U.S. patent number 6,323,185 [Application Number 08/682,255] was granted by the patent office on 2001-11-27 for anti-viral guanosine-rich oligonucleotides and method of treating hiv.
This patent grant is currently assigned to The United States of America as represented by the Department of Health and Human Services. Invention is credited to Susan Fennewald, Michael E. Hogan, Joshua O. Ojwang, Robert F. Rando, Joseph G. Zendegui.
United States Patent |
6,323,185 |
Rando , et al. |
November 27, 2001 |
Anti-viral guanosine-rich oligonucleotides and method of treating
HIV
Abstract
A method and compositions for treating viral infection in vitro
and in vivo using a guanosine-rich oligonucleotide. The
oligonucleotides have sufficient guanosine to form a guanosine
tetrad. Also provided are oligonucleotides of at least two runs of
at least two guanosines. Also provided are guanosine-rich
oligonucleotides and methods for treating viral infections in
humans, and a method for designing guanosine-rich oligonucleotides
having anti-viral activity and integrase inhibition activity.
Inventors: |
Rando; Robert F. (The
Woodlands, TX), Fennewald; Susan (The Woodlands, TX),
Zendegui; Joseph G. (The Woodlands, TX), Ojwang; Joshua
O. (Spring, TX), Hogan; Michael E. (The Woodlands,
TX) |
Assignee: |
The United States of America as
represented by the Department of Health and Human Services
(Washington, DC)
|
Family
ID: |
27567273 |
Appl.
No.: |
08/682,255 |
Filed: |
July 17, 1996 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
535168 |
|
6184369 |
|
|
|
682255 |
|
|
|
|
|
682255 |
|
|
|
|
|
145704 |
Oct 28, 1993 |
5567604 |
|
|
|
053027 |
Apr 23, 1993 |
|
|
|
|
Current U.S.
Class: |
514/44R;
257/E23.119; 435/5; 435/6.13; 536/23.1; 536/24.5 |
Current CPC
Class: |
A61K
31/70 (20130101); A61K 31/711 (20130101); A61K
31/7115 (20130101); A61K 31/7125 (20130101); C07H
21/00 (20130101); C12N 15/1132 (20130101); C12N
15/1133 (20130101); H01L 23/293 (20130101); A61K
38/00 (20130101); C12N 2310/151 (20130101); C12N
2310/18 (20130101); C12N 2310/315 (20130101); C12N
2310/321 (20130101); C12N 2310/33 (20130101); C12N
2310/335 (20130101); C12N 2310/351 (20130101); C12N
2310/3515 (20130101); C12N 2310/321 (20130101); C12N
2310/3521 (20130101); H01L 2924/0002 (20130101); H01L
2924/0002 (20130101); H01L 2924/00 (20130101) |
Current International
Class: |
C07H
21/00 (20060101); C12N 15/11 (20060101); H01L
23/28 (20060101); H01L 23/29 (20060101); A61K
38/00 (20060101); A61K 031/70 (); C07H
021/00 () |
Field of
Search: |
;514/44 ;435/6
;536/23.1,24.5 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0375408 |
|
Jun 1990 |
|
EP |
|
0713705A |
|
May 1996 |
|
EP |
|
8901036 |
|
Feb 1989 |
|
WO |
|
WO9408053 |
|
Apr 1994 |
|
WO |
|
Other References
He et al., "Characterization of Human Cytomegalovirus UL84 Early
Gene and Identification of Its Putative Protein Product," J.
Virology, 66(2), 1098-1108 (1992).* .
Oram et al., "Use of Recombinant Plasmids to Investigate the
Structure of the Human Cytomegalovirus Genome," J. Gen. Virology,
59, 111-129 (1982).* .
Weston et al., "Sequence of the Short Unique Region, Short Repeats,
and art of theLong Repeats of Human Cytomegalovirus," J. Mol.
Biology, 192, 177-208 (1986).* .
Tamashiro et al.(I), "Structure of the Heterogeneous L-S Junction
Region of Human Cytomegalovirus Strain AD169 DNA," J. Virology,
52(2), 541-548 (1984). .
Mocarski et al., "Structure and Variability of the .alpha. Sequence
in the Genome of Human Cytomegalovirus (Towne Strain)," J. Gen.
Virology, 68, 2223-2230 (1987). .
Tamashiro et al.(II), "Terminal Structure and Heterogeneity in
Human Cytomegalovirus Strain AD 169," J. Virology, 59(3), 591-604
(1986). .
Henninghausen et al., "Nuclear Factor 1 Interacts with Five DNA
Elements int eh Promoter Region of the Human Cytomegalovirus Major
Immediate Early Gene," EMBO J., 5(6), 1367-1371 (1986). .
Rasmussen et al., "Sequences in Human Cytomegalovirus Which
Hybridize with the Avian Retrovirus Oncogene v myc Are G+C Rich and
Do Not Hybridize with the Human c-myc Gene," Molecular &
Cellular Biology, 5(6), 1525-1530 (1985). .
G. Zon, "Oligonucleotide Analogues as Potential Chemotherapeutic
Agents," Pharmaceutical Research, 5(9), 539-549 (1988). .
Miller et al., "Control of Ribonucleic Acid Function by
Oligonucleoside Methylphosphonates," Biochemie, 67, 769-776 (1985).
.
Marshall et al., "Phosphorodithioate DNA as a Potential Therapeutic
Drug," Science, 259, 1564-1570 (1993). .
Gura, "Antisense has Growing Pains--Efforts to Develop Antisense
Compounds for Cancer, AIDS, and Other Diseases Have Encountered
Some Unexpected Questions About How the Drugs Really Work,"
Science, 270, 575-577 (1995). .
Kreig et al., "CpG Motifs in Bacterial DNA Trigger Direct B-Cell
Activation," Nature, 374, 546-549 (Apr. 6, 1995). .
Patick et al., "Antiviral and Resistance Studies of AG1343, an
Orally Bioavailable Inhibitor of Human Immunodeficiency Virus
Protease," Antimicrobial Agents and Chemotherapy, 40(2), 292-297
(Feb., 1996); supplied but not cited by applicant.* .
Rusconi et al., "Naphthalene Sulfonate Polymers with CD4-Blocking
and Anti-Human Immunodefiency Virus Type 1 Activities,"
Antimicrobial Agents and Chemotherapy, 40(1), 234-236 (Jan. 1996);
supplied but not cited by applicant.* .
Wallace et al.(I), "Pharmacokinetics and Distribution of a .sup.33
P-Labeled Anti-Human Immunodeficiency Virus Oligonucleotide (AR177)
After Single-and Multiple-Dose Intravenous Administration to Rats,"
J. Pharmacology and Experimental Therapeutics, 280(3), 1480-1488
(1997); supplied but not cited by applicant.* .
Wallace et al. (II), "Single-Dose Hemodynamic Toxicity and
Pharmacokinetics of a Partial Phosphorothiate Anti-HIV
Oligonucleotide (AR177) After Intravenous Administration to
Cynomolgus Monkeys," J. Pharmacology and Experimental Therapeutics,
278(3), 1306-1312 (1996); supplied but not citied by applicant.*
.
Wallace et al. (III), "Repeat-Dose Toxicity and Pharmacokinetics of
a Partial Phosphorothioate Anti-HIV Oligonucleotide (AR177) After
Bolus Intravenous Adminstration to Cynomolgus Monkeys," J.
Pharmacology and Experimental Therapeutics, 278(3), 1313-1317
(1987); supplied but not cited by applicant.* .
Rando, "Clinical Trial Results of Aronex's Anti-HIV Oligonucleotide
(AR177) and Recent Antisense Technology Advances," IBC's Fourth
International Symposium on Antisense Therapeutics with New
Applications for Genomics, International Business Communications,
Inc., Wyndham Emerald Plaza Hotel, San Diego, CA Feb. 6-7, 1997;
only abstract supplied; supplied but not cited by applicant. .
Clinical Update, Hybridon, Inc. Worcester, MA, Feb. 10, 1997; press
release apparently obtained from the Internet; supplied but not
cited by applicant. .
Hybridon Moves GEM.RTM. 91 into Confirmatory Clinical Trail in
Advanced HIV-Positive Patient, Hybridon, Inc., Cambridge, MA, Feb.
10, 1997; original release date was Feb. 6-7, 1997 in San Diego, CA
(See ref. RB supra); supplied but not cited by applicant. .
Kahn et al., "Phase 1 Study of AR-177 (Zintevir), an HIV-1
Inhibitor with Significant Activity Against Integase Protein:
Safety, Pharmacokinetics, Immunologic and Virologic Activity,"
Abstract of presentation at the 11th International Conference on
Aids, Vancouver, BC, Jul. 7-12, 1996; supplied but not cited by
applicant. .
Kern, "Preclinical Evaluation of Antiviral Agents: In Vitro and
Animal Model Testing," Ch. 3 in Antiviral Agents and Viral Disease
in Man, Galasso et al. (eds.), Raven Press, Ltd., New York, NY
1990, pp. 87-114, only pp. 87 and 94-95 supplied. .
Balzarini, J., "Suppression of the Breakthrough of Human
Immunodeficiency Virus Type 1 (HIV-1) in Cell Culture by
Thiocarboxanilide Derivatives When Used Individually or in
Combination with Other HIV-1 Specific Inhibitos (i.e., TSAO
Derivatives)," Proc. Natl. Acad. Sci. USA 92:5470-5474 (Jun. 1995).
.
Nagy, K. et al., "Antiviral Activity of Human Immunodeficiency
Virus Type 1 Protease Inhibitors in a Single Cycle of Infection:
Evidence for a Role of Protease in the Early Phase," J. Virol.
68:757-765 (Feb. 1994). .
Nelson et al., "Bifunctional Oligonucleotide Probes Synthesized
Using a Novel CPG Support are Able to Detect Single Base Pair
Mutations," Nucleic Acids Research, 17:7187-7194 (1989) Issue No.
18. .
Nelson et al., "A new and Versatile Reagent for Incorporation
Multiple Primary Aliphatic Amines Into Synthetic Oligonucleotides,"
Nucleic Acids Research, 17:7187-7194 (1989) Issue No. 18. .
Vlassov et al., "The Effect of Modification of Terminal Groups of
Oligonucleotides on Their Stability in Mycoplasma Culture,"
Biopolim. Kletka, Vol. 7, No. 5 (Novosibirsk, USSR), pp. 37-41, see
Biosis, Abstract No. 94-032, 483, (1984). Month of publication data
is unavailable for this reference. .
Zendugui et al., "In Vivo Stability and Kinetics of Absorption and
Disposition of 3'-Phosphopropl Amine Oligonucleotides," Nucleic
Acids Research, 20:307-314 (1992) Issue No. 2. Month of publication
data is unavailable for this reference. .
Agrawal S. et al., "Oligodeoxynucleoside Phosphoramidates and
Phosphorothioates as Inhibitors of Human Immunodeficiency Virus"
Proceedings of the National Academy of Science of USA, Vol. 85,
Oct. 1, 1988, pp. 7079-7083. .
Wyatt, J. et al., "Combinatorially selected guanosine-quartet
structure is a potent inhibitor of human immunodeficiency virus
envelope-mediated cell fusion" Proceedings of the National Academy
of Sciences of USA., vol. 91, Feb. 1994. .
Rando, R. et al., "Suppression of human immunodeficiency virus type
1 activity in vitro by oligonucleotides which form intramolecular
tetrads" Journal of Biological Chemistry., vol. 270, Jan. 27, 1995,
pp. 1754-1760. .
Supplementary Partial European Search Report, dated Jul. 16, 1998,
that was received in EPC counterpart application EP 94 917899,
filed on Apr. 25, 1994..
|
Primary Examiner: Geist; Gary
Assistant Examiner: Crane; L Eric
Government Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
Research leading to this invention was supported in part by a grant
from the United States Government through the National Institute of
Health under a CRADA agreement. The U.S. Government has certain
rights in this invention.
Parent Case Text
CROSS REFERENCE TO RELATED APPLICATIONS
The present application is a continuation-in-part of U.S. patent
application Ser. No. 08/145,704 filed Oct. 28, 1993, now U.S. Pat.
No. 5,567,604, which is a continuation-in-part of U.S. patent
application Ser. No. 08/053,027 filed Apr. 23, 1993, now abandoned.
This application is also a continuation-in-part of allowed U.S.
patent application Ser. No. 08/535,168, filed Oct. 23, 1995, now
U.S. Pat. No. 6,184,369, which is the U.S. national stage of
PCT/US94/04529 filed Apr. 25, 1994. The present application also
claims the benefit of the following 35 U.S.C .sctn.111(b)
provisional applications: Ser. Nos. 60/001,505, filed Jul. 19,
1995, 60/013,688, filed Mar. 19, 1996, 60/014,007, filed Mar. 25,
1996, 60/015,714, filed Apr. 17, 1996, and 60/016,271, filed Apr.
23, 1996.
Claims
What is claimed is:
1. An oligonucleotide having a nucleotide sequence chosen from the
group consisting of SEQ ID NOS 2-27, 29, 31-39, 46-52 and 53-87,
wherein said nucleotide sequence is optionally modified at the 3'
terminus or 5' terminus by attachment of a substituent moiety
selected from the group consisting of propylamine, poly-L-lysine,
cholesterol, fatty acid chains of length 2 to 24 carbons, and
vitamin E.
2. An oligonucleotide having a nucleotide sequence chosen from the
group consisting of SEQ ID NOS 2-27 29, 31-39, 46-52 and 53-87,
wherein said nucleotide sequence includes at least one modification
selected from the group consisting of:
a modified 3' terminus by attachment of a substituent moiety
selected from the group consisting of propylamine, poly-L-lysine,
cholesterol, fatty acid chains of length 2 to 24 carbons, and
vitamin E;
a modified 5' terminus by attachment of a substituent moiety
selected from the group consisting of propylamine, poly-L-lysine,
cholesterol, fatty acid chains of length 2 to 24 carbons, and
vitamin E;
a replacement of at least one phosphodiester moiety with a
phosphorothioate moiety;
a deletion of a thymidine base from at least one nucleotide;
a substitution of a guanosine for at least one thymidine;
a substitution of 5- propynyl-2'-deoxyuridine for at least one
thymidine;
a substitution of 5-bromo-2'-deoxyuridine for at least one
thymidine;
a substitution of 5-iodo-2'-deoxyuridine for at least one
thymidine;
a substitution of 2'-deoxyinosine for at least one thymidine;
and
a substitution of at least one cytidine for at least one
thymidine.
3. An oligonucleotide having the basic sequence of
said basic sequence optionally modified by addition to or deletion
of at least one nucleotide from the 3' or 5' terminus such that
said oligonucleotide has a nucleotide sequence from 9 to 45
nucleotides in length;
optionally modified at the 3' terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified at the 5' terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified by replacement of at least one phosphodiester
moiety with a phosphorothioate moiety;
optionally modified by deletion of a thymidine base from at least
one nucleotide;
optionally modified by substitution of 5-1propynyl-2'-deoxyuridine
for at least one thymidine,
optionally modified by substitution of5-bromo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 5-iodo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 2'-deoxyinosine for at least
one thymidine,
optionally modified by substitution of at least one cytidine for at
least one thymidine, and
optionally modified by substitution of ribose 2'-O-alkylribose, or
2'-arylribose for the deoxyribose of at least one nucleotide.
4. The oligonucleotide of claim 3 wherein at least one nucleotide
is modified by deletion of a thymidine base.
5. The oligonucleotide of claim 3 having the nucleotide sequence
and phosphorothioate linkage distribution
wherein * indicates a phosphorothioate linkage.
6. An oligonucleotide having a sequence selected from the group
consisting of
wherein_denotes a nucleotide lacking a base;
optionally modified at the 3'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine cholesterol and cholesterol with a
triglycyl linker;
optionally modified at the 5'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified by replacement of at least one phosphodiester
moiety with a phosphorothioate moiety;
optionally modified by deletion of a thymidine base from at least
one nucleotide;
optionally modified by substitution of 5-propynyl-2'-deoxyuridine
for at least one thymidine,
optionally modified by substitution of 5-bromo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 5-iodo -2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 2'-deoxyinosine for at least
one thymidine,
optionally modified by substitution of at least one cytidine for at
least one thymidine, and
optionally modified by substitution of ribose 2'-O-alkylribose, or
2'-O-arylribose for the deoxyribose of at least one nucleotide.
7. An oligonucleotide having a sequence selected from the group
consisting of
wherein
P is 5-propynyl-2'-deoxyuridine
I is 2'-deoxyinosine
B is 5-bromo 2'-deoxyuridine, and
u is uridine or 2'-O-methyluridine;
optionally modified at the 3'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified at the 5'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine cholesterol and cholesterol with a
triglycyl linker; and
optionally modified by replacement of at least one phosphodiester
moiety with a phosphorothioate moiety.
8. An oligonucleotide having the nucleotide and phosphorothioate
linkage distribution
wherein * indicates a phosphorothioate linkage, and
_indicates a nucleotide lacking a base
optionally modified at the 3 'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl
optionally modified at the 5'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified by replacement of at least one phosphodiester
moiety with a phosphorothioate moiety;
optionally modified by deletion of a thymidine base from at least
one nucleotide;
optionally modified by substitution of 5-propynyl-2'-deoxyuridine
for at least one thymidine,
optionally modified by substitution of 5-bromo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 5-iodo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 2'-deoxyinosine for at least
one thymdine,
optionally modified by substitution of at least one cytidine for at
least one thymidine, and
optionally modified by substitution of ribose 2'-O-alkylribose, or
2'-O-arylribose for the deoxyribose of at least one nucleotide.
9. An oligonucleotide selected from the group consisting of
and
wherein * indicates a phosphorothioate linkage
optionally modified at the 3'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified at the 5'terminus by attachment of a
substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and cholesterol with a
triglycyl linker;
optionally modified by substitution of 5-propynyl-2'deoxyuridine
for at least one thymidine,
optionally modified by substitution of5-bromo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 5-iodo-2'-deoxyuridine for
at least one thymidine,
optionally modified by substitution of 2'-deoxyinosine for at least
one thymidine, and
optionally modified by substitution of ribose or 2'-O-arylribose
for the deoxyribose of at least one nucleotide.
10. An oligonucleotide having the nucleotide sequence
optionally modified by substitution of phosphorothioate for
phosphodiester linkages; and modified at the 3' end by attachment
of a substituent moiety selected from the group consisting of
propylamine, poly-L-lysine, cholesterol and similar lipophilic or
amine groups which enhance cellular uptake or stability of the
oligonucleotide.
11. A pharmaceutical composition for inhibiting production of human
immunodeficiency virus type 1 (HIV-1) comprising an oligonucleotide
of any one of claim 1 and a pharmaceutically acceptable
carrier.
12. A method of treating a disease associated with HIV-1 infection
pharmacologically effective dose comprising administering to a
person in need thereof a of the composition of claim 11 said dose
being sufficient to inhibit the production of HIV-1 virus.
13. The method of claim 12 wherein said dose is at least 3.0 mg/kg
of patient body weight.
14. A method of treating an infection by a human immunodeficiency
virus, comprising administering to a person in need thereof a
pharmacological dose of the composition of claim 11.
15. The method of claim 14 wherein said dose is at least 3.0 mg/kg
of patient body weight administered in seven equal doses over 14
days.
16. The method of claim 14 further comprising administering another
drug, having a different antiviral mechanism of action than that of
said oligonucleotide, optionally before or after said administering
of said composition such that resistance to said other drug or to
said composition is avoided.
17. A method of making a pharmaceutical composition for the
treatment of HIV-1 infection comprising
synthesizing at least one of the oligonucleotides of claim 5 or 8,
in the form of a fully neutralized salt,
dissolving said oligonucleotide in phosphate-buffered saline;
sterilizing said phosphate-buffered saline solution of said
oligonucleotide; and
preparing said solution at a concentration of about 25 mg/mL.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates generally to the field of
oligonucleotide chemistry and anti-viral pharmacotherapy. More
specifically, the present invention relates to novel guanosine-rich
oligonucleotides and their use as novel anti-viral agents.
2. Description of the Related Art
General In Vitro Studies
Previously, it was believed that "antisense" oligonucleotides
inhibit viruses by interfering with protein translation via an
RNA:DNA duplex structure. More recent research, however, indicates
a variety of possible mechanisms by which oligo-nucleotides inhibit
viral infections. For example, oligodeoxycytidine (poly SdC)
inhibits HIV-1. Marshall et al., PNAS (1992) 89:6265-6269,
discussed the potential mechanism (competitive inhibition) by which
oligodeoxycytidine directly inhibits viral reverse transcriptase.
Poly SdC also inhibited AMV reverse transcriptase and Pol I (Klenow
fragment) and polymerase .alpha., .beta. and .gamma.. Previously,
Matsukura et al., PNAS (1987) 84:7706-7710, used a similar
phosphorothioate derivative of oligo-deoxycytidine to demonstrate
inhibition of HIV-1 in culture. Marshall and Caruthers, Science
(1993) 259:1564-1569, reported the use of diphosphorothioate
oligo-nucleotides, e.g., antisense-specific, random nucleotide
combinations and oligodeoxycytidine against HIV-1. In all cases,
the mechanism of action was attributed to a direct inhibition of
HIV-1 reverse transcriptase. Other potential mechanisms of
anti-viral action of oligonucleotides were postulated by Boiziau et
al., PNAS (1992) 89:768-772, e.g., promotion of RNAse H activity
and inhibition of reverse transcriptase initiating cDNA synthesis.
In addition, Goa et al., Molecular Pharmacology (1992) 41:223-229
reported that phosphorothioate oligonucleotides inhibit human DNA
polymerases and RNAse H, and the adsorption or penetration of the
virus into cells. Iyer et al., Nucleic Acids Research (1990)
18:2855-2859 reported that if a base was removed from an anti-sense
polynucleotide forming an abasic site, the compound did not lose
its activity which argues against the need for the formation of an
RNA:DNA antisense mediated hybrid for anti-viral activity. Stein et
al. have characterized the interaction of poly SdC with the V3 loop
of HIV-1 gp120, and postulated that the specific interaction of
poly SdC with the HIV-1 V3 loop may be a mechanism by which an
oligonucleotide could inhibit HIV-1 in vivo.
It is known that synthetic oligonucleotides may be designed which
are capable of binding to duplex DNA to form triplex DNA. See U.S.
Pat. No. 5,176,996 Hogan & Kessler issued Jan. 5, 1993. That
patent discloses a method for making synthetic guanosine-rich
oligonucleotides which are targeted to specific sequences in duplex
DNA and which form collinear triplexes by binding to the major
groove of the DNA duplex.
Specific In Vitro Studies/In Vitro HIV Inhibition With T30177
Infection with the human immunodeficiency virus type 1 (HIV-1) and
the subsequent development of acquired immunodeficiency syndrome
(AIDS), has become a threat to public health on a global scale.
Preventing further spread of this disease is a major health
priority worldwide. Although HIV-1 was confirmed to be the
causative agent of AIDS as early as 1984, few drugs and no vaccines
are effective at preventing the ultimate onset of AIDS in HIV-1
seropositive individuals. This is due, in large part, to the
complexity of the causative agent itself, the dynamics of virus
production and the speed at which drug-resistant mutants can arise.
Ho, et al., Nature 373:123-126 (1995); Wei, et al., Nature
373:117-122 (1995).
Infection of T-cells by HIV-1 results in the insertion of proviral
(double-stranded) DNA into the host cell genome. Goff, S. P., Annu.
Rev. Genet. 26:527-544 (1992). The integration process involves
both the sequence-specific and sequence independent endonucleolytic
and strand transfer activities of the virally encoded integrase
enzyme. Katz, et al., Ann. Rev. Biochem. 63:133-173 (1994); Vink,
et a., Trends in Genetics 9:433-438 (1993). Once the proviral state
is established, the infection may manifest itself in several ways
including a latent infection in which viral replication is not
measurable until the cell becomes activated or through a chronic
infection in which dividing or non-dividing cells persistently
release virus in the absence of any cytopathic effect. In addition,
recent reports on the kinetics of virus production (and clearance)
indicate a dynamic process in which virtually a complete
replacement of wild-type virus by drug-resistant virus in plasma
can occur after only two to four weeks of drug therapy. Ho, et al.,
Nature 373:123-126 (1995); Wei, et al., Nature 373:117-122 (1995).
For this reason it is of utmost importance to develop new
anti-HIV-1 agents which can complement, by additive or synergistic
activity, current therapies.
One relatively new approach used in the development of antiviral
therapeutics for HIV-1 is the use of oligonucleotides designed as
antisense agents. Letsinger, et al., Proc. Natl. Acad. Sci. USA
86:6553-6556 (1989); Lisziewicz, et al., Proc. Natl. Acad. Sci. USA
90:3860-3864 (1993); Milligan, et al., J. Med. Chem. 36:1923-1937
(1993). While much effort is being spent on rationally designed
oligonucleotides such as antisense agents there have also been
recent findings of multiple alternative mechanisms by which
oligonucleotides can inhibit viral infections. Gao, et al., J.B.C.
264:11521-11526 (1989); Marshall, et al., Proc. Natl. Acad. Sci.
USA 89:6265-6269 (1992); Ojwang, et al., J. AIDS 7:560-570 (1994);
Rando, et al, J. Biol. Chem. 270:1754-1760 (1995). For example,
Stein et al. (Stein, et al., Antisense Research and Development
3:19-31 (1993)) have characterized the interaction of
oligodeoxycytidine, containing a phosphorothioate (PT) backbone
(poly (SdC)) with the v3 loop of HIV-1 gp 120. It was determined
that poly (SdC).sub.28 specifically interacted with the positively
charged V3 loop with a Kd of approximately 5.times.10.sup.-7 M.
Stein et al. (Antisense Research and Development 3:19-31 (1993))
then postulated that the interaction of poly (SdC) with the HIV-1
v3 loop may be a mechanism by which poly (SdC) could inhibit HIV-1
in vivo. More recently, Wyatt et. al. (Wyatt, et al., Proc. Natl.
Acad. Sci. USA 91:1356-1360 (1994)) have described the interaction
of a short G-rich oligonucleotide, synthesized with a total PT
backbone, which also interacts with the v3 loop of HIV-1 gp 120. In
addition, we have previously reported that oligonucleotides
containing only deoxyguanosine (G) and thymidine (T), synthesized
with natural phosphodiester (PD) internucleoside linkages, were
capable of inhibiting HIV-1 in culture. Ojwang, et al., J. AIDS
7:560-570 (1994). The most efficacious member of he G22 this
dG-rich class of oligonucleotides, I100-15, was found capable of
folding upon itself to form a structure stabilized by the formation
of two stacked guanosine-tetrads which yielded a guanosine-octet.
Rando, et al, J. Biol. Chem. 270:1754-1760 (1995). Furthermore, it
was observed that the positions of the guanosine bases in the
I100-15 sequence, found in both the tetrads and connecting loops in
that structure, were extremely important to the overall anti-HIV-1
activity of the oligonucleotide. Rando, et al, J. Biol. Chem.
270:1754-1760 (1995).
Site of Activity Studies-Viral Integrase Inhibition
Two events which are characteristic of the life cycle of
retroviruses can be utilized for therapeutic intervention. One is
reverse transcription, whereby the single-stranded RNA genome of
the retrovirus is reverse transcribed into singled-stranded cDNA
and then copied into double-stranded DNA. The next event is
integration, whereby the double-stranded viral DNA generated by
reverse transcriptase is inserted into a chromosome of the host
cell, establishing the proviral state. Integration is catalyzed by
the retroviral enzyme integrase which is encoded at the 3'-end of
the pol gene. Varmus, et al. Mobile DNA, pp. 53-108, Am. Soc.
Microbiol, Washington, D.C. (1989). Integrase first catalyzes the
excision of the last two nucleotides from each 3'-end of the linear
viral DNA, leaving the terminal conserved dinucleotide CA-3'-OH at
these recessed 3' ends (FIG. 23A). This activity is referred to as
the 3'-processing or dinucleotide cleavage. After transport to the
nucleus as a nucleoprotein complex, Varmus, et al. Mobile DNA, pp.
53-108, Am. Soc. Microbiol, Washington, D.C. (1989), integrase
catalyzes a concerted DNA strand transfer reaction by nucleophilic
attack of the two viral ends onto a host chromosome. This reaction
generates a recombination intermediate resembling an X structure,
analogous to a Holliday junction intermediate. [For recent reviews
see Katz and Skalka, Katz, et al., Ann. Rev. Biochem. 63, 133-173
(1994), and Vink and Plasterk, Vink, et al., Trends Genet. 9,
433-437 (1993)]. Mutation analyses of the viral integrase gene
demonstrate that integration is required for effective retroviral
replication and that it is a legitimate target for the design of
antiretroviral drugs (Engleman, et al., J. Virol. 69, 2729-2736
(1995); Englund, et al, J. Virol. 69, 3216-3218 (1995)).
It is known that AZT nucleotides can inhibit HIV-1 integrase,
Mazumder, et al., Proc. Natl. Acad. Sci. 91, 5771-5775 (1994), and
that substitution or unsaturation at the 3'-position of the
deoxyribose confers potency against HIV-1 integrase. These results
suggested that the enzyme's nucleotide binding site could serve as
a potential drug target. It has been shown that the potential
stacking interactions gained from the heterocyclic rings can
further enhance potency against HIV-1 integrase.
Recently, oligonucleotides composed of deoxyguanosine and thymidine
have been reported to inhibit HIV-1 replication. Rando, et al., J.
Biol. Chem. 270, 1754-1760 (1995); Wyatt, et al., Proc. Natl. Acad.
Sci. U.S.A. 91, 1356-1360 (1994). Oligonucleotides forming
intramolecular G4s did not block virus adsorption but rather
inhibited viral-specific transcripts. Rando, et al., J. Biol. Chem.
270, 1754-1760 (1995); Ojwang et al. J. Aids 7:560-570 (1994).
Structure-Function Studies
It is known that G-rich nucleic acid sequences can fold, in the
presence of Na.sup.+ or K.sup.+ ion, to form orderly structures
stabilized by guanosine tetrads. Depending on sequence,
intramolecular folds, Rando et al. J. Biol. Chem. 270: 1754-1760,
1995), dimers (Smith, F. W., & Feigon, J. (1992) Nature
(London) 344, 410-414, Sundquist, W. I. & Klug, A. (1989)
Nature (London) 334, 364-366; Kang, et al. (1992) Nature (London)
356, 126131; Balaguumoorthy, P. & Brahmachari, S. K. (1994) J.
Biol. Chem. 269, 21858-21869), tetrameres (Son, D. & Gilbert,
W. (1990) Nature (London) 344, 410-414; Jin, et al. (1990) Science
250, 543-546; Jin, et al. (1992) Proc. Natl. Acad. Sci. USA 89,
8832-8836; Lu et al., (1992) Biochemistry 31, 2455-2459), and
higher order associations have been detected. Such tetrad based
structures have been postulated to serve as the structural basis
for telomere function (Sen, D. & Gilbert, W. (1988) Nature
(London) 334, 364-366), and have been hypothesized to play a role
in retroviral replication (Bock et al. (1992) Nature (London) 355,
564-566), and transcription regulation (Marshall et al. (1992)
Proc. Nalt. Acid. Sci. USA 8,9, 6265-6269; Wyatt et al. (1994)
Proc. Natl. Acad. Sci. USA 91, 1356-60).
Recently, several groups have shown that compounds which contain
tetrad-based folds may have activity as potential drug compounds.
Bock and colleagues have shown that an intramolecular fold,
obtained by a SELEX procedure can bind tightly to thrombin, so as
to inhibit clotting (Bock et al. (1992) Nature (London) 355,
564-566). Additionally Wyatt et al. (Wyatt et al. (1994) Proc.
Natl. Acad. Sci. USA 91, 1356-60) has shown that a dimer-wise
pairing of phosphorothioate oligomers with the sequence T2G4T2
(four stranded intermolecular tetrads) gives rise to anti-HIV
activity, by inhibition of viral adsorption to the cell
surface.
The present inventors have also obtained evidence for
sequence-selective inhibition of HIV-1 by simple phosphodiester
oligonucleotides which form G-tetrad based structures. The highest
activity was obtained with a 17 mer, referred to as T30177, with
composition G12-T5 (Rando et al., (1994) J. Biol. Chem. 270,
1754-1760; Ojwang, J. et al. (1995) J. Aids 7, 560-570), with 2
phosphorothioate linkages (1 at each end) to block cellular
exonuclease activity (Bishop et al. (1996) J. Biol. Chem. 271,
5698-5703). NMR evidence was obtained (Rando et al., (1995) J.
Biol. Chem. 270, 1754-1760) to suggest that, by reference to
similar oligomers (Smith, F. W., & Feigon, J. (1992) Nature
(London) 344, 410-414), T30177 forms a stable intramolecular fold
which is stabilized by a pair of G-tetrads, connected by three
singlestranded loops and a 1-2 base long tail to either side of the
fold. Those preliminary studies suggested that oligomer folding was
coupled to K.sup.+ ion binding (Rando et al., (1995) J. Biol. Chem.
270, 1754-1760). Additional studies have suggested that T30177 and
related derivatives are potent inhibitors of HIV-1 integrase, in
vitro (Ojwang et al. (1995) Antimicrob. Agent Chemotherepy 39,
2426-35).
Pharmacokinetic Studies-Single Dose
Antisense, triple-helix, duplex decoy, and protein-binding
(aptamer) oligonucleotides have been shown to have potential as
drugs for the treatment of a variety of human clinical disorders
(Stein and Cheng, 1993; Marshall and Caruthers, 1993, Science 259:
1564-1570; Chubb and Hogan, 1992, Trends in Biotechnology 10:
132-136; Stull and Szoka, 1995, Pharm. Res. 12: 465-483. A number
of oligonucleotides have undergone pre-clinical testing, and
several are in human clinical trials. One finding that has aroused
some concern (Black et al., 1994, Antisense Res. Dev. 4: 299-301)
is the observation that total phosphorothioate oligonucleotides
cause hemodynamic changes following rapid intravenous
administration. Severe hypotension, leukopenia, complement
activation, and death have been reported to occur in primates after
rapid infusions of total phosphorothioate oligonucleotides (Cornish
et al., 1993, Pharmacol. Commun. 3: 239-247; Galbraith et al.,
1994, Antisense Res. Dev. 4: 201-206). These findings have raised
the question of whether the cardiovascular toxicity is a property
of phosphorothioate oligonucleotides, or of all oligonucleotides.
On the basis of these findings, an FDA commentary has recommended
that cardiovascular screening be performed for the pre-clinical
safety assessment of oligonucleotides (Black et al., 1994).
Pharmacokinetic Studies-Repeat Dose
Oligonucleotides have advanced to the stage that they are now
considered as potential therapeutics for the treatment of a variety
of human diseases, and several are presently in clinical trials.
Pre-clinical studies have generally shown that doses up to
approximately 50 mg/kg are safe, but that higher doses can cause
kidney and liver damage, and death (Srinivasan and Iversen, 1995,
J. Clin. Lab. Analysis 9:129-137) Bolus intravenous administration
has posed a particular concern since it has been shown to sometimes
result in serious hypotensive events in primates (Cornish et al.,
1993; Galbraith et al., 1994; Black et al., 1995). However, because
the number of oligonucleotides that have been studied has been
small, it is difficult to conclude at the time of making the
invention whether all oligonucleotides share similar toxicities. In
particular, given the various ways of modifying the backbone of
oligonucleotides (Wu-Pong, 1994, BioPharm 7:20-33) and their
ability to fold into distinct three-dimensional structures (Stull
and Szoka, 1995, Pharm. Res. 12:465-483), Rando et al. J. Biol.
Chem. 270; 1754-1760, 1995, the safety profile of different
oligonucleotides may be quite distinct.
Human Clinical Trials
In addition to toxicological studies, efficacy studies should be
carried out for oligonucleotide drugs. In the past, the preferred
method of testing drug efficacy, especially in HIV-1 infected
patients, was to monitor survival of treated patients. However,
recent statistical studies have shown that a good indicator of
anti-HIV drug efficacy is the reduction in the numbers of copies of
viral genome per unit of patient serum (viral load). Mellors et al.
(1996) Science 272:1167-1170. Reductions in viral load of 90%, or
more preferably 99% are desired. However, reductions of viral load
of lesser percentages can be useful, especially where the trend of
the overall treatment regime is consistently downward.
Thus, there is a substantial need for antiviral drugs with novel
chemistry and with sites of activity distinct from drugs presently
used. Most highly desired would be antiviral drugs whose efficacy
in humans is known.
SUMMARY OF THE INVENTION
In one embodiment of the present invention, there are provided
methods and compositions useful in treating pathophysiological
states caused by viruses, comprising administering a
pharmacological dose of an oligonucleotide, the dose being
sufficient to inhibit production of the virus, wherein the
oligonucleotide contains a high percentage of guanosine bases. In
preferred embodiments, the oligonucleotide has a three dimensional
structure and this structure is stabilized by guanosine tetrads. In
a further embodiment, the oligonucleotide compositions of the
invention have two or more runs of two contiguous deoxyguanosines.
In certain embodiments of the present invention, the target virus
is either herpes simplex virus, human immunodeficiency virus, human
papilloma virus, human cytomegalovirus, adenovirus, and hepatitis B
virus.
In still yet another embodiment of the present invention, there is
provided a guanosine-rich oligonucleotide having a three
dimensional structure, wherein the three dimensional structure is
stabilized by guanosine tetrads or at least two runs of two
contiguous deoxyguanosines and wherein these oligonucleotides
exhibit anti-viral activity. In a further embodiment, the
oligonucleotides of the present invention have partially (pPT) or
fully (PT) phosphorothioated internucleoside linkages (backbones)
or other chemical modifications. In a further embodiment, the
oligonucleotides of the present invention have chemically modified
or unnatural (synthetic) bases.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures for Section A
FIG. 1A shows a 1973 base pair Hind III to Eco R1 sub fragment of
the Friend Murine Leukemia Virus (FMLV) clone 57 genome. FIG. 1B
shows a 172 base pair (HindIII to StuI) fragment which is an
expanded portion of the 1973 base pair fragment. Within this
fragment is the purine rich target to which triple helix forming
oligonucleotides are directed. FIG. 1C shows the entire Hind
III/Eco R1 FMLV fragment cloned into the pT7-2 plasmid (United
States Biochemical Corporation) yielding p275A. In this recombinant
the Hind III site is 10 base pairs downstream of the T7 MRNA start
site. The 5' portion of the triple helix target region is 63 base
pairs downstream of the mRNA start and the Dde I site is 131 base
pairs downstream of the mRNA start site. FIG. 1D shows the Hind
III/Eco R1 FMLV fragment was cloned into pBS (Stratagene) yielding
pBSFMLV. The Hind III site, triple helix target site and Dde I site
are respectively 50, 103 and 171 base pairs downstream from the
mRNA start site.
FIG. 2 shows that G-Rich phosphorothioated-oligonucleotides induced
reduction in HSV-2 viral titer. VERO cells infected with HSV-2 were
treated with various concentrations of the indicated drug. The
results are plotted as percent virus yield relative to VERO cells
infected with virus but not treated with drug (titer=1). The filled
square (B106-62) (SEQ. ID. NO. 5) represents a single concentration
point (20 .mu.M) for this oligonucleotide. B106-96 is the fully
phosphorothioated version of B106-62 (SEQ. ID. NO. 5). B106-97 is
the fully phosphorothioated version of B106-71 (SEQ. ID. NO. 6).
ACV (4a and 4b) is acyclovir tested against two different stock
concentrations of HSV-2 strain HG52. In two experiments, after
virus infection and before reapplication of oligonucleotide (BIO-96
or BIO-97), the cells were rinsed with a pH 3 buffer in order to
remove all virus not yet internalized (96p3 and 97p3).
FIG. 3 shows MT-2 cells infected with 0.01 m.o.i. of HIV-1 and then
treated with various concentrations of oligonucleotide or AZT or
ddC. The data represents the number of viable cells remaining in
the culture dish, i.e., not undergoing virus induced cytopathic
effects (CPE). In this graph, 100% is the level of CPE occurring in
cultures infected with virus but not treated with any drug.
FIG. 4 shows the culture media taken from NIH3T3 cells chronically
infected with FMLV was mixed with various concentrations of I100-51
(SEQ. ID. NO. 29) or I100-12 (SEQ. ID. NO. 27) (fully
phosphorothioate version of I100-00 (SEQ. ID. NO. 20)). The
mixtures were then assayed for the presence of viral reverse
transcriptase. The data is presented as a percent of measurable
reverse transcriptase in culture medium not treated with
oligonucleotide.
FIGS. 5A, 5B and 5C show the radioabelled (.sup.32 P) full-length
or truncated mRNA transcripts were analyzed by polyacrylamide gel
electrophoresis, and then quantitated by cutting out the specific
transcript and measuring the radioactivity in a scintillation
counter. FIG. 5A shows that the reduction in full length
transcripts directed by the T7 and T3 promoter when I100-51 (SEQ.
ID. NO. 29) (anti-parallel triple helix forming oligonucleotide;
FMLV2ap) was added. Samples in which no oligonucleotide was added
were counted and used as 100% transcription reference points. In
all other reactions 4.times.10.sup.-6 M of G101-50 (SEQ. ID. NO.
12) (4e-6) was added and where indicated G101-50 plus I100-51 at
concentrations ranging from 2.times.10.sup.-9 to 2.times.10.sup.-6
M (2e-9 to 2e-6). FIG. 5B shows the reduction in full length
transcript by I100-01 (SEQ. ID. NO. 21) (FMLV2p). T7 directed
transcripts were treated as in FIG. 5A. G101-50 was added to each
reaction except the control (no oligo) with or without various
concentration of I100-01 or I100-11 (SEQ. ID. NO. 26) (26% G-ctl).
FIG. 5C shows the analysis of truncated (63 base pair)
transcript.
FIG. 6 shows inhibition of HIV-1 induced syncytia formation four
days post-infection. SUP T1 cells were infected with HIV-1.sub.DV
for four hours and then treated with various concentrations of
oligonucleotides. Four days post-infection cells were scored for
syncytium formation. All assays were performed in quadruplicate and
the average values used to plot this graph. The legend to the right
of the graph indicates the symbol used for each oligonucleotide
tested.
FIG. 7 shows continued suppression of HIV-1 p24 production seven
days post removal of oligonucleotide. Four days post-infection with
HIV-1.sub.DV, the media from infected cells treated with
oligonucleotides (2.5 .mu.M) was removed and replaced with fresh
media without oligonucleotide. The presence of viral p24 antigen
was then assayed 7 and 11-days post infection. All samples were
assayed in quadruplicate and the average values used to plot this
graph. I100-07 (SEQ. ID. NO. 24): I100-15 (SEQ. ID. NO. 33);
I100-18 (SEQ. ID. NO. 36); I10021 (SEQ. ID. NO. 39). The legend to
the right of the graph indicates the symbol used for each
oligonucleotide tested.
FIG. 8 shows a Dixon Plot of random oligonucleotide 1232 (SEQ. ID.
NO. 41) obtained from kinetic analysis of inhibition of HIV-RT with
respect to dNTP. The inhibition constant K.sub.i was determined by
simultaneously varying dNTP (without dATP) concentrations at the
same time as inhibitor (oligonucleotide 1232). The K.sub.i
determination was performed at 0.125 mM, 0.25 mM and 0.5 mM dNTP
concentrations with constant Primer-Template concentration of 0.2
pM. HIV-RT was used at 1 unit in each reaction. The reported values
are the result of simultaneous independent duplicates
determinations.
FIG. 9A reveals PBMCs derived from HIV-1 positive patients were
mixed with HIV-1 negative PBMCs in culture medium containing drug
I100-15 (SEQ. ID. NO. 33). On day 7 the cocultures were washed and
resuspended in fresh medium containing drug. The p24 levels in
medium collected on day 7 (before medium change) and day 10 were
assayed for p24. FIG. 9B HIV-1 negative PBMCs from two different
donors were infected with HIV-1.sub.DV and then incubated in the
presence of drug for 10 days at which time the culture medium was
assayed for the presence of p24 antigen.
FIGS. 10A and 10B show inhibition of binding of V3 loop specific
Mabs to HIV-1 gp120 by phosphorothioate containing
oligonucleotides. Matched sequence oligonucleotides with either
phosphodiester (PD) or phosphorothioate (PT) backbones were assayed
for their ability to inhibit the interaction of V3 loop specific
Mabs with the gp120 molecule: SEQ. ID. NOS. 31 (1173) and 32
(1174); SEQ ID. NOS. 24 (I100-07) and 39 (I100-21); or SEQ. ID.
NOS. 42 (1229) and 43 (1230). To do this, immobilized gp120 was
preincubated with oligonucleotides before washing and the addition
of Mab NEA 9284 (FIG. 10A) or Mab NEA 9301 (FIG. 10B).
FIG. 11 shows a schematic diagram of the HIV-1 genome not drawn to
scale. FIG. 11A shows DNA primers. FIG. 11B shows RNA primers.
FIG. 12 shows analysis of DNA (PCR) and RNA (RT-PCR) extracted from
SUP T1 cells three days post-infection with HIV-1. (Top Panel). PCR
analysis of HIV-1 infected drug treated SUP T1 cell DNA used 0.1
.mu.g of total extracted DNA for each reaction. In this experiment
either AZT, at 0.3 .mu.M which is 10 fold over the IC.sub.50 value
(lane 1) or I100-15 (SEQ. ID. NO. 33) at 5.0 (lane 2) or 0.3 .mu.M
(lane 3) were added to SUP T1 cells at the same time as HIV-1.
Lanes 4 (AZT), 5 (5.0 .mu.M I100-15 (SEQ. ID. NO. 33)) and 6(0.3
.mu.M I100-15) are the results of DNA samples obtained from cells
in which drug was added 8 hours post-infection. Lanes 8 to 10
contain 10, 100 or 1000 ng of DNA extracted from HIV-1 infected
control SUP T1 cells. The band corresponding to 220 bp is the
predicted size of the internal .beta.-actin control and the 200 bp
fragment is the predicted size for the amplified portion of the
HIV-1 genome. The bottom panel contains RT-PCR analysis of
extracted RNA (1 .mu.g/reaction) obtained from cells treated in an
identical fashion as those described in lanes 1-6 of the top panel.
Lanes 7 and 8 are control HIV-1 infected cell mRNA and lanes 9 and
10 are the results obtained using uninfected untreated SUP T1 cell
mRNA.
FIG. 13 shows the results of three oligonucleotides (10.sup.-5 M)
incubated with increasing concentrations (0, 7.5, 15, 30, 60 and
120 mM) of KCl (lanes 1-6 for I100-15 (SEQ. ID. NO. 33), 7-12 for
I100-18 (SEQ. ID. NO. 36) and 13-18 for Z106-50). The nucleotide
markers are poly dT.
FIG. 14 shows a line model for I100-15 (SEQ. ID. NO. 33) folded
into an intramolecular tetrad of the Oxytricha class is depicted.
The 5'-end of the molecule is in the bottom left hand side. The
bases (Gs) are stacked on top of each other with the 4 bases in
each plane stabilized through their hydrogen bonding with each
other and their interaction with the K.sup.+ ion complex in the
center of the tetrad.
FIG. 15 displays a one dimensional NMR analysis of a KCl titration
and thermal melting parameters for I100-15 (SEQ. ID. NO. 33).
Figures for Section B
FIG. 16. Dose responsive profile for T30177, AZT and ddC. CEM-SS
cells were infected with HIV-1.sub.RF (0.01 MOI) and treated with
various concentrations of each drug for six days at which time the
degree of HIV-1 -induced syncytium formation (cytopathic effect,
cpe) was addressed. The results shown are the averages of three or
more experiments with the standard deviations indicated.
FIG. 17. Effect of T30177 on HIV-1 replication in primary
macrophages. Primary macrophages were obtained from PBMC
preparations and infected with HIV-1.sub.DV for 24 hours in the
presence of the indicated amount of drug. Seven days post-infection
the intracellular levels of p24 were quantitated using the Coulter
p24 antigen capture ELISA kit. The results shown are the averages
of three or more experiments.
FIG. 18. Effect of time of drug addition on the inhibition profile
of T30177, AZT, and DS5000. MT4 cells, infected with HIV-1.sub.IIIB
at a MOI of 1, were treated at various times during (time 0) or
post-virus-infection with the test compounds at a concentration
100-fold higher than their respective IC.sub.50 values. Viral p24
levels in the culture medium were monitored 29 hour post-infection.
The results shown are the averages of three or more
experiments.
FIG. 19. HeLa-CD4-.beta.-galactosidase cell assays. (FIG. 19A).
HeLa-CD4-.beta.-galactosidase cells were incubated in medium
containing drug for one hour before virus was added to the culture
medium. One hour after the addition of virus the cells were washed
extensively to remove unbound virus and extracellular test
material. Forty-eight hours post-infection the cells were fixed and
stained with X-gal. Blue multinuclear cells were then counted under
an inverted microscope (5). (FIG. 19B).
HeLa-CD4-.beta.-galactosidase cells were incubated for 1 hour in
the presence of test compound at which time an equal number of
HL2/3 cells were added to each well. Cells were incubated for 48
hours at which time they were fixed, stained with X-gal and counted
under an inverted microscope.
FIG. 20. Long term suppression of HIV-1.sub.IIIB after treatment of
infected cell cultures with T30177. (A) MT4 cells were infected
with 0.01 MOI of HIV-1.sub.IIIB and then cultured for 4 days in the
presence of T30177, AZT, DS5000, JM2763 or JM3100 using a
concentration of drug equivalent to 100fold over the respective
IC.sub.50 value. After 4 days the cells were washed extensively and
further incubated in drug free medium. The level of viral p24
antigen in the culture medium was monitored at various times after
removal of drug from the infected cell cultures. The values given
are the averages of three or more experiments.
FIGS. 21A-B. Single cycle analysis of viral DNA. CEM-SS cells
infected with HIV-1.sub.SKI at an MOI of 1, were treated with
T30177, UC38, CSB or ddC at the indicated time post-viral
infection. Time 0 indicates the treatment of cell cultures with
drug during virus infection. After 12 hours the DNA was extracted
from the infected cells and used as a template for PCR. The
concentration of drug used in each assay is equivalent to 10 to
100-fold over their respective IC2.sub.50 values.
FIGS. 22A-D. Analysis of replicated viral DNA. CEM-SS cells were
infected with HIV-1.sub.SKI at an MOI of 1 and then treated with
T30177. Eighteen to 20 hour post-infection the low molecular weight
Hirt DNA was analyzed using PCR primers which would amplify
mitochondrial DNA (FIG. 22A), early viral synthesized cDNA (FIG.
22C), viral gag cDNA (FIG. 22D) and viral 2-LTR circles (FIG. 22B).
The drug concentrations used were 0.0, 0.01, 0.1, 1 and 10 .mu.M
corresponding to lanes 1 to 5 respectively. The unlabeled lane in
each panel contains molecular size marker control DNA.
Figures for Section C
FIG. 23. Inhibition of HIV-1 integrase 3'-processing and strand
transfer and HIV-1.sub.RF cytopathicity by guanosine quartets.
(FIG. 23A) Schematic diagram showing 3'-processing (3'P, which
liberates a GT dinucleotide) and strand transfer (S.T., which
results in the insertion of one 3'-processed oligonucleotide into
another target DNA), with 5'-end labeled (asterisk), blunt-ended
oligonucleotide. (FIG. 23B) Left panel, concentration-response
obtained from a typical experiment. The DNA substrate (21 mer),
3'-processing product (19 mer), and strand transfer products (STP)
are shown. Lane 1, DNA along; lane 2, with integrase; lanes 3-6,
with integrase in the presence of the indicated concentrations of
T30177. Right panel, graph derived from quantitation (see Materials
and Methods) of the dose response in the left panel showing
inhibition of integrase-catalyzed 3'-processing (open squares) and
strand transfer (filled squares). (FIG. 23C) Structures of
guanosine quartets oligonucleotides. (FIG. 23D) IC.sub.50 values
for several G4 oligonucleotides against both activities of HIV
integrase and HIV-1.sub.RF in cell culture. Insertions into the
parent compound T30177 are shown by an italicized and underlined
nucleotide while mutations are designated by a lower case
nucleotide. The guanosines involved in the quartets are shaded and
the loops are designated by the corresponding numbers (see FIG.
23D).
FIGS. 24A-B. Inhibition of strand transfer and 3'-processing
activities of HIV-1 integrase by the guanosine quartet T30177.
(FIG. 24A) Left, schematic diagram depicting the strand transfer
assay using the precleaved oligonucleotide (19 mer substrate).
Right Phosphorimager picture showing inhibition of strand transfer
with T30177. The DNA substrate (19 mer) and strand transfer
products (STP) are shown. Lane 1, DNA alone; lane 2, plus
integrase; lanes 3-6, plus integrase in the presence of the
indicated concentrations of T30177. (FIG. 24B) Left, schematic
diagram depicting the 3'-processing assay using the oligonucleotide
labeled at the 3'-end with .sup.32 P-cordycepin (*A) (22 mer
substrate). Right, phosphorimager picture showing inhibition of
HIV-1 integrase-catalyzed 3'-processing with T30177. Lane 1, DNA
alone; lane 2, with integrase; lanes 3-6, in the presence of the
indicated concentrations of T30177.
FIGS. 25A-B. Inhibition of the DNA binding activity of HIV-1
integrase by guanosine quartets. DNA binding was measured after UV
crosslinking of reactions in which integrase was preincubated for
30 minutes at 30.degree. C. with the guanosine quartet prior to
addition of the DNA substrate. (FIG. 25A) Phosphorimager picture
showing differential inhibition of DNA binding with T30177 and
T30659. Lane 1, DNA alone (20 nM); lanes 2, 8, and 14, with
integrase (200 nM); lanes 3-7, in the presence of the indicated
concentrations of T30177; lanes 9-13, in the presence of the
indicated concentrations of T30659. The mitigations of proteins of
known molecular weight are shown to the right of the gel. (FIG.
25B) Graph derived from quantitation of the does response in (FIG.
25A) showing inhibition of integrase binding by T30177 (open
squares) but not by T30659 (filled squares).
FIG. 26. Differential activities of T30177 on wild-type and
deletion mutants of HIV integrase. (FIG. 26A) Schematic diagram
showing the three domains of HIV-1 integrase. (B) Inhibition of
wild-type IN.sup.1-288 (open squares), IN.sup.1-212 (closed
squares), and IN.sup.50-212 (open triangles) in the disintegration
assay. (FIG. 26C) Binding of HIV-1 integrase wild-type
(IN.sup.1-288) and deletion mutants at a final concentration of 1
.mu.M to .sup.32 P-end labeled guanosine quartet T30177 at a final
concentration of 250 nM. The mobility of proteins of known
molecular weight (in KDa) are shown to the right of each figure.
Lane 1, T30177 alone; lanes 8-9, binding to wild-type, full-length
HIV-1 integrase (IN.sup.1-288) in the presence of the indicted
metal; lanes 2-3, binding to IN.sup.1-212 in the presence of the
indicated metal; lanes 6-7, binding to IN.sup.50-212 in the
presence of the indicated metal are lanes 4-5, binding to
IN.sup.50-288.
FIGS. 27A-B. DNA binding activity of the zinc finger domain of
HIV-1 integrase. Binding of IN.sup.1-55 to T30177 or the viral DNA
substrate (see FIG. 23A, 21 mer). Lanes 1, DNA alone (50 nM); lanes
2, IN.sup.1-55 (2 .mu.M) with no metal; lanes 3, IN.sup.1-55 with
manganese (7.5 mM); lanes 4, IN.sup.1-55 with magnesium (7.5 mM);
lanes 5, IN.sup.1-55 with manganese (7.5 mM) and zinc (4.2 mM);
lanes 6, IN.sup.1-55 with magnesium (7.5 mM) and zinc (4.2 mM);
lanes 7-10, IN.sup.1-55 in the presence of the indicated
concentration of zinc alone.
FIGS. 28A-D. Increased binding to and inhibition by guanosine
quartets in magnesium versus manganese. (FIG. 28A) Phosphorimager
picture showing DNA binding of wild-type integrase to radiolabeled
T30177. Lane 1, DNA alone (27 nM); lanes 2-5; binding of integrase
(200 nM) in manganese buffer to the indicated concentration of
T30177; lanes 6-9, binding of integrase (200 nM) in magnesium
buffer to the indicated concentration of T30177. The migrations of
proteins of known molecular weight are shown to the right of the
gel. (FIG. 28B) Structures of T30177 and two analogs in which the
internucleotidic linkages have been changed. (FIG. 28C) graph
derived from quantitation (see Materials and Methods) of the
inhibition of integrase-catalyzed 3'-processing in the presence of
T30177 and analogs in either magnesium or manganese. Inhibition by
T30177 (triangles), T30175 (squares), and T30038 (circles is shown
either containing magnesium (filled symbols) or manganese (open
symbols). (FIG. 28D) Table showing IC.sub.50 values for
3'-processing for the guanosine quartets in buffer containing
manganese and magnesium and the ratio of these values.
FIGS. 29A-B. Competition of binding to either U5 viral
oligonucleotide (see FIG. 23A, 21 mer) (FIG. 29A) or guanosine
quartet T30177. (FIG. 29B) Lanes 1, DAN alone; lanes 2, with
wildtype, full-length HIV-1 integrase. Lanes 3-6 in panel (FIG.
29A), with integrase in the presence of the indicated
concentrations of T30177 added after a 5 minute preincubation with
the U5 viral DNA oligonucleotide. Lanes 3-6 in panel (FIG. 29B),
with integrase in the presence of the indicated concentrations of
viral U5 DNA oligonucleotide added after a 5 minute preincubation
with the guanosine quartet T30177.
FIGS. 30A-B. Inhibition of the related retroviral integrases. (FIG.
30A) Inhibition of 3'-processing and strand transfer catalyzed by
HIV-1 (lanes 2-8), HIV-2 (lanes 9-15), FIV (lanes 16-22), and SIV
(lanes 23-29) integrases in the presence of T30177. Lane 1, DNA
alone; lanes 2, 8, 9, 15, 16, 22, 23, and 29, with integrase; lanes
3-7, 10-14, 17-21, and 24-28, with integrase in the presence of the
indicated concentrations of T30177. (FIG. 30B) Graph derived from
quantitation (see Materials and Methods) of the dose responses in
(FIG. 30A) showing inhibition of HIV-1 (open rectangles), HIV-2
(filled rectangles), FIV (open triangles), or SIV (filled
triangles) integrase-catalyzed 3'-processing.
FIG. 31. Three-dimensional drawings of certain guanosine tetrad
forming oligonucleotides referred to in Tables C-1 and C-2.
Halosubstituted, end modified, and intermolecular guanosine
quartets are shown.
FIG. 32. Three-dimensional drawings of certain guanosine tetrad
forming oligonucleotides referred to in Tables C-1 and C-2. Unless
otherwise specified, all oligonucleotides have phosphorothiodiester
linkages between the ultimate and penultimate bases at both the 5'
and 3' ends. (*) denotes the position of the phosphorothiodiester
linkages.
FIG. 33. Percentage inhibition of 3' processing by certain
oligonucleotides in Table C-1.
FIG. 34. Inhibition of syncytium formation by certain
oligonucleotides in Table C-1.
FIG. 35. Mutations in the loops of T30177. Three-dimensional
drawings of certain guanosine tetrad forming oligonucleotides
referred to in Tables C-1 and C-2.
FIG. 36. Mutations, deletions and insertions in G quartets.
Three-dimensional drawings of certain guanosine tetrad forming
oligonucleotides referred to in Tables C-1 and C-2. IC.sub.50 for
3' proc./str. tra. is indicated to the right of each tetrad.
Figures for Section D
FIGS. 37A-B. Structure Models. FIG. 37A. The sequence and a
structure model for oligonucleotides used in this study presented
All four oligomers have been modified so as to include a single
phosphorothioate linkage at the 5' and 3' terminus. Proposed sites
of G-quartet formation have been identified by dotted lines. The
continuity of the phosphodiester backbone is identified by solid
lines. FIG. 37B. A two step kinetic model for ion induced folding
of oligomers in this study. It is proposed that binding a first
K.sup.+ or Rb.sup.+ ion equivalent, marked as a (+), occurs within
the central G-octet, which has been identified by dotted lines.
This first step is relatively fast, and is associated with higher
apparent ion binding affinity. It is also associated with formation
of unstacked loop domains, and the resultant net loss of UV
hypochromism, as compared to the initial random coil state. The
second step in the process involves as many as two additional
K.sup.+ or Rb.sup.+ ion equivalents, (+), at the junction between
the core octet and flanking loop regions. This second step requires
significant ordering of the flanking loop domains, and is therefor
associated with an increase of base stacking interaction, and a
generally high activation energy.
FIGS. 38A-C. Thermal Stability of Oligomer Folding. Thermal
denaturation of oligomers has been measured as a function of ion
type, ion concentration and strand concentration. Data have been
obtained at 240 nm, in 20 mM Li3PO4, pH 7, as the supporting
buffer. Tm values were calculated from the first derivative of a
plot of absorbance vs. temperature, but similar values were
obtained by using the midpoint of the overall absorbance change.
FIG. 38A. Tm values for T30695 (curve a), T30177 (curve b), T30376
(curve c), and T30677 (curve d) obtained as a function of added 12
KCl concentration. FIG. 38B. The Tm Of T30695 obtained as a
function of KCl, RbCl, NaCl or CsCl concentration. FIG. 38C. The
strand concentration dependence of Tm has been measured at 1 mM of
added KCl.
FIGS. 39A-C. Oligomer Folding Monitored by Circular dichroism (CD).
CD data have been obtained at 25.degree. C. in 20 mM Li3PO4 as a
function of added ion concentration. Data have been presented as
molar ellipticity in units of dmole bases. FIG. 39A. The CD
spectrum of T30695 in the presence of 0 mM (curve a), 0.05 mM
(curve b), or 10 mM (curve e) of added KCl. FIG. 39B. The change in
ellipticity at 264 nm, relative to that measured in the absence of
added ion is presented as a function of added KCl concentration for
T30695 (curve a), T30177 (curve b) and T30676 (curve c). The
overall midpoint of the measured KCl induced transition has been
plotted for each oligomer: 0.02 mM, 0.15 mM and 0.27 mM,
respectively. FIG. 39C. T30695 has been treated with increasing
concentration of several different cations. The change in
ellipticity at 264 nm was then measured as described in part B as a
function of added KCl (curve a), RbCl (curve b) or NaCl (curve
e).
FIGS. 40A1-3,B1-3. The Kinetics of Ion Induced Folding. Ion was
added to oligomers at time zero in the standard 20 mM Li3PO4 assay
buffer. Data have been presented as absorbance (A) vs. time after
addition of metal ion. FIG. 40A. Kinetics for T30177 were measured
at three added KCl concentrations: 0.2 mM (curve a); 1.0 mM (curve
b); and 10 mM (curve e). FIG. 40B. Kinetics for T30695 were
measured at three added RbC1 concentrations: 1.0 mM (curve a), 5.0
mM (curve b) and 10 mM (curve e). For both, the data has been fit
to a sum of two exponentials, i.e. A(.tau.)=A.sub.1
exp(-.tau./T.sub.1)+A.sub.2 exp(-.tau./T.sub.2).
Figures for Section E
FIGS. 41A-D. Mean arterial pressure of cynomolgus monkeys pAor to,
during and following intravenous administration of AR177 over ten
minutes. Blood pressure was continuously monitored via an
indwelling femoral artery catheter. The values are the mean.+-.s.d.
of three monkeys at each dose.
FIGS. 42A-D. Neutrophil levels in blood of cynomolgus monkeys prior
to, during and following intravenous administration of AR177 over
ten minutes. Neutrophil levels were determined pre-dose (-10
minutes), and at 10, 20, 40, 60,120 and 1440 minutes following the
initiation of the ten-minute infusion of AR177 into cynomolgus
monkeys. The values are the mean.+-.s.d. of three monkeys at each
dose.
FIG. 43. aPTT versus time profile following a ten-minute infusion
of AR177 to cynomolgus monkeys. aPTT was determined before and at
various time after intravenous infusion of AR177 as described in
the Methods section. aPTT levels returned to baseline by 24 hours
in all groups. Certain aPTT values in monkeys at the 20 and 50
mg/kg dose time points, denoted by asterisks, exceeded the upper
limit of the assay.
FIG. 44. Complement factor Bb concentration versus time profile
following a ten minute infusion of AR177 to cynomolgus monkeys. Bb
was determined before and at various times after intravenous
infusion of AR177 as described in the Methods section. Bb levels
returned to baseline by 24 hours in all groups.
FIG. 45. CH50 levels in blood of cynomolgus monkeys prior to,
during and following intravenous administration of AR177 over ten
minutes. CH50 levels were determined pre-dose (-10 minutes), and at
10, 20, 40, 60,120 and 1440 minutes following the initiation of the
ten-minute infusion of AR177 into cynomolgus monkeys. The values
are the mean of two monkeys in the saline and 50 mg/kg groups, and
three monkeys in the 20 mg/kg group. Data for the third monkey in
the saline and 50 mg/kg groups, and for all of the 5 mg/kg group
was not available.
FIG. 46. Plasma C.sub.max of AR177 in cynomolgus monkeys
administered AR177 as a ten-minute intravenous infusion. The plasma
concentration of AR177 was determined by anion-exchange HPLC as
described in the Methods section.
FIG. 47. AR177 plasma concentration versus time profiles following
a ten-minute intravenous infusion to cynomolgus monkeys. The plasma
concentration of AR177 was determined by anion-exchange HPLC as
described in the Methods section. The plasma AR177 concentration at
24 hours for the 5, 20 and 50 mg/kg groups were <0.020 g/mL for
the 5 and 20 mg/kg groups, and 0.24.+-.0.42 .mu./mL for the 50
mg/kg group.
FIG. 48. The relationship between plasma AR177 and aPTT in
cynomolgus monkeys following a ten-minute intravenous infusion of 5
mg AR177/kg. The plasma concentration of AR177 was determined by
anion-exchange HPLC as described in the Methods section. The
baseline aPTT level (at 10 minutes prior to dosing) was 32.1.+-.4.4
seconds (mean.+-.s.d.).
FIG. 49. The relationship between plasma AR177 and aPTT in
cynomolgus monkeys following a ten-minute intravenous infusion of
20 mg AR177/kg. The plasma concentration of AR177 was determined by
anion-exchange HPLC as described in the Methods section. The
baseline aPTT level (at 10 minutes prior to dosing) was 41.6.+-.6.7
seconds (mean.+-.s.d.). The aPTT value in monkeys at the 10 minute
time point, denoted by an asterisk, exceeded the upper limit of the
assay.
FIG. 50. The relationship between plasma AR177 and aPTT in
cynomolgus monkeys following a ten-minute intravenous infusion of
50 mg AR177/kg. The plasma concentration of AR177 was determined by
anion-exchange HPLC as described in the Methods section. The
baseline aPU level (at 10 minutes prior to dosing) was 33.2.+-.4.8
seconds (mean.+-.s.d.). Certain aPTT values in monkeys at the 10 to
120 time points, denoted by asterisks, exceeded the upper limit of
the assay.
Figures for Section F
FIG. 51. AR177 plasma concentration after bolus IV dose 1 or 12
versus dose amount in Cynomolgus monkeys. Cynomolgus monkeys were
given intravenous doses of 2.5, 10 or 40 mg/kg/day every other day
for a total of 12 doses. Blood was obtained 5, 30 and 240 minutes
following doses 1 and 12. The concentration of AR177 in the plasma
of every monkey was determined by anion-exchange HPLC as described
in the Methods section. There were six monkeys in the 10 and 40
mg/kg groups, and eight monkeys in the 40 mg/kg group. There was a
linear relationship between each dose and the plasma concentration
that was achieved at each of the sampling times.
FIG. 52. AR177 plasma concentration versus time profile following a
bolus IV injection (dose 12) to Cynomolgus monkeys. Cynomolgus
monkeys were given intravenous doses of 2.5, 10 or 40 mg/kg/day
every other day for a total of 12 doses. This figure shows the
concentration of AR177 in the plasma 5, 30 and 240 minutes
following dose 12. The concentration of AR177 in the plasma was
determined in every monkey by anion-exchange HPLC as described in
the Methods section. There were six monkeys in the 2.5 and 10 mg/kg
groups, and eight monkeys in the 40 mg/kg group. There were no
apparent difference between the disappearance of AR177 from the
plasma following the 1st (FIG. F-3) and 12th doses.
FIG. 53. The relationship between the plasma AR177 concentration
and aPTT in Cynomolgus monkeys following a bolus IV injection of
2.5 mg AR177/kg. Cynomolgus monkeys were given intravenous doses of
2.5 mg/kg/day every other day for a total of 12 doses. This figure
shows the plasma AR177 concentration versus aPTT levels 5, 30 and
240 minutes following doses 1 and 12. The concentration of AR177 in
the plasma was determined in every monkey by anion-exchange HPLC as
described in the Methods section. There were six monkeys in the 2.5
mg/kg group. The baseline aPTT levels just prior to (pre-dose)
doses 1 and 12 were 24.1.+-.3.4 seconds and 22.1.+-.2.2. There was
no change in the aPTT levels at any of the time points after the
1st or 12th doses of AR177 at 2.5 mg/kg.
FIG. 54. The relationship between the plasma AR177 concentration
and APTT in cynomolgus monkeys following a bolus IV injection of 10
mg AR177/kg. Cynomolgus monkeys were given intravenous doses of 10
mg/kg/day every other day for a total of 12 doses. This figure
shows the plasma AR177 concentration versus aPTT levels 5, 30 and
240 minutes following doses 1 and 12. The concentration of AR177 in
the plasma was determined in every monkey by anion-exchange HPLC as
described in the Methods section. There were six monkeys in the 10
mg/kg group. The baseline aPTT levels just prior to (pre-dose)
doses 1 and 12 were 23.3.+-.1.8 seconds and 21.6.+-.2.2. There was
a close correlation between the aPTT] levels after the 1st or 12th
doses of AR177 at 10 mg/kg and the aPTT levels.
FIG. 55. The relationship between the plasma AR177 concentration
and aPTT in cynomolgus monkeys following abolus IV injection of 40
mg AR177/kg. Cynomolgus monkeys were given intravenous doses of 10
mg/kg/day every other day for a total of 12 doses. This figure
shows the plasma AR177 concentration versus aPTT levels 5, 30 and
240 minutes following doses 1 and 12. The concentration of AR177 in
the plasma was determined in every monkey by anion-exchange HPLC as
described in the Methods section. There were eight monkeys in the
40 mg/kg group. The baseline aPTT levels just prior to (pre-dose)
doses 1 and 12 were 24.8.+-.3.3 seconds and 22.5.+-.2.5. Certain
aPTT] values in monkeys at the 20 and 50 mg/kg dose time points at
five minutes following doses 1 or 12, denoted by asterisks,
exceeded the upper limit of the assay. There was a close
correlation between the aPTT levels after the 1st or 12th doses of
AR177 at 40 mg/kg and the aPTT levels.
Figures for Section G
FIG. 56. AR177 pharmacokinetics following a single IV dose of 0.75
mg/kg to humans. Four HIV-positive human patients were administered
AR 177 at 0.75 mg/kg as a two-hour intravenous (IV) infusion. Blood
samples were collected in EDTA-coated tubes at various time points
during and following the IV infusion. Plasma was obtained following
low speed centriguation of the blood. The concentration of AR177 in
the plasma was determined using a validated anion-exchange HPLC
method.
FIG. 57. AR177 pharmacokinetics following a single IV dose of 1.5
mg/kg to humans. Four HIV-positive human patients were administered
AR177 at 1.5 mg/kg as a two-hour intravenous (IV) infusion. Blood
samples were collected in EDTA-coated tubes at various time points
during and following the IV infusion. Plasma was obtained following
low speed centriguation of the blood. The concentration of AR177 in
the plasma was determined using a validated anion-exchange HPLC
method.
FIG. 58. AR177 pharmacokinetics following a single IV dose o 3.0
mg/kg to humans. Two HIV-positive human patients were administered
AR177 at 3.0 mg/kg as a two-hour intravenous (IV) infusion. Blood
samples were collected in EDTA-coated tubes at various time points
during and following the IV infusion. Plasma was obtained following
low speed centriguation of the blood. The concentration of AR177 in
the plasma was determined using a validated anion-exchange HPLC
method.
FIG. 59. AR177 pharmacokinetics following a single IV dose of 0.75,
1.5 or 3.0 mg/kg to humans. Ten HIV-positive human patients were
administered AR177 at 0.75, 1.5 or 3.0 mg/kg as a two-hour
intravenous (IV) infusion. Blood samples were collected in
EDTa-coated tubes at various time points during and following the
IV infusion. Plasma was obtained following low speed centriguation
of the blood. The concentration of AR177 in the plasma was
determined using a validated anion-exchange HPLC method.
FIG. 60. AR177 T1/2 and C.sub.MAX following single doses to humans.
HIV-positive human patients were administered AR177 at 0.75, 1.5 or
3.0 mg/kg as a two-hour intravenous infusion. The concentration of
AR177 was determined in the plasma using a validated anion-exchange
HPLC method. The C.sub.MAX (maximal plasma concentration of AR177)
and plasma T1/2 (half-life of AR177 in plasma) were determined
using PKAnalyst software (Micro Math, Salt Lake City, Utah).
PD. The term "PD" indicates phosphodiester internucleotide linkages
in an oligonucleotide.
PT. The term "PT" indicates phosphorothioate internucleotide
linkages in an oligonucleotide.
pPT. The term "pPT" indicates both phosphoroyhioate and
phosphodiester internucleotide linkages in an oligonucleotide.
FIG. 61. AR177 clearance following single doses to humans.
HIV-positive human patients were administered AR177 at 0.75, 1.5 or
3.0 mg/kg as a two-hour intravenous infusion. The concentration of
AR177 was determined in the plasma using a validated anion-exchange
HPLC method. The plasma clearance was determined using PKAnalyst
software (Micro Math, Salt Lake City, Utah).
DETAILED DESCRIPTION OF THE INVENTION
INDEX TO DETAILED DESCRIPTION OF THE INVENTION
Definitions
A. General In Vitro Studies
B. Specific In Vitro Studies and In Vitro HIV Inhibition Using
T30177
C. Site of Activity Studies-Viral Integrase Inhibition
D. Structure-Function Studies
E. Single Dose Pharmacokinetic Studies
F. Repeat Dose Pharmacokinetic Studies
G. Human Clinical Trials
Definitions
The following terms as defined will be used in the description of
the invention:
OLIGONUCLEOTIDE
The term "oligonucleotide" as used herein is defined as a molecule
comprised of two or more deoxyribonucleotides or ribonucleotides,
preferably more than ten. Its exact size will depend on many
factors including the specificity and anti-viral activity of the
oligonucleotide for various viruses. In addition, bases can refer
to unnatural (synthetic) bases used in place of an A, C, T or
G.
BASE
In referring to "bases" herein, the term includes both the
deoxyribonucleic acids and ribonucleic acids. The following
abbreviations are used. "A" refers to adenine as well as to its
deoxyribose derivative, "T" refers to thymine, "U" refers to
uridine, "G" refers to guanine as well as its deoxyribose
derivative, "C" refers to cytosine as well as its deoxyribose
derivative. A person having ordinary skill would readily recognize
that these bases may be modified or derivatized to optimize the
methods of the present invention. In addition, bases can refer to
unnatural (synthetic) bases used in place of an A, C, T, or G.
INHIBITION
The term "inhibition" of viral replication is meant to include
partial and total inhibition of viral replication as well as
decreases in the rate of viral replication. The inhibitory dose or
"therapeutic dose" of the compounds in the present invention may be
determined by assessing the effects of the oligonucleotide on viral
replication in tissue culture or viral growth in an animal. The
amount of oligonucleotide administered in a therapeutic dose is
dependent upon the age, weight, kind of concurrent treatment and
nature of the viral condition being treated.
PHARMACOLOGICAL DOSE
The term "pharmacological dose" as used herein refers to the dose
of an oligonucleotide which causes a pharmacological effect when
given to an animal or human. The pharmacological dose introduced
into the animal or human to be treated, will provide a sufficient
quantity of oligonucleotide to provide a specific effect, e.g., (1)
inhibition of viral protein or enzymes, (2) inhibition of
viral-specific replication, (3) preventing the target site from
functioning or (4) damaging the duplex DNA at the specific site or
(5) ablating the DNA at the site or (6) inhibiting the
transcription/translation of the gene under the regulation of the
site being bound or (7) internal inhibition of transcription or
translation of the gene containing the sequence. One skilled in the
art will readily recognize that the dose will be dependent upon a
variety of parameters, including the age, sex, height and weight of
the human or animal to be treated, the organism or gene location
which is to be attacked and the location of the target sequence
within the organism. Given any set of parameters, one skilled in
the art will be able to readily determine the appropriate dose.
PATHOPHYSIOLOGICAL STATE
The term "pathophysiological state" as used herein refers to any
abnormal, undesirable or life-threatening condition caused directly
or indirectly by a virus.
GTO
The term "GTOs" means an oligonucleotide in which there is a high
percentage of deoxyguanosine, or contains two or more segments
(runs) of two or more deoxyguanosine residues per segment.
GUANOSINE TETRAD
As used herein, the term "guanosine tetrads" refers to the
structure that is formed of eight hydrogen bonds by coordination of
the four O.sup.6 atoms of guanine with alkali cations believed to
bind to the center of a quadruplex, and by strong stacking
interactions. Of particular interest to the I100-15 class of GTO is
the structure of the telomere sequence repeat T.sub.4 G.sub.4,
first detected in Oxytricha. The oxytricha repeat has been studied
in oligonucleotides by NMR and by crystallographic methods. See
Smith et al., Nature, 1992, 356:164-68, and Kang et al., Nature,
1992 356:126-31. As predicted from numerous previous physical and
biochemical studies, both the NMR and crystallographic studies
suggest that folding is mediated by square planar Hoogsteen
H-bonding among G-residues, with overall antiparallel orientation
of the four strand equivalents comprising the tetrad fold. As
expected, the crystallography has shown that the structure is
selectively stabilized by tight binding of a small monovalent
cation to the O.sup.6 oxygen of guanosine.
The following examples are offered by way of illustration and are
not intended to limit the invention in any manner.
A. General In Vitro Studies
The present invention provides methods and compositions for
treating a pathophysiological state caused by a virus, comprising
the step of administering a pharmacological dose of an
oligonucleotide, the dose being sufficient to inhibit the
replication of the virus, wherein the oligonucleotide contains
sufficient contiguous guanosines so that a guanosine tetrad (inter-
or intra-molecular) can form, and the three dimensional structure
of the oligonucleotide is stabilized by guanosine tetrads formed at
strategic locations. Generally, this method of treating a
virus-induced pathophysiological state may be useful against any
virus. More preferably, the methods of the present invention may be
useful in treating pathophysiological states caused by viruses such
as herpes simplex virus, human papilloma virus, Epstein Barr virus,
human immunodeficiency virus, adenovirus, respiratory syncytial
virus, hepatitis B virus, human cytomegalovirus and HTLV I and
II.
Generally, the oligonucleotides of the present invention contain a
percentage of guanosine bases high enough to ensure anti-viral
efficacy. The guanosine is important in forming tetrads which
stabilize the three dimensional structure of the oligonucleotides.
Thus, the oligonucleotides of the present invention may have any
percentage of guanosine bases which will allow for tetrad formation
provided that the oligonucleotide exhibits anti-viral activity.
Preferably, the oligonucleotides of the present invention contain
two or more segments of two or more guanosine bases, and an overall
high percentage of G in order to enable the oligonucleotide to form
at least one quanosine tetrad.
Generally, the oligonucleotides of the present invention may be
capped at either the 3' or the 5' terminus with a modifier.
Preferably, the modifier is selected from the group consisting of
polyamine or similar compounds that confer a net positive charge to
the end of the molecule, poly-L-lysine or other similar compounds
that enhance uptake of the oligonucleotide, cholesterol or similar
lipophilic compounds that enhance uptake of the oligonucleotide and
propanol amine or similar amine groups that enhance stability of
the molecule.
The phosphodiester linkage of the oligonucleotides of the present
invention may be modified to improve the stability or increase the
anti-viral activity. For example, a phosphodiester linkage of the
oligonucleotide may be modified to a phosphorothioate linkage.
Other such modifications to the oligonucleotide backbone will be
obvious to those having ordinary skill in this art.
The present invention also provides specific methods of treating
viral states. For example, the present invention provides a method
of treating a pathophysiological state caused by a virus (in
preferred embodiments, as specific virus such as, herpes simplex
virus, human papilloma virus, Epstein Barr virus, human
immunodeficiency virus, adenovirus, respiratory syncytial virus,
hepatitis B virus, human cytomegalovirus and HTLV I and II),
comprising the step of administering a pharmacological dose of an
oligonucleotide, the dose being sufficient to inhibit the
replication of the virus, wherein the three dimensional structure
of the oligonucleotide is stabilized by the formation of guanosine
tetrads.
This invention discloses a novel anti-viral technology. The total
number of antiviral mechanisms by which oligonucleotides, and
especially G-rich oligonucleotides, work is not completely known,
although the inventors have at least narrowed the sites of action
as to certain oligonucleotide drugs as will be seen below. However,
in the different virus culture systems listed above, G-rich
oligonucleotides were able to significantly reduce virus production
in each. More importantly, actual human clinical studies have
demonstrated the efficacy of the drug in reducing viral replicons
in AIDS patients. The present invention is also drawn to
oligonucleotides that have three dimensional structures stabilized
by the formation of guanosine tetrads.
The present invention demonstrates poly and/or oligonucleotides
inhibit growth of HIV-1, HSV1, HSV2, FMLV and HCMV and other
viruses if the molecule contains a high percentage of ribo- or
deoxyriboguanosine. The rest of the molecule is composed of
thymine, cytosine, xanthosine or adenine nucleotides (ribo- or
deoxyribo-), their derivatives, or other natural or synthetic
bases. The 5' and 3' termini of the oligonucleotide can have any
attachment which may enhance stability, uptake into cells (and cell
nuclei) or anti-viral activity. The backbone which connects the
nucleotides can be the standard phosphodiester linkage or any
modification of this linkage which may improve stability of the
molecule or anti-viral activity of the molecule (such as a
phosphorothioate linkage).
Structural formulas for representative G-rich oligonucleotides
disclosed in the instant invention are listed below in Table
A-1.
TABLE A-l SEQ ID NO 5(B106-62)
5'-gtggtggtggtgttggtggtggtttggggggtgggg-3' SEQ ID NO 6(B106-71)
5'-gtggttggtggtggtgtgtgggtttggggtgggggg-3' SEQ ID NO 21(I100-01)
5'-tggtgggtgtgtggggggtgttgggggttgttggtggggtggtgg-3' SEQ ID NO
24(I100-07) 5'-gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg-3' SEQ
ID NO 28(I100-50) 5'-ggtggtggggtggttgttgggggttg-3' SEQ ID NO
29(I100-51) 5'-ggtggtggggtggttgttgggggttgttgggggtgtgtgggtggt-3' SEQ
ID NO 26(I100-11)
5'-gatccatgtcagtgacactgcgtagatccgatgatccagtcgatg-3' SEQ ID NO
12(Gl01-50) 5'-ggtgggtggtttgtgtggttggtgggttt-3' SEQ ID NO
13(G105-50) 5'-ggggggggggtgtgggggggggttgtggtgg-3' SEQ ID NO
14(G106-50) 5'-ggtgggtgggttggggggtgggtgggg-3' SEQ ID NO 15(G109-50)
5'-ggggtttgggtggggggttgggtggttg-3' SEQ ID NO 16(G110-50)
5'-gggtggtggtgttggtgttgtgtg-3' SEQ ID NO 17(G113-50)
5'-ggtgggggggttggtgtgtttg-3' SEQ ID NO 1(A100-00)
5'-tgggtggggtggggtgggggggtgtggggtgtggggtg-3' SEQ ID NO 2(A100-50)
3'-tgggtggggtggggtgggggggtgtggggtgtggggtg-5' SEQ ID NO 4(A101-00)
5'-ggtggtgggggggggtggggtggtggtgggggtgg-3' SEQ ID NO 18(HIV26ap)
5'-gtgtgggggggtggggtggggtgggt-3' SEQ ID NO 19(HIV26ctl)
5'-gggtgggtgggtgggtgggtgggtgg-3' SEQ ID NO 9(B107-51)
5'-ggtggggtggtggtggttggggggggggggt-3' SEQ ID NO 10(B133-54)
5'-ggtggttggggggtggggggg-3' SEQ ID NO 11(B133-55)
5'-gggtggggtggtgggtggggg-3' SEQ ID NO 20(I100-00)
5'-gttgggggttgttggtggggtggtgg-3' SEQ ID NO 27(I100- 12,PT)
5'-gttgggggttgttggtggggtggtgg-3' SEQ ID NO 22(I100-05)
5'-tggtgggtgtgtggggggtgttgggggttgttggtggggtggtgg-CHOL SEQ ID NO
23(I100-06) 5'-gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg-CHOL
SEQ ID NO 25(I100-08) 5'-gttgggggttgttggtggggtggtgg-CHOL SEQ ID NO
3 5'-gggtgggtgggtgggtgg-3' SEQ ID NO 30 5'-gggtggttgggtggttgg-3'
SEQ ID NO 31(1173) 5'-gggtgggtgggtgggtgg-3' SEQ ID NO 32(1174,PT)
5'-gggtgggtgggtgggtgg-3' SEQ ID NO 33(I100-15)
5'-gtggtgggtgggtgggt-3' SEQ ID NO 34(I100-16)
5'-gtggtgggtgggtgggtggtgggtggt-3' SEQ ID NO 35(I100-17)
5'-gtggtgggtgggtgggtggtgggtggtggttgtgggt-3' SEQ ID NO 36(I100-18)
5'-ttgtgggtgggtggtg-3' SEQ ID NO 37(I100-19)
5'-tggtgggtggtggttgtgggtgggtggtg-3' SEQ ID NO 38(I100-20)
5'-gtgggtgggtggtgggtggtggttgtgggtgggtggtg-3' SEQ ID NO
39(I100-21,PT) 5'-gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg-3'
SEQ ID NO 40(1231) 5'-gatccatgtcagtgacac-3' SEQ ID NO 41(1232,PT)
5'-gatccatgtcagtgacac-3' SEQ ID NO 42(1229)
5'-cccccccccccccccccc-3' SEQ ID NO 43(1230,PT)
5'-cccccccccccccccccc-3' SEQ ID NO 44(1198)
5'-ttcatttgggaaacccttggaacctgactgactggccgtcgttttac-3' SEQ ID NO
45(1200) 5'-gtaaaacgacggcca-3' SEQ ID NO 46(I100-25)
5'-gtggtgggtgggtgggg-3' SEQ ID NO 47(I100-26)
5'-gtggtgggtgggtggg-3' SEQ ID NO 48(I100-35) 5'-ggtgggtgggtgggt-3'
SEQ ID NO 49(I100-27) 5'-gtggtgggtgggt-3' SEQ ID NO 50(I100-28)
5'-gtggtgggt-3' SEQ ID NO 51(I100-30) 5'-gtgggtgggtgggt-3' SEQ ID
NO 52(I100-29) 5'-gtgggtgggt-3'
HSV-2 CULTURE ASSAY
In viral yield reduction assays, Vero cells (4.times.10.sup.4
cells/tissue culture well) were incubated with oligonucleotide(s)
for 14 hours before the oligonucleotide was removed and virus
(HSV-2 strain HG52) was added to the cells at a multiplicity of
infection (m.o.i.) of 0.1 to 1.0 (4.times.10.sup.3 to
4.times.10.sup.4 PFU). The infection was allowed to proceed for 10
minutes after which the cells are washed and fresh media,
containing the same oligonucleotide was added for an additional 14
hours. Then, the cells were subjected to a freeze/thaw lysis after
which the released virus was titered.
HIV-1 CULTURE ASSAY
The SUP T1 T lymphoma cell line was infected with HIV-1 strain DV
at a multiplicity of infection (m.o.i.) of 0.1 for one hour at
37.degree. C. After the infection, free virus was washed off and
the newly infected cells were plated (5.times.10.sup.4 cells) in
quadruplicate in 96 well plates that had been prepared with various
dilutions of oligonucleotide. The final concentration of drug
varied between 0.1 and 20 uM. After 3 days of incubation at
37.degree. C., the plates were scored for the presence of
multinucleated giant cells (syncytia).
In assays designed to inhibit syncytia formation, a number of
oligonucleotides exhibited anti-HIV-1 activity. The
oligonucleotides and their IC50 are listed in Table A-2. I100-05 is
the same as I100-01 with a cholesterol group attached to the 3' end
via a triglycyl-linker. I100-08 is the same as I100-00 with a
cholesterol group attached to the 3' end via a triglycyl-linker.
I100-07 was designed as a sequence isomer to I100-01 and I100-06 is
the cholesterol derivative of I100-07. A100-00 is the same sequence
in the opposite orientation to HIB38p (A100-50). I100-07,
originally designed as a control for I100-01 to be used in
anti-FMLV experiments, was the most efficacious oligonucleotide
tested against HIV-1.
In other experiments, the HIV-1 strain LAV was used to infect MT-2
cells at an m.o.i of 0.01. After 7 days, these cells were scored
for cytopathic effects (CPE). In anti-HIV-1 assays in which MT-2
cells were infected at an m.o.i. of 0.01, several G-Rich
oligonucleotides were able to inhibit viral-induced cytopathic
effects with effective dose 50's (IC50s) in the 0.5-1.0 uM range
(FIG. 3). The oligonucleotides shown in FIG. 3 were effective in
the 0.5 to 1.0 uM range, including A100-00 (HIV38p) and A100-50
(HIV38ap), A101-00 (HIV38ctl), HIV-26ctl. The oligonucleotide
HIV-26ap exhibited less efficacy in this assay with an IC50 in the
5 to 10 uM range. In FIG. 3, TE represents buffer alone, i.e., no
drug, while AZT and ddC are control drugs.
TABLE A-2 IC.sub.50 for oligonucleotides in an anti-HIV-1 syncytia
formation assay. G-Rich oligonucleotide IC50 I100-00 3.75 .mu.M
I100-01 4.50 .mu.M I100-05 3.25 .mu.M I100-08 3.25 .mu.M 1100-06
0.70 .mu.M I100-07 0.25 .mu.M A100-00 3.25 .mu.M
FMLV CULTURE ASSAY
Friend Murine Leukemia Virus (FMLV) was grown in a chronically
infected murine fibroblast cell line (pLRB215) or was propagated in
an acute assay system by infection of NIH3T3 cells. When the
chronically infected cell line was used, pLRB215 cells were split
(1.times.10hu 5) into 24 well culture dishes and incubated 16 to 20
hours at 37.degree. C. The media was then removed and replaced with
media containing various concentrations of oligonucleotide. After
1, 3 or 5 days, culture media was assayed for the presence of the
viral reverse transcriptase enzyme.
In acute assays, NIH3T3 cells were split (1.times.10.sup.4) into 96
well dishes and allowed to incubate for 16-20 hours. After
incubation, culture media was removed and concentrated virus stock
(10 ul) was added to each well in 100 ul of completed media
containing 2 ug/ml polybrene. The virus infection was allowed to
proceed for 18 hours at which time the virus containing media was
removed and complete media containing various concentrations of
oligonucleotide was added. After 4 to 7 days, the culture media was
assayed for the presence of viral reverse transcriptase.
HCMV CULTURE ASSAY
Human cytomegalovirus was cultured in the human diploid lung
fibroblast cell line MRC-5. These cells were split and placed into
24 well culture dishes and preincubated for 24 hours with various
concentrations of oligonucleotide (0.5 to 20 uM) in complete media.
The oligonucleotide was then washed off and virus was added to the
cells (approximately 0.1 m.o.i.) for 2 hours at 37.degree. C. The
virus was then removed and complete media containing the same
concentration of oligonucleotide was added. Cells were then placed
at 37.degree. C. for 10-12 days at which time virus in the culture
media was titered using a standard agar overlay procedure.
BACTERIAL T3 AND T7 ASSAYS
In this assay system, a 2 kb fragment (HindIII to EcoR1) of the
FMLV virus (clone 57) was molecularly cloned between the
HindIII/EcoR1 sites 10 bp downstream of the bacterial T7 promoter
(p275A) or 50 bp downstream of the bacterial T3 promoter
(pBSFMLV2). A shematic representation of these two recombinant
plasmids can be seen in FIG. 1. Isolated recombinant DNA was then
digested with DdeI. Oligonucleotides were then incubated with the
digested DNA and the mixture was subjected to in-vitro
transcription using either the T7 or T3 bacterial enzymes.
REVERSE TRANSCRIPTASE ASSAY
In this assay, reverse transcriptase (either MMLV or FMLV from
pLRB215 culture media) was incubated with various concentrations of
oligonucleotide and then assayed using the enzyme linked
oligonucleotide sorbent assay ELOSA), the ELOSA kit which is
commercially available from New England Nuclear.
EUKARYOTIC IN VITRO TRANSCRIPTION
In this assay, a recombinant plasmid containing the HSV-1 IE175
promoter fused to the bacterial chloramphenicol acetyltransferase
gene (CAT) was linearized and used as a template for run off
transcription studies. Commercially available HeLa cell nuclear
extracts or prepared nuclear extracts of HSV-2 infected VERO cell
were used.
INHIBITION OF HSV-2 ACTIVITY
The oligonucleotide B106-62 was originally designed to form a
triple helix structure with a portion of the promoter region of the
major immediate early protein of HSV-2 (IE175). The
phosphorothioate derivative of two oligonucleotides were
synthesized and tested for anti-viral activity against HSV-2. FIG.
2 shows that the B106-62 oligonucleotide at 20 .mu.M was able to
reduce viral titers by approximately 20% whereas the
phosphorothioate version (B106-96) reduced virus by 50% in the
submicromolar concentration range. The control oligonucleotide
(106-97), the phosphorothioate backbone derivative of B106-71, was
also able to inhibit virus at the same levels as B106-96. Even when
an extensive washing procedure at a pH of 3.0 was employed to
remove excess virus not internalized during the infection,
incubation with both B106-96 and B106-97 was able to significantly
reduce virus yield. Thus, the inventors concluded that the
mechanism of anti-viral activity was not merely a blocking of the
adsorption of HSV-2 virions to cells.
FIG. 2 also shows the results of acyclovir in the same molar range
as the oligonucleotides. Acyclovir was tested against two different
stocks of HSV-2 strain HG52, as illustrated in FIG. 4.
OLIGONUCLEOTIDE SYNTHESIS
All oligonucleotides used in these examples were synthesized on a
DNA synthesizer (Applied Biosystems, Inc., model 380B or 394),
using standard phosphoramidite methods. All oligonucleotides were
synthesize with an amino modified 3'-terminal, which resulted in
the covalent attachment of a propanolamine group to the 3'-hydroxyl
group or resulted in a cholesterol moiety attached to the
3'-terminal via a triglycyl-linker. Oligonucleotides used in this
example were capped at their 3'-terminal with either a
propanolamine or a cholesterol moiety to reduce degradation by
cellular exonucleases. Phosphorothioate containing oligonucleotides
were prepared using the sulfurizing agent TETD or beaucauge
reagent. The 3'-cholesterol modified oligonucleotides were prepared
and purified as described by Vu et al. (in Second International
Symposium on Nucleic Acids Chemistry, Sapporo, Japan, 1993).
STABILITY AND TOXICITY
Guanosine-rich oligonucleotides with either full length
phosphodiester (PD) or full length phosphorothioate (PT) backbones
were stable in the culture media for 4 days, while oligonucleotides
consisting of a more random composition of nucleotides were rapidly
degraded. This indicates that the 3'-modified G-rich
oligonucleotides with PD backbones were stable against both
endonuclease and exonuclease digestion over a defined four day
incubation in culture. The concentration of oligonucleotide needed
to reduce cell proliferation by 50% (TC.sub.50) of selected
compounds, based on the dye metabolism assay was approximately 40
to 50 .mu.M for oligonucleotides with PD backbones and 15 to 40
.mu.M for those compounds containing a PT backbone. The TC.sub.50
for selected oligonucleotides are presented in Table A-3. Stability
and toxicity tests were replaced as described below
TABLE A-3 Guanosine/Thymidine and Control Oligonucleotide Sequences
Oligo.sup.a Length 3'-Modification.sup.b Sequence TC.sub.50 .sup.c
I100-07 45 mer amine
5'-gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg-3' >50 .mu.M
I100-06 45 mer cholesterol
5'-gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg-3' I100-00 26 mer
amine 5'- gttgggggttgttggtggggtggtgg-3' 37 .mu.M I100-08 26 mer
cholesterol 5'- gttgggggttgttggtggggtggtgg-3' I100-12 26 mer
amine(PT) 5'- gttgggggttgttggtggggtggtgg-3' 18 .mu.M I100-01 45 mer
amine 5'-tggtgggtgtgtggggggtgttgggggttgttggtggggtggtgg-3' I100-05
45 mer cholesterol
5'-ggtgggtgtgtggggggtgttgggggttgttggtggggtggtgg-3' A100-00 38 mer
amine 5'-tgggtggggtggggtgggggggtgtggggtgtggggtg -3' 1173 18 mer
amine 5'-gggtgggtgggtgggtgg -3' I100-11 45 mer amine
5'-gatccatgtcagtgacactgcgtagatccgatgatccagtcgatg-3' 46.5 .mu.M 1231
18 mer amine 5'-gatccatgtcagtgacac -3' 1229 18 mer amine
5'-cccccccccccccccccc -3' .sup.a All oligonucleotides listed were
synthesized with phosphodiester backbones except I100-12 which had
phosphorothioate (PT) linkages. .sup.b The capping group at the
3'-end of the oligonucleotides was either a propanolamine or
cholestrol moiety. .sup.c Median inhibitory (toxic) concentration
in tissue culture.
A. Cytotoxicity and Stability Assays.
The cytotoxicity of selected oligonucleotides was assayed using the
CellTiter 96.TM. Aqueous Non-Radioactivity Cell Proliferation Assay
(Promega). This is a colormetric method for determining the number
of viable cells in proliferation or chemosensitive assays using a
solution if MTS. Dehydrogenase enzymes found in metabolically
active cells convert MTS into a formazan product. The SUP T1 cells
used in the cytotoxicity assays were in log phase growth at the
time of the assay. Cytotoxicity profiles for GTOs with PD backbones
such as I100-15 (SEQ. ID. NO. 33) had TC.sub.50 s (50% cytotoxic
concentration) in the range of 30 to 50 .mu.M while GTOs with PT
backbones such as I100-15 had TC.sub.5 s in the 10 to 30 .mu.M
range. The TC.sub.50 for AZT in this assay format was approximately
10 .mu.M.
Blockage of the hydroxyl terminus of oligonucleotides has been
shown by many investigators to greatly reduce degradation by
cellular exonucleases. Therefore, all oligonucleotides used in
these studies were modified at their 3'-end with either a
propanolamine group or a cholesterol group. For stability studies,
10 .mu.M of GTOs were incubated in MEM (GIBCO) supplemented with
10% FBS. Aliquots were taken after 10 min, 1 day, 2 days, 3 days
and 4 days. The aliquots at each time point were immediately
extracted twice with 50:50 phenol-chloroform solution and then
precipitated by the addition of ethanol. The recovered
oligonucleotides were 5'-end-labeled using [.gamma.-.sup.32 P]ATP
and polynucleotide kinase. The integrity of the oligonucleotides
was then analyzed on a 20% polyacrylamide gel with 7 M urea. The
results indicated that a portion of each GTO with a PD backbone was
present in the culture medium for three to four days while
oligonucleotides composed of a more random assortment of all four
nucleotides were rapidly degraded. In addition, positions within PD
GTOs where there existed two or more contiguous pyrimidines were
more susceptible to endonuclease digestion than regions containing
purines or alternating purines and pyrimidines.
INHIBITION OF HIV-1 PRODUCTION IN CULTURE ASSAYS
B. Long Term Suppression of Acute HIV-1 Infections in SUP T1
cells
The anti-HIV-1 activity of a series of guanosine/thymidine
oligonucleotides (GTOs), with PD backbones, containing different
sequences motifs was tested. As seen in Table A-2, one of the
sequence motifs tested (oligonucleotide I100-07) was 10 fold more
active at inhibiting HIV-1 induced syncytium formation than the
other motifs tested (e.g. I100-00 shown in Table A-1). I100-07 and
its derivatives (length and chemical modifications) were further
tested for their ability to inhibit virus in a dose-dependent
fashion by measurement of syncytium formation and viral p24
production.
Briefly, HIV-1.sub.DV was used to infect the SUP T1 lymphoblastoid
cell line at an m.o.i. of 0.1 TCID.sub.50 for one hour at
37.degree. C. prior to washing and resuspension in increasing
concentrations of GTOs. The cells (2.times.10.sup.4 cells/well)
were inoculated in triplicate in 200 ul of RPMI 1640 containing 10%
fetal calf serum. Four days later, the number of syncytia per well
or the level of p24 in the medium was determined. The results of
these assays are presented in Table A-4. which results indicated
that GTOs with simple PD linkages were capable of inhibiting HIV-1
syncytia formation and p24 production in culture.
TABLE A4. Guanosine/Thymidine Oligonucleotide Sequences IC50.sup.b
(.mu.M) Oligo Length linkage.sup.a Sequence Syn p24 T.I..sup.c I100
-07 45 mer PD 5'- gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg
0.25 0.55 -21 45 mer PT 5'-
gtggtgggtgggtgggtggtgggtggtggttgtgggtgggtggtg 0.225 <0.20
>100 -20 38 mer PD 5'- gtgggtgggtggtgggtggtggttgtgggtgggtggtg
1.00 1.00 -19 29 mer PD 5'- tggtgggtggtggttgtgggtgggtggtg 3.75 2.00
-18 16 mer PD 5'- tgtgggtgggtggtg 3.75 3.00 -17 37 mer PD 5'-
gtggtgggtgggtgggtggtgggtggtggttgtgggt 0.30 0.20 -16 27 mer PD 5'-
gtggtgggtgggtgggtggtgggtggt 0.25 0.15 >200 -15 17 mer PD 5'-
gtggtgggtgggtgggt 0.125 0.08 >200 -00 26 mer PD 5'-
gttgggggttgttggtggggtggtgg 3.25 ND -12 26 mer PT 5'-
gttgggggttgttggtggggtggtgg 0.225 >0.20 AZT 0.04 0.40 >200
.sup.a The internucleotide backbone linkages are denoted as PD for
phosphodiester and PT for phosphorothioate. .sup.b The IC50 valur
for the syncytium p24 inhibition assays in uM concentration. .sup.c
T.I. = therapeutic index.
In order to determine the effect of backbone modification on GTO
anti-viral activity, the PD backbone in two oligonucleotides
sequences motifs was replaced with a PT backbone. The
phosphorothioate containing oligonucleotides (I100-12 (SEQ. ID. NO.
27)) and I100-21 (SEQ. ID. NO. 24)) were then tested for their
ability to inhibit HIV-1 induced syncytium formation and production
of HIV-1 p24 in the SUP T1 acute assay system (Table A-4). The
results from these assays indicated that the presence of
phosphorothioate for phosphodiester substitutions in the
oligonucleotide backbone molecules in the oligonucleotide backbone
greatly enhanced the anti-viral activity of I100-00 (SEQ. ID. NO.
20) (I100-12 (SEQ. ID. NO. 27) but had little if any effect on
I100-07 (SEQ. ID. NO. 24) (I100-21 (SEQ. ID. NO. 39) (Table
A-4).
It was apparent from the studies that the anti-viral activity of
I100-07 (SEQ. ID. NO. 24) was maintained when steps were taken to
reduce the length of the molecule to 17 by deleting segments from
the 3'-end (I100-15, -16, -17) (SEQ. ID. NOS. 33, 34, 35) but not
by deletions from the 5'-end (I100-18, -19, -20) (SEQ. ID. NOS. 36,
37, 38). To further determine to optimal size of the PD
oligonucleotide needed for maximal anti-HIV-1 activity, the I100-15
(SEQ. ID. NO. 33) size variants listed in Table A-5 were
synthesized and assayed for antiviral activity.
TABLE A-5 Inhibition of HIV-1 Induced Syncytia Using Size variants
of 1100-15. oligo Sequence IC50 Syn.(uM) I100-15* 5'
gtggtgggtgggtgggt -3' 0.16 I100-25 5' gtggtgggtgggtgggg -3' 0.25
I100-26* 5' gtggtgggtgggtggg -3' 0. 12 I100-35 5' tggtgggtgggtgggt
-3' 1.75 I100-27 5' gtggtgggtgggt -3' 4.50 I100-28 5' gtggtgggt -3'
4.50 I100-30 5' gtgggtgggtgggt -3' 4.50 I100-29 5' gtgggtgggt -3'
>10.00 AZT 0.02 *At 5 uM these compounds suppressed virus at
least 7 days post-removal of drug. All other compounds at 5 uM were
the same AZT 7 days after removal of drug.
The duration of the viral suppression was assayed by changing the
medium in HIV-1 infected cultures containing 2.5 uM of various
oligonucleotides to complete media without added oligonucleotide on
day 4 post-viral infection. The production of viral p24 antigen was
then assayed on day 7 and day 11 post-infection. The results of
this experiment indicated that the shorter variants of I100-07
(SEQ. ID. NO. 24) (I100-15 (SEQ. ID. NO. 33) and I100-16 (SEQ. ID.
NO. 34)) as well as the PT version of this molecule (I100-21) (SEQ.
ID. NO. 39), were capable of totally suppressing HIV-1 p24
production for at least 7 days after removal of the drug from the
culture medium (table A-6). This substantial level of prolonged
inhibition was >99% for I100-15 (SEQ. ID. NO. 33), I100-16 (SEQ.
ID. NO. 34) and I100-21 (SEQ. ID. NO. 39) when compared to the p24
antigen levels obtained for untreated HIV-1 infected cells (Table
A-6). The quantitation of p24 production relative to untreated
HIV-1 infected SUP T1 cells for all oligonucleotides tested is
presented in Table A-6. The presence of sulfur molecules in the
backbone of oligonucleotide I100-7 (SEQ. ID. NO. 24) (I100-21 (SEQ.
ID. NO. 39)) had a more marked effect on the reduction of virus
seven days after removal of compound from the culture medium than
was observed at the four day post-infection assay point (Table
A-5).
TABLE A-6 Detection of HIV-1 p24 Antigen in the Culture Media of
GTO-Treated SUP T1 Cells. Percent p24.sup.a Oligonucleotide (2.5
uM) Day 4.sup.b Day 7 Day 11 Control SUP T1 cells 100.0% 100.0%
100.0% I100-07 6.0% 15.9% 8.6% I100-21 (PT).sup.d 0.0% 0.0% 0.0%
I100-15 0.0% 0.0% 0.0% I100-16 0.0% 0.0% 0.0% I100-18 144.5% 9.7%
5.3% I100-19 208.0% 21.8% 15.0% 1100-12 (PT) 0.0% 0.0% 0.0% .sup.a
Level of detectable p24 in culture medium relative to control
(infected but untreated SUP T1 cells after subtraction of
background values. .sup.b Day 4 post-infection culture medium was
replaced with fresh medium without oligonucleotide. .sup.c SUP T1
cells infected with HIV-1 but not treated with oligonucleotides or
AZT were used as positive control cells in this experiment. .sup.d
1100-21 and 1100-12 contain phosphorothioate backbone linkages
(PT).
In control experiments, the culture medium from HIV-1 infected SUP
T1 cells treated with AZT (4 .mu.M) was also replaced on day 4
post-infection with drug free media. In these experiments, two days
after removal of AZT from the culture medium the presence of
syncytium was observed in the HIV-1 infected cell cultures and by
day 4 all cells were visibly infected with HIV-1.
To determine whether the prolonged suppression of HIV-1 was due to
toxicity of the oligonucleotides, SUP T1 cells were counted for all
treated samples 7 days after removal of the oligonucleotides from
the infected cell cultures. The results indicated that for cells
treated with 2.5 .mu.M of drug there was no difference in the
number of cells when compared with control cultures (uninfected,
untreated) of SUP T1 cells.
C. Inhibition of HIV expression in patient derived peripheral blood
mononuclear cells (PBMCs)
I100-15 was assessed for activity in PBMC cultures derived from
AIDS patients. Briefly, PHA activated uninfected PBMC's were added
to 4PBMC's derived from patients with HIV infection in the presence
of varying concentrations of oligonucleotide. Anti-HIV activity was
assessed by analyzing supernatants, collected every three days from
these mixed cultures, for the presence of HIV p24. The PHA
activated PBMC's were grown in the presence of 10 units/ml of IL-1
and medium was exchanged every three days for a period of three
weeks. HIV p24 antigen production was assayed in drug-treated as
compared to untreated control specimens. It should be noted that
the results in these experiments (FIGS. 9A-B) observed for AZT were
obtained when AZT was used at 12 uM which is roughly 300 fold
greater than the IC.sub.50 for this compound.
D. In-Vitro inhibition of HIV-1 reverse transcriptase (RT)
The ability of oligonucleotides to inhibit HIV-1 RT in vitro has
been well documented. Marshall et al. PNAS 1992 89:6265-6269 have
described a competitive interaction at the active site as the
mechanism by which mono- or diphosphorothioate containing
oligonucleotides inhibit HIV-1 RT independent of whether the
molecule tested was antisense, a random sequence or poly SdC.
In order to determine whether I100-15 or its parent molecule,
I100-07 (or the PT version I100-21), was interacting with HIV-1 RT,
the activity of this enzyme was assayed in the presence of various
concentrations of oligonucleotides. A kinetic analysis of the
resultant enzyme inhibition was conducted to determine the
mechanism of inhibition. The GTOs appeared to be inhibiting the RNA
dependent DNA polymerase activity of the RT enzyme by competitive
inhibition at the active site of the enzyme.
The K.sub.i value for all of the oligonucleotides tested is
presented in Table A-7. The data indicate that for all
oligonucleotides tested the presence of the sulfur group in the
backbone greatly enhanced the interaction between the
oligonucleotides and the enzymes. The median inhibitory dose
(ID.sub.50) for these oligonucleotides were also calculated (Table
A-7). The ID.sub.50 results are based on the ability of these
compounds to inhibit 10 nM of HIV RT.
Short oligonucleotides (18 mers) with PD or PT backbones were
assayed to determine whether the nature of the nucleotide sequence
contributed to inhibition of HIV-1 RT in this assay system.
Comparison of the effects of the PD versions of a GTO (1173 or
I100-15), poly dC (1229) or a random nucleotide sequence (1231)
suggested that at this length none of the sequence motifs inhibited
RT (Table A-7). Other 18 mer PD GTO sequence motifs tested yielded
similar results. Enzyme inhibition monitored by both K.sub.1 and
ID.sub.50 was observed for the PT versions of these same 18 mer
oligonucleotides (Table A-7). The degree of enhancement of observed
enzyme inhibition for all oligonucleotides tested when the sulfur
group was present in the backbone, was between one to three orders
of magnitude (Table A-7).
TABLE A-7 In Vitro Inhibition of HIV-1 RT by PD and PT
Oligonucleotides. Oligonucleotides Length Linkage.sup.b Ki (.mu.M)
ID50 (.mu.M) I 100-00 26 PD 0.37 5.0 I 100-12 26 PT 0.005 0.015 I
100-07 45 PD 0.137 2.5 I 100-21 45 PT 0.001 0.004 I 100-15 17 PD
>5.0 >5.0 1173 18 PD >5.0 >5.0 1174 18 PT 0.015 0.0154
1229 (poly dC) 18 PD >5.0 >5.0 1230 (poly dC) 18 PT 0.044
0.033 1231 (GATC) 18 PD >5.0 >5.0 1232 (GATC) 18 PT 0.56
0.045 .sup.a Each pair of oligonucleotides contain the same
sequence and differ only in the nature of their backbone linkage.
Oligonucleotides 1229 and 1230 were poly dC while the 1231 and 1232
oligonucleotides were a random sequence of all four bases (GATC).
.sup.b The backbone modifications are denoted as PD for
phosphodiester and PT for phosphorothioate.
The results from this set of experiments demonstrated that I100-15
is minimally inhibitory to the RNA dependent DNA polymerase
activity of HIV-1 RT. The data also indicated that chemically
modifying GTOs, poly dC or a random sequence oligonucleotide
greatly enhanced the in vitro inhibitory activity of the molecule.
Therefore, chemically modified oligonucleotides such as the
antiviral G-rich molecule describe by Wyatt et al. [112] has, by
nature, a different set of characteristics from oligonucleotides
with natural PD backbones.
E. Inhibition of the interaction of HIV-1 gp120 with cellular
CD4
The outer envelope glycoprotein gp120 of HIV-1 mediates viral
attachment to the cell surface glycoprotein CD4 in the initial
phase of HIV-1 infection. The effects of both PD and PT modified
oligonucleotides on this interaction were examined using a gp120
capture ELISA kit.
The concentration of the gp120 used in these studies (125 ng/ml)
was determined to be within the linear range of the detection
assay. The ability of oligonucleotides to inhibit gp120/CD4
interactions by binding to gp120 was determined by preincubation of
the test compounds with soluble gp120 before addition to the
immobilized CD4. The results of this experiment (Table A-8) are
presented as the concentration of oligonucleotide needed to reduce
by 50% CD4 bound gp120 (ID.sub.50 [gp120]). The reciprocal
experiment was then performed to measure the ability of the
oligonucleotides to inhibit these interactions by binding to
immobilized CD4. In this set of experiments I100-00 (SEQ. ID. NO.
20), I100-07 (SEQ. ID. NO. 24) and the PT versions of these two
oligonucleotides were capable of preventing the interaction of
gp120 with immobilized CD4 (ID.sub.50 [CD4], Table A-8). For both
sequences tested, the PT version of the oligonucleotide had
ID.sub.50 values which were 50 to 100 fold lower than that of the
PD version.
A fixed length (18 mer) set of oligonucleotides with either PD or
PT backbones were assayed to determine whether the nature of the
nucleotide sequence contributed to inhibition of gp120/CD4
interactions. As was observed for the inhibition of HIV-1 RT, the
PD versions of these molecules had little or no measurable effects
on the binding of gp120 with CD4. However, the PT versions of these
oligonucleotides did yield measurable inhibitory activity. The 18
mer GTO (1174) interrupted gp120/CD4 interactions at approximately
10 fold lower concentrations than poly (SdC).sub.18 (1230) while
the random sequence 18 mer (1232) had no measurable activity (Table
A-7).
TABLE A-8 In Vitro Inhibition or HIV-1 gp120 Interaction with CD4
by PD and PT Oligonucleotides. Oligonucleotide Linkage.sup.a ID50
[gp 120](.mu.M) ID50[CD4](.mu.M) I 100-00 PD 3.50 18 I 100-12 PT
0.08 0.475 I 100-07 PD 0.80 4.25 I 100-21 PT 0.07 0.048 1173 PD
>100 >100 1174 PT 0.09 0.45 1229 (poly dC) PD >100 >100
1230 (poly dC) PT 1.00 3.25 1231 (GATC) PD >100 >50 1232
(GATC) PT >10 >10 .sup.a Each pair of oligonucleotides
contain the same sequence and differ only in the nature of their
backbone linkage. .sup.b The backbone modifications are denoted as
PD for phosphodiester and PT for phosphorothioate.
F. Oligonucleotide interactions with the v3 loop of HIV-1 gp120
It had been reported previously that poly SdC oligonucleotides were
able to bind to the third variable loop domain of HIV-1 gp120 (v3
loop). The degree of interaction was reported to be dependent on
the length of the oligonucleotide studied, with a rapid decrease in
binding affinity observed for compounds shorter than 18
nucleotides.
It was noted that the detection antibody used to monitor inhibition
of gp120/CD4 interactions in the capture gp120 ELISA KIT
(HRP-.alpha.-GP120) as described above (Table A-8) recognized an
epitope in the gp120 v3 loop (manufacturer's information). For this
reason, control experiments were performed to determine whether the
observed inhibition of gp120/CD4 interactions was due in part, or
in whole, to interference with the HRP-.alpha.-gp120 detection
antibody. The results indicated that I100-07 (SEQ. ID. NO. 24) and
I173 (SEQ. ID. NO. 31) (PD backbones) did not inhibit the detection
of immobilized gp120. However, the PT oligonucleotides tested
(I100-21 (SEQ. ID. NO. 39) and 1174 (SEQ. ID. NO. 32)) were able to
slightly inhibit the detection of gp120 at oligonucleotide
concentrations above 5 .mu.M. This level of inhibition was too
small to account for the ID.sub.50 [gp120] values presented for
I100-21(SEQ. ID. NO. 39) and 1174 (SEQ. ID. NO. 32) in Table
A-8.
Further analysis of oligonucleotide interactions with the v3 loop
was conducted using a v3 loop specific murine Mab, NEA-9284 (FIG.
10). PT oligonucleotides were able to inhibit binding of NEA-9284
to gp120. The presence of bound gp120 specific Mab was determined
using a HRP-labeled goat-.alpha.-mouse antibody. The results of
these experiments indicated that PT oligonucleotides were able to
inhibit binding of NEA -9284 to gp120. The ID.sub.50 for the most
active oligonucleotide (1100-21) (SEQ. ID. NO. 39) was
approximately 4 to 7 .mu.M. This concentration is approximately 10
to 30 fold higher than the IC.sub.50 for this oligonucleotide
against HIV-1 in culture (Table A-8). The PD oligonucleotides
tested did not inhibit the binding of any Mab to gp120. Therefore,
it was determined to be unlikely that this was the mechanism by
which the PD GTOs such as I100-07 (and hence I100-15) (SEQ. ID. NO.
33) were inhibiting HIV-1.
G. Analysis of HIV-1 RNA and DNA in single cycle assays
Total RNA and DNA were extracted from SUP T1 cells 36 hours after
infection with 0.1 m.o.i of HIV-1.sub.DV. In this assay, the
infected cells were treated with I100-15 (SEQ. ID. NO. 33) or AZT
at various time points before, during or after infection.
Harvesting of the infected cells at 36 hr post-infection allowed
for the analysis of approximately one round of viral replication. A
schematic diagram of the positions of the PCR primers used in the
DNA and RNA analysis is shown in FIG. 11.
Total extracted DNA was analyzed using a PCR primer set which would
amplify a 200 bp portion of the viral genome spanning the repeat
element (R) into the gag gene. The primer set detected full-length
or nearly completely synthesized viral DNA. This is the last region
of the minus strand of viral DNA that is synthesized. Thus, for DNA
to be detected by this primer set, two template-switching events
have occurred and contiguous 5'LTR to gag sequences must be present
on either the minus or plus strand of DNA.
In the same reaction mixture, a PCR primer set which would amplify
a 220 bp region of the human .beta.-actin gene was used. The
results indicated that in cells treated with AZT there was a marked
decrease in viral DNA synthesis when the drug was added up to 4 hrs
post-infection (data in FIG. 12 shows zero hour and 8 hour time of
addition studies). The effects of I100-15 on the early rounds of
viral DNA synthesis was minimal.
The results of this experiment indicated that I100-15 did not
inhibit virus entry into the cells because of the detectable levels
of viral DNA even in samples treated with I100-15 (SEQ. ID. NO. 33)
at the same time as virus infection (zero hour addition).
Furthermore, it suggested that I100-15 (SEQ. ID. NO. 33) had a
different mechanism of action compared to AZT.
Additional experiments using alternative PCR primers suggested that
there may be alterations in the viral DNA synthesis caused by
I100-15 (SEQ. ID. NO. 33). The observed amplification products,
when primers clustered in the U3 region of the virus were used,
yielded a banding pattern which was not predicted and obviously
different from the infected cell control (untreated) and the AZT
treated infected cell samples.
RNA extracted from HIV-1 infected cells was analyzed by RT-PCR. In
this assay, the antisense primer of the PCR primer pairs was used
with MMLV RT and extracted mRNA to synthesize cDNA strand. The
resultant cDNA was then used as a template in PCR reactions. Two
RNA primer sets were used to analyze unspliced (primers r1 and r2)
and spliced (primers r1 and r3) HIV-1 transcripts. Predicted sizes
of the amplified products were 101 bp and 214 bp for the unspliced
and spliced species respectively. The same .beta.-action primers
used for the analysis of the DNA samples were used as controls in
this experiment.
The results obtained using primer pair r1 and r3 are depicted in
FIG. 12. The results of this experiment clearly indicated that a
reduced level of HIV-1 specific transcript was observed in samples
treated with I100-15 (SEQ. ID. NO. 33) in the samples treated with
drug at the same time as virus infection (zero hours). It was also
clear that while samples treated with AZT had reduced levels of
viral cDNA, viral mRNA was still being produced. The same decrease
in HIV-1 specific transcript was observed in viral infected cells
treated with I100-15 (SEQ. ID. NO. 33) when the r1 and r2 primer
pair was used (data not shown).
H. Structural analysis of I100-15 and I100-26
I100-07 (SEQ. ID. NO. 24), and its derivative products including
I100-15 (SEQ. ID. NO. 33) and I100-26 (SEQ. ID. NO. 47), are
composed entirely of deoxyguanosine (G) and deoxythymidine (T).
These G-rich oligonucleotides were purified using anion exchange
reverse phase HPLC. Using this procedure the oligonucleotide is
purified in the presence of sodium ions. Monovalent cations are
known to encourage self-associated structures for G-rich molecules,
all of which involve formation of G-tetrads. The G-tetrad formation
involves the formation of eight hydrogen bonds by coordination of
the four O.sup.6 atoms of guanine with alkali cations believed to
bind to the center of a quadruplex, and by strong stacking
interactions. The oligonucleotides purified using anion exchange
chromatography then have an opportunity to form inter- or
intra-molecular tetrads. The tetrad structure can be strengthened
by replacing the sodium ion with potassium.
I. Nondenaturing gel analysis
I100-15 (SEQ. ID. NO. 33)(17 mer, Table A-5) was analyzed using
nondenaturing polyacrylamide gel electrophoresis. In this
experiment, trace concentrations of radiolabeled oligonucleotide
(10.sup.-7 M) was incubated with increasing concentrations of cold
oligonucleotide (up to 10.sub.-5 M) before gel analysis in the
presence of monovalent cation. Under the gel conditions used,
I100-15 (SEQ. ID. NO. 33) migrated as a unique band faster than a
random coiled (denatured) 17 mer oligonucleotide would and it was
shown to do so in a concentration independent fashion (data not
shown). This was in contrast to I100-18 (SEQ. ID. NO. 36)(16 mer,
10 fold less active than I100-15 (SEQ. ID. NO. 33)) which appeared
to migrate as multiple species in a concentration dependent fashion
under the same gel conditions (data not shown). The same phenomena
was observed when 10.sup.-5 oligonucleotide (total cold and
radiolabeled oligonucleotide) was incubated with increasing
concentration of KCl (FIG. 13). I100-15 (SEQ. ID. NO. 33) migrated
as a unique species at all concentrations of KCl while I100-18
(SEQ. ID. NO. 36) and Z106-50 (ggttgggggttggg) migrated as multiple
species.
The results from these assay suggested that I100-15 (SEQ. ID. NO.
33) folds into an intramolecular structure while other G-rich
oligonucleotides such as I100-18 (SEQ. ID. NO. 36) and Z106-S50
aggregate into higher order intermolecular structures. It was noted
that the total phosphorothioate oligonucleotide G-rich compound
described by Wyatt et al., P.N.A.S. 1994 91:1356-66, with the
sequence T.sub.2 G.sub.4 T.sub.2, was claimed to fold into an
intermolecular tetrad. Therefore, I100-15 (SEQ. ID. NO. 33) (PD
backbone) is structurally and chemically different from the
oligonucleotide reported (ISIS PT oligonucleotide).
J. Tetrad Structure. Principally due to its role in telomere
formation, the structure of four stranded nucleic acid tetrads has
been well studied
Most eukaryotes possess a repeating G-rich sequence of the form
T/C)nGm where n=1-4 and m=1-8. Of particular interest to the study
of the I100-15 (SEQ. ID. NO. 33) class of GTO was the structure of
the telomere sequence repeat T.sub.2 G.sub.4, first detected in
Oxytricha. The Oxytricha repeat has been studied in
oligonucleotides by NMR, Smith et al., Nature 1992, 356:164-68, and
by crystallographic methods, Kang et al. Nature, 1992, 356:126-31.
As had been predicted from numerous previous physical and
biochemical studies, both the NMR and crystallographic studies
suggested that folding is mediated by square planar Hoogsteen
H-bonding among G residues, with overall antiparallel orientation
of the four strand equivalents comprising the tetrad fold. As
expected, the crystallography has shown that the structure is
selectively stabilized by tight binding of a small monovalent
cation to the O.sup.6 oxygen of guanosine. But surprisingly, both
NMR and crystallography confirm that the folded structure possess
alternating syn/anti glycosidic bond angles (as opposed to all anti
for most duplex structures).
Feigon and colleagues have used NMR and modelling to deduce the
structure of a 28 base-long oligonucleotide (G.sub.4 T.sub.4
G.sub.4 T.sub.4 G.sub.4 T.sub.4 G.sub.4, Oxy 3.5) which is capable
of forming a well-defined all-antiparallel intramolecular tetrad,
Smith et al., Nature 1992, 356:164-68. The present inventors
postulated that if the GTO I100-15 (SEQ. ID. NO. 33) were to fold
to form a stable intramolecular tetrad, its NMR properties would be
expected to be similar to those of the Oxy 3.5 molecule.
In the folded state, the salient NMR characteristics of the
intramolecular Oxy 3.5 tetrad were as follows:
1. Narrow linewidths, indicative of monomer formation only.
2. Induction of well-defined guanosine N1 Hoogsteen imino
resonances in the 11.2 to 11.7 ppm range. The chemical exchange
rate of these protons is very slow, reflective of the high positive
cooperativity of tetrad folding and dissociation.
3. Spectral simplicity, indicative of a single predominant folded
structure, rather than an equilibrium among different folded
structures.
4. Intrabase H8-C1' and interbase H7-C2" NOE connectivity which
demands a pattern of alternating syn-anti glycosidic bond angle
throughout the "tetrad stem" of the folded structure.
K. One dimensional NMR analysis
Displayed in FIG. 14 is a line model for I100-15 (SEQ. ID. NO. 33),
folded to form an intramolecular tetrad of the Oxytricha class.
From a physical perspective, the possibility that an intramolecular
tetrad structure might form in high KCl or NaCl is not surprising.
What was surprising was the fact that this model proposed a stem
region comprising a single G-octet and intervening loop regions
which were only two bases long.
In order to test the general feasibility of this model, a detailed
3D molecular model for a I100-15 (SEQ. ID; NO. 33) was constructed.
In so doing, the inventors assumed that the 8 G's comprising the
octet core of the structure formed a standard square planar octet,
and that glycosidic angles were as in the crystal and NMR
structures of the antiparallel Oxytricha tetrads, Smith et al.,
Nature 1992, 356:164-68, and Kang et al., Nature 1992, 356:126-31.
Additionally, a single K.sup.+ ion was introduced into the center
of the G-octet, with octahedral coordination to GO.sub.6.
Initially, 2 base loop structures were created so as to connect
elements of the octet without disruption. Subsequent to this
initial postulation, the structure was subjected to mechanical
refinement with full electrostatics, employing Charmm parameters in
Sybyl.
After refinement, it was observed that coordinates of the octet
core were not significantly altered and that backbone parameters
within the loop domains were within acceptable energetic
limits.
First, the structure was very compact, nearly spherical, with the
three loop regions and the 5' "GT tail" comprising the surface of
the tetrad core. Based upon this structure, it appeared likely that
interaction with cellular macromolecules would be heavily dominated
by the structures of these surface loops. In that regard, the
inventors believe that it may be inappropriate to think of such
interactions as "tetrad binding." The inclusion of G-tetrads in
such a structure may not be important as a recognition element per
se, but instead provides a latticework upon which an orderly loop
array is positioned.
Further, although the loop regions did not appear to be under
mechanical stress, they were short enough so that they possessed
very high configurational freedom. Because of those severe length
constraints, it was found that all feasible loop models display a
distinct "rabbit ears" structure, wherein the two base planes of
the loop region are unstacked, and point outward from the center of
the octet core. Such rigid, unstacked, single strand loop character
was very distinctive as compared to other known folded nucleic acid
structures. Therefore, varying the sequence or chemical structure
of these loops, one at a time, was necessary to determine if
bonding interactions between these loops and cellular
macromolecules are important to the observed anti-HIV activity.
The structures described above possessed a single G-octet core,
which was known to be the minimum structure required for nucleation
of tetrad formation. Therefore, when paired with the observed short
loop size, the intramolecular tetrad structure proposed for I100-15
(SEQ. ID. NO. 33) is best described as meta-stable, relative to
other more robust tetrads which have been described in the
literature. An increase of the core from 2 to 3 stacked tetrads, or
an increase in the length of flexibility of one or more loops would
be expected to increase the thermodynamic and/or kinetic stability
of this structure significantly. Thus, the observed anti-HIV
activity can be improved by sequence modification which enhances
the stability of the underlying tetrad latticework.
Finally, it was observed that I100-15 (SEQ. ID. NO. 33) and
homologues display profound resistance to cellular nucleases. One
interesting aspect of the proposed structure was that, even in the
loop domains, phosphodiester linkages are generally buried from
interaction with large solutes, such as a nuclease. The structure
analysis proposed defined local phosphodiester backbone structure
at low resolution. When paired with explicit biochemical analysis
of phosphodiester cleavage rate, it is possible to define sites for
selective introduction of backbone modification in I100-15 (SEQ.
ID. NO. 33) homologies, for the purpose of extending the biological
half life in vivo.
The gel electrophoresis data described above suggested that I100-15
(SEQ. ID. NO. 33) spends very little time as a random coil at
25.degree. C., under native salt conditions. Although the gel data
rules out intermolecular associations, the data do not constrain
the oligomer to any particular folded monomeric structure.
Oligonucleotide folding in I100-15 (SEQ. ID. NO. 33) has been
studied employing a combination of high resolution NMR and
methods.
Stable formation of a discrete octet core, mediated by tight
binding of a single monovalent ion is crucial to the model
described above. Given that G-N1 imino protons give rise to sharp,
characteristic .sup.1 H NMR signals in such a structure, focus has
been on the potassium ion dependence and temperature dependence of
I100-15 (SEQ. ID. NO. 33) folding, as assessed by .sup.1 H NMR at
500 mHz.
For these measurements, I100-15 (SEQ. ID. NO. 33) was synthesized
at 15 uM scale employing fast deblocking "Expedite" chemistry on a
Milligen synthesizer. Subsequent to purification by denaturing
anion-exchange chromatography in base (10 mM LiOH, 0.2 to 0.7M
NaCl), oligomer purity was confirmed by denaturing gel
electrophoresis (7M urea, 65.degree. C.). For NMR, the oligomer was
desalted and transferred into 20 mM LiC1 adjusted to pH 6.0, which
minimizes folding to form tetrads. Oligonucleotide strand
concentration was held constant at 2.7 mM. NMR was measured in
H.sub.20, employing a Redfield pulse sequence to saturate the water
resonance, as described previously, Dittrich et al., Biochemistry,
1994 33:4111-4120.
In FIG. 15 a KCl titatation is displayed. At 300.degree. K., in the
absence of added K.sup.+, imino proton signals cannot be resolved
in the 10-12 ppm region. Subsequent to addition of KCl, substantial
narrowing of imino signals was obtained, saturating at an added KCl
concentration of 3 mM, which is very close to one added K.sup.+
equivalent per octet. Above 4 mM, it can be seen that at least two
classes of imino resonance can be detected in the 10-12 ppm range
with roughly equal intensity: a broad envelope from 10-11 ppm, upon
which several sharp resonances are superimposed in the 11-11.5 ppm
region.
By analogy with chemical shifts of other G tetrad structures, the
inventors tentatively ascribed the sharp imino signals to the 8
Hoogsteen H bonds of the core octet. The broad envelope was
ascribed to the G and T imino resonances contributed by the loop
and 5' terminal domains. Consistent with published tetrad NMR data,
a broad envelop of signal was detected at 9 ppm, which most likely
results from unusually slow exchange of guanosine N2 protons
engaged in Hoogsteen pairing.
In order to better distinguish the two classes of imino.sup.1 H
signal and, additionally, to investigate the gross stability
characteristics of the folded I100-15 structure, thermal melting
analysis, at 2.7 mM in strands, 6 mM KCl, 20 mM LiCl, pH 6.0 over
the range from 300.degree. K. to 345.degree. K. was performed.
Substantial line narrowing of "Hoogsteen" imino proton signals was
seen at 310.degree. K., which appears to be accompanied by
broadening of the poorly resolved imino envelope at 10.7 ppm. This
caused a narrowing of the plateau above 310.degree. K., giving rise
to 7-8 well-resolved imino protons at 320.degree. K. By reference
to the NMR behavior of the Oxytricia tetrad and other tetrad
structures, the formation of 7 to 8 narrow, well-resolved imino
resonances at elevated temperatures strongly suggested that in the
presence of one bound K.sup.+ ion per octet equivalent, I100-15
folded into a discreet tetrad structure, stabilized by the 8
Hoogsteen H-bonds of the presumed octet.
In the range from 330 to 340.degree. K., the imino proton spectrum
undergoes an abrupt transition, which is likely to be
representative of cooperative unfolding of the octet. Stability of
this kind, accompanied by apparently high thermal cooperativity is
very striking indeed, and is generally indicative of a single,
well-defined folded oligonucleotide structure.
The origin of the shallow temperature dependence of the spectral
parameters, leading to enhanced .sup.1 H resolution at 320.degree.
K., remains to be determined. It is likely to have resulted from
weak intermolecular association which occur in the millimolar
strand concentration range. This interpretation is born out by
preliminary analysis of spectral parameters as a function of strand
concentration (not shown). Independent of interpretation, the data
suggested that high quality NMR data may be obtained for
exchangeable and non-exchangeable I100-15 (SEQ. ID. NO. 33) protons
at 35.degree. C., 20 mM, LiCl, 6 mM KCl and 2 mM in strand
equivalents.
INHIBITION OF HCMV ACTIVITY
Several different oligonucleotides reduced HCMV titers in tissue
culture. Each of the oligonucleotides contained a different
percentage of guanosine residues and a different number of total
nucleotides in the polymer. The results of this assay are depicted
in Table A-9. All oligonucleotides were capable of reducing viral
titer in culture including G101-50 (SEQ. ID. NO. 12) which
contained only 53% G residues (16 out of 30 total nucleotides). In
Table A-9, the length and percent guanosine nucleotides is
indicated for each oligonucleotide tested.
TABLE A-9 Oligonucleotide Inhibition of HCMV Activity Viral Yield
in plaque forming units (PFU) oligonucleotide (% G) G101-50 G105-50
G106-50 G109-50 G113-50 Oligo. (53%) (80%) (78%) (65%) (64%) Conc.
30 mer 31 mer 29 mer 29 mer 24 mer None 4.5 .times. 10.sup.3 4.5
.times. 10.sup.3 4.5 .times. 10.sup.3 4.5 .times. 10.sup.3 4.5
.times. 10.sup.3 PFU PFU PFU PFU PFU 20.0 .mu.M .O slashed. 4.5
.times. 10.sup.1 2.5 .times. 10.sup.1 8.0 .times. 10.sup.1 3.5
.times. 10.sup.1 PFU PFU PFU PFU 10.0 .mu.M 2.5 .times. 10.sup.1
1.8 .times. 10.sup.2 4.0 .times. 10.sup.1 4.5 .times. 10.sup.1 4.0
.times. 10.sup.1 PFU PFU PFU PFU PFU 1.0 .mu.M 7.0 .times. 10.sup.2
1.9 .times. 10.sup.2 6.0 .times. 10.sup.1 1.5 .times. 10.sup.2 5.0
.times. 10.sup.2 PFU PFU PFU PFU PFU 0.5 .mu.M 8.0 .times. 10.sup.2
2.7 .times. 10.sup.2 1.3 .times. 10.sup.2 3.0 .times. 10.sup.2 5.4
.times. 10.sup.2.about. PFU PFU PFU PFU PFU
In NIH3T3 cells chronically infected with FMLV, oligonucleotides
(FIG. 1) were capable of inhibiting virus production. However,
oligonucleotide controls in this experiment were capable of
inhibiting virus production in culture.
IN VITRO ENZYMATIC ASSAYS
Culture media containing FMLV reverse transcriptase (RT) was mixed
with various concentrations of I100-51 (SEQ. ID. NO. 29) or I100-12
(SEQ. ID. NO. 27), (the phosphodiester backbone of I100-51 (SEQ.
ID. NO. 29) having been modified to a phosphorothioate backbone).
Reverse transcriptase was measured as described in the section
entitled "Reverse Transcriptase Assay" above. FIG. 4 shows that
both oligonucleotides were capable of inhibiting the RT enzyme.
Inhibitory concentrations for 50% reduction in RT activity was
between 0.5 to 1 .mu.M for I100-51 and less than 0.5 uM for I100-12
(SEQ. ID. NO. 27).
The I100-51 (SEQ. ID. NO. 29)(FMLV2ap), attenuated full length
transcription directed by either the T7 or T3 polymerases (FIG.
5A). As can be seen in FIG. 1, full length transcripts directed by
the T7 promoter would be 131 bases long while full length
transcripts directed by the T3 promoter would be 171 bases long
(position of the Dde I site relative to the mRNA start site). The
sequence isomer of I100-51 (SEQ. ID. NO. 29)(I100-01 (SEQ. ID. NO.
21)=FMLV2p), designed parallel to the target strand was also
capable of significantly inhibiting transcription from the T7
promoter (FIG. 5B). However, only the anti-parallel triple helix
forming oligonucleotide FMLV2ap inhibited via attenuation of
transcription as can be seen in the build up of a truncated
transcript in the reaction mix (FIG. 5C). The truncated transcript
analyzed in FIG. 5C was approximately 63 bases long and matched the
predicted size fragment when p275A was used as a template (T7
promoter). G101-50 (SEQ. ID. NO. 12) (53% G) inhibited T7, but not
T3 directed, transcription by a mechanism other than attenuation
(FIG. 5A) since no truncated transcripts were observed when this
oligonucleotide was used alone. I100-11 (SEQ. ID. NO. 26) (26% G)
increased the level of specific transcripts directed by the T7
promoter (FIG. 4).
In experiments designed to monitor inhibition of transcription
initiation of the HSV-1 IE175 promoter, using oligonucleotides,
both specific and control G-Rich oligonucleotides were capable of
inhibiting eukaryotic transcription when a HeLa cell extract system
was used. The oligonucleotides used were B133-54 (SEQ. ID. NO. 10);
B133-55 (SEQ. ID. NO. 11) and B107-51 (SEQ. ID. NO. 9) as specific
inhibitors via potential triple helix mechanism of action and
G101-50 (SEQ. ID. NO. 12) and I100-11 (SEQ. ID. NO. 26) as the low
G-content control oligonucleotides.
The experiments described above clearly demonstrated the anti-viral
activity in tissue culture assays for several G-Rich
oligonucleotides against HSV-2, HIV-1, HCMV and FMLV. In addition,
G-Rich oligonucleotides specifically inhibited the bacterial RNA
polymerase enzymes T7 and T3, the FMLV and HIV-1 reverse
transcriptase enzyme and eukaryotic RNA polymerase.
B. Specific In Vitro Studies and In Vitro HIV Inhibition Using
T30177
As was demonstrated by the inventors in the studies initially
conducted as described below, T30177 is an oligonucleotide composed
of only deoxyguanosine and thymidine, it is 17 nucleotides in
length is the same sequence as I10015 (SEQ. ID. NO. 33), and it
contains single phosphorothioate internucleoside linkages at its 5'
and 3' ends for stability. This oligonucleotide does not share
significant primary sequence homology with, or possess any
complementary (antisense) sequence motifs to the HIV-1 genome. As
shown below, T30177 inhibited replication of multiple laboratory
strains of HIV-1 in human T-cells lines, peripheral blood
lymphocytes, and macrophages. T30177 was also shown to be capable
of inhibiting multiple clinical isolates of HIV-1 and preventing
the cytopathic effect of HIV-1 in primary CD4.sup.+ T-lymphocytes.
In assays using human peripheral blood lymphocytes there was no
observable toxicity associated with T30177 at the highest
concentration tested (100 .mu.M), while the median inhibitory
concentration IC.sub.50) was determined to be in the 0.1 to 1.0
.mu.M range for the clinical isolates tested, resulting in a high
therapeutic index for this drug. In temporal studies, the kinetics
of addition of T30177 to infected cell cultures indicated that like
the known viral adsorption blocking agents dextran sulfate and
Chicago sky blue, T30177 needed to be added to cells during, or
very soon after, viral infection. However, analysis of nucleic
acids extracted 12 hr-post infection from cells treated with
T30177, at the time of virus infection, established the presence of
unintegrated viral cDNA, including circular proviral DNA, in the
treated cells. In vitro analysis of viral enzymes revealed that
T30177 was a potent inhibitor of HIV-1 integrase reducing enzymatic
activity by 50% at concentrations in the range of 0.01 to 0.10
.mu.M. T30177 was also able to inhibit viral reverse transcriptase
activity, however, the 50% inhibitory value obtained was in the
range of 1-10 .mu.M depending upon the template used in the
enzymatic assay. No observable inhibition of viral protease was
detected at the highest concentration of T30177 used (10 .mu.M). In
experiments in which T30177 was removed from infected cell cultures
4 days post-HIV-1 infection, total suppression of virus production
was observed for more than 27 days. Polymerase chain reaction
analysis of DNA extracted from cells treated in this fashion was
unable to detect the presence of viral DNA 11 days after removal of
drug from the infected cell cultures. The ability of T30177 to
inhibit both laboratory and clinical isolates of HIV-1 and the
experimental data suggested to the inventors that T30177
represented a novel class of integrase inhibitors, indicating that
this compound was a viable candidate against evaluation as a
therapeutic agent for HIV-1 in humans.
In the present study the inventors disclose the mechanism by which
a variant of I100-15 (SEQ. ID. NO. 33) (T30177) was able to inhibit
multiple HIV-1 laboratory strains in acute and long-term
suppression assays. The data indicated that T30177 is a potent and
selective inhibitor of HIV-1 via at least two mechanisms. One
mechanism involves interfering with CD4- and gp120-mediated cell
fusion events. However, T30177 is 100-fold less effective in
inhibiting gp 120-induced cell fusion events than it is at
inhibiting an early event in the viral life cycle, suggesting a
specific point of interdiction distinct from that of blocking
virus/cell interactions. The data also clearly showed that T30177
is a potent inhibitor of the HIV-1 integrase enzyme in vitro and
that by blocking these events in the viral life cycle T30177 is
able to suppress virus production for prolonged periods after an
initial short treatment regimen with the drug.
Materials Used in In Vitro HIV Inhibition Studies
Oligonucleotides. The deoxyguanosine-rich and other
oligodeoxynucleotides used in this study were synthesized,
purified, and characterized as previously reported. Ojwang, et al.,
J. AIDS 7:560-570 (1994); Rando, et al, J. Biol. Chem.
270:1754-1760 (1995). The sequence and phosphorothioate (PT)
pattern of the oligonucleotides used in antiviral assays is shown
in Table B-7.
Materials. Zidovudine (3'-azido-3'-deoxythymidine, AZT) and the
nucleoside analogs 2',3'-dideoxyionsine (ddI) and
2',3'-dideoxycytidine (ddC) were obtained from the AIDS Research
and Reference Reagents Program, National Institute of Allergy and
Infectious Diseases. Dextran sulfate (DS5000) was purchased from
Sigma, and the bicyclam derivatives JM2763 and JM3100 (De Clereq,
et al., Antimicrob. Agents Chemother. 38:668-674 (1994)) were
obtained from Johnson Matthey (Westchester, Pa.). Chicago sky blue
(CSB) was obtained from the Drug Synthesis and Chemistry Branch,
National Cancer Institute.
Cytotoxicity Analysis. The cytotoxicity of T30177 was assayed as
described above. The concentration of drug necessary to give
one-quarter (TC.sub.25), one-half (TC.sub.50) or 95% (TC.sub.95) of
the maximum inhibition of growth response was then determined. The
degree of cell proliferation was determined according to the
manufacturer's instructions.
In other experiments the effect of T30177 on the viability of
primary human PBMCs, PBLs and macrophages was determined using the
trypan blue dye exclusion technique. Griffiths, B., IRL Press, p.
48 (1992), or by measuring the degree of [.sup.3 H]thymidine or
[.sup.3 ]leucine uptake in these cells (McGrath, M. S., et al.
Proc. Natl. Acad. Sci. USA 86:2844-2848 (1989)).
Antiviral assays
HIV-1 infection assays using cell lines
Laboratory strains of HIV-1, HIV-2, simian immunodeficiency virus
(SIV), or the low passage isolate HIV-1.sub.DV (Ojwang, et al., J.
AIDS 7:560-570 (1994)), were used to infect established cell lines
using the indicated multiplicity of infection (MOI) of virus, for
one hour at 37.degree. C. prior to washing and resuspension in
medium containing increasing concentrations of drug. The infected
cells (2.times.10.sup.4 cells/well) were inoculated in triplicate
in 200 .mu.l of complete medium which contains RPMI 1640 (Life
Technologies) supplemented with 10% FBS, penicillin (50 U/mL),
streptomycin (50 .mu.g/mL) and L-glutamine, (2 mM). Four to 6 days
post-infection, drug treated and control wells were analyzed for
HIV-1 induced cytopathic effects, for the presence of viral reverse
transcriptase (RT) or viral p24 antigen in the culture medium.
Buckheit, et al., AIDS Research and Human Retroviruses 7:295-302
(1991); Ojwang, et al., J. AIDS 7:560-570 (1994); Rando, et al, J.
Biol. Chem. 270:1754-1760 (1995). Cytopathic effects (CPE) were
monitored by either direct counting of HIV-1 inducted syncytium
formation or by staining cells with the tetrazolium dye XT or MTT.
Buckheit, et al., AIDS Research and Human Retroviruses 7:295-302
(1991). The AZT resistant strain of HIV-1 (ADP/141) was kindly
provided by Dr. Brendan Larder and the AIDS Directed Programme
Reagent Project, Medical Research Council, England.
HIV-1 infection of PBMCs
Peripheral blood mononuclear cells (PBMCs) were isolated from blood
of HIV-1 negative and hepatitis B virus (HBV) negative (healthy)
donors by Ficoll/Hypaque density gradient centrifugation, cultured
as described by Gartner and Popovic (Gartner et al., In Techniques
in HIV Research, p. 59-63 (1990)), then activated with
phytohemagglutinin (2 .mu.g/mL) and cultured in RPMI 1640 medium
supplemented with 15% fetal bovine serum (FBS) and human
recombinant interleukin 2 (IL-2, 30 units/mL). After 3 days PBMCs
(2.times.10.sup.5 cells/well) were infected with various isolates
of HIV-1 at a multiplicity of infection (MOI) of 0.01. After 2
hours at 37.degree. C. cells were washed and treated with various
concentrations of T30177 or AZT, as described by Buckheit and
Swanstrom, id. (1991). The medium was changed on day 3 or 4
post-infection and fresh drug was added at these times. Seven days
after infection, HIV-1 replication was analyzed using the Coulter
p24 antigen-capture assay. Assays were performed in triplicate.
Data was obtained by spectrophotometric analysis at 40 nm using a
Molecular Devices Vmax plate reader.
HIV-1 infection of PBLs
Human peripheral blood lymphocytes (PBLs) were isolated from blood
drawn from HIV-1 and HBV seronegative donors. PBLs were isolated by
Ficoll-Hypaque density gradient centrifugation. The PBLs were
suspended in culture medium (RPMI 1640 medium supplemented with 2
mM L-glutamine, 20% FBS and 50 .mu.g/mL gentamicin) and the cells
counted using the trypan blue exclusion technique. After adjustment
of cell density to 1.times.10.sup.7 cells per mL with culture
medium, the suspension was placed in a T-75 culture flask and
incubated flat at 37.degree. C. in a humidified atmosphere of 5%
CO.sub.2 for 2 hours. The non-adherent cell population was decanted
into a sterile disposable flask. Phytohemagglutinin (PHA-P) was
added to the PBL suspension at a concentration of 2 .mu.g/mL and
the PBl preparation was then further incubated at 37.degree. C. for
48 hours. At this time an aliquot of the culture was used for virus
infectivity studies. PBLs (5.times.10.sup.5 cells/well) were
infected with HIV-1 isolates at an MOI of 0.2. This level of
infection yielded a satisfactory virus control RT activity value
result at day 7 post-infection (Buckheit, et al., id. (1991)). Two
hours post-infection, the cells were separated from the virus by
centriguation, washed twice with culture medium, and suspended in
culture medium containing IL-2 at a concentration 30 units/mL and
at a cell density 2.times.10.sup.5 PHA-P-stimulated PBL cells/0.1
mL of culture medium. Seven day post-infection, HIV-1 replication
was analyzed using either the RT or p24 assay systems. Data was
obtained in the p24 assays by spectrophotometric analysis at 450 nm
using a Molecular Devices Vmax plate reader.
Inhibition of acute infection of primary human macrophages
Human macrophage cultures were established as described by Crow et
al. Crowe, et al., AIDS Research and Human Retroviruses
3(2):135-145 (1987). Briefly, PBMC's isolated from HIV-1 and HBV
seronegative donors was allowed to adhere to glass at 37.degree. C.
for two hours in calcium and magnesium free PBS (pH 7.4). The
non-adherent cells were aspirated and the adherent cells were
washed three times with cold PBS. The adherent macrophages were
scraped free from the plate, counted, and inoculated into 96 well
plates at a concentration of 10.sup.5 cells/well in RPMI 1640
medium supplemented with 10% human serum. The macrophages were
cultivated in RPMI 1640 with 10% human serum. After incubation
overnight at 37.degree. C. the macrophages were infected with
HIV-1.sub.DV at a multiplicity of infection of 0.1 for 24 hours at
37.degree. C. in the presence of the indicated amount of drug.
Unabsorbed virus was then washed off and the cells were further
incubated for 7 days at 37.degree. C. in complete medium
supplemented with the indicated amount of drug. On day 7
post-infection the adherent macrophages were washed extensively
with PBS and lysed with detergent. Cytoplasmic HIV p24 levels were
then quantitated and percent inhibition were calculated and
compared to control infected but untreated cells.
Long term suppression studies
Long term suppression assays were performed in MT-4 cells infected
with HIV-1.sub.MB (MOI of 0.01) using drug concentrations
representing 1, 10 or 100-fold over the median IC.sub.50 value for
each compound. Four days post-infection, cells were washed twice
with phosphate-buffered saline (PBS) and resuspended in complete
medium without drug (day 0). Viral breakthrough was monitored at
several time points by measurement of viral p24 antigen production
in the culture medium or the presence of intracellular viral DNA as
described previously, (Rando, et al, J. Biol. Chem. 270:1754-1760
(1995)).
Other viral assays
Respiratory syncytial virus (RSV strain A2), and influenza A (FLUA
strain H3N2) virus assays were performed as described by Wyde et
al. (Wyde, et al., Drug. Dev. Res. 28:467-472 (1993)) while Herpes
Simplex viruses types 1 and 2 (HSV-1, HSV-2) plaque reduction
assays were performed as previously described. Lewis, et al,
Antimicrob. Agents Chemother. 38:2889-2895 (1994). Vesicular
stomatitis virus (VSV), Vaccinia virus, Sindbis virus, Coxsackie
virus B4, Polio virus-1, and Semliki forest virus assays were
performed as described by De Clercq. De Clereq, E., Antimicrob.
Agents Chemother. 28:84-89 (1985). The arenaviridae assays (Junin
and Tacaribe viruses) were performed as described by Andrei and De
Clercq. Andrei, et al., Antiviral Res. 14:287-299 (1990). Punta
Toro virus (ATCC VR-559) and Yellow fever virus (vaccine strain
17D) assays were performed using Vero cells.
Flow cytometric analysis of HIV-1 infected lymphocytes
Seven days post-HIV-1 infection of PBMCs, the infected cell culture
medium was analyzed for HIV-1 production using the p24
antigen-capture assay. In addition, cells from both the drug
treated and control wells were analyzed for CD4 and CD8 antigens by
cytofluorometry. Briefly, cells were washed and treated with
fluorochrome-labeled monoclonal antibodies to CD4 or CD8 (Becton
Dickinson). The cells were washed again and fixed with 2%
paraformaldehyde before analysis. Crissman, et al., Flow Cytometry
and Sorting, p. 229-230 (1990) and Crowe et al., AIDS Res. Hum.
Retroviruses 3:135-145 (1987).
Single cycle analysis of mHV-1 cDNA
CEM-SS cells (2.times.10.sup.6 cells/well) in 0.5 mL of complete
medium were infected with HIV-1.sub.SKI at a MOI of 1.0 for 45
minutes on ice at which time complete culture medium (10 mL) was
added to the cells. The infected cells were then pelleted (1000 RPM
for 10 min. at 4.degree. C.), washed twice and aliquoted into a
24-well flat bottom plate (2.times.10.sup.5 cells/well). The
indicated amount of drug was added to the infected cell cultures at
various times during or post-infection. The cells were harvested 12
hours post-infection at which time cell pellets were lysed in 100
.mu.L polymerase chain reaction (PCR) lysis buffer (50 mM KCl, 10
mM Tris-HCl (pH8.3), 2.5 mM MgCl.sub.2, 0.1 mg/mL gelatin, 0.45%
Nonidet P40, 0.45% Tween 20 and 75 .mu.g/mL Proteinase K) at
50.degree. C. for one hour followed by 95.degree. C. for 10
minutes. The lysate was stored at -20.degree. C. until use.
PCR analysis of viral cDNA was performed using 10 .mu.L of total
cell lysate in a 100 .mu.L reaction buffer as previously described
(Rando, et al, J. Biol. Chem. 270:1754-1760 (1995)). The primers
used were 5'-ATAATCCACCTATCCCAG TAGGAGAAAT-3' and
5'-TTTGGTCCTTGTCTTATGTCCAGAATCG-3' which will amplify a 115 bp
segment of the HIV-1 genome. The cycle conditions used were
95.degree. C. for 10 minutes to denature the DNA, followed by 30
cycles of 95.degree. C. for 75 seconds, 60.degree. C. for 75
seconds, and a final extension step at 60.degree. C. for 10
minutes. Thirty .mu.L of the amplification reaction were mixed with
10 ul of .tau.-.sup.32 P-labeled internal probe
(5'-ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC-3'), placed at
95.degree. C. for 7.5 minutes and then annealed at 55.degree. C.
for 15 minutes. The resultant products were separated by
electrophoresis on a 10% polyacrylamide gel.
Analysis of viral replication
CEM-SS cells (2.times.10.sup.7) were infected with HIV-1.sub.SKI
(MOI of I) for 45 minutes at 37.degree. C. with gentle mixing.
Following virus attachment, the cells were gently pelleted, washed
twice and resuspended in complete tissue culture medium. The cells
were then divided into aliquots, treated with various
concentrations of drug and placed in T75 culture flasks. The cells
were incubated at 37.degree. C. for 18-20 hours and then harvested
by centriguation. To extract nucleic acids for analysis of HIV-1
integration low- and high-molecular weight DNA were prepared from
HIV-1 infected cells (untreated or treated with increasing
concentrations of drug) according to the protocol originally
described by Hirt (Hirt, B. J., J. Mol. Biol. 26:365-369 (1967))
and modified by Gowda et al. Gowda, et al., J. Inmunol. 142:773-780
(1989).
DNA (300 ng), obtained from the low-molecular weight Hirt
fractions, was used as the template in PCR analysis undergoing a 30
cycle amplification reaction using the conditions described by
Steinkasserer et al. (Steinkasserer, et al., J. Virol. 69:814-824
(1995)). PCR primer sets included control primers for the
amplification of mitochondrial DNA (sense,
5'-GAATGTCTGCACAGCCACTTT-3'; antisense,
5'-ATAGAAAGGCTAGGACCAAAC-3'; amplified product, 427 bp); primers
for the detection of early viral transcription events (M667 and
AA55 primers as described by Zack et al. (Zack, et al., Cell
61:213-222 (1990)), amplified product, 142 bp); primers for the
detection of the viral gag gene (sense,
5'-AGTGGGGGGACATCAAGCAGCCATGCAAAT-3'; antisense,
5'-TTTGGTCCTTGTCTTATGTCCAGAATG-3', amplified product 300 bp); and
primers for the detection of circular proviral DNA (sense,
5'-CCTTTTAGTCAGTGTGGAAAATCTCTAGCA-3'; antisense, 5'-CAG
TGGGTTCCCTAGTTAGC-3', amplified product, 536 bp). PCR products were
separated by agarose gel electrophoresis and visualized by ethidium
bromide staining.
Reverse transcriptase enzyme inhibition assays
Purified recombinant RT (HIV-1.sub.BH10) was obtained from the
University of Alabama, Center for AIDS research. The enzyme assays
utilized three different template:primer systems, primed ribosomal
RNA, gapped duplex DNA, and poly(rA)p(dT).sub.12-18 to evaluate the
inhibition of HIV-1 RT as described by White et al. (White, et al.,
Antiviral Res. 16:257-266 (1991), and Parker et al. (Parker, et
al., J. Biol. Chem. 266:1754-1762 (1991)).
Integrase enzyme assays
Purified recombinant HIV-1 integrase enzyme (wild-type) was a
generous gift from Dr. R. Craigie, Laboratory of Molecular Biology,
National Institute of Diabetes and Digestive and Kidney Diseases.
The enzyme (0.25 .mu.M) was preincubated in reaction buffer at
30.degree. C. for 30 minutes. All 3'-processing and strand-transfer
reactions were performed as described previously by Fresen et al.
(Fresen, et al., Proc. Natl. Acad. Sci. USA 90:2399-2403 (1993))
and Mazumder et al. (Mazumder, et al., Proc. Natl. Acad. Sci. USA
91:5771-5775 (1994)). Enzyme reactions were quenched by the
addition of Maxam-Gilbert loading dye, and an aliquot was
electrophoresed on a denaturing 20% polyacrylamide gel. Gels were
then dried and subjected to autoradiography using Kodax XAR-2 film
or exposed in a Molecular Dynamics Phospholmager cassette.
Protease assays
HIV-1 protease enzyme (Bachem) was diluted to 166 ug/mL in 50 mM
NaOAc, 5 mM DTT, 2 mM EDTA, and 10% glycerol (pH 5.0) and stored as
10 ul aliquots at -20.degree. C. HIV protease substrate I
(Molecular Probes) was diluted to a working concentration of 0.32
nmol/.mu.L. Enzyme (20 .mu.L), substrate (20 .mu.L) and drug (20
.mu.L) were added to each well of a microtiter plate. Positive and
negative controls were evaluated in parallel. Fluorescence was
quantitated on a Labsystems Fluoroskan II using 355 nm for
excitation and 460 nm emission wavelengths at 37.degree. C. at time
zero and at 30 minute intervals for 2 hours.
HeLa-CD4-.beta.-galactosidase cell assays
Two different assays using genetically engineered HeLa cells were
performed as described previously. Buckheit, et al., AIDS Research
and Human Retroviruses 10: 1497-1506 (1994). These assays utilized
the HeLa-CD4-LTR-.beta.-galactosidase cell line (Kimpton, et al.,
J. Virol. 66:2232-2239 (1992)), which employ a tat protein-induced
transactivation of the .beta.-galactosidase gene driven by the
HIV-1 long terminal repeat (LTR). One assay involved infecting the
HeLa-CD4LTR-.beta.-galactosidase cells with HIV-1 while the second
assay monitored the expression of .beta.-galactosidase after
incubation of the HeLa-CD4-LTR-.beta.-galactosidase cell with HL2/3
cells. Buckheit, et al., AIDS Research and Human Retroviruses
10:1497-1506 (1994); Ciminale, et al., AIDS Research and Human
Retroviruses 6:1281-1287(1990). The HL2/3 cells express both the
HIV-1 envelope glycoprotein and tat gene product so that
co-cultivation of these cells with the
HeLa-CD4-LTR-.beta.-galactosidase cells would allow for CD4- and
gp120-mediated cell fusion. The extent of cell fusion can then be
monitored by the degree of tat transactivation of LTR-driven
.beta.-galactosidase expression. Buckheit, et al., AIDS Research
and Human Retroviruses 10:1497-1506 (1994); Ciminale, et al., AIDS
Research and Human Retroviruses 6:1281-1287 (1990).
Results of the In Vitro HIV Inhibition Studies
As described above, the anti-HIV-1 activity, in cell culture assays
of the oligonucleotide (I100-15) (SEQ. ID. NO. 33) composed
entirely of G and T was established by the inventors. See also,
Ojwang, et al., J. AIDS 7:560-570(1994); Rando, et al, J. Biol.
Chem. 270:1754-1760 (1995). I100-15 (SEQ. ID. NO. 33) was found to
inhibit HIV-1.sub.DV in SUP T1 cells with a median inhibitory
concentration (IC.sub.50) of 0.125 .mu.M. I100-15 (SEQ. ID. NO. 33)
was synthesized with an unmodified (natural) PD internucloeside
linkage and a propanolamine group attached to the 3'-terminus to
increase the stability of the oligonucleotide. T30177, a modified
variant of I100-15 (SEQ. ID. NO. 33), has the same sequence as
I100-15 (SEQ. ID. NO. 33) but contains an hydroxyl moiety at its
3'-terminus and a single PT internucleoside linkage at both the 5'-
and 3'-ends.
Cytotoxidty Assays
The cytotoxicity of T30177 was determined using several different
cell lines and primary human cells as described above. The
TC.sub.25, TC.sub.50 and TC.sub.95 values obtained are shown in
Table B-1. The cytotoxicity profile obtained for log phase growing
cells was variable depending upon the cell line used, while the
slower growing PBMCs, PBLs, and macrophages all tolerated the
compound at concentrations exceeding 100 .mu.M as monitored using
the trypan blue exclusion, [.sup.3 H]thymidine uptake, or [.sup.3
H]leucine uptake techniques.
TABLE B-1 Cytotoxicity of T30177 in established cell lines and
primary cells. CYTOTOXICITY (.mu.M).sup.a Cell Type TC.sub.25
TC.sub.50 TC.sub.95 Cell Lines.sup.b CEM-SS 50.8 .+-. 3.2 92.0 .+-.
3.0 >100 MT4 34 .+-. 4.0 70 .+-. 7.1 >100 CEMx174 10 .+-. 2.5
50 .+-. 5.2 >100 MT2 27 .+-. 3.5 61.2 .+-. 5.5 >100 AA5 45.66
.+-. 2.0 94.2 .+-. 3.1 >100 U937 >100 >100 >100 Vero
>100 >100 >100 NIH3T3 >100 >100 >100 Primary PBLs
>100 >100 >100 human PBMC >100 >100 >100
cells.sup.c Macrophages >100 >100 >100 .sup.a TC.sub.25,
TC.sub.50, and TC.sub.95 values are the concentrations of T30177
required to inhibit 25%, 50% and 95% of growth (cell lines) or cell
survival (primary human cells). .sup.b The cytotoxicity of T30177
in human cell lines was determined using log phase growing cells.
.sup.c The cytotoxicity of T30177 in primary human cells was
determined using trypan blue exclusion technique or by measuring
the uptake of [.sup.3 H]thymidine or [.sup.3 H]leucine on slow
growing primary cells.
Inhibition of Viral Replication in Cell Lines
CEM-SS cells were infected with HIV-1.sub.RF at an MOI of 0.01 and
treated with T30177 (pPT variant of SEQ. ID. NO. 33, i.e., having
part phosphorothiodiester linkages and part phosphodiester
linkages, AZT or ddC for six days. In this assay system T30177
inhibited HIV-1.sub.RF replication in a dose-dependent manner with
an IC.sub.50 value of 0.075 .mu.M while the control drugs, AZT and
ddC, had IC.sub.50 values of 0.007 and 0.057 .mu.M respectively
(FIG. 16). T30177 was then assayed against additional strains of
HIV-1 in a variety of different cell lines. The results from these
assays showed that the degree of inhibition observed for each
strain of HIV-1 analyzed was greatly influenced by the cell line
used (Table B-2). In addition, as observed for DS5000, T30177 was
inhibitory for the AZT-resistant strain of HIV-1 tested (ADP/141)
which has four mutations in its RT gene (67N, 70R, 215F and
219Q).
TABLE B-2 Inhibitory effects of T30177, AZT, and DS500 on viral
replication. IC.sub.50 (.mu.M).sup.a Virus Cell Line T30177 AZT
DS5000.sup.b HIV-1 strains.sup.c SKI CEM-SS 0.025 .+-. 0.006 0.022
.+-. 0.0001 -- MT2 0.06 .+-. 0.001 0.66 .+-. 0.005 -- RF CEM-SS
0.075 .+-. 0.0002 0.007 .+-. 0.0002 -- MT2 0.270 .+-. 0.04 0.03
.+-. 0.005 -- MT4 0.037 .+-. 0.03 -- 0.018 .+-. 0.02 DV SUP T1 0.06
.+-. 0.004 0.03 .+-. 0.005 -- IIIB CEM-SS 2.83 .+-. 0.17 0.002 .+-.
0.0003 -- MT2 1.94 .+-. 0.12 0.01 .+-. 0.004 -- MT4 0.15 .+-. 0.02
-- 0.034 .+-. 0.016 SUP T1 0.6 .+-. 0.06 0.03 .+-. 0.006 -- AA5
<0.32 <0.003 -- ADP/141 MT4 0.27 .+-. 0.05 -- 0.032 .+-.
0.008 HIV-2/SIV strains HIV-2.sub.ROD MT4 27.5 .+-. 11.6 -- 0.082
.+-. 0.088 HIV-2.sub.EHO MT4 5.98 .+-. 1.05 -- 0.084 .+-. 0.086
SIV.sub.MAC251 MT4 1.5 .+-. 1.2 -- 0.548 .+-. 0.48 .sup.a The IC50
value is the concentration of drug required to inhibit virus
production by 50%. The results presented are the averages of three
or more experiments. .sup.b For DS5000 the .mu.M units are an
approximation based upon the average molecular weight (5000) of the
material used in these studies.
T30177 was also tested for its ability to inhibit laboratory
strains of HIV-2 and SIV. The results (Table B-2) from these assays
indicate that T30177 is more active against the strains of HIV-1
and SIV tested than against the two strains of HIV-2 tested (ROD
and EHO). In addition, T30177 was found to be inactive against a
variety of enveloped and nonenveloped viruses tested (Table B-3)
with IC.sub.50 values found to be grater than the highest
concentration of drug tested (200 .mu.g/mL or 37 .mu.M). This is in
contrast to DS5000 which was found to be a potent inhibitor of all
of the enveloped viruses tested except Vaccinia and Semliki forest
viruses (Table B-3).
TABLE B-3 Inhibition of viral replication in cell lines treated
with T30177 or DS5000. IC.sub.50 (.mu.g/mL).sup.a T30177 DS5000
T30177 DS5000.sup.b Envelope Viruses: HSV-1 (KOS) >200 2 400
>400 HSV-2 (G) >200 2 400 >400 HSV-1 TK (B2006) >200 2
400 >400 HSV-1 TK (VMW1837) >200 2 400 >400 Sindbis virus
>200 10 .gtoreq.200 >400 Semliki forest virus >200 >400
.gtoreq.200 >400 Vesicular Stomatitis virus >200 20 400
>400 Vaccinia virus >200 >400 400 >400 Punta Toro virus
>200 10.9 >200 >400 Yellow Fever virus >200 26 >200
>200 RSV (A2) >200 4 >400 >200 Influenza A (H3N2)
>125 -- >200 >400 Junin virus >50 13 >50 >200
Tacaribe >50 13.5 >50 >200 Non Enveloped Viruses:
Coxsackle virus (B4) >200 >400 .gtoreq.400 >400 Polio
virus-1 >200 >400 .gtoreq.400 >400 .sup.a Concentration of
drug required to reduce virus-induced cytopathogenicity by 50%
(IC.sub.50). The assay results are presented in .mu.g/mL units. For
T30177 5.4 .mu.g/mL is equal to 1 .mu.M and for DS500O 5 .mu.g/mL
is approximately equal to 1 .mu.M. .sup.b The minimum concentration
required to cause microscopically detectable alterations is normal
cell morphology (MCC). The results presented are the averages of
the three or more experiments.
Inhibition of HIV-1 Replication in Peripheral Blood Cells
The primary targets of HIV-1 infection in vivo are CD4.sup.+ T
lymphocytes and macrophages. Therefore in the following set of
experiments the inventors tested the efficacy of T30177 on HIV-1
replication in PBMCs, PBLs and macrophages.
Activated PBMCs were infected with laboratory strains of HIV-1 and
cultured in the presence of T30177, AZT or ddl. Treatment of
infected PBMCs with T30177 inhibited the replication of the all
four HIV-1 isolates tested with IC.sub.50 values ranging from 0.12
to 1.35 .mu.M (Table B-4). In this assay AZT was more efficacious
against all HIV-1 isolates tested, on a molar scale, than T30177
while at the same time T30177 was more potent than ddI against the
two HIV-1 strains tested. It is also interesting to note that
HIV-1.sub.IIIB was more susceptible to T30177 in assays performed
using PBMCs than in assays using T-cell lines (Tables B-2 and
B-4).
TABLE B4 HIV-1 replication in primary human cells treated with
T30177, ddI or AZT Virus Strains IC.sub.50 .mu.M.sup.a (Cells)
HIV-1 Isolate T30177 ddI AZT Laboratory IIIB 0.12 .+-. 0.006 0.74
.+-. 0.05 0.003 .+-. Isolates.sup.b 0.0002 (PBMCs) JR.sub.CSF 0.28
.+-. 0.04 2.0 .+-. 0.5 0.0025 .+-. 0.001 RF 0.75 .+-. 0.13 ND.sup.C
0.272 .+-. 0.003 MN 1.35 .+-. 0.10 ND 0.053 .+-. 0.001 Clinical
WEJO(SI) 0.30 .+-. 0.01 2.18 .+-. 0.026 0.017 .+-. Isolates.sup.b
0.0001 (PBLs) BAKI(SI) 0.23 .+-. 0.005 2.61 .+-. 0.003 0.020 .+-.
0.006 WOME(SI) 0.71 .+-. 0.002 0.41 .+-. 0.008 0.025 .+-. 0.0003
ROJO(SI) 3.9 .+-. 0.02 0.87 .+-. 0.001 0.052 .+-. 0.0004 JOGA(NSI)
0.33 .+-. 0.004 ND >1.0 BLCH(NSI) 3.08 .+-. 0.006 ND 0.022 .+-.
0.0008 VIHU(NSI) 1.3 .+-. 0.02 1.21 .+-. 0.009 0.036 .+-. 0.0007 S.
E. Asia 0.58 .+-. 0.003 ND 0.06 .+-. 0.005 N. Amer. #1 0.25 .+-.
0.003 ND 0.01 .+-. 0.004 N. Amer. #2 2.92 .+-. 0.005 ND 1.65 .+-.
0.007 942716 0.86 .+-. 0.006 ND 0.002 .+-. 0.003 942751 0.38 .+-.
0.003 2.2 .+-. 0.02 0.028 .+-. 0.0025 .sup.a Concentration of drug
required to inhibit viral production by 50% (IC.sub.50) was
determined using the Coulter p24 antigen capture or RT assays.
.sup.b Antiviral assays were performed using laboratory strains of
HIV-1 in peripheral blood mononuclear cells (PBMCs) or using
syncytium inducing (SI) or non-syncytium inducing (NSI) clinical
isolates of HIV-1 in PBLs. .sup.c The value was not determined
(ND).
The therapeutic potential of any anti-HIV drug is dependent upon
its ability to inhibit clinical isolates of the virus obtained from
different geographical locations. Therefore, the inventors
evaluated the ability of T30177 to inhibit the infection of PBLs
using a variety of clinical isolates of HIV-1 which were both
syncytium inducing (SI) and non syncytium inducing (NSI) strains of
HIV-1. In addition, the isolates used in this study had their
origins in different geographic regions. After infection with HIV-1
the PBLs were cultured in the presence of T30177, AZT or ddI for
seven days. T30177 inhibited the viral replication of all the HIV-1
isolates tested with IC.sub.50 values ranging from 0.23 to 3.08
.mu.M (Table B-4). In the same assay, AZT and ddI had IC.sub.50
values ranging from 0.01 to 1.65 .mu.M and 0.41 to 2.61 .mu.M,
respectively. It is important to note that T30177 was active
against both NSI and SI isolates and was very active against he
JOGA isolate which was obtained from a pediatric patient. The JOGA
isolate was also observed to be relatively resistant to AZT
treatment (Table B-4).
Another major target cell of HIV-1 infection is the macrophage.
Fully differentiated macrophages were infected with HIV-1.sub.DV
and treated with T30177 or AZT. T30177 significantly inhibited
HIV-1 replication in macrophages (FIG. 17). However, due to the
long exposure of cells to virus (24 hours), T30177 and AZT worked
best when administered at concentrations above the IC.sub.50 values
obtained for these drugs in assays performed in established cell
lines.
Variations in Viral MOI
To investigate the effect of variations in the MOI on the
anti-HIV-1 activity of T30177, CEM-SS or MT4 cells were infected
with various MOIs of HIV-1.sub.RF or HIV-1.sub.IIIB (Table B-5).
Unlike AZT, T30177 was much less sensitive to changes in the viral
MOI. For example in these assays when the MOI of HIV-1.sub.RF was
changed from 0.01 to 1.28, T30177 only exhibited a 14-fold increase
in its IC.sub.50 value while at the same time the IC.sub.50 value
for AZT increased over 1000-fold (Table B-5).
TABLE B-5 Effect of changes in viral multiplicity of infection
(MOI) on the anti-HIV-1 activity of T30177 and AZT. Multi- plicity
HIV-1.sup.b of IC50/IC90 in Isolate/ Infec- 23 .mu.M.sub.a Cell
tion T30177 AZT RF 0.01 0.20/0.50 .+-. 0.01/0.03 0.01/0.19 .+-.
0.001/0.001 (CEM- 0.02 0.41/1.50 .+-. 0.03/0.04 0.02/0.47 .+-.
0.009/0.046 SS) 0.04 0.60/1.56 .+-. 0.01/0.02 0.07/0.86 .+-.
0.005/0.03 0.08 0.70/1.56 .+-. 0.01/0.08 0.50/1.0 .+-. 0.01/0.005
0.16 0.87/1.6 .+-. 0.01/0.03 0.6/>10.0 .+-. 0.05 0.32 1.25/4.7
.+-. 0.15/0.27 8.5/>10.0 0.64 2.64/4.75 .+-. 0.05/0.16
>10.0/>10.0 1.28 2.81/4.77 .+-. 0.04/0.06 >10.0/>10.0
IIIB 0.02 3.1/6.6 .+-. 0.23/0.8 0.037/0.22 .+-. 0.003 (MT4) 0.01
2.7/9.2 .+-. 0.03/0.25 0.01/0.03 .+-. 0.002 0.3 3.38/7 .+-.
0.15/0.5 0.15/3.3 .+-. 0.01/0.05 1 6.8/26 .+-. 0.53/5.1 0.42/3412
.+-. 0.1/10 .sup.a The concentration of drug needed to limit virus
production by 50 (IC50) and 90 (IC90) percent as measured in the
cpe assay .sup.b The strain of HIV-1 and cell line used for each
assay is indicated.
Effect of T30177 on CD4 and CD8 T-cell Subsets
One of the principal immunological markers correlated with
progression to AIDS is the decline in T lymphocytes which express
the CD4 cell determining marker (CD4). The change in CD4.sup.+
T-lymphocytes is usually monitored by noting changes in the ratio
of CD4.sup.+ to CD8.sup.+ lymphocytes in the blood. To determine
the effect of T30177 treatment on the CD4/CD8 ratio, CD4 and CD8
antigen expression was analyzed on the surface of cultured PBMCs
seven days post-infection with either laboratory strains or
clinical isolates of HIV-1. In these experiments treatment with
either AZT or T30177 increased the number of CD4.sup.+ T-cells in
the cell culture, relative to untreated infected cultures (Table
B-6). The observed increase in CD4.sup.+ cells was dependent on the
drug concentration used and was inversely correlated with the level
of virus production (FIGS. 16 and Tables B-2 and B-4). These
results suggest that the blockage of HIV-1 replication parallels
the suppression of the cytopathic effects of the virus in primary
human lymphocytes.
TABLE B-6 Effect of T30177 or AZT on the ratio of CD4/CD8
lymphocytes in HIV-1 infected PBMCs.sup.a. HIV-1 CD4/CD8 HIV-1
CD4/CD8 Strains Drug Conc. % CD4 % CD8 Ratio Isolates Drug Conc. %
CD4 % CD8 Ratio No Virus No Drug, Day 0 39% 80% 0.49 No Virus No
Drug, Day 0 39% 80% 0.49 No Drug, Day 7 45% 71% 0.63 No Drug, Day 7
45% 71% .063 IIIB No Drug 1% 98% 0.01 SE Asia No Drug 2% 99% 0.02
0.1 .mu.M AZT 31% 79% 0.39 0.1 .mu.M AZT 29% 82% 0.35 1.0 .mu.M AZT
30% 81% 0.37 1.0 .mu.M AZT 31% 82% 0.38 5.0 .mu.M AZT 27% 86% 0.31
5.0 .mu.M AZT 29% 86% 0.34 0.1 .mu.M T30177 1% 98% 0.01 0.1 .mu.M
T30177 2% 99% 0.02 1.0 .mu.M T30177 18% 85% 0.21 1.0 .mu.M T30177
12% 90% 0.13 5.0 .mu.M T30177 27% 83% 0.33 5.0 .mu.M T30177 29% 82%
0.35 10.0 .mu.M T30177 27% 83% 0.33 10.0 .mu.M T30177 29% 82% 0.35
MN No Drug 6% 96% 0.06 N. Amer. #1 No Drug 28% 79% 0.35 0.1 .mu.M
AZT 25% 82% 0.30 0.1 .mu.M AZT 25% 83% 0.30 1.0 .mu.M AZT 35% 79%
0.44 1.0 .mu.M AZT 25% 84% 0.30 5.0 .mu.M AZT 36% 78% 0.46 5.0
.mu.M AZT 26% 85% 0.31 0.1 .mu.M T30177 5% 95% 0.05 0.1 .mu.M
T30177 21% 84% 0.25 1.0 .mu.M T30177 18% 86% 0.21 1.0 .mu.M T30177
26% 80% 0.33 5.0 .mu.M T30177 25% 81% 0.31 5.0 .mu.M T30177 27% 81%
0.33 10.0 .mu.M T30177 26% 80% 0.33 10.0 .mu.M T30177 29% 81% 0.36
RF No Drug 14% 89% 0.16 N. Amer. #2 No Drug 4% 97% 0.04 0.1 .mu.M
AZT 23% 84% 0.27 0.1 .mu.M AZT 6% 95% 0.06 1.0 .mu.M AZT 32% 76%
0.42 1.0 .mu.M AZT 13% 89% 0.15 5.0 .mu.M AZT 34% 81% 0.42 5.0
.mu.M AZT 25% 85% 0.29 0.1 .mu.M T30177 10% 92% 0.11 0.1 .mu.M
T30177 4% 98% 0.04 1.0 .mu.M T30177 26% 82% 0.32 1.0 .mu.M T30177
5% 95% 0.05 5.0 .mu.M T30177 31% 83% 0.37 5.0 .mu.M T30177 28% 82%
0.34 10.0 .mu.M T30177 29% 85% 0.34 10.0 .mu.M T30177 27% 84% 0.32
.sup.a The percentage of CD4 and CD8 antigen bearing T-cells in the
HIV-1 infected PBMC population was determined by flow cytometric
analysis of cells treated with fluorescein labeled a-CD4 or a-CD8
monoclonal antibodies.
In vitro some HIV-1 isolates infect CD4.sup.+ lymphocytes, shed
infectious virus into the culture medium but do not cause
destruction of the infected cells. Garry, R. F., AIDS 3:683-694
(1989). This may explain results obtained when the inventors used
the North American isolate number 1 (N. Amer. #1, Table B-5). When
this virus was used to infect PBMC's, in the absence of drug, a
CD4/CD8 ratio of 0.35 was observed 7 days post-infection. At the
same time analysis of the culture medium from cells infected with
this isolate revealed the presence of viral p24 antigen (Table B-4)
which suggested that a productive viral infection had occurred.
Time of drug addition studies
T30177, DS5000 or AZT was added to MT-4 cells infected with
HIV-1.sub.IIIB (MOI of 1) at various times post-infection. Test
compounds were added at a concentration 100-fold higher than the
determined IC.sub.50 value for each drug in the standard assay
performed using MT-4 cells and the IIIB strain of HIV-1 (Table
B-2). Viral p24 antigen levels were monitored 29 hour
post-infection. The results of this assay indicate that postponing
the addition of T30177 for one hour was enough to dramatically
reduce the inhibitory effects of this compound in a fashion similar
to that of DS5000 and clearly different from AZT which lost its
protective capacity when added to the cell culture medium 3 or 4
hours post-infection (FIG. 18). A similar result was obtained when
comparing T30177 with CSB, a known inhibitor of both virus binding
to cells and fusion related events (Clanton, et al., J. Aids
5:771-781 (1992)), in that the antiviral activity of both T30177
and CSB was greatly reduced if added to infected cell cultures one
hour post-virus infection (data not shown).
HeLa-CD4.beta.-galactosidase cell studies
To differentiate the effects of T30177 on early events in the viral
life cycle, through integration and subsequent production of the
tat gene product, from the inhibition of HIV-1 gp 120-mediated cell
fusion two experimental protocols were employed. The first protocol
monitored the effects of the drug on the ability of HIV-1.sub.RF to
infect and/or replicate within HeLa-CD4-LTR-.beta.-galactosidase
cells and was performed as described in Methods. In this experiment
drug interdiction at any step in the viral life cycle through the
production of the tat gene product would cause a decrease in
expression of the .beta.-galactosidase gene, the transcription of
which is regulated by the HIV-1 LTR. The results show that T30177
is a potent inhibitor of .beta.-galactosidase production in this
assay with an IC.sub.50 value of 0.009 .mu.M, while the IC.sub.50
value obtained for CSB in the same experiment was 0.26 .mu.M (FIG.
19A). In control experiments T30177 had no observable direct effect
on .beta.-galactosidase enzyme activity at concentrations up to 10
.mu.M (data not shown).
The second protocol used was a virus-free assay designed to monitor
CD4- and gp120-mediated cell fusion events. In this assay T30177
was able to interfere with the fusion process (FIG. 19B). However,
the observed IC.sub.50 value (1 .mu.M) was approximately 100-fold
higher than that needed to interfere with .beta.-galactosidase
production in the virus infection assay (FIG. 19A). In the same
assay system the IC.sub.50 value observed for CSB increased
approximately 3-fold to 0.8 .mu.M over the concentration needed to
interrupt .beta.-galactosidase production in the virus infection
assay (FIG. 19).
The three-dimensional structure of an oligonucleotide with the
sequence of T30177 is stabilized by the formation of an
intramolecular G-octet, (Rando, et al, J. Biol. Chem. 270:1754-1760
(1995)). Previously the inventors have reported how the replacement
of one of the Gs involved with tetrad formation with a
deoxyadenosine (A) reduced the anti-HIV-1 activity of the resultant
molecule. Rando, et al, J. Biol Chem. 270:1754-1760 (1995). To
determine the effects of intramolecular tetrad formation in T30177
on the observed inhibition of .beta.-galactosidase production in
the two assays presented in FIG. 19, the inventors tested T30526,
an oligonucleotide in which a dA has been substituted for a dG at a
position that would interrupt the formation of one of the two
tetrads involved in the G-octet. T30526 has the same partial PT
patterns as T30177 (Table B-7). T30526 has the same partial PT
pattern as T30177 (Table B-7). T30526 was found to be approximately
100-fold less potent that T30177 in inhibiting HIV-1.sub.RF
production in culture assays (Table B-7), 10-15-fold less potent at
inhibiting virus-infected cell .beta.-galactosidase production
(FIG. 19A) and did not inhibit cell fusion at the highest
concentration of drug tested (20 .mu.M, FIG. 19B).
TABLE B-7 Inhibition of various HIV-1 strains in culture assays and
the HIV-1 integrase enzyme in vitro. Antiviral Assay.sup.a
Anti-Integrase Assay.sup.b IC.sub.50 (.mu.M) IC.sub.50.mu.M)
Compound nucleotide sequence backbone.sup.c RF SKI IIIB 3'-proc
strand tran. G-0ctet anti-HIV-1: T30175 5'-GTGGTGGGTGGGTGGGT-3' PD
6.58 -- -- 0.170 0.125 T30177 5'-GTGGTGGGTGGGTGGGT-3' pPT 0.075
0.025 2.83 0.092 0.046 T30038 5'-GTGGTGGGTGGGTGGGT-3' PT 0.030 --
-- 0.090 0.070 T30526 5'-GTGATGGGTGGGTGGGT-3' pPT 11.7 -- -- 0.200
0.123 G-0ctet thrombin binding: T30340 5'-GGTTGGTGTGGTTGG-3' PD
> -- -- >0.50 >0.5 T30659 5'-GGTTGGTGTGGTTGG-3' pPT 100.0
2.81. >20.0 >0.50 >0.5 T30341 5'-GGTTGGTGTGGTTGG-3' PT
>20.0 -- -- 0.042 0.023 4.76 Antisense, Anti-HIV-1: T30658
5'-TCTTCCTCTCTCTACCCACGCTCIC-3' PD >20.0 >20.0 >20.0
>0.5 >0.5 T30662 pPT >20.0 >20.0 >20.0 >0.5
>0.5 T30531 5'-TCTTCCTCTCTCTACCCACGCTCIC-3' PT 0.17 -- -- 0.030
0.036 5'-TCTTCCTCTCTCTACCCACGCTCIC-3' Control Compounds: 0.007
0.022 0.002 >1.0 >1.0 AZT 0.016 -- 0.031 0.07 0.06
DS500.sup.d 0.057 0.26 0.078 >1.0 >1.0 ddC 0.02 0.09 0.09 --
-- UC38 1.7 1.6 0.6 -- -- CSB .sup.a Antiviral assay results were
obtained from infection of CEM-SS or MT4 cells with the indicated
virus strain. The results are the averages of three or more
experiments. .sup.b Anti-integrase results were obtained from
experiments designed to monitor the 3'-processing or
strand-transfer activities of the enzyme, the results presented are
the averages of three or more experiments. .sup.c Oligonucleotides
were synthesized with either total phosphodiester (PD) backbone,
total phosphorothioate (PT) backbone, or partial phosphorothioate
(pPT) backbone, in which the 5'-and 3'-penultimate internucleoside
linkages were phosphorothioate. .sup.d For DS5000 the .mu.M units
are an approximation based upon the average molecular weight (5000)
of the material used in these studies.
Long term suppression of HIV-1
In separate experiments, HIV-1.sub.IIIB infected MT-4 cells were
treated with T30177, AZT, DS5000, or the bicyclam compounds JM2763
or JM3100 for four days using drug concentrations equivalent to 1,
10 or 100-fold over their respective IC.sub.50 values (Table B-7).
The IC.sub.50 values used for JM2763 and JM3100 were from
previously reported results, (De Clereq, et al., Antimicrob. Agents
Chemother. 38:668-674 (1994)). After four days in culture the cells
were washed and then further cultured in complete medium without
drug. The cells were monitored daily for the appearance of
viral-induced syncytium formation and every second or third day for
viral p24 antigen in the culture medium. In cells treated with
T30177, at 100-fold over the IC.sub.50 value (approximately 10
.mu.M), suppression of virus P24 production was observed for at 1st
27 days after removal of drug from the infected cell culture (FIG.
20). Furthermore, there was no detectable viral cDNA (by PCR
analysis) in cells examined up to 11 days after the removal of
T30177 from the infected cell culture (data not shown). Cells
treated in the same fashion with AZT, DS5000, JM2763, or JM31000
had measurable levels of viral p24 antigen in the culture medium
within 3 days after removal of the drug (FIG. 20). The degree of
continued suppression was contingent upon the concentration of
T30177 used in the assay and the duration of the drug treatment
regimen (data not shown). The concentration and duration of
treatment regimen data are consistent with those previously
reported for 1100-15, (Rando, et al, J. Biol. Chem. 270:1754-1760
(1995)).
To determine if exposure of cells to T30177 protects them for
subsequent infection with HIV-1, cultures of HIV-1 infected MT-4
cells treated for 4 days with T30177 (100-fold over the IC.sub.50
value) were washed and then reinfected with HIV-1.sub.IIIB before
resuspension in fresh culture medium without drug. In these assays
there was no protection of cells from the second round of viral
infection (data not shown).
Single cycle analysis of viral cDNA
Total DNA from HIV-1.sub.SKI infected CEM-SS cells was isolated 12
hour post-infection and analyzed for the presence of viral cDNA as
described in Methods. In this experiment viral cDNA was detected in
cells treated with 1 or 10 .mu.M T30177 (approximately 10- to
100-fold over the IC.sub.50 value) even when the drug was added to
the cell culture at the time of virus infection (FIG. 21). This is
in contrast to the results obtained when the adsorption blocking
drug CSB (10 .mu.M), the nucleoside RT inhibitor ddC (10 .mu.M), or
the nonnucleoside RT inhibitor UC38 (1 .mu.M) were used as control
drugs. UC38 is an analog of oxathiincarboxanilide. Bader, et al.,
Proc. Natl. Acad. Sci. U.S.A. 88:6740-6744 (1991); McMahon, et al.,
Proc. Natl. Acad. Sci. USA (1995). As expected there was no
detectable viral DNA in cells treated during, or very soon after,
virus infection with any of the three control drugs when used at
concentrations 10- to 100-fold over their reported IC.sub.50 values
(Table B-7, FIG. 21).
Analysis of replicated viral DNA
The inventors have previously reported on the presence of viral
cDNA in T30177 treated SUP T1 cells 36 hour post infection with a
lower MOI (multiplicity of infection of virus) of HIV-1.sub.DV.
Rando, et al, J. Biol. Chem. 270:1754-1760 (1995). As described
above, viral cDNA was also detected in T30177 treated cells 12 hour
post-infection with a high MOI of virus (FIG. 21). To determine the
extent of viral replication within these cells PCR primers were
used which would differentiate between the different stages of
viral replication through the production of circular proviral DNA
(2-LTR circles). The results of these experiments indicate that
viral replication has occurred in the T30177 treated cells up to an
including the production of 2-LTR circles (FIGS. 22A-D).
Inhibition of viral enzymes
Oligonucleotides with PT backbones have been reported to be much
more potent inhibitors of HIV-1 reverse transcriptase (RT) than the
same molecules with PD backbones. Ojwang, et al., J. AIDS 7:560-570
(1994). T30177 was able to inhibit HIV-1 RT however, the
concentration needed to inhibit the enzyme by 50% was above 5 .mu.M
when gapped duplex DNA or RNA:DNA templates were used (Table B-8).
It is interesting to note that when the primed ribosomal RNA
template was used the IC.sub.50 value for T30177 was in the 1 .mu.M
range (Table B-8).
TABLE B-8 Inhibition of recombinant HIV-1 Reverse Transcriptase.
IC.sub.50 (.mu.M) Template T30177 AZT 5'-triphosphate poly(rA)
.multidot. p(dT) 12-18 11.0 0.59 4.2 0.6 gapped duplex DNA 8.0 0.47
10.0 0.40 ribosomal RNA 1.2 0.019 0.36 0.008 .sup.a The
concentration required to inhibit enzyme activity by 50%
(IC.sub.50) is given for duplicate experiments in .mu.M units.
T30177 was also tested for its ability to inhibit HIV-1 protease
and integrase enzymes. When concentrations of T30177 up to 10 .mu.M
were used in protease inhibition assays no effect on the viral
enzyme was observed (data not shown). However, when assayed for its
effect on HIV-1 integrase, T30177 was able to reduce both the
3'-processing and strand transfer activities of the integrase
enzyme with IC.sub.50 values of 0.092 and 0.046 .mu.M, respectively
(Table B-7).
To determine if the sequence, three dimensional structure, chemical
composition of the backbone or a combination of these parameters
contributed to the observed anti-integrase activity of T30177, the
inventors synthesized and tested for enzyme inhibitory activity the
oligonucleotides shown in Table B-7. T30038, T30175, and T30526 are
variations of T30177. T30340, T30341 and T30659 are variations of
the thrombin-binding aptamer sequence reported by Bock et al. Bock,
et al., Nature 355:564-566 (1992). Both the dG-rich sequence of the
anti-HIV-1 oligonucleotide T30177 and the thrombin binding aptamer
have been shown to fold upon themselves to form structures
stabilized by intramolecular G-octets. Rando, et al, J. Biol. Chem.
270:1754-1760 (1995).; Schultze, et al., J. Mol. Biol.
235:1532-1547 (1994); Wang, et al., Biochem. 32:1899-1904 (1993).
Oligonucleotides T30531, T30658 and T30662 are variations of the
antisense compound GEM91 reported to be a potent inhibitor of
HIV-1. Agrawal et al., Antisense Research and Development 2:261-266
(1992).
The IC.sub.50 values for each of these oligonucleotides tested in
the integrase assay are shown in Table B-7. The results of this
experiment indicate that any of the sequence motifs tested were
potent inhibitors of the HIV-1 integrase enzyme when the
oligonucleotides were synthesized with a PT backbone. When the
number of PT linkages in the backbone was reduced to one linkage at
each end of the molecule (pPT) the thrombin binding aptamer
(T30559) and the antisense sequence (T30662) no longer displayed
anti-integrase activity while the level of inhibition observed
using T30177 was relatively the same as that observed using the
total PT version of this molecule (T30038). For compounds with
total PD backbones only the total PD version of T30177 sequence
motif was able to inhibit viral integrase with IC.sub.50 values of
170 and 125 nM for the 3' processing and strand transfer enzyme
activities, respectively. T30526, the tetrad-disrupted mutant
version of T30177, was still able to inhibit viral integrase
protein in this assay, albeit at a concentration 2- to 3-fold
higher than that observed using T30177.
Conclusions of the In Vitro HIV Inhibition Studies
The inventors expanded upon the earlier observations of their
initial studies (see also, Ojwang, et al., J. AIDS 7:560-570
(1994); Rando, et al, J. Biol. Chem. 270:1754-1760 (1995)) on the
anti-HIV-1 activity of dG-rich oligonucleotides by demonstrating
the efficacy of T30177 against multiple laboratory strains and
clinical isolates of HIV-1. Using the cytotoxicity (Table B-1) and
the efficacy data (Tables B-2 and B-4), it was found T30177 to have
a wide range of therapeutic indices TIs) depending upon the viral
strain and cell line used in a given assay. For example, when
T30177 was used to inhibit HIV-1.sub.SKI in CEM-SS cells a TI of
3680 was obtained. However, when measuring the effect on
HIV-1.sub.RF in MT2 cells, the TI for T30177 was only 226.
The variability in efficacy of T30177 in PBMCs and PBLs, which
depended upon the clinical isolate tested, was very similar to the
variation in activity observed for the nucleoside analogs AZT and
ddI. It is interesting to note that an approximately 20 fold
variation in the IC.sub.50 value was observed for T30177 when used
to inhibit HIV-1.sub.IIIB in CEM-SS cells (2.8 .mu.M) versus PBMSc
(0.12 .mu.M) (Tables B-2 and B-3). An explanation for this
observation may be that when viruses are propagated continuously in
homogeneous cell lines the "adapt" to those cells and begin to
display phenotypes different from low passage clinical isolates.
Therefore, results obtained using clinical isolates to infect
heterogeneous populations of primary cells (PBMCs or PBLs) may be
more predictive of in vivo efficacy than data generated using
laboratory strains of HIV-1 in established cell lines. It is
unlikely that HIV-1.sub.IIIB is a resistant strain of HIV-1 since
T30177 was more effective against this virus in PBMCs than in cell
lines. However, given the well documented ability of HIV-1 to
mutate and thus develop resistance to known therapies, efforts are
underway to determine if resistant mutants can arise after
treatment of HIV-1 infected cells with T30177.
In mechanism of action studies it was found that T30177 displayed
some antiviral activity which indicated a mechanism of action
similar to the known blockers of virus adsorption or virus mediated
cell fusion such as dextran sulfate and CSB (FIGS. 18 and 19). Like
CSB and DS5000, T30177 needed to be added to cells at the time of
or soon after virus infection. However, T30177 is 100-fold less
effective in inhibiting gp 120-induced cell fusion events than it
is at inhibiting early events in the viral life cycle, suggesting a
specific point of interdiction with virus distinct at least from
that of CSB. In addition, the antiviral profile of T30177 also
displayed other characteristics which distinguished T30177 from
DS5000 and CSB. For example, while DS5000 is active against a wide
range of enveloped viruses, T30177 appears to be a more selective
inhibitor of retroviruses with maximum efficacy displayed when used
to inhibit strains of HIV-1 (Tables B-2 and B-3).
Experimental results presented in FIG. 21 show that unlike control
drugs CSB, AZT, and UC38, when T30177 was added to cell cultures
during virus infection it was unable to completely block viral
infection even when used at concentrations 100-fold over the
IC.sub.50 value (.about.10 .mu.M). Furthermore, analysis of viral
DNA demonstrated that viral replicative intermediates including
circular proviral DNA were present in infected cells treated with
T30177 (FIGS. 21 and 22). This data, coupled with the ability of
T30177 to completely suppress virus outbreak (FIG. 20), and
possibly clear virus from infected cell cultures, after removal of
drug from infected cells (a profile not observed for AZT, DS5000,
JM2763 or JM3100), suggests that a second mechanism of action,
distinct from inhibition of virus binding or inhibition of cell
fusion events, is at work. One possible alternative mechanism is
that T30177 interferes with the viral integration process. A
combination of activities including inhibition of virus attachment
or internalization, virus-mediated cell fusion events and viral
integration could explain the loss of virus from infected cell
cultures. This typothesis is supported by the observation that
T30177 is a potent inhibitor of HIV-1 integrase function in vitro
(Table B-7) and by the observed accumulation of circularized
proviral DNA in the low-molecular weight Hirt DNA fractions (FIG.
22).
It is clear that highly charged molecules such as DS5000 and
oligonucleotides with total PT backbones are excellent inhibitors
of the integrase enzyme in vitro. However, since T30177, of all the
pPT molecules tested maintained its level of enzyme inhibitory
activity (Table B-7), it is unlikely that the mechanism of
inhibition is totally based upon a polyanion effect as seen for
compounds such as DS5000 and suramin. Carteau, et al., Arch.
Biochem. Biophys. 305:606-610 (1993). It is unclear at this time
whether the G-octet structure, with the two base long dG loops,
found in T30177 is of paramount importance for inhibition of viral
integrase since the G-octet sequence found in T30659 did not
inhibit integrase activity while T30526 (tetrad disrupting mutant)
was able to inhibit enzyme activity albeit at a reduced level.
While the time of drug addition studies would suggest interference
with virus internalization as a key mechanism of action for T30177
it is also clear that readily detectable viral nucleic acids do
enter the cells. It is quite possible that T30177 inhibits HIV-1
via several different mechanisms of action. Another possibility is
that T30177 is carried into the cell along with the infecting virus
or is slow to accumulate within cells (Bishop et al. 1996 J. Biol.
Chem. 271:56988-5703) hence the need to add drug during virus
infection. Experiments designed to address these possibilities are
underway.
The recently reported emergence rate of drug-resistant virus to
current approved therapies for HIV-1 (T.sub.1/4 of approximately 2
days) suggests that single drug therapy for this virus cannot
succeed (Ho, et al., Nature 373:123-126 (1995); Wei, et al., Nature
373:117-122 (1995), and therefore, a likely treatment regimen for
any new drug candidate would be in combination with one or more
other drugs which have differing antiviral mechanisms of action.
Further experimentation might determine that the actual mechanism
of action for T30177 may not be via either inhibition of virus
binding/internalization or inhibition of viral integration,
however, it is unlikely that this oligonucleotide is acting via the
same mechanism as drugs currently in use for HIV-1. In additional
studies the Applicants have determined that T30177 is stable in
serum and within cells, with a half-life measured in days (Bishop,
et al. J. Biol. Chem. 1996 271:5698-5703). This information taken
together with the ability of T30177 to suppress HIV-1 for over four
weeks after an initial treatment regimen, in culture, makes this
class of compounds an attractive candidate for development of
oligonucleotide-based therapeutic agents for HIV-1.
C. Site of Activity Studies-Viral Integrase Inhibition
Next the inventors undertook studies to demonstrate the potent
inhibition of HIV-1 integrase by oligonucleotides containing
intramolecular guanosine quartets or octets abbreviated (G4s) and
to provide better understanding of the structure-activity results
from a series of these structures and the site of molecular
interactions with HIV-1 integrase. The relevance of these findings
with respect to HIV-1 integrase binding to its DNA substrate and to
dimerization of the retroviral genome was also reviewed.
Materials Used in Site of Activity Studies
Preparation of oligonucleotide substrates and inhibitors
The following HPLC purified oligonucleotides were purchased from
Midland Certified Reagent Company (Midland, Tex.): AE117,
5'-ACTGCTAGAGATTTTCCACAC-3'; AE118, 5'-GTGTGGAAAATCTCTAGCAGT-3';
AE157, 5'-GAAAGCGACCGCGCC-3'; AE146,
5'-GGACGCCATAGCCCCGGCGCGGTCGCTTTC-3'; AE156,
5'-GTGTGGAAAATCTCTAGCAGGGGCTATGGCGTCC-3'; AE118S,
5'-GTGTGGAAAATCTCTAGCA-3'; RM22M, 5'-TACTGCTAGAGATTTTCCACAC-3'. The
AE117, AE118, and the first 19 nucleotides of AE156, correspond to
the U5 end of the HIV-1 long terminal repeat (LTR).
To analyze the extents of 3'-processing and strand transfer using
5'-end labeled substrates, AE118 was 5'-end labeled using T.sub.4
polynucleotide kinase (Gibco BRL) and y-[.sup.32P ]-ATP
(Dupont-NEN). The kinase was heat-inactivated and AE117 was added
to the same final concentration. The mixture was heated at
95.degree. C., allowed to cool slowly to room temperature, and run
on a G-25 Sephadex quick spin column (Boehringer Mannheim) to
separate annealed double-stranded oligonucleotide from
unincorporated label.
To analyze the extent of strand transfer using the "precleaved"
substrate, AEI118S was 5'-end labeled, annealed to AE117, and
column purified as above.
To analyze the choice of nucleophile for the 3'-processing
reaction, AE118 was 3'-end labeled using .alpha.-[.sup.32P
]-crdycepin triphosphate (Dupont-NEN) and terminal transferase
(Boehringer Manheim). Engleman, et al, Cell 67, 1211-1221 (1991);
Vink, et al., Nucleic Acids Res. 19, 6691-6698 (1991). The
transferase was heat-inactivated and RM22M was added to the same
final concentration. The mixture was heated at 95.degree. C.,
allowed to cool slowly to room temperature, and run on a G-25 spin
column as before.
To determine the extent of 30 mer target strand generation during
disintegration, Chow, et al., Science 255, 723-726 (1992), AE157
was 5'-end labeled, annealed to AE156, AE146, and AE117, annealed,
and column purified as above.
Oligonucleotides composed of deoxyguanosine and thymidine were
synthesized, purified, and incubated with potassium ion to generate
the G4s. The guanosine quartet (G4) forming structures were then
purified as previously described. Rando, et al., J. Biol. Chem.
270, 1754-1760 (1995).
Integrase proteins and assays
Purified recombinant wild-type HIV-1 integrase, deletion mutants
IN.sup.1-212, IN.sup.50-288, IN.sup.50-212, Bushman, et al., Proc.
Natl. Acad. Sci. U.S.A. 90, 3428-3432 (1993), and IN.sup.1-55 and
site-directed mutants INF.sup.F185K/C280S and
IN.sup.F185K/C280S/H12N/H16N were generous gift T. Jenkins and R.
Craigie, Laboratory of Molecular Biology, NIDDK, NIH, Bethesda, Md.
Dr. Craigie also provided the expression system for the wild-type
HIV-1 integrase. A plasmid encoding the HIV-2 integrase was
generously provided by Dr. R. H. A. Plasterk (Netherlands Cancer
Institutes). Purified recombinant wild-type FIV and SIV integrases
were generous gifts of Drs. S. Chow (UCLA) and R. Craigie (NIDDK),
respectively.
Integrase was preincubated at a final concentration of 200 (for
HIV-1 and HIV-2) or 600 nM (for FIV and SIV) with inhibitor in
reaction buffer (50 mM Nacl, 1 mM HEPES, pH 7.5, 50 .mu.M
dithiothreitol, 10% glycerol (wt/vol), 7.5 mM MnCl.sub.2 or
MgCL.sub.2 (when specified), 0.1 mg/mL bovine serum albumin, 20 mM
2-mercaptoethanol, 10% dimethyl sulfoxide, and 25 mM MOPS, pH 7.2)
at 30.degree. C. for 30 minutes. When magnesium was used as the
divalent metal ion, polyethylene glycol was added at a final
concentration of 5% to increase activity as previously described
(Engelman & Craigie, 1995). Preincubation for 30 minutes of the
enzyme with inhibitor was performed to optimize increases the
inhibitory activity in the 3'-processing reaction (Fesen et al.,
1994). Then, 30 nM of the 5'-end .sup.32 P-labeled linear
oligonucleotide substrate was added, and incubation was continued
for an additional 1 hr. The final reaction volume was 16 .mu.L.
Disintegration reactions, Chow, et al., Science 255, 723-726
(1992), were performed as above with a Y oligonucleotide (i.e., the
branched substrate in which the U5 end was "integratred" into
target DNA) was used.
Electrophoresis and quantitation
Reactions were quenched by the addition of an equal volume (18
.mu.L) of loading dye (98% deionized formamide, 10 mM EDTA, 0.025%
xylene cyanol, 0.025% brornophenol blue). An aliquot (5 .mu.L) was
electrophoresed on a denaturing 20% polyacrylamide gel (0.09 M
Tris-borate pH 8.3, 2 mM EDTA, 20% acrylamide, 8M urea). Gels were
dried, exposed in a Molecular Dynamics Phosphorimager cassette, and
analyzed using a Molecular Dynamics phosphorimager (Sunnyvale,
Calif.). Percent inhibition was calculated using the following
equation:
where C, N, and D are the fractions of 21 mer substrate converted
to l9 mer (3'-processing product) or strand transfer products for
DNA alone, DNA plus integrase, and integrase plus drug,
respectively. IC.sub.50 was determined by plotting the drug
concentration versus percent inhibition and determining the
concentration which produced 50% inhibition.
UV crosslinking experiments
The method used has been described by Engleman et al. Engelman, et
al., J. Virol. 68, 5911-5917 (1994). Briefly, integrase (at the
indicated concentration) was incubated with substrate in reaction
buffer as above for 5 minutes at 30.degree. C. Reactions were then
irradiated with a UV transilluminator (254 mm wavelength) from 3 cm
above (2.4 mW/cm.sub.2) at room temperature for 10 minutes. An
equal volume (16 .mu.L) of 2.times.SDS-PAGE buffer (100 mM Tris, pH
6.8, 4% 2-mercaptoethanol, 4% SDS, 0.2% bromophenol blue, 20%
glycerol) was added to each reaction. Twenty .mu.L aliquots were
heated at 95.degree. C. for 3 minutes prior to loading on a 12% or
18% SDS-polyacrylamnide gel. The gel was run at 120 V for 1.5
hours, dried, and exposed in a Phosphorimager cassette. For
inhibition of DNA binding experiments (FIG. 21), integrase (200 nM)
was preincubated with the guanosine quartet (at the indicated
concentration) for 30 minutes at 30.degree. C. prior to the
subsequent addition of the radiolabeled viral DNA substrate (20
nM). For the competition experiments (FIG. 29), integrase (200 nM)
was preincubated with either the radiolabeled viral DNA substrate
(20 nM) or T30177 (20 nM) for 5 minutes at 30.degree. C. prior to
the addition of competitor DNA at the indicated concentration.
Results of the Site of Activity Studies
Guanosine quartet oligonucleotides inhibit HIV-1 integrase
The inhibition of HIV-1 integrase by a series of oligonucleotides
which can form G4s is shown in FIG. 23. Oligonucleotides T30177 and
T30659 (a variant of the thrombin binding optimer shown in Table
C-1)(Ojwang, et al., Antimicrob. Agents Chemother. 39, 2426-2435
(1995)) fold upon themselves into structures stabilized by two G4s
stacked upon each other to form a guanosine octet (Rando, et al.,
J. Biol. Chem. 270, 1754-1760 (1995); Schultze, et al., J. Mol.
Biol. 235, 1532-1547 (1994)). Interestingly, T30177 (SEQ ID NO.87)
is active against HIV-1 in cell culture and against purified HIV-1
integrase in vitro (Ojwang, et al., Antimicrob. Agents Chemother.
39, 2426-2435 (1995)) while T30659 (SEQ ID NO.53) is not. For
example, inhibition of both the 3'-processing and strand transfer
activities of HIV-1 integrase (FIGS. 23A) by T30177 was observed in
the nanomolar range (see FIG. 23B).
In order to ascertain why T30177 was effective and T30659 was not,
the inventors made a series of compounds to incrementally change
one compound into the other. The structures of these compounds are
shown in panels C and D of FIG. 23. The differences between T30177
and T30659 (i.e., the presence of additional bases at both ends,
different sequences in all three loops, and extension of loop 2)
manifest themselves in dramatic increases in the IC50 values (FIG.
23D). To distinguish the contributions of each of these changes,
the inventors first added the same 5'- and 3'-nucleotides to T30659
as are present on T30177, yielding T30674 (a variant of SEQ. ID.
NO. 33 shown in Table C-1) (FIG. 23C). These changes did not confer
potency (FIG. 23D). Then it was undertaken to change either loop 1
to obtain T30675 (FIG. 23C) or the three bases in loop 2 into those
found in T30177, yielding compound T30677 (FIG. 23C). Neither
change by itself conferred potency (FIG. 23D). However, when the
change was accomplished in two of the loops to resemble T30177,
yielding T30676 or T30678 (variants of SEQ. ID. NO. 33 shown in
Table C-1) (FIG. 23C), the inventors were able to significantly
improve the activity over that of T30659. Interestingly, a two- to
three-fold decrease in potency was also observed when a second
quartet was unable to form, yielding T30526 (FIG. 23D). These data
suggest not only that the octet structure is critical but also that
the loops are important for interaction with HIV-1 integrase.
The activities of the oligonucleotides in the cellular assays did
not strictly correlate with the in vitro anti-integrase activity
(FIG. 23D). The correlation is complicated by the differential
stabilities and susceptibilities to nuclease digestion of the
oligonucleotides in vivo (Joshua O. Ojwang and Robert F. Rando,
unpublished).
In FIG. 23, G4 oligonucleotides were initially tested in a dual
assay which measures both 3'-processing and strand transfer.
Craigie, et al., Cell 62, 829-837 (1990); Katz, et al., Cell 63,
87-95 (1990). A strand transfer assay using "preprocessed"
(3'-recessed) substrate (19 mer in FIG. 24A, left panel) was also
performed to determine whether the strand transfer reaction was
truly being inhibited or whether the inhibition of the
3'-processing reaction caused the decrease in the subsequent strand
transfer products. Inhibition of strand transfer using this
substrate was observed in the same concentration range (FIG. 24A,
right panel) as that seen with the blunt-ended, duplex
oligonucleotide substrate (FIG. 23A, top). Therefore, G4
oligonucleotides inhibit both steps of the integrase reactions:
3'-processing and strand transfer.
Inhibition of 3'-processing was confirmed using DNA substrates
labeled at the 3'-end, (Engleman, et al, Cell 67, 1211-1221 (1991);
Vink, et al., Nucleic Acids Res. 19, 6691-6698 (1991)) (FIG. 24B,
left panel), showed that all of the G4s tested inhibited
glycerolysis, hydrolysis, and circular nucleotide formation to the
same extent (FIG. 24B, right panel). Thus, G4 oligonucleotides
exert a global inhibition of the three nucleophiles in the
3'-processing reaction (glycerol, water, or the hydroxyl group of
the viral DNA terminus).
Having demonstrated that the catalytic activities of integrase
could be inhibited by G4 oligonucleotides, the inventors next
examined whether DNA binding was also affected, They performed UV
crosslinking of integrase-DNA reactions to address this question.
Crosslinking of substrate DNA to integrase followed by
electrophoresis results in a product having a molecular weight of
approximately 39 kDa (Engleman et al., 1994, Yoshinaga et al.,
1994). As seen in FIGS. C-3A and C-3B, binding of HIV-1 integrase
to radiolabeled U5 DNA substrate was inhibited by preincubation of
the enzyme with T30177 in the same concentration range as its
IC.sub.50 value for strand transfer (lanes 3-7). In contrast,
preincubation of the enzyme with T30659, which was poorly active in
the 3'-processing/strand transfer assay (FIG. 23D), resulted in
only modest inhibition of DNA binding even at a T30659
concentration of 500 nM (FIG. 25A, lanes 9-13).
Importance of the HIV-1 integrase zinc finger region for guanosine
quartet oligonucleotide interactions
Integrase can catalyze in vitro an apparent reversal of the DNA
strand transfer reaction called disintegration. Chow, et al.,
Science 255, 723-726 (1992). In contrast to the 3'-processing and
strand transfer reactions, disintegration requires neither the
N-terminal zinc-finger region nor the C-terminal DNS-binding domain
of integrase. Bushman, et al., Proc. Natl. Acad. Sci. U.S.A. 90,
3428-3432 (1993). For this reason, the HIV-1 integrase catalytic
core domain, In.sup.50-212 (FIG. 26A), can be use din the
intramolecular disintegration assay and for testing the site of
action of inhibitors. Mazumder, et al., Proc. Natl. Acad. Sci. 91,
5771-5775 (1994); Mazumder, et al., AIDS Res. Hum. Retrov. 11,
115-125 (1995).
In the disintegration assay, only the In.sup.1-288 and IN.sup.1-212
proteins (FIG. 26B) were inhibited by T30177 (with IC.sub.50 s of
270 and 600 nM, respectively) while neither IN.sup.50-212 (FIG.
26B) nor IN.sup.50-288 (data not shown) showed more than 30%
inhibition at a 3 .mu.M concentration of T30177. The concentration
of T30177 required for inhibition of disintegration was higher than
that required for inhibition of either 3'-processing or strand
transfer. These results are consistent with those observed with
other molecules (Fesen et al., 1994, Mazumder et al, 1994). This
observation suggests that the active site of HIV-1 integrase may
tolerate drug-induced protein or DNA distortion during the
disintegration reaction, consistent with the relative tolerance of
integrase to mutagenesis of either substrate features (Chow &
Brown, 1994) or protein structural domains (Bushman et al., 1993)
in this reaction. This is the first example of an HIV-1 integrase
inhibitor requiring the enzyme zinc-finger region for inhibitory
activity. These results suggest that the zinc-finger may assist in
stabilizing binding to T30177.
This hypothesis was investigated further by monitoring binding of
wild-type, full length integrase (IN.sup.1-288) and of the deletion
mutants to radiolabeled T30177. The concentration of T30177
required for DNA-protein complex formation was the same as that
required for complex formation using the viral U5 DNA substrate
(i.e., in the 20 nM range). UV crosslinking assays, Engelman, et
al., J. Virol. 68, 5911-5917 (1994), showed that INI.sup.1-288
formed a DNA-protein complex of the expected molecular weight in
the absence or presence of added manganese (FIG. 26C, lanes 8 and
9). The IN.sup.1-212 protein, which has previously been shown to
bind to linear viral DNA only at high concentrations (approximately
2.56 .mu.M) and only in the presence of divalent metal ion,
(Engelman, et al., J. Virol. 68, 5911-5917 (1994)), was able to
crosslink to T30177 with the same efficiency as wild-type integrase
in the absence or presence of added manganese (lanes 2 and 3). The
IN.sup.50-288 protein, which contains a nonspecific DNA-binding
domain, was also able to crosslink to T30177 with the same
efficiency as wild-type integrase in the absence or presence of
added manganese (lanes 4 and 5), consistent with its ability to
bind to viral U5 DNA (Engelman et al., 1994). The extent of
crosslinking was significantly diminished in the case of the core
mutant IN.sup.50-212 compared to IN.sup.1-212 in the absence or
presence of manganese (compare lanes 2 and 3 with 6 and 7, faster
migrating complex). The higher molecular weight species in lane 6,
having the expected molecular weight of a dimer, has been
reproducibly observed, but its density has not been confirmed.
These data support the notion that the N-terminus of HIV-1
integrase assist in the formation or stabilization of an HIV-1
integrase-T30177 complex, perhaps by binding the
oligonucleotide.
DNA-binding activities of the HIV-1 integrase zinc finger
domain
To further analyze the binding of the N-terminal zinc finger region
to T30177 and compare these results to the viral U5 substrate, UV
crosslinking was performed with an In.sup.1-55 deletion mutant
(FIG. 26A) containing only this domain. As seen in FIG. 27A-B, this
mutant could not bind either the T30177 oligonucleotide or the
viral DNA substrate when only manganese or magnesium was present
left and right panels, lanes 3 and 4). However, the IN.sup.1-55
protein could bind to both DNAs in the presence of zinc and either
manganese or magnesium (left and right panels, lanes 5 and 6).
Significantly, the In.sup.1-55 protein was able to bind to the
T30177 G4 oligonucleotide, but not the viral DNA substrate, in the
presence of zinc alone (left and right panels, lanes 9 and 10).
These results are in accord with the known zinc-binding ability of
this domain. Bushman, et al., Proc. Natl. Acad. Sci. U.S.A. 90,
3428-3432 (1993); Burke, et al., J. Biol. Chem. 267, 9639-9644
(1992). But they also suggest that the N-terminal domain of
integrase has DNA binding capabilities on its own. Finally, these
experiments demonstrate comparable binding of the HIV-1 integrase
zinc finger domain to an oligonucleotide containing in G4s than to
a double-stranded, linear, viral DNA oligonucleotide when both
manganese (or magnesium) and zinc are present but more efficient
binding to the G4 oligonucleotide under non physiological
conditions (zinc alone). The inventors also found that the
nucleocapsid protein of HIV-1, a nucleic acid annealing protein
which contains two CCHC zinc fingers and which is essential for
dimerization of the retroviral RNA genome, Tsuchihashi, et al., J.
Virol. 68, 5863-5870 (1994), was able to bind efficiently to T30177
(data not shown). The ability of zinc to confer DNA binding ability
on the IN.sup.1-55 protein was examined by replacement of this ion
with other transition metals. Consistent with spectroscopic data
(Burke et al., 1992), only zinc was able to induce detectable DNA
binding to the G4 oligonucleotide (data not shown).
Increased potency of guanosine quartets in magnesium
In contrast to IN.sup.1-55, the extent of crosslinking (and
presumably binding) of wild-type integrase to radiolabeled
guanosine quartet was increased in the presence of magnesium
relative to manganese at several concentrations of the guanosine
quarter (FIG. 28A). This observation led us to examine whether the
inhibitory activity of T30177 and analogs could also be enhanced by
buffer containing magnesium. In order to address this question, the
inventors tested three versions of T30177 as shown in FIG. 28B.
T30175 has the same base sequence as T30177 (pPT variant of SEQ.
ID. NO. 33) but is composed entirely of phosphorothiodiester
internucleotidic linkages. The inhibition of 3'-processing
catalyzed by HIV-1 integrase by these guanosine quartets is shown
in FIG. 28C. Both T30175 and T30177 showed four to five-fold
increases in potency when magnesium was used as the divalent metal
instead of manganese. In contrast, T30038 showed no significant
increase in potency when magnesium was used as the ion (FIG. 28D).
These data are in accord with the increased stability constants for
magnesium-nucleotide complexes when oxygen replaces sulfur
(Pecoraro et al., 1984). The opposite is true for manganese.
Therefore, the greater inhibitory potency of T30177 in buffer
containing magnesium versus manganese may reflect a requirement for
magnesium ion coordination along the phosphodiester backbone of
T30177 in order to confer inhibitory activity and optimum
interaction of T30177 with HIV-1 integrase. This coordination can
occur with more stability when either T30177 or T30175 are assayed
in buffer containing magnesium rather than manganese and is
manifested in a greater potency against 3'-processing.
DNA competition experiments
The relative affinity for the G4 oligonucleotide was probed by
attempting to compete off the integrase bound to radiolabeled HIV-1
viral U5 DNA with increasing concentrations of unlabeled T30177
(FIG. 29A). The converse experiment, where binding of integrase to
radiolabeled G4 oligonucleotide was carried out prior to the
addition of increasing concentrations of unlabeled HIV-1 viral U5
DNA, was also performed (FIG. 29B). In each case, a band having the
apparent mobility of an integrase-DNA complex was evident. In FIG.
29A, the viral DNA-integrase complex has a molecular weight of
38,500 while in FIG. 29B, the T30177-integrase complex has a
molecular weight of 37,000. Neither complex could not be competed
off by either competitor DNA even at concentrations where the
competitor was in 500-fold excess (FIG. 29A, lane 6). Similar
results were seen when the In.sup.1-212 and IN.sup.50-212 proteins
were used in competition experiments (data not shown). Therefore,
the stability of the G4 oligonucleotide DNA-integrase complex is
comparable to that of the viral DNA-integrase complex is comparable
to that of the viral DNA-integrase complex. Ellison, et al, Proc.
Natl. Acad. Sci. U.S.A. 91, 7316-7320 (1994); Vink, et al., Nuc.
Acids Res. 22, 4103-4110 (1994).
Inhibition of related lentiviral integrases
T30177 was tested for inhibition of the related retroviral
integrases from HIV-2 (van Gent et al., 1992), simian
immunodeficiency virus (SIV) and feline immunodeficiency virus
(FIV) (Vink et al., 1994b). As seen in FIGS. 30A and 30B, T30177
inhibited 3'-processing catalyzed by HIV-1 integrase in the
expected concentration range (FIG. 30A, lanes 2-8; IC.sub.50 =55
nM). Inhibition of HIV-2 integrase (using HIV-1 DNA) was also
observed in the same range (lanes 9-15; IC.sub.50 =90 nM). However,
FIV integrase was inhibited at three-fold higher concentrations of
T30177 (lanes 16-22; IC.sub.50 =175 nM), and SIV integrase was
inhibited at seven-fold higher concentrations to T30177 (lanes
23-29; IC.sub.50 =420 nM). Therefore, the T30177 G4 oligonucleotide
displayed some selectivity among the lentiviral integrases.
Conclusions Regarding the Site of Activity Studies
The present study demonstrates for the first time the binding of
DNA guanosine quartet structures to HIV-1 integrase, and that some
oligonucleotides recently shown to exhibit antiviral activity are
potent HIV-1 integrase inhibitors.
Guanosine Quartet Oligonucleotides are Novel and Potent Inhibitors
of HIV-1 integrase
Oligonucleotides composed of deoxyguanosine and thymidine and
forming guanosine-tetrads (G4) structures have previously been
shown in inhibit HIV replication. Rando, et al., J. Biol. Chem.
270, 1754-1760 (1995); Wyatt, et al., Proc. Natl. Acad. Sci. U.S.A.
91, 1356-1360 (1994). Two mechanisms have been invoked. First, some
oligonucleotides have been shown to bind to the V3 loop of the
envelope protein gp120 and subsequently inhibit virus adsorption
and cell fusion. Wyatt, et al., Proc. Natl. Acad. Sci. U.S.A. 91,
1356-1360 (1994). Secondly, oligonucleotides such as those
described in the present study also inhibit viral-specific
transcripts, Rando, et al., J. Biol. Chem. 270, 1754-1760 (1995),
presumably by inhibiting viral integration. Ojwang, et al.,
Antimicrob. Agents Chemother. 39, 2426-2435 (1995). The present
finding that inhibition of the HIV-1.sub.RF strain in cell culture
parallels that of purified integrase in vitro in the series of G4
oligonucleotides tested (FIG. 23D) further demonstrates the
possibility that HIV-1 integrase can be targeted by some G4
oligonucleotides.
G4 oligonucleotides differ from previously published HIV-1
integrase inhibitors in several ways. (Table C-1) First, they are
among the most potent inhibitors to date with IC50's in the
nanomolar range. Their potency range is comparable to flavone,
Fesen, et al., Biochem. Pharmacol. 48, 595-608 (1994), and
tyrophostin derivatives, Mazumder, et al, Biochemistry 34, in press
(1995), which, however, generally fail to show antiviral activity.
Secondly, the zinc finger domain of HIV-1 integrase contributes to
the inhibition by G4 oligonucleotides, as truncation mutant enzymes
lacking this domain are resistant to the G4 oligonucleotides. This
property is unique, as all the other inhibitors to date are active
against the HIV integrase catalytic core domain. (Table C-2)
Mazumder, et al., Proc. Natl. Acad. Sci. 91, 5771-5775 (1994);
Mazumder, et al., Mol. Pham. submitted (1995); Fesen, et al.,
Biochem. Pharmacol. 48, 595-608 (1994); Mazumder, et al.,
Biochemistry 34, in press (1995). Finally, G4 oligonucleotides form
stable enzyme complexes that cannot be displaced by excess viral
DNA oligonucleotide.
TABLE C-1 HIV-1 Integrase Inhibitor Compound Design and List T30177
5' gtggtgggtgggtgggt -3' pPT version of parent compound I100-15 17
mer (SEQ ID NO 87) T30038 5' gtggtgggtgggtgggt -3' PT, Total PT
version T30177 17 mer (SEQ ID NO 87) T30340 5' ggttggtgtggttgg -3'
PD version of thrombin binding aptamer 15 mer (SEQ ID NO 53) T30341
5' ggttggtgtggttgg -3' pPT version of thrombin binding aptamer 15
mer (SEQ ID NO 53) T30659 5' ggttggtgtggttgg -3' PT version of
thrombin binding aptamer 15 mer (SEQ ID NO 53) T30673 5'
gtggttggtgtggttgg -3' pPT variant T30177 17 mer (SEQ ID NO 54)
T30674 5' gtggttggtgtggttggt -3' pPT variant T30177 18 mer (SEQ ID
NO 55) T30675 5' gtggtgggtgtggttggt -3' pPT variant T30177 18 mer
(SEQ ID NO 56) T30676 5' gtggtgggtgtggtgggt -3' pPT variant T30177
18 mer (SEQ ID NO 57) T30677 5' gtggttggtg ggttggt -3' pPT variant
T30177 17 mer (SEQ ID NO 55) T30678 5' gtggtgggtg ggttggt -3' pPT
variant T30177 17 mer (SEQ ID NO 56) T30679 5' gtggttggtg ggtgggt
-3' pPT variant T30177 17 mer (SEQ ID NO 58) T30660 5'
guggugggugggugggu -3' pPT version using 2'0-methyl RNA* 17 mer (SEQ
ID NO 59) T30661 5' guggugggugggugggu -3' pPT version RNA* 17 mer
(SEQ ID NO 59) T30695 5' g ggtgggtgggtgggt -3' pPT variant remove T
near 5'-end 16 mer (SEQ ID NO 60) T30696 5' gtgggtggtgggtgggt -3'
pPT variant invert loop 1 17 mer (SEQ ID NO 61) T30697 5'
gtggtggggtggtgggt -3' pPT variant invert loop 2 17 mer (SEQ ID NO
62) T30698 5' gtggtgggtggggtggt -3' pPT variant invert loop 3 17
mer (SEQ ID NO 63) T30699 5' gtgggtggtggggtggt -3' pPT variant
invert loops 1 and 3 17 mer (SEQ ID NO 64) T30700 5'
gtggTgggtgggtgggt -3' pPT variant T = c-5 propynyl dU 17 mer (SEQ
ID NO 65) T30701 5' gtggtgggtgggTgggt -3' pPT variant T = c-5
propynyl dU 17 mer (SEQ ID NO 66) T30702 5' gtggTgggtgggTgggt -3'
pPT variant T = c-5 propynyl dU 17 mer (SEQ ID NO 67) T30177 5'
gtggtgggtgggtgggt -3' pPT version of parent compound T100-15 17 mer
(SEQ ID NO 87) T30719 5' g ggTgggtgggTgggt -3' pPT variant T = c-5
propynyl dU 16 mer (SEQ ID NO 68) T30720 5' g gggTggtgggTgggt -3'
pPT variant T =c-5 propynyl dU 16 mer (SEQ ID NO 69) T30721 5' I
ggIIggIIggIIggI -3' pPT variant I = dI where I = inosine 16 mer
(SEQ ID NO 70) T30722 5' gtgggTggtgggTgggt -3' pPT variant T = c-5
propynyl dU 17 mer (SEQ ID NO 71) T30075 5' gtggtgggtgggtgggt -3'
3'-cholesterol via triglycyl linker 17 mer (SEQ ID NO 72) T30570 5'
gtggtgggtgggBgggt -3' pPT version B = 5-Bromo dU 17 mer (SEQ ID NO
73) T30571 5' gtggBgggBgggBgggt -3' pPT version B = 5-Bromo dU 17
mer (SEQ ID NO 74) T30576 5' gtggIgggtgggtgggt -3' pPT version I =
5-Iodo dU 17 mer (SEQ ID NO 75) T30577 5' gtggtgggIgggtgggt -3' pPT
version I = 5-Iodo dU 17 mer (SEQ ID NO 76) T30578 5'
gtggtgggtgggIgggt -3' pPT version I = 5-Iodo dU 17 mer (SEQ ID NO
77) T30579 5' gtggIgggIgggIgggt -3' pPT version I = 5-Iodo dU 17
mer (SEQ ID NO 78) T30743 5' gtggCgggtgggtgggt -3' pPT version C =
cytosine 17 mer (SEQ ID NO 79) T30744 5' gtggtgggCgggtgggt -3' pPT
version C = cytosine 17 mer (SEQ ID NO 80) T30745 5'
gtggtgggtgggCgggt -3' pPT version C = cytosine 17 mer (SEQ ID NO
81) T30746 5' gtggCgggCgggCgggt -3' pPT version C = cytosine 17 mer
(SEQ ID NO 82) T30748 5' tgggaggtgggtctg -3' pPT New sequence -
intermolecular tetrad 15 mer (SEQ ID NO 83) T30747A 5'
tgggaggtgggtctg -3' All phosphodiester linkages 15 mer (SEQ ID NO
84) T30747B 5' tgggaggtgggtctg -3' All phosphodiester link. DMT at
3'-end 15 mer (SEQ ID NO 85) T30754 5' gcggggctccatgggggtcg -3' pPT
New sequence - intermolecular tetrad* 20 mer (SEQ ID NO 86) S935833
5' gcggggctccatgggggtcg -3' pPT see below* 20 mer (SEQ ID NO 86)
All compounds were synthesized using commercially available
reagents except for T30075 which was synthesized with a cholesterol
moiety at the 3'-end attached via a triglycyl linker as described
in the paper by Rando et al. (J. Biol. Chem. 1995 270: 1754-1760]
and more extensively by Vu et al. [1994 Bioconjugate Chem. 5:
666-668]. The propynyl dU building blocks contain uracil bases in
which a propynyl group has been added to the c-5 position. The
propynyl dC building blocks contain cytosine bases in which a
propynyl group has been added to the c-5 position. These reagents
are commercially available from Glen Research Reagent co. Other
unusual bases used such as dI (inosine) and iodo and bromo dU are
also commercially available. pPT is shorthand for ODNs in which the
linkage between the ultimate and penultimate bases has been changed
from phosphodiester to phosphorothioate. PT is shorthand to
indicate that all linkages are phosphorothioate. Compounds T30660
and T30661 use RNA sugars or 2'-0-methyl RNA sugars as indicated
instead of 2'-deoxy sugars as found in DNA. The thrombin binding
aptamer sequence used was the first described by Bock et al.
[Nature 1992 355: 564-566] and reported to fold into an structure
stabilized by an intramolecular tetrad by Want et al. Biochemistry
1993 32: 1899-1904]. Compound T30747 A/B contain only natural
phosphodiester linkages. T30747B is 3'-modified in that the
dimethoxy trityl capping group was left attached after removal of
the oligonucleotide from the solid support and subsequent
purification. Usually this group is removed after synthesis of the
molecule. Compound S935833 has the following pattern of
phosphorothioate (PT) linkages where * denotes the PT linkage:
5'-g*c*gggc*t*c*c*a*tggggg*t*c*g-3'. Compound T30754 has a pPT
pattern in which only the 5' and 3' linkages are PT:
5'-g*cggggctccatgggggtc*g-3'. For structures of certain of the
olignucleotides listed, see FIGS. C-9, C-10, C-13, and C-14. For
percentage inhibition of 3'-processing, and for inhibition of
syncytium formation, of certain of these same oligonucleotides, see
FIGS. C-11 and C-12, respectively.
TABLE C-2 Anti-HIV-1 Integrase Activity in vitro and Anti-HIV-1
Virus Production in Cell Culture Enzyme (IC 50 .mu.M) Cell Culture
Stran Trans 3-'process IC50 (.mu.M) T30177 5' gtggtgggtgggtgggt -3'
0.079 0.049 0.075 (SEQ ID NO 87) T30038 5' gtggtgggtgggtgggt -3'
0.090 0.070 0.06 (SEQ ID NO 87) T30340 5' ggttggtgtggttgg -3'
>0.500 >0.500 >50.0 (SEQ ID NO 53) T30341 5'
ggttggtgtggttgg -3' 0.042 0.023 4.76 (SEQ ID NO 53) T30659 5'
ggttggtgtggttgg -3' 0.870 0.750 >20.0 (SEQ ID NO 53) T30673 5'
gtggttggtgtggttgg -3' 0.790 0.600 >35.0 (SEQ ID NO 54) T30674 5'
gtggttggtgtggttggg -3' 0.760 0.610 >50.0 (SEQ ID NO 55) T30675
5' gtggtgggtgtggttggt -3' 0.485 0.500 >30.0 (SEQ ID NO 56)
T30676 5' gtggtgggtgtggtgggt -3' 0.148 0.134 1.0 (SEQ ID NO 57)
T30677 5' gtggttggtg ggttggt -3' 0.725 0.620 >40.0 (SEQ ID NO
55) T30678 5' gtggtgggtg ggttggt -3' 0.098 0.120 3.95 (SEQ ID NO
56) T30679 5' gtggttggtg ggtgggt -3' 0.159 0.156 3.46 (SEQ ID NO
58) T30660 5' guggugggugggugggu -3' >50.0 (SEQ ID NO 59) T30661
5' guggugggugggugggu -3' 0.111 0.084 46.6 (SEQ ID NO 59) T30695 5'
g ggtgggtgggtgggt -3' 0.060 0.020 0.07 (SEQ ID NO 60) T30696 5'
gtgggtggtgggtgggt -3' 0.122 0.013 (SEQ ID NO 61) T30697 5'
gtggtggggtggtgggt -3' 0.130 0.013 (SEQ ID NO 62) T30698 5'
gtggtgggtggggtggt -3' 0.150 0.016 (SEQ ID NO 63) T30699 5'
gtgggtggtggggtggt -3' 0.136 0.050 (SEQ ID NO 64) T30700 5'
gtggTgggtgggtgggt -3' 0.082 0.040 (SEQ ID NO 65) T30701 5'
gtggtgggtgggTgggt -3' 0.072 0.030 (SEQ ID NO 66) T30702 5'
gtggTgggtgggTgggt -3' 0.032 0.030 4.91 (SEQ ID NO 67) T30177 5'
gtggtgggtgggtgggt -3' 0.079 0.049 0.075 (SEQ ID NO 87) T30719 5' g
ggTgggtgggTgggt -3' 0.055 0.055 (SEQ ID NO 68) T30720 5' g
gggTggtgggTgggt -3' 0.059 0.062 (SEQ ID NO 69) T30721 5' I
ggIIggIIggIIggI -3' 0.070 0.088 (SEQ ID NO 70) T30722 5'
gtgggTggtgggTgggt -3' 0.129 0.134 (SEQ ID NO 71) T30075 5'
gtggtgggtgggtgggt -3' 0.110 0.095 0.07 (SEQ ID NO 72) T30570 5'
gtggtgggtgggBgggt -3' 0.090 0.070 (SEQ ID NO 73) T30571 5'
gtggBgggBgggBgggt -3' 0.055 0.050 (SEQ ID NO 74) T30576 5'
gtggIgggtgggtgggt -3' 0.065 0.050 (SEQ ID NO 75) T30577 5'
gtggtgggIgggtgggt -3' 0.065 0.055 (SEQ ID NO 76) T30578 5'
gtggtgggtgggIgggt -3' 0.060 0.050 (SEQ ID NO 77) T30579 5'
gtggIgggIgggIgggt -3' 0.060 0.055 (SEQ ID NO 78) T30744 5'
gtggtgggCgggtgggt -3' 0.105 0.060 (SEQ ID NO 80) T30745 5'
gtggtgggtgggCgggt -3' 0.100 0.100 (SEQ ID NO 81) T30746 5'
gtggCgggCgggCgggt -3' 0.150 0.150 (SEQ ID NO 82) T30747A 5'
tgggaggtgggtctg -3' >0.250 >0.250 (SEQ ID NO 84) T30747B 5'
tgggaggtgggtctg -3' 0.120 0.120 (SEQ ID NO 85) T30748 5'
tgggaggtgggtctg -3' 0.125 0.125 (SEQ ID NO 83) S935833 5'
gcggggctccatgggggtcg -3' 0.060 0.045 0.63 (SEQ ID NO 86) T30745 5'
gcggggctccatgggggtcg -3' 0.120 0.120 (SEQ ID NO 86) The integrase
and viral inhibition (cell culture) assays were performed as
described by Ojwang et al. [1995 Antimicrobial Agents and
Chemotherapy 39: 2426-2435]. Integrase inhibition assays monitor
two different enzymatic activities, the 3'-processing (3'-process)
activity and the strand transfer (stran trans) activity of the
enzyme. The units for the enzyme assays are in nM while the units
for the cell culture inhibition assays are in .mu.M.
Role of the HIV-1 Integrase Zinc Finger Region
Mutation and deletion analyses show that the zinc finger motif
(H-H-C-C) of retroviral integrases is required for integration
(3'-processing and strand transfer) activity. Engelman, et al., J.
Virol. 66, 6361-6369 (1992). However, the structural role of this
region has not been elucidated. It has been postulated too provide
DNA sequence-specificity, Bushman, et al., Proc. Natl. Acad. Sci.
U.S.A. 90, 3428-3432 (1993), stabilize DNA-enzyme, Vink, et al.,
Nuc. Acids Res. 22, 4103-4110 (1994), and enzyme multimer
complexes. Ellison, et al, J. Biol. Chem. 270, 3320-3326 (1995).
These data provide the first direct evidence that the HIV-1
integrase N-terminus region (amino acids 1-55 [FIG. 26A]) can
interact directly with viral DNA in the presence of both zinc and
magnesium (or manganese). The fact that the IN.sup.1-55 protein
binds to the G4 oligonucleotides in the presence but not in the
absence of zinc is consistent with the formation of a zinc finger
in this region. Burke, et al., J. Biol. Chem. 267, 9639-9644
(1992). Hence, it is possible that the zinc finger region can
selectively bind to non-B DNA structures. It is noteworthy that the
recently solved structure of HIV-1 integrase, Dyda, et al., Science
266, 1981-1984 (1994), resembles that of the Rev C Holliday
junction-resolving enzyme, Ariyoshi, et al, Cell 78, 1063-1072
(1994), and of the bacteriophage Mu transposes core. Rice, et al.,
Cell 82, 209-220 (1995). These structurally related proteins also
bind multiple double helices, generating X structure intermediates.
(For review See Katz et al., Ann. Rev. Biochem 63:133-173 (1994)
and Vink et al; Trends in Genetics 9:433-438 (1993).
Although the zinc finger region of integrase is required for
inhibition by the G4s, the IN.sup.50-212 protein, which contains
only the central catalytic domain, was capable of binding to T30177
(FIG. 26C). The inventors also found that an HIV-1 integrase mutant
with the two zinc finger histidines mutated to asparagines was able
to bind to G4 oligonucleotides (data not shown). These data suggest
that HIV-1 integrase may have two separate binding sites, one for
viral DNA and one for target or "host" DNA. This scenarios would be
expected if integrase were to bind both the viral and host DNA at
sites which were instinct but in close proximity in vivo. Vincent,
et al., J. Virol. 67, 425-437 (1993). It should be noted that the
existence of a single binding site on HIV integrase for both viral
and target DNA has been proposed by others. Vink, et al., Nucleic
Acids Res. 21, 1419-1425 (1993).
Biological relevance of G4 structures
Several similarities exist between retroviral genomes and telomeric
regions of eukaryotic chromosomes. The two RNA strands comprising
the HIV-1 genome can potentially dimerize and form intermolecular
G4s in vitro, Sundquist, et al, Proc. Natl. Acad. Sci. U.S.A. 90,
3393-3397 (1993); Awang, et al., Biochemistry 32, 11453-11457
(1993), as does telomeric DNA. Sundquist, et al., Nature 342,
825-829 (1989). In addition, the .beta. subunit of the Oxytrichia
telomere binding protein has bene proposed as a molecular chaperone
for the formation of G4s at the end of chromosomes by enhancing the
rate of a thermodynamically favored transition. Fang, et al., Cell
74, 875-885 (1993). In retroviruses, the nucleocapsid protein may
also act as a molecular chaperone to enhance dimer formation.
Sundquist, et al, Proc. Natl. Acad. Sci. U.S.A. 90, 3393-3397
(1993). In this manner, it may facilitate the formation of and bind
to the G4. The inventors also found that G4s can bind to purified
nucleocapsid protein (data not shown). Thus, G4s may be
structurally important as molecular scaffolds in both retroviral
preintegration complexes and telomeres, and these structures may
have associated chaperones in both cases. Finally, a G4 containing
structure may act as a negative regulator of telomere elongation in
vivo due to its ability to inhibit telomerase in vitro. Zahler, et
al., Nature 350, 718-720 (1991). Analogously, G4 structures may act
to inhibit integrase (FIG. 23A-D) and thereby act as a block to
auto integration or digestion of the viral DNA prior to insertion
into the host chromosome.
The existence of G4s in vivo has not been demonstrated. However,
they have been shown to form in vitro in telomeric sequences,
Sundquist, et al., Nature 342, 825-829 (1989); Smith, et al.,
Nature 356, 164-168 (1992); Kang, et al., Nature 356, 126-131
(1992), HIV-1 RNA sequences, Sundquist, et al, Proc. Natl. Acad.
Sci. U.S.A. 90, 3393-3397 (1993); Awang, et al., Biochemistry 32,
11453-11457 (1993), fragile X syndrome nucleotide repeats, Fry, et
al., Proc. Natl. Acad. Sci. U.S.A. 91, 4950-4954 (1994), the
retinoblastoma susceptibility gene, Murchie, et al., Nuc. Acids
Res. 20, 49-53 (1992), immunoglobulin switch region sequences, Sen,
D., et al., Nature 334, 364-366 (1988), and possibly during meiotic
recombination. Liu, et al., Cell 77, 1083-1092 (1994). Given these
results, it is not surprising that proteins such as thrombin, Bock,
et al., Nature 355, 564-566 (1992), (not normally known to bind
nucleic acids), chick topoisomerase II, Chung, et al., Nucleic
Acids Res. 20, 1973-1977 (1992), MyoD (a transcription factor that
regulates myogenesis), Walsh, et al., J. Biol. Chem. 267,
13714-13718 (1992), an hepatocyte chromatin protein,
Weisman-Shomer, et al., J. Biol. Chem. 268, 3306-3312 (1993),
macrophage scavenger receptors, Pearson, et al., J. Biol. Chem.
268, 3546-2554 (1993), and a protein from Tetrahymena thennophila,
Schierer, et al., Biochemistry 33, 2240-2246 (1994), have been
found to bind G4 containing nucleic acids. Another G4 binding
protein, KEM1, has been isolated and implicated in
recombination-type reactions in vivo. Liu, et al., Cell 77,
1083-1092 (1994). The catalytic activities of this protein and of
the integrase protein are DNA endonucleolytic cleavage and strand
transfer. However, unlike KEM1, integrase does not catalyze
endonucleolytic cleavage reactions on G4s (data not shown). Thus,
G4s may be mechanistically relevant in a diverse set of biological
processes involving enzymes with similar activities.
In summary, the inventors demonstrated that oligonucleotides
containing intramolecular G4s are potent inhibitors of HIV-1
integrase. Inhibition is dependent on the zinc finger region of
integrase and on the structure and sequence of the G4s. These
findings also suggest that novel AIDS therapies could be based upon
G4s as inhibitors of HIV-1 integrase.
D. Structure-Function Studies
As shown previously, the inventors obtained evidence for inhibition
of HIV-1 infection by treatment with phosphodiester
oligonucleotides containing only G and T bases. Additional studies
noted above suggested to the inventors that such oligomers were
potent inhibitors of HIV-1 integrase, in vitro. The highest
activity was obtained using the 17 mer, referred to as T30177 (pPT
variant of SEQ. ID. NO. 33), with composition G12-T5. NMR evidence
suggested to the inventors that T30177 forms an intramolecular fold
which is stabilized by a pair of G-tetrads, connected by three
single stranded loops, with a 1-2 base tail to ether side of the
fold.
Thus, the inventors undertook studies to determine sequence
dependence of the intramolecular folding mechanism, in a set of
four closely related 16-17 base oligonucleotide homologues, with
sequences in the range G10-12-T4-7. The original T30177 compound
was included, along with three derivatives which were designed so
as to alter the structure of loop domains, while keeping the pair
of G-tetrads intact. Based on thermal denaturation, CD and kinetic
analysis, the inventors were able to show that a single base
alteration within the loop or tail domains can produce a very large
change in folding stability. The K.sup.+ ion dependence of these
data suggested a preliminary model wherein the loop and tail
domains interact to form stable metal ion-binding sites. A 16 mer
derivative (T30695) was designed within the context of that model,
with the intent of enhancing the interaction between K.sup.+ and
the 5' terminus of the oligomer. The inventors showed that T30695
(a variant of SEQ. ID. NO. 33, shown in Table C-1) folding is
indeed more stable than other members of the group and is highly
specific for K.sup.+, as assessed from the ion dependence of
thermal denaturation, CD spectra and UV detected folding
kinetics.
To assess the relationship between biological activity and
formation of the ion-selective oligomer fold, the inventors
compared tertiary structure stability at three K.sup.+
concentrations with the capacity of the folded oligomers to inhibit
the HIV-1 integrase enzyme in vitro, or HIV-1 infection in cell
culture. The stability and activity data are found to be highly
correlated, as a function of sequence alteration, suggesting that
formation of the stable intramolecular fold may be a prerequisite
for both integrase inhibition and anti-HIV-1 activity. Although the
structure of the folded state has not yet been confirmed at high
resolution, the data presented here suggested that the structure of
the T30695 complex with K.sup.+ ion may be of pharmaceutical
significance and could serve as the basis for additional
improvement of the observed HIV-1 activity.
Materials and Methods for the Structure/Function Studies
Oligonucleotide Synthesis
All oligonucleotides used in this study were synthesized on an
Applied Biosystems Inc. DNA synthesizer, model 380B or 394, using
standard phosphoramidite chemistry, or fast deblocking Expedite
chemistry on a Milligen synthesizer. All oligomers possessed 2
phosphorothioate linkages (one on each terminus) which were
introduced by the H-phosphonate method. Oligonucleotides were
purified by preparative anion exchange HPLC, on Q-Sepharose. Chain
purity was confirmed by analytical Q-sepbarose chromatography, and
by denaturing electrophoresis of 32P labeled oligomers on a 20%
polyaerylamide (19:1), 7M urea gel matrix (Rando et al., (1994) J.
Biol. Chem. 270, 1754-1760, 17). In all instances, greater than 90%
of the purified oligomer was determined to be full length. Oligomer
folding was monitored by native gel electrophoresis on 15%
acrylamide (19:1) matrix in TBE. Folded, 32P labeled samples were
loaded subsequent to annealing in 20 mM Li3P04, pH 7.0, 10 mM KCl
at 7 uM in strands, as described below.
Annealing
Prior to UV, CD or kinetic analysis, oligonucleotides were annealed
at 20 mM Li3P04, pH 7 at 3-15 uM in strands. Samples were heated to
90.degree. C. for 5 min and then incubated for 1 hour at 37.degree.
C. Metal ion could be added as the chloride either before or after
the 37 .degree. C. incubation, with no measurable difference in
final state, as assessed by UV, CD or gel analysis. As assessed by
native gel electrophoresis (not shown), this annealing method was
found to produce a single product with mobility consistent with a
folded monomer over the strand concentration range from 3-15 uM, at
all ion concentrations described.
Ultraviolet Spectroscopy
UV measurements were obtained on a HP 8452A diode array
spectrometer, using a HP 89090A temperature regulator. Except where
noted, thermal denaturation profiles were obtained at a rate of
1.25.degree. C./min over the range from 20.degree. C.-80.degree.
C., on samples at 20 mM Li3P04, pH 7, at 7 uM in strands.
Absorbance was monitored at 240 nm, which was determined to be the
point of maximal temperature induced change. For melting analysis,
metal ion was added to the desired concentration, followed by a one
hour pre-incubation at 37.degree. C., to ensure compete annealing.
Folding kinetics were obtained by manual addition of metal ion at
t=0, followed by absorption measurement at 264 nm. Mixing dead time
was determined to be 10 sec. Kinetics were monitored over the range
from 10 sec to 15 min at 25.degree. C.
Circular Dichroism
CD spectra were obtained at 25.degree. C. in 20 mM Li3P04, pH 7, at
15 uM in strands, on a Jasco J-500A spectropolarimeter. Metal ion
was added to the desired concentration, followed by one hour of
pre-incubation at 37.degree. C. Each spectrum in the text
represents 5 averaged scans. To conform to traditional standards,
data are presented in molar ellipticity (deg-cm2-dmolE-1) as
measured in base, rather than strand equivalents.
Antiviral assay. The RF laboratory strain of HIV-1 was used to
infect established cell lines for one hour at 37.degree. C. prior
to washing and resuspension in medium containing increasing
concentrations of drug. Four to six days post-infection, drug
treated and control wells were analyzed for HIV-1 induced
cytopathic effects, for the presence of viral reverse transcriptase
(RF) or viral p24 antigen in the culture medium as previously
described by Ojwang et al. (Bishop et al., (1996) J. Biol. Chem.
271, 5698-5703). Purified recombinant HIV-1 integrate enzyme
(wild-type) was a generous gift from Dr. Craigie, Laboratory of
Molecular Biology, NIDDK. All 3'-processing and strand-transfers
were performed as described previously by Fresen et al. (Fresen et
al. (1993) Proc. Natl. Acad. Sci. USA 90, 2399-2403) and Mazurnder
et al. (Mazumder et al. (1994) Proc. Natl. Acad. Sci. USA 91,
5771-75).
Results of Structure/Function Studies
The structure of the oligonucleotides in this study are presented
in FIG. 37A. For the purposes of clarity, they have been
represented in the context of a particular folding model which
places eight of the guanosincs as a central octet and the remainder
of the oligomer in either a loop region, or as part of a 1-2 base
long tail region at the 5' or 3' terminus. Previous electrophoresis
and ID NMR data (Rando et al., (1994) J. Biol. Chem. 270,
1754-1760) have strongly suggested that T30177 folds so as to form
an intramolecular G-tetrad based structure which is stabilized by a
single central G-octet. Therefore, for T30177, the simple model
presented in FIG. 37A is adequately substantiated by structural
data. The validity of a similar structural model for the other
members of the series is legitimately assumed based upon their
sequence similarity, to be tested in terms of the data presented
below.
Thermal Denaturation Analysis
Based upon previous NMR data, and the general literature, the
inventors postulated that folding of T30177 should be strongly
dependent upon K.sup.+ binding. To quantify this, they measured the
thermal stability of T30177, as a function of added KC1
concentration. Coupled equilibrium theory predicts that, in the
instance that K.sup.+ binding stabilizes formation of an
intramolecular fold, measured TM values should increase linearly
with the Log of the KC1 concentration. Such data are shown in FIG.
38A, line b. It is seen that in the presence of 20 mM Li3PO4,
measured Tm values for T30177 increase from 38.degree. C. to
65.degree. C. in the range from 0.1 to 10 mM of added KC1. This
very large increase in Tm below 10 mM of added KC1, in the presence
of 20 mM of Li3PO4 as buffer, argues strongly that the effect of
K.sup.+ binding is not a simple ionic strength effect.
The inventors have noticed that the measured Tm values for T30177
are consistently higher, by 1030.degree. C., than has been seen for
other small intramolecular folds (Smith, F. W., & Feigon, J.
(1992) Nature (London) 344, 410-414; Schultze, et al., J. (1994) J.
Mol. Biol. 235, 1532-1547). Since T30177 differs from these other
homologues only in terms of the proposed loop domains, the
inventors have synthesized homologues of T30177 where the central
G-octet remains constant, but where the loop domains to either side
have been modified by addition or replacement of a single base. In
the context of the simple folding model (FIG. 37A) the T30676
homologue is identical to T30177, but has been modified so as to
add an additional G into the topmost loop of the structure. As seen
in FIG. 38A, line c, this one base addition produces a 20.degree.
C. decrease in Tm over the entire range of K.sup.+ ion tested.
Similarly, the T30677 (SEQ. ID. NO. 55) homologue was prepared
(FIG. 37A), which is identical to T30177 (pPT variant of SEQ. ID.
NO. 33), but has been modified so as to convert a pair of Gs in the
bottommost loop domain. As seen in FIG. 38A, line d, this two base
loop substitution produces a 30.degree. C. decrease in Tm over the
range of K.sup.+ ion tested.
In the context of these substantial stability changes, the
inventors sought to confirm that the general mechanism of folding
had not been altered by base substitution. Thus, Tm analysis was
repeated at 1 mM KC1 as a function of strand concentration in the
range from 3 to 10 .mu.M (FIG. 38C). As seen, a measurable strand
concentration dependence could not be detected over this three fold
range of variation, for any of the derivatives, thus verifying that
the folding equilibrium remains intramolecular throughout. This was
confirmed by native gel electrophoresis, which continued to display
a single folded oligomer state (not shown), similarly, it was
observed that the thermal difference spectrum for all three
homologues was very similar (not shown).
Oligomer Design Improvement
Based upon the unusually high thermal stability of T30177, relative
to intramolecular folds in the literature, and upon the
20-40.degree. C. decrease in Tm observed as a function of what
should have been a simple loop modification (FIG. 37A), the
inventors concluded that interactions within the loop domains may
contribute to stability. Specifically, it is proposed that K.sup.+
ions may engage in stable binding to the loop domains of T30177.
Simple docking calculations, performed with BIOSYM software (not
shown) suggested that the TGTG loop configuration at the lower face
of these folded homologues could, in cooperation with the proximal
G-tetrad, give rise to tight K.sup.+ coordination which is similar
to that seen when K.sup.+ (or Na.sup.+) ion coordinates between
G-tetrads (Bishop et al., (1996) J. Biol. Chem. 271, 5698-5703). In
the context of that proposal, the inventors noticed that, if the
penultimate T were removed from the 5' terminus of T30177, the
distribution of nucleotide bases in the uppermost face of the fold
would be similar to that of the lower face, but with one less
internucleotidyl phosphate linkage.
Those considerations served as the basis for the design of the 16
mer oligonucleotide, T30695 (FIG. 37A). As seen in FIG. 38A, line
a, even though T30695 is one base shorter than the T30177
homologue, it was found to melt at approximately 10.degree. C.
higher temperature, over the entire K.sup.+ range tested. As for
the other homologues, Tm values for T30695 were found to be strand
concentration independent, confining the general similarity of the
folding process (FIG. 38C).
For T30695, the K.sup.+ ion dependence of thermal stability was
very striking. In the presence of 20 mM of Li3PO4 as buffer,
measured Tm values increase from 40.degree. C. to 65.degree. C.
over the added KC1 range from 50 EM to 1 mM. Again, this ion
dependence argues that the observed stabilization is likely to
result from site-specific ion binding, rather than simple
ion-screening effects.
In order to explore the selectivity of ion binding by T30695, Tm
values have been measured for alkaline metal ions with differing
radius: Na.sup.+ (0.99A), K.sup.+ (1.38A), Rb.sup.+ (1.49A), and
Cs+ (1.69A). As seen in FIG. 38B, significant K.sup.+ ion
selectivity is detected. Although Rb.sup.+ is very similar to
K.sup.+ in general chemical properties, and differs by only +0.11A
in ion radius, it is seen that the Rb.sup.+ complex with T30695
melts at approximately 20-30.degree. C. lower temperature over the
entire concentration range studied. Na.sup.+ ion and Cs+ ion, which
differ from K.sup.+ in ion radius by -0.37A and +0.29A,
respectively, are seen to be even more destabilizing. Similar ion
binding selectivity were obtained by this method for the T30177
homologue (not shown).
Circular Dichroism
In order to explore the nature of these ion binding effects, the
inventors monitored the folding of T30695 by circular dichroism
(CD) methods. It is known that G-quartet based folding, both intra
and intermolecular, gives rise to large induced ellipticity values
(Balagurumoorthy, P. & Brahmachari, S. K. (1994) J. Biol. Chem.
269, 21858-21869; Jin, et al. (1992) Proc. Natl. Acad. Sci. USA 89,
8832-8836; Lu et al. (1992) Biochemistry 31, 2455-2459; Gray et al.
(1992) Methods in Enzymology 211, 389-406). Stable tetrad folds are
characterized by nonconservative spectra, with maxima at 264 nm
(.about.1.times.10+5 deg-cm2/dmol) and 210 rim (.about.5.times.10+4
deg-cm2/dmol) and a minima at 240 rim (-4.times.1044
deg-cm2/dmol).
In FIG. 39A, the inventors monitored the CD spectrum of T30695 at
0, 0.05 and 10rnM KC1. As seen, at the highest added KC1
concentration, the induced CD spectrum is very similar to that
predicted for an orderly G-tetrad based fold. Interestingly, the
spectrum obtained in the absence of added KC1 is indicative of
significant folding in the absence of added K.sup.+ ion, at
25.degree. C. in the supporting 20 mM Li3PO4 buffer. Tm data for
T30695 in FIG. 38A suggests an extrapolated Tm near to 20.degree.
C. in the limit of very low added K.sup.+ ion. That extrapolated
value is consistent with the structure evidenced at 0 mM KC1 in
FIG. 39A.
Detailed K.sup.+ titration data of that kind have been presented in
FIG. 39B, for T30695, T30177, and T30676. As seen, all three
oligomers displayed a generally similar increase in elliptic as a
function of added K.sup.+ ion concentration, which is consistent
with the hypothesis that they fold ire a fashion similar to the
simple model of FIG. 37A. However, the ion concentration dependence
of the folding process is quantitatively different for the three.
As would have been predicted from the Tm data of FIG. 38A, it was
found that the coupling between K.sup.+ ion binding and folding is
stronger for T30695 (transition midpoint near to 0.02 mM), than is
the case for T30177 (0.15 mM) or T30676 (0.27 mM). The T30677
oligomer, which was the least stable of the oligomers tested by Tm
analysis, showed very little ellipticity change over the 0-100 mM
KC1 range, and therefore has not been presented in FIG. 39B.
Closer inspection of the data in FIGS. 39A and 39B suggested that
the CD titration for T30695 is biphasic, with a first step
completed by 0.1 rnM, and a second step which is complete in the
1-2 rnM range. In order to confirm that the K.sup.+ induced folding
process involves two steps, the inventors have performed CD
titrations with different alkaline metal ions (FIG. 39C). The
inventors Rb.sup.+ induced folding of T30695 is associated with an
overall ellipticity increase which is very similar to that induced
by K.sup.+. This argues that the Rb.sup.+ and K.sup.+ complexes are
folded in a similar fashion. However, as expected from the Tm
differences seen in FIG. 38B, it is observed that Rb.sup.+ ion
induced folding is quantitatively different, occurring only at
relatively high added ion concentration (0.5 rnM midpoint as
compared to 0.02 rnM for K.sup.+). This confirms that Rb.sup.+ is a
much poorer effector of the folding process. A very similar K.sup.+
vs. Rb.sup.+ differential was seen for T30177 (not shown), which
suggests that the two oligomers display similar overall ion binding
selectivity.
The biphasic character of the T30695 folding process now easily
detected upon addition of Rb.sup.+ (FIG. 39C). The magnitude of the
CD change associated with the first and second ion induced steps
are similar for both K.sup.+ and Rb.sup.+, confirming that the
folding process has not been significantly altered in a qualitative
fashion by Rb.sup.+. For comparison, it was observed that folding
of T30695 as a function of Na.sup.+ ion binding is not biphasic,
and is associated with a total ellipticity increase which is no
larger than that of the first transition seen in the presence of
K.sup.+ and Rb.sup.+ ion. One interpretation of this difference is
that Na.sup.+ ion is capable of driving the first, but not the
second step in the folding process. This proposal will be discussed
below.
Folding Kinetics
In order to investigate the two step folding process in more
detail, the inventors have measured the kinetics of oligomer
folding, for T30695 and T30177 at 25.degree. C. in the standard 20
rnM Li3PO4 buffer. Data were obtained by manual addition of K.sup.+
or Rb.sup.+ ion at time zero, followed by measurement of UV
absorbance change at 264 nm, in the 0 to 300 second time range. In
FIG. 40A, K.sup.+ ion has been added to T30177 at 0.2 uM (curve a),
1.0 rnM (curve b) or 10 uM (curve c). In FIG. 40B, Rb.sup.+ ion has
been added to T30695 at 1 uM (curve a), 5 uM (curve b) or 10 uM
(curve c). These three values are approximately those required to
obtain the midpoint, endpoint and ten times the endpoint of the
K.sup.+ induced (FIG. 39B, curve b) or Rb.sup.+ induced folding
process (FIG. 39C). Although not shown, the kinetic data described
below were found to be nucleic acid concentration independent over
the range from 3-10 uM in strands, confirming that the folding
process is intramolecular.
As seen in FIG. 40A, upon addition of K.sup.+ to T30177 to 0.2 mM
(curve a), a single slow kinetic process is detected with a time
constant near 18 sec. Interestingly, this component is
hyperchromic, indicating a net loss of base stacking interaction
during this first step of the folding process. Upon addition of
sufficient K.sup.+ to drive the folding transition to completion (1
uM, curve b), a second kinetic component is detected (.about.=15
sec, t2=1.times.104 sec). The second component is hypochromic,
indicative of a net increase in base stacking, and is very slow.
Upon an additional increase of K.sup.+ ion to 10 .mu.M (curve c),
the first kinetic component becomes nearly too fast to be detected
in the current apparatus, while the time constant for the second
step has decreased to about 50 sec. Very similar kinetics, but
approximately 20-fold slower, have been obtained upon addition of
Rb.sup.+ ion to T30177 (not shown).
In FIG. 40B, the inventors have performed a similar folding
analysis on T30695, but with Rb.sup.+ instead of K.sup.+ ion. This
was done because, for T30695, the kinetics of K.sup.+ induced
folding were too fast to be detected in the simple optical
apparatus employed. As seen in FIG. 40B, upon addition of Rb.sup.+
to 1 mM (curve a), a single slow kinetic process is detected,
similar to that obtained at low K.sup.+ ion concentration with
T30695 (Taul=48 sec). Again, this component is hyperchromic,
indicating a net loss of base stacking interaction. Upon addition
of sufficient Rb.sup.+ to drive the T30695 folding transition to
completion (5 uM, curve b), a second kinetic component is detected.
Again, the second component is hypochromic, indicative of a net
increase in base stacking. Upon additional increase of Rb.sup.+ ion
concentration to 10 .mu.M (curve c), the first kinetic component
becomes nearly too fast to be detected, while the time constant for
the second step has decreased from about 60 sec (curve b) to about
16 sec.
Although these initial kinetic data are not sufficient to solve for
rate constants, the absorbance-detected kinetic data for both
T30177 and T30695 are consistent with the equilibrium binding data
obtained by CD (FIGS. 39B and C). Both techniques suggest that for
K.sup.+ and Rb.sup.+, the ion induced oligomer folding process is
aphasic. Kinetic data obtained with Na.sup.+ ion (not shown),
suggest that only the first, hyperchromic transition is obtained at
any concentration in the 0-200 mM range. That observation is also
generally consistent with Na.sup.+ titration data (FIG. 39C). A
structural model is proposed below to rationalize those
observations.
A Relationship Between Structure and Function
The inventors' interest in T30177 and its derivatives has arisen
because this class of oligonucleotide is a potent inhibitor of HIV
infection in culture (Rando et al., (1994) J. Biol. Chem. 270,
1754-1760; Ojwang et al. (1994) J. AIDS 7, 560-570; Bishop et al.,
(1996) J. Biol. Chem. 271, 5698-5703; Ojwang et al. (1995)
Antimicrob. Agent Chemotherepy 39, 242-635), and in vitro, has been
shown herein to be the most potent inhibitor of HIV-1 integrase to
have been identified thus far (see also Ojwang et al. (1995)
Antimicrob. Agent Chemotherepy 39, 2426-35). In Table D-1, there is
provided a catalog of the melting temperatures of the closely
related set of derivatives used in this study, as an index of their
stability as an intramolecular tetrad-based fold. Stability has
been presented at three different added K.sup.+ ion concentrations,
spanning a range of Tm values which differ by 50.degree. C. This
was done to ensure that stability-activity correlations would not
be limited to any particular K.sup.+ ion concentration.
Three kinds of activity data have been presented. Integrase
inhibition by these oligonucleotides has been monitored for both
the 3' exonuclease and strand transfer activities of the purified
HIV-1 integrase (Ojwang et al. (1995) Antimicrob. Agent
Chemotherepy 39, 2426-35). Data are presented in Table D-1 as the
IC50, in nM of added oligonucleotide. Antiviral activity has been
obtained as described herein and elsewhere (Ojwang et al. (1995)
Antimicrob. Agent Chemotherepy 39, 2426-35), and is presented as
the IC50, in nM, of added oligonucleotide.
Inspection of Table D-1 suggests that, relative to any added
K.sup.+ ion concentration, there is a correlation between thermal
stability of the folded state and the capacity to inhibit the
exonuclease or strand transfer activity of purified HIV-1
integrase. A qualitative correlation is also obtained when
comparing thermal stability with measured anti-HIV activity in cell
culture. A relationship between thermal stability and function can
only be meaningful for folded structures which are very similar.
However, given the sequence similarity among these four homologues
in Table D-1, and the similarity of their ion-induced folding
process, the correlations are likely to be meaningful.
Conclusions Regarding the Structure/Function Studies
Data were obtained suggesting that the anti-HIV oligonucleotide
drug T30177 and its homologue T30695, fold via intramolecular
G-tetrad formation, to yield a structure which is stabilized by
K.sup.+ ion binding. It is well known from the literature that
alkaline metal ions can stabilize G-tetrad formation (Williamson,
J. R. (1994) Annul Rev. Biophys. Biomal. Struct. 27, 703-730). What
distinguishes the behavior of these two oligomers is the unusually
high stability of the folded state (FIG. 38A), the high selectivity
shown for K.sup.+ ion (FIGS. 38B and 39C) and the possibility that
K.sup.+ coordination may be strongly coupled to loop structure
within the oligonucleotide fold (FIGS. 38A and 39B). Consistent
with the idea that ion binding may occur with G-tetrads and with
loops, the inventors have observed that the folding of T30695 and
T30177 appears to occur as a two step process, as detected by
equilibrium (FIG. 39) and kinetic methods (FIG. 40).
In order to relate these various observations, the inventors have
found it useful to propose a simple, two step folding model (FIG.
37B). They suggest that the first, higher affinity ion binding step
occurs by coordination of metal ion with the central-most pair of
G-tetrads, thereby generating a core octet which is similar to that
seen in related intramolecular folds (Williamson, et al. (1989)
Cell 59, 871-880; Panyutin, et al. (1990) Proc. Natl. Acad. Sci.
USA 87, 867-870; Smith, F. W., & Feigon, J. (1992) Nature
(London) 344, 410-414; Schultze, et al. (1994) J. Mol. Biol. 235,
1532-1547). It is proposed that, by analogy to those other, better
understood G-tetrad based structures, this first ion binding step
has rather modest selectivity among the alkaline metal ions
(Williamson, J. R. (1994) Annul Rev. Biophys. Biomal. Struct. 27,
703-730). The inventors propose that the second step in the folding
process involves binding of additional ion equivalents to the loop
regions of the structure. It is also proposed that this second
process, which occurs at higher added ion concentration (FIG. 39)
and which is associated with the slow kinetic step of FIG. 40, is
coupled to a rearrangement of the loop domains to yield two
additional sites for metal ion coordination.
In preliminary modeling studies (not shown), the inventors have
confirmed that orderly structures of the proposed kind can be
obtained in which carbonyl oxygens from T and G base plains are
organized in the loops so as to complement the end of the G-octet,
resulting in octahedral coordination of one K.sup.+ equivalent at
each of the two junctions between loop and core octet domains. It
is proposed that this capacity for additional K.sup.+ ion binding
is the origin for the remarkable stability of T30695, the corollary
being that other homologues described in this work are less stable
because they have lost one or the other of the proposed K.sup.+
coordination sites. A second corollary of the model is that the
high ion selectivity seen for these oligomer folds is dominated by
the structural requirements for ion binding to the loops, rather
than from ion binding within the core octet. Preliminary NMR data
(Ding & Hogan, unpublished data) suggests that the additional
binding step involves 2 equivalents of K.sup.+, yielding 3 K.sup.+
equivalents per oligomer fold, at saturation.
Confirmation of this model awaits detailed structure analysis.
However, the data at hand (Table D-1) suggest that formation of the
ion-selective oligomer fold described herein may be a necessary
pre-condition for anti-integrase and the overall anti-HIV activity
of these compounds. As such, refinement of the present folding
model could prove useful as the basis for pharmaceutical
improvement.
TABLE D-1 T.sub.m (.degree. C.) T.sub.m (.degree. C.) T.sub.m
(.degree. M) IC.sub.50 (nM) IC.sub.50 (nM) IC.sub.50 (nM) Oligomers
5'-Sequence-3' (1 mM KC1) (10 mM KC1) (180 mM KC1) 3'-PROC STR.TRA
HIV-1RF T30695 GGGTGGGTGGGTGGGT 67 87* 110* 43 .+-. 17 24 .+-. 4 70
T30177 GTGGTGGGTGGGTGGGT 53 70* 92* 79 .+-. 24.sup.a 49 .+-.
5.sup.a 75.sup.a T30676 GTGGTGGGTGTGGTGGGT 33 46 65 148 .+-. 26 134
.+-. 16 1000 T30677 GTGGTTGGTGGGTTGGT 17* 27 40 725 620 >40,000
T.sub.m with * were obtained by a calculation according to the
linear fitting functions of T.sub.m vs. Log[KC1]. The data with
.sup.a were previously reported by Ojwang et al. (Ojwang et al.
(1995) Antimicrob. Agent Chemotherepy 39, 2426-35.).
Pharmacokinetic Studies
E. Single-dose hemodynamic toxicity and pharmacokinetics of a
partial phosphorothioate anti-HIV oligonucleotide (AR177) following
intravenous infusion to cynomolgus monkeys
As part of the pre-clinical assessment of AR177, a toxicity study
of AR177 (T30177) was conducted with the objective of establishing
the dose-response relationship between intravenous infusion of
AR177 and hemodynamic parameters in cynomolgus monkeys. Intravenous
infusion is the proposed route of administration of AR177 to
humans. The present study was conducted using the short term
infusion protocol recommended by the Food and Drug Administration
(Black et al., 1994), with measurement of central blood pressure,
serum chemistry, hematology, coagulation factors, complement
factors, and plasma AR177 concentrations.
Materials and Methods for Pre-Clinical Toxicology Screens
Materials
AR177 was synthesized at Aronex on a Milligen 8800 oligonucleotide
synthesizer, and made into a stock solution at 25 mg/mL in sterile
phosphate-buffered saline. AR177 has a molecular weight of 5793
daltons, and is a fully neutralized sodium salt. The structure of
AR177 was characterized by phosphorus and proton NMR, sequencing,
base composition, laser Resorption mass spectrometry, anion
exchange HPLC and polyacrylamide gel electrophoresis. The AR177 was
approximately 94% pure according to HPLC and electrophoretic
analysis. All analyses are consistent with the proposed
structure.
For HPLC analysis of plasma AR 177, tris was obtained from Fisher,
NaBr and NaCl were obtained from Sigma, and methanol was purchased
from J. T. Baker. The Gen-Pak Fax anion-exchange HPLC column
(4.6.times.100 mm; cat. no. #15490) was purchased from Waters.
Dosing
Twelve experimentally naive cynomolgus monkeys were assigned to
four groups of three animals each. Prior to dosing, each animal was
lightly sedated with a combination of ketamine (10 mg/kg) and
diazepam (0.5 mg/kg), and a catheter was introduced into the
femoral artery for recording central arterial pressure. Monkeys
were given a single intravenous infusion of 5, 20, or 50 mg
AR177/kg or saline over ten minutes through a cephalic vein
catheter using a Harvard infusion pump. Arterial blood samples were
drawn at -10, +10, +20, +40, +60 and +120 minutes relative to the
initiation of infusion into EDTA-containing tubes for hematology,
complement factors, coagulation assay, serum chemistry, and plasma
AR177 determination. At 24 hours post-infusion, blood was drawn via
the femoral vein into EDTA-containing tubes for these same
parameters. The concentration of AR177 in dosing solutions was
confirmed post experiment by absorbance at 280 nm on a
spectrophotometer. For the determination of AR177 by HPLC, the
plasma fraction was obtained by low speed centrifugation of blood,
and stored at -20.degree. C. until used. Electrocardiograms (ECGs),
central pressure, and heart rate were recorded continuously for 120
minutes following the initiation of dosing. Table E-1 summarizes
the study design. The animals were observed twice daily for
pharmacotoxic signs and general health beginning two days before
dosing and for seven days following dosing. The monkeys were not
necropsied at the end of the study.
Serum chemistry parameters
The following were determined: sodium, potassium, chloride, carbon
dioxide, total bilirubin, direct bilirubin, indirect bilirubin
alkaline phosphatase, lactate dehydrogenase, aspartate
aminotransferase, alanine aminotransferase,
gamma-glutamyltransferase, calcium, phosphorus, glucose, urea
nitrogen, creatinine, uric acid total protein, albumin, globulin,
cholesterol and triglycerides. The samples were analyzed at Sierra
Nevada Laboratories (Reno, Nev.).
Hematology and coagulation parameters
The following were determined: red blood cell count and morphology,
total and differential white blood cells, hemoglobin, hematocrit,
prothrombin time, fibrinogen, mean cell hemoglobin, mean
corpuscular volume, mean corpuscular hemoglobin concentration,
platelet count, and activated partial thromboplastin time.
Hematology parameters were determined at Sierra Nevada Laboratories
(Reno, Nev.).
Complement factors
The complement split product Bb and total hemolytic complement CH50
were determined. The choice of measuring the Bb split product, as
opposed to other complement factors, was based on a published study
showing the involvement of the alternative pathway in complement
activation induced by oligonucleotides (Galbraith et al, 1994).
Complement determinations were performed in the laboratory of Dr.
Patricia Giclas at the Complement Laboratory, National Jewish
Center for Immunology (Denver, Colo.).
HPLC analysis of AR177 plasma concentrations
AR177 was assayed in the plasma using an anion-exchange HPLC method
on a Waters HPLC system with a 626 pump, 996 photodiode array
detector, 717 autosampler and Millennium system software controlled
by an NEC Image 466 computer. Buffer A consisted of 0.1 M Tris
base, 20% methanol, pH 12, and Buffer B consisted of 0.1 M Tris
base, 1.0 M NaBr, pH 12. The anion-exchange column (Gen-Pak Fax
column) was equilibrated at 80% buffer A/20% buffer B for 30
minutes before each HPLC run. Fifty microliters of
0.2.about.filtered, neat plasma were analyzed per run. The elusion
conditions were: a) five-minute isoaatic run at 80% A/20% B. during
which the majority of the plasma proteins eluted, b) 25-minute
linear gradient to 30% A/70% B during which AR177 elutes, c)
five-minute Socratic run at 30% A/70% B. d) one-minute linear
gradient to 100% B. e) two- minute run at 100% B for column
clean-up, and fl two-minute linear gradient to 70% A/30% B for the
step in the HPLC clean-up. The high pH (12) of the elusion buffers
was necessary to dissociate AR177 from tissue constituents, which
bind AR177 tightly around physiological pH. AR177 is completely
stable at pH 12. This method can clearly distinguish between the
full length AR177 and n-1, n-2, etc. species, which are potential
metabolic products. The ultraviolet detection wavelength was 260
nm. The flow rate was 0.5 mL/minute in all steps. Column clean up
between runs was performed by a 500 pL bolus injection of 0.1 M
Tris base, 2 M NaCl, pH 10.5, followed by: a) ten-minute linear
gradient to 60% A/40% B. b) one-minute linear gradient to 100% B.
c) a three-minute isocratic run at 100% B and d) one-minute linear
gradient to 80% A/20% B.
A standard curve was generated by spiking AR177 into cynomolgus
monkey plasma in order to achieve concentrations of 0.04 to 128
.mu./mL. The plasma standards and unspiked plasma (control) were
run on the anion-exchange HPLC column using e above conditions. The
Waters Millennium software was used to determine the area under the
peak for each AR177 standard at 260 nm. The HPLC peak area versus
AR177 concentration was plotted using Cricket Graph III 1.5.1
software. There were one to three HPLC replicate runs per AR177
standard. The limit of quantitation was 25 ng/mL (50 pL injection),
whereas the limit of detection was 5 ng/mL (50 pL injection). The
overall correlation coefficient of the fitted lines on the standard
curve plots was greater than 0.999 on two different standard curves
used in this study. The standard curve was linear over an
approximate 3,200-fold range. The variability of the replicates was
1-2% at all concentrations. There was one HPLC run per monkey
plasma sample. This method was validated. Further details about the
method will be published elsewhere (Wallace et al., submitted).
Pharmacokinetic parameters
The volume of distribution (Vd) was calculated by dividing the
total dose administered by the concentration at the end of the
infusion (Rowland and Tozer, 1995). The C.sub.MAX, (maximum
concentration) was taken from the plasma concentration at the
conclusion of the ten-minute intravenous infusion.
Results/Clinical Observations and Hemodynamic Parameters
Aside from an anticoagulant effect described below, there were no
indications of significant toxicity. No clearly treatment-related
changes in blood pressure (FIG. 41), heart rate (data not shown) or
electrocardiographic activity (data not shown) were observed, no
animals died following AR177 infusion. One high-dose (50 mg/kg)
monkey exhibited a rise in arterial pressure during the infusion
followed by a decline to approximately 20-30 mm Hg below the
pre-infusion blood pressure. These changes are qualitatively
similar to, but less pronounced, than those seen in monkeys given
total phosphorothioateoligonucleotides (Galbraith et al., 1994).
Although suggestive of a treatment effect, the alterations in blood
pressure in the subject animal could not be clearly distinguished
from normal fluctuations that occurred in other animals, including
one control monkey. The only treatment related clinical sign was
emesis during the infusion, which occurred in two of the three
animals in the 50 mg/kg group and all of the monkeys that received
the 20 mg/kg dose.
Serum Chemistry
There were no changes in any of the serum chemistry parameters that
could be attributed to AR177.
Hematology
There were no changes in hematology values attributable to AR 177.
Neutrophil counts were increased to a similar extent in all groups,
including the saline control group, probably as a result of the
stress associated with the experimental procedure (FIG. 42). The
characteristic neutropenia and rebound neutrophilia that has been
reported with other oligonucleotides did not occur in the
AR177-treated monkeys, which is consistent with the relatively
small changes in complement Bb split product (FIG. 44) and CH50
(FIG. 45) levels.
Coagulation parameters
The most salient effect of AR177 observed in this study was a
pronounced, albeit transient, dose-dependent, reversible
prolongation of aPTT in the 20 and 50 mg/kg groups, which reflected
inhibition of the intrinsic coagulation pathway. There was at least
a four-fold prolongation of aPTT in the 20 and 50 mg/kg dose groups
at the conclusion of the infusion of AR177. Determination of the
upper aPTT value was limited by the range of the assay. (See FIG.
43). This change was reversible in both dose groups. The aPTT was
increased beyond the upper limit of the assay in the 50 mg/kg group
for all or most of the two-hour monitoring period, but had returned
to normal by the following day. Baseline aPTT values were
reestablished by two hours after termination of dosing with the 20
mg/kg dose. In the 5 mg/kg group, only a small and transient rise
in aPTT was observed, and there was no change in prothrombin time
(PT). Similar changes have been observed with other
oligonucleotides, and are believed to be, at least in part,
attributable to direct and reversible binding of the
oligonucleotide to thrombin (Henry et al., 1994, Pharmaceutical
Res. 11: S353, 1994). PT was affected to a much lesser extent than
aPTT in the 20 and 50 mg AR177/kg groups (data not shown),
indicating little or no effect on the extrinsic pathway.
Complement activation
Plasma levels of the complement split product Bb, a marker for
activation of the alternative pathway, were increased 60-85% over
baseline in the 5 mg/kg group, approximately 2-fold over baseline
in the 20 mg/kg group, and approximately 2- to 4-fold in the 50
mg/kg group at the end of infusion. (See FIG. 44). The elevation in
Bb persisted through the duration of the 2-hour monitoring period,
but the values had returned to normal by the following day. These
increases in Bb were small in magnitude. There were also small and
transient decreases in the CH50 levels (FIG. 45) in the 20 and 50
mg/kg doses, but there was no dose-CH50 level relationship. In
confirmation of this minimal change in CH50, AR177 had no effect on
complement CH50 at doses up to 236 .mu./mL when it was tested in
vitro in human or cynomolgus monkey plasma. (See below). Thus, a
large increase in complement activation, and resulting
characteristic neutropenia and rebound neutrophilia, that has been
reported with other oligonucleotides (Galbraith et al., 1994) did
not occur in the AR177-treated monkeys (FIG. 42).
Plasma AR177 concentration
Plasma concentrations of AR177 were maximal at the end of the
infusion and declined thereafter with an approximate initial
half-life of 20-30 minutes (FIG. 46). Another more complete study
in cynomolgus monkeys has shown the terminal half-life to be
approximately 24 hours (See below). These half-lives are much
longer than that reported by Lee et al. ((1995) Pharnaceut. Res.
12:1943-1947) in cynomolgus monkeys for GS-522, a 15 mer
oligonucleotide that has a tetrad structure similar to AR177. No
metabolites of AR 177 could be observed in the plasma at any time
point or dose. This contrasts with the results of Lee et al.
(1995), who found significant amounts of shorter species of GS522
in monkey plasma following intravenous infusion. The results with
AR177 suggest that AR177 does not undergo metabolism. There was a
direct relationship between the AR177 plasma Cmax and the dose that
was administered as a ten-minute intravenous infusion to the
monkeys (FIG. 45). Plasma Cmaxs of 83.2+/-7.2, 397.8 +/-30.8, and
804.7+/-226.3 .mu.g/mL were achieved for the 5, 20, or 50 mg/kg
doses, respectively, at the end of the infusion (+10 minute time
point) (Table E-2; FIG. 47).
The initial volume of distribution (Vd) of the three doses ranged
from 200-248 mL (mean +s.d.) (Table E-2) at the conclusion of the
intravenous infusion. The mean body weight of the monkeys in the
AR177 dose groups was 3.67 kg. Assuming that plasma volume is 4% of
body weight (Davies and Morris, 1993, Pharmaceutical Res. 10:
1093-1095), the plasma volume would be 147 mL. Thus, the initial Vd
was slightly greater than the plasma volume.
In general, there was a direct relationship between the plasma
concentration of AR177 and aPTT Atomated Partial Thromboplastin
Time for the 5 (FIG. 48) and 20 (FIG. 49) mg/kg doses. For the 50
mg/kg dose (FIG. 50), the aPTT values were off-scale during the
two-hour sampling period so it was not possible to determine the
relationship between the plasma concentration and aPTT. There was a
no effect plasma AR177 concentration versus aPTT of approximately
60-100 ug AR177/mL, above which there was prolongation of aPTT.
Doubling of aPTT was observed at plasma AR177 concentrations of
approximately 100-250 ug AR177/mL. Tripling of aPTT was observed at
plasma AR177 concentrations of approximately 250-300 fig AR177/mL,
after which no correlation was possible because the aPTT values
were beyond the aPTT assay range. The disappearance of AR177 from
plasma was roughly correlated with the return of the aPTT to
baseline, which is consistent with direct and reversible binding of
the oligonucleotide to one or more clotting factors. By contrast,
there did not appear to be a correlation between the plasma
concentration of AR177 and complement split product Bb (data not
shown).
In addition to the in vivo study in cynomolgus monkeys, an in vitro
study was performed which investigated the effect of AR177 on the
coagulation- cascade and complement activity in cynomolgus monkey
and human plasma (coagulation) and serum (complement),
respectively. AR177 caused a two-fold increase in aPTT at a
concentration between 30 and 59 .mu.g/mL of human plasma, whereas
the compound caused a two-fold increase in aPTT at a concentration
between 118 and 236 .mu.g/mL of cynomolgus monkey plasma in vitro.
AR177 had no effect on thrombin time in human plasma, but caused
approximately a 2.5-fold increase in thrombin time in cynomolgus
monkey plasma at 236 .mu.g/mL. AR177 had no effect on either
fibrinogen or complement CH50 at doses up to 236 ug/mL in human or
cynomolgus monkey plasma. AR177 caused a 30% increase in
prothrombin time in human plasma and approximately a 15% increase
in prothrombin time in cynomolgus monkey plasma at 236
.mu.g/mL.
Discussion
Using an identical dosing regimen to that used in previous
experiments that resulted in profound hemodynamic effects, the
present study showed that AR177 was very safe. Although limited
conclusions can be drawn from the present study because only one
partial phosphorothioate (AR177) was examined, it is possible that
the lack of the cardiovascular toxicity is due to the limited
number of phosphorothioate linkages (two) in AR177. It is also
speculated that the lack of toxicity could be due to the
three-dimensional (i.e. tetrad) shape of AR177 (Rando et al., 1995,
J. Biol. Chem. 270: 1754-1760). In confirmation of the lack of
toxicity of AR177 found in the present study, AR177 does not cause
toxicity when it is administered as a bolus intravenous injection
to cynomolgus monkeys every other day at 40 mg/kg for a total of 12
doses (see below).
There was minimal activation of the complement system following
administration of AR177. Small increases (2-4 fold) in plasma Bb
levels occurred at plasma AR177 concentrations as high as 750
.mu./mL after a dose of 50 mg/kg given as a ten-minute intravenous
infusion. Minimal changes (-25%) in the CHX levels occurred at
plasma AR177 concentrations as high as 750 .mu.g/mL after a dose of
50 mg/kg given as a ten-minute intravenous infusion. The complement
activation that was seen with AR177 at these high doses did not
even result in hypotension. By contrast, Galbraith et al. (1994)
have reported that GEM91, a 25-mer phosphorothioate
oligonucleotide, caused an 80% decrease in complement CH50, a 700%
increase in the level of complement C5a, and death in two out of
four monkeys following the intravenous infusion of 20 mg/kg over
ten minutes. The mechanism by which oligonucleotides activate the
complement system is unknown. However, this phenomenon bears
resemblance to a similar phenomenon in human patients during
dialysis in which contact between blood and dialyser membrane
induces complement activation and profound neutropenia (Heierli et
al., 1988, Nephrol. Dial. Transplant 3: 773-783; Jacobs et al.,
1989, Nephron 52: 119-124). The present work indicates that
although AR177 induces some minimal complement activation, this is
not translated into the hemodynamic toxicity that has been seen
with other oligonucleotides.
AR177 administration resulted in the dose-dependent inhibition of
the intrinsic coagulation pathway, reflected by prolongation of
aPTT. The effect was maximal at the end of infusion and was
reversed in parallel with clearance of AR177 from plasma. The
inhibition of coagulation was significant at the highest dose
level, but marginal and not considered clinically significant at
the 5 mg/kg dose level. An anticoagulant effect has been reported
to be a class effect of oligonucleotides (Henry et al., 1994). The
anticoagulant results with AR177 thus agree with results that have
been seen with other oligonucleotides, although AR177 is 40-fold
less potent than the thrombin-binding aptamer oligonucleotide that
has been reported by Griffin et al. (1993).
In conclusion, AR177 does not cause mortality, cardiovascular
toxicity, or alterations in clinical chemistry in cynomolgus
monkeys receiving doses up to 50 mg/kg as a ten-minute intravenous
infusion. However, there was a reversible prolongation of
coagulation time at doses of 20 and 50 mg/kg. Taken together, the
data suggest that AR 177 does not have the hemodynamic toxicities
that are associated with total phosphorothioate oligonucleotides,
and can be administered safely as an intravenous infusion over ten
minutes.
TABLE E-1 Monkey Dosing Information Dose Monkey Dose level Dose
Conc. volume weight (kg) Group Treatment (mg/kg) (mg/mL) (mL/kg)
Male Female mean .+-. s.d. 1 Placebo 0 0 4.0 1 2 3.67 .+-. 0.38 2
AR177 5 1.25 4.0 2 1 4.12 .+-. 0.83 3 AR177 20 5.0 4.0 2 1 3.67
.+-. 0.29 4 AR177 50 4.0 4.0 1 2 3.23 .+-. 0.76
Table E-1 - Monkey dosing information
Cynomolgus monkeys were given ten-minute, intravenous infusions of
5, 20 or 50 mg AR177/kg at a volume of 4 mL/kg.
TABLE E-2 Plasma AR177, Vd, aPTT and complement Bb values at
C.sub.MAX Dose AR177 plasma a PTT Bb (mg/kg) (.mu.g/mL) Vd (mL)
(seconds) (.mu.g/mL) 5 83.2 .+-. 7.2 247.6 .+-. 21.4 45.9 .+-. 11.4
0.59 .+-. 0.07 20 397.8 .+-. 30.8 184.5 .+-. 14.3 >166.8 .+-.
23.8 1.48 .+-. 0.44 50 804.7 .+-. 226.3 200.7 .+-. 56.4 >170.0
.+-. 34.6 1.28 .+-. 0.46
Table E-2 - Plasma AR177 Cm, x, aPTT and complement Bb levels
The AR177 plasma C.sub.MAX, aPTT, and Bb values are the means .+-.
standard deviations of data at the +10 minute tune point (end of
the infusion). The baseline (10 minutes prior to dosing) aPTT
levels were 32.1.+-.4.4, 41.6, 6.7 and 33.2.+-.4.8 seconds for the
5, 20, and 50 mg/kg doses, respectively (mean .+-.s.d.). The
baseline (10 minutes prior to dosing) Bb levels were 0.44.+-.0.14,
0.78.+-.0.46 and 0.49.+-.0.21 .mu./mL for Me 5, 20, and 50 mg/kg
doses. Volume of distribution (Vd)=dose/plasma C.sub.MAX, where the
dose is the total mg of AR177.
Serum Chemistry Values Pre-dose 60 min 24 hr Pre-dose 60 min 24 hr
Group Alkaline phosphatase (Units/L) Group Lactate deyhdrogenase
(Units/L) Saline 315.0 .+-. 21.6 293.3 .+-. 209.3 314.0 .+-. 234.7
Saline 340.0 .+-. 190.7 337.3 .+-. 133.1 1138.3 .+-. 1248.1 5 mg/kg
257.7 .+-. 141.8 256.7 .+-. 142. 344.7 .+-. 195.1 5 mg/kg 228.7
.+-. 14.8 219.3 .+-. 11.9 799.0 .+-. 528.7 20 mg/kg 269.3 .+-.
157.3 245.0 .+-. 121.5 238.0 .+-. 136.0 20 mg/kg 266.0 .+-. 74.
242.7 .+-. 61.5 583.3 .+-. 177.4 50 mg/kg 143.0 .+-. 21.1 140.0
.+-. 33.8 149.3 .+-. 28.7 50 mg/kg 203.3 .+-. 7.1 189.3 .+-. 19.7
409.7 .+-. 18.6 Asparate aminotransferase (Units/L) Alanine
aminotransferase (Units/L) Saline 36.3 .+-. 16.7 36.7 .+-. 10.0
193.7 .+-. 188.9 Saline 49.3 .+-. 27.5 42.7 .+-. 23.8 93.3 .+-.
55.3 5 mg/kg 35.0 .+-. 7.5 31.7 .+-. 7.6 258.0 .+-. 218.4 5 mg/kg
27.7 .+-. 3.5 27.0 .+-. 4.0 148.3 .+-. 136.9 20 mg/kg 48.7 .+-. 6.8
51.0 .+-. 12.3 119.7 .+-. 22.6 20 mglkg 56.3 .+-. 34.0 49.3 .+-.
30.0 97.3 .+-. 19.9 50 mg/kg 39.7 .+-. 16.5 41.7 .+-. 20.2 128.3
.+-. 21.2 50 mg/kg 31.3 .+-. 7.4 30.3 .+-. 10.3 62.7 .+-. 7.6 Urea
nitrogen (mg/dL) Creatinine (mg/dL) Saline 20.7 .+-. 1.5 20.7 .+-.
2.3 23.7 .+-. 2.5 Saline 0.90 .+-. 0.45 0.63 .+-. 0.12 0.90 .+-.
0.10 5 mg/kg 16.7 .+-. 0.6 17.0 .+-. 1.0 20.7 .+-. 3.1 5 mg/kg 0.63
.+-. 0.06 0.60 .+-. 0.00 0.97 .+-. 0.06 20 mg/kg 21.7 .+-. 2.9 21.7
.+-. 2.1 27.3 .+-. 0.6 20 mg/kg 0.67 .+-. 0.05 0.67 .+-. 0.15 0.83
.+-. 0.15 50 mg/kg 14.7 .+-. 3.5 15.7 .+-. 2.5 25.0 .+-. 6.6 50
mg/kg 0.50 .+-. 0.10 0.53 .+-. 0.06 0.67 .+-. 0.15 Serum chemistry
was evaluated at pre-dose, and 1 and 24 hours following initiation
of intravenous AR177 infusion. Values represent the mean .+-. s.d.
of 3 monkeys. Pre-dose 10 min 20 min 40 min 60 min 120 min 24 hr
Group White blood cells (10.sup.3 /mm.sup.3) Saline 14.1 .+-. 40
13.6 .+-. 3.3 13.9 .+-. 3.0 14.2 .+-. 2.7 14.0 .+-. 2.0 17.8 .+-.
2.2 21.1 .+-. 2.0 5 mg/kg 9.3 .+-. 1.0 9.2 .+-. 2.3 9.5 .+-. 1.7
9.8 .+-. 1.2 8.6 .+-. 3.0 11.3 .+-. 2.7 13.2 .+-. 0.2 20 mg/kg 8.1
.+-. 1.7 12.3 .+-. 0.3 12.0 .+-. 0.6 11.5 .+-. 2.2 11.8 .+-. 02.2
14.9 .+-. 0.7 14.4 .+-. 5.5 50 mg/kg 6.7 .+-. 1.4 11.8 .+-. 1.7
10.9 .+-. 0 11.6 .+-. 3.1 13.8 .+-. 1.9 21.3 .+-. 4.0 13.2 .+-. 0.8
Lymphocytes (10.sup.3 /mm.sup.3) Saline 8.2 .+-. 1.5 7.9 .+-. 1.7
8.4 .+-. 1.0 8.8 .+-. 0.2 9.2 .+-. 0.5 7.7 .+-. 1.5 11.6 .+-. 5.3 5
mg/kg 6.2 .+-. 0.8 5.6 .+-. 10 6.5 .+-. 0.3 6.8 .+-. 1.1 5.7 .+-.
1.6 5.9 .+-. 0.8 5.5 .+-. 1.6 20 mg/kg 5.0 .+-. 1.3 8.5 .+-. 0.3
8.3 .+-. 0.5 8.8 .+-. 1.9 8.5 .+-. 1.5 7.9 .+-. 1.2 5.3 .+-. 2.5 50
mg/kg 4.1 .+-. 1.0 7.6 .+-. 0.7 7.7 .+-. 1.5 8.0 .+-. 1.1 10.5 .+-.
0.4 10.9 .+-. 1.9 5.3 .+-. 2.4 Monocytes (10.sup.3 /mm.sup.3)
Saline 0.54 .+-. 0.25 0.71 .+-. 0.17 0.62 .+-. 0.20 0.58 .+-. 0.20
0.59 .+-. 0.43 0.98 .+-. 0.53 1.64 .+-. 1.06 5 mg/kg 0.37 .+-. 0.09
0.36 .+-. 0.22 0.35 .+-. 0.13 0.45 .+-. 0.06 0.36 .+-. 0.21 0.52
.+-. 0.30 1.37 .+-. 1.00 20 mg/kg 0.24 .+-. 0.05 0.66 .+-. 0.32
0.59 .+-. 0.30 0.31 .+-. 0.15 0.60 .+-. 0.17 0.59 .+-. 0.30 0.99
.+-. 0.59 50 mg/kg 0.16 .+-. 0.09 0.94 .+-. 0.69 0.33 .+-. 0.15
0.32 .+-. 0.18 0.32 .+-. 0.23 0.75 .+-. 0.48 0.53 .+-. 0.35
Platelet (10.sup.3 mm.sup.3) Saline 266.8 .+-. 41.9 251.3 .+-. 28.3
258.0 .+-. 47.8 262.3 .+-. 51.7 270.0 .+-. 47.6 278.0 .+-. 46.5
183.7 .+-. 124.5 5 mg/kg 297.3 .+-. 34.4 362.3 .+-. 5.8 369.7 .+-.
14.6 367.3 .+-. 52.9 371.7 .+-. 44.5 292.3 .+-. 33.0 383.0 20 mg/kg
272.3 .+-. 45.8 172.0 178.0 173.0 .+-. 48.1 206.0 .+-. 48.1 258.3
.+-. 29.0 158.7 .+-. 132.4 50 mg/kg 329.3 .+-. 70.8 UA UA 144.0 UA
278.0 .+-. 151.3 325.3 .+-. 105.6 Hematology was evaluated at
pre-dose, at 10, 20, 40, 60 and 120 minutes and 24 hours following
initiation of intravenous AR177 infusion. Values represent the mean
.+-. s.d. of 2 to 3 monkeys. UA = sample unavailable. Red Blood
Cell, Hemoglobin and Hematocrit Values Red blood cells (10.sup.6
/mm.sup.3) Saline 5.7 .+-. 0.4 5.4 .+-. 0.4 5.3 .+-. 0.4 5.3 .+-.
0.4 5.2 .+-. 0.5 5.2 .+-. 0.6 4.7 .+-. 0.6 5 5.1 .+-. 0.5 4.9 .+-.
0.4 5.1 .+-. 0.6 5.1 .+-. 0.5 5.1 .+-. 0.5 5.0 .+-. 0.5 4.7 .+-.
0.4 20 5.5 .+-. 0.4 5.1 .+-. 0.4 5.4 .+-. 0.2 5.2 .+-. 0.2 4.9 .+-.
0.3 5.0 .+-. 0.3 4.0 .+-. 0.8 50 5.3 .+-. 0.4 5.1 .+-. 0.3 5.4 .+-.
0.1 4.9 .+-. 0.6 5.1 .+-. 0.4 4.9 .+-. 0.8 3.7 .+-. 1.0 Hemoglobin
(g/dL) Saline 13.9 .+-. 1.6 13.1 .+-. 1.3 13.1 .+-. 1.4 13.2 .+-.
1.4 128 .+-. 1.9 12.6 .+-. 2.0 11.7 .+-. 1.6 5 12.3 .+-. 0.8 11.7
.+-. 0.5 12.1 .+-. 0.7 12.2 .+-. 0.5 12.1 .+-. 0.7 12.0 .+-. 0.8
11.3 .+-. 0.4 20 12.8 .+-. 0.9 12.3 .+-. 0.7 12.7 .+-. 0.9 12.1
.+-. 0.3 11.6 .+-. 0.5 11.9 .+-. 0.7 9.5 .+-. 1.7 50 12.7 .+-. 0.9
12.7 .+-. 0.7 13.1 .+-. 0.0 12.1 .+-. 1.2 12.6 .+-. 0.8 12.1 .+-.
1.7 0.2 .+-. 2.4 Hematocrit (%) Saline 42.1 .+-. 4.4 40.2 .+-. 2.5
39.9 .+-. 3.6 40.3 .+-. 3.6 39.6 .+-. 4.2 39.0 .+-. 5.4 35.6 .+-.
5.1 5 37.8 .+-. 2.0 35.8 .+-. 1.6 37.1 .+-. 2.1 37.5 .+-. 1.3 37.1
.+-. 20 36.5 .+-. 1.9 34.1 .+-. 0.4 20 39.6 .+-. 2.9 37.5 .+-. 2.2
39.3 .+-. 2.7 37.4 .+-. 1.0 35.8 .+-. 1.3 36.6 .+-. 1.9 29.2 .+-.
5.4 50 39.8 .+-. 2.2 393. .+-. 1.7 40.4 .+-. 0.4 37.5 .+-. 3.2 38.9
.+-. 2.3 37.3 .+-. 5.1 28.1 .+-. 6.9 Hematology was evaluated at
pre-dose, at 10, 20, 40, 60 and 120 minutes and 24 hours following
initiation of intravenous AR177 infusion. Values represent the mean
.+-. s.d. of 3 monkeys.
F. Repeat-dose toxicity and pharmacokinetics of a partial
phosphorothioate anti-HIV oligonucleotide (AR177) following bolus
intravenous administration to cynomolgus monkeys
AR177 is a 17-mer partial phosphorothioate oligonucleotide with the
sequence 5'GTGGTGGGTGGGTGGGT-3' (SEQ. ID. NO. 33), with sulfurs at
the terminal internucleoside linkages at the 3' and 5' ends. It is
a potent inhibitor of HIV integrase and HIV production in vitro
(Rando et al., 1995; Ojwang et al., 1995), and has a long tissue
half-life in rodents (unpublished data). AR177 does not have an
antisense- or triplex-based mechanism of action. A previous study
has shown that AR177 does not cause the characteristic hypotension
or neutropenia of other oligonucleotides (Cornish et al., 1993;
Galbraith et al., 1994) following a ten-minute intravenous
infusion, at doses up to 50 mg/kg (Wallace et al., submitted,
1996). As part of the pre-clinical assessment of AR177, an
intravenous toxicity study of AR177 was conducted in cynomolgus
monkeys with the objective of establishing the clinical and
histopathological changes that occur following repeated doses.
Materials and Methods for Repeat Dose Studies
Materials
For HPLC analysis of plasma AR177 concentrations, tris was obtained
from Fisher, NaBr and NaCl were obtained from Sigma, and methanol
was purchased from J. T. Baker. The Gen-Pak Fax anion-exchange HPLC
column (4.6.times.100 mm, cat. no. #15490) was purchased from
Waters.
AR177 was synthesized at Biosearch, a division of PerSeptive
Biosystems, on a Milligen 8800 oligonucleotide synthesizer, and
vialed at 25 mg/mL in phosphate buffered saline. AR177 has a
molecular weight of 5793, and is a fully neutralized sodium salt.
The structure of AR177 was characterized by phosphorus and proton
NMR, sequencing, base composition, laser Resorption mass
spectrometry, anion exchange HPLC and polyacrylamide gel
electrophoresis. All analyses were consistent with the proposed
structure. The AR177 was approximately 94% pure according to HPLC
and electrophoresis analysis.
The monkeys used in this study were laboratory bred (C.V. Primates,
Indonesia or Yunnan National Laboratory, China) and were
experimentally naive prior to the study. The age of the monkeys was
3 to 61/2 years.
Dosing
AR177 was administered intravenously over 1-2 minutes into
unsedated monkeys every other day for 23 days (12 doses) by
injection into the femoral vein. (See Table E-1). The monkeys were
not sedated, but were restrained during dosing. The highest dose
level (40 mg/kg/injection) was selected based on observations in a
previous single-dose study of pronounced anticoagulant activity of
AR177 at a dose of 50 mg/kg infused over 10 minutes (Wallace et
al., submitted). A comparable or greater degree of anticoagulation
was expected to occur with fast (1-2 minute) infusion of 40 mg/kg,
and was confirmed by the results of this study. The dosing schedule
(every other day) was chosen in order to avoid excessive
accumulation of the test material, which, based on pharmacokinetic
data obtained in rats (Wallace et al., submitted), would be
expected to occur with daily administration.
The monkeys were observed twice daily for general health, changes
in appetite and clinical signs of adverse events. Body weights were
measured within a few days prior to the first dose (Day 1) and
approximately weekly thereafter. Electrocardiographic (ECG)
recordings were obtained from all animals prior to the study and on
Day 22, and from recovery animals on Day 35. Blood samples were
collected for evaluation of serum chemistry, hematology and
coagulation parameters from all animals prior to the initiation of
the study, on the first day of dosing (Dose 1; Day 1), and on the
last day of dosing (Dose 12; Day 23). The sample collection on Days
1 and 23 was timed relative to dose administration in order to
characterize possible acute effects on hematology parameters. An
additional clinical pathology evaluation was conducted for all
animals on Day 24, as well as for recovery animals on Day 37. Blood
was collected from all animals at 5 minutes, 30 minutes and 4 hours
post-dosing on Days 1 and 23 for analysis of the plasma AR177
concentration.
On Day 25 (two days after the last dose), three males and three
females from each group were humanely euthanized and necropsied,
while the remaining two animals each in the high-dose and control
groups were continued on study for an additional two-week
treatment-free "recovery" period, and were euthanized on Day 38.
Complete gross necropsies were performed on all animals at their
scheduled termination. Urine was collected from each animal during
necropsy by bladder puncture and submitted for routine urinalysis.
Weights of 13 major organs were recorded, and numerous tissues were
collected, preserved and processed for histology.
Serum chemistry parameters
Serum chemistry was determined pre-study, on day 24 (one day after
the 12th dose), and on day 37 in the recovery monkeys. The
following were determined: sodium, potassium, chloride, carbon
dioxide, total bilirubin, direct bilirubin, indirect bilirubin
alkaline phosphatase, lactate dehydrogenase, aspartate
aminotransferase, alanine aminotransferase,
gammaglutamyltransferase, calcium, phosphorus, glucose, urea
nitrogen, creatinine, uric acid total protein, albumin, globulin,
cholesterol and triglycerides. Serum chemistry was determined at
Sierra Nevada Laboratories (Reno, Nev.).
Hematology and coagulation parameters
Hematology and coagulation parameters were determined 9-11 days
prior to the start of the study, just prior to administering doses
1 (day 1) and 12 (day 23), five minutes after dosing (coagulation
only), 30 minutes and 4 hours following dosing, one day after the
12th dose (day 24), and in recovery monkeys at sacrifice (day 37).
The following were determined: red blood cell count and morphology,
total and differential white blood cells, hemoglobin, hematocrit,
prothrombin time, fibrinogen, mean cell hemoglobin, mean
corpuscular volume, mean corpuscular hemoglobin concentration,
platelet count, activate partial thromboplastin time, and D-dimer.
Hematology was determined at Sierra Nevada Laboratories (Reno,
Nev.).
AR177 plasma HPLC analysis
Blood was taken for plasma analysis of AR 177 just prior to, and at
5, 30 and 240 minutes following administration of doses 1 and 12.
The plasma fraction was obtained by low speed centrifugation of
blood, and stored at -20.degree. C. until analyzed for the AR177
concentration. Plasma AR177 concentrations were assayed using an
anion-exchange HPLC method on a Waters HPLC system with a 626 pump,
996 photodiode array detector, 717 autosampler and Millennium
system software controlled by an NEC Image 466 computer. Buffer A
was 0.1 M Tris base, 20% methanol, pH 12, and Buffer B was 0.1 M
Tris base, 1.0 M NaBr, pH 12. anion-exchange column tGen-Pak Fax
column) was equilibrated at 80% buffer A/20% buffer B for 30
minutes before each HPLC run. Fifty microliters of plasma were
analyzed per run. The elusion conditions were: a) five-minute
isocratic run at 80% A/20% B. during which the majority of the
plasma proteins eluted, b) 30-minute linear gradient to 30% A/70% B
during which the AR177 eluted, c) five-minute isocratic run at 30%
A/70% B. d) one minute linear gradient to 100% B. e) two- minute
run at 100% B for initial column cleanup, and fl two-minute linear
gradient to 70% A/30% B for the initial step in the clean-up method
for HPLC column clean-up. The high pH (12) of the elusion buffers
was necessary to dissociate AR177 from tissue constituents, which
bind AR177 tightly around physiological pH. AR177 is completely
stable at pH 12. This method can clearly distinguish between the
full length AR177 and n-1, n-2, etc. species, which are potential
metabolic products. The W detection wavelength was 260 nm. The flow
rate was 0.5 mL/minute in all steps. All runs were performed at
room temperature. Column clean up between runs was performed by a
500 .mu.L bolus injection of 0.1 M Tris base, 2 M NaCl, pH 10.5,
followed by: a) ten-minute linear gradient to 60% A/40% B. b)
one-minute linear gradient to 100% B. c) a three-minute isocratic
run at 100% B and d) one-minute linear gradient to 80% A/20% B.
AR177 was spiked into cynomolgus monkey plasma in order to achieve
concentrations of 0.0635 to 125 .mu.g/mL for the standard curve.
The plasma standards and unspiked plasma (control) were run on the
anion-exchange HPLC column using the above conditions. The Waters
Millennium software was used to determine the area under the peak
for each AR177 standard at 260 nm. The HPLC area versus AR177
concentration was plotted using Cricket Graph m 1.5.1 software.
There were two HPLC replicate runs per AR177 standard. The areas
which represented the lowest concentration were at least two times
the background area at 260 nm. The overall correlation coefficient
of the fitted lines on the standard curve plots was greater than
0.999. There was a linear concentration versus A260 relationship
over a minimum 6,500 fold range. The variability of the replicates
was 1-2%. This method was validated.
Necropsy and histopathology
A complete necropsy was conducted on all monkeys, and included
examination of the external surface of body (body orifices; dosing
site; cranial, nasal, paranasal, thoracic, abdominal and pelvic
cavities), and the external surface of the brain and spinal cord.
The organ weights of the adrenals, epididymies, liver, pituitary,
spleen, thyroids, parathyroids, brain, heart, lungs, prostate,
testes, uterus, cervix, kidney, ovaries, seminal vesicles, and
thymus were recorded.
A histopathological assessment was made of 46 hematoxylin and
eosin-stained tissues by a veterinary pathologist. These included
tissues from the cardiovascular, digestive, respiratory,
urogenital, lymphoid/hematopoietic, skin/musculoskeletal and
nervous systems, and all major organs.
Results
Clinical observations
No animals died during the course of the study, and there were no
effects on body weight. The only treatment-related clinical sign
was an incidence of discoloration around the eyes in three
high-dose animals, which occurred on only one occasion (Day 16 or
18) for two of the animals, and on four consecutive days (Days
18-21) in the third animal. The latter monkey also had swelling
around the eyes on Day 18. The reaction was transient and was
limited to the high-dose group.
ECG, clinical chemistry, urinalysis and hematology
No abnormalities in the ECG recordings were noted, and there were
no treatment-related changes in serum chemistry or urinalysis
parameters. The only changes in hematology parameters considered
possibly treatment-related were an acute and transient increase in
lymphocytes in the high-dose group, and an acute decrease in
eosinophils which was seen in all groups, but appeared to be more
pronounced in the AR177-treated groups. Both of these changes were
observed shortly following dosing on Days 1 and 23 (i.e., those
days when clinical pathology was evaluated at several time points
post-dosing), but were largely absent on Day 24 (one day after the
last dose). The values generally remained within the normal range
and were not considered indicative of significant toxicity.
Necropsy and Histopathology
No clearly treatment-related histopathologic changes were seen in
any organs or tissues, and no effects on organ weight were evident.
Eosinophilic material was seen in a few tubules in the medullary
area of the kidneys of three monkeys in the high dose group on day
25, but was not seen in the controls or in the recovery animals.
Although this may be treatment-related, eosinophilic material can
sometimes be observed in the renal tubules of healthy, untreated
monkeys.
Plasma AR177 concentration
FIG. 51 shows that there was no difference between the AR177 plasma
concentrations that were achieved after the first and twelfth
(last) doses at either 2.5, 10 or 40 mg/kg. The plasma
concentration versus time profile of AR177 is shown in FIG. 52. At
the earliest sampling time point (five minutes after initiation of
dosing), maximal plasma levels of 35.79.+-.5.99, 135.43.+-.16.19
and 416.54.+-.54.55 .mu./mL were achieved for dose #1 at 2.5, 10
and 40 mg/kg (FIG. 52). At the earliest sampling time point (five
minutes after initiation of dosing), maximal plasma levels of
33.98+9.98, 113.71.+-.26.55 and 386.39.+-.70.29 .mu./mL were
achieved for dose #12 at 2.5, 10 and 40 mg/kg. The decay kinetics
of the 2.5 mg/kg dose appeared to be different than the decay
kinetics of the 10 and 40 mg/kg doses after either dose 1 (FIG.
52), although no definite conclusions can be drawn because of the
limited number of time points. No metabolites (i.e. n-1, n-2, etc.)
could be observed in the plasma at any time or any dose. This
confirms results in rats showing no metabolism of AR177 (Wallace et
al., submitted).
Coagulation parameters
Dose-dependent anticoagulant activity was manifested at the 10
(FIG. 54) and 40 (FIG. 55) mg/kg doses, whereas there was no
anticoagulant activity following the 2.5 mg/kg dose (FIG. 53). This
activity was evident from the prolongation of activated partial
thromboplastin time (aPTT), which reflects a primary effect on the
intrinsic coagulation pathway. Following both the 1st and 12th
doses, mean aPTT in the 10 mg/kg group was increased to
approximately twice the pre-dose value by 5 minutes post-dosing,
but had returned to baseline levels by four hours. Following both
the 1st and 12th doses, mean aPTT in the 40 mg/kg group exceeded
the upper limit of the assay five minutes after dosing. By 30
minutes post-dosing, aPTT values in the 40 mg/kg group had declined
to approximately 2 to 4-fold above the pre-dose level. By four
hours, the aPTT had returned to the pre-dose levels in all but one
monkey.
The relationship between the AR177 plasma concentration and aPTT is
also shown in FIGS. 53, 54, and 55 for doses 2.5, 10, and 40 mg/kg,
respectively. There was a no effect plasma AR177 concentration
versus aPTT of approximately 60-100 .mu.g AR177/mL, above which
there was prolongation of aPTT. Doubling of aPTT was observed at
plasma AR177 concentrations of approximately 100-220 .mu.g
AR177/mL. Tripling of aPTT was observed at plasma AR177
concentrations of approximately 220-300 .mu.g AR177/mL, after which
no correlation was possible because the aPTT values were off-scale.
There was no change in aPTT after the first or twelfth doses of 2.5
mg/kg (FIG. 53), since the AR177 plasma concentration did not reach
the threshold of approximately 60-100 .mu.g/mL. There was a maximal
two-fold increase in aPTT after the first or twelfth 10 mg/kg doses
(FIG. 54). The elimination kinetics of AR177 and the return of aPTT
to baseline levels were similar after the first or twelfth
doses.
Discussion
These results indicate that AR177, administered as bolus
intravenous injections up to 40 mg/kg every other day for 12 doses,
did not cause mortality, histopathological or cardiovascular events
that have been described for other oligonucleotides (Galbraith et
al., 1994; Srinivasan and Iversen, 1995). The only significant
change that was observed was a prolongation of aPTT, which was
reversible. To our knowledge, this is the first oligonucleotide
that has not been observed to cause liver and kidney toxicity
following intravenous administration.
The structure of AR177 may contribute to its lack of general
toxicity. AR177 contains only two phosphorothioate bonds at the 3'
and 5' termini. These phosphorothioate bonds were designed to help
prevent endonuclease-induced cleavage of AR177. We speculate that
the small number of sulfurs may have reduced the propensity to bind
to proteins, a phenomenon that has been observed for full
phosphorothioates, which has been speculated to cause toxicity
(Srinivasan and Iversen, 1995). AR177's three-dimensional shape may
also contribute to its lack of toxicity. AR177 has been shown to
form a structure in which hydrogen bonds form between
deoxyguanosine residues to create a "G-tetrad" (Rando et al.,
1995). This tetrad structure imparts a compact shape which makes it
resistant to degradation (Bishop et al., 1996) and may make it
relatively non-toxic by minimizing reactive sites. The resistance
to degradation has been noted in single and repeat dose
pharmacokinetics studies in rodents (Wallace et al., submitted),
and in a more complete pharmacokinetic study in cynomolgus monkeys
which showed a terminal plasma half-life of greater than 24 hours
(data not shown).
The results of the AR177 plasma analysis demonstrated that there
was no difference between the AR177 plasma concentrations that were
achieved after the first or twelfth (last) doses of 2.5, 10 or 40
mg/kg. These results can be interpreted to mean that AR177 does not
induce metabolic enzymes that would, if they were induced, reduce
the concentration of AR177 by increasing its metabolism. This has
the important implication that repeat doses of AR177, at least when
given every other day for 23 days, will not result in
pharmacokinetic tolerance.
The results of the AR177 plasma analysis demonstrated that there
was a close relationship between the AR177 plasma concentration and
aPTT. There was a no effect plasma AR177 concentration versus aPTT
of approximately 60-100 .mu.g AR177/mL, above which there was
prolongation of aPTT. The ability to prolong coagulation has been
noted to be a feature of other oligonucleotides (Bock et al., 1992;
Henry et al., 1994). An oligonucleotide composed of deoxyguanosines
and thymidines has been described that binds to thrombin (Paborsky
et al., 1993), demonstrates sequence dependent inhibition of
coagulation in vitro (Bock et al. 1992), has a G-tetrad structure
(Wang et al., 1993), and is active as a short acting anticoagulant
in vivo (Griffin et al., 1993; DeAnda et al., 1994). The structure
of the oligonucleotide, (GGTTGGTGTGGTTGG) bears some resemblance to
AR177 (GTGGTGGGTGGGTGGGT). Both oligonucleotides form G-tetrad
structures. A comparison of the anticoagulant properties of these
oligonucleotides indicates that the oligonucleotide is
approximately 10-100 times more potent than AR177. An examination
of the anti-HIV properties of the oligonucleotide showed that it
had little or no anti-HIV activity (unpublished data). Thus,
although both oligonucleotides are composed of deoxyguanosines and
thymidine, and form G-tetrads, they have distinct biological
properties.
In conclusion, administration of up to 40 mg/kg of AR177 to
cynomolgus monkeys by bolus intravenous injection every other day
for 23 days was well tolerated. No mortality or clinical signs of
significant toxicity occurred. The most salient alteration in
clinical pathology parameters was the prolongation of aPTT in the
10 and 40 mg/kg groups, which reflects inhibition of the intrinsic
coagulation pathway. The approximate doubling of aPTT observed in
the middle-dose group (10 mg/kg) is considered to be marginally
clinically significant following bolus intravenous injection. The
severe inhibition of coagulation in the 40 mg/kg group may not be
dose limiting since aPTT values had returned to baseline levels
fours hours following dosing. It is probable that prolongation of
aPTT at these doses could be circumvented by administering AR177 as
a slow infusion over the course of several hours in order to stay
below the threshold for anticoagulation, which was established to
be 60-100 .mu.g/mL of AR177. The absence of clinical pathology
abnormalities or tissue histopathology at even the highest dose (40
mg/kg) after repeated intravenous administration suggests that
there is little potential for cumulative toxicity with T31077 with
any type of administration.
TABLE F-1 Monkey dosing information Number Dose Dose Dose
sacrificed on: level Conc. volume # of animals Day 25 Day 38 Weight
(kg) Group Treatment (mg/kg) (mg/mL) (ML/kg) Male Female (m/f)
(m/f) mean .+-. s.d. 1 Placebo 0 0 3.2 3 5 3/3 0/2 3.0 .+-. 0.6 2
AR177 2.5 0.781 3.2 3 3 3/3 3.0 .+-. 0.5 3 AR177 10 3.125 3.2 3 3
3/3 3.2 .+-. 0.7 4 AR177 40 12.5 3.2 4 4 3/3 1/1 3.2 .+-. 0.6 Table
1 - Monkey dosing information. Cynomolgus monkeys were given bolus
intravenous injections of AR177 at 2.5, 10 or 40 mg/kg/day at a
constant volume every other day for a total of 12 doses. Control
monkeys received sterile saline. There were 8 monkeys per group,
evenly split between males and females, except for the placebo
group, which inadvertently had an extra female. The main group was
sacrificed on day 25 # following initiation of dosing, which was
two days following the twelfth dose on day 23. Two monkeys in the
placebo and 40 mg/kg groups were in a recovery group. The recovery
group monkeys were sacrificed two weeks (on day 38 after initiation
of dosing) after the other monkeys.
TABLE F-2 Body Weights Group Prestudy Day 7 Day 14 Day 21 Day 25
Day 28 Day 35 Day 38 Saline 3.0 .+-. 0.6 3.1 .+-. 0.6 3.1 .+-. 0.7
3.1 .+-. 0.7 3.3 .+-. 0.6 2.4 .+-. 0.2 2.5 .+-. 0.2 2.5 .+-. 0.2
2.5 3.1 .+-. 0.5 3.1 .+-. 0.6 3.2 .+-. 0.6 3.2 .+-. 0.6 3.1 .+-.
0.6 * * * 10 3.2 .+-. 0.7 3.2 .+-. 0.7 3.3 .+-. 0.7 3.3 .+-. 0.7
3.2 .+-. 0.7 * * * 40 3.2 .+-. 0.6 3.2 .+-. 0.6 3.3 .+-. 0.6 3.2
.+-. 0.6 3.1 .+-. 0.6 3.4 .+-. 0.9 3.5 * 0.9 3.5 .+-. 1.0 * All
monkeys were sacrificed on day 25. Monkeys were weighed at
pre-study and approximately weekly thereafter. The weights listed
for days 28, 35 and 38 are the recovery group monkeys. Values
represent the mean .+-. s.d. of 2-8 monkeys. There were two monkeys
per group in the saline and 40 mg/kg recovery groups, and six
monkeys per group in the non-recovery groups.
TABLE F-3 Serum Chemistry Values Prestudy Day 24 Day 37 Prestudy
Day 24 Day 37 Alkaline phosphatase (Units/L) Lactate dehydrogenase
(Units/L) Saline 426.8 .+-. 194.3 379.4 .+-. 176.7 222.0 .+-. 134.4
Saline 506.4 .+-. 530.6 1091.6 .+-. 1057.1 206.0 .+-. 0.0 2.5 459.0
.+-. 269.9 389.3 .+-. 211.5 * 2.5 432.5 .+-. 218.7 625.5 .+-. 170.2
* 10 19.3 .+-. 237.1 343.5 .+-. 184.3 * 10 460.3 .+-. 246.7 391.0
.+-. 151.0 * 40 355.1 .+-. 194.5 294.6 .+-. 112.7 289.5 .+-. 130.8
40 1985.4 .+-. 3242.6 764.3 .+-. 655.7 169.5 .+-. 20.5 Aspartate
aminotransferase (Units/L) Alanine aminotransferase (Units/L)
Saline 54.1 .+-. 62.1 115.3 .+-. 96.8 28.0 .+-. 7.1 Saline 55.8
.+-. 23.6 62.6 .+-. 27.9 58.5 .+-. 6.4 2.5 59.0 .+-. 56.7 80.5 .+-.
36.9 * 2.5 54.0 .+-. 16.5 65.0 .+-. 15.5 * 10 74.3 .+-. 798.2 54.0
.+-. 15.1 * 10 53.7 .+-. 13.7 41.2 .+-. 6.2 * 40 203.3 .+-. 335.7
160.9 .+-. 127.3 24.0 .+-. 9.9 40 91.3 .+-. 106.7 61.3 .+-. 28.5
30.0 .+-. 57 Blood Urea nitrogen (mg/dL) Creatinine (mg/dL) Saline
16.4 .+-. 4.5 20.3 .+-. 5.9 22.5 .+-. 0.7 Saline 0.79 .+-. 0.14
0.64 .+-. 0.07 0.50 .+-. 0.00 2.5 16.2 .+-. 5.9 22.7 .+-. 5.1 * 2.5
0.78 .+-. 0.17 0.67 .+-. 0.10 * 10 19.0 .+-. 3.2 19.8 .+-. 2.7 * 10
0.73 .+-. 0.05 0.62 .+-. 0.04 * 40 16.1 .+-. 3.9 21.4 .+-. 4.8 17.5
.+-. 4.9 40 0.79 .+-. 0.11 0.71 .+-. 0.11 0.60 .+-. 0.14 Serum
chemistry was evaluated at pre-study, and at days 24 and 37
(recovery monkeys only) following initiation of intravenous AR177
administration. Values represent the mean .+-. s.d. of 2-8 monkeys.
There were two monkeys per group in the saline and 40 mg/kg
recovery groups, and six monkeys per group in the non-recovery
groups.
TABLE F-4 White Blood Cell, Lymphocytes, Monocytes and Platelet
Values Day 1 Day 23 Group Predose 30 min 4 hr Pre-dose 30 min 4 hr
Day 24 Day 37 White blood cells (10.sup.3 /mm.sup.3) Saline 13.4
.+-. 2.8 19.4 .+-. 5.9 17.5 .+-. 5.1 14.8 .+-. 5.3 20.6 .+-. 10.2
18.7 .+-. 5.3 11.1 .+-. 3.1 9.8 .+-. 5.4 2.5 15.7 .+-. 4.3 22.4
.+-. 4.7 18.5 .+-. 4.7 13.6 .+-. 41 18.8 .+-. 9.1 16.2 .+-. 6.4
12.4 .+-. 7.2 * 10 11.1 .+-. 2.7 19.2 .+-. 4.7 20.1 .+-. 4.1 11.4
.+-. 3.2 16.3 .+-. 4.0 19.1 .+-. 5.5 9.1 .+-. 2.5 * 40 16.0 .+-.
1.7 28.1 .+-. 4.5 25.0 .+-. 5.4 12.3 .+-. 2.8 20.1 .+-. 5.6 20.2
.+-. 6.0 8.9 .+-. 2.7 15.4 .+-. 6.2 Lymphocytes (10.sup.3
/mm.sup.3) Saline 9.4 .+-. 3.3 7.0 .+-. 1.8 58 .+-. 1.7 7.6 .+-.
3.4 7.0 .+-. 3.8 5.0 .+-. 1.0 5.4 .+-. 1.7 4.7 .+-. 1.2 2.5 9.4
.+-. 3.8 7.0 .+-. 3.0 6.3 .+-. 2.4 7.6 .+-. 2.3 7.2 .+-. 4.0 5.1
.+-. 3.1 5.7 .+-. 2.5 * 10 7.0 .+-. 2.4 9.7 .+-. 2.6 6.9 .+-. 2.0
6.2 .+-. 2.5 6.6 .+-. 1.9 4.4 .+-. 2.0 4.9 .+-. 1.4 * 40 10.6 .+-.
2.1 13.8 .+-. 3.4 6.9 .+-. 1.4 7.4 .+-. 2.5 11.3 .+-. 4.9 5.8 .+-.
1.9 4.6 .+-. 1.5 8.7 .+-. 5.3 Monocytes (10.sup.3 /mm.sup.3) Saline
0.35 .+-. 0.25 0.69 .+-. 0.64 1.00 .+-. 0.28 0.55 .+-. 0.38 0.48
.+-. 0.30 0.89 .+-. 0.40 0.44 .+-. 0.10 0.49 .+-. 0.31 2.5 0.29
.+-. 0.26 0.58 .+-. 0.48 0.88 .+-. 0.53 0.56 .+-. 0.29 0.51 .+-.
0.47 0.64 .+-. 0.36 0.45 .+-. 0.34 * 10 0.36 .+-. 0.15 0.61 .+-.
0.60 0.98 .+-. 0.788 0.43 .+-. 0.33 0.40 .+-. 0.20 0.76 .+-. 0.45
0.39 .+-. 0.25 * 40 0.37 .+-. 0.29 0.92 .+-. 0.57 1.07 .+-. 0.45
0.65 .+-. 0.40 0.72 .+-. 0.39 1.10 .+-. 0.74 0.39 .+-. 0.24 0.46
.+-. 0.18 Platelet (10.sup.3 mm.sup.3) Saline 309.0 .+-. 92. 323.0
.+-. 100.7 296.3 .+-. 138.2 336.5 .+-. 81.7 337.3 .+-. 71.3 334.9
.+-. 74.6 335.1 .+-. 87.8 331.5 .+-. 112.4 2.5 319.5 .+-. 80.6
321.2 .+-. 84.8 303.0 .+-. 77.1 376.5 .+-. 92.0 281.4 .+-. 110.2
299.6 .+-. 65.8 341.0 .+-. 75.6 * 10 391.4 .+-. 154.3 352.2 .+-.
177.7 337.8 .+-. 199.5 463.7 .+-. 137.9 458.3 .+-. 132.3 417.2 .+-.
58.5 431.3 .+-. 85.7 * 40 358.6 .+-. 52.6 159.5 .+-. 24.7 337.3
.+-. 81.6 431.4 .+-. 71.5 353.5 .+-. 178.9 399.5 .+-. 65.8 394.4
.+-. 86.8 393.0 .+-. 38.2 Leukocytes and platelet hematology were
evaluated at predose, 30 minutes and 4 hours on days 1 and 23, and
on day 24 and 37 following initiation of intravenous AR177
administration. Values represent the mean .+-. s.d. of 2 to 8
monkeys. (*) = All monkeys were sacrificed on day 25.
TABLE F-5 Red Blood Cell, Reticulocyte, Hemoglobin and Hematocrit
Values Day 1 Day 23 Group Pre-dose 30 min 4 hr Pre-dose 30 min 4 hr
Day 24 Day 37 Red blood cells (10.sup.3 /mm.sup.3) Saline 6.0 .+-.
0.4 5.8 .+-. 0.4 5.6 .+-. 0.3 6.0 .+-. 0.6 5.8 .+-. 0.4 5.6 .+-.
0.4 4.8 .+-. 0.4 6.1 .+-. 0.3 2.5 6.0 .+-. 0.4 5.6 .+-. 0.4 5.5
.+-. 0.3 6.0 .+-. 0.5 5.6 .+-. 0.5 5.4 .+-. 0.5 4.7 .+-. 0.4 * 10
5.6 .+-. 0.5 5.4 .+-. 0.5 5.3 .+-. 0.4 5.8 .+-. 0.6 5.6 .+-. 0.5
5.4 .+-. 0.4 4.6 .+-. 0.4 * 40 5.8 .+-. 0.6 5.5 .+-. 0.6 5.4 .+-.
0.5 5.8 .+-. 0.7 5.5 .+-. 0.6 5.3 .+-. 0.6 4.6 .+-. 0.6 6.4 .+-.
0.2 Reticulocytes (10.sup.5 /mm.sup.3) Saline 0.77 .+-. 0.29 0.87
.+-. 0.27 0.82 .+-. 0.22 1.08 .+-. 0.49 0.82 .+-. 0.37 0.81 .+-.
0.31 0.72 .+-. 0.34 0.54 .+-. 0.23 2.5 0.83 .+-. 0.21 0.79 .+-.
0.26 0.68 .+-. 0.15 0.97 .+-. 0.45 0.82 .+-. 0.24 0.72 .+-. 0.27
0.84 .+-. 0.32 * 10 0.59 .+-. 0.16 0.53 .+-. 0.13 0.66 .+-. 0.20
1.09 .+-. 0.31 0.72 .+-. 0.25 0.81 .+-. 0.26 0.63 .+-. 0.14 * 40
0.99 .+-. 0.56 0.60 .+-. 0.20 0.99 .+-. 0.44 1.09 .+-. 0.33 0.60
.+-. 0.23 0.87 .+-. 0.27 0.92 .+-. 0.33 0.80 .+-. 0.07 Hemoglobin
(g/dL) Saline 13.4 .+-. 1.4 12.8 .+-. 1.4 12.3 .+-. 1.3 13.3 .+-.
0.7 12.8 .+-. 1.1 12.4 .+-. 1.0 10.8 .+-. 1.1 11.7 .+-. 0.2 2.5
14.0 .+-. 1.1 13.3 .+-. 1.0 13.0 .+-. 12. 14.0 .+-. 0.9 13.3 .+-.
1.0 12.8 .+-. 1.0 11.2 .+-. 0.8 * 10 12.9 .+-. 0.7 12.5 .+-. 0.9
12.3 .+-. 0.8 13.2 .+-. 0.9 12.9 .+-. 0.8 12.5 .+-. 1.1 10.6 .+-.
0.8 * 40 13.6 .+-. 1.4 13.0 .+-. 1.3 12.7 .+-. 1.5 13.5 .+-. 1.2
12.9 .+-. 1.1 12.3 .+-. 1.1 10.8 .+-. 1.4 12.4 .+-. 2.4 Hematocrit
(%) Saline 41.3 .+-. 3.5 39.6 .+-. 3.6 37.6 .+-. 3.3 45.1 .+-. 1.8
40.1 .+-. 3.0 38.8 .+-. 2.2 33.3 .+-. 3.1 37.5 .+-. 1.2 2.5 42.6
.+-. 3.3 40.0 .+-. 2.4 39.2 .+-. 2.8 43.1 .+-. 2.7 40.5 .+-. 3.1
39.1 .+-. 2.9 34.0 .+-. 2.4 * 10 38.9 .+-. 1.9 38.0 .+-. 2.5 37.2
.+-. 1.8 40.9 .+-. 2.6 39.6 .+-. 2.7 38.1 .+-. 3.3 32.3 .+-. 2.0 *
40 41.6 .+-. 2.8 39.5 .+-. 3.1 38.6 .+-. 4.0 41.7 .+-. 3.3 39.8
.+-. 23. 37.8 .+-. 3.0 32.7 .+-. 3.6 39.3 .+-. 6.2 Red blood cell
hematology was evaluated at pre-dose, 30 minutes and 4 hours on
days 1 and 23, and on day 24 and 37 following initiation of
intravenous AR177 administration. Values represent the mean .+-.
s.d. of 2 to 8 monkeys. (*) = All monkeys were sacrificed on day
25.
G. Human Clinical Trials
Four HIV-infected patients/group were dosed with AR177 at 0.75
mg/kg and 115 mg/kg, and two HIV-infected patients were dosed so
far with AR177 at 3.0 mg/kg by intravenous infusion over two
hours.
Methods
Blood was collected in EDTAp coated tubes at 0.25, 0.5, 1, 2, 2.05,
2.5, 3, 3.5, 4, 6, 8, 11, 14, 26, 48, 98, and 122 hours following
initiation of drug administration. Plasma was obtained by low speed
centrifugation of the blood, and was stored frozen until analyzed
by HPLC for AR177 concentration. The concentration of AR177 was
determined in patient plasma using a validated anion-exchange HPLC
method at the Division of Clinical Pharmacy of the University of
California, San Francisco. This method has a limit of quantitation
of 15 ng/mL in human plasma.
Pharmacokinetic analysis
Pharmacokinetic parameters were calculated using PKAnalyst software
(MicroMath, Salt Lake City, Utah). The pharmacokinetic data best
fit a two compartment model for all of the patients. The alpha and
beta half-lives were almost identical in each of the patients,
based on the software interpretation of the AR177 plasma
concentration versus time plot (FIGS. 56-59). For this reason, only
one half-life is reported. (Note that in monkeys, a third half-life
of approximately 24 hours was observed at a dose of 5 mg/kg given
as an intravenous infusion over two hours. A third half-life was
not evident in human data, except perhaps for patient #10.) For
each pharmacokinetic parameter, the mean .+-.s.d. of n=4 was
calculated for the 0.75 and 1.5 mg/kg groups and the mean .+-.s.d.
of n=2 was calculated for the 3.0 mg/kg group.
Results
The plasma concentrations of AR177 following intravenous infusion
are shown in FIG. 56 (0.75 mg/kg), FIG. 57 (1.5 mg/kg), FIG. 58
(3.0 mg/kg) and FIG. 59 (all doses). Analysis of this data indicate
that the plasma pharmacokinetics of AR177 are not directly
proportional to the dose (Table G-1). The increase in the C.sub.max
and AUC were proportionally much greater than the increase in the
dose from 0.75 to 3.0 mg/kg. The increase in the C.sub.max and AUC
were much greater than the increase in the dose. The C.sub.max
value in the 0.75 mg/kg group was 5.1.+-.1.4 .mu.g/mL and the
C.sub.max value in the 3.0 mg/kg group was 37.5.+-.0.1 .mu.g/mL,
approximately a seven-fold increase (FIG. 60). The AUC value in the
0.75 mg/kg group was 703.6.+-.154.7 .mu.g-min/mL and the AUC value
in the 3.0 mg/kg group was 8,277.8.+-.2.937.4 .mu.g-min/mL,
approximately a 12-fold increase (Table 1).
The plasma clearance and Vd values reflected the C.sub.max and AUC
data. The plasma clearance in the 0.75 mg/kg group was 1.1.+-.0.2
mL/min/kg and the clearance in the 3.0 mg/kg group was 0.4.+-.0.2
mL/min/kg, approximately a 65% decrease (FIG. 61). the initial and
steady-state volumes of distribution in the 0.75 mg/kg group were
0.16.+-.0.05 L/kg and 0.14.+-.0.05 L/kg, respectively, whereas the
initial and steady-state volumes of distribution (Vd) in the 3.0
mg/kg group were 0.08.+-.0.00 L/kg and 0.05.+-.0.03 L/kg,
respectively (Table 1).
In agreement with the above data, the plasma half-life in the 0.75
mg/kg group was 28.0.+-.12.7 minutes, and the half-life in the 3.0
mg/kg group was 120.1.+-.60.7 minutes, approximately a four fold
increase (FIG. 60).
Conclusions
These results indicate that the plasma pharmacokinetics of AR177
are non-linear and suggest that there is a saturable mechanism for
the elimination of the drug.
TABLE G-1 Phase I plasma AR177 pharmacokinetic parameters Parameter
Patient #01 Patient #02 Patient #03 Patient #04 mean .+-. s.d. Dose
(mg/kg) 0.75 0.75 0.75 0.75 Total dose (mg) 65.1 49.23 50.78 54.23
Body weight (kg) 86.9 65.9 67.1 72.3 C.sub.MAX (.mu.g/mL) 5.3 6.7
3.3 5.1 5.1 .+-. 1.4 AUC.sub.O-infinity) (.mu.g-min/mL) 730.6 910.2
563.9 609.7 703.6 .+-. 154.7 Terminal T.sub.1/2 (min) 24.2 33.3
42.3 12.5 28.0 .+-. 12.7 CL (mL/min) 89.1 54.1 90.0 89.0 80.5 .+-.
17.6 CL (mL/min/kg) 1.0 0.8 1.3 1.2 1.1 .+-. 0.2 Vd.sub.init (L)
12.30 7.40 15.20 10.60 11.38 .+-. 3.26 Vd.sub.init (L/kg) 0.14 0.11
0.23 0.15 0.16 .+-. 0.05 Vd.sub.SS (L) 11.0 6.3 13.9 8.9 10.02 .+-.
3.19 Vd.sub.SS (L/kg) 0.13 0.10 0.21 0.12 0.14 .+-. 0.05
AUMC.sub.(O-infinity) (.mu.g-min.sup.2 /mL) 90197.3 106558.0
86825.3 609803.1 86120.9 .+-. 18892.0 Parameter Patient #05 Patient
#06 Patient #07 Patient #08 mean .+-. s.d Dose (mg/kg) 1.5 1.5 1.5
1.5 Total dose (mg) 93.75 93.15 110.7 135.6 Body weight (kg) 62.5
62.1 74 90.4 C.sub.MAX (.mu.g/mL) 11.6 12.9 11.9 15.2 12.9 .+-. 1.6
AUC.sub.(O-infinity) (.mu.g-min/mL) 1,745.6 1,949.0 1,953.0 2,794.7
2110.6 .+-. 466.3 Terminal T.sub.1/2 (min) 110.1 75.4 29.3 42.3
64.3 .+-. 36.2 CL (mL/min) 53.7 47.8 56.7 48.5 51.7 .+-. 4.3 CL
(mL/min/kg) 0.9 0.8 0.8 0.5 0.7 .+-. 0.1 VD.sub.init (L) 8.10 7.20
9.30 8.90 8.38 .+-. 0.93 Vd.sub.init (L/kg) 0.13 0.12 0.13 0.10
0.12 .+-. 0.01 Vd.sub.SS (L) 5.40 6.26 8.76 8.11 7.13 .+-. 1.57
Vd.sub.SS (L/kg) 0.09 0.10 0.12 0.09 0.10 .+-. 0.01
AUMC.sub.(O-infinity) (.mu.g-min.sup.2 /mL) 175479.1 255258.6
301785.9 467118.0 299910.4 .+-. 123070.2 Parameter Patient #09
Patient #10 Patient #11 Patient #12 mean .+-. s.d Dose (mg/kg) 3 3
Total dose (mg) 224.7 233.4 Body weight (kg) 74.9 77.8 C.sub.MAX
(.mu.g/mL) 37.4 37.6 37.5 .+-. 0.1 AUC.sub.(O-infinity)
(.mu.g-min/,L) 6,200.8 10,354.9 8277.8 .+-. 2937.4 Terminal
T.sub.1/2 (min) 163.0 77.2 120.1 .+-. 60.7 CL (mL/min) 36.2 22.5
29.4 .+-. 9.7 CL (mL/min/kg) 0.5 0.3 0.4 .+-. 0.1 Vd.sub.init (L)
6.00 6.20 6.10 .+-. 0.14 Vd.sub.init (L/kg) 0.08 0.08 0.08 .+-.
0.00 Vd.sub.SS (L) 1.58 5.40 3.49 .+-. 2.70 Vd.sub.SS (L/kg) 0.02
0.07 0.05 .+-. 0.03 AUMC.sub.(O-infinity) (.mu.g-min.sub.2 /mL)
269622.5 2478968.5 1374295.5 .+-. 1562243.5
Multi-Dose Trials
Zintevir.TM. (AR177; T30177) was next used in multiple dosing
experiments with AIDS patients. Supporting rationale include:
anti-HIV-1 activity at sub-micromolar concentrations in lymphocytes
infected with clinical isolates of HIV-1;
prevention of cytopathic effects if HIV-1 in primary CD.sub.4
+T-cell lymphocytes;
activity at high multiplicities of infection (MOI); and
a novel mechanism of action that does not involve inhibition of
either reverse transcriptase (RT) or protease activity.
Study Design
This was an open-label, single-center, study to evaluate the
safety, pharmacokinetic profile and virologic/immunologic activity
of AR177 in HIV patients. Patients that met the screening criteria
received multiple doses of AR177 infused every other day for 14
days (seven doses). Patients were allowed to participate in the
study at ONLY one dose level. Patients were confined to the
Research Unit from Day 0 through Day 18. Patient activities outside
the unit had to be acceptable to, and agreed upon prior to study
initiation.
Drugs
AR177 was provided by Aronex Pharmaceuticals, Inc. AR177 was
obtained from multiple lots during the course of the study. The
study drug was available in two vial sizes. These clear glass vials
contained 2.2 cc or 15.9 cc of product. Each ml of active drug will
deliver a 25 mg dose; thus, the expected total mg dose per vial is
55.0 milligrams and 397.50 milligrams, respectively.
Dosages
Patients meeting all entry criteria were given a two-hour
continuous infusion of AR177 every other day for a total of seven
infusions. The dosing schedule utilized is shown in the following
table (G-2).
DOSAGE SCHEDULE Group Study Medication Dose Level Number of
Patients 1 AR177 1.5 mg/kg 3 *2 AR177 3.0 mg/kg 8 *Escalation will
occur at a 100% increment from 1.5 mg/kg (Group 1) to 3.0 mg/kg
(Group 2), if no .gtoreq.Grade III toxicity(ies) occurs.
Dose escalation occurred at a 100% increment from the starting does
of 1.50 mg/kg (Group 1) to 3.0 mg/kg (Group 2), if no .gtoreq.Grade
III toxicities are observed. Details regarding does escalation
and/or decalation, and the number of patients to be enrolled at
each dose level if toxicity is observed, was determined.
DOSE ADMINISTRATION
The intravenous infusion of study medication will be administered
continuously via an indwelling I.V. catheter at a rate of 2 mL/min
for two hours.
RESULTS
The plasma levels of HIV-1 RNA are an accepted measure of the
plasma viral titer and are directly related to the progression of
HIV infection to acquired immunodeficiency disease syndrome (AIDS)
and death in humans. Mellors et al. (1996) Science 272:1167-1170.
Striking results were obtained over the course of a 14-day
treatment. In each of the three patients given 3.0 mg/kg dosages,
viral load was significantly reduced.
TABLE G-3 Viral Load Data Plasma PCR/HIV-1 RNA Number or copies/ml)
Dose Level: 3.0 mg/kg Patient Day 18 I.D. No. Day 0 Day 7 Day 13 %
Decrease (4 days post) MMJ/038 111,560 85,020 74,350 33% 106,190
RLV/050 21,400 24,380 18,890 12% 26,450 RAH/055 187,740 152-820
84,580 55% 114,260
All patents and publications mentioned in this specification are
indicative of the levels of those skilled in the art to which the
invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
One skilled in the art will readily appreciate that the present
invention is well adapted to carry out the objects and obtain the
ends and advantages mentioned as well as those inherent therein.
The oligonucleotides, compounds, methods, procedures and techniques
described herein are presently representative of preferred
embodiments, are intended to be exemplary and are not intended as
limitations on the scope. Changes therein and other uses will occur
to those skilled in the art which are encompassed within the spirit
of the invention or defined by the scope of the appended claims. It
will be readily apparent to one skilled in the art that various
substitutions and modifications may be made to the invention
disclosed herein without departing from the scope and spirit of the
invention.
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 87 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 38 (D) OTHER
INFORMATION: /note= "Amine moiety attached to 3' end" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:1 TGGGTGGGGT GGGGTGGGGG GGTGTGGGGT GTGGGGTG
38 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2 GTGGGGTGTG GGGTGTGGGG GGGTGGGGTG GGGTGGGT
38 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:3 GGGTGGGTGG GTGGGTGG 18 (2) INFORMATION FOR
SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4
GGTGGTGGGG GGGGGTGGGG TGGTGGTGGG GGTGTTGG 38 (2) INFORMATION FOR
SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5
GTGGTGGTGG TGTTGGTGGT GGTTTGGGGG GTGGGG 36 (2) INFORMATION FOR SEQ
ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6
GTGGTTGGTG GTGGTGTGTG GGTTTGGGGT GGGGGG 36 (2) INFORMATION FOR SEQ
ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B)
LOCATION: 36 (D) OTHER INFORMATION: /note= "phosphorothioate
backbone" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 GTGGTGGTGG
TGTTGGTGGT GGTTTGGGGG GTGGGG 36 (2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
36 (D) OTHER INFORMATION: /note= "phosphorothioate backbone" (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:8 GTGGTTGGTG GTGGTGTGTG GGTTTGGGGT
GGGGGG 36 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:9 GGTGGGGTGG TGGTGGTTGG GGGGGGGGGG
T 31 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:10 GGTGGTTGGG GGGTGGGGGG G 21 (2)
INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:11 GGGTGGGGTG GTGGGTGGGG G 21 (2)
INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:12 GGTGGGTGGT TTGTGTGGTT GGTGGGTTTT 30 (2)
INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:13 GGGGGGGGGG TGTGGGGGGG GGTTGTGGTG G 31 (2)
INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:14 GGTGGGTGGG TTGGGGGGTG GGTGGGG 27 (2)
INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:15 TGGGGTTTGG GTGGGGGGTT GGGTGGTTG 29 (2)
INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:16 GGGTGGTGGT GTTGGTGTTG TGTG 24 (2)
INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:17 GGTGGGGGGG TTGGTGTGTT TG 22 (2)
INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:18 GTGTGGGGGG GTGGGGTGGG GTGGGT 26 (2)
INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:19 GGGTGGGTGG GTGGGTGGGT GGGTGG 26 (2)
INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 26 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end" (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:20 GTTGGGGGTT GTTGGTGGGG TGGTGG 26 (2) INFORMATION FOR
SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: not provided (ix) FEATURE: (A) NAME/KEY: misc_feature
(B) LOCATION: 45 (D) OTHER INFORMATION: /note= "Amine moiety
attached to 3' end" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21
TGGTGGGTGT GTGGGGGGTG TTGGGGGTTG TTGGTGGGGT GGTGG 45 (2)
INFORMATION FOR SEQ ID NO: 22: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 45 (D) OTHER INFORMATION:
/note= "cholesterol moiety attached to 3' end" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:22 TGGTGGGTGT GTGGGGGGTG TTGGGGGTTG
TTGGTGGGGT GGTGG 45 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 45 (D) OTHER
INFORMATION: /note= "cholesterol moiety attached to 3' end" (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:23 GTGGTGGGTG GGTGGGTGGT GGGTGGTGGT
TGTGGGTGGG TGGTG 45 (2) INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 45 (D) OTHER
INFORMATION: /note= "Amine moiety attached to 3' end" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:24 GTGGTGGGTG GGTGGGTGGT GGGTGGTGGT
TGTGGGTGGG TGGTG 45 (2) INFORMATION FOR SEQ ID NO: 25: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 26 (D) OTHER
INFORMATION: /note= "cholesterol moiety attached to 3' end" (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:25 GTTGGGGGTT GTTGGTGGGG TGGTGG 26
(2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 45 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end" (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:26 GATCCATGTC AGTGACACTG CGTAGATCCG ATGATCCAGT CGATG 45
(2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 26 (D) OTHER INFORMATION:
/note= "phosphorothioate backbone and amine moiety attached to
backbone" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27 GTTGGGGGTT
GTTGGTGGGG TGGTGG 26 (2) INFORMATION FOR SEQ ID NO: 28: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28 GGTGGTGGGG
TGGTTGTTGG GGGTTG 26 (2) INFORMATION FOR SEQ ID NO: 29: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29 GGTGGTGGGG
TGGTTGTTGG GGGTTGTTGG GGGTGTGTGG GTGGT 45 (2) INFORMATION FOR SEQ
ID NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30
GGGTGGTTGG GTGGTTGG 18 (2) INFORMATION FOR SEQ ID NO: 31: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
18 (D) OTHER INFORMATION: /note= "Amine moiety attached to 3' end"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31 GGGTGGGTGG GTGGGTGG 18 (2)
INFORMATION FOR SEQ ID NO: 32: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 18 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end and phosphothioate
backbone" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32 GGGTGGGTGG
GTGGGTGG 18 (2) INFORMATION FOR SEQ ID NO: 33: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 17 (D) OTHER
INFORMATION: /note= "Amine moiety attached to 3' end" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:33 GTGGTGGGTG GGTGGGT 17 (2) INFORMATION FOR
SEQ ID NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B)
LOCATION: 27 (D) OTHER INFORMATION: /note= "Amine moiety attached
to 3' end" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34 GTGGTGGGTG
GGTGGGTGGT GGGTGGT 27 (2) INFORMATION FOR SEQ ID NO: 35: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
37 (D) OTHER INFORMATION: /note= "Amine moiety attached to 3' end"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35 GTGGTGGGTG GGTGGGTGGT
GGGTGGTGGT TGTGGGT 37 (2) INFORMATION FOR SEQ ID NO: 36: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
16 (D) OTHER INFORMATION: /note= "Amine moiety attached to 3' end"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36 TTGTGGGTGG GTGGTG 16 (2)
INFORMATION FOR SEQ ID NO: 37: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 29 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end" (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:37 TGGTGGGTGG TGGTTGTGGG TGGGTGGTG 29
(2) INFORMATION FOR SEQ ID NO: 38: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 38 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end" (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:38 GTGGGTGGGT GGTGGGTGGT GGTTGTGGGT GGGTGGTG 38 (2)
INFORMATION FOR SEQ ID NO: 39: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 45 (D) OTHER INFORMATION:
/note= "phosphorothioate backbone and amine moiety attached to 3'
end" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39 GTGGTGGGTG GGTGGGTGGT
GGGTGGTGGT TGTGGGTGGG TGGTG 45 (2) INFORMATION FOR SEQ ID NO: 40:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
18 (D) OTHER INFORMATION: /note= "Amine moiety attached to 3' end"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40 GATCCATGTC AGTGACAC 18 (2)
INFORMATION FOR SEQ ID NO: 41: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 18 (D) OTHER INFORMATION:
/note= "Amine moiety attached to 3' end and phosphorothioate
backbone" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41 GATCCATGTC
AGTGACAC 18 (2) INFORMATION FOR SEQ ID NO: 42: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION: 18 (D) OTHER
INFORMATION: /note= "Amine moiety attached to 3' end" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:42 CCCCCCCCCC CCCCCCCC 18 (2) INFORMATION
FOR SEQ ID NO: 43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18
base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL
SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A) NAME/KEY:
misc_feature (B) LOCATION: 18 (D) OTHER INFORMATION: /note= "Amine
moiety attached to 3' end and phosphorothioate backbone" (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:43 CCCCCCCCCC CCCCCCCC 18 (2)
INFORMATION FOR SEQ ID NO: 44: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:44 TTCATTTGGG AAACCCTTGG AACCTGACTG
ACTGGCCGTC GTTTTAC 47 (2) INFORMATION FOR SEQ ID NO: 45: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45 GTAAAACGAC
GGCCA 15 (2) INFORMATION FOR SEQ ID NO: 46: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:46 GTGGTGGGTG GGTGGGG 17 (2)
INFORMATION FOR SEQ ID NO: 47: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:47 GTGGTGGGTG GGTGGG 16 (2) INFORMATION FOR
SEQ ID NO: 48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48
TGGTGGGTGG GTGGGT 16 (2) INFORMATION FOR SEQ ID NO: 49: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49 GTGGTGGGTG GGT
13 (2) INFORMATION FOR SEQ ID NO: 50: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:50 GTGGTGGGT 9 (2) INFORMATION FOR SEQ ID
NO: 51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51
GTGGGTGGGT GGGT 14 (2) INFORMATION FOR SEQ ID NO: 52: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:52 GTGGGTGGGT 10 (2) INFORMATION
FOR SEQ ID NO: 53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15
base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL
SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:53 GGTTGGTGTG GTTGG 15 (2) INFORMATION FOR SEQ ID NO: 54: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54 GTGGTTGGTG
TGGTTGG 17 (2) INFORMATION FOR SEQ ID NO: 55: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:55 GTGGTTGGTG TGGTTGGT 18 (2)
INFORMATION FOR SEQ ID NO: 56: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:56 GTGGTGGGTG TGGTTGGT 18 (2) INFORMATION
FOR SEQ ID NO: 57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18
base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL
SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:57
GTGGTGGGTG TGGTGGGT 18 (2) INFORMATION FOR SEQ ID NO: 58: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
11 (D) OTHER INFORMATION: /note= "the base is removed from this
nucleotide" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58 GUGGUGGGUG
GGUGGGU 17 (2) INFORMATION FOR SEQ ID NO: 59: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
RNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:59 GUGGUGGGUG GGUGGGU 17 (2)
INFORMATION FOR SEQ ID NO: 60: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (D) OTHER INFORMATION: /note= "the base is
removed from this nucleotide" (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:60 GNGGTGGGTG GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 61: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61 GTGGGTGGTG
GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 62: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:62 GTGGTGGGGT GGTGGGT 17 (2)
INFORMATION FOR SEQ ID NO: 63: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:63 GTGGTGGGTGG GGTGGT 17 (2) INFORMATION FOR
SEQ ID NO: 64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64
GTGGGTGGTGG GGTGGT 17 (2) INFORMATION FOR SEQ ID NO: 65: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (D) OTHER
INFORMATION: /note= "C-5 propynl dU" (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:65 GTGGNGGGGT GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 66:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
13 (D) OTHER INFORMATION: /note= "C-5 propynl dU" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:66 GTGGTGGGTG GGNGGGT 17 (2) INFORMATION FOR
SEQ ID NO: 67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B)
LOCATION: 5,13 (D) OTHER INFORMATION: /note= "C-5 propynl dU" (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:67 GTGGNGGGTG GGNGGGT 17 (2)
INFORMATION FOR SEQ ID NO: 68: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (D) OTHER INFORMATION: /note= "the base is
removed from this nucleotide" (ix) FEATURE: (A) NAME/KEY:
misc_feature (B) LOCATION: 5,13 (D) OTHER INFORMATION: /note= "C-5
propynl dU" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68 GUGGUGGGUG
GGUGGGU 17 (2) INFORMATION FOR SEQ ID NO: 69: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (ix)
FEATURE: (A) NAME/KEY: misc_feature (D) OTHER INFORMATION: /note=
"the base is removed from this nucleotide" (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 6,13 (D) OTHER INFORMATION:
/note= "C-5 propynl dU" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69
GNGGGTGGTG GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 70: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (D) OTHER
INFORMATION: /note= "the base is removed from this nucleotide" (ix)
FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
1,5,6,9,10,13,14,17 (D) OTHER INFORMATION: /note= "deoxyinosine"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:70 NNGGNNGGNN GGNNGGN 17 (2)
INFORMATION FOR SEQ ID NO: 71: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 6,13 (D) OTHER INFORMATION:
/note= "C-5 propynl dU" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71
GNGGGTGGTG GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 72: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
13 (D) OTHER INFORMATION: /note= "3' cholesterol via triglycyl
linker" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72 GTGGTGGGTG GGTGGGT
17 (2) INFORMATION FOR SEQ ID NO: 73: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 13 (D) OTHER INFORMATION:
/note= "5-bromo dU" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73
GTGGTGGGTG GGNGGGT 17 (2) INFORMATION FOR SEQ ID NO: 74: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
5,9,13 (D) OTHER INFORMATION: /note= "5-bromo dU" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:74 GTGGNGGGNG GGNGGGT 17 (2) INFORMATION FOR
SEQ ID NO: 75: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (D) OTHER INFORMATION: /note= "5-iodo dU"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:75 GTGGNGGGTG GGTGGGT 17 (2)
INFORMATION FOR SEQ ID NO: 76: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (D) OTHER INFORMATION: /note= "5-iodo dU"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:76 GTGGTGGGNG GGTGGGT 17 (2)
INFORMATION FOR SEQ ID NO: 77: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (ix) FEATURE: (A)
NAME/KEY: misc_feature (B) LOCATION: 13 (D) OTHER INFORMATION:
/note= "5-iodo dU" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77
GTGGTGGGTG GGNGGGT 17 (2) INFORMATION FOR SEQ ID NO: 78: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (ix) FEATURE: (A) NAME/KEY: misc_feature (B) LOCATION:
5,9,13 (D) OTHER INFORMATION: /note= "5-iodo dU" (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:78 GTGGNGGGNG GGNGGGT 17 (2) INFORMATION FOR
SEQ ID NO: 79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79
GTGGCGGGTG GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 80: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80 GTGGTGGGCG
GGTGGGT 17 (2) INFORMATION FOR SEQ ID NO: 81: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:81 GTGGTGGGTG GGCGGGT 17 (2)
INFORMATION FOR SEQ ID NO: 82: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:82 GTGGCGGGCG GGCGGGT 17 (2) INFORMATION FOR
SEQ ID NO: 83: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83
TGGGAGGTGG GTCTG 15 (2) INFORMATION FOR SEQ ID NO: 84: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: not provided (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:84 TGGGAGGTGG GTCTG 15 (2)
INFORMATION FOR SEQ ID NO: 85: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi)
ORIGINAL SOURCE: (A) ORGANISM: not provided (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:85 TGGGAGGTGG GTCTG 15 (2) INFORMATION FOR
SEQ ID NO: 86: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A)
ORGANISM: not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86
GCGGGGCTCC ATGGGGGTCG 20 (2) INFORMATION FOR SEQ ID NO: 87: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM:
not provided (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87 GTGGTGGGTG
GGTGGGT 17
* * * * *