Pneumococcal fimbrial protein A
Russell , et al. June 6, 1
Patent Grant 5422427
U.S. patent number 5,422,427 [Application Number 07/791,377] was granted by the patent office on 1995-06-06 for pneumococcal fimbrial protein a. This patent grant is currently assigned to The United States of America as represented by the United States. Invention is credited to Steven P. O'Connor, Harold Russell, Jacquelyn Sampson.
| United States Patent | 5,422,427 |
| Russell , et al. | June 6, 1995 |
Pneumococcal fimbrial protein A
Abstract
The present invention relates, in general, to pneumococcal fimbrial protein A. In particular, the present invention relates to a DNA segment encoding a pneumococcal fimbrial protein A gene; polypeptides encoded by said DNA segment; recombinant DNA molecules containing the DNA segment; cells containing the recombinant DNA molecule; a method of producing a pneumococcal fimbrial protein A polypeptide; antibodies specific to pneumococcal fimbrial protein A; and a method of measuring the amount of pneumococcal fimbrial protein A in a sample.
| Inventors: | Russell; Harold (Atlanta, GA), Sampson; Jacquelyn (College Park, GA), O'Connor; Steven P. (Roswell, GA) |
|---|---|
| Assignee: | The United States of America as
represented by the United States (Washington, DC) |
| Family ID: | 25153553 |
| Appl. No.: | 07/791,377 |
| Filed: | September 17, 1991 |
| Current U.S. Class: | 530/350; 530/300; 530/324; 530/325; 530/326; 530/327; 530/328; 530/329; 530/330; 530/402; 530/825 |
| Current CPC Class: | C07K 14/3156 (20130101); C07K 16/1275 (20130101); Y10S 530/825 (20130101) |
| Current International Class: | C07K 14/195 (20060101); C07K 14/315 (20060101); C07K 16/12 (20060101); C07K 014/00 (); C07K 016/00 (); C07K 017/00 () |
| Field of Search: | ;530/350,402,825,300,330,329,328,327,326,325,324 |
References Cited [Referenced By]
U.S. Patent Documents
| 4762713 | August 1988 | Anderson |
| 4894362 | January 1990 | Yamaguchi et al. |
| 5037760 | August 1991 | Smith et al. |
| 5130417 | July 1992 | Stanley, Jr. et al. |
| 0206852AI | Dec 1986 | EP | |||
| 0429816AI | Jun 1991 | EP | |||
Other References
|
Harold Russell et al., "Monoclonal Antibody Recognizing a Species-Specific Protein from Streptococcus pneumoniae" Journal of Clinical Microbiology, vol. 28, pp. 2191-2195, Oct. 1990. . Ganeshkumar et al., "Nucleotide Sequence of a Gene Coding for a Saliva-Binding Protein (SsaB) from Streptococcus sanguis 12 and Possible Role of the Protein in Coaggregation with Actinomyces", Inspection and Immunity, vol. 59, No. 3, 1093-1099, Mar. 1991. . Clarke-Lewis et al (1986) Science 231: 134-139. . Caruthers (1985) Science 230: 281-285. . Science (1988) 240: 362. . Fenno, et al. (1989) Infection & Immunity 57: 3527-3533. . Fives-Taylor et al. (1987) Infection & Immunity 55: 123-128. . Russell, et al. (1990) Journal of Clinical Microbiology 28: 2191-2195. . Russell, et al. (1990) Abstracts of the Annual Meeting of the American Society for Microbiology 90: 436. . Sampson (et al) (1991) Abstracts of the Annual Meeting of the American Society for Microbiology 91: 97.. |
Primary Examiner: Furman; Keith C.
Assistant Examiner: Kim; Hyosuk
Attorney, Agent or Firm: Needle & Rosenberg
Claims
What is claimed is:
1. A polypeptide free of the proteins with which it is naturally associated comprising the amino acid sequence of pneumococcal fimbrial protein A set forth in SEQ ID NO:2, or an allelic variation thereof.
2. The polypeptide according to claim 1, wherein said polypeptide comprises the amino acid sequence set forth in SEQ ID NO:2.
3. The polypeptide of claim 1 wherein the polypeptide is bound to a solid support.
4. The polypeptide according to claim 3, wherein said polypeptide comprises the amino acid sequence set forth in SEQ ID NO:2.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates, in general, to pneumococcal fimbrial protein A (PfpA). In particular, the present invention relates to a DNA segment encoding a pneumococcal fimbrial protein A gene (pfpA); polypeptides encoded by the DNA segment; recombinant DNA molecules containing the DNA segment; cells containing the recombinant DNA molecule; a method of producing a pneumococcal fimbrial protein A polypeptide; antibodies specific to pneumococcal fimbrial protein A; and a method of measuring the amount of pneumococcal fimbrial protein A in a sample.
2. Background Information
Disease caused by Streptococcus pneumoniae (pneumococcus) is an important cause of morbidity and mortality in the United States and developing countries (Sorensen, J. et al. (1986) Scand. J. Infect. Dis. 18:329-335; Wall, R. A. et al. (1986) Bull. WHO 64-4:553-558; Walsh, J. A., and K. S. Warren (1979) N. Eng. J. Med. 301:967-974; Williams, W. W. et al. (1988) Ann. Intern. Med. 108:616-625; Yolken, R. H. et al. (1984) J. Clin. Microbiol. 20:802-805). Pneumococcal disease is very prevalent among the very young, the elderly, and immunocompromised persons. Despite its prevalence, diagnosis of the disease continues to be a problem.
Several tests have been developed to detect pneumococcus antigens and/or antibodies as a means of diagnosing pneumococcus infections (Coonrod, J. D., and M. W. Rytel (1973) J. Lab Clin. Med. 81:778-786; Holmberg, H. et al. (1985) J. Clin. Microbiol. 22:111-115; Ingram, D. L. et al. (1983) J. Clin. Microbiol. 18:1119-1121; Jalonen, E. et al. (1989) J. Infect. 19:127-134; Kanclerski, K. et al. (1988) J. Clin. Microbiol. 26-1:96-100; Makela, P. H. (1982) Scand. J. Infect. Dis. Suppl. 36:111-113; Perlino, C. A. (1984) J. Infect. Dis. 150:139-144; Sippel, J. E. et al. (1984) J. Clin. Microbiol. 20:884-886; Whitby, M. et al. (1985) J. Clin. Pathol. 38:341-344; Yolken, R. H. et al. (1984) J. Clin. Microbiol. 20:802-805). The sensitivity of existing antigen detection tests utilizing body fluids such as serum and urine, remains very low (Ajello, G. W. et al. (1987) J. Clin. Microbiol. 25:1388-1391; Anhalt, J. P., and P. K. W. Yu (1975) J. Clin. Microbiol. 2:510-515; Bartram, C. E. Jr. et al. (1974) J. Lab. Clin. Med. 83:591-598; Congeni, B. L. et al. (1984) Ped. Infect. Dis. 3:417-419; Coonrod, J. D. (1983) Proceedings of the American Journal of Medicine Symposium, Jul. 28, 1983, Am. J. Med. 75:85-92; Coovadia, Y. B. and K. K. Naidu (1985) J. Clin. Pathol. 38:561-564; Dilworth, J. A. (1975) J. Clin. Microbiol. 2:453-455; Doskeland, S. O., and B. P. Berdal (1980) J. Clin. Microbiol. 11:380-384; Martin, S. J. et al. (1987) J. Clin. Microbiol. 25:248-250), except for antigen detection in cerebrospinal fluids (Henrichsen, J. et al. (1980) J. Clin. Microbiol. 11:589-592; Ingram, D. L. et al. (1983) J. Clin. Microbiol. 18:1119-1121; Lenthe-Eboa, S. et al. (1987) Eur. J. Clin. Microbiol. 6:28-34; Tilton, R. C. et al. (1984) J. Clin. Microbiol. 20:231-234; Yolken, R. H. et al. (1984) J. Clin. Microbiol. 20:802-805). The measurement of antibody response to pneumolysin by enzyme immunoassay (ELISA) appears to be promising for presumptive etiologic diagnosis (Jalonen, E. et al. (1989) J. Infect. 19:127-134; Kalin, M. et al. (1987) J. Clin. Microbiol. 25:226-229; Kanclerski, K. et al. (1988) J. Clin. Microbiol. 26-1:96-100), but the sensitivity and specificity of the test need improvement.
Although a positive blood culture is diagnostic for pneumococcus disease, most patients with bacterial pneumonia do not have bacteremia (Austrian, R. (1974) Prev. Med. 3:443-445; Austrian, R., and I. Gold (1964) Ann. Intern. Med. 60:759-776; Kalin, M. and A. A. Lindberg (1983) Scand. J. Infect. Dis. 15:247-255). The value of sputum cultures has also been questioned because of contamination of the specimens with pharyngeal flora that can include pneumococci (Barrett-Cooner, E. (1971) Ann. Rev. Resp. Dis. 103:845-848). Thus, clinical laboratories are rarely successful in establishing a firm bacterial etiology for those patients with respiratory infections diagnosed presumptively as pneumococcus pneumonia. Researchers have been in constant search for immunodiagnostic markers or tests to aid in the early diagnosis of pneumococcus infections.
SUMMARY OF THE INVENTION
It is a general object of this invention to provide pneumococcal fimbrial protein A (PfpA) (a 37-kilodalton protein).
It is a specific object of this invention to provide a DNA segment which encodes a pneumococcal fimbrial protein A gene (pfpA).
It is a further object of the invention to provide a polypeptide corresponding to a pneumococcal fimbrial protein A gene (pfpA).
It is another object of the invention to provide a recombinant DNA molecule comprising a vector and a DNA segment encoding a pneumococcal fimbrial protein A gene (pfpA).
It is a further object of the invention to provide a cell that contains the above-described recombinant molecule.
It is another object of the invention to provide a method of producing a polypeptide encoding a pneumococcal fimbrial protein A gene (pfpA).
It is a further object of the invention to provide antibodies having binding affinity to a pneumococcal fimbrial protein A gene (pfpA), or a unique portion thereof.
It is a further object of the invention to provide a method of measuring the amount of pneumococcal fimbrial protein A in a sample.
Further objects and advantages of the present invention will be clear from the description that follows.
In one embodiment, the present invention relates to a DNA segment coding for a polypeptide comprising an amino acid sequence corresponding to a pneumococcal fimbrial protein A gene.
In another embodiment, the present invention relates to a polypeptide free of proteins with which it is naturally associated and comprising an amino acid sequence corresponding to a pneumococcal fimbrial protein A gene.
In a further embodiment, the present invention relates to a recombinant DNA molecule comprising a vector and a DNA segment that codes for a polypeptide comprising an amino acid sequence corresponding to a pneumococcal fimbrial protein A gene.
In yet another embodiment, the present invention relates to a cell that contains the above-described recombinant DNA molecule.
In a further embodiment, the present invention relates to a method of producing a polypeptide comprising an amino acid sequence corresponding to a pneumococcal fimbrial protein A gene.
In yet another embodiment, the present invention relates to an antibody having binding affinity to a polypeptide encoding a pneumococcal fimbrial protein A gene, or a unique portion thereof.
In a further embodiment, the present invention relates to a method of measuring the amount of pneumococcal fimbrial protein A in a sample, comprising contacting the sample with the above-described antibodies and measuring the amount of immunocomplexes formed between the antibodies and any pneumococcal fimbrial protein A in the sample.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Immunoblot of S. pneumoniae whole-cell antigen preparations with pneumococcus MAbs. Protein standards (STD) (in kilodaltons) and different serotypes of S. pneumoniae are shown. Lanes: 1, serotype 3; 2, serotype 6B; 3, serotype 7F; 4, serotype 8; 5, serotype 9V; 6, serotype 10A; 7, serotype 11A; 8, serotype 12F; 9, serotype 15B; 10, serotype 19A; 11, serotype 19F; 12, serotype 22F. The MAbs revealed an antigen at 37 kDa (arrow) in all serotypes tested.
FIG. 2. Immunofluorescence assay staining of S. pneumoniae cells with pneumococcal MAbs.
FIG. 3. Transmission electron microscopy of S. pneumoniae R36A after embedding, cutting, reacting with MAbs, and staining with gold-labeled goat anti-mouse immunoglobulin.
DETAILED DESCRIPTION OF THE INVENTION
In one embodiment, the present invention relates to a DNA segment coding for a polypeptide comprising an amino acid sequence corresponding to pneumococcal fimbrial protein A, or at least 5 contiguous amino acids thereof. In one preferred embodiment, the DNA segment comprises the sequence shown in SEQ ID NO:1, allelic or species variation thereof, or at least 15 contiguous nucleotides thereof (preferably, at least 20, 30, 40, or 50 contiguous nucleotides thereof). In a further preferred embodiment, the DNA segment encodes the amino acid sequence set forth in SEQ ID NO:2, allelic or species variation thereof, or at least 5 contiguous amino acids thereof (preferably, at least 5, 10, 15, 20, 30 or 50 contiguous amino acids thereof).
In a further embodiment, the present invention relates to a polypeptide free of proteins with which it is naturally associated or a polypeptide bound to a solid support and comprising an amino acid sequence corresponding to pneumococcal fimbrial protein A, or at least 5 contiguous amino acids thereof (preferably, at least 5, 10, 15, 20, 30 or 50 contiguous amino acids thereof). In one preferred embodiment, the polypeptide comprises the amino acid sequence set forth in SEQ ID NO:2, or allelic or species variation thereof equivalent thereto (for example, immunologically or functionally, equivalent thereto), or at least 5 contiguous amino acids thereof (preferably, at least 5, 10, 15, 20, 30 or 50 contiguous amino acids thereof).
In another embodiment, the present invention relates to a recombinant DNA molecule comprising a vector (for example plasmid or viral vector) and a DNA segment (as described above) coding for a polypeptide corresponding to pneumococcal fimbrial protein A, as described above. In a preferred embodiment, the encoding segment is present in the vector operably linked to a promoter.
In a further embodiment, the present invention relates to a cell containing the above described recombinant DNA molecule. Suitable host cells include procaryotes (such as bacteria, including E. coli) and both lower eucaryotes (for example yeast) and higher eucaryotes (for example, mammalian cells). Introduction of the recombinant molecule into the cell can be effected using methods known in the art.
In another embodiment, the present invention relates to a method of producing a polypeptide having an amino acid sequence corresponding to pneumococcal fimbrial protein A comprising culturing the above-described cell under conditions such that the DNA segment is expressed and the polypeptide thereby produced and isolating the polypeptide.
In yet another embodiment, the present invention relates to an antibody having binding affinity for pneumococcal fimbrial protein A, or a unique portion thereof. In one preferred embodiment, pneumococcal fimbrial protein A comprises the amino acid sequence set forth in SEQ ID NO:2, allelic or species variation thereof, or at least 5 contiguous amino acids thereof (preferably, at least 5, 10, 15, 20, 30 or 50 contiguous amino acids thereof).
Antibodies (monoclonal or polyclonal) can be raised to pneumococcal fimbrial protein A, or unique portions thereof, in its naturally occuring form and in its recombinant form. Binding fragments of such antibodies are also within the scope of the invention.
Pneumococcal fimbrial protein A may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens. Pneumococcal fimbrial protein A or its fragments may be fused or covalently linked to a variety of immunogens, such as keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, etc. See for example, Microbiology, Hoeber Medical Division (Harper and Row, 1969), Landsteiner, Specificity of Serological Reactions (Dover Publications, New York, 1962) and Williams et al., Methods in Immunology and Immunochemistry, Vol. 1 (Academic Press, New York, 1967), for descriptions of methods of preparing polyclonal antisera. A typical method involves hyperimmunization of an animal with an antigen. The blood of the animal is then collected shortly after the repeated immunizations and the gamma globulin is isolated.
In some instances, it is desirable to prepare monoclonal antibodies from various mammalian hosts. Description of techniques for preparing such monoclonal antibodies may be found in Stites et al., editors, Basic and Clinical Immunology, (Lange Medical Publications, Los Altos, Calif., Fourth edition) and references cited therein, and in particular in Kohler and Milstein in Nature 256:495-497 (1975), which discusses one method of generating monoclonal antibodies.
In another embodiment, the present invention relates to a hybridoma which produces a monoclonal antibody or binding fragment thereof having binding affinity for pneumococcal fimbrial protein A. In one preferred embodiment, the pneumococcal fimbrial protein A has the amino acid sequence set forth in SEQ ID NO:2, allelic or species variation thereof, or at least 5 contiguous amino acids thereof (preferably, at least 5, 10, 15, 20, 30 or 50 contiguous amino acids thereof). In another preferred embodiment, the hybridoma comprises 1E7A3D7C2.
In yet another embodiment, the present invention relates to a diagnostic kit comprising:
i) at least one of the above-described monoclonal antibodies, and
ii) a conjugate comprising a binding partner of said monoclonal antibody and a label.
In a further embodiment, the present invention relates to a diagnostic kit comprising a conjugate comprising:
i) at least one of the above-described monoclonal antibodies, and
ii) a label.
In a further embodiment, the present invention relates to a method of measuring the amount of pneumococcal fimbrial protein A in a sample, comprising contacting the sample with the above-described antibodies and measuring the amount of immunocomplexes formed between the antibodies and any pneumococcal fimbrial protein A in the sample. Methods of measuring the amount of immunocomplexes formed can be those well known in the art, such as RIA, ELISA, and direct and indirect immunoassays.
In another embodiment, the present invention relates to a vaccine comprising the above-identified polypeptides. The presently used commercial vaccine, Pneumovax, is a mixture of 23 capsular polysaccharides from S. pneumoniae. The vaccine is efficacious in adults but not effective in children less than two years of age. Since the polypeptides of the present invention are proteins, they can be used to protect against pneumococcal disease in children and adults. In one preferred embodiment, the polypeptides describe-above, may be conjugated to components of the existing commercial vaccine. Preliminary data indicate that some children less than two years of age produce antibodies to the pneumococcal fimbrial protein A (the 37-kDa protein).
The present invention is described in further detail in the following non-limiting Examples.
EXAMPLES
The following protocols and experimental details are referenced in the Examples that follow:
Bacterial Strains
The S. pneumoniae strain R36A was kindly provided by D. E. Briles (University of Alabama at Birmingham). Twenty-four serotypes of S. pneumoniae were provided by R. Facklam, Centers for Disease Control (CDC), Atlanta, Ga. These serotypes are 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11F, 11A, 12F, 14, 15B, 18C, 19A, 19F, 20, 22F, 23F, and 33F. Enterococcus avium, E. casseliflavus, and E. gallinarum were also provided by R. Facklam. Anaerobic bacteria were obtained from V. R. Dowell, CDC. These included Bacteroides asaccharolyticus, B. fragilis, B. intermedius, B. thetaiotaomicron, Eubacterium lentum, Fusobacterium necrophorum, F. nucleatum, Peptostreptococcus anaerobius, P. asaccharolyticus, Propionibacterium acnes, and Staphylococcus saccharolyticus. Branhamella catarrhalis and Bordetella parapertussis were obtained from R. Weaver, CDC. Mycobacterium tuberculosis was provided by R. C. Good, CDC. R. Barnes, CDC, provided Chlamydia pneumoniae. The following remaining bacteria were from the stock collection of the Immunology Laboratory, CDC: Bordetella pertussis, Enterobacter aerogenes, E. agglomerans, E. cloacae, E. gergoviae, Escherichia coli, Klebsielia pneumoniae, Haemophilus influenzae (types a-f), Legionella micdadei, L. pneumophila, Mycoplasma pneumoniae, Pseudomonas aeruginosa, Serratia marcescens, Staphylococcus aureus, Streptococcus agalactiae, S. equisimilis, S. pyogenes, and group G streptococci.
Production of MAbS
Female BALB/c mice were immunized with whole cell suspensions of S. pneumoniae R36A, a rough derivative of the capsular type 2 strain D39 (Avery, O. T. et al. (1944) J. Exp. Med. 79:137-157). The mice were immunized by intravenous injection three times and intraperitoneal injection one time. The maximum number of cells injected at any time was 10.sup.8. Fusion was done on day 25 by using standard procedures (Clafin, L., and K. Williams (1978) Curr. Top. Microbiol. Immunol. 81:107-109). Spleen cells of 4 mice were fused with Sp2/0-Ag14 myeloma cells (Schulman, M. et al. (1978) Nature (London) 276:269-270). Culture fluids of the growing hybridomas were tested for antibodies to S. pneumoniae whole cells in an ELISA. A clone designated 1E7A3D7C2 was one of 10 selected for further study. Further references to MAbs in this article refer to hybridoma clone 1E7A3D7C2.
ELISA
Screening of hybridoma culture supernatants was done by ELISA. U-bottom microtitration plates (Costar, Cambridge, Mass.) were sensitized with 50 .mu.l of S. pneumoniae whole cell suspension (10.sup.9 CFU/ml) diluted 1:4,000 in 0.1M carbonate buffer, pH 9.6, and kept for 16 h at 4.degree. C. The plates were washed 5 times with 0.9% NaCl containing 0.05% Tween 20 (NaCl-T). Culture supernatants (50 .mu.l) from the fusion plates were added to 50 .mu.l of a solution containing 2% bovine serum albumin (BSA), 10% normal rabbit serum, 0.3% Tween-20, and 0.02% Merthiolate in phosphate buffered saline (PBS), pH 7.2, (ELISA diluent) (Wells, D. E. et al. (1987) J. Clin. Microbiol. 25:516-521) in the plates and were incubated for 30 min at 37.degree. C. The plates were washed 5 times with NaCl-T. Fifty microliters of goat anti-mouse immunoglobulin horseradish peroxidase conjugate, diluted in ELISA diluent was added to each well. The plates were incubated for 30 min at 37.degree. C. The plates were washed, and 50 .mu.l of 3,3',5,5'-tetramethylbenzidine (0.1 mg/ml in 0.1M sodium acetate, 0.1M citric acid [pH 5.7] with 0.005% hydrogen peroxide) was added to each well and incubated for 30 min at 37.degree. C. The reaction was stopped by adding 1 ml of 4M H.sub.2 SO.sub.4 and the optical density was read on a Dynatech ELISA Reader (Dynatech Laboratories, Inc., Alexandria, Va.) at 450 nm. An optical density of >0.200 was considered positive.
SDS-PAGE and Immunoblot Analysis
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed by the method of Tsang et al. (Tsang, V. C. W. et al. (1983) Methods Enzymol. 92:377-391), using an 8% acrylamide resolving gel. Equal volumes of sample buffer (5% SDS-10% 2-mercaptoethanol-20% glycerol in 0.01M Tris HCL, [pH 8.0]) and cell suspension containing 2.4 .mu.g protein per .mu.l were mixed, heated at 100.degree. C. for 5 min, and a 5-.mu.l portion was applied to 1 of 15 wells. If the final protein content of the portion of sample to be tested was <1.2 .mu.g/.mu.l, a volume up to 10 .mu.l of sample was applied to achieve a final concentration of 6 .mu.g of protein per well. Protein concentrations were determined by the method of Markwell et al. (Markwell, M. A. et al. (1978) Anal. Biochem. 87:206-210), with BSA as the standard.
Proteins separated by SDS-PAGE were either silver stained by the method of Morrissey (Morrissey, J. H. (1981) Anal. Biochem. 117:307-310) or electroblotted onto nitrocellulose (Schleicher & Schnell, Inc., Keene, N.H.). The immunoblot procedure was done according to the method of Tsang et al. (Tsang, V. C. W. et al. (1983) Methods Enzymol. 92:377-391) with slight modifications. The blots were given three 5-min washes with PBS, pH 7.2, containing 0.3% Tween-20 and were gently agitated overnight (16 h) at 25.degree. C. The blots were blocked for 1 h with casein-thimerosal buffer (CTB) (Kenna, J. G. et al. (1985) J. Immunol. Meth. 85:409-419). After three rinses with CTB, the blots were exposed to goat anti-mouse immunoglobulin horseradish peroxidase conjugate (Bio-Rad Laboratories, Richmond, Calif.) for 2 h at 25.degree. C. Conjugate dilutions (1:2,000) were made in CTB. The blots were again rinsed three times with CTB and exposed to 3-3'diaminobenzadine-4-hydrochloride in PBS, pH 7.2 (0.5 mg/ml), with 0.003% H.sub.2O.sub.2 for 5 min at 25.degree. C. Reactivity was expressed as a visible colored band on the nitrocellulose paper. Low-molecular-mass protein standards (Bio-Rad) were used in PAGE and immunoblotting. Rabbit antisera to the protein standards were used to develop the standards (Carlone, G. M. (1986) Anal. Biochem. 155:89-91). Molecular masses were calculated by the method of Neville and Glossman (Neville, D. M., and H. Glossman (1974) Methods Enzymol. 32:92-102) using appropriate molecular mass standards.
IFA
A bacterial suspension containing approximately 400-500 CFU per field (10 .mu.l) was allowed to dry at room temperature on each well of acetone-resistant, 12-well (5 mm diameter), glass slides (25.times.75 mm) (Cel-Line Associates, Newfield, N.J.). The slides were then immersed in acetone for 10 min and air dried at room temperature. MAbs were added to the slides, which were incubated for 30 min at 37.degree. C. After incubation, the slides were gently rinsed with PBS and soaked twice at 5-min intervals, blotted on filter paper, and air dried at room temperature. Fluorescein-labeled rabbit anti-mouse immunoglobulin (courtesy of W.F.Bibb, CDC) was then added, and the slides were incubated for 30 min at 37.degree. C. They were then washed twice with PBS and gently blotted on filter paper. Slides were covered with carbonate-buffered mounting fluid, pH 9.0, and cover slips and were then read with a Leitz Dialux 20 fluorescence microscope equipped with a HBO-100 mercury incident light source, an I cube filter system, a 40x dry objective lens, and 6.3x binoculars (E. Leitz, Inc., Rockleigh, N.J.).
Immunoelectron Microscopy
Pneumococcal cells were washed two times with PBS and fixed in a mixture of 1% paraformaldehyde-0.1% glutaraldehyde (freshly made) for 20 min at 4.degree. C. The cells were dehydrated in a graded alcohol series and then in a 1:1 mixture of absolute ethanol and Lowicryl K4M (Ladd Research Industries, Inc.,Burlington, Vt.) for 1 h at 4.degree. C. The cells were pelleted and suspended in a 1:2 mixture of absolute ethanol and Lowicryl K4M for 1 h at 4.degree. C. They were again pelleted and suspended in Lowicryl K4M (undiluted) for 16 h at 4.degree. C.
The cells were transferred to fresh Lowicryl K4M two times during the next 24-hour period. The Lowicryl K4M-treated cells were imbedded in gelatin capsules, which were placed inside a box lined with aluminum foil. The capsules were hardened by holding them, in the box, 35 cm from a short-wave UV light source for 72 h at -20.degree. C. The box was brought to room temperature, and the capsules were allowed to continue hardening for up to 14 days.
Samples of the capsule were cut into 100-.mu.m thin sections and picked up on nickel grids. Grids containing the sample were placed on a droplet of ovalbumin solution in PBS containing sodium azide (E.Y. Laboratories, Inc., San Mateo, Calif.) for 5 min. The grids (wet) were transferred to a solution of primary MAbs diluted in a solution of BSA reagent (1% BSA in PBS containing 0.1% Triton X-100, Tween 20, and sodium azide) (E.Y. Laboratories) and incubated for 1 h at room temperature or 18 to 48 h at 4.degree. C. in a moist chamber. For antibody binding controls, other grids were wetted with MAbs against Legionella pneumophila. The grids were rinsed two times with PBS and incubated on droplets of goat anti-mouse IgG-labeled colloidal gold particles (20 .mu.m) (E.Y. Laboratories) for 1 h at room temperature. The grids were rinsed two times and poststained with osmium tetroxide, uranyl acetate, and lead citrate. The grids were examined with a Philips 410 transmission electron microscope.
EXAMPLE 1
Monoclonal Antibodies
Hybridoma clone 1E7A3D7C2 produced MAbs that reacted with a 37-kilodalton (kDa) protein antigen (pneumococcal fimbrial protein A) found in S. pneumoniae. The MAbs reacted with an antigen fractionated in SDS-PAGE, yielding a single immunoblot band. This indicates that the MAb reacted with epitopes found only on the 37-kDa antigen (pneumococcal fimbrial protein A).
The MAbs produced by the immunization of mice with pneumococcal cells reacted with all pneumococcal strains tested (24 serotypes) to yield a sensitivity of 100%. For specificity, 55 different nonpneumococcal strains of bacteria that can also cause respiratory infections (Donowitz, G. R., and G. L. Mandell (1985) In: Principles and practices in infectious diseases, 2nd ed. (G. L. Mandell, R. G. Douglas, and J. E. Bennett, ed.) John Wiley & Sons, Inc., New York, pp. 394-404) were tested for antigens reacting with the MAbs. The latter strains represented 19 genera and 36 species of bacteria. None of the strains tested reacted with the pneumococcal MAbs, thus yielding a specificity of 100%
Of 44 patients known to have pneumococcus disease, 34 (77%) had antibodies that reacted with the 37-kDa antigen (pneumococcal fimbrial protein A) by Western immunoblot (FIG. 1).
The MAbs reacted with whole pneumococcal cells to yield a positive test result in both the ELISA and IFA. FIG. 2 shows the bright immunofluorescence of whole pneumococcus cells stained by the MAbs and fluorescein-labeled anti-mouse immunoglobulin in the IFA. Results from both the ELISA and the IFA indicate that the antigen has exposed epitopes on the surface of the cell or that the immunoglobulin and other immunologic reagents are able to penetrate the pneumococcal cell walls.
Several strains of group A streptococci were tested for immunofluorescence after reacting with the pneumococcus MAbs. None of the heterologous bacterial cells fluoresced in this test, indicating that the IFA reaction was specific for pneumococcus cells.
To further determine the location on the cell of the 37-kDa antigen (pneumococcal fimbrial protein A) epitopes reacting with the MAbs, immunolabeling experiments were performed. FIG. 3 shows that the cells were typical of gram-positive cocci in the process of division. The figure also shows the reaction of MAbs and colloidal gold-labeled anti-mouse immunoglobulin G with thin sections of whole pneumococcal cells. A large portion of the antigen appears to be intracellular since there is no coating or layering of the labeled MAbs around the cell. The large patch of colloidal gold staining indicates that the MAbs bound antigen located inside the cell wall. There was no colloidal gold binding to control pneumococci that were exposed to the MAbs against L. pneumophila.
EXAMPLE 2
Cloning of the Pneumococcal Fimbrial Protein A Gene
Streptococcus pneumoniae DNA digested with restriction enzyme Sau3A1 was ligated to BamHI digested pUC13 and transformed into E. coli TB1. Recombinant clones were identified by colony immunoblot using the 37-kDa monoclonal antibody. The plasmid pSTR3-1 is an example of the pneumococcal fimbrial protein A gene cloned into pUC13.
All publications mentioned hereinabove are hereby incorporated in their entirety by reference. Additionally, Russell et al. (October 1990), J. of Clin. Microbiol. 28:2191-2195 is hereby incorporated in its entirety by reference.
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention and appended claims.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1175 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 243..1172 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CTCATCACACCCGCTGCGACAGCCTATCTCTATGCCAATAGCCTCTGGTCCATGATGCTC60 CTTTCATCCGGATTAGGTGCCCTAGCCTCTATCCTAGGACTCTTTATCGGCTACAGTTTC120 AACATCGCCGTCGGGTCTTGTATC GTCCTCACTTCTGCCATCTTCTTTCTCATCAGCTTC180 TTTATCGCTCCTAAGCAGAGAAAGAATAAGCACGCTCTTTCACCTCATTAAAGGAGAAAC240 ACATGAAAAAAATCGCTTCTGTCCTCGCCCTCTTTGTGGCGCTCTTG287 MetLysLysIleAlaSerValLeuAlaLeuPheValAlaLeuLeu 151015 TTCGGCCTGTTGGCCTGCAGCAAAGGCACTTCTTCCAAGTCCTCATCC335 PheGlyLeuLeuAlaCysSerLysGlyThrSerSerLysSerSerSer 202530 GATAAATTGAAGGTGGTTACCACCAACTCCATCCTTGCCGATATCACC383 AspLysLeuLysValValThrThrAsnSerIleLeuAlaAspIleThr 354045 AAAAATATCGCTGGGGATAAAATCGAGCTCCACAGTATTGTACCTGTC431 L ysAsnIleAlaGlyAspLysIleGluLeuHisSerIleValProVal 505560 GGTCAAGATCCCCACGAGTACGAACCGCTCCCAGAAGATGTCAAAAAA479 GlyGln AspProHisGluTyrGluProLeuProGluAspValLysLys 657075 ACTTCACAAGCAGACCTGATCTTCTACAATGGGATCAACCTCGAAACG527 ThrSerGlnAlaAsp LeuIlePheTyrAsnGlyIleAsnLeuGluThr 80859095 GGTGGCAATGCTTGGTTTACCAAATTGGTCAAAAATGCCAATAAAGTA575 GlyGlyAsnAl aTrpPheThrLysLeuValLysAsnAlaAsnLysVal 100105110 GAAAACAAGGACTATTTCGCTGCCAGCGATGGCGTAGAGGTCATCTAC623 GluAsnLysA spTyrPheAlaAlaSerAspGlyValGluValIleTyr 115120125 CTGGAAGGCCAAAACCAAGCTGGAAAAGAAGACCCTCACGCTTGGCTC671 LeuGluGlyGln AsnGlnAlaGlyLysGluAspProHisAlaTrpLeu 130135140 AATCTCGAAAACGGGATTATCTACGCTAAAAACATTGCCAAACAATTA719 AsnLeuGluAsnGlyIle IleTyrAlaLysAsnIleAlaLysGlnLeu 145150155 ATCGCCAAAGATCCAAAAAATAAGGACTTCTACGAAAAAAATCTAGCA767 IleAlaLysAspProLysAsnLysAs pPheTyrGluLysAsnLeuAla 160165170175 GCCTACACTGAAAAACTCAGCAAGCTAGACCAAGAAGCCAAGCAAGCA815 AlaTyrThrGluLysLeuSerL ysLeuAspGlnGluAlaLysGlnAla 180185190 TTCAATAACATCCCAGCAGAGAAGAAGATGATCGTAACCAGCGAAGGT863 PheAsnAsnIleProAlaGlu LysLysMetIleValThrSerGluGly 195200205 TGCTTCAAGTACTTCTCCAAAGCCTACGGCGTCCCATCTGCCTATATC911 CysPheLysTyrPheSerLysAla TyrGlyValProSerAlaTyrIle 210215220 TGGGAAATCAACACTGAAGTAGAAGGGACACCTGAACAAATCAAAACG959 TrpGluIleAsnThrGluValGluGlyTh rProGluGlnIleLysThr 225230235 CTGCTAGAGAAATTGCGTCAAACCAAAGTACCGTCCCTCTTTGTCGAA1007 LeuLeuGluLysLeuArgGlnThrLysValProSerL euPheValGlu 240245250255 TCCAGTGTCGATGAGCGTCCTATGAAAACTGTGTCTAAGGATAGCAAT1055 SerSerValAspGluArgProMetLysThrVal SerLysAspSerAsn 260265270 ATCCCTATCTTTGCAAAGATCTTTACTGACTCGATTGCCAAAGAAGGC1103 IleProIlePheAlaLysIlePheThrAspSer IleAlaLysGluGly 275280285 GAAGAAGGCGACAGCTACTACAGCATGATGAAATGGAATTTGGAGAAA1151 GluGluGlyAspSerTyrTyrSerMetMetLysTr pAsnLeuGluLys 290295300 ATCGCAGAAGGTTTGAACAAATAA1175 IleAlaGluGlyLeuAsnLys 305 310 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 310 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: MetLysLysIleAlaSerValLeuAlaLeuPheValAlaLeuLeuPhe 15 1015 GlyLeuLeuAlaCysSerLysGlyThrSerSerLysSerSerSerAsp 202530 LysLeuLysValValThrThrAsnSer IleLeuAlaAspIleThrLys 354045 AsnIleAlaGlyAspLysIleGluLeuHisSerIleValProValGly 505560 G lnAspProHisGluTyrGluProLeuProGluAspValLysLysThr 65707580 SerGlnAlaAspLeuIlePheTyrAsnGlyIleAsnLeuGluThrGly 859095 GlyAsnAlaTrpPheThrLysLeuValLysAsnAlaAsnLysValGlu 100105110 AsnLysAspTyrPhe AlaAlaSerAspGlyValGluValIleTyrLeu 115120125 GluGlyGlnAsnGlnAlaGlyLysGluAspProHisAlaTrpLeuAsn 130135 140 LeuGluAsnGlyIleIleTyrAlaLysAsnIleAlaLysGlnLeuIle 145150155160 AlaLysAspProLysAsnLysAspPheTyrGluLysAsnLeu AlaAla 165170175 TyrThrGluLysLeuSerLysLeuAspGlnGluAlaLysGlnAlaPhe 180185190 AsnA snIleProAlaGluLysLysMetIleValThrSerGluGlyCys 195200205 PheLysTyrPheSerLysAlaTyrGlyValProSerAlaTyrIleTrp 210 215220 GluIleAsnThrGluValGluGlyThrProGluGlnIleLysThrLeu 225230235240 LeuGluLysLeuArgGlnThrLysValPro SerLeuPheValGluSer 245250255 SerValAspGluArgProMetLysThrValSerLysAspSerAsnIle 260265 270 ProIlePheAlaLysIlePheThrAspSerIleAlaLysGluGlyGlu 275280285 GluGlyAspSerTyrTyrSerMetMetLysTrpAsnLeuGluLysIle 29 0295300 AlaGluGlyLeuAsnLys 305310
* * * * *
uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.
While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.
All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.
| 