U.S. patent number 5,656,493 [Application Number 08/199,505] was granted by the patent office on 1997-08-12 for system for automated performance of the polymerase chain reaction.
This patent grant is currently assigned to The Perkin-Elmer Corporation. Invention is credited to Larry Johnson, Richard A. Leath, Louis M. Mezei, Kary B. Mullis, Timothy J. Wennberg, Joseph T. Widunas.
United States Patent |
5,656,493 |
Mullis , et al. |
August 12, 1997 |
System for automated performance of the polymerase chain
reaction
Abstract
There is disclosed herein a machine for performing nucleic acid
amplification under computer control. The machine utilizes any one
of a number of heating and cooling systems under control of a host
computer which directs the heating and cooling systems to heat and
cool a reaction-chamber-containing heat exchanger at appropriate
times in the process. The reaction chambers are pre-loaded with the
nucleic acid(s) to be amplified, a thermostable enzyme to catalyze
polymerization, specific oligonucleotide primers, and four
different nucleotide triphosphates. Also disclosed is the process
for the amplification chain reaction implemented by the machine,
which utilizes a thermostable enzyme.
Inventors: |
Mullis; Kary B. (LaJolla,
CA), Johnson; Larry (San Jose, CA), Leath; Richard A.
(Berkley, CA), Wennberg; Timothy J. (Mariposa, CA),
Mezei; Louis M. (Madison, WI), Widunas; Joseph T.
(Freemont, CA) |
Assignee: |
The Perkin-Elmer Corporation
(Norwalk, CT)
|
Family
ID: |
27533926 |
Appl.
No.: |
08/199,505 |
Filed: |
February 18, 1994 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
21624 |
Feb 22, 1993 |
5333675 |
|
|
|
709374 |
Jun 3, 1991 |
|
|
|
|
899061 |
Aug 22, 1986 |
|
|
|
|
833368 |
Feb 25, 1986 |
|
|
|
|
709374 |
|
|
|
|
|
716975 |
Mar 28, 1985 |
|
|
|
|
Current U.S.
Class: |
435/286.1;
236/1C; 236/15BG; 236/91R; 236/97; 422/50; 422/62; 435/285.1;
435/287.2; 435/6.12; 435/91.1; 435/91.2 |
Current CPC
Class: |
B01J
19/0046 (20130101); B01L 7/52 (20130101); C12Q
1/686 (20130101); C12Q 1/686 (20130101); B01J
2219/00495 (20130101); B01J 2219/0059 (20130101); B01J
2219/00689 (20130101); B01J 2219/00722 (20130101); C40B
40/06 (20130101); C40B 60/14 (20130101); C12Q
2537/101 (20130101) |
Current International
Class: |
B01L
7/00 (20060101); B01J 19/00 (20060101); C12Q
1/68 (20060101); C12M 003/02 (); C12M 001/00 ();
G01N 021/00 (); C12N 015/00 () |
Field of
Search: |
;435/6,183,91.1,91.2,286.11,287.1,287.2,285.1
;536/23.1,24.3,24.33,25.3 ;935/76,77,85,87,88 ;422/50,62
;236/91R,97,1C,15BG |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0110408 |
|
Nov 1983 |
|
EP |
|
171140 |
|
May 1984 |
|
EP |
|
0 325 763 |
|
Feb 1989 |
|
EP |
|
2413708 |
|
Dec 1977 |
|
FR |
|
2650593 |
|
May 1977 |
|
DE |
|
53-99063 |
|
Aug 1978 |
|
JP |
|
2161815 |
|
Jan 1986 |
|
GB |
|
Other References
"PC Application Ideas" Instruments and Control Systems (Oct. 1980).
.
Techne TP-16 Operating Manual May 1984. .
Techne TP-16 Operating Manual Dec. 1984. .
Smith, M., Appl. of Synthetic Oligodeoxyribonucleotides . . . pub.
in Nucleic Acids Synthesis: Applications to Molecule Biology and
Genetic Engineering . . . Nucleic Acids Research--Nucleic Acids
Symposium Series No. 7, pp. 387-396 (1980). .
Koster, H., Introduction, pub. in Nucleic Acids Synthesis:
Applications to Molecular Biology and Genetic Engineering . . .
Nucleic Acids Research--Nucleic Acids Symposium Series No. 7, pp.
1-4 (1980). .
Agarwal et al., Nature 277, 27 (1970). .
Kleppe et al., Studies on Polynucleotides . . . , J. Molecular
Biology, 56, 1971, pp. 341-361. .
Panet et al., Studies on Polynucleotides . . . , J. Biological
Chemistry, 242(16), 1974, pp. 5213-5221. .
Khorana, Research Proposal Submitted to the Division of Biological
Sciences, National Science Foundation re: NSF Grant, Prop.No.
GB-36881X, Grant Prop.No. PCM73-06757, sub. Oct. 11, 1972, funded
for the period Feb. 1, 1973 through Jan. 31, 1978. .
Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, 1982. .
Wallace et al., The use of synthetic oligonucleotides as
hybridization probes . . . , Nucleic Acids Res., 9:4, pp. 879-894
(1981). .
Suggs et al., Use of synthetic oligonucleotides as hybridization
probes . . . PNAS USA, 78:11, pp. 6613-6617, (1981). .
Suggs et al., Use of synethetic oligodeoxyribo-nucleotides,
Developmental Biology Using Purified Genes, pp. 683-693, Academic
Press, 1981. .
Goeddel et al., Human leukocyte interferon produced by E. coli is
biologically active, Nature, 287, pp. 411-416 (1980). .
Wallace et al., Directed deletion of a yeast transfer RNA
intervening sequence, Science, 209, pp. 1395-1400 (1980). .
Wallace et al., A set of synthetic oligodeoxy-ribonucleotide
primers for DNA sequencing in the plasmid vector pBR322, Gene, 16,
pp. 21-26 (1981). .
Hong, Sequencing of large double-stranded DNA using the dideoxy
sequencing technique, Bioscience Reports, 2, pp. 907-912 (198).
.
Smith et al., Sequence of the gene for Iso-1-Cytochrome c in
Saccharomyces cerevisiae, Cell, 16, 753-761 (1979). .
Hong, A method for sequencing single-stranded cloned DNA in both
directions, Bioscience Reports, 1, pp. 243-252 (1981). .
Sanger et al., Nucleotide sequence of Bacteriophage .lambda. DNA,
J. Molecular Biology, 162, pp. 729-773 (1982). .
Zagursky et al., Rapid and easy sequencing of large linear
double-stranded DNA and supercoiled plasmid DNA, Gene Anal. Techn.,
2, pp. 89-94, (1985). .
Itakura et al., Synthesis and use of synthetic oligonucleotides,
Ann. Rev. Biochem, 53, pp. 323-356, (1984). .
Yansura et al., Studies on gene control regions IX. The effect of
hypoxanthine-substituted lac operators on the lac operator-lac
repressor interaction, J. Mol. Biol., 133, pp. 117-135 (1979).
.
Goeddel et al., Studies on gene control regions VI. The 5-methyl of
thymine, a lac repressor recognition site, Nucleic Acids Research,
4:9, pp. 3039-3054 (1977). .
Gergen et al., Filter replicas and permanent collections of
recombinant DNA plasmids, Nucleic Acids Research, 7:8, pp.
2115-2136 (1979). .
Rossi et al., An alternate method for synthesis of double-stranded
DNA segments, J. Biol. Chem., 257:16, pp. 9226-9229 (1982). .
Szostak et al., Hybridization with synthetic oligonucleotides,
Methods in Enzymology, 68, pp. 419-428 (1979). .
Zoller et al., Laboratory methods: oligonucleotide-directed
mutagenesis: a simple method using two oligonucleotide primers and
a single stranded DNA template, DNA, 3:6, pp. 479-488 (1984). .
Woo, A sensitive and rapid method for recombinant phage screening,
Methods in Enzymology, 68, pp. 389-395 (1979). .
Stetler et al., Isolation of a cDNA clone for the human HLA-DR
antigen .alpha. chain by using a synthetic oligonucleotide as a
hybridization probe, PNAS USA, 79, pp. 5966-5970 (1982). .
Cavalieri et al., DNA polymerase: evidence for multiple molecular
species, PNAS USA, 59, pp. 951-958 (1968). .
Yoshida et al., Multiple Molecular Species of Escherichia coli DNA
polymerase, PNAS USA, 68:1, pp. 200-204 (1971). .
Goulian et al., Enzymatic synthesis of DNA, XXIV. Synthesis of
infectious phage .phi.X174 DNA, PNAS USA, 58, pp. 2321-2328 (1967).
.
Maniatis et al., Chain Length Determination of Small Double
Stranded and Single Stranded DNA Molecules by Polyacrylamide Gel
Electrophoresis, Biochemistry, 14: 17, pp. 3787-3794 (1975). .
Sanger et al., Use of DNA Polymerase I Primed by a Synthetic
Oligonucleotide to Determine a Nucleotide Sequence in Phage F1 DNA,
PNAS USA, 70:4, pp. 1209-1213 (1973). .
Deininger, Approaches to Rapid DNA Sequence Analysis, Anal.
Biochemistry, 135, 247-263 (1983). .
Tecam Dry Heat Baths, Techne Catalog 7051081, 1986. .
Techne (OG-1 Black Digestor), Catalog 7051091, 1986. .
Techne (Dri-Block 08-3), Catalog 7051101, 1986. .
Histomat advertisement, R. Jung GmbH, Oct., 1980. .
Techne Brochure for Temperature programmer TP-16, Dec., 1984. .
P. S. Martin, et al., J. Parent, Sci. Tech., p. 63. .
Techne Ad for Dri Block PHC-1. .
Techne TP-16 Temperature Programmer Advertisement. .
Biores b.v. Bioexcellence TAQ-Polymerase and Ampliclone Kit Ad.
.
Techne PHC-2 Ad. .
Techne PCH-2 Temperature Cycler Ad. .
Techne Flow Coolers FC-200 and FC200 and Dip Cooler RU-200. .
Techne Tempunit or Tempette Immersion Circulators Ad. .
Brookfield Test Chamber. .
Cole-Parmer Instr. Co. 1985-86 Catalog. .
IEEE Transactions on Biomedical Engineering, vol. BME-29, No. 8,
Aug. 1982, pp. 557-568 V.J. Anselmo, et al. "Programmable
Temperature Control System For Biological Materials". .
"Advances in Laboratory Automation Robotics 1984" By Zymark Corp.
.
"Studies on Polynucleotides--The Linkage of Deoxyribopolynucleotide
Templates to Cellulose and Its Use in Their Replication" by Panet
and Khorara, The Journal of Biological Chemistry, vol. 249, No. 16,
Issue of Aug. 25, pp. 5213-5221 (1974). .
"Studies on Polynucleotides--Hybridization of Polydeoxynucleotides
With Tyrosine Transfer RNA Sequences to the r-Strand of .phi.80 psu
DNA", by Miller et al., J. Mol. Biol. (1972) 72, pp. 503-522. .
Automation of Microliter Plate Chromogenic Substrate LAL Endotoxin
Assay Method by Use of a Modified Pro/Pette Express Sysstem, Martin
et al., J. Parent Sci. Tech. vol. 40, No. 2, pp. 61-66, Mar.-Apr.,
1986. .
Forma Scientific Advertisement, Analytic Chemistry, Aug. 8, 1982.
.
Cole-Parmer Instrument Co., 1985-86 Catalog (compiled 1984). .
Lake Shore Cryotronics, Inc., Review of Scientific Instruments,
Jul. 1980. .
Barber-Colman Co., 1980. .
Techne Brochure, 1982. .
Techne Brochure, 1988. .
"Amino Acid Analysis System" Rev. Sci. Instrum. 51(7), Jul. 1980.
.
"Studies on Polynucleotides--Repair Replication of Short Synthetid
DNA's as Catalyzed by DNA Polymerase" by Kleppe, et al., J. Mol.
Biol. (1971) 56, pp. 341-461. .
Studies on Polynucleotides--Total Synthesis of the Structural Gene
for an Alanic Transfer Ribonucleic Acid from Yeast, by Khorana et
al., J. Mol. Biol. (1972) 72, pp. 209-217. .
P.A. Martin, et al., J. Parent. Sci Tech., 40:61-66 (1986). .
Zymark, Advances in Lab Auto Robotics 1989 pp. 1-17. .
Panet et al Studies on Polynucleotides T Bio Chem vol. 249, No. 16,
Aug. 1974. .
Saiki et alii, "Enzymatic Amplification of .beta.-Globin Genomic
Sequences and Restriction Site Analysis for Diagnosis of Sickle
Cell Anemia", Science, vol. 230, No. 4732, pp. 1350-1354, 1985.
.
Techne, Operating Instructions, TP-16, Temperature Programmer, Jun.
19, 1985..
|
Primary Examiner: Sisson; Bradley L.
Attorney, Agent or Firm: Hone; William J. Ferrara; Richard
P.
Parent Case Text
This application is a continuation of Ser. No. 08/021,624, filed
Feb. 22, 1993, now U.S. Pat. No. 5,333,675, which is a continuation
of Ser. No. 709,374, filed Jun. 3, 1991, now abandoned, which is a
continuation of Ser. No. 899,061, filed Aug. 22, 1986, now
abandoned, which is a continuation-in-part of application Ser. No.
833,368, filed Feb. 25, 1986, now abandoned, which is hereby
incorporated by reference. Application Ser. No. 791,308, filed Oct.
25, 1985, now U.S. Pat. No. 4,683,202, is hereby incorporated by
reference, and is a continuation-in-part of application Ser. No.
716,975, filed Mar. 28, 1985, now abandoned, which is hereby
incorporated by reference. Microfiche Appendices A-G are attached,
including one sheet of microfiche comprising 88 frames.
Claims
We claim:
1. A thermal cycling system for performing a polymerase chain
reaction amplification protocol comprising multiple cycles of the
steps of thermal denaturation of double-stranded DNA, primer
hybridization to single-stranded DNA, and template-dependent primer
extension by a DNA polymerase, comprising:
at least one reaction mixture comprising at least one single- or
double-stranded nucleic acid sequence to be amplified, four
different deoxyribonucleotides, and a pair of
oligodeoxyribonucleotide primers for each said at least one nucleic
acid sequence to be amplified,
for each said at least one reaction mixture, a heat-conducting
reaction chamber,
in thermal contact with each said at least one chamber, a variable
temperature heating and cooling system, the temperature of said
heating and cooling system being computer controllable, and
a user-initiable computer controllingly coupled to said heating and
cooling system, said computer being programmed to vary the
temperature of said heating and cooling system and thereby to vary
the temperature of said at least one chamber in accordance with
said polymerase chain reaction protocol upon initiation by a
user.
2. The thermal cycling system of claim 1, wherein said multiple
cycles of the polymerase chain reaction protocol include a
repetitive cycle which includes denaturation in the range of from
90.degree. to 105.degree. C. for up to 4 minutes.
3. The thermal cycling system of claim 2, wherein said cycle is
repeated at least 15 times.
4. The thermal cycling system of claim 1 comprising a plurality of
reaction mixtures, each in a separate reaction chamber, and wherein
said heating and cooling system includes a metal block having a
plurality of recesses shaped to fit said chambers and fluid flow
channels, a temperature-controlled cooling fluid reservoir, and
controllable pumping apparatus for pumping a cooling fluid from
said cooling fluid reservoir through said channels in said
block.
5. The thermal cycling system of claim 4, wherein said multiple
cycles of the polymerase chain reaction protocol include a
repetitive cycle which includes bring said chamber to a
hybridization temperature in the range of from 35.degree. to
65.degree. C. for from 0.5 to 5 minutes, followed by extension
product synthesis at a temperature in the range of from 40.degree.
to 80.degree. C. for from 0.5 to 40 minutes and then by heating
said chamber to a denaturation temperature in the range of from
90.degree. to 105.degree. C. for from 0.5 to 4 minutes.
6. The thermal cycling system of claim 5, wherein said cycle is
repeated at least 15 times.
7. The thermal cycling system of claim 4, wherein said multiple
cycles of the polymerase chain reaction protocol include a
repetitive cycle which includes bringing said chamber to a
hybridization temperature in the range of from 35.degree. to
65.degree. C., followed by heating said chamber to a denaturation
temperature in the range of from 90.degree. to 105.degree. C. for
from 0.5 to 4 minutes.
8. The thermal cycling system of claim 7, wherein said cycle is
repeated at least 15 times.
9. The thermal cycling system of claim 4, wherein said heating and
cooling system comprises a temperature-controlled heating fluid
reservoir and controllable pumping apparatus for pumping a heating
fluid from said heating fluid reservoir through said channels in
said block.
10. The thermal cycling system of claim 4, further comprising a
computer-controlled liquid handler having at least one reagent
container and pipettes for transferring reagent from said at least
one reagent container into said chamber in response to a transfer
control signal.
11. The thermal cycling system of claim 4, wherein said heating and
cooling system comprises in electrical heater.
12. The thermal cycling system of claim 1, wherein said heating and
cooling system has the capability to cool said at least one
reaction mixture to temperatures suitable for reactions utilizing
E. coli DNA polymerase I.
13. The thermal cycling system of claim 1, wherein said heating and
cooling system has the capability to cool said at least one
reaction mixture to temperatures suitable for reactions utilizing
Klenow fragment of E. coli DNA polymerase I.
14. The thermal cycling system of claim 1, wherein said steps of
hybridization and extension are performed at the same
temperature.
15. The thermal cycling system of claim 1, wherein said step of
extension is performed at a temperature higher than said step of
hybridization.
16. The thermal cycling system of claim 1 comprising a plurality of
reaction mixtures and a plurality of reaction chambers, and wherein
said heating and cooling system includes a metal block having a
plurality of recesses shaped to fit said chambers and a Peltier
device.
17. The thermal cycling system of claim 1, wherein said programmed
computer is user-programmable in real time.
Description
BACKGROUND OF THE INVENTION
The invention pertains to the field of chain reactions for
amplifying DNA or RNA (nucleic acids), and, more particularly, to
the field of machines for automatically performing this process
through temperature cycling.
Methods described in the past for synthesizing nucleic acid
sequences from an existing sequence, for example, the
phosphodiester and phosphotriester methods [see Narang et al.,
Meth. Entymol. 68, 90 (1979); and Brown et al., Meth. Enzymol. 68,
109 (1979), respectively], are not practical to produce large
amounts of nucleic acid sequences. Such methods are laborious and
time-consuming, require expensive equipment and reagents, and have
a low overall efficiency.
There are methods for producing nucleic acid sequences in large
amounts from small amounts of an existing sequence. Such methods
involve cloning of a nucleic acid sequence in an appropriate host
system, and culturing the host, wherein the vector in which the
nucleic acid sequence has been inserted is replicated, resulting in
copies of the vector and hence the Sequence. See T. Maniatis, et
al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, pp. 390-401 (1982); and U.S. Pat. Nos. 4,416,988 and
4,403,036. The original sequence can also be organically
synthesized before insertion in a vector. See U.S. Pat. No.
4,293,652.
A method, described by Saiki et al., Science, 230, 1530-1534
(1985), has been devised for amplifying one or more specific
nucleic acid sequences or a mixture thereof using primers,
nucleotide triphosphates, and an agent for polymerization, such as
DNA polymerase, The extension product of one primer, when
hybridized to the other, becomes a template for the production of
the desired specific nucleic acid sequence, and vice versa. The
process is repeated as often as necessary to produce the desired
amount of the sequence. The method is referred to in the Science
article as Polymerase Chain Reaction or "PCR".
This method is especially useful for performing clinical tests on
the DNA or RNA from a fetus or other donor where large amounts of
the DNA or RNA are not readily available and more DNA or RNA must
be manufactured to have a sufficient amount to perform tests. The
presence of diseases which have unique DNA or RNA signatures can be
detected by amplifying a nucleic acid sample from a patient and
using various probe procedures to assay for the presence of the
nucleic acid sequence being detected in the test. Such test might
be prenatal diagnosis of sickle cell anemia, as described by Saiki
et al., supra, where the amplification of specific B-globin target
sequences in genomic DNA resulted in the exponential increase
(220,000 times) of target DNA copies, increasing sensitivity and
speed while reducing the complexity of diagnosis. Another test is
the diagnosis of the AIDS virus, which is thought to alter the
nucleic acid sequence of its victims.
Five patent applications which describe the amplification process,
PCR, are U.S. patent application Ser. No. 818,127, filed Jan. 10,
1986, now abandoned, U.S. Ser. No. 716,982, filed Mar. 28, 1985,
now U.S. Pat. No. 4,683,194, U.S. Ser. No. 791,308, filed Oct. 25,
1985, now U.S. Pat. No. 4,683,202, U.S. Ser. No. 828,144, filed
Feb. 7, 1986, now U.S. Pat. No. 4,683,195, and U.S. Ser. No.
839,331, filed Mar. 13, 1986, now abandoned, the disclosures of all
of which are incorporated herein by reference.
The amplification method, PCR, bears some similarity to the
molecular cloning methods described above, but does not involve
propagation of a host organism, avoiding the hazards and
inconvenience therein involved. In addition, the amplification
method does not require synthesis of nucleic acid sequences
unrelated to the desired sequence, and thereby obviates the need
for extensive purification of the product from a complicated
biological mixture. Finally, the amplification is more efficient
than the alternative methods for producing large amounts of nucleic
acid sequences from a target sequence and for producing such
sequences in a comparatively short period of time.
At first, the amplification procedure, PCR, described above was
carried out by hand in the laboratories. The manual process
involves a great deal of repetitive liquid handling steps and
incubations at controlled temperatures. This is not only
time-consuming and tedious, but it is also subject to error caused
by human operator attention span drift. Such errors could result in
a misdiagnosis of a genetic birth defect and an unnecessary
abortion or the lack of an abortion where a birth defect exists.
Further, such errors could result in misdiagnosis of sickle cell
anemia or other genetic disorders.
Further, certain nucleic acids amplify more efficiently than
others, so some nucleic acid sequence amplifications require more
amplification cycles than others because the cost of laboratory
labor can be high, and the risks to which a laboratory is subjected
are high in case of error in erroneously performing amplification,
there has arisen a need for a system which can automate the
amplification process.
SUMMARY OF THE INVENTION
The amplification process, PCR, maybe conducted continuously. In
one embodiment of an automated process, the reaction may be cycled
through a denaturing region, a reagent addition region, and a
reaction region. In another embodiment, the enzyme used for the
synthesis of primer extension products can be immobilized in a
column. The other reaction components can be continuously
circulated by a pump through the column and a heating coil in
series; thus the nucleic acids produced can be repeatedly denatured
without inactivating the enzyme.
One embodiment of a machine for automating the amplification
process utilizes a liquid handling system under computer control to
make liquid transfers of enzyme stored at a controlled temperature
in a first receptacle into a second receptacle whose temperature is
controlled by the computer to conform to a certain incubation
profile. The second receptacle stores the nucleic acid sequence to
be amplified plus certain reagents. The computer includes a user
interface through which a user can enter process parameters which
control the characteristics of the various steps in the sequence
such as the times and temperatures of incubation, the amount of
enzyme to transfer on each cycle into the second receptacle from
the first receptacle, as well as the number of cycles through the
amplification sequence that the user desires the machine to
perform. The first and second receptacles may be controlled in
temperature by use of three circulating fluid reservoirs and
solenoid operated valves. Of course, any other method for
controlling the temperatures of the receptacles will also work for
purposes of the invention, and the invention is not limited to the
use of heated and chilled circulating fluids. These solenoid
operated valves are coupled to the computer such that the proper
temperature fluid can be directed through the supporting structure
for the first and second receptacles at the proper times in the PCR
sequence under computer control. The first receptacle, which stores
enzyme to be added to the reaction well of the second receptacle,
is kept at a constant temperature. The second receptacle, which is
where the PCR reaction occurs, is switched under computer control
between two temperatures by the transmission of a control signal to
the solenoid operated valves at the proper time in the sequence to
gate either the hot fluid or the cold fluid through the support
structure of the second receptacle.
While the above-described machine increases the amount of nucleic
acid sequence which can be amplified per unit of labor, thereby
decreasing the possibility of error, it involves liquid handling,
where reagents must be continuously transferred at various cycles.
There is a need also for a machine which not only automates the
amplification process, but also makes it faster and more
convenient. This can be accomplished using an enzyme which is
thermostable, i.e., will not break down when subjected to
denaturing temperatures.
A second embodiment of the invention utilizes a temperature-cycling
instrument for implementing the amplification process when a
thermostable enzyme is employed. The use of a thermostable enzyme
avoids the need for liquid transferring of the enzyme, which is
necessitated when the enzyme is unstable in the presence of heat.
As used herein to describe enzymes, "thermostable" means stable at
temperatures above 90.degree. C. and "heat-stable" means stable at
temperatures 65.degree.-90.degree. C.
More specifically, this second embodiment of the invention herein
relates to an apparatus for performing automated amplification of
at least one specific nucleic acid sequence comprising:
a heat-conducting container for holding a reaction mixture
comprising a thermostable enzyme, said nucleic acid sequence(s) to
be amplified, four different nucleotide triphosphates, and one
oligonucleotide primer for each different specific sequence being
amplified, wherein each primer is selected to be substantially
complementary to different strands of each specific sequence, such
that the extension product synthesized from one primer, when it is
separated from its complement, can serve as a template for
synthesis of the extension product of the other primer;
means for heating, cooling, and maintaining said container to or at
any of a plurality of predetermined (user-defined) temperatures and
having an input for receiving a control signal controlling which of
said predetermined temperatures at or to which said container is
heated, cooled, or maintained; and
a computer means, coupled to the input of said means for heating
and cooling to generate the proper control signals to control the
temperature levels, temperature rate-of-change ramps, and timing of
the incubations at certain temperature levels.
A variation of the second embodiment of this invention also
provides an apparatus for performing automated amplification of at
least one specific nucleic acid sequence comprising:
a first means for holding a reaction mixture comprising said
nucleic acid sequence(s) to be amplified, four different nucleotide
triphosphates, a thermostable enzyme, and one oligonucleotide
primer for each different specific sequence being amplified,
wherein each primer is selected to be substantially complementary
to different strands of each specific sequence, such that the
extension product synthesized from one primer, when it is separated
from its complement, can serve as a template for synthesis of the
extension product of the other primer, said holding being carried
out at any selected temperature or plurality of temperatures;
and
a second means for automatically performing a predetermined
sequence of steps including causing said first means to heat its
contents for a first period and to cool its contents for a second
period.
In yet another variation of the second embodiment, the invention
herein provides an apparatus for performing an assay including
heating and cooling steps as part of the sequence of steps of the
assay comprising:
means for performing the sequence of steps wherein heating and
cooling steps would be beneficial; and
means in said means for performing for causing said heating and
cooling steps to be performed at the proper point in the sequence
of steps comprising the assay.
In a third embodiment, this invention provides a method for
amplifying at least one specific nucleic acid sequence comprising
the steps of:
using a computer-directed machine to heat to a predetermined
temperature for a predetermined time a sample of the nucleic acid
sequence(s) to be amplified, four different nucleotide
triphosphates, a thermostable enzyme, and one oligonucleotide
primer for each different specific sequence being amplified,
wherein each primer is selected to be substantially complementary
to different strands of each specific sequence, such that the
extension product synthesized from one primer, when it is separated
from its complement, can serve as a template for synthesis of the
extension product of the other primer (hereafter the mixture);
and
using a computer-directed machine to chill the mixture to a
predetermined temperature.
In a variation of the third embodiment, this invention provides a
method of amplifying at least one specific nucleic acid sequence
comprising the steps of:
a) using a computer-directed machine to issue a heat signal to a
heating apparatus to cause a reaction chamber to be heated for a
predetermined time to and/or at a predetermined temperature,
wherein said reaction chamber contains the mixture described
above;
b) using a computer-directed machine to issue a cool signal to a
cooling apparatus to cause said reaction chamber to be cooled for a
predetermined time to and/or at a predetermined temperature;
and
c) using a computer-directed machine to repeat the cycle consisting
of steps a through c when the elapsed time for the active cooling
signal equals a user-defined time if the number of cycles performed
thus far is less than a user-defined number of cycles.
The apparatus herein also generally contains a power supply for
operation, a structural system to contain all the elements of the
apparatus, and a keyboard and display panel to allow control of the
apparatus by an operator.
The receptacle which holds the reagents where the reaction occurs
has its temperature controlled by a computer to conform to a
certain incubation profile defined by the user. Circulating fluid
reservoirs (three for the first embodiment, two for the second) and
solenoid operated valves, or any other method, may be employed to
control temperature. The Peltier heat pumps available from
Materials Electronics Products Corporation in Trenton, N.J., may
also be used, as well as a water heat exchanger or any other
heating and cooling system which may be controlled by a
computer.
If solenoid-operated valves are employed, they are coupled to the
computer such that the proper temperature fluid can be directed
through the supported structure for the heat-conducting receptacle
at the proper times in the amplification process under computer
control. The receptacle is switched under computer control between
two temperatures by the transmission of a control signal to the
solenoid-operated valves at the proper time in the sequence to gate
either the hot fluid or the cold fluid through the support
structure of the receptacle. A temperature sensor coupled to the
reaction chamber and the computer is used to provide a signal
indicating the actual temperature. The computer compares the actual
temperature to the desired temperature. An error signal is
generated in this fashion which is used to control the apparatus
which heats and cools the reaction chambers. The computer also
keeps track of the elapsed time at particular temperatures to
implement the incubation periods in the protocol.
The basic process that the machine performs to implement the
amplification protocol after the starting materials are loaded into
the reaction well, in one embodiment using water baths, is as
follows.
The computer signals the solenoid-operated valves to gate the hot
fluid through the supporting structure for the reaction chamber
thereby heating the contents of the reaction well to the
temperature of the hot fluid.
The amount of time the hot fluid is gated "on" is measured by an
elapsed time counter.
The computer compares the elapsed time the hot fluid has been gated
"on" to a variable set in memory. In the preferred embodiment, this
variable can be changed by the user through the user interface. In
other embodiments, it may be fixed.
When the elapsed time matches the variable for the hot incubation,
the computer sends a signal to the solenoid-operated valves to stop
the hot fluid flow and gate the cold fluid flow through the
supporting structure for the reaction vessel.
In embodiments using temperature control feedback instead of
empirically determined "on" times for the hot and cold fluids, a
temperature profile versus time for the reaction chamber is
programmed into the computer via the user interface. This causes
the computer to control the reaction or reagent vessel temperature
in the sequence required by the particular amplification reaction
parameters. Such an embodiment uses a thermistor or other
temperature sensor to monitor the temperature of the reaction
chamber and generates an error signal derived by comparing the
actual temperature of the reaction chamber to the user-defined
temperature profile. The error signal is used to control a heat
pump or other heating and cooling apparatus to maintain the desired
temperature profile during the high temperature heat-up and high
temperature incubation and during the chill-down and
low-temperature incubation.
On either temperature feedback or empirically determined time
embodiments, the computer starts a timer and compares the elapsed
time for hot or cold fluid flow or the elapsed time at a particular
temperature to a user-defined variable stored in memory for each
segment or leg in the temperature profile. These variables can be
set by the user in the preferred embodiment through the user
interface. In embodiments where no temperature sensor is used, the
variable for proposed time of hot or cold fluid flow is empirically
determined by the user as the time it takes to heat or cool the
reaction vessel to a predetermined temperature from the starting
temperature plus the desired incubation time.
The above temperature profile control apparatus and methods for
embodiments using hot and cold fluid reservoirs and
solenoid-operated valves are equally applicable to embodiments
using Peltier heat pumps or other forms of heating and cooling
apparatus coupled to the reaction chamber or chambers.
In the first embodiment with a liquid handler for enzyme addition,
as soon as the elapsed time for gating the cold fluid matches the
variable, the computer sends signals to the liquid handler to cause
it to aspirate from the first receptacle an amount of enzyme
controlled by a user defined variable stored in the computer memory
and deposit it in the reaction well. In the preferred embodiment,
the computer sends the proper signals to cause the liquid handler
to mix the newly deposited enzyme with the pre-existing contents of
the reaction well. When multiple rows of enzyme and multiple rows
of reaction chambers are being used multiple rows of tips are used.
Each row of tips is mapped to a specific row of enzyme and to a
specific row of reaction chambers. Thus the tips in each row
contact only the enzyme and nucleic acid from their specified rows
of enzyme and reaction chambers. The tips from each row never
contact either enzyme in wells that have been used to store enzyme
transferred to other rows of reaction chambers with different
nucleic acids therein and never contact the nucleic acid in other
rows of reaction chambers other than the specifically designated
row of reaction chambers. This prevents cross contamination and the
attendant dangers posed thereby. Further, in the preferred
embodiment, the tips are stored in storage wells which are
completely enclosed such that each tip is separated by a physical
barrier from each other tip. This prevents any enzyme or nucleic
acid which clings to the tip after an enzyme transfer cycle from
accidentally being splashed, thrown or blown onto other tips to
cross contaminate them.
After the deposit of new enzyme, the computer starts a timer to
measure the time of a cold incubation at the temperature of the
cold fluid then flowing through the support structure of the
reaction well. When the elapsed time matches a variable stored in
the memory, preferably specified by the user, the first cycle is
done.
For all embodiments, the above process repeats itself for the
number of cycles specified by the user.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a general block diagram of a machine which can perform
the amplification process using the thermostable enzyme and Peltier
heat pumps to cycle the temperature of the reaction vessels.
FIG. 2 is a general block diagram of a machine which can perform
the thermostable enzyme amplification process herein using water
baths to cycle the temperature of the reaction vessels.
FIG. 3 is a diagram of a solid state heat pump and reaction chamber
heat exchanger structure.
FIG. 4 is a schematic diagram of the interface unit for a solid
state heat pump .
FIG. 5 is a diagram of a typical user-defined temperature
profile.
FIG. 6A and FIG. 6B comprise a first part and a second part
respectively, of a flow diagram for the control software for the
empirical embodiments which do not use feedback of the actual
reaction chamber temperature. FIGS. 6A and 6B may be referred to
collectively herein as "FIG. 6".
FIG. 7A and FIG. 7B comprise a first part and a second part,
respectively of a flow diagram for the control software for the
preferred embodiments which use actual temperature feedback signals
to monitor the actual temperature of the reaction chamber and 5
compare it to the desired temperature Profile. FIGS. 7A and 7B may
be referred to collectively herein as "FIG. 7".
FIG. 8 is a general block diagram of a machine with liquid handling
capability which can perform the PCR amplification process.
FIG. 9 is a flow chart of the process carried out by the machine of
FIG. 8.
FIG. 10 is a drawing of a typical liquid handler which can be used
for performing the liquid handling steps for the PCR amplification
protocol.
FIG. 11 is a block diagram of the electronics which control the
machine of FIG. 10 when doing the amplification protocol in any of
the embodiments with a liquid handler described herein.
FIGS. 12A-12C are detailed flow charts of the amplification
protocol steps carried out by the liquid handler using the software
of microfiche Appendix A on either a PRO/PETTE.RTM. or a
PRO/GROUP.RTM. machine.
FIG. 13 is a block diagram of another embodiment of a machine which
can perform the amplification protocol, with liquid handling
capability, with the computer monitoring the temperature of the
reaction chamber and controlling the temperature along a user
defined profile.
FIGS. 14A-14B are flow diagrams of the process flow implemented by
the embodiment shown in FIG. 13.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Amplification Machine Using Thermostable Enzyme and No Liquid
Handling
Referring to FIG. 1, there is shown a general block diagram of a
machine which can perform the nucleic acid amplification process
using the thermostable enzyme. The starting materials, comprised of
the nucleic acid samples to be amplified and the necessary
reagents, are initially loaded into a reaction well 40 in heat
exchanger 10. The heat exchanger 10 supports the reaction well 40,
which may be a recess machined into the heat exchanger, but
preferably is a plastic container which holds the fluids involved
in the reaction and which sits in a recess formed in heat exchanger
10 (hereafter sometimes referred to as plate 1). In the preferred
embodiment, heat exchanger 10 is a heat-conducting block,
preferably aluminum, with a plurality of recesses formed therein
sized to allow a given number of 0.5 ml (milliliter) Eppendorf
tubes to fit therein.
The purpose of the tubes is to line the reaction well to separate
the fluids from the walls of the recesses in the heat exchanger 10
to avoid cross contamination when the same reaction well is used to
amplify different nucleic acid sequences. The purpose of heat
exchanger 10 is to support the tubes and to act as a heat exchanger
to transfer thermal energy to and from the fluids stored in the
tubes in the reaction wells, such that the reaction components may
be incubated at various temperatures for user-defined times.
To that end, heat exchanger 10 must be structured in such a way
that the fluids in the reaction wells such as the reaction chamber
40 may be heated and cooled at the appropriate times in the process
and for the appropriate duration. Any structure or method may be
used to perform this heating and cooling function such as
electrical heating and refrigeration apparatus in or connected to
heat exchanger 10 such as a heat pump or Peltier or Thompson solid
state thermoelectronic coolers. It is only necessary that whatever
apparatus is used for this heating and cooling be capable of
reaching and sustaining the temperatures involved, and that the
apparatus for heating and cooling achieve the user-defined
temperature versus time profile.
In a preferred embodiment, pictured in FIG. 1, one such
electrically driven heating and cooling apparatus is a Peltier
solid state thermoelectric heat pump 12, a FRIGICHIP.RTM. device,
available from Melcor Corporation in Trenton, N.J. A conventional
heat pump using a compressor, an evaporator and a condenser will
also work for heat pump 12. Solid state heat pumps such as Peltier
devices are comprised of N and P type bismuth telluride in the form
of oriented polycrystalline ingots forming back to back PN
junctions and with the ends soldered to copper bus bars interfaced
with ceramic plates. FIG. 3 shows such an arrangement. These heat
pumps heat or cool by driving currents through them in particular,
known ways to move heat in either direction between a heat sink 14
and the heat exchanger 10. These solid state heat pumps have been
used by Gilford Instruments Corporation to heat and cool cuvettes,
and are available in wattage ranges up to and including 150 watts.
These devices are capable of cooling or heating a mass of material
to which they are thermally coupled to temperatures in a range from
-150 to +110 degrees centigrade. Such semiconductors could be
thermally coupled in known ways to heat exchanger 10 or could be
directly thermally coupled to the insert tubes or wells. Such
semiconductors can be easily controlled to reach and maintain
particular temperatures by modulating the currents which flow
through them in accordance with the desired temperature level
according to standard process control algorithms. The manner of
designing such a solid state heat pump system is published in an
application note on the FRIGICHIP.RTM. series FC solid state
thermoelectric heat pump by Melcor (990 Spruce Street, Trenton,
N.J. 08648 (609)-393-4178) which is hereby incorporated by
reference.
In another embodiment, illustrated in FIG. 2, water baths 16 and 18
which maintain reservoirs of fluids at constant temperatures may be
used. Again, heat exchanger 10 is an aluminum plate or some other
metal with good heat-conducting properties. Passageways or channels
201 are machined or molded into the metal of the heat exchanger
through which heated or cooled fluids may be pumped. In one
embodiment of the machine pictured in FIG. 2, heat exchanger 10 has
a fluid inlet coupled to a tube 42 and a fluid outlet coupled to a
tube 44. These two tubes are coupled to the outputs of a fluid
multiplexer 46. The fluid multiplexer has two pairs of input/output
ports. One pair 47 is coupled to high temperature fluid conveyance
tubes 48 and 50 and the other pair 49 is coupled to low temperature
fluid conveyance tubes 52 and 54. Each pair of ports has one input
channel and one output channel. For example, the first pair has its
input channel coupled to tube 48 and its output channel coupled to
tube 50. Likewise, the output pair of the fluid multiplexer 46 has
one output channel, coupled to the tube 42, and one input channel,
coupled to the tube 44. The purpose of the fluid multiplexer 46 is
to couple selectively either the first input pair, tubes 48 and 50,
or the second input pair, tubes 52 and 54, to the output pair 43 in
accordance with a select signal on a line 56. If the first pair of
ports 47 is selected, the tube 48 is coupled in fluid communication
to the tube 42 through an internal fluid passage in the fluid
multiplexer 46 in the form of a solenoid-operated valve designated
SOV 1. Likewise, the tube 50 is coupled to the tube 44 through an
internal fluid channel in the fluid control multiplexer 46 in the
form of a solenoid-operated valve designated SOV 2. A similar
connection occurs if the second pair of ports 49 is selected.
In this manner, the temperature of the heat exchanger 10 and the
fluids stored in the tubes in the reaction wells such as the well
40 may be controlled by the state of a TEMP SELECT signal on the
conductor 56. In one embodiment, the fluid multiplexer 46 is
implemented with four solenoid-operated valves, designated SOV's 1
through 4, which are properly interconnected with the tubes 42, 44,
48, 50, 52 and 54. However, any apparatus that can perform the
fluid switching noted above will suffice. Indeed, if a solid state
or conventional heat pump 12 is used in connection with controlling
the temperature of heat exchanger 10, the need for and expense of
the fluid multiplexer 46 is eliminated.
The heated and cooled fluid flowing in the tubes coupled to the
fluid multiplexer 46 is pumped from a high temerature fluid
reservoir 16 and a low temperature fluid reservoir 18,
respectively. The purpose of these reservoirs is to maintain a
volume of fluid such as water or antifreeze at a constant
temperature. Generally, the high temperature fluid is maintained at
a constant temperature of 80.degree. to 105.degree. C., preferably
90.degree.-100.degree. C., and the low temperature fluid is
maintained at a constant temperature of about 35.degree.-60.degree.
C., preferably about 37.degree. C. to 50.degree. C. The reservoirs
16 and 18 are adjustable in terms of the temperatures at which they
maintain their fluid reservoirs. Water bath 18 is preferably
adjustable so as to be able to achieve a reservoir temerature
anywhere in the range from -35.degree. to +150.degree. C. The water
bath 18 preferably has a water capacity of 13 liters and a rapid
chill-down feature so as to have a cool-down rate in excess of
100.degree. C. per minute. This helps minimize temperature
stabilization time. Any type of fluid heating and cooling apparatus
which can achieve and maintain such temperatures over the duration
of the amplification process will suffice for purposes of the
invention. In the preferred embodiment, VWR 1135 and VW2 1155 water
baths are used.
The enzyme used in the amplification process is added to the other
reagents in the reaction well 40 initially.
The enzyme employed herein is a thermostable enzyme, as defined
hereinbelow, which can withstand the high temperatures employed to
denature the nucleic acid strands. Therefore, a liquid handler is
not necessary to add the thermostable enzyme to the reaction well
at certain points in the temperature profile. The enzyme may stay
in the reaction well 40 at all times.
Control over the temperature of the reaction vessel is maintained
by the CPU 20 in the case of either the embodiment of FIG. 1 or the
embodiment of FIG. 2. The CPU runs control program which will be
described in more detail below. Basically, the control program,
which is stored in a memory 24, controls the heat pump 12 or the
fluid multiplexer 46. The user is interrogated by the control
program through the CPU 20 and a display/keyboard user interface 22
regarding what temperature profile the user wishes to run. The user
responds with temperatures on the desired profile and the times the
user wants those temperatures to be achieved. These responses are
read by the CPU 20 from a user interface 22. The queries to the
user are displayed on the display of the user interface 22, and the
user's responses are received via the keyboard thereof. User
responses in the form of time and temperature checkpoints on the
desired profile are stored in a RAM 24. A typical time versus
temperature profile is shown in FIG. 5. The CPU then generates the
proper control signals to cause heat to be added to or taken away
from heat exchanger 10 to maintain the reaction vessel 40 on the
desired temperature profile.
In the case of the embodiment shown in FIG. 1, the control signals
generated by the CPU 20 to control the heat pump consist of a pulse
train of pulse width modulated control pulses. These pulses are
coupled to a heat pump interface circuit 26 on a line 56.
The circuitry of the heat pump interface is shown in more detail in
FIG. 4. The purpose of this interface circuit is to convert the
pulse width modulated control pulses at logic levels from the CPU
into high current pulses of the same duration through the solid
state heat pump 12. Four N channel MOSFET power transistors 30, 32,
34 and 36 are used for this purpose. These transistors are
connected in a bridge arrangement with the solid state heat pump 12
as a load. This bridge reverses the direction of current flow
through the load 12 under the influence of two control signals from
the CPU on lines 39 and 40. When the cool control signal on line 40
is active, the transistors 34 and 32 are turned on and the
transistors 30 and 36 are turned off. The reason for this is that
the cool signal is coupled to the gate of the transistor 34 by the
line 58 and turns this transistor on. The cool signal also turns on
a transistor 62 which pulls the gate voltage on the line 64 down to
ground potential thereby turning off transistor 36.
The heat control signal on line 39 is always in the opposite binary
state as the cool control signal on line 40. Then cool is active,
the gate 66 of transistor 30 is low at logic 0 and this transistor
will be off. The logic 0 on line 66 also turns off a transistor 68,
which allows the +15 volt voltage on line 70 to drive the gate 72
of the translator 32 to a logic 1 level. This turns on transistor
32, thereby completing a current path from right to left through
the load 12, i.e., from line 70 and the power supply through the
drain and source of transistor 34, through line 76, the load 12 and
line 78, and through the drain and source of transistor 32 to
ground.
The reverse situation occurs when the heat signal is active. In
this case, transistors 30, 68 and 36 are on and transistors 34, 62
and 32 are off.
In the embodiment shown in FIG. 2, the interface circuit of FIG. 4
is not necessary. However, some solenoid driver interface will be
necessary to allow the CPU to control the solenoid-operated valves.
The design of a suitable interface will be well known to those
skilled in the art.
The CPU 20 in the embodiments of either FIG. 1 or FIG. 2 may be any
one of a number of different types of computers. It may be a custom
designated computer, an off the shelf controller such as the Model
2010 PuP.TM. controller available from LFE Corporation in Clinton,
Mass., or it may be an IBM or other personal computer, minicomputer
or mainframe. Whatever type of computer is used, it must be capable
of accepting data from the user regarding the desired temperature
profile either in real time or at the time the computer is
installed. There should be some mechanism to calculate a "set
point" in embodiments using actual temperature sensors such as the
sensors 80 in FIGS. 1 and 2. A "set point" is a target temperature
taken from the user-defined temperature profile which can be used
in calculating an error signal based upon the error between the
actual temperature and the target temperature. Refer now to typical
temperature profile illustrated in FIG. 5. Typical user-defined
temperature profile checkpoints are shown as small circles.
Checkpoint 1 is characterized by a temperature level L.sub.o at the
reaction vessel 40 at time T.sub.o. Checkpoint 2 is characterized
by a temperature level L.sub.2 at a later time T.sub.2. Checkpoint
3 is characterized by the existence of a temperature level L.sub.2
at the reaction vessel 40 at a time T.sub.2 and so on. The sections
between checkpoints will be called "legs".
The CPU 20, in embodiments that do not use actual temperature
sensors, must be programmed to keep track of the time during which
heating or cooling action takes place. Further, the CPU must be
capable of storing one or more empirically determined times against
which actual elapsed time during a heating or cooling leg may be
compared. These empirically determined times are experimentally
determined by the user. Typically the user will set a certain
current flow during the design of the solid state heat pump
interface of FIG. 4, and this current flow will be used for all
heating and cooling in the embodiment of FIG. 1. In the case of the
embodiment of FIG. 2, the user must set the temperature level of
the hot and cold reservoirs 16 and 18. The fixed current in the
case of the embodiment of FIG. 1 and the fixed temperature level
for the reservoirs in the case of the embodiment of FIG. 2 will
establish a user-defined heating or cooling rate of change for a
given mass of the heat exchanger 10 and reaction vessel and
contents. The user will then define the desired checkpoints and
determine the times it takes to heat or cool to these checkpoints
at the fixed heating or cooling rate. If the times taken to reach
the checkpoints are not acceptable, the heating or cooling rate
must be adjusted until the times are right. Of course, this
approach is not very flexible if the heating or cooling rate cannot
be adjusted in real time, since the slope of the heating and
cooling legs must always be the same using these embodiments, which
will be referred to as the "empirical" class of embodiments.
An alternative empirical type embodiment class is to program the
CPU 20 to use different heating and cooling rates on each leg. This
allows each leg to have a different slope. This may be accomplished
using pulse width modulation, but not using any temperature sensor
and actual temperature feedback (illustration of the temperature
sensors in dashed lines is intended to symbolize these embodiments)
in either of the embodiments of FIGS. 1 and 2. In these alternative
embodiments, the heating or cooling current flow (or fluid flow in
the case of the embodiment of FIG. 2) is a stream of pulses. The
duty cycle is controlled by the CPU 20 such that if a greater
heating or cooling rate is needed, the "on" time of the pulses is
increased. The reverse situation applies if the heating or cooling
rate is to be decreased. In these embodiments, the user has more
freedom to adjust the temperature profile because the empirical
time and heating and cooling rate may both be adjusted until the
interval between and temperature levels at the checkpoints are as
desired.
Generally, this requires more work on the part of the user than the
preferred embodiment and is not as accurate. The reason is that
once the user establishes a fixed heating or cooling rate for each
leg, that rate is fixed for that leg and cannot be altered in real
time to account for changing conditions. That is, in these
embodiments, the CPU 20 does not alter the heating and cooling
rates in real time to correct for changing ambient conditions or
other variations.
The preferred embodiment uses actual temperature feedback and a
closed loop control system to control the heating and cooling rate.
This allows real time error signal generation to conform the actual
temperature profile to the desired temperature profile. To
implement the preferred embodiment, the CPU 20 is programmed to
prompt the user to enter "checkpoints" for the desired temperature
profile. Then, the CPU 20 starts a clock running to measure elapsed
time and periodically calculates "set points" based upon the
desired temperature profile defined by the checkpoints. The
calculated set points are targets to achieve and are used in
another software routine to generate an error signal.
The error signal generation routine reads the actual temperature of
the reaction chamber from the temperature sensor 80 and compares it
to the desired temperature defined by the set point. Typical set
points calculated for the temperature profile of FIG. 5 are shown
by the three x's on leg 1 between checkpoints 1 and 2. The
comparison yields an error signal which is used by a pulse width
modulation routine to generate the control signals which cause
heating or cooling of the reaction chamber by the heating and
cooling apparatus.
The pulse width modulation routine calculates the necessary "on"
time or duty cycle for the heat and cool control signals and
determines which of these two control signals should be active. The
proper control signals are then generated and written to the solid
state heat pump interface 26 or to the fluid multiplexer or other
heating and cooling apparatus.
The amplification process which the machine must perform for an
empirical time embodiment not using a sensor 80 for the embodiments
shown in FIGS. 1 and 2 is given in flow chart format in FIG. 6. The
process starts at block 74 with a command from the user to start
the amplification processing. Prior to this time the user must have
loaded the proper enzyme into the reaction chambers 40 in heat
exchanger 10 along with the nucleic acid sequence(s) to be
amplified plus the proper reagents defined below.
Upon receiving the start command, the CPU 70, in a step 82,
retrieves the first checkpoint data and issues the proper signal on
the temperature select line 56 in FIG. 2 (the method of operation
of FIG. 6 is equally applicable to the embodiment shown in FIG. 1)
to cause the opening of the SOV pair 46 to heat the heat exchanger
10 to a high temperature equal to a user-defined level, which will
be hereafter referred to as temperature variable L.sub.H. In some
embodiments, temperature variable L.sub.H will not be a variable,
but will be a constant fixed at the temperature of the high
temperature reservoir 16. In other non-empirical embodiments using
actual temperature feedback data, the variable L will be
user-defined and the CPU 70 will monitor the temperature of the
reaction chamber 40 and issue the proper command signal to the
temperature control apparatus (solenoid-operated valves plus
reservoirs or heat pump interface plus heat pump) to cause it to
heat the heat exhanger 10 until the desired temperature is reached,
and then will issue the proper commands to the temperature control
apparatus to cause the desired temperature to be maintained. No
monitoring of the temperature of heat exchanger 10 is done by the
CPU 20 in the empirical embodiment currently under discussion.
However, in the preferred embodiment, the temperature of the heat
exchanger 10 and reaction vessel is monitored by the CPU 40, and an
error signal is generated by comparison of the actual temperature
to the calculated set points from the user-defined checkpoints to
control the temperature of the heat exchanger 10 according to a
user-defined time versus temperature profile.
The temperature of the reaction chamber 40 during this
high-temperature incubation should be maintained at
80.degree.-105.degree. C., preferably 90.degree.-100.degree. C.,
The minimum temperature at which the denaturation process will
occur is 80.degree. C. The temperature rise profile to the
temperature L.sub.H should be as rapid as possible, generally 0.5
to 5 minutes, more preferably 1-3 minutes, to save time in the
overall completion time of one cycle.
Of course, before all this may happen, the user must enter the
checkpoint data. The steps to prompt the user for the checkpoints,
to store the data so entered, and to retrieve it sequentially for
calculation of set points are conventional and are not critical to
the process, so they are not shown.
The amplification process of these empirical time embodiments
involves a high-temperature incubation period for a user-defined,
empirically determined time from start of heating to end of
incubation. For implementation of the incubation, the computer
starts a clock in step 84 and times the elapsed time from the start
of heating toward temperature level L.sub.H and compares the
elapsed time to a high-temperature incubation time, T.sub.H,
entered by the user as symbolized by step 86. In the preferred
embodiments, the incubation time variable may be set at any desired
non-empirical value by the user in real time.
In other embodiments, the time T.sub.H (heating and high
temperature incubation time) may be a fixed time which is
experimentally determined and then "burned" into a ROM for
permanent storage. In some embodiments, the CPU 20 may monitor the
temperature of the heat exchanger 10 such as by use of the
temperature sensor 80 shown attached to heat exchanger 10 in FIG. 1
and coupled to the CPU 20 through a line 81, and begin timing the
high temperature incubation period when plate 1 reaches the
temperature of temperature variable L.sub.H.
In the embodiment of FIG. 6, the user sets variable T.sub.H at a
time which is empirically established to include the time it takes
plate 1 to reach the desired temperature L.sub.H plus the desired
time for high-temperature incubation at temperature L.sub.H. In
embodiments where the computer starts tracking elapsed time only
when the desired temperature L.sub.H is reached, i.e., where a
temperature sensor 80 is used, the variable T.sub.H may be set by
the user at the amount of time desired for high-temperature
incubation at temperature L.sub.H without regard for the amount of
time it takes for plate 1 to reach temperature L.sub.H. In the
preferred embodiment, temperature L.sub.H is fixed at
90.degree.-100.degree. C. In both these embodiments, as will be
appreciated, the time T.sub.H as described is a function of the
time for which the container holding the reaction mixture is to be
maintained at one temperature.
When the elapsed time at temperature L.sub.H equals the desired
incubation time as determined by step 88, the CPU 20 sends the
proper command to the heating and cooling apparatus to cause plate
1 to be cooled toward a low temperature incubation temperature LL
set by the user. This is symbolized by step 90. Step 90 represents
the transmission by the CPU 20 of a command, in the case of the
embodiments of FIG. 2, to the fluid control multiplexer 46 to
select the tubes 52 and 54 to couple to the tubes 42 and 44 such
that fluid at the temperature of low-temperature fluid reservoir
18, set at LL by the user manually, begins to flow through the heat
exchanger 10. In other embodiments, the CPU 20 may simply send a
command to the heating and cooling apparatus to turn on an
electrically driven refrigeration unit thermally coupled to plate
1, such as the Peltier heat pump 12. The range of chill-down rates
from the high temperature to the low temperature which may be
successfully used is governed by a balance of considerations. A
very rapid chill-down, such as by using dry ice to bring the
temperature of the reaction chamber down immediately, will inhibit
or stop the amplification process. On the other hand, slow
chill-down will lengthen the overall completion time of one cycle.
Preferably, the chill-down rate will range from about 0.5 to 5
minutes, preferably in the range from 1 to 3 minutes. In the
preferred embodiment, a fixed temperature within the range of from
about 35.degree. to 60.degree.C. is set by the user by manual
adjustment of low-temperature fluid reservoir 18 to maintain this
temperature in the case of the embodiment of FIG. 2. In the case of
the embodiment of FIG. 1, the CPU 20 will establish the proper
direction of current flow and duty cycle based upon the user
entered data for L.sub.L. The duty cycle may be based upon
user-defined data for the particular leg or may be fixed in either
type embodiment. The temperature range of from about 35.degree. to
60.degree. C. is the optimum temperature for the thermostable
enzyme used in the amplification protocol. The broad range of
temperatures at which the amplification protocol can be
successfully performed is about 30.degree.-35.degree. to
105.degree. C.
The next step is symbolized by step 92 and represents the process
of measuring the elapsed time and comparing it to the user-defined
low temperature incubation time T.sub.L. The optimum time it takes
to reach temperature L.sub.L is not exactly known, but
approximately 1-3 minutes is known to be effective. In the
empirical embodiments, the CPU 20 does not monitor the temperature
of plate 1; it only keeps track of the elapsed time since the
command was issued to chill plate 1. The user must empirically
determine how long it takes to reduce the temperature of plate 1 to
temperature L.sub.L. The CPU 20 in step 92 constantly compares the
actual elapsed time to the user-defined time T.sub.L. When the
required time has passed, processing proceeds to step 94.
Step 94 symbolizes the process of monitoring for completion of the
low-temperature incubation. In some embodiments, the computer CPU
20 begins tracking elapsed time when temperature L.sub.L is
reached. Step 94 represents the process of the computer comparing
the actual elapsed time to a low-temperature incubation time,
user-defined variable T.sub.L. In some embodiments, this variable
is a real time, user-defined time stored in the memory of the
computer, while in other embodiments, the time T.sub.L is fixed and
permanently stored after being empirically determined.
As soon as the elapsed time equals the desired low-temperature
incubation time T.sub.L, step 94 causes processing to proceed to a
step 96, which increments a software cycle counter to mark the end
of the first cycle. If the actual elapsed time does not equal the
time T.sub.L, processing proceeds on line 98 to step 92 for another
comparison of elapsed time to desired time T.sub.L. After step 96,
the CPU 20 proceeds to step 100.
Step 100 and step 102 represent the process of comparison of the
cycle count to a user-defined variable in memory representing the
desired number of cycles. In some embodiments, the desired number
of cycles is a fixed number, but in the preferred embodiment, the
desired number of cycles is a user-defined number. This gives the
user the flexibility to vary the number of cycles of amplification
performed to account for the differing efficiencies of
amplification of different nucleic acid sequences, as described
further below. If the cycle count does not match the desired number
of cycles, processing proceeds via line 104 to step 106 to reset
the elapsed time clock, and from there processing proceeds to step
82 via line 108 where another cycle is begun. If the desired number
of cycles has been performed, then processing proceeds to step 108.
There it is determined whether the user desires to run another
temperature profile stored in another "file" or database. Every
temperature profile entered by the user has a link data field in
which there is stored the file identification of the next file or
temperature profile to be run, if any. The contents of this link
field are read in step 108. If the user has made no entry to the
link field, then processing proceeds to step 110, and a finished
message is displayed. If step 108 finds a file number in the link
field, then processing proceeds to step 112. This step resets the
elapsed time clock, and retrieves the first checkpoint from the new
file. Processing then proceeds, starting at step 82, to run the
temperature profile determined by the checkpoints in the new
file.
The control process of FIG. 6 shows only two checkpoints for the
temperature profile. In other embodiments, a greater number of
checkpoints may be used so long as there is a generally high
temperature incubation and a generally low temperature incubation
at the proper temperatures for sufficient times.
In the preferred non-empirical "closed loop" embodiments running
the process shown in FIG. 7, the CPU 20 in step 81 starts the
heating for leg 1 for the user-defined temperature profile at a
default rate and starts the clock in step 83. The CPU 20 then
computes a set point in step 85 as a target temperature and
continuously monitors the temperature of plate 1 in step 87 and
compares it to the set point on the user-defined temperature
profile. Step 85 periodically updates the set point by computing
the slope of the temperature profile between user-defined
checkpoints and calculating the new set point based upon the slope
and elapsed time at the time of the calculation. An error signal
based on the comparison can be generated by the CPU 20 in step 89.
This error signal is then converted to the proper control signal to
control the heating and cooling apparatus in step 91. In the case
of a solid state heat pump, the error signal is used to change the
duty cycle. The updated control signal is then output on the line
56 to cause the heating and cooling apparatus to adjust the
reaction chamber temperature. If plate 1 became hotter than the
desired profile for a particular set point, then the cold fluid
would be switched on to cool it in the embodiment of FIG. 2. In the
case of the embodiment of FIG. 1, the direction of current flow
through the solid state heat pump could be reduced or the "on" time
of the heat pulse duty cycle could be reduced to reduce the error
signal magnitude toward zero.
In the preferred embodiment control process of FIG. 7, the CPU 20
begins timing the elapsed time at the same time the command is sent
to the temperature control apparatus to begin heating plate 1 to
the high temperature incubation level in step 81. After step 91 (or
step 89 if no error is present) is performed in FIG. 7, step 93 is
performed to compare the actual elapsed time to the user-defined
time stored in memory at which the next checkpoint shall have been
reached. If the elapsed time is equal to or greater than the
checkpoint time, processing proceeds to step 95 to retrieve the
time and temperature data for the next checkpoint.
If the elapsed time is less than the time to the next checkpoint,
processing returns on line 97 to step 87 on FIG. 7. The next set
point is then calculated, and processing continues as described
above.
The error signal computation of step 89 is done using any known
proportional control algorithm. Such algorithms are well known and
are described in Shinskey, Process Control Systems, 2d ed., Chapter
1 (McGraw Hill 1979) ISBN 0-07-056891x, which is hereby
incorporated by reference.
After retrieval of the time and temperature data for the next
checkpoint, the CPU determines in step 99 whether the complete
temperature profile has been processed. If the cycle has not been
completed, processing returns on line 97 to step 87 to compute the
next set point. Processing then continues from step 87 as defined
above.
If the temperature profile has been completed, then step 101 is
performed to increment the cycle counter (a software counter) to
indicate that one complete cycle through the temperature profile
has been completed. Next, the CPU 20 retrieves from memory the
value from a data field in the database indicating the desired
number of cycles through the particular temperature profile just
completed. This is symbolized by step 103. This value is retrieved
from a database that is filled with the checkpoint data and other
information supplied by the user via the user interface 22 in FIGS.
1 and 2 and stored in RAM 24. In step 105, the number of cycles
completed is compared to the user-defined desired number of
cycles.
If the desired number of cycles have not been completed, then
processing returns to step 81 on line 107. The first checkpoint in
the same profile is then retrieved, and the processing of the same
checkpoints in the current temperature profile starts over again as
described above.
If step 305 indicates that the desired number of cycles through the
temperature profile have been completed, then step 109 is performed
to determine file linkage. Some users may wish to run one
temperature profile for some number of cycles, x, and then run a
different temperature profile for a different number of cycles, y,
and so on for several different temperature profiles. Each
temperature profile database is given a file identification number,
and each file has a link field in the database for that profile.
The content of this link field is retrieved in step 109 and is the
file number of the next temperature profile to be performed, i.e.,
the next file to be "run". If the contents of this link field are
zero or some other predetermined code, then no linking is to occur
and processing stops with an indication on the display that such is
the case. If there is a linkage, step 111 is performed to retrieve
the first checkpoint of the new profile and processing continues
from step 81 as described above. The linking process is repeated at
the end of the next temperature profile and the next until no
linking address is found. Processing is then complete.
Operation of Embodiments for Amplification with Liquid Handling
Capability
Referring to FIG. 8, there is shown a general block diagram of a
machine which can perform the PCR DNA or RNA amplification process.
The starting materials comprised of the DNA or RNA to be amplified
and the necessary reagents are initially loaded into a reaction
well 40A in plate 1. Plate 1 supports the reaction well 40A which
may be a recess machined into the plate, but preferably is a
plastic container which holds the fluids involved in the reaction
and which sits in a recess formed in plate 1. In the preferred
embodiment, plate 1 is an aluminum block with a plurality of
recesses formed therein sized to allow 0.5 ml (milliliter)
Eppendorf tubes to fit therein.
The purpose of the tubes is to line the reaction well to separate
the fluids from the walls of the recess in the plate 1 to avoid
cross contamination when the same reaction well is used to amplify
different nucleic acid sequences. The purpose of plate 1 is to
support the tubes and to act as a heat exchanger to transfer
thermal energy to and from the fluids stored in the tubes in the
reaction wells such that the reaction components may be incubated
at various temperatures at the appropriate times in the
process.
To that end plate 1 must be structured in such a way that the
fluids in the reaction wells such as the well 40A may be heated and
cooled at the appropriate times in the process and for the
appropriate duration. Any structure or method may be used to
perform this heating and cooling function such as by electrical
heating and refrigeration apparatus in or connected to plate 1. It
is only necessary that whatever apparatus is used for this heating
and cooling be capable of reaching and sustaining the temperatures
involved, and that the apparatus for heating and cooling can
achieve the required temperature versus time profile. One such
electrically driven heating and cooling apparatus is Peltier heat
pumps available from Materials Electronics Products Corporation in
Trenton, N.J. Such heat pumps are comprised of N and P type bismuth
telluride in the form of oriented polycrystalline ingots with the
ends soldered to copper bus bars interfaced with ceramic plates.
These heat pumps heat or cool by driving currents through them in
particular, known ways. These semiconductors have been used in the
prior art by Gilford Instruments Corporation to heat and cool
cuvettes, and are available in wattage ranges including 150 watts.
These devices are capable of cooling or heating a mass of material
to which they are thermally coupled to temperatures in a range from
-150 to +110 degrees centigrade. Such semiconductors could be
thermally coupled in known ways to plates 1 and 2 or could be
directly thermally coupled to the insert tubes or wells which are
placed in the storage wells in plate 2 and the reaction wells in
plate 1. Such semiconductors can be easily controlled to reach and
maintain particular temperatures by modulating the currents which
flow through them in accordance with the desired temperature level
according to standard process control algorithms.
In a preferred embodiment, water baths which maintain reservoirs of
fluids at constant temperatures are used, and plate 1 is an
aluminum plate or some other metal with good heat conducting
properties. Passageways are machined or molded into the metal
through which heated or cooled fluids may be pumped. In a preferred
embodiment of the machine, plate 1 has a fluid inlet coupled to a
tube 42A and a fluid outlet coupled to a tube 44A. These two tubes
are coupled to the outputs of a fluid multiplexer 46A. The fluid
multiplexer has two pairs of inputs. One pair is coupled to high
temperature fluid conveyance tubes 48A and 50A and the other pair
is coupled to low temperature fluid conveyance tubes 52A and 54A.
Each pair of inputs has one input channel and one output channel.
For example, the first pair has its input channel coupled to tube
48A and its output channel coupled to tube 50A. Likewise, the
output pair of the fluid multiplexer 46A has one output channel,
coupled to the tube 42A and one input channel, coupled to the tube
44A. The purpose of the fluid multiplexer 46A is to selectively
couple either the first input pair, tubes 48A and 50A, or the
second input pair, tubes 52A and 54A, to the output pair in
accordance with a select signal on a line 56A. If the first pair of
inputs is selected, the tube 48A is coupled in fluid communication
to the tube 42A through an internal fluid passage in the fluid
multiplexer 46A. Likewise, the tube 50A is coupled to the tube 44A
through an internal fluid channel in the fluid control multiplexer
46A. A similar connection occurs if the second pair of inputs is
selected. In this manner, the temperature of the plate 1 and the
fluids stored in the tubes in the reaction wells such as the well
40A may be controlled by the state of a TEMP SELECT signal on the
conductor 56A. In the preferred embodiment, the fluid multiplexer
46A is implemented with four solenoid operated valves properly
interconnected with the tubes 42A, 44A, 48A, 50A, 52A and 54A.
However, any apparatus that can perform the fluid switching noted
above will suffice. Indeed, if electrical heating and refrigeration
apparatus is used in connection with controlling the temperature of
plate 1, the need for the fluid multiplexer 46A is eliminated.
The heated and cooled fluid flowing in the tubes coupled to the
fluid multiplexer 46A is pumped, by pump 200A, from a high
temperature fluid reservoir 58A and a low temperature fluid
reservoir 60A respectively. The purpose of these reservoirs is to
maintain a volume of fluid such as water or antifreeze at a
constant temperature. In a preferred embodiment, the high
temperature fluid is maintained at a constant temperature of 98
degrees centigrade and the low temperature fluid is maintained at a
constant temperature of 37 degrees centigrade. The water baths 58A
and 60A are adjustable in terms of the temperatures at which they
maintain their fluid reservoirs. Water bath 60A is preferably
adjustable so as to be able to achieve a reservoir temperature
anywhere in the range from -35 to +150 degrees centigrade. The
water bath 60A preferably has a water capacity of 13 liters and a
rapid chill down feature so as to have a cool down rate in excess
of 100 degree Centigrade per minute. This helps minimize
temperature stabilization time. Any type of fluid heating and
cooling apparatus which can achieve and maintain such temperatures
over the duration of the PCR amplification process will suffice for
purposes of the invention. In the preferred embodiment, VWR 1135
and VWR 1155 water baths are used.
As is described in more detail below, these embodiments do not
require a thermostable enzyme. Referring to FIG. 8, this enzyme is
stored in a receptacle such as the receptacle 62A in plate 2. Plate
2 is also a heat exchanger structure with the same material and the
same type of internal configuration as plate 1 serving the same
purpose as plate 1, i.e., to maintain the enzyme stored in plate 2
at the temperature of the fluid pumped therethrough. In the
preferred embodiment, plate 2 is maintained at a constant
temperature of -1 degree centigrade by chilled fluid circulating
therethrough from a fluid circuit comprised of an inlet tube 64A,
an outlet tube 66A and a constant temperature regulating water bath
67A similar to water baths 58A and 60A. All the water baths have
circulating pumps which circulate fluid from the reservoir through
the inlet and outlet tubes and the plates 1 and 2. In some
embodiments, the water baths 58A and 60A and 67A will have
temperature control inputs which are coupled to control signal
lines carrying signals which control the temperatures at which the
water baths maintain the fluid in the various reservoirs.
The PCR protocol or sequence in these embodiments requires that at
certain times in the cycles, an enzyme be added to the reaction
well so that it can be incubated at a certain temperature with the
nucleic acid sequence being amplified and the other reagents in the
reaction well. It is the purpose of a liquid handler 68A to provide
the apparatus needed to make the transfer of enzyme from plate 2 to
plate 1. Many types of liquid handlers are known, and any machine
which can move fluid at a controllable time in a controllable
amount in a given range of small volumes with sufficient accuracy
from a first receptacle to a second receptacle will suffice for
purposes of practicing the invention. Typically, amounts of enzyme
in the range of 5 microliters plus or minus 20% must be transferred
from plate 2 to plate 1, so the liquid handler must be able to
accurately handle fluid amounts in this range of volumes. The
manner of movement of the enzyme from plate 2 to plate 1 is not
critical to the invention, and any one of a number of known ways of
moving fluid may be used.
The preferred method of liquid movement involves use of a movable
pipette which can be dipped into the enzyme storage receptacle to
aspirate an aliquot of enzyme and then moved over the reaction well
to deposit the aspirated enzyme. One machine of this type which may
be used as the liquid handler 68A of this invention is the
PRO/PETTE.RTM. liquid handler available from Cetus Corporation in
Emeryville, Calif. The preferred embodiment uses the PRO/PETTE.RTM.
machine for the liquid handler 68A. Another machine of this type
which may be used as the liquid handler 68A of this invention is
the PRO/GROUP.RTM. liquid handler also available from Cetus
Corporation in Emeryville, Calif. Both these machines have
microprocessors in them which drive a collection of stepper motors
which move the various elements of the machine to allow an enzyme
transfer from plate 2 to plate 1. The microprocessor of the
PRO/PETTE.RTM. machine should be programmed with the PRO/PETTE
EXPRESS.RTM. software with the plate to plate transfer file to
operate satisfactorily as the liquid handler 68A. This software is
available from Cetus Corporation, and is well known. The source
code needed to modify the PRO/PETTE EXPRESS.RTM. software to cause
the PRO/PETTE.RTM. liquid handler to run the PCR amplification
protocol is attached hereto as microfiche Appendix A. The actual
object code of the PRO/PETTE EXPRESS.RTM. software as modified to
run the PCR amplification protocol is attached hereto as microfiche
Appendix B. The microprocessor of the PRO/GROUP.RTM. liquid handler
comes programmed with modified PRO/PETTE.RTM. software which
includes all the routines or "files" of the PRO/PETTE EXPRESS.RTM.
software plus some new files which do not exist in the PRO/PETTE
EXPRESS.RTM. software, and which are not necessary to run the PCR
protocol.
To run the PCR protocol on either the PRO/PETTE.RTM. or
PRO/GROUP.RTM. liquid handlers, the two files of microfiche
Appendix A plus the data structures listed there must be added to
the PRO/PETTE EXPRESS.RTM. software. The combined software plus the
Cetus Real Time Nucleus, and the motor controller code and hand
held controller code for the particular machine selected must then
be loaded into the program memory of the machine. Microfiche
Appendix A is the source code for the PRO/PETTE.RTM. machine and
calls the standard PRO/PETTE.RTM. routines for basic functions such
as moving the bed and movable head. Those skilled in the art will
appreciate that the source code of microfiche Appendix A may need
to be modified somewhat to allow it to work properly with the
PRO/GROUP.RTM. machines. The software for the PRO/GROUP.RTM.
machine's motor controller chips, hand held controller
microprocessor and Cetus Real Time Nucleus operating system is
given in the remaining microfiche appendices.
If another liquid handler mechanism without an internal computer is
used as the liquid handler 68A, a computer 70A having a control
program stored in program memory 72A is used to control it. The
computer 70A may be any general purpose computer or microprocessor
which is capable of generating the proper control signals which are
necessary to cause the liquid handler 68A to transfer the proper
amount of enzyme from plate 2 to plate 1 at the proper time. There
must also be the proper interface circuitry in the computer to
convert the control signal from the computer to the proper type and
amplitude of signal to cause the liquid handler 68A to properly
carry out the transfer. The computer 70A must also be able to
generate a temperature control signal to cause the temperature of
plate 1 to be varied between the various temperatures needed in the
process, and must be able to control duration and starting time of
each incubation interval in the PCR amplification process.
The program stored in the program memory 72A will vary depending
upon what type of heating and cooling apparatus is used to control
the temperature of plate 1 and the type of liquid handler 68A used
in the system. Certain criteria must be met, however, to cause the
system to successfully carry out the amplification protocol. The
process which the machine must perform is given in flow chart
format in FIG. 9.
The amplification cycle of FIG. 9 starts at block 74A with with a
command from the user to start the amplification processing. Prior
to this time the user must have loaded the proper enzyme into the
storage wells in plate 2 and the nucleic acid sequence to be
amplified plus the proper reagents in the tubes must be stored in
the reaction wells in plate 1. In some embodiments, the wells in
plates 1 and 2 may be loaded with the proper starting materials
automatically by the liquid handler under the control of the
computer 70A.
Upon receiving the start command, the computer 70A in a step 76A
issues the proper signal on the temperature select line 56A to
cause the temperature control apparatus for plate 1 to heat plate 1
to a high temperature equal to temperature variable T1. In some
embodiments, temperature variable T1 will not be a variable but
will be a constant fixed at the temperature of the water bath which
the user will manually set. In other embodiments, the variable will
be user defined and the computer 70A will monitor the temperature
of plate 1 and issue the proper command signal to the temperature
control apparatus to cause it to heat plate 1 until the desired
temperature is reached and then will issue the proper commands to
the temperature control apparatus to cause the desired temperature
to be maintained. In a preferred embodiment, a single fixed
temperature water bath is used where the user sets the temperature
of the bath. In this embodiment, the step 76A is comprised of a
command on the line 56A to the fluid control multiplexer 46A to
select tubes 48A and 50A for coupling to the tubes 42A and 44A. No
monitoring of the temperature of plate 1 is done by the computer
70A in a preferred embodiment. However, in some embodiments, the
temperature of plate 1 is monitored by the computer and an error
signal is generated to control the temperature of plate 1 according
to a user defined time versus temperature profile.
The temperature of plate 1 during this high temperature incubation
should be maintained at 95 degrees centigrade plus or minus 3
degrees centigrade. The applicants believe that the process will
occur at 90 degrees centigrade. The temperature rise profile to the
temperature T1 should be as rapid as possible to save time in the
overall completion time of one cycle.
The amplification process involves a high temperature incubation
period. To implement the incubation, the computer times the elapsed
time at the high temperature and compares the elapsed time to a
high temperature incubation variable A as symbolized by step 78A.
In the preferred embodiment, the incubation time variable may be
set at any desired value by the user. In other embodiments, it may
be a fixed time. In some embodiments, the computer 70A may monitor
the temperature of plate 1 such as by use of a temperature sensor
79A shown attached to plate 1 in FIG. 8 and coupled to the computer
through a line 81A, and begin timing the incubation period when
plate 1 reaches the temperature of temperature variable T1.
In other embodiments such as that shown in FIG. 13 running the
process shown in FIG. 14, the computer may continuously monitor the
temperature of plate 1 and compare it to a user defined temperature
profile. An error signal based on the comparison can be generated
by the computer and interface circuitry (lumped together in box 70A
in FIG. 13) on the line 56A to cause the fluid control multiplexer
46A (FIG. 8) to switch either the hot or cold fluid flow into the
fluid passageways of plate 1 to control the temperature of the
plate according to the profile if the heating and cooling apparatus
of FIG. 8 is being used. That is, if plate 1 became hotter than the
desired profile, then the cold fluid would be switched on to cool
it. Conversely, the hot fluid would be switched on if plate 1
became colder than the desired temperature profile. Of course, the
hot and cold fluid reservoirs and the fluid control multiplexer 46A
could be dispensed with and the error signal on line 56A could be
coupled to a heat pump driver 57A which in turn drives a
thermoelectric heat pump such as a Peltier heat pump 59A as shown
in FIG. 13. The amplification protocol the embodiment of FIG. 13
implements is shown in FIG. 14. The protocol of FIG. 14 is the same
as that of FIG. 9 except that steps 77A, 83A, and 87A are inserted
where shown to monitor the temperature sensor 79A and generate the
error signal on line 56A to cause the heat pump driver 57A to
control the heat pump 59A so as to maintain plate 1 on the desired
temperature profile at each point in the elapsed time for the heat
up and cool down cycles and the high temperature and the low
temperature incubations respectively.
In a preferred embodiment, the computer begins timing the elapsed
time at the same time the command is sent to the temperature
control apparatus to begin heating plate 1 to the high temperature
incubation level. In a preferred embodiment of FIG. 8, the user
sets variable A at a time which is empirically established to
include the time it takes plate 1 to reach the desired temperature
plus the desired time for high temperature incubation. In
embodiments where the computer starts tracking elapsed time only
when the desired temperature is reached, the variable A may be set
by the user at the amount of time desired for high temperature
incubation without regard for the amount of time it takes for plate
1 to reach temperature T1. In a preferred embodiment, temperature
T1 is fixed at 95 degrees centigrade.
When the elapsed time at temperature T1 equals the desired
incubation time, the computer 70A sends the proper command to the
heating and cooling apparatus to cause plate 1 to be cooled toward
a temperature T2. This is symbolized by step 80A. In a preferred
embodiment a fixed temperature of 37 degrees centigrade is set by
the user by manual adjustment of low temperature fluid reservoir
60A to maintain this temperature. The applicants believe that 37
degrees centigrade is the optimum temperature for the particular
enzyme used in the amplification protocol of example 4. Step 80A
represents, in a preferred embodiment, the transmission by the
computer 70A of a command to the fluid control multiplexer to
select the tubes 52A and 54A to couple to the tubes 42A and 44A
such that fluid at the temperature of low temperature fluid
reservoir 60A, set at T2 by the user manually, begins to flow
through plate 1. In other embodiments, the computer 70A may simply
send a command to the heating and cooling apparatus to turn on an
electrically driven refrigeration unit thermally coupled to plate
1. The applicants do not presently know the range of chill down
rates from the high temperature to the low temperature which may be
successfully used, but it is believed that a very rapid chill down
such as by using dry ice to bring the temperature of the reaction
chamber down immediately will inhibit or stop the PCR amplification
process.
The next step is symbolized by step 82A and represents the process
of measuring the elapsed time to bring plate 1 to temperature T2.
The optimum time it takes to reach temperature T2 is not exactly
known, but approximately three minutes is known to be effective. In
a preferred embodiment, the computer 70A does not monitor the
temperature of plate 1; it only keeps track of the elapsed time
since the command was issued to connect the low temperature
circulating fluid to plate 1. The user must empirically determine
how long it takes to get the temperature of plate 1 down to
temperature T2 or 37 degrees centigrade in a preferred embodiment.
The computer 70A constantly compares the elapsed time to the user
defined time. When the required time has passed, processing
proceeds to step 84A. In other embodiments, the computer monitors
the temperature of plate 1 and compares it to the temperature
variable T2 which is set by the user. When temperature T2 is
reached, processing proceeds to step 84A.
Step 84A represents the issuance of the proper commands to the
liquid handler 68A to cause it to transfer an aliquot of enzyme
from plate 2 to plate 1. In the preferred embodiment, the amount of
enzyme which is transferred is user definable and varies from 5
microliters down to the minimum amount which the liquid handler can
reliably measure and transfer. In the preferred embodiment, step
84A represents the steps of issuing the proper stepper motor
commands in the PRO/GROUP.RTM. machine to cause it to pick up a row
of disposable pipette tips and to make the transfer. The detailed
steps of the transfer process will be given later herein.
After the transfer is complete a low temperature incubation is
performed to complete the cycle as symbolized by the steps 86A and
88A. Step 86A symbolizes the process carried out by the computer of
continuing to issue the proper command to cause plate 1 to continue
to be cooled and maintained at low temperature T2. In some
embodiments, this involves continually monitoring the temperature
of plate 1 and issuing the proper commands to control the heating
and cooling apparatus to maintain plate 1 at temperature T2. In a
preferred embodiment, step 86A symbolizes the process of causing
the fluid control multiplexer to continue to select tubes 52A and
54A for connection to tubes 42A and 44A.
Step 88A symbolizes the process of monitoring for completion of the
low temperature incubation. In the preferred embodiment, the
computer 70A begins tracking elapsed time at temperature T2 when
the liquid transfer of step 84A is completed. Step 88A represents
the process of the computer comparing the elapsed time to a low
temperature incubation time variable C. In some embodiments, this
variable is actually a fixed time stored in the memory of the
computer. In the preferred embodiment, the variable C is user
definable, and can be changed from one run to the next depending
upon the user's wishes or needs.
As soon as the elapsed time equals the desired low temperature
incubation time, processing proceeds to a step 90A which marks the
end of the first cycle. In step 90A, the computer 70A increments a
cycle count that it keeps in memory, and processing proceeds to
step 92A.
Step 92A represents the process of comparison of the cycle count to
a variable D in memory representing the desired number of cycles,
i.e., the number of times the steps 76A through 88A are to be
performed. In some embodiments, the variable D is a fixed number,
but in the preferred embodiment D is a user definable number. This
gives the user the flexibility to vary the number of cycles of
amplification performed to account for the differing efficiencies
of amplification of different DNA or RNA sequences. If the cycle
count matches the desired number, processing proceeds to step 94A
and the amplification process is complete. If not, processing
proceeds to step 76A, and the next cycle is started
immediately.
The Liquid Handler Apparatus
Referring to FIG. 10, there is shown an overall physical
perspective view of the mechanical layout of one type of liquid
handler which may be used to practice the invention. FIG. 10
represents a PRO/GROUP.RTM. machine, although a PRO/PETTE.RTM.
machine will also work. In application of the PRO/GROUP.RTM.
machine to perform the amplification protocol, many of its
capabilities are not used. The machine includes several
microprocessors including a microprocessor that performs bar code
reading, a microprocessor which controls the user interface,
microprocessors which are specially programmed to control the
various stepper motors in the system and a central microprocessor
which runs the main program and which communicates with all the
other programs. The software which these various microprocessors
run to perform all the tasks for which the PRO/GROUP.RTM. is
programmed is included herewith in the microfiche appendices
attached hereto starting with microfiche Appendix C and following
in Intel hex code. All of these microfiche appendices are labeled
as to which microprocessors each appendix pertains to. As noted
above, the PRO/GROUP.RTM. machine is known and publicly available,
and a description of this machine is made here only for
completeness.
Another machine, the Cetus PRO/PETTE.RTM. liquid handler, which is
described in U.S. Pat. No. 4,478,094, may also be used as the
liquid handler 68A in FIG. 8, and is well known to those skilled in
the art. Both the PRO/PETTE.RTM. and the PRO/GROUP.RTM. machine
main microprocessors run programs written in the "C" high level
language, and the various liquid handling routines which each
machine performs are coded in "files". These files call upon
various functional routines which do standard "building block"
functions such as getting tips out of their storage positions,
moving the multichannel head up or down, moving the plungers up or
down to aspirate or deposit liquid using the pipette's, moving the
table, and putting the tips back into their storage positions. As
noted earlier herein, to run the amplification protocol on either
of these machines requires that two new files and their associated
data structures be programmed into the machine. These two new files
and their associated data structures are included herewith as
microfiche Appendix A. Microfiche Appendix A was written for the
PRO/PETTE.RTM. machine, but can be adapted by those skilled in the
art to also run on the PRO/GROUP.RTM. machine with little or no
modification by adding the data structures given in microfiche
Appendix A and adding the two files in object code format and
insuring that the "building block" routines called in "seq-pcr"
"file" or sequence have the same names and that the "seq-pcr"
routine looks for them at the proper locations in memory. If a
PRO/PETTE.RTM. or PRO/GROUP.RTM. machine is used for the liquid
handler 68A, there is no need for a separate computer 70A or
program memory 72A since these functions are implemented by the
main microprocessor in the liquid handler.
Alternatively, those skilled in the art can use a different liquid
handler 68A and write their own program to implement the process
shown in the flow charts herein, or use a PRO/GROUP.RTM. machine
and write an entirely new program to implement the detailed flow
chart given below for the movements involved in the liquid handling
steps. Such a program could be written by those skilled in the art
easily given the description of the process herein.
FIG. 11 is a block diagram of the electrical control apparatus of
the PRO/GROUP.RTM. liquid handler that drives the machine.
Referring jointly to FIGS. 10 and 11 will give an integrated
picture of the liquid handling machine's structure. A carrousel
120A stores a plurality of test tubes 122A which store tissue
samples or chemicals or solutions to be assayed. The test tubes are
shown as having bar codes 121A thereon. The actual positions of
these bar codes are above the upper surface of the test tubes so
that they can be read while the tubes are in their stored
positions. Immediately radially behind each test tube is a storage
position for a long pipette tip in the form of a hole in the
carrousel in which a pipette tip rests such as the pipette 124A.
The pipette tips have long projecting tips that can reach the
bottom of the test tubes to extract tissue samples or chemicals
from the bottom of the tubes. There is one tip stored for each test
tube so that cross contamination will not occur as each tip is used
with its particular test tube only.
The carrousel is moved by a stepper motor (not shown in FIG. 10) #1
in FIG. 11. Motor 1 moves the carrousel through a belt drive
mechanism (not shown), but other drive mechanisms would work also
such as direct drive or chain drive. The carrousel is moved so as
to place one and only one test tube at any given time in an
"active" position under an x-y head 128A. The x-y head is shown in
its left position in preparation for moving its long pipette tip
down into the test tube in the active position below the tip 130A.
The x-y head has another position further left wherein a tip holder
(not shown) is aligned directly over a projecting end of the
pipette tip stored behind the test tube in the active position. The
tip holder has an outside diameter which is matched to the inside
diameter of the long pipette tip ends protecting from the pipette
storage positions such that the tips can be picked up when the head
is lowered such that the tip holder engages the tip.
The x-y head 128A is part of an integrated transfer head 132A which
combines several liquid handling apparatus in one small space and
shares the function of various drive motors among the various head
units comprising the whole. The entire head 132A moves vertically
(along the Z axis in FIG. 10) up and down on tracks (not shown)
under the control of a head vertical motion motor #6 in FIG. 11
(not shown in FIG. 10) under the control of the main microprocessor
134A and a motor driver (not shown) in the interface circuit 136A.
The x-y head 128A also moves horizontally (along the X axis in FIG.
10) under the control of the x-y head drive motor #5 in FIG. 11
(not shown in FIG. 10). The mechanical details of the transfer head
132A are contained in a copending patent application commonly
assigned to the assignee of the present invention entitled "Liquid
Manipulation Device and Method", filed Jul. 5, 1985, Ser. No.
752,449 which is hereby incorporated by reference.
In order to pick up a long tip such as the tip 130A, the motor #5
is commanded by the main microprocessor 134A and the interface
board 136A to move the x-y head to the position where the tip
holder is lined up with the tip stored behind the tube in the
active position, and the motor #6 is commanded to move the entire
head 132A down until the tip holder is seated in the projecting
portion of the long tip stored in the tip holder position behind
the active tube. The motor #6 is then commanded to lift the entire
head to draw the entire tip out of the storage position. The tip
can then be moved to any position along the X axis by motor #5.
The x-y head also has a movable piston (not shown) within the
cylinder coupled to the pipette holder and tip. The piston can be
moved up and down in the Z direction by a piston drive frame 138A
which is connected to the piston, and which is driven by a piston
drive motor #7 in FIG. 11 and shown at 140A in FIG. 10. This motor
is connected by a worm gear (not shown) to the piston drive frame
138A such that rotation of the worm gear is translated into Z axis
motion of the frame 138A.
The integrated head 132A is also comprised of a multichannel head
142A, a wash head 144A and a dispense manifold 146A.
The dispense manifold 146A is a multichannel liquid dispense
manifold with multiple outlets 148A which can be lowered into wells
to fill them with liquids pumped into the manifold 146A by a
peristaltic pump 150A through a section of flexible hose 152A. The
input of the pump is coupled through another hose 154A to a
reservoir of solution such as saline solution. In the preferred
embodiment, the dispense manifold has the same number of outlets
148A as there are wells in mixing plates 156A, 158A and a diluent
tray 160A and a reagent tray 162A and has the same center to center
spacing for the outlets 148A as the wells in the trays have. The
plates 156A and 158A are the heat exchanger blocks designated plate
1 and plate 2 in the preferred embodiment, and are connected to the
fluid control multiplexer 46A and to the constant temperature fluid
reservoirs by the tubes 44A and 42A and the tubes 64A and 66A,
respectively. In the preferred embodiment, the diluent tray 160A
and the reagent tray 162A are replaced by a single tip storage tray
with wells for storage of multiple rows of pipette tips. Each well
is completely enclosed in the preferred embodiment such that when
liquid clings to the tip there is no chance of the liquid being
thrown, blown or flipped off the tip when the tip is ejected
because of the physical barrier surrounding each tip. This is
another measure taken to prevent cross contamination.
Although the liquid handler of FIG. 10 has the capability of
reading bar codes on the plates and tubes, the amplification
protocol does not utilize this capability.
The wash head is a multichannel head for filling the wells in the
various trays with wash solutions, preventing overfill conditions
and for emptying the wells. Each well filling position, and there
are a plurality of such positions, has an empty and overfill
cannula which is connected to an evacuated manifold to empty wells,
and a fill cannula which is connected to a manifold which is
supplied by wash liquid under pressure from a peristaltic pump 164A
through a flexible tube 166A. The input to the pump 164A is
connected through a flexible tube 168A to a wash solution
reservoir. The wash head 144A is coupled to the integrated head
132A by a mechanism (not shown) such that it can be lowered up and
down independently of any movement of the entire head. There is a
separate wash head movement motor, motor #11 in FIG. 11 which
implements the independent wash head movement, and a solenoid
operated valve 172A, #12 in FIG. 11.
The pumps 150A and 164A are driven by pump motors #3 and #4
respectively in FIG. 11 under control of the main microprocessor
134A and motor drive controllers (not shown) in the interface
136A.
The multichannel head 142A consists of a plurality of pipette tip
supports which are equal in number and have the same center to
center spacing as the wells in the plates 156A, 158A, 160A and 162A
under the head. Each tip support, as in the case of the long tips
picked up by the x-y head, is sized so as to fit into the
projecting end of a short tip stored in a storage position in the
plate 162A beneath the head. The manner of picking up the tips is
the same as in the case of the x-y head but there is no need to
move the multichannel head 142A in the X direction. This is because
the plate 62A is in a registered position on a bed 174A such that
the tip supports are exactly lined up with the center lines of the
tips stored in the storage positions in the plate 62A. The bed 174A
is supported on rails (not shown) such that it can slide either way
in the Y direction. The bed 174A is driven by a belt drive and a
motor #2 in FIG. 11 (not shown in FIG. 10) to cause movement to any
desired position on the Y axis. Such movements are made under
control of the main microprocessor 134A and the motor controller
for motor #2 in the interface 136A. In other embodiments, the head
132A may be mounted on tracks and moved in the Y direction, and the
bed 174A can be stationary. To pick up a short tip, the bed 174A is
moved such that the short tips are lined up under the multichannel
head tip supports and the integrated head 132A is lowered until the
tip supports are seated in the short tip projecting portions. FIG.
10 shows the multichannel head with short tips in position on the
tip supports. The multichannel head can move in the Z direction
only under the control of motor #6 and the main microprocessor
134A.
There is a tip ejector plate (not shown) located at the bottom of
the multichannel head 142A between the upper ends of the tips
closest to the multichannel head and the bottom surface of the
multichannel head. This plate can move up and down in the Z
direction under control of two tip ejector solenoids 176A and 178A
controlled by the computer and symbolized as solenoids #8 in FIG.
11. When these solenoids are activated, the tip ejector plate is
driven down, and the tips are ejected. During this tip ejection
action, the tip ejector plate travels a known distance, D,
downward. The significance of this is as follows. In the preferred
embodiment, the tips have ribs extending radially therefrom around
the circumference of the tip at the end where the multichannel head
engages the tip. These tips extend longitudinally down the tip for
a short distance and stop. The ends of these ribs provide support
points upon which the tip rests when it is in place in its storage
container. In the preferred embodiment, after an enzyme transfer
cycle when the tips are about to be ejected back into their storage
wells, the multichannel head is lowered to a point such that the
bottoms of the ribs are located a distance D above the top surface
of the tip storage well upon which the ribs of the tips will
eventually rest. The tip ejector plate is then operated such that
the tips are driven down into solid contact with the tip storage
tray. This prevents the tips from wobbling when they are ejected
such that fluid clinging to the tip is discouraged from being
thrown off. This minimizes the chances of cross contamination where
multiple tips which are mapped to specific rows of nucleic acids
and specific rows of enzymes are used. There is also a projection
on the tip ejector plate to eject the long tip on the x-y head when
it is moved to the extreme right position in the X direction
(farthest from the origin).
There are two bar code read heads which cannot be seen in FIG. 10
and which serve to read bar codes on the test tubes and the mixing
trays to provide identifying information to the host computer and
supervisory microprocessor 134A regarding the samples or chemicals
in the test tubes and the donors or chemicals present in the mix
trays. These bar code readers are conventional and their details of
structure and operation need not be given here.
There is a hollow cavity or cylinder in the x-y head which has a
volume which changes with position of the piston drive frame 138A.
The mechanical details of the x-y head 128A are known and available
from Cetus Corporation in Emeryville, Calif. in certain models of
the PRO/PETTE.RTM. liquid handler. This internal volume is coupled
in any conventional way to a pressure transducer (not shown) by a
flexible hose 180A which is long enough to not interfere with
operation of the head 132A. Preferably the pressure transducer is
mounted in the instrument cabinet 182A near the main microprocessor
134A and the interface 136A. This transducer is symbolized by the
transducer #13 in FIG. 11.
FIG. 11 also includes a programmable read only memory (PROM) 184A
and a random access memory (RAM) 186A. The PROM stores all the
preprogrammed sequences of instructions, i.e., subroutines and
"files", for various operations which cause the main microprocessor
134A to send the proper addresses, data and control signals on the
busses 188A, 190A and 192A to the interface 136A to cause the
peripheral devices and motors etc., #'s 1-13, to perform the proper
movements in the proper sequence. The PROM also contains
instructions to ask the user a series of initialization questions
regarding the process parameters to be used for each process. The
questions are asked through a series of displayed messages on the
display of the user interface 194A. Default answers are stored in
the PROM and any answers provided by the user through the keyboard
on the user interface are read by the main microprocessor 134A and
stored in a database for that particular file in an EEPROM 185A.
The EEPROM 185A then stores the user supplied answers for a
modified file as a database for that file along with the file
number supplied by the user for that file and the routine in PROM
184A to which the data pertains. Thereafter, when the user requests
that that file be run, the main microprocessor 134A accesses the
database in EEPROM 185A and stores it in RAM 186A. When the
computer needs to know how much liquid to draw, which wells to put
it in etc., it accesses the particular process parameter it needs
from RAM 186A when it reaches the particular point in the
instruction sequence stored in PROM 184A that calls for the data.
There is also a linking field stored in the database for each file
which instructs the main microprocessor 134A which file, i.e.,
which address in the EEPROM 185A to start with in executing the
next file stored in EEPROM 185A after completing execution of the
file currently being processed. Only user modified files stored in
EEPROM 185A can be linked. At the end of each subroutine in PROM
184A there is an instruction or set of instructions which cause the
main microprocessor 134A to access the database for that file in
EEPROM 185A and read the linking field. That field will contain the
address of the starting point for the next sequence of
instructions, i.e., the next file, to be run by the main
microprocessor 134A from the EEPROM 185A. By changing the contents
of the linking field in the database for each file, the user can
put together long strings of files for execution. The user is asked
at the end of each batch of file initialization questions whether
he wants to link the file he his just customized to another
file.
The interface 136A serves to connect the host computer to the bar
code scanners through a UART 187A and to the motors through a
plurality of single chip microprocessor motor controllers. The host
microprocessor 134A, an Intel 8085 for which the software is
included herewith as a microfiche appendix has data, address and
control busses 190A, 188A, and 192A which are coupled to a UART
187A and a dual UART 189A. The two UART's convert the parallel data
on the data bus 190A to serial data for communication to other
devices in the interface and to a host CPU (not shown). The serial
data from the UART 187A is coupled on line 191A to a set of Intel
8051 microprocessors which are programmed as motor controllers
193A. The program which customizes each general purpose Intel 8051
microprocessor to become a stepper motor controller (each
controller is identical, and each controller can control 4 motors
in the system) is attached hereto as a microfiche appendix.
To run the amplification sequence, one of the motor controller
output pins is dedicated to controlling the fluid control
multiplexer. This is shown as line 56A coupling the motor
controllers 193A to a solenoid driver 57A. This solenoid driver may
either drive the solenoids directly or may drive a relay which in
turn controls the current flow through the solenoids which are used
to implement the fluid control multiplexer 46A in FIG. 8.
Each microprocessor programmed with the code of microfiche Appendix
C becomes a motor controller which can accept a predetermined set
of motor control commands from the main microprocessor 134A to
start and stop each motor it controls, tell each how many steps to
move, and tell each the run rate. Each motor controller can also
read the position of any motor under its control and report that
information to the main microprocessor 134A. The microprocessor
134A sends these motor controllers commands which control the modes
the motors operate in, indicate which motor is being addressed, and
controls whether the motor is to be started, stopped, jogged or
sent to its home position. Certain data bytes are sent to specify
the start rate, the run rate, the jog rate, the acceleration rate
and the maximum position limit to which the motor will be allowed
to move. These data bytes are used to control the velocity profile
for each movement of the motors for maximum accuracy in delivery
quantities and position. Every start, jog and home command will
also contain a destination word indicating the desired position to
which the motor should move its driven part. There are also read
commands so that the main microprocessor 134A can read the position
of any given motor to determine the position of that motor's driven
part.
The line 191A is also coupled to a bar code microprocessor 195A,
the software for which is included herewith as a microfiche
appendix. The bar code microprocessor 195A is coupled to the bar
code read heads #'s 9 and 10, and interprets their signals. The
mechanical details of the placement and apparatus for causing the
bar code read heads to read the bar codes are conventional. The
data derived from the bar code read heads is sent to the main
microprocessor 134A via the line 191A and the UART 187A for storage
in the RAM 186A.
The signals on the control bus 192A tell the various interface
circuits whether the computer is reading or writing and other
things about the status of the busses and the main microprocessor
134A. Each of the motor controllers, UART's and the A/D converter
has a separate chip select input on the control bus 192A such that
the microprocessor 134A can individually address each one of these
devices alone while the other devices have their bus ports in the
tri-state condition effectively isolating the desired device on the
bus.
The motor controllers 193A also contain I/O pins which are
connected to the tip eject solenoid #8 and to the wash head
solenoid vacuum control valve. These pins have specific addresses,
and when the host main microprocessor 134A wishes to activate one
of the solenoids, it addresses the particular I/O pin and sends a
data byte which changes the voltage level on the I/O pin to the
proper level to activate the solenoid in the proper fashion.
In addition the interface 136A has an A/D converter 197A to convert
the analog signal from a pressure transducer #13 to a digital
signal which can be read by the main microprocessor 134A and put
through a comparison routine. The purpose is to sense pressure
rises in the pipette connected to the x-y head of greater than a
certain amount. The A/D converter has a conversion ready interrupt
line 199A which signals when the conversion is ready. This line is
regularly polled by the microprocessor 134A, and when it signals
the conversion is ready, the host computer reads the conversion
data from the A/D converter and stores it for a comparison.
Alternatively, the pressure transducer interface circuitry can
consist of any circuit which can detect a rise in the pressure in
the chamber of the x-y pipette tip. One way of doing this is to set
a known reference level and compare the signal from the transducer
to the reference level. When the level is exceeded, an interrupt
can be generated to signal the processor that the condition being
watched for has occurred.
The UART 189A is coupled to a user interface 194A consisting of a
display and keyboard through which the host main microprocessor
134A displays messages and queries to the user and reads the users
responses on the keyboard. The manner of displaying and reading the
queries is conventional. There is also a printer 101A which can be
connected to the UART 189A to print the user defined files stored
in EEPROM 185A.
The specific software sequence that the host microprocessor 134A
runs to perform the amplification protocol is attached hereto in
source code format as microfiche Appendix A, and starts at page 4
thereof as the "seq-pcr" sequence. Microfiche Appendix A, pages
1-3, also includes the data structures and text strings that need
to be added to the PRO/GROUP.RTM. software attached hereto as the
other microfiche appendixes to modify it to run the amplification
protocol embodied in the software of microfiche Appendix A. The
amplification process motor movement commands, display commands and
solenoid valve control commands start with the statement at line 11
of page 4. The source code of the amplification sequence will be
explained with reference to the flow diagram of FIG. 12 which is a
PRO/GROUP.RTM. and PRO/PETTE.RTM. specific movement and command
sequence to implement the amplification protocol.
The sequence starts with step 200A which constitutes a start
command from the user interface terminal 194A after the user has
answered a series of questions regarding the desired process
parameters which are to control the various aspects of the process.
The database of process parameters is built by the known
PRO/PETTE.RTM. or PRO/GROUP.RTM. file editor. The database is
stored in an array shown in microfiche Appendix A. The user is
requested by the editor to supply a time in minutes and seconds for
the high temperature incubation and a time for the low temperature
chill down. The user is also asked to supply the volume desired for
the enzyme transfer and the amount of enzyme to aspirate during the
enzyme pick-up stage. The user is also asked to specify how much
enzyme to aspirate and expel during the mixing stage and how much
enzyme to dispense during the initial discharge of enzyme into the
reaction chamber. Finally, the user is asked to specify the time
for the post transfer incubation at low temperature, any rows to
skip, the number of amplification cycles to perform and the speed
of liquid transfer followed by the number of the next file to link
to for further processing. All this activity is symbolized by the
block 195A.
After the process parameters are defined and the array shown in
microfiche Appendix A is filled in, the user is asked whether he or
she wishes to run the amplification file, print the process
parameters just defined or store the answers in memory for future
use. This is symbolized by step 196A. If the answer is store or
print, processing proceeds to the appropriate one of blocks 197A or
198A to carry out the appropriate action. If the answer is run,
processing proceeds to step 200A and the amplification protocol is
begun.
The first step is to home all the relevant stepper motors to a
known home position as symbolized by step 202A. Next, the
microprocessor checks the process parameter array to determine
whether the high temperature incubation time is non-zero as
symbolized by step 204A. If it is non-zero, processing proceeds to
step 206A where the high temperature apparatus is switched on to
begin heating plate 1 to the high temperature incubation
temperature. The elapsed time from the time the high temperature
mechanism is turned on is timed in step 208A and compared to the
time in the process parameter array (hereafter the array). When the
two times are equal, processing proceeds to step 210A where the
time for chill down to the transfer temperature defined in the
array is examined to determine if it is non-zero. If the answer in
step 204A was that the high temperature incubation time was zero,
processing proceeds directly to step 210A. Steps 204A to 208A are
implemented by lines 31 through 34 on page 4 of microfiche Appendix
A.
If the answer to the question of step 210A is that a non-zero chill
down time is specified in the array, then processing proceeds to
step 212A to switch on the low temperature mechanism. At this time,
the system begins timing the elapsed time since the chill mechanism
was turned on as symbolized by step 214A. When this time equals the
chill down time specified in the array, processing proceeds to step
216A to begin the transfer of enzyme from plate 2 to plate 1. The
chill down time specified in the array is preferably empirically
determined to be the time it takes to chill plate 1 from 98 degrees
centigrade to 37 degrees centigrade. Steps 210A through 214A are
implemented by the code at lines 36 to 39. The steps 206A and 212A
are implemented by the "mtr-cmd" statements at lines 33 and 37
respectively. The statement at line 33 clears one output bit on one
motor controller chip which bit is coupled through suitable
interface circuitry to the solenoid operated valves which are used
to implement the fluid control multiplexer 46A of FIG. 8. Clearing
this bit causes the heated fluid to be switched to a circulatory
path through plate 1. The statement of line 37 sets the same bit
which causes the solenoid operated valves to switch such that the
chilled fluid is switched into a circulatory path which includes
plate 1.
The first step in the transfer of enzyme is to pick up tips in step
216A. This is a known, standard PRO/PETTE.RTM. and PRO/GROUP.RTM.
routine (known routines from these two machines will hereafter be
referred to as standard routines and their details will not be
given other than a short summary of what they do) which moves the
bed 174A such that the multichannel head is aligned over the row of
pipette tips stored in a tip storage tray in the position 162A. The
integrated head 132A is then lowered until the nozzles of the
multichannel head 142A engage the pipette tips with a press fit and
the head is picked up to allow the tips to clear the storage block.
The multichannel head 142A is modified for the amplification
protocol in that only 6 channels, i.e., every other channel, are
used because of the increased width of the plastic inserts in the
reaction chambers. These inserts are wider than the wells in the
plates normally used with the PRO/PETTE.RTM. and PRO/GROUP.RTM.
machines, so every other channel is used. The process of step 216A
is implemented in microfiche Appendix A by the statement at line 12
of page 5.
After the tips are picked up, the bed 174A is moved to put the
proper row of the enzyme containing wells in plate 2 under the
pipette tips as symbolized by step 218A on FIG. 12B. This is
implemented by calling the standard routine move-m(TABLE . . .
shown on line 14 of page 5 of microfiche Appendix A.) The row from
which enzyme is picked up is alternated in cyclical fashion during
each amplification cycle. This is implemented by lines 11-25 at
page 4 of microfiche Appendix A.
Next, step 220A is performed to aspirate the amount of enzyme
specified in the array from the appropriate well. To do this a call
is made to the "move head" standard routine at line 14 at page 5 of
microfiche Appendix A, and this is followed by a call to a standard
aspirate routine which checks the array for the desired amount and
orders the piston drive motor 140A to move the piston far enough to
aspirate the desired amount of enzyme. After the enzyme is
aspirated, another call to the "move head" standard routine is made
to lift the tips up out of the enzyme far enough to clear the
enzyme storage plate. The process of step 220A is implemented by
the statements at lines 16 and 17 at page 5 of microfiche Appendix
A.
The next step is to deposit the desired amount of enzyme into the
plastic inserts in the row of reaction chambers in plate 1. This is
symbolized by step 222A. This step calls the standard "move bed"
routine to move the bed 174A to place the appropriate row of
reaction chambers under the tips as implemented by line 17 at page
5 of microfiche Appendix A. The head 132A in FIG. 10 is then moved
down to place the tips in the liquid in the plastic inserts in the
reaction chambers as implemented by line 18 at page 5 of microfiche
Appendix A. The standard expel routine is called at line 19 which
checks the array for the desired amount of enzyme to deliver and
orders the piston drive motor 140A to move the piston drive frame
138A and pistons far enough to expel the amount of enzyme specified
by the user in the array.
Next in step 224A, the array is checked to determine if the user
desires a mix sequence to be performed. This is implemented by line
21 at page 5 of microfiche Appendix A. If the answer is yes, the
standard "aspirate" and "expel" routines are called alternately at
lines 22 and 23 to aspirate the amount of enzyme specified in the
"mix volume" entry in the array and to discharge it back into the
chamber. This is repeated the number of times specified in the
array. The last "expel" call causes the piston drive motor 140A to
move the piston drive frame 138A down farther than necessary to
expel the specified amount of enzyme. This is done to "blow out"
the last drops of enzyme and reaction mix to prevent a drop from
falling out of the pipette when the tips are moved back to their
storage positions, possibly thereby causing cross-contamination.
This is symbolized by step 228A and is implemented by the "putips"
routine called at line 28 at page 5 of microfiche Appendix A. This
routine is slightly modified for the amplification protocol however
in that the tips are not ejected until the head is lowered to the
point that the bottoms of the ribs on the tips are located a
distance D above the top surface of the plate where D is equal to
the distance that the tip ejector plate moves during the ejection
motion. The tips are ejected into the row in the tip storage block
which is mapped to the row of enzyme and the row of reaction
chambers between which the enzyme aliquot was just transferred. In
the preferred embodiment, each tip is completely surrounded by a
physical barrier tip storage well to prevent cross contamination by
splashing.
This completes the enzyme transfer for the first cycle. A step 230A
then increments the tip pointer to the next tip row. There are
plural rows of tips, enzyme storage wells and reaction chambers in
the preferred embodiment. Each row of tips is mapped to a specific
row of enzyme and a specific row of reaction chambers to prevent
the tips in a particular row from ever touching nucleic acid from
one row of reaction chambers and accidentally cross contaminating
the nucleic acid in another row of reaction chambers by virtue of
liquid clinging to pipette tips. The tips rows are mapped to
particular enzyme rows because multiple transfers of enzyme are
transferred between each row of enzyme and its assigned row of
reaction chambers. Because of the multiple transfers, and because
the liquid clings to the tips during each transfer, each row of
enzyme becomes contaminated with the nucleic acid from its assigned
row. If only one enzyme row were used for all reaction chamber
rows, cross contamination could occur which could destroy the
integrity of the amplification procedure. The amplification
protocol is carried out on only one row of reaction chambers in
plate 1 during any particular cycle. The increment tip pointer step
230A merely prepares the machine for the next cycle to pick up the
appropriate row of tips which are used for processing the next row
of reaction chambers to be processed. This step is implemented by
lines 36 and 37 at page 5 of microfiche Appendix A.
Next, the computer checks the array to determine if the low
temperature incubate time is non-zero as symbolized by step 232A.
If it is, the computer begins timing the low temperature incubation
elapsed time in step 234A. When the specified time has elapsed,
processing proceeds to step 236A where the number of amplification
cycles completed at that point is compared to the number of
amplification cycles desired by the user. If the desired number
have been completed, processing is done as symbolized by step 238A.
If more cycles remain to be done, processing returns to step 200A
on FIG. 12A.
Adaptation of the PRO/GROUP.RTM. or PRO/PETTE.RTM. Machines for
Heat or Cool Steps During Other Assays
Heating and/or cooling steps are sometimes useful in assays to do
such things as heat reagents or reaction mixes or cool the same. To
carry out such an assay using the apparatus disclosed herein and
the known PRO/GROUP.RTM. and PRO/PETTE.RTM. machines would require
a simple modification of the programs stored in those machines. For
example, to perform a heating or cooling step at any point in the
blood grouping process carried out by the PRO/GROUP.RTM. machine as
disclosed in the U.S. patent application identified above and
incorporated herein by reference describing that machine and the
blood grouping process performed by it, certain statements would
have be added to the program run by the machine. Those statements
are the motor command statements shown at lines 33 and/or 37 at
page 5 of microfiche Appendix A. The statement at line 56 would be
added at the appropriate place in the code implementing the step in
the process where a heating step was desired, and the statement at
line 60 would be added at the appropriate place in the code
implementing a step in the process where a cooling step was to be
performed. Another example of a process which could be performed to
advantage using the heating and cooling steps of which the machine
is capable is the process disclosed in U.S. Pat. No. 4,683,202
"Method for Detection of Polymorphic Restriction Sites and Nucleic
Acid Sequences", which is hereby incorporated by reference.
Amplification Protocol
The amplification protocol automated by the present invention is a
process for amplifying existing nucleic acid sequences using
thermostable enzymes. The amplification process is disclosed and
claimed in U.S. patent application Ser. No. 899,513 filed Aug. 22,
1986, now abandoned (Cetus Case 2177.3) filed concurrently
herewith, wherein Cetus Corporation is the assignee, as in the
present invention, entitled "Process for Amp-lifying, Detecting,
and/or Cloning Nucleic Acid Sequences Using A Thermostable Enzyme."
The disclosure for said application is herein incorporated by
reference.
More specifically, the amplification method involves amplifying at
least one specific nucleic acid sequence contained in a nucleic
acid or a mixture of nucleic acids, wherein if the nucleic acid is
double-stranded, it consists of two separated complementary strands
of equal or unequal length, which process comprises:
(a) contacting each nucleic acid strand with four different
nucleotide triphosphates and one oligonucleotide primer for each
different specific sequence being amplified, wherein each primer is
selected to be substantially complementary to different strands of
each specific sequence, such that the extension product synthesized
from one primer, when it is separated from its complement, can
serve as a template for synthesis of the extension product of the
other primer, said contacting being at a temperature which promotes
hybridization of each primer to its complementary nucleic acid
strand;
(b) contacting each nucleic acid strand, at the same time as or
after step (a), with a thermostable enzyme which catalyzes
combination of the nucleotide triphosphates to form primer
extension products complementary to each strand of each nucleic
acid;
(c) heating the mixture from step (b) for an effective time and at
an effective temperature to promote the activity of the enzyme, and
to synthesize, for each different sequence being amplified, an
extension product of each primer which is complementary to each
nucleic acid strand template, but not so high as to separate each
extension product from its complementary strand template;
(d) heating the mixture from step (c) for an effective time and at
an effective temperature to separate the primer extension products
from the templates on which they were synthesized to produce
single-stranded molecules, but not so high as to denature
irreversibly the enzyme;
(e) cooling the mixture from step (d) for an effective time and to
an effective temperature to promote hybridization of each primer to
each of the single-stranded molecules produced in step (d); and
(f) heating the mixture from step (e) for an effective time and to
an effective temperature to promote the activity of the enzyme and
to synthesize, for each different sequence being amplified, an
extension product of each primer which is complementary to each
nucleic acid strand template produced in step (d), but not so high
as to separate each extension product from its complementary strand
template, wherein steps (e) and (f) may be carried out
simultaneously or sequentially.
Steps (d)-(f) may be repeated until the desired level of sequence
amplification is obtained.
The amplification method is useful not only for producing large
amounts of an existing completely specified nucleic acid sequence,
but also for producing nucleic acid sequences which are known to
exist but are not completely specified. In either case an initial
copy of the sequence to be amplified must be available, although it
need not be pure or a discrete molecule.
The term "oligonucleotide" as used herein is defined as a molecule
comprised of two or more deoxyribonucleotides or ribonucleotides,
preferably more than three. Its exact size will depend on many
factors, which in turn depend on the ultimate function or use of
the oligonucleotide. The oligonucleotide may be derived
synthetically or by cloning.
The term "primer" as used herein refers to an oligonucleotide,
whether occurring naturally as in a purified restriction digest or
produced synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is induced, i.e., in the presence of four
different nucleotide triphosphates and a thermostable enzyme at a
suitable temperature and pH.
The primer is preferably single-stranded for maximum efficiency in
amplification, but may alternatively be double-stranded. If
double-stranded, the primer is first treated to separate its
strands before being used to prepare extension products.
Preferably, the primer is an oligodeoxyribonucleotide. The primer
must be sufficiently long to prime the synthesis of extension
products in the presence of thermostable enzyme. The exact lengths
of the primers will depend on many factors, including temperature,
source of primer and use of the method. For example, depending on
the complexity of the target sequence, the oligonucleotide primer
typically contains 15-25 or more nucleotides, although it may
contain more or fewer nucleotides. Short primer molecules generally
require cooler temperatures to form sufficiently stable hybrid
complexes with template.
The primers herein are selected to be "substantially" complementary
to the different strands of each specific sequence to be amplified.
This means that the primers must be sufficiently complementary to
hybridize with their respective strands. Therefore, the primer
sequence need not reflect the exact sequence of the template. For
example, a non-complementary nucleotide fragment may be attached to
the 5 end of the primer, with the remainder of the primer sequence
being complementary to the strand. Alternatively, non-complementary
bases or longer sequences can be interspersed into the primer,
provided that the primer sequence has sufficient complementarity
with the sequence of the strand to be amplified to hybridize
therewith and thereby form a template for synthesis of the
extension product of the other primer. However, for detection
purposes, particularly using labeled sequence-specific probes, the
primers typically have exact complementarity to obtain the best
results.
As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes each of which cut
double-stranded DNA at or near a specific nucleotide sequence.
For embodiments employing liquid handling apparatus but not a
thermostable enzyme, to the cooled mixture is added an appropriate
agent for inducing or catalyzing the primer extension reaction
(herein called "inducing agent"), and the reaction is allowed to
occur under conditions known in the art. This synthesis reaction
may occur at from room temperature up to a temperature above which
the inducing agent no longer functions efficiently. Thus, for
example, if DNA polymerase is used as inducing agent, the
temperature is generally no greater than about 40.degree. C. Most
conveniently the reaction occurs at approximately 37.degree. C.
The inducing agent may be any compound or system which will
function to accomplish the synthesis of primer extension products,
including enzymes. Suitable enzymes for this purpose include, for
example, E. coli DNA polymerase I, Klenow fragment of E. coli DNA
polymerase I, T4 DNA polymerase, other available DNA polymerases,
reverse transcriptase, and other enzymes, including heat-stable
enzymes, which will facilitate combination of the nucleotides in
the proper manner to form the primer extension products which are
complementary to each nucleic acid strand. Generally, the synthesis
will be initiated at the 3' end of each primer and proceed in the
5' direction along the template strand, until synthesis terminates,
producing molecules of different lengths. There may be inducing
agents, however, which initiate synthesis at the 5' end and proceed
in the other direction, using the same process as described
above.
As used herein, the term "thermostable enzyme" refers to an enzyme
which is stable to heat and is heat resistant and catalyzes
(facilitates) combination of the nucleotides in the proper manner
to form the primer extension products which are complementary to
each i nucleic acid strand. Generally, the synthesis will be
initiated at the 3 end of each primer and will proceed in the 5'
direction along the template strand, until synthesis terminates,
producing molecules of different lengths. There maybe thermostable
enzymes, however, which initiate synthesis at the 5' end and
proceed in the other direction, using the same process as described
above.
The thermostable enzyme herein must satisfy a single criterion to
be effective for the amplification reaction, i.e., the enzyme must
not become irreversibly denatured (inactivated) when subjected to
the elevated temperatures for the time necessary to effect
denaturation of double-stranded nucleic acids. Irreversible
denaturation for purposes herein refers to permanent and complete
loss of enzymatic activity. The heating conditions necessary for
denaturation will depend, e.g., on the buffer salt concentration
and the length and nucleotide composition of the nucleic acids
being denatured, but typically range from about 90.degree. to about
105.degree. C. for a time depending mainly on the temperature and
the nucleic acid length, typically about 0.5 to four minutes.
Higher temperatures may be tolerated as the buffer salt
concentration and/or GC composition of the nucleic acid is
increased. Preferably, the enzyme will not become irreversibly
denatured at about 90.degree.-100.degree. C.
The thermostable enzyme herein preferably has an optimum
temperature at which it functions which is higher than about
40.degree. C., which is the temperature below which hybridization
of primer to template is promoted. The higher the temperature
optimum for the enzyme, the greater the specificity and/or
selectivity of the primer-directed extension process. However,
enzymes which are active below 40.degree. C., e.g., at 37.degree.
C., are also within the scope of this invention provided they are
heat-stable. Preferably, the optimum temperature ranges from about
50.degree. to 80.degree. C., more preferably 60.degree.-80.degree.
C.
Examples of enzymes which have been reported in the literature as
being resistant to heat include heat-stable polymerases, such as,
e.g., polymerases extracted from the thermophilic bacteria Thermus
flavus, Thermus tuber, Thermus thermophilus, Bacillus
stearothermophilus (which has a somewhat lower temperature optimum
than the others listed), Thermus aquaticus, Thermus lacteus,
Thermus rubens, and Methanothermus fervidus.
The preferred thermostable enzyme herein is a DNA polymerase
isolated from Themus aquaticus, strain YT-1, and purified as
described in U.S. application Ser. No. 899,241, filed Aug. 22, 1986
now abandoned (Cetus Docket 2303), entitled "Purified Thermostable
Enzyme," the disclosure of which is incorporated herein by
reference. Briefly, Thermus aquaticus cells are grown and the
polymerase is isolated and purified from the crude extract using
the first five steps indicated by Kaledin et al., Biokhimiya, 45,
644-651 (1980), the disclosure of which is incorporated herein by
reference. During the fifth step (DEAE column at pH 7.5), an assay
is made for contaminating deoxyribonucleases (endonucleases and
exonucleases) and only those fractions with polymerase activity and
minimal nuclease contamination are pooled. The last chromatographic
purification step uses a phosphocellulose column suggested by Chien
et al., J. Bacteriol., 127: 1550-1557 (1976), the disclosure of
which is incorporated herein by reference. Nuclease(s) and
polymerase activities are assayed, and only those polymerase
fractions with minimal nuclease contamination are pooled.
While Kaledin et al. and Chien et al. report a purified enzyme with
a molecular weight of 62-63 kdaltons, data using the purified
protocol described above suggest a molecular weight of about 86-90
kdaltons.
In general, the amplification process involves a chain reaction for
producing, in exponential quantities relative to the number of
reaction steps involved, at least one specific nucleic acid
sequence given (a) that the ends of the required sequence are known
in sufficient detail that oligonucleotides can be synthesized which
will hybridize to them, and (b) that a small amount of the sequence
is available to initiate the chain reaction. The product of the
chain reaction will be a discrete nucleic acid duplex with termini
corresponding to the ends of the specific primers employed.
Any nucleic acid sequence, in purified or nonpurified form, can be
utilized as the starting nucleic acid(s), provided it contains or
is suspected to contain the specific nucleic acid sequence desired.
Thus, the process may employ, for example, DNA or RNA, including
messenger RNA, which DNA or RNA may be single-stranded or
double-stranded. In addition, a DNA-RNA hybrid which contains one
strand of each may be utilized. A mixture of any of these nucleic
acids may also be employed, or the nucleic acids produced from a
previous amplification reaction herein using the same or different
primers may be so utilized. The specific nucleic acid sequence to
be amplified may be only a fraction of a larger molecule or can be
present initially as a discrete molecule, so that the specific
sequence constitutes the entire nucleic acid.
It is not necessary that the sequence to be amplified be present
initially in a pure form; it may be a minor fraction of a complex
mixture, such as a portion of the B-globin gene contained in whole
human DNA (as exemplified in the Saiki et al. article, supra) or a
portion of a nucleic acid sequence due to a particular
microorganism which organism might constitute only a very minor
fraction of a particular biological sample. The starting nucleic
acid sequence may contain more than one desired specific nucleic
acid sequence which may be the same or different. Therefore, the
amplification process is useful not only for producing large
amounts of one specific nucleic acid sequence, but also for
amplifying simultaneously more than one different specific nucleic
acid sequence located on the same or different nucleic acid
molecules.
The nucleic acid(s) may be obtained from any source, for example,
from plasmids such as pBR322, from cloned DNA or RNA, or from
natural DNA or RNA from any source, including bacteria, yeast,
viruses, organelles, and higher organisms such as plants or
animals. DNA or RNA may be extracted from blood, tissue material
such as chorionic villi, or amniotic cells by a variety of
techniques such as that described by Maniatis et al., Molecular
Cloning (1982), 280-231.
If probes are used which are specific to a sequence being amplified
and thereafter detected, the cells may be directly used without
extraction of the nucleic acid if they are suspended in hypotonic
buffer and heated to about 90.degree.-100.degree. C., until cell
lysis and dispersion of intracellular components occur, generally 1
to 15 minutes. After the heating step the amplification reagents
may be added directly to the lysed cells.
Any specific nucleic acid sequence can be produced by the
amplification process. It is only necessary that a sufficient
number of bases at both ends of the sequence be known in sufficient
detail so that two oligonucleotide primers can be prepared which
will hybridize to different strands of the desired sequence and at
relative positions along the sequence such that an extension
product synthesized from one primer, when it is separated from its
template (complement), can serve as a template for extension of the
other primer into a nucleic acid sequence of defined length. The
greater the knowledge about the bases at both ends of the sequence,
the greater can be the specificity of the primers for the target
nucleic acid sequence, and thus the greater the efficiency of the
process.
It will be understood that the world "primer" as used hereinafter
may refer to more than one primer, particularly in the case where
there is some ambiguity in the information regarding the terminal
sequence(s) of the fragment to be amplified. For instance, in the
case where a nucleic acid sequence is inferred from protein
sequence information, a collection of primers containing sequences
representing all possible codon variations based on degeneracy of
the genetic code will be used for each strand. One primer from this
collection will be homologous with the end of the desired sequence
to be amplified.
The oligonucleotide primers may be prepared using any suitable
method, such as, for example, the phosphotriester and
phosphodiester methods described above, or automated embodiments
thereof. In one such automated embodiment, diethylphosphoramidites
are used as starting materials and may be synthesized as described
by Beaucage et al., Tetrahedron Letters (1981), 22: 1859-1862. One
method for synthesizing oligonucleotides on a modified solid
support is described in U.S. Pat. No. 4,458,066. It is also
possible to use a primer which has been isolated from a biological
source (such as a restriction endonuclease digest).
The specific nucleic acid sequence is produced by using the nucleic
acid containing that sequence as a template. The first step
involves contacting each nucleic acid strand with four different
nucleotide triphosphates and one oligonucleotide primer for each
different nucleic acid sequence being amplified or detected. If the
nucleic acids to be amplified or detected are DNA, then the
nucleotide triphosphates are dATP, dCTP, dGTP and TTP.
The nucleic acid strands are used as a template for the synthesis
of additional nucleic acid strands. This synthesis can be performed
using any suitable method. Generally it occurs in a buffered
aqueous solution, preferably at a ph of 7-9, most preferably about
8. Preferably, a molar excess (for cloned nucleic acid, usually
about 1000:1 primer:template, and for genomic nucleic acid, usually
about 10.sup.6 :1 primer:template) of the two oligonucleotide
primers is added to the buffer containing the separated template
strands. It is understood, however, that the amount of
complementary strand may not be known if the process herein is used
for diagnostic applications, so that the amount of primer relative
to the amount of complementary strand cannot be determined with
certainty. As a practical matter, however, the amount of primer
added will generally be in molar excess over the amount of
complementary strand (template) when the sequence to be amplified
is contained in a mixture of complicated long-chain nucleic acid
strands. A large molar excess is preferred to improve the
efficiency of the process.
The resulting solution is then treated according to whether the
nucleic acids being amplified or detected are double or
single-stranded. If the nucleic acids are single-stranded, then no
denaturation step need be employed, and the reaction mixture is
held at a temperature which promotes hybridization of the primer to
its complementary target (template) sequence. Such temperature is
generally from about 35.degree. to about 65.degree. C. or more,
preferably about 37.degree. C. to about 50.degree. C., for an
effective time, generally one-half to five minutes, preferably
one-three minutes.
The complement to the original single-stranded nucleic acid may be
synthesized by adding one or two oligonucleotide primers thereto.
If an appropriate single primer is added, a primer extension
product is synthesized in the presence of the primer, the
thermostable enzyme and the nucleotide triphosphates. The product
will be partially complementary to the single-stranded nucleic acid
and will hybridize with the nucleic acid strand to form a duplex of
strands of unequal length which may then be separated into single
strands as described above to produce two single separated
complementary strands. Alternatively, two appropriate primers may
be added to the single-stranded nucleic acid and the reaction
carried out.
If the nucleic acid contains two strands, it is necessary to
separate the strands of the nucleic acid before it can be used as
the template. This strand separation can be accomplished by any
suitable denaturing method including physical, chemical or
enzymatic means. One preferred physical method of separating the
strands of the nucleic acid involves heating the nucleic acid until
it is completely (>99%) denatured. Typical heat denaturation
involves temperatures ranging from about 90.degree. to 105.degree.
C. for times generally ranging from about 0.5 to 5 minutes.
Preferably the effective denaturing temperature is
90.degree.-100.degree. C. for 0.5 to 3 minutes. Strand separation
may also be induced by an enzyme from the class of enzymes known as
helicases or the enzyme RecA, which has helicase activity and in
the presence of riboATP is known to denature DNA. The reaction
conditions suitable for separating the strands of nucleic acids
with helicases are described by Kuhn Hoffmann-Barling,
CSH-Quantitative Biology, 43: 63 (1978), and techniques for using
RecA are reviewed in C. Radding, Ann. Rev. Genetics, 16: 405-37
(1982). The denaturation produces two separated complementary
strands of equal or unequal length.
If the double-stranded nucleic acid is denatured by heat, the
reaction mixture is allowed to cool to a temperature which promotes
hybridization of each primer present to its complementary target
(template) sequence. This temperature is usually from about
35.degree. to 65.degree. C. or more, preferably from about
37.degree. C. to about 50.degree. C., maintained for an effective
time, generally 0.5 to 5 minutes, and preferably 1-3 minutes. In
practical terms, the temperature is simply lowered from about
95.degree. C. to about 65.degree. C. or to as low as 37.degree. C.
and hybridization occurs at a temperature within this range.
Whether the nucleic acid is single- or double-stranded, the
thermostable enzyme may be added at the denaturation step or when
the temperature is being reduced to or is in the range for
promoting hybridization. The reaction mixture is then heated to a
temperature at which the activity of the enzyme is promoted or
optimized, i.e., a temperature sufficient to increase the activity
of the enzyme in facilitating synthesis of the primer extension
products from the hybridized primer and template. The temperature
must actually be sufficient to synthesize an extension product of
each primer which is complementary to each nucleic acid template,
but must not be so high as to denature each extension product from
its complementary template (i.e., the temperature is generally less
than about 80.degree.-90.degree. C.).
Depending mainly on the types of enzyme and nucleic acid(s)
employed, the typical temperature effective for this synthesis
reaction generally ranges from about 40.degree. to 80.degree. C.,
preferably 50.degree.-70.degree. C. The temperature more preferably
ranges from about 60.degree.-65.degree. C. when a polymerase from
Thermus aquaticus is employed. The period of time required for this
synthesis may range from about 0.5 to 40 minutes or more, depending
mainly on the temperature, the length of the nucleic acid, the
enzyme and the complexity of the nucleic acid mixture, preferably 1
to 3 minutes. If the nucleic acid is longer, a longer time period
is generally required. Preferably, an amount of dimethylsulfoxide
(DMSO) which is sufficient to facilitate detection of amplified
product is also present in the reaction mixture. The DMSO may be
added at any step of the process herein, but preferably is present
at this step and at all succeeding steps. Most preferably, 5-10% by
volume of DMSO is present.
The newly synthesized strand and its complementary nucleic acid
strand form a double-stranded molecule which is used in the
succeeding steps of the process. In the next step, the strands of
the double-stranded molecule are separated by heat denaturation at
a temperature effective to denature the molecule, but not so high
that the thermostable enzyme is completely and irreversibly
denatured or inactivated. Depending mainly on the type of enzyme
and the length of nucleic acid, this temperature generally ranges
from about 90.degree. to 105.degree. C., more preferably
90.degree.-100.degree. C., and the time for denaturation typically
ranges from 0.5 to four minutes, depending mainly on the
temperature and the nucleic acid length.
After this time, the temperature is decreased to a level which
promotes hybridization of the primer to its complementary
single-stranded molecule (template) produced from the previous
step. Such temperature is described above.
After this hybridization step, or in lieu of (or concurrently with)
the hybridization step, the temperature is adjusted to a
temperature which is effective to promote the activity of the
thermostable enzyme to enable synthesis of a primer extension
product using as template the newly synthesized strand from the
previous step. The temperature again must not be so high as to
separate (denature) the extension product from its template, as
previously described (usually from 40.degree. to 80.degree. C. for
0.5 to 40 minutes, preferably 50.degree. to 70.degree. C. for 1-3
minutes). Hybridization may occur during this step, so that the
previous step of cooling after denaturation is not required. In
such a case using simultaneous steps, a temperature range of
50.degree.-70.degree. C. is preferred.
The heating and cooling steps of strand separation, hybridization,
and extension product synthesis can be repeated as often as needed
to produce the desired quantity of the specific nucleic acid
sequence, depending on the ultimate use. The only limitation is the
amount of the primers, the thermostable enzyme and the nucleotide
triphosphates present. Preferably, the steps are repeated at least
once. For use in detection, the number of cycles will depend, e.g.,
on the nature of the sample. For example, fewer cycles will be
required if the sample being amplified is pure. If the sample is a
complex mixture of nucleic acids, more cycles will be required to
amplify the signal sufficiently for its detection. For general
amplification and detection, preferably the process is repeated at
least 20 times.
When labeled sequence-specific probes are employed as described
below, preferably the steps are repeated at least five times. When
human genomic DNA is employed with such probes, the process is
repeated preferably 15-30 times to amplify the sequence
sufficiently that a clearly detectable signal is produced, i.e., so
that background noise does not interfere with detection.
As will be described in further detail below, the amount of the
specific nucleic acid sequence produced will accumulate in an
exponential fashion.
No additional nucleotides, primers, or thermostable enzyme need be
added after the initial addition, provided that the enzyme has not
become denatured or inactivated irreversibly, in which case it is
necessary to replenish the enzyme after each denaturing step.
Addition of such materials at each step, however, will not
adversely affect the reaction.
When it is desired to produce more than one specific nucleic acid
sequence from the first nucleic acid or mixture of nucleic acids,
the appropriate number of different oligonucleotide primers are
utilized. For example, if two different specific nucleic acid
sequences are to be produced, four primers are utilized. Two of the
primers are specific for one of the specific nucleic acid sequences
and the other two primers are specific for the second specific
nucleic acid sequence. In this manner, each of the two different
specific sequences can be produced exponentially by the present
process.
For embodiments with a liquid handling capability, the PCR method
can be performed in a step-wise fashion where after each step new
reagents are added, or simultaneously, where all reagents are added
at the initial step, or partially step-wise and partially
simultaneous, where fresh reagent is added after a given number of
steps. If a method of strand separation, such as heat, is employed
which will inactivate the inducing agent, as in the case of a
heat-labile enzyme, then it is necessary to replenish the inducing
agent after every strand separation step. The simultaneous method
may be utilized when an enzymatic means is used for the strand
separation step. In the simultaneous procedure, the reaction
mixture may contain, in addition to the nucleic acid strand(s)
containing the desired sequence, the strand-separating enzyme
(e.g., helicase), an appropriate energy source for the
strand-separating enzyme, such as rATP, the four nucleotides, the
oligonucleotide primers in molar excess, and the inducing agent,
e.g., Klenow fragment of E. coli DNA polymerase I. If heat is used
for denaturation in a simultaneous process, a heat-stable inducing
agent such as a thermostable polymerase may be employed which will
operate at an elevated temperature, preferably
65.degree.-90.degree. C. depending on the inducing agent, at which
temperature the nucleic acid will consist of single and double
strands in equilibrium. For smaller lengths of a nucleic acid
sequence, lower temperatures of about 50.degree. C. may be
employed. The upper temperature will depend on the temperature at
which the enzyme will degrade or the temperature above which an
insufficient level of primer hybridization will occur. Such a
heat-stable enzyme is described, e.g., by A. S. Kaledin et al.,
Biokhimiya, 45, 644-651 (1980). Each step of the process will occur
sequentially notwithstanding the initial presence of all the
reagents. Additional materials may be added as necessary.
The PCR process may be conducted continuously. In one embodiment of
the automated process, the reaction may be cycled through a
denaturing region, a reagent addition region, and a reaction
region. In another embodiment, the enzyme used for the synthesis of
primer extension products can be immobilized in a column. The other
reaction components can be continuously circulated by a pump
through the column and a heating coil in series, thus the nucleic
acids produced can be repeatedly denatured without inactivating the
enzyme.
After the appropriate length of time has passed to produce he
desired amount of the specific nucleic acid sequence, the reaction
may be halted by inactivating the enzyme in any known manner or by
separating the components of the reaction.
The present invention is demonstrated diagrammatically below, where
double-stranded DNA containing the desired sequence [S] comprised
of complementary strands [S.sup.+ ] and [S.sup.- ] is utilized as
the nucleic-acid. During the first and each subsequent reaction
cycle, extension of each oligonucleotide primer on the original
template will produce one new ssDNA molecule product of indefinite
length which terminates with only one of the primers. These
products, hereafter referred to as "long products," will accumulate
in a linear fashion; that is, the amount present after any number
of cycles will be proportional to the number of cycles.
The long products thus produced will act as templates for one or
the other of the oligonucleotide primers during subsequent cycles
and will produce molecules of the desired sequence [S.sup.+ ] or
[S.sup.- These molecules will also function as templates for one or
the other 5 of the oligonucleotide primers, producing further
[S.sup.+ ] and [S.sup.- ], and thus a chain reaction can be
sustained which will result in the accumulation of [S] at an
exponential rate relative to the number of cycles.
By-products formed by oligonucleotide hybridizations other than
those intended are not self-catalytic (except in rare instances)
and thus accumulate at a linear rate.
The specific sequence to be amplified, [S], can be depicted
diagrammatically as: ##STR1## The appropriate oligonucleotide
primers would be: ##STR2## so that if DNA containing [S] . . .
zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz . .
.
. . zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz
. . .
is separated into single strands and its single strands are
hybridized to Primers 1 and 2, the following extension reactions
can be catalyzed by a thermostable polymerase in the presence of
the four nucleotide triphosphates: ##STR3## If these four strands
are allowed to rehybridize with Primers 1 and 2 in the next cycle,
the thermostable polymerase will catalyze the following reactions:
##STR4## If the strands of the above four duplexes are separated,
the following strands are found: ##STR5##
It is seen that each strand which terminates with the
oligonucleotide sequence of one primer and the complementary
sequence of the other is the specific nucleic acid sequence [S]
that is desired to be produced.
The amount of original nucleic acid remains constant in the entire
process, because it is not replicated. The amount of the long
products increases linearly because they are produced only from the
original nucleic acid. The amount of the specific sequence
increases exponentially. Thus, the specific sequence will become
the predominant species. This is illustrated in the following
table, which indicates the relative amounts of the species
theoretically present after n cycles, assuming 100% efficiency at
each cycle:
______________________________________ Number of Double Strands
After 0 to n Cycles Cycle Number Template Long Products Specific
Sequence [S] ______________________________________ 0 1 -- -- 1 1 1
0 2 1 2 1 3 1 3 4 5 1 5 26 10 1 10 1013 15 1 15 32,752 20 1 20
1,048,555 n 1 n (2.sup.n - n - 1)
______________________________________
When a single-stranded nucleic acid is utilized as the template,
only one long product is formed per cycle.
A sequence within a given sequence can be amplified after a given
number of amplifications to obtain greater specificity of the
reaction by adding after at least one cycle of amplification a set
of primers which are complementary to internal sequences (which are
not on the ends) of the sequence to be amplified. Such primers may
be added at any stage and will provide a shorter amplified
fragment. Alternatively, a longer fragment can be prepared by using
primers with non-complementary ends but having some overlap with
the primers previously utilized in the amplification.
The amplification method may be utilized to clone a particular
nucleic acid sequence for insertion into a suitable expression
vector. The vector may be used to transform an appropriate host
organism to produce the gene product of the sequence by standard
methods of recombinant DNA technology. Such cloning may involve
direct ligation into a vector using blunt-end ligation, or use of
restriction enzymes to cleave at sites contained within the
primers.
In addition, the amplification process can be used for in vitro
mutagenesis. The oligodeoxyribonucleotide primers need not be
exactly complementary to the DNA sequence which is being amplified.
It is only necessary that they be able to hybridize to the sequence
sufficiently well to extended by the thermostable enzyme. The
product of an amplification reaction wherein the primers employed
are not exactly complementary to the original template will contain
the sequence of the primer rather than the template, thereby
introducing an in vitro mutation. In further cycles this mutation
will be amplified with an undiminished efficiency because no
further mispaired priming are required. The mutant thus produced
may be inserted into an appropriate vector by standard molecular
biological techniques and might confer mutant properties on this
vector such as the potential for production of an altered
protein.
The process of making an altered DNA sequence as described above
could be repeated on the altered DNA using different primers to
induce further sequence changes. In this way, a series of mutated
sequences could gradually be produced wherein each new addition to
the series could differ from the last in a minor way, but from the
original DNA source sequence in an increasingly major way. In this
manner, changes could be made ultimately which were not feasible in
a single step due to the inability of a very seriously mismatched
primer to function.
In addition, the primer can contain as part of its sequence a
non-complementary sequence, provided that a sufficient amount of
the primer contains a sequence which is complementary to the strand
to be amplified. For example, a nucleotide sequence which is not
complementary to the template sequence (such as, e.g., a promoter,
linker, coding sequence, etc.) may be attached at the 5' end of one
or both of the primers, and thereby appended to the product of the
amplification process. After the extension primer is added,
sufficient cycles are run to achieve the desired amount of new
template containing the non-complementary nucleotide insert. This
allows production of large quantities of the combined fragments in
a relatively short period of time (e.g., two hours or less) using a
simple technique.
The amplification method may also be used to enable detection
and/or characterization of specific nucleic acid sequences
associated with infectious diseases, genetic disorders or cellular
disorders such as cancer, e.g., oncogenes. Amplification is useful
when the amount of nucleic acid available for analysis is very
small, as, for example, in the prenatal diagnosis of sickle cell
anemia using DNA obtained from fetal cells. Amplification is
particularly useful if such an analysis is to be done on a small
sample using nonradioactive detection techniques which may be
inherently insensitive, or where radioactive techniques are being
employed, but where rapid detection is desirable.
For the purposes of this discussion, genetic diseases may include
specific deletions and/or mutations in genomic DNA from any
organism, such as, e.g., sickle cell anemia, a-thalassemia,
B-thalassemia, and the like. Sickle cell anemia can be readily
detected via oligomer restriction analysis as described by EP
Patent Publication 164,054 published Dec. 11, 1985, or via a
RFLP-like analysis following amplification of the appropriate DNA
sequence by the amplification method. a-Thalassemia can be detected
by the absence of a sequence, and B-thalassemia can be detected by
the presence of a polymorphic restriction site closely linked to a
mutation that causes the disease.
All of these genetic diseases may be detected by amplifying the
appropriate sequence and analyzing it by Southern blots without
using radioactive probes. In such a process, for example, a small
sample of DNA from, e.g., amniotic fluid containing a very low
level of the desired sequence is amplified, cut with a restriction
enzyme, and analyzed via a Southern blotting technique. The use of
non-radioactive probes is facilitated by the high level of the
amplified signal.
In another embodiment, a small sample of DNA may be amplified to a
convenient level and then a further cycle of extension reactions
performed wherein nucleotide derivatives which are readily
detectable (such as .sup.32 p-labeled or biotin-labeled nucleotide
triphosphates) are incorporated directly into the final DNA
product, which may be analyzed by restriction and electrophoretic
separation or any other appropriate method.
In a further embodiment, the nucleic acid may be exposed to a
particular restriction endonuclease prior to amplification. Since a
sequence which has been cut cannot be amplified, the appearance of
an amplified fragment, despite prior restriction of the DNA sample,
implies the absence of a site for the endonuclease within the
amplified sequence. The presence or absence of an amplified
sequence can be detected by an appropriate method.
A practical application of the amplification technique, that is, in
facilitating the detection of sickle cell anemia via the oligomer
restriction technique [described in EP 164,054, supra, and by Saiki
et al., Bio/Technology, Vol. 3, pp. 1008-1012 (1985)] is described
in detail in the Saiki et al. Science article cited above. In that
Science article, a specific amplification protocol is exemplified
using a B-globin gene segment.
The amplification method herein may also be used to detect directly
single-nucleotide variations in nucleic acid sequence (such as
genomic DNA) using sequence-specific oligonucleotides, as described
more fully in U.S. Ser. No. 839,331, filed Mar. 13, 1986, now
abandoned and in U.S. Ser. No. 899,344, filed Aug. 22, 1986, now
abandoned (Cetus Case 2262.1), which is a continuation-in-part of
U.S. Ser. No. 839,331, the disclosures of both of which are
incorporated herein by reference.
Briefly, in this process, the amplified sample is spotted directly
on a series of membranes, and each membrane is hybridized with a
different labeled sequence-specific oligonucleotide probe. After
hybridization the sample is washed and the label is detected. This
technique is especially useful in detecting DNA polymorphisms.
Various infectious diseases can be diagnosed by the presence in
clinical samples of specific DNA sequences characteristic of the
causative microorganism. These include bacteria, such as
Salmonella, Chlamydia, Neisseria; viruses, such as the hepatitis
viruses, and parasites, such as the Plasmodium responsible for
malaria. U.S. Patent Reexamination Certificate B1 4,358,535 issued
to Falkow et al. on May 13, 1986 describes the use of specific DNA
hybridization probes for the diagnosis of infectious diseases. A
relatively small number of pathogenic organisms may be present in a
clinical sample from an infected patient and the DNA extracted from
these may constitute only a very small fraction of the total DNA tn
the sample. Specific amplification of suspected sequences prior to
immobilization and detection by hybridization of the DNA samples
could greatly improve the sensitivity and specificity of
traditional procedures.
Routine clinical use of DNA probes for the diagnosis of infectious
diseases would be simplified considerably if non-radioactively
labeled probes could be employed as described in EP 63,879 to Ward.
In this procedure biotin-containing DNA probes are detected by
chromogenic enzymes linked to avidin or biotin-specific antibodies.
This type of detection is convenient, but relatively insensitive.
The combination of specific DNA amplification by the present method
and the use of stably labeled probes could provide the convenience
and sensitivity required to make the Falkow et al. and Ward
procedures useful in a routine clinical setting.
A specific use of the amplification technology for detecting or
monitoring for the AIDS virus is described in U.S. application Ser.
No. 818,127, filed Jan. 10, 1986, now abandoned, the disclosure of
which is incorporated herein by reference. Briefly, the
amplification and detection process is used with primers and probes
which are designed to amplify and detect, respectively, nucleic
acid sequences which are substantially conserved among the nucleic
acids in AIDS viruses and specific to the nucleic acids in AIDS
viruses. Thus, the sequence to be detected must be sufficiently
complementary to the nucleic acids in AIDS viruses to initiate
polymerization preferably at room temperature in the presence of
the enzyme and nucleotide triphosphates.
The amplification process can also be utilized to produce
sufficient quantities of DNA from a single copy human gene such
that detection by a simple non-specific DNA stain such as ethidium
bromide cna be employed to diagnose DNA directly.
In addition to detecting infectious diseases and pathological
abnormalities in the genome of organisms, the amplification process
can also be used to detect DNA polymorphisms which may not be
associated with any pathological state.
In summary, the amplification process is seen to provide a process
for amplifying one or more specific nucleic acid sequences using a
chain reaction and a thermostable enzyme, in which reaction primer
extension products are produced which can subsequently act as
templates for further primer extension reactions. The process is
especially useful in detecting nucleic acid sequences which are
initially present in only very small amounts.
The following examples are offered by way of illustration only and
are by no means intended to limit the scope of the claimed
invention. In these samples, all percentages are by weight if for
solid and by volume if for liquids, and all temperatures are given
in degrees Celsius.
EXAMPLE I
I. Synthesis of the Primers
The following two oligonucleotide primers were prepared by the
method described below:
These primers, both 20-mers, anneal to opposite strands of the
genomic DNA with their 5' ends separated by a distance of 110 base
pairs.
A. Automated Synthesis Procedures: The diethylphosphoramidites,:
synthesized according to Beaucage and Caruthers (Tetrahedron
Letters (1981) 22: 1859-1862) were sequentially condensed to a
nucleoside derivatized controlled pore glass support using a
Biosearch SAM-1. The procedure included detritylation with
trichloroacetic acid in dichloromethane, condensation using
benzotriazole as activating proton donor, and capping with acetic
anhydride and dimethylaminopyridine in tetrahydrofuran and
pyridine. Cycle time was approximately 30 minutes. Yields at each
step were essentially quantitative and were determined by
collection and spectroscopic examination of the dimethoxytrityl
alcohol released during detritylation.
B. Oligodeoxyribonucleotide Deprotection and Purification
Procedures: The solid support was removed from the column and
exposed to 1 ml concentrated ammonium hydroxide at room temperature
for four hours in a closed tube. The support was then removed by
filtration and the solution containing the partially protected
oligodeoxynucleotide was brought to 55.degree. C. for five hours.
Ammonia was removed and the residue was applied to a preparative
polyacrylamide gel. Electrophoresis was carried out at 30 volts/cm
for 90 minutes after which the band containing the product was
identified by UV shadowing of a fluorescent plate. The band was
excised and eluted with 1 ml distilled water overnight at 4.degree.
C. This solution was applied to an Altech RP18 column and eluted
with a 7-13% gradient of acetonitrile in 1% ammonium acetate buffer
at pH 6.0. The elution was monitored by UV5 absorbance at 260 nm
and the appropriate fraction collected, quantitated by UV
absorbance in a fixed volume and evaporated to dryness at room
temperature in a vacuum centrifuge.
C. Characterization of Oligodeoxyribonucleotides: Test aliquots of
the purified oligonucleotides were 32p labeled with polynucleotide
kinase and y-32p-ATP. The labeled compounds were examined by
autoradiography of 14-20% polyacrylamide gels after electrophoresis
for 45 minutes at 50 volts/cm. This procedure verifies the
molecular weight. Base composition was determined by digestion of
the oligodeoxyribonucleotide to nucleosides by use of venom
diesterase and bacterial alkaline phosphatase and subsequent
separation and quantitation of the derived nucleosides using a
reverse phase HPLC column and a 10% acetonitrile, 1% ammonium
acetate mobile phase.
II. Isolation of Human Genomic DNA from Cell Line
High molecular weight genomic DNA was isolated from a T cell line,
Molt 4, homozygous for normal B-globin available from the Human
Genetic Mutant Cell Depository, Camden, N.J. as GM2219C using
essentially the method of Maniatis et al., Molecular Cloning
(1982), 280-281.
III. Purification of a Polymerase From Thermus aquaticus
Thermus aquaticus strain YT1, available without restriction from
the American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Md., as ATCC No. 25,104 was grown in flasks in the
following medium:
______________________________________ Sodium Citrate 1 mM
Potassium Phosphate, pH 7.9 5 mM Ammonium Chloride 10 mM Magnesium
Sulfate 0.2 mM Calcium Chloride 0.1 mM Sodium Chloride 1 g/l Yeast
Extract 1 g/l Tryptone 1 g/l Glucose 2 g/l Ferrous Sulfate 0.01 mM
______________________________________ (The pH was adjusted to 8.0
prior to autoclaving.)
A 10-liter fermentor was inoculated from a seed flask cultured
overnight in the above medium at 70.degree. C. A total of 600 ml
from the seed flask was used to inoculate 10 liters of the same
medium. The pH was controlled at 8.0 with ammonium hydroxide with
the dissolved oxygen at 40%, with the temperature at 70.degree. C.,
and with the stirring rate at 400 rpm.
After growth of the cells, they were purified using the protocol
(with slight modification) of Kaledin et al., supra, through the
first five stages and using a different protocol for the sixth
stage. All six steps were conducted at 4.degree. C. The rate of
fractionation on columns was 0.5 column volumes/hour and the
volumes of gradients during elution were 10 column volumes.
Briefly, the above culture of the T. aquaticus cells was harvested
by centrifugation after nine hours of cultivation, in late log
phase, at a cell density of 1.4 9 dry weight/l. Twnety grams of
cells was resuspended in 80 ml of a buffer consisting of 50 mM
Tris-HCl pH 7.5, 0.1 mM EDTA. Cells were lysed and the lysate was
centrifuged for two hours at 35,000 rpm in a Beckman TI 45 rotor at
4.degree. C. The supernatant was collected (fraction A) and the
protein fraction precipitating between 45 and 75.times. saturation
of ammonium sulfate was collected, dissolved in a buffer consisting
of 0.2M potassium phosphate buffer, pH 6.5, 10 mM
2-mercaptoethanol, and 5% glycerine, and finally dialyzed against
the same buffer to yield fraction B.
Fraction B was applied to a 2.2.times.30-cm column of
DEAE-cellulose, equilibrated with the above described buffer. The
column was then washed with the same buffer and the fractions
containing protein (determined by absorbance at 280 nm) were
collected. The combined protein fraction was dialyzed against a
second buffer, containing 0.01M potassium phosphate buffer, pH 7.5,
10 mM 2-mercaptoethanol, and 5% glycerine, to yield fraction C.
Fraction C was applied to a 26.times.21-cm column of
hydroxyapatite, equilibrated with a second buffer. The column was
then washed and the enzyme was eluted with a linear gradient of
0.010.5M potassium phosphate buffer, pH 7.5, containing 10 mM
2-mercaptoethanol and 5% glycerine. Fractions containing DNA
polymerase activity (90-180 mM potassium phosphate) were combined,
concentrated four-fold using an Amicon stirred cell and YM10
membrane, and dialyzed against the second buffer to yield fraction
D.
Fraction D was applied to a 1.6.times.28-cm column of
DEAE-cellulose, equilibrated with the second buffer. The column was
washed and the polymerase was-eluted with a linear gradient of
0.01-0.5M potassium phosphate in the second buffer. The fractions
were assayed for contaminating endonuclease(s) and exonuclease(s)
by electrophoretically detecting the change in molecular weight of
phage DNA or supercoiled plasma DNA after incubation with an excess
of DNA polymerase (for endonuclease) and after treatment with a
restriction enzyme that cleaves the DNA into several fragments (for
exonuclease). Only those DNA polymerase fractions (65-95 mM
potassium phosphate) having minimal nuclease contamination were
pooled. To the pool was added autoclaved gelatin in an amount of
250 .mu.g/ml, and dialysis was conducted against the second buffer
to yield Fraction E.
Fraction E was applied to a 9 ml phosphocellulose column and eluted
with a 100 ml gradient (0.01-0.4M KCl gradient in 20 mM potassium
phosphate buffer pH 7.5). The fractions were assayed for
contaminating endo/exonuclease(s) as described above as well as for
polymerase activity (by the method of Kaledin et al.) and then
pooled. The pooled fractions were dialyzed against the second
buffer, then concentrated by dialysis against 50% glycerine and the
second buffer.
The molecular weight of the polymerase was determined by SDS PAGE.
Marker proteins (Bio-Rad low molecular weight standards) were
phosphorylase B (92,500), bovine serum albumin (66,200), ovalbumin
(45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor
(21,500), and lysozyme (14,400).
Preliminary data suggest that the polymerase has a molecular weight
of about 86,000-90,000 daltons, not 62,000-63,000 daltons reported
in the literature (e.g., by Kaledin et al.).
IV. Amplification Reaction
One microgram of the genomic DNA described above was diluted in an
initial 100 .mu.l aqueous reaction volume containing 25 mM
Tris.multidot.HCl buffer (pH 8.0), 50 mM KCl, 10 mM MgCl.sub.2, 5
mM dithiothreitol, 200 .mu.g/ml gelatin, 1 .mu.M of primer PC03, 1
.mu.M of primer PC04, 1.5 mM dATP, 1.5 .mu.M dCTP, 1.5 mM dGTP and
1.5 mM TTP. The sample was heated for 10 minutes at 98.degree. C.
to denature the genomic DNA, then cooled to room temperature. Four
microliter of the polymerase from Thermus aquaticus was added to
the reaction mixture and overlaid with a 100 .mu.l mineral oil cap.
The sample was then placed in the aluminum heating block of the
liquid handling and heating instrument described in U.S.
application Ser. No. 833,368 filed Feb. 25, 1986, now abandoned the
disclosure of which is incorporated herein by reference.
The DNA sample underwent 20 cycles of amplification in the machine,
repeating the following program cycle:
1) heating from 37.degree. C. to 98.degree. C. in heating block
over a period of 2.5 minutes; and
2) cooling from 98.degree. C. to 37.degree. C. over a period of
three minutes to allow the primers and DNA to anneal.
After the last cycle, the sample was incubated for an additional 10
minutes at 55.degree. C. to complete the final extension
reaction.
V. Synthesis and Phosphorylation of Oligodeoxyribonucleotide
Probes
A labeled DNA probe, designated RS24, of the following sequence was
prepared:
where * indicates the label. This probe is 40 bases long, spans the
fourth through seventeenth codons of the gene, and is complementary
to the normal .beta.-globin allele (.beta..sup.A). The schematic
diagram of primers and probes is given below: ##STR6##
This probe was synthesized according to the procedures described in
Section I of Example I. The probe was labeled by contacting 20
pmole thereof with 4 units of T4 polynucleotide kinase (New England
Biolabs) and about 40 pmole .sup.-32 P-ATP (New England Nuclear,
about 7000 Ci/mmole) in a 40 .mu.l reaction volume containing 70 mM
Tris buffer (pH 7.6), 10 mM .mu.gCl.sub.2, 1.5 rM spermine and 10
mM dithiothreitol for 60 minutes at 37.degree. C. The total volume
was then adjusted to 100 .mu.l with 25 mM EDTA and purified
according to the procedure of Maniatis et al., Molecular Cloning
(1982), 466-467 over a 1 ml Bio Gel P-4 (Bio-Rad) spin dialysis
column equilibrated with Tris-EDTA (TE) buffer (10 mM Tris buffer,
0.1 mM EDTA, pH 8.0). TCA precipitation of the reaction product
indicated that for RS24 the specific activity was 4.3 .mu.Ci/pmole
and the final concentration was 0.118 pmole/.mu.l.
VI. Dot Blot Hybridizations
Four microliter of the amplified sample from Section I and 5.6
.mu.l of appropriate dilutions of B-globin plasmid DNA calculated
to represent amplification efficiencies of 70, 75, 80, 85, 90, 95
and 100% were diluted with 200 .mu.l 0.4 H NaOH, 25 mM EDTA and
spotted onto a Genatran 45 (Plasco) nylon filter by first wetting
the filter with water, placing it in a Bio-Dot (Bio-Rad, Richmond,
Calif.) apparatus for preparing dot blots which holds the filters
in place, applying the samples, and rinsing each well with 0.1 ml
of 20.times. SSPE (3.6M NaCl, 200 mM NaH.sub.2 PO.sub.4, 20 mM
EDTA), as disclosed by Reed and Mann, Nucleic Acids Research, 13,
7202-7221 (1985). The filters were then removed, rinsed in
20.times. SSPE, and baked for 30 minutes at 80.degree. C. in a
vacuum oven.
After baking, each filter was then contacted with 16 ml of a
hybridization solution consisting of 3.times. SSPE, 5.times.
Denhardt's solution (1.times.=0.02% polyvinylpyrrolidone,
0.02.times. Ficoll, 0.02% bovine serum albumin,, 0.2 mM Tris, 0.2
mM EDTA, pH 8.0), 0.5% SDS, and 30% formamide, and incubated for
two hours at 42.degree. C. Then 2 pmole of probe RS24 was added to
the hybridization solution and the filter was incubated for two
hours at 42.degree. C.
Finally, each hybridized filter was washed twice with 100 ml of
2.times. SSPE and 0.1% SDS for 10 minutes at room temperature. Then
the filters were treated once with 100 ml of 2.times. SSPE, 0.1%
SDS at 60.degree. C. for 10 minutes.
Each filter was then autoradiographed, with the signal readily
apparent after two hours.
VII. Discussion of Autoradiogram
The autoradiogram of the dot blots was analyzed after two hours and
compared in intensity to standard serial dilution .beta.-globin
reconstructions prepared with HaeIII/MaeI-digested
pBR:.beta..sup.A, where .beta..sup.A is the wild-type allele, as
described in Saiki et al., Science, supra. Analysis of the reaction
product indicated that the overall amplification efficiency was
about 95%, corresponding to a 630,000-fold increase in the
.beta.-globin target sequence.
EXAMPLE II
I. Amplification Reaction
Two 1 .mu.9 samples of genomic DNA extracted from the Molt 4 cell
line as described in Example I were each diluted in a 100 .mu.l
reaction volume containing 50 mM KCl, 25 mM Tris HCl buffer pH 8.0,
10 mM MgCl.sub.2, 1 .mu.M of primer PC03, 1 .mu.M of primer PC04,
200 .mu.g/ml gelatin, 10% dimethylsulfoxide (by volume), 1.5 mM
dATP, 1.5 mM dCTP, 1.5 mM dGTP, and 1.5 mM TTP. After this mixture
was heated for 10 minutes at 98.degree. C. to denature the genomic
DNA, the samples were cooled to room temperature and 4 .mu.l of the
polymerase from Thermus aquaticus described in Example I was added
to each sample. The samples were overlaid with mineral oil to
prevent condensation and evaporative loss.
One of the samples was placed in the heating block of the machine
described in Example I and subjected to 25 cycles of amplification,
repeating the following program cycle:
(1) heating from 37.degree. to 93.degree. C. over a period of 2.5
minutes;
(2) cooling from 93.degree. C. to 37.degree. C. over a period of
three minutes to allow the primers and DNA to anneal; and
(3) maintaining at 37.degree. C. for two minutes.
After the last cycle the sample was incubated for an additional 10
minutes at 60.degree. C. to complete the final extension
reaction.
The second sample was placed in the heat-conducting container of
the machine, described in more detail herein, supra. The
heat-conducting container is attached to Peltier heat pumps which
adjust the temperature upwards or downwards and a microprocessor
controller to control automatically the amplification sequence, the
temperature levels, the temperature ramping and the timing of the
temperature.
The second sample was subjected to 25 cycles of amplification,
repeating the following program cycle:
(1) heating from 37.degree. to 95.degree. C. over a period of three
minutes;
(2) maintaining at 95.degree. C. for 0.5 minutes to allow
denaturation to occur;
(3) cooling from 95.degree. to 37.degree. C. over a period of one
minute: and
(4) maintaining at 37.degree. C. for one minute.
II. Analysis
Two tests were done for analysis, a dot blot and an agarose gel
analysis.
For the dot blot analysis, a labeled DNA probe, designated RS18, of
the following sequence was prepared.
where * indicates the label. This probe is 19 bases long, spans the
fourth through seventeenth codons of the gene, and is complementary
to the normal .beta.-globin allele (.beta..sup.A). The schematic
diagram of primers and probes is given below: ##STR7##
This probe was synthesized according to the procedures described in
Section I of Example I. The probe was labeled by contacting 10
pmole thereof with 4 units of T4 polynucleotide kinase (New England
Biolabs) and about 40 pmol .sup.-32 P-ATP (New England Nuclear,
about 7000 Ci/mmole) in a 40 .mu.l reaction volume containing 70 mM
Tris HCl buffer (pH 7.6), 10 mm MgCl.sub.2, 1.5 mM spermine and 10
mM dithiothreitol for 60 minutes at 37.degree. C. The total volume
was then adjusted to 100 .mu.l with 25 mM EDTA and purified
according to the procedure of Maniatis et al., Molecular Cloning
(1982), 466-467 over a 1 ml Bio Gel P-4 (BioRad) spin dialysis
column equilibrated with Tris-EDTA (TE) buffer (10 mM Tris-HCl
buffer, 0.1 mM EDTA, pH 8.0). TCA precipitation of the reaction
product indicated that for RS18 the specific activity was 4.6
.mu.ci/pmole and the final concentration was 0.114 pmole/.mu.l.
Five microliter of the amplified sample from Section I and of a
sample amplified as described above except using the Klenow
fragment of E. coli DNA Polymerase I instead of the thermostable
enzyme were diluted with 195 .mu.l 0.4N NaOH, 25 mM EDTA and
spotted onto two replicate Genatran 45 (Plasco) nylon filters by
first wetting the filters with water, placing them in a Bio-Dot
(Bio-Rad, Richmond, Calif.) apparatus for preparing dot blots which
holds the filters in place, applying the samples, and rinsing each
well with 0.4 ml of 20.times. SSPE (3.6M NaCl, 200 mM NaH.sub.2
PO.sub.4, 20 mM EDTA), as disclosed by Reed and Mann, Nucleic Acids
Research, 13, 7202-7221 (1985). The filters were then removed,
rinsed in 20.times. SSPE, and baked for 30 minutes at 80.degree. C.
in a vacuum oven.
After baking, each filter was then contacted with 6 ml of a
hybridization solution consisting of 5.times. SSPE, 5.times.
Denhardt's solution (1.times.=0.02% polyvinylpyrrolidone, 0.02%
Ficoll, 0.02% bovine serum albumin, 0.2 nM Tris, 0.2 mM EDTA, pH
8.0) and 0.5% SDS, and incubated for 60 minutes at 55.degree. C.
Then 5 .mu.l of probe RS18 was added to the hybridization solution
and the filter was incubated for 60 minutes at 55.degree. C.
Finally, each hybridized filter was washed twice with 100 ml of
2.times. SSPE and 0.1% SDS for 10 minutes at room temperature. Then
the filters were treated twice more with 100 ml of 5.times. SSPE,
0.1% SDS at 60.degree. C. for 1) one minute and 2) three minutes,
respectively.
Each filter was then autoradiographed, with the signal readily
apparent after 90 minutes.
In the agarose gel analysis, 5 .mu.l each amplification reaction
was loaded onto 4% NuSieve/0.5% agarose gel in 1.times. TBE buffer
(0.089M Tris borate, 0.089M boric acid, and 2 mM EDTA) and
electrophoresed for 60 minutes at 100 V. After staining with
ethidium bromide, DNA was visualized by UV fluorescence.
The results show that the machines used in Example I and this
example herein were equally effective in amplifying the DNA,
showing discrete high-intensity 110-base pair bands of similar
intensity, corresponding to the desired sequence, as well as a few
other discrete bands of much lower intensity. In contrast, the
amplification method as described in Example I of U.S. application
Ser. No. 839,331 filed Mar. 13, 1986, now abandoned, supra, which
involves reagent transfer after each cycle using the Klenow
fragment of E. coli Polymerase I, gave a DNA smear resulting from
the nonspecific amplification of many unrelated DNA sequences.
It is expected that similar improvements in amplification and
detection would be achieved in evaluating HLA-DQ, DR and DP
regions.
EXAMPLE III
Amplification and Cloning
For amplification of a 119-base pair fragment on the human
.beta.-hemoglobin gone, a total of 1 microgram each of human
genomic DNA isolated from the Molt 4 cell line or from the GM2064
cell line (representing a homozygous deletion of the .beta.- and
-hemoglobin region and available from the Human Genetic Mutant Cell
Depository, Camden, N.J.) as described above was amplified in a 100
.mu.l reaction volume containing 50 mM KCl, 25 mM Tris NCl, pH 8,
10 mM MgCl.sub.2, 200 .mu.g/ml gelatin, S mM beta-mercaptoethanol,
1.5 mM dATP, 1.5 mM dCTP, 1.5 mM dTTP, 1.5 mM dGTP, and 1 .mu.M of
each of the following primers:
where lower case letters denote mismatches from wild-type sequence
to create restriction enzyme sites. GH18 is a 26-base
oligonucleotide complementary to the negative strand and contains
an internal PstI site. GH19 is a 23-base oligonucleotide
complementary to the plus strand and contains an internal HindIII
recognition sequence. These primers were selected by first
screening the regions of the gene for homology to the PstI and
HindIII restriction sites of bacteriophage M13. The primers were
then prepared as described in Example I.
The above reaction mixtures were heated for 10 minutes at
95.degree. C. and then cooled to room temperature. A total of 4
.mu.l of the polymerase described in Example I was added to each
reaction mixture, and then each mixture was overlayed with mineral
oil. The reaction mixtures were subjected to 30 cycles of
amplification with the following program:
2.5 min. ramp, 37.degree. to 98.degree. C.
3 min. ramp, 98.degree. to 37.degree. C.
2 min. soak, 37.degree. C.
After the last cycle, the reaction mixtures were incubated for 20
minutes at 65.degree. C. to complete the final extension. The
mineral oil was extracted with chloroform and the mixtures were
stored at 20.degree. C.
A total of 10 .mu.l of the amplified product has digested with 0.5
.mu.g M13mp10 cloning vector, which is publicly available from
Boehringer-Mannheim in a 50 .mu.l volume containing 50 mM NaCl, 10
mM Tris.multidot.HCl, pH 7.8, 10 mM MgCl2, 20 units PstI and 26
units HindIII for 90 minutes at 37.degree. C. The reaction was
stopped by freezing at 20.degree. C. The volume was adjusted to 110
.mu.l with TE buffer and loaded (100 .mu.l) onto a 1 ml BioGel P-4
spin dialysis column. One 0.1 ml fraction was collected and ethanol
precipitated.
(At this point it was discovered that there was .beta.-globin
amplification product in the GM2064 sample. Subsequent experiments
traced the source of contamination to the primers, either GH18 or
GH19. Because no other source of primers was available, the
experiment was continued with the understanding that some cloned
sequences would be derived from the contaminating DNA in the
primers.)
The ethanol pellet was resuspended in 15 .mu.l water, then adjusted
to 20 .mu.l volume containing 50 mM Tris.multidot.HCl, pH 7.8, 10
mM MgCl.sub.2, 0.5 mM ATP, 10 mM dithiothreitol, and 400 units
ligase. This mixture was incubated for three hours at 16.degree.
C.
Ten microliters of ligation reaction mixture containing Molt 4 DNA
was transformed into E. coli strain JM103 competent cells, which
are publicly available from BRL in Bethesda, Md. The procedure
followed for preparing the transformed strain is described in
Messing, J. (1981) Third Cleveland Symposium on
Macromolecules:Recombinant DNA, ed. A. Walton, Elsevier, Amsterdam,
143-153. A total of 651 colorless plaques (and O blue plaques) were
obtained. Of these, 119 had a (+)-strand insert (18%) and 19 had a
(-)-strand insert (3%). This is an increase of almost 20-fold over
the percentage of .beta.-globin positive plaques among the
primer-positive plaques from the amplification technique using
Klenow fragment of E. coli Polymerase I, where the reaction
proceeded for two minutes at 25.degree. C., after which the steps
of heating to 100.degree. C. for two minutes, cooling, adding
Klenow fragment, and reacting were repeated nine times. These
results confirm the improved specificity of the amplification
reaction employing the thermostable enzyme herein.
In a later cloning experiment with GM2064 and the contaminated
primers, 43 out of 510 colorless plaques (8%) had the (+)-strand
insert. This suggests that approximately one-half of the 119 clones
from volt 4 contain the contaminant sequence.
Ten of the (+)-strand clones from Molt 4 were sequenced. Five were
normal wild-type sequence and five had a single C to T mutation in
the third position of the second codon of the gene (CAC to CAT).
Four of the contaminant clones from GM2064 were sequenced and all
four were normal.
Restriction site-modified primers may also be used to amplify and
clone and partially sequence the human N-ras oncogene and to clone
base pair segments of the HLA DQ-.alpha., DQ-.beta. and DR-.beta.
genes using the above technique. All of these amplification
reactions may be carried out in the presence of 10% by volume
dimethylsulfoxide.
Plating and Screening
The filters were probed with the primer PC04 to determine the
percentage of inserts resulting from amplification and cloning. The
percentage of B-globin positive plaques among the amplified
primer-positive plaques was approximately 20%. This is an increase
of 20-fold over the percentage of B-globin positive plaques among
the primer-positive plaques from the amplification technique using
Klenow fragment of E. coli Polymerase I, where the reaction
proceeded for two minutes at 25.degree. C., after which the steps
of heating to 100.degree. C. for two minutes, cooling, adding
Klenow fragment, and reacting were repeated nine times. These
results confirm the improved specificity of the amplification
reaction of the invention herein employing a thermostable
enzyme.
Restriction site-modified primers may also be used to amplify and
clone and partially sequence the human N-ras oncogene and to clone
base pair segments of the HLA DQ-.alpha., DQ-.beta., and DR-.beta.
genes using the above technique. All of these amplification
reactions may be carried out in the presence of 10% by volume
dimethylsulfoxide.
In summary, the present invention provides an apparatus for
performing automated amplification of one or more nucleic acid
sequences involving a temperature-cycled chain reaction and a
thermostable enzyme, which apparatus has a heat-conducting
container for the reagents, means for heating, cooling and
maintaining the container to or at any given temperature, and a
computer means to generate signals that control the temperature
levels. The amplification process results in increased yields of
amplified product, greater specificity, and fewer steps necessary
to carry out the procedure over what has been previously
disclosed.
EXAMPLE IV
Comparative Example of PCR Protocol Run Manually and on Automated
PCR Machine
The following example illustrates that equivalent results are
obtained when the PCR protocol is run on a machine of the instant
invention and when run manually. The results are indicated by the
intensity of the dot-blots on an autoradiograph of samples of DNA
which had been amplified either manually or on the PCR machine and
then hybridized to radioactive probes. These examples are
illustrative only and are by no means intended to limit the scope
of the claimed invention.
Isolation of Human Genomic DNA from Cell Lines
High molecular weight genomic DNA was isolated from the lymphoid
cell lines, Molt4, SC-1 and GM2064 using essentially the method of
Maniatis et al., Molecular Cloning (1982), 280-281.
Molt4 (Human Mutant Cell Repository, GM2219C) is a T cell line
homozygous for normal .beta.-globin, and SC-1, is an
EBV-transformed B cell line homozygous for the sickle cell allele.
The cell line SC-1 (CTCC #0082) was deposited on Mar. 19, 1985 with
the American Type Culture Collection (ATCC), 12301 Parklawn Drive,
Rockville, Md. 20852 USA, with ATCC Accession No. CRL #8756. GM2064
(Human Mutant Cell Repository, GM2064) was originally isolated from
an individual homozygous for hereditary persistence of fetal
hemoglobin (HPFH) and contains no beta- or delta-globin gene
sequences. All cell lines were maintained in RPMI-1640 with 10%
fetal calf serum.
Polymerase Chain Reaction to Amplify Selectively DNA
Sequences--Automated Samples
Six samples of the above genomic DNA, three from GM2064, two from
Molt4 and one from SC-1 were amplified by the automated PCR machine
of the instant invention.
In each instance, one microgram of the genomic DNA was amplified in
an initial 100 .mu.l reaction volume containing 10 .mu.l of Klenow
salts [10 mM Tris buffer (pH 7.5), 50 mM NaCl, 10 mM MgCl.sub.2 ],
10 .mu.l DMSO, 35 .mu.l water, 15 .mu.l of 40 mM deoxynucleotide
triphosphate [(dNTP) 10 mM of dATP, dCTP, dGTP and dTTP were used],
10 .mu.l of 10 .mu.M of the primer PC03 [5' ACACAACTGTGTTCACTAGC
3'; Saiki et al., Science, Vol. 230, pp. 1350-54, (Dec. 20, 1985)]
and 10 .mu.l of 10 .mu.M of the primer PC04 [3'
CCACTTGCACCTACTTCAAC 5'; Saiki et al., id.]. The mixture in an
Eppendorf tube for each sample was overlaid with approximately 100
.mu.l of mineral oil to prevent evaporation. The Eppendorf tubes
with the samples to be amplified were placed in the heating block
(plate 1).
An enzyme mixture was also prepared in Eppendorf tubes placed in
the block (plate 2) behind the DNA sample. A 570 .mu.l enzyme
preparation was prepared composed of 38 .mu.l of Klenow fragment of
E. coli DNA polymerase I (Pharmacia, 5 units per .mu.l which was
diluted herein to 0.33 units per .mu.l), 57 .mu.l of Klenow salts
and 475 .mu.l of water. The 570 .mu.l enzyme preparation was then
divided into six Eppendorf tubes (95 .mu.l each). The tubes were
placed in plate 2 which is maintained at a constant temperature of
-1.degree. Centigrade. At that temperature of the plate, the enzyme
mixture is kept at approximately 2.degree. C. depending on the
ambient temperature as stated above.
Each DNA sample underwent 20 cycles of amplification in the PCR
machine. The DNA samples were first denatured at approximately
94.degree. to 95.degree. wherein the plate 1 temperature is
maintained at 98.degree. C. for eight minutes and then the
following cycle was repeated for twenty times:
1) denatured in the PCR heating block (plate 1) for 2.5
minutes;
2) the mixture was then cooled to 37.degree. C., the cooling period
being for about three minutes, allowing the primers and genomic DNA
to anneal;
3) 3 .mu.l of the enzyme preparation was then transferred
automatically by pipette from the back block (plate 2) to the DNA
samples held in the heating block (plate 1); by automatic
aspiration and redispensing, the enzyme and DNA preparations were
mixed;
4) the extension reaction was then allowed to proceed for two
minutes at 37.degree. C.
The pipetting speed was rapid. The enzyme tip height was set at
1800 whereas the dispensing height was set at 1740. When plate 1 is
cooled to 37.degree. C., the reaction mixture also attains
approximately 37.degree. C.
The 20 cycles took approximately 21/2 hours to perform. The samples
were not denatured after the last cycle as double-stranded DNA was
desired. The oil from each tube was removed with 0.1 .mu.l of
chloroform. The final sample volumes in each tube were
approximately 160 .mu.l [100 .mu.l initially to which was added 60
.mu.l of enzyme preparation (3 .mu.l each for 20 cycles)] with a
5.5% variation. The samples were then stored at -20.degree. C.
Manually-Prepared Samples
The steps, which in the above protocol were automated, had been
essentially performed manually for two samples, one from Molt4, and
one from GM2064 with the following modifications. The initial
incubation/denaturing step was performed as in the automated
protocol above for eight minutes at 95.degree. C.; however, the
first denaturing step, which is repeated in each cycle, was for 2
minutes rather than 2.5 minutes. The annealing step was performed
for only two minutes. The enzyme volume was only 2 .mu.l but at a
concentration of enzyme of similarly 1 unit of Klenow fragment (0.5
units per .mu.l) so that the final reaction volume was 140 .mu.l
per sample.
Dot Hybridization Procedure
Dot blots were prepared containing the automated and hand-processed
amplified DNA sequences. .beta.-globin reconstructions were
prepared with HaeIII/MaeI-digested pBR:.beta..sup.A (.beta..sup.A
is the wild-type allele; Saiki et al., id.) in order to compare the
manual and automated samples and estimate the comparative
efficiencies of the automated versus manual procedures.
The dot blot procedure is explained in Kafatos et al.,
"Determination of nucleic acid sequence homologies and relative
concentrations by a dot blot hybridization procedure," Nucleic
Acids Research, vol. 7, no. 6, pp. 1541-1552 (1979).
Thirty-six nanograms of each of the eight amplified samples and
each of the eleven reconstruction samples (the latter ranging from
50-100% at 5% increments as a dilution series standard for the
.beta.-globin segment containing the wild-type allele) were diluted
to approximately 200 .mu.l of 0.4N NaOH and 25 mM of EDTA (ethylene
diaminetetraacetic acid). Each sample was spotted onto a Genatrans
nylon membrane (Plasco) which was held in a Bio-Dot clamping device
(Bio-Rad Laboratories, Richmond, Calif.). Each well was rinsed with
0.4 ml 20.times. SSPE (1.times. SSPE is 0.18M NaCl, 10 mM NaH.sub.2
PO.sub.4, 1 mM EDTA, pH 7.4). The entire filter was then rinsed in
20.times. SSPE, blotted to dry, and then baked in a vacuum oven for
30 minutes at 80.degree. C.
The filter was prehybridized in 10 ml 3.times. SSPE, 5.times. DET
(1.times. DET is 0.02 percent each polyvinylpyrrolidone, Ficoll,
and bovine serum albumin; 0.2 mM tris, 0.2 mM EDTA, pH 8.0), 0.5%
SDS and 30% formamide and heated at 42.degree. C. for 30 minutes in
an incubator oven. Hybridization with 1.0 pmol of the
phosphorylated RS06 in 10 ml of the same buffer as tn the
prehybridization step was carried out for 60 minutes at 42.degree.
C.
The filter was then hybridized with a .sup.32 p-labelled 40-base
oligonucleotide probe, RS06, which is complementary to the target
sequence, that is , the .beta.-globin segment. (See Saiki et al.,
id.)
The filter was washed twice in 100 ml of 2.times. SSPE, 0.1% sodium
dodecyl sulfate (SDS) at room temperature for ten minutes, and then
again in 100 ml of 2.times. SSPE and 0.1% SDS for ten minutes at
55.degree. C.
The filter was then autoradiographed and the blots were compared in
intensity to the standard serial dilution reconstructions. The
hand- and automated-processed samples containing GM2064 which
contains no delta- or beta-globin gone sequences showed no
intensity except some background which was removed by a higher
stringency wash.
The spots containing the automated amplified samples containing the
wild-type allele (.beta..sup.A) from Molt4 and the sickle-cell
anemia allele (.beta..sup.s) from SC-1 were similar in intensity to
the hand-processed sample containing the Molt4 DNA with the
.beta..sup.A alleles.
All four of the samples showing intensity (3 automated and 1
hand-processed) were comparable to the 90% reconstruction.
Other modifications of the above-described embodiments of the
invention that are obvious to those of skill in the mechanical and
electrical arts and related disciplines are intended to be within
the scope of the following claims.
* * * * *