U.S. patent number 5,866,330 [Application Number 08/544,861] was granted by the patent office on 1999-02-02 for method for serial analysis of gene expression.
This patent grant is currently assigned to The Johns Hopkins University School of Medicine. Invention is credited to Kenneth W. Kinzler, Victor E. Velculescu, Bert Vogelstein, Lin Zhang.
United States Patent |
5,866,330 |
Kinzler , et al. |
February 2, 1999 |
**Please see images for:
( Certificate of Correction ) ** |
Method for serial analysis of gene expression
Abstract
Serial analysis of gene expression, SAGE, a method for the rapid
quantitative and qualitative analysis of transcripts is provided.
Short defined sequence tags corresponding to expressed genes are
isolated and analyzed. Sequencing of over 1,000 defined tags in a
short period of time (e.g., hours) reveals a gene expression
pattern characteristic of the function of a cell or tissue.
Moreover, SAGE is useful as a gene discovery tool for the
identification and isolation of novel sequence tags corresponding
to novel transcripts and genes.
Inventors: |
Kinzler; Kenneth W. (Bel Air,
MD), Vogelstein; Bert (Baltimore, MD), Velculescu; Victor
E. (Baltimore, MD), Zhang; Lin (Baltimore, MD) |
Assignee: |
The Johns Hopkins University School
of Medicine (Baltimore, MD)
|
Family
ID: |
27062344 |
Appl.
No.: |
08/544,861 |
Filed: |
October 18, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
527154 |
Sep 12, 1995 |
5695937 |
|
|
|
Current U.S.
Class: |
435/6.12;
435/91.2; 536/24.33; 536/23.1; 536/24.3 |
Current CPC
Class: |
C12N
15/1096 (20130101); C12Q 1/6809 (20130101); C12Q
1/6809 (20130101); C12Q 2539/103 (20130101); C12Q
1/6869 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12N 15/10 (20060101); C12Q
001/68 (); C12P 019/34 (); C07H 021/02 (); C07H
021/04 () |
Field of
Search: |
;435/6,5,91.2
;536/23.1,24.3,24.33 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 679 716 A1 |
|
Feb 1995 |
|
EP |
|
WO 93/00353 |
|
Jan 1993 |
|
WO |
|
WO 93/16178 |
|
Aug 1993 |
|
WO |
|
WO 94/16092 |
|
Jul 1994 |
|
WO |
|
WO 95/21944 |
|
Aug 1995 |
|
WO |
|
WO 95/20681 |
|
Aug 1995 |
|
WO |
|
WO 95/27080 |
|
Oct 1995 |
|
WO |
|
Other References
Unrau and Deugau , Gene 145: 163-169, 1994. .
White et al., Anal. Biochem. 199: 184-'90, 1991. .
Sambrook et al. Molecular Cloning: A Laboratory Munual, vol. 2,
8.27-8.29, vol. 3, F.8,F.11, 1989. .
Liu, et al., Large-Scale Cloning of Human Chromosome 2-specific
Yeast Artificial Chromosomes (YACs) Using an Interspersed
Repetitive Sequences (IRS)-PCR Approach, Genomics, 26:178, 1995.
.
Carney, et al., Random rapid amplification of cDNA ends
(RRACE)allows for cloning of multiple novel human cDNA fragments
containing (CAG)n repeats, Gene, 155:289, 1995. .
Munroe, et al., Systematic screening of an arrayed cDNA Library by
PCR, Proc. Natl. Acad. Sci., USA, 92:2209, 1995. .
Okubo, et al., Large Scale cDNA sequencing for analysis of
quantitative and qualitative aspects of gene expression, Nature
Genetics, 2:173, 1992. .
Adams, et al., Sequence identification of 2,375 human brain genes,
Nature, 355:632, 1992. .
Fields, et al., How many genes in the human genome?, Nature
Genetics, 7:345, 1994. .
Olson, et al., A Common Language for Physical Mapping of the Human
Genome, Science, 245:1434, 1989. .
Altschul, et al., Basic Local Alignment Search Tool, J. of
Molecular Biology, 213(1):403, 1990. .
Liang and Pardee, Differential Display of Eukaryotic Messenger RNA
by Means of the Polymerase Chain Reaction, Science, 257:967, 1992.
.
Ivanova and Belyavsky, Identification of differentially expressed
genes by restriction endonuclease-based gene expression
fingerprinting, Nucleic Acids Research, 23(15):2954, 1995. .
Prashar and Weissman, Analysis of differential gene expression by
display of 3' end restriction fragments of cDNAs, Proc. Natl. Acad.
Sci. USA, 93:659, 1996. .
Sambrook, et al., Alternative Methods of Cloning cDNA, Molecular
Cloning, A Laboratory Manual, 1989 2:8.27-8.29 (Second edition, New
York, Cold Spring Harbor Laboratory Press). .
Sambrook, et al., Ligation of phosphorylated linkers to blunt-ended
target fragments, Molecular Cloning, A Laboratory Manual, 1989,
3:F.9-F.11 (Second edition, New York, Cold Spring Harbor Laboratory
Press). .
Unrau, et al., Non-cloning amplification of specific DNA fragments
from whole genomic DNA digests using DNA `indexers`, Gene, 1994,
145:163-169. .
White, et al., Concatemer Chain Reaction: A Taq DNA
Polymerase-Mediated Mechanism for Generating Long Tandemly
Repetitive DNA Sequences, Analytical Biochemistry, 1991,
199:184-190. .
Kato, Kikuya, Description of the entire mRNA population by a 3' end
cDNA fragment generated by class IIS restriction enzymes, Nucleic
Acids Research, 1995, 23:3685-3690. .
Adams et al., "Complementary DNA Sequencing: Expressed Sequence
Tags and Human Genome Project", Science, 1991, 252, 1651-1656.
.
Adams et al., "Sequence identification of 2,375 human brain genes,"
Nature, 1992, 355, 632-634. .
Okubo et al., "Large scale cDNA sequencing for analysis of
quantitative and qualitative aspects of gene expression," Nature
Genetics, 1992, 2, 173-179. .
Velculescu et al., "Serial Analysis of Gene Expression", Science,
1995, 270, 484-487. .
Adams, "Serial analysis of gene expression: ESTs get smaller",
Bioessays, 1996, 18(4), 261-262..
|
Primary Examiner: Zitomer; Stephanie W.
Attorney, Agent or Firm: Fish & Richardson P.C.
Government Interests
This invention was made with support from National Institutes of
Health Grant Nos. CA57345, CA35494, and GM07309. The Government has
certain rights in this invention.
Parent Case Text
This application is a continuation-in-part application of Serial
No. 08/527,154, filed Sep. 12, 1995 now U.S. Pat. No. 5,695,937.
Claims
What is claimed is:
1. An isolated oligonucleotide composition derived from cDNA, said
composition comprising:
at least two different defined nucleotide sequence tags, wherein
each defined nucleotide sequence tag consists of about 6 to 30
nucleotides of said cDNA 5' of the 5'-most cleavage site of a
restriction endonuclease within said cDNA or 3' of the 3'-most
cleavage site of a restriction endonuclease within said cDNA;
wherein at least one tag corresponds to at least one expressed
gene.
2. The composition of claim 1, wherein at least two of said tags
are joined tail-to-tail to form a ditag, wherein said tail of said
tag is distalmost to said cleavage site within said cDNA and
wherein the oligonucleotide consists of about 1 to 200 ditags.
3. The composition of claim 2, wherein the oligonucleotide consists
of about 8 to 20 ditags.
4. A method for the detection of gene expression comprising:
providing complementary deoxyribonucleic acid (cDNA)
oligonucleotides;
cleaving said cDNA oligonucleotides with a restriction enzyme at a
first restriction endonuclease site to provide cDNA fragments;
isolating the 5' or 3' end of said cDNA fragments to provide
defined nucleotide sequence tags to said oligonucleotides of said
fragments;
isolating a first define nucleotides sequence tag from a first cDNA
oligonucleotides and second defined nucleotide sequence tag from a
second cDNA oligonucleotides;
linking the first tag to a first oligonucleotides linker, wherein
the first oligonucleotides linker comprises a first sequence for
hybridization of an amplification primer and linking the second tag
to a second tag to a second oligonucleotides linker, wherein the
second oligonucleotides linker comprises a second sequence for
hybridization of an amplification primer; and
determining the nucleotide sequence of a tag, wherein said tag
corresponds to an expressed gene.
5. The method of claim 4, further comprising ligating the first tag
linked to the first oligonucleotide linker to the second tag linked
to the second oligonucleotide linker and forming a ditag.
6. The method of claim 5, further comprising amplifying the ditag
oligonucleotide.
7. The method of claim 5, further comprising producing concatemers
of the ditags.
8. The method of claim 7, wherein the concatemer consists of about
2 to 200 ditags.
9. The method of claim 8, wherein the concatemer consists of about
8 to 20 ditags.
10. The method of claim 4, wherein the first and second
oligonucleotide linkers comprise the same nucleotide sequence.
11. The method of claim 4, wherein the first and second
oligonucleotide linkers comprise different nucleotide
sequences.
12. The method of claim 11, wherein the first and second
oligonucleotide linkers have a sequence:
5'-TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG-3' (SEQ ID NO:1)
3'-ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT-5' (SEQ ID NO:2)
or
5'-TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG-3' (SEQ ID
NO:3)
3'-AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT-5' (SEQ ID NO:4)
wherein A is dideoxy A.
13. The method of claim 4, wherein the linkers comprise a second
restriction endonuclease recognition site which allows cleavage at
a site distant from the recognition site.
14. The method of claim 13, wherein the second restriction
endonuclease is a type IIS endonuclease.
15. The method of claim 14, wherein the type IIS endonuclease is
selected from the group consisting of BsmFI and FokI.
16. The method of claim 5, wherein the ditag is about 12 to 60 base
pairs.
17. The method of claim 16, wherein the ditag is about 18 to 22
base pairs.
18. The method of claim 6, wherein the amplifying is by polymerase
chain reaction (PCR).
19. The method of claim 18, wherein primers for PCR are selected
from the group consisting of
5'-CCAGCTTATTCAATTCGGTCC-3' (SEQ ID NO:5) and
5'-GTAGACATTCTAGTATCTCGT-3' (SEQ ID NO:6).
20. A method for detection of gene expression comprising:
cleaving a cDNA sample with a first restriction endonuclease,
wherein the endonuclease cleaves the cDNA at a defined position at
the 5' or 3' terminus of the cDNA thereby producing defined
sequence tags;
isolating the defined sequence tags;
dividing said defined sequence tags into first and second
pools;
ligating a first pool of tags with a first oligonucleotide linker
having a first sequence capable of hybridizing to an amplification
primer and ligating a second pool of tags with a second
oligonucleotide linker having a second sequence capable of
hybridizing to an amplification primer;
cleaving the tags with a second restriction endonuclease which
cleaves at a position outside its recognition sequence;
ligating the two pools of tags to produce a ditag; and
determining the nucleotide sequence of the tag(s), wherein the
tag(s) correspond to a mRNA from an expressed gene.
21. The method of claim 20, further comprising amplifying the
ditag.
22. The method of claim 20, wherein the first restriction
endonuclease has at least one recognition site in the cDNA.
23. The method of claim 22, wherein the first restriction enzyme
has a four base pair recognition site.
24. The method of claim 23, wherein the restriction endonuclease is
NlaIII.
25. The method of claim 20, wherein the cDNA comprises a means for
capture.
26. The method of claim 25, wherein the means for capture is a
binding element.
27. The method of claim 26, wherein the binding element is
biotin.
28. The method of claim 20, wherein the first and second
oligonucleotide linkers comprise the same nucleotide sequence.
29. The method of claim 20, wherein the first and second
oligonucleotide linkers comprise different nucleotide
sequences.
30. The method of claim 29, wherein the first and second
oligonucleotide linkers have a sequence;
5'-TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG-3' (SEQ ID NO:1)
3'-ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT-5' (SEQ ID NO:2)
or
5'-TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG-3' (SEQ ID
NO:3)
3'-AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT-5' (SEQ ID NO:4)
wherein A is dideoxy A.
31. The method of claim 20, wherein the second restriction
endonuclease is a type IIS endonuclease.
32. The method of claim 31, wherein the type IIS endonuclease is
selected from the group consisting of BsmFI and FokI.
33. The method of claim 20, wherein the ditag is about 12 to 60
base pairs.
34. The method of claim 34, wherein the ditag is about 14 to 22
base pairs.
35. The method of claim 20, further comprising ligating the ditags
to produce a concatemer.
36. The method of claim 35, wherein the concatemer consists of
about 2 to 200 ditags.
37. The method of claim 36, wherein the concatemer consists of
about 8 to 20 ditags.
38. The method of claim 20, wherein the amplifying is by polymerase
chain reaction (PCR).
39. The method of claim 38, wherein primers for PCR are selected
from the group consisting of
5'-CCAGCTTATTCAATTCGGTCC-3' (SEQ ID NO:5) and
5'-GTAGACATTCTAGTATCTCGT-3' (SEQ ID NO:6).
40. A kit useful for detection of gene expression wherein the
presence of a cDNA ditag is indicative of expression of a gene
having a sequence of a tag of the ditag, the kit comprising a first
container containing a first oligonucleotide linker having a first
hybridization sequence which hybridizes an amplification primer; a
second container containing a second oligonucleotide linkers having
a second hybridization sequence which hybridizes to an
amplification primer, wherein the linkers further comprise a
restriction endonuclease recognition site; and third and fourth
containers having nucleic acid primers for hybridization to the
first and second hybridization sequences of the linkers.
41. The kit of claim 40, wherein the linkers have a sequence
5'-TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG-3' (SEQ ID NO:1)
3'-ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT-5' (SEQ ID NO:2)
or
5'-TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG-3' (SEQ ID
NO:3)
3'-AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT-5' (SEQ ID NO:4)
wherein A is dideoxy A.
42. The kit of claim 40, wherein the restriction endonuclease is a
type IIS endonuclease.
43. The kit of claim 42, wherein the type IIS endonuclease is
BsmFI.
44. The kit of claim 40, wherein the primers for amplification are
selected from the group consisting of
5'-CCAGCTTATTCAATTCGGTCC-3' (SEQ ID NO:5) and
5'-GTAGACATTCTAGTATCTCGT-3' (SEQ ID NO:6).
Description
FILED OF THE INVENTION
The present invention relates generally to the field of gene
expression and specifically to a method for the serial analysis of
gene expression (SAGE) for the analysis of a large number of
transcripts by identification of a defined region of a transcript
which corresponds to a region of an expressed gene.
BACKGROUND OF THE INVENTION
Determination of the genomic sequence of higher organisms,
including humans, is now a real and attainable goal. However, this
analysis only represents one level of genetic complexity. The
ordered and timely expression of genes represents another level of
complexity equally important to the definition and biology of the
organism.
The role of sequencing complementary DNA (cDNA), reverse
transcribed from mRNA, as part of the human genome project has been
debated as proponents of genomic sequencing have argued the
difficulty of finding every mRNA expressed in all tissues, cell
types, and developmental stages and have pointed out that much
valuable information from intronic and intergenic regions,
including control and regulatory sequences, will be missed by cDNA
sequencing (Report of the Committee on Mapping and Sequencing the
Human Genome, National Academy Press, Washington, D.C., 1988).
Sequencing of transcribed regions of the genome using cDNA
libraries has heretofore been considered unsatisfactory. Libraries
of cDNA are believed to be dominated by repetitive elements,
mitochondrial genes, ribosomal RNA genes, and other nuclear genes
comprising common or housekeeping sequences. It is believed that
cDNA libraries do not provide all sequences corresponding to
structural and regulatory polypeptides or peptides (Putney, et al.,
Nature, 302:718, 1983).
Another drawback of standard cDNA cloning is that some mRNAs are
abundant while others are rare. The cellular quantities of mRNA
from various genes can vary by several orders of magnitude.
Techniques based on cDNA subtraction or differential display can be
quite useful for comparing gene expression differences between two
cell types (Hedrick, et al., Nature, 308:149, 1984; Liang and
Pardee, Science, 257:967, 1992), but provide only a partial
analysis, with no direct information regarding abundance of
messenger RNA. The expressed sequence tag (EST) approach has been
shown to be a valuable tool for gene discovery (Adams, et al.,
Science 252:1656, 1991; Adams, et al., Nature, 355:632, 1992; Okubo
et al., Nature Genetics, 2:173, 1992), but like Northern blotting,
RNase protection, and reverse transcriptase-polymerase chain
reaction (RT-PCR) analysis (Alwine, et al., Proc. Natl. Acad Sci,
U.S.A., 74:5350, 1977; Zinn et al, Cell, 34:865, 1983; Veres, et
al., Science, 237:415, 1987), only evaluates a limited number of
genes at a time. In addition, the EST approach preferably employs
nucleotide sequences of 150 base pairs or longer for similarity
searches and mapping.
Sequence tagged sites (STSs) (Olson, et al., Science, 245:1434,
1989) have also been utilized to identify genomic markers for the
physical mapping of the genome. These short sequences from
physically mapped clones represent uniquely identified map
positions in the genome. In contrast, the identification of
expressed genes relies on expressed sequence tags which are markers
for those genes actually transcribed and expressed in vivo.
There is a need for an improved method which allows rapid, detailed
analysis of thousands of expressed genes for the investigation of a
variety of biological applications, particularly for establishing
the overall pattern of gene expression in different cell types or
in the same cell type under different physiologic or pathologic
conditions. Identification of different patterns of expression has
several utilities, including the identification of appropriate
therapeutic targets, candidate genes for gene therapy (e.g., gene
replacement), tissue typing, forensic identification, mapping
locations of disease-associated genes, and for the identification
of diagnostic and prognostic indicator genes.
SUMMARY OF THE INVENTION
The present invention provides a method for the rapid analysis of
numerous transcripts in order to identify the overall pattern of
gene expression in different cell types or in the same cell type
under different physiologic, developmental or disease conditions.
The method is based on the identification of a short nucleotide
sequence tag at a defined position in a messenger RNA. The tag is
used to identify the corresponding transcript and gene from which
it was transcribed. By utilizing dimerized tags, termed a "ditag",
the method of the invention allows elimination of certain types of
bias which might occur during cloning and/or amplification and
possibly during data evaluation. Concatenation of these short
nucleotide sequence tags allows the efficient analysis of
transcripts in a serial manner by sequencing multiple tags on a
single DNA molecule, for example, a DNA molecule inserted in a
vector or in a single clone.
The method described herein is the serial analysis of gene
expression (SAGE), a novel approach which allows the analysis of a
large number of transcripts. To demonstrate this strategy, short
cDNA sequence tags were generated from mRNA isolated from pancreas,
randomly paired to form ditags, concatenated, and cloned. Manual
sequencing of 1,000 tags revealed a gene expression pattern
characteristic of pancreatic function. Identification of such
patterns is important diagnostically and therapeutically, for
example. Moreover, the use of SAGE as a gene discovery tool was
documented by the identification and isolation of new pancreatic
transcripts corresponding to novel tags. SAGE provides a broadly
applicable means for the quantitative cataloging and comparison of
expressed genes in a variety of normal, developmental, and disease
states.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a schematic of SAGE. The first restriction enzyme, or
anchoring enzyme, is NlaIII and the second enzyme, or tagging
enzyme, is FokI in this example. Sequences represent primer derived
sequences, and transcript derived sequences with "X" and "O"
representing nucleotides of different tags.
FIG. 2 shows a comparison of transcript abundance. Bars represent
the percent abundance as determined by SAGE (dark bars) or
hybridization analysis (light bars). SAGE quantitations were
derived from Table 1 as follows: TRY 1/2 includes the tags for
trypsinogen 1 and 2, PROCAR indicates tags for procarboxypeptidase
A1, CHYMO indicates tags for chymotrypsinogen, and ELA/PRO includes
the tags for elastase IIIB and protease E. Error bars represent the
standard deviation determined by taking the square root of counted
events and converting it to a percent abundance (assumed Poisson
distribution).
FIG. 3 shows the results of screening a cDNA library with SAGE
tags. P1 and P2 show typical hybridization results obtained with 13
bp oligonucleotides as described in the Examples. P1 and P2
correspond to the transcripts described in Table 2. Images were
obtained using a Molecular Dynamics PhosphorImager and the circle
indicates the outline of the filter membrane to which the
recombinant phage were transferred prior to hybridization.
FIG. 4 is a block diagram of a tag code database access system in
accordance with the present invention.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention provides a rapid, quantitative process for
determining the abundance and nature of transcripts corresponding
to expressed genes. The method, termed serial analysis of gene
expression (SAGE), is based on the identification of and
characterization of partial, defined sequences of transcripts
corresponding to gene segments. These defined transcript sequence
"tags" are markers for genes which are expressed in a cell, a
tissue, or an extract, for example.
SAGE is based on several principles. First, a short nucleotide
sequence tag (9 to 10 bp) contains sufficient information content
to uniquely identify a transcript provided it is isolated from a
defined position within the transcript. For example, a sequence as
short as 9 bp can distinguish 262,144 transcripts (4.sup.9) given a
random nucleotide distribution at the tag site, whereas estimates
suggest that the human genome encodes about 80,000 to 200,000
transcripts (Fields, et al., Nature Genetics, 7:345 1994). The size
of the tag can be shorter for lower eukaryotes or prokaryotes, for
example, where the number of transcripts encoded by the genome is
lower. For example, a tag as short as 6-7 bp may be sufficient for
distinguishing transcripts in yeast.
Second, random dimerization of tags allows a procedure for reducing
bias (caused by amplification and/or cloning). Third, concatenation
of these short sequence tags allows the efficient analysis of
transcripts in a serial manner by sequencing multiple tags within a
single vector or clone. As with serial communication by computers,
wherein information is transmitted as a continuous string of data,
serial analysis of the sequence tags requires a means to establish
the register and boundaries of each tag. All of these principles
may be applied independently, in combination, or in combination
with other known methods of sequence identification.
In a first embodiment, the invention provides a method for the
detection of gene expression in a particular cell or tissue, or
cell extract, for example, including at a particular developmental
stage or in a particular disease state. The method comprises
producing complementary deoxyribonucleic acid (cDNA)
oligonucleotides, isolating a first defined nucleotide sequence tag
from a first cDNA oligonucleotide and a second defined nucleotide
sequence tag from a second cDNA oligonucleotide, linking the first
tag to a first oligonucleotide linker, wherein the first
oligonucleotide linker comprises a first sequence for hybridization
of an amplification primer and linking the second tag to a second
oligonucleotide linker, wherein the second oligonucleotide linker
comprises a second sequence for hybridization of an amplification
primer, and determining the nucleotide sequence of the tag(s),
wherein the tag(s) correspond to an expressed gene.
FIG. 1 shows a schematic representation of the analysis of
messenger RNA (mRNA) using SAGE as described in the method of the
invention. mRNA is isolated from a cell or tissue of interest for
in vitro synthesis of a double-stranded DNA sequence by reverse
transcription of the mRNA. The double-stranded DNA complement of
mRNA formed is referred to as complementary (cDNA).
The term "oligonucleotide") as used herein refers to primers or
oligomer fragments comprised of two or more deoxyribonucleotides or
ribonucleotides, preferably more than three. The exact size will
depend on many factors, which in turn depend on the ultimate
function or use of the oligonucleotide.
The method further includes ligating the first tag linked to the
first oligonucleotide linker to the second tag linked to the second
oligonucleotide linker and forming a "ditag". Each ditag represents
two defined nucleotide sequences of at least one transcript,
representative of at least one gene. Typically, a ditag represents
two transcripts from two distinct genes. The presence of a defined
cDNA tag within the ditag is indicative of expression of a gene
having a sequence of that tag.
The analysis of ditags, formed prior to any amplification step,
provides a means to eliminate potential distortions introduced by
amplification, e.g., PCR. The pairing of tags for the formation of
ditags is a random event. The number of different tags is expected
to be large, therefore, the probability of any two tags being
coupled in the same ditag is small, even for abundant transcripts.
Therefore, repeated ditags potentially produced by biased standard
amplification and/or cloning methods are excluded from analysis by
the method of the invention.
The term "defined" nucleotide sequence, or "defined" nucleotide
sequence tag, refers to a nucleotide sequence derived from either
the 5' or 3' terminus of a transcript. The sequence is defined by
cleavage with a first restriction endonuclease, and represents
nucleotides either 5' or 3' of the first restriction endonuclease
site, depending on which terminus is used for capture (e.g., 3'
when oligo-dT is used for capture as described herein).
As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes which bind to a
specific double-stranded DNA sequence termed a recognition site or
recognition nucleotide sequence, and cut double-stranded DNA at or
near the specific recognition site.
The first endonuclease, termed "anchoring enzyme" or "AE" in FIG.
1, is selected by its ability to cleave a transcript at least one
time and therefore produce a defined sequence tag from either the
5' or 3' end of a transcript. Preferably, a restriction
endonuclease having at least one recognition site and therefore
having the ability to cleave a majority of cDNAs is utilized. For
example, as illustrated herein, enzymes which have a 4 base pair
recognition site are expected to cleave every 256 base pairs
(4.sup.4) on average while most transcripts are considerably
larger. Restriction endonucleases which recognize a 4 base pair
site include NlaIII, as exemplified in the EXAMPLES of the present
invention. Other similar endonucleases having at least one
recognition site within a DNA molecule (e.g., cDNA) will be known
to those of skill in the art (see for example, Current Protocols in
Molecular Biology, Vol. 2, 1995, Ed. Ausubel, et al., Greene
Publish. Assoc. & Wiley Interscience, Unit 3.1.15; New England
Biolabs Catalog, 1995).
After cleavage with the anchoring enzyme, the most 5' or 3' region
of the cleaved cDNA can then be isolated by binding to a capture
medium. For example, as illustrated in the present EXAMPLES,
streptavidin beads are used to isolate the defined 3' nucleotide
sequence tag when the oligo dT primer for cDNA synthesis is
biotinylated. In this example, cleavage with the first or anchoring
enzyme provides a unique site on each transcript which corresponds
to the restriction site located closest to the poly-A tail.
Likewise, the 5' cap of a transcript (the cDNA) can be utilized for
labeling or binding a capture means for isolation of a 5' defined
nucleotide sequence tag. Those of skill in the art will know other
similar capture systems (e.g., biotin/streptavidin,
digoxigenin/anti-digoxigenin) for isolation of the defined sequence
tag as described herein. The invention is not limited to use of a
single "anchoring" or first restriction endonuclease. It may be
desirable to perform the method of the invention sequentially,
using different enzymes on separate samples of a preparation, in
order to identify a complete pattern of transcription for a cell or
tissue. In addition, the use of more than one anchoring enzyme
provides confirmation of the expression pattern obtained from the
first anchoring enzyme. Therefore, it is also envisioned that the
first or anchoring endonuclease may rarely cut cDNA such that few
or no cDNA representing abundant transcripts are cleaved. Thus,
transcripts which are cleaved represent "unique" transcripts.
Restriction enzymes that have a 7-8 bp recognition site for
example, would be enzymes that would rarely cut cDNA. Similarly,
more than one tagging enzyme, described below, can be utilized in
order to identify a complete pattern of transcription.
The term "isolated" as used herein includes polynucleotides
substantially free of other nucleic acids, proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. cDNA is not naturally occurring as such, but rather is
obtained via manipulation of a partially purified naturally
occurring mRNA. Isolation of a defined sequence tag refers to the
purification of the 5' or 3' tag from other cleaved cDNA.
In one embodiment, the isolated defined nucleotide sequence tags
are separated into two pools of cDNA, when the linkers have
different sequences. Each pool is ligated via the anchoring, or
first restriction endonuclease site to one of two linkers. When the
linkers have the same sequence, it is not necessary to separate the
tags into pools. The first oligonucleotide linker comprises a first
sequence for hybridization of an amplification primer and the
second oligonucleotide linker comprises a second sequence for
hybridization of an amplification primer. In addition, the linkers
further comprise a second restriction endonuclease site, also
termed the "tagging enzyme" or "TE". The method of the invention
does not require, but preferably comprises amplifying the ditag
oligonucleotide after ligation.
The second restriction endonuclease cleaves at a site distant from
or outside of the recognition site. For example, the second
restriction endonuclease can be a type IIS restriction enzyme. Type
IIS restriction endonucleases cleave at a defined distance up to 20
bp away from their asymmetric recognition sites (Szybalski, W.,
Gene, 40:169, 1985). Examples of type IIS restriction endonucleases
include BsmFI and Fokl.Other similar enzymes will be known to those
of skill in the art (see, Current Protocols in Molecular Biology,
supra).
The first and second "linkers" which are ligated to the defined
nucleotide sequence tags are oligonucleotides having the same or
different nucleotide sequences. For example, the linkers
illustrated in the Examples of the present invention include
linkers having different sequences:
5'-TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG-3' (SEQ ID NO:1)
3'-ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT-5' (SEQ ID NO:2)
and
5'-TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG-3' (SEQ ID
NO:3)
3'-AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT-5' (SEQ ID NO:4), wherein
A is a dideoxy nucleotide (e.g., dideoxy A). Other similar linkers
can be utilized in the method of the invention; those of skill in
the art can design such alternate linkers.
The linkers are designed so that cleavage of the ligation products
with the second restriction enzyme, or tagging enzyme, results in
release of the linker having a defined nucleotide sequence tag
(e.g., 3' of the restriction endonuclease cleavage site as
exemplified herein). The defined nucleotide sequence tag may be
from about 6 to 30 base pairs. Preferably, the tag is about 9 to 11
base pairs. Therefore, a ditag is from about 12 to 60 base pairs,
and preferably from 18 to 22 base pairs.
The pool of defined tags ligated to linkers having the same
sequence, or the two pools of defined nucleotide sequence tags
ligated to linkers having different nucleotide sequences, are
randomly ligated to each other "tail to tail". The portion of the
cDNA tag furthest from the linker is referred to as the "tail". As
illustrated in FIG. 1, the ligated tag pair, or ditag, has a first
restriction endonuclease site upstream (5') and a first restriction
endonuclease site downstream (3') of the ditag; a second
restriction endonuclease cleavage site upstream and downstream of
the ditag, and a linker oligonucleotide containing both a second
restriction enzyme recognition site and an amplification primer
hybridization site upstream and downstream of the ditag. In other
words, the ditag is flanked by the first restriction endonuclease
site, the second restriction endonuclease cleavage site and the
linkers, respectively.
The ditag can be amplified by utilizing primers which specifically
hybridize to one strand of each linker. Preferably, the
amplification is performed by standard polymerase chain reaction
(PCR) methods as described (U.S. Pat. No. 4,683,195).
Alternatively, the ditags can be amplified by cloning in
prokaryotic-compatible vectors or by other amplification methods
known to those of skill in the art.
The term "primer" as used herein refers to an oligonucleotide,
whether occurring naturally or produced synthetically, which is
capable of acting as a point of initiation of synthesis when placed
under conditions in which synthesis of primer extension product
which is complementary to a nucleic acid strand is induced, i.e.,
in the presence of nucleotides and an agent for polymerization such
as DNA polymerase and at a suitable temperature and pH. The primer
is preferably single stranded for maximum efficiency in
amplification. Preferably, the primer is an oligodeoxy
ribonucleotide. The primer must be sufficiently long to prime the
synthesis of extension products in the presence of the agent for
polymerization. The exact lengths of the primers will depend on
many factors, including temperature and source of primer.
The primers herein are selected to be "substantially" complementary
to the different strands of each specific sequence to be amplified.
This means that the primers must be sufficiently complementary to
hybridize with their respective strands. Therefore, the primer
sequence need not reflect the exact sequence of the template. In
the present invention, the primers are substantially complementary
to the oligonucleotide linkers.
Primers useful for amplification of the linkers exemplified herein
as SEQ ID NO:1-4 include 5'-CCAGCTTATTCAATTCGGTCC-3' (SEQ ID NO:5)
and 5'-GTAGACATTCTAGTATCTCGT-3' (SEQ ID NO:6). Those of skill in
the art can prepare similar primers for amplification based on the
nucleotide sequence of the linkers without undue
experimentation.
Cleavage of the amplified PCR product with the first restriction
endonuclease allows isolation of ditags which can be concatenated
by ligation. After ligation, it may be desirable to clone the
concatemers, although it is not required in the method of the
invention. Analysis of the ditags or concatemers, whether or not
amplification was performed, is by standard sequencing methods.
Concatemers generally consist of about 2 to 200 ditags and
preferably from about 8 to 20 ditags. While these are preferred
concatemers, it will be apparent that the number of ditags which
can be concatenated will depend on the length of the individual
tags and can be readily determined by those of skill in the art
without undue experimentation. After formation of concatemers,
multiple tags can be cloned into a vector for sequence analysis, or
alternatively, ditags or concatemers can be directly sequenced
without cloning by methods known to those of skill in the art.
Among the standard procedures for cloning the defined nucleotide
sequence tags of the invention is insertion of the tags into
vectors such as plasmids or phage. The ditag or concatemers of
ditags produced by the method described herein are cloned into
recombinant vectors for further analysis, e.g., sequence analysis,
plaque/plasmid hybridization using the tags as probes, by methods
known to those of skill in the art.
The term "recombinant vector" refers to a plasmid, virus or other
vehicle known in the art that has been manipulated by insertion or
incorporation of the ditag genetic sequences. Such vectors contain
a promoter sequence which facilitates the efficient transcription
of the a marker genetic sequence for example. The vector typically
contains an origin of replication, a promoter, as well as specific
genes which allow phenotypic selection of the transformed cells.
Vectors suitable for use in the present invention include for
example, pBlueScript (Stratagene, La Jolla, Calif.); pBC, pSL301
(Invitrogen) and other similar vectors known to those of skill in
the art. Preferably, the ditags or concatemers thereof are ligated
into a vector for sequencing purposes.
Vectors in which the ditags are cloned can be transferred into a
suitable host cell. "Host cells" are cells in which a vector can be
propagated and its DNA expressed. The term also includes any
progeny of the subject host cell. It is understood that all progeny
may not be identical to the parental cell since there may be
mutations that occur during replication. However, such progeny are
included when the term "host cell" is used. Methods of stable
transfer, meaning that the foreign DNA is continuously maintained
in the host, are known in the art.
Transformation of a host cell with a vector containing ditag(s) may
be carried out by conventional techniques as are well known to
those skilled in the art. Where the host is prokaryotic, such as E.
Coli, competent cells which are capable of DNA uptake can be
prepared from cells harvested after exponential growth phase and
subsequently treated by the CaCl.sub.2 method using procedures well
known in the art. Alternatively, MgCl.sub.2 or RbCl can be used.
Transformation can also be performed by electroporation or other
commonly used methods in the art.
The ditags present in a particular clone can be sequenced by
standard methods (see for example, Current Protocols in Molecular
Biology, supra, Unit 7) either manually or using automated
methods.
In another embodiment, the present invention provides a kit useful
for detection of gene expression wherein the presence of a defined
nucleotide tag or ditag is indicative of expression of a gene
having a sequence of the tag, the kit comprising one or more
containers comprising a first container containing a first
oligonucleotide linker having a first sequence useful hybridization
of an amplification primer; a second container containing a second
oligonucleotide linker having a second oligonucleotide linker
having a second sequence useful hybridization of an amplification
primer, wherein the linkers further comprise a restriction
endonuclease site for cleavage of DNA at a site distant from the
restriction endonuclease recognition site; and a third and fourth
container having a nucleic acid primers for hybridization to the
first and second unique sequence of the linker. It is apparent that
if the oligonucleotide linkers comprise the same nucleotide
sequence, only one container containing linkers is necessary in the
kit of the invention.
In yet another embodiment, the invention provides an
oligonucleotide composition having at least two defined nucleotide
sequence tags, wherein at least one of the sequence tags
corresponds to at least one expressed gene. The composition
consists of about 1 to 200 ditags, and preferably about 8 to 20
ditags. Such compositions are useful for the analysis of gene
expression by identifying the defined nucleotide sequence tag
corresponding to an expressed gene in a cell, tissue or cell
extract, for example.
It is envisioned that the identification of differentially
expressed genes using the SAGE technique of the invention can be
used in combination with other genomics techniques. For example,
individual tags, and preferably ditags, can be hybridized with
oligonucleotides immobilized on a solid support (e.g.,
nitrocellulose filter, glass slide, silicon chip). Such techniques
include "parallel sequence analysis" or PSA, as described below.
The sequence of the ditags formed by the method of the invention
can also be determined using limiting dilutions by methods
including clonal sequencing (CS).
Briefly, PSA is performed after ditag preparation, wherein the
oligonucleotide sequences to which the ditags are hybridized are
preferably unlabeled and the ditag is preferably detectably
labeled. Alternatively, the oligonucleotide can be labeled rather
than the ditag. The ditags can be detectably labeled, for example,
with a radioisotope, a fluorescent compound, a bioluminescent
compound, a chemiluminescent compound, a metal chelator, or an
enzyme. Those of ordinary skill in the art will know of other
suitable labels for binding to the ditag, or will be able to
ascertain such, using routine experimentation. For example, PCR can
be performed with labeled (e.g., fluorescein tagged) primers.
Preferably, the ditag contains a fluorescent end label.
The labeled or unlabeled ditags are separated into single-stranded
molecules which are preferably serially diluted and added to a
solid support (e.g., a silicon chip as described by Fodor, et al.,
Science, 251:767, 1991) containing oligonucleotides representing,
for example, every possible permutation of a 10-mer (e.g., in each
grid of a chip). The solid support is then used to determine
differential expression of the tags contained within that support
(e.g., on a grid on a chip) by hybridization of the
oligonucleotides on the solid support with tags produced from cells
under different conditions (e.g., different stage of development,
growth of cells in the absence and presence of a growth factor,
normal versus transformed cells, comparison of different tissue
expression, etc). In the case of fluoresceinated end labeled
ditags, analysis of fluorescence is indicative of hybridization to
a particular 10-mer. When the immobilized oligonucleotide is
fluoresceinated for example, a loss of fluorescence due to
quenching (by the proximity of the hybridized ditag to the labeled
oligo) is observed and is analyzed for the pattern of gene
expression. An illustrative example of the method is shown in
Example 4 herein.
The SAGE method of the invention is also useful for clonal
sequencing, similar to limiting dilution techniques used in cloning
of cell lines. For example, ditags or concatemers thereof, are
diluted and added to individual receptacles such that each
receptacle contains less than one DNA molecule per receptacle. DNA
in each receptacle is amplified and sequenced by standard methods
known in the art, including mass spectroscopy. Assessment of
differential expression is performed as described above for
SAGE.
Those of skill in the art can readily determine other methods of
analysis for ditags or individual tags produced by SAGE as
described in the present invention, without resorting to undue
experimentation.
The concept of deriving a defined tag from a sequence in accordance
with the present invention is useful in matching tags of samples to
a sequence database. In the preferred embodiment, a computer method
is used to match a sample sequence with known sequences.
In one embodiment, a sequence tag for a sample is compared to
corresponding information in a sequence database to identify known
sequences that match the sample sequence. One or more tags can be
determined for each sequence in the sequence database as the N base
pairs adjacent to each anchoring enzyme site within the sequence.
However, in the preferred embodiment, only the first anchoring
enzyme site from the 3' end is used to determine a tag. In the
preferred embodiment, the adjacent base pairs defining a tag are on
the 3' side of the anchoring enzyme site, and N is preferably
9.
A linear search through such a database may be used. However, in
the preferred embodiment, a sequence tag from a sample is converted
to a unique numeric representation by converting each base pair (A,
C, G, or T) of an N-base tag to a number or "tag code" (e.g., A=O,
C=1, G=2, T=3, or any other suitable mapping). A tag is determined
for each sequence of a sequence database as described above, and
the tag is converted to a tag code in a similar manner. In the
preferred embodiment, a set of tag codes for a sequence database is
stored in a pointer file. The tag code for a sample sequence is
compared to the tag codes in the pointer file to determine the
location in the sequence database of the sequence corresponding to
the sample tag code. (Multiple corresponding sequences may exist if
the sequence database has redundancies).
FIG. 4 is a block diagram of a tag code database access system in
accordance with the present invention. A sequence database 10
(e.g., the Human Genome Sequence Database) is processed as
described above, such that each sequence has a tag code determined
and stored in a pointer file 12. A sample tag code X for a sample
is determined as described above, and stored within a memory
location 14 of a computer. The sample tag code X is compared to the
pointer file 12 for a matching sequence tag code. If a match is
found, a pointer associated with the matching sequence tag code is
used to access the corresponding sequence in the sequence database
10.
The pointer file 12 may be in any of several formats. In one
format, each entry of the pointer file 12 comprises a tag code and
a pointer to a corresponding record in the sequence database 12.
The sample tag code X can be compared to sequence tag codes in a
linear search. Alternatively, the sequence tag codes can be sorted
and a binary search used. As another alternative, the sequence tag
codes can be structured in a hierarchical tree structure (e.g., a
B-tree), or as a singly or doubly linked list, or in any other
conveniently searchable data structure or format.
In the preferred embodiment, each entry of the pointer file 12
comprises only a pointer to a corresponding record in the sequence
database 10. In building the pointer file 12, each sequence tag
code is assigned to an entry position in the pointer file 12
corresponding to the value of the tag code. For example, if a
sequence tag code was "1043", a pointer to the corresponding record
in the sequence database 10 would be stored in entry #1043 of the
pointer file 12. The value of a sample tag code X can be used to
directly address the location in the pointer file 12 that
corresponds to the sample tag code X, and thus rapidly access the
pointer stored in that location in order to address the sequence
database 10.
Because only four values are needed to represent all possible base
pairs, using binary coded decimal (BCD) numbers for tag codes in
conjunction with the preferred pointer file 12 structure leads to a
"sparse" pointer file 12 that wastes memory or storage space.
Accordingly, the present invention transforms each tag code to
number base 4 (i.e., 2 bits per code digit), in known fashion,
resulting in a compact pointer file 12 structure. For example, for
tag sequence "AGCT", with A=00.sub.2, C=01.sub.2, G=10.sub.2,
T=11.sub.2, the base four representation in binary would be
"00011011".
In contrast, the BCD representation would be "00000000 00000001
00000010 000000011". Of course, it should be understood that other
mappings of base pairs to codes would provide equivalent
function.
The concept of deriving a defined tag from a sample sequence in
accordance with the present invention is also useful in comparing
different samples for similarity. In the preferred embodiment, a
computer method is used to match sequence tags from different
samples. For example, in comparing materials having a large number
of sequences (e.g., tissue), the frequency of occurrence of the
various tags in a first sample can be mapped out as tag codes
stored in a distribution or histogram-type data structure. For
example, a table structured similar to pointer file 12 in FIG. 4
can be used where each entry comprises a frequency of occurrence
value. Thereafter, the various tags in a second sample can be
generated, converted to tag codes, and compared to the table by
directly addressing table entries with the tag code. A count can be
kept of the number of matches found, as well as the location of the
matches, for output in text or graphic form on an output device,
and/or for storage in a data storage system for later use.
The tag comparison aspects of the invention may be implemented in
hardware or software, or a combination of both. Preferably, these
aspects of the invention are implemented in computer programs
executing on a programmable computer comprising a processor, a data
storage system (including volatile and non-volatile memory and/or
storage elements), at least one input device, and at least one
output device. Data input through one or more input devices for
temporary or permanent storage in the data storage system includes
sequences, and may include previously generated tags and tag codes
for known and/or unknown sequences. Program code is applied to the
input data to perform the functions described above and generate
output information. The output information is applied to one or
more output devices, in known fashion.
Each such computer program is preferably stored on a storage media
or device (e.g., ROM or magnetic diskette) readable by a general or
special purpose programmable computer, for configuring and
operating the computer when the storage media or device is read by
the computer to perform the procedures described herein. The
inventive system may also be considered to be implemented as a
computer-readable storage medium, configured with a computer
program, where the storage medium so configured causes a computer
to operate in a specific and predefined manner to perform the
functions described herein.
The following examples are intended to illustrate but not limit the
invention. While they are typical of those that might be used,
other procedures known to those skilled in the art may
alternatively be used.
EXAMPLES
For exemplary purposes, the SAGE method of the invention was used
to characterized gene expression in the human pancreas. NlaIII was
utilized as the first restriction endonuclease, or anchoring
enzyme, and BsmFI as the second restriction endonuclease, or
tagging enzyme, yielding a 9 bp tag (BsmFI was predicted to cleave
the complementary strand 14 bp 3' to the recognition site GGGAC and
to yield a 4 bp 5' overhang (New England BioLabs). Overlapping the
BsmFI and NlaIII (CATG) sites as indicated (GGGACATG) would be
predicted to result in a 11 bp tag. However, analysis suggested
that under the cleavage conditions used (37.degree. C.), BsmFI
often cleaved closer to its recognition site leaving a minimum of
12 bp 3' of its recognition site. Therefore, only the 9 bp closest
to the anchoring enzyme site was used for analysis of tags.
Cleavage at 65.degree. C. results in a more consistent 11 bp
tag.
Computer analysis of human transcripts from Gen Bank indicated that
greater than 95% of tags of 9 bp in length were likely to be unique
and that inclusion of two additional bases provided little
additional resolution. Human sequences (84,300) were extracted from
the GenBank 87 database using the Findseq program provided on the
IntelliGenetics Bionet on-line service. All further analysis was
performed with a SAGE program group written in Microsoft Visual
Basic for the Microsoft Windows operating system. The SAGE database
analysis program was set to include only sequences noted as "RNA"
in the locus description and to exclude entries noted as "EST",
resulting in a reduction to 13,241 sequences. Analysis of this
subset of sequences using NlaIII as anchoring Enzyme indicated that
4,127 nine bp tags were unique while 1,511 tags were found in more
than one entry. Nucleotide comparison of a randomly chosen subset
(100) of the latter entries indicated that at least 83% were due to
redundant data base entries for the same gene or highly related
genes (>95% identity over at least 250 bp). This suggested that
5381 of the 9 bp tags (95.5%) were unique to a transcript or highly
conserved transcript family. Likewise, analysis of the same subset
of GenBank with an 11 bp tag resulted only in a 6% decrease in
repeated tags (1511 to 1425) instead of the 94% decrease expected
if the repeated tags were due to unrelated transcripts.
Example I
As outlined above, mRNA from human pancreas was used to generate
ditags. Briefly, five ug mRNA from total pancreas (Clontech) was
converted to double stranded cDNA using a BRL cDNA synthesis kit
following the manufacturer's protocol, using the primer
biotin-5'T.sub.18 -3'. The cDNA was then cleaved with NlaIII and
the 3' restriction fragments isolated by binding to magnetic
streptavidin beads (Dynal). The bound DNA was divided into two
pools, and one of the following linkers ligated to each pool:
5'-TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG-3'
3'-ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT-5' (SEQ ID NO:1 and 2)
5'-TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG-3'
3'-AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT-5'(SEQ ID NO:3 and 4),
where A is a dideoxy nucleotide (e.g., dideoxy A).
After extensive washing to remove unligated linkers, the linkers
and adjacent tags were released by cleavage with BsmFI. The
resulting overhangs were filled in with T4 polymerase and the pools
combined and ligated to each other. The desired ligation product
was then amplified for 25 cycles using 5'-CCAGCTTATTCAATTCGGTCC-3'
and 5'-GTAGACATTCTAGTATCTCGT-3' (SEQ ID NO:5 and 6, respectively)
as primers. The PCR reaction was then analyzed by polyacrylamide
gel electrophoresis and the desired product excised. An additional
15 cycles of PCR were then performed to generate sufficient product
for efficient ligation and cloning.
The PCR ditag products were cleaved with NlaIII and the band
containing the ditags was excised and self-ligated. After ligation,
the concatenated ditags were separated by polyacrylamide gel
electrophoresis and products greater than 200 bp were excised.
These products were cloned into the SphI site of pSL301
(Invitrogen). Colonies were screened for inserts by PCR using T7
and T3 sequences outside the cloning site as primers. Clones
containing at least 10 tags (range 10 to 50 tags) were identified
by PCR amplification and manually sequenced as described (Del Sal,
et al. , Biotechniques 7:514, 1989) using
5'-GACGTCGACCTGAGGTAATTATAACC-3' (SEQ ID NO:7) as primer. Sequence
files were analyzed using the SAGE software group which identifies
the anchoring enzyme site with the proper spacing and extracts the
two intervening tags and records them in a database. The 1,000 tags
were derived from 413 unique ditags and 87 repeated ditags. The
latter were only counted once to eliminate potential PCR bias of
the quantitation. The function of SAGE software is merely to
optimize the search for gene sequences.
Table 1 shows analysis of the first 1,000 tags. Sixteen percent
were eliminated because they either had sequence ambiguities or
were derived from linker sequences. The remaining 840 tags included
351 tags that occurred once and 77 tags that were found multiple
times. Nine of the ten most abundant tags matched at least one
entry in GenBank R87. The remaining tag was subsequently shown to
be derived from amylase. All ten transcripts were derived from
genes of known pancreatic function and their prevalence was
consistent with previous analyses of pancreatic RNA using
conventional approaches (Han, et al., Proc. Natl. Acad. Sci. U.S.A.
83:110, 1986; Takeda, et al., Hum. Mol. Gen., 2:1793, 1993).
TABLE 1 ______________________________________ Pancreatic SAGE Tags
TAG Gene N Percent ______________________________________ GAGCACACC
Procarboxypeptidase A1 (X67318) 64 7.6 TTCTGTGTG Pancreatic
Trypsinogen 2 (M27602) 46 5.5 GAACACAAA Chymotrypsinogen (M24400)
37 4.4 TCAGGGTGA Pancreatic Trypsin 1 (M22612) 31 3.7 GCGTGACCA
Elastase 111B (M18692) 20 2.4 GTGTGTGCT Protease E (D00306) 16 1.9
TCATTGGCC Pancreatic Lipase (M93285) 16 1.9 CCAGAGAGT
Procarboxypeptidase B (M81057) 14 1.7 TCCTCAAAA No Match, See Table
2, P1 14 1.7 AGCCTTGGT Bile Salt Stimulated Lipase (X54457) 12 1.4
GTGTGCGCT No Match 11 1.3 TGCGAGACC No Match, See Table 2, P2 9 1.1
GTGAAACCC 21 Alu entries 8 1.0 GGTGACTCT No Match 8 1.0 AAGGTAACA
Secretary Trypsin Inhibitor (M11949) 6 0.7 TCCCCTGTG No Match 5 0.6
GTGACCACG No Match 5 0.6 CCTGTAATC M91159, M29366,11 Alu entries 5
0.6 CACGTTGGA No Match 5 0.6 AGCCCTACA No Match 5 0.6 AGCACCTCC
Elongation Factor 2 (Z11692) 5 0.6 ACGCAGGGA No Match, See Table 2,
P3 5 0.6 AATTGAAGA No Match, See Table 2, P4 5 0.6 TTCTGTGGG No
Match 4 0.5 TTCATACAC No Match 4 0.5 GTGGCAGGC NF-kB(X61499), Mu
entry (S94541) 4 0.5 GTAAAACCC TNF receptor 11 (M55994), Alu entry
(X01448) 4 0.5 GAACACACA No Match 4 0.5 CCTGGGAAG Pancreatic Mucin
(J05582) 4 0.5 CCCATCGTC Mitochondrial CytC Oxidase (X15759) 4 0.5
(SEQ ID NO:8-37) ______________________________________ Summary
______________________________________ SAGE tags Greater than three
times 380 45.2 Occurring Three times (15 .times. 3=) 45 5.4 Two
times (32 .times. 2=) 64 7.6 One time 351 41.8 Total SAGE Tags 840
100.0 ______________________________________
"Tag" indicates the 9 bp sequence unique to each tag, adjacent to
the 4 bp anchoring NlaIII site. "N" and "Percent" indicates the
number of times the tag was identified and its frequency,
respectively. "Gene" indicates the accession number and description
of GenBank R87 entries found to match the indicated tag using the
SAGE software group with the following exceptions. When multiple
entries were identified because of duplicated entries, only one
entry is listed. In the cases of chymotrypsinogen, and trypsinogen
1, other genes were identified that were predicted to contain the
same tags, but subsequent hybridization and sequence analysis
identified the listed genes as the source of the tags. "Alu entry"
indicates a match with a GenBank entry for a transcript that
contained at least one copy of the alu consensus sequence
(Deininger, et al., J Mol. Biol., 151:17, 1981).
Example 2
The quantitative nature of SAGE was evaluated by construction of an
oligo-dT primed pancreatic cDNA library which was screened with
cDNA probes for trypsinogen 1/2, procarboxpeptidase A1,
chymotrypsinogen and elastase I-IIB/protease E. Pancreatic mRNA
from the same preparation as used for SAGE in Example 1 was used to
construct a cDNA library in the ZAP Express vector using the ZAP
Express cDNA Synthesis kit following the manufacturer's protocol
(Stratagene). Analysis of 15 randomly selected clones indicated
that 100% contained cDNA inserts. Plates containing 250 to 500
plaques were hybridized as previously described (Ruppert, et al.,
Mol. Cell. Biol. 8:3104, 1988). cDNA probes for trypsinogen 1,
trypsinogen 2, procarboxypeptidase A1, chymotrypsinogen, and
elastase IIIB were derived by RT-PCR from pancreas RNA. The
trypsinogen 1 and 2 probes were 93% identical and hybridized to the
same plaques under the conditions used. Likewise, the elastase IIIB
probe and protease E probe were over 95% identical and hybridized
to the same plaques.
The relative abundance of the SAGE tags for these transcripts was
in excellent agreement with the results obtained with library
screening (FIG. 2). Furthermore, whereas neither trypsinogen 1 and
2 nor elastase IIIB and protease E could be distinguished by the
cDNA probes used to screen the library, all four transcripts could
readily be distinguished on the basis of their SAGE tags (Table
1).
Example 3
In addition to providing quantitative information on the abundance
of known transcripts, SAGE could be used to identify novel
expressed genes. While for the purposes of the SAGE analysis in
this example, only the 9 bp sequence unique to each transcript was
considered, each SAGE tag defined a 13 bp sequence composed of the
anchoring enzyme (4 bp) site plus the 9 bp tag. To illustrate this
potential, 13 bp oligonucleotides were used to isolate the
transcripts corresponding to four unassigned tags (P1 to P4), that
is, tags without corresponding entries from GenBank R87 (Table 1).
In each of the four cases, it was possible to isolate multiple cDNA
clones for the tag by simply screening the pancreatic cDNA library
using 13 bp oligonucleotide as hybridization probe (examples in
FIG. 3).
Plates containing 250 to 2,000 plaques were hybridized to
oligonucleotide probes using the same conditions previously
described for standard probes except that the hybridization
temperature was reduced to room temperature. Washes were performed
in 6.times.SSC/0.1% SDS for 30 minutes at room temperature. The
probes consisted of 13 bp oligonucleotides which were labeled with
.gamma..sup.32 P-ATP using T4 polynucleotide kinase. In each case,
sequencing of the derived clones identified the correct SAGE tag at
the predicted 3' end of the identified transcript. The abundance of
plaques identified by hybridization with the 13-mers was in good
agreement with that predicted by SAGE (Table 2). Tags P1 and P2
were found to correspond to amylase and preprocarboxypeptidase A2,
respectively. No entry for preprocarboxypeptidase A2 and only a
truncated entry for amylase was present in GenBank R87, thus
accounting for their unassigned characterization. Tag P3 did not
match any genes of known function in GenBank but did match numerous
EST's, providing further evidence that it represented a bona fide
transcript. The cDNA identified by P4 showed no significant
homology, suggesting that it represented a previously
uncharacterized pancreatic transcript.
TABLE 2
__________________________________________________________________________
Characterization of Unassigned SAGE Tags Abundance SAGE TAG SAGE
13mer Hyb Tag Description
__________________________________________________________________________
P1 TCCTCAAAA 1.7% 1.5% (6/388) + 3' end of Pancreatic Amylase
(M28443) (SEQ ID NO:38) P2 TGCGAGACC 1.1% 1.2% + 3' end of
Preprocarboxypeptidase A2 (SEQ ID NO:39) (43/3700) (U19977) P3
ACGCAGGGA 0.6% 0.2% + EST match (R45808) (SEQ ID NO:40) (5/2772) P4
AATTGAAGA 0.6% 0.4% + no match (SEQ ID NO:41) (6/1587)
__________________________________________________________________________
"Tag" and "SAGE Abundance" are described in Table 1; "13mer Hyb"
indicates the results obtained by screening a cDNA library with a
13mer, as described above. The number of positive plaques divided
by the total plaques screened is indicated in parentheses following
the percent abundance. A positive in the "SAGE Tag" column
indicates that the expected SAGE tag sequence was identified near
the 3' end of isolated clones. "Description" indicates the results
of BLAST searches of the daily updated GenBank entries at NCBI a of
Jun. 9, 1995 (Altschul, et al., J Mol. Biol., 215:403, 1990). A
description and Accession number are given for the most significant
matches. P1 was found to match a truncated entry for amylase, and
P2 was found to match an unpublished entry for
preprocarboxypeptidase A2 which was entered after GenBank R87.
Example 4
Ditags produced by SAGE can be analyzed by PSA or CS, as described
in the specification. In a preferred embodiment of PSA, the
following steps are carried out with ditags:
Ditags are prepared, amplified and cleaved with the anchoring
enzyme as described in the previous examples.
OOOOOOOOOOXXXXXXXXXXCATG-3' 3'-GTACOOOOOOOOOOXXXXXXXXXX
Four-base oligomers containing an identifier (e.g., a fluorescent
moiety, FL) are prepared that are complementary to the overhangs,
for example, FL-CATG. The FL-CATG oligomers (in excess) are ligated
to the ditags as shown below:
5'-FL-CATGOOOOOOOOOOXXXXXXXXXXCATG
GTACOOOOOOOOOOXXXXXXXXXXGTAC-FL-5'
The ditags are then purified and melted to yield single-stranded
DNAs having the formula:
5'-FL-CATGOOOOOOOOOOOXXXXXXXXXCATG and
GTACOOOOOOOOOOXXXXXXXXXXGTAC-FL-5', for example. The mixture of
single-stranded DNAs is preferably serially diluted. Each serial
dilution is hybridized under appropriate stringency conditions with
solid matrices containing gridded single-stranded oligonucleotides;
all of the oligonucleotides contain a half-site of the anchoring
enzyme cleavage sequence. In the example used herein, the
oligonucleotide sequences contain a CATG sequence at the 5'
end:
CATGOOOOOOOOOO, CATGXXXXXXXXXX, etc.
(or alternatively a CATG sequence at the 3' end: OOOOOOOOOCATG)
The matrices can be constructed of any material known in the art
and the oligonucleotide-bearing chips can be generated by any
procedure known in the art, e.g. silicon chips containing
oligonucleotides prepared by the VLSIP procedure (Fodor et al.,
supra).
The oligonucleotide-bearing matrices are evaluated for the presence
or absence of a fluorescent ditag at each position in the grid.
In a preferred embodiment, there are 4.sup.10, or 1,048,576,
oligonucleotides on the grid(s) of the general sequence
CATGOOOOOOOOOO, such that every possible 10-base sequence is
represented 3' to the CATG, where CATG is used as an example of an
anchoring enzyme half site that is complementary to the anchoring
enzyme half site at the 3' end of the ditag. Since there are
estimated to be no more than 100,000 to 200,000 different expressed
genes in the human genome, there are enough oligonucleotide
sequences to detect all of the possible sequences adjacent to the
3'-most anchoring enzyme site observed in the cDNAs from the
expressed genes in the human genome.
In yet another embodiment, structures as described above containing
the sequences PRIMER A- GGAGCATG (X).sub.10 (O).sub.10 CATGCATCC-
PRIMER B PRIMER A- CCTCGTAC (X).sub.10 (O).sub.10 GTACGTAGG- PRIMER
B are amplified, cleaved with tagging enzyme and thereafter with
anchoring enzyme to generate tag complements of the structure:
(O).sub.10 CATG-3', which can then be labeled, melted, and
hybridized with oligonucleotides on a solid support.
A determination is made of differential expression by comparing the
fluorescence profile on the grids at different dilutions among
different libraries (representing differential screening probes).
For example:
______________________________________ Library A, Ditags Diluted
1:10 Library B, Ditags Diluted 1:10 A B C D E A B C D E 1 FL 1 FL 2
FL 2 FL FL 3 FL FL 3 FL FL 4 FL 4 5 FL 5 FL FL
______________________________________ Library A, Ditags Diluted
1:50 Library A, Ditags Diluted 1:100 A B C D E A B C D E 1 FL 1 FL
2 2 3 FL 3 FL 4 FL 4 FL 5 FL 5 FL
______________________________________ Library B, Ditags Diluted
1:50 Library B, Ditags Diluted 1:100 A B C D E A B C D E 1 FL 1 FL
2 FL 2 FL 3 FL FL 3 FL 4 4 5 5
______________________________________
The individual oligonucleotides thus hybridize to ditags with the
following characteristics:
TABLE 3 ______________________________________ 1:10 1:50 1:100
Dilution Lib A Lib B Lib A Lib B Lib A Lib B
______________________________________ 1A + + + + + + 2C + + + 2E +
+ 3B + + + + + + 3C + + + 4D + + + 5A + + + + 5E +
______________________________________
Table 3 summarizes the results of the differential hybridization.
Tags hybridizing to 1A and 3B reflect highly abundant nRNAs that
are not differentially expressed (since the tags hybridize to both
libraries at all dilutions); tag 2C identifies a highly abundant
mRNA, but only in Library B. 2E reflects a low abundance transcript
(since it is only detected at the lowest dilution) that is not
found to be differentially expressed; 3C reflects a moderately
abundant transcript (since it is expressed at the lower two
dilutions) in Library B that is expressed at low abundance in
Library A. 4D reflects a differentially-expressed, high abundance
transcript restricted to Library A; 5A reflects a transcript that
is expressed at high abundance in Library A but only at low
abundance in Library B; and 5E reflects a differentially-expressed
transcript that is detectable only in Library B.
In another PSA embodiment, step 3 above does not involve the use of
a fluorescent or other identifier; instead, at the last round of
amplification of the ditags, labeled dNTPs are used so that after
melting, half of all molecules are labeled and can serve as probes
for hybridization to oligonucleotides fixed on the chips.
In yet another PSA embodiment, instead of ditags, a particular
portion of the transcript is used, e.g., the sequence between the
3' terminus of the transcript and the first anchoring enzyme site.
In that particular case, a double-stranded cDNA reverse transcript
is generated as described in the Detailed Description. The
transcripts are cut with the anchoring enzyme, a linker is added
containing a PCR primer and amplification is initiated (using the
primer at one end and the poly A tail at the other) while the
transcripts are still on the strepavidin bead. At the last round of
amplification, fluoresceinated dNTPs are used so that half of the
molecules are labeled. The linker-primer can be optionally removed
by use of the anchoring enzyme at this point in order to reduce the
size of the fragments. The soluble fragments are then melted and
captured on solid matrices containing CATGOOOOOOOOOO, as in the
previous example. Analysis and scoring (only of the half of the
fragments which contain fluoresceinated bases) is as described
above.
For use in clonal sequencing, ditags or concatemers would be
diluted and added to wells of multiwell plates, for example, or
other receptacles so that on average the wells would contain,
statistically, less than one DNA molecule per well (as is done in
limited dilution for cell cloning). Each well would then receive
reagents for PCR or another amplification process and the DNA in
each receptacle would be sequenced, e.g., by mass spectroscopy. The
results will either be a single sequence (there having been a
single sequence in that receptacle), a "null" sequence (no DNA
present) or a double sequence (more than one DNA molecule), which
would be eliminated from consideration during data analysis.
Thereafter, assessment of differential expression would be the same
as described herein.
These results demonstrate that SAGE provides both quantitative and
qualitative data about gene expression. The use of different
anchoring enzymes and/or tagging enzymes with various recognition
elements lends great flexibility to this strategy. In particular,
since different anchoring enzymes cleave cDNA at different sites,
the use of at least 2 different Aes on different samples of the
same cDNA preparation allows confirmation of results and analysis
of sequences that might not contain a recognition site for one of
the enzymes.
As efforts to fully characterize the genome near completion, SAGE
should allow a direct readout of expression in any given cell type
or tissue. In the interim, a major application of SAGE will be the
comparison of gene expression patterns in among tissues and in
various developmental and disease states in a given cell or tissue.
One of skill in the art with the capability to perform PCR and
manual sequencing could perform SAGE for this purpose. Adaptation
of this technique to an automated sequencer would allow the
analysis of over 1,000 transcripts in a single 3 hour run. An ABI
377 sequencer can produce a 451 bp readout for 36 templates in a 3
hour run (45 lbp/11 bp per tag.times.36=1476 tags). The appropriate
number of tags to be determined will depend on the application. For
example, the definition of genes expressed at relatively high
levels (0.5% or more) in one tissue, but low in another, would
require only a single day. Determination of transcripts expressed
at greater than 100 mRNA's per cell (0.025% or more) should be
quantifiable within a few months by a single investigator. Use of
two different Anchoring Enzymes will ensure that virtually all
transcripts of the desired abundance will be identified. The genes
encoding those tags found to be most interesting on the basis of
their differential representation can be positively identified by a
combination of data-base searching, hybridization, and sequence
analysis as demonstrated in Table 2. Obviously, SAGE could also be
applied to the analysis of organisms other than humans, and could
direct investigation towards genes expressed in specific biologic
states.
SAGE, as described herein, allows comparison of expression of
numerous genes among tissues or among different states of
development of the same tissue, or between pathologic tissue and
its normal counterpart. Such analysis is useful for identifying
therapeutically, diagnostically and prognostically relevant genes,
for example. Among the many utilities for SAGE technology, is the
identification of appropriate antisense or triple helix reagents
which may be therapeutically useful. Further, gene therapy
candidates can also be identified by the SAGE technology. Other
uses include diagnostic applications for identification of
individual genes or groups of genes whose expression is shown to
correlate to predisposition to disease, the presence of disease,
and prognosis of disease, for example. An abundance profile, such
as that depicted in Table 1, is useful for the above described
applications. SAGE is also useful for detection of an organism
(e.g., a pathogen) in a host or detection of infection-specific
genes expressed by a pathogen in a host.
The ability to identify a large number of expressed genes in a
short period of time, as described by SAGE in the present
invention, provides unlimited uses.
Although the invention has been described with reference to the
presently preferred embodiment, it should be understood that
various modifications can be made without departing from the spirit
of the invention. Accordingly, the invention is limited only by the
following claims.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 7 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 43 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA
(genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TTTTACCAGCTTATTCAATTCGGTCCTCTCGCACAGGGACATG43 (2) INFORMATION FOR
SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY:
both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:2: ATGGTCGAATAAGTTAAGCCAGGAGAGCGTGTCCCT36 (2) INFORMATION
FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 44 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY:
both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:3: TTTTTGTAGACATTCTAGTATCTCGTCAAGTCGGAAGGGACATG44 (2)
INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both
(D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:4: AACATCTGTAAGATCATAGAGCAGTTCAGCCTTCCCT37
(2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both
(D) TOPOLOGY: both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:5: CCAGCTTATTCAATTCGGTCC21 (2) INFORMATION
FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY:
both (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:6: GTAGACATTCTAGTATCTCGT21 (2) INFORMATION FOR SEQ ID
NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:7: GACGTCGACCTGAGGTAATTATAACC26
__________________________________________________________________________
* * * * *