U.S. patent number 4,800,159 [Application Number 06/943,948] was granted by the patent office on 1989-01-24 for process for amplifying, detecting, and/or cloning nucleic acid sequences.
This patent grant is currently assigned to Cetus Corporation. Invention is credited to Norman Arnheim, Henry A. Erlich, Glenn T. Horn, Kary B. Mullis, Randall K. Saiki, Stephen J. Scharf.
United States Patent |
4,800,159 |
Mullis , et al. |
* January 24, 1989 |
**Please see images for:
( Certificate of Correction ) ** |
Process for amplifying, detecting, and/or cloning nucleic acid
sequences
Abstract
The present invention is directed to a process for amplifying
and detecting any target nucleic acid sequence contained in a
nucleic acid or mixture thereof. The process comprises treating
separate complementary strands of the nucleic acid with a molar
excess of two oligonucleotide primers, extending the primers to
form complementary primer extension products which act as templates
for synthesizing the desired nucleic acid sequence, and detecting
the sequence so amplified. The steps of the reaction may be carried
out stepwise or simultaneously and can be repeated as often as
desired. In addition, a specific nucleic acid sequence may be
cloned into a vector by using primers to amplify the sequence,
which contain restriction sites on their non-complementary ends,
and a nucleic acid fragment may be prepared from an existing
shorter fragment using the amplification process.
Inventors: |
Mullis; Kary B. (La Jolla,
CA), Erlich; Henry A. (Oakland, CA), Arnheim; Norman
(Woodland Hills, CA), Horn; Glenn T. (Emeryville, CA),
Saiki; Randall K. (Richmond, CA), Scharf; Stephen J.
(Berkeley, CA) |
Assignee: |
Cetus Corporation (Emeryville,
CA)
|
[*] Notice: |
The portion of the term of this patent
subsequent to July 28, 2004 has been disclaimed. |
Family
ID: |
27125165 |
Appl.
No.: |
06/943,948 |
Filed: |
December 17, 1986 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
828144 |
Feb 7, 1986 |
4683195 |
Jul 28, 1987 |
|
|
824044 |
Jan 30, 1986 |
|
|
|
|
791308 |
Oct 25, 1985 |
4683202 |
Jul 28, 1987 |
|
|
716975 |
Mar 28, 1985 |
|
|
|
|
Current U.S.
Class: |
435/91.2;
435/320.1; 435/91.41; 536/23.5; 536/23.53; 536/24.33 |
Current CPC
Class: |
C12Q
1/6858 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12N 015/00 (); C12P 019/34 ();
C07H 021/04 () |
Field of
Search: |
;435/91,172.1,172.3
;935/17,18 ;536/27 |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Rossi et al., J. Biol. Chem. 257: 9226-9229 (1982). .
E. Taparowsky et al., Cell, 34:581-586 (1983)..
|
Primary Examiner: Martinell; James
Attorney, Agent or Firm: Kaster; Kevin R. Hasak; Janet E.
Halluin; Albert P.
Claims
What is claimed is:
1. A process for cloning into a vector a specific nucleic acid
sequence contained in a nucleic acid or a mixture of nucleic acids,
which process comprises:
a. treating the nucleic acid(s) with one oligonucleotide primer for
each strand of each different specific sequence being amplified,
under conditions such that for each strand of each different
sequence being amplified an extension product of wherein said
primer or primers are selected so as to be sufficiently
complementary to each strand of each specific sequence to hybridize
therewith such that the extension product synthesized from one
primer, when it is separated from its complement, can serve as a
template for synthesis of the extension product of the other
primer, and wherein said primer or primers each contain a
restriction site on its 5' end which is the same as or different
from the restriction site(s) on the other primer(s);
b. separating the primer extension products from the templates on
which they were synthesized to produce single-stranded
molecules;
c. treating the single-stranded molecules generated from step (b)
with oligonucleotide primers such that a primer extension product
is synthesized using each of the single strands produced in step
(b) as a template, wherein depending on the particular sequence
being amplified, steps (a) and (c) are carried out in the presence
of from 0 to 10% dimethylsulfoxide or at a temperature of
35.degree. C. to 45.degree. C.
d. adding to the product of step (c) a restriction enzyme for each
of said restriction sites to obtain cleaved products in a
restriction digest; and
e. ligating the cleaved product(s) into one or more cloning
vectors.
2. The process of claim 1, further comprising the step of passing
the restriction digest of step (d) through a desalting column
before step (e).
3. The process of claim 1, further comprising, after step (e),
sequencing the specific nucleic acid sequence.
4. The process of claim 1, further comprising, after step (e),
expressing the protein encoded by the specific nuclei acid
sequence.
5. The process of claim 1, wherein one sequence is being amplified,
the restriction sites are different on each primer, and the product
of step (d) is ligated into a cloning vector with a specific
orientation.
6. The process of claim 1, wherein the specific nucleic acid
sequence being amplified is or is contained within the
.beta.-globin gene or the N-RAS oncogene.
Description
FIELD OF THE INVENTION
The present invention relates to a process for amplifying existing
nucleic acid sequences if they are present in a test sample and
detecting them if present by using a probe. More specifically, it
relates to a process for producing any particular nuclei acid
sequence from a given sequence of DNA or RNA in amounts which are
large compared to the amount initially present so as to facilitate
detection of the sequences. The DNA or RNA may be single- or
doublestranded, and may be a relatively pure species or a component
of a mixture of nucleic acids. The process of the invention
utilizes a repetitive reaction to accomplish the amplification of
the desired nucleic acid sequence.
BACKGROUND OF THE INVENTION
For diagnostic applications in particular, the target nucleic acid
sequence may be only a small portion of the DNA or RNA in question,
so that it may be difficult to detect its presence using
nonisotopically labeled or end-labeled oligonucleotide probes. Much
effort is being expended in increasing the sensitivity of the probe
detection systems, but little research has been conducted on
amplifying the target sequence so that it is present in quantities
sufficient to be readily detectable using currently available
methods.
Several methods have been described in the literature for the
synthesis of nucleic acids de novo or from an existing sequence.
These methods are capable of producing large amounts of a given
nucleic acid of completely specified sequence.
One known method for synthesizing nucleic acids de novo involves
the organic synthesis of a nucleic acid from nucleoside
derivatives. This synthesis may be performed in solution or on a
solid support. One type of organic synthesis is the phosphotriester
method, which has been utilized to prepare gene fragments or short
genes. In the phosphotriester method, oligonucleotides are prepared
which can then be joined together to form longer nucleic acids. For
a description of this method, see Narang, S.A., et al., Meth.
Enzymol., 68, 90 (1979) and U.S. Pat. No. 4,356,270. The patent
describes the synthesis and cloning of the somatostatin gene.
A second type of organic synthesis is the phosphodiester method,
which has been utilized to prepare a tRNA gene. See Brown, E.L., et
al., Meth. Enzymol., 68, 109 (1979) for a description of this
method. As in the phosphotriester method, the phosphodiester method
involves synthesis of oligonucleotides which are subsequently
joined together to form the desired nucleic acid.
Although the above processes for de novo synthesis may be utilized
to synthesize long strands of nucleic acid, they are not very
practical to use for the synthesis of large amounts of a nucleic
acid. Both processes are laborious and time-consuming, require
expensive equipment and reagents, and have a low overall
efficiency. The low overall efficiency may be caused by the
inefficiencies of the synthesis of the oligonucleotides and of the
joining reactions. In the synthesis of a long nucleic acid, or even
in the synthesis of a large amount of a shorter nucleic acid, many
oligonucleotides would need to be synthesized and many joining
reactions would be required. Consequently, these methods would not
be practical for synthesizing large amounts of any desired nucleic
acid.
Methods also exist for producing nucleic acids in large amounts
from small amounts of the initial existing nucleic acid. These
methods involve the cloning of a nucleic acid in the appropriate
host system, where the desired nucleic acid is inserted into an
appropriate vector which is used to transform the host. When the
host is cultured the vector is replicated, and hence more copies of
the desired nuclei acid are produced. For a brief description of
subcloning nucleic acid fragments, see Maniatis, T., et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, pp. 390-401 (1982). See also the techniques described
in U.S. Pat. Nos. 4,416,988 and 4,403,036.
A third method for synthesizing nucleic acids, described in U.S.
Pat. No. 4,293,652, is a hybrid of the above-described organic
synthesis and molecular cloning methods. In this process, the
appropriate number of oligonucleotides to make up the desired
nucleic acid sequence is organically synthesized and inserted
sequentially into a vector which is amplified by growth prior to
each succeeding insertion.
The present invention bears some similarity to the molecular
cloning method; however, it does not involve the propagation of any
organism and thereby avoids the possible hazards or inconvenience
which this entails. The present invention also does not require
synthesis of nucleic acid sequences unrelated to the desired
sequence, and thereby the present invention obviates the need for
extensive purification of the product from a complicated biological
mixture.
SUMMARY OF THE INVENTION
The present invention resides in a process for amplifying one or
more specific nucleic acid sequences present in a nucleic acid or
mixture thereof using primers and agents for polymerization and
then detecting the amplified sequence. The extension product of one
primer when hybridized to the other becomes a template for the
production of the desired specific nucleic acid sequence, and vice
versa, and the process is repeated as often as is necessary to
produce the desired amount of the sequence. This method is expected
to be more efficient than the methods described above for producing
large amounts of nucleic acid from a target sequence and to produce
such nucleic acid in a comparatively short period of time. The
present method is especially useful for amplifying rare species of
nucleic acid present in a mixture of nucleic acids for effective
detection of such species.
More specifically, the present invention provides a process for
detecting the presence or absence of at least one specific nucleic
acid sequence in a sample containing a nucleic acid or mixture of
nucleic acids, or distinguishing between two different forms of
sequences in said sample, wherein the sample is suspected of
containing said sequence or sequences, which process comprises:
(a) treating the sample with one oligonucleotide primer for each
strand of each different specific sequence suspected of being
present in the sample, under hybridizing conditions such that for
each strand of each different sequence to be detected an extension
product of each primer is synthesized which is complementary to
each nucleic acid strand, wherein said primer or primers are
selected so as to be substantially complementary to each strand of
each specific sequence such that the extension product synthesized
from one primer, when it is separated from its complement, can
serve as a template for synthesis of the extension product of the
other primer;
(b) treating the sample under denaturing conditions to separate the
primer extension products from their templates if the sequence or
sequences to be detected are present;
(c) treating the sample with oligonucleotide primers such that a
primer extension product is synthesized using each of the single
strands produced in step (b) as a template, resulting in
amplification of the specific nucleic acid sequence or sequences if
present;
(d) adding to the product of step (c) a labeled probe capable of
hybridizing to said sequence being detected or a mutation thereof;
and
(e) determining whether said hybridization has occurred.
The steps (a)-(c) may be conducted sequentially or simultaneously.
In addition, steps (b) and (c) may be repeated until the desired
level of sequence amplification is obtained.
In other embodiments the invention relates to diagnostic kits for
the detection of at least one specific nucleic acid sequence in a
sample containing one or more nucleic acids at least one of which
nucleic acid is suspected of containing said sequence, which kit
comprises, in packaged form, a multicontainer unit having
(a) one container for each oligonucleotide primer for each strand
of each different sequence to be detected, which primer or primers
are substantially complementary to each strand of each specific
nucleic acid sequence such that an extension product synthesized
from one primer, when it is separated from its complement, can
serve as a template for the synthesis of the extension product of
the other primer;
(b) a container containing an agent for polymerization;
(c) a container for each of four different nucleoside
triphosphates;
(d) a container containing a probe capable of detecting the
presence of said sequence in said sample; and
(e) a container containing means for detecting hybrids of said
probe and said sequence.
In yet another embodiment, the invention relates to a process for
cloning into a vector a specific nucleic acid sequence contained in
a nucleic acid or a mixture of nucleic acids, which process
comprises:
(a) treating the nucleic acid(s) with one oligonucleotide primer
for each strand of each different specific sequence being
amplified, under conditions such that for each strand of each
different sequence being amplified an extension product of each
primer is synthesized which is complementary to each nucleic acid
strand, wherein said primer or primers are selected so as to be
substantially complementary to each strand of each specific
sequence such that the extension product synthesized form one
primer, when it is separated from its complement, can serve as a
template for synthesis of the extension product of the other
primer, and wherein said primer or primers each contain a
restriction site on its 5' end which is the same as or different
from the restriction site(s) on the other primer(s);
(b) separating the primer extension products from the templates on
which they are synthesized to produce single-stranded
molecules;
(c) treating the single-stranded molecules generated from step (b)
with oligonucleotide primers such that a primer extension product
is synthesized using each of the single strands produced in step
(b) as a template, wherein depending on the particular sequence
being amplified, steps (a) and (c) are carried out in the presence
of from 0 up to an effective amount of dimethylsulfoxide or at a
temperature of up to about 45.degree. C.;
(d) adding to the product of step (c) a restriction enzyme for each
of said restriction sites to obtain cleaved products in a
restriction digest; and
(e) ligating the cleaved product(s) into one or more cloning
vectors.
In yet another embodiment, the invention herein relates to a
process for synthesizing a nucleic acid fragment from an existing
nucleic acid fragment having fewer nucleotides than the fragment
being synthesized and two oligonucleotide primers, wherein the
nucleic acid being synthesized is comprised of a left segment, a
core segment and a right segment, and wherein the core segment
represents at least substantially the nucleotide sequence of said
existing nucleic acid fragment, and the right and left segments
represent the sequence nucleotide present in the 5' ends of the two
primers, the 3' ends of which are complementary or substantially
complementary to the 3' ends of the single strands produced by
separating the strands of said existing nucleic acid fragment,
which process comprises:
(a) treating the strands of said existing fragment with two
oligonucleotide primers under conditions such that an extension
product of each primer is synthesized which is complementary to
each nucleic acid strand, wherein said primers are selected so as
to be substantially complementary to the 3' end of each strand of
said existing fragment such that the extension product synthesized
from one primer, when it is separated from its complement, can
serve as a template for synthesis of the extension product of the
other primer, and wherein each primer contains, at its 5' end, a
sequence of nucleotides which are not complementary to said
existing fragment and which correspond to the two ends of the
nucleic acid fragment being synthesized;
(b) separating the primer extension products from the templates on
which they were synthesized to produce single-stranded
molecules;
(c) treating the single-stranded molecules generated from step (b)
with the primers of step (a) under conditions such that a primer
extension product is synthesized using each of the single strands
produced in step (b) as a template so as to produce two
intermediate double-stranded nucleic acid molecules, into each of
which has been incorporated the nucleotide sequence present in the
5' end of one of the oligonucleotide primers, and two full-length
doublestranded nucleic acid molecules, into each of which has been
incorporated the nucleotide sequence present in the 5' ends of both
of the oligonucleotide primers;
(d) repeating steps (b) and (c) for a sufficient number of times to
produce the full-length double-stranded molecule in an effective
amount;
(e) treating the strands of the product of step (d) with two
primers so as to lengthen the product of step (d) on both ends;
and
(f) repeating steps (a)-(d) using the product of step (d) as the
core fragment and two oligonucleotide primers which are
complementary or substantially complementary to the 3' ends of the
single strands produced by separating the strands of the product of
step (d).
The core fragment may be obtained by the steps comprising:
(a) reacting two oligonucleotides, each of which contain at their
3' ends a nucleotide sequence which is complementary to the other
oligonucleotide at its 3' end, and which are non-complementary to
each other at their 5' ends, with an agent for polymerization and
four nucleoside triphosphates under conditions such that an
extension product of each oligonucleotide is synthesized which is
complementary to each nucleic acid strand;
(b) separating the extension products from the templates on which
they are synthesized to produce single-stranded molecules; and
(c) treating the single-stranded molecules generated from step (b)
with the oligonucleotides of step (a) under conditions such that a
primer extension product is synthesized using each of the single
strands produced in step (b) as a template, resulting in
amplification of the core fragment.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates a 94 base pair length sequence of human
.beta.-globin desired to be amplified. The single base pair change
which is associated with sickle cell anemia is depicted beneath the
94-mer.
FIG. 2 illustrates a photograph of an ethidium bromidestained
polyacrylamide gel demonstrating amplification of the 94-mer
contained in human wild-type DNA and in a plasmid containing a 1.9
kb BamHI fragment of the normal .beta.-globin gene
(pBR328:HbA).
FIG. 3 illustrates a photograph of an ethidium bromidestained
polyacrylamide gel demonstrating amplification of any of the
specific target 94-mer sequence present in pBR328:HbA, a plasmid
containing a 1.9 kb BamHI fragment of the sickel cell allele of
.beta.-globin (pBR328:HbS), pBR328:HbA where the sequence to be
amplified is cleaved with MstII, and pBR328:HbS where the sequence
to be amplified has been treated but not cleaved with MstII.
FIG. 4 illustrates in detail the steps and products of the
polymerase chain reaction for amplification of the desired 94-mer
sequence of human .beta.-globin for three cycles using two
oligonucleotide primers.
FIG. 5 represents a photograph of an ethidium bromidestained
polyacrylamide gel demonstrating amplification after four cycles of
a 240-mer sequence in pBR328:HbA, where the aliquots are digested
with NcoI (Lane 3), MstII (Lane 4) or HinfI (Lane 5). Lane 1 is the
molecular weight standard and Lane 2 contains the intact 240-bp
product.
FIG. 6 illustrates the sequence of the normal (.beta..sup.A) and
sickle cell (.beta..sup.S) .beta.-globin genes in the region of the
DdeI and HinfI restriction sites, where the single lines for
.beta..sup.A mark the position of the DdeI site (CTGAG) and the
double bars for .beta..sup.A and .beta..sup.S mark the position of
the HinfI site (GACTC).
FIG. 7 illustrates the results of sequential digestion of normal
.beta.-globin using a 40-mer probe and DdeI followed by HinfI
restriction enzymes.
FIG. 8 illustrates the results of sequential digestion of sickel
.beta.-globin using the same 40-mer probe as in FIG. 7 and DdeI
followed by HinfI restriction enzymes.
FIG. 9 illustrates a photograph of an ethidium bromidestained
polyacrylamide gel demonstrating the use of the same 40-mer probe
as in FIG. 7 to specifically characterize the beta-globin alleles
present in samples of whole human DNA which have been subjected to
amplification, hybridization with the probe, and sequential
digestion with DdeI and HinFfI.
FIG. 10 illustrates a photograph of a 6% NuSieve agarose gel
visualized using ethidium bromide and UV light. This photograph
demonstrates amplfication of a sub-fragment of a 110-bp
amplification product which sub-fragment is an inner nested set
within the 110-bp fragment.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The term "oligonucleotide" as used herein in referring to primers,
probes, oligomer fragments to be detected, oligomer controls and
unlabeled blocking oligomers is defined as a molecule comprised of
two or more deoxyribonucleotides or ribonucleotides, preferably
more than three. Its exact size will depend on many factors, which
in turn depend on the ultimate function or use of the
oligonucleotide.
The term "primer" as used herein refers to an oligonucleotide
whether occurring naturally as in a purified restriction digest or
produced synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is induced, i.e., in the presence of
nucleotides and an agent for polymerization such as DNA polymerase
and at a suitable temperature and pH. The primer is preferably
single stranded for maximum efficiency in amplification, but may
alternatively be double stranded. If double stranded, the primer is
first treated to separate its strands before being used to prepare
extension products. Preferably, the primer is an
oligodeoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
agent for polymerization. The exact lengths of the primers will
depend on many factors, including temperature and source of
primers. For example, depending on the complexity of the target
sequence, the oligonucleotide primer typically contains 15-25 or
more nucleotides, although it may contain fewer nucleotides. Short
primer molecules generally require cooler temperatures to form
sufficiently stable hybrid complexes with template.
The primers herein are selected to be "substantially" complementary
to the different strands of each specific sequence to be amplified.
This means that the primers must be sufficiently complementary to
hybridize with their respective strands. Therefore, the primer
sequence need not reflect the exact sequence of the template. For
example, a non-complementary nucleotide fragment may be attached to
the 5' end of the primer, with the remainder of the primer sequence
being complementary to the strand. Alternatively, noncomplementary
bases or longer sequences can be interspersed into the primer,
provided that the primer sequence has sufficient complementarity
with the sequence of the strand to be amplified to hybridize
therewith and thereby form a template for synthesis of the
extension product of the other primer.
As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes each of which cut
double-stranded DNA at or near a specific nucleotide sequence.
As used herein, the term "DNA polymorphism" refers to the condition
in which two or more different nucleotide sequences coexist in the
same interbreeding population in a DNA sequence.
The term "restriction fragment length polymorphism" ("RFLP") refers
to the differences in DNA nucleotide sequences that are randomly
distributed throughout the entire human genome and that produce
different restriction endonuclease patterns.
The present invention is directed to a process for amplifying any
one of more desired specific nucleic acid sequences suspected of
being in a nucleic acid. Because large amounts of a specific
sequence may be produced by this process, the present invention may
be used for improving the efficiency of cloning DNA or messenger
RNA and for amplifying a target sequence to facilitate detection
thereof.
In general, the present process involves a chain reaction for
producing, in exponential quantities relative to the number of
reaction steps involved, at least one specific nucleic acid
sequence given (a) that the ends of the required sequence are known
in sufficient detail that oligonucleotides can be synthesized which
will hybridize to them, and (b) that a small amount of the sequence
is available to initiate the chain reaction. The product of the
chain reaction will be a discrete nucleic acid duplex with termini
corresponding to the ends of the specific primers employed.
Any source of nucleic acid, in purified or nonpurified form, can be
utilized as the starting nucleic acid or acids, provided it is
suspected of containing the specific nucleic acid sequence desired.
Thus, the process may employ, for example, DNA or RNA, including
messenger RNA, which DNA or RNA may be single stranded or double
stranded. In addition, a DNA-RNA hybrid which contains one strand
of each may be utilized. A mixture of any of these nucleic acids
may also be employed, or the nucleic acids produced from a previous
amplification reaction herein using the same or different primers
may be so utilized. The specific nucleic acid sequence to be
amlified may be only a fraction of a larger molecule or can be
present initially as a discrete molecule, so that the specific
sequence constitutes the entire nucleic acid. It is not necessary
that the sequence to be amplified be present initially in a pure
form; it may be a minor fraction of a complex mixture, such as a
portion of the .beta.-globin gene contained in whole human DNA or a
portion of nucleic acic sequence due to a particular microorganism
which organism might constitute only a very minor fraction of a
particular biological sample. The starting nucleic acid may contain
more than one desired specific nucleic acid sequence which may be
the same or different. Therefore, the present process is useful not
only for producing large amounts of one specific nucleic acid
sequence, but also for amplifying simultaneously more than one
different specific nucleic acid sequence located on the same or
different nucleic acid molecules.
The nucleic acid or acids may be obtained from any source, for
example, from plasmids such as pBR322, from cloned DNA or RNA, or
from natural DNA or RNA from any source, including bacteria, yeast,
viruses, and higher organisms such as plants or animals. DNA or RNA
may be extracted from blood, tissue material such as chorionic
villi or amniotic cells by a variety of techniques such as that
described by Maniatis et al., Molecular Cloning: A Laboratory
Manual, (New York: Cold Spring Harbor Laboratory, 1982), pp.
280-281.
Any specific nucleic acid sequence can be produced by the present
process. It is only necessary that a sufficient number of bases at
both ends of the sequence be known in sufficient detail so that two
oligonucleotide primers can be prepared which will hybridize to
different strands of the desired sequence and at relative positions
along the sequence such that an extension product synthesized from
one primer, when it is separated from its template (complement),
can serve as a template for extension of the other primer into a
nucleic acid of defined length. The greater the knowledge about the
bases at both ends of the sequence, the greater can be the
specificity of the primers for the target nucleic acid sequence,
and thus the greater the efficiency of the process. It will be
understood that the word primer as used hereinafter may refer to
more than one primer, particularly in the case where there is some
ambiguity in the information regarding the terminal sequence(s) of
the fragment to be amplified. For instance, in the case where a
nucleic acid sequence is inferred from protein sequence information
a collection of primers containing sequences representing all
possible codon variations based on degeneracy of the genetic code
will be used for each strand. One primer from this collection will
be homologous with the end of the desired sequence to be
amplified.
The oligonucleotide primers may be prepared using any suitable
method, such as, for example, the phosphotriester and
phosphodiester methods described above, or automated embodiments
thereof. In one such automated embodiment diethylphosphoramidites
are used as starting materials and may be synthesized as described
by Beaucage et al., Tetrahedron Letters (1981), 22:1859-1862. One
method for synthesizing oligonucleotides on a modified solid
support is described in U.S. Pat. No. 4,458,066. It is also
possible to use a primer which has been isolated from a biological
source (such as a restriction endonuclease digest).
The specific nuclei acid sequence is produced by using the nucleic
acid containing that sequence as a template. If the nucleic acid
contains two strands, it is necessary to separate the strands of
the nucleic acid before it can be used as the template, either as a
separate step or simultaneously with the synthesis of the primer
extension products. This strand separation can be accomplished by
any suitable denaturing method including physical, chemical or
enzymatic means. One physical method of separating the strands of
the nucleic acid involves heating the nucleic acid until it is
completely (>99%) denatured. Typical heat denaturation may
involve temperatures ranging from about 80.degree. to 105.degree.
C. for times ranging from about 1 to 10 minutes. Strand separation
may also be induced by an enzyme from the class of enzymes known as
helicases or the enzyme ReCA, which has helicase activity and in
the presence of riboATP is known to denature DNA. The reaction
conditions suitable for separating the strands of nucleic acids
with helicases are described by Cold Spring Harbor Symposia on
Quantitative Biology, Vol. XLIII "DNA: Replication and
Recombination" (New York: Cold Spring Harbor Laboratory, 1978), B.
Kuhn et al., "DNA Helicases", pp. 63-67, and techniques for using
RecA are reviewed in C. Radding, Ann. Rev. Genetics, 16:405-37
(1982).
If the original nucleic acid containing the sequence to be
amplified is single stranded, its complement is synthesized by
adding one or two oligonucleotide primers thereto. If an
appropriate single primer is added, a primer extension product is
synthesized in the presence of the primer, an agent for
polymerization and the four nucleotides described below. The
product will be partially complementary to the single-stranded
nucleic acid and will hybridize with the nucleic acid strand to
form a duplex of unequal length strands that may then be separated
into single strands as described above to produce two single
separated complementary strands. Alternatively, two appropriate
primers may be added to the single-stranded nucleic acid and the
reaction carried out.
If the original nucleic acid constitutes the sequence to be
amplified, the primer extension product(s) produced will be
completely complementary to the strands of the original nucleic
acid and will hybridize therewith to form a duplex of equal length
strands to be separated into single-stranded molecules.
When the complementary strands of the nucleic acid or acids are
separated, whether the nucleic acid was originally double or single
stranded, the strands are ready to be used as a template for the
synthesis of additional nucleic acid strands. This synthesis can be
performed using any suitable method. Generally it occurs in a
buffered aqueous solution, preferably at a pH of 7-9, most
preferably about 8. Preferably, a molar excess (for cloned nucleic
acid, usually about 1000:1 primer:template, and for genomic nucleic
acid, usually about 10.sup.6 :1 primer:template) of the two
oligonucleotide primers is added to the buffer containing the
separated template strands. It is understood, however, that the
amount of complementary strand may not be known if the process
herein is used for diagnostic applications, so that the amount of
primer relative to the amount of complementary strand cannot be
determined with certainty. As a practical matter, however, the
amount of primer added will generally be in molar excess over the
amount of complementary strand (template) when the sequence to be
amplified is contained in a mixture of complicated long-chain
nucleic acid strands. A large molar excess is preferred to improve
the efficiency of the process.
The deoxyribonucleoside triphosphates dATP, dCTP, dGTP and TTP are
also added to the synthesis mixture in adequate amounts and the
resulting solution is heated to about 90.degree.-100.degree. C. for
from about 1 to 10 minutes, preferably from 1 to 4 minutes. After
this heating period the solution is allowed to cool to from
20.degree.-40.degree. C., which is preferable for the primer
hybridization. To the cooled mixture is added an agent for
polymerization, and the reaction is allowed to occur under
conditions known in the art. This synthesis reaction may occur at
from room temperature up to a temperature above which the agent for
polymerization no longer functions efficiently. Thus, for example,
if DNA polymerase is used as the agent for polymerization, the
temperature is generally no greater than about 45.degree. C.
Preferably an amount of dimethylsulfoxide (DMSO) is present which
is effective in detection of the signal or the temperature is
35.degree.-40.degree. C. Most preferably 5-10% by volume DMSO is
present and the temperature is 35.degree.-40.degree. C. For certain
applications, where the sequences to be amplified are over 110 base
pair fragments, such as the HLA DQ-.alpha. or -.beta. genes, an
effective amount (e.g., 10% by volume) of DMSO is added to the
amplification mixture, and the reaction is carried at
35.degree.-40.degree. C., to obtain detectable results or to enable
cloning.
The agent for polymerization may be any compound or system which
will function to accomplish the synthesis of primer extension
products, including enzymes. Suitable enzymes for this purpose
include, for example, E. coli DNA polymerase I, Klenow fragment of
E. coli DNA polymerase I, T4 DNA polymerase, other available DNA
polymerases, reverse transcriptase, and other enzymes, including
heatstable enzymes, which will facilitate combination of the
nucleotides in the proper manner to form the primer extension
products which are complementary to each nucleic acid strand.
Generally, the synthesis will be initiated at the 3' end of each
primer and proceed in the 5' direction along the template strand,
until synthesis terminates, producing molecules of different
lengths. There may be agents, however, which initiate synthesis at
the 5' end and proceed in the other direction, using the same
process as described above.
The newly synthesized strand and its complementary nucleic acid
strand form a double-stranded molecule which is used in the
succeeding steps of the process. In the next step, the strands of
the double-stranded molecule are separated using any of the
procedures described above to provide single-stranded
molecules.
New nucleic acid is synthesized on the single-stranded molecules.
Additional inducing agent, nucleotides and primers may be added if
necessary for the reaction to proceed under the conditions
prescribed above. Again, the synthesis will be initiated at one end
of the oligonucleotide primers and will proceed along the single
strands of the template to produce additional nucleic acid. After
this step, half of the extension product will consist of the
specific nucleic acid sequence bounded by the two primers.
The steps of strand separation and extension product synthesis can
be repeated as often as needed to produce the desired quantity of
the specific nucleic acid sequence. As will be described in further
detail below, the amount of the specific nucleic acid sequence
produced will accumulate in an exponential fashion.
When it is desired to produce more than one specific nucleic acid
sequence from the first nucleic acid or mixture of nucleic acids,
the appropriate number of different oligonucleotide primers are
utilized. For example, if two different specific nucleic acid
sequences are to be produced, four primers are utilized. Two of the
primers are specific for one of the specific nucleic acid sequences
and the other two primers are specific for the second specific
nucleic acid sequence. In this manner, each of the two different
specific sequences can be produced exponentially by the present
process.
The present invention can be performed in a step-wise fashion where
after each step new reagents are added, or simultaneously, where
all reagents are added at the initial step, or partially step-wise
and partially simultaneous, where fresh reagent is added after a
given number of steps. If a method of strand separation, such as
heat, is employed which will inactivate the agent for
polymerization, as in the case of a heat-labile enzyme, then it is
necessary to replenish the agent for polymerization after every
strand separation step. The simultaneous method may be utilized
when a number of purified components, including an enzymatic means
such as helicase, is used for the strand separation step. In the
simultaneous procedure, the reaction mixture may contain, in
addition to the nucleic acid strand(s) containing the desired
sequence, the strandseparating enzyme (e.g., helicase), an
appropriate energy source for the strand-separating enzyme, such as
rATP, the four nucleotides, the oligonucleotide primers in molar
excess, and the inducing agent, e.g., Klenow fragment of E. coli
DNA polymerase I. If heat is used for denaturation in a
simultaneous process, a heat-stable inducing agent such as a
thermostable polymerase may be employed which will operate at an
elevated temperature, preferably 65.degree.-90.degree. C. depending
on the inducing agent, at which temperature the nucleic acid will
consist of single and double strands in equilibrium. For smaller
lengths of nucleic acid, lower temperatures of about 50.degree. C.
may be employed. The upper temperature will depend on the
temperature at which the enzyme will degrade or the temperature
above which an insufficient level of primer hybridization will
occur. Such a heat-stable enzyme is described, e.g., by A. S.
Kaledin et al., Biokhimiya, 45, 644-651 (1980). Each step of the
process will occur sequentially notwithstanding the initial
presence of all the reagents. Additional materials may be added as
necessary. After the appropriate length of time has passed to
produce the desired amount of the specific nucleic acid sequence,
the reaction may be halted by inactivating the enzymes in any known
manner or separating the components of the reaction.
The process of the present invention may be conducted continuously.
In one embodiment of an automated process, the reaction may be
cycled through a denaturing region, a reagent addition region, and
a reaction region. In another embodiment, the enzyme used for the
synthesis of primer extension products can be immobilized in a
column. The other reaction components can be continuously
circulated by a pump through the column and a heating coil in
series; thus the nucleic acids produced can be repeatedly denatured
without inactivating the enzyme.
The present invention is demonstrated diagrammatically below where
double-stranded DNA containing the desired sequence [S] comprised
of complementary strands [S.sup.+ ] and [S.sup.- ] is utilzied as
the nucleic acid. During the first and each subsequent reaction
cycle extension of each oligonucleotide primer on the original
template will produce one new ssDNA molecule product of indefinite
length which terminates with only one of the primers. These
products, hereafter referred to as "long products," will accumulate
in a linear fashion; taht is, the amount present after any number
of cycles will be proportional to the number of cycles.
The long products thus produced will act as templates for one or
the other of the oligonucleotide primers during subsequent cycles
and will produce molecules of the desired sequence [S.sup.+ ] or
[S.sup.- ]. These molecules will also function as templates for one
of the other of the oligonucleotide primers, producing further
[S.sup.+ ] and [S.sup.- ], and accumulation of [S] at an
exponential rate relative to the number of cycles.
By-products formed by oligonucleotide hybridizations other than
those intended are not self-catalytic (except in rare instances)
and thus accumulates at a linear rate.
The specific sequence to be amplified, [S], can be depicted
diagrammatically as: ##STR1##
It is seen that each strand which terminates with the
oligonucleotide sequence of one primer and the complementary
sequence of the other is the specific nucleic acid sequence [S]
that is desired to be produced.
The steps of this process can be repeated indefinitely, being
limited only by the amount of Primers 1 and 2, the agent for
polymerization and nucleotides present. For detection, the number
of cycles used is that required to produce a detectable signal, an
amount which will depend, e.g., on the nature of the sample. For
example, if the sample is pure or diluted, fewer cycles may be
required than if it is a complex mixture. If the sample is human
genomic DNA, preferably the number of cycles is from about
10-30.
The amount of original nucleic acid remains constant in the entire
process, because it is not replicated. The amount of the long
products increases linearly because they are produced only from the
original nucleic acid. The amount of the specific sequence
increases exponentially. Thus, the specific sequence will become
the predominant species. This is illustrated in the following
table, which indicates the relative amounts of the species
theoretically present after n cycles, assuming 100% efficiency at
each cycle:
______________________________________ Number of Double Strands
After 0 to n Cycles Long Specific Cycle Number Template Products
Sequence [S] ______________________________________ 0 1 -- -- 1 1 1
0 2 1 2 1 3 1 3 4 5 1 5 26 10 1 10 1013 15 1 15 32,752 20 1 20
1,048,555 n 1 n (2.sup.n - n - 1)
______________________________________
When a single-stranded nucleic acid is utilized as the template,
only one long product is formed per cycle.
The method herein may be utilized to clone a particular nucleic
acid sequence for insertion into a suitable expression vector. The
vector may then be used to transform an appropriate host organism
to produce the gene product of the sequence by standard methods of
recombinant DNA technology.
Normally, such cloning would either involve direct ligation into a
vector or the addition of oligonucleotide linkers followed by
restriction enzyme cleavage. Both of these methods involve,
however, the inefficient blunt-end ligation reaction. Also, neither
technique would control for the orientation or multiplicity of
insertion of the amplified product into the cloning vector.
The amplification process herein may yield a mixture of nucleic
acids, resulting from the original template nucleic acid, the
expected target amplified products, and various background
non-target products. The amplified product can also be a mixture if
the original template DNA contains multiple target sequences, such
as in a heterozygous diploid genome or when there is a family of
related genes.
The primers herein may be modified to assist the rapid and specific
cloning of the mixture of the DNAs produced by the amplification
reaction. In such modification the same or different restriction
sites are incorporated at the 5' ends of the primers to result in
restriction sites at the two ends of the amplified product. When
cut with the appropriate enzymes, the amplified product can then be
easily inserted into plasmid or viral vectors and cloned. This
cloning allows the analysis or expression of individual amplified
products, not a mixture.
Although the same restriction site an be used for both primers, the
use of different sites allows the insertion of the product into the
vector with a specific orientation and suppresses multiple
insertions as well as insertions arising from amplifications based
on only one of the two primers. The specific orientation is useful
when cloning into single-strand sequencing vectors, when
single-strand hybridization probes are used, or when the cloned
product is being expressed.
One method to prepare the primers is to choose a primer sequence
which differs minimally from the target sequence. Regions in which
each of the primers is to be located are screened for homology to
restriction sites appropriate to the desired vector. For example,
the target sequence "CAGTATCCGA . . . " differs by only one base
from one containing a BamHI site. A primer sequence is chosen to
match the target exactly at its 3' end, and to contain the altered
sequence and restriction site near its 5' end (for example,
"CATgATCCGA . . . ", where the lower case letter symbolizes a
mismatch with the target sequence). This minimally altered sequence
will not interfere with the ability of the primer to hybridize to
the original target sequence and to initiate polymerization. After
the first amplification cycle the primer is copied, becomes the
target, and matches exactly with new primers. After the
amplification process, the products are cleaved with the
appropriate restriction enzymes, optionally separated from
inhibitors of ligation such as the nucleotide triphosphates and
salts by passing over a desalting column or molecular weight
chromatography column, and inserted by ligation into a cloning
vector such as bacteriophage M13. The gene may then be sequenced
and/or expressed using well known techniques.
The second method for preparing the primers involves taking the 3'
end of the primers from the target sequence and adding the desired
restriction site(s) to the 5' end of the primer. For the above
example, a HindIII site could be added to make the sequence
"cgaagcttCAGTATCCGA . . . ", where lower case letters are as
described above. The added bases would not contribute to the
hybridization in the first cycle of amplification, but would match
in subsequent cycles. The final amplified products are then cut
with restriction enzyme(s) and cloned and expressed as described
above. The gene being amplified may be, for example, human
beta-hemaglobin or the human HLA DQ, DR or DP-.alpha. and -.beta.
genes.
In addition, the process herein can be used for in vitro
mutagenesis. The oligodeoxyribonucleotide primers need not be
exactly complementary to the DNA sequence which is being amplified.
It is only necessary that they be able to hybridize to the sequence
sufficiently well to be extended by the polymerase enzyme or by
whatever other inducing agent is employed. The product of a
polymerase chain reaction wherein the primers employed are not
exactly complementary to the original template will contain the
sequence of the primer rather than the template, thereby
introducing an in vitro mutation. In further cycles this mutation
will be amplified with an undiminished efficiency because no
further mispaired primings are required. The mutant thus produced
may be inserted into an appropriate vector by standard molecular
biological techniques and might confer mutant properties on this
vector such as the potential for production of an altered
protein.
The process of making an altered DNA sequence as described above
could be repeated on the altered DNA using different primers so as
to induce further sequence changes. In this way a series of mutated
sequences could gradually be produced wherein each new addition to
the series could differ from the last in a minor way, but from the
original DNA source sequence in an increasingly major way. In this
manner changes could be made ultimately which were not feasible in
a single step due to the inability of a very seriously mismatched
primer to function.
In addition, the primer can contain as part of its sequence a
non-complementary sequence provided that a sufficient amount of the
primer contains a sequence which is complementary to the strand to
be amplified. For example, a nucleotide sequence which is not
complementary to the template sequence (such as, e.g., a promoter,
linker, coding sequence, etc.) may be attached at the 5' end of one
or both of the primers, and thereby appended to the product of the
amplification process. After the extension primer is added,
sufficient cycles are run to achieve the desired amount of new
template containing the non-complementary nucleotide insert. This
allows production of large quantities of the combined fragments in
a relatively short period of time (e.g., two hours or less) using a
simple technique.
Moreover, the process herein may be used to synthesize a nucleic
acid fragment from an existing nucleic acid fragment which is
shorter than its product (called the core segment) using certain
primers the 3' ends of which are complemenary to or substantially
complementary to the 3' ends of the single strands produced by
separating the strands of the original shorter nucleic acid
fragments, and the 5' ends of which primers contain sequence
information to be appended to the core segment. This process
comprises:
(a) treating the strands of said existing fragment with two
oligonucleotide primers under conditions such that an extension
product of each primer is synthesized which is complementary to
each nucleic acid strand, wherein said primers are selected so as
to be substantially complementary to the 3' end of each strand of
said existing fragment such that the extension product synthesized
from one primer, when it is separated from its complement, can
serve as a template for synthesis of the extension product of the
other primer, and wherein each primer contains, at its 5' end, a
sequence of nucleotides which are not complementary to said
existing fragent and which correspond to the two ends of the
nucleic acid fragment being synthesized;
(b) separating the primer extension products from the templates on
which they are synthesized to produce single-stranded
molecules;
(c) treating the single-stranded molecules generated from step (b)
with the primers of step (a) under conditions such that a primer
extension product is synthesized using each of the single strands
produced in step (b) as a template so as to produce two
intermediate double-stranded nucleic acid molecules, into each of
which has been incorporated the nucleotide sequence present in the
5' end of one of the oligonucleotide primers, and two full-length
double-stranded nucleic acid molecules, into each of which has been
incorporated the nucleotide sequence present in the 5' ends of both
of the oligonucleotide primers;
(d) repeating steps (b) and (c) for a sufficient number of times to
produce the full-length double-stranded molecule in an effective
amount;
(e) treating the strands of the product of step (d) with two
primers so as to lengthen the product of step (d) on both ends;
and
(f) repeating steps (a)-(d) using the product of step (d) as the
core fragment and two oligonucleotide primers which are
complementary or substantially complementary to the 3' ends of the
single strands produced by separating the strands of the product of
step (d).
Steps (b) and (c) are repeated as often as necessary, usually at
least 5 times, to produce the required amount of the fulllength,
double-stranded product to synthesize the final product (i.e., the
effective amount). In addition, the core segment may be obtained as
the product of a previous amplification cycle. The product produced
in step (d) may be purified before a new cycle of extension and
amplification, or used directly by employing the reaction mixture
containing the product.
If the 3' ends of the primers are not exactly complementary to the
3' ends of the single strands of the original shorter nucleic acid,
the core fragment of the product will not be exactly the same as
the sequence information resident in the original shorter nucleic
acid. Therefore, mutants of the original nucleic acid may be made
by using primers which are substantially complementary at their 3'
ends to the 3' ends of the single strands of the original shorter
nucleic acid.
If restriction site linkers are incorporated into the primers, then
the amplified double-stranded products can be digested with the
appropriate restriction enzymes and ligated directly into an M13
vector for rapid cloning and sequencing. The M13 plaques containing
the specific amplified target sequences can be identified by
hybridizing plaque lift filters with a probe specific for the
target sequence.
The method herein may also be used to enable detection and/or
characterization of specific nucleic acid sequences associated with
infectious diseases, genetic disorders or cellular disorders such
as cancer, e.g., oncogenes. Amplification is useful when the amount
of nucleic acid available for analysis is very small, as, for
example, in the prenatal diagnosis of sickle cell anemia using DNA
obtained from fetal cells. Amplification is particularly useful if
such an analysis is to be done on a small sample using
non-radioactive detection techniques which may be inherently
insensitive, or where radioactive techniques are being employed but
where rapid detection is desirable.
For purposes of this invention genetic diseases may include
specific deletions and/or mutations in genomic DNA from any
organism, such as, e.g., sickle cell anemia, cystic fibrosis,
.alpha.-thalassemia, .beta.-thalassemia, and the like. Sickle cell
anemia can be readily detected via oligomer restriction analysis or
a RFLP-like analysis following amplification of the appropriate DNA
sequence by the present method. .alpha.-Thalassemia can be detected
by the absence of a sequence, and .beta.-thalassemia can be
detected by the presence of a polymorphic restriction site closely
linked to a mutation which causes the disease.
All of these genetic diseases may be detected by amplifying the
appropriate sequence and analyzing it by Southern blots without
using radioactive probes. In such a process, for example, a small
sample of DNA from, e.g., amniotic fluid containing a very low
level of the desired sequence is amplified, cut with a restriction
enzyme, and analyzed via a Southern blotting technique. The use of
nonradioactive probes is facilitated by the high level of the
amplified signal.
In another embodiment a small sample of DNA may be amplified to a
convenient level and then a further cycle of extension reactions
performed wherein nucleotide derivatives which are readily
detectable (such as .sup.32 P-labeled or biotin labeled nucleoside
triphosphates) are incorporated directly into the final DNA
product, which may be analyzed by restriction and electrophoretic
separation or any other appropriate method. An example of this
technique in a model system is demonstrated in FIG. 5.
In a further embodiment, demonstrated in a model system in FIG. 3,
the nucleic acid may be exposed to a particular restriction
endonuclease prior to amplification. Since a sequence which has
been cut cannot be amplified, the appearance of an amplified
fragment, despite prior restriction of the DNA sample, implies the
absence of a site for the endonuclease within the amplified
sequence. The presence or absence of an amplified sequence can be
detected by an appropriate method.
A practical application of this technique can be illustrated by its
use in facilitating the detection of sickel cell anemia via the
oligomer restriction technique described herein and in U.S. Pat.
No. 4,683,194. Sickle cell anemia is a hemoglobin disease which is
caused by a single base pair change in the sixth codon of the
.beta.-globin gene. FIG. 6 illustrates the sequences of normal and
sickel cell .beta.-globin genes in the region of their
polymorphism, where the single bars mark the location of a DdeI
site present only in the normal gene and where the double bars mark
the location of a HinfI site which is non-polymorphic and thus
present in both the normal and sickel cell alleles. FIG. 7
illustrates the process of oligomer restriction of normal
.beta.-globin DNA using a probe spanning both restriction sites and
labeled where the asterisk appears. (The probe is preferably
labeled at the end which is fewer base pairs from the restriction
site than the other end of the probe.) The DNA, amplified as
provided herein, is denatured and annealed to the labeled probe.
The amplification may be carried out at elevated temperatures
(35.degree.-40.degree. C.) in the presence of dimethyl sulfoxide to
minmize formation of secondary structure. The enzyme DdeI cleaves
the DNA at the reformed DdeI site and generates a labeled octamer.
Under the conditions used in the test the octamer is short enough
to dissociate from the duplex. The subsequent addition of the
enzyme HinfI has no effect on the now single-stranded octamer.
Figure 8 illustrates the same process applied to the sickel cell
allele of .beta.-globin DNA. The enzyme DdeI cannot cleave the
duplex formed by the amplfied DNA and the labeled probe because of
the A--A base pair mismatch. The enzyme HinfI, however, does
restrict the hybrid and a labeled trimer is produced. In practice
the method can diagnose the DNA of an individual as being either
homozygous for the wild type, homozygous for the sickel type or a
heterozygous carrier of the sickle cell trait, since a specific
signal is associated with the presence of either allele. Use of
this above-described method to amplify the pertinent sequence
allows for a rapid analysis of a single copy gene using a probe
with only a single .sup.32 P label.
Various infectious diseases can be diagnosed by the presence in
clinical samples of specific DNA sequences characteristic of the
causative microorganism. These include bacteria, such as
Salmonella, Chlamydia, and Neisseria; viruses, such as the
hepatitis viruses; and parasites, such as the Plasmodium
responsible for malaria. U.S. Pat. No. 4,358,535 issued to Falkow
describes the use of specific DNA hybridization probes for the
diagnosis of infectious diseases. A problem inherent in the Falkow
procedure is that a relatively small number of pathogenic organisms
may be present in a clinical sample from an infected patient and
the DNA extracted from these may constitute only a very small
fraction of the total DNA in the sample. Specific amplification of
suspected sequences prior to immobilization and hybridization
detection of the DNA samples could greatly improve the sensitivity
and specificity of these procedures.
Routine clinical use of DNA probes for the diagnosis of infectious
disesases would be simplified considerably if nonradioactively,
labeled probes could be employed as described in EP 63,879 to Ward.
In this procedure biotin-containing DNA probes are detected by
chromogenic enzymes linked to avidin or biotin-specific antibodies.
This type of detection is convenient, but relatively insensitive.
The combination of specific DNA amplification by the present method
and the use of stably labeled probes could provide the convenience
and sensitivity required to make the Falkow and Ward procedures
useful in a routine clincal setting.
In addition, the probe may be a biotinylated probe in which the
biotin is attached to a spacer arm of the formula: ##STR2## where Y
is 0, NH or N--CHO, x is a number from 1 to 4, and y is a number
from 2 to 4. The spacer arm is in turn attached to a psoralen
moiety of the formula: ##STR3## The psoralen moiety intercalates
into and crosslinks a "gapped circle" probe as described by
Courage-Tebbe et al., Biochim, Biophys. Acta, 697 (1982) 1-5,
wherein the single-stranded hybridization region of the gapped
circle spans the region contained in the primers. The details of
this biotinylation and dot blot procedure are described more fully
in U.S. Pat. Nos. 4,582,789 and 4,617,261, the disclosures of which
are incorporated herein by reference.
The amplification process can also be utilized to produce
sufficient quantities of DNA from a single copy human gene such
that detection by a simple non-specific DNA stain such as ethidium
bromide can be employed so as to make a DNA diagnosis directly.
In addition to detecting infectious diseases and pathological
abnormalities in the genome of organisms, the process herein can
also be used to detect DNA polymorphism which may not be associated
with any pathological state.
The following examples are offered by way of illustration and are
not intended to limit the invention in any manner. In these
examples all percentages are by weight if for solids and by volume
if for liquids, and all temperatures are in degrees Celsius unless
otherwise noted.
EXAMPLE 1
A 25 base pair sequence having the nucleotide sequence
contained on a 47 base pair FokI restriction fragment of pBr322
obtainable from ATCC was prepared as follows. A FokI digest of
pBR322 containing the 47-bp fragment was produced by digesting
pBR322 with FokI in accordance with the conditions suggested by the
supplier, New England Biolabs Inc. The primers which were utilized
were 5' d(CCTCGGCACCG) 3' and 5' d(AGCATCCAGGGTG) 3', and were
prepared using conventional techniques. The following ingredients
were added to 33 .mu.l of buffer which consisted of 25 mM potassium
phosphate, 10 mM magnesium chloride and 100 mM sodium chloride at
pH 7.5: 2433 pmoles of each of the primers described above, 2.4
pmoles of the FokI digest of pBR322, 12 nmoles of dATP, 22 nmoles
of dCTP, 19 nmoles of dGTP and 10 nmoles of TTP.
The mixture was heated to 85.degree. C. for five minutes and
allowed to cool to ambient temperature. Five units of the Klenow
fragment of E. coli DNA polymerase I were added and the temperature
was maintained for 15 minutes. After that time, the mixture was
again heated to 85.degree. C. for five minutes and allowed to cool.
Five units of the Klenow fragment were again added and the reaction
was carried out for 15 minutes. The heating, cooling and synthesis
steps were repeated eleven more times.
After the final repetition, a 5 .mu.l aliquot was removed from the
reaction mixture. This was heated to 85.degree. C. for three
minutes and allowed to cool to ambient temperature. 12.5 pmoles of
.alpha.-P.sup.32 -deoxycytidine triposphate and 5 units of Klenow
fragment were added and the reaction was allowed to proceed for 15
minutes. The labeled products were examined by polyacrylamide gel
electrophoresis. The FokI digest was labeled in a similar fashion
and served as a control and molecular weight markers. The only
heavily labeled band visible after the 13 cycles was the intended
25 base pair sequence.
EXAMPLE 2
The desired sequence to be amplified was a 94 base pair sequence
contained within the human beta-globin gene and spanning the MstII
site involved in sickle cell anemia. The sequence has the
nucleotide sequence shown in FIG. 1.
I. Synthesis of Primers
The following two oligodeoxyribonucleotide primers were prepared by
the method described below:
Automated Synthesis Procedures: The diethylphosphoramidites,
synthesized according to Beaucage and Caruthers (Tetrahedron
Letters (1981) 22:1859-1862), were sequentially condensed to a
nucleoside derivatized controlled pore glass support using a
Biosearch SAM-1. The procedure included detritylation with
trichloracetic acid in dichloromethane, condensation using
benzotriazole as activating proton donor, and capping with acetic
anhydride and dimethylaminopyridine in tetrahydrofuran and
pyridine. Cycle time was approximately 30 minutes. Yields at each
step were essentially quantitative and were determined by
collection and spectroscopic examination of the dimethoxytrityl
alcohol released during detritylation.
Oligodeoxyribonucleotide Deprotection and Purification Procedures:
The solid support was removed from the column and exposed to 1 ml
concentrated ammonium hydroxide at room temperature for four hours
in a closed tube. The support was then removed by filtration and
the solution containing the partially protected
oligodeoxyribonucleotide was brought to 55.degree. C. for five
hours. Ammonia was removed and the residue was applied to a
preparative polyacrylamide ge. Electrophoresis was carried out at
30 volts/cm for 90 minutes after which the band containing the
product was identified by UV shadowing of a fluorescent plate. The
band was excised and eluted with 1 ml distilled water overnight at
4.degree. C. This solution was applied to an Altech RP18 column and
eluted with a 7-13% gradient of acetonitrile in 1% ammonium acetate
buffer at pH 6.0. The elution was monitored by UV absorbance at 260
nm and the appropriate fraction collected, quantitated by UV
absorbance in a fixed volume and evaporated to dryness at room
temperature in a vacuum centrifuge.
Characterization of Oligodeoxyribonucleotides: Test aliquots of the
purified oligonucleotides were .sup.32 P labeled with
polynucleotide kinase and .gamma.-.sup.32 P-ATP. The labeled
compounds were examined by autoradiography of 14-20% polyacrylamide
gels after electrophoreis for 45 minutes at 50 volts/cm. This
procedure verifies the molecular weight. Base composition was
determined by digestion of the oligodeoxyribonucleotide to
nucleosides by use of venom diesterase and bacterial alkaline
phosphatase and subsequent separation and quantitation of the
derived nucleosides using a reverse phase HPLC column and a 10%
acetonitrile, 1% ammonium acetate mobile phase.
II. Source of DNA
A. Extraction of Whole Human Wild-Type DNA
Human genomic DNA homozygous for normal .beta.-globin was extracted
from the cell line Molt4 (obtained from Human Genetic Mutant Cell
Repository and identified as GM2219c) using the technique described
by Stetler et al., Proc. Nat. Acad. Sci. USA (1982),
79:5966-5970.
B. Construction of Cloned Globin Genes
A 1.9 kb BamHI fragment of the normal .beta.-globin gene was
isolated from the cosmid pFC11 and inserted into the BamHI set of
pBR328 (Soberon, et al., Gene (1980) 9:287-305). This fragment,
which encompasses the region that hybridizes to the synthetic
40-mer probe, includes the first and second exons, first intron,
and 5' flanking sequences of the gene (Lawn et al., Cell (1978),
15:1157-1174). This clone was designated pBR328:HbA and deposited
under ATCC No. 39,698 on May 25, 1984.
The corresponding 1.9 kb BamHI fragment of the sickle cell allele
of .beta.-globin was isolated from the cosmid pFC12 and cloned as
described above. This clone was designated pBR328:HbS and deposited
under ATCC No. 39,699 on May 25, 1984.
Each recombinant plasmid was transformed into and propagated in E.
coli MM294 (ATCC No. 39,607).
C. Digestion of Cloned Globin Genes with MstII
A total of 100 .mu.g each of pBR328:HbA and pBR328:HbS were
individually digested with 20 units of MstII (New England Biolabs)
for 16 hours at 37.degree. C. in 200 .mu.l of 150 mM NaCl, 12 mM
Tris HCl (pH 7.5), 12 mM MgCl.sub.2, 1 mM dithiothreitol (DTT), and
100 .mu.g/ml bovine serum albumin (BSA). The products are
designated pBR328:HbA/MstII and pBR328:HbS/MstII, respectively.
III. Polymerase Chain Reaction
To 100 .mu.l of buffer consisting of 60 mM sodium acetate, 30 mM
tris acetate and 10 mM magnesium acetate at pH 8.0 was added 2
.mu.l of a solution containing 100 picomoles of Primer A (of the
sequence d(CACAGGGCACTAACG)), 100 picomoles of Primer B (of the
sequence d(TTTGCTTCTGACACA)) and 1000 picomoles each of dATP, dCTP,
dGTP and TIP. In addition, one of the following sources of DNA
described above was added:
10 .mu.g whole human wild-type DNA (Reaction I)
0.1 picomole pBR328:HbA (Reaction II)
0.1 picomole pBR328:HbS (Reaction III)
0.1 picomole pBR328:HbA/MstII (Reaction IV)
0.1 picomole pBR328:HbS/MstII (Reaction V)
No target DNA (Reaction VI)
Each resulting solution was heated to 100.degree. C. for four
minutes and allowed to cool to room temperature for two minutes,
whereupon 1 .mu.l containing four units of Klenow fragment of E.
coli DNA polymerase was added. Each reaction was allowed to proceed
for 10 minutes, after which the cycle of adding the primers,
nucleotides and DNA, heating, cooling, adding polymerase, and
reacting was repeated nineteen times for Reaction I and four times
for Reactions II-VI.
Four microliter aliquots of Reactions I and II removed before the
first cycle and after the last cycle of each reaction were applied
to a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH 8.3
and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts/cm for
four hours, transferred to a nylon membrane serving as solid phase
support and probed with a 5'-.sup.32 P-labeled 40 bp synthetic
fragment, prepared by standard techniques, of the sequence
in 30% formamide, 3 x SSPE, 5 x Denhardt's, 5% sodium dodecyl
sulfate at pH 7.4. FIG. 2 is an autoradiograph of the probed nylon
membrane for Reactions I and II. Lane 1 is 0.1 picomole of a 58-bp
synthetic fragment control one strand of which is complementary to
the above probe. Lane 2 is 4 .mu.l of Reaction I prior to the first
amplification cycle. Lane 3 is 4 .mu.l of Reaction I after the 20th
amplification cycle. Lane 4 is 4 .mu.l of Reaction II after five
amplification cycles. Lane 5 is a molecular weight standard
consisting of FokI (New England Biolabs) digest of pBR322 (New
England Biolabs) labeled with alpha-.sup.32 P-dNTPs and polymerase.
Lane 3 shows that after twenty cycles the reaction mixture I
contained a large amount of the specific sequence of the proper
molecular weight and no other detectable products. Reaction mixture
II after five cycles also contained this product, as well as the
starting nucleic acid and other products, as shown by Lane 4.
To 5.0 .mu.l aliquots of Reactions II-VI after the fourth cycle
were added 5 pmoles of each primer described above. The solutions
were heated to 100.degree. C. for four minutes and allowed to
equilibrate to room temperature. Three pmoles each of alpha-.sup.32
P-dATP, alpha-.sup.32 P-cCTP, alpha-.sup.32 P-dGTP and
alpha-.sup.32 P-TTP and four units of Klenow fragment were added.
The reaction, in a final volume of 10 .mu.l and at the salt
concentrations given above, was allowed to proceed for 10 minutes.
The polymerase activity was terminated by heating for 20 minutes at
60.degree. C. Four .mu.l aliquots of Reactions II-VI were loaded
onto a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH
8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts/cm
for four hours after which autoradiography was performed.
FIG. 3 is an autoradiograph of the electrophoresis. Lane 1 is a
molecular weight standard, Lane 2 is Reaction II, Lane 3 is
Reaction III, Lane 4 is Reaction IV and Lane 5 is Reaction V.
Another lane for Reaction VI with no DNA as control had no images
in any of the lanes. It can be seen from the figure that the 94-bp
fragment predicted from the target DNA was present only where
intact .beta.-globin DNA sequences were available for
amplification, i.e., pBR328:HbA (Lane 2), pBR328:HbS (Lane 3) and
pBR328:HbS/MstII (Lane 5). MstII digestion cuts pBR328:HbA in the
94-mer sequence rendering it incapable of being amplified, and the
94-mer band does not appear in Lane 4. In contrast, the 94-mer
sequence in pBR328:HbS does not cut when the plasmid is digested
with MstII and thus is available for amplification as shown in Lane
5.
FIG. 4 illustrates the chain reaction for three cycles in
amplifying the 94-bp sequence. PC01 and PC02 are Primers A and B.
The numbers on the right indicate the cycles, whereas the mumbers
on the left indicate the cycle number in which a particular
molecule was produced.
EXAMPLE 3
This example illustrates amplification of a 110 bp sequence
spanning the allelic MstII site in the human homoglobin gene.
A total of 1.0 microgram whole human DNA, 100 picomoles
d(ACACAACTGTGTTCACTAGC) and 100 picomoles d(CAACTTCATCCACGTTCACC),
the primers having been prepared by the technique of Example 2,
were dissolved in 100 .mu.l of a solution which was:
1.5 mM in each of the four deoxyribonucleoside triphosphates
30 mM in Tric acetate buffer at pH 7.9
60 mM in sodium acetate
10 mM in magnesium acetate
0.25 mM in dithiothreitol
The solution was heated to 100.degree. C. for one minute and
brought rapidly to 25.degree. C. for one minute, after which was
added 2.5 units Klenow fragment of DNA polymerase. The polymerase
reaction was allowed to proceed for two minutes at 25.degree. C.,
after which the cycle of heating, cooling, adding Klenow, and
reacting was repeated as often as desired.
With a 70% efficiency at each cycle, 15 cycles resulted in the
synthesis of 1.4 femtomoles of the desired 110 bp fragment of the
.beta.-globin gene.
EXAMPLE 4
This example illustrates amplification of a 240 bp sequence
spanning the allelic MstII site in the human hemoglobin gene. This
sequence contains NcoI, HinfI and MstII restriction sites.
To 100 .mu.l of a mixture of 60 mM sodium acetate, 30 mM Tris
acetate and 10 mM magnesium acetate at pH 8.0 containing 0.1 pmole
pBR328:HbA was added 2 .mu.l of Solution A containing:
100 pmoles d(GGTTGGCCAATCTACTCCCAGG) primer
100 pmoles d(TAACCTTGATACCAACCTGCCC) primer
1000 pmoles each of dATP, dCTP, dGTP and TTP
The two primers were prepared by the technique described in Example
2. The solution was heated to 100.degree. C. for four minutes and
allowed to cool in ambient air for two minutes, after which added 1
.mu.l containing four units Klenow fragment of E. coli DNA
polymerase. The reaction was allowed to proceed for 10 minutes
after which the cycle of solution A addition, heating, cooling,
adding polymerase, and reacting was repeated three times. To a 5.0
.mu.l aliquot of the reactions was added 5 picomoles of each
oligonucleotide primer described above. The solution was heated to
100.degree. C. for four minutes and allowed to come to ambient
temperature, after which 3 picomoles each of the alpha-.sup.32
P-labeled deoxyribonucleoside triphosphates and 4 units Klenow
fragment were added. The reaction, in a final volume of 10 .mu.l
and at the salt concentrations given above, was allowed to proceed
for 10 minutes. The polymerase activity was terminated by heating
for 20 minutes at 60.degree. C. Two .mu.l aliquots were digested
with NcoI, MstII, or HinfI and loaded onto a 12% polyacrylamide gel
0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel
was electrophoresed at 25 volts/cm for four hours and
autoradiography was performed. FIG. 5 illustrates the
autoradiograph of the electrophoresis, where Lane 1 is the
molecular weight standard, Lane 2 is without digestion with enzyme
(240 bp intact), Lane 3 is digestion with NcoI (131 and 109 bp),
Lane 4 is digestion with MstII (149 and 91 bp), and Lane 5 is
digestion with HinfI (144 and 96 bp). The autoradiograph is
consistent with the amplification of the 240 bp sequence.
EXAMPLE 5
This example illustrates use of the process herein to detect sickle
cell anemia by sequential digestion. Synthesis and Phosphorylation
of Oligodeoxyribonucleotides
A labeled DNA probe, RS06, of the sequence:
5' *CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG 3' where * indicates
the label, and an unlabeled blocking oligomer, RS10, of the
sequence:
3' GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5' which has three base
pair mismatches with RS06 were synthesized according to the
procedures provided in Example 2(I). The probe RS06 was labeled by
contacting five pmole thereof with 4 units of T4 polynucleotide
kinase (New England Biolabs) and 50 pmole .gamma..sup.32 P-ATP (New
England Nuclear, about 7200 Ci/mmole) in a 40 .mu.l reaction volume
containing 70 mM Tris buffer (ph 7.6), 10 mM MgCl.sub.2, 1.5 mM
spermine, and 2.5 mM dithiothreitol for 90 minutes at 37.degree. C.
The total volume was then adjusted to 100 .mu.l with 25 mM EDTA and
purified according to the procedure of Maniatis et al., Molecular
Cloning: A Laboratory Manual (New York: Cold Spring Harbor
Laboratory, 1982), pp. 464-465, over a 1 ml Bio Gel P-4 spin
dialysis column from Bio-Rad equilibrated with Tris-EDTA (TE)
buffer (10 mM Tris buffer, 0.1 mM EDTA, pH 8.0). The labeled probe
was further purified by electrophoresis on a 18% polyacrylamide gel
(19:1 acrylamide:BIS, BioRad) in Tris-boric acid-EDTA, (TBE) buffer
(89 mM Tris, 89 mM boric acid, 2.5 mM EDTA, pH 8.3) for 500 vhr.
After localization by autoradiography, the portion of the gel
containing the labeled probe was excised, crushed and eluted into
0.2 ml TE buffer overnight at 4.degree. C. TCA precipitation of the
reaction product indicated that the specific activity was 4.9
Ci/mmole and the final concentration was 20 pmole/ml.
The unlabeled RS10 blocking oligomer was used at a concentration of
200 pmole/ml.
Isolation of Human Genomic DNA from Cell Lines
High molecular weight genomic DNA was isolated from the lymphoid
cell lines Molt4, SC-1 and GM2064 using essentially the method of
Stetler et al., Proc. Natl. Acad. Sci. USA (1982), 79, 5966-5970
(for Molt4) and Maniatis et al, Molecular Cloning: A Laboratory
Manual (New York: Cold Spring Harbor Laboratory, 1982), pp.
280-281.
Molt4 (Human Mutant Cell Repository, GM2219C) is a T cell line
homozygous for normal .beta.-globin, and SC-1, deposited with ATCC
on Mar. 19, 1985, is an EBV-transformed B cell line homozygous for
the sickle cell allele. GM2064 (Human Mutant Cell Repository,
GM2064) was originally isolated from an individual homozygous for
hereditary persistance of fetal hemoglobin (HPFH) and contains no
beta- or deltaglobin gene sequences. All cell lines were maintained
in RPMI-1640 with 10% fetal calf serum.
Isolation of Human Genomic DNA from Clinical Blood Samples
A clinical blood sample designated CH12 from a known sickle cell
carrier (AS) was obtained from Dr. Bertram Lubin of Children's
Hospital in Oakland, California. Genomic DNA was prepared from the
buffy coat fraction, which is composed primarily of peripheral
blood lymphocytes, using a modification of the procedure described
by Nunberg et al., Proc. Nat. Acad. Sci. USA, 75, 5553-5556
(1978).
The cells were resuspended in 5 ml Tris-EDTA-NaCl (TEN) buffer (10
mM Tris buffer pH 8, 1 mM EDTA, 10 mM NaCl) and adjusted to 0.2
mg/ml proteinase K, 0.5% SDS, and incubated overnight at 37.degree.
C. Sodium perchlorate was then added to 0.7 M and the lysate gently
shaken for 1-2 hours at room temperature. The lysate was extracted
with 30 ml phenol/chloroform (1:1), then with 30 ml chloroform, and
followed by ethanol precipitation of the nucleic acids. The pellet
was resuspended in 2 ml of TE buffer and RNase A added to 0.005
mg/ml. After digestion for one hour at 37.degree. C., the DNA was
extracted once each with equal volumes of phenol,
phenol/chloroform, and chloroform, and ethanol precipitated. The
DNA was resuspended in 0.5 ml TE buffer and the concentration was
determined by absorbance at 260 nm.
Polymerase Chain Reaction to Amplify Selectively .beta.-Globin
Sequences
Two micrograms of genomic DNA was amplified in an initial 100 .mu.l
reaction volume containing 10 mM Tris Buffer (pH 7.5), 50 mM NaCl,
10 mM MgCl.sub.2, 150 pmole of Primer A of the sequence
d(CACAGGGCACTAACG), and 150 pmole of Primer B of the sequence
d(CTTTGCTTCTGACACA) and overlayed with about 100 .mu.l mineral oil
to prevent evaporation.
Each DNA sample underwent 15 cycles of amplification where one
cycle is composed of three steps:
1. Denature in a heat block set at 95.degree. C. for two
minutes.
2. Transfer immediately to a heat block set at 30.degree. C. for
two minutes to allow primers and genomic DNA to anneal.
3. Add 2 .mu.l of a solution containing 5 units of the Klenow
fragment of E. coli DNA polymerase I (New England Biolabs), 1 nmole
each of dATP, dCTP, dGTP and TTP, in a buffer composed of 10 mM
Tris (pH 7.5), 50 mM NaCl, 10 mM MgCl.sub.2, and 4 mM
dithiothreitol. This extension reaction was allowed to proceed for
10 minutes at 30.degree. C.
After the final cycle, the reaction was terminated by heating at
95.degree. C. for two minutes. The mineral oil was extracted with
0.2 ml of chloroform and discarded. The final reaction volume was
130 .mu.l.
Hybridization/Digestion of Amplified Genomic DNA with Probes and
DdeI/HinfI
Forty-five microliters of the amplifier genomic DNA was ethanol
precipitated and resuspended in an equal volume of TE buffer. Ten
microliters (containing the pre-amplification equivalent of 154 ng
of genomic DNA) was dispensed into a 1.5 ml Microfuge tube and 20
.mu.l of TE buffer to a final volume of 30 .mu.l. The sample was
overlayed with mineral oil and denatured at 95.degree. C. for 10
minutes. Ten microliters of 0.6 M NaCl containing 0.02 pmole of
labeled RS06 probe was added to the tube, mixed gently, and
immediately transferred to a 56.degree. C. heat block for one hour.
Four microliters of unlabeled RS10 blocking oligomer (0.8 pmole)
was added and the hybridization continued for an additional 10
minutes at the same temperature. Five microliters of 60 mM
MgCl.sub.2 /0.1% BSA and 1 .mu.l of DdeI (10 units, New England
Biolabs) were added and the reannealed DNA was digested for 30
minutes at 56.degree. C. One microliter of HinfI (10 units, New
England Biolabs) was then added and incubated for another 30
minutes. The reaction was stopped by the addition of 4 .mu.l 75 nM
EDTA and 6 .mu.l tracking dye to a final volume of 61 .mu.l.
The mineral oil was extracted with 0.2 ml chloroform, and 18 .mu.l
of the reaction mixture (45 ng genomic DNA) was loaded onto a 30%
polyacrylamide mini-gel (19:1, Bio-Rad) in a Hoeffer SE200
apparatus. The gel was electrophoresed at approximately 300 volts
for one hour until the bromphenol blue dye front migrated to 3.0 cm
off-origin. The top 1.5 cm of the gel was removed and the remaining
gel was exposed for four days with one intensification screen at
-70.degree. C. Discussion of Photograph (FIG. 9)
Each lane contains 45 ng of amplified genomic DNA. Lane A contains
Molt4 DNA; Lane B, CH12; Lane C, SC-1; and Lane D, GM2064. Molt4
represents the genotype of a normal individual with two copies of
the .beta..sup.A gene per cell (AA), CH12 is a clinical sample from
a sickle cell carrier with one .beta..sup.A and one .beta..sup.S
gene per cell (AS), and SC-1 represents the genotype of a sickle
cell individual with two copies of the .beta..sup.S gene cell (SS).
GM2064, which contains no beta- or delta-globin sequences, is
present as a negative control.
As seen in the photograph, the DdeI-cleaved, .beta..sup.A -specific
octamer is present only in those DNA's containing the .beta..sup.A
gene (Lanes A and B), and the HinfI-cleaved, .beta..sup.S -specific
trimer is present only in those DNA's containing the .beta..sup.S
gene (Lanes B and C). The presence of both trimer and octamer (Lane
B) is diagnostic for a sickle cell carrier and is distinguishable
from a normal individual (Lane A) with only octamer and a sickle
cell afflicted individual (Lane C) with only trimer.
As a comparison, repeating the experiment described above using
non-amplified genomic DNA revealed that the amplification increased
the sensitivity of detection by at least 1000 fold.
EXAMPLE 6
This example illustrates direct detection of a totally unpurified
single copy gene in whole human DNA on gels without the need for a
labeled probe.
Using the technique described in Example 3, a 110-bp fragment from
a sequence in the first exon of the beta-globin gene was amplified
from 10 micrograms of whole human DNA after 20 cycles. This 110-bp
fragment produced after 20 cycles was easily visualized on gels
stained with ethidium bromide.
The sequence was not amplified when it was first cut with the
restriction enzyme DdeI unless, as in the beta-globin S allele, the
sequence does not contain the restriction site recognized by the
enzyme.
EXAMPLE 7
A. A total of 100 fmoles pBR328 containing a 1.9 kb insert from the
human beta-globin A allele, 50 nmoles each alpha-32P-dNTP at 500
Ci/mole, and 1 nmole of each of the primers used in Example 3 were
dissolved in a solution containing 100 .mu.l 30 mM Tris-acetate at
pH 7.9, 60 mM sodium acetate, 100 mM dithiothreitol, and 10 mM
magnesium acetate. This solution was brought to 100.degree. C. for
two minutes and cooled to 25.degree. C. for one minute. A total of
1 .mu.l containing 4.5 units Klenow fregment of E. coli DNA
polymerase I and 0.09 units inorganic pyrophosphatase was added to
prevent the possible build-up of pyrophosphate in the reaction
mixture and the reaction was allowed to proceed for two minutes at
25.degree. C., after which the cycle of heating, cooling, adding
enzyme, and reacting was repeated nine times. Ten-.mu.l aliquots
were removed and added to 1 .mu.l 600 mM EDTA after each synthesis
cycle. Each was analyzed on a 14% polyacrylamide gel in 90 mM
Tris-borate and 2.5 mM EDTA at pH 8.3 and 24 volts/cm for 2.5
hours. The completed gel was soaked for 20 minutes in the same
buffer with the addition of 0.5 .mu.g/ml ethidium bromide, washed
with the original buffer, and photographed in UV light using a red
filter.
The 110-bp fragment produced was excised from the gel under
ultraviolet light and the incorporated .sup.32 P counted by
Cerenkov radiation. An attempt to fit the data to an equation of
the form: pmoles/10 .mu.l =0.01 [(1+y).sup.N -yN-1], where N
represents the number of cycles and the y fractional yield per
cycle, was optimal with y=0.619. This indicates that a significant
amplification is occurring.
B. The above experiment was repeated except that 100 nmoles of each
dNTP was added to a 100 .mu.l reaction, no radiolabel was employed,
and aliquots were not removed at each cycle. After 10 cycles the
reaction was terminated by boiling for two minutes and
rehybridization was performed at 57.degree. C. for one hour. The
sequence of the 110-bp product was confirmed by subjecting 8 .mu.l
aliquots to restriction analysis by addition of 1 .mu.l bovine
serum albumin (25 mg/ml) and 1 .mu.l of the appropriate restriction
enzyme (HinfI, MnlI, MstII, NcoI) and by reaction at 37.degree. C.
for 15 hours. PAGE was peformed as described above.
EXAMPLE 8
This example illustrates the use of different primers to amplify
various fragments of pBR328 and 322.
A. The experiment described in Example 7A was repeated except using
the following primers: d(TTTGCTTCTGACACAACTGTGTTCACTAGC) and
d(GCCTCACCACCAACTTCATCCACGTTCACC) to produce a 130-bp fragment of
pBR328.
B. The experiment described in Example 7A was repeated except using
the following primers: d(GGTTGGCCAATCTACTCCCAGG) and
d(TGGTCTCCTTAAACCTGTCTTG) to produce a 262-bp fragment of pBR328.
The reaction time was 20 minutes per cycle.
C. The experiment described in Example 8B was repeated except that
100 fmoles of an MstII digest of pBR328 containing a 1.9 kb insert
from the human beta-globin S allele was used as initial template.
This plasmid was cleaved several times by MstII but not inside the
sequence to be amplified. In addition, the primers employed were as
follows:
to produce a 240-bp fragment.
D. The experiment described in Example 7B was repeated except that
100 fmoles of an NruI digest of pBR322 was used as template, 200
nmoles of each dNTP were used in the 100 .mu.l reaction, and the
primers were:
to produce a 500-bp fragment from pBR322. Reaction times were 20
minutes per cycle at 37.degree. C. Final rehybridization was 15
hours at 57.degree. C. Electrophoresis was on a 4% agarose gel.
EXAMPLE 9
This example illustrates the invention process wherein an in vitro
mutation is introduced into the amplified segment.
A. A total of 100 fmole of pBR322 linearized with NruI, 1 nmole
each of the primers:
designed to produce a 75-bp fragment, 100 nmole each dNTP, in 100
.mu.l 40 mM Tris at pH 8, 20 mM in MgCl.sub. 2, 5 mM in
dithiothreitol, and 5 mg/ml bovine serum albumin were combined. The
mixture was brought to 100.degree. C. for one minute, cooled for
0.5 minutes in a water bath at 23.degree. C., whereupon 4.5 units
Klenow fragment and 0.09 units inorganic pyrophosphatase were
added, and a reaction was allowed to proceed for three minutes. The
cycle of heating, cooling, adding enzymes, and reacting was
repeated nine times. The tenth reaction cycle was terminated by
freezing and an 8-.mu.l aliquot of the reaction mixture was applied
to a 4% agarose gel visualized with ethidium bromide.
B. The experiment described in Example 9A was repeated except that
the oligonucleotide primers employed were:
These primers are designed to produce a 101-bp fragment, 26
nucleotides of which (in the second listed primer) are not present
in pBR322. These nucleotides represent the sequence of the T7
promoter, which was appended to the 75-bp sequence from pBR322 by
using the primer with 20 complementary bases and a 26-base 5'
extension. The procedure required less than two hours and produced
two picomoles of the relatively pure 101-bp fragment from 100
fmoles of pBR322.
The T7 promoter can be used to initiate RNA transcription. T7
polymerase may be added to the 101-bp fragment to produce
single-stranded RNA.
C. The experiment described in Example 8D was repeated except that
the oligonucleotide primers employed were as follows:
to produce a 1000-bp frament from pBR322.
D. The experiment described in Example 9C was repeated except that
the oligonucleotide primers employed were as follows:
so as to produce a 1026-bp fragment, 26 nucleotides of which (in
the second listed primer) are not present in pBR322 and represent
the T7 promoter described above. The promoter has been inserted
adjacent to a 1000-bp fragment from pBR322.
The results indicate that a primer which is not a perfect match to
the template sequence but which is nonetheless able to hybridize
sufficiently to be enzymatically extended produces a long product
which contains the sequence of the primer rather than the
corresponding sequence of the original template. The long product
serves as a template for the second primer to introduce an in vitro
mutation. In further cycles this mutation is amplified with an
undiminished efficiency, because no further mispaired primings are
required. In this case, a primer which carries a non-complementary
extension on its 5' end was used to insert a new sequence in the
product adjacent to the template sequence being copied.
EXAMPLE 10
This example illustrates employing nested sets of primers to
decrease the background in the amplification of single copy
genes.
Whole human DNA homozygous for the wild-type .beta.-globin allele
was subjected to twenty cycles of amplification as follows: A total
of 10 .mu.g DNA, 200 picomoles each of the primers:
and 100 nanomoles each dNTP in 100 .mu.l of 30 mM Tris-acetate pH
7.9, 60 mM sodium acetate, 10 mM dithiothreitol, and 10 mM
magnesium acetate were heated to 100.degree. C. for one minute,
cooled to 25.degree. C. for one minute, and treated with 2 units
Klenow fragment for two minutes. The cycle of heating, cooling and
adding Klenow was repeated 19 times. A ten-.mu.l aliquot was
removed from the reaction mixture and subjected to a further ten
cycles of amplification using each of the primers:
which amplify a 58-bp fragment contained within the 110-bp fragment
produced above. This final ten cycles of amplification was
accomplished by diluting the 10-.mu.l aliquot into 90 .mu.l of the
fresh Tris-acetate buffer described above containing 100 nanomoles
each dNTP and 200 pmoles of each primer. Reaction conditions were
as above. After ten cycles a 10-.mu.l aliquot (corresponding to 100
nanograms of the original DNA) was applied to a 6% NuSieve (FMC
Corp.) agarose gel and visualized using ethidium bromide.
FIG. 10 illustrates this gel illuminated with UV light and
photographed through a red filter as is known in the art. Lane 1 is
molecular weight markers. Lane 2 is an aliquot of the reaction
described above. Lane 3 is an aliquot of a reaction identical to
that described above, except that the original wild-type DNA was
cleaved with DdeI prior to amplification. Lane 4 is an aliquot of a
reaction identical to that described above, except that human DNA
homozygous for the sickle betaglobin allele was treated with DdeI
prior to amplification (the sickle allele does not contain a DdeI
site in the fragment being amplified here). Lane 5 is an aliquot of
a reaction identical to that described above, except that salmon
sperm DNA was substituted for human DNA. Lane 6 is an aliquot of a
reaction identical to that described above, except that the aliquot
was treated with DdeI after amplification (DdeI should convert the
58-bp wild-type product into 27-and 31-bp fragments). Lane 7 is an
aliquot of the Lane 4 material treated with DdeI after
amplification (the 58-bp sickle product contains no DdeI site).
Detection of a 58-bp fragment representative of a singlecopy gene
from one microgram of human DNA using only ethidium bromide
staining of an agarose gel requires an amplification of about
500,000fold. This was accomplished by using the two nested sets of
oligonucleotide primers herein. The first set amplified the 110-bp
fragment and the inner nested set amplifies a sub-fragment of this
product up to the level of convenient detection shown in FIG. 10.
This procedure of using primers amplifying a smaller sequence
contained within the sequence being amplified in the previous
amplification process and contained in the extension products of
the other primers allows one to distinguish the wild-type from the
sickle allele at the betaglobin locus without resorting to either
radioisotopic or non-radioisotopic probe hybridization methodology
such as that of Conner et al., Proc. Natl. Acad. Sci. USA, 80:278
(1983) and Leary et al., Proc. Natl. Acad. Sci USA, 80:4045
(1983).
EXAMPLE 11
The present process is expected to be useful in detecting, in a
patient DNA sample, a specific sequence associated with an
infectious disease such as, e.g., Chlamydia using a biotinylated
hybridization probe spanning the desired amplified sequence and
using the process described in U.S. Pat. No. 4,358,535, supra. The
biotinylated hybridization probe may be prepared by intercalation
and irradiation of a partially double-stranded DNA with a
4'-methylene substituted 4,5'-8-trimethylpsoralen attached to
biotin via a spacer arm of the formula: ##STR4## where Y is O, NH
or N-CHO, x is a number from 1 to 4, and y is a number from 2 to 4,
as described in U.S. Pat. Nos. 4,582,789 issued Apr. 15, 1986, and
4,617,261 issued Oct. 14, 1986, the disclosures of which are
incorporated herein by reference. Detection of the biotinyl groups
on the probe may be accomplished using a streptavidin-acid
phosphatase complex commercially obtainable from Enzo Biochemical
using the detection procedures suggested by the manufacturer in its
brochure. The hybridized probe is seen as a spot of precipitated
stain due to the binding of the detection complex, and the
subsequent reaction catalyzed by acid phosphatase, which produces a
precipitable dye.
EXAMPLE 12
In this example, the process of Example 7 was basically used to
amplify a 119 base pair fragment on the human .beta.-hemoglobin
gene using the primers:
where lower case letters denote mismatches from wild-type sequence
to create restriction enzyme sites. The full scheme is shown in
Table I. Table I illustrates a diagram of the primers GH18 and GH19
which are used for cloning and sequencing a 119-base pair fragment
of the human .beta.-globin gene and which are designed to contain
internal restriction sites. The start codon ATG is underlined. GH18
is a 26-base oligonucleotide complementary to the negative strand
and contains an internal PstI site. GH19 is a 23-base
oligonucleotide complementary to the plus strand and contains an
internal HindIII recognition sequence. Arrows indicate the
direction of extension by DNA polymerase I. The boxed sequences
indicate the restriction enzyme recognition sequences of each
primer. These primers were selected by first screening the regions
of the gene for homology to the PstI and HindIII restriction sites
of bacteriophage M13. The primers were then prepared as described
in previous examples.
TABLE I
__________________________________________________________________________
DdeI
__________________________________________________________________________
##STR5## ##STR6##
TGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTG(+)
GAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGGTACCACGTGGACTGAGG
ACTCCTCTTCAGACGGCAATGACGGGACACCCCGTTCCACTTGCACCTACTTCAACCAC(-)
##STR7## ##STR8##
__________________________________________________________________________
Amplification and Cloning
After twenty cylces of amplification of 1 microgram of human
genomic DNA isolated from the cell line Molt 4 as described in
Example 2, 1/14h of the reaction product was hybridized to the
labeled .beta.-globin specific oligonucleotide probe, RS06, of the
sequence 5'-globin CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG-3'
using the methods described above for oligomer restriction.
Following solution hybridization, the reaction mixture was treated
with DdeI under restriction digestion conditions as described
above, to produce an 8-bases pair oligonucleotide. The amount of
this 8-base pair product is proportional to the amount of amplified
product produced. The digestion products were resolved on a 30%
polyacrylamide gel and visualized by autoradiography.
Analysis of the autoradiogram revealed that the amplification was
comparable in efficiency to that of amplification with primers PC03
(5'-ACACAACTGTGTTCACTAGC-3') and PC04 (5'-CCACTTGCACCTACTTCAAC-3'),
which are complementary to the negative and positive strands,
respectively, of the wild-type .beta.-globin.
The amplified product was ethanol precipitated to desalt and
concentrate the sample, redissolved in a restriction buffer of 10
mM Tris pH 8, 10 mM MgCl.sub.2, 1 mM DTT, 100 mM NaCl.sub.2, and
simultaneously digested with PstI and HindIII. After digestion the
sample was desalted with a Centricon 10 concentrator and ligated
overnight at 12.degree. C. with 0.3 micrograms of the PstI/HindIII
digested vector M13mp10w, which is publicly available from
Boehringer-Mannheim.
The entire ligation mixture was transformed into E. coli strain
JM103, which is publicly available from BRL in Bethesda, MD. The
procedure followed for preparing the transformed strain is
described in Messing, J. (1981) Third Cleveland Symposium on
Macromolecules: Recombinant DNA, ed. A. Walton, Elsevier,
Amsterdam, 143-153.
The transformation mixture was plated onto x-gal media for
screening via plaque hybridization with nylon filters. The filters
were probed with a .beta.-globin-specific oligonucleotide probe
RS24 of the sequence 5'-CCCACAGGGCAGTAACGGCAGACTTCTCCTCAGGAGTCAG-3'
to determine the number of .beta.-globin inserts. The filters were
then reprobed with the prime PC04 to determine the total number of
inserts.
Plating and Screening
Table II summarizes the plating and plaque hybridization data. The
filters were probed with the primer PC04 to determine the
percentage of inserts resulting from amplification and cloning;
1206 clear plaques (90% of total number of clear plaques)
hybridized to the primer. Fifteen plaques hybridized to the
.beta.-globin specific probe RS24. The percentage of .beta.-globin
positive plaques among the amplified primer-positive plaques is
approximately 1%.
TABLE II ______________________________________ Blue No
.beta.-Globin Plate No. Plaques Inserts* Inserts** Inserts
______________________________________ 1 28 25 246 1 2 29 18 222 2
3 11 26 180 0 4 24 20 192 5 5 22 27 185 5 6 39 21 181 3 TOTAL 158
132 1206 15 ______________________________________ % of plaques
containing amplified sequences which contain .beta.-globin insert =
15/1206 .times. 100 = 1.24% % of total plaques which contain
.beta.-globin insert = 15/1496 .times. 100 = ca. 1% % of total
plaques which contain amplified sequences = 1206/1496 .times. 100 =
0.8% *Clear plaques which do not hybridize to primer PCO4 **Clear
plaques which hybridize to primer PCO4
Restriction Enzyme and Southern Blot Analysis
DNAs from phage DNA minipreparation of three .beta.-globin positive
and two .beta.-globin negative (but PC04 primer positive) plaques
were analyzed by restriction enzyme analysis. MstII digestion of
DNA from M13 clones containing the amplified .beta.-globin fragment
should generate a characteristic 283 base-pair fragment. Following
MstII digestion, the three .beta.-globin positive clones all
produced the predicted 283 base pair fragment, while the two clones
which were positive only with the primer produced larger
fragments.
The gel from this analysis was transferred to a MSI nylon filter
and hybridized with a radiolabeled nick-translated .beta.-globin
probe prepared by standard nick translation methods as described by
Rigby et al., J. Mol. Biol. (1977), 113:237-51. The only bands
which hybridized to the .beta.-globin probe were the three
.beta.-globin positive clones. The two other clones had inserts
which did not hybridize to the .beta.-globin probe.
Sequence Analysis
The .beta.-globin positive clones which were shown by restriction
enzyme analysis to contain the .beta.-globin insert were sequenced
using the M13-dideoxy sequencing method. Of the ten clones, nine
were identical to the .beta.-globin wild-type sequence. The other
clone was identical to the .differential.-blobin gene which had
been shown to be amplified to only a small degree by the
.beta.-globin primers.
In conclusion, the modified linker primers were nearly as efficient
as the unmodified primers in amplifying the .beta.-globin sequence.
The primers were able to faciltate insertion of amplified DNA into
cloning vectors. Due to the amplification of other segments of the
genome, only 1% of the clones contained hemoglobin sequences.
Nine of the ten clones were found to be identical to the published
.beta.-globin sequence, showing that the technique amplifies
genomic DNA with high fidelity. One clone was found to be identical
with the published .beta.-globin sequence, confirming that the
primers are specific for the .beta.-globin gene despite their
having significant sequence homology with .beta.-globin.
When cloning was carried out with a 267 base pair fragment of the
.beta.-globin gene, cloning was effective only when
dimethylsulfoxide was present (10% by volume at 37.degree. C.) in
the amplification procedure.
Restriction site-modified primers were also used to amplify and
clone and partially sequence the human N-ras oncogene and to clone
240-base pair segments of the HLA DQ-.alpha. and DQ-.beta. genes.
All of these amplifications were carried out in the presence of 10%
by volume dimethylsulfoxide at 37.degree. C. The primers for
amplifying HLA DQ-.alpha. and DQ-.beta. genes were much more
specific for their intended targets than were the .beta.-globin and
DR-.beta. primers, which, rather than giving a discrete band on an
ethidium bromide stained agarose gel, produced only a smear. In
addition, the HLA DQ-.alpha. primers produced up to 20% of clones,
with amplified inserts which contained the desired HLA target
fragment, whereas 1% of the .beta.-globin clones contained the
target sequence. The HLA DQ-.alpha. and DQ-.beta. gene cloning was
only effective when the DMSO was present and the temperature was
elevated.
EXAMPLE 13
This example illustrates the use of the process herein to prepare
the TNF gene of 494 base pairs starting from two oligonucleotides
of 74 base pairs each.
PRIMERS
The primers employed were prepared by the method described in
Example 2 and are identified below, each being 74 mers.
##STR9##
OVERALL PROCEDURE
I. Ten cycles of the protocol indicated below were carried out
using primers TN10 and TN11, which interact as shown in the diagram
below, step (a).
II. A total of 2 .mu.l of the reaction mixture from Part I above
was added to the primers LL09 and LL12. The protocol described
below was carried out for 15 cycles, so that the primers would
interact with the product of Part I as shown in the diagram below,
step (b).
III. A total of 2 .mu.l of the reaction mixture from Part II above
was added to the primers TN08 and TN13. The protocol described
below was carried out for 15 cycles, so that the primers would
interact with the product of Part II as shown in the diagram below,
step (c).
IV. A total of 2 .mu.l of the reaction mixture from Part III above
was added to he primers LL07 and LL14. The protocol described below
was carried out for 15 cycles, so that the primers would interact
with the product of Part III as shown in the diagram below, step
(d).
PROTOCOL
Each reaction contained 100 .mu.l of:
2 mM of each of dATP, dCTP, dGTP and TTP
3 .mu.M of each of the primers used at that step
1.times.polymerase buffer, (30 mM Tris-acetate, 60 mM Na-acetate,
10 mM Mg-acetate, 2.5 mM dithiothreitol) Each cycle
constituted:
1. 1 min. in boiling water
2. 1 min. cooling at room temperature
3. add 1 .mu.l (5 units) of the Klenow fragment of DNA
polymerase
4. allow the polmerization reaction to proceed for 2 min. For the
next cycle start again at step 1. ##STR10##
Deposit of Materials
The cell line SC-1 (CTCC #0082) was deposited on Mar. 19, 1985 with
the American Type Culture Collection (ATCC), 12301 Parklawn Drive,
Rockville, Md. 20852 USA, with ATCC Accession No. CRL#8756. The
deposit of SC-1 was made pursuant to a contract between the ATCC
and the assignee of this patent application, Cetus Corporation. The
contract with ATCC provides for permanent availability of the
progeny of this cell line to the public on the issuance of the U.S.
patent describing and identifying the deposit or the publications
or upon the laying open to the public of any U.S. or foreign patent
application, whichever comes first, and for availability of the
progeny of this cell line to one determined by the U.S.
Commissioner of Patents and Trademarks to be entitled thereto
according to 35 CFR .sctn.122 and the Commissioner's rules pursuant
thereto (including 37 CFR .sctn.1.14 with particular reference to
886 0G 638). The assignee of the present application has agreed
that if the cell line on deposit should die or be lost or destroyed
when cultivated under suitable conditions, it will be promptly
replaced on notification with a viable culture of the same cell
line.
In summary, the present invention is seen to provide a process for
detecting sequences in nucleic acids by first amplifying one or
more specific nucleic acid sequences using a chain reaction in
which primer extension products are produced which can subsequently
act as templates for further primer extension reactions. The
process is especially useful in detecting nucleic acid sequences
which are initially present in only very small amounts. Also, the
amplification process can be used for molecular cloning.
Other modifications of the above described embodiments of the
invention which are obvious to those of skill in the area of
molecular biology and related disciplines are intended to be within
the scope of the following claims.
* * * * *