U.S. patent number 5,854,416 [Application Number 08/715,131] was granted by the patent office on 1998-12-29 for streptococcus pneumoniae 37-kda surface adhesin a protein and nucleic acids coding therefor.
This patent grant is currently assigned to The United States of America as represented by the Department of Health and Human Services. Invention is credited to Edwin W. Ades, George M. Carlone, Harold Russell, Jacquelyn S. Sampson, Jean A. Tharpe.
United States Patent |
5,854,416 |
Sampson , et al. |
December 29, 1998 |
Streptococcus pneumoniae 37-KDA surface adhesin a protein and
nucleic acids coding therefor
Abstract
The invention provides a nucleic acid encoding the 37-kDa
protein from Streptococcus pneumoniae. Also provided are isolated
nucleic acids comprising a unique fragment of at least 10
nucleotides of the 37-kDa protein. The invention also provides
purified polypeptides encoded by the nucleic acid encoding the
37-kDa protein from and the nucleic acids comprising a unique
fragment of at least 10 nucleotides of the 37-kDa protein. Also
provided are antibodies which selectively binds the polypeptides
encoded by the nucleic acid encoding the 37-kDa protein and the
nucleic acids comprising a unique fragment of at least 10
nucleotides of the 37-kDa protein. Also provided are vaccines
comprising immunogenic polypeptides encoded by the nucleic acid
encoding the 37-kDa protein and the nucleic acids comprising a
unique fragment of at least 10 nucleotides of the 37-kDa protein.
Further provided is a method of detecting the presence of
Streptococcus pneumoniae in a sample comprising the steps of
contacting a sample suspected of containing Streptococcus
pneumoniae with nucleic acid primers capable of hybridizing to a
nucleic acid comprising a portion of the nucleic acid encoding the
37-kDa protein, amplifying the nucleic acid and detecting the
presence of an amplification product, the presence of the
amplification product indicating the presence of Streptococcus
pneumoniae in the sample. Further provided are methods of detecting
the presence of Streptococcus pneumoniae in a sample using
antibodies or antigens, methods of preventing and treating
Streptococcus pneumoniae infection in a subject.
Inventors: |
Sampson; Jacquelyn S. (College
Park, GA), Russell; Harold (Atlanta, GA), Tharpe; Jean
A. (Lithonia, GA), Ades; Edwin W. (Atlanta, GA),
Carlone; George M. (Stone Mountain, GA) |
Assignee: |
The United States of America as
represented by the Department of Health and Human Services
(Washington, DC)
|
Family
ID: |
27397058 |
Appl.
No.: |
08/715,131 |
Filed: |
September 17, 1996 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
222179 |
Apr 4, 1994 |
|
|
|
|
791377 |
Sep 17, 1991 |
5422427 |
|
|
|
Current U.S.
Class: |
536/23.7;
536/23.1; 424/244.1; 435/320.1 |
Current CPC
Class: |
A61P
31/04 (20180101); C07K 16/1275 (20130101); C07K
14/3156 (20130101); A61K 39/00 (20130101) |
Current International
Class: |
C07K
16/12 (20060101); C07K 14/195 (20060101); C07K
14/315 (20060101); C07H 021/04 () |
Field of
Search: |
;536/23.7,23.1
;435/320.1 ;424/244.1 |
References Cited
[Referenced By]
U.S. Patent Documents
|
|
|
4762713 |
August 1988 |
Anderson et al. |
4894362 |
January 1990 |
Yamaguchi et al. |
5037760 |
August 1991 |
Smith et al. |
5130417 |
July 1992 |
Stanley, Jr., et al. |
5422427 |
June 1995 |
Russell et al. |
|
Foreign Patent Documents
|
|
|
|
|
|
|
EP 0 206 852 A1 |
|
Dec 1986 |
|
EP |
|
EP 0 429 816 A1 |
|
Jun 1991 |
|
EP |
|
Other References
Berry et al. Infection and Immunity 64:5255-5262, submitted to
database 11/95; 1996. .
Attached database sheet. .
Sampson et al. Infection and Immunity 62:319-324; 1994. .
Fenno et al. Infection and Immunity 57:3527-3533; 1989. .
Ganeshkumar et al. "Nucleotide Sequence of a Gene Coding for a
Saliva-Binding Protein (SsaB) from Streptococcus sanguis 12 and
Possible Role of the Protein in Coaggregation with Actinomyces",
Inspection and Immunity. vol. 59, No. 3, 1093-1099, Mar., 1991.
.
Sampson et al. Abstracts of the Annual Meeting of the American
Society for Microbiology 91:97, 1991. .
Harold Russell et al. "Monoclonal Antibody Recognizing a
Species-Specific Protein from Streptococcus pneumoniae", J. Clin.
Microbiol. 28:2191-2195, Oct. 1990. .
Russell et al. Abstracts of the Annual Meeting of the American
Society for Microbiology 90:436, 1990. .
Fenno et al. "Nucleotide Sequence Analysis of a Type 1 Fimbrial
Gene of Streprocpccus sanguis FW214" Infec & Immun.
57(11):3527-3533, Nov. 1989. .
Advertisement offering custom DNA/Peptides; total gene synthesis,
Science. 240:362, 1988. .
Fives-Taylor et al., "Expression of Streptococcus sanguis Antigens
in E. coli: Cloning of a Structural Gene for Adhesion Fimbriae"
Infec. and Immun. 55(1):123-128, Jan 1987. .
Clarke-Lewis et al. Science. 231:134-139, 1986. .
Caruthers "Gene Synthesis Machines:DNA Chemistry and Its Uses"
Science. 230:281-285, Oct. 1985. .
Tharpe et al. Purification and Seroreactivity of Pneumococcal
Surface Adhesin A (PsaA) Clinical and Diagnostic Laboratory
Immunology. 3(2):227-229, Mar 1996. .
Sampson et al. "Cloning and Nucleotide Sequence Analysis of psaA,
The Streptococcus pneumoniae Gene Encoding a 37-kilodalton Protein
Homologous to Previously Reported Streptococcus sp. Adhesinss."
Infect. Immun. 62:319-324, 1994. .
Sampson et al. "Conservation of the 37-kDa Protein Gene among
Streptococcus pneumoniae Sterotypes" Interscience Conference of
Antimicrobial Agents and Chemotherapy (ICAAC), Sept. 17,
1995..
|
Primary Examiner: Housel; James C.
Assistant Examiner: Shaver; Jennifer
Attorney, Agent or Firm: Fitch, Even, Tabin &
Flannery
Parent Case Text
This application is a continuation-in-part of Ser. No. 08/222,179,
filed Apr. 4, 1994 now abandoned, which is a continuation-in-part
of Ser. No. 07/791,377, filed Sep. 17, 1991, now U.S. Pat. No.
5,422,427, both of which are hereby incorporated by reference in
their entirety.
Claims
What is claimed is:
1. An isolated nucleic acid whose nucleotide sequence encodes a
protein of Streptococcus pneumoniae, the protein being the 37-kDa
surface adhesin A protein whose amino acid sequence is set forth in
SEQ ID NO:2.
2. The isolated nucleic acid of claim 1, wherein the nucleic acid
is the nucleic acid set forth in SEQ ID NO:1.
3. An isolated nucleic acid comprising at least 50 contiguous
necleotides of the nucleic acid set forth in SEQ ID NO:1.
4. An isolated nucleic acid comprising the nucleic acid set forth
in SEQ ID NO:3.
5. An isolated nucleic acid comprising the nucleic acid set forth
in SEQ ID NO:4.
6. The isolated nucleic acid of claim 1 in a vector appropriate for
expressing the nucleic acid.
7. The vector of claim 6 in a host cell appropriate for expressing
the nucleic acid.
8. The isolated nucleic acid of claim 3 in a vector appropriate for
expressing the nucleic acid.
9. The vector of claim 8 in a host cell appropriate for expressing
the nucleic acid.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to the 37-kDa Streptococcus pneumoniae
surface adhesin A protein. Specifically, the invention relates to
an isolated nucleic acid encoding the 37-kDa protein of
Streptococcus pneumoniae, to unique fragments of the nucleic acid
encoding the 37-kDa protein of Streptococcus pneumoniae, and to the
polypeptides encoded by those nucleic acids. The invention further
relates to antibodies to those polypeptides, and to methods of
detecting the presence of Streptococcus pneumoniae, methods of
preventing Streptococcus pneumoniae infection, and methods of
treating a Streptococcus pneumoniae infection.
2. Background Art
Pneumococcal disease continues to be a leading cause of sickness
and death in the United States and throughout the world. Both the
lack of efficacy of the currently used polysaccharide vaccines in
children under 2 years of age and their variable serotype-specific
efficacy among vaccinated individuals, have prompted manufacturers
to investigate alternative vaccine formulations that do not require
the use of multiple capsular polysaccharides. One current approach
under consideration is the use of immunogenic species-common
proteins as vaccine candidates. These proteins could be used in
combination with other immunogenic proteins or as protein carriers
in a protein-polysaccharide or oligosaccharide conjugate vaccine.
An effective vaccine that included a common protein could eliminate
the need for formulations based on multiple capsular
polysaccharides (as in the 23-valent polysaccharide vaccine) by
offering a broader range of protection against a greater number of
serotypes. Additionally, a protein-based vaccine would be T-cell
dependent and provide a memory response, resulting in a more
efficacious vaccine.
Of the reported pneumococcal proteins, only pneumolysin and the
pneumococcal surface protein A (PspA) have been extensively
examined for their suitability as vaccine candidates. While both
have been shown to be partially protective in mice (Paton et al.
1983. "Effect of immunization with pneumolysin on survival time of
mice challenged with Streptococcus pneumoniae." Infect. Immun.
40:548-552 and McDaniel et al. 1991. "PspA, a surface protein of
Streptococcus pneumoniae, is capable of eliciting protection
against pneumococci of more than one capsular type." Infect. Immun.
59:222-228), there are disadvantages to their use as vaccine
immunogens. Pneumolysin, although well conserved among pneumococci,
has been shown to have strong toxic effects in its native state
(AlonsoDeVelasco et al. 1995. "Streptococcus pneumoniae: Virulence
factors, pathogenesis, and vaccines." Microbiol. Rev. 59:591-603).
Recombinant derivatives of reduced toxicity have been produced, and
while they show promise in animal protection studies (Alexander et
al. 1994. "Immunization of mice with pneumolysin toxoid confers a
significant degree of protection against at least nine serotypes of
Streptococcus pneumoniae. Infect. Immun. 62:5683-5688) the problem
of maintaining maximal immunogenicity and eliminating toxicity to
humans is still in question. PspA, on the other hand, is
serologically and structurally heterogeneous. (Crain et al. 1990.
"Pneumococcal surface protein A (PspA) is serologically highly
variable and is expressed by all clinically important capsular
serotypes of Streptococcus pneumoniae." Infect. Immun.
58:3293-3299). Its use in vaccine formulations would require
multiple PspA types, thus increasing the complexity of vaccine
preparation.
An immunogenic species-common protein has been identified from
Streptococcus pneumoniae. (Russell et al. 1990. "Monoclonal
antibody recognizing a species-specific protein from Streptococcus
pneumoniae." J. Clin. Microbiol. 28:2191-2195 and U.S. Pat. No.
5,422,427 in which the 37-kDa protein is referred to as
pneumococcal fimbrial protein A). The 37-kDa S. pneumoniae protein
has been the focus of several studies and has been designated
pneumococcal surface adhesin protein A (PsaA). Immunoblot analysis
studies using anti-PsaA monoclonal antibody showed that PsaA is
common to all 23 pneumococcal vaccine serotypes (Russell et al.
1990). Enzyme-linked-immunosorbent assay studies have indicated
that patients with pneumococcal disease show an antibody increase
in convalescent-phase serum to PsaA compared with acute-phase serum
antibody levels (Tharpe et al. 1995. "Purification and
seroreactivity of pneumococcal surface adhesin A (PsaA)." Clin.
Diagn. Lab. Immunol. 3:227-229 and Tharpe et al. 1994. "The utility
of a recombinant protein in an enzyme immunoassay for antibodies
against Streptococcus pneumoniae." abstr. V-2, p. 617. 1994.
American Society for Microbiology, Washington, D.C.). Additionally,
a limited in vivo protection study showed that antibodies to the
37-kDa protein protect mice from lethal challenge (Talkington et
al. 1996. "Protection of mice against fatal pneumococcal challenge
by immunization with pneumococcal surface adhesin A (PsaA)."
Microbial Pathogenesis 21:17-22).
The gene encoding PsaA from S. pneumoniae strain R36A (an
unencapsulated strain) has been cloned in Escherichia coli and
sequenced, but this serotype does not contain a 37 kDa protein
encoding nucleic acid that is highly conserved among the various
serotypes. (Sampson et al. 1994. "Cloning and nucleotide sequence
analysis of psaA, the Streptococcus pneumoniae gene encoding a
37-kilodalton protein homologous to previously reported
Streptococcus sp. adhesins." Infect. Immun. 62:319-324). This
particular nucleic acid and polypeptide, therefore, are of limited
value for use as diagnostic reagents, in infection prevention, in
infection treatment, or in vaccine development.
Sequence conservation is a necessary requirement for a candidate
species-common vaccine. At present, there are no studies that have
investigated the sequence conservation of the psaA gene among
pneumococcal types, specifically among encapsulated pneumococci
which cause the vast majority of serious disease. Therefore, a need
exists to investigate the conservation of the gene in order to
provide a polypeptide which can serve as a vaccine for multiple
strains of Streptococcus pneumoniae. The present invention fulfills
that need by analyzing psaA genes from the 23 serotypes in the
23-valent polysaccharide vaccine and by providing a polypeptide and
antibodies to that polypeptide which are conserved among the S.
pnuemoniae serotypes and which confer protection to Streptococcus
pneumoniae infection.
SUMMARY OF THE INVENTION
In accordance with the purpose(s) of this invention, as embodied
and broadly described herein, this invention, in one aspect,
relates to an isolated nucleic acid encoding the 37-kDa protein of
Streptococcus pneumoniae as set forth in the Sequence Listing as
SEQ ID NO:2. The invention also provides unique fragments of at
least 10 nucleotides of the nucleic acid set forth in the Sequence
Listing as SEQ ID NO:1, which can be used in methods to detect the
presence of Streptococcus pneumoniae in a sample and as immunogenic
vaccines.
The invention further provides a purified polypeptide encoded by
the nucleic acid encoding the 37-kDa protein of Streptococcus
pneumoniae as set forth in the Sequence Listing as SEQ ID NO:1,
which can be used as immunogenic vaccines.
In another aspect, the invention provides purified antibodies which
bind to the 37-kDa protein of Streptococcus pneumoniae or fragments
thereof. These antibodies can be used in methods to detect the
presence of Streptococcus pneumoniae in a sample and in therapeutic
and prophylactic methods.
The advantages of the invention will be realized and attained by
means of the elements and combinations particularly pointed out in
the appended claims. It is to be understood that both the foregoing
general description and the following detailed description are
exemplary and explanatory only and are not restrictive of the
invention, as claimed.
Throughout this application, various publications are referenced.
The disclosures of these publications in their entireties are
hereby incorporated by reference into this application in order to
more fully describe the state of the art to which this application
pertains.
DETAILED DESCRIPTION OF THE INVENTION
The present invention may be understood more readily by reference
to the following detailed description of the preferred embodiments
of the invention and the Examples included therein.
Before the present compounds and methods are disclosed and
described, it is to be understood that this invention is not
limited to specific proteins, specific methods, or specific nucleic
acids, as such may, of course, vary. It is also to be understood
that the terminology used herein is for the purpose of describing
particular embodiments only and is not intended to be limiting.
It must be noted that, as used in the specification and the
appended claims, the singular forms "a," "an," and "the" include
plural referents unless the context clearly dictates otherwise.
Thus, for example, reference to "a nucleic acid" includes multiple
copies of the nucleic acid and can also include more than one
particular species of nucleic acid molecule.
Nucleic Acids
In one aspect, the invention provides an isolated nucleic acid
encoding the 37-kDa protein of Streptococcus pneumoniae as set
forth in the Sequence Listing as SEQ ID NO:2. The term "isolated"
refers to a nucleic acid which is essentially separated from other
genes that naturally occur in S. pneumoniae. In one embodiment, the
present invention provides an isolated nucleic acid encoding the
37-kDa protein of Streptococcus pneumoniae wherein the nucleic acid
is the nucleic acid set forth in the Sequence Listing as SEQ ID
NO:1.
The nucleic acids of the present invention can include the positive
and/or negative RNA strand as well as the sense and/or nonsense DNA
strand, or any combinations thereof. These nucleic acids include
the genomic DNA fragment encoding the 37-kDa protein and any
subgenomic nucleic acids, including DNA and RNA, in the organism
encoding all, or a fragment of the 37-kDa protein. The nucleic acid
can also be modified, such as nucleic acids containing methylated
bases.
This nucleic acid can comprise the coding sequence for the 37-kDa
protein itself, or the coding sequence with the gene's upstream and
downstream regulatory sequences, or any combination thereof This
nucleic acid can, for example, comprise a DNA and include its own
promoter, or another promoter can be operatively linked to the
nucleic acid such that the coding sequence of the 37-kDa protein is
expressed. Alternatively, the nucleic acid can comprise an RNA such
that the RNA is translated and the resulting polypeptide comprises
the 37-kDa protein. Therefore sequences normally found associated
with the 37-kDa protein coding sequence, such as the promoter, and
the translation signals, can be substituted, deleted, or
modified.
An isolated nucleic acid comprising a unique fragment of at least
10 nucleotides of the nucleic acid set forth in the Sequence
Listing as SEQ ID NO:1 is also provided. Unique fragments, as used
herein means a nucleic acid of at least 10 nucleotides that is not
identical to any other known nucleic acid sequence. Examples of the
sequences of at least 10 nucleotides that are unique to the nucleic
acid set forth in the Sequence Listing as SEQ ID NO:1 can be
readily ascertained by comparing the sequence of the nucleic acid
in question to sequences catalogued in GenBank, or any other
sequence database, using computer programs such as DNASIS (Hitachi
Engineering, Inc.) or Word Search or FASTA of the Genetics Computer
Group (GCG) (Madison, Wis.), which search the catalogued nucleotide
sequences for similarities to the nucleic acid in question. If the
sequence does not match any of the known sequences, it is unique.
For example, the sequence of nucleotides 1-10 can be used to search
the databases for an identical match. If no matches are found, then
nucleotides 1-10 represent a unique fragment. Next, the sequence of
nucleotides 2-11 can be used to search the databases, then the
sequence of nucleotides 3-13, and so on up to nucleotides 1320 to
1330 of the sequence set forth in the Sequence Listing as SEQ ID
NO:1. The same type of search can be performed for sequences of 11
nucleotides, 12 nucleotides, 13 nucleotides, etc. The possible
fragments range from 10 nucleotides in length to 1 nucleotide less
than the sequence set forth in the Sequence Listing as SEQ ID NO:1.
These unique nucleic acids, as well as degenerate nucleic acids can
be used, for example, as primers for amplifying nucleic acids from
other strains of Streptococcus pneumoniae in order to isolate
allelic variants of the 37-kDa protein, or as primers for reverse
transcription of 37-kDa protein RNA, or as probes for use in
detection techniques such as nucleic acid hybridization. One
skilled in the art will appreciate that even though a nucleic acid
of at least 10 nucleotides is unique to a specific gene, that
nucleic acid fragment can still hybridize to many other nucleic
acids and therefore be used in techniques such as amplification and
nucleic acid detection.
Also provided are nucleic acids which encode allelic variants of
the 37-kDa protein of S. pneumoniae set forth in the Sequence
Listing as SEQ ID NO:2, and those proteins. As used herein, the
term "allelic variations" or "allelic variants" is used to describe
the same, or similar 37-kDa pneumococcal surface adhesin proteins
that are diverged from the 37-kDa Streptococcus pneumoniae protein
set forth in the Sequence Listing as SEQ ID NO:2 by less than 15%
in their corresponding amino acid identity. In another embodiment,
these allelic variants are less than 10% divergent in their
corresponding amino acid identity. In another embodiment, these
allelic variants are less than 7% divergent in their corresponding
amino acid identity. In another embodiment, these allelic variants
are less than 5% divergent in their corresponding amino acid
identity. In another embodiment, these allelic variants are less
than 3% divergent in their corresponding amino acid identity. In
another embodiment, these allelic variants are less than 2%
divergent in their corresponding amino acid identity. In yet
another embodiment, these allelic variants are less than 1%
divergent in their corresponding amino acid identity. These amino
acids can be substitutions within the amino acid sequence set forth
in the Sequence Listing as SEQ ID NO:2, they can be deletions from
the amino acid sequence set forth in the Sequence Listing as SEQ ID
NO:2, and they can be additions to the amino acid sequence set
forth in the Sequence Listing as SEQ ID NO:2.
The homology between the protein coding region of the nucleic acid
encoding the allelic variant of the 37-kDa protein is preferably
less than 20% divergent from the region of the nucleic acid set
forth in the Sequence Listing as SEQ ID NO:1 encoding the 37-kDa
protein. In another embodiment, the corresponding nucleic acids are
less than 15% divergent in their sequence identity. In another
embodiment, the corresponding nucleic acids are less than 10%
divergent in their sequence identity. In another embodiment, the
corresponding nucleic acids are less than 7% divergent in their
sequence identity. In another embodiment, the corresponding nucleic
acids are less than 5% divergent in their sequence identity. In
another embodiment, the corresponding nucleic acids are less than
4% divergent in their sequence identity. In another embodiment, the
corresponding nucleic acids are less than 3% divergent in their
sequence identity. In another embodiment, the corresponding nucleic
acids are less than 2% divergent in their sequence identity. In yet
another embodiment, the corresponding nucleic acids are less than
1% divergent in their sequence identity. In particular, the nucleic
acid variations can create up to about 15% amino acid sequence
variation from the protein set forth in the Sequence Listing as SEQ
ID NO:2.
One skilled in the art will appreciate that nucleic acids encoding
homologs or allelic variants of the 37-kDa protein set forth in the
Sequence Listing as SEQ ID NO:2 can be isolated from related
gram-positive bacteria in a manner similar to that used to isolate
the nucleic acid set forth in the Sequence Listing of the present
invention as SEQ ID NO:1. For example, given the sequence of the
primers used to amplify the nucleic acid set forth in the sequence
listing as SEQ ID NO:1, one can use these or similar primers to
amplify a homologous gene from related gram-positive bacteria.
Alternatively, allelic variants can be identified and isolated by
nucleic acid hybridization techniques. Probes selective to the
nucleic acid set forth in the Sequence Listing as SEQ ID NO:1 can
be synthesized and used to probe nucleic acid from the various
serotypes of S. pneumoniae. High sequence complementarity and
stringent hybridization conditions can be selected such that the
probe selectively hybridizes to allelic variants of the sequence
set forth in the Sequence Listing as SEQ ID NO:1. For example, the
selectively hybridizing nucleic acids of the invention can have at
least 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity
with the segment of the sequence to which it hybridizes. The
nucleic acids can be at least 10, 12, 50, 100, 150, 200, 300, 500,
750, or 1000 nucleotides in length. Thus, the nucleic acid can be a
coding sequence for the 37-kDa protein or fragments thereof that
can be used as a probe or primer for detecting the presence of S.
pneumoniae. If used as primers, the invention provides compositions
including at least two nucleic acids which hybridize with different
regions so as to amplify a desired region. Depending on the length
of the probe or primer, target region can range between 70%
complementary bases and full complementarity and still hybridize
under stringent conditions. For example, for the purpose of
diagnosing the presence of an allelic variant of the sequence set
forth in the Sequence Listing as SEQ ID NO:1, the degree of
complementarity between the hybridizing nucleic acid (probe or
primer) and the sequence to which it hybridizes is at least enough
to distinguish hybridization with a nucleic acid from unrelated
bacteria. The invention provides examples of nucleic acids unique
to SEQ ID NO:1 in the Sequence Listing so that the degree of
complementarity required to distinguish selectively hybridizing
from nonselectively hybridizing nucleic acids under stringent
conditions can be clearly determined for each nucleic acid. One
skilled in the art will appreciate that sequences can be added to
either one end or both ends of unique fragments, for example, to
aid subsequent cloning, expression, or detection of the
fragment.
"Stringent conditions" refers to the washing conditions used in a
hybridization protocol. In general, the washing conditions should
be a combination of temperature and salt concentration chosen so
that the denaturation temperature is approximately
5.degree.-20.degree. C. below the calculated T.sub.m of the nucleic
acid hybrid under study. The temperature and salt conditions are
readily determined empirically in preliminary experiments in which
samples of reference DNA immobilized on filters are hybridized to
the probe or protein coding nucleic acid of interest and then
washed under conditions of different stringencies. The T.sub.m of
such an oligonucleotide can be estimated by allowing 2.degree. C.
for each A or T nucleotide, and 4.degree. C. for each G or C. For
example, an 18 nucleotide probe of 50% G+C would, therefore, have
an approximate T.sub.m of 54.degree. C.
In another aspect, the present invention provides an isolated
nucleic acid comprising the nucleic acid as set forth in the
Sequence Listing as SEQ ID NO:3.
In another aspect, the present invention provides an isolated
nucleic acid comprising the nucleic acid as set forth in the
Sequence Listing as SEQ ID NO:4.
The nucleic acid encoding a 37-kDa protein may be obtained by any
number of techniques known to one skilled in the art. One method is
to synthesize a recombinant nucleic acid molecule. For example,
oligonucleotide synthesis procedures are routine in the art and
oligonucleotides coding for a particular protein or regulatory
region are readily obtainable through automated DNA synthesis. A
nucleic acid for one strand of a double-stranded molecule can be
synthesized and hybridized to its complementary strand. One can
design these oligonucleotides such that the resulting
double-stranded molecule has either internal restriction sites or
appropriate 5' or 3' overhangs at the termini for cloning into an
appropriate vector. Double-stranded molecules coding for relatively
large proteins or regulatory regions can be synthesized by first
constructing several different double-stranded molecules that code
for particular regions of the protein or regulatory region,
followed by ligating these DNA molecules together. For example,
Cunningham et al. ("Receptor and Antibody Epitopes in Human Growth
Hormone Identified by Homolog-Scanning Mutagenesis," Science,
243:1330-1336 (1989)), have constructed a synthetic gene encoding
the human growth hormone gene by first constructing overlapping and
complementary synthetic oligonucleotides and ligating these
fragments together. See also, Ferretfi, et al. (Proc. Nat. Acad.
Sci. 82:599-603 (1986)), wherein synthesis of a 1057 base pair
synthetic bovine rhodopsin gene from synthetic oligonucleotides is
disclosed. Once the appropriate DNA molecule is synthesized, this
DNA can be cloned downstream of a promoter. Techniques such as this
are routine in the art and are well documented.
An example of another method of obtaining a nucleic acid encoding a
37-kDa surface adhesin A protein is to isolate that nucleic acid
from the organism in which it is found and clone it in an
appropriate vector. For example, a DNA or cDNA library can be
constructed and screened for the presence of the nucleic acid of
interest. The probe used to screen the library can be designed to
be selective for the 6B serotype protein. Methods of constructing
and screening such libraries are well known in the art and kits for
performing the construction and screening steps are commercially
available (for example, Stratagene Cloning Systems, La Jolla,
Calif.). Once isolated, the nucleic acid can be directly cloned
into an appropriate vector, or if necessary, be modified to
facilitate the subsequent cloning steps. Such modification steps
are routine, an example of which is the addition of oligonucleotide
linkers which contain restriction sites to the termini of the
nucleic acid. General methods are set forth in Sambrook et al.,
"Molecular Cloning, a Laboratory Manual," Cold Spring Harbor
Laboratory Press (1989).
Yet another example of a method of obtaining a Streptococcal 37-kDa
surface adhesin A encoding nucleic acid is to amplify the nucleic
acid from the nucleic acids found within the host organism.
Amplification procedures are well known to those skilled in the
art, for example see Innis et al. "PCR Protocols: A Guide to
Methods and Applications" Academic Press, Inc. 1990. An example of
amplification of a nucleic acid encoding the 37-kDa protein of
Streptococcus pneumoniae serotype 6B is discussed in the Example
contained herein.
37-kDa Protein
The present invention also provides a purified polypeptide as set
forth in the Sequence Listing a SEQ ID NO:2 and a purified
polypeptide encoded by a nucleic acid comprising a unique fragment
of at least 10 nucleotides of SEQ ID NO:1. The protein can be used
as a vaccine component as well as a reagent for identifying host
antibodies raised against Streptococcus pneumoniae during
infection. The purified protein can also be used in methods for
detecting the presence of Streptococcus pneumoniae.
Unique fragments of the 37-kDa protein can be identified in the
same manner as that used to identify unique nucleic acids. For
example, a sequence of 3 amino acids or more, derived from the
sequence of the 37-kDa protein as set forth in the Sequence Listing
as SEQ ID NO:2 can be used to search the protein sequence
databases. Those that do not match a known sequence are therefore
unique.
"Purified protein" as used herein means the protein or fragment is
sufficiently free of contaminants or cell components with which the
protein normally occurs to distinguish the protein from the
contaminants or cell components. It is not contemplated that
"purified" necessitates having a preparation that is technically
totally pure (homogeneous), but purified as used herein means the
protein or polypeptide fragment is sufficiently separated from
contaminants or cell components with which it normally occurs to
provide the protein in a state where it can be used in an assay,
such as immunoprecipitation or ELISA. For example, the "purified"
protein can be in an electrophoretic gel.
Once a nucleic acid encoding a 37-kDa pneumococcal surface adhesin
protein of serotype 6B, or a fragment of that nucleic acid, is
constructed, modified, or isolated, that nucleic acid can then be
cloned into an appropriate vector, which can direct the in vivo or
in vitro synthesis of that 37-kDa pneumococcal surface adhesin
protein, or fragment thereof. The vector is contemplated to have
the necessary functional elements that direct and regulate
transcription of the inserted gene, or gene fragment. These
functional elements include, but are not limited to, a promoter,
regions upstream or downstream of the promoter, such as enhancers
that may regulate the transcriptional activity of the promoter, an
origin of replication, appropriate restriction sites to facilitate
cloning of inserts adjacent to the promoter, antibiotic resistance
genes or other markers which can serve to select for cells
containing the vector or the vector containing the insert, RNA
splice junctions, a transcription termination region, or any other
region which may serve to facilitate the expression of the inserted
gene or gene fragment. (See generally, Sambrook et al.).
There are numerous E. coli (Escherichia coli) expression vectors
known to one of ordinary skill in the art which are useful for the
expression of the nucleic acid insert. Other microbial hosts
suitable for use include bacilli, such as Bacillus subtilis, and
other enterobacteriaceae, such as Salmonella, Serratia, and various
Pseudomonas species. In these prokaryotic hosts one can also make
expression vectors, which will typically contain expression control
sequences compatible with the host cell (e.g., an origin of
replication). In addition, any number of a variety of well-known
promoters will be present, such as the lactose promoter system, a
tryptophan (Trp) promoter system, a beta-lactamase promoter system,
a promoter system from phage lambda, or other phage promoters such
as T4 or T7 promoters. The promoters will typically control
expression, optionally with an operator sequence, and have ribosome
binding site sequences for example, for initiating and completing
transcription and translation. If necessary, an amino terminal
methionine can be provided by insertion of a Met codon 5' and
in-frame with the downstream nucleic acid insert. Also, the
carboxy-terminal extension of the nucleic acid insert can be
removed using standard oligonucleotide mutagenesis procedures.
Alternatively, viral expression systems can be used to express the
nucleic acid of the present invention, or fragments thereof For
example, vaccinia virus vectors can accept large inserts and can be
used to express foreign genes for vaccination purposes. (See, e.g.,
Friedman, T. Science 244:1275 (1989)). Other viral expression
systems, such as the baculovirus expression system, are also
commonly used in the art.
Additionally, yeast expression can be used. There are several
advantages to yeast expression systems. First, evidence exists that
proteins produced in a yeast secretion systems exhibit correct
disulfide pairing. Second, post-translational glycosylation is
efficiently carried out by yeast secretory systems. The
Saccharomyces cerevisiae pre-pro-alpha-factor leader region
(encoded by the MF"-I gene) is routinely used to direct protein
secretion from yeast. (Brake et al., ".alpha.-Factor-Directed
Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces
cerevisiae. " Proc. Nat. Acad. Sci., 81:4642-4646 (1984)). The
leader region of pre-pro-alpha-factor contains a signal peptide and
a pro-segment which includes a recognition sequence for a yeast
protease encoded by the KEX2 gene: this enzyme cleaves the
precursor protein on the carboxyl side of a Lys-Arg dipeptide
cleavage signal sequence. The nucleic acid coding sequence can be
fused in-frame to the pre-pro-alpha-factor leader region. This
construct is then put under the control of a strong transcription
promoter, such as the alcohol dehydrogenase I promoter or a
glycolytic promoter. The nucleic acid coding sequence is followed
by a translation termination codon which is followed by
transcription termination signals. Alternatively, the nucleic acid
coding sequences can be fused to a second protein coding sequence,
such as Sj26 or .beta.-galactosidase, used to facilitate
purification of the fusion protein by affinity chromatography. The
insertion of protease cleavage sites to separate the components of
the fusion protein is applicable to constructs used for expression
in yeast. Efficient post translational glycosylation and expression
of recombinant proteins can also be achieved in Baculovirus
systems.
Mammalian cells permit the expression of proteins in an environment
that favors important post-translational modifications such as
folding and cysteine pairing, addition of complex carbohydrate
structures, addition of lipid moieties, and secretion of active
protein. Vectors useful for the expression of active proteins in
mammalian cells are characterized by insertion of the protein
coding sequence between a strong viral promoter and a
polyadenylation signal. The vectors can contain genes conferring
hygromycin resistance, gentamicin resistance, or other genes or
phenotypes suitable for use as selectable markers, or methotrexate
resistance for gene amplification. The chimeric protein coding
sequence can be introduced into a Chinese hamster ovary (CHO) cell
line using a methotrexate resistance-encoding vector, or other cell
lines using suitable selection markers. Presence of the vector DNA
in transformed cells can be confirmed by Southern blot analysis.
Production of RNA corresponding to the insert coding sequence can
be confirmed by Northern blot analysis. A number of other suitable
host cell lines capable of secreting intact human proteins have
been developed in the art, and include the CHO cell lines, HeLa
cells, myeloma cell lines, Jurkat cells, etc. Expression vectors
for these cells can include expression control sequences, such as
an origin of replication, a promoter, an enhancer, and necessary
information processing sites, such as ribosome binding sites, RNA
splice sites, polyadenylation sites, and transcriptional terminator
sequences. Preferred expression control sequences are promoters
derived from immunoglobulin genes, SV40, Adenovirus, Bovine
Papilloma Virus, etc. The vectors containing the nucleic acid
segments of interest can be transferred into the host cell by
well-known methods, which vary depending on the type of cellular
host. For example, calcium chloride transformation, transduction,
and electroporation are commonly utilized for prokaryotic cells,
whereas calcium phosphate, DEAE dextran, or lipofectin mediated
transfection or electroporation may be used for other cellular
hosts.
Alternative vectors for the expression of genes in mammalian cells,
those similar to those developed for the expression of human
gamma-interferon, tissue plasminogen activator, clotting Factor
VIII, hepatitis B virus surface antigen, protease Nexinl, and
eosinophil major basic protein, can be employed. Further, the
vector can include CMV promoter sequences and a polyadenylation
signal available for expression of inserted nucleic acids in
mammalian cells (such as COS-7).
Expression of the gene or hybrid gene can be by either in vivo or
in vitro. In vivo synthesis comprises transforming prokaryotic or
eukaryotic cells that can serve as host cells for the vector.
Alternatively, expression of the gene can occur in an in vitro
expression system. For example, in vitro transcription systems are
commercially available which are routinely used to synthesize
relatively large amounts of MRNA. In such in vitro transcription
systems, the nucleic acid encoding the 37-kDa pneumococcal surface
adhesin protein would be cloned into an expression vector adjacent
to a transcription promoter. For example, the Bluescript II cloning
and expression vectors contain multiple cloning sites which are
flanked by strong prokaryotic transcription promoters. (Stratagene
Cloning Systems, La Jolla, Calif.). Kits are available which
contain all the necessary reagents for in vitro synthesis of an RNA
from a DNA template such as the Bluescript vectors. (Stratagene
Cloning Systems, La Jolla, Calif.). RNA produced in vitro by a
system such as this can then be translated in vitro to produce the
desired 37-kDa pneumococcal surface adhesin protein. (Stratagene
Cloning Systems, La Jolla, Calif.).
Another method of producing a 37-kDa pneumococcal surface adhesin
protein is to link two peptides or polypeptides together by protein
chemistry techniques. For example, peptides or polypeptides can be
chemically synthesized using currently available laboratory
equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc
(tert-butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc.,
Foster City, Calif.). One skilled in the art can readily appreciate
that a peptide or polypeptide corresponding to a 37-kDa
pneumococcal surface adhesin protein can be synthesized by standard
chemical reactions, either continuous synthesis or step-wise
synthesis. For example, a partial polypeptide can be synthesized
and not cleaved from its synthesis resin whereas another fragment
can be synthesized and subsequently cleaved from the resin, thereby
exposing a terminal group which is functionally blocked on the
other fragment. By peptide condensation reactions, these two
fragments can be covalently joined via a peptide bond at their
carboxyl and amino termini, respectively, to form a 37-kDa
pneumococcal surface adhesin protein. (Grant G. A., "Synthetic
Peptides: A User Guide," W. H. Freeman and Co., N.Y. (1992) and
Bodansky, M and Trost, B., Ed., "Principles of Peptide Synthesis,"
Springer-Verlag Inc., N.Y. (1993)). Alternatively, the 37-kDa
pneumococcal surface adhesin protein can by independently
synthesized in vivo as described above. Once isolated, these
independent polypeptides may be linked to form a 37-kcDa
pneumococcal surface adhesin protein via similar peptide
condensation reactions.
For example, enzymatic ligation of cloned or synthetic peptide
segments can allow relatively short peptide fragments to be joined
to produce larger peptide fragments, polypeptides or whole protein
domains (Abrahmsen et al., Biochemistry, 30:4151 (1991)).
Alternatively, native chemical ligation of synthetic peptides can
be utilized to synthetically construct large peptides or
polypeptides from shorter peptide fragments. This method consists
of a two step chemical reaction (Dawson et al, "Synthesis of
Proteins by Native Chemical Ligation," Science, 266:776-779
(1994)). The first step is the chemoselective reaction of an
unprotected synthetic peptide-.alpha.-thioester with another
unprotected peptide segment containing an amino-terminal Cys
residue to give a thioester-linked intermediate as the initial
covalent product. Without a change in the reaction conditions, this
intermediate undergoes spontaneous, rapid intramolecular reaction
to form a native peptide bond at the ligation site. Application of
this native chemical ligation method to the total synthesis of a
protein molecule is illustrated by the preparation of human
interleukin 8 (IL-8) (Clark-Lewis et al., FEBS Lett., 307:97
(1987), Clark-Lewis et al., J. Biol. Chem., 269:16075 (1994),
Clark-Lewis et al, Biochem. 30:3128 (1991), and Rajarathnam et al.,
Biochem. 29:1689 (1994)).
Alternatively, unprotected peptide segments can be chemically
linked where the bond formed between the peptide segments as a
result of the chemical ligation is an unnatural (non-peptide) bond
(Schnolzer et al., Science, 256:221 (1992)). This technique has
been used to synthesize analogs of protein domains as well as large
amounts of relatively pure proteins with full biological activity
(deLisle Milton et al., "Techniques in Protein Chemistry IV,"
Academic Press, New York, pp. 257-267 (1992)).
The invention also provides fragments of the 37-kDa pneumococcal
surface adhesin protein. The polypeptide fragments of the present
invention can be recombinant proteins obtained by cloning nucleic
acids encoding fragments of the polypeptide in an expression system
capable of producing the polypeptide fragments thereof, as
described above for the 37-kDa protein. For example, one can
determine an immunoreactive region of a 37-kDa pneumococcal surface
adhesin protein which can cause a significant immune response,
clone the nucleic acid encoding that polypeptide into an expression
vector, and isolate that particular polypeptide for further uses,
such as diagnostics, therapy, and vaccination. In one example,
amino acids found to not contribute to the immunoreactivity and/or
specificity can be deleted without a loss in the respective
activity.
For example, amino or carboxy-terminal amino acids, can be
sequentially removed from the 37-kDa pneumococcal surface adhesin
protein and the immunoreactivity tested in one of many available
assays. Alternatively, internal amino acids can be sequentially
removed and the immunoreactivity tested for each of the deletions.
In another example, a fragment of a 37-kDa pneumococcal surface
adhesin protein can comprise a modified polypeptide wherein at
least one amino acid has been substituted for the naturally
occurring amino acid at specific positions, or a portion of either
amino terminal or carboxy terminal amino acids, or even an internal
region of the polypeptide, can be replaced with a polypeptide
fragment or other moiety, such as biotin, which can facilitate in
the purification of the modified 37-kDa pneumococcal surface
adhesin protein. For example, a modified 37-kDa pneumococcal
surface adhesin protein can be fused to a maltose binding protein,
through either peptide chemistry of cloning the respective nucleic
acids encoding the two polypeptide fragments into an expression
vector such that the expression of the coding region results in a
hybrid polypeptide. The hybrid polypeptide can be affinity purified
by passing it over an amylose ainity column, and the modified
37-kDa pneumococcal surface adhesin protein can then be separated
from the maltose binding region by cleaving the hybrid polypeptide
with the specific protease factor Xa. (See, e.g., New England
Biolabs Product Catalog, 1996, pg. 164.)
Immunoreactive fragments of a 37-kDa pneumococcal surface adhesin
protein can also be synthesized directly or obtained by chemical or
mechanical disruption of larger 37-kDa pneumococcal surface adhesin
protein. An immunoreactive fragment is defined as an amino acid
sequence of at least about 6 consecutive amino acids derived from
the naturally occurring amino acid sequence, which has the relevant
activity, e.g., evoking an immune response.
The fragments, whether attached to other sequences or not, can also
include insertions, deletions, substitutions, or other selected
modifications of particular regions or specific amino acids
residues, provided the immunoreactivity of the peptide is not
significantly impaired compared to the 37-kDa pneumococcal surface
adhesin protein. These modifications can provide for some
additional property, such as to remove/add amino acids capable of
disulfide bonding, to increase its bio-longevity, etc. In any case,
the peptide must possess a bioactive property, such as
immunoreactivity. Functional or active regions of the 37-kDa
pneumococcal surface adhesin protein may be identified by
mutagenesis of a specific region of the protein, followed by
expression and testing of the expressed polypeptide. Such methods
are readily apparent to a skilled practitioner in the art and can
include site-specific mutagenesis of the nucleic acid encoding the
receptor. (See, e.g., Smith, M "In vitro mutagenesis" Ann. Rev.
Gen., 19:423-462 (1985) and Zoller, M. J. "New molecular biology
methods for protein engineering" Curr. Opin. Struct. Biol.,
1:605-610 (1991)).
Antibodies
The present invention also provides a purified antibody which
selectively binds with the polypeptide encoded by the nucleic acid
set forth in the sequence listing as SEQ ID NO:1, or a polypeptide
encoded by a unique fragment of at least 10 nucleotides of SEQ ID
NO:1. The antibody (either polyclonal or monoclonal) can be raised
to the 37-kDa pneumococcal surface adhesin protein of a unique
fragment thereof, in its naturally occurring form and in its
recombinant form. The antibody can be used in techniques or
procedures such as diagnostics, treatment, or vaccination.
Antibodies can be made by many well-known methods (See, e.g. Harlow
and Lane, "Antibodies; A Laboratory Manual" Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., (1988)). Briefly, purified
antigen can be injected into an animal in an amount and in
intervals sufficient to elicit an immune response. Antibodies can
either be purified directly, or spleen cells can be obtained from
the animal. The cells can then fused with an immortal cell line and
screened for antibody secretion. The antibodies can be used to
screen nucleic acid clone libraries for cells secreting the
antigen. Those positive clones can then be sequenced. (See, for
example, Kelly et al., Bio/Technology, 10:163-167 (1992);
Bebbington et al., Biol/Technology, 10:169-175 (1992)).
The phrase "selectively binds" with the polypeptide refers to a
binding reaction which is determinative of the presence of the
protein in a heterogeneous population of proteins and other
biologics. Thus, under designated immunoassay conditions, the
specified antibodies bound to a particular protein do not bind in a
significant amount to other proteins present in the sample.
Selective binding to an antibody under such conditions may require
an antibody that is selected for its specificity for a particular
protein. A variety of immunoassay formats may be used to select
antibodies selectively bind with a particular protein. For example,
solid-phase ELISA immunoassays are routinely used to select
antibodies selectively immunoreactive with a protein. See Harlow
and Lane "Antibodies, A Laboratory Manual" Cold Spring Harbor
Publications, New York, (1988), for a description of immunoassay
formats and conditions that could be used to determine selective
binding.
In some instances, it is desirable to prepare monoclonal antibodies
from various hosts. A description of techniques for preparing such
monoclonal antibodies may be found in Stites et al., editors,
"Basic and Clinical Immunology," (Lange Medical Publications, Los
Altos, Calif., Fourth Edition) and references cited therein, and in
Harlow and Lane ("Antibodies, A Laboratory Manual" Cold Spring
Harbor Publications, New York, (1988)).
The present invention also provides a monoclonal antibody
designated 1E7A3D7C2, or a fragment thereof which retains the
characteristics of antibody 1E7A3D7C2, such as its binding
specificity and its binding affinity.
The present invention also provides a monoclonal antibody
designated 1B6E12H9, or a fragment thereof which retains the
characteristics of antibody 1B6E12H9.
The present invention also provides a monoclonal antibody
designated 3C4D5C7, or a fragment thereof which retains the
characteristics of antibody 3C4D5C7.
The present invention also provides a monoclonal antibody
designated 4E9G9D3, or a fragment thereof which retains the
characteristics of antibody 4E9G9D3.
The present invention also provides a monoclonal antibody
designated 4H5C10F3, or a fragment thereof which retains the
characteristics of antibody 4H5C10F3.
The present invention also provides a monoclonal antibody
designated 6F6F9C8, or a fragment thereof which retains the
characteristics of antibody 6F6F9C8.
The present invention also provides a monoclonal antibody
designated 8G12G11B10, or a fragment thereof which retains the
characteristics of antibody 8G12G11B10.
Vaccines
Also provided by the present invention is a vaccine comprising an
immunogenic polypeptide encoded by the nucleic acid as set forth in
the Sequence Listing as SEQ ID NO:1, or a unique fragment of at
least 10 nucleotides of SEQ ID NO:1. The polypeptides provided by
the present invention can be used to vaccinate a subject for
protection from a particular disease, infection, or condition
caused by the organism from which the 37-kDa pneumococcal surface
adhesin protein of a unique fragment thereof was derived.
Polypeptides of a 37-kDa pneumococcal surface adhesin protein of
serotype 6B or a unique fragment thereof, therefore, can be used to
inoculate a host organism such that the host generates an active
immune response to the presence of the polypeptide or polypeptide
fragment which can later protect the host from infection by
organism from which the polypeptide was derived. One skilled in the
art will appreciate that an immune response, especially a
cell-mediated immune response, to a 37-kDa pneumococcal surface
adhesin protein from a specific strain can provide later protection
from reinfection or from infection from a closely related strain.
The 37-kDa protein provided by the present invention, however, is
relatively conserved among many of the various serotypes of S.
pneumoniae and can serve as a multivalent vaccine.
Immunization with the 37-kDa pneumococcal surface adhesin protein
can be achieved through artificial vaccination. (Kuby, J.
"Immunology" W. H. Freeman and Co. New York, 1992). This
immunization may be achieved by administering to subjects the
37-kDa pneumococcal surface adhesin protein either alone or with a
pharmaceutically acceptable carrier.
Immunogenic amounts of the 37-kDa pneumococcal surface adhesin
protein can be determined using standard procedures. Briefly,
various concentrations of the present polypeptide are prepared,
administered to subjects, and the immunogenic response (e.g., the
production of antibodies to the polypeptide or cell mediated
immunity) to each concentration is determined. Techniques for
monitoring the immunogenic response, both cellular and humoral, of
patients after inoculation with the polypeptide, are very well
known in the art. For example, samples can be assayed using
enzyme-linked immunosorbent assays (ELISA) to detect the presence
of specific antibodies, such as serum IgA (Hjelt et al. J. Med.
Virol. 21:39-47, (1987)), or lymphocytes or cytokine production can
be monitored. The specificity of a putative immunogenic antigen of
any particular polypeptide can be ascertained by testing sera,
other fluids or lymphocytes from the inoculated patient for
cross-reactivity with other closely related 37-kDa pneumococcal
surface adhesin proteins.
The amount of a polypeptide of the 37-kDa pneumococcal surface
adhesin protein administered will depend on the subject, the
condition of the subject, the size of the subject, etc., but will
be at least an immunogenic amount. The polypeptide can be
formulated with adjuvants and with additional compounds, including
cytokines, with a pharmaceutically acceptable carrier.
It is also contemplated that immunization against Streptococcus
pneumoniae can be achieved by a "naked" DNA vaccine approach.
Briefly, DNA constructs containing promoter sequences upstream of
the 37-kDa protein or specific antigen coding sequences can be
injected into muscle tissue or administered via the mucosa and
result in expression of viral antigens that induce a protective
immune response.
The pharmaceutically acceptable carrier or adjuvant in the vaccine
of the present invention can be selected by standard criteria
(Arnon, R. (Ed.) "Synthetic Vaccines" I:83-92, CRC Press, Inc. Boca
Raton, Fla., 1987). By "pharmaceutically acceptable" is meant a
material that is not biologically or otherwise undesirable, i.e.,
the material may be administered to an individual along with the
selected compound without causing any undesirable biological
effects or interacting in a undesirable manner with any of the
other components of the pharmaceutical composition in which it is
contained. The carrier or adjuvant may depend on the method of
administration and the particular patient.
Methods of administration can be by oral, sublingual, mucosal,
inhaled, absorbed, or by injection. Actual methods of preparing the
appropriate dosage forms are known, or will be apparent, to those
skilled in this art; for example, see Remington's Pharmaceutical
Sciences (Martin, E. W. (ed.) latest edition Mack Publishing Co.,
Easton, Pa.
Parenteral administration, if used, is generally characterized by
injection. Injectables can be prepared in conventional forms,
either as liquid solutions or suspensions, solid forms suitable for
solution or suspension in liquid prior to injection, or as
emulsions. A more recently revised approach for parenteral
administration involves use of a slow release or sustained release
system, such that a constant level of dosage is maintained. See,
e.g., U.S. Pat. No. 3,710,795, which is incorporated by reference
herein.
Detection Methods
The present invention also provides a method of detecting the
presence of the Streptococcus pneumoniae in a sample, comprising
the steps of contacting a sample suspected of containing
Streptococcus pneumoniae with nucleic acid primers capable of
hybridizing to a nucleic acid comprising a unique portion of the
nucleic acid set forth in the Sequencing Listing as SEQ ID NO:1,
amplifying the nucleic acid, detecting the presence of an
amplification product, the presence of the amplification product
indicating the presence of Streptococcus pneumoniae in the sample.
Alternatively, a unique fragment of the nucleic acid of SEQ ID NO:1
can be used to specifically identify a non-selectively amplified
nucleic acid.
The specific amplification methods are well known in the art. For
example, and as disclosed in the Example contained herein the
polymerase chain reaction (PCR) can be used to amplify nucleic acid
in a sample specific for Streptococcus pneumoniae. Other
amplification techniques can also be used to detect the presence of
Streptococcus pneumoniae in a sample, such as the ligase chain
reaction (LCR), the self-sustained sequence replication (3SR)
system, the transcription-based amplification system (TAS), and the
RNA replication system based on Q.beta. replicase.
The amplified nucleic acid can be detected in any number of
detection assays. For example, the primers can be radio-labeled
such that the amplification product containing these primers can be
detected by the detecting the radioactive decay from those primers.
Alternatively, the primers can contain other detectable moieties,
such as biotin, or the amplified nucleic acid can be stained and
visualized, such as with ethidium bromide staining.
The present invention also provides a method of detecting the
presence of Streptococcus pneumoniae in a subject, comprising the
steps of contacting an antibody-containing sample from the subject
with purified polypeptide encoded by the nucleic acid set forth in
the Sequence Listing as SEQ ID NO:1, or a purified polypeptide
encoded by a nucleic acid comprising a unique fragment of at least
10 nucleotides of SEQ ID NO:1, and detecting the binding of the
antibody with the polypeptide, the binding indicating the presence
of Streptococcus pneumoniae in the subject.
The present invention further provides a method of detecting the
presence of Streptococcus pneumoniae in a subject, comprising the
steps of contacting a sample from the subject with an antibody
which selectively binds the purified polypeptide encoded by the
nucleic acid set forth in the Sequence Listing as SEQ ID NO:1, or a
purified polypeptide encoded by a nucleic acid comprising a unique
fragment of at least 10 nucleotides of SEQ ID NO:1 and detecting
the binding of the antibody with an antigen, the binding indicating
the presence of Streptococcus pneumoniae in the subject.
There are numerous immunodiagnostic methods that can be used to
detect antigen or antibody as the following non-inclusive examples
illustrate. These methods, as well as others, can not only detect
the presence of antigen or antibody, but quantitate antigen or
antibody as well.
Immunoassays such as immunofluorescence assays (IFA), enzyme linked
immunosorbent assays (ELISA) and immunoblotting can be readily
adapted to accomplish the detection and quantitation of the antigen
or antibody. An ELISA method effective for the detection of the
antigen, for example, can be as follows: (1) bind the antibody to a
substrate; (2) contact the bound antibody with a fluid or tissue
sample containing the antigen; (3) contact the above with a
secondary antibody bound to a detectable moiety (e.g., horseradish
peroxidase enzyme or alkaline phosphatase enzyme); (4) contact the
above with the substrate for the enzyme; (5) contact the above with
a color reagent; (6) observe color change. The above method can be
readily modified to detect antibody as well as antigen.
Another immunologic technique that can be useful in the detection
utilizes monoclonal antibodies (MAbs) for detection of antibodies
that specifically bind a specific antigen. Briefly, sera or other
body fluid from the subject is reacted with the antigen bound to a
substrate (e.g. an ELISA 96-well plate). Excess sera is thoroughly
washed away. A labeled (enzyme-linked, fluorescent, radioactive,
etc.) monoclonal antibody is then reacted with the previously
reacted antigen-serum antibody complex. The amount of inhibition of
monoclonal antibody binding is measured relative to a control (no
patient serum antibody). The degree of monoclonal antibody
inhibition can be a specific test for a particular species or
subspecies or variety or strain since it is based on monoclonal
antibody binding specificity. MAbs can also be used for detection
directly in cells by IFA.
A micro-agglutination test can also be used to detect the presence
of antibodies in a subject. Briefly, latex beads (or red blood
cells) are coated with the antigen and mixed with a sample from the
subject, such that antibodies in the tissue or body fluids that are
specifically reactive with the antigen crosslink with the antigen,
causing agglutination. The agglutinated antigen-antibody complexes
form a precipitate, visible with the naked eye or detectable by a
spectrophotometer. In a modification of the above test, antibodies
specifically reactive with the antigen can be bound to the beads
and antigen in the tissue or body fluid thereby detected.
In addition, as in a typical sandwich assay, the antibody can be
bound to a substrate and contacted with the antigen. Thereafter, a
labeled secondary antibody is bound to epitopes not recognized by
the first antibody and the secondary antibody is detected.
In the diagnostic methods taught herein, the antigen can be bound
to a substrate and contacted by a fluid sample such as serum,
urine, saliva or gastric juice. This sample can be taken directly
from the subject, or in a partially purified form. In this manner,
antibodies specific for the antigen (the primary antibody) will
specifically bind with the bound antigen. Thereafter, a secondary
antibody bound to, or labeled with, a detectable moiety can be
added to enhance the detection of the primary antibody. Generally,
the secondary antibody or other ligand which binds specifically
with a different epitope of the antigen or nonspecifically with the
ligand or bound antibody, will be selected for its ability to bind
with multiple sites on the primary antibody. Thus, for example,
several molecules of the secondary antibody can bind with each
primary antibody, making the primary antibody more detectable.
The detectable moiety will allow visual detection of a precipitate
or a color change, visual detection by microscopy, or automated
detection by spectrometry, radiometric measurement or the like.
Examples of detectable moieties include fluorescein and rhodamine
(for fluorescence microscopy), horseradish peroxidase (for either
light or electron microscopy and biochemical detection),
biotin-streptavidin (for light or electron microscopy) and alkaline
phosphatase (for biochemical detection by color change). The
detection methods and moieties used can be selected, for example,
from the list above or other suitable examples by the standard
criteria applied to such selections (Harlow et al., "Antibodies: A
Laboratory Manual" Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., (1988)).
Methods of Treating and Preventing Infection
The present invention also provides a method of preventing
Streptococcus pneumoniae infection in a subject, comprising
administering to the subject a prophylactically effective amount of
a vaccine comprising an immunogenic polypeptide encoded by the
nucleic acid encoding the 37-kDa protein of Streptococcus
pneumoniae as set forth in the Sequence Listing as SEQ ID NO:1, or
an immunogenic polypeptide encoded by a nucleic acid comprising a
unique fragment of at least 10 nucleotides of SEQ ID NO:1., either
alone or with a pharmaceutically acceptable carrier.
The present invention further provides a method of preventing
Streptococcus pneumoniae infection in a subject, comprising
administering to the subject a prophylactically effective amount of
an anti-idiotype antibody to the polypeptide encoded by the nucleic
acid as set forth in the Sequence Listing as SEQ ID NO:1, or a
polypeptide encoded by a nucleic acid comprising a unique fragment
of at least 10 nucleotides of SEQ ID NO:1, either alone or with a
pharmaceutically acceptable carrier.
Anti-idiotype antibodies represent the image of the original
antigen and can serve as a vaccine to induce an immune response to
a pathogenic antigen, therefore avoiding immunization with the
pathogen itself. This type of protection has been demonstrated by
immunizing mice with anti-idiotype antibody to the binding site of
TEPC-15, the major component of the pneumococcal cell wall C
polysaccharide. Mice immunized with these anti-idiotype antibodies
were immune when they were later challenged with live pneumococci.
Mice have also been used to demonstrate anti-idiotype antibodies
can provide protection against hepatitis B virus, rabies virus,
Sendai virus, Streptococcus pneumoniae, Listeria monocytogenes,
Trypanosoma rhodesiense, and Schistosoma mansoni. (See, Kuby, J.
"Immunology" W. H. Freeman and Co. New York, 1992).
The present invention further provides a method of treating a
Streptococcus pneumoniae infection in a subject, comprising
administering to the subject a therapeutically effective amount of
an antibody to the polypeptide encoded by the nucleic acid as set
forth in the Sequence Listing as SEQ ID NO:1, or a polypeptide
encoded by a nucleic acid comprising a unique fragment of at least
10 nucleotides of SEQ ID NO:1, either alone or with a
pharmaceutically acceptable carrier.
Treating a subject already infected with a particular organism by
administering to the subject antibody against the organism is well
known in the art. For example, immune globulin isolated from
animals or humans previously exposed to rabies virus is currently a
therapy for rabies virus infection. Better treatment of infected
individuals can be achieved by administering to those individuals
monoclonal antibodies since those monoclonals react or bind more
specifically that the polyclonals. (See, e.g. Kaplan et al.
"Rabies" Sci. Am. 242:120-134 (1980)).
The following example is put forth so as to provide those of
ordinary skill in the art with a complete disclosure and
description of how the attenuated prokaryotes claimed herein are
made and evaluated, and demonstrates the methods of the present
invention, and is intended to be purely exemplary of the invention
and is not intended to limit the scope of what the inventors regard
as their invention. Efforts have been made to ensure accuracy with
respect to numbers (e.g., amounts, temperature, etc.) but some
errors and deviations should be accounted for. Unless indicated
otherwise, parts are parts by weight, temperature is in .degree.C.
and pressure is at or near atmospheric.
EXAMPLES
Bacterial strains
The S. pneumoniae strain R36A was kindly provided by D. E. Briles
(University of Alabama at Birmingham). Twenty-four serotypes of S.
pneumoniae were provided by R. Facklam, Centers for Disease Control
(CDC), Atlanta, Ga. These serotypes are 1, 2, 3, 4, 5, 6A, 6B, 7F,
8, 9N, 9V, 10A, 11F, 11A, 12F, 14, 15B, 18C, 19A, 19F; 20, 22F,
23F, and 33F. Entex,ococcus avium, E. casseliflavus, and E.
gallinarum were also provided by R. Facklam. Anaerobic bacteria
were obtained from V. R. Dowell, CDC. These included Bacteroides
asaccharolyticus, B. fragilis, B. intermedius, B. thetaiotaomicron,
Eubacterium lentum, Fusobacterium necrophorum, F. nucleatum,
Peptostreptococcus anaerobius, P. asaccharolyticus,
Propionibacterium acnes, and Staphylococcus saccharolyticus.
Branhamella catarrhalis and Bordetella parapertussis were obtained
from R. Weaver, CDC. Mycobacterium tuberculosis was provided by R.
C. Good, CDC. R. Barnes, CDC, provided Chlamydia pneumoniae. The
following remaining bacteria were from the stock collection of the
Immunology Laboratory, CDC: Bordetella pertussis, Enterobacter
aerogenes, E. agglomerans, E. cloacae, E. gergoviae, Escherichia
coli, Klebsiella pneumoniae, Haemophilus influenzae (types a-f),
Legionella micdadei, L. pneumophila, Mycoplasma pneumoniae,
Pseudomonas aeruginosa, Serratia marcescens, Staphylococcus aureus,
Streptococcus agalactiae, S. equisimilis, S. pyogenes, and group G
streptococci.
Production of MAbs
Female BALB/c mice were immunized with whole cell suspensions of S.
pneumoniae R36A, a rough derivative of the capsular type 2 strain
D39 (Avery et al. (1944) J. Exp. Med. 79:137-157). The mice were
immunized by intravenous injection three times and intraperitoneal
injection one time. The maximum number of cells injected at any
time was 10.sup.8. Fusion was done on day 25 by using standard
procedures (Clafin et al. (1978) Curr. Top. Microbiol. Immunol.
81:107-109). Spleen cells of 4 mice were fused with Sp2/0-Ag14
myeloma cells (Schulman et al. (1978) Nature (London) 276:269-270).
Culture fluids of the growing hybridomas were tested for antibodies
to S. pneumoniae whole cells in an ELISA. A clone designated
1E7A3D7C2 was one of 10 selected for further study.
ELISA
Screening of hybridoma culture supernatants was done by ELISA.
U-bottom microtitration plates (Costar, Cambridge, Mass.) were
sensitized with 50 .mu.l of S. pneumoniae whole cell suspension
(10.sup.9 CFU/ml) diluted 1:4,000 in 0.1M carbonate buffer, pH 9.6,
and kept for 16 h at 4.degree. C. The plates were washed 5 times
with 0.9% NaCl containing 0.05% Tween 20 (NaCl-T). Culture
supernatants (50 .mu.l) from the fusion plates were added to 50
.mu.l of a solution containing 2% bovine serum albumin (BSA), 10%
normal rabbit serum, 0.3% Tween-20, and 0.02% Merthiolate in
phosphate buffered saline (PBS), pH 7.2, (ELISA diluent) (Wells. et
al. (1987) J. Clin. Microbiol. 25:516-521) in the plates and were
incubated for 30 min at 37.degree. C. The plates were washed 5
times with NaCl-T. Fifty microliters of goat anti-mouse
immunoglobulin horseradish peroxidase conjugate, diluted in ELISA
diluent was added to each well. The plates were incubated for 30
min at 370.degree. C. The plates were washed, and 50 .mu.l of
3,3',5,5'-tetramethylbenzidine (0.1 mg/ml in 0.1M sodium acetate,
0.1M citric acid (pH 5.7] with 0.005% hydrogen peroxide) was added
to each well and incubated for 30 min at 37.degree. C. The reaction
was stopped by adding 1 ml of 4M H.sub.2 SO.sub.4 and the optical
density was read on a Dynatech ELISA Reader (Dynatech Laboratories,
Inc., Alexandria, Va.) at 450 nm. An optical density of >0.200
was considered positive.
SDS-PAGE and immunoblot analysis
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) was performed by the method of Tsang et al. (Tsang et
al. (1983) Methods Enzymol. 92:377-391), using an 8% acrylamide
resolving gel. Equal volumes of sample buffer (5% SDS-10%
2-mercaptoethanol-20% glycerol in 0.01M Tris HCL, [pH 8.0]) and
cell suspension containing 2.4 .mu.g protein per .mu.l were mixed,
heated at 100.degree. C. for 5 min, and a 5-.mu.l portion was
applied to 1 of 15 wells. If the final protein content of the
portion of sample to be tested was <1.2 .mu.g/.mu.l, a volume up
to 10 .mu.l of sample was applied to achieve a final concentration
of 6 .mu.l of protein per well. Protein concentrations were
determined by the method of Markwell et al. (Markwell et al. (1978)
Anal. Biochem. 87:206-210), with BSA as the standard.
Proteins separated by SDS-PAGE were either silver stained by the
method of Morrissey (Morrissey, J. H. (1981) Anal. Biochem.
117:307-310) or electroblotted onto nitrocellulose (Schleicher
& Schnell, Inc., Keene, N. H.). The immunoblot procedure was
done according to the method of Tsang et al. (Tsang et al. (1983)
Methods Enzymol. 92:377-391) with slight modifications. The blots
were given three 5-min washes with PBS, pH 7.2, containing 0.3%
Tween-20 and were gently agitated overnight (16 h) at 25.degree. C.
The blots were blocked for 1 h with casein-thimerosal buffer (CTB)
(Kenna et al. (1985) J. Immunol. Meth. 85:409-419). After three
rinses with CTB, the blots were exposed to goat anti-mouse
immunoglobulin horseradish peroxidase conjugate (Bio-Rad
Laboratories, Richmond, Calif.) for 2 h at 25.degree. C. Conjugate
dilutions (1:2,000) were made in CTB. The blots were again rinsed
three times with CTB and exposed to
3-3'diaminobenzadine-4-hydrochloride in PBS, pH 7.2 (0.5 mg/ml),
with 0.003% H.sub.2 O.sub.2 for 5 min at 25.degree. C. Reactivity
was expressed as a visible colored band on the nitrocellulose
paper. Low molecular-mass protein standards (Bio-Rad) were used in
PAGE and immunoblotting. Rabbit antisera to the protein standards
were used to develop the standards (Carlone, G. M. (1986) Anal.
Biochem. 155:89-91). Molecular masses were calculated by the method
of Neville and Glossman (Neville et al. (1974) Methods Enzymol.
32:92-102) using appropriate molecular mass standards.
IFA
A bacterial suspension containing approximately 400-500 CFU per
field (10 .mu.l) was allowed to dry at room temperature on each
well of acetone-resistant, 12-well (5 mm diameter), glass slides
(25.times.75 mm) (Cel-Line Associates, Newfield, N.J.). The slides
were then immersed in acetone for 10 min and air dried at room
temperature. MAbs were added to the slides, which were incubated
for 30 min at 37.degree. C. After incubation, the slides were
gently rinsed with PBS and soaked twice at 5-min intervals, blotted
on filter paper, and air dried at room temperature.
Fluorescein-labeled rabbit anti-mouse immunoglobulin (courtesy of
W. F. Bibb, CDC) was then added, and the slides were incubated for
30 min at 37.degree. C. They were then washed twice with PBS and
gently blotted on filter paper. Slides were covered with
carbonate-buffered mounting fluid, pH 9.0, and cover slips and were
then read with a Leitz Dialux 20 fluorescence microscope equipped
with a HBO-100 mercury incident light source, an I cube filter
system, a 40.times. dry objective lens, and 6.3.times. binoculars
(E. Leitz, Inc., Rockleigh, N.J).
Immunoelectron-microscopy
Pneumococcal cells were washed two times with PBS and fixed in a
mixture of 1% paraformaldehyde-0.1% glutaraldehyde (freshly made)
for 20 min at 4.degree. C. The cells were dehydrated in a graded
alcohol series and then in a 1:1 mixture of absolute ethanol and
Lowicryl K4M (Ladd Research Industries, Inc., Burlington, Vt.) for
1 h at 4.degree. C. The cells were pelleted and suspended in a 1:2
mixture of absolute ethanol and Lowicryl K4M for 1 h at 4.degree.
C. They were again pelleted and suspended in Lowicryl K4M
(undiluted) for 16 h at 4.degree. C.
The cells were transferred to fresh Lowicryl K4M two times during
the next 24-hour period. The Lowicryl K4M-treated cells were
imbedded in gelatin capsules, which were placed inside a box lined
with aluminum foil. The capsules were hardened by holding them in
the box 35 cm from a short-wave UV light source for 72 h at
-20.degree. C. The box was brought to room temperature, and the
capsules were allowed to continue hardening for up to 14 days.
Samples of the capsule were cut into 100-.mu.m thin sections and
picked up on nickel grids. Grids containing the sample were placed
on a droplet of ovalbumin solution in PBS containing sodium azide
(E. Y. Laboratories, Inc., San Mateo, Calif.) for 5 min. The grids
(wet) were transferred to a solution of primary MAbs diluted in a
solution of BSA reagent (1% BSA in PBS containing 0.1% Triton
X-100, Tween 20, and sodium azide) (E. Y. Laboratories) and
incubated for 1 h at room temperature or 18 to 48 h at 4.degree. C.
in a moist chamber. For antibody binding controls, other grids were
wetted with MAbs against Legionella pneumophila. The grids were
rinsed two times with PBS and incubated on droplets of goat
anti-mouse IgG-labeled colloidal gold particles (20 .mu.m)(E. Y.
Laboratories) for 1 h at room temperature. The grids were rinsed
two times and post-stained with osmium tetroxide, uranyl acetate,
and lead citrate. The grids were examined with a Philips 410
transmission electron microscope.
CBA/CaBN/J Mice
X-linked immune deficiency (xid) of CBA/N mice as prepared by
Wicker, L. S. and I. Seher, Curr. Top. Microbiol. Immunol.
124:86-101 were used to study the protection afforded by the 37 kDa
protein.
Example 1
Monoclonal Antibodies
Hybridoma clone 1E7A3D7C2 produced MAbs that reacted with a
37-kilodalton (kDa) protein antigen (pneumococcal fimbrial protein
A) found in S. pneumoniae. The MAbs reacted with an antigen
fractionated in SDS-PAGE, yielding a single immunoblot band. This
indicates that the MAb reacted with epitopes found only on the
37-kDa antigen (pneumococcal fimbrial protein A). The MAbs produced
by the immunization of mice with pneumococcal cells reacted with
all pneumococcal strains tested (24 serotypes) to yield a
sensitivity of 100%. For specificity, 55 different nonpneumococcal
strains of bacteria that can also cause respiratory infections
(Donowitz et aL (1985) In: Principles and practices in infectious
diseases, 2nd ed. (G. L. Mandell, R. G. Douglas, and J. E. Bennett,
ed.) John Wiley & Sons, Inc., New York, pp.394-404) were tested
for antigens reacting with the MAbs. The latter strains represented
19 genera and 36 species of bacteria. None of the strains tested
reacted with the pneumococcal MAbs, thus yielding a specificity of
100%.
Of 44 patients known to have pneumococcus disease, 34 (77%) had
antibodies that reacted with the 37-kDa antigen (pneumococcal
fimbrial protein A) by Western immunoblot.
The MAbs reacted with whole pneumococcal cells to yield a positive
test result in both the ELISA and IFA. Results from both the ELISA
and the IFA indicate that the antigen has exposed epitopes on the
surface of the cell or that the immunoglobulin and other
immunologic reagents are able to penetrate the pneumococcal cell
walls.
Several strains of group A streptococci were tested for
immunofluorescence after reacting with the pneumococcus MAbs. None
of the heterologous bacterial cells fluoresced in this test,
indicating that the IFA reaction was specific for pneumococcus
cells.
To further determine the location on the cell of the 37-kDa antigen
(pneumococcal fimbrial protein A) epitopes reacting with the MAbs,
immunolabeling experiments were performed. The cells were typical
of gram-positive cocci in the process of division. A large portion
of the antigen appears to be intracellular since there is no
coating or layering of the labeled MAbs around the cell. The large
patch of colloidal gold staining indicates that the MAbs bound
antigen located inside the cell wall. There was no colloidal gold
binding to control pneumococci that were exposed to the MAbs
against L. pneumophila.
Example 2
Cloning of the Pneumococcal Fimbrial Protein A Gene
Streptococcus pneumoniae DNA digested with restriction enzyme
Sau3A1 was ligated to BamHi digested pUC13 and transformed into E.
coli TB1. Recombinant clones were identified by colony immunoblot
using the 37-kDa monoclonal antibody. The plasmid pSTR3-1 is an
example of the pneumococcal-fimbrial protein A gene cloned into
pUC13 .
Example 3
Preparation of Purified 37 kDa Protein Antigen
Two methods for preparing the 37 kDa protein are used. (1)
Streptococcus pneumoniae is conventionally cultured and the cells
harvested. Purified 37 kDa protein antigen (pneumococcal fimbrial
protein A) is isolated from the Streptococcus pneumoniae cell mass
by extraction with a non-ionic detergent and further purified by
ammonium sulfate fractionation and isoelectric focusing. (2) E.
coli TB1 strains containing plasmid pSTR3-1 is cultured
conventionally and the cells harvested. For improved yields, E.
coli strains, transformed with an expression vector that carries a
strong, regulated prokaryotic promoter and which contains the gene
coding for the 37 kDa protein, is used. Suitable expression vectors
are those that contain a bacteriophage .lambda.PL Promoter (e.g.,
pKK1773-3), a hybrid trp-lac promoter (e.g., pET-3a) or a
bacteriophage T7 promoter. The 37 kDa protein (PfpA) is then
extracted from the separated cell mass.
PROTECTION EXPERIMENTS WITH 37 kDa PROTEIN
Experiment No. 1
Twenty CBA/CaHN/J mice carrying the xid (x-linked immunodeficiency)
mutation were used in this protection study. They were tested for
protection against challenge with a virulent type 3 Streptococcus
pneumoniae strain, WU2. Mice were anesthetized with Ketamine/Rompun
and bled infraorbitally to obtain pre-immunization sera. 37-kDa
protein (pneumococcal fimbrial protein A) was emulsified in
complete Freund's adjuvant (CFA) to a protein concentration of 54
.mu.g per ml. Ten mice were injected subcutaneously into 2 axillary
and 2 inguinal sites at 0.1 ml per site, delivering approximately
22 .mu.g protein/mouse. Ten control mice were treated identically
with CFA and buffer substituting for protein. Fourteen days later,
the ten test mice were injected intraperitoneally (IP) with 100
.mu.g of the 37-kDa protein; controls were injected IP with buffer
eight days following the IP immunizations, all mice were bled
infraorbitally to obtain post-immunization sera, and challenged
intravenously (IV) with 60 CFU of a log phase culture of S.
pneumoniae strain WU2, a virulent capsular type 3 strain. Mice were
observed for 21 days, and deaths were recorded.
Sera were collected prior to immunizations to establish baseline
exposures, and also following the full immunization protocol (but
before challenge) in order to correlate circulating antibody to the
37 kDa protein with protection.
Days post challenge:
1--no deaths
2--3 control mice dead
3--2 control mice dead
4--2 control mice dead, one sick
5--1 control mouse dead
6-21 no deaths
Immunized with 37 kDa protein: 10/10 survived
Controls with no protein:2/10 survived (8/10 died)
Difference statistically significant: (p=0.0008) Rank sum test
Experiment No. 2
Twenty CBA/CaHN/J mice carrying the xid mutation were injected
according to the following protocol:
1. All mice were bled prior to immunization to establish baseline
immunity. Ten test mice were immunized subcutaneously in four sites
with a total of 21 .mu.g of 37-kDa protein antigen (pneumococcal
fimbrial protein A) emulsified in Complete Freund's adjuvant (CFA).
Ten control mice were immunized identically with CFA and buffer
substituting for the antigen.
2. Fourteen days later, the mice were boosted intraperitoneally
(I.P.) with 100 .mu.g of the 37 kDa protein antigen (test mice) or
with buffer (controls). No adjuvant was used with this booster
immunization.
3. Eight days later, all mice were bled via the infraorbital sinus
and the sera were collected and pooled into the two groups
(immunized and controls). At the same time, blood was collected
from individual mice to assay for antibody responses.
4. One day later, two additional mice were injected I.O. with 0.1
ml of pooled immune sera to attempt to passively transfer immunity.
Three additional mice were injected I.P. with 0.1 ml of pooled
control mouse sera. (only five mice were injected at this step
because of the small amount of sera obtained from the immunized
mice.).
5. One hour after the I.P. injections, these five mice were
challenged intravenously (I.V.) with 140 colony-forming units (CFU)
of a mid-log phase pneumococcal type 3 strain, WU2.
6. At the same time, the eighteen (8 test and 10 control)* mice
were challenged I.V. with the same culture of WU2.
7. Deaths were tallied daily.
______________________________________ RESULTS: No. Dead/No.
Challenged ______________________________________ Immunized with
the 37 kDa protein: 0/8* Control mice: 10/10 Passive Protection:
mice receiving immune sera: 0/2 Mice receiving control sera: 3/3
______________________________________ *Two of ten test mice died
of other causes prior to challenged with WU2.
Mice immunized with the 37 kDa protein were protected from fatal
challenge with strain WU2, and this immunity could be passively
transferred with sera from immunized mice.
Experiment No. 3
An enzyme-linked immunosorb6nt assay (ELISA) was developed using
purified S. pneumoniae 37-kDa protein antigen as a capture for
human antibodies. Paired sera were tested from children, less than
24 months of age, known to have pneumococcal pneumonia. Disease
confirmation was determined by blood culture or antigen in the
urine. It was found that 35% (9/26) had antibody titers greater
than sera from non-ill children of the same age group, p=0.06. This
illustrates that some of the children responded to the 37-kDa
protein antigen after natural infection.
PREPARATION OF THE 37 kDa PROTEIN OR POLYPEPTIDE CONJUGATE
Conjugates can be prepared by use of a carrier protein bound to the
37-kDa protein or polypeptides derived from the 37-kDa protein via
a linker, to elicit a T cell dependent response. Such carrier
proteins could be any immunogenic protein, for example, keyhole
limpet hemocyanin, bovine serum albumin, tetanous toxoid,
diphtheria toxoid, and bacterial outer membrane proteins. Examples
of bacterial outer membrane proteins, useful as conjugates, include
outer membrane proteins of Neisseria meningitides and Haemophilus
influenzae. Neisseria meningitides can be an organism selected from
Neisseria meningitides, group A, B, or C.
In addition, the 37-kDa protein or polypeptides thereof can be used
in a conjugate where the 37-kDa protein or polypeptides thereof are
the T-cell dependent immunogenic carrier for polysaccharide
antigens that are B-cell stimulators. This is based on the theory
that polysaccharide antigens are B-cell stimulators and that
protective immunity is usually generated by a combination of B-cell
and T-cell stimulation. Protein antigens exhibit T-cell dependent
properties; i.e., booster and carrier priming. T-cell dependent
stimulation is important because children less than two years of
age do not respond to T-cell independent antigens. The attachment
or conjugation of antigens can be accomplished by conventional
processes, such as those described in U.S. Pat. No. 4,808,700,
involving the addition of chemicals that enable the formation of
covalent chemical bonds between the carrier immunogen and the
immunogen.
In use, the 37-kDa protein antigen of this invention can be
administered to mammals; e.g., human, in a variety of ways.
Exemplary methods include parenteral (subcutaneous) administration
given with a nontoxic adjuvant, such as an alum precipitate or
peroral administration given after reduction or ablation of gastric
activity; or in a pharmaceutical form that protects the antigen
against inactivation by gastric juice (e.g., a protective capsule
or microsphere).
The dose and dosage regimen will depend mainly upon whether the
antigen is being administered for therapeutic or prophylactic
purposes, the patient, and the patient's history. The total
pharmaceutically effective amount of antigen administered per dose
will typically be in the range of about 2 .mu.g to 50 .mu.g per
patient.
For parenteral administration, the antigen will generally be
formulated in a unit dosage injectable form (solution, suspension,
emulsion) in association with a pharmaceutically acceptable
parenteral vehicle. Such vehicles are inherently nontoxic and
nontherapeutic. Examples of such vehicles include water, saline,
Ringer's solution, dextrose solution, and 5% human serum albumin.
Non aqueous vehicles, such as fixed oils and ethyl oleate, may also
be used. Liposomes may be used as vehicles. The vehicle may contain
minor amounts of additives, such as substances which enhance
isotonicity and chemical stability; e.g., buffers and
preservatives.
Example 4
Bacterial strains. All isolates of S. pneumoniae were provided and
serotyped by the Streptococcal Reference Laboratory, Division of
Bacterial and Mycotic Diseases, NCID, Centers for Disease Control
and Prevention (CDC). The pneumococcal serotype 6B strain used for
cloning and sequencing was a CDC reference strain (SP-86).E. coli
DH5.alpha. (Bethesda Research Laboratories, Gaithersburg, Md.) was
used as the recipient host for plasmids, pUC19 and its
derivatives.
S. pneumoniae strains were grown on Trypticase soy agar plates with
5% sheep blood cells or, where indicated, in Todd-Hewitt broth
containing 0.5% yeast extract. E. coli cultures were grown in Luria
broth which, when required, was supplemented with 100 .mu.g/ml of
ampicillin (Sigma Chemical Co., St. Louis, Mo.).
Cloning and sequencing of the psaA gene from S. pneumoniae,
serotype 6b.
A chromosomal library from S. pneumoniae serotype 6B was prepared
as previously described (Sampson et al. 1994. Cloning and
nucleotide sequence analysis of psaA, the Streptococcus pneumoniae
gene encoding a 37-kilodalton protein homologous to previously
reported Streptococcus sp. adhesins. Infect. Immun. 62:319-324.),
except that pUC18 was used as the cloning vector instead of pUC 13.
Recombinants were screened by colony immunoblot using monoclonal
antibody (MAb) 1E7. (Russell et al. 1990. Monoclonal antibody
recognizing a species-specific protein from Streptococcus
pneumoniae J. Clin. Microbiol. 28:2191-2195). This procedure, as
well as plasmid purification from positive clones (Ish-Horowicz et
al. 1981. Rapid and efficient cosmid cloning. Nucleic Acids Res.
9:2989-2998.) and restriction endonuclease analysis, has all been
previously described. (Sampson et al. 1990. Nucleotide sequence of
htpB, the Legionella pneumophila gene encoding the 58-kilodalton
(kDa) common antigen, formerly designated the 60-kDa common
antigen. Infect. Immun. 58:3154-3157 and Sampson et al. 1994).
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and Western blot analysis were done as before (Sampson
et al. 1990). All other DNA manipulations were done according to
methods described in Sambrook et al. DNA sequencing was performed
using the ABI PRISM Dye Terminator Cycle Sequencing kit and
procedure (Perkin-Elmer, Cetus, Foster City, Calif.). Sequence data
were analyzed with the DNASTAR software program (DNASTAR Inc.,
Madison, Wis.) and the Wisconsin Genetics Computer Group sequence
analysis software program (Fenno et al. 1989. Nucleotide sequence
analysis of a type 1 fimbrial gene of Streptococcus sanguis FW213.
Infect. Immun. 57:3527-3533).
Preparation of genomic DNA for PCR-RFLP analysis. High molecular
weight pneumococcal DNA was prepared by the procedure of Graves and
Swaminathan (Graves et al. 1993. Universal bacterial DNA isolation
procedure, p. 617-621. In D. H. Pershing et al. (ed), Diagnostic
molecular biology. American Society for Microbology, Washington,
D.C.) with modifications. Sixteen-hour cultures of type specific S.
pneumoniae were grown in 50 ml of Todd-Hewitt broth containing 0.5%
yeast extract in screw cap flasks at 37.degree. C. without shaking.
Cultures were pelleted at 8000.times.g for 15 min at room
temperature and washed with phosphate-buffered saline (10 mM pH
7.2). The cell pellet was solubilized in 2.5 ml of buffer composed
of 10 mM Tris, 1.0 mM EDTA, pH 8.0, and 0.4% SDS. Fifteen
microliters of proteinase K (20 mg/ml) was added, and the lysate
was incubated at 37.degree. C. for 1 h. The mixture was adjusted to
0.48M NaCl with the addition of 500 .mu.l of 5M NaCl and, after
mixing by inversion, 400 .mu.l of 10% hexadecyltrimethylammonium
bromide in 0.7% NaCl was added. This suspension was mixed as
before, incubated for 30 min at 65.degree. C., and extracted with
an equal volume of phenol-chloroform-isoamyl alcohol. The upper
aqueous phase was separated by centrifugation at 1500.times.g and
extracted with chloroform-isoamyl alcohol. DNA was precipitated
from the upper aqueous phase with 2.5 volumes of ethanol at
-70.degree. C. for 30 min. It was pelleted and dried in a
desiccator, resuspended in water and quantitated by measuring
absorbance at 260 nm.
PCR-RFLP. Restriction enzymes EcoRI, HinfI, MaeIII, MboII, MnlI,
and NheI were obtained from Boerhringer Mannheim Biochemicals
(Indianapolis, Id.); RsaI, Tsp509I, Eco57I, and XmnI were purchased
from New England Biolabs (Beverly, Mass.). Primer sequences for the
amplification reaction were selected from the N-terminal
(nucleotides 181-201) and C-terminal (nucleotides 1106-1126)
sequences of the S. pneumoniae serotype 6B gene (P1,
AGGATCTAATGAAAAAATTAG (SEQ ID NO:3); P2, TCAGAGGCTTATTTTGCCAAT (SEQ
ID NO:4)) and flanking regions. The primers were synthesized at the
Centers for Disease Control and Prevention using standard
procedures.
(i) DNA amplification. The reaction was performed with the
Perkin-Elmer PCR amplification kit. Reaction volumes were 100 .mu.l
and contained the standard 1.times. reaction buffer without Mg, 1
.mu.M of each primer, 2.0 mM MgCl.sub.2, 0.2 mM dNTPs, template
DNA, and 2.5 U of Taq DNA polymerase. The source of the template
DNA was either extracted purified chromosomal DNA or a bacterial
colony. Conditions for amplification were as follows:30 cycles of
denaturation 94.degree. C., 1 min., annealing 52.degree. C., 0.5
min., and extension 72.degree. C., 1.5 min. Amplified products were
separated on a 1% agarose gel and visualized with ethidium bromide.
A direct colony amplification procedure was adapted, which
shortened template preparation by eliminating the necessity of
extracting chromosomal DNA. The procedure consisted of adding a
single bacterial colony directly from the plate into the PCR
reaction mixture and heating at 95.degree. C. for 10 minutes. The
remaining PCR steps were performed as outlined for extracted
chromosomal DNA and are given above.
(ii) Enzyme digestion. Digestion of amplified products was
performed as directed by the manufacturer for the designated
enzymes in volumes of 20 .mu.l. Digestion products were analyzed by
agarose (2% Metaphor agarose, FMC Corp., Rockland, Me.) gel
electrophoresis and visualized after being stained with ethidium
bromide.
Analysis of type 6B psaA.
Genomic DNA was partially digested by Sau3AI was ligated to
BamHi-digested pUC 18 and used to transform E. coli DH5.alpha..
Recombinant colonies were selected for resistance to ampicillin and
the formation of white colonies in the presence of
isopropyl-.beta.-D-galactopyranoside (IPTG) and
5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside. Colony
immunoblot screening (using anti-PsaA MAb) of approximately 2,500
colonies yielded two positive clones, which were selected,
purified, and rescreened by Western blot analysis using the same
MAb. They both expressed a protein reactive with MAb to PsaA and
which migrated in SDS-PAGE with the expected molecular mass of
approximately 37 kDa. One was selected for continued study and was
designated pSTR6.
Limited restriction enzyme analysis of DNA from the recombinant
plasmid showed that the positive clone contained an insert that was
3.5 kb with sites for enzymes ClaI, EcoRl, and HindIII. To localize
the PsaA coding region, the insert was double digested with SstI
(multiple cloning site in vector) and HindIII. The resultant
fragments were ligated into pUC18 and transformed into E. coli
DH5.alpha.. This generated a recombinant containing an insert of
.about.1.3 kb in size. The resultant subclone pSTR6y, when analyzed
by SDS-PAGE and Western blot using anti-PsaA MAb, was shown to
express full length PsaA immuno-reactive protein.
The complete nucleotide sequence on both strands of the 1.3-kb
insert was determined by cycle sequencing of the plasmid subclone
using oligonucleotide primers complementary to the sequence. These
were made as sequence information became available. The nucleotide
sequence of the entire streptococcal insert is set forth in the
Sequence Listing as SEQ ID NO:1. The single open reading frame
(ORF) present, beginning at nucleotide (nt) 189 and ending at nt
1117, encodes the psaA gene sequence. This ORF is 930 nt long and
when amplified and subcloned into vector systems such as pGEM
(Promega, Madison, Wis.) and BAC-to-BAC.TM. expression system
(Bethesda Research Laboratories, Gaithersburg, Md.) expresses
full-length PsaA, reactive with anti-PsaA MAb antibodies. This ORF
encodes a peptide of 309 amino acids with a deduced molecular
weight of 34,598 and an isoelectric point of 5.23. Analysis of the
peptide using the algorithm of Kyte and Doolittle (Kyte et al.
1982. "A simple method for displaying the hydropathic character of
a protein." J. Mol. Biol. 157:105-132) shows that the peptide
contains a major hydrophobic region of 20 amino acids which encodes
a putative leader sequence. This leader contains the consensus
sequence for signal peptidase cleavage (LXXC). Removal of this
leader would result in a peptide of molecular mass 32,465 with a
predicted isoelectric point of 4.97. A consensus sequence for a
ribosomal binding site (Shine et al. 1974. "The 3'-terminal
sequence of E. coil 16S ribosomal RNA: complementarity to nonsense
triplets and ribosomal binding sites." Proc. Natl. Acad. Sci.
U.S.A. 71:1324-1346) is located 5 nt upstream of the ATG start
codon.
Comparison of the serotype 6B sequence with streptococcal
homologs
Comparison of the serotype 6B psaA nucleotide sequence ((Bilofsky
et al. 1988. A GenBank genetic sequence database. Nucleic Acids
Res. 16:1861-1864) GenBank accession number U53509) and its
flanking regions with the previously published strain R36A psaA
sequence (Sampson et al. 1994. "Cloning and nucleotide sequence
analysis of psaA, the Streptococcus pneumoniae gene encoding a
37-kilodalton protein homologous to previously reported
Streptococcus sp. adhesins." Infect. Immun. 62:319-324) shows the
differences between the nucleotide sequences. The computed homology
between the two sequences is 74%. Major areas of discord are in
regions upstream and downstream of the ORF and in the initial 60 nt
which encode the putative signal peptide. When the two PsaA coding
sequences are compared the sequence homology increases to 78%.
Serotype 6B sequence was also compared to the psaA DNA sequence for
another vaccine serotype, serotype 2, which was recently submitted
to GenBank by Berry and Paton (Accession number U40786). Computer
analysis of these two sequences shows that they are very similar,
with computed DNA homology percentages of 99% between the two psaA
DNA sequences. There are eight single base differences between the
two sequences.
A comparison of serotype 2 and 6B PsaAs shows almost complete
identity: the computed similarity value is 99.3. The eight base
difference at the nucleotide level translated into a difference at
the peptide level of six amino acids with two of the changes
resulting in conservative substitutions. Further analyses and
comparisons of the serotype 6B sequence to the other five GenBank
PsaA homologues from viridans Streptococci and E. faecalis (Fenno
et al. 1989. "Nucleotide sequence analysis of a type 1 fimbrial
gene of Streptococcus sanguis FW213." Infect. Immun. 57:3527-3533,
Sampson et al. 1994. "Cloning and nucleotide sequence analysis of
psaA, the Streptococcus pneumoniae gene encoding a 37-kilodalton
protein homologous to previously reported Streptococcus sp.
adhesins." Infect. Immun. 62:319-324, Ganeshkumar et al. 1991.
"Nucleotide sequence of a gene coding for a salvia-binding protein
(SsaB) from Streptococcus sanguis 12 and possible role of the
protein in coaggregation with actinomyces." Infect. Immun.
59:1093-1099, Kolenbrander et al. 1994. "Nucleotide sequence of the
Streptococcus gordonii PK488 coaggregation adhesin gene scaA and
ATP-binding cassette." Infect. Immun. 62:4469-4480, and Lowe et al.
1995. "Cloning of an Enterococcus faecalis endocarditis antigen:
homology with some adhesins from oral streptococci. " Infect. Immun
63:703-706) revealed significant sequence similarity between them.
Sequence identities were 81%, 81%, 77%, 82%, and 57%, respectively,
for PsaA (S. pneumoniae strain R36A), SsaB (S. sanguis), FimA (S.
parasanguis), ScaA (S. gordonii) and EfaA (E. faecalis).
Additionally, all six sequences showed great similarity in
organization. They have a hydrophobic leader peptide containing the
prolipoprotein consensus sequence LXXC (for signal peptidase II
cleavage) within the first 17-20 amino acids. This N-terminal
leader sequence appears to represent the area of greatest
variability. It is followed by a region of high similarity from
amino acids 36-150. The region from 150 to 198 is a variable region
and is followed by another conserved region (198-309).
PCR-RFLP analysis of chromosomal DNA from the 23 serotype strains
in a 23-valent vaccine.
PCR-RFLP was used to examine the degree of conservation of the gene
among 23 S. pneumoniae serotypes, representing the 23 serotypes in
a 23-valent vaccine. Since previous attempts to amplify
pneumococcal type strains with primers corresponding to strain R36A
were unsuccessful, primers for PCR were selected from N-terminal
and C-terminal sequences of serotype 6B. Using primers
complementary to serotype 6B, the psaA gene from all 23 serotypes
and subtypes represented in the 23-valent vaccine was amplified
from chromosomal DNA. A total of 10 enzymes were chosen that had
restriction endonuclease digestion sites throughout the entire
length of the serotype 6B psaA gene. Nine of the 10 enzymes gave
identical patterns for all 23 psaA genes analyzed.
Cleavage with restriction enzyme Tsp509I was the one exception to
those enzymes that generated identical patterns. Tsp509I has six
sites within the gene and generates seven fragments upon digestion
with sizes of 7, 30, 68, 146, 151, 166, and 362 bp. When these
fragments are separated on 2% metaphor agarose gel, a five-band
pattern can be seen (7- and 30-bp fragments are not seen on these
gels because of their small size). For 21 of 23 serotypes this
five-fragment enzyme pattern was obtained; but for strains of
serotype 4 and 33F, the 146-bp fragment is absent and two new
fragments appear flanking the 68-bp fragment making a total of
seven bands. This increase in fragment number results from the
presence of an extra Tsp509I site within the 146-bp fragment.
To ascertain the prevalence of this extra site, the Tsp509I
patterns of 3 to 4 additional strains of each of 23 serotype
strains (additional strains of serotype 2 and serotype 25 were not
available) were analyzed. All strains analyzed were random clinical
isolates from the United States that had been submitted to CDC for
serotyping. The majority of the 80 strains were blood isolates;
exceptions were 2 from cerebrospinal fluid, 2 from pleural fluid,
and 1 each from the eye and nose. Of the strains analyzed, 10% had
the extra Tsp509I site, resulting in the altered RFLP pattern. This
modification was seen only in types 4, 8, 11F, and 33F. In an
attempt to determine prevalence of this altered pattern, we
analyzed the psaA gene from 8 additional strains of these 4 types
for the Tsp509I variation (bringing the total to 11-12 for these 4
types). Table 1 summarizes the analyses of serotypes 4, 8, 11A, and
33F; it shows that the modified pattern is randomly present in 4
and 8, but is present in 11 of 12 strains of 11A and all strains of
33F. The occurrence of this pattern could not be correlated with
geographic location or region of the United States since strains
that showed variation came from diverse regions of the country. All
strains of types 4, 8, 11A, and 33F were blood isolates except one
33F strain, which was a nasal isolate; thus the relevance of the
site of isolation on prevalence of this modification could not be
assessed.
TABLE 1 ______________________________________ Screening of
selected serotypes for additional Tsp509I restriction site Ratio of
serotypes with additional Total serotypes with site to total no. of
serotypes tested unique patterns Serotype Expt. #1.sup.a Expt.
#2.sup.b % Unique pattern ______________________________________ 4
1/3 3/9 .sup. 33 (4/12).sup.c 8 3/4 4/9 44 (7/13) 11A 2/3 9/9 92
(11/12) 33F 3/3 9/9 100 (12/12)
______________________________________ .sup.a Initial Tsp509I
analysis which included survey of 2-3 strains each of all 23
vaccine types. .sup.b Tsp509I analysis of more strains of types
showing additional Tsp509I site. .sup.c Shown in parenthesis is
ratio of number with additional site to number tested.
This analysis discloses the cloning and sequencing of the gene
encoding PsaA from S. pneumoniae serotype 6B and a subsequent
analysis of the gene in the 23 pneumococcal polysaccharide vaccine
serotypes. Sequence analysis revealed that the serotype 6B sequence
and the previously published strain R36A were less similar than
expected. The nucleotide sequence and its flanking regions were
only 73% homologous to the original strain R36A psaA, with the
actual PsaA coding sequences had a computed homology of 78%.
Protein sequence similarity between the two sequences was only 81%.
A comparison of the serotype 6B sequence with the newly submitted
serotype 2 pneumococcal psaA (a vaccine serotype) gave computed DNA
homology values of 99% and 98% protein sequence similarity. These
values are evidence of the high sequence conservation for the gene
within the vaccine serotypes. Moreover, when the deduced amino acid
sequences of these two sequences were compared with other published
sequences for PsaA homologues within the genus, large areas of
similarity were evident for all five proteins. Similarity values
within the group ranged from 57% to 82%.
The need for a Streptococcus pneumoniae vaccine candidate prompted
us to clone and sequence the psaA gene from S. pneumoniae serotype
6B. The heterogeneity between the two pneumococcal psaA genes (6B
and R36A) led us to examine the vaccine serotypes to determine the
degree of diversity among strains. Primers homologous with the N
terminus and C terminus of the serotype 6B sequence amplified all
23 of the vaccine serotypes. PCR-RFLP analysis using 10 different
restriction enzymes representing 21 sites within the serotype 6B
gene and shows only one area of diversity, which resulted in an
additional Tsp509I site for a small number of strains.
This study demonstrates that the serotype 6B gene sequence is
representative of the sequence found among the vaccine serotypes.
Evidence for this includes the 99% DNA sequence identity between
serotype 2 and serotype 6B and the uniform and identical
restriction patterns covering the 21 sites examined in this study.
It is clear that our earlier strain R36A psaA sequence represents a
variant sequence seemingly not present in the serotypes that were
analyzed here since we were unable to amplify them using primers to
strain R36A psaA.
The more important aspect of this study, however, is that there is
limited diversity among the vaccine serotypes analyzed. These are
the serotypes that cause disease and thus, the ones against which
prophylactic measures are needed. The lack of genetic diversity of
psaA among these serotypes suggests that gene is highly conserved
and is an excellent candidate for vaccine development.
The 37-kDa protein from serotype 22F was used to generate
monoclonal antibodies 1B6E12H9, 3C4D5C7, 4E9G9D3, 4H5C10F3,
6F6F9C8, 8G12G11B10 which were analyzed for their ability to confer
protection from infection by Streptococcus pneumoniae. Table 2
shows that of 5 monoclonal antibodies tested, one in particular
gave efficient protection from subsequent S. pneumoniae challenge
(8G12G11B10). The protection from S. pneumoniae was
dose-responsive, demonstrating that the monoclonal antibody was
responsible for the protection (Table3).
TABLE 2 ______________________________________ Passive protection
of five (5) Anti-37 kDa murine monoclonal antibodies in an infant
mouse model to Streptococcus pneumoniae serotype 6B. Death 37 kDa
MAb Bacteremia @ 48 h @ 14 d Cell Line.sup.a @ 48 h (%) (%) (%)
______________________________________ 1E7. . . 100 100 100 8G12. .
. 100 0 20 4E9. . . 100 80 100 6F6. . . 100 60 100 1B6. . . 100 80
100 ______________________________________ .sup.a Challenge does
(1.7 .times. 10.sup.3 cfu) or 10X bacteremic dose 100%
(BD.sub.100). Five/mice group given 50 .mu.g total antibody. All
MAbs are IgG.
TABLE 3 ______________________________________ Effect of a Second
Dose on the Passive Protective Potential of the Anti-37 kDa Murine
Monoclonal Antibody 8G12. Ab Dose Level Bacteremia Death (.mu.g) @
48h @ 48 h. @ 10 d Pre Post.sup.a % Ave cfu/ml (%) (%)
______________________________________ 50 -- 100 1.2 .times.
10.sup.4 0 30 50 50 80 1.0 .times. 10.sup.4 0 50 5 -- 100 4.7
.times. 10.sup.4 70 100 5 5 100 3.0 .times. 10.sup.4 50 80 -- --
100 >10.sup.5 80 100 ______________________________________
.sup.a All infant mice were challenged with 10X BC.sub.100 (2
.times. 10.sup.3 cfu). Ab given 24 h prior to and 24 h after (post)
challenge. 10 mice/group.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 4 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 1330 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:
189..1115 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TACTGCTTCAGTTTTGGGACTCTTTATTGGCTATAGTTTTAATGTTGCGGCAGGTTCTAG60
TATCGTGCTTACAGCTGCTAGTTTCTTTCTCATTAGCTTCTTTATCGCTCCCAAACAACG120
ATATTTGAAACTGAAAAATAAACATTTGTTAAAATAAGGGGCAAAGCCCTAATAAATTGG180
AGGATCTAATGAAAAAATTAGGTACATTACTCGTTCTCTTTCTTTCTGCA230
MetLysLysLeuGlyThrLeuLeuValLeuPheLeuSerAla 1510
ATCATTCTTGTAGCATGTGCTAGCGGAAAAAAAGATACAACTTCTGGT278
IleIleLeuValAlaCysAlaSerGlyLysLysAspThrThrSerGly 15202530
CAAAAACTAAAAGTTGTTGCTACAAACTCAATCATCGCTGATATTACT326
GlnLysLeuLysValValAlaThrAsnSerIleIleAlaAspIleThr 354045
AAAAATATTGCTGGTGACAAAATTGACCTTCATAGTATCGTTCCGATT374
LysAsnIleAlaGlyAspLysIleAspLeuHisSerIleValProIle 505560
GGGCAAGACCCACACGAATACGAACCACTTCCTGAAGACGTTAAGAAA422
GlyGlnAspProHisGluTyrGluProLeuProGluAspValLysLys 657075
ACTTCTGAGGCTGATTTGATTTTCTATAACGGTATCAACCTTGAAACA470
ThrSerGluAlaAspLeuIlePheTyrAsnGlyIleAsnLeuGluThr 808590
GGTGGCAATGCTTGGTTTACAAAATTGGTAGAAAATGCCAAGAAAACT518
GlyGlyAsnAlaTrpPheThrLysLeuValGluAsnAlaLysLysThr 95100105110
GAAAACAAAGACTACTTCGCAGTCAGCGACGGCGTTGATGTTATCTAC566
GluAsnLysAspTyrPheAlaValSerAspGlyValAspValIleTyr 115120125
CTTGAAGGTCAAAATGAAAAAGGAAAAGAAGACCCACACGCTTGGCTT614
LeuGluGlyGlnAsnGluLysGlyLysGluAspProHisAlaTrpLeu 130135140
AACCTTGAAAACGGTATTATTTTTGCTAAAAATATCGCCAAACAATTG662
AsnLeuGluAsnGlyIleIlePheAlaLysAsnIleAlaLysGlnLeu 145150155
AGCGCCAAAGACCCTAACAATAAAGAATTCTATGAAAAAAATCTCAAA710
SerAlaLysAspProAsnAsnLysGluPheTyrGluLysAsnLeuLys 160165170
GAATATACTGATAAGTTAGACAAACTTGATAAAGAAAGTAAGGATAAA758
GluTyrThrAspLysLeuAspLysLeuAspLysGluSerLysAspLys 175180185190
TTTAATAAGATCCCTGCTGAAAAGAAACTCATTGTAACCAGCGAAGGA806
PheAsnLysIleProAlaGluLysLysLeuIleValThrSerGluGly 195200205
GCATTCAAATACTTCTCTAAAGCCTATGGTGTCCCAAGTGCCTACATC854
AlaPheLysTyrPheSerLysAlaTyrGlyValProSerAlaTyrIle 210215220
TGGGAAATCAATACTGAAGAAGAAGGAACTCCTGAACAAATCAAGACC902
TrpGluIleAsnThrGluGluGluGlyThrProGluGlnIleLysThr 225230235
TTGGTTGAAAAACTTCGCCAAACAAAAGTTCCATCACTCTTTGTAGAA950
LeuValGluLysLeuArgGlnThrLysValProSerLeuPheValGlu 240245250
TCAAGTGTGGATGACCGTCCAATGAAAACTGTTTCTCAAGACACAAAC998
SerSerValAspAspArgProMetLysThrValSerGlnAspThrAsn 255260265270
ATCCCAATCTACGCACAAATCTTTACTGACTCTATCGCAGAACAAGGT1046
IleProIleTyrAlaGlnIlePheThrAspSerIleAlaGluGlnGly 275280285
AAAGAAGGCGACAGCTACTACAGCATGATGAAATACAACCTTGACAAG1094
LysGluGlyAspSerTyrTyrSerMetMetLysTyrAsnLeuAspLys 290295300
ATTGCTGAAGGATTGGCAAAATAAGCCTCTGAAAAACGTCATTCTCATGTG1145
IleAlaGluGlyLeuAlaLys 305
AGCTGGCGTTTTTTCTATGCCCACATTTCCGGTCAAATCATTGGAAAATTCTGACTGTTT1205
CAGATACAATGGAAGAAAAAAGATTGGAGTATCCTATGGTAACTTTTCTCGGAAATCCTG1265
TGAGCTTTACAGGTAAACAACTACAAGTCGGCGACAAGGCGCTTGATTTTTCTCTTACTA1325
CAACA1330 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 309 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2:
MetLysLysLeuGlyThrLeuLeuValLeuPheLeuSerAlaIleIle 151015
LeuValAlaCysAlaSerGlyLysLysAspThrThrSerGlyGlnLys 202530
LeuLysValValAlaThrAsnSerIleIleAlaAspIleThrLysAsn 354045
IleAlaGlyAspLysIleAspLeuHisSerIleValProIleGlyGln 505560
AspProHisGluTyrGluProLeuProGluAspValLysLysThrSer 65707580
GluAlaAspLeuIlePheTyrAsnGlyIleAsnLeuGluThrGlyGly 859095
AsnAlaTrpPheThrLysLeuValGluAsnAlaLysLysThrGluAsn 100105110
LysAspTyrPheAlaValSerAspGlyValAspValIleTyrLeuGlu 115120125
GlyGlnAsnGluLysGlyLysGluAspProHisAlaTrpLeuAsnLeu 130135140
GluAsnGlyIleIlePheAlaLysAsnIleAlaLysGlnLeuSerAla 145150155160
LysAspProAsnAsnLysGluPheTyrGluLysAsnLeuLysGluTyr 165170175
ThrAspLysLeuAspLysLeuAspLysGluSerLysAspLysPheAsn 180185190
LysIleProAlaGluLysLysLeuIleValThrSerGluGlyAlaPhe 195200205
LysTyrPheSerLysAlaTyrGlyValProSerAlaTyrIleTrpGlu 210215220
IleAsnThrGluGluGluGlyThrProGluGlnIleLysThrLeuVal 225230235240
GluLysLeuArgGlnThrLysValProSerLeuPheValGluSerSer 245250255
ValAspAspArgProMetLysThrValSerGlnAspThrAsnIlePro 260265270
IleTyrAlaGlnIlePheThrAspSerIleAlaGluGlnGlyLysGlu 275280285
GlyAspSerTyrTyrSerMetMetLysTyrAsnLeuAspLysIleAla 290295300
GluGlyLeuAlaLys 305 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
AGGATCTAATGAAAAAATTAG21 (2) INFORMATION FOR SEQ ID NO:4: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:4: TCAGAGGCTTATTTTGCCAAT21
__________________________________________________________________________
* * * * *