U.S. patent number 5,707,807 [Application Number 08/621,914] was granted by the patent office on 1998-01-13 for molecular indexing for expressed gene analysis.
This patent grant is currently assigned to Research Development Corporation of Japan. Invention is credited to Kikuya Kato.
United States Patent |
5,707,807 |
Kato |
January 13, 1998 |
Molecular indexing for expressed gene analysis
Abstract
This invention relates to a method for classifying (indexing)
cDNA which has been reverse-transcribed from tissue- or
cell-derived RNA, or DNA in a short period without duplication by
using class-IIS restriction enzymes or a combination of a class-IIS
and a class-II restriction enzymes. According to this invention, it
is possible to analyse and diagnose variations such as tumors
easily, correctly and promptly by comparing the analyzed pattern of
genes expressed in a cell or tissue sample with the analyzed
pattern of normal genes. This method is also applicable to the
search and isolation of genes of physiologically active substances
that are potential pharmaceuticals or causative genes of hereditary
diseases, as well as the isolation of those genes that are useful
for improving agricultural products.
Inventors: |
Kato; Kikuya (Osaka,
JP) |
Assignee: |
Research Development Corporation of
Japan (JP)
|
Family
ID: |
27300117 |
Appl.
No.: |
08/621,914 |
Filed: |
March 26, 1996 |
Foreign Application Priority Data
|
|
|
|
|
Mar 28, 1995 [JP] |
|
|
7-069695 |
Jul 20, 1995 [JP] |
|
|
7-184006 |
Sep 12, 1995 [JP] |
|
|
7-234122 |
|
Current U.S.
Class: |
435/6.14; 435/5;
435/91.1; 435/91.2; 435/91.5; 536/24.3; 536/24.33 |
Current CPC
Class: |
C12N
15/1096 (20130101); C12Q 1/6809 (20130101); C12Q
1/6855 (20130101); C12Q 1/6809 (20130101); C12Q
1/6855 (20130101); C12Q 2537/149 (20130101); C12Q
2521/313 (20130101); C12Q 2537/149 (20130101); C12Q
2521/313 (20130101) |
Current International
Class: |
C12N
15/10 (20060101); C12Q 1/68 (20060101); C12Q
001/68 (); C12Q 001/70 (); C12P 019/34 (); C07N
021/04 () |
Field of
Search: |
;435/6,5,91.1,91.5,91.2
;536/24.3,24.33 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 93/06239 |
|
Apr 1993 |
|
WO |
|
WO 93/18176 |
|
Sep 1993 |
|
WO |
|
WO 94/01582 |
|
Jan 1994 |
|
WO |
|
WO 94/11383 |
|
May 1994 |
|
WO |
|
WO 95/13369 |
|
May 1995 |
|
WO |
|
Other References
K Kato, 1995, "Description of the entire mRNA population by a 3'
end cDNA fragment generated by class IIS restriction enzymes", Nuc.
Acids Res. 23:3685-3690. .
McClelland et al., 1995, "RNA fingerprinting and differential
display using arbitrarily primed PCR", TIG 11:242-246. .
Schena et al., 1995, "Quantitative monitoring of gene expression
patterns with a complementary DNA microarray", Science 270:467-470.
.
D.R. Smith, 1992, "Ligation-mediated PCR of restriction fragments
from large DNA molecules", PCR Methods and Applications 2:21-27.
.
Velculescu et al., 1995, "Serial analysis of gene expression",
Science 270:484-487. .
Wang et al. PNAS 88: 11505-11509, 1991. .
Liang et al. Science 257:967-971, 1992. .
Hakvoort et al. Nucleic Acids Research 22:879-79, 1994. .
Brenner and Livak, PNAS 86:8902-6, 1992. .
Unrau et al. Gene 145: 163-169, 1994..
|
Primary Examiner: Jones; W. Gary
Assistant Examiner: Rees; Dianne
Attorney, Agent or Firm: Pennie & Edmonds LLP
Claims
What is claimed is:
1. A method for determining the molecular index of a cDNA
preparation comprising the following steps:
(a) digesting the cDNA preparation which has been
reverse-transcribed by oligo-dT priming from a RNA preparation with
a first class-IIS restriction enzyme;
(b) ligating each of the resultant cDNA fragments to an adaptor
from a pool of 64 adapters cohesive to all possible overhangs of
DNA fragments produced by the digestion in step (a) and thereby
producing a ligation product, wherein each adaptor from said pool
of adaptors has an overhang sequence and comprises a biotinylated
oligonucleotide strand and a non-biotinylated oligonucleotide
strand which has the overhang sequence;
(c) digesting the resultant ligation product with a second and a
third class-IIS restriction enzymes which are different from the
first class-IIS restriction enzyme used in step (a) and thereby
obtaining a cDNA sample;
(d) recovering cDNA fragments which are ligated to adaptors from
the cDNA samples by binding to streptavidin, removing
non-biotinylated strands of polynucleotides from the recovered cDNA
fragments, and thereby obtaining a single-stranded cDNA sample;
(e) amplifying the single-stranded cDNA sample by polymerase chain
reaction using a first primer comprising a sequence identical to a
segment or the whole of the biotinylated oligonucleotide strand of
the adaptor and a second primer which is an anchor oligo-dT primer
selected from the group consisting of d(T).sub.25 A, d(T).sub.25 C
and d(T).sub.25 G, and thereby obtaining an amplification product;
and
(f) separating the amplification product by denaturing
polyacrylamide gel electrophoresis, recording the molecular sizes
of DNA molecules in the amplification product, and thereby
obtaining the molecular index of the cDNA preparation.
2. A method for determining the molecular index of a cDNA
preparation comprising the following steps:
(a) digesting the cDNA preparation which has been
reverse-transcribed by oligo-dT priming from a RNA preparation with
a first class-IIS restriction enzyme;
(b) ligating each of the resultant cDNA fragments to an adaptor
from a pool of 64 adapters cohesive to all possible overhangs of
DNA fragments produced by the digestion in step (a) and thereby
producing a ligation product, wherein each adaptor from said pool
of adaptors has an overhang sequence and comprises a biotinylated
oligonucleotide strand and a non-biotinylated oligonucleotide
strand which has the overhang sequence;
(c) digesting the resultant ligation product with a second and a
third class-IIS restriction enzymes which are different from the
first class-IIS restriction enzyme used in step (a) and thereby
obtaining a first cDNA sample;
(d) obtaining a second cDNA sample by repeating steps (a) to (c),
wherein in step (a), the cDNA preparation is digested by the second
class-IIS restriction enzyme, and in step (c), the ligation product
is digested with the first and third class-IIS restriction
enzymes;
(e) obtaining a third cDNA sample by repeating steps (a) to (c),
wherein in step (a), the cDNA preparation is digested by the third
class-IIS restriction enzyme, and in step (c), the ligation product
is digested with the first and second class-IIS restriction
enzymes;
(f) recovering cDNA fragments which are ligated to adaptors from
the first, second and third cDNA samples by binding to
streptavidin, removing non-biotinylated strands of polynucleotides
from the recovered cDNA fragments, and thereby obtaining a
single-stranded cDNA sample;
(g) amplifying the single-stranded cDNA sample by polymerase chain
reaction using a first primer comprising a sequence identical to a
segment or the whole of the biotinylated oligonucleotide strand of
the adaptor and a second primer which is an anchor oligo-dT primer
selected from the group consisting of d(T).sub.25 A, d(T).sub.25 C
and d(T).sub.25 G, and thereby obtaining an amplification product;
and
(h) separating the amplification product by denaturing
polyacrylamide gel electrophoresis, recording the molecular sizes
of DNA molecules in the amplification product, and thereby
obtaining the molecular index of the cDNA preparation.
3. The method according to claim 1 or 2, wherein the class-IIS
restriction enzymes are used in a combination of Fok I, Bsm AI and
Bsm FI.
4. The method according to claim 1 or 2, wherein the cDNA
preparation has been synthesized by reverse-transcribing RNA using
as primer a mixture of the following oligonucleotides: ##STR6##
5. The method according to claim 4, wherein the amplification of
the single-stranded cDNA sample is carried out using as the second
primer an oligonucleotide selected from the group consisting of:
##STR7## instead of an anchored oligo-dT primer.
6. The method according to claim 1 or 2, wherein the first or
second primer is labeled with a marker.
7. The method according to claim 5, wherein the marker is an
radioactive atom, fluorescent dye or enzyme.
8. The method according to claim 1 or 2, wherein the streptavidin
is attached to paramagnetic beads.
9. The method according to claim 1 or 2, wherein the RNA
preparation is isolated from an animal cell or tissue, or a plant
cell or tissue.
10. A method for determining the molecular index of a cDNA or DNA
preparation comprising the following steps:
(a) digesting the cDNA or DNA preparation with a class-II
restriction enzyme and thereby producing a first cDNA fragment
preparation or first DNA fragment preparation, wherein the cDNA
preparation has been reverse-transcribed by oligo-dT priming from a
RNA preparation;
(b) ligating each cDNA fragment in the first cDNA preparation or
each DNA fragment in the first DNA fragment preparation to a first
adaptor which is cohesive to the overhang of cDNA fragments or DNA
fragments produced by the class-II restriction enzyme and thereby
producing a first ligated cDNA preparation or first ligated DNA
preparation;
(c) digesting the first ligated cDNA preparation or first ligated
DNA preparation with a class-IIS restriction enzyme and thereby
producing a second cDNA fragment preparation or second DNA fragment
preparation;
(d) ligating each cDNA fragment in the second cDNA fragment
preparation or each DNA fragment in the second DNA fragment
preparation to a second adaptor from a pool of 64 adapters cohesive
to all possible overhangs of cDNA fragments or DNA fragments
produced by the digestion with the class-IIS restriction enzyme and
thereby producing a second ligated cDNA preparation or second
ligated DNA preparation, wherein each second adaptor from said pool
of adaptors has an overhang sequence and comprises a biotinylated
oligonucleotide strand and a non-biotinylated oligonucleotide
strand which has the overhang sequence;
(e) recovering cDNA fragments or DNA fragments which are ligated to
adaptors from the second ligated cDNA preparation or second ligated
DNA preparation by binding to streptavidin, removing
non-biotinylated strands of polynucleotides from the recovered cDNA
fragments or DNA fragments, and thereby obtaining a single-stranded
cDNA or DNA sample;
(f) amplifying the single-stranded cDNA or DNA sample by polymerase
chain reaction using a first primer comprising a sequence identical
to a segment or the whole of the biotinylated oligonucleotide
strand of the second adaptor and a second primer comprising a
sequence identical or complementary to a segment or the whole of an
oligonucleotide strand of the first adaptor, and thereby producing
an amplification product; and
(g) separating the amplification product by denaturing
polyacrylamide gel electrophoresis, recording the molecular sizes
of amplified cDNA or DNA molecules in the amplification product,
and thereby obtaining the molecular index of the cDNA or DNA
preparation.
11. The method according to claim 10, wherein the class-IIS
restriction enzyme is Fok I, Bsm AI, Bsm FI, Sfa NI or Bbv I.
12. The method according to claim 10, wherein the first or second
primer is labeled with a marker.
13. The method according to claim 12, wherein the marker is an
radioactive atom, fluorescent dye or enzyme.
14. The method according to claim 10, wherein the streptavidin is
attached to paramagnetic beads.
15. The method according to claim 10, wherein the DNA preparation
or RNA preparation is isolated from an animal cell or tissue, or a
plant cell or tissue.
Description
FIELD OF THE INVENTION
This invention relates to a method for molecular indexing which is
applicable to the analysis and diagnosis of diseases such as
cancers, the search and isolation of genes of physiologically
active substances that are potential pharmaceuticals or causative
genes of hereditary diseases, as well as the isolation of those
genes that are useful for improving agricultural products.
BACKGROUND OF THE INVENTION
For examining differences in gene expression between two tissues,
there has been described a method wherein a portion (about 50-200
genes) of the expressed gene population is amplified by PCR (the
polymerase chain reaction method) using any short primers and then
separated by polyacrylamide gel electrophoresis [P. Liang and A. B.
Pardee, Differential display of eukaryotic messenger RNA by means
of the polymerase chain reaction, Science 257:967-971 (1992)].
However, in such differential display by means of PCR, only a
portion of the whole gene population is amplified in principle and
yet a plurality of bands are generated from the same gene.
Furthermore, such display involves a large quantity of artifacts
and thus is technically incomplete. Therefore, such display only
shows differences in gene expression between two tissues which are
not remote from each other or differences in gene expression in
cells. Such differential display has a problem that it cannot
record the expression of individual genes.
It is also possible to analyze variations in tissues or cells by
determining the level of a particular gene in such tissues or cells
through measuring the amount of its mRNA by Northern blot
hybridization method. However, this method is not applicable when
the target gene is not cloned or the base sequence thereof is
unknown. In addition, this method is not suitable for the analysis
of a large number of genes. For example, since genes being
expressed in a certain cell are considered about 10,000 species, it
will take for about two years even if Northern blot hybridization
is performed for 100 genes per week. Thus, this method is not
practically useful.
On the other hand, those restriction enzymes which belong to class
IIS (hereinafter, referred to as "class-IIS restriction enzymes")
are restriction enzymes having an ability to cut at a precise
distance outside their recognition sites. Those fragments cut by a
class-IIS restriction enzyme are characterized to have
non-identical, cohesive ends consisting of several nucleotides.
There have been known more than 30 class-IIS restriction enzymes
including Fok I, Bsm FI, Bsm AI, Bbv I, Sfa NI and Hga I. It is
estimated that genes which have at least one cleavage site of Fok
I, Bsm FI or Bsm AI will be 97% of total genes. Brenner et al. has
introduced a method of preparing a more detailed genome map using a
class-IIS restriction enzyme which generates 4-nt (nucleotide)
sequences in place of conventional restriction enzymes [S. Brenner
and K. J. Livak, DNA fingerprinting by sampled sequencing, Proc.
Natl. Acad. Sci. U.S.A., 86:8902-6 (1989)]. There is also disclosed
a method wherein a part of restriction enzyme fragments derived
from a phage or cosmid is amplified by using those adaptors which
are complementary to all possible 4-nt cohesive ends generated by
class-IIS restriction enzymes [D. R. Smith, ligation-mediated PCR
or restriction fragments from large DNA molecules, PCR Methods
Appl. 2:21-27 (1992); Unrau, P. and Deugau, K. V., Gene, 145,
163-169 (1994)]. However, though all of these methods employ
class-IIS restriction enzymes and use the 4-nt overhangs generated
by them as means for structural analysis of genomes, unlike the
present invention, they do not aim at recording the expression of
genes in a specific tissue or cell.
In the Human Genome Project, there is vigorously argued an approach
to take a tissue-derived cDNA fragment as a sample and to determine
a partial sequence thereof as well as its location in a chromosome.
In conventional methods, cDNA fragments are randomly taken from
cDNA library. Accordingly, it is impossible to avoid a repeated
sampling of the same fragment and there is a tendency that highly
expressed fragments are selectively taken.
It is an object of the present invention to provide a method which
can analyze the state of expression of genes or deletion due to
some abnormalities in a tissue or a cell in a short period and yet
easily for a large quantity of genes.
It is a further object of the present invention to provide a method
which is applicable to a rapid isolation of the coding region of a
protein as well as an amplification of restriction fragments of
cloned DNA or genomic DNA.
SUMMARY OF THE INVENTION
The present inventor has made extensive and intensive researches
toward the solution of the above assignment and, as a result, found
that, by using class-IIS restriction enzymes or a combination of a
class-IIS enzyme and a class-II restriction enzyme, it is possible
to classify (index) cDNA or DNA into groups in a short period and
without duplication. Thus, the present invention has been
achieved.
The present invention relates to a method for molecular indexing
comprising the following steps (hereinafter referred to as "Method
I"):
(1) digesting cDNA which has been reverse-transcribed from tissue-
or cell-derived RNA with a first restriction enzyme of
class-IIS,
(2) ligating each of the resultant cDNA fragments to one from a
pool of 64 biotinylated adaptors cohesive to all possible
overhangs,
(3) digesting the resultant cDNA fragments further with a second
and a third restriction enzymes of class-IIS which are different
from the first class-IIS restriction enzyme used in (1) above to
thereby obtain a first cDNA sample,
(4) obtaining a second cDNA sample by repeating the above steps (1)
to (3) wherein the second class-IIS restriction enzyme is used for
the initial digestion and the first and the third class-IIS
restriction enzymes are used for the subsequent digestion,
(5) obtaining a third cDNA sample by repeating the above steps (1)
to (3) wherein the third class-IIS restriction enzyme is used for
the initial digestion and the first and the second class-IIS
restriction enzymes are used for the subsequent digestion,
(6) recovering each of the resultant ligation samples by using
streptavidin-coated paramagnetic beads and then removing from the
samples the oligonucleotide complementary to an adaptor-primer to
be used in (7),
(7) amplifying each of the resultant cDNA samples by PCR using an
adaptor-primer and one of anchored oligo-dT primers,
(8) separating the amplified products by denaturing polyacrylamide
gel electrophoresis and recording the sizes of the fragments
obtained.
The present invention also relates to a method for molecular
indexing comprising the following steps (hereinafter referred to as
"Method II"):
(1) digesting cDNA which has been reverse-transcribed from tissue-
or cell-derived RNA, or DNA with a restriction enzyme of
class-II,
(2) ligating each of the resultant cDNA or DNA fragments to an
adaptor cohesive to ends generated by the class-II restriction
enzyme,
(3) digesting the resultant cDNA or DNA fragments further with a
restriction enzyme of class-IIS,
(4) ligating each of the resultant cDNA or DNA fragments to one
from a pool of 64 biotinylated adaptors cohesive to all possible
overhangs,
(5) recovering the resultant ligated sample by using
streptavidin-coated paramagnetic beads and then removing from said
sample the oligonucleotides complementary to adaptor-primers to be
used in (6),
(6) amplifying the resultant cDNA or DNA sample by PCR using
adaptor-primers,
(7) separating the amplified products by denaturing polyacrylamide
gel electrophoresis and recording the sizes of the fragments
obtained.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a schematic illustration for the principle of Method
I. N is a mixture of A, C, G and T.
FIG. 2 shows structures of cDNA which has been synthesized by
reverse-transcribing RNA using a mixture of 3 oligonucleotides as
primers.
FIG. 3 shows a schematic illustration for the principle of Method
II. N is a mixture of A, C, G and T.
FIG. 4 shows an example of the polyacrylamide electrophoresis
pattern of mouse liver RNA obtained by Method I.
FIG. 5 shows an example of the polyacrylamide electrophoresis
pattern of an amplified product from mouse liver RNA obtained by
Method II.
EFFECT OF THE INVENTION
According to Method I, it is possible to examine the state of
expression of those genes having cleavage sites of class-IIS
restriction enzymes (97% of total genes are estimated to have such
sites when Fok I, Bsm AI and Bsm FI are used) in a tissue with one
to two week experiment per one human subject, since a small number
of DNA sub-groups will do for this analysis. Furthermore, according
to Method I, since the number of fragments amplified from one gene
is only one in principle, genes can be classified (indexed) into
sub-groups without redundancy. Therefore, by comparing the analyzed
pattern between normal and abnormal tissues by using Method I, it
is possible to diagnose variations such as tumors easily, correctly
and promptly. In addition, Method I is also applicable to the
search and isolation of genes of physiologically active substances
that are potential pharmaceuticals or the causative genes of
hereditary diseases, as well as the isolation of those genes that
are useful for improving agricultural products.
On the other hand, according to Method II, the target of analysis
is not limited to RNA (or cDNA reverse-transcribed therefrom),
since oligo-dT primers for poly A are not used as primers.
According to Method II, it is also possible to amplify restriction
fragments of cosmid DNA or genomic DNA. Therefore, Method II is
applicable to the mapping of these DNAs.
In addition, regions amplified by PCR is not restricted to
non-coding regions and thus it is not necessary to obtain clones of
upstream regions in order to know the primary structure of a
protein.
DETAILED DESCRIPTION OF THE INVENTION
[I] Hereinbelow, the steps, action and effects of Method I will be
described with reference to FIG. 1.
(1) First, the total RNA of a cell or a tissue is converted to cDNA
with a reverse-transcriptase and the resultant cDNA is digested
with a first class-IIS restriction enzyme.
(2) One from a pool of 64 biotinylated adaptors described below is
ligated to the resultant cDNA fragments with E. coli DNA ligase.
Each adaptor has a 4-nt 5' end overhang wherein the outermost base
is a mixture of A, C, G and T and the inner three bases are one of
all possible sequences. (These adaptors must not be phosphorylated
at their 5' ends which form protruding cohesive ends.) At this
point, the restriction fragments are classified into 64
sub-groups.
(3) Subsequently, the cDNA fragments are further digested with a
second and a third class-IIS restriction enzymes which are
different from the first class-IIS restriction enzyme used in (1)
above to thereby obtain a first cDNA sample.
A second cDNA sample is obtained by repeating the above steps (1)
to (3) wherein the second class-IIS restriction enzyme is used for
the initial digestion and the first and the third class-IIS
restriction enzymes are used for the subsequent digestion, and also
a third cDNA sample is obtained by repeating the above steps (1) to
(3) wherein the third class-IIS restriction enzyme is used for the
initial digestion and the first and the second class-IIS
restriction enzymes are used for the subsequent digestion.
(4) As a result of digestion with the 3 class-IIS restriction
enzymes described above, there are produced fragments which have
lost poly A [see FIG. 1, (2)] and fragments which still have poly A
[see FIG. 1, (ii)]. Of these fragments, the former ones which have
lost poly A will no longer be amplified in the subsequent
amplification step and only the latter ones with poly A will be
amplified. Accordingly, the latter fragments are further classified
into 64.times.3=192 sub-groups at this point depending on the
cleavage site nearest the poly A side (i.e., depending on the
cleavage site of which of the three restriction enzymes used).
(5) Subsequently, the ligation sample is recovered with
streptavidin-coated paramagnetic beads and the cDNA fragments are
treated with a dilute alkaline solution. By these operations, the
oligonucleotide complementary to an adaptor-primer to be used in
(6) is removed (the oligonucleotide will become an inhibitor
against PCR reaction).
(6) The resultant cDNA sample is amplified by PCR by using a
combination of an adaptor-primer and one of d(T).sub.25 A(SEQ ID
NO:1), d(T).sub.25 C (SEQ ID NO:2) and d(T).sub.25 (SEQ ID NO:3) G
which are anchored oligo-dT primers. Depending on the base (T, C or
G) adjacent to the poly(A) tail, fragments amplified by the above
three oligo-dT primers are determined. At this point, the cDNA
fragments are further classified into 192.times.3=576 groups.
(7) The amplified products are separated by denaturing
polyacrylamide gel electrophoresis and the sizes of the fragments
obtained are automatically recorded by a sequencer.
The above-described procedures are repeated with 64 adaptors, 3
class-IIS restriction enzymes and 3 anchored oligo-dT primers.
Therefore, an RNA population is classified into 576 groups. With
respect to class-IIS restriction enzymes, it is estimated that 97%
of genes have at least one cleavage site of Fok I, Bsm AI or Bsm
FI.
Accordingly, by using these 3 restriction enzymes in the method of
the invention, it is theoretically possible to recover and present
without redundancy almost all of one total RNA population.
In addition, the above method (Method I) of the invention may be
similarly carried out in a modified method which is different from
the above only in the following points. In step (2) above, one from
a pool of 256 biotinylated adaptors is used. Each adaptor of the
pool has a four-nucleotide 5' end overhang wherein the sequence is
one of all possible sequences. The second digestion with class-IIS
restriction enzymes described in (3) above is not carried out.
In this modified method, an RNA population is classified into 768
groups since 256 adaptors and 3 anchored oligo-dT primers are
used.
Further, in Method I, a mixture of the following oligonucleotides
may be used as primers when converting the total RNA from a cell or
tissue into cDNA with a reverse transcriptase: ##STR1##
When such primers are used, there can be obtained cDNA molecules
which have T, G or C adjacent to poly (A) on the 5' side and a
6-base sequence added to the outside (3' side) of poly A) (see FIG.
2).
In this case, amplification is carried out by using any one of
5'OH-GGATCCT.sub.16 A-3' [instead of the above anchored oligo-dT
primer d(T).sub.25 A],5'OH-CAGCTGT.sub.16 C-3' [instead of the
above d(T).sub.25 C] and 5'OH-CTCGAGT.sub.16 G-3' [instead of the
above d(T).sub.25 G]. According to these procedures, analysis can
be more correct because, in addition to the specificity to cDNA of
only one base of the 3' end of primers, specificity to cDNA by the
6-base sequence of the 5' end of primers is utilized.
The target RNA for Method I of the invention is isolated and
purified from, for example, body tissues such as hematopoietic
tissues including bone marrow, peripheral blood, lymphocytes, etc.
or cells in a body fluid by conventional methods such as the
guanidine thiocyanate method and the phenol-chloroform extraction
method and then incubated with a reverse transcriptase and
deoxyribonucleotide triphosphates for reverse-transcription into
cDNA.
With respect to the class-IIS restriction enzymes used in Method I
of the invention, there is no particular limitation as long as the
restriction enzyme forms a 5'-protruding cohesive end consisting of
4 bases. Specific examples include commercially available Fok I
(Takara Shuzo) and Bsm AI and Bsm FI (both manufactured by NEB).
These three restriction enzymes may be used in combination for the
initial digestion (with one enzyme) and the subsequent digestion
(with two enzymes). In the modified method, one of these three
enzymes may be used.
In Method I of the invention, the biotinylated adaptor means the
adaptor consisting of i) an oligonucleotide of 24-27 nucleotides
which forms a 4-nt 5' protruding cohesive end wherein the outermost
base is a mixture of A, C, G and T, and inter three bases are one
of all possible sequences, and ii) an oligonucleotide which is
complementary to the oligonucleotide i), shorter by 4 bases and
biotinylated at the 5' end. Thus, there are 64 kinds of the
biotinylated adaptors.
In the modified method, the biotinylated adaptor means the adaptor
consisting of i) an oligonucleotide of 24-27 nucleotides which
forms a 4-nt 5' protruding cohesive end wherein the sequence is one
of all possible sequences, and ii) an oligonucleotide which is
complementary to the oligonucleotide i), shorter by 4 bases and
biotinylated at the 5' end. Thus, there are 256 kinds of the
biotinylated adaptors.
In order to allow E. coli DNA ligase to recognize the 3 bases of a
cDNA fragment adjacent to the binding site, phosphorylation of the
5' ends of the above adaptors which form cohesive ends is not
carried out.
In Method I of the invention, one of the two primers used for PCR
is an oligonucleotide having a common sequence with the
oligonucleotide constituting the adaptor described above which is
subjected to ligation to cDNA at 3' end (=adaptor-primer). As a
marker which labels this adaptor-primer, those which are used in
conventional analysis may be used. Specific examples include
fluorescent dyes, radioactive materials and enzymes.
In Method I of the invention, another primer used for PCR is one of
three oligo-dT primers, of which 3' end base is A, C or G. These
primers may be synthesized by a commercial nucleic acid
synthesizer.
[II] Hereinbelow, the steps, action and effects of Method II will
be described with reference to FIG. 3.
(1) First, DNA or cDNA of a cell or tissue is digested with a
class-II restriction enzyme (EcoRI is used in FIG. 3).
(2) An adaptor which is cohesive to ends generated by the class-II
enzyme is ligated to each of the DNA or cDNA fragments with T4 DNA
ligase (the adaptor must be phosphorylated at the 5' end which form
cohesive ends).
(3) The resultant DNA or cDNA sample is further digested with a
class-IIS restriction enzyme (Bsm AI is used in FIG. 3).
(4) One from a pool of 64 biotinylated adaptors described below is
ligated to each of the resultant cDNA or DNA fragments with E. coli
DNA ligase. Each adaptor has a 4-nt 5' end overhang wherein the
outermost base is a mixture of A, C, G and T, and the inner three
bases are one of all possible sequences. (These adaptors must not
be phosphorylated at their 5' ends which form cohesive ends.) At
this point, the restriction fragments are classified into 64
groups.
(5) Subsequently, the ligation sample is recovered with
streptavidin-coated paramagnetic beads and the DNA or cDNA
fragments are treated with a dilute alkaline solution. By these
operations, those oligonucleotides complementary to adaptor-primers
which will become inhibitors against PCR reaction are removed.
(6) Amplification by PCR is carried out using two adaptor-primers.
The one derived from the adaptor for ends generated by the class-II
enzyme is referred to as "adaptor-primer 1" and the other derived
from the biotinylated adaptors is referred to as "adaptor-primer
2". Details will be described afterwards.
(7) The amplified products are separated by denaturing
polyacrylamide gel electrophoresis and the sizes of the fragments
obtained are automatically recorded by a sequencer.
By using a class-II restriction enzyme, a class-IIS restriction
enzyme and 64 biotinylated adaptors in the operations described
above, the DNA or cDNA fragments generated by the class-II and
class-IIS restriction enzymes used can be separated and
displayed.
When cDNA which has been reverse-transcribed from RNA is used as a
target of analysis of Method II, a cDNA sample is prepared as
follows. RNA is isolated and purified from, for example, body
tissues such as hematopoietic tissues including bone marrow,
peripheral blood, lymphocytes, etc. or cells in a body fluid by
conventional methods such as the guanidine thiocyanate method and
the phenol-chloroform extraction method and then incubated with a
reverse transcriptase and deoxyribonucleotide triphosphates for
reverse-transcription into cDNA.
It is also possible to use DNA as a target of analysis of Method
II. In this case, a DNA sample is prepared as follows. DNA isolated
from, for example, body tissues such as hematopoietic tissues
including bone marrow, peripheral blood, lymphocytes, etc. or a
cell suspension in a body fluid is crushed with polytron or the
like and incubated with proteinase K to thereby degrade proteins.
Then, the reaction solution is subjected to phenol extraction and 2
volumes of ethanol is added to the aqueous layer for precipitation.
The precipitate is treated with ribonuclease (RNase) not containing
deoxyribonuclease (DNase) to thereby remove RNA.
With respect to the class-II restriction enzyme used in Method II
of the invention, there is no particular limitation as long as the
enzyme recognizes a specific base sequence, cut the site
specifically and generate cohesive ends. Specific examples include
EcoRI, BamHI, HindIII, BclII, BglII, SalI, XhoI, AccI, AvaI, Sau3A,
TaqI, NotI (which form 5'-protruding cohesive ends), and PstI,
SacI, KpnI, HaeII (which form 3'-protruding ends).
In particular, for the analysis of genomic DNA, restriction enzymes
which recognize a 8-base sequence (e.g., NotI) are preferably
used.
With respect to the class-IIS restriction enzyme used in Method II
of the invention, there is no particular limitation as long as the
enzyme generates 4-base 5'-protruding cohesive ends. Specific
examples include commercially available Fok I (Takara Shuzo) and
Bsm AI, Bsm FI, SfaNI and BbvI (all manufactured by NEB).
It is also possible to use 2 or 3 class-IIS restriction enzymes in
combination to increase the number of groups as described in Method
I.
In Method II of the invention, the adaptor consists of i) an
oligonucleotide of 20-30 nucleotides forming a 5'- (or 3'-)
overhang which is cohesive to ends of restriction fragments, and
ii) an oligonucleotide which is complementary to the above
oligonucleotide i) and shorter by the number of bases forming the
overhang.
The adaptor must be phosphorylated at its 5' end (which form a
cohesive end) so that an adaptor oligonucleotide is bound to the
DNA strand which is recovered with streptavidin-coated beads.
In Method II of the invention, the biotinylated adaptor means the
adaptor consisting of i) an oligonucleotide of 24-27 nucleotides
which forms a 4-nt 5' protruding cohesive end wherein the outermost
base is a mixture of A, C, G and T and inner three bases are one of
all possible sequences, and ii) an oligonucleotide which is
complementary to the oligonucleotide i), shorter by 4 bases and
biotinylated at the 5' end. Thus, there are 64 kinds of the
biotinylated adaptors.
In order to allow E. coli DNA ligase to recognize the 3 bases of a
cDNA fragment adjacent to the binding site, phosphorylation of the
5' end of the above biotinylated adaptor which form a cohesive end
is not carried out.
In Method II, one of the primers used in PCR is an oligonucleotide
having a common sequence with the oligonucleotide constituting the
adaptor described above which is subjected to ligation to cDNA or
DNA fragments at its 3' end (adaptor-primer 1)
In Method II of the invention, another primer used for PCR is an
oligonucleotide having a common sequence with the oligonucleotide
constituting the biotinylated adaptor described above which is
subjected to ligation to cDNA or DNA fragments at its 3' end
(adaptor-primer 2). As a marker which labels this adaptor-primer,
those which are used in conventional analysis may be used. Specific
examples include fluorescent dyes, radioactive materials and
enzymes.
These primers may be synthesized by using a commercial nucleic acid
synthesizer.
Potential target diseases which may be analyzed or diagnosed by
Method I or Method II of the invention include malignant tumors
such as brain tumor, stomach cancer, large intestine cancer, breast
cancer, uterus cancer, skin cancer, prostate cancer and malignant
melanoma; virus infections such as herpes group infections, chronic
hepatitis, cytomegalovirus infection and acquired immunodeficiency
syndrome; and multifactorial hereditary diseases such as diabetes
and hypertension.
PREFERRED EMBODIMENTS OF THE INVENTION
The present invention will be described in more detail below with
reference to the following Reference Example and Examples, which
are provided for the purpose of explanation and should not be
construed as limiting the scope of the invention.
Reference Example
Preparation of cDNA
(1) Purification of RNA by Ultracentrifugation
Mouse livers lyophilized in dry ice or liquid nitrogen were crushed
with a homogenizer. To the crushed material, 5 volumes of a GuCNS
solution was added at room temperature and agitated with a vortex
mixer.
To a 10 ml polyallomer tube, 3.5 ml of 5.7M CsCl/0.1M EDTA solution
was added and 6 ml of the resultant sample was layered over and
then centrifuged overnight at 15.degree. C. at 32000 rpm using
Beckman L70 centrifuge.
(2) Recovery of the RNA after Ultracentrifugation
The tube was removed from the rotor and all of the supernatant was
discarded. The tube wall was wiped and dried. Thereafter, the
precipitate was dissolved in 300 .mu.l of TE buffer.
(3) Ethanol Precipitation
To the aqueous layer, 1/10 volume of 3M potassium acetate (pH 5.0)
was added, mixed gently and placed in ice. Then, 2.5 volumes of
ice-cooled ethanol was added to the above mixture and mixed gently.
The resultant mixture was left at -8020 C. for several hours and
centrifuged at 4.degree. C. for 5 minutes to precipitate RNA. The
ethanol was discarded. The RNA precipitate was washed with
ice-cooled 70% ethanol and re-centrifuged to precipitate RNA. After
the ethanol was discarded, the RNA precipitate was dried.
The above precipitate was dissolved in about 100 .mu.l of sterile
distilled water per 1 g of the tissue cells to obtain an RNA
solution (RNA concentration=approx. 5 .mu.g/.mu.l).
(4) Preparation of cDNA Template
(4-1) Preparation of Single-Stranded cDNA Molecules
First, the resultant RNA and oligo-dT primers only were heated at
70.degree. C. for 2-3 minutes. Then, other reagents were added
thereto and kept at 37.degree. C. for 1 hour to synthesize cDNA
molecules.
______________________________________ * Composition of the
reaction solution ______________________________________ 5x Reverse
transcriptase buffer (Gibco-BRL) 4 .mu.l 2mM dNTP (Pharmacia) 4
.mu.l 0.1M DTT 2 .mu.l 10 pmol/.mu.l 5'-amino (dT).sub.18 (SEQ ID
NO:16) 1 .mu.l Total RNA (3 .mu.g) and distilled water 7.5 .mu.l
RNase inhibitor .sup.*1) (40 u/ .mu.l) (Toyobo) 0.5 .mu.l 200 u/
.mu.l M-MLV Reverse transcriptase.sup.*2) (Gibco-BRL) 1 .mu.l
______________________________________ .sup.*1) derived from human
placentas .sup.*2) Molony Murine Leukemia Virus
(4-2) Synthesis of Double-Stranded cDNA Molecules
The reaction solution described below was added to the
single-stranded cDNA reaction solution and kept at 16.degree. C.
for 2 hours to thereby prepare double-stranded cDNA molecules.
After the completion of the reaction, 3 .mu.l of 0.2M EDTA (pH 7.5)
and 2 .mu.l of 5M NaCl were added thereto. Then, phenol extraction
and ethanol precipitation were conducted and the precipitate was
dissolved in 240 .mu.l of distilled water.
______________________________________ * Composition of the
reaction solution ______________________________________ 10 mM
MgCl.sub.2 70 .mu.l 1M Tris-Cl (pH 7.5) 10 .mu.l 1M
(NH.sub.4).sub.2 SO.sub.4 1.5 .mu.l RNase H (Toyobo) (1 u/ .mu.l)
1.5 .mu.l E. coli DNA polymerase I (Toyobo) (10 u/.mu.l) 4.5 .mu.l
______________________________________
EXAMPLE 1
Analysis by the DNA Molecular Indexing Method
(1) Digestion with a Class-IIS Restriction Enzyme (Initial
Digestion)
The cDNA prepared in Reference Example described above was digested
with a restriction enzyme by keeping the cDNA in any one of the
following reaction solutions (A) to (C) at a specified temperature
under specified conditions.
______________________________________ * Composition of the
reaction solution (A) (usinq Fok I)
______________________________________ 10 .times. M buffer 10 .mu.l
0.1% BSA (Takara Shuzo) 10 .mu.l cDNA sample 80 .mu.l Fok I (Takara
Shuzo) (10 u/ .mu.1) 0.5 .mu.l Kept at 37 .degree. C. for 50
minutes to 1 hour. * Composition of the reaction solution (B)
(usinq Bsm AI) ______________________________________ 10 .times.
buffer for Bsm AI (NEB) 10 .mu.l 0.1% BSA 10 .mu.l cDNA sample 80
.mu.l Bsm AI (NEB) (5 u/ .mu.l) 1 .mu.l Kept at 55.degree. C. for
50 minutes to 1 hour. * Composition of the reaction solution (C)
(usinq Bsm FI) ______________________________________ 10 .times. H
buffer 10 .mu.l Distilled water 10 .mu.l cDNA sample 80 .mu.l Bsm
FI (NEB) (5 u/ .mu.l) 1 .mu.l Kept at 65 .degree. C. for 50 minutes
to 1 hour. ______________________________________
After the completion of each of the reactions (i), (ii) and (iii)
above, 3 .mu.l of 0.25M EDTA (pH 7.5) and 2 .mu.l of 5M NaCl were
added to each reaction solution. Then, phenol extraction and
ethanol precipitation were conducted and each precipitate was
dissolved in 70 .mu.l of distilled water.
(2) Addition of Adaptors
To the cDNA fragments obtained in (1) above, one of the following
adaptors having the sequences described below: ##STR2## (wherein B
represents biotin; N represents any of the four bases; and XYZ
represents one of the 64 possible sequences. When YZ=AA, AT, TA OR
TT C1G adaptor were used. Otherwise, C1T adaptors were used.)
were added and kept in the following reaction solution at
16.degree. C. overnight, to thereby ligate the cDNA fragments to
the adaptors.
______________________________________ * Composition of the
reaction solution ______________________________________ 10 .times.
E. coli DNA ligase buffer 1 .mu.l 100 mM (NH.sub.4).sub.2 SO.sub.4
1 .mu.l 1 pmol/ .mu.l adaptor solution 1 .mu.l cDNA sample diqested
with a class-IIS restriction enzyme 1 .mu.l E. coli DNA ligase 3
units Distilled water to make 10 .mu.l
______________________________________
(when the sequence XYZ did not contain G nor C, 5 pmol/.mu.l
adaptor solution and 30 units of E. coli DNA ligase were used.)
(3) Digestion with Class-IIS Restriction Enzymes (the Second
Digestion)
The cDNA fragments obtained in (2) above were further digested with
class-IIS restriction enzymes by keeping the cDNA sample at a
specified temperature under the conditions specified below:
(i) When a Fok I digest was used:
40 .mu.l of distilled water and 5 .mu.l of 10.times. H buffer were
added.
Bsm FI (1 unit) was added and kept at 65.degree. C. for 50
minutes.
Bsm AI (1 unit) was added and kept at 55.degree. C. for 50
minutes.
(ii) When a Bsm AI digest was used:
40 .mu.l of distilled water and 5 .mu.l of 10.times. T buffer were
added.
Fok I (1 unit) was added and kept at 37.degree. C. for 50
minutes.
Bsm FI (1 unit) was added and kept at 65.degree. C. for 50
minutes.
(iii) When a Bsm FI digest was used:
40 .mu.l of distilled water and 5 .mu.l of 10.times. M buffer were
added.
Fok I (1 unit) was added and kept at 37.degree. C. for 50
minutes.
Bsm AI (1 unit) and 1 .mu.l of 4M NaCl were added and kept at
55.degree. C. for 50 minutes.
(4) Amplification by PCR
(4-1) Recovery of the Adaptor Molecules with Paramagnetic Beads
Immediately before use, streptavidin-coated paramagnetic beads were
washed twice with 0.1% BSA and once with 1.times. B&W buffer
(10 mM Tris-Cl pH 7.5, 1M NaCl, 1 mM EDTA) and then suspended in an
equal volume of 1.times. B&W buffer.
To each sample, 15 .mu.l of 5M NaCl and 5 .mu.l of the paramagnetic
beads were added, left stationary for 15 minutes and washed with
1.times. B&W buffer once. Then, 10 .mu.l of 0.1M NaOH was added
thereto and left stationary for 5 minutes. Thereafter, the
resultant mixture was washed with 50 .mu.l of 0.1M NaOH once, with
1.times. B&W buffer once and with distilled water twice.
(4-2) PCR Reaction
The reaction solutions having the compositions described below were
placed in an Eppendorf tube and heated at 96.degree. C. for 1
minute to allow a prompt initiation of reactions. Then, a thermal
cycle consisting of 30 seconds at 94.degree. C. , 1 minute at
50.degree. C. and 1 minute at 72.degree. C. was repeated 25 to 35
times. After an extension step was carried out at 72.degree. C. for
20 minutes, the reaction solution was cooled to room
temperature.
______________________________________ * Compositions of the
reaction solutions (per one sample)
______________________________________ (i) Enzyme reaction solution
10 .times. PCR buffer for Stoffel fragment 1 .mu.l 2 mM dNTP 1
.mu.l 25 mM MgCl.sub.2 1.2 .mu.l Distilled water 4.3 .mu.l 10 u/
.mu.l Stoffel fragment .sup.*1) 0.05 .mu.l (ii) Primer reaction
solution 10 pmol/ .mu.l fluorescent-C1T 0.5 .mu.l 10 pmol/ .mu.l
d(T).sub.2 5 A [or d(T).sub.2 5 C, d(T).sub.2 5 2] .mu.l
______________________________________ .sup.*1) A portion of
AmpliTaq DNA polymerase fragment (Perkin Elmer)
The primers are used in the combinations of JOE-C1T and d(T).sub.25
A; FAM-C1T and d(T).sub.25 C; and TAMRA-C1T and d(T).sub.25 G.
[JOE: 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein, FAM:
5'-carboxyfluorescein, TAMRA: 6-carboxy-tetramethyl rhodamine (all
manufactured by Perkin Elmer; the sequence of C1T:
d(GTACATATTGTCGTTAGAACGCT)(SEQ ID NO:11)].
Alternatively, when C1G adaptors were used, the composition of the
primer reaction solution is:
______________________________________ 10 pmol/.mu.l
fluorescent-C1G 0.5 .mu.l 10 pmol/.mu.l d(T).sub.25 A [or
d(T).sub.25 C, d(T).sub.25 2] .mu.l
______________________________________
The primers are used in the combinations of JOE-C1G and d(T).sub.25
A; FAM-C1G and d(T).sub.25 C; and TAMRA-C1G and d(T).sub.25 G.
[JOE: 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein, FAM:
5'-carboxyfluorescein, TAMRA: 6-carboxy-tetramethyl rhodamine (all
manufactured by Perkin Elmer; the sequence of C1G:
d(GTACATATTGTCGTTAGAACGCG)(SEQ ID NO:12)].
(4-3) Preparation of Electrophoresis Samples
From each of the reaction products, a sample was taken as follows:
1 .mu.l from the combination of FAM-C1 and d(T).sub.25 C, 3 .mu.l
from the combination of JOE-C1 and d(T).sub.25 A and 3 .mu.l from
the combination of TAMRA-C1 and d(T).sub.25 G. To each sample, 5
.mu.l of T4 DPase solution having the following composition was
added and reacted at 37.degree. C. for 40 minutes.
______________________________________ Composition of T4 DPase
solution (per one sample) ______________________________________ 10
.times. M buffer 0.5 .mu.l 2 mM dNTP 0.5 .mu.l Distilled water 4
.mu.l T4 DNA polymerase (Toyobo) 1 unit
______________________________________
After ethanol precipitation of the reaction solution, 3.5 .mu.l of
a buffer (80% formaldehyde, 10 mM EDTA, 6 mg/ml blue dextran) was
added to the sample (i.e., precipitate), heated at 95.degree. C.
for 4 minutes, then immediately applied to the sample well of ABI
373A electrophoresis apparatus (Perkin Elmer) and run (at a
constant electric power of 30W for 13 hours).
FIG. 4 shows one example of the electrophoresis patterns
obtained.
EXAMPLE 2
Analysis by the DNA Molecular Indexing Method
(1) Digestion with a Class-II Restriction Enzyme
The cDNA prepared in Reference Example described above was digested
with a restriction enzyme by keeping the cDNA in the following
reaction solution at a specified temperature under specified
conditions.
______________________________________ * Composition of the
reaction solution (usinq EcoRI)
______________________________________ 10 .times. hiqh salt buffer
(attached to the enzyme) 5 .mu.l cDNA Sample 45 .mu.l EcoRI (Toyobo
or Takara Shuzo) 5 units ______________________________________
Kept at 37.degree. C. for 1 hour.
______________________________________
After the completion of the reaction, phenol extraction and ethanol
precipitation were carried out and the total precipitate was used
for the subsequent reaction.
(2) Addition of Adaptors
To the cDNA fragments obtained in (1) above, the following adaptors
##STR3## were ligated by keeping the cDNA sample in the following
reaction solution at 16.degree. C. for 16 hours or more.
______________________________________ * Composition of the
reaction solution ______________________________________ 10 .times.
ligation buffer (similar to Toyobo's) 2 .mu.l 2.5 pmol/ .mu.l EcoRI
adaptors 2 .mu.l T4 DNA ligase 150 units Total volume 20 .mu.l
______________________________________
After the completion of the reaction, phenol extraction and ethanol
precipitation were carried out and the total precipitate was used
for the subsequent reaction.
(3) Digestion with a Class-IIS Restriction Enzyme
The cDNA treated in (2) above was further digested with a
restriction enzyme by keeping the cDNA sample in the following
reaction solution at a specified temperature under specified
conditions.
______________________________________ * Composition of the
reaction solution (using Bsm AI)
______________________________________ 10 .times. buffer for Bsin
AI(NEB) 10 .mu.l 0.1% BSA 10 .mu.l cDNA sample 80 .mu.l Bsm AI
(NEB) (5u/ .mu.l) 0.5 .mu.l
______________________________________
Kept at 65.degree. C. for 50 minutes to 1 hour.
After the completion of the reaction, phenol extraction and ethanol
precipitation were carried out and the precipitate was dissolved in
30 .mu.l of purified water.
(4) Addition of Biotinylated Adaptors
To the cDNA fragments obtained in (3) above, the following
adaptors: ##STR4## (wherein B represents biotin; N represents any
of the four bases; and XYZ represents one of the 64 possible
sequences. When YZ=AT or TA, C1G sequences were used. Otherwise,
C1T sequences were used.)
were ligated by keeping the cDNA sample in the following reaction
solution at 16.degree. C. overnight.
______________________________________ * Composition of the
reaction solution ______________________________________ 10 .times.
E. coli DNA ligase buffer 1 .mu.l 100 mM (NH.sub.4).sub.2 SO.sub.4
1 .mu.l 1 pmol/ .mu.l adaptor solution 1 .mu.l cDNA fragments
diqested with 1 .mu.l a class-IIS restriction enzyme E. coli DNA
ligase 3 units Distilled water to make 10 .mu.l
______________________________________
(when the sequence XYZ did not contain G nor C, 5 pmol/.mu.l
adaptor solution and 6 units of E. coli DNA ligase were used.)
(5) Amplification by PCR
(5-1) Recovery of the Adaptor Molecules with Paramagnetic Beads
Immediately before use, streptavidin-coated paramagnetic beads were
washed twice with 0.1% BSA and once with 1.times. B&W buffer
(10 mM Tris-Cl pH 7.5, 1M NaCl, 1 mM EDTA) and then suspended in an
equal volume of 1.times. B&W buffer.
To the sample, 15 .mu.l of 5M NaCl and 5 .mu.l of the paramagnetic
beads were added, left stationary for 15 minutes and washed with
1.times. B&W buffer once. Then, 10 .mu.l of 0.1M NaOH was added
thereto and left stationary for 5 minutes. Thereafter, the
resultant mixture was washed with 50 .mu.l of 0.1M NaOH once, with
1.times. B&W buffer once and with distilled water twice.
(5-2) PCR Reaction
The reaction solutions having the compositions described below were
placed in an Eppendorf tube and heated at 96.degree. C. for 1
minute to allow a prompt initiation of reactions. Then, a thermal
cycle consisting of 30 seconds at 94.degree. C., 1 minute at
50.degree. C. and 1 minute at 72.degree. C. was repeated 25 to 35
times. After an extension step was carried out at 72.degree. C. for
20 minutes, the reaction solution was cooled to room
temperature.
______________________________________ * Compositions of the
reaction solutions (per one sample)
______________________________________ (i) Enzyme reaction solution
10 .times. PCR buffer for Stoffel fragment 1 .mu.l 2 mM dNTP 1
.mu.l 25 mM MgCl.sub.2 1.2 .mu.l Distilled water 4.3 .mu.l 10 u/
.mu.l Stoffel fragment .sup.*1) 0.05 .mu.l (ii) Primer reaction
solution 10 pmol/ .mu.l fluorescent-C1S primer 0.5 .mu.l 10 pmol/
.mu.l .lambda. gt10 forward primer 0.5 .mu.l
______________________________________ .sup.*1) A portion of
AmpliTaq DNA polymerase fragment (Perkin Elmer)
The two kinds of primers having the following sequences are used in
combination: ##STR5##
(5-3) Preparation of Electrophoresis Samples
A 3 .mu.l sample was taken from the reaction products and 5 .mu.l
of T4 DPase solution having the following composition was added
thereto. The resultant mixture was reacted at 37.degree. C. for 40
minutes.
______________________________________ * Composition of T4 DPase
solution (per one sample) ______________________________________ 10
.times. M buffer 0.5 .mu.l 2 mM dNTP 0.5 .mu.l Distilled water 4
.mu.l T4 DNA polymerase (Toyobo) 1 unit
______________________________________
After ethanol precipitation of the reaction solution, 3.5 .mu.l of
a buffer (80% formaldehyde, 10 mM EDTA, 6 mg/ml blue dextran) was
added to the sample (i.e., precipitate), heated at 95.degree. C.
for 4 minutes, then immediately applied to the sample well of ABI
373A electrophoresis apparatus (Perkin Elmer) and run (at a
constant electric power of 30W for 13 hours).
FIG. 5 shows one example of the electrophoresis patterns
obtained.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 16 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE:
other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TTTTTTTTTTTTTTTTTTTTTTTTTA26 (2) INFORMATION FOR SEQ ID NO:2: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:2: TTTTTTTTTTTTTTTTTTTTTTTTTC26 (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:3: TTTTTTTTTTTTTTTTTTTTTTTTTG26 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:4: GGATCCTTTTTTTTTTTTTTTTA23 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:5: CAGCTGTTTTTTTTTTTTTTTTC23 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:6: CTCGAGTTTTTTTTTTTTTTTTG23 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:7: GTACATATTGTCGTTAGAACGCT23 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:8: NNNNAGCGTTCTAACGACAATATGTAC27 (2) INFORMATION FOR SEQ ID
NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:9: GTACATATTGTCGTTAGAACGCG23 (2) INFORMATION FOR SEQ ID
NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:10: NNNNCGCGTTCTAACGACAATATGTAC27 (2) INFORMATION FOR SEQ
ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY:
unknown (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:11: GTACATATTGTCGTTAGAACGCT23 (2)
INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic
acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GTACATATTGTCGTTAGAACGCG23 (2) INFORMATION FOR SEQ ID NO:13: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii)
MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:13: AATTCTTAACCAGGCTGAACTTGCTC26 (2) INFORMATION FOR SEQ ID
NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:14: GAGCAAGTTCAGCCTGGTTAAG22 (2) INFORMATION FOR SEQ ID
NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:15: GTACATATTGTCGTTAGAACGC22 (2) INFORMATION FOR SEQ ID
NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:16: TTTTTTTTTTTTTTTTTT18
__________________________________________________________________________
* * * * *