U.S. patent number 6,171,596 [Application Number 09/070,291] was granted by the patent office on 2001-01-09 for oligomeric hiv-1 envelope glycoproteins.
This patent grant is currently assigned to The United States of America as represented by the Department of Health and Human Services. Invention is credited to Christopher C. Broder, Robert W. Doms, Patricia L. Earl, Bernard Moss.
United States Patent |
6,171,596 |
Earl , et al. |
January 9, 2001 |
Oligomeric HIV-1 envelope glycoproteins
Abstract
Immunogenic compositions and methods of stimulating an immune
response against the envelope protein of HIV-1. Immunogenic
compositions include a purified oligomeric structure that comprises
a C-terminally truncated form of HIV-1 gp160 protein that is
missing the gp41 transmembrane domain. The gp120-gp41 proteolytic
processing site is retained in one form of the composition and is
deleted in a different form of the composition. In one embodiment,
the engineered env protein is proteolytically cleaved, but the
gp120 and gp41 components of the complex remain noncovalently
associated. Immunization with these compositions advantageously
stimulates the production of conformation-dependent antibodies.
Inventors: |
Earl; Patricia L. (ChevyChase,
MD), Broder; Christopher C. (Rockville, MD), Doms; Robert
W. (Berwyn, PA), Moss; Bernard (Bethesda, MD) |
Assignee: |
The United States of America as
represented by the Department of Health and Human Services
(Washington, DC)
|
Family
ID: |
26861275 |
Appl.
No.: |
09/070,291 |
Filed: |
April 30, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
805889 |
Mar 3, 1997 |
6039957 |
|
|
|
165314 |
Dec 10, 1993 |
|
|
|
|
Current U.S.
Class: |
424/208.1;
424/188.1; 424/199.1; 530/389.4; 530/388.35 |
Current CPC
Class: |
A61K
39/12 (20130101); C07K 14/005 (20130101); A61P
31/18 (20180101); A61K 39/21 (20130101); C07K
16/1063 (20130101); A61K 39/00 (20130101); A61K
2039/55577 (20130101); C12N 2740/16134 (20130101); C12N
2740/16122 (20130101); A61K 2039/5256 (20130101); A61K
2039/545 (20130101); A61K 2039/55572 (20130101); C12N
2710/24143 (20130101); A61K 2039/54 (20130101); A61K
2039/55566 (20130101); C12N 2710/14143 (20130101); A61K
2039/57 (20130101) |
Current International
Class: |
A61K
39/21 (20060101); C07K 16/10 (20060101); C07K
14/005 (20060101); C07K 14/16 (20060101); C07K
16/08 (20060101); A61K 39/00 (20060101); A61K
039/21 (); A61K 039/12 (); C07K 016/00 () |
Field of
Search: |
;424/188.1,208.1,199.1
;530/388.35,389.4 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Folding, Interaction with GRP78-BiP, Assembly and Transport of the
Human Immunodeficiency Virus Type 1 Envelope Protein, Earl, Et al.,
Journal of Virology, Apr. 1991, pp. 2047-2055. .
Multimeric CD4 Binding Exhibited by Human and Simian
Immunodeficiency Virus Envelope Protein Dimers, Earl, et al.,
Journal of Virology, Sep. 1992, pp. 5610-5614. .
Native Oligomeric Human Immunodeficiency Virus Type 1 Envelope
Glycoprotein Elicits Diverse Monoclonal Antibody Reactivities,
Earl, et al., Journal of Virology, May 1994, pp. 3015-3026. .
Antigenic implications of human immunodeficiency virus type 1
envelope quaternary structure: Oligomer-specific and -sensitive
monoclonal antibodies, Earl, et al., Proc. Natl. Acad. Sci. USA
vol. 91, pp. 11699-11703, Nov. 1994, Medical Sciences. .
Berman, et al. (1989) Expression and Immunogenicity of the
extracellular domain of the human immunodeficiency virus type 1
envelope glycoprotein, gp 160. Journal of Virology 3489-3498. .
Earl, et al. (1992) Multimeric CD4 binding exhibited by human and
simian immunodeficiency virus envelope protein dimers. Joural of
Virology 5610-5614. .
Kieny, et al. (1988) Improved antigenicity of the HIV env protein
by cleavage site removal. Protein Engineering 2(3):219-225. .
Marasco, et al. Design, intracellular expression, and the activity
of a human anti-human immunodeficiency virus type 1 gp120
single-chain antibody. Proc. Natl. Acad. Sci. 90:7889-7893. .
Nakamura, et al. (1992) Monoclonal antibodies to the extracellular
domain of HIV-1 IIIB gp160 that neutralize infectivity, block
binding to CD4, and react with diverse isolates. Aids Research and
Human Retroviruses 8(11). .
Pasquali, et al. (1990) Immunogenicity and epitope mapping of a
recombinant soluble gp160 of the human immunodeficiency virus type
1 envelope glycoprotein. Aids Research and Human Retroviruses 6(9).
.
Steimer, et al. (1991) Neutralization of divergent HIV-1 isolates
by conformation-dependent human antibodies to gp120. Science
254:105-108. .
Seaver, S. (1994) Monoclonal antibodies in industry: more difficult
than originally thought. Gen. Eng. News pp. 10, 21. .
Earl et al., Proc. Natl. Acad. Sci-USA 87:648-652, Jan. 1990. .
Earl et al., J. Viroli 65(i): 31-41, Jan. 1991. .
Galfre et al., Meth Enzymol 73: 3-46, 1981. .
Berman, Phillip W., et al.; Protection of chimpanzees from
infection by HIV-1 after vaccination with recombinant glycoprotein
gp120 but not gp160: Nature, vol. 345; Jun. 14, 1990; pp. 622-625.
.
Greene, Warner C.; AIDS and the Immune System; Life, Death and the
Immune System; Scientific American, Sep. 1993; pp. 97-105. .
Moore, John P.; Primary Isolates of Human Immunodeficiency Virus
Type 1 Are Relatively Resistant to Neutrlization by Monoclonal
Antibodies to gp120, and Their Neutralization Is Not Predicted by
Studies with Monomeric gp120; Jounal of Virology; Jan. 1995; pp.
101-109. .
Li, John; Infection of Cynomolgus Monkeys with a Chimeric HIV-1/SIV
mac Virus That Expresses the HIV-1 Envelope Glycoproteins; Journal
of Acquired Immune Deficiency Syndromes; 1992; pp. 639-646. .
Reiman, Keith A.; An env Gene Derived from a Primary Human
Immunodefieciency Virus Type 1 Isolate Confers High In Vivo
Replicative Capacity to a chimeric Simian/Human Immunodeficiency
Virus in Rhesus Monkeys; Journal of Virology; May 1996; pp.
3198-3206. .
Pialoux, Gilles; A Prime-Boost Approach to HIV Prevenive Vacine
Using a Recombinant Carnarypox Virus Expressing Glycoprotein 160
(MN) followed by a Recombinant Glycoprotein 160 (MN/LAI): AIDS
Reseach and Human Retroviruses; vol. 11, No. 3; 1995; pp. 373-3142.
.
Berman, Phillip W.; Expression of Membrane-Associated and Secreted
Variants of gp160 of Human Immunodeficiency Virus Type 1 In Vitro
and in Continuous Cell Lines; Journal of Virology; Sep. 1988; pp.
3135-3142. .
VanCott, Thomas C.; Antibodies with Specificity to Native gp120 and
Neutralization Activity against Primary Human Immunodeficiency
Virus Type 1 Isolates Elicited by Immunization with Oligomeric
gp160; Journal of Virology; Jun. 1997; pp. 4319-4330..
|
Primary Examiner: Park; Hankyel
Attorney, Agent or Firm: Knobbe, Martens, Olson & Bear,
LLP
Parent Case Text
RELATED APPLICATIONS
The present application is a continuation-in-part of U.S.
application Ser. No. 08/805,889, filed Mar. 3, 1997, now U.S. Pat.
No. 6,039,957 which is a divisional of U.S. application Ser. No.
08/165,314, filed Dec. 10, 1993 now abandoned. The disclosures of
these previous applications are hereby incorporated herein in their
entirety by this reference thereto.
Claims
What is claimed is:
1. An immunogenic composition comprising a pharmaceutically
acceptable carrier and a recombinant uncleaved gp140 protein
retaining its oligomeric structure so as that neutralizing
antibodies against conformational epitopes of HIV-1 envelope
proteins found on the oligomeric structure of said gp140 are
produced in an immunized human, said gp140 protein being defined as
a C-terminally truncated form of HIV-1 gp160 protein that is
missing the gp41 transmembrane domain.
2. The immunogenic composition of claim 1, wherein said gp140
protein is obtained by running said gp14O through lectin
chromatography followed by a sizings separation.
3. The immunogenic composition of claim 1, wherein said gp140
protein is obtained by running said gp140 through affinity
chromatography with elution at pH8 followed by a sizing
separation.
4. The immunogenic composition of claim 1, 2, or 3, wherein said
gp140 protein is further defined as missing the gp120/gp41 cleaving
site.
5. The immunogenic composition of claim 1, 2, or 3 wherein said
gp140 protein is further defined as retaining the gp120/pg41
cleavage site.
Description
FIELD OF THE INVENTION
The present invention relates to the use of recombinant proteins to
stimulate an immune response in a mammal. Specifically, the present
invention describes methods for producing and purifying genetically
engineered HIV-1 gp140, 140(prime) and gp120/20 glycoprotein
oligomers that can be used as immunogens.
BACKGROUND OF THE INVENTION
The HIV-1 envelope (env) glycoprotein is a structurally complex
integral membrane protein that targets the virus to CD4 positive
cells and mediates the fusion between the viral envelope and the
cellular membrane. This glycoprotein also harbors antigenic
determinants that are recognized by neutralizing antibodies.
The two recognized categories of antibodies that are capable of
neutralizing HIV-1 infection include: those that recognize
determinants in the V3 loop of gp120 and those that block the
gp120-CD4 interaction by binding to conserved regions of gp120.
Antibodies directed against the V3 loop generally recognize
epitopes formed by a short continuous sequence and are usually
referred to as conformation-independent. These
conformation-independent antibodies can be elicited by immunization
with either peptides or denatured env protein subunits. Extensive
antigenic variation in the V3 domain of the env protein restricts
the neutralizing activity of anti-V3 loop antibodies to closely
related strains of HIV-1. Hence, antibodies capable of neutralizing
infection by one strain of HIV-1 may not effectively neutralize
infection by a different strain of HIV-1.
In contrast, antibodies to epitopes that are sensitive to the
conformation of the protein are typically more broadly
neutralizing. Antibodies to these conformation-sensitive epitopes
are referred to herein as "conformation-dependent" antibodies.
Conformation-dependent antibodies that block CD4 binding, for
example, recognize conserved, discontinuous, conformational
epitopes in gp120. These antibodies are broadly neutralizing and
have been shown to comprise a significant fraction of the total
neutralization activity present in HIV-1 infected human sera. In
addition, there is evidence that neutralizing antibodies may also
be directed against conformationally-dependent epitopes on gp120
(Steimer et al., Science, 254:105 (1991)).
Newly synthesized gp160 monomers noncovalently associate to form
higher order oligomeric structures. The association of two env
monomers to form a dimer is the most elemental such structure. A
larger structure that is believed to be composed of a dimer of
dimers, or four monomers, can also form. The ectodomain of gp41 is
required for efficient oligomerization of dimers and tetramers
(Earl et al., Proc. Natl. Acad. Sci. USA 87:648 (1990); Earl and
Moss, AIDS Res. 9:589-594 (1993)).
Given its antigenic nature, the use of recombinant gp160 or
derivatives thereof as immunogens represents an attractive vaccine
strategy. However, the attempts that have been made to date in this
regard have all suffered one or another deficiency. To the extent
that humoral immune responses against various gp160 immunogens have
been analyzed, none satisfactorily stimulates the broadly
neutralizing antibodies that would be required of an effective
HIV-1 vaccine. Hence, there remains a need for a vaccine
composition that can stimulate the production of broadly
neutralizing antibodies against various strains of HIV-1.
SUMMARY OF THE INVENTION
In a first aspect of the invention, there is provided a composition
for stimulating an anti-HIV-1 env immune response in a mammal. The
composition includes an oligomer of a secreted C-terminally
truncated form of an HIV-1 gp160 and a pharmaceutically acceptable
carrier. The secreted C-terminally truncated form of an HIV-1 gp160
includes a gp120-gp41 proteolytic processing site. According to one
embodiment the HIV-1 gp160 is found in a laboratory-adapted strain
of HIV-1, such as BH8. According to another embodiment the HIV-1
gp160 is found in a primary isolate of HIV-1, such as HIV-1 89.6 or
HIV-1 CM235. When the secreted C-terminally truncated form of the
HIV-1 gp160 includes a gp120-gp41 proteolytic processing site, the
pharmaceutically acceptable carrier can include a saline solution,
and additionally may include an adjuvant. According to yet another
embodiment of the invention, the secreted C-terminally truncated
form of the HIV-1 gp160 can include the entire amino acid sequence
of gp120 of the HIV-1.
In a second aspect of the invention, there is provided another
composition for stimulating an anti-HIV-1 env immune response in a
mammal. This composition includes an oligomeric gp120/20, which is
a proteolytically cleaved form of a secreted C-terminally truncated
form of an HIV-1 gp160, and a pharmaceutically acceptable carrier.
In one embodiment the HIV-1 gp160 of the composition is found in a
primary isolate of HIV-1, and the oligomeric gp120/20 has a
molecular weight of at least 200 kDa.
In a third aspect of the invention, there is provided a method of
stimulating the formation of neutralizing antibodies against
conformational epitopes of HIV-1 env proteins in a mammal. This
method includes the steps of first identifying a mammal at risk of
contracting an HIV infection; and then administering to the mammal
a composition which includes an oligomer of gp140(prime) and a
pharmaceutically acceptable carrier, wherein the gp140(prime) is a
C-terminally truncated form of an HIV-1 gp160, and the HIV-1 gp160
has a gp120-gp41 proteolytic processing site. According to one
embodiment of the method, the composition is administered
intramuscularly and can be administered intramuscularly a plurality
of times. According to another embodiment, the HIV-1 gp160 is found
in a laboratory-adapted strain of HIV-1, such as HIV-1 BH8.
According to still another embodiment of the invention, the HIV-1
gp160 is found in a primary isolate of HIV-1, such as HIV-1 89.6 or
HIV-1 CM235. According to yet another embodiment, the C-terminally
truncated form of the HIV-1 gp160 includes the entire sequence of a
mature gp120 that does not include a signal peptide.
In a fourth aspect of the invention, there is provided a
recombinant oligomeric gp140.
In a fifth aspect of the invention, there is provided a recombinant
oligomeric gp140(prime).
In a sixth aspect of the invention, there is provided a recombinant
oligomeric gp120/20.
In a seventh aspect of the invention, there is provided a
recombinant oligomeric gp140 or gp140(prime) having been produced
by a two-step purification process.
In an eighth aspect of the invention, there is provided a vaccine
which includes oligomeric gp140, gp140(prime) or gp120/20.
In a ninth aspect of the invention, there is provided a method of
preventing HIV infection in a subject. This method includes the
steps of administering a vaccine which includes oligomeric gp140,
gp140(prime) or gp120/20 in an amount sufficient to prevent HIV
infection.
In a tenth aspect of the invention, there is provided the
recombinant viral construct vPE12B.
In an eleventh aspect of the invention, there is provided the
plasmid construct pPE12B.
In a twelfth aspect of the invention, there is provided the
recombinant viral construct vCB-14.
In a thirteenth aspect of the invention, there is provided the
plasmid construct pCB-14.
BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1A-1D show the results of a FACS sort. The horizontal axes
represents fluorescence intensity while the vertical axes
represents cell number. The antibodies used in the experiments
summarized in FIGS. 1A-1D were a control mouse IgG, anti-gp120
monoclonal antibody 110.4, anti-gp120 monoclonal antibody D34 and
anti-gp41 monoclonal antibody D6, respectively.
DETAILED DESCRIPTION OF THE INVENTION
We have discovered that recombinant HIV-1 env proteins can be
produced and purified in such a way that the humoral immune
response to these immunogens exhibits a bias toward
conformation-sensitive epitopes, thereby producing
conformation-dependent antibodies to these proteins.
Significantly, sera from HIV-1 infected individuals is also known
to contain high titers of neutralizing antibodies that are reactive
against conformation sensitive epitopes. Our discovery therefore
provides a means by which immunization with an env subunit
preparation can be used to recapitulate some aspects of the immune
response that are observed in individuals who have been infected
with viable HIV-1.
The recombinant env glycoprotein that provided the advantageous
immune response was modified in two ways. First, the proteolytic
cleavage recognition site that ordinarily facilitates separation of
the gp120 and gp41 subunits was eliminated by site directed
mutagenesis. This mutation ensured that a single glycoprotein
species was produced that exhibited structural features of both
gp120 and gp41. Furthermore, the presence of gp41 amino acid
sequences provided a means by which monomers could associate into
higher order structures. The second modification to the env
glycoprotein was the introduction of stop codons just upstream of
the gp41 transmembrane domain. This latter modification allowed the
env glycoprotein to be produced in a secreted form. Hence, the
recombinant HIV-1 env immunogen described in the present invention
is a secreted molecule with an amino acid sequence characteristic
of both gp120 and gp41. This recombinant env glycoprotein has a
molecular weight of 140 kDa, and so has been termed "gp140."
Several lines of evidence suggested that secreted, oligomeric gp140
would reflect the native env structure. First, the protein was
efficiently secreted. Since misfolded molecules are typically
retained and degraded in the endoplasmic reticulum, it was unlikely
that the folded structure of gp140 was grossly aberrant. Second,
gp140 efficiently bound soluble CD4 (sCD4) and the
conformation-dependent anti-gp120 monoclonal antibody (MAb), F105.
Since the CD4 and F105 epitopes on gp120 are discontinuous in
nature, our findings indicated the gp120 portion of the molecule
exhibited structural features that were characteristic of the
native conformation. The strongest evidence that purified gp140
accurately reflected native env structure came from analysis of
anti-gp140 antibodies. The great majority of MAbs raised against
oligomeric gp140 recognized env proteins on the surface of cells
chronically infected with HIV-1. More than half (79 of 138) of the
MAbs that were tested recognized conformational epitopes found on
either gp120 or gp41.
These findings demonstrated that an oligomeric gp140 immunogen
could be used according to the methods described below to elicit
antibodies against conformational epitopes on HIV-1. The large
number of MAbs obtained having specificity for conformational
epitopes using the process defined below indicated that oligomeric
gp140 elicited a qualitatively different immune response than
monomeric protein (whether native or denatured). Our findings show
that it is possible to produce and purify a soluble, oligomeric
form of env which reflects the native structure of the wild-type
protein.
Some of the secreted oligomeric HIV-1 env proteins that were used
as immunogens in our procedures were produced by exemplary
recombinant vaccinia viruses, vPE12B and vCB-14. Both of these
virus constructs express genes that encode mutated env
glycoproteins. The protein coding sequences in these constructs
were truncated after amino acid 678 (Lys), just before the
transmembrane domain so as to result in 140 kDa env molecules
(gp140). To prevent dissociation of gp120 from the gp41 ectodomain
fragment during purification, a deletion was made in the region of
the env gene that encoded the amino acids at the gp120-gp41
cleavage site. In J. Virology 65:31 (1991), Earl et al. showed that
this mutation, when introduced into the full length env gene,
yielded a non-cleaved form of env that efficiently folds,
assembles, is transported to the plasma membrane and can bind CD4.
Notably, since the ectodomain of gp41 is required for efficient
oligomerization of gp160 dimers and tetramers (Earl et al., Proc.
Natl. Acad. Sci. USA 87:648 (1990); Earl and Moss, AIDS Res.
9:589-594 (1993)), the oligomeric env proteins described herein
must retain the essential part of the ectodomain that is
responsible for interaction between monomers. Thus, it is
contemplated that recombinant oligomeric env glycoproteins which
retain the advantageous immunogenic properties as described herein
could be created using less than the full gp41 ectodomain. The
oligomeric nature of the env immunogens must be retained, however.
A synthetic early/late vaccinia virus promoter was utilized to
drive high levels of gene expression in the constructs described
below.
Example 1 illustrates the construction of recombinant vaccinia
viruses that express modified HIV-1 env glycoproteins. It should be
understood that, while the following procedures employ the BH8
HIV-1 env as the source of env sequences in the construction of
vectors useful for expressing modified env glycoproteins, the HIV-1
env glycoproteins modified as described in the following Example
can be created using any HIV-1 env sequence. This is true for env
proteins corresponding to both laboratory-adapted strains and
primary isolates of HIV-1.
EXAMPLE 1
Construction of a Recombinant Vaccinia Virus for Expression of a
Truncated HIV-1 env Protein
Two recombinant vaccinia viruses were constructed for production of
soluble, secreted, HIV-1 env glycoprotein gp140. The BH8 HIV-1
isolate (Genbank accession number K02011) was used as the source of
the env gene in these constructions. Nucleotide numbers referenced
below correspond to this sequence. For construction of both
recombinant viruses, two translation termination codons were
inserted after nucleotide 2034, just prior to the transmembrane
domain of gp41 after amino acid residue 678. These mutagenesis
reactions were performed using a two-step polymerase chain reaction
(PCR) protocol as described by Ho, et al. in Gene 77:51 (1989).
Numbering of amino acids started at the beginning of the open
reading frame and thus includes the signal peptide. In the first
step, two DNA fragments with overlapping ends were synthesized.
These fragments spanned a region of the env gene from the HindIII
restriction site (nucleotide 2128), through the transmembrane
coding region, to the BamHI restriction site (nucleotide 2462). One
fragment was generated in a PCR reaction with a first primer (a)
5'-AACAATTACACAAGCTTAATACACTC-3' (Seq. I.D. No: 1) containing the
HindIII restriction site and a second primer
(b)5'-CCCCCGCGGTTATTATTTTATATACCACAGCCAATTTGT-3' (Seq. I.D. No: 2)
containing the translation termination codons. The other fragment
was generated with oligonucleotide
(c)5'-GTGCTAAGGATCCGTTCACTAATCG-3' (Seq. I.D. No: 3) containing the
BamHI restriction site in conjunction with
(d)5'-TAATAACCGCGGGGGTTATTCATAATGATAGTAGGAGGC-3' (Seq. I.D. No: 4).
These two amplified fragments were then used together in a second
PCR reaction along with oligonucleotides (a) and (c), to generate a
372 base pair fragment. This fragment was digested with HindIII and
BamHI and exchanged with the analogous fragment in the env gene of
pSC60 (S. Chakrabarti, unpublished), a plasmid which contains the
entire env gene under control of a synthetic early/late vaccinia
virus promoter. The resulting plasmid, pCB-14, thus contained the
env gene truncated after amino acid 678. The proteolytic cleavage
sites between gp120 and gp41 were removed by restriction fragment
substitution of a 575 base pair SspI--HindIII fragment between
nucleotides 1553 and 2128 with the analogous fragment from the
plasmid, pPE12, which has been described by Earl et al., in J.
Virology 65:31 (1991), to generate pPE12B. The plasmid pPE12
contained the env gene from which 12 amino acids, including the
primary and secondary cleavage sites, had been removed. Hence,
plasmids pCB-14 and pPE12B were used to generate recombinant
vaccinia viruses (vCB-14 and vPE12B) which expressed cleavable and
non-cleavable secreted gp140 molecules, respectively.
Several other recombinant vaccinia viruses were also used. vPE16
has been described by Earl et al. in J. Virology 64:2448 (1990) and
expresses wild type gp160 under control of the vaccinia virus 7.5k
promoter. vSC60 expresses wild type gp160 under control of the
vaccinia virus synthetic early/late promoter. vPE12 expresses a
noncleavable form of gp160; vPE8 expresses gp120; and the series
VPE17, vPE18, vPE20, vPE21, and vPE22 (Earl et al., J Virology
65:31 (1991)) express C-terminally truncated env glycoprotein
molecules. vSC64 expresses a chimeric env glycoprotein molecule
consisting of HIV-2 gp120 and HIV-1 gp41 (S. Chakrabarti,
unpublished). vCB-5 which has been described by Broder and Berger
in J Virology 67:913 (1993), expresses soluble CD4 (372 amino acid
residues). Finally, the plasmid, pPE63, which has been described by
Earl and Moss in AIDS Res. and Hum. Retro. 9:589 (1993) expresses a
truncated env glycoprotein via the hybrid vaccinia/T7 system.
The protein made by vCB-14 infected cells was secreted in both
cleaved and non-cleaved forms while that expressed by vPE12B was
recovered primarily as non-cleaved gp140.
To produce oligomeric gp140 glycoproteins for use as immunogens,
BS-C-1 monolayers (ATCC CCL26) were infected with vPE12B. The
secreted gp140 was purified from the culture medium using a
two-step procedure as described below in Example 2.
EXAMPLE 2
Purification of Secreted Recombinant HIV-1 env Glycoprotein gp140
for Immunizations
Typically, 40 confluent 150 cm.sup.2 flasks, containing
approximately 1.5.times.10.sup.7 BS-C-1 cells per flask, were
infected with vPE12B at a multiplicity of infection of 10. Two
hours after infection, the monolayers were washed three times with
phosphate buffered saline (PBS) to remove free virus particles and
then overlaid with the commercially available reduced serum media,
OPTI-MEM (Gibco, Grand Island, N.Y.). After 24 to 36 hours, the
medium was harvested and culture debris was removed by
centrifugation for 30 minutes at 12,000 rpm. TRITON X-100 was then
added to 0.5% final concentration. Glycoproteins were then purified
by LENTIL LECTIN-SEPHAROSE (Pharmacia, Piscataway, N.J.)
chromatography as follows: The pooled culture supernatant
containing secreted gp140 was cycled continuously over a 13
cm.times.1 cm column overnight. The column was washed with PBS
containing 10 mM Tris-HCl pH 8.0, 0.3M NaCl, 0.5% TRITON X-100 (10
column volumes) followed by PBS containing 10 mM Tris-HCl pH 8.0 (2
column volumes). Glycoproteins were eluted with 0.5M methyl
alpha-D-mannopyranoside in PBS containing 10 mM Tris-HCl pH 8.0 (3
column volumes) and concentrated 20 to 30.times. in CENTRICON
microconcentrators. This step resulted in elimination of most
contaminating proteins. The concentrated material was loaded onto
5-20% sucrose gradients and centrifuged 20 hours in an SW40 rotor
at 40,000 rpm, 4.degree. C. After fractionation of the gradients,
aliquots were analyzed by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) followed by Western blotting using a
rabbit polyclonal antisera to HIV-1 gp160 (R160) described by
Willey et al., in Virology 184:319 (1991) and .sup.125 I-labeled
protein A (Amersham). The results of the Western blot showed a band
corresponding to a 140 kDa molecular weight protein. The majority
of the gp140 glycoprotein was in dimeric and higher order forms. A
minor peak that contained monomeric gp140 and gp120 was also
obtained. Fractions containing monomeric, dimeric, and tetrameric
env glycoprotein were separately pooled and concentrated.
To verify the oligomeric status of each pooled fraction, aliquots
were cross-linked with 1 mM ethylene
glycolbis(succinimidylsuccinate) (EGS) (Pierce, Rockford, Ill.) and
analyzed by SDS-PAGE (4%) and Western blotting with R160 as
described by Earl et al., in Proc. Natl. Acad. Sci. USA 87:648
(1990). The Western blotting results confirmed that the dimeric and
tetrameric gp140 fractions were cross linked into dimers and larger
forms, respectively, whereas monomeric gp140 was not cross-linked
into larger molecular weight species. The gradient separations were
judged to be efficient, as there was no evidence for cross
contamination between the monomer, dimer and tetramer fractions.
Analysis of the protein staining pattern of each sucrose gradient
peak indicated that gp140 was the predominant band in all three
preparations.
Example 3 illustrates how mice can be injected with the isolated
gp140 glycoproteins to stimulate an anti-env immune response.
Further, Example 3 describes the production of hybridomas from the
spleen cells of the immunized mice.
EXAMPLE 3
Immunization of Mice and Production of Hybridomas
A.SW/SnJ mice (Jackson Laboratories, Bar Harbor, Me.) were
immunized with either monomeric (2 mice), dimeric (3 mice), or
tetrameric (4 mice) gp140 preparations with RIBI adjuvant (RiBi
Immunochem Research Inc., Hamilton, Mont.) as recommended by the
supplier. A preliminary test indicated that emulsification of the
preparations in this adjuvant did not affect the oligomeric state
of the env glycoprotein as shown by chemical cross-linking followed
by Western blot analysis. Mice were inoculated at 3 week intervals
with 15-20 .mu.g of purified HIV-1 env glycoprotein per mouse (1/2
subcutaneously and 1/2 intraperitoneally). Serum collected from
each animal after the first inoculation efficiently reacted with
gp140 as assayed by immunoprecipitation. The serum was also
reactive with gp160, gp120, and gp41 as assayed by Western
blotting. Mice receiving monomeric and dimeric gp140 preparations
were inoculated three times while mice receiving tetrameric gp140
were inoculated four times.
Three days after the final inoculation, mice were sacrificed and
the spleens harvested and prepared for cell fusion using standard
methods. Splenocytes were fused with Sp2/0 Agl4 myeloma cells (ATCC
CRL1581) with polyethylene glycol using a modification of the
method of Gefter et al., described in Somat. Cell Genet. 3:231
(1977). Following polyethylene glycol fusion, the cell preparations
were distributed in 96-well plates at a density of 10.sup.5 cells
per well, based on the number of Sp2/0 partner cells, and selected
in Ivscove's minimal essential medium (IMEM) supplemented with
hypoxanthine/aminopterin/thymidine (HAT medium), 10% FCS (Hyclone
Laboratories, Hazelton, Mont.), and 100 units of IL-6 per ml
(Boehringer Mannheim Biochemicals, Indianapolis, Ind.). No feeder
cell cultures were employed. The medium was replaced with fresh
HAT-supplemented IMEM approximately 10 days after plating.
To identify hybridomas producing MAbs that were capable of
recognizing conformation-dependent epitopes, hybridoma supernatants
were tested for the ability to immunoprecipitate radioiodinated,
gradient purified oligomeric or monomeric gp140. Example 4
illustrates the method used to prepare the radiolabeled env
reagents, and to screen the various MAbs for binding activity.
EXAMPLE 4
Screening MAbs for gp140 Oligomer Binding
Preparations of purified monomeric, dimeric, or tetrameric gp140
glycoproteins (50 .mu.g) were labeled with .sup.125 I by the
chloramine T method using IODOBEADS (Pierce Chemical) as described
by Markwell in Anal. Biochem. 125:427 (1982). Radiolabeled
glycoproteins were separated from free iodine by passage over a
G-25 Sepharose column, and stored at 4.degree. C. Typically, 1.0
.mu.g of gp140 contained approximately 1 to 2.times.10.sup.6 CPM.
lodination of gp140 preparations did not disrupt their oligomeric
structure as determined by cross-linking with 1 mM EGS and analysis
by SDS-PAGE (4%) and Western blotting.
Twelve days after plating, the supernatants from all wells
containing a hybridoma colony were screened by immunoprecipitation
with radioiodinated gp140 preparations. A 100 .mu.l sample of
culture supernatant was incubated with 100 .mu.l of PBS containing
0.5% TRITON X-100, 0.5% NONIDET P-40, radioiodinated gp140
(approximately 100,000 CPM), and 4 .mu.g of rabbit anti-mouse IgG
(Calbiochem, La Jolla, Calif.) for 1 hour at room temperature in
microcentrifuge tubes. The oligomeric forms of gp140 used for
screening each set were the same as that used for immunization.
Protein A Sepharose beads (100 .mu.l of a 20% suspension) were then
added and tubes rocked for 30 minutes. The Protein A Sepharose
beads we used in our procedures were obtained from Pharmacia
(catalog number 17-0780-01). The Sepharose beads were centrifuged
and the pellets were washed once with PBS containing 0.5% TRITON
X-100 and 0.5% NP-40. The tubes were counted in a Beckman Gamma
5500B counter. The MAb 902, which binds the V3 loop of gp120,
described by Chesebro and Wehrly, in J. Virology 62:3779 (1988),
and polyclonal rabbit antibody R160, which identifies all forms of
env, were included as positive controls. Culture supernatant from
an irrelevant hybridoma was included as a negative control.
The results of this screening procedure were unambiguous.
Supernatants from negative wells precipitated <1000 CPM of gp140
while most positive supernatants immunoprecipitated >20,000 CPM.
During the initial screening, random samples that were deemed
positive were analyzed by SDS-PAGE to ensure that gp140 was indeed
immunoprecipitated. No false positives were detected. Altogether,
190 hybridomas from 9 mice in 5 fusion experiments were strongly
positive using this assay. Of these, 180 were still positive after
expansion. Of this number, 138 were cloned by limiting dilution
using standard methods. Of this number only 15 were derived from
mice immunized with monomeric gp140.
Since the mice used as spleen donors for hybridoma production had
been immunized with a non-cleavable, truncated form of env it was
important to demonstrate that the MAbs recognized the authentic
HIV-1 env molecule. To do this, approximately 90% of the MAbs were
screened by FACS analysis for the ability to recognize naturally
occurring env on the surface of cells chronically infected with
HIV-1 IIIB. Example 5 describes the procedures that were used to
carry out these tests.
EXAMPLE 5
Identification of MAbs that Recognize Native HIV-1 env
Human T cells (1.times.10.sup.6 /50 .mu.l) chronically infected
with HIV-1 (IIIB) were incubated with the various hybridoma
supernatants described above. After 30 minutes at 4.degree. C., the
cells were washed twice with PBS containing 1% bovine serum
albumin, incubated with goat anti-mouse-fluorescein isotiocyanate
for 30 minutes at 4.degree. C. and then washed 2 times. The cells
were resuspended in 1 ml of 4% paraformaldehyde and analyzed with a
fluorescence-activated cell sorter (FACScan; Becton Dickinson).
Representative FACS profiles are shown in FIGS. 1A-1D. A control
mouse IgG did not label the cells (FIG. 1A), while a previously
described MAb to gp120, 110.4 (FIG. 1B) labeled the cells strongly.
The profiles of one new anti-gp120 MAb, D34, and one new anti-gp41
MAb, D6 are shown in FIGS. 1C and 1D, respectively. At least 80% of
the MAbs against the oligomeric form of gp140 were clearly positive
in this assay. Lack of reactivity could be due to a very low titer
of antibody or reactivity with an epitope that is unique to the
recombinant gp140 molecule. The fact that the large majority of the
MAbs tested recognized native HIV-1 env provided strong evidence
that the recombinant, oligomeric gp140 used here faithfully
reflected the antigenic structure of the authentic molecule.
To determine which of the MAbs recognized linear,
conformation-independent epitopes, each was screened for the
ability to react with Western blotted gp140 that had been denatured
and reduced prior to SDS-PAGE. Monoclonal antibodies that
recognized protein that had been Western blotted in this fashion
were judged to bind epitopes that were independent of the protein's
conformation. The methods used to make these determinations are
presented in Example 6.
EXAMPLE 6
Identification of MAbs that Bind Conformation-Independent
Epitopes
Protein extracts from BS-C-1 cells infected with vaccinia virus
recombinants that expressed different HIV-1 env genes from Example
2 were separated on SDS-PAGE (10%) and transferred to
nitrocellulose membranes. In some cases, proteins were separated on
preparative gels and the nitrocellulose was cut into 10 mm strips
after protein transfer. The nitrocellulose membranes were incubated
with anti-gp140 monoclonal antibodies (usually 1:5 dilution) for 1
hour at room temperature. After washing with PBS containing 0.2%
Tween-20, the strips were incubated with .sup.125 H labeled rabbit
anti-mouse IgG for 30 minutes followed by washing. Hybridization
with polyclonal antibody R160 was done at a 1:500 dilution followed
by detection with .sup.125 I Protein A. Proteins were visualized by
autoradiography using standard, well known methods.
Representative results from this Western blotting protocol are
summarized in Table 1. We found that 43% of the MAbs reacted
strongly with denatured env, 11% reacted very weakly (e.g., D9,
D59), and 46% were completely negative even though they efficiently
immunoprecipitated env. We defined MAbs that reacted either very
weakly or not at all to denatured env as conformation-dependent.
The remaining MAbs, which reacted strongly with denatured env, were
defined as conformation-independent. By this criteria, 57% (79/138)
of the MAbs recognized conformationally sensitive epitopes while
43% (59/145) recognized linear or conformation-independent epitopes
(Table 2). Of the 59 conformation-independent MAbs analyzed, 50
recognized epitopes in gp120 while 9 recognized epitopes in gp41
(Table 2).
TABLE 1 Binding Specificities of Anti-gp140 MAbs MAb gp160 gp120
gp41 M12 - - - D9 + - - D19 +++ +++ - D20 - - - D33 - - - D34 +++
+++ - D38 - - - D47 +++ +++ - D59 + - - T3 +++ - +++ T6 - - - T17
+++ +++ - T20 - - - T30 +++ - +++ 902 +++ + - Negative - - - R160
+++ +++ +++
Thus, the immunization and screening approach that we have
described generated a large number of MAbs that bind the env
glycoprotein. The procedure described in Example 6 provided results
that indicated which of the subunits of the env glycoprotein
harbored epitopes that were recognized by the
conformation-independent antibodies. Since less than half of all
the MAbs that bound the env glycoprotein recognized
conformation-independent epitopes, we expected the majority of the
MAbs raised against the recombinant proteins to recognize
conformation-dependent epitopes.
We used a protocol based on immunoprecipitation of metabolically
labeled env glycoproteins to identify which of the subunits were
recognized by the conformation-dependent epitopes. Example 7
describes the techniques used to produce radiolabeled env
glycoprotein reagents that were used in these assays.
EXAMPLE 7
Metabolic Labeling and Isolation of env Glycoproteins
BS-C-1 cells were infected with recombinant vaccinia virus at a
multiplicity of infection of 20. At 4 hours post infection, the
virus inoculum was replaced with methionine-free minimal essential
medium (MEM) containing 100 .mu.Ci [.sup.35 S]methionine/ml and
incubated overnight. Cells were lysed in buffer containing 100 mM
Tris-HCl pH 8.0, 100 mM NaCl, 0.5% TRITON X-100. Soluble, secreted
forms of env glycoprotein were obtained from the medium of infected
cells. For preparation of the ectodomain fragment of gp41 (gp41s),
the medium of infected cells was concentrated using Amicon
microconcentrators and separated on a 5-20% sucrose gradient as
described above. Monomeric gp120 was obtained from the medium of
infected cells and in some cases was purified on a sucrose density
gradient.
The epitope recognized by each MAb was initially mapped to either
gp120 or the gp41 ectodomain. Mapping of the
conformation-independent MAbs was done by Western blot analysis as
described in Example 6. Mapping of the conformation-dependent MAbs
was performed by immunoprecipitation analyses using several
different metabolically labeled forms of env. These included
monomeric gp120; a gradient purified gp41 ectodomain fragment
derived from vCB-14; and a cell lysate containing full length
gp160, gp120 and gp41.
Example 8 describes the immunoprecipitation protocol that was used
to identify the subunit target of MAbs that did not stain Western
blotted env proteins.
EXAMPLE 8
Mapping the Subunit Targets of MAbs that Recognize
Conformation-Dependent Epitopes
Immunoprecipitations were performed by incubating metabolically
labeled env with various antibodies overnight at 4.degree. C.
Typically, 200 .mu.l of a hybridoma culture supernatant or 1 .mu.l
of a polyclonal antiserum were used per immunoprecipitation. Where
appropriate, 4 .mu.g of rabbit anti-mouse IgG (Calbiochem) was then
added for 30 minutes followed by 100 .mu.l of a 20% protein A
SEPHAROSE suspension. After 30 minutes of rocking, the Sepharose
beads were centrifuged at 1000.times.g for 4 minutes and the
pellets were washed twice with 1 ml TRITON buffer (50 mM Tris-HCl
pH 8.0, 300 mM NaCl, 0.1% TRITON X-100). Proteins were eluted by
boiling 5 minutes at 100.degree. C. in sample buffer containing 5%
2-mercaptoethanol.
Table 2 presents a summary of monoclonal antibody reactivities that
were raised against native, soluble, gp140. The MAb entries in the
table are classified on the basis of which subunit they recognize
(gp120 or gp41), whether they recognize conformation-dependent or
conformation-independent epitopes, and by the original immunogenic
target oligomeric form. Of the 79 conformation-dependent MAbs
analyzed, 33 mapped to gp120. Many of these anti-gp120 MAbs
coprecipitated gp41 in a lysate containing gp160, gp120, and gp41
whereas none of the anti-gp41 MAbs coprecipitated gp120.
Of the MAbs that did not immunoprecipitate purified gp120, many
immunoprecipitated the purified gp41 ectodomain fragment indicating
that their epitopes reside in the gp41 ectodomain. However, a
number of MAbs were unable to immunoprecipitate either purified
gp120 or the gp41 ectodomain fragment. Some of these MAbs
immunoprecipitated both gp41 and gp160 from cell lysates. As a
consequence, it was not possible to determine if these MAbs
recognized gp160 specific epitopes and coimmunoprecipitated gp41,
or whether they recognized oligomer dependent epitopes present in
gp41. To distinguish between these possibilities, the MAbs were
tested for their ability to immunoprecipitate a chimeric env
protein consisting of HIV-2 gp120 and HIV-1 gp41 (vSC64). The vSC64
chimeric protein is transported to the cell surface and can mediate
syncytia formation, indicating that it folds and assembles
correctly. None of these MAbs immunoprecipitated the HIV-2 env
protein. They did, however, recognize the chimeric protein,
indicating that their epitopes are present in the HIV-1 gp41
ectodomain.
Thus, more than one-third of the MAbs derived from immunization
with native oligomeric gp140 were directed against epitopes in the
gp41 ectodomain. Comparison of the subunit mapping results with the
data on conformation dependence revealed that the antigenic
structure of gp41 is exquisitely sensitive to conformation. More
than 80% (43/52) of the MAbs to gp41 recognized
conformation-dependent epitopes (Table 2). By contrast, the
antigenic structure of gp120 appeared to be less sensitive to env
tertiary structure, since 42% (33/79) of the gp120 MAbs recognized
conformational epitopes (Table 2).
TABLE 2 Summary of Re-activities of MAbs Raised Against Native,
Soluble, gp140 Conf Conf Indep Dep CD4 Total Epitope Epitope V3
Loop blocking All Mabs Total 138 59 79 15/82 19/76 Conformation Dep
79 -- -- 0/32 19/49 Conformation Indep 59 -- -- 15/50 0/27 gp120
Mabs Total 83 50 33 15/82 19/41 Conformation Dep 33 -- -- 0/32
19/20 Conformation Indep 50 -- -- 15/50 0/21 gp41 Mabs Total 52 9
43 -- 0/35 Conformation Dep 43 -- -- -- 0/29 Conformation Indep 9
-- -- -- 0/6 Immunogen-Monomer All Mabs 15 9 6 -- 3/12 gp120 Mabs
12 9 3 7/12 3/10 gp41 Mabs 3 0 3 -- 0/2 Immunogen-Dimer All Mabs 68
19 49 -- 14/41 gp120 Mabs 34 14 20 6/33 14/22 gp41 Mabs 31 5 26 --
0/19 Immunogen-Tetramer All Mabs 55 31 24 -- 2/23 gp120 Mabs 37 27
10 2/37 2/9 gp41 Mabs 18 4 14 -- 0/14
Example 9 describes the method used to more precisely map the env
glycoprotein epitopes recognized by the MAbs. The approach we
employed relied on the use of a series of recombinant env molecules
that differed from each other by sequential deletions from the
carboxy terminal end of the protein.
EXAMPLE 9
Detailed Epitope Mapping of MAbs
A series of C-terminally truncated env molecules expressed either
by recombinant vaccinia viruses or by the transient vaccinia/T7
system described by Fuerst et al., in Proc. Natl. Acad. Sci. USA
83:8122 (1986), served as binding substrates for the MAbs. The env
molecules used in this procedure included full length gp140 (678
amino acids), two molecules with sequential truncations in gp41
(635 and 574 amino acids), full length gp120 (502 amino acids), and
three truncated forms of gp120 (393, 287, and 204 amino acids) as
described by Earl et al., J. Virology 65:31 (1991), and by Earl et
al., in AIDS Res. and Hum. Retro. 9:589 (1993). Mapping of the
conformation-independent MAbs was performed by Western blotting
extracts of cells expressing the truncated env molecules. The
results are summarized in Table 3. Of the 9 anti-gp41 MAbs tested,
1 mapped to amino acids 503-574, 5 mapped to amino acids 575-635,
and 3 mapped to amino acids 636-678. Of the 50 anti-gp120 MAbs to
conformation-independent epitopes, 32 mapped to the amino terminal
204 amino acids, 3 mapped to amino acids 205-287, and 15 mapped to
amino acids 288-393. Somewhat surprisingly, no
conformation-independent MAbs mapped to the C-terminal region of
gp120 (between amino acids 394-502) even though antibodies to this
region are abundant in human serum. One explanation for this
finding is that the C-terminal region of gp120 is partially
sequestered by interactions with adjoining env subunits or with
gp41.
TABLE 3 env Total # Total # of truncation of Mabs amino acids gp120
1-204 32 204 205-287 3 83 288-393 15 106 394-502 0 109 gp41 503-574
1 72 575-635 5 61 636-678 3 43
Initial mapping of the conformation-dependent MAbs was done by
immunoprecipitation of metabolically labeled, truncated env
molecules. Of the 39 anti-gp41 MAbs tested, 3 efficiently
immunoprecipitated the 636 amino acid env molecule indicating that
amino acids 635-678 are not necessary for antibody recognition. Of
the 32 anti-gp120 antibodies tested, only 2 immunoprecipitated the
393 amino acid gp120 molecule; one of these also immunoprecipitated
the 287 amino acid molecule. However, the inability of a
conformation-dependent MAb to immunoprecipitate a truncated form of
env does not necessarily imply that its epitope lies completely or
even partially within the truncated area since the overall
structure of the truncated molecules may be significantly different
from the native, full length protein.
To determine the fraction of MAbs directed against the gp120 V3
loop generated by immunization with oligomeric gp140, a V3 loop
peptide ELISA assay was performed with both conformation-dependent
and -independent anti-gp120 MAbs. Example 10 describes the method
used to assess the ability of MAbs to recognize the V3 loop region
of gp120.
EXAMPLE 10
Reactivity of MAbs with the V3 Loop Peptide
The HIV-1 IIIB V3-loop peptide (CNTRKSIRIQRGPGRAFVTIGK) (Seq. I.D.
No: 5) (American Bio-Technologies, Cambridge, Mass.) and the HIV-1
MN V3-loop peptide (YNKRKRIHIGPGRAFYTTKNIIG) (Seq. I.D. No: 6)
(NIAID, Biological Resources Branch) were used to determine the V3
loop reactivities of the MAbs. Briefly, the wells of IMMULON II 96
well assay plates were coated with 50 .mu.l of 0.05M sodium
carbonate pH 9.5, containing 0.25. .mu.g of peptide, overnight at
4.degree. C. Plates were washed with PBS containing 0.1% Tween 20
and blocked with a solution of proteolyzed gelatin (Boehringer
Mannheim Biochemicals). Antibody binding was performed at room
temperature for 1 hour. Serial dilutions were tested in duplicate.
Bound MAb was detected with a peroxidase-conjugated anti-mouse IgG
(Boehringer Mannheim Biochemicals) and
2,2'-Amino-di-[3-ethylbenzthiazoline sulfonate] substrate
(Boehringer Mannheim Biochemicals). All MAbs exhibiting binding
were reexamined on mock-coated plates, and no false positives were
detected.
We found that 15 of 50 conformation-independent MAbs exhibited
reactivity with the HIV-1 IIIB V3 loop peptide (Table 2). Of these,
two cross-reacted with a V3 loop peptide from the MN strain.
Surprisingly, a correlation was observed between the oligomeric
state of the immunogen used and the frequency with which anti-V3
loop MAbs were derived. Of the 15 MAbs derived from animals
immunized with monomeric gp140, 7 were against the V3 loop. In
contrast, only 6 of 32 MAbs from animals immunized with dimer and 2
of 38 immunized with tetramer bound to the V3 loop peptide (Table
2). Thus, a greater proportion of non-V3 loop MAbs was obtained
when oligomeric gp140 was used as the immunogen indicating that the
V3 loop may not be a predominant epitope when presented in the
context of oligomeric gp140. For this reason, immunization with
oligomeric gp140 may, as a consequence, generate a greater
proportion of antibodies to conserved, conformational epitopes
rather than to variable, linear regions of the protein.
Unlike antibodies to the V3 loop, neutralizing antibodies which
block env-CD4 binding generally recognize conformationally
sensitive epitopes and often recognize the env from divergent
strains. We tested a large panel of MAbs to both gp120 and gp41 for
the ability to block binding of sCD4 to env.
Example 11 describes the methods used to assay the abilities of
different MAbs to block the env-CD4 interaction.
EXAMPLE 11
Ability of MAbs to Block env-CD4 Binding
Metabolically labeled gp140 and sCD4 were prepared from the medium
of cells infected with vPE12B and vCB-5, respectively. Dimeric
gp140 was purified by sucrose density gradient centrifugation as
described above. 100 .mu.l of hybridoma supernatant (MAb in excess
of env) was incubated overnight at 4.degree. C. with dimeric gp140.
A small amount of sCD4 was added and incubated for 30 minutes at
room temperature. Then 2 .mu.g of rabbit anti-mouse IgG was added
for 30 minutes, followed by 100 .mu.l of Protein A Sepharose beads
(20% suspension). After 30 minutes of gentle rocking, the beads
were washed once with buffer containing 100 mM Tris-HCl pH 8.0, 100
mM NaCl, 0.5% TRITON X-100 and samples were analyzed by SDS-PAGE
(10%). MAb F105, which blocks CD4 binding, was used as a positive
control for CD4 blocking activity. The MAb F105 was obtained from
the AIDS Research and Reference Program. The anti-V3 loop MAb, 902,
that does not block CD4 binding was used as a negative control in
these procedures.
However, we discovered that of the 20 conformation-dependent
anti-gp120 MAbs tested, 19 efficiently blocked sCD4 binding (Table
2). In contrast, none of the 21 conformation-independent anti-gp120
MAbs tested blocked CD4 binding. As expected, none of the anti-gp41
MAbs blocked binding of sCD4 regardless of their conformational
dependence. Thus, in this panel of MAbs, the ability to block sCD4
binding was restricted to conformation-dependent antibodies that
bound gp120. We have therefore discovered that antibodies raised
against the oligomeric form of gp140 provide advantages in that
they can efficiently block CD4/env interactions.
It is known that conformation-dependent epitopes typically
represent highly conserved structural features of proteins. For
this reason MAbs raised against the oligomeric structure of env
proteins should bind epitopes common to a broad spectrum of HIV-1
strains. Such a class of MAbs will be particularly useful as
diagnostic reagents. Example 12 illustrates how one of ordinary
skill in the art can identify conformation-dependent MAbs that
recognize the env epitopes common to a variety of HIV-1
strains.
EXAMPLE 12
Identification of Conformation-Dependent MAbs that Recognize a
Broad Spectrum of HIV-1 Strains
Human blood samples are taken from normal donors and individuals
known to be infected with HIV-1. The infected blood samples have
been previously typed, either by antibody staining or nucleic acid
analysis, so that the strain of HIV-1 that is the infectious agent
in each sample is identified. A panel of blood specimens is then
chosen that includes a normal sample to be used as a negative
control, and several additional samples that collectively represent
infections by a variety of different HIV- 1 strains. Aliquots of
the blood samples are incubated with antibodies against oligomeric
env. Methods for producing these antibodies are described in
Example 3. Antibodies that are not specific for conformational
epitopes are also included as controls. After incubation of
approximately 30 minutes at 4.degree. C., the cells are washed
twice with PBS containing 1% bovine serum albumin, and incubated
with a goat anti-mouse IgG antibody conjugated to fluorescein
isothiocyanate for 30 minutes at 4.degree. C. The cell samples are
subsequently washed two additional times with PBS and then
resuspended in 1 ml of 4% paraformaldehyde. These samples are then
analyzed with a fluorescence-activated cell sorter (FACScan; Becton
Dickinson). The fluorescence intensity observed for the normal
control sample establishes the level of non-specific background
labeling. In general, conformation-dependent MAbs bind to a wide
range of HIV-1 strains, whereas non-conformational dependent
antibodies only bind to one strain of HIV-1.
Given the identification of conformational-dependent MAbs that bind
a broad range of HIV-1 strains, it then becomes advantageous to use
these antibodies as reagents in immunoassays to identify HIV-1.
These antibodies advantageously identify a wide range of different
HIV-1 strains. Such a protocol will provide a more accurate and
inexpensive HIV-1 assay. An immunoassay conducted with a single MAb
detection reagent will require fewer reagents and a lesser number
of control samples to ensure assay reliability. Example 13
illustrates how the MAbs identified in Example 12 can be used to
identify a patient having an HIV-1 infection.
EXAMPLE 13
Assay for the Presence of HIV-1 Antigens in Serum Samples
A blood sample drawn from a patient suspected of having an HIV-1
infection is centrifuged to produce a serum supernatant. Samples of
the test serum are placed in wells of a 96-well microtiter plate.
Control samples of serum from uninfected (negative control), and
HIV-1 (positive control) infected individuals are placed in
different wells of the microtiter plate. A MAb having specificity
for oligomeric gp140, and identified as recognizing a variety of
HIV-1 strains, is then added to all wells that contain control or
test serum samples. After incubation for 1-2 hours at 37.degree.
C., the wells are washed three times with PBS. Alkaline
phosphatase-conjugated goat anti-mouse IgG is then added to each of
the sample wells. The plates are incubated at 37.degree. C. for an
additional hour, washed twice with PBS and incubated with
p-nitrophenyl phosphate at 0.5 mg/ml in diethanolamine as a
phosphatase substrate. Absorbance readings at 410 nm are then taken
for all samples. The negative control has a low absorbance reading,
and establishes a background reference. The positive control has a
high absorbance reading and indicates that all reagents used in the
assay are performing properly. Comparison of the absorbance
readings obtained for the wells having the patient's serum with
those from the positive and negative controls unambiguously
indicates the presence or absence of HIV-1 antigens.
The recombinant gp140 oligomers produced according to the method of
the present invention could also be useful as a vaccine for the
prevention of HIV-1 infection. Since oligomeric gp140 glycoproteins
elicit a humoral immune response skewed toward
conformation-dependent epitopes, rather than
conformation-independent epitopes, it is likely that such a
response will be advantageously protective against a broad range of
HIV-1 strains.
Example 14 illustrates one vaccination protocol that can be used to
stimulate a humoral immune response against conformation-specific
epitopes on HIV-1. Those of ordinary skill in the art will
recognize that other methods for performing a vaccination are well
known in the art.
EXAMPLE 14
Use of Recombinant HIV-1 env Glycoproteins as Immunogens in a
Vaccine
Human subjects at risk of exposure to HIV-1 are vaccinated with
sucrose gradient-purified gp140 env glycoprotein oligomers that are
produced in a manner detailed in Example 2. These glycoprotein
preparations are dialyzed against cold isotonic saline buffer prior
to being assayed for protein concentration. The dialyzed subunit
proteins are diluted to a final concentration range of 10-1000
.mu.g/ml, and administered by injection together with a
pharmaceutically acceptable carrier, such as phosphate buffered
saline. Injection of the glycoprotein immunogen is repeated once
every 3 weeks, for a total of 4 injections. Immunizing doses of the
gradient-purified env glycoprotein are determined in accordance
with methods that are well known to those of ordinary skill in the
art. Stimulation of an immune response in the patient is monitored
by the appearance of anti-env antibodies in serum using standard
techniques, such as ELISA, that are also known to those who are
skilled in the art.
EXAMPLE 15
Use of Antibodies Against the Oligomeric Structure of gp140
A patient having an HIV infection is identified by standard, well
known methods. Antibodies against the oligomeric form of gp140 are
raised as described above. A pharmaceutically effective
concentration of 1-10,000 .mu.g/kg body weight of anti-gp140 are
injected into the patient. A second (control) patient, suffering
from an HIV infection, is injected with an antibody with
specificity for a non-HIV epitope. After approximately 1 week,
progress of the HIV infection is measured in each patient. The
control patient has an increased progression of HIV infection as
compared to the patient injected with the anti-gp140
antibodies.
Above there is described the construction of multiple forms of
soluble, oligomeric HIV-1 env glycoprotein which reflect native env
structure. More particularly, Example 1 describes the construction
of two recombinant vaccinia viruses that express different forms of
the truncated HIV-1 env protein. The first version of the secreted
gp140 molecule was encoded by the vCB-14 recombinant virus. This
first recombinant env glycoprotein was truncated just upstream of
the gp41 transmembrane domain and could be proteolyzed to cleave
the peptide backbone which joined the gp120 and gp41 domains of the
molecule. A second version of the secreted gp140 molecule was
encoded by the vPE12B recombinant virus. This second recombinant
env glycoprotein also was truncated just upstream of the gp41
transmembrane domain, but additionally included a deletion that
removed the primary and secondary cleavage sites. This meant that
the resulting molecule could not be proteolytically processed to
separate the gp120 and gp41 domains of the recombinant
glycoprotein. For convenience, recombinant molecules having a
mutated proteolytic processing site to prevent cleavage of the
peptide backbone are referred to as "gp140." Molecules that retain
the proteolytic processing site are referred to as
"gp140(prime)".
The engineered env protein and the source of the env gene used to
construct the vaccinia expression vector for producing recombinant
protein are conveniently referred to by following the type of
engineered protein (either gp140 or gp140(prime)) with the name of
the HIV-1 isolate that served as the env gene donor in parentheses.
Thus, "oligomeric gp140 (IIIB)" refers to the oligomeric form of
gp140 wherein the env gene of HIV-1 (IIIB) was used as the source
of the env-encoding polynucleotide for creating the vaccinia
expression vector according to the method described in Example 1.
Similarly, "oligomeric gp140(prime)(89.6)" refers to the oligomeric
form of gp140(prime) wherein the env gene of HIV-1 (89.6) was used
to create the expression vector. This nomenclature is useful
because different expression constructs have been used to
demonstrate that the methods for preparing and using the
recombinant env proteins described herein can be generalized to
different gp140 and gp140(prime) constructs which are based on the
env sequences characteristic of different HIV-1 isolates.
It should be appreciated that several of the env glycoproteins
characteristic of different HIV-1 isolates referred to herein are
closely related to each other. For example, the BH8 and HXB2
isolates of HIV-1 are derived from the laboratory-adapted strain
called HIV-1 (IIIB). The SF2 and MN strains are heterologous
laboratory-adapted strain of the virus. Conversely, HIV-1 (89.6) is
a primary isolate of the virus that was taken from a patient
infected with HIV-1. Accordingly, it should also be appreciated
that challenge with HXB2 following immunization with oligomeric
gp140 (BH8) represents a homologous challenge because the HXB2 and
BH8 viruses are closely related to each other.
Although oligomeric gp140 and gp140(prime) complexes useful as
immunogens can be isolated using the two-step procedure described
in Example 2, other procedures also can be used with equally good
results. For example, below there is described a two-step
purification method that involves the initial lentil lectin
affinity purification step which is disclosed in Example 2, but
that substitutes sizing column chromatography for sucrose density
gradient separation as the second step in the procedure. It should
be understood that sizing column chromatography also is known in
the art as "gel filtration" or "gel exclusion" chromatography. In
the purification procedures described below oligomeric gp140 and
gp140(prime) were isolated using SUPERDEX-200 chromatography media
that was purchased from Pharmacia. While the sucrose gradient
purification method described in Example 2 and the sizing column
chromatography method employed below both separate macromolecules
based on size, we find that the chromatographic method is more
convenient and gives equally good results. When the chromatographic
step was employed, most of the uncleaved env glycoprotein eluted
from the column in fractions containing material having molecular
weights greater than 200 kDa. Although not shown below, the env
proteins that eluted in these fractions were oligomeric, as judged
by chemical cross-linking analyses. Polyacrylamide gel
electrophoresis and protein staining confirmed that the purified
protein co-migrated with high molecular weight protein present in
medium from infected cells. Thus, oligomeric gp140 and gp140(prime)
useful as immunogens can be prepared according to different
protocols that advantageously preserve the oligomeric structure of
the immunogen.
As detailed above, oligomeric gp140 was useful as an immunogen for
stimulating the production of a diverse array of antibody
reactivities, including antibodies specific for conformational
epitopes in the native env glycoprotein. The repertoire of
antibodies raised against oligomeric gp140 was qualitatively
different from that previously raised against monomeric env
immunogens. Accordingly, it is clear that env oligomeric structure
has significant antigenic implications both in gp41 and gp120. The
large number of MAbs we have generated against gp41, all of which
immunoprecipitate native protein, should make it possible to
construct a relatively detailed antigenic map of this subunit and
to identify regions that are immunogenic, conserved and to which
neutralizing antibodies are directed. These findings, coupled with
observations that native gp140 elicited neutralizing antibodies
more effectively than the denatured molecule, strongly argue that
taking into account env oligomeric structure will be important for
understanding the humoral response to HIV-1 infection and for the
design of env subunit preparations which can effectively elicit
broadly cross reactive, neutralizing antibodies.
The following Example describes experimental results which proved
that an immunogenic composition that included oligomeric gp140
(BH8) advantageously stimulated an immune response that was
protective against subsequent virus challenge. The SHIV virus used
in the procedures described below is a chimeric simian/human
immunodeficiency virus which closely mimics the mechanism of HIV-1
entry into host cells. This is because the chimeric SHIV includes
the authentic HIV-1 env glycoprotein rather than the SIV env
glycoprotein that ordinarily would characterize simian
immunodeficiency virus (SIV). Chimeric SHIV viruses have been
described, for example, by Reimann et al., in J. Virol. 70:3198
(1996) where it is shown that an env gene derived from a primary
HIV-1 isolate conferred high in vivo replicative capacity in the
rhesus monkey. Thus, the animal model employed in the following
Example adequately represents the essential features of an
experimental system for testing inhibition of HIV infection in a
mammal.
Example 16 describes the methods used to demonstrate that an
immunogenic composition that included an oligomeric gp140 (BH8)
stimulated an immune response that was broadly protective. More
particularly, a macaque model was used to test the immunogenicity
and protective efficacy of oligomeric gp140.
EXAMPLE 16
Oligomeric gp140 Stimulates Protective Immunity in an Animal Model
of HIV Infection
The vPE12B recombinant virus was used to produce oligomeric gp140
(BH8) essentially as described in Examples 1 and 2 except that a
gel filtration step was substituted for the sucrose density
gradient step in the method of Example 2. Conditioned medium from
infected cell cultures was cycled over a LENTIL LECTIN SEPHAROSE 4B
column to immobilize glycoproteins. The column was washed first
with PBS containing 20 mM Tris-HCl (pH 7.8), 0.2% TRITON X-100, and
0.3M NaCl; and then with PBS containing 20 mM Tris-HCl (pH 7.8).
Column-bound glycoproteins were eluted with 0.5M alpha methyl
mannose. After concentrating the eluted glycoproteins using a
CENTRICON microconcentrator, oligomeric gp140 was purified using a
SUPERDEX-200 column (Pharmacia) that was developed using PBS.
Column fractions containing oligomeric gp140 were identified by
standard spectrophotometric means, pooled and again concentrated.
Purity of material contained in the samples was verified by
standard protein gel electrophoresis and protein staining. These
procedures resulted in substantially purified oligomeric gp140 that
was useful as an immunogen.
Four macaques were immunized with oligomeric gp140 while two
macaques served as unimmunized controls. The immunized macaques
were each administered with 500 .mu.l of a composition that
included 300 .mu.g of purified oligomeric gp140 dispersed in PBS
and QS21 adjuvant (Aquila Biopharmaceuticals, Mass.). This
immunogenic composition was administered intramuscularly at 0, 4, 8
and 24 week time points for a total of four administrations.
Chimeric SIV viruses (SHIVs) described by Li et al. in J. Virol.
69:7061 (1995) and by Lu et al. in J. Acquired. Immun. Defic. Synd.
12:99 (1996) were tested in in vitro neutralization assays
according to the procedure described by Montefiori et al. in J.
Clin. Micro. 26:231 (1988) to verify that neutralizing antibodies
had been produced before proceeding with the virus challenge. The
SHIVs also served as challenge viruses to determine whether
protective immunity had been established by immunization of the
test animals with oligomeric gp140. Since the HIV-HXB2 clone is
closely related to the BH8 clone upon which the oligomeric gp140
described in Example 1 was based, SHIV-HXB2 was used to test serum
samples for the presence of neutralizing antibodies as described
above.
Results from these procedures indicated that the immunogenic
composition which included oligomeric gp140 stimulated a broadly
reactive immune response that inhibited subsequent virus challenge.
The results presented in Table 4 clearly show that animals
administered with oligomeric gp140 had high neutralizing antibody
titers against SHIV-HXB2 after the third and fourth immunizations
at 2 and 6 months, respectively. Numerical values in Table 4
represent the serum dilution at which 50% duction in virus was
observed.
TABLE 4 Serum Antibodies from Monkeys Immunized with gp140 (BH8)
Neutralize SHIV-HXB2 week animal 10 12 20 26 gp140 17951 187 134
<20 424 18001 348 159 40 844 18066 296 109 <20 313 18102 868
510 81 1315 control 18024 <20 <20 <20 <20 18062 <20
<20 <20 <20
The results presented in Table 5 show that infectious activity of
heterologous isolates HIV-1 MN, HIV-1 SF2, and HIV-1 89.6 also was
neutralized by the anti-oligomeric gp140 immune response that had
been stimulated in some of the animals. Numerical values in Table 5
represent the serum dilution at which 50% reduction in virus was
observed, with higher values indicating a stronger neutralizing
antibody response. Thus, neutralizing antibodies raised against the
immunogen advantageously neutralized infection by viruses that
displayed divergent env glycoproteins.
TABLE 5 Immunization with Oligomeric gp140 (BH8) Induced
Cross-Reactive Neutralizing Antibodies HIV-1 animal SHIV-HXB2 HIV-1
MN SF2 SHIV-89.6 gp140 17951 424 22 48 <10 18001 844 23 44
<10 18066 313 <10 19 <10 18102 1315 33 48 16 control 18024
<20 <10 <10 <10 18062 <20 <10 <10 <10
Since neutralizing activity directed against a homologous isolate
conceivably could be due to anti-V3 loop reactivity, neutralization
of SHIV-HXB2 by serum was tested after absorption of V3 antibodies
according to the procedure presented by Montefiori et al., in J.
Clin. Invest. 92:840 (1993). Residual neutralizing activity
represented the activity of antibodies directed to non-V3
epitopes.
The results presented in Table 6 show that substantial neutralizing
activity remained after depletion of anti-V3 loop antibodies from
the sera. Numerical values in the Table represent the serum
dilution at which 50% reduction of virus was observed. These
results contrast with findings obtained using sera from macaques
immunized with monomeric gp120 where less than 5% of the
neutralizing activity was due to non-V3 loop reactivity (D.
Montefiori, personal communication). Thus, antibodies elicited by
immunization with oligomeric gp140 advantageously exhibited
cross-reactive neutralizing activity against a variety of
heterologous HIV isolates.
TABLE 6 Absorption of Neutralizing Antibodies with a V3 Peptide
(IIIB) animal pre-absorption post-absorption % non-V3 17951 323 192
59 18001 422 174 41 18066 204 100 49 18102 1241 284 23
Three weeks after the fourth immunization with oligomeric gp140,
all 6 macaques were challenged with 10 TCID.sub.50 (tissue culture
infective doses) of SHIV-HXB2. This amount of SHIV-HXB2 was
sufficient to guarantee SHIV infection in a naive macaque.
Infection was monitored by virus co-cultivation from macaque
peripheral blood mononuclear cells (PBMCS) (Table 7), detection of
anti-SIV gag antibodies (Table 8), RT-PCR (reverse
transcriptase-primed PCR) of viral RNA in plasma samples (Table 9),
and maintenance of high levels of neutralizing antibodies (Table
10). Numerical values in Table 7 are the number of TCID.sub.50
/10.sup.6 cells as determined by limiting dilution analysis, and
"n.i." means "no infection." In Table 8, "-" indicates the absence
of a band on a Western blot or on a gel loaded with
immunoprecipitate, "+" indicates the presence of a strong signal,
and "+/-" indicates the presence of a weak signal. Numerical
results in Table 9 represent viral RNA copies/ml, while "n.t."
indicates a sample that was not tested. Numerical results in Table
10 represent the serum dilution at which 50% reduction in virus was
observed. Both control animals exhibited high levels of
neutralizing antibodies (Table 10), high levels of replicating
virus, significant p27 antibody levels, viral RNA in plasma, and
sustained neutralizing antibody titers. In contrast, the four
immunized animals showed strong protective immunity. Two monkeys
(17951 and 18102) exhibited sterilizing immunity. Very small but
detectable evidence of viremia was found in the other 2 immunized
animals. Monkey 18001 was determined to be infected by all criteria
used, although virus load was reduced by 4 logs as measured by
virus co-cultivation. Viremia in animal 18066 was even less
pronounced than that in 18001, and the only indication of infection
was a very small amount of virus in PBMC. There was no sign of
infection by the other 3 assays. Thus, although two of the
immunized monkeys showed signs of infection, the magnitude of
infection was very limited and transient in nature. This indicated
that administration of oligomeric gp140 provided protective
immunity in controlling virus replication. Thus, an immunogenic
composition that included oligomeric gp140 could stimulate
protective immunity against SHIV infection, wherein the infecting
virus displayed an env glycoprotein characteristic of HIV.
TABLE 7 Virus Isolation from PBMCs TCID.sub.50 /10.sup.6 Cells week
post challenge animal 2 3 4 6 8 10 12 14 18 22 26 gp140 17951 n.i.
n.i. n.i. n.i. n.i. n.i n.i. n.i. n.i. n.i. n.i. 18001 n.i. 3 n.i.
n.i. 1 n.i. n.i. n.i. 1 n.i. n.i. 18066 1 n.i. n.i. n.i. n.i. n.i.
n.i. n.i. n.i. n.i. n.i. 18102 n.i. n.i. n.i. n.i. n.i. n.i. n.i.
n.i. n.i. n.i. n.i. control 18024 10000 1 1 1 1 n.i. n.i. 1 n.i.
n.i. n.i. 18062 10000 10 1 1 n.i. n.i. n.i. n.i. n.i. 1 n.i.
TABLE 8 Reactivity of Sera with gag Proteins after Challenge with
SHIV-HXB2- Immunoprecipitation of Western blot HIV-2 p27
SIV.sub.239 gag week week post-challenge post-challenge animal pre
10 26 pre 4 12 34 gp140 17951 - - - - - - - 18001 - +/- + - - + +
18066 - - - - - - - 18102 - - - - - - - control 18024 - + + - +/- +
+ 18062 - + + - +/- + +
TABLE 9 Plasma Virus Levels in Monkeys Immunized with gp140 (BH8)
and Challenged with SHIV-HXB2 week post challenge SHIV-HXB2
.tangle-soliddn. animal 26 2 3 8 53 gp140 17951 <1200 <3000
<1200 <1200 <300 18001 <1200 <3000 1600 <1200
<300 18066 <1200 <1200 <1200 <1200 <300 18102
<1200 <1200 <1200 <1200 <300 control 18024 <1200
94,000 11,000 <1200 <300 18062 <1200 n.t. 8,600 <1200
<300
TABLE 10 Neutralizing Antibody Titers After Challenge with
SHIV-HXB2 week post challenge SHIV-HXB2 .tangle-soliddn. animal 26
4 6 10 26 gp140 17951 424 147 49 23 <20 18001 844 563 690 471
469 18066 313 70 36 13 <20 18102 1315 686 408 543 153 control
18024 <20 4032 705 510 968 18062 <20 <20 25 79 793
It would be expected from the results described in the foregoing
Example that an oligomeric gp140 immunogen would be useful for
stimulating a protective immune response against HIV challenge.
The recombinant gp140 and gp140(prime) molecules described herein
are structurally unique and possess unexpected antigenic properties
when compared with previously described compositions that include
engineered env proteins. For example, Berman et al., in J. Virol.
62:3135 (1988) describe a recombinant protein that is truncated
before the transmembrane domain of gp41 and that retains the
gp120-gp41 proteolytic processing site, but that additionally
includes replacement of 30 amino acids of the N-terminus of the
mature (processed) form of gp160 with 25 amino acids of the herpes
simplex virus type 1 glycoprotein D. Further, Berman et al., in J.
Virol. 63:3489 (1989) describe a secreted protein called "sgp160"
that is C-terminally truncated to remove the gp41 transmembrane
domain and that harbors a deletion of the gp120-gp41 proteolytic
processing site. However, the sgp160 differs structurally from
gp140 described herein because the sgp16O protein has been modified
to replace the N-terminal signal sequence and 12 amino acids of
gp160 with the signal sequence and 9 amino acids from the mature
N-terminus of HSV-1 gD (Nature 345:622 (1990)). Importantly, Berman
et al. report in Nature 345:622 (1990) that an immunogenic
composition that included a recombinant form of gp120 provided
protective immunity against HIV-1 infection in test animals, but a
composition including sgp160 was not protective. Thus, the finding
that gp140 could stimulate protective immunity in a mammal was
surprising in light of the findings that appear in the scientific
literature.
The following Examples present results obtained using gp140(prime)
as an immunogen. Although the methods used to produce and purify
gp140(prime) are described above, the procedures are again
presented to further illustrate how slightly different methods of
purification can be used to obtain equally good results in the
production and use of an immunogenic composition that includes
oligomeric gp 140(prime).
Example 17 describes the methods that were used to prepare
gp140(prime) which was useful in preparing an immunogenic
composition.
EXAMPLE 17
Method of Preparing gp140(prime)
Monolayers of BS-C-1 cells were washed twice with PBS and then
infected with 5 plaque forming units (pfu) per cell of the
gp140(prime)(89.6)-encoding clone vBD1 in OPTI-MEM (Gibco). The
vBD1 construct was prepared essentially according to the method of
Example 1, except that HIV-1 89.6 and not HIV-1 BH8 was used as the
source of env-encoding polynucleotide sequences. After 2 hours, the
monolayers were overlaid with OPTI-MEM and the infection allowed to
proceed for 24-30 hours at 37.degree. C. in a CO.sub.2 incubator.
The medium was removed and centrifuged at 1800.times. g for 20
minutes. The cleared supernatant was then centrifuged at
10000.times. g for 30 minutes. TRITON X-100 was added to a final
concentration of 0.2% and sodium azide was added to a final
concentration of 0.02%. The medium was cycled over a LENTIL LECTIN
SEPHAROSE 4B column to immobilize glycoproteins. The column was
washed with PBS containing 20 mM Tris-HCl (pH 7.8), 0.2% TRITON
X-100, and 0.3M NaCl followed by PBS containing 20 mM Tris-HCl (pH
7.8) to remove nonspecifically bound material. Glycoproteins were
then eluted with 0.5M alpha methyl mannose. After concentrating
macromolecules using a CENTRICON microconcentartor, the
gp140(prime) was purified over a SUPERDEX-200 column (Pharmacia)
that was developed using PBS. Oligomeric gp140(prime) was removed
from the sizing column in fractions containing proteins of
molecular weight greater than 200 kDa. Purity of the eluted
gp140(prime) was verified by electrophoresing a sample on a 10%
SDS-polyacrylamide gel and staining for proteins.
The purified oligomeric gp140(prime), like oligomeric gp140, can be
administered to a mammal at risk of exposure to HIV in order to
stimulate protective immunity to the virus. The purified oligomeric
glycoprotein can be combined with a carrier that typically will
include a buffered saline solution, and which additionally may
contain protein-stabilizing agents. While an immunogenic
composition useful for stimulating an immune response necessarily
will include oligomeric gp140 or oligomeric gp140(prime), the
composition also may include an adjuvant. Preferred adjuvants
include alum (such as ALHYDROGEL which is available from Superfos
Biosector A/S (Vedback, Denmark)), polyphosphazene, MPL (RIBI
ImmunoChem (Hamilton, Mont.)), QS-21 (Aquila Biopharmaceuticals,
Mass.) and RAS3C (RIBI). The immunogenic compositions taught herein
can be administered to a mammal in need thereof by intramuscular
injection. Dosages used for immunization typically will range from
5-500 .mu.g, more preferably from 10-300 .mu.g, and most preferably
300 .mu.g per injection. The immunogenic composition may be
administered by injection at least once, and as many as five times
over the course of several months in order to establish a vigorous
immune response. The precise regimen for administering the
immunogenic composition can be determined using procedures that
will be familiar to those having ordinary skill in the art using no
more than routine experimentation.
It is appreciated in the art that different isolates of HIV-1 can
be characterized by different genotype classes which are referred
to as "clades." This is significant because different clades tend
to predominate in different geographic regions of the world. For
example, HIV-1 isolates from the United States typically represent
clade "B" isolates, while HIV-1 isolates from Thailand typically
represent clade "E" isolates. Structural differences between the
env glycoproteins of the various clade isolates typically are
slight and are not believed to be significant with respect to the
constructions discussed herein. Thus, it is possible to create
recombinant oligomeric gp140 and gp140(prime) env glycoproteins
corresponding to all of the different clade isolates using the
approach described herein. The gp140(prime) molecules for the
different clades will be C-terminally truncated forms of HIV-1
gp160 protein that is missing the transmembrane domain of gp41.
Similarly, the gp140 molecules for the different clades will have
all of the features of the gp140(prime) molecules but additionally
will harbor deletions or other substitutions of amino acids that
will prevent proteolytic cleavage to separate the gp120 and gp41
domains of the molecule.
Since primary isolates of HIV-1 are known to differ significantly
from laboratory-adapted strains with respect to neutralization
properties (Moore et al., J. Virol. 69:101 (1995)), we have also
produced oligomeric gp140(prime)(89.6) to complement the results
obtained using the gp140 (BH8) that was prepared in Example 1. The
gp140(prime)(89.6) was selected for study because the 89.6 virus
clone was derived from a primary isolate of HIV-1 (Collman et al.,
J. Virol. 66:7517 (1992)) and because several well characterized
SHIVs containing the 89.6 env are available for use as a challenge
virus. Like the env protein of HIV-1 (IIIB), the 89.6 env protein
was produced using a recombinant vaccinia virus expression vector.
Analyses by polyacrylamide gel electrophoresis and protein staining
of eluates from lentil lectin chromatography and size-separated
material indicated that only about 30-50% of the env molecules
present in the conditioned medium of cells infected with the
recombinant vaccinia virus expressing gp140(prime)(89.6) were
cleaved in the cell during processing. A substantial amount of
uncleaved oligomeric gp140(prime) resulted. Virtually all of the
protein eluted in the oligomeric fractions from the SUPERDEX-200
column was gp140(prime). The gp120 was not retained in the
oligomeric complex. Oligomeric gp140(prime) was separated from the
monomeric forms of gp140(prime)(89.6) and gp120 (89.6) by
SUPERDEX-200 chromatography.
A second study using the macaque model of HIV infection described
in Example 16 was conducted to verify that oligomeric gp140(prime)
corresponding to an envelope other than the env of HIV-1 BH8 also
could stimulate a protective immune response in a mammal. In the
procedures described below macaques were immunized with oligomeric
gp140(prime)(89.6) or monomeric gp120 (89.6) env protein prepared
from vBD2-infected cells.
Example 18 describes the method used to immunize macaques with
oligomeric gp140(prime)(89.6) or monomeric gp120 (89.6). As
indicated below, both immunogenic compositions stimulated similar
neutralizing antibody responses.
EXAMPLE 18
Immunization with gp140(prime)
Oligomeric gp140(prime)(89.6), prepared essentially as described in
Example 17, and monomeric gp120, prepared also according to the
method of Example 17 except that the monomeric gp120 fraction from
the SUPERDEX-200 column was isolated and the expression vector vBD2
was used to express gp120 (89.6), were tested as immunogens
essentially according to the method of Example 16.
Five animals each were immunized with one of the two immunogens.
Two animals were left as unimmunized controls. The immunized
monkeys received 5 administrations of the immunogenic composition
that included 300 .mu.g of the recombinant env glycoprotein
dispersed in PBS and combined with QS21 adjuvant. Monkeys were
administered by injection intramuscularly at 0, 4, 8, 24 and 58
weeks. Serum samples from all monkeys were tested for the presence
of antibodies having neutralizing activity against SHIV-89.6, a
chimeric virus containing the homologous env, according to the
method of Montefiori et al. in J. Clin. Micro. 26:231 (1988).
The results presented in Table 11 showed that all animals
administered with the oligomeric gp140(prime)(89.6) immunogen had
measurable neutralizing antibodies against SHIV-89.6, a chimeric
virus expressing the homologous env.
TABLE 11 Immunization with gp140(prime(89.6) or gp120 (89.6)
Induced Antibodies that Neutralized SHIV-89.6 Infection week animal
10 26 29 32 36 60 gp140(prime) 18010 29 116 70 46 33 <20 18014
598 2673 623 513 197 662 18049 49 76 60 53 44 48 18085 42 249 157
86 44 24 18135 31 40 52 55 27 31 gp120 17983 27 57 58 43 29 33
18068 70 474 161 123 55 127 18103 404 2511 418 176 107 555 18228
301 234 199 181 124 109 18236 46 281 826 234 123 106 control 18061
<10 <10 <20 18162 <10 <10 <20
The results presented in Table 12 indicated that immunization with
the oligomeric gp140(prime)(89.6) stimulated an immune response
characterized by the production of antibodies that neutralized
heterologous HIV-1 isolates, HIV-MN but not HIV-SF2. Conversely,
immunization with the monomeric gp120 (89.6) stimulated production
of antibodies that neutralized both HIV-MN and HIV-SF2. Numerical
results in Table 9 indicate the serum dilution at which 50% of
virus was neutralized.
TABLE 12 Neutralizing Antibodies Induced by Immunization with
gp140(prime)(89.6) or gp120 (89.6) animal HIV-1 MN HIV-1 SF-2 gp140
18010 228 <20 18014 >2560 <20 18049 32 <20 18085 341
<20 18135 53 <20 gp120 17983 64 <20 18068 634 126 18103
171 184 18228 407 91 18236 198 131 control 18061 <20 <20
18162 N.T. <20
Sera from all animals contained antibodies that neutralized both
SHIV-89.6 and HIV-1 89.6 in a highly stringent assay wherein virus
propagation and neutralization was assayed using human PBMCs. This
conclusion is based on the results presented in Table 13. Numerical
results in Table 13 indicate the percent reduction in infectivity
at a single serum dilution (1:5). In this assay, reduction in the
amount of 80% or greater was considered significant.
TABLE 13 Neutralization of Viruses Grown and Assayed in Human PBMC
animal SHIV-89.6 HIV-1 89.6 gp140 18010 91 69 18014 95 88 18049 87
56 18085 83 69 18135 61 60 gp120 17983 40 40 18068 87 72 18103 87
75 18228 69 73 18236 68 60 control 18061 -7 -29 18162 -27 -44
In addition, the importance of anti-V3 loop antibodies in
neutralization was studied using two chimeric viruses in which the
V3 loops of HXB2 and 89.6 were exchanged (Kim et al., J. Virol.
69:1755 (1995)) (Table 14). Very little cross neutralization of
SHIV-HXB2, containing the heterologous env, was observed. Also, no
neutralization of the chimeric virus, HX.DELTA.BM, which contains
the backbone of HXB2 and the V3 loop of 89.6, was detected. In
contrast, neutralization of the chimeric virus 89.6.DELTA.BM, which
contains the backbone of 89.6 and V3 loop of HXB2, was observed.
Taken together, this suggests that the neutralizing activity
elicited by immunization with 89.6 env is not V3 specific.
This contrasts with results obtained by immunization with IIIB env
in which most neutralizing activity is attributable to V3
antibodies.
TABLE 14 Neutralizing antibodies induced by immunization with 89.6
env HX.DELTA.BM 89.6.DELTA.BM animal SHIV-89.6 SHIV-HXB2 (89.6 V3)
(HXB2 V3) gp140 18010 116 14 <10 186 18014 2673 20 <10 209
18049 76 <10 <10 33 18085 249 <10 <10 287 18135 40
<10 <10 26 gp120 17983 57 <10 <10 32 18068 474 17
<10 125 18103 2511 21 <10 213 18228 234 18 <10 874 18236
281 14 <10 82 control 18061 <10 <10 <10 <20 18162
<10 <10 <10 <20
Example 19 describes a procedure that will be followed to confirm
that test animals administered with an immunogenic composition that
includes oligomeric gp140(prime)(89.6) stimulates an immune
response that is protective against subsequent virus challenge.
EXAMPLE 19
Immunization with gp140(prime) Stimulates Protective Immunity
At 2-3 weeks after the initial administration of the immunogenic
composition, all test animals described in the procedure under
Example 18 are challenged with 10 TCID.sub.50 units of SHIV-89.6.
Viremia is measured according to standard procedures, such as those
as described under Example 16. Results from the procedure show that
control animals that were not administered with the
gp140(prime)-containing immunogenic composition exhibit evidence of
viremia at a time post-challenge. In contrast, animals that had
been immunized with a composition that included the gp140(prime)
show substantially no evidence for viremia. This result indicates
that the immunogenic composition comprising gp140(prime) stimulates
protective immunity in vivo.
Following proteolytic processing of the gp140(prime) glycoprotein
there is produced a gp120 molecule and a noncovalently associated
molecule representing the ectodomain of gp41. The resulting gp120
and gp41 ectodomain molecules can be physically separated from each
other. For example, under Example 7 there is described a
composition prepared from gradient purified gp41 ectodomain
fragment derived from vCB-14. However, there also can exist a
noncovalently associated bimolecular complex of gp120 and the
ectodomain of gp41 that results from proteolytic processing of the
gp140(prime) molecule. This bimolecular complex also is
contemplated for use in an immunogenic composition useful for
stimulating the production of conformation-dependent antibodies. As
referred to below, this complex is termed the gp120/20 complex to
reflect the fact that the gp41 component of the complex has a
molecular weight of approximately 20 kDa.
Example 20 describes a method that can be used to prepare the
gp120/20 complex.
EXAMPLE 20
Preparation of Recombinant gp120/20
Monolayers of host cells are washed twice with PBS and then
infected with 5 plaque forming units (pfu) of a recombinant
vaccinia virus expressing a gp140(prime) per cell in OPTI-MEM
(Gibco), After 2 hours, the monolayers are overlaid with OPTI-MEM
and the infection is allowed to proceed for 24-30 hours at
37.degree. C. in a CO.sub.2 incubator. The medium is removed and
centrifuged at 1800.times. g for 20 minutes. It is then centrifuged
at 10000.times.g for 30 minutes. TRITON X-100 is added to 0.2% and
sodium azide is added to 0.02%. The medium is passed over a LENTIL
LECTIN SEPHAROSE 4B column to bind glycoproteins. The column is
washed with PBS containing 20 mM Tris-HCl pH 7.8, 0.2% TRITON
X-100, and 0.3M NaCl followed by PBS containing 20 mM Tris-HCl (pH
7.8). Glycoproteins are then eluted with 0.5M alpha methyl mannose.
After concentration, the HIV-1 envelope glycoprotein is purified
through a SUPERDEX-200 column (Pharmacia). Fractions containing
oligomeric protein, including cleaved yet stably associated
gp120/20 molecules, are pooled and concentrated. Purity and extent
of cleavage is checked by standard electrophoresis on a 10%
SDS-polyacrylamide gel followed by staining with COOMASSIE
BRILLIANT BLUE.
Purified oligomeric gp120/20 can be administered to a mammal at
risk of exposure to HIV in order to stimulate protective immunity
to the virus according to the same protocol that can be used for
administering oligomeric gp140 or oligomeric gp140(prime), as
described above. Thus, the gp120/20 can be combined with a carrier
that typically will include a buffered saline solution, and further
may be combined with an adjuvant including the adjuvants listed
above. An immunogenic composition that includes gp120/20 can be
administered to a mammal in need thereof by intramuscular
injection. Dosages used for immunization typically will range from
5-500 .mu.g, more preferably from 10-300 .mu.g, and most preferably
300 .mu.g per injection. The immunogenic composition may be
administered by injection at least once, and as many as five times
over the course of several months in order to establish a vigorous
immune response.
The following Example describes the method used to produce and
purify an oligomeric form of secreted gp140(prime) wherein the env
polypeptide sequence was derived from a primary isolate of HIV-1.
In this Example the CM235 clade E isolate served as a template for
producing the recombinant env expression vector. The recombinant
glycoprotein useful as an immunogen was called
gp140(prime)(CM235).
EXAMPLE 21
Method of Producing gp140(prime)(CM235)
The CM235 HIV-1 isolate (Genbank accession number L03698) was used
as a source of the env-encoding polynucleotide in the construction
of the gp140(prime)(CM235) expression vector. A two-step cloning
procedure was used to insert the env gene into the vaccinia virus
expression vector called pVOTE.2 (Ward et al. Proc. Natl. Acad.
Sci. USA 92:6773 (1995)). In the first step, the 5' end of the gene
was modified such that the ATG translation initiation codon was
included in an NdeI site. This was performed by replacing an
EcoRI-BalI fragment in the original polynucleotide with a fragment
that was produced by annealing complementary oligonucleotides
having the sequences:
5'-AATTCGCGCCATATGAGAGTAAAGGAGACACAGATGAATTGG-3' (SEQ ID NO:7) and
5'-CCAATTCATCTGTGTCTCCTTTACTTCATATGGCGCG-3' (SEQ ID NO:8). In the
second step of the cloning procedure, a translation stop codon was
inserted just upstream of the region encoding the gp41
transmembrane domain. Thus, a fragment was generated in polymerase
chain reaction using a plasmid containing the entire env sequence
of CM235 as a template and the following two oligonucleotides as
primers: 5'-CAGCATCTGTTGCAACTCACAGTCTGGGGC-3' (SEQ ID NO:9) and
5'-CGCGGCTTGGTCGACGCCTTATTTTATATACCACAGCCACTTTGTTATGTC AAACC-3'
(SEQ ID NO:10).
The amplified fragment was cut with restriction endonucleases Avr2
and SalI and then used to replace the Avr2-SalI fragment in the
plasmid containing the env gene. Subsequently, the modified CM235
env gene (containing an Nde1 site at the 5' end and a Sall site at
the newly created 3' end) was cloned into the pVOTE.2 vector that
has been described by Ward et al., in Proc. Natl. Acad. Sci. USA
92:6773 (1995). The resulting plasmid, called pWS1, was used to
generate the recombinant vaccinia virus called vWS1 according to
standard procedures that will be familiar to those having ordinary
skill in the art (see Earl and Moss (1991) p.16.17.1-16.17.16 In
Current Protocols in Molecular Biology, Ausubel et al., eds., John
Wiley & Sons, New York). Accordingly, there was created a
vaccinia expression vector that encoded gp140(prime)(CM235).
Oligomeric gp140(prime)(CM235) was prepared using the vWSl
expression vector according to the method of Example 17 with slight
modification. According to this modification, at two hours after
infecting BS-C-1 monolayers with the recombinant virus the OPTI-MEM
medium that was overlaid onto the infected monolayers was made 60
mM isopropyl .beta.-D-thiogalactopyranoside (IPTG). Procedures for
preparing gp140(prime)(CM235) were otherwise as described in
Example 17 and resulted in a preparation that could be used as an
immunogenic composition.
Example 22 describes the methods used to demonstrate that
oligomeric gp140(prime)(CM235) stimulated an anti-HIV-1 env immune
response in rabbits.
EXAMPLE 22
Immunization with gp140(prime)(CM235)
Rabbits were immunized with 100 .mu.g of oligomeric
gp140(prime)(CM235) that had been prepared as described in the
preceding Example. Animals received 3 intramuscular injections of
the oligomeric gp140(prime)(CM235) in one of the following adjuvant
combinations: (1) MPL/QS21, (2) RAS3C, (3) polyphosphazine and (4)
QS21. An additional group of rabbits received only saline as a
negative control. Each group consisted of 3 rabbits. Sera from all
immunized rabbits contained env-binding antibodies as judged by a
standard ELISA protocol using recombinant gp160(CM244), also
representing a clade E isolate as the substrate for antibody
binding. This substrate protein was produced in a baculovirus
system using procedures that will be familiar to those having
ordinary skill in the art. No env-binding activity was detected in
serum samples from the negative control rabbits, as expected. These
results indicated that specific immune responses directed against
the env glycoprotein had been stimulated by immunization with
oligomeric gp140(prime)(CM235), as expected. In addition, serum
samples from the animals in two of the adjuvant groups (MPL/QS21
and RAS3C) were assayed for neutralizing activity against five
different lade E viruses. These five viruses were: CM235, 9461,
9466, NPO3 and 42368. Table 15 summarizes results from these
neutralizing assays.
TABLE 15 gp140(prime)(CM235) Stimulates a Broadly Neutralizing
Immune Response >80% Reduction Adjuvant Animal of Virus Saline 1
0/5 2 0/5 3 1/5 MPL/QS21 4 2/5 5 4/5 6 2/5 RAS3C 7 1/5 8 2/5 9
1/5
Numerical values in the last column of the Table represent the
number of viruses (out of 5 clade E viruses tested) which showed
replication reduced by at least 80% in the neutralizing assay. Sera
from animals 5, 6 and 8 reduced the amount of one of the viruses in
the neutralization assay by 100%. These results confirmed that an
oligomeric gp140(prime) stimulated a broadly reactive immune
response that was not limited to a single strain of HIV-1. We
reasonably expect that animals having been immunized with
oligomeric gp140(prime)(CM235) and that show evidence for
neutralizing antibodies also will show evidence for protection
against virus challenge. More particularly, we contemplate that the
anti-HIV-1 env immune response in animals having been administered
with oligomeric gp140(prime)(CM235) will inhibit infection by a
challenge virus.
Example 23 describes a method of stimulating an anti-HIV immune
response in a human. Although the following Example describes the
use of oligomeric gp140(prime)(89.6) as an immunogen, it is
contemplated that other oligomeric gp140(prime) or oligomeric
gp120/20 compositions could be substituted with good results.
EXAMPLE 23
Stimulating an Anti-HIV Response in a Human
A human patient at risk of contracting an HIV infection is first
identified. A pharmaceutical composition is then obtained that
includes oligomeric gp140(prime)(89.6) dispersed in saline and
mixed with an adjuvant appropriate for use in humans. The
gp140(prime)(89.6) is prepared essentially according to the method
of Example 17. The pharmaceutical composition is then injected into
the patient intramuscularly at monthly intervals over the course of
four months (0, 1, 2, 3 and 4 months). A serum sample isolated from
the patient's blood prior to receiving the first administration of
the composition failed to show evidence for HIV neutralizing
antibodies when tested essentially according to the method of
Montefiori et al. in J. Clin. Micro. 26:231 (1988). Conversely,
high titer neutralizing antibodies are measured in a serum sample
isolated from the injected patient two months after the last of
five intramuscular injections. This shows the immunogenic
composition stimulates neutralizing antibodies in a human.
The patient, having received multiple intramuscular administrations
of the immunogenic composition, is inadvertently exposed to HIV by
injection with HIV-contaminated gamma globulin. A naive patient who
had not been administered with the immunogenic composition also was
inadvertently injected with the same amount of HIV-contaminated
gamma globulin. One year following exposure to the contaminated
gamma globulin, blood from the naive patient contained HIV virions
as judged by standard RT-PCR analysis. Blood from the patient that
had received the immunogenic composition prior to being exposed to
the contaminated gamma globulin did not contain amplifiable HIV
transcripts. These results indicate that the immunogenic
composition stimulated a protective immune response in a human.
* * * * *