108-109 (1991). .
Whalen, et al., "DNA-Mediated Immunization to the Helatitis B
Surface Antigen: Activation and Entrainment of the Immune
Response". Ann. NY Acad. Sci. 772:64-76 (1995). .
Whalen, "DNA vaccines for emerging infection diseases: what if?".
Emerg. Infect. Dis. 2(3):168-175 (1996). .
Wloch, et al., "The influence of DNA sequence on the
immunostimulatory properties of plasmid DNA vectors". Hum. Gene
Ther. 9(10):1439-1447 (Jul. 1998). .
Woolridge, et al., "Immunostimulatory oligodeoxynucleotides
containing CpG motifs enhance the efficacy of monoclonal antibody
therapy of lymphoma". Blood 89:2994-2998 (1997). .
Wu, et al., "Receptor-mediated gene delivery and expression in
vivo". J. Biol. Chem. 263:14621-14624 (1988). .
Wu-Pong, "Oligonucleotides: opportunities for drug therapy and
research". Pharmaceutical Tech. 18:102-114 (1994). .
Wyatt, et al., "Combinatorially selected guanosine-quartet
structure is a potent inhibitor of human immunodeficiency virus
envelope-mediated cell fusion". Proc. Natl. Acad. Sci. USA
91:1356-1360 (Feb. 1994). .
Yamamoto, et al., "Ability of oligonucleotides with certain
palindromes to induce interferon production and augment natural
killer cell activity is associated with their base length".
Antisense Res. Dev. 4:119-123 (1994). .
Yamamoto, "Unique palindromic sequences in synthetic
oligonucleotides are required to induce inf and augment
INF-mediated natural killer activity". J. Immunol.
148(12):4072-4076 (1992). .
Yamamoto, et al., "In vitro augmentation of natural killer cell
activity and production of interferon-alpha/beta and -gamma with
deoxyribonucleic acid fraction from Mycobacterium bovis BCG". Jpn.
J. Cancer Res. 79:866-873 (1988). .
Yamamoto, et al., "Synthetic oligonucleotides with certain
palindromes stimulate interferon production of human peripheral
blood lymphocytes in vitro". Jpn. J. Cancer Res. 85:775-779 (1994).
.
Yamamoto, et al., "Mode of action of oligonucleotide fraction
extracted from Mycobacterium bovis BeG". Kekkaku 69(9):29-32
(1994). .
Yamamoto, et al., "DNA from bacteria, but not vetebrates, induces
interferons, activates natural killer cells, and inhibits tumor
growth". Microbiol. Immunol. 36(9):983-997 (1992). .
Yamamoto, et al., "Lipofection of synthetic
oligodeoxyribonucleotide having a palindromic sequence AACGTT to
murine splenocytes enhances interferon production and natural
killer activity". Microbiol. Immunol. 38(10):831-836 (1994). .
Yaswen, et al., "Effects of Sequence of Thioated Oligonucleotides
on Cultured Human Mammary Epithelial Cells". Antisense Research and
Development 3:67-77 (1993). .
Yew, et al., "Contribution of Plasmid DNA to Inflammation in the
Lung After Administration of Cationic Lipid: pDNA Complexes". Hum.
Gene Ther. 10(2):223-234 (1999). .
Yi, et al., "IFN-.gamma. promotes IL-6 and 1gM secretion in
response to CpG motifs in bacterial DNA and oligodeoxynucleotides".
J. Immunol. 156:558-564 (1996). .
Zelphati, et al., "Inhibition of HIV-1 Replication in Cultured
Cells with Antisense Oligonucleotides Encapsulated in
Immunoliposomes". Antisense Res. Dev. 3:323 (1993). .
Zhang, et al., "Antigen- and Isotype-Specific Immune Responses to a
Recombinant Antigen-Allergen Chimeric (RAAC) Protein". J. Immunol.
151:791-799 (1993). .
Zhao, et al., "Comparison of cellular binding and uptake of
antisense phosphodiester, phosphorothioate, and mixed
phosphorothioate and methylphosphonate oligonucleotides". Antisense
Res. Dev. 3(1):53-66 (1993). .
Zhao, et al., "Stage-specific oligonucleotide uptake in murine bone
marrow B-Cell precursors". Blood 84(11):3660-3666 (1994). .
Zheng, et al., "Contribution of Vascular Endothelial Growth Factor
in the Neovascularization Process During the Pathogenesis of
Herpetic Stromal Keratitis". J. Vriol. 75(20):9828-9835 (2001).
.
Zhu, et al., "Macaque blood-derived antigen-presenting cells elicit
SIV-specific immune responses". J. Med. Primatol 29:182-192 (2000).
.
Zimmermann, et al., "CpG oligodeoxynucleotides trigger protective
and curative Th1 responses in lethal murine leishmaniasis". J.
Immunol. 160:3627-3630 (1998)..
|
Primary Examiner: Nguyen; Dave Trong
Attorney, Agent or Firm: Klarquist Sparkman, LLP
Government Interests
STATEMENT OF GOVERNMENT SUPPORT
This invention was supported in part by Military Interdepartmental
Purchase Request MM8926. The Government of the United States has
certain rights in this invention.
Parent Case Text
PRIORITY CLAIM
This is a continuation-in-part of U.S. application Ser. No.
09/958,713 filed on Oct. 11, 2001, which is the United States
national phase application under 35 U.S.C. .sctn. 371 of PCT
Application No. PCT/US00/09839 filed on Apr. 12, 2000, which claims
priority to U.S. Provisional Patent Application No. 60/128,898
filed on Apr. 12, 1999, all of which are incorporated herein by
reference in their entirety.
Claims
We claim:
1. A substantially pure or isolated oligodeoxynucleotide of between
18 and 30 nucleotides in length, comprising any one of
2. The stabilized oligodeoxynucleotide of claim 1, wherein the
oligodeoxynucleotide is modified to prevent degradation.
3. The stabilized oligodeoxynucleotide of claim 1, wherein the
oligodeoxynucleotide has a phosphate backbone modification.
4. The stabilized oligodeoxynucleotide of claim 3, wherein the
phosphate backbone modification is a phosphorothioate backbone
modification.
5. An oligodeoxynucleotide delivery complex comprising the
stabilized oligodeoxynucleotide of claim 1, and a targeting
moiety.
6. The stabilized oligodeoxynucleotide delivery complex of claim 5,
wherein the targeting moiety is selected from the group consisting
of a cholesterol, a virosome, a liposome, a lipid, and a target
cell specific binding agent.
7. The oligodeoxynucleotide of delivery complex of claim 5, wherein
the stabilized oligodeoxynucleotide and the targeting moiety are
covalently linked.
8. A pharmacological composition comprising the stabilized
oligodeoxynucleotide of claim 1, and a pharmacologically acceptable
carrier.
9. The stabilized oligodeoxynucleotide of claim 1, wherein the
stabilized oligonucleotide comprises at least one phosphodiester
base.
10. The stabilized oligodeoxynucleotide of claim 9, wherein the
stabilized oligonucleotide comprises a plurality of phosphodiester
bases.
11. The stabilized oligodeoxynucleotide of claim 9, wherein the
stabilized oligonucleotide comprises one or more phosphorothioate
bases.
12. The stabilized oligodeoxynucleotide of claim 9, wherein the
stabilized oligonucleotide comprises a plurality of
phosphorothioate bases.
13. The stabilized oligodeoxynucleotide of claim 1, further
comprising at least one additional G in the 5' far flanking region.
Description
FIELD OF THE DISCLOSURE
The present invention relates to the induction of an immune
response, specifically to oligodeoxynucleotides including a CpG
motif and their use in inducing an immune response.
BACKGROUND
Cells of the immune system recognize and are activated by conserved
pathogen associated molecular patterns (PAMPs) in infectious
agents. The unmethylated CpG dimers embedded in bacterial DNA, as
well as certain synthetic oligodeoxynucleotides (ODNs) containing
unmethylated CpG sequences (termed a CpG motif) that emulated them,
are more frequent in the genomes of bacteria and viruses than
vertebrates. Recent studies suggest that immune recognition of
these motifs may contribute to the host's innate immune response
(Klinman et al., Proc. Natl. Acad. Sci. USA 93: 2879, 1996; Yi et
al, J. Immun. 157: 5394, 1996; Liang et al., J. Clin. Invest.
98:1119, 1996; Krieg et al., 374 Nature 374: 546, 1995).
In mice, CpG DNA induces proliferation in almost all (>95%) of B
cells and increases immunoglobulin (Ig) secretion. This B-cell
activation by CpG DNA is T-cell independent and antigen
non-specific. In addition to its direct effects on B cells, CpG DNA
has also been shown to activate cells of the immune system (see,
for example, International Patent Applications WO 95/26204, WO
96/02555, WO 98/11211, WO 98/18810, WO 98/37919, WO 98/40100, WO
98/52581, PCT/US98/047703, and PCT/US99/07335; U.S. Pat. No.
5,663,153).
Although bacterial DNA and certain oligonucleotides can induce a
murine immune response, little is known about the immunostimulatory
capacity of these materials for the human immune system (Ballas et
al., 157 J. Immun. 157: 1840 1996). In addition, differences in the
responsiveness of human and murine B cells to certain stimuli
render it difficult to extrapolate results obtained from mouse to
man.
In view of the above, there exists a need for oligonucleotides that
induce an immune response in humans. In addition, there is a need
for methods utilizing CpG containing oligonuceotides in the
treatment of human diseases.
BRIEF SUMMARY OF SPECIFIC EMBODIMENTS
A substantially pure or isolated oligodeoxynucleotide (ODN) is
disclosed herein that is at least about 16 nucleotides in length.
The ODNs are referred to herein as D type ODNs, and are distinct
from the previously described K type ODNs.
The oligodeoxynucleotide includes a sequence represented by the
following formula:
wherein the central CpG motif is unmethylated, Pu is a purine
nucleotide, Py is a pyrimidine nucleotide, X and W are any
nucleotide, M is any integer from 0 to 10, and N is any integer
from 4 to 10. In one embodiment, X.sub.1 X.sub.2 X.sub.3 and
X.sub.4 X.sub.5 X.sub.6 are self-complementary. In another
embodiment, at least two G's are included at the 5' end of the
molecule, such that the oligodeoxynucleotide includes a sequence
represented by the formula:
These oligodexoynucleotides are also referred to as "D type"
oligodeoxynucleotides. In one embodiment, Pu.sub.1 Py.sub.2 CpG
Pu.sub.3 Py.sub.4 are phosphodiester bases. In one specific,
non-limiting example, Pu.sub.1 is an adenine and Py.sub.2 is a
tyrosine. In another specific, non-limiting example, Pu.sub.3 is an
adenine and Py.sub.4 is a tyrosine.
These oligodeoxynucleotides stimulate cell types of the immune
system to mount distinct immune responses. In one embodiment, the
oligonucleotide induces production of a cytokine. Specific,
non-limiting examples are interferon-gamma (IFN-.gamma.),
interferon-alpha (IFN-.alpha.), IP-10, or IL-10. In another
embodiment, a method is provided for activating a cell of the
immune system. These cells include, but are not limited to,
dendritic cells, natural killer (NK cells), and monocytes. Thus by
employing D type ODN, the immune system can be manipulated to
support specific therapeutic goals.
Also disclosed herein is a delivery complex for D type
oligodeoxynucleotides and pharmacological composition comprising
the D-type oligodeoxynucleotides.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 is a set of bar graphs illustrating the response of PBMC to
K and D ODN. PBMC from 35 donors were stimulated for 72 h with K or
D ODN (3 mM). D19 (GGTGCATCGATGCAGGGGGG, SEQ ID NO: 1) and D29
(GGTGCACCGGTGCAGGGGGG, SEQ ID NO: 2) exemplify the response of PBMC
to ODN that selectively induce IFN-.gamma., whereas K3
(ATCGACTCTCGAGCGTTCTC, SEQ ID NO: 3) and K23 (TCGAGCGTTCT, SEQ ID
NO: 4) exemplify ODN that induce IgM and IL-6 secretion and cell
proliferation but little IFN-.gamma.. Control ODN have the CG dimer
reversed or the C in the CG dimer replaced by a T; therefore,
control D (GGTGCACGCGTGCAGGGGGG, SEQ ID NO: 5) and control K
(TGCAGGCTTCTC, SEQ ID NO: 6). Bases in bold-face type are
phosphorodiester, and those in normal type are phosphorothioate.
Cytokine and immunoglobulin (Ig) concentrations in supernatants
were determined by ELISA, and cell proliferation was assessed by
[.sup.3 H] thymidine uptake. All assays were done in triplicate.
Statistical significance was determined by the nonparametric
Mann-Whitney U test.
FIG. 2 is several sets of sequences and bar graphs showing the
parameters governing D ODN induced immune activation. FIG. 2A is a
set of sequences and a bar graph demonstrating that D ODNs require
an unmethylated CpG. FIG. 2B is a set of sequences and a bar graph
demonstrating that D ODNs require a phosphodiester backbone for
optimal stimulation. FIG. 2C is a set of sequences and a bar graph
demonstrating that a self complementary Pu.sub.1 Py.sub.2 CpG
Pu.sub.3 Py.sub.4 increases the stimulation index. FIG. 2D is a set
of sequences and a bar graph showing how size of an ODN affects
stimulation index. FIG. 2E is a set of sequences and a bar graph
demonstrating that increased stimulation is obtained with a self
complementary flanking region. FIG. 2F is a set of sequences and a
bar graph demonstrating that 3' poly-G sequences can be used to
improve activity of D ODNs. The ODN shown here are representative
of 120 ODN used to characterize the structural requirements of D
ODN. CGs are underlined; immunostimulatory motifs are in bold;
extended motifs are in italics; methylated bases have an asterisk;
dots indicate identity; and shaded backgrounds identify
phosphorodiester-linked bases. Important base changes in the
sequence are circled. Data is expressed as stimulation indices,
representing the fold increase in cytokine secretion relative to
unstimulated cells from the same donor. Bars represent the mean and
SE of 20 different experiments. The ODN shown do not induce
significant levels of IgM or proliferation. Statistical
significance was determined by the non-parametric Mann-Whitney U or
nonparametric ANOVA: *, p<0.05; **, p<0.01; ***,
p<0.001.
FIG. 3 shows the cell type-dependent response to CpG ODN. Fold
increase in IFN-.gamma. production by NK-92cells and IL-6-secreting
cell number by RPMI 8226 cells in response to ODN (3 mM for NK
cells and 1 mM for B cells). The number of cells secreting IL-6 was
determined by ELISPOT, and the secretion of IFN-g was determined at
72 h in culture supernatants by ELISA. Sequences: D19, D29 (see
FIG. 1), D28 (GGTGCGTCGATGCAGGGGGG, SEQ ID NO: 7), K16
(TC-GACTCTCGAGCGTTCTC, SEQ ID NO: 8), K19 (ACTCTCGAGCGTTCTC, SEQ ID
NO:9), K101 (CTCGAGCGTTCT, SEQ ID NO: 10). Statistical significance
determined by non-parametric Mann-Whitney U and non-parametric
ANOVA tests.
FIG. 4A-F show the results of a study where PBMC from 8-20 normal
human donors (A, C and E) and 20 rhesus macaques were stimulated
for 72 hours with a panel of "K", "D" or control ODN (3 .mu.M).
IL-6 and IFN-.alpha. (A and B) levels in culture supernatants were
determined by ELISA while cell proliferation was assessed by
[H].sup.3 thymidine uptake (C and D). Note that D ODN induce the
secretion of IFN.alpha. while K ODN induce cell proliferation and
IL-6 production. All assays were performed in triplicate.
Statistical significance was determined by ANOVA of log normalized
data. * p<0.05; ** p<0.01.
FIG. 5A-C shows the results of a study where PBMC from rhesus
macaques (N=12-20) were stimulated in vitro for 72 hours with a
mixture of D19, D29 and D35 (1 .mu.M each) or K3 and K123 (1.5
.mu.M each). D122 and K163 were used in the control ODN mixture.
Levels of IL-6 (B) and IFN.alpha. (C) in culture supernatants were
measured by ELISA, while proliferation was measured by [H].sup.3
-thymidine uptake (A). Statistical significance was determined by
ANOVA of the normalized data. ** p<0.01.
FIG. 6 shows the results of a study where Macaques (3/group) were
immunized on day 0 s.c. with 4 .mu.g of OVA plus 125 .mu.g of alum
and 250 .mu.g of a mixture of (D19+D29), (K3+K23) or control (AA3M)
ODN. Monkeys were boosted 12 weeks later (black arrow). Serum IgG
anti-OVA titers were determined by ELISA. Values represent the
geometric mean titer.+-.SEM. The anti-OVA IgG titers in the group
that received "D" ODN are significantly higher (p<0.01).
FIG. 7 shows the results of a study were Rhesus macaques were
primed subcutaneously (s.c.) with 250 .mu.g of alum-adjuvanted HKLV
alone (N=6) or combined with 500 .mu.g of a mixture of (D19, D29
and D35) (N=5) or (K3 and K123) (N=5) and boosted 4 weeks later. On
week 14, the monkeys were challenged on the opposite forehead with
10.sup.7 metacyclic promastigotes. The average size of the
resultant lesions is shown as the mean area (calculated as mean
diameter/2).sup.2.times.pi). Macaques immunized with
HKLV-ALUM-"D"ODN had significantly smaller lesions (p<0.01).
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
I . Abbreviations
A: adenine
Ab: antibody
APC: antigen presenting cell
C: cytosine
APC: antigen presenting cell
CpG ODN: an oligodexoynucleotide (either a D or a K type) including
a CpG motif.
DC: dendritic cell
FCS: fetal calf serum
G: guanine
h: hour
HKLV: heat-killed leishmania vaccine
IFN-.alpha.: interferon alpha
IFN-.gamma.: interferon gamma
IL-10: interleukin 10
mm: millimeter
mRNA: messenger ribonucleic acid.
ODN: oligodeoxynucleotide
Pu: purine
Py: pyrimidine
s.c.: subcutaneaous
T: thymine
.mu.g: microgram
II. Terms
Unless otherwise noted, technical terms are used according to
conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al.
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
Unless otherwise explained, all technical and scientific terms used
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. The
singular terms "a," "an," and "the" include plural referents unless
context clearly indicates otherwise. Similarly, the word "or" is
intended to include "and" unless the context clearly indicates
otherwise. The term "comprises" means "includes." It is further to
be understood that all base sizes or amino acid sizes, and all
molecular weight or molecular mass values, given for nucleic acids
or polypeptides are approximate, and are provided for description.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, suitable methods and materials are described
below. In case of conflict, the present specification, including
explanations of terms, will control. In addition, the materials,
methods, and examples are illustrative only and not intended to be
limiting.
In order to facilitate review of the various embodiments of the
invention, the following explanations of specific terms are
provided:
Allergen: A substance that can induce an allergic or asthmatic
response in a susceptible subject. The list of allergens is
enormous and can include pollens, insect venoms, animal dander
dust, fungal spores and drugs (e.g. penicillin). Examples of
natural, animal and plant allergens include proteins specific to
the following genera: Canine (Canis familiaris); Dermatophagoides
(e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia); Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinosa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashel); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis). The term "allergy"
refers to acquired hypersensitivity to a substance (allergen). An
"allergic reaction" is the response of an immune system to an
allegen in a subject allergic to the allergen. Allergic conditions
include eczema, allergic rhinitis or coryza, hay fever, bronchial
asthma, urticaria (hives) and food allergies, and other atopic
conditions.
Animal: Living multi-cellular vertebrate organisms, a category that
includes, for example, mammals and birds. The term mammal includes
both human and non-human mammals. Similarly, the term "subject"
includes both human and veterinary subjects.
Antigen: A compound, composition, or substance that can stimulate
the production of antibodies or a T-cell response in an animal,
including compositions that are injected or absorbed into an
animal. An antigen reacts with the products of specific humoral or
cellular immunity, including those induced by heterologous
immunogens. The term "antigen" includes all related antigenic
epitopes.
Anti-infectious agent: A substance (such as a chemical compound,
protein, antisense oligonucleotide, or other molecule) of use in
treating infection of a subject. Anti-infectious agents include,
but are not limited to, anti-fungals, anti-virals, and
antibiotics.
Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two
strands, a 5'.fwdarw.3' strand, referred to as the plus strand, and
a 3'.fwdarw.5' strand (the reverse compliment), referred to as the
minus strand. Because RNA polymerase adds nucleic acids in a
5'.fwdarw.3' direction, the minus strand of the DNA serves as the
template for the RNA during transcription. Thus, the RNA formed
will have a sequence complementary to the minus strand and
identical to the plus strand (except that U is substituted for
T).
Antisense molecules are molecules that are specifically
hybridizable or specifically complementary to either RNA or the
plus strand of DNA. Sense molecules are molecules that are
specifically hybridizable or specifically complementary to the
minus strand of DNA. Antigene molecules are either antisense or
sense molecules directed to a dsDNA target. In one embodiment, an
antisense molecule specifically hybridizes to a target mRNA and
inhibits transcription of the target mRNA.
Asthma: A disorder of the respiratory system characterized by
inflammation, narrowing of the airways and increased reactivity of
the airways to inhaled agents. Asthma is frequently, although not
exclusively associated with atopic or allergic symptoms.
Autoimmune disorder: A disorder in which the immune system produces
an immune response (e.g. a B cell or a T cell response) against an
endogenous antigen, with consequent injury to tissues.
CpG or CpG motif: A nucleic acid having a cytosine followed by a
guanine linked by a phosphate bond in which the pyrimidine ring of
the cytosine is unmethylated. The term "methylated CpG" refers to
the methylation of the cytosine on the pyrimidine ring, usually
occurring the 5-position of the pyrimidine ring. A CpG motif is a
pattern of bases that include an unmethylated central CpG
surrounded by at least one base flanking (on the 3' and the 5' side
of) the central CpG. Without being bound by theory, the bases
flanking the CpG confer part of the activity to the CpG
oligodeoxynucleotide. A CpG oligonucleotide is an oligonucleotide
that is at least about ten nucleotides in length and includes an
unmethylated CpG. CpG oligonucleotides include both D and K type
oligodeoxynucleotides (see below). CpG oligodeoxynucleotides are
single-stranded. The entire CpG oligodeoxynucleotide can be
unmethylated or portions may be unmethylated. In one embodiment, at
least the C of the 5' CG 3' is unmethylated.
Cancer: A malignant neoplasm that has undergone characteristic
anaplasia with loss of differentiation, increase rate of growth,
invasion of surrounding tissue, and is capable of metastasis. For
example, thyroid cancer is a malignant neoplasm that arises in or
from thyroid tissue, and breast cancer is a malignant neoplasm that
arises in or from breast tissue (such as a ductal carcinoma).
Residual cancer is cancer that remains in a subject after any form
of treatment given to the subject to reduce or eradicate thyroid
cancer. Metastatic cancer is a cancer at one or more sites in the
body other than the site of origin of the original (primary) cancer
from which the metastatic cancer is derived.
Chemotherapy; chemotherapeutic agents: As used herein, any chemical
agent with therapeutic usefulness in the treatment of diseases
characterized by abnormal cell growth. Such diseases include
tumors, neoplasms, and cancer as well as diseases characterized by
hyperplastic growth such as psoriasis. In one embodiment, a
chemotherapeutic agent is an agent of use in treating neoplasms
such as solid tumors. In one embodiment, a chemotherapeutic agent
is radioactive molecule. One of skill in the art can readily
identify a chemotherapeutic agent of use (e.g. see Slapak and Kufe,
Principles of Cancer Therapy, Chapter 86 in Harrison's Principles
of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch.
17 in Abeloff, Clinical Oncology 2.sup.nd ed., .COPYRGT. 2000
Churchill Livingstone, Inc; Baltzer L, Berkery R (eds): Oncology
Pocket Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year Book,
1995; Fischer D S, Knobf M F, Durivage H J (eds): The Cancer
Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book,
1993).
Cytokine: Proteins made by cells that affect the behavior of other
cells, such as lymphocytes. In one embodiment, a cytokine is a
chemokine, a molecule that affects cellular trafficking.
Dendritic cell (DC): Dendritic cells are the principle antigen
presenting cells (APCs) involved in primary immune responses. Their
major function is to obtain antigen in tissues, migrate to lymphoid
organs and present the antigen in order to activate T cells.
When an appropriate maturational cue is received, DC are signaled
to undergo rapid morphological and physiological changes that
facilitate the initiation and development of immune responses.
Among these are the up-regulation of molecules involved in antigen
presentation; production of pro-inflammatory cytokines, including
IL-12, key to the generation of Th1 responses; and secretion of
chemokines that help to drive differentiation, expansion, and
migration of surrounding naive Th cells. Collectively, these
up-regulated molecules facilitate the ability of DC to coordinate
the activation and effector function of other surrounding
lymphocytes that ultimately provide protection for the host.
Although the process of DC maturation is commonly associated with
events that lead to the generation of adaptive immunity, many
stimuli derived from the innate branch of the immune system are
also capable of activating DC to initiate this process. In this
manner, DC provide a link between the two branches of the immune
response, in which their initial activation during the innate
response can influence both the nature and magnitude of the ensuing
adaptive response. A dendritic cell precursor is a cell that
matures into an antigen presenting dendritic cell. In one
embodiment, a dendritic cell is a plasmacytoid dendritic cell.
Differentiation: The process by which cells become more specialized
to perform biological functions, and differentiation is a property
that is totally or partially lost by cells that have undergone
malignant transformation. For example, dendritic cell precursors
undergo maturation to become APCs.
Epitope: An antigenic determinant. These are particular chemical
groups or peptide sequences on a molecule that are antigenic, i.e.
that elicit a specific immune response. An antibody binds a
particular antigenic epitope.
Functionally Equivalent: Sequence alterations, for example in a D
type ODN, that yield the same results as described herein. Such
sequence alterations can include, but are not limited to,
deletions, base modifications, mutations, labeling, and
insertions.
Immune response: A response of a cell of the immune system, such as
a B cell, T cell to a stimulus. In one embodiment, the response is
specific for a particular antigen (an "antigen-specific
response").
Immune system deficiency: A disease or disorder in which the
subject's immune system is not functioning in normal capacity or in
which it would be useful to boost a subject's immune response.
Immune system deficiencies include those diseases or disorders in
which the immune system is not functioning at normal capacity, or
in which it would be useful to boost the immune system response. In
one specific, non-limiting example, a subject with an immune system
deficiency has a tumor or cancer (e.g. tumors of the brain, lung
(e.g. small cell and non-small cell), ovary, breast, prostate,
colon, as well as other carcinomas and sarcomas).
Infectious agent: An agent that can infect a subject, including,
but not limited to, viruses, bacteria, and fungi.
Examples of infectious virus include: Retroviridae; Picornaviridae
(for example, polio viruses, hepatitis A virus; enteroviruses,
human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae
(such as strains that cause gastroenteritis); Togaviridae (for
example, equine encephalitis viruses, rubella viruses); Flaviridae
(for example, dengue viruses, encephalitis viruses, yellow fever
viruses); Coronaviridae (for example, coronaviruses); Rhabdoviridae
(for example, vesicular stomatitis viruses, rabies viruses);
Filoviridae (for example, ebola viruses); Paramyxoviridae (for
example, parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (for example,
influenza viruses); Bungaviridae (for example, Hantaan viruses,
bunga viruses, phleboviruses and Nairo viruses); Arena viridae
(hemorrhagic fever viruses); Reoviridae (e.g., reoviruses,
orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae
(Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae
(papilloma viruses, polyoma viruses); Adenoviridae (most
adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and
HSV-2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxviridae (variola viruses, vaccinia viruses, pox
viruses); and Iridoviridae (such as African swine fever virus); and
unclassified viruses (for example, the etiological agents of
Spongiform encephalopathies, the agent of delta hepatitis (thought
to be a defective satellite of hepatitis B virus), the agents of
non-A, non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
Examples of infectious bacteria include: Helicobacter pyloris,
Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps
(such as. M. tuberculosis, M. avium, M. intracellulare, M. kansaii,
M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae,
Neisseria meningitidis, Listeria monocytogenes, Streptococcus
pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B
Streptococcus), Streptococcus (viridans group), Streptococcus
faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.),
Streptococcus pneumoniae, pathogenic Campylobacter sp.,
Enterococcus sp., Haemophilus influenzae, Bacillus antracis,
corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix
rhusiopathiae, Clostridium perfringers, Clostridium tetani,
Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella
multocida, Bacteroides sp., Fusobacterium nucleatum,
Streptobacillus moniliformis, Treponema pallidium, Treponema
pertenue, Leptospira, and Actinomyces israelli.
Examples of infectious fungi include, but are not limited to,
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida
albicans.
Other infectious organisms (such as protists) include: Plasmodium
falciparum and Toxoplasma gondii.
Interferon alpha: At least 23 different variants of IFN-.alpha. are
known. The individual proteins have molecular masses between 19-26
kDa and consist of proteins with lengths of 156-166 and 172 amino
acids. All IFN-.alpha. subtypes possess a common conserved sequence
region between amino acid positions 115-151 while the
amino-terminal ends are variable. Many IFN-.alpha. subtypes differ
in their sequences at only one or two positions. Naturally
occurring variants also include proteins truncated by 10 amino
acids at the carboxy-terminal end.
There are at least 23 different IFN-.alpha. genes. They have a
length of 1-2 kb and are clustered on human chromosome 9p22. Based
upon the structures two types of IFN-alpha genes, designated class
I and II, are distinguished. They encode proteins of 156-166 and
172 amino acids, respectively.
IFN-.alpha. is assayed by a cytopathic effect reduction test
employing human and bovine cell lines. Minute amounts of
IFN-.alpha. can be assayed also by detection of the Mx protein
specifically induced by this interferon. A sandwich ELISA employing
bi-specific monoclonal antibodies for rapid detection is also
available.
Interferon gamma: IFN-.gamma. is a dimeric protein with subunits of
146 amino acids. The protein is glycosylated at two sites, and the
pl is 8.3-8.5. IFN-.gamma. is synthesized as a precursor protein of
166 amino acids including a secretory signal sequence of 23 amino
acids. Two molecular forms of the biologically active protein of 20
and 25 kDa have been described. Both of them are glycosylated at
position 25. The 25 kDa form is also glycosylated at position 97.
The observed differences of natural IFN-.gamma. with respect to
molecular mass and charge are due to variable glycosylation
patterns. 40-60 kDa forms observed under non-denaturing conditions
are dimers and tetramers of IFN-.gamma.. The human gene has a
length of approximately 6 kb. It contains four exons and maps to
chromosome 12q24.1.
IFN-.gamma. can be detected by sensitive immunoassays, such as an
ELISA test that allows detection of individual cells producing
IFN-.gamma.. Minute amounts of IFN-.gamma. can be detected
indirectly by measuring IFN-induced proteins such as Mx protein.
The induction of the synthesis of IP-10 has been used also to
measure IFN-gamma concentrations. In addition, bioassays can be
used to detect IFN-.gamma., such as an assay that employs induction
of indoleamine 2,3-dioxygenase activity in 2D9 cells.
Interferon Inducible Protein 10: A cytokine that is 98 amino acids
in length that has homology to platelet factor-4, and is a
chemokine. The human IP-10 genes contains four exons and maps to
chromosome 4q12-21.
Interleukin-10: IL-10 is a homodimeric protein with subunits having
a length of 160 amino acids that is a cytokine. Human IL-10 shows
73 percent amino acid homology with murine IL-10. The human IL-10
gene contains four exons.
IL10 inhibits the synthesis of a number of cytokines such as IL-2
and IFN-.gamma. in Th1 subpopulations of T-cells but not of Th2.
IL10 can be detected with an ELISA assay. In addition, the murine
mast cell line D36 can be used to bioassay human IL10. The
intracellular factor can be detected also by flow cytometry.
Isolated: An "isolated" biological component (such as a nucleic
acid, peptide or protein) has been substantially separated,
produced apart from, or purified away from other biological
components in the cell of the organism in which the component
naturally occurs, i.e., other chromosomal and extrachromosomal DNA
and RNA, and proteins. Nucleic acids, peptides and proteins which
have been "isolated" thus include nucleic acids and proteins
purified by standard purification methods. The term also embraces
nucleic acids, peptides and proteins prepared by recombinant
expression in a host cell as well as chemically synthesized nucleic
acids.
Leukocyte: Cells in the blood, also termed "white cells," that are
involved in defending the body against infective organisms and
foreign substances. Leukocytes are produced in the bone marrow.
There are 5 main types of white blood cell, subdivided between 2
main groups: polymorphomnuclear leukocytes (neutrophils,
eosinophils, basophils) and mononuclear leukocytes (monocytes and
lymphocytes). When an infection is present, the production of
leukocytes increases.
Mammal: This term includes both human and non-human mammals.
Similarly, the term "subject" includes both human and veterinary
subjects.
Maturation: The process in which an immature cell, such as
dendritic cell, changes in form or function to become a functional
mature cell, such as an APC.
Neoplasm: An abnormal cellular proliferation, which includes benign
and malignant tumors, as well as other proliferative disorders.
Nucleic acid: A deoxyribonucleotide or ribonucleotide polymer in
either single or double stranded form, and unless otherwise
limited, encompasses known analogues of natural nucleotides that
hybridize to nucleic acids in a manner similar to naturally
occurring nucleotides.
Oligonucleotide or "oligo": Multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (Py) (e.g. cytosine (C), thymine
(T) or uracil (U)) or a substituted purine (Pu) (e.g. adenine (A)
or guanine (G)). The term "oligonucleotide" as used herein refers
to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides
(ODNs). The term "oligonucleotide" also includes oligonucleosides
(i.e. an oligonucleotide minus the phosphate) and any other organic
base polymer. Oligonucleotides can be obtained from existing
nucleic acid sources (e.g. genomic or cDNA), but are preferably
synthetic (e.g. produced by oligonucleotide synthesis).
A "stabilized oligonucleotide" is an oligonucleotide that is
relatively resistant to in vivo degradation (for example via an
exo- or endo-nuclease). In one embodiment, a stabilized
oligonucleotide has a modified phosphate backbone. One specific,
non-limiting example of a stabilized oligonucleotide has a
phophorothioate modified phosphate backbone (wherein at least one
of the phosphate oxygens is replaced by sulfur). Other stabilized
oligonucleotides include: nonionic DNA analogs, such as alkyl- and
aryl-phophonates (in which the charged phosphonate oxygen is
replaced by an alkyl or aryl group), phophodiester and
alkylphosphotriesters, in which the charged oxygen moiety is
alkylated. Oligonucleotides which contain a diol, such as
tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
An "immunostimulatory oligonucleotide," "immunostimulatory CpG
containing oligodeoxynucleotide," "CpG ODN," refers to an
oligodeoxynucleotide, which contains a cytosine, guanine
dinucleotide sequence and stimulates (e.g. has a mitogenic effect
or induces cytokine production) vertebrate immune cells. The
cytosine, guanine is unmethylated.
An "oligonucleotide delivery complex" is an oligonucleotide
associated with (e.g. ionically or covalently bound to; or
encapsulated within) a targeting means (e.g. a molecule that
results in a higher affinity binding to a target cell (e.g. B-cell
or natural killer (NK) cell) surface and/or increased cellular
uptake by target cells). Examples of oligonucleotide delivery
complexes include oligonucleotides associated with: a sterol (e.g.
cholesterol), a lipid (e.g. cationic lipid, virosome or liposome),
or a target cell specific binding agent (e.g. a ligand recognized
by a target cell specific receptor). Preferred complexes must be
sufficiently stable in vivo to prevent significant uncoupling prior
to internalization by the target cell. However, the complex should
be cleavable or otherwise accessible under appropriate conditions
within the cell so that the oligonucleotide is functional. (Gursel,
J. immunol. 167: 3324, 2001)
Pharmaceutical agent or drug: A chemical compound or composition
capable of inducing a desired therapeutic or prophylactic effect
when properly administered to a subject. Pharmaceutical agents
include, but are not limited to, chemotherapeutic agents and
anti-infective agents.
Pharmaceutically acceptable carriers: The pharmaceutically
acceptable carriers useful in this invention are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack
Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of the fusion proteins herein disclosed.
In general, the nature of the carrier will depend on the particular
mode of administration being employed. For instance, parenteral
formulations usually comprise injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(e.g., powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
Preventing or treating a disease: "Preventing" a disease refers to
inhibiting the full development of a disease, for example in a
person who is known to have a predisposition to a disease such as
an autoimmune disorder. An example of a person with a known
predisposition is someone with a history of diabetes in the family,
or who has been exposed to factors that predispose the subject to a
condition, such as lupus or rheumatoid arthritis. "Treatment"
refers to a therapeutic intervention that ameliorates a sign or
symptom of a disease or pathological condition after it has begun
to develop.
Purified: The term purified does not require absolute purity;
rather, it is intended as a relative term. Thus, for example, a
purified peptide preparation is one in which the peptide or protein
is more enriched than the peptide or protein is in its natural
environment within a cell. Preferably, a preparation is purified
such that the protein or peptide represents at least 50% of the
total peptide or protein content of the preparation.
Self-complementary nucleic acid sequence: A nucleic acid sequence
that can form Watson-Crick base pairs. The four bases
characteristic of deoxyribonucleic unit of DNA are the purines
(adenine and guanine) and the pyrimidines (cytosine and thymine).
Adenine pairs with thymine via two hydrogen bonds, while guanine
pairs with cytosine via three hydrogen bonds. If a nucleic acid
sequence includes two or more bases in sequence that can form
hydrogen bonds with two or more other bases in the same nucleic
acid sequence, then the nucleic acid includes a self-complementary
sequence. In several embodiments, a self-complementary nucleic acid
sequence includes 3, 4, 5, 6 or more bases that could form hydrogen
bonds with 3, 4, 5, 6 or more bases, respectively, of the same
nucleic acid sequence.
Therapeutically effective dose: A dose sufficient to prevent
advancement, or to cause regression of the disease, or which is
capable of relieving symptoms caused by the disease, such as pain
or swelling.
Vaccine: A preparation of attenuated microorganisms (including but
not limited to bacteria and viruses), living microorganisms,
antigen, or killed microorganisms, administered for the prevention,
amelioration or treatment of infectious disease.
A. CpG Oligodeoxynucleotides
K type CpG ODNs have been previously described. K ODNs which
exhibit the greatest immunostimulatory activity share specific
characteristics. These characteristics differ from those of the
Formula II or D ODN (see below). In addition, K ODN have specific
effects on the cells of the immune system, which differ from the
effects of D ODN. For example, K ODN stimulate proliferation of B
cells and stimulate the production of IL-6.
The K ODNs at least about 10 nucleotides and include a sequence
represented by either Formula I:
wherein the central CpG motif is unmethylated, W is A or T, and
N.sub.1, N.sub.2, N.sub.3, N.sub.4, N.sub.5, and N.sub.6 are any
nucleotides.
These Formula I or K ODN, stimulate B cell proliferation and the
secretion of IgM and IL-6, processes involved in the body's humoral
immunity, such as the production of antibodies against foreign
antigens. In one embodiment, the K ODNs induce a humoral immune
response.
In one embodiment, K type oligonucleotides of the formula
contain a phosphate backbone modification. In one specific,
non-limiting example, the phosphate backbone modification is a
phosphorothioate backbone modification (i.e., one of the
non-bridging oxygens is replaced with sulfur, as set forth in
International Patent Application WO 95/26204, herein incorporated
by reference). In one embodiment, K ODNs have a phophorothioate
backbone, and at least one unmethylated CpG dinucleotide.
Eliminating the CpG dinucleotide motif from the K ODN significantly
reduces immune activation. Incorporating multiple CpGs in a single
K ODN increases immune stimulation. Preferably, the K ODN are at
least 12 bases long. In addition, K ODN containing CpG motifs at
the 5' end are the most stimulatory, although at least one base
upstream of the CpG is required. More particularly, the most active
K ODNs contain a thymidine immediately 5' from the CpG
dinucleotide, and a TpT or a TpA in a position 3' from the CpG
motif. Modifications which are greater than 2 base pairs from the
CpG dinucleotide motif appear to have little effect on K ODN
activity.
D type ODNs differ both in structure and activity from K type ODNs.
The unique activities of D type ODNs are disclosed below (see
section C). For example, as disclosed herein, D
oligodeoxynucleotides stimulate the release of cytokines from cells
of the immune system. In specific, non-limiting examples D type
oligonucleotides stimulate the release or production of IP-10 and
IFN-.alpha. by monocytes and/or plasmacitoid dendritic cells and
the release or production of IFN-.gamma. by NK cells. The
stimulation of NK cells by D oligodeoxynucleotides can be either
direct or indirect.
With regard to structure, in one embodiment, a CpG motif in a D
type oligonucleotides has been described by Formula II:
wherein the central CpG motif is unmethylated, R is A or G (a
purine), and Y is C or T (a pyrimidine). D-type oligonucleotides
include an unmethylated CpG dinucleotide. Inversion, replacement or
methylation of the CpG reduces or abrogates the activity of the D
oligonucleotide.
In one embodiment, a D type ODN is at least about 16 nucleotides in
length and includes a sequence represented by Formula III:
wherein the central CpG motif is unmethylated, Pu is a purine
nucleotide, Py is a pyrimidine nucleotide, X and W are any
nucleotide, M is any integer from 0 to 10, and N is any integer
from 4 to 10.
The region Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 is termed the
CpG motif. The region X.sub.1 X.sub.2 X.sub.3 is termed the 5'
flanking region, and the region X.sub.4 X.sub.5 X.sub.6 is termed
the 3' flanking region. If nucleotides are included 5' of X.sub.1
X.sub.2 X.sub.3 in the D ODN these nucleotides are termed the 5'
far flanking region. Nucleotides 3' of X.sub.4 X.sub.5 X.sub.6 in
the D ODN are termed the 3' far flanking region.
In one specific non-limiting example, Py.sub.2 is a cytosine. In
another specific, non-limiting example, Pu.sub.3 is a guanidine. In
yet another specific, non limiting example, Py.sub.2 is a thymidine
and Pu.sub.3 is an adenine. In a further specific, non-limiting
example, Pu.sub.1 is an adenine and Py.sub.2 is a tyrosine. In
another specific, non-limiting example, Pu.sub.3 is an adenine and
Py.sub.4 is a tyrosine.
In one specific not limiting example, N is from about 4 to about 8.
In another specific, non-limiting example, N is about 6.
D-type CpG oligonucleotides can include modified nucleotides.
Without being bound by theory, modified nucleotides can be included
to increase the stability of a D-type oligonucleotide. Without
being bound by theory, because phosphorothioate-modified
nucleotides confer resistance to exonuclease digestion, the D ODN
are "stabilized" by incorporating phosphorothioate-modified
nucleotides. In one embodiment, the CpG dinucleotide motif and its
immediate flanking regions include phosphodiester rather than
phosphorothioate nucleotides. In one specific non-limiting example,
the sequence Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 includes
phosphodiester bases. In another specific, non-limiting example,
all of the bases in the sequence Pu.sub.1 Py.sub.2 CpG Pu.sub.3
Py.sub.4 are phosphodiester bases. In yet another specific,
non-limiting example, X.sub.1 X.sub.2 X.sub.3 and X.sub.4 X.sub.5
X.sub.6 (W).sub.M (G).sub.N include phosphodiester bases. In yet
another specific, non-limiting example, X.sub.1 X.sub.2 X.sub.3
Pu.sub.1 Py.sub.2 CpG Pu.sub.3 Py.sub.4 X.sub.4 X.sub.5 X.sub.6
(W).sub.M (G).sub.N include phosphodiester bases. In further
non-limiting examples the sequence X.sub.1 X.sub.2 X.sub.3 includes
at most one or at most two phosphothioate bases and/or the sequence
X.sub.4 X.sub.5 X.sub.6 includes at most one or at most two
phosphotioate bases. In additional non-limiting examples, X.sub.4
X.sub.5 X.sub.6 (W).sub.M (G).sub.N includes at least 1, at least
2, at least 3, at least 4, or at least 5 phosphothioate bases.
Thus, a D type oligodeoxynucleotide can be a
phosphorothioate/phosphodiester chimera.
As disclosed herein, any suitable modification can be used in the
present invention to render the D oligodeoxynucleotide resistant to
degradation in vivo (e.g., via an exo- or endo-nuclease). In one
specific, non-limiting example, a modification that renders the
oligodeoxynucleotide less susceptible to degradation is the
inclusion of nontraditional bases such as inosine and quesine, as
well as acetyl-, thio- and similarly modified forms of adenine,
cytidine, guanine, thymine, and uridine. Other modified nucleotides
include nonionic DNA analogs, such as alkyl or aryl phosphonates
(i.e., the charged phosphonate oxygen is replaced with an alkyl or
aryl group, as set forth in U.S. Pat. No. 4,469,863),
phosphodiesters and alkylphosphotriesters (i.e., the charged oxygen
moiety is alkylated, as set forth in U.S. Pat. No. 5,023,243 and
European Patent No. 0 092 574). Oligonucleotides containing a diol,
such as tetraethyleneglycol or hexaethyleneglycol, at either or
both termini, have also been shown to be more resistant to
degradation. The D type oligodeoxynucleotides can also be modified
to contain a secondary structure (e.g., stem loop structure).
Without being bound by theory, it is believed that incorporation of
a stem loop structure renders and oligodeoxynucleotide more
effective.
In a further embodiment, Pu.sub.1 Py.sub.2 and Pu.sub.3 Py.sub.4
are self-complementary. In another embodiment, X.sub.1 X.sub.2
X.sub.3 and X.sub.4 X.sub.5 X.sub.6 are self complementary. In yet
another embodiment X.sub.1 X.sub.2 X.sub.3 Pu.sub.1 Py.sub.2 and
Pu.sub.3 Py.sub.4 X.sub.4 X.sub.5 X.sub.6 are self
complementary.
Specific non-limiting examples of a D type oligonucleotide wherein
Pu.sub.1 Py.sub.2 and Pu.sub.3 Py.sub.4 are self-complementary
include, but are not limited to, ATCGAT, ACCGGT, ATCGAC, ACCGAT,
GTCGAC, or GCCGGC. Without being bound by theory, the
self-complementary base sequences can help to form a stem-loop
structure with the CpG dinucleotide at the apex to facilitate
immunostimulatory functions. Thus, in one specific, non-limiting
example, D type oligonucleotides wherein Pu.sub.1 Py.sub.2 and
Pu.sub.3 Py.sub.4 are self-complementary induce higher levels of
IFN-.gamma. production from a cell of the immune system (see
below). The self-complementary need not be limited to Pu.sub.1
Py.sub.2 and Pu.sub.3 Py.sub.4. Thus, in another embodiment,
additional bases on each side of the three bases on each side of
the CpG-containing hexamer form a self-complementary sequence (see
above).
One specific, non-limiting example of a sequence wherein Pu.sub.1
Py.sub.2 and Pu.sub.3 Py.sub.4 are self-complementary but wherein
the far-flanking sequences are not self-complementary is
GGTGCATCGATACAGGGGGG (ODN D 113, SEQ ID NO:11).
This oligodeoxynucleotide has a far flanking region that is not
self complementary and induces high levels of IFN-.gamma. and
IFN-.alpha..
Another specific, non-limiting example of a D oligodeoxynucleotides
is:
GGTGCGTCGATGCAGGGGGG (D28, SEQ ID NO:7).
This oligodeoxynucleotide is of use for inducing production and/or
release of cytokines from immune cells, although it lacks a
self-complementary motif.
In one embodiment, the D type oligodeoxynucleotides disclosed
herein are at least about 16 nucleotides in length. In a second
embodiment, a D type oligodeoxynucleotide is at least about 18
nucleotides in length. In another embodiment, a D type
oligodeoxynucleotide is from about 16 nucleotides in length to
about 100 nucleotides in length. In yet another embodiment, a D
type oligodexoynucleotide is from about 16 nucleotides in length to
about 50 nucleotides in length. In a further embodiment, a D type
oligodeoxynucleotide is from about 18 nucleotides in length to
about 30 nucleotides in length.
In another embodiment, the oligodeoxynucleotide is at least 18
nucleotides in length, and at least two G's are included at the 5'
end of the molecule, such that the oligodeoxynucleotide includes a
sequence represented by Formula IV:
The D type oligodeoxynucleotide can include additional G's at the
5' end of the oligodeoxynucleotide. In one specific example, about
1 or about 2 G's are included at the 5' end of an
olgiodeoxynucleotide including a sequence as set forth as Formula
IV.
Examples of a D type oligodeoxynucleotide include, but are not
limited to, 5'XXTGCATCGATGCAGGGGGG 3' (SEQ ID NO: 12)
5'XXTGCACCGGTGCAGGGGGG3' (SEQ ID NO: 13),
5'XXTGCGTCGACGCAGGGGGG3' (SEQ ID NO: 14),
5'XXTGCGTCGATGCAGGGGGG3' (SEQ ID NO: 16),
5'XXTGCGCCGGCGCAGGGGGG3' (SEQ ID NO: 17),
5'XXTGCGCCGATGCAGGGGGG3' (SEQ ID NO: 18),
5'XXTGCATCGACGCAGGGGGG3' (SEQ ID NO: 19),
5'XXTGCGTCGGTGCAGGGGGG3' (SEQ ID NO: 20),
wherein X any base, or is no base at all. In one specific,
non-limiting example, X is a G.
The oligodeoxynucleotides disclosed herein can be synthesized de
novo using any of a number of procedures well known in the art. For
example, the oligodeoxynucleotides can be synthesized as set forth
in U.S. Pat. No. 6,194,388, which is herein incorporated by
reference in its entirety. A D type oligodeoxynucleotide may be
synthesized using, for example, the B-cyanoethyl phophoramidite
method or nucleoside H-phosphonate method. These chemistries can be
performed by a variety of automated oligonucleotide synthesizers
available in the market. Alternatively, oligodeoxynucleotides can
be prepared from existing nucleic acid sequences (e.g. genomic or
cDNA) using known techniques, such as employing restriction
enzymes, exonucleases or endonucleases, although this method is
less efficient than direct synthesis.
B. Delivery Complexes and Pharmaceutical Compositions
In one embodiment, a D type oligodeoxynucleotide is included in
delivery complex. The delivery complex can include the D type ODN
and a targeting means. Any suitable targeting means can be used.
For example, a D type oligodeoxynucleotide can be associated with
(e.g., ionically or covalently bound to, or encapsulated within) a
targeting means (e.g., a molecule that results in higher affinity
binding to a target cell, such as a B cell). A variety of coupling
or cross-linking agents can be used to form the delivery complex,
such as protein A, carbodiamide, and
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Examples of
an oligodeoxynucleotide delivery complexes include a D type
oligodeoxynucleotide associated with a sterol (e.g., cholesterol),
a lipid (e.g., a cationic lipid, anionic lipid, virosome or
liposome), and a target cell specific binding agent (e.g., a ligand
recognized by target cell specific receptor). Without being bound
by theory, the complex is sufficiently stable in vivo to prevent
significant uncoupling prior to delivery to the target cell. In one
embodiment, the delivery complex is cleavable such that the
oligodeoxynucleotide is released in a functional form at the target
cells.
In one embodiment, a pharmacological composition is provided that
includes a D type oligonucleotide and a pharmacologically
acceptable carrier. Pharmacologically acceptable carriers (e.g.,
physiologically or pharmaceutically acceptable carriers) are well
known in the art. A suitable pharmacological composition can be
formulated to facilitate the use of a D type ODN in vivo and/or ex
vivo. Such a composition can be suitable for delivery of the active
ingredient to any suitable host, such as a patient for medical
application, and can be manufactured in a manner that is itself
known, e.g., by means of conventional mixing, dissolving,
granulating, dragee-making, levigating, emulsifying, encapsulating,
entrapping or lyophilizing processes.
Pharmacological compositions for use can be formulated in a
conventional manner using one or more pharmacologically (e.g.,
physiologically or pharmaceutically) acceptable carriers comprising
excipients, as well as optional auxiliaries that facilitate
processing of the active compounds into preparations which can be
used pharmaceutically. Proper formulation is dependent upon the
route of administration chosen, and whether use will be an in vivo
or an ex vivo use. For use in vivo, administration can be either
systemic or local. In addition, one of skill in the art can readily
select a suitable route of administration, including, but not
limited to intravenous, intramuscular, intraperitioneal,
transmucosal, subcutaneous, transdermal, transnasal, and oral
administration.
Thus, for injection, the active ingredient can be formulated in
aqueous solutions, preferably in physiologically compatible
buffers. For transmucosal administration, penetrants appropriate to
the barrier to be permeated are used in the formulation. Such
penetrants are generally known in the art. For oral administration,
the active ingredient can be combined with carriers suitable for
inclusion into tablets, pills, dragees, capsules, liquids, gels,
syrups, slurries, suspensions and the like. For administration by
inhalation, the active ingredient is conveniently delivered in the
form of an aerosol spray presentation from pressurized packs or a
nebuliser, with the use of a suitable propellant. The active
ingredient can be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Similarly, D type oligodeoxynucleotides can be formulated for
intratracheal or for inhalation. Such compositions can take such
forms as suspensions, solutions or emulsions in oily or aqueous
vehicles, and can contain formulatory agents such as suspending,
stabilizing and/or dispersing agents. Other pharmacological
excipients are known in the art.
C. Method of Inducing an Immune Response
A method is disclosed herein for stimulating a cell of the immune
system. The method includes contacting the cell with an effective
amount of a D type oligodeoxynucleotide disclosed herein, thereby
stimulating the cell (see also PCT Application Nos. WO0061151A3,
WO9956755A1, WO9840100A1, WO9818810A1, WO0122990A2; which are
herein incorporated by reference in their entirety).
In contrast, D type oligodeoxynucleotides have different
immunostimulatory activities. As disclosed herein, administration
of a D type oligodexoynucleotide activates monocytes and/or natural
killer cells, and induces the maturation of dendritic cells.
Furthermore, a D type oligodeoxynucleotide can be used to increase
the production of cytokines (for example IP-10, IFN-.alpha. or
IFN-.gamma.) by a cell of the immune system.
Administration of the D type oligodeoxynucleotide can be by any
suitable method. For example, the ODN can be administered in vivo
or ex vivo.
Thus, in one embodiment, a method is also disclosed herein for
producing an immune response in a subject. The subject can be any
mammal, particularly a primate, such as a human. The method
includes administering a D type oligodeoxynucleotide to the
subject, thereby inducing the immune response. In yet one
embodiment, the immune response includes induction of the
maturation of a dendritic cell or the activation of a natural
killer cell and/or a monocyte. In a further embodiment, the immune
response includes the production of a cytokine, such as, for
example, IL-10, IP-10, IFN-.alpha. or IFN-.gamma..
In one embodiment, a method is provided for inducing an immune
response in a subject wherein the method includes contacting a
monocyte or a dendritic cell precursor in vitro with a D type
oligodeoxynucleotide to produce an activated antigen presenting
cell. The monocytes or dendritic cell precursors can be contacted
with the D type oligodeoxynucleotides in the presence of or in the
absence of antigen. The activated antigen presenting cell is then
administered to the subject to induce an immune response.
In another embodiment, a method is provided herein for inducing an
immune response in a subject that includes contacting a monocyte or
a dendritic cell precursor in vitro with a D type
oligodeoxynucleotide to produce an activated antigen presenting
cell. The monocytes or dendritic cell precursors can be contacted
with the D type oligodeoxynucleotides in the presence of or in the
absence of antigen. Lymphocytes or natural killer are then
contacted with the activated antigen presenting cells in vitro, or
with cytokines secreted by the activated antigen presenting cells
in vitro, to produce activated lymphocytes or activated natural
killer cells. The activated lymphocytes or natural killer cells are
administered to the subject to induce the immune response.
In order to induce an immune response, a D type
oligodeoxynucleotide is administered either alone or in conjunction
with another molecule. Co-administration includes administering the
molecule and the D type oligodeoxynucleotide at the same time, or
sequentially. The other molecule can be any other agent, such as a
protein, an antigenic epitope, a hydrocarbon, lipid, mitogen, an
anti-infectious agent (such as antiviral, antifungal, or
anti-bacterial agent) or a vaccine (such as a live, attenuated, or
heat-killed vaccine).
Without being bound by theory, when administered to a subject, it
is believed that the ODNs initially act on antigen presenting cells
(e.g., B cells, macrophages and dendritic cells). These cells then
release cytokines, which activate natural killer (NK) cells. The
activation of natural killer cells may be direct (e.g. through
contact of the NK cell with a D type ODN) or indirect (e.g. by
activating the secretion of cytokines, which then activate the
natural killer cells). Either a cell-mediated or humoral immune
response then occurs in the host.
As disclosed herein, D type oligodeoxynucleotides are a unique type
of CpG containing oligodeoxynucleotides that have specific effects
on the cells of the immune system. For several examples, D type
oligonucleotides activate natural killer cells and monocytes, and
induce the maturation of dendritic cells. In other examples, D type
oligodeoxynucleotides increase production of cytokines such as
IP-10, IL-10, IFN.alpha. and IFN-.gamma.. These effects are
different from the effects of K type oligodeoxynucleotides. As
previously described, K type oligodeoxynucleotides support B cell
proliferation, and induce the production of IL-6. Thus, the
elucidation of the immunostimulatory effects of D type
oligodeoxynucleotides allows for customizing or tailoring of the
type of immune obtained by administration of oligodeoxynucleotides.
For example, a K type oligodeoxynucleotide can be utilized when
production of IL-6 is desired, whereas D type oliogdeoxynucleotides
can be used when production of IFN-.gamma. is desired.
In one embodiment, a D type oligodeoxynucleotide is administered to
a subject, such as a subject that has an autoimmune disease.
Specific, non-limiting examples of autoimmune diseases include, but
are not limited to diabetes, rheumatoid arthritis, lupus
erythematosus, and multiple sclerosis. In one embodiment, the
subject has cancer.
Also disclosed herein are methods of use to treat, prevent, or
ameliorate an allergic reaction in a subject. An allergy refers to
an acquired hypersensitivity to a substance (i.e., an allergen).
Allergic conditions include eczema, allergic rhinitis or coryza,
hay fever, bronchial asthma, uticaria (hives), food allergies, and
other atopic conditions. The list of allergens is extensive and
includes pollens, insect venoms, animal dander, dust, fungal
spores, and drugs (e.g., penicillin). Examples of natural, animal,
and plant allergens can be found in International Patent
Application WO 98/18810. In one embodiment a D-type
oligodeoxynucleotide administered to a subject to treat an allergic
condition such as allergic asthma. In another embodiment, the D
type oligodeoxynucleotide is administered in combination with any
suitable anti-allergenic agent. Suitable anti-allergenic agents
include those substances given in treatment of the various allergic
conditions described above, examples of which can be found in the
Physicians' Desk Reference (1998).
In another embodiment, a D type oligodeoxynucleotide is
administered to a subject that has a neoplasm. The D-type
oligodeoxynucleotide is administered either alone or in combination
with any suitable anti-neoplastic agent, such as a chemotherapeutic
agent or radiation. Suitable neoplasms include, but are not limited
to, solid tumors such as cancers of the brain, lung (e.g., small
cell and non-small cell), ovary, breast, prostate, and colon, as
well as carcinomas and sarcomas. Without being bound by theory, it
is believed that the D type oligodeoxynucleotide increases the
immune response to the neoplasm, and thus is involved in the
reduction of tumor burden.
In a further embodiment, a method is provided to enhance the
efficacy of any suitable vaccine. Suitable vaccines include those
directed against Leishmania, Hepatitis A, B, and C, examples of
which can be found in the Physicians' Desk Reference (1998), and
DNA vaccines directed against, for example, malaria. (See generally
Klinman et al., 17 Vaccine 17: 19, 1999; McCluskie and Davis, J.
Immun. 161:4463, 1998).
D type oligodeoxynucleotides can be used to treat, prevent, or
ameliorate any condition associated with an infectious agent. The D
type oligodeoxynucleotide can be administered to a subject infected
with the infectious agent alone or in combination with any suitable
anti-infectious agent, such as an antiviral, anti-fungal or
anti-bacterial agent (see Physicians' Desk Reference, 1998).
Specific, non-limiting examples of infectious agents conditions
associated with infectious agents are tularemia, francisella,
schistosomiasis, tuberculosis, malaria, and leishmaniasis. Examples
of infectious agents are viruses, bacteria, fungi, and other
organisms (e.g., protists) can be found in International Patent
Application WO 98/18810.
The D type oligodeoxynucleotides disclosed herein can also be used
with any suitable antisense therapy. Suitable antisense agents are
those that specifically bind either with a target DNA or a target
RNA and inhibit expression of the target sequence (see Lonnberg et
al., Ann. Med. 28: 511, 1996; Alama et al., Pharmacol. Res. 36:
171, 1997; Scanlon et al., FASEB J. 9: 1288, 1995; Oberbauer, 109
Wien Klin Wochenschr 109: 40, 1997).
The present invention is further described in the following
examples. These examples are intended only to illustrate the
invention and are not intended to limit the scope of the invention
in any way.
EXAMPLES
Example 1
Cytokine Production
The oligodeoxynucleotides disclosed herein can be used to produce
an immune response. In one embodiment, an immune response can be
measured by cytokine production. As shown herein, K type
oligodexoynucleotides can be used to increase the production of the
cytokines IL-6 and induce cell proliferation. D type
oligodeoxynucleotides induce the production of IFN-.gamma..
Human peripheral blood mononuclear cells (PBMC) were isolated, as
described elsewhere (Ballas et al., J. Allergy Clin. Immunol. 85:
453, 1990; Ballas a Rasmussen, J. Immunol. 45:1039, 1990; Ballas
and Rasmussen, J. Immunol. 150: 17, 1993). Oligodeoxynucleotides
(ODNs) were synthesized on a DNA synthesizer (Applied Biosystems
Inc., Foster City, Calif.), as described elsewhere (Beacage and
Caruthers, Tetrahedron Letters 22: 1859, 1981). In some ODNs, the
normal DNA backbone phosphodiesterase linkages were replaced with
phosphorothioate linkages, as described elsewhere (Agrawal et al.,
Proc. Natl. Acad. Sci. USA 94: 2620, 1997; Agrawal TIB TECH 14:
376, 1996). To reduce degradation of the ODNs, those that did not
have an entire phosphorothioate backbone contained phosphorothioate
linkages at the 5' and 3' ends. Cells were incubated for
approximately 72 hrs with the various ODNs. IL-6 and TNF-.gamma.
levels were determined by ELISA using anti-IL-6 and
anti-TNF-.gamma. antibodies, as described elsewhere (Maniatis et
al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York, 1989). Cell proliferation was
determined by [.sup.3 H] thymidine incorporation, as described
elsewhere (Liang et al., J Clin. Invest. 98:1121, 1996).
IL-6 levels and cell proliferation are set forth in Table 1:
Induction of a Humoral Immune Response In Vitro. These data
demonstrate that a sequence containing 5' N.sub.1 N.sub.2 N.sub.3
T-CpG-WN.sub.4 N.sub.5 N.sub.6 3', wherein the central CpG motif is
unmethylated, W is A or T, and N.sub.1, N.sub.2, N.sub.3, N.sub.4,
N.sub.5, and N.sub.6 are any nucleotides, (K type
oligodeoxynucleotides) induce a the production of IL-6 and a
humoral immune response. However, D type oligodeoxynucleotides
induce only low levels of IL-6 production.
In addition, maximum induction was observed for K type ODNs that
contained a phosphorothioate backbone. IFN-.gamma. levels and cell
proliferation are set forth in Table 1. These data demonstrate that
D type oligonucletotides increase production of IFN-.gamma..
Maximum induction occurred with ODNs containing phosphodiesterase
linkages.
TABLE 1 ODN SEQUENCE IFN-g* IL-6* IgM* PROLIF* media (None) 0.9 0.8
0.7 1 0.5 0.5 0.9 0.6 D ODN DV104 GGTGCATCGATGCAGGGGGG (SEQ ID
NO:1) 47.7 64.7 30.8 31 10.2 12.3 2.9 1.7 DV19 GGTGCATCGATGCAGGGGGG
(SEQ ID NO:1) 44.0 71.8 12.5 17 9.6 21.0 3.1 3.1 DV29
GGTGCACCGGTGCAGGGGGG (SEQ ID NO:2) 35.9 38.9 3.8 4 2.5 2.9 1.7 1.2
DV35 GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) 33.3 63.6 28.0 29 5.7 8.4
2.0 1.1 DV28 GGTGCGTCGATGCAGGGGGG (SEQ ID NO:7) 32.2 45.3 13.8 23
9.0 14.3 2.8 2.0 DV106 GGTGTGTCGATGCAGGGGGG (SEQ ID NO:26) 29.9
71.4 7.5 6 32.2 94.5 2.9 1.8 DV116 TGCATCGATGCAGGGGGG (SEQ ID
NO:12) 25.1 28.9 28.3 25 6.2 3.3 2.6 1.6 DV113 GGTGCATCGATACAGGGGGG
(SEQ ID NO:11) 21.1 15.3 144.8 255 4.0 4.2 4.7 5.6 DV34
GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) 16.2 19.1 3.6 6 2.4 2.6 3.2 4.5
DV102 GGTGCATCGTTGCAGGGGGG (SEQ ID NO:30) 15.8 39.4 6.6 7 24.0 58.0
2.1 1.1 DV32 GGTGCGTCGACGCAGGGGGG (SEQ ID NO:31) 14.5 18.0 2.7 5
1.4 2.1 2.8 0.9 DV117 GGTCGATCGATGCACGGGGG (SEQ ID NO:32) 13.4 14.6
25.8 23 19.6 22.8 6.2 2.7 DV37 GGTGCATCGATGCAGGGGGG (SEQ ID NO:1)
13.0 19.6 13.3 21 38.0 33.0 4.8 3.6 DV25 GGTGCATCGATGCAGGGGGG (SEQ
ID NO:1) 12.2 7.9 2.0 3 2.1 2.7 0.9 0.7 DV30 GGTGCATCGACGCAGGGGGG
(SEQ ID NO:35) 11.3 8.1 2.4 3 6.4 6.9 2.4 1.2 dv120
GGTGCATCGATAGGCGGGGG (SEQ ID NO:36) 8.7 11.5 1.0 1 3.5 1.1 1.9 1.0
DV27 GGTGCACCGATGCAGGGGGG (SEQ ID NO:37) 8.5 7.3 2.9 4 3.3 4.9 1.9
1.5 dv119 CCTGCATCGATGCAGGGGGG (SEQ ID NO:38) 7.5 9.1 2.0 1 1.6 0.4
1.0 0.3 D142 GGTATATCGATATAGGGGGG (SEQ ID NO:39) 7.3 1.1 15.9 5
22.5 5.0 2.0 1.0 d143 GGTGGATCGATCCAGGGGGG (SEQ ID NO:40) 6.4 4.5
16.0 8 47.0 12.0 2.0 1.0 D CONTROLS dv17 GGTGCAACGTTGCAGGGGGG (SEQ
ID NO:41) 2.3 1.5 5.0 4 8.0 2.0 4.0 2.0 DV78 GGTGCATCGATAGAGGGGGG
(SEQ ID NO:42) 0.8 0.5 2.0 4 4.2 3.0 1.4 0.9 DV96
GGTGCATCGTAGCAGGGGGG (SEQ ID NO:43) 1.1 0.7 1.5 2 1.1 2.9 1.2 0.3
DV95 GGTGGTTCGATGCAGGGGGG (SEQ ID NO:44) 2.1 2.2 2.5 3 1.2 1.8 1.2
0.7 DV93 GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) 0.9 1.3 11.9 26 2.7 3.5
1.5 0.6 DV92 GGTGCACCGGTGCAAAAAAA (SEQ ID NO:46) 0.4 0.7 2.0 3 0.8
1.2 1.4 0.8 DV81 GGTGCATCGATAGAGGGG (SEQ ID NO:47) 0.8 1.1 1.2 2
1.2 1.6 1.4 0.6 DV77 GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) 1.0 1.6 9.5
13 82.1 181.9 6.5 12.2 DV76 GGTGCATCGATGCAAAAAAA (SEQ ID NO:49) 1.6
1.5 1.3 2 1.2 1.5 1.7 0.4 DV71 GGGGTCGACAGGG (SEQ ID NO:50) 1.4 2.2
1.8 2 0.7 0.5 1.2 1.0 DV49 GGTGCATAAATGCAGGGGGG (SEQ ID NO:51) 1.5
1.2 1.3 2 1.0 1.0 1.2 1.0 DV48 GGTGCATCAATGCAGGGGGG (SEQ ID NO:52)
1.0 0.5 1.2 2 1.0 1.0 1.2 1.0 DV47 GGTGCATTGATGCAGGGGGG (SEQ ID
NO:53) 1.2 0.5 1.5 2 1.0 1.0 1.2 1.0 DV45 GGTGCATC*GATGCAGGGGGG
(SEQ ID NO:54) 3.4 2.9 7.0 14 0.8 1.5 1.3 0.3 DV26
GGTGCATGCATGCAGGGGGG (SEQ ID NO:55) 7.6 15.3 0.0 0 0.6 1.0 1.3 1.4
DV20 GGTGCATGCATGCAGGGGGG (SEQ ID NO:55) 2.3 4.2 2.1 2 1.0 1.8 1.1
0.8 DV122 GGTGCATTGATGCAGGGGGG (SEQ ID NO:53) 0.9 1.5 1.3 1 2.0 0.4
0.7 0.3 DV114 GGTGCACTGGTGCAGGGGGG (SEQ ID NO:58) 1.8 2.0 1.8 2 1.2
1.2 1.0 0.6 DV111 GGTGTATCGATGCAAAAGGG (SEQ ID NO:59) 5.8 5.1 12.3
13 4.8 7.6 4.4 8.0 DV108 GGTGCCCCGTTGCAGGGGGG (SEQ ID NO:60) 1.2
1.4 1.7 3 1.0 1.5 1.0 0.2 DV107 GGTGCAACGGGGCAGGGGGG (SEQ ID NO:61)
2.5 3.3 7.7 15 0.4 0.6 1.1 0.4 DV105 AATGCATCGATGCAAAAAAA (SEQ ID
NO:62) 1.1 1.8 2.4 3 1.2 1.5 1.0 0.4 DV103 GGTGCACCGTGGCAGGGGGG
(SEQ ID NO:63) 9.4 16.8 8.7 12 5.4 8.4 1.7 1.9 DV100
GGTGCATCGAAGCAGGGGGG (SEQ ID NO:64) 3.4 3.5 7.2 6 21.0 24.0 9.1 5.9
d79 GGTGGATCGATGCAGGGGGG (SEQ ID NO:65) 0.6 0.5 1.0 1 23.0 2.0 d145
GGTGCACGCGTGCAGGGGGG (SEQ ID NO:5) 4.8 0.8 2.5 4 16.8 3.0 d144
GGTGCATGTATGCAGGGGGG (SEQ ID NO:67) 0.0 0.0 0.6 1 1.3 2.0 AA20
GGGGGATCGATGGGGG (SEQ ID NO:68) 2.7 5.1 3.1 3 2.2 2.5 1.6 1.2 AA3M
GGGGGAAGCTTCGGGG (SEQ ID NO:69) 2.2 3.2 1.1 2 0.4 0.8 1.2 1.0 K ODN
K22 CTCGAGCGTTCTC (SEQ ID NO:70) 9.3 1.8 43.3 20 131.8 94.0 18.3
3.3 DV84 ACTCTCGAGCGTTCTA (SEQ ID NO:71) 1.1 1.6 42.6 91 79.7 105.3
18.5 25.8 K21 TCTCGAGCGTTCTC (SEQ ID NO:72) 7.2 2.8 39.6 17 237.6
194.2 34.6 9.3 K82 ACTCTGGAGCGTTCTC (SEQ ID NO:73) 1.9 0.1 38.5 5
25.5 16.8 10.7 0.6 K30 TGCAGCGTTCTC (SEQ ID NO:74) 9.5 10.5 30.8 31
253.1 256.3 7.0 6.9 k31 TCGAGGCTTCTC (SEQ ID NO:75) 22.1 26.3 30.7
18 290.3 150.6 12.9 9.0 K39 GTCGGCGTTGAC (SEQ ID NO:76) 7.0 11.0
27.3 22 100.3 137.9 16.1 6.3 K16 TCGACTCTCGAGCGTTCTC (SEQ ID NO:8)
3.1 3.1 25.2 21 72.7 79.5 22.3 20.6 K3 ATCGACTCTCGAGCGTTCTC (SEQ ID
NO:3) 9.0 22.7 22.6 17 113.5 60.0 25.0 19.4 k23 TCGAGCGTTCTC (SEQ
ID NO:79) 5.2 8.3 21.9 28 111.3 145.4 28.3 16.0 DV110 TCGAGGCTTCTC
(SEQ ID NO:75) 2.2 2.2 21.8 25 70.3 142.8 19.6 19.8 K40
GTCGGCGTCGAC (SEQ ID NO:81) 11.3 14.3 20.7 11 127.1 222.2 11.0 5.0
DV101 CTCGAGCGTTCT (SEQ ID NO:10) 2.6 2.2 20.0 26 28.0 34.3 25.3
28.3 DV89 ACTCTTTCGTTCTC (SEQ ID NO:83) 1.6 1.6 19.7 23 169.1 390.3
6.7 7.2 K34 GTCGACGTTGAC (SEQ ID NO:84) 4.3 5.3 17.2 8 265.8 273.4
11.3 6.7 DV86 ACTCTCGAGCGTTCTC (SEQ ID NO:9) 0.8 1.6 16.9 37 36.0
40.7 5.1 3.0 K83 ACTCTCGAGGGTTCTC (SEQ ID NO:86) 0.0 0.0 16.5 5
16.9 9.7 6.9 0.7 K19 ACTCTCGAGCGTTCTC (SEQ ID NO:9) 4.8 7.9 14.8 16
151.0 223.6 23.4 16.1 DV88 ACTCTCGAGCGTTCTCAAAA (SEQ ID NO:88) 1.9
3.0 14.5 14 49.7 55.0 10.2 11.5 DV85 CATCTCGAGCGTTCTC (SEQ ID
NO:89) 0.9 1.5 12.0 11 82.0 126.8 12.2 13.0 K73 GTCGTCGATGAC (SEQ
ID NO:90) 4.5 5.2 11.7 7 99.2 110.7 17.7 13.2 DV109 TCGAGCGTTCT
(SEQ ID NO:4) 2.2 2.2 11.3 9 28.4 46.4 14.5 12.6 D123 TCGTTCGTTCTC
(SEQ ID NO:92) 3.3 1.6 9.6 12 50.9 72.3 39.3 30.5 D124 TCGTTTGTTCTC
(SEQ ID NO:93) 3.0 2.0 7.3 6 63.2 88.6 34.1 28.1 K46 GTCGACGCTGAC
(SEQ ID NO:94) 3.5 5.1 5.2 2 21.9 15.1 8.7 5.0 D139 TCGATGCTTCTC
(SEQ ID NO:95) 2.2 1.4 5.1 4 97.8 157.5 39.1 27.9 D137 TCGCCGCTTCTC
(SEQ ID NO:96) 1.4 0.5 4.3 2 78.7 107.6 31.6 22.3 K47 GTCGACGTCGAC
(SEQ ID NO:54) 3.8 7.1 3.9 1 14.1 6.2 5.8 2.3 K72 GTCATCGATGCA (SEQ
ID NO:98) 1.8 2.3 3.7 3 95.6 79.3 11.0 5.4 DV90 ACTCTTTCGATCTC (SEQ
ID NO:99) 1.6 2.0 3.6 4 19.2 24.8 4.6 5.7 K37 GTCAGCGTCGAC (SEQ ID
NO:100) 10.8 19.5 3.4 1 52.4 63.0 6.4 2.2 k25 TCGAGCGTTCT (SEQ ID
NO:4) 3.6 3.7 2.9 4 17.9 24.8 D127 TGGAGCGTTCTC (SEQ ID NO:102) 2.3
1.6 2.8 3 89.7 136.4 21.4 11.9 D138 TGCTGCGTTCTC (SEQ ID NO:103)
0.7 0.7 2.1 1 69.0 105.5 18.4 12.1 D125 TTGAGCGTACTC (SEQ ID
NO:104) 3.3 3.2 2.0 1 35.1 53.8 7.8 5.2 D134 TGCTTCGAGCTC (SEQ ID
NO:105) 1.8 0.8 1.8 1 17.7 24.8 9.1 5.7 D136 TGCACCGTTCTC (SEQ ID
NO:106) 1.7 0.2 1.7 1 69.2 106.5 12.1 7.9 CONTROL K ODN DV89
ACTCTTTCGTTGTC (SEQ ID NO:83) 1.6 1.6 19.7 23 169.1 419.7 6.7 7.2
d112 TGCAGGCTTCTC (SEQ ID NO:6) 16.0 28 20.4 32.6 DV112
TTGAGTGTTCTC (SEQ ID NO:109) 2.1 2.7 16.0 28 20.4 32.6 9.8 10.8
DV112 TTGAGTGTTCTC (SEQ ID NO:109) 2.1 2.7 16.0 28 20.4 32.6 9.8
10.8 K41 GTCGGCGCTGAC (SEQ ID NO:120) 5.7 7.4 13.3 8 29.1 24.7 8.8
5.7 DV109 TCGAGCGTTCT (SEQ ID NO:4) 3.4 4.0 11.3 9 28.4 46.4 14.5
12.6 k10 ATGCACTCTGCAGGCTTCTC (SEQ ID NO:119) 2.7 4.5 6.1 7 27.3
28.8 5.7 5.4 K38 GTCAGCGCTGAC (SEQ ID NO:118) 1.4 1.9 4.5 3 4.5 1.3
2.2 1.1 k29 TCGAGCG (SEQ ID NO:112) 19.7 25.9 4.2 5 2.8 3.6 k26
TCGAGCGTTC (SEQ ID NO:45) 6.6 4.9 4.1 1 22.3 24.4 k27 TCGAGCGTT
(SEQ ID NO:108) 4.6 3.4 3.7 5 4.1 3.7 K36 GTCAACGCTGAC (SEQ ID
NO:107) 2.2 3.3 3.4 2 8.6 2.0 5.5 2.8 K35 GTCAACGTCGAC (SEQ ID
NO:101) 21.8 41.9 3.3 2 15.9 13.9 5.0 2.8 K44 GTCGACGCCGAC (SEQ ID
NO:97) 4.1 6.0 3.0 2 9.4 6.3 2.6 1.2 k28 TCGAGCGT (SEQ ID NO:91)
21.5 26.2 2.9 3 6.7 9.1 AA19 GGGGGAACGTTGGGGG (SEQ ID NO:87) 9.4
14.6 2.2 1 4.7 4.5 1.5 0.5 D135 TGCAGCGAGCTC (SEQ ID NO:85) 1.4 0.5
1.8 2 4.3 6.6 3.4 1.5 D141 CCGAGGCTTCTC (SEQ ID NO:82) 1.3 0.4 1.7
2 53.7 99.0 12.8 9.0 D126 ACGAGGGTTCTC (SEQ ID NO:80) 2.6 0.8 1.7 1
75.5 107.5 15.2 8.7 K42 GTCAACGCCGAC (SEQ ID NO:78) 2.6 3.1 1.7 1
5.7 5.3 4.3 3.7 D140 GCGAGGCTTCTC (SEQ ID NO:77) 1.2 0.5 1.5 1 56.7
85.4 10.9 7.0 d121 ACTCTTGAGTGTTCTC (SEQ ID NO:66) 3.6 6.2 1.0 1
10.2 18.5 17.3 44.5 K45 GTCGGCGCCGAC (SEQ ID NO:57) 5.7 6.6 0.4 1
18.3 22.1 10.1 4.3 K43 GTCAGCGCCGAC (SEQ ID NO:56) 2.1 1.6 0.3 1
6.9 8.6 5.1 5.7 K24 CGAGCGTTCTC (SEQ ID NO:48) 4.9 5.1 0.1 0 0.7
1.0 1.0 0.1 Underlined bases are phosphodiester. * indicates
methylated CG. Bold indicates self-complementary sequences.
Sequence identifier is noted below the nucleic acid sequence. For
each heading (IFN-g, IL-6, IgM, PROLIF (proliferation)) first
column is average and second column is standard deviation.
The foregoing data demonstrates the induction of an immune response
in human cells, as exemplified by PBMC. Specifically, the results
demonstrate that K type oligodeoxynucleotides induce IL-6, cell
proliferation and a humoral response, while D type
oligodeoxynucletides induce the production of IFN-.gamma..
Example 2
Production of IL-6
The following example demonstrates induction of an immune response,
as measured by cytokine production, by K type
oligodeoxynucleotides. Specifically, it is demonstrated that
production of the cytokine IL-6 can be induced by K type
oligodeoxynucleotides, and that B cells are stimulated by K type
oligodeoxynucleotides.
A human B cell line (RPMI 8226) was maintained according to the
manufacturers recommendations. ODNs were synthesized as described
in Example 1. In some ODNs, the normal DNA phosphodiesterase
linkages were replaced with phosphorothioate linkages, as described
in Example 1. To reduce degradation of the ODNs, those that did not
have an entire phosphorothioate backbone contained phosphorothioate
linkages at the ends. The cells were incubated with various ODNs
for 14 hrs. IL-6 production was determined by ELISA using anti-IL-6
antibodies, as described in Example 1.
IL-6 levels are set forth in Table 1. These data confirm that a
sequence containing 5' N.sub.1 N.sub.2 N.sub.3 T-CpG-WN.sub.4
N.sub.5 N.sub.6 3', which are linked by phosphorothioate bonds and
wherein the central CpG motif is unmethylated, W is A or T, and
N.sub.1, N.sub.2, N.sub.3, N.sub.4, N.sub.5, and N.sub.6 are any
nucleotides, is desirable to induce a humoral immune response.
The foregoing data demonstrates the induction of an immune response
in human cells by K type oligodeoxynucleotides, as exemplified by
the human B cell line RPMI 8226, and as measured by production of
the cytokine IL-6.
Example 3
Exemplary Material and Methods
The following example delineates material and methods that were
used to investigate the induction of an immune response by D-type
ODNs. Exemplary D type ODNs are shown in Table 2 below.
TABLE 2 IFNg ODN AVG SD Media 0.9 0.8 DV104 GGTGCATCGATGCAGGGGGG
47.7 64.7 (SEQ ID NO:1) DV19 GGTGCATCGATGCAGGGGGG 44.0 71.8 (SEQ ID
NO:1) DV29 GGTGCACCGGTGCAGGGGGG 35.9 38.9 (SEQ ID NO:2) DV35
GGTGCATCGATGCAGGGGGG 33.3 63.6 (SEQ ID NO:1) DV28
GGTGCGTCGATGCAGGGGGG 32.2 45.3 (SEQ ID NO:7) DV106
GGTGTGTCGATGCAGGGGGG 29.9 71.4 (SEQ ID NO:26) DV116
TGCATCGATGCAGGGGGG 25.1 28.9 (SEQ ID NO:12) DV113
GGTGCATCGATACAGGGGGG 21.1 15.3 (SEQ ID NO:11) DV34
GGTGCATCGATGCAGGGGGG 16.2 19.1 (SEQ ID NO:1) DV102
GGTGCATCGTTGCAGGGGGG 15.8 39.4 (SEQ ID NO:30) DV32
GGTGCGTCGACGCAGGGGGG 14.5 18.0 (SEQ ID NO:31) DV117
GGTCGATCGATGCACGGGGG 13.4 14.6 (SEQ ID NO:32) dv37
GGTGCATCGATGCAGGGGGG 13.0 19.6 (SEQ ID NO:1) DV25
GGTGCATCGATGCAGGGGGG 12.2 7.9 (SEQ ID NO:1) DV30
GGTGCATCGACGCAGGGGGG 11.3 8.1 (SEQ ID NO:35) dv120
GGTGCATCGATAGGCGGGGG 8.7 11.5 (SEQ ID NO:36) DV27
GGTGCACCGATGCAGGGGGG 8.5 7.3 (SEQ ID NO:37) dv119
CCTGCATCGATGCAGGGGGG 7.5 9.1 (SEQ ID NO:38) D142
GGTATATCGATATAGGGGGG 7.3 1.1 (SEQ ID NO:39) d143
GGTGGATCGATCCAGGGGGG 6.4 4.5 (SEQ ID NO:40) UNDERLINED =
PHOSPHODIESTER; *METHYLATED C
Normal PBMC were obtained from the National Institutes of Health
Department of Transfusion Medicine (Bethesda, Md.). The human
myeloma cell line RPMI 8226 (CCL-155; American Type Culture
Collection, Manassas, Va.) and the NK-92 human NK cell line (a kind
gift of Dr. J. Ortaldo, National Cancer Institute, Frederick, Md.)
were grown in RPMI 1640 supplemented with 10% FCS,
penicillin/streptomycin, L-glutamine, HEPES, sodium pyruvate, and
2-ME in a 5% CO2 in-air incubator. Medium for NK-92 cells was
supplemented with IL-2 (200 IU/ml; R&D Systems, Minneapolis,
Minn.) and IL-15 (15 ng/ml; Endogen, Boston, Mass.).
Oligodeoxynucleotides
ODN were synthesized at the Center for Biologics Evaluation and
Research core facility. All had <0.1 endotoxin U/ml endotoxin at
ODN concentrations of 1 mg/ml.
Antibodies
Abs against human IFN-g (Endogen), IL-6 (R&D Systems), and IgM
(Se-rotec, Oxford, U.K.) were used for ELISA and enzyme-linked
immunospot (ELISPOT) assays. FITC- and/or CyChrome-labeled Abs
against human CD3, CD4, CD14, CD11c, CD16, CD56, CD83, HLA-DR,
IL-6, and IFN-.gamma. were obtained from BD PharMingen (San Diego,
Calif.) or BD Bio-sciences (San Jose, Calif.) and used as
recommended by the manufacturer. Neutralizing Abs to IL-12 were
obtained from R&D Systems, and Abs to IL-18 were kindly
provided by Dr. Howard Young (National Cancer Institute).
Mononuclear Cell Preparation
Mononuclear cells were separated by density gradient centrifugation
over Ficoll-Hypaque as described (17). Cells were washed three
times and cultured in RPMI 1640 medium supplemented with 10%
heat-inactivated FCS for 72 h at 53 10 5 cells/well in the presence
of 1-3 mM ODN.
ELISA and ELISPOT Assays
Ninety-six-well microtiter plates (Millipore, Bedford, Mass.) were
coated with anti-cytokine Ab or anti-IgM and blocked with PBS-5%
BSA (17,18). Cytokines and Ig in culture sups or secreted by
individual cells were detected colorimetrically using
biotin-labeled Abs followed by phosphatase conjugated avidin and
then phosphatase-specific colorimetric substrate. Standard curves
were generated to quantitate ELISA results using known amounts of
recombinant cytokine or purified IgM. The detection limit of the
assays was: 6 pg/ml for IFN-g, 20 pg/ml for IL-6, and 10 ng/ml for
IgM. Stimulation index was calculated by the formula: (value for
stimulated cells 2 background)/(value for unstimulated cells 2
background). In cases where cytokine/Ig production was below assay
sensitivity, the lower limit of detection was used to calculate the
stimulation indices. All assays were performed in triplicate.
Proliferation Assays
A total of 10 5 PBMC/well were incubated with 3 mM of ODN for 68 h,
pulsed with 1 mCi of [.sup.3 H]thymidine, and then harvested 4 h
later. The proliferation index represents the fold difference
between stimulated and unstimulated cells. All assays were
performed in triplicate.
Intracellular Cytokine Staining and Flow Cytometry
PBMC were cultured for 8 h (K type) or 24 h (D type) with 3 mM of
various ODN. Brefeldin A (20 mg/ml) was added to the cultures after
2 or 12 h, respectively. Cells were harvested with warm PBS-0.02%
EDTA and washed. PBMC (1 3 10 6/sample) were fixed and
permeabilized using the Fix & Perm cell permeabilization kit
(Caltag, Burlingame, Calif.) as recommended by the manufacturer.
Cells were then stained with PE-conjugated anti-IL-6 or anti-IFN g
plus specified FITC- or Cy Chrome-conjugated Abs against cell
surface markers for 30 min in darkness. After labeling, the cells
were washed twice, and 40,000 events per sample were analyzed by
FAC-Scan flow cytometry (BD Biosciences). Cell Quest software (BD
Bio-sciences) was used for data analysis.
Statistical Analysis
Statistically significant differences were determined using a
two-tail non-parametric Mann-Whitney U test and nonparametric
ANOVA.
Example 4
Response of Human Peripheral Blood Mononuclear Cells (PBMC) to CpG
ODN
Response of human PBMC to CpG ODN Novel ODN were studied for their
ability to stimulate human PBMC to proliferate and/or secrete Ig or
cytokines. As shown in FIG. 1 , two structurally distinct ODN
classes were identified that stimulated PBMC from 0.95% of the
donors. Those of the K type stimulated significantly greater cell
proliferation (p<0.0001) and induced higher levels of IL-6 (240
vs 85 pg/ml; p<0.01) and IgM(695 vs 20 ng/ml; p<0.0001) than
D ODN. In contrast, D ODN were stronger inducers of IFN-g (70 vs 13
pg/ml; p<0.05). FIG. 1 illustrates the response of PBMC to K and
D ODN.
Type D ODN
Modifications were introduced in various regions of D ODN to
identify the critical sequences and structures that account for the
ability of these ODN to induce IFN-.gamma.. To standardize results
from the large number of subjects and experiments included in the
analysis, the magnitude of each response is presented as fold
increase over cells from the same subject incubated in medium
alone. The general magnitude of these responses was comparable to
that shown in FIG. 1.
FIG. 2 illustrates the parameters governing D ODN induced immune
activation. All D-type ODNs contain an unmethylated CpG
dinucleotide (FIG. 2). Inversion, replacement, or methylation of
the CpG reduces or abrogates reactivity (FIG. 2A, line 1 vs lines
2-6, and line 7 vs line 8; p<0.0001). In addition, the results
demonstrate that D ODN are stimulatory only if the CpG dinucleotide
and its immediate flanking regions are composed of phosphodiester
(shown in gray) rather than phosphorothioate nucleotides (FIG. 2B,
line 1 vs line 2; p<0.001). Because phosphorothioate-modified
nucleotides confer resistance to exonuclease digestion, they are
incorporated at the ends of the ODN to improve activity (FIG. 2B,
lines 1 and 5 versus lines 3 and 4; p<0.07). Unless otherwise
stated, all D ODN studied were phosphorothioate/phosphodiester
chimeras.
As shown in FIG. 2, the level of immune stimulation induced by D
ODN was demonstrated to be influenced by the bases flanking the CpG
dinucleotide. Self-complementary hexamers consisting of a Pu Py CG
Pu Py were the most active, as exemplified by ATCGAT and ACCGGT
(FIG. 2C, lines 1 and 2). Substituting a Pu for a Py, or vice
versa, significantly reduced or eliminated ODN activity (circled
nucleotides in FIG. 2C, lines 1 and 2 vs lines 6-13; p<0.0001.
By comparison, hexamers that maintained the PuPyCGPuPy sequence,
but are non self-complementary induced lower levels of IFN-g
production (FIG. 2C, lines 1 and 2 vs lines 3-5; p<0.001).
Sequential deletion experiments showed that the minimum length of
an active D ODN is 16 bp (FIG. 2D; p<0.01). This finding
suggested that sequences outside the central hexamer might
influence D ODN activity.
Indeed, stimulation was maximal when the three bases on each side
of the CpG-containing hexamer formed a self-complementary sequence
(FIG. 2E, lines 1 and 2 versus lines 3 and 4; p<0.0001). Without
being bound by theory, computer modeling of D ODN suggested that
these self-complementary base sequences help form a stem-loop
structure with the CpGdi nucleotide at the apex at 37.degree. C.
The ends of the ODN also contribute to its activity, with the
inclusion of more than four Gs at the 39 end significantly
increased function (FIG. 2F, lines 1-3 versus lines 4 and 5;
p<0.001). Thus, modifications in any of the three areas (the
central hexamer, the region flanking the hexamer, or the poly G
tail) can be used to influence ODN activity.
Type K ODN
K ODN trigger cell proliferation and the secretion of IgM and IL-6,
but little IFN-g (see Table 1 and FIG. 1). These ODN have a
phosphorothioate backbone and at least one unmethylated CpG
dinucleotide.
TABLE 5 Rules Governing K ODN Induced Immune Activation Stimulation
Index IL-6 Proliferation IgM Assay Subject #: 1 2 1 2 1 2 A.
Multiple CpGs induce more stimulation 1 ATCGACTCTCGAGCGTTCTC (SEQ
ID NO:3) 50 57 13 30 138 71 2 TCGAGCGTTCTC (SEQ ID NO:79) 35 40 15
37 19 79 3 TCGAGGCTTCTC (SEQ ID NO:75) 28 12 8 25 8 22 4
TGCAGGCTTCTC (SEQ ID NO:6) 1 0 5 7 5 4 B. Minimum size of
stimulatory "K" ODN 1 TCGACTCTCGAGCGTTCTC (SEQ ID NO:8) 20 23 37 72
>100 100 2 ACTCTCGAGCGTTCTC (SEQ ID NO:9) 20 18 30 46 >100
100 3 TCTCGAGCGTTCTC (SEQ ID NO:72) 16 40 28 41 >100 100 4
TCGAGCGTTCTC (SEQ ID NO:79) 23 15 13 25 >100 80 5 CTCGAGCGTTCT
(SEQ ID NO:10) 21 14 16 21 95 92 6 TCGAGCGTTCT (SEQ ID NO:4) 10 4
15 35 45 78 7 TCGAGCGTTC (SEQ ID NO:116) 6 5 17 40 35 82 8
TCGAGCGTT (SEQ ID NO:117) 1 7 5 7 32 25 9 TCGAGCGT (SEQ ID NO:91) 1
5 1 13 25 12 10 TCGAGCG (SEQ ID NO:115) 1 1 1 5 9 4 C: CpG motifs
located at the 5' end of the ODN are most stimulatory 1
TCGAGCGTTCTC (SEQ ID NO:79) 12 40 52 59 80 >100 2 TCGAGGCTTCTC
(SEQ ID NO:75) 6 12 51 61 >100 >100 3 TGCTTCGAGCTC (SEQ ID
NO:105) 4 3 12 16 20 60 4 GCGAGGCTTCTC (SEQ ID NO:121) 5 12 18 14
>100 >100 5 TGCAGCGAGCTC (SEQ ID NO:85) 5 2 4 4 1 16 6
CGAGCGTTCTC (SEQ ID NO:48) <1 <1 1 1 <1 2 D. Optimization
of the 5' CpG flanking region 1 TCGATGCTTCTC (SEQ ID NO:95) 5 12 60
67 100 9 2 TCGAGGCTTCTC (SEQ ID NO:75) 6 12 51 61 160 5 3
ACGAGGCTTCTC (SEQ ID NO:34) 3 3 18 23 110 11 4 GCGAGGCTTCTC (SEQ ID
NO:127) 3 1 18 14 72 6 5 CCGAGGCTTCTC (SEQ ID NO:82) 4 1 15 25 25 7
6 TGCTTCGAGCTC (SEQ ID NO:105) 3 1 12 16 60 40 7 TGCAGCGAGCTC (SEQ
ID NO:82) 2 1 4 4 16 8 E. Optimization of the 3' CpG flanking
region 1 TCGTTTGTTCTC (SEQ ID NO:93) 8 8 28 31 >100 >100 2
TCGTATGTACTC (SEQ ID NO:33) 8 8 26 32 2 33 3 TCGGATGAGCTC (SEQ ID
NO:29) 6 8 9 20 28 41 4 TCGAATGCTCTC (SEQ ID NO:28) 3 5 14 22 6 14
5 TTGTTCGTTCTC (SEQ ID NO:27) 3 4 15 14 19 26 6 TTGTTCGTACTC (SEQ
ID NO:25) 2 4 14 13 15 72 7 TTGTTCGAGCTC (SEQ ID NO:24) 2 4 6 4 6
16 8 TTGTTCGAACTC (SEQ ID NO:24) 2 2 11 5 1 1 Over 200 novel ODN
were synthesized, and their ability to activate PBMC from multiple
donors examined. PBMC were stimulated for 72 hours in the presence
of ODN (1 .mu.M added at time 0). Cytokine and antibody secretion
in the supernatants were assessed by ELISA, while proliferation was
determined by [H].sup.3 uptake. Examples of general findings are
presented in this Table. Results are expressed as fold increase
over unstimulated cells.
As with D ODN, eliminating the CpG dinucleotide from a K type ODN
significantly reduced immune activation (Table 3A, line 3 versus
line 4; p, 0.02). Incorporating multiple CpGs in a single ODN
increased immune stimulation (Table 3A, lines 1-3). To determine
the minimum length of a stimulatory K ODN, nucleotides were
sequentially deleted from each end. ODN at least 12 bases long
consistently induced strong immune cell activation, whereas shorter
ODN were relatively less active (Table IB, lines 1-5 vs lines
6-10). CpG motifs at the 5' end were the most stimulatory (Table
3C, line 2 vs line 3 and line 4 vs line 5), although at least one
base upstream of the CpG was required (Table 3C, line 1 vs line 6).
Indeed, a thymidine in the immediate 5' position (Table 3D, lines 1
and 2 vs lines 3-5 and line 6 vs line 7) and a 3' TpT or a TpA
(Table 3E, lines 1 and 2 vs lines 3 and 4 and lines 5 and 6 vs line
7) yielded the most active K ODN. Modifications >2 bp from the
CpG dinucleotide had relatively less effect on ODN activity.
Example 5
Cellular Targets of K and D ODN
The phenotype of the cells stimulated to produce cytokine was
determined by combined cell surface and intracytoplasmic staining.
As seen in Table 4, D ODN selectively stimulated
CD3-CD16+CD56+CD14-cells to produce IFN-.gamma., consistent with
the direct activation of NK cells.
TABLE 4 Phenotype of PBMC stimulated by CpG ODN to secrete
cytokines A. Phenotype of PBMC activated by "D" ODN to produce
IFN.gamma. Cell surface marker % positive cells CD16 91 CD56 99 CD3
5 CD24 <1 B. Phenotype of PBMC activated by "K" ODN to produce
IL-6 Cell surface marker % positive cells CD83 93 CD14 70 CD11c 69
CD19 13 CD16 <1 Freshly isolated PBMC were stimulated with K" (8
hr) or D (24 hr) ODN. Cells were fixed, permeabilized and stained
with PE-anti-IL-6 or anti-IFN.gamma.. Results are representative of
4-10 experiments.
Without being bound by theory, the effect appears to be direct
because D ODN do not induce a significant increase in IL-12
secretion. Moreover, studies using neutralizing anti-IL-12, which
reduce the production of IFN-g by PBMCs stimulated with PHA (44% p,
0.05) or with bacillus Calmette-Guerin (77%; p, 0.05), did not
decrease the IFN-.gamma. production induced by CpG-ODN. By
comparison, K ODN stimulated CD14+, CD11c+, and CD83+ cells to
produce IL-6, indicating that they were of monocyte/dendritic cell
lineage (Table 4B). K ODN also stimulated a fraction of CD19+ B
cells to release IL-6.
To confirm these findings, human NK, T, and B cell lines were
tested for their responsiveness to K and D ODN. The NK-92 cell line
responded exclusively to D ODN by secreting IFN-.gamma., whereas
the human RPMI 8226 B cell line was stimulated by K ODN to release
IL-6. Non-CpG ODN did not stimulate either cell line.
Thus, as disclosed herein, there are two structurally distinct
types of CpG ODN that stimulate different cellular elements of the
immune system to mount divergent responses. K type ODN induce
monocytes/dendritic cells to produce IL-6 and B cells to
proliferate and secrete IgM, whereas D type ODN support NK
production of IFN-.gamma. (see Table 1). These CpG ODN can be used
as vaccine adjuvants, anti-allergens, and immunoprotective agents,
as disclosed herein.
The CpG motifs at the center of K and D ODN differ. The optimal K
motif contains a thymidine immediately 5' of the CpG, and a TpT or
TpA 3' of the CpG. By comparison, optimally active D type ODN
contain Pu-Py dimers on each side of the CpG. D ODN also are
longer. In one embodiment, the CpG flanking regions are
self-complementary. Two dimensional computer modeling further
suggested that this self-complementary sequence facilitates the
formation of a hairpin loop that exposes the CpG at the apex.
Without being bound by theory, this stem-loop structure contributes
to the recognition of D ODN because IFN-.gamma. production declines
when the length or binding strength of the palindrome is reduced
(FIG. 2E). Without being bound by theory, the inclusion of poly G
at the 3' end of the ODN likely further confers a structural
benefit. Alternatively, the poly Gs may improve the efficiency of
cellular uptake.
As demonstrated herein, K and D ODNs activate distinct cell types.
K ODN activate monocytes and B cells to secrete IL-6, whereas D
type ODN stimulate NK cells to secrete IFN-.gamma. (Table 1). It is
believed that this difference is not due to differential uptake of
the ODNs, as monocytes and NK cells take up both D and K ODNs.
Without being bound by theory, K and D type ODNs activate their
target cells directly, as 1) CpG ODN stimulate cloned cell lines to
secrete cytokines; 2) cytokine mRNA appears within minutes of ODN
stimulation; and 3) ELISPOT studies show that the CpG ODN induced
rapid increase (two to five-fold) in IL-6 and IFN-.gamma. secreting
PBMC (5 and 18 hour after stimulation, respectively). Moreover,
flow cytometric analysis of cells stimulated to secrete IFN-.gamma.
by CpG ODN were CD3- even after 72 h of stimulation, indicating
that the increased IFN-.gamma. in supernatents is not due to the
secondary activation of T cells.
Example 6
Further Evidence of Differing Functions of D and K ODNs
Material and Methods
Oligonucleotides and antibodies: ODN were synthesized at the CBER
core facility. Sequences of the CpG ODN used in this study are:
5'-TCGAGCGTTCTC-3' (K23, SEQ ID NO: 79) and
5'-GGtgcatcgatgcaggggGG-3' (D35, SEQ ID NO: 1). The control for K
ODN was: 5'-TCAAGTGTTCTC-3' (SEQ ID NO: 122) and for D ODN was:
5'-GgtgcatctatgcaggggGG-3' (SEQ ID NO: 123). In this example, bases
shown in capital letters are phosphorothioate while those in lower
case are phosphodiester. CpG dinucleotides are underlined. All
FITC, PE and cychrome labeled Mabs were purchased from Pharmingen
(San Jose, Calif.). All ODNs used in this study contained <0.1
U/mg of endotoxin.
Cell cultures: PBMC from normal donors (provided by the NIH
Department of Transfusion Medicine) were isolated by Ficoll-Hypaque
density gradient centrifugation (Verthelyi, D, et al., J. Immunol.
166:2372-2377, 2000). Countercurrent centrifugal elutriation was
used to isolate monocytes that were >95% pure.
0.5-4.times.10.sup.6 cells/ml were cultured in RPMI 1640 containing
5% FCS, 50 U/ml penicillin, 50 .mu.g/ml streptomycin, 0.3 mg/mL
L-glutamine, 0.1 mM non-essential amino acids, 1 mM sodium
pyruvate, 10 mM HEPES and 10.sup.-5 M 2-mercaptoethanol. Cells were
stimulated with ODN for 8-72 h with 1-3 .mu.M ODN, depending upon
the assay.
Analysis of cell proliferation: PBMC were cultured in complete
medium plus 3 .mu.M ODN for 72 h. To study B cell proliferation,
cells were loaded with 10 nM of CFSE (Molecular Probes Inc.,
Eugene, Oreg.) as described before (24). Proliferation of CD11c+
monocytes was monitored by adding 10 .mu.M of BrdU (Pharmingen, San
Jose, Calif.) for the last 18 h of culture. Staining for BrdU was
performed as recommended by the manufacturers.
ELISA assays: 96-well microtiter plates (Millipore, Bedford, Mass.)
were coated with anti-cytokine or anti-IgM Ab and blocked with
PBS-5% BSA (8). The plates were incubated for 2 h with culture
supernatants from PBMC (5.times.10.sup.5 /ml) that had been
stimulated for 8-24 h with ODN as described above. IL-6, IFN.gamma.
and IgM were detected colorimetrically using biotin-labeled
antibodies followed by phosphatase-conjugated avidin and a
phosphatase specific colorimetric substrate (Verthelyi, D, et al.,
J. Immunol. 166:2372-2377, 2000). The detection limit of the assays
was: 6 pg/ml for IFN.gamma., 20 pg/ml for IL-6, and 10 ng/ml for
IgM. All assays were performed in triplicate.
Staining for cell surface markers and Intracellular cytokine:
Cultured cells were washed in cold PBS, fixed, and stained with
fluorescent labeled anti-CD69 (24 h), anti-CD25 (72 h), anti-CD83
(72 h) or anti-CD86 (72 h). To detect intracytoplasmic cytokine,
cells incubated with ODN for 8 h were washed, fixed, permeabilized
(as per manufacturer's instructions, Caltag, Calif.) and stained
with 4 .mu.g/ml PE-conjugated anti-IL-6 or 2 .mu.g/ml PE-conjugated
anti-IFN.gamma. (Pharmingen, San Jose, Calif.) plus various FITC
and Cy-Chrome labeled surface markers for 30' at RT. Samples were
washed and analyzed (20,000-40,000 events) on a FACScan flow
cytometer (Becton Dickinson, San Jose, Calif.) after gating on live
cells with proper electronic compensation. The data were analyzed
using CELLQuest software (Becton Dickinson Immunocytometry Systems,
San Jose, Calif.).
Analysis of cell-surface binding and internalization of ODN: PBMC
(4.times.10.sup.6 /ml) were incubated with biotinylated ODN (1-3
.mu.M) for 10' at 4.degree. C. (binding experiments) or 37.degree.
C. for 1 h (uptake experiments). To detect internalized ODN,
surface bound ODN was blocked with 100 .mu.g/ml of "cold"
streptavidin. After washing, these cells were permeabilized, fixed,
and stained with PE-conjugated streptavidin (1 .mu.g/ml) plus FITC
or Cy-Chrome conjugated cell surface markers.
Confocal Microscopy Elutriated monocytes (4.times.10.sup.6 /ml)
were incubated with Cy-3 or FITC labeled K and/or D ODN at
37.degree. C. for 1 h. The cells were washed, and mounted using the
Prolong antifade kit (Molecular Probes, Oregon, USA). Subcellular
localization of Cy3 and FITC labeled ODN was determined by confocal
microscopy under 1000.times. magnification (LSM5 PASCAL, Carl Zeiss
In., Thornwood, N.Y.).
Binding and Internalization of CpG ODN.
The ability of human PBMC to bind and internalize CpG ODN was
examined using fluorescent-labeled K23 and D35 ODN. Both types of
ODN bound rapidly to the surface of virtually all human monocytes
at 4.degree. C. A significant fraction of B lymphocytes (20-45%)
and NK cells (.about.10-20%) also bound these ODN. Simultaneous
staining with K and D ODN showed that the same cells were binding
both types of ODN. In contrast, interaction with T cells barely
exceeded background levels.
To monitor internalization, PBMC were incubated with biotin-labeled
ODN for 60' at 37.degree. C. Surface-bound ODN was blocked with
excess strepavidin, and internalized ODN detected by staining
fixed, permeabilized cells with FITC-avidin. The fraction of
monocytes, B lymphocytes and NK cells that internalized K23 and D35
ODN was similar to the fraction of each cell type that bound these
ODN. Similar results were obtained using other D and K ODN. No
internalization was observed when cells were incubated with ODN for
10' at 4.degree. C., suggesting that ODN uptake involves metabolic
activity.
The ratio of membrane bound: internalized ODN was compared. Based
on differences in mean fluorescence intensity, it was calculated
that target cells internalized approximately half of the ODN that
had bound to their cell surface. For all cell types, the absolute
magnitude of D ODN uptake exceeded that of K ODN. For example, the
amount of labeled D ODN that bound to and was taken up by monocytes
exceeded that of equimolar K ODN by .about.2-fold throughout the
functional concentration range of these agents (p<0.001). To
achieve equivalent levels of binding and uptake required that "D"
ODN be used at a 4-fold lower concentration than K (e.g. 0.75 vs
3.0 .mu.M).
The intracellular localization of these two types of ODN was
examined by confocal microscopy of labeled monocytes. K and D ODN
largely occupied discrete areas within the same cell, although
there was a limited degree of co-localization. D ODN largely
occupied punctuated vesicles, whereas K ODN were more diffusely
distributed, staining the nucleus as well as cytoplasmic vesicles.
This difference in localization was associated with the presence or
absence of a poly G tail, since control (non-CpG) ODN with a poly G
tail showed the same distribution pattern as did D ODN. In
contrast, the fluorescent dyes used did not influence distribution,
since switching dyes had no effect on ODN localization pattern.
Differential Effect of K Versus D ODN on B Cell Function
Whole PBMC were treated with optimal concentrations of K23 and D35
ODN. K ODN rapidly activated CD19.sup.+ B cells, reflected by a
significant increase in the expression of the CD69 early activation
marker and the CD25 late activation marker (p<0.001). K ODN also
triggered a >10-fold increase in B cell proliferation
(p<0.05), a >10-fold increase in IgM production (p<0.01),
and a 5-fold increase in the number of B cells secreting IL-6
(p<0.001). The effect of K23 exceeded that of D35 (and of a
control for the K type ODN of the same structure but lacking the
critical CpG motif) by >10-fold in each of these functional
assays. D ODN were not entirely inactive, however, since they
induced a modest increase in CD25 and CD69 expression by CD19.sup.+
B cells.
Differential Effect of K Versus D ODN on NK Cells
NK cells were identified by their expression of the CD16 surface
marker. D ODN stimulated approximately 25% of these cells to
increase expression of CD25 and CD69 (p<0.001). Consistent with
previous studies, D ODN also triggered a significant increase in
IFN.gamma. secretion by NK cells (p<0.05). By comparison,
neither K ODN nor a non-CpG control for the D ODN significantly
stimulated IFN.gamma. production (see also Table 1). K23 did induce
a modest increase in the number of NK cells expressing CD25 and
CD69 (p<0.05). None of these ODN induced NK cells to
proliferate.
Differential Effect of K Versus D ODN on Monocytes
K and D ODN had disparate effects on purified monocytes. K23
stimulated CD14.sup.+ monocytes to proliferate (p<0.05) and
secrete IL-6 (p<0.001), while D35 had no effect in these assays
(Table 5). Instead, D (but not K) ODN stimulated monocytes to
mature into CD83.sup.+ /CD86.sup.+ dendritic cells (DC)
(p<0.001, Table 5). The divergent effects of K versus D ODN on
monocytes persisted throughout the physiologic concentration range
of both types of ODN, and was observed using a variety of D and K
ODN, indicating that these differences were not due to variation in
ODN binding or uptake. Although both types of ODN increased CD69
and CD25 expression, D ODN up-regulated these activation markers in
monocytes significantly more effectively (p<0.001, Table 5).
TABLE 5 Effects of D ODN % of Cells Expressing/Producing ODN type
CD25 CD 69 IL-6 L-6 (ng/ml) Proliferation (SI) DC maturation K23
32.8 .+-. 1.1 39.7 .+-. 5.3 24.1 .+-. 2.4 2.0 .+-. 0.3 7.0 .+-. 1.4
3.5 .+-. 0.3 D35 48.6 .+-. 7.5 82.1 .+-. 2.4 4.6 .+-. 0.3 0.8 .+-.
0.1 1.0 .+-. 0.5 23.7 .+-. 2.0 K23 + D35 44.7 .+-. 13.9 53.8 .+-.
12.5 ND 2.2 .+-. 0.1 2.8 .+-. 1.7 5.2 .+-. 0.8 "K" control 21.8
.+-. 2.2 30.2 .+-. 2.5 5.1 .+-. 0.6 <.03 2.1 .+-. 1.6 1.8 .+-.
0.1 PBMC or elutriated monocytes were stimulated with 3 uM of ODN
for 8-72 h. The percent of CD14.sup.+ monocytes induced to secrete
IL-6 was determined by intracytoplasmic staining. Due to the
down-regulation of CD14, CD11c was used to monitor the expression
of CD25 and CD69 by stimulated cells. The percent of CD83.sup.+
/CD86.sup.+ dendritic cells in culture was determined after 72 h.
IL-6 levels in culture # supernatants were determined by ELISA,
while proliferation was evaluated BrDU incorporation. Results
represent the mean .+-. SD of 5 independent experiments.
Competition Between K and D ODN at the Single Cell Level
The above findings suggested that monocytes responded differently
to stimulation by K versus D ODN. There are two possible
explanations for this observation: either i) these two types of ODN
were triggering the same cells to mount distinct types of immune
response or ii) K and D ODN were acting on different subpopulations
of monocytes. The latter explanation seemed unlikely, given that
confocal microscopy showed that the same cells were binding and
internalizing both types of ODN.
To clarify this situation, monocytes were treated simultaneously
with D35 plus K23. At optimally stimulatory concentrations, these
ODN did not cross-compete for uptake or binding. Yet when their
function was analyzed, co-administration of K ODN reduced the
ability of D ODN to trigger monocyte differentiation by 70%
(p<0.001). The inhibitory effect of K ODN on the activity of D
ODN was sequence specific and concentration dependent, since
control non-CpG ODN did not significantly interfere with the
activity of D ODN. Conversely, D ODN significantly reduced the
ability of K ODN to induce monocytes to proliferate (p<0.05). As
above, the inhibitory effect of D on the activity of K ODN was
sequence specific and concentration dependent.
A very different pattern emerged when B and NK cells were studied.
In these cells, the co-administration of D with K ODN was not
inhibitory. Rather, the ability of K ODN to stimulate B cells to
proliferate and secrete IL-6 and IgM was unaffected by the presence
of D ODN, and the ability of D ODN to stimulate NK cells to secrete
IFN.gamma. was not reduced by inclusion of K ODN.
Example 7
D ODN Enhance Tumor Lysis
Reports of tumor regression following systemic bacterial infection
stimulated research into immune adjuvants as a strategy for tumor
treatment. Immunostimulatory oligodeoxynucleotides (ODNs)
containing the CpG motif have been demonstrated to induce the
production of various cytokines, natural killer cells, monocytes,
lymphocytes and dendritic cells (see above). Thus, short-term
bladder transitional cell carcinoma (TCC) cultures were treated
with CpG ODN immunostimulated PBMC and the cultures were analyzed
for evidence of tumor lysis.
Materials and Methods
Papillary TCCs from 4 patients were cultured. Peripheral blood
mononuclear cells (PBMCs) were obtained from each patient. In
matched cultures, the tumor cells were treated with PBMCs
stimulated in-vitro with: 1) CpG ODN in the presence or and absence
of tumor cells, 2) bacillus Calmette-Guerin (BCG) stimulated PBMCs
(positive control and standard of care), 3) unstimulated PBMCs,
and/or 4) BCG or CpG ODN in the absence of the patient's PBMCs
(negative controls).
The morphologic and lytic characteristics of these cultures were
compared with those of untreated matched tumor cell cultures. A
chromium based CTL assay method was used for quantitative
comparison of tumor lysis.
Results
PBMCs that were stimulated in vitro with CpG ODN type D in the
presence of tumor cells lysed 30-70% of the tumor cells from 3 of 4
patients.
TABLE 6 Percent lysis PBMC + TCC 4 + 5 PBMC + TCC + D ODN 41 + 15
PBMC + TCC + K ODN 3 + 3 PBMC + TCC + CONTROL ODN 3 + 2 PBMC + TCC
+ BCG 71 + 24
Thus, CpG ODN immunostimulation was associated with enhancement of
tumor lysis comparable to that of BCG. K ODN did not enhance tumor
lysis. Similarly, tumor lysis was not enhanced in the absence of
CpG ODN (the negative control).
Example 8
Primates Provide a Model System for the Study of CpG ODN
Primate PBMCs respond in a similar manner as human PBMCs to CpG
ODN. To demonstrate the similarities, PBMC from normal human donors
and Rhesus macaques were stimulated with a panel of K, D or control
ODNs, and the IL-6 and IFN-.alpha. levels produced were monitored
(FIGS. 4 and 5). In both human and monkey PBMC cultures, D ODNs
induced the secretion of IFN-.alpha., while K ODNs induced cells
proliferation and IL-6 production. Thus, rhesus macaques provide a
accurate model system for studying the effects of ODNs in
vitro.
In order to establish that rhesus macaques were a model system for
in vivo experiments, macaques were treated an antigen (OVA) and
with either D type (D19 and D29) or K type (K3 and K23) ODNs, or
with a control ODN (A23). The anti-OVA IgG titers in the group that
received D ODN were significantly higher (FIG. 6), thus
demonstrating that D ODN can increase the immune response to a
protein antigen in vivo. Thus, rhesus macaque monkeys provide an in
vivo model system to study the effects of ODNs.
Example 9
Effect of D ODN on PBMC from Primates
As disclosed in this example, rhesus macaques provide a useful
model for assessing the activity of CpG ODN in vivo. In vitro
studies established that PBMC from rhesus macaques responded to the
same panel of K and D ODN that were highly active on human PBMC.
CpG ODN were co-administered with a mixture of ovalbumin plus alum.
The ODN significantly boosted the antigen-specific IgG response of
macaques, with D being superior to K ODN. A cutaneous leishmania
infection model was then used to examine whether CpG ODN could
boost protective immunity in primates. The nature, severity,
duration and histopathology of the cutaneous disease caused by L.
major in macaques is quite similar to that in humans (for example
see. Amaral et al., Exp Parasitol 82:34, 1996). Results indicate
that D ODN significantly improve the protection conferred by
co-administered heat-killed leishmania vaccine (HKLV).
Materials and Methods Utilized
Rhesus monkeys: Healthy 3 year old female rhesus macaques (M.
mulata) were obtained from the FDA colony in South Carolina. All
studies were ACUC approved and were conducted in an AAALAC
accredited facility. Animals were monitored daily by veterinarians.
No systemic or local adverse reactions to CpG ODN, OVA or HKLV
immunizations were observed. Treatments were administered and
peripheral blood samples obtained from ketamine anesthetized
animals (10 mg/kg, Ketaject, Phoenix Pharmaceuticals, St Joseph,
Md.).
Vaccination groups and protocol: Two in vivo studies were
conducted. 1) 3 monkeys/group were immunized subcutaneously (s.c.)
and boosted 12 weeks (wk) later with a mixture of 4 .mu.g of
ovalbumin, 250 .mu.g ODN and 125 .mu.g of alum (Rehydragel HPA,
Reheis, Berkeley Heights, N.J.). 2) 5-6 monkeys/group were
immunized s.c. and boosted 4 weeks later with 250 .mu.g of GMP
grade HKLV (Biobras, Montes Claros, Brazil) plus 125 .mu.g of alum,
as previously described (27). The HKLV was administered alone, or
combined with 500 .mu.g of ODN. Preliminary studies established
that this dose of ODN was active in vivo and well-tolerated.
Animals were exposed to non-viable L. amazonensis metacycle
promastigotes on week 8, a treatment that induced no disease and no
change in antibody titer or proliferative response to Leishmania
antigens when compared to control animals. Animals were challenged
on the forehead on week 14 with 10.sup.7 viable L. major
(WHOM/IR//173) metacyclic promastigotes i.d. The monkeys developed
a typical self-limited in situ lesion characterized by erythema,
induration, and ulceration. Lesion size, which reflects the
severity of infection, was measured weekly.
Oligodeoxynucleotides: ODN were synthesized by the CBER Core
Facility. All ODN had less than <0.1 EU of endotoxin per mg of
ODN as assessed by a Limulus amebocyte lysate assay (QCL-1000,
BioWhittaker). The following ODN were used in this work:
D19: GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) D29: GGTGCACCGGTGCAGGGGGG
(SEQ ID NO:2) D35: GGTGCATCGATGCAGGGGGG (SEQ ID NO:1) D122:
GGTGCATTGATGCAGGGGGG (SEQ ID NO:53) K3: ATCGACTCTCGAGCGTTCTC (SEQ
ID NO:3) K123: TCGTTCGTTCTC (SEQ ID NO:92) K23: TCGAGCGTTCTC (SEQ
ID NO:79) K163: TTGAGTGTTCTC (SEQ ID NO:109) AA3M: GGGCATGCATGGGGGG
(SEQ ID NO:124)
Mononuclear cell preparation: Human and monkey mononuclear cells
were isolated by density gradient centrifugation of PBMC over
Ficoll-Hypaque as described (see above). Cells were washed 3 times
and cultured in RPMI 1640 supplemented with 10% heat-inactivated
FCS (FCS), 1.5 mM L-glutamine and 100 U/ml of
penicillin/streptomycin at 5.times.10.sup.5 cells/well in the
presence of 3 .mu.M ODN. Supernatants were collected after 72 hours
and tested by ELISA for cytokine and antibody levels.
ELISA: 96-well microtiter plates (Millipore Corp., Bedford, Mass.)
were coated with Abs that cross-reactively recognized human and
macaque IL-6 (R&D, Minneapolis, Minn.), IFN-.alpha. (PBL
Biomedical Laboratories, New Brunswick, N.J.), and IgG
(Boehringer-Mannheim Biochemicals, Germany). The plates were
blocked with PBS-5% BSA. Culture supernatants from PBMC cultures
were added, and their cytokine content quantitated by the addition
of biotin-labeled anti-cytokine Ab followed by
phosphatase-conjugated avidin and phosphatase-specific colorimetric
substrate. Standard curves were generated using known amounts of
recombinant human cytokine or purified Ig. All assays were
performed in triplicate. Titers of antibodies to ovalbumin in sera
were assayed on OVA-coated plates.
ELIspot: The number of PBMC secreting IFN-.gamma. in response to
soluble leishmania antigen (SLA) were determined by ELIspot as
described (Hagiwara Cytokine 7:815, 1995). Briefly, Millipore
96-well filtration plates (Millipore Corp., Bedford, Mass.) were
coated overnight at 4.degree. C. with 1 .mu.g/ml of anti-human
IFN-.gamma. antibodies (Clone GZ4, Alexis, San Diego, Calif.) in
PBS and then blocked with PBS-5% BSA for 2 hr. The plates were
overlaid with 5.times.10.sup.5 cells/well (1-2 series/monkey) and
incubated at 37.degree. C. in a humidified 5% CO.sub.2 in air
incubator for 18 hr in the presence of 25 .mu.g soluble leishmania
antigen (SLA). The plates were then washed with water-0.025% Tween
and overlaid with biotin conjugated anti-human IFN-.gamma. (clone
76-B-1,Mabtech, Sweden). After 2 hr the plates were washed again
and then overlaid with alkaline phosphatase-conjugated
streptavidin. Spots were visualized by the addition of
5-bromo-4-chloro-3-indolyl phosphate (Kirkegaard and Perry
Laboratories, Gaithersburg, Md.) and counted using the KS ELIspot
Imagine System (Carl Zeiss, Inc., Thornwood, N.Y.).
Cell proliferation assay: 10.sup.5 PBMC/well were incubated with 3
.mu.M of ODN for 68 h, pulsed with 1 .mu.Ci of [.sup.3 H] thymidine
and harvested 4 h later. All assays were performed in
triplicate.
Statistical Analysis: Statistically significant differences were
determined using a 2-tailed non-parametric ANOVA with Dunnett's
post test analysis. Differences in lesion sizes were tested by
repeated-measures ANOVA using the Proc Mixed procedure from the
Statistical Analysis System (SAS). RESULTS:
Response of PBMC from Human and Non-human Primates to K and D
ODN
As disclosed herein, human PBMC respond to two structurally
distinct classes of CpG ODN. D type ODN triggered the secretion of
IFN-.gamma. and IFN-.alpha. whereas K ODN induced human PBMC to
proliferate and secrete IL-6 and IgM (Table 1). D and K ODN that
strongly activated human cells were tested for their ability to
stimulate PBMC from rhesus macaques.
The response of rhesus PBMC to "D" ODN was evaluated on the basis
of IFN-.gamma. production. Results show that macaque PBMC are
activated by the same D ODN that stimulate human PBMC (p<0.002,
FIG. 4). In contrast, neither K ODN, nor control ODN that are
structurally similar to D ODN but lack the critical CpG
dinucleotide, had this effect.
Proliferation and IL-6 secretion were used to compare the response
of macaque and human PBMC to K ODN. PBMC from both species were
stimulated by K ODN to proliferate (p<0.002) and secrete IL-6
(p<0.01), whereas controls of the same structure as K ODN but
lacking the critical CpG motif failed to trigger immune
stimulation. The results demonstrated that the pattern of
reactivity of PBMC from rhesus macaques (N=20) and humans (N=8-20)
to K and D ODN is similar.
Mixtures of ODN were identified that strongly stimulated PBMC from
all human donors were utilized in further experiments. These
mixtures were tested on PBMC from macaques and found to be
uniformly active (FIG. 5). Subsequent in vivo studies were conduced
with these ODN mixtures.
Adjuvant Activity of CpG ODN In vivo
Previous studies in mice showed that CpG ODN could boost the immune
response to a co-administered protein antigen (such as ovalbumin).
This effect was amplified by adding alum to the mixture of CpG ODN
plus antigen (for example see Klinman, Vaccine 17:19, 1999).
Building on these results, macaques were immunized and boosted with
a mixture of OVA, alum, and ODN (see FIG. 6). Animals immunized
with mixtures containing DODN increased their IgG anti-OVA response
by 470-fold after primary (p<0.05) and by 600-fold after
secondary (p<0.01) immunization. By comparison, K ODN boosted
the IgG Ab response by 7-fold after primary and 35-fold after
secondary immunization when compared to pre-treatment values
(p<0.05). Macaques immunized with OVA plus control ODN generated
only a 4-fold increase in anti-OVA titer. These findings indicate
that D ODN are particularly effective at boosting the
antigen-specific humoral response to a co-administered antigen.
CpG ODN that activate human immune cells in vitro are only weakly
immunostimulatory in mice. The results disclosed herein document
that rhesus macaques are a relevant model for examining the in vivo
activity of CpG ODN. PBMC from macaques mirrored the response of
human PBMC in their response to both "K" and "D" ODN. At the
immunostimulatory doses used in this study, neither type of ODN
triggered any adverse events. In vivo, broadly immunostimulatory
mixtures of K and D ODN boosted antigen-specific IgG responses in
macaques immunized with OVA and increased IFN-.gamma. production in
animals vaccinated with HKLV. In addition, as described below, D
ODN significantly increased the protective response elicited by a
co-administered vaccine.
Example 10
Effect of CpG ODN on the Immunogenicity and Protective Efficacy of
Heat-Killed Leishmania Vaccine (HKLV)
Previous human clinical trials showed that HKLV was safe, but
poorly immunogenic (Handman et al., Clin Microboiol. Rev. 14:229,
2001). In addition, HKLV combined with alum and IL-12 induces
short-term protective immunity in rhesus macaques (Kenney et al., J
Immunol 163:4481, 1999), and CpG ODN plus alum increased the immune
response to the hepatitis B vaccine in cyalomongus monkeys (Hartmen
et al., J Immunol 164:1617, 2000).
Macaques were immunized and boosted with a mixture of HKLV, alum
and CpG ODN. PBMC from these animals were isolated 10 days post
boost and re-stimulated in vitro with leishmania antigen for 72 hr.
As seen in FIG. 7, both K and D ODN significantly increased the
number of PBMC triggered to secrete IFN-.gamma. (p<0.05). In
contrast, animals immunized with alum-adsorbed HKLV alone showed no
increased IFN-.gamma. production when compared to unimmunized
controls.
The critical measure of an antigen/adjuvant combination is its
ability to induce protective immunity. Vaccinated animals were
therefore challenged with 10.sup.7 L. major metacyclic
promastigotes. Animals vaccinated with HKLV-alum alone developed
typical cutaneous lesions with a peak surface area of 300+60
mm.sup.2 26 days after challenge (FIG. 7). Monkeys vaccinated with
HKLV-alum plus K ODN developed lesions of similar size, although
the peak lesion formation was slightly delayed. Animals immunized
with HKLV-alum plus "D" ODN had significantly smaller lesions
(maximal size 80+13 mm.sup.2, p<0.05), consistent with a reduced
parasite burden.
All animals treated with CpG ODN, either alone or with antigen,
remained healthy and active throughout the study. No hematologic or
serologic abnormalities were observed 3 days or 9 months after
injection and no weight loss or change in behavior were detected
following administration of CpG ODN at therapeutic doses
As disclosed herein, cutaneous infection of macaques with L. major
provides a means for testing the protective efficacy of CpG
ODN--vaccine combinations. The nature, severity and duration of the
cutaneous disease caused by L. major in macaques is quite similar
to that in humans. The leading leishmania vaccine candidate (HKLV)
has proven safe but poorly immunogenic in clinical trials (Handman,
Clin Microboiol. Rev. 14:229, 2001). Co-administration of both D
and K ODN with this alum-adjuvanted HKLV vaccine significantly
increased the number of PBMC triggered to secrete IFN-.gamma. when
stimulated with leishmania antigen in vitro. However, the critical
test of any vaccine/adjuvant combination is its ability to induce
protective immunity. Results show that the cutaneous lesions of
macaques vaccinated with HKLV plus "D" ODN were significantly
reduced when compared to HKLV-alum alone. A reduction in lesion
size correlates with a reduced parasite load. Thus, without being
bound by theory, the findings suggest that the ability of D ODN to
stimulate IFN-.gamma. and IFN .alpha. production while promoting
the maturation of antigen presenting cells can be useful for the
induction of a protective response against leishmania. In addition,
without being bound by theory, the findings suggest that the
ability of D ODN to stimulate IFN-.gamma. and IFN .alpha.
production while promoting the maturation of antigen presenting
cells can be useful as a vaccine adjuvant.
All of the references cited herein, including patents, patent
applications, and publications, are hereby incorporated in their
entireties by reference.
While this invention has been described with an emphasis upon
preferred embodiments, it will be obvious to those of ordinary
skill in the art that variations of the preferred embodiments may
be used and it is intended that the invention may be practiced
otherwise than as specifically described herein. Accordingly, this
invention includes all modifications encompassed within the spirit
and scope of the invention as defined by the following claims.
SEQUENCE LISTING <100> GENERAL INFORMATION: <160>
NUMBER OF SEQ ID NOS: 120 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 1 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 1 ggtgcatcga tgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 2 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 2 ggtgcaccgg tgcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 3 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 3 atcgactctc gagcgttctc 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 4
<211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 4 tcgagcgttc t
11 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 5
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 5 ggtgcacgcg
tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 6 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 6
tgcaggcttc tc 12 <200> SEQUENCE CHARACTERISTICS: <210>
SEQ ID NO 7 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 7 ggtgcgtcga tgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 8 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 8 tcgactctcg agcgttctc 19 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 9 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 9 actctcgagc gttctc 16
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 10
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 10 ctcgagcgtt
ctctcgagcg ttct 24 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 11 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 11 ggtgcatcga tacagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 12 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 12 tgcatcgatg cagggggg 18 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 13 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 13 tgcaccggtg cagggggg 18
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 14
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 14 tgcgtcgacg
cagggggg 18 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 15 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 15
gggcatgcat gggggg 16 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 16 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 16 tgcgtcgatg cagggggg 18 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 17 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 17 tgcgccggcg cagggggg 18 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 18 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 18 tgcgccgatg cagggggg 18
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 19
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 19 tgcatcgacg
cagggggg 18 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 20 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 20
tgcgtcggtg cagggggg 18 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 21 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 21 ggtgcatcta tgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 22 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 22 tcaagtgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 23 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 23 ttgttcgaac tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 24 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 24 ttgttcgagc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 25 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 25 ttgttcgtac tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 26 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 26 ggtgtgtcga tgcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 27 <211>
LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 27 ttgttcgttc tc 12
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 28
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 28 tcgaatgctc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 29 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 29 tcggatgagc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 30 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 30 ggtgcatcgt tgcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 31 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 31 ggtgcgtcga cgcagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 32
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 32 ggtcgatcga
tgcacggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 33 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 33
tcgtatgtac tc 12 <200> SEQUENCE CHARACTERISTICS: <210>
SEQ ID NO 34 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 34 acgaggcttc tc 12 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 35 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 35 ggtgcatcga cgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 36 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 36 ggtgcatcga taggcggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 37 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 37 ggtgcaccga tgcagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 38
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 38 cctgcatcga
tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 39 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 39
ggtatatcga tatagggggg 20 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 40 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 40 ggtggatcga tccagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 41 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 41 ggtgcaacgt tgcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 42 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 42 ggtgcatcga tagagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 43
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 43 ggtgcatcgt
agcagggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 44
ggtggttcga tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 45 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 45 gtcggcgctg ac 12 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 46 ggtgcaccgg tgcaaaaaaa 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 47 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 47 ggtgcatcga tagagggg 18 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 48 <211>
LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 48 cgagcgttct c 11
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 49
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 49 ggtgcatcga
tgcaaaaaaa 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 50 <211> LENGTH: 13 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 50
ggggtcgaca ggg 13 <200> SEQUENCE CHARACTERISTICS: <210>
SEQ ID NO 51 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 51 ggtgcataaa tgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 52 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 52 ggtgcatcaa tgcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 53 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 53 ggtgcattga tgcagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 54
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 54 ggtgcatcga
tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 55
ggtgcatgca tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 56 <211> LENGTH: 12 <212> TYPE:
DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 56 gtcagcgccg ac 12 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 57 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 57 gtcggcgccg ac 12 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 58 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 58 ggtgcactgg tgcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 59 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 59 ggtgtatcga tgcaaaaggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 60 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 60 ggtgccccgt tgcagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 61
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 61 ggtgcaacgg
ggcagggggg 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 62
aatgcatcga tgcaaaaaaa 20 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 63 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 63 ggtgcaccgt ggcagggggg 20 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 64 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 64 ggtgcatcga agcagggggg 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 65 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 65 ggtggatcga tgcagggggg 20
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 66
<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 66 actcttgagt
gttctc 16 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID
NO 67 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 67
ggtgcatgta tgcagggggg 20 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 68 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 68 gggggatcga tggggg 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 69 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 69 gggggaagct tcgggg 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 70 <211> LENGTH: 13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 70 ctcgagcgtt ctc 13 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 71 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 71 actctcgagc gttcta 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 72 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 72 tctcgagcgt tctc 14 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 73 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 73 actctggagc gttctc 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 74 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 74 tgcagcgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 75 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 75 tcgaggcttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 76 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 76 gtcggcgttg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 77 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 77 gcgaggcttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 78 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 78 gtcaacgccg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 79 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 79 tcgagcgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 80 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 80 acgagggttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 81 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 81 gtcggcgtcg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 82 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 82 ccgaggcttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 83 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
<400> SEQUENCE: 83 actctttcgt tctc 14 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 84 <211> LENGTH:
12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 84 gtcgacgttg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 85 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 85 tgcagcgagc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 86 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 86 actctcgagg gttctc 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 87 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 87 gggggaacgt tggggg 16 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 88 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 88 actctcgagc gttctcaaaa 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 89 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 89 catctcgagc gttctc 16
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 90
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 90 gtcgtcgatg ac
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 91
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 91 tcgagcgt 8
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 92
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 92 tcgttcgttc tc
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 93
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 93 tcgtttgttc tc
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 94
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 94 gtcgacgctg ac
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 95
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 95 tcgatgcttc tc
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 96
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 96 tcgccgcttc tc
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 97
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 97 gtcgacgccg ac
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 98
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 98 gtcatcgatg ca
12 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 99
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 99 actctttcga
tctc 14 <200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO
100 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 100
gtcagcgtcg ac 12 <200> SEQUENCE CHARACTERISTICS: <210>
SEQ ID NO 101 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 101 gtcaacgtcg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 102 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 102 tggagcgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 103 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 103 tgctgcgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 104 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 104 ttgagcgtac tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 105 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 105 tgcttcgagc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 106 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 106 tgcaccgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 107 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 107 gtcaacgctg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 108 <211> LENGTH: 9
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 108 tcgagcgtt 9 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 109 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 109 ttgagtgttc tc 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 110 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 110 tcgagcgttc 10 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 111 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 111 gtcggcgctg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 112
<211> LENGTH: 7 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 112 tcgagcg 7
<200> SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 113
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligonucleotide <400> SEQUENCE: 113 atgcactctg
caggcttctc 20 <200> SEQUENCE CHARACTERISTICS: <210> SEQ
ID NO 114 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligonucleotide <400> SEQUENCE: 114
gtcagcgctg ac 12 <200> SEQUENCE CHARACTERISTICS: <210>
SEQ ID NO 115 <211> LENGTH: 7 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 115 tcgagcg 7 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 116 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 116 tcgagcgttc 10 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 117 <211> LENGTH: 9 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 117 tcgagcgtt 9 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 118 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligonucleotide <400>
SEQUENCE: 118 gtcagcgctg ac 12 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 119 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligonucleotide
<400> SEQUENCE: 119 atgcactctg caggcttctc 20 <200>
SEQUENCE CHARACTERISTICS: <210> SEQ ID NO 120 <211>
LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligonucleotide <400> SEQUENCE: 120 gtcggcgctg ac 12
* * * * *